U.S. patent application number 13/993047 was filed with the patent office on 2014-02-27 for system and methods for massively parallel analysis of nucleic acids in single cells.
This patent application is currently assigned to GIGAGEN. The applicant listed for this patent is David Scott Johnson, Everett Hurteau Meyer. Invention is credited to David Scott Johnson, Everett Hurteau Meyer.
Application Number | 20140057799 13/993047 |
Document ID | / |
Family ID | 46245400 |
Filed Date | 2014-02-27 |
United States Patent
Application |
20140057799 |
Kind Code |
A1 |
Johnson; David Scott ; et
al. |
February 27, 2014 |
System and Methods for Massively Parallel Analysis of Nucleic Acids
in Single Cells
Abstract
Methods and systems are provided for massively parallel genetic
analysis of single cells in emulsion droplets or reaction
containers. Genetic loci of interest are targeted in a single cell
using a set of probes, and a fusion complex is formed by molecular
linkage and amplification techniques. Methods are provided for
high-throughput, massively parallel analysis of the fusion complex
in a single cell in a population of at least 10,000 cells. Also
provided are methods for tracing genetic information back to a cell
using barcode sequences.
Inventors: |
Johnson; David Scott; (San
Francisco, CA) ; Meyer; Everett Hurteau; (Redwood
City, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Johnson; David Scott
Meyer; Everett Hurteau |
San Francisco
Redwood City |
CA
CA |
US
US |
|
|
Assignee: |
GIGAGEN
San Francisco
CA
|
Family ID: |
46245400 |
Appl. No.: |
13/993047 |
Filed: |
December 16, 2011 |
PCT Filed: |
December 16, 2011 |
PCT NO: |
PCT/US11/65600 |
371 Date: |
June 10, 2013 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61459600 |
Dec 16, 2010 |
|
|
|
Current U.S.
Class: |
506/9 ;
506/26 |
Current CPC
Class: |
C07K 16/00 20130101;
C12Q 1/6874 20130101; C12Q 1/6846 20130101; C12Q 1/6837 20130101;
C12N 15/1065 20130101; C12Q 1/6888 20130101; C12Q 2600/158
20130101; C12Q 1/6886 20130101; C12Q 2600/156 20130101; C12N
15/1006 20130101; C40B 50/06 20130101; C07K 2317/622 20130101; C12Q
1/6881 20130101; C12Q 1/6883 20130101; C12N 15/1075 20130101; C12Q
1/6846 20130101; C12Q 2525/161 20130101; C12Q 2525/307 20130101;
C12Q 2563/159 20130101 |
Class at
Publication: |
506/9 ;
506/26 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. A method for analyzing at least two nucleic acid sequences in a
single cell contained within a population of at least 10,000 cells,
comprising: providing a first set of nucleic acid probes, the first
set comprising a first probe comprising a sequence that is
complementary to a first target nucleic acid subsequence, a second
probe comprising a sequence that is complementary to a second
subsequence of the first target nucleic acid and a second sequence
that is complementary to an exogenous sequence, a third probe
comprising the exogenous sequence and a sequence that is
complementary to a first subsequence of a second target nucleic
acid, and a fourth probe comprising a sequence that is
complementary to a second subsequence of the second target nucleic
acid sequence, wherein the first target nucleic acid or the second
target nucleic acid comprises an endogenous sequence; isolating the
single cells with at least one set of nucleic acid probes;
amplifying the first and second target nucleic acid sequences
independently, wherein the first target nucleic acid sequence is
amplified using the first probe and the second probe, and wherein
the second target nucleic acid sequence is amplified using the
third probe and the fourth probe; hybridizing the exogenous
sequence to its complement; amplifying the first target nucleic
acid sequence, the second target nucleic acid sequence, and the
exogenous sequence using the first and fourth probes, thereby
generating a fused complex; and performing a bulk sequencing
reaction to generate sequence information for at least 100,000
fused complexes from at least 10,000 cells within the population of
cells, wherein the sequence information is sufficient to
co-localize the first target nucleic acid sequence and the second
target nucleic acid sequence to a single cell from the population
of at least 10,000 cells.
2. The method of claim 1, wherein the single cell is isolated in an
emulsion micro droplet.
3. The method of claim 1, wherein the single cell is isolated in a
reaction container.
4. The method of claim 1, wherein the amplifying step comprises
performing a polymerase chain reaction, and wherein the first and
third probes are forward primers and the second and fourth probes
are reverse primers for the polymerase chain reaction.
5. The method of claim 1, wherein the amplifying step comprises
performing a ligase chain reaction.
6. The method of claim 1, wherein the amplifying step comprises
performing a polymerase chain reaction, a reverse-transcriptase
polymerase chain reaction, a ligase chain reaction, or a ligase
chain reaction followed by a polymerase chain reaction.
7. The method of claim 1, wherein the fused complex is
circular.
8. The method of claim 1, wherein the first or second target
nucleic acid sequence is an RNA sequence.
9. The method of claim 1, wherein the first or second target
nucleic acid sequence is a DNA sequence.
10. The method of claim 1, wherein the first or second target
nucleic acid sequence comprises a T-cell receptor sequence.
11. The method of claim 1, wherein the first target nucleic
sequence, the second target nucleic acid sequence or both target
nucleic acid sequences comprise an immunoglobulin sequence.
12. The method of claim 1, wherein the first target nucleic acid
comprises a T-cell receptor sequence, and the second target nucleic
sequence comprises a second molecule that is associated with immune
cell function.
13. The method of claim 12, wherein the second molecule is selected
from the group consisting of: interleukin-2 (IL-2), interleukin-4
(IL-4), interferon gamma (IFN.gamma.), interleukin-10 (IL-10),
interleukin-1 (IL-1), interleukin-13 (IL-13), interleukin-17
(IL-17), interleukin-18 (IL-18), tumor necrosis factor alpha
(TNF.alpha.), tumor necrosis factor beta (TNF.beta.), T-box
transcription factor 21 (TBX21), forkhead box P3 (FOXP3), cluster
of differentiation 4 (CD4), cluster of differentiation 8 (CD8),
cluster of differentiation 1d (CD1d), cluster of differentiation
161 (CD161), cluster of differentiation 3 (CD3), major
histocompatibility complex (MHC), cluster of differentiation 19
(CD19), interleukin 7 receptor (IL-17 receptor), cluster of
differentiation 10 (CD10), cluster of differentiation 20 (CD20),
cluster of differentiation 22 (CD22), cluster of differentiation 34
(CD34), cluster of differentiation 27 (CD27), cluster of
differentiation 5 (CD5), and cluster of differentiation 45 (CD45),
cluster of differentiation 38 (CD38), cluster of differentiation 78
(CD78), interleukin-6 receptor, Interferon regulatory factor 4
(IRF4), and cluster of differentiation 138 (CD138).
14. The method of claim 1, wherein the first target nucleic acid
sequence comprises an immunoglobulin sequence, and the second
sequence comprises a second molecule associated with immune cell
function.
15. The method of claim 14, wherein the second molecule is selected
from the group consisting of: interleukin-2 (IL-2), interleukin-4
(IL-4), interferon gamma (IFN.gamma.), interleukin-10 (IL-10),
interleukin-1 (IL-1), interleukin-13 (IL-13), interleukin-17
(IL-17), interleukin-18 (IL-18), tumor necrosis factor alpha
(TNF.alpha.), tumor necrosis factor beta (TNF.beta.), T-box
transcription factor 21 (TBX21), forkhead box P3 (FOXP3), cluster
of differentiation 4 (CD4), cluster of differentiation 8 (CD8),
cluster of differentiation 1d (CD1d), cluster of differentiation
161 (CD161), cluster of differentiation 3 (CD3), major
histocompatibility complex (MHC), cluster of differentiation 19
(CD19), interleukin 7 receptor (IL-17 receptor), cluster of
differentiation 10 (CD10), cluster of differentiation 20 (CD20),
cluster of differentiation 22 (CD22), cluster of differentiation 34
(CD34), cluster of differentiation 27 (CD27), cluster of
differentiation 5 (CD5), and cluster of differentiation 45 (CD45),
cluster of differentiation 38 (CD38), cluster of differentiation 78
(CD78), interleukin-6 receptor, Interferon regulatory factor 4
(IRF4), and cluster of differentiation 138 (CD138).
16. The method of claim 1, wherein the first or second target
nucleic acid comprises a rare gene sequence.
17. The method of claim 16, wherein the rare gene sequence is
present in fewer than 5% of the cells.
18. The method of claim 17, wherein the rare gene sequence is
present in fewer than 1% of the cells.
19. The method of claim 18, wherein the rare gene sequence is
present in fewer than 0.1% of the cells.
20. The method of claim 16, wherein the rare gene sequence results
from a genetic mutation.
21. The method of claim 20, wherein the mutation is a somatic
mutation.
22. The method of claim 20, wherein the mutation is associated with
a disease.
23. The method of claim 22, wherein the disease is cancer.
24. The method of claim 20, wherein the genetic mutation is a
mutation in a gene selected from the group consisting of epidermal
growth factor receptor (EGFR), phosphatase and tensin homolog
(PTEN), tumor protein 53 (p53), MutS homolog 2 (MSH2), multiple
endocrine neoplasia 1 (MEN1), adenomatous polyposis coli (APC), Fas
receptor (FASR), retinoblastoma protein (Rb1), Janus kinase 2
(JAK2), (ETS)-like transcription factor 1 (ELK1), v-ets avian
erythroblastosis virus E26 oncogene homolog 1 (ETS1), breast cancer
1 (BRCA1), breast cancer 2 (BRCA2), hepatocyte growth factor
receptor (MET), ret protoco-oncogene (RET), V-erb-b2 erythroblastic
leukemia viral oncogene homolog 2 (HER2), V-Ki-ras2 Kirsten rat
sarcoma viral oncogene homolog (KRAS), B-cell lymphoma 2 (BCL2),
V-myc myelocytomatosis viral oncogene homolog (MYC),
neurofibromatosis type 2 gene (NF2), v-myb myeloblastosis viral
oncogene homolog (MYB), and mutS homolog 6 (E. coli) (MSH6).
25. The method of claim 23, wherein the cancer is selected from the
group consisting of: lung carcinoma, non-small cell lung cancer,
small cell lung cancer, uterine cancer, thyroid cancer, breast
carcinoma, prostate carcinoma, pancreas carcinoma, colon carcinoma,
lymphoma, Burkitt lymphoma, Hodgkin lymphoma, myeloid leukemia,
leukemia, sarcoma, blastoma, melanoma, seminoma, brain cancer,
glioma, glioblastoma, cerebellar astrocytoma, cutaneous T-cell
lymphoma, gastric cancer, liver cancer, ependymona, laryngeal
cancer, neck cancer, stomach cancer, kidney cancer, pancreatic
cancer, bladder cancer, esophageal cancer, testicular cancer,
medulloblastoma, vaginal cancer, ovarian cancer, cervical cancer,
basal cell carcinoma, pituitary adenoma, rhabdomyosarcoma, and
Kaposi sarcoma.
26. The method of claim 1, further comprising fixing and
permeabilizing the cells prior to performing the amplification
step.
27. The method of claim 1, further comprising lysing the cells
prior to performing the amplification step.
28. The method of claim 1, further comprising quantifying the
sequence information generated from the bulk sequencing
reaction.
29. The method of claim 1, wherein the single cell is contained
within a population of at least 25,000 cells.
30. The method of claim 29, wherein the single cell is contained
within a population of at least 50,000 cells.
31. The method of claim 30, wherein the single cell is contained
within a population of at least 75,000 cells.
32. The method of claim 31, wherein the single cell is contained
within a population of at least 100,000 cells.
33. The method of claim 1, wherein performing the bulk sequencing
reaction to generate sequence information is carried out for at
least 1,000,000 fused complexes from at least 10,000 cells within
the population of cells.
34. The method of claim 1, further comprising: providing a second
set of nucleic acid probes, the second set comprising a fifth probe
comprising a sequence that is complementary to a third target
nucleic acid subsequence, a sixth probe comprising a sequence that
is complementary to a second subsequence of the third target
nucleic acid sequence and a second sequence that is complementary
to a second exogenous sequence, a seventh probe comprising the
exogenous sequence and a sequence that is complementary to a first
subsequence of a fourth target nucleic acid sequence, and an eighth
probe comprising a sequence that is complementary to a second
subsequence of the fourth target nucleic acid sequence; isolating
the single cells with the first and second sets of nucleic acid
probes; amplifying the third and fourth target nucleic acid
sequences independently, wherein the third target nucleic acid
sequence is amplified using the fifth probe and the sixth probe,
and wherein the fourth target nucleic acid sequence is amplified
using the seventh probe and the eighth probe; hybridizing the
exogenous sequence to its complement; amplifying the third target
nucleic acid sequence, the fourth target nucleic acid sequence and
the exogenous sequence using the fifth and eighth probes, thereby
generating a fused complex; and performing a bulk sequencing
reaction to generate sequence information for at least 100,000
fused complexes from at least 10,000 cells within the population of
cells, wherein the sequence information is sufficient to
co-localize the first target nucleic acid sequence, the second
target nucleic acid sequence, the third target nucleic acid
sequence, and the fourth target nucleic acid sequence to a single
cell from the population of at least 10,000 cells.
35. The method of claim 34, wherein the first target nucleic acid
sequence and the third target nucleic acid sequence are the
same.
36. The method of claim 34, wherein the first target nucleic acid
sequence and the third target nucleic acid sequence are
different.
37. The method of claim 1, further comprising: providing N sets of
nucleic acid probes, wherein each of the N sets comprise an I.sub.1
probe comprising a sequence that is complementary to an I.sub.a
target nucleic acid first subsequence, an I.sub.2 probe comprising
a sequence that is complementary to an I.sub.a target nucleic acid
second subsequence and a second sequence that is complementary to
an I exogenous sequence, an I.sub.3 probe comprising the I
exogenous sequence and a sequence that is complementary to an
I.sub.b target nucleic acid first subsequence, and an I.sub.4 probe
comprising a sequence that is complementary to an h target nucleic
acid second subsequence, wherein I ranges from 1 to N; isolating
the single cells with the N sets of nucleic acid probes; amplifying
for all values of I, the I.sub.a and I.sub.b target nucleic acid
sequences independently, wherein the I.sub.a target nucleic acid
sequence is amplified using the I.sub.1 probe and the I.sub.2 probe
and the I.sub.b target nucleic acid sequence is amplified using the
I.sub.3 probe and the I.sub.4 probe; hybridizing the I exogenous
sequence to its complement; amplifying for each I, the I.sub.a
target sequence, the I.sub.b target sequence and the I exogenous
sequence using the I.sub.1 and I.sub.4 probes, thereby generating N
fused complexes; and performing a bulk sequencing reaction to
generate sequence information for at least 100,000 fused complexes
from at least 10,000 cells within the population of cells, wherein
the sequence information is sufficient to co-localize the N I.sub.a
target nucleic acid sequence and the I.sub.b target nucleic acid
sequence to a single cell from the population of at least 10,000
cells.
38. The method of claim 37, wherein N is less than or equal to
10.
39. The method of claim 37, wherein N is less than or equal to
100.
40. The method of claim 37, wherein N is less than or equal to
1000.
41. The method of claim 37, wherein N is less than or equal to
10,000.
42. The method of claim 37, wherein N is less than or equal to
100,000.
43. The method of claim 37, wherein N represents all of the
polyadenylated transcripts in a cell.
44. A method for analyzing at least two nucleic acid sequences in a
single cell contained within a population of at least 10,000 cells,
comprising: isolating each of a plurality of single cells from a
population of at least 10,000 cells in an emulsion microdroplet or
a reaction container, introducing a unique barcode sequence
comprising at least six nucleotides into each of the plurality of
single cells, wherein each barcode sequence is selected from a pool
of barcode sequences with greater than 1000-fold diversity in
sequence; for each of the plurality of single cells, providing at
least one set of nucleic acid probes, the set comprising a first
probe comprising a sequence that is complementary to a nucleic acid
sequence that is located at the 5' end of the barcode sequence, a
second probe comprising a sequence that is complementary to a
nucleic acid sequence that is located at the 3' end of the barcode
sequence and a second region of sequence that is complementary to a
non-human, exogenous sequence, a third probe comprising a sequence
that comprises the non-human, exogenous sequence and a sequence
that is complementary to a first subsequence of a second target
nucleic acid sequence, and a fourth probe comprising a sequence
that is complementary to a second subsequence of the second target
nucleic acid sequence, and wherein the second target nucleic acid
sequence comprises an endogenous sequence; amplifying the first and
second nucleic acid sequences independently, wherein the first
target nucleic acid sequence is amplified using the first probe and
the second probe, and wherein the second target nucleic acid
sequence is amplified using the third probe and the fourth probe;
hybridizing the exogenous sequence to its complement; amplifying
the first target nucleic acid sequence, the second target nucleic
acid sequence, and the exogenous sequence using the first and
fourth probes; performing bulk sequencing of the fused complexes;
and identifying a single cell for each of the fused complexes based
on the barcode sequence.
45. The method of claim 44, wherein the barcode sequence is affixed
to a bead or a solid surface.
46. The method of claim 45, wherein the bead or the solid surface
is isolated in the emulsion microdroplet or the reaction
container.
47. The method of claim 46, wherein introducing a unique barcode
sequence comprises fusing the emulsion microdroplet or a reaction
container comprising the single cell with the emulsion microdroplet
or a reaction container comprising the barcode sequence affixed to
the bead or the solid surface.
48. The method of claim 44, wherein the second target nucleic acid
sequence is complementary to an RNA sequence.
49. The method of claim 44, wherein the second target nucleic acid
sequence is complementary to a DNA sequence.
50. The method of claim 44, wherein amplifying comprises performing
a polymerase chain reaction.
51. The method of claim 44, wherein amplifying comprises performing
a ligase chain reaction.
52. The method of claim 44, wherein amplifying comprises performing
by ligase chain reaction followed by polymerase chain reaction.
53. The method of claim 44, wherein the single cell is contained
within a population of at least 25,000 cells.
54. The method of claim 53, wherein the single cell is contained
within a population of at least 50,000 cells.
55. The method of claim 54, wherein the single cell is contained
within a population of at least 75,000 cells.
56. The method of claim 55, wherein the single cell is contained
within a population of at least 100,000 cells.
57. The method of claim 44, further comprising quantifying the
fused complexes.
58. The method of claim 44, wherein the fused complexes are
circular.
59. The method of claim 44, further comprising: providing N sets of
nucleic acid probes, wherein each of the N sets comprise an I.sub.1
probe comprising a sequence that is complementary a first
subsequence of a barcode sequence, an I.sub.2 probe comprising a
sequence that is complementary to a second subsequence of the
barcode sequence and a second sequence that is complementary to an
I exogenous sequence, an I.sub.3 probe comprising the I exogenous
sequence and a sequence that is complementary to an I.sub.b target
nucleic acid first subsequence, and an I.sub.4 probe comprising a
sequence that is complementary to an h target nucleic acid second
subsequence, wherein I ranges from 1 to N; isolating the single
cells with the N sets of nucleic acid probes; amplifying for all
values of I, the barcode sequence and the I.sub.b target nucleic
acid sequences independently, wherein the barcode sequence is
amplified using the I.sub.1 probe and the I.sub.2 probe and the
I.sub.b target nucleic acid sequence is amplified using the I.sub.3
probe and the I.sub.4 probe; hybridizing the I exogenous sequence
to its complement; amplifying for each I, the barcode sequence, the
I.sub.b target sequence and the I exogenous sequence using the
I.sub.1 and I.sub.4 probes, thereby generating N fused complexes;
and performing a bulk sequencing reaction to generate sequence
information for at least 100,000 fused complexes from at least
10,000 cells within the population of cells, wherein the sequence
information is sufficient to co-localize the barcode sequence and
the h target nucleic acid sequence to a single cell from the
population of at least 10,000 cells.
60. The method of claim 59, wherein N is less than or equal to
10.
61. The method of claim 59, wherein N is less than or equal to
100.
62. The method of claim 59, wherein N is less than or equal to
1000.
63. The method of claim 59, wherein N is less than or equal to
10,000.
64. The method of claim 59, wherein N is less than or equal to
100,000.
65. The method of claim 59, wherein N represents all of the
polyadenylated transcripts in a cell.
66. The method of claim 59, wherein the barcode sequence is the
same sequence for all N.
67. A method for introducing unique barcode sequences into reaction
containers or emulsion microdroplets, comprising: providing a pool
of unique barcode sequences, wherein each barcode sequence is
linked to a selection resistance gene; providing a population of
single cells; transfecting the population of single cells with the
pool of unique barcode sequences; selecting cells comprising a
unique barcode sequence, an endogenous target nucleic acid
sequence, and the selection resistance gene; and isolating each of
the selected cells into reaction containers or emulsion
microdroplets.
68. The method of claim 67, wherein the selection resistance gene
comprises a gene that encodes resistance to gentamycin, neomycin,
hygromycin, or puromycin.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Application No. 61/459,600, filed Dec. 16, 2010, which is hereby
incorporated in its entirety by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The invention relates to the fields of molecular biology and
molecular diagnostics, and more specifically to methods for
massively parallel genetic analysis of nucleic acids in single
cells.
[0004] 2. Description of the Related Art
[0005] Certain quantitative genetic analyses of biological tissues
and organisms are best performed at the single cell level. However,
single cells only contain picograms of genetic material.
Conventional methods, such as polymerase chain reaction (PCR), RNA
sequencing (Mortazavi et al., 2008 Nature Methods 5:621-8),
chromatin immunoprecipitation sequencing (Johnson et al., 2007
Science 316:1497-502), or whole genome sequencing (Lander et al.,
2001 Nature 409:860-921), require more genetic material than is
found in a single cell and are usually performed with thousands to
millions of cells. These techniques provide useful genetic
information at the cell population level, but have serious
limitations for understanding biology at the single cell level.
Current biological tools also lack the capacity to assay genetic
measurements in many single cells in parallel.
[0006] Conventional single cell techniques are slow, tedious, and
limited in the quantity of cells that can be analyzed at once. For
example, in pre-implantation genetic diagnosis (PGD), a single cell
is removed from a cleavage stage human embryo for genome-wide
analysis of genetic diseases (Johnson et al., 2010 Human
Reproduction 25:1066-75). Applications such as PGD require
time-consuming, hand-guided biopsy technology, and the largest
studies include hundreds of single cells. In another example,
genetic recombination between loci of interest can be measured in
single sperm cells (Jiang et al., 2005 Nucleic Acids Research
33:e91), but a manual analysis of thousands of single sperm would
be time-consuming and impractical.
[0007] An established method for single cell analysis is
fluorescence-activated cell sorting (FACS). Single cells are
diluted into reaction wells, and various genetic and molecular
biology techniques can be performed in the wells, from whole genome
amplification to single locus PCR assays. However, due to the
physical limits of parallelization using reaction wells, FACS is
only useful for analyzing hundreds of single cells, rather than
hundreds of thousands of single cells.
[0008] Single cells can also be used as reaction compartments for
performing various genetic analyses (Embleton et al., 1992 Nucleic
Acids Research 20:3831-37; Hviid, 2002 Clinical Chemistry
48:2115-2123; U.S. Pat. No. 5,830,663). Single cells can be sorted
in aqueous-in-oil microdroplet emulsions, and molecular analyses
can be performed in the microdroplets (Johnston et al., 1996
Science 271:624-626; Brouzes et al., 2009 PNAS 106:14195-200; Kliss
et al., 2008 Anal Chem 80:8975-81; Zeng et al., 2010 Anal Chem
82:3183-90). These single cell assays are limited to single cell
PCR in emulsions, or in situ PCR in single fixed and permeabilized
cells. Moreover, when analyzing large populations of cells, it is
difficult to trace back each gene product to a single cell or
subpopulations of cells.
[0009] Thus, there is a need for methods for high-throughput,
massively parallel genetic characterization of single cells and
methods for identifying the cell or subpopulation of cells that
originated the genetic material.
SUMMARY OF THE INVENTION
[0010] Disclosed herein is a method for analyzing at least two
nucleic acid sequences in a single cell contained within a
population of at least 10,000 cells. The method includes providing
a providing a first set of nucleic acid probes, the first set
comprising a first probe comprising a sequence that is
complementary to a first target nucleic acid subsequence, a second
probe comprising a sequence that is complementary to a second
subsequence of the first target nucleic acid and a second sequence
that is complementary to an exogenous sequence, a third probe
comprising the exogenous sequence and a sequence that is
complementary to a first subsequence of a second target nucleic
acid, and a fourth probe comprising a sequence that is
complementary to a second subsequence of the second target nucleic
acid sequence.
[0011] The method includes isolating the single cells with at least
one set of nucleic acid probes; amplifying the first and second
target nucleic acid sequences independently, wherein the first
target nucleic acid sequence is amplified using the first probe and
the second probe, and wherein the second target nucleic acid
sequence is amplified using the third probe and the fourth probe;
hybridizing the exogenous sequence to its complement; and
amplifying the first target nucleic acid sequence, the second
target nucleic acid sequence, and the exogenous sequence using the
first and fourth probes, thereby generating a fused complex.
[0012] The method also provides performing a bulk sequencing
reaction to generate sequence information for at least 100,000
fused complexes from at least 10,000 cells within the population of
cells, wherein the sequence information is sufficient to
co-localize the first target nucleic acid sequence and the second
target nucleic acid sequence to a single cell from the population
of at least 10,000 cells.
[0013] In one aspect, the single cell is isolated in an emulsion
microdroplet. In another aspect, the single cell is isolated in a
reaction container.
[0014] In one embodiment, the amplifying step includes performing a
polymerase chain reaction, wherein the amplifying step comprises
performing a polymerase chain reaction, and wherein the first and
third probes are forward primers and the second and fourth probes
are reverse primers for the polymerase chain reaction. In another
embodiment, the amplifying step includes performing a polymerase
chain reaction, wherein the first and third amplification primers
are forward primers and the second and fourth amplification primers
are reverse primers for the polymerase chain reaction. In some
embodiments, the amplifying step comprises performing a ligase
chain reaction. The amplifying step can include performing a
polymerase chain reaction, a reverse-transcriptase polymerase chain
reaction, a ligase chain reaction, or a ligase chain reaction
followed by a polymerase chain reaction.
[0015] In another embodiment, the fused complex is circular. In
some embodiments, the first or second target nucleic acid sequence
is an RNA sequence. The first or second target nucleic acid
sequence can also be a DNA sequence. In one embodiment, the first
or second target nucleic acid sequence comprises a T-cell receptor
sequence. In another embodiment, the first target nucleic sequence,
the second target nucleic acid sequence or both target nucleic acid
sequences comprises an immunoglobulin sequence. In other
embodiments, the first target nucleic acid comprises a T-cell
receptor sequence, and the second target nucleic sequence comprises
a second molecule that is associated with immune cell function. In
another embodiment, the first target nucleic acid sequence
comprises an immunoglobulin sequence, and the second sequence
comprises a second molecule associated with immune cell function.
In one embodiment, the second molecule associated with immune cell
function is selected from the group consisting of: interleukin-2
(IL-2), interleukin-4 (IL-4), interferon gamma (IFN.gamma.),
interleukin-10 (IL-10), interleukin-1 (IL-1), interleukin-13
(IL-13), interleukin-17 (IL-17), interleukin-18 (IL-18), tumor
necrosis factor alpha (TNF.alpha.), tumor necrosis factor beta
(TNF.beta.), T-box transcription factor 21 (TBX21), forkhead box P3
(FOXP3), cluster of differentiation 4 (CD4), cluster of
differentiation 8 (CD8), cluster of differentiation 1d (CD 1d),
cluster of differentiation 161 (CD 161), cluster of differentiation
3 (CD3), major histocompatibility complex (MHC), cluster of
differentiation 19 (CD19), interleukin 7 receptor (IL-17 receptor),
cluster of differentiation 10 (CD10), cluster of differentiation 20
(CD20), cluster of differentiation 22 (CD22), cluster of
differentiation 34 (CD34), cluster of differentiation 27 (CD27),
cluster of differentiation 5 (CD5), and cluster of differentiation
45 (CD45), cluster of differentiation 38 (CD38), cluster of
differentiation 78 (CD78), interleukin-6 receptor, Interferon
regulatory factor 4 (IRF4), cluster of differentiation 138
(CD138).
[0016] In an embodiment, the first or second target nucleic acid
includes a rare gene sequence. In some embodiments, the rare gene
sequence is present in fewer than 5% of the cells, fewer than 1% of
the cells, or fewer than 0.1% of the cells. In one embodiment, the
rare gene sequence results from a genetic mutation. In another
embodiment, the genetic mutation is a somatic mutation. In an
embodiment, the genetic mutation is a mutation in a gene selected
from the group consisting of epidermal growth factor receptor
(EGFR), phosphatase and tensin homolog (PTEN), tumor protein 53
(p53), MutS homolog 2 (MSH2), multiple endocrine neoplasia 1
(MEN1), adenomatous polyposis coli (APC), Fas receptor (FASR),
retinoblastoma protein (Rb1), Janus kinase 2 (JAK2), (ETS)-like
transcription factor 1 (ELK1), v-ets avian erythroblastosis virus
E26 oncogene homolog 1 (ETS1), breast cancer 1 (BRCA1), breast
cancer 2 (BRCA2), hepatocyte growth factor receptor (MET), ret
protoco-oncogene (RET), V-erb-b2 erythroblastic leukemia viral
oncogene homolog 2 (HER2), V-Ki-ras2 Kirsten rat sarcoma viral
oncogene homolog (KRAS), B-cell lymphoma 2 (BCL2), V-myc
myelocytomatosis viral oncogene homolog (MYC), neurofibromatosis
type 2 gene (NF2), v-myb myeloblastosis viral oncogene homolog
(MYB), and mutS homolog 6 (E. coli) (MSH6). In other embodiments,
the mutation is associated with a disease, and in one embodiment,
the disease is cancer. In some embodiments, the cancer is a cancer
selected from the group consisting of lung carcinoma, non-small
cell lung cancer, small cell lung cancer, uterine cancer, thyroid
cancer, breast carcinoma, prostate carcinoma, pancreas carcinoma,
colon carcinoma, lymphoma, Burkitt lymphoma, Hodgkin lymphoma,
myeloid leukemia, leukemia, sarcoma, blastoma, melanoma, seminoma,
brain cancer, glioma, glioblastoma, cerebellar astrocytoma,
cutaneous T-cell lymphoma, gastric cancer, liver cancer,
ependymona, laryngeal cancer, neck cancer, stomach cancer, kidney
cancer, pancreatic cancer, bladder cancer, esophageal cancer,
testicular cancer, medulloblastoma, vaginal cancer, ovarian cancer,
cervical cancer, basal cell carcinoma, pituitary adenoma,
rhabdomyosarcoma, or Kaposi sarcoma.
[0017] In addition, the method can include in certain embodiments
fixing and permeabilizing the cells prior to performing the
amplification step. The method can also include lysing the cells
prior to performing the amplification step and quantifying the
sequence information generated from the bulk sequencing
reaction.
[0018] In some embodiments, the method for analyzing the single
cell includes a single cell contained within a population of at
least 25,000 cells, at least 50,000 cells, at least 75,000 cells,
or at least 100,000 cells. In some embodiments, the single cell is
a unique cell with respect to the remaining cells in the
population. In other embodiments, the single cell is a
representative of a subpopulation of cells within the population.
The population can be considered in some embodiments to be the
total number of cells analyzed in a method of the invention.
[0019] In one embodiment, performing the bulk sequencing reaction
to generate sequence information is carried out for at least
1,000,000 fused complexes from at least 10,000 cells within the
population of cells.
[0020] The method includes providing a second set of nucleic acid
probes, the second set comprising a fifth probe comprising a
sequence that is complementary to a third target nucleic acid
subsequence, a sixth probe comprising a sequence that is
complementary to a second subsequence of the third target nucleic
acid sequence and a second sequence that is complementary to a
second exogenous sequence, a seventh probe comprising the exogenous
sequence and a sequence that is complementary to a first
subsequence of a fourth target nucleic acid sequence, and an eighth
probe comprising a sequence that is complementary to a second
subsequence of the fourth target nucleic acid sequence.
[0021] The method also provides isolating the single cells with the
first and second sets of nucleic acid probes; amplifying the third
and fourth target nucleic acid sequences independently, wherein the
third target nucleic acid sequence is amplified using the fifth
probe and the sixth probe, and wherein the fourth target nucleic
acid sequence is amplified using the seventh probe and the eighth
probe; hybridizing the exogenous sequence to its complement;
amplifying the third target nucleic acid sequence, the fourth
target nucleic acid sequence and the exogenous sequence using the
fifth and eighth probes, thereby generating a fused complex; and
performing a bulk sequencing reaction to generate sequence
information for at least 100,000 fused complexes from at least
10,000 cells within the population of cells, wherein the sequence
information is sufficient to co-localize the first target nucleic
acid sequence, the second target nucleic acid sequence, the third
target nucleic acid sequence, and the fourth target nucleic acid
sequence to a single cell from the population of at least 10,000
cells.
[0022] In some aspects, the first target nucleic acid sequence and
the third target nucleic acid sequence are the same. In other
aspects, the first target nucleic acid sequence and the third
target nucleic acid sequence are different.
[0023] In other embodiments, the method includes providing N sets
of nucleic acid probes, wherein each of the N sets comprise an
I.sub.1 probe comprising a sequence that is complementary to an
I.sub.a target nucleic acid first subsequence, an I.sub.2 probe
comprising a sequence that is complementary to an I.sub.a target
nucleic acid second subsequence and a second sequence that is
complementary to an I exogenous sequence, an I.sub.3 probe
comprising the I exogenous sequence and a sequence that is
complementary to an I.sub.b target nucleic acid first subsequence,
and an I.sub.4 probe comprising a sequence that is complementary to
an I.sub.b target nucleic acid second subsequence, wherein I ranges
from 1 to N
[0024] The method also includes isolating the single cells with the
N sets of nucleic acid probes; amplifying for all values of I, the
I.sub.a and I.sub.b target nucleic acid sequences independently,
wherein the I.sub.a target nucleic acid sequence is amplified using
the I.sub.1 probe and the I.sub.2 probe and the I.sub.b target
nucleic acid sequence is amplified using the I.sub.3 probe and the
I.sub.4 probe; hybridizing the I exogenous sequence to its
complement; amplifying for each I, the I.sub.a target sequence, the
I.sub.b target sequence and the I exogenous sequence using the
I.sub.1 and I.sub.4 probes, thereby generating N fused complexes;
and performing a bulk sequencing reaction to generate sequence
information for at least 100,000 fused complexes from at least
10,000 cells within the population of cells, wherein the sequence
information is sufficient to co-localize the N I.sub.a target
nucleic acid sequence and the I.sub.b target nucleic acid sequence
to a single cell from the population of at least 10,000 cells.
[0025] In other embodiments, N is less than or equal to 10, less
than or equal to 100, less than or equal to 1000, less than or
equal to 10,000, less than or equal to 100,000 or N represents all
of the polyadenylated transcripts in a cell.
[0026] In some embodiments the method includes introducing a unique
barcode sequence comprising at least six nucleotides into each of
the plurality of single cells, wherein each barcode sequence is
selected from a pool of barcode sequences with greater than
1000-fold diversity in sequences. For each of the plurality of
single cells, the method includes providing at least one set of
nucleic acid probes. The method includes steps for analyzing at
least two nucleic acid sequences in a single cell contained within
a population of at least 10,000 cells, comprising isolating each of
a plurality of single cells from a population of at least 10,000
cells in an emulsion microdroplet or a reaction container. The
method includes introducing a unique barcode sequence comprising at
least six nucleotides into each of the plurality of single cells,
wherein each barcode sequence is selected from a pool of barcode
sequences with greater than 1000-fold diversity in sequence.
[0027] For each of the plurality of single cells, the method
provides at least one set of nucleic acid probes, the set
comprising a first probe comprising a sequence that is
complementary to a nucleic acid sequence that is located at the 5'
end of the barcode sequence, a second probe comprising a sequence
that is complementary to a nucleic acid sequence that is located at
the 3' end of the barcode sequence and a second region of sequence
that is complementary to a non-human, exogenous sequence, a third
probe comprising a sequence that comprises the non-human, exogenous
sequence and a sequence that is complementary to a first
subsequence of a second target nucleic acid sequence, and a fourth
probe comprising a sequence that is complementary to a second
subsequence of the second target nucleic acid sequence.
[0028] The method continues by amplifying the first and second
nucleic acid sequences independently, wherein the first target
nucleic acid sequence is amplified using the first probe and the
second probe, and wherein the second target nucleic acid sequence
is amplified using the third probe and the fourth probe;
hybridizing the exogenous sequence to its complement; amplifying
the first target nucleic acid sequence, the second target nucleic
acid sequence, and the exogenous sequence using the first and
fourth probes; performing bulk sequencing of the fused complexes;
and identifying a single cell for each of the fused complexes based
on the barcode sequence.
[0029] In some embodiments, the barcode sequence is affixed to a
bead or a solid surface. The bead or the solid surface can be
isolated in the emulsion microdroplet or the reaction
container.
[0030] In other embodiments, the method includes introducing a
unique barcode sequence comprises fusing the emulsion microdroplet
or a reaction container comprising the single cell with the
emulsion microdroplet or a reaction container comprising the
barcode sequence affixed to the bead or the solid surface. The
second target nucleic acid sequence can be complementary to an RNA
sequence. The second target nucleic acid sequence can be
complementary to a DNA sequence.
[0031] In certain embodiments, amplifying comprises performing a
polymerase chain reaction, performing a ligase chain reaction, or
performing by ligase chain reaction followed by polymerase chain
reaction.
[0032] In one embodiment, the single cell is contained within a
population of at least 25,000 cells. In other embodiments, the
single cell is contained within a population of at least 50,000
cells. The single cell can be contained within a population of at
least 75,000 cells or within a population of at least 100,000
cells.
[0033] In certain embodiments, the method also includes quantifying
the fused complexes. In other embodiments, the fused complexes are
circular.
[0034] In one aspect, the method includes providing N sets of
nucleic acid probes, wherein each of the N sets comprise an I.sub.1
probe comprising a sequence that is complementary a first
subsequence of a barcode sequence, an I.sub.2 probe comprising a
sequence that is complementary to a second subsequence of the
barcode sequence and a second sequence that is complementary to an
I exogenous sequence, an I.sub.3 probe comprising the I exogenous
sequence and a sequence that is complementary to an I.sub.b target
nucleic acid first subsequence, and an I.sub.4 probe comprising a
sequence that is complementary to an I.sub.b target nucleic acid
second subsequence, wherein I ranges from 1 to N.
[0035] The method also provides isolating the single cells with the
N sets of nucleic acid probes; amplifying for all values of I, the
barcode sequence and the I.sub.b target nucleic acid sequences
independently, wherein the barcode sequence is amplified using the
I.sub.1 probe and the I.sub.2 probe and the I.sub.b target nucleic
acid sequence is amplified using the I.sub.3 probe and the I.sub.4
probe; hybridizing the I exogenous sequence to its complement;
amplifying for each I, the barcode sequence, the I.sub.b target
sequence and the I exogenous sequence using the I.sub.1 and I.sub.4
probes, thereby generating N fused complexes; and performing a bulk
sequencing reaction to generate sequence information for at least
100,000 fused complexes from at least 10,000 cells within the
population of cells, wherein the sequence information is sufficient
to co-localize the barcode sequence and the I.sub.b target nucleic
acid sequence to a single cell from the population of at least
10,000 cells.
[0036] In other aspects, N is less than or equal to 10, less than
or equal to 100, less than or equal to 1000, less than or equal to
100,000, or N represents all of the polyadenylated transcripts in a
cell. In some embodiments, the barcode sequence is the same
sequence for all N.
[0037] In other embodiments the invention also provides a method
for introducing said barcode sequences into reaction containers or
emulsion microdroplets. The method includes providing a pool of
unique barcode sequences, wherein each barcode sequence is linked
to a selection resistance gene. The method also includes providing
a population of single cells, transfecting the population of single
cells with the pool of unique barcode sequences, selecting cells
containing a unique barcode sequence and the selection resistance
gene, and isolating each of the selected cells into reaction
containers or emulsion microdroplets. The selection resistance gene
can encode resistance to gentamycin, neomycin, hygromycin, or
puromycin, for example.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0038] These and other features, aspects, and advantages of the
present invention will become better understood with regard to the
following description, and accompanying drawings, where:
[0039] FIG. 1A shows an example of sequence linkage in a single
cell by intra-cellular multiprobe circularization of a molecular
complex, according to one embodiment of the invention. Each probe
has a region of complementarity to each of the target loci. The
complex includes two nucleic acid probes (a and b) and two target
nucleic acids (c and d). The single cell (e) can be contained in a
reaction container or an emulsion droplet (j).
[0040] FIG. 1B illustrates an example of sequence linkage in a
single cell (also in a reaction container or emulsion droplet (j))
by intra-cellular multiprobe circularization of a complex,
according to one embodiment of the invention. The two nucleic acid
probes (a and b) are hybridized to the complementary regions of the
two target nucleic acids (c and d).
[0041] FIG. 1C illustrates an example of circularization of a
probe-target linkage complex occurs by amplification, according to
one embodiment of the invention.
[0042] FIG. 2 is an example of amplification of a circularized
probe-target linkage complex (a) using a polymerase (b), according
to one embodiment of the invention. In some embodiments, a .phi.-29
polymerase is used in a mediated rolling circle amplification, and
copies (b and c) of the circularized probe-target complex are
generated.
[0043] FIG. 3 illustrates an example of amplification of a
circularized probe-target linkage complex (a) using a polymerase
(b) and primers (c and d), according to one embodiment of the
invention. The primers (c and d) are used to amplify the region of
the circularized probe-target complex that is complementary to the
target nucleic acid. Multiple copies (e) of a linear
double-stranded polynucleic acid amplicon are generated and
sequenced in bulk.
[0044] FIG. 4 illustrates an example of amplification of a
circularized probe-target linkage complex (a) in a single cell (b),
according to one embodiment of the invention. Amplification occurs
by transformation into bacteria and subsequent selection with
antibiotics. The amplicon (a) contains an antibiotic resistant gene
and cells (c) that are transformed with the amplicon are selected
in the presence of antibiotics. Cells without the circularized
probe-target complex (d) are not selected.
[0045] FIG. 5A shows an example of single cell sequence linkage by
intracellular overlap extension polymerase chain reaction,
according to one embodiment of the invention. A forward primer (a)
targets one locus of a first target nucleic acid (g). A reverse
primer (b) targets another locus of the first target nucleic acid
(g) and has a region of complementarity (c) to a region (d) of the
forward primer (e). The forward primer (e) has a region of
complementarity to the second target nucleic acid (h) and the
reverse primer (f) targets another region of the second target
nucleic acid (h). The steps of FIG. 5 can be performed in a
reaction container or an emulsion droplet.
[0046] FIG. 5B illustrates an example of the hybridization of the
probes (a, b, e and f) to respective target nucleic acids (g and
h), according to one embodiment of the invention.
[0047] FIG. 6A illustrates an example of the complementary regions
(c) and (d) between amplicons (g) and (h), according to one
embodiment of the invention. FIG. 6B shows linkage amplification of
the amplicons (g) and (h) using polymerase (e) to create a linked
major amplicon (i). The end product is a library of "major
amplicons" that include the linked amplicons (g) and (h), which can
be sequenced in bulk. The steps of FIG. 6 can be performed in a
reaction container or an emulsion droplet.
[0048] FIGS. 7A and 7B illustrate an example of single cell
sequence linkage by intracellular ligase chain reaction combined
with overlap extension polymerase chain reaction, according to one
embodiment of the invention.
[0049] FIG. 8A shows an example of the complementary regions
between amplicons (a) and (d), according to one embodiment of the
invention. FIG. 8B shows linkage amplification of the amplicons
using polymerase (e) to create a linked major amplicon. The steps
of FIGS. 7 and 8 can be performed in a reaction container or an
emulsion droplet.
[0050] FIG. 9A shows an example of a linked amplicon (f), according
to one embodiment of the invention. FIG. 9B shows the resulting
amplicon produced from the steps shown in FIGS. 8A and 8B. The end
product can be a library of "major amplicons" and are be sequenced
in bulk.
[0051] FIG. 10 illustrates an example of the components required
for a single cell sequence linkage by padlock probes combined with
overlap extension polymerase chain reaction, according to one
embodiment of the invention.
[0052] FIG. 11 shows the complementary regions between a first
padlock probe (a) and the first target nucleic acid (c) and between
a second padlock probe (b) and a second target nucleic acid (d) in
a single cell, according to one embodiment of the invention.
[0053] FIG. 12 illustrates the resulting circularized amplicons (g)
and (h) and the primers that are used to amplify the circularized
amplicons, according to one embodiment of the invention.
[0054] FIG. 13 shows an example of the resulting amplicons from
amplification of the circular probes (g) and (h), according to one
embodiment of the invention.
[0055] FIG. 14 shows an example of overlap extension PCR
amplification of the amplicons using a polymerase (e), according to
one embodiment of the invention.
[0056] FIG. 15 illustrates an example of plasmid library
deconvolution by barcoded tailed end (5'-end barcoded) polymerase
chain reaction, which is followed by bulk sequencing and
informatics, according to one embodiment of the invention. The
barcode sequence can be traced back to a well and plate position,
the barcode sequence can then be traced to a nucleic acid sequence,
and the nucleic acid sequence is traced back to a well. Each of the
primers in (a) and (b) have a 5'-end barcoded tag. The target
nucleic acids in (c) and (d) are amplified using the primers in (a)
and (b). The steps can be performed in enclosed containers or
emulsion droplets, as shown in (c) and (d).
[0057] FIG. 16 shows an example of amplification (e, f) of two
target nucleic acids (A and B) using primers that include barcode
sequences, according to one embodiment of the invention. The
resulting amplicons that include the barcode sequences are shown in
(g) and (h).
[0058] FIG. 17 shows a simplified example of tracing back a barcode
sequence in an amplicon to a cell target (A or B), and tracing back
the cell target to a physical location (c, d) (e.g., a well),
according to one embodiment of the invention.
[0059] FIG. 18 illustrates molecular linkage between two
transcripts (g and h) and a molecular barcode sequence (k),
according to one embodiment of the invention.
[0060] FIG. 19 shows an example of amplification of the target
nucleic acids (g and h) using primers as shown, according to one
embodiment of the invention.
[0061] FIG. 20 shows an example of amplicons resulting after
amplification of two target nucleic acids and a barcode sequence
(k), according to one embodiment of the invention.
[0062] FIG. 21 illustrates a fused amplicon that includes sequences
of two target nucleic acids (g and h) and a barcode sequence (k)
inside an emulsion droplet or reaction container (j), according to
one embodiment of the invention. The fused ("major") amplicon can
be isolated by reverse emulsion and bulk sequenced.
[0063] FIG. 22 is an example of molecular linkage between two
transcripts (g and h) and a molecular barcode sequence (k) attached
to a bead (m), according to one embodiment of the invention.
[0064] FIG. 23 illustrates the forward and reverse primers that are
used in a molecular linkage between two transcripts (g and h) and a
molecular barcode sequence (k) attached to a bead (m), according to
one embodiment of the invention.
[0065] FIG. 24 shows an example of amplicons resulting after
amplification of two target nucleic acids and a barcode sequence
(k) attached to a bead (m), according to one embodiment of the
invention.
[0066] FIG. 25 illustrates a fused amplicon that includes sequences
of two target nucleic acids (g and h) and a barcode sequence (k),
inside an emulsion droplet or reaction container (j), according to
one embodiment of the invention. The fused ("major") amplicon can
be isolated by reverse emulsion and bulk sequenced.
[0067] FIG. 26 is an example of single cell sequence linkage by
ligase chain reaction combined with overlap extension polymerase
chain reaction, as applied to a method for noninvasive prenatal
diagnosis, according to one embodiment of the invention.
[0068] FIG. 27 shows an example of hybridization of primers and
target nucleic acids in a single cell sequence linkage by ligase
chain reaction combined with overlap extension polymerase chain
reaction, as applied to a method for noninvasive prenatal
diagnosis, according to one embodiment of the invention. The
process is carried out in an emulsion droplet or reaction container
(k).
[0069] FIG. 28 shows an example of resulting amplicons produced in
a single cell sequence linkage by ligase chain reaction combined
with overlap extension polymerase chain reaction, as applied to a
method for noninvasive prenatal diagnosis, according to one
embodiment of the invention.
[0070] FIG. 29 shows hybridization of overlapping complementary
regions of the resulting amplicons, and overlap extension
polymerase chain reaction, as applied to a method for noninvasive
prenatal diagnosis, according to one embodiment of the
invention.
[0071] FIG. 30 shows the resulting amplicons from the overlap
extension polymerase chain reaction, as applied to a method for
noninvasive prenatal diagnosis, according to one embodiment of the
invention. The end product is a library of "major amplicons", or
linked loci, which can then be sequenced in bulk.
[0072] FIG. 31 shows a simplified workflow for high-throughput
generation of TCR.beta. repertoire libraries, according to one
embodiment of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0073] Briefly, and as described in more detail below, described
herein are methods and systems for massively parallel genetic
analysis of single cells in emulsion droplets or reaction
containers. Genetic loci of interest are targeted in a single cell
using specially-designed probes, and a fusion complex is formed by
molecular linkage and amplification techniques. Multiple genetic
loci can be targeted, and many sets of probes can be multiplexed by
PCR into a single analysis, such that several loci or even the
entire transcriptome or genome is analyzed.
[0074] The invention is useful for analyzing genetic information in
single cells in a high-throughput, parallel fashion for a large
quantity of cells (10.sup.4 or greater cells). The invention is
also useful for tracing genetic information back to a cell or
population of cells using unique barcode sequences.
DEFINITIONS
[0075] Terms used in the claims and specification are defined as
set forth below unless otherwise specified.
[0076] The term "cell" refers to a functional basic unit of living
organisms. A cell includes any kind of cell (prokaryotic or
eukaryotic) from a living organism. Examples include, but are not
limited to, mammalian mononuclear blood cells, yeast cells, or
bacterial cells.
[0077] The term "polymerase chain reaction" or PCR refers to a
molecular biology technique for amplifying a DNA sequence from a
single copy to several orders of magnitude (thousands to millions
of copies). PCR relies on thermal cycling, which requires cycles of
repeated heating and cooling of the reaction for DNA melting and
enzymatic replication of the DNA. Primers (short DNA fragments)
containing sequences complementary to the target region of the DNA
sequence and a DNA polymerase are key components to enable
selective and repeated amplification. As PCR progresses, the DNA
generated is itself used as a template for replication, setting in
motion a chain reaction in which the DNA template is exponentially
amplified. A heat-stable DNA polymerase, such as Taq polymerase, is
used. The thermal cycling steps are necessary first to physically
separate the two strands in a DNA double helix at a high
temperature in a process called DNA melting. At a lower
temperature, each strand is then used as the template in DNA
synthesis by the DNA polymerase to selectively amplify the target
DNA. The selectivity of PCR results from the use of primers that
are complementary to the DNA region targeted for amplification
under specific thermal cycling conditions.
[0078] The term "reverse transcriptase polymerase chain reaction"
or RT-PCR refers to a type of PCR reaction used to generate
multiple copies of a DNA sequence. In RT-PCR, an RNA strand is
first reverse transcribed into its DNA complement (complementary
DNA or cDNA) using the enzyme reverse transcriptase, and the
resulting cDNA is amplified using traditional PCR techniques.
[0079] The term "ligase chain reaction" or LCR refers to a type of
DNA amplification where two DNA probes are ligated by a DNA ligase,
and a DNA polymerase is used to amplify the resulting ligation
product. Traditional PCR methods are used to amplify the ligated
DNA sequence. LCR provides greater specificity compared with
PCR.
[0080] The term "emulsion droplet" or "emulsion microdroplet"
refers to a droplet that is formed when two immiscible fluids are
combined. For example, an aqueous droplet can be formed when an
aqueous fluid is mixed with a non-aqueous fluid. In another
example, a non-aqueous fluid can be added to an aqueous fluid to
form a droplet. Droplets can be formed by various methods,
including methods performed by microfluidics devices or other
methods, such as injecting one fluid into another fluid, pushing or
pulling liquids through an orifice or opening, forming droplets by
shear force, etc. The droplets of an emulsion may have any uniform
or non-uniform distribution. Any of the emulsions disclosed herein
may be monodisperse (composed of droplets of at least generally
uniform size), or may be polydisperse (composed of droplets of
various sizes). If monodisperse, the droplets of the emulsion may
vary in volume by a standard deviation that is less than about plus
or minus 100%, 50%, 20%, 10%, 5%, 2%, or 1% of the average droplet
volume. Droplets generated from an orifice may be monodisperse or
polydisperse. An emulsion may have any suitable composition. The
emulsion may be characterized by the predominant liquid compound or
type of liquid compound that is used. The predominant liquid
compounds in the emulsion may be water and oil. "Oil" is any liquid
compound or mixture of liquid compounds that is immiscible with
water and that has a high content of carbon. In some examples, oil
also may have a high content of hydrogen, fluorine, silicon,
oxygen, or any combination thereof, among others. For example, any
of the emulsions disclosed herein may be a water-in-oil (W/O)
emulsion (i.e., aqueous droplets in a continuous oil phase). The
oil may be or include at least one silicone oil, mineral oil,
fluorocarbon oil, vegetable oil, or a combination thereof, among
others. Any other suitable components may be present in any of the
emulsion phases, such as at least one surfactant, reagent, sample
(i.e., partitions thereof), buffer, salt, ionic element, other
additive, label, particles, or any combination thereof.
[0081] "Droplet" refers to a small volume of liquid, typically with
a spherical shape or as a slug that fills the diameter of a
microchannel, encapsulated by an immiscible fluid. The volume of a
droplet, and/or the average volume of droplets in an emulsion, may
be less than about one microliter (i.e., a "microdroplet") (or
between about one microliter and one nanoliter or between about one
microliter and one picoliter), less than about one nanoliter (or
between about one nanoliter and one picoliter), or less than about
one picoliter (or between about one picoliter and one femtoliter),
among others. A droplet may have a diameter (or an average
diameter) of less than about 1000, 100, or 10 micrometers, or of
about 1000 to 10 micrometers, among others. A droplet may be
spherical or nonspherical. In some embodiments, the droplet has a
volume and diameter that is large enough to encapsulate a cell.
[0082] The term "barcode" refers to a nucleic acid sequence that is
used to identify a single cell or a subpopulation of cells. In some
embodiments, a barcode sequence is used to identify a particular
organism or a species. As described below, barcode sequences can be
introduced into a cell, linked by various amplification methods to
a target nucleic acid of interest, and used to trace back the
amplicon to the cell. Barcode sequences can be flanked by universal
sequences that can be used to amplify libraries of barcodes using
universal primer pairs. The barcode sequences can be contained
within a circular or linear double-stranded molecule, or in a
single-stranded linear molecule.
[0083] The term "bulk sequencing" or "next generation sequencing"
or "massively parallel sequencing" refers to any high throughput
sequencing technology that parallelizes the DNA sequencing process.
For example, bulk sequencing methods are typically capable of
producing more than one million polynucleic acid amplicons in a
single assay. The terms "bulk sequencing," "massively parallel
sequencing," and "next generation sequencing" refer only to general
methods, not necessarily to the acquisition of greater than 1
million sequence tags in a single run. Any bulk sequencing method
can be implemented in the invention, such as reversible terminator
chemistry (e.g., Illumina), pyrosequencing using polony emulsion
droplets (e.g., Roche), ion semiconductor sequencing (IonTorrent),
single molecule sequencing (e.g., Pacific Biosciences), massively
parallel signature sequencing, etc.
[0084] The term "in situ" refers to examining a biological
phenomenon in the environment in which it occurs e.g. the practice
of in situ hybridization refers to hybridization of a probe to a
nucleic acid target with the cell still intact.
[0085] The term "in vivo" refers to processes that occur in a
living organism.
[0086] The term "mammal" as used herein includes both humans and
non-humans and include, but is not limited to, humans, non-human
primates, canines, felines, murines, bovines, equines, and
porcines.
[0087] The term "T cell" refers to a type of cell that plays a
central role in cell-mediated immune response. T cells belong to a
group of white blood cells known as lymphocytes and can be
distinguished from other lymphocytes, such as B cells and natural
killer T (NKT) cells by the presence of a T cell receptor (TCR) on
the cell surface. T cells responses are antigen-specific and are
activated by foreign antigens. T cells are activated to proliferate
and differentiate into effector cells when the foreign antigen is
displayed on the surface of the antigen-presenting cells in
peripheral lymphoid organs. T cells recognize fragments of protein
antigens that have been partly degraded inside the
antigen-presenting cell. There are two main classes of T
cells--cytotoxic T cells and helper T cells. Effector cytotoxic T
cells directly kill cells that are infected with a virus or some
other intracellular pathogen. Effector helper T cells help to
stimulate the responses of other cells, mainly macrophages, B cells
and cytotoxic T cells.
[0088] The term "B cell" refers to a type of lymphocyte that plays
a large role in the humoral immune response (as opposed to the
cell-mediated immune response, which is governed by T cells). The
principal functions of B cells are to make antibodies against
antigens, perform the role of antigen-presenting cells (APCs) and
eventually develop into memory B cells after activation by antigen
interaction. B cells are an essential component of the adaptive
immune system.
[0089] It must be noted that, as used in the specification and the
appended claims, the singular forms "a," "an," and "the" include
plural referents unless the context clearly dictates otherwise.
Methods of the Invention
[0090] I. Methods of Massively Parallel Single Cell Molecular
Analysis
[0091] A. Microfluidics Methods for Generating Single Cell Emulsion
Droplets
[0092] In some embodiments, a microfluidic device is used to
generate single cell emulsion droplets. The microfluidic device
ejects single cells in aqueous reaction buffer into a hydrophobic
oil mixture. The device can create thousands of emulsion
microdroplets per minute. After the emulsion microdroplets are
created, the device ejects the emulsion mixture into a trough. The
mixture can be pipetted or collected into a standard reaction tube
for thermocycling.
[0093] Custom microfluidics devices for single-cell analysis are
routinely manufactured in academic and commercial laboratories
(Kintses et al., 2010 Current Opinion in Chemical Biology
14:548-555). For example, chips may be fabricated from
polydimethylsiloxane (PDMS), plastic, glass, or quartz. In some
embodiments, fluid moves through the chips through the action of a
pressure or syringe pump. Single cells can even be manipulated on
programmable microfluidic chips using a custom dielectrophoresis
device (Hunt et al., 2008 Lab Chip 8:81-87). In one embodiment, a
pressure-based PDMS chip comprised of flow-focusing geometry
manufactured with soft lithographic technology is used (Dolomite
Microfluidics (Royston, UK)) (Anna et al., 2003 Applied Physics
Letters 82:364-366). The stock design can typically generate 10,000
aqueous-in-oil microdroplets per second at size ranges from 10-150
.mu.m in diameter. In some embodiments, the hydrophobic phase will
consist of fluorinated oil containing an ammonium salt of
carboxy-perfluoropolyether, which ensures optimal conditions for
molecular biology and decreases the probability of droplet
coalescence (Johnston et al., 1996 Science 271:624-626). To measure
periodicity of cell and droplet flow, images are recorded at 50,000
frames per second using standard techniques, such as a Phantom V7
camera or Fastec InLine (Abate et al., 2009 Lab Chip
9:2628-31).
[0094] The microfluidic system can optimize microdroplet size,
input cell density, chip design, and cell loading parameters such
that greater than 98% of droplets contain a single cell. There are
three common methods for achieving such statistics: (i) extreme
dilution of the cell solution; (ii) fluorescent selection of
droplets containing single cells; and (iii) optimization of cell
input periodicity. For each method, the metrics for success
include: (i) encapsulation rate (i.e., the number of drops
containing exactly one cell); (ii) the yield (i.e., the fraction of
the original cell population ending up in a drop containing exactly
one cell); (iii) the multi-hit rate (i.e., the fraction of drops
containing more than one cell); (iv) the negative rate (i.e., the
fraction of drops containing no cells); and (v) encapsulation rate
per second (i.e., the number of droplets containing single cells
formed per second).
[0095] In some embodiments, single cell emulsions are generated by
extreme cell dilution. Under disordered conditions, the probability
that a microdroplet will contain k cells is given by the Poisson
distribution:
f ( k ; .lamda. ) = .lamda. k - .lamda. k ! , ##EQU00001##
[0096] where e is the natural logarithm and the expected number of
occurrences in the interval is .lamda.. Thus, for
P(k=1).apprxeq.0.98, the cell solution must be extremely dilute,
such that .lamda..apprxeq.0.04 and only 3.84% of all drops contain
a single cell.
[0097] In some embodiments, a simple microfluidic chip with a
drop-making junction is used, such that an aqueous stream flows
through a 10 .mu.m square nozzle and dispenses the aqueous-in-oil
emulsion mixtures into a reservoir. The emulsion mixture can then
be pipetted from the reservoir and thermocycled in standard
reaction tubes. This method will produce predictably high
encapsulation rates and low multi-hit rates, but a low
encapsulation rate per second. A design that can achieve filled
droplet throughput of 1000 Hz is capable of sorting up to 10.sup.6
cells in less than 17 minutes.
[0098] Fluorescence techniques can also be used to sort
microdroplets with particular emission characteristics (Baroud et
al., 2007 Lab Chip 7:1029-1033; Kintses et al., 2010 Current
Opinion in Chemical Biology 14:548-555). In these studies, chemical
methods are used to stain cells. In some embodiments,
autofluorescence is used to select microemulsions that contain
cells. A fluorescent detector reduces the negative rate resulting
from extreme cell dilution. A microfluidic device can also be
equipped with a laser directed at a "Y" sorting junction downstream
of the cell encapsulation junction. The Y junction has a "keep" and
a "waste" channel. A photomultiplier tube is used to collect the
fluorescence of each drop as it passes the laser. The voltage
difference is calibrated between empty drops and drops with at
least one cell. Next, when the device detects a droplet that
contains at least one cell, and electrodes at the Y sorting
junction create a field gradient by dielectrophoresis (Hunt et al.,
2008 Lab on a Chip 8:81-87) and push droplets containing cells in
to the keep channel. The microfluidic device uses extreme cell
dilution to control the multi-hit rate and fluorescent cell sorting
to reduce the negative rate.
[0099] In some embodiments, input cell flow is aligned with droplet
formation periodicity, such that greater than 98% of droplets
contain a single cell (Edd et al., 2008 Lab Chip 8:1262-1264; Abate
et al., 2009 Lab Chip 9:2628-31). In these microfluidic devices, a
high-density suspension of cells is forced through a high
aspect-ratio channel, such that the cell diameter is a large
fraction of the channel's width. The chip is designed with a 27
.mu.m.times.52 .mu.m rectangular microchannel that flows cells into
microdroplets at >104/min (Edd et al., 2008 Lab Chip
8:1262-1264). A number of input channel widths and flow rates are
tested to arrive at an optimal solution.
[0100] In some embodiments, cells with different morphology might
behave differently in the microchannel stream of the microfluidic
device, confounding optimization of the technique when applied to
clinical biological samples. To address this issue, a field
gradient perpendicular to the microchannel by dielectrophoresis is
induced. Dielectrophoresis pulls the cells to one side of the
microchannel, creating in-channel ordering that is independent of
cell morphology. This method requires substantial optimization of
charge and flow rate and a more complicated chip and device design,
so this method may be necessary if existing methodologies fail to
perform for certain cell types.
[0101] The emulsion microdroplet mixtures are pipetted from the
trough in the microfluidic device to a reaction tube for
thermocycling. After thermocycling the emulsions, a number of
methods might achieve emulsion reversal to recover the aqueous
phase of the reaction. Two straightforward reversal processes that
have been used by prior investigators are flash-freezing in liquid
nitrogen for 10 seconds (Kliss et al., 2008 Analytical Chem
80:8975-8981) and passage through a 15 .mu.m mesh filter (Zeng et
al., 2010 Analytical Chem 82: 3183-90). Emulsion reversal can also
be achieved using commercially available reagents designed for this
purpose (Brouzes et al., 2009 PNAS 106:14195-200). Success of the
emulsion reversal is assessed by visualization of the aqueous and
hydrophobic phases under a microscope.
[0102] In some embodiments, the methods of the invention use single
cells in reaction containers, rather than emulsion droplets.
Examples of such reaction containers include 96 well plates, 0.2 mL
tubes, 0.5 mL tubes, 1.5 mL tubes, 384-well plates, 1536-well
plates, etc.
[0103] B. Methods for Molecular Linkage in Single Cell Emulsions
and Massively Parallel Sequencing
[0104] 1) Molecular Linkage Using Polymerase Chain Reaction
(PCR)
[0105] PCR is used to amplify many kinds of sequences, including
but not limited to SNPs, short tandem repeats (STRs), variable
protein domains, methylated regions, and intergenic regions.
Methods for overlap extension PCR are used to create fusion
amplicon products of several independent genomic loci in a single
tube reaction (Johnson et al., 2005 Genome Research 15:1315-24;
U.S. Pat. No. 7,749,697).
[0106] In some embodiments, at least two nucleic acid target
sequences (e.g., first and second nucleic acid target sequences, or
first and second loci) are chosen in the cell and designated as
target loci. Forward and backward primers are designed for each of
the two nucleic acid target sequences, and the primers are used to
amplify the target sequences. "Minor" amplicons are generated by
amplifying the two nucleic acid target sequences separately, and
then fused by amplification to create a fusion amplicon, also known
as a "major" amplicon. In one embodiment, a "minor" amplicon is a
nucleic acid sequence amplified from a target genomic loci, and a
"major" amplicon is a fusion complex generated from sequences
amplified between multiple genomic loci. Exemplary primers that can
be used for generating minor and major amplicons are listed in
Table 2. These primers are used for multiplexed amplification of a
single cell's TCR.beta. and then linkage of the TCR.beta. to immune
effector targets IL-2, IL-4, INFG, TBX21, FOXP3, or TNF.alpha.. In
one embodiment, SEQ ID NOs: 1-57 are pooled together with primers
for a single immune effector target, e.g., SEQ ID NOs: 68 and
69.
[0107] The method uses "inner" primers (i.e., the reverse primer
for the first locus and the forward primer for the second locus)
comprising of one domain that hybridizes with a minor amplicon and
a second domain that hybridizes with a second minor amplicon.
"Inner" primers are a limiting reagent, such that during the
exponential phase of PCR, inner primers are exhausted, driving
overlapping domains in the minor amplicons to anneal and create
major amplicons.
[0108] PCR primers are designed against targets of interest using
standard parameters, i.e., melting temperature (Tm) of
approximately 55-65.degree. C., and with a length 20-50
nucleotides. The primers are used with standard PCR conditions, for
example, 1 mM Tris-HCl pH 8.3, 5 mM potassium chloride, 0.15 mM
magnesium chloride, 0.2-2 .mu.M primers, 200 .mu.M dNTPs, and a
thermostable DNA polymerase. Many commercial kits are available to
perform PCR, such as Platinum Taq (Life Technologies), Amplitaq
Gold (Life Technologies), Titanium Taq (Clontech), Phusion
polymerase (Finnzymes), HotStartTaq Plus (Qiagen). Any standard
thermostable DNA polymerase can be used for this step, such as Taq
polymerase or the Stoffel fragment.
[0109] In one embodiment, a set of nucleic acid probes (or primers)
are used to amplify a first target nucleic acid sequence and a
second target nucleic acid sequence to form a fusion complex. The
first probe includes a sequence that is complementary to a first
target nucleic acid sequence (e.g., the 5' end of the first target
nucleic acid sequence). The second probe includes a sequence that
is complementary to the first target nucleic acid sequence (e.g.,
the 3' end of the first target nucleic acid sequence) and a second
sequence that is complementary to an exogenous sequence. In some
embodiments, the exogenous sequence is a non-human nucleic acid
sequence and is not complementary to either of the target nucleic
acid sequences. The first and second probes are the forward primer
and reverse primer for the first target nucleic acid sequence.
[0110] The third probe includes a sequence that is complementary to
the portion of the second probe that is complementary to the
exogenous sequence and a sequence that is complementary to the
second target nucleic acid sequence (e.g., the 5' end of the second
target nucleic acid sequence). The fourth probe includes a sequence
that is complementary to the second target nucleic acid sequence
(e.g., the 3' end of the second target nucleic acid sequence). The
third probe and the fourth probe are the forward and reverse
primers for the second target nucleic acid sequence.
[0111] The second and third probes are also called the "inner"
primers of the reaction (i.e., the reverse primer for the first
locus and the forward primer for the second locus) and are limiting
in concentration, (e.g., 0.01 .mu.M for the inner primers and 0.1
.mu.M for all other primers). This will drive amplification of the
major amplicon preferentially over the minor amplicons. The first
and fourth probes are called the "outer" primers.
[0112] The first and second nucleic acid sequences are amplified
independently, such that the first nucleic acid sequence is
amplified using the first probe and the second probe, and the
second nucleic acid sequence is amplified using the third probe and
the fourth probe. Next, a fusion complex is generated by
hybridizing the complementary sequence regions of the amplified
first and second nucleic acid sequences and amplifying the
hybridized sequences using the first and fourth probes. This is
called overlap extension PCR amplification.
[0113] During overlap extension PCR amplification, the
complementary sequence regions of the amplified first and second
nucleic acid sequences act as primers for extension on both strands
and in each direction by DNA polymerase molecules. In subsequent
PCR cycles, the outer primers prime the full fused sequence such
that the fused complex is duplicated by DNA polymerase. This method
produces a plurality of fusion complexes.
[0114] FIGS. 5-6 show an example of the single cell sequence
linkage by intracellular overlap extension polymerase chain
reaction, according to one embodiment of the invention. In FIG. 5A,
a forward primer (a) targets one locus of a first target nucleic
acid (g). A reverse primer (b) targets another locus of the first
target nucleic acid (g) and has a region of complementarity (c) to
a region (d) of the forward primer (e). The forward primer (e) has
a region of complementarity to the second target nucleic acid (h)
and the reverse primer (f) targets another region of the second
target nucleic acid (h). FIG. 5B illustrates an example of the
hybridization of the probes (a, b, e and f) to respective target
nucleic acids (g and h), according to one embodiment of the
invention. FIG. 6A illustrates an example of the complementary
regions (c) and (d) between amplicons (g) and (h), according to one
embodiment of the invention. FIG. 6B shows linkage amplification of
the amplicons (g) and (h) using polymerase (e) to create a linked
major amplicon (i). The end product is a library of "major
amplicons" that include the linked amplicons (g) and (h), which can
be sequenced in bulk. The steps of FIGS. 5-6 can be performed in a
reaction container or an emulsion droplet.
[0115] In some embodiments, multiple loci are targeted in a single
cell, and many sets of probes can be multiplexed into a single
analysis, such that several loci or even the entire transcriptome
or genome is analyzed. Multiplex PCR is a modification of PCR that
uses multiple primer sets within a single PCR mixture to produce
amplicons of varying sizes that are specific to different DNA
sequences. By targeting multiple genes at once, additional
information may be gained from a single test run that otherwise
would require several times the reagents and more time to perform.
In one embodiment, 10-20 different transcripts are targeted in a
single cell and linked to a second target nucleic acid (e.g.,
linked to a variable region such as a mutated gene sequence, a
barcode, or an immune variable region).
[0116] In one embodiment, single cells are encapsulated in
aqueous-in-oil picoliter microdroplets. The droplets enable
compartmentalization of reactions such that molecular biology can
be performed on millions of single cells in parallel. Monodisperse
aqueous-in-oil microdroplets can be generated on microfluidic
devices at size ranges from 10-150 .mu.m in diameter.
Alternatively, droplets can be generated by vortexing or by a
TissueLyser (Qiagen). Two embodiments of oil and aqueous solutions
for creating PCR microdroplets are: (i) PCR buffer that contains
0.5 .mu.g/.mu.L bovine serum albumin (New England Biolabs) combined
with mixture of fluorocarbon oil (3M), Krytox 157FSH surfactant
(Dupont), and PicoSurf (Sphere Microfluidics); and (ii) PCR buffer
with 0.1% Tween 20 (Sigma) combined with a mixture of light mineral
oil (Sigma), EM90 (Evonik), and Triton X-100 (Sigma). Several
replicate assays quantifying 1 million amplicons by next-generation
sequencing have shown that both chemistries form monodisperse
microdroplets that are >99.98% stable after 40 cycles of PCR.
PCR can occur in a standard thermocycling tube, a 96-well plate, or
a 384-well plate, using a standard thermocycler (Life
Technologies). PCR can also occur in heated microfluidic chips, or
any other kind of container that can hold the emulsion and transfer
heat.
[0117] After thermocycling and PCR, the amplified material must be
recovered from the emulsion. In one embodiment, ether is used to
break the emulsion, and then the ether is evaporated from the
aqueous/ether layer to recover the amplified DNA in solution. Other
methods include adding a surfactant to the emulsion, flash-freezing
with liquid nitrogen, and centrifugation.
[0118] Once the linked and amplified products are recovered from
the emulsion, there are a number of methods to prepare the product
for bulk sequencing. In one embodiment, the major amplicon is
isolated from the minor amplicons using gel electrophoresis. If
yield is not sufficient, the major amplicon is amplified again
using PCR and the two outer primers. This material can then be
sequenced directly using bulk sequencing. In some embodiments, the
outer primers are used to produce molecules than can be sequenced
directly. In other embodiments, adapters must be added to the major
amplicon before bulk sequencing. Once the sequencing library is
synthesized, bulk sequencing can be performed using standard
methods and without significant modification.
[0119] 2) Molecular Linkage Using Reverse Transcriptase Polymerase
Chain Reaction (RT-PCR)
[0120] The overlap extension PCR method adapts to single tube
overlap extension RT-PCR, which amplifies DNA from RNA transcripts.
The RT-PCR method combines cDNA synthesis and PCR in enclosed tubes
without buffer exchange or reagent addition between the molecular
steps. Thermostable reverse transcriptase (RT) enzymes are used
that withstand temperatures greater than 95.degree. C., though
thermostable RT is not necessary if first strand cDNA synthesis
occurs prior to PCR amplification. For example, both ThermoScript
RT (Lucigen) and GeneAmp Thermostable rTth (Life Technologies) are
designed and used in single-tube reverse transcriptase PCR. In one
embodiment, a set of nucleic acid probes (or primers) are used to
amplify a first target nucleic acid sequence and a second target
nucleic acid sequence to form a fusion complex. The first target
nucleic acid sequence or the second target nucleic acid sequence is
RNA.
[0121] The first probe includes a sequence that is complementary to
a first target nucleic acid sequence (e.g., the 5' end of the first
target nucleic acid sequence). The second probe includes a sequence
that is complementary to the first target nucleic acid sequence
(e.g., the 3' end of the first target nucleic acid sequence) and a
second sequence that is complementary to an exogenous sequence. In
some embodiments, the exogenous sequence is a non-human nucleic
acid sequence and is not complementary to either of the target
nucleic acid sequences. The first and second probes are the forward
primer and reverse primer for the first target nucleic acid
sequence.
[0122] The third probe includes a sequence that is complementary to
the portion of the second probe that is complementary to the
exogenous sequence and a sequence that is complementary to the
second target nucleic acid sequence (e.g., the 5' end of the second
target nucleic acid sequence). The fourth probe includes a sequence
that is complementary to the second target nucleic acid sequence
(e.g., the 3' end of the second target nucleic acid sequence). The
third probe and the fourth probe are the forward and reverse
primers for the second target nucleic acid sequence.
[0123] The second and third probes are also called the "inner"
primers of the reaction (i.e., the reverse primer for the first
locus and the forward primer for the second locus) and are limiting
in concentration, (e.g., 0.01 .mu.M for the inner primers and 0.1
.mu.M for all other primers). This will drive amplification of the
major amplicon preferentially over the minor amplicons. The first
and fourth probes are called the "outer" primers.
[0124] The method includes amplifying using RT-PCR the first and
second nucleic acid sequences independently, such that the first
nucleic acid sequence is amplified using the first probe and the
second probe, and the second nucleic acid sequence is amplified
using the third probe and the fourth probe. Using overlap extension
PCR amplification, a fusion complex is generated by hybridizing the
complementary sequence regions of the amplified first and second
nucleic acid sequences and amplifying the hybridized sequences
using the first and fourth probes. (See FIGS. 5-6).
[0125] 3) Molecular Linkage Using Ligase Chain Reaction
[0126] Ligase chain reaction (LCR) is used to target and amplify
genetic loci of interest (Landegren et al., 1988 Science
241:1077-1080; Benjamin et al., 2003 Methods in Molecular Biology
226: 135-149; U.S. Pat. No. 6,235,472). In ligase chain reaction,
two polynucleic acid probes target a polynucleic acid locus of
interest. Upon hybridization, the two probes are ligated by a
ligase enzyme. In contrast with PCR, LCR amplifies both RNA and
DNA, facilitating many different kinds of multiplexed analysis.
Another notable advantage of ligase chain reaction is the capacity
for allele-specific amplification. Whereas PCR amplifies both
alleles for a particular variant, the ligation process of LCR is
allele-specific.
[0127] In some embodiments, LCR probes are used as a molecular
"switch." For example, if millions of single cells are screened for
a particular variant, only cells that include that variant will
produce major amplicons. LCR is used to perform genetic analysis
only on cells that contain a particular sequence of interest. Cells
that lack the sequence of interest are not substantially amplified
and are therefore silent in the reaction. LCR can also be
multiplexed more efficiently than PCR, using hundreds of probes
targeting hundreds of genetic loci in a single cell microdroplet or
intracellular reaction.
[0128] In one embodiment, a single tube-single buffer overlap
extension LCR/PCR reaction mixture is formulated using DNA and/or
RNA, LCR probes, the PCR primers, Ampligase (Epicentre), a DNA
polymerase such as Stoffel fragment (Life Technologies), and
reaction buffer (20 mM Tris-HCl, 25 mM KCl, 10 mM MgCl.sub.2, 0.5
mM NAD, 0.01% Triton X-100). The method combines LCR with overlap
extension PCR to leverage the benefits of both LCR and PCR (FIGS.
7-9). The "inner" probes are added at 1/10.sup.th of the
concentration of the other oligonucleotides in the reaction such
that they become a limiting reagent at later cycles. For the
initial annealing and ligation, the mixtures can be incubated for 4
minutes at 20.degree. C., 5 minutes at 95.degree. C., and 15
minutes at 60.degree. C. Standard PCR thermocycling conditions are
used to amplify the minor and major amplicons (95.degree. C., 5
minutes; [95.degree. C., 30 seconds; 60.degree. C., 30 seconds;
72.degree. C., 30 seconds].times.30 cycles). The major amplicon is
amplified further by gel size selection and another round of
amplification using the outer primers only. FIGS. 7A and 7B
illustrate an example of single cell sequence linkage by
intracellular ligase chain reaction combined with overlap extension
polymerase chain reaction, according to one embodiment of the
invention. A forward LCR primer (a) targets one locus of a first
target nucleic acid (g). A reverse LCR primer (b) targets another
locus of the first target nucleic acid (g) and has a region of
complementarity (c) to a region (d) of the forward primer (e). The
forward LCR primer (e) has a region of complementarity to the
second target nucleic acid (h) and the reverse LCR primer (f)
targets another region of the second target nucleic acid (h).
[0129] FIG. 8A shows another example of the complementary regions
between amplicons (a) and (d), according to one embodiment of the
invention. FIG. 8B shows linkage amplification of the amplicons
using polymerase (e) to create a linked major amplicon. The steps
of FIGS. 7 and 8 can be performed in a reaction container or an
emulsion droplet.
[0130] FIG. 9A shows an example of a linked amplicon (f), according
to one embodiment of the invention. FIG. 9B shows the resulting
amplicon produced from the steps shown in FIGS. 8A and 8B. The end
product can be a library of "major amplicons" and are sequenced in
bulk.
[0131] In another embodiment, the single cell sequence linkage by
intracellular ligase chain reaction combined with overlap extension
polymerase chain reaction is performed with the following set of
probes: a first LCR probe comprising a sequence that is
complementary to a first target nucleic acid subsequence, a second
probe comprising a sequence that is complementary to a second
subsequence of the first target nucleic acid and a second sequence
that is complementary to an exogenous sequence, a third probe
comprising the exogenous sequence and a sequence that is
complementary to a first subsequence of a second target nucleic
acid, and a fourth probe comprising a sequence that is
complementary to a second subsequence of the second target nucleic
acid sequence. The method includes isolating the single cells with
at least one set of nucleic acid probes. The first and second
probes are hybridized to the first nucleic acid and ligated by a
ligase enzyme. Similarly, the third and fourth probes are
hybridized to the second target nucleic acid and ligated by a
ligase enzyme. Then, the ligated probes for the first and second
target nucleic acids are hybridized across the complementary region
comprising the exogenous sequence and overlap extension PCR is used
to generating a fused complex. The fused complexes can be bulk
sequenced.
[0132] 4) Molecular Linkage Using Padlock Probes
[0133] A padlock probe is a circularized, single stranded DNA or
RNA molecule with complementarity to a sequence target of interest
(Hardenbol et al., 2003 Nature Biotechnology 21:673-678; U.S. Pat.
No. 6,858,412). After hybridization to the target molecules, a
polymerase fills the gap between the two ends of the probe, and a
ligase completes the polynucleotide chain to form a circularized
polynucleotide molecule. The circularized molecule can then be
amplified with multiple displacement amplification (MDA). MDA is an
isothermal amplification method that functions by annealing single
stranded polynucleotides to the template, followed by DNA synthesis
by a high fidelity enzyme such as .phi.-29 polymerase. Inverse PCR
can also be used to amplify only the circularized molecules because
PCR primers that amplify the circularized molecules will not
amplify the single stranded probes (U.S. Pat. No. 6,858,412).
[0134] A notable advantage of padlock probes over PCR is the
capacity for allele-specific amplification. Whereas PCR amplifies
both alleles for a particular variant, the ligation process of
padlock probes is allele-specific. As with LCR, padlock probes are
used as a molecular "switch." If millions of single cells are
screened for a particular variant, only cells that include that
variant will produce major amplicons. Thus, padlock probes are used
to perform genetic analysis only on cells that contain a particular
sequence of interest. Also, in certain embodiments, padlock probes
are highly multiplexed, with tens of thousands of probe types
targeting tens of thousands of genetic loci in a single cell
microdroplet or intracellular reaction (See U.S. Pat. No.
6,858,412).
[0135] Padlock probes are typically hybridized to targets by
cycling at least 20 times between 95.degree. C. for 5 min and
55.degree. C. for 20 min (Baner et al., 2003 Nucleic Acids Research
31: e103). The single nucleotide gaps are then filled with Stoffel
polymerase and ligase, such as Tth ligase or Ampligase (Epicentre).
The circularized probes are then be amplified using PCR with
universal primers. When multiplexed for overlap extension PCR, two
sets of universal primers are used, one for each padlock probe
type. The universal primers contain sequence regions of overlap,
which enables standard overlap extension PCR following initial
sequence capture by the padlock probes. (See FIGS. 10-14). The
probes can also be engineered to contain the appropriate primer
sequences for bulk sequencing, so the library is sequenced directly
after PCR amplification.
[0136] FIG. 10 illustrates an example of the components required
for a single cell sequence linkage by padlock probes combined with
overlap extension polymerase chain reaction, according to one
embodiment of the invention. FIG. 11 shows the complementary
regions between a first padlock probe (a) and the first target
nucleic acid (c) and between a second padlock probe (b) and a
second target nucleic acid (d) in a single cell, according to one
embodiment of the invention. The reaction components can be
contained in a physical reaction container or an emulsion droplet
(k). The first padlock probe (a) includes two separate regions that
are complementary to the first target nucleic acid (c). The second
padlock probe (b) includes two separate regions that are
complementary to a second target nucleic acid (d). A polymerase and
a ligase are used (m) to amplify and ligate the gap between
complementary regions of the padlock probes (a) and (b).
[0137] FIG. 12 illustrates the resulting circularized amplicons (g)
and (h) and the primers that are used to amplify the circularized
amplicons, according to one embodiment of the invention. A forward
primer (a) and a reverse primer (i) are used to amplify circular
amplicon (g). Forward and reverse primers (j) and (f) are used to
amplify circular amplicon (h). Primer (i) has a region (b) that is
complementary to a region of amplicon (g) and a region (c) that is
complementary to region (d) of primer (j). Primer (j) has a region
(e) that is complementary to the amplicon (h) and a region (d) that
is complementary to region (c) of primer (i).
[0138] FIG. 13 is an example of the resulting amplicons from
amplification of the circular probes (g) and (h), according to one
embodiment of the invention. In this figure, region (a) is
complementary to amplicon (g) and region (b) is complementary to
region (c). Region (d) is complementary to amplicon (h) and region
(c) is complementary to region (b).
[0139] FIG. 14 is an example of overlap extension PCR amplification
of the amplicons using a polymerase (e), according to one
embodiment of the invention. The resulting amplicon (f) includes
sequences (a), (d), and the overlapping sequences (b) and (c). The
resulting amplicon (f) can be used for bulk sequencing. The steps
can be performed in a reaction container or an emulsion droplet
(g).
[0140] 5) Molecular Linkage Using Multiprobe Circularization
[0141] In some embodiments, multiprobe circularization can be used.
In multiprobe circularization, two padlock probes target two
genetic loci. After hybridization to the target molecules, a
polymerase fills the gap between the ends of the two probes, and a
ligase completes the polynucleotide chains to form a circularized
polynucleotide molecule. (See FIGS. 1A-1C). The circularized
molecule can then be amplified with multiple displacement
amplification (MDA). Inverse PCR can also be used to amplify only
the circularized molecules, because PCR primers that amplify the
circularized molecules will not amplify the single stranded probes
(See FIGS. 2-3).
[0142] In one embodiment, the probes are hybridized to targets by
cycling at least 20 times between 95.degree. C. for 5 min and
55.degree. C. for 20 min (Baner et al., 2003 Nucleic Acids Research
31: e103). The single nucleotide gaps are filled with a Stoffel
polymerase and ligase. The circularized probes are amplified using
PCR with universal primers. When multiplexed for overlap extension
PCR, the two sets of universal primers are used, one for each
padlock probe type. The universal primers contain sequence regions
of overlap, which enables standard overlap extension PCR following
initial sequence capture by the padlock probes (FIGS. 2-3). The
probes can also be engineered to contain the appropriate primer
sequences for bulk sequencing, so the library is sequenced directly
after PCR amplification.
[0143] FIG. 1 shows an example of sequence linkage in a single cell
by intra-cellular multiprobe circularization of a molecular
complex, according to one embodiment of the invention. Each probe
has a region of complementarity to each of the target loci. The
complex includes two nucleic acid probes (a and b) and two target
nucleic acids (c and d). The single cell (e) can be contained in a
reaction container or an emulsion droplet (j). FIG. 1A illustrates
that the nucleic acid probe (a) has a first region (f) that is
complementary to a region on the target nucleic acid (c), and a
second region (g) that is complementary to a region on the target
nucleic acid (d). The nucleic acid probe (b) has a first region (h)
that is complementary to a region on the target nucleic acid (c)
and a second region (i) that is complementary to a region on the
target nucleic acid (d). FIG. 1B illustrates an example of sequence
linkage in a single cell (also in a reaction container or emulsion
droplet (j)) by intra-cellular multiprobe circularization of a
complex, according to one embodiment of the invention. The two
nucleic acid probes (a and b) are hybridized to the complementary
regions of the two target nucleic acids (c and d). FIG. 1C
illustrates an example of circularization of a probe-target linkage
complex occurs by amplification, according to one embodiment of the
invention. In one example, a .phi.-29 polymerase mediated rolling
circle amplification is used to circularize the end regions (f) of
the two nucleic acid probes (a) and (b).
[0144] FIG. 2 shows an example of amplification of a circularized
probe-target linkage complex (a) using a polymerase (b), according
to one embodiment of the invention. In some embodiments, a .phi.-29
polymerase is used in a mediated rolling circle amplification, and
copies (b and c) of the circularized probe-target complex are
generated. In addition, FIG. 3 illustrates an example of
amplification of a circularized probe-target linkage complex (a)
using a polymerase (b) and primers (c and d), according to one
embodiment of the invention. The primers (c and d) are used to
amplify the region of the circularized probe-target complex that is
complementary to the target nucleic acid. Multiple copies (e) of a
linear double-stranded polynucleic acid amplicon are generated and
sequenced in bulk.
[0145] 6) Methods Using Barcode Nucleic Acids
[0146] Bulk sequencing requires destruction of cells or emulsion
microdroplets, such that all polynucleic acid analytes are pooled
into a single reaction mixture. Trace back of a particular sequence
target from bulk sequencing data to a particular cell is typically
not possible. However, many applications will require trace back of
sequences to their original single cells. For example, an
investigator may wish to analyze a cell population for single cell
expression patterns for two RNA transcripts. Overlap extension
reverse transcriptase PCR amplification of two RNA transcript
targets followed by bulk sequencing is not adequate for such an
analysis because all of the transcripts are mixed together, and
transcripts from high-expressing cells are indistinguishable from
transcripts from low-expressing cells. To address this problem,
polynucleic acid barcodes are used. Each single cell emulsion
microdroplet or physical reaction container contains a single
unique clonal polynucleic acid barcode. This barcode is then linked
to the target polynucleic acids (i.e., RNA transcripts), and is
used to trace back the major amplicons to a single cell (See FIGS.
18-25). With trace back of each sequence to an original single
cell, it is possible to tabulate genetic data for each single cell,
which then enables single cell quantification (i.e., single cell
gene expression levels).
[0147] In one embodiment, the linker barcode oligonucleotide is
highly diluted, such that less than 1% of picoliter emulsion
microdroplets carry more than one linker barcode. This enables the
linking of a single cell to a single barcode. The linker barcode
oligonucleotide is amplified by PCR using universally primers
inside each droplet, such that each droplet will contain millions
of copies of only one linker barcode sequence, and that barcode
will be unique to that droplet (FIGS. 18-21). The dilution follows
Poisson statistics such that for P(k=1).apprxeq.0.99, the linker
barcodes need to be diluted to .lamda..apprxeq.0.01. The barcode is
then physically linked to the target molecule by overlap extension
PCR. Barcodes can be produced by a number of methods. In one
embodiment, a library of random decamers are subcloned into a
plasmid vector (e.g., Life Technologies). This produces a mixed
plasmid library with >1 million unique decamer barcodes. Then,
the plasmids are transformed into bacteria and 3,840 clones are
picked. The clones are sequenced by capillary sequencing
(Sequetech) and archived in glycerol stocks on 384-well plates.
Next, the clones are digested at restriction sites on either side
of the random decamer inserts to produce a .about.100 bp fragment.
These fragments are then biotinylated using Klenow fragment with
standard procedures. Washing between molecular steps is performed
with the aid of Ampure bead technology (PerkinElmer). The
biotinylated fragments are then be affixed to 17 .mu.m diameter
streptavidin beads (Life Technologies) in each well, producing
3,840 clonal populations of barcode beads. Nucleic acid
amplification using bead emulsions is described in U.S. Pat. No.
7,842,457.
[0148] In one embodiment, the method provides beads attached to
barcode nucleic acid sequences. A library of random 15-mers is
subcloned into a plasmid vector (Life Technologies). This produces
a mixed plasmid library with >1 billion unique 15-mer barcodes.
The biotinylated fragments are then affixed to 17 .mu.m diameter
streptavidin beads (Life Technologies). The plasmid barcode mixture
is diluted in PCR mix such that 99% of the droplets that contain a
plasmid will contain only a single clonal plasmid. The PCR mix
contains biotinylated nucleotides, such that amplified barcodes are
biotinylated. Then, streptavidin beads are flowed into this PCR mix
to encapsulate single beads in microdroplets. At least 10 million
beads are typically encapsulated, and then the bead/plasmid mixes
are thermocycled to amplify and biotinylate the barcodes. The
barcoded beads are then recovered and can be used in the droplet
barcoding method.
[0149] In another embodiment, a microfluidic device injects beads
coated with clonal linker barcode oligonucleotides into the single
cell emulsion microdroplets. Such a device enables visualization of
single beads and single cells in each drop, eliminating the
requirement for highly dilute linker barcode oligonucleotides. In
this embodiment, PCR is also used to amplify the linker barcode
oligonucleotide, such that each droplet contains millions of copies
of the same barcode sequence, but each barcode would be unique to a
single microdroplet. The barcode is then linked to the target
nucleic acid sequence using overlap extension PCR. During overlap
extension PCR amplification, the complementary sequence regions of
the amplified first and second nucleic acid sequences act as
primers for extension on both strands in each direction by DNA
polymerase molecules. In subsequent PCR cycles, the outer primers
prime the full fused sequence such that it is duplicated by DNA
polymerase. This method produces a plurality of fusion
complexes.
[0150] In another embodiment, the method includes steps for
providing a pool of unique barcode sequences, where each barcode
sequence is linked to a selection resistance gene, providing a
population of single cells, transfecting the population of single
cells with the pool of unique barcode sequences, selecting cells
comprising a unique barcode sequence and the selection resistance
gene, and isolating each of the selected cells into reaction
containers or emulsion microdroplets. In some embodiments, the
selection resistance gene encodes resistance to gentamycin,
neomycin, hygromycin, or puromycin. The selection resistance gene
enables one to select cells that have incorporated the barcode
sequence into the cell. Cells that lack the plasmid also lack the
selection resistance gene and therefore are killed in the presence
of a mammalian selection chemical such as gentamycin, neomycin,
hygromycin, or puromycin.
[0151] FIG. 15 illustrates an example of plasmid library
deconvolution by barcoded tailed end (5'-end barcoded) polymerase
chain reaction, which is followed by bulk sequencing and
informatics, according to one embodiment of the invention. The
barcode sequence can be traced back to a well and plate position,
the barcode sequence can then be traced to a nucleic acid sequence,
and the nucleic acid sequence is traced back to a well. Each of the
primers in (a) and (b) have a 5'-end barcoded tag. The target
nucleic acids in (c) and (d) are amplified using the primers in (a)
and (b). The steps can be performed in enclosed containers or
emulsion droplets, as shown in (c) and (d). FIG. 16 also shows an
example of amplification (e, f) of two target nucleic acids (A and
B) using primers that include barcode sequences, according to one
embodiment of the invention. The resulting amplicons that include
the barcode sequences are shown in (g) and (h). Moreover, FIG. 17
illustrates a simplified example of tracing back a barcode sequence
in an amplicon to a cell target (A or B), and tracing back the cell
target to a physical location (c, d) (e.g., a well), according to
one embodiment of the invention.
[0152] In addition, FIG. 18 illustrates the components for
molecular linkage between two transcripts (g and h) and a molecular
barcode sequence (k), according to one embodiment of the invention.
The targets (g and h) can be RNA transcripts, and the molecular
barcode sequence (k) is flanked by universal priming sites. Only
one copy of the molecular barcode oligonucleotide is contained in
the emulsion droplet or reaction container (j), and universal PCR
primers amplify the oligonucleotide to produce a plurality of
clonal barcode polynucleic acids. A forward primer (a) and reverse
primer (m) are used to amplify target nucleic acid (g). A forward
primer (n) and reverse primer (f) are used to amplify target
nucleic acid (h). The reverse primer (m) includes a region (b) that
is complementary to the target nucleic acid (g) and a region (c)
that is complementary to region (d) on primer (n). Primer (n)
includes a region (e) of complementarity to target nucleic acid (h)
and a region (d) of complementarity to region (c) of primer (m). In
some embodiments, more than two targets can be linked, and the
targets can also be DNA.
[0153] In addition, FIG. 19 shows an example of amplification of
the target nucleic acids (g and h) using primers as shown,
according to one embodiment of the invention. The forward primer
(a) is complementary to target nucleic acid (g), and the reverse
primer (b) for the target nucleic acid (g) includes a region (c)
that is complementary to the barcode sequence (k). Forward primer
(e) and reverse primer (f) are used to amplify target nucleic acid
(h). The forward primer (e) includes a region (d) that is
complementary to the barcode sequence (k).
[0154] In FIG. 20, amplicons resulting after amplification of two
target nucleic acids and a barcode sequence (k) are shown,
according to one embodiment of the invention. FIG. 21 illustrates a
fused amplicon that includes sequences of two target nucleic acids
(g and h) and a barcode sequence (k) inside an emulsion droplet or
reaction container (j), according to one embodiment of the
invention. The fused ("major") amplicon can be isolated by reverse
emulsion and bulk sequenced. In FIG. 22, the targets (g and h) can
be RNA transcripts, and the molecular barcode sequence (k) is
flanked by universal priming sites. Only one copy of the molecular
barcode sequence (k) is contained in the single cell emulsion
droplet or reaction container (j), and universal PCR primers
amplify the oligonucleotide to produce a plurality of clonal
barcode polynucleic acids. Forward primer (a) and reverse primer
(b) are used to amplify target nucleic acid (g). Forward primer (n)
and reverse primer (f) are used to amplify target nucleic acid (h).
The reverse primer (m) includes a region (b) that is complementary
to the target nucleic acid (g) and a region (c) that is
complementary to region (d) on primer (n). Primer (n) includes a
region (e) of complementarity to target nucleic acid (h) and a
region (d) of complementarity to region (c) of primer (m). In some
embodiments, more than two targets can be linked, and the targets
can also be DNA.
[0155] FIG. 23 illustrates the forward and reverse primers that are
used in a molecular linkage between two transcripts (g and h) and a
molecular barcode sequence (k) attached to a bead (m), according to
one embodiment of the invention. Forward primer (a) and reverse
primer (b) are used to amplify target nucleic acid (g). Forward
primer (n) and reverse primer (f) are used to amplify target
nucleic acid (h). The reverse primer (m) includes a region (b) that
is complementary to the target nucleic acid (g) and a region (c)
that is complementary to region (d) on primer (n). Primer (n)
includes a region (e) of complementarity to target nucleic acid (h)
and a region (d) of complementarity to region (c) of primer (m).
The two target nucleic acids are complementary to a DNA sequence
(l). FIG. 24 is an example of amplicons resulting after
amplification of two target nucleic acids and a barcode sequence
(k) attached to a bead (m), according to one embodiment of the
invention. FIG. 25 illustrates a fused amplicon that includes
sequences of two target nucleic acids (g and h) and a barcode
sequence (k), inside an emulsion droplet or reaction container (j),
according to one embodiment of the invention. The fused ("major")
amplicon can be isolated by reverse emulsion and bulk sequenced.
FIGS. 24-25 illustrate an example of amplicons resulting after
amplification of two target nucleic acids and a barcode sequence
(k) attached to a bead (m), according to one embodiment of the
invention.
[0156] 7) Methods Using Combination Amplification
[0157] Targeting and amplification of genetic loci in cells can be
performed using PCR, LCR, padlock probes, RT-PCR, or multi-probe
circularization. Any combination of these methods to target and
amplify different loci can be used. For example, a combination
amplification approach is used to amplify a genomic DNA locus and
an RNA transcript. In one embodiment, a thermostable reverse
transcriptase enzyme, such as ThermoScript RT (Lucigen) or GeneAmp
Thermostable rTth (Life Technologies), is combined with a
thermostable DNA polymerase, such as the Stoffel fragment or Taq
DNA polymerase. Thermocycling can induce first strand cDNA
synthesis from the RNA transcript target. Once cDNA from the RNA
transcript is synthesized, overlap extension PCR is performed using
the cDNA and the genomic DNA target sequences.
[0158] 8) Bulk Sequencing Methods
[0159] There are a number of new commercial methodologies for
polynucleic acid sequencing. These technologies are often referred
to as "next generation sequencing," "massively parallel
sequencing," or "bulk sequencing." These terms are used
interchangeably to describe any sequencing method that is capable
of acquiring more than one million polynucleic acid sequence tags
in a single run. Typically these methods function by making highly
parallelized measurements, i.e., parallelized screening of millions
of DNA clones on glass slides. The methods for linking multiple
polynucleic acid targets in single cells could be used in
combination with any commercialized bulk sequencing method. These
methods include reversible terminator chemistry (Illumina),
pyrosequencing using polony emulsion droplets (Roche), single
molecule sequencing (Pacific Biosciences), and others (IonTorrent,
Halcyon, etc.).
[0160] After the molecular linkage protocols are performed, and
before bulk sequencing, it is useful to specifically amplify and
purify major amplicons to reduce the overall sequencing required to
obtain useful data. Otherwise, many minor amplicons and other kinds
of unwanted background sequences will be sequenced unnecessarily.
This is accomplished by PCR using only the outer primers and the
nucleic acid analyte obtained from the lysed cells, followed by
size selection using a method such as gel agarose electrophoresis.
Other methods, such as size exclusion columns, microfluidic
electrophoresis, or micropore filters, might be used to select the
proper size molecules.
[0161] In one embodiment, the method provides the step of
performing a bulk sequencing reaction to generate sequence
information for at least 100,000 fused complexes from at least
10,000 cells within a population of cells. In another embodiment,
the bulk sequencing reaction generates sequence information for at
least 75,000, 50,000, or 25,000, or 10,000 fused complexes from at
least 10,000 cells within a population of cells.
[0162] The fused complexes can then be used to quantify the
particular biological or clinical phenomenon of interest. In the
case of functional T or B cell analysis, particular clonotypes that
express functional molecules can be analyzed by first determining
the CDR3 peptide sequence of the fused complex, and then tabulating
the instances of that CDR3 peptide linked to a particular effector
molecule. In this way the bulk sequencing quantifies clonal
expansion and biological function of each single clonotype. When
primers targeting multiple effector molecules and all possible
variable regions are multiplexed into a single assay, and one can
separate clonotypes into functional compartments. In the case of
linkage between barcodes and transcript targets, one can stratify
the bulk sequencing data by barcode and then tabulate the instances
of a particular barcode linked to a transcript target. When primers
targeting multiple transcripts are multiplexed into a single assay,
one can use barcodes to infer multigenic expression patterns for
single cells traced back to single droplets. In the case of linkage
between a mutant or variable sequence and other mutant or variable
sequences, one can analyze the bulk sequencing data to determine
the sequence at each locus in each molecule in the bulk sequencing
library, and then tabulate the instances of each sequence type. If,
for example, a mutation in each of the two linked targets is
required to produce a disease phenotype, quantifying the number of
linked targets with two mutations can be used to detect disease in
an individual.
[0163] C. Intracellular Linkage in Fixed Cells Followed by
Massively Parallel Sequencing
[0164] The molecular methods described in section B above can be
performed intracellularly in thousands to millions of single fixed
cells (Embleton et al., 1992 Nucleic Acids Research 20:3831-37;
Hviid, 2002 Clinical Chemistry 48:2115-2123; U.S. Pat. No.
5,830,663). The cell membranes of the cells serve as reaction
compartments, enabling linkage between two or more genetic loci in
thousands to millions of single fixed cells analyzed in parallel.
Using fixed cells as reaction compartments is more cost-effective
than a microfluidic chip to make emulsion microdroplets. Also,
heterogeneity in cell size or morphology in a particular cell
population is less likely to disrupt the fixed cell method than the
emulsion microdroplet method. However, in some cases, leakage of
nucleic acids from cells can cause background noise in the
molecular genetic analysis, so care must be taken to wash cells
between molecular steps and perform rigorous quality analysis of
analytes. Therefore, in one embodiment, fixed and permeabilized
cells are encapsulated into microdroplets, and amplification occurs
using fixed, permeabilized cells in microdroplets instead of lysed
cells inside of microdroplets.
[0165] 1) Molecular Linkage in Fixed Cell Methods
[0166] Our work using single cell whole genome amplification (WGA)
and PCR from single fixed cells has shown that cell fixation in
glutaraldehyde inhibits WGA but not PCR. In any embodiment of
intracellular linkage protocols, care must be taken to ensure that
fixation and/or permeabilization does not inhibit molecular
amplification.
[0167] For fixation, reagents such as glutaraldehye,
paraformaldehyde, IntraStain (Dako), or similar reagents can be
used. For permeabilization, reagents such as Triton X-100,
Tween-20, IntraStain (Dako), or similar reagents can be used
(Lippincott-Schwartz 2003 Short Protocols in Cell Biology; Celis
2005 Cell Biology: A Laboratory Handbook). After fixation and/or
permeabilization, the cells are washed multiple times in a buffer,
such as phosphate-buffered saline (PBS). Once the cells are fixed
and/or permeabilized, reaction buffers containing primers/probes
and enzymes are delivered to the intracellular compartment without
special machinery or methods.
[0168] For example, when using RT-PCR to amplify the target loci in
single cells, the fixed and permeabilized cells are soaked in
reaction buffer and the first strand cDNA is intracellularly
synthesized at 55-70.degree. C. for four hours. Without washing or
buffer exchange, one could then use standard overlap extension PCR
thermocycling conditions to amplify and link the targets. After
this amplification procedure, the mixture is washed several times
with PBS, and the supernatant is retained for quality control
analysis. The membranes of the resuspended cells are then disrupted
using alkaline lysis buffer or proteinase K solutions (Johnson et
al., 2010 Human Reproduction 25:1066-75).
[0169] After lysis of the cells and before bulk sequencing, it is
useful to specifically amplify linked complexes to reduce the
overall sequencing required to obtain useful data. This is
accomplished by PCR using only the outer primers and the nucleic
acid analyte obtained from the lysed cells, followed by size
selection using a method such as gel agarose electrophoresis.
[0170] II. Methods of Pooled Clone Library Deconvolution
[0171] Highly multiplexed libraries of nucleic acids are often
produced using parallelized methods that fail to produce individual
molecules at optimized molarity for applications of interest. The
method herein provides for parallelized synthesis, deconvolution,
and re-multiplexing of polynucleic acid libraries. The method
retains the advantages of both parallelized synthesis and
individual clone optimization. These polynucleic acid libraries are
used for a variety of applications, including but not limited to,
multiplexed amplification of target nucleic acid sequences for
sequencing and analysis (FIGS. 15-17).
[0172] A. Padlock Probe Synthesis Method
[0173] 1) Pre-Probe Pool Deconvolution Method
[0174] In one embodiment, a pool of thousands of padlock probes
that target single nucleotide polymorphisms, or SNPs, are
generated. DNA oligonucleotide probe precursors are synthesized in
pools (Atactic or NimbleGen). Universal primers are then used to
PCR amplify double-stranded DNA from the oligonucleotide pool
(Porreca et al., 2007 Nature Methods 4:931-36). Next, the ends of
the double-stranded PCR amplicon library are digested using a
restriction enzyme. For example, EcoP15I is used, which cleaves 25
base pairs from the recognition site and removes the universal PCR
binding sites. EcoP15I is one example of an enzyme that is adequate
for subcloning, and uncleaved products do not affect downstream
molecular steps. The digested library is subcloned into
custom-engineered plasmid vectors that confer ampicillin
resistance. The plasmids are then transformed into bacterial
cultures under selection with an antibiotic.
[0175] FIG. 4 illustrates an example of amplification of a
circularized probe-target linkage complex (a) in a single cell (b),
according to one embodiment of the invention. Amplification occurs
by transformation into bacteria and subsequent selection with
antibiotics. The amplicon (a) contains an antibiotic resistant gene
and cells (c) that are transformed with the amplicon are selected
in the presence of antibiotics. Cells without the circularized
probe-target complex (d) are not selected.
[0176] 2) Single Stranded Probe Synthesis En Masse
[0177] In some embodiments, a bacterial stock containing a mixed
library of thousands of clones, each targeting a particular SNP, is
used for single stranded probe synthesis en masse. For example, the
bacterial cultures are spread on LB agar plates under ampicillin
selection, and then individual colonies are picked. Next, PCR with
barcoded primers is used to amplify the probe sequence and flanking
universal priming regions. The result is an amplicon that contains
both the probe sequence and a barcode that can be traced back to a
single well. In one embodiment, a unique molecular barcode will
indicate a particular well position in a particular 384-well plate.
For example, the system could have 3,840 unique barcodes that
indicate the well positions and plate number for 3,840 PCRs in one
of ten 384-well plates. To deconvolute a 10,000-plex library of
clones, four rounds of deconvolution are performed using the set of
3,840 barcoded PCRs, and oversampling and screening a total of
15,360 clones. For each round of deconvolution, the PCR products
can then be pooled and sequenced using any bulk sequencing
method.
[0178] With the probe sequences matched to a barcode, a
deconvolution algorithm can then be used to deconvolute the
library. Because the barcode is matched to the insert sequence, a
table is created that matches the barcode sequence to the original
well and plate, and accordingly, this matches the insert sequence
to a well. The bacterial clones can then be stored as glycerol
stocks, and sequences of these stocks can then be catalogued in a
database and stored at -80.degree. C.
[0179] To synthesize single stranded padlock probes from the
template glycerol stocks, a derivation of the SMART technique is
used (Krishnakumar et al., 2008 PNAS 105:9296-9301). At a high
level, this method involves (i) digestion of a double stranded DNA
with a restriction endonuclease; (ii) dephosphorylation of the
"sticky end"; (iii) digestion of the second end of the double
stranded DNA with a second restriction endonuclease; and (iv)
digestion of the desphosphorylated strand of DNA using a .lamda.
exonuclease. First, the desired clones are picked, and then
cultured in 384-well plates. After incubation overnight, the
optical density of each culture is assessed, and then the stocks
are equalized. 5 .mu.L from the normalized bacterial cultures is
pooled, and the plasmid pool is purified using standard methods
(Qiagen). Next, a set of universal PCR primers is used to generate
a pool of double-stranded PCR amplicons. The resulting PCR mixture
is then subjected to digestion with a restriction enzyme, such as
HaeIII (NEB), followed by dephosphorylation with shrimp alkaline
phosphatase (SAP). After desphosphorylation, the analyte is
digested with a restriction enzyme, such as BstUI (NEB). This
product can then be digested with .lamda. exonuclease (NEB),
producing single stranded DNA molecules. Finally, single stranded
DNA (ssDNA) is purified from any undigested double stranded DNA
using a commercial kit (Zymo Research). In this way, hundreds of
thousands of probes are synthesized in parallel.
[0180] B. Cell Clone Deconvolution
[0181] The methods in Section II. A. can also be used to
deconvolute mixed libraries of cells or organisms with different
underlying genetic characteristics. The goal is to separate the
mixed library of clones into reaction compartments, perform
barcoded PCR followed by bulk sequencing on the clones, and then
map sequence data back to the clones in reaction compartments. In
one example, a population of mammalian cells is mutagenized and
then clonal populations of mutagenized cells are isolated from the
mixed population. In this embodiment, single mutagenized cells are
sorted into reaction compartments, and then targeted barcoded PCR
or padlock probes are performed at genetic loci of interest. Bulk
sequencing data is used to trace back to the original clones, and
then the physical clone stocks is used for further investigation or
use.
EXAMPLES
[0182] Below are examples of specific embodiments for carrying out
the present invention. The examples are offered for illustrative
purposes only, and are not intended to limit the scope of the
present invention in any way. Efforts have been made to ensure
accuracy with respect to numbers used (e.g., amounts, temperatures,
etc.), but some experimental error and deviation should, of course,
be allowed for.
[0183] The practice of the present invention will employ, unless
otherwise indicated, conventional methods of protein chemistry,
biochemistry, recombinant DNA techniques and pharmacology, within
the skill of the art. Such techniques are explained fully in the
literature. See, e.g., T. E. Creighton, Proteins: Structures and
Molecular Properties (W.H. Freeman and Company, 1993); A. L.
Lehninger, Biochemistry (Worth Publishers, Inc., current addition);
Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd
Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan
eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences,
18th Edition (Easton, Pa.: Mack Publishing Company, 1990); Carey
and Sundberg Advanced Organic Chemistry 3.sup.rd Ed. (Plenum Press)
Vols A and B (1992).
Example 1
Methods of T-cell Analysis
[0184] The immune system responds to disease by inducing cellular
responses. Nearly all immunology is involved with detection of
clonotype expansion or contraction in response to an antigen and/or
functional analysis of the expanded or contracted clonotypes.
Described in this example are methods that leverage the information
contained in immune response to diagnose and treat disease. Active
and/or memory cells are particularly informative because these
cells indicate a functional immune response to a disease, and
therefore have high information content. Variable DNA regions and
RNA transcripts were analyzed in single cells from populations of
activated and/or memory immune cells, and then correlated with
disease. These profiles were used to develop noninvasive
diagnostics, high-value diagnostics that inform treatment regimens,
and novel therapeutic agents.
[0185] T cells include T cell receptors (TCR) that recognize
antigens and control immune responses. The T cell receptor is
composed of two subunits: .alpha. and .beta. or .gamma. and
.delta.. Current methods to examine T cells by their T cell
receptors overwhelmingly sequence T cell receptor subunits from
bulk populations that range from a few to millions of cells. This
results in a catalogue of subunit sequences (.alpha. or .delta.)
that are unlinked to the other corresponding subunit sequence found
in individual cells (.beta. or .gamma.). This gives population
level information about T cell receptor diversity but does not give
a description of individual T cell receptors in individual cells by
both subunits (.alpha. and .beta. or .gamma. and .delta.). By
linking sequences in a single cell using the methods in Sections I.
A-C, the TCRs of individual cells in mixed populations are analyzed
with finer resolution, and this allows an unprecedented mapping of
human T-cell diversity.
[0186] The sequences of TCR subunits and immune functionality
molecules were linked using the methods described in Sections I.
A-C. This approach, called "functional T cell sequencing," focused
specifically on T cells likely to have a clinically or biologically
relevant function. For example, the immune function of a T cell is
indicated by expression of both clonal TCR and signaling molecules
such as interleukin-4 (IL-4). Naive T cells express clonal TCR but
do not express signaling molecules such as IL-4, and have different
immune functions. The TCR was linked to the signaling molecule,
which in turn linked the TCR to clinical function. Primers
amplifying the full TCR.beta. repertoire were linked to a single
immune effector molecule, such as IL-4. Primers amplifying the full
TCR.beta. repertoire were linked to dozens of immune effector
molecules, resulting in a full T cell phenotype for each T cell
clonotype in the assay.
[0187] Examples of molecules that are associated with immune
function and that are linked to a TCR sequence include, but are not
limited to: interleukin-2 (IL-2), interleukin-4 (IL-4), interferon
gamma (IFN.gamma.), interleukin-10 (IL-10), interleukin-1 (IL-1),
interleukin-13 (IL-13), interleukin-17 (IL-17), interleukin-18
(IL-18), tumor necrosis factor alpha (TNF.alpha.), tumor necrosis
factor beta (TNF.beta.), T-box transcription factor 21 (TBX21),
forkhead box P3 (FOXP3), cluster of differentiation 4 (CD4),
cluster of differentiation 8 (CD8), cluster of differentiation 1d
(CD 1d), cluster of differentiation 161 (CD 161), cluster of
differentiation 3 (CD3), and T-box transcription factor TBX21
(T-BET).
[0188] The TCR .beta. chain was linked to a molecule associated
with immune function. In another exemplary method, the TCR .alpha.
and .beta., or TCR .gamma. and .delta., or any of the individual
subunits, were linked to immune functionality molecules. Published
primers optimized for amplification of recombined genomic TCR were
used (Robins et al., 2009 Blood 114:4099-107). Much of the peptide
variability of the TCR was encoded in CDR3.beta., which was formed
by recombination between noncontiguous variable (V), diversity (D),
and joining (J) segments in the b chain loci (Wang et al., 2010
PNAS 107:1518-23). Previously published PCR primers targeting the
CDR3.beta. locus can also be used (Robins et al., 2009 Blood
114:4099-107; Robins et al., 2010 Science Translational Med
2:47ra64). This set of forty-five forward primers and thirteen
reverse primers amplify the .about.200 base pair recombined genomic
CDR3.beta. region for multiplex amplification of the full
CDR3.beta. complement of a sample of human peripheral blood
mononuclear cells. The CDR3.beta. region begins with the second
conserved cysteine in the 3' region of the V.beta. segment and ends
with the conserved phenylalanine encoded by the 5' region of the
J.beta. segment (Monod et al., 2004 Bioinformatics 20:1379-i385).
Thus, amplified sequences were informatically translated to locate
the conserved cysteine, obtain the intervening peptide sequence,
and tabulate counts of each unique clone in the sample.
[0189] Examples of primers that can be used for multiplex
amplification of TCR sequences and linkage to various immune
effector molecules are shown in Table 2. These primers have been
used, for example with the methods of Section I. A-C, to amplify
and link TCR sequences to various immune effector molecules.
Example 2
High-Throughput Protocol for TCR.beta. Repertoire Library
Construction
[0190] In one embodiment, a high-throughput protocol was
implemented for human or mouse TCR.beta. repertoire library
construction. The libraries were sequenced directly on the GAIIx
next-gen sequencing platform (Illumina). For human samples,
multiplex PCR was performed using a set of 20 primers to amplify
across all 50 V segments and 10 primers to amplify across all 13 J
segments. The primers libraries generated libraries that were the
reverse complement of the native TCR.beta. sequence. This enabled
sequencing from the J side of the constructs without further
manipulation. The primers also had tails with the same sequence as
a portion of the Illumina TruSeq library adapter. The 30 primers
were pooled in a single 400 .mu.l PCR, which contained genomic DNA
from at least 5.times.10.sup.5 cells. The reactions were then
thermocycled for no more than 25 cycles, depending on the number of
input cells. After thermocycling, a PCR column (Qiagen) was used to
remove the primers. Next, a second round of PCR was performed,
using an aliquot of the purified first round analyte and a set of
universal primers. The universal primers for the second round of
PCR annealed to the tails of the first primers, producing final PCR
products that had the full Illumina sequencing adapter sequence
fused to a library of TCR.beta. sequences. The universal primers
also had barcode tags, which enabled multiplexing of dozens of
samples in a single next-generation sequencing lane. Finally, the
libraries were purified with gel size selection, and quantified
with a quantitative PCR kit (Kapa Biosystems) prior to sequencing.
Over 300 TCR.beta. libraries were built and sequenced using this
protocol.
[0191] FIG. 31 shows a simplified workflow for high-throughput
generation of TCR.beta. repertoire libraries. The first round used
a set of 30 primers to amplify the full TCR.beta. repertoire and
attaches universal priming regions. The second round amplified the
repertoire with universal primers and added sequences for
next-generation sequencing.
Example 3
Protocol Optimization Using 48-Plex Pool of TCR.beta. Plasmid
Clones
[0192] The true content of any particular TCR.beta. repertoire is
not known, so an endogenous TCR.beta. repertoire cannot serve as a
gold standard for protocol optimization. A 48-plex pool of mouse
TCR.beta. plasmid clones was designed to act as template for
protocol optimization. First, multiplexed amplification was
performed of the mouse TCR.beta. repertoire as described in Example
2. The PCR products were subcloned using the TOPO-TA vector (Life
Technologies), transformed post ligation into TOP10 competent cells
(Life Technologies), and 48 transformed colonies were picked. Next,
the clones were sequenced by Sanger sequencing to identify the
TCR.beta. clonotype sequences. All of the clones were unique, and
represented a broad range of possible V-J.beta. combinations. The
plasmids were then mixed in a single tube, across three orders of
magnitude and with six replicates at each concentration.
[0193] The 48-plex mixture was used to optimize the TCR.beta.
amplification protocol. The purification methodology after the
first and second PCR steps, the number of cycles in the first PCR,
and the annealing temperature in the first PCR were optimized. WA
PCR column or gel excision for the purification technology were
used. Due to spurious mispriming, the first round of PCR produced
multiple bands in addition to a major band in the target size range
of 150-200 bp. Gel excision removed the undesired material, but the
process was tedious and results in loss of up to 75% of the desired
material. Protocols with fewer first PCR amplification cycles
typically produce less severe amplification bias, whereas
amplification bias is typically skewed in protocols with >30
cycles. Annealing temperature controls the stringency of priming
events, with lower temperatures producing higher yields but less
specificity.
[0194] 68 Illumina libraries were constructed using the mixture of
48 plasmids and varying protocol parameters as described above. The
libraries were sequenced on a next-generation sequencing machine
(Illumina) to obtain >500 k paired-end 80 bp sequence tags for
each library. To analyze the sequencing data, each 2.times.80 bp
sequence tag was aligned to the sequences of the 48 known
clonotypes to obtain the best match. The number of tags aligned to
each plasmid for each library was counted, and then these results
were correlated with the expected ratios of the input plasmid
clones. A linear regression analysis to fit each data set was
performed (see Table 1: yielding correlation, R.sup.2 of 1, and a
slope of 1. The protocol used 15 cycles of amplification for the
first PCR, an annealing temperature of 61.degree. C., PCR column
purification after the first PCR, and gel purification following
the second PCR.
TABLE-US-00001 TABLE 1 Analysis of selected pilot protocol
optimization experiments. R.sup.2 and slope were computed from a
regression analysis between the observed count of sequences in each
library versus the known input count. Conditions in row 3 (bold)
are an example of an optimized protocol. 1st PCR 1st PCR 2nd PCR
Cycles 1st PCR Ta Cleanup Cleanup R2 Slope 15 57 column gel 0.56
0.54 15 59 column gel 0.7 0.68 15 61 column gel 0.72 0.71 15 63
column gel 0.69 0.7 25 57 column gel 0.47 0.43 25 59 column gel
0.44 0.4 25 61 column gel 0.45 0.45 25 63 column gel 0.41 0.39 35
57 column gel 0.47 0.41 35 59 column gel 0.43 0.37 35 61 column gel
0.42 0.4 35 63 column gel 0.41 0.4
Example 4
TCR.beta. Repertoire Data Analysis
[0195] Because the TCR.beta. repertoire contains as many as
5.times.10.sup.6 clonotypes, and CDR3 regions often differ by only
a few nucleotides, a sophisticated custom analysis platform was
necessary just to identify the clones in the library. The turnkey
fast-alignment methods, such as BLAST (Altschul et al., 1990), BLAT
(Kent 2002), and SOAP (Li et al., 2008), were inadequate for the
task at hand, because they resulted in many spurious matches.
Moreover, highly accurate turnkey methods such as Smith-Waterman
(Smith and Waterman, 1981) were cumbersomely slow for this kind of
analysis. Finally, all of these methods would require a huge
reference library (10.sup.15 diversity) of all possible CDR3
nucleotide sequences, which is a computational burden.
[0196] To address these problems, an algorithm was built that is
faster than any current method by almost an order of magnitude, and
which has the same accuracy as standard alignment methods. A table
of 4-8 nucleotide "words" that uniquely identify the V and J
segments of mouse or human within the amplified region is
generated. The validity of each match is tested by identifying the
distance to and the sequence of the second conserved cysteine. The
match was accepted as correct only if both distance and sequence
confirm the match. Using data from our TCR.beta. repertoire
sequencing experiments, we typically identified 99.98% of V-J.beta.
combinations unambiguously. The remaining reads were discarded.
[0197] We also employed two further quality control steps: (i) the
CDR3 region must not contain any sequencing errors in the form of
uncalled bases; and (ii) the CDR3 region is in frame as defined by
the second conserved cysteine. If all quality tests are passed, the
method identified the protein coding sequence of the CDR3 region
within the known reading frame for that particular gene. This
algorithm ensured speed, accuracy and lowest error rates. It can
easily be adapted for use with other variable gene families, such
as TCR.alpha., or IgH.
[0198] A number of experiments were performed to demonstrate the
utility of our protocols for deep TCR.beta. sequencing. Mouse bone
marrow transplantations were performed in matched and mismatched
genetic backgrounds. To determine the systemic impact of these
transplantation events on the mice, the T cell repertoires of the
colon were examined. The most common TCR.beta. clonotypes in colons
from replicate mismatched bone marrow transplantations were more
closely related than the most common TCR clonotypes in a colon from
syngenic transplantation, especially in the top 1% of clones.
Profiles of control colons were nearly identical in the top 1% of
clonotypes. These data indicate that the protocols described herein
produce quality, quantitative data of utility to research
customers.
Example 5
Constructing a Control Library of TCR.beta. Clones and Optimizing
PCR Conditions Using the Control Library
[0199] Additional experiments are performed to build a library of
960 TCR.beta. clones that contains at least one representative from
each of the 650 possible human V-J.beta. combinations. This set of
clones is used for molecular and statistical optimizations. A
plasmid library of human TCR.beta. is generated as described above
in Example 4. About 3,000 transformant colonies are picked and the
clones are sequenced using standard capillary sequencing (e.g.,
Sequetech). The V-J.beta. pairing corresponding to each sequenced
clone is identified as described above in Example 4. The goal is to
obtain at least one representative clone for each V-J.beta. pair.
If sequencing finds that some V-J.beta. pairs are missing, those
pairs are rescued by making libraries of TCR.beta. using only
primers for those missing V-J.beta. pairs, subcloning, and
sequencing. After several rounds, clones are identified for every
possible V-J.beta. pair. These plasmids are mixed into a single
template mixture, with 96 clones at each concentration and 10
different concentrations across three orders of magnitude.
Example 6
Optimizing PCR Conditions Using the Control Library
[0200] Previous experiments have shown that the first PCR
amplification causes most of the amplification bias. Additional
experiments are performed using the 960-clone pool and
next-generation sequencing to further optimize first PCR cycle
number. About 60 TCR.beta. libraries are generated from the plasmid
mixture, with four replicates for each of the 15 cycle numbers
between 10 and 25. The library mixtures are quantified and .about.4
million sequences are obtained from each library a GAIIx next-gen
sequencer (Illumina). The V-J.beta. pairing corresponding to each
sequenced clone as described above in Example 4, and the counts of
sequence tags are tallied for each clone in each data set.
[0201] Prior work has shown that GC content can affect
amplification efficiency (Markoulatos et al., 2002). The immense
variety of V(D)J.beta. combinations result in an assortment GC
contents and lengths. The amplification bias is tested after
addition of various reagents, such as betaine or magnesium
chloride. Approximately 60 TCR.beta. libraries are generated from
the plasmid mixture, with four replicates for each of 15 different
buffers. The library mixtures are quantified and .about.4 million
sequences are obtained from each library using a GAIIx next-gen
sequencer (Illumina). The V-J.beta. pairing is identified
corresponding to each sequenced clone as described above in Example
4, and the counts of sequence tags are tabulated for each clone in
each data set.
Example 7
T Cell Analysis and Transplant Monitoring
[0202] Methods of the invention are applied to post-transplant
immune monitoring. After an allogeneic transplant (i.e., kidney or
liver), a host's T cells response to transplants are assessed to
monitor the health of the host and the graft. Molecular monitoring
of blood or urine is helpful to detect acute or chronic rejection
before a biopsy would typically be indicated. For example,
detection of alloantibodies to human leukocyte antigen (HLA) has
been associated with chronic allograft rejection (Terasaki and
Ozawa, 2004 American Journal of Transplantation 4:438-43). Other
molecular markers include b.sub.2-microglobulin, neopterin, and
proinflammatory cytokines in urine and blood (Sabek et al., 2002
Transplantation 74:701-7; Tatapudi et al., 2004 Kidney
International 65:2390; Matz et al., 2006 Kidney International
69:1683; Bestard et al., 2010 Current Opinion in Organ
Transplantation 15:467-473). However, none of these methods has
become widely adopted in clinical practice, perhaps due to low
specificity and sensitivity. Prior work has shown that regulatory T
cells (Treg) induce graft tolerance by down-regulating helper T
cells (Th) (Graca et al., 2002 Journal of Experimental Medicine
195: 1641). Additionally, transplanting hematopoietic stem cells
from HLA-mismatched donors into the recipient has resulted in
long-term nonimmunosuppressive renal transplant tolerance up to 5
years after transplant (Kawai et al., 2008 NEJM 358:353-61).
[0203] Primers are designed that target transcripts from several
immune functionality genes (described above), which produce overlap
extension fusion constructs with CDR3.beta. amplicons. In one
embodiment, these primers are designed to specifically amplify cDNA
by spanning RNA splice junctions and hybridize to cDNA from
processed messenger RNA. Examples of molecules that are associated
with immune function include, but are not limited to, T-BET and
IFN-g, which indicate T helper 1 cells (Th1); GATA3 and IL-4, which
indicate T helper 2 cells (Th2); IL-17, which indicates T helper 17
cells (Th17); and FoxP3 and IL-10, which indicate T regulatory
cells (Treg). Such signaling molecules are members of large protein
families with strong homology between paralogues, which may result
in background amplification during PCR. Accordingly, nucleotide
alignments of all of the paralogues in each family (i.e., all of
the interleukin genes) are generated and PCR primers are designed
that span exons and have the lowest possible sequence homology to
other genes in the family.
[0204] Functional T cell monitoring involves the following steps:
(i) isolation of single peripheral blood mononuclear cells in
emulsion microdroplet reactors; (ii) overlap extension
amplification of complexes between TCR.beta. and immune
functionality molecules in microdroplet reactors; and (iii)
emulsion reversal followed by bulk sequencing. The TCR.beta. and
immune functionality primer sets will be combined to produce major
amplicon fusion constructs from the minor amplicons. The overlap
extension primers are a combination of the reverse TCR.beta.
primers with approximately half of each immune functionality
molecule forward primer, which results in a total of 91 fusion
reverse TCR.beta. primers. The fusion primers between the forward
primer for each immune functionality minor amplicon contain
approximately half of each of the 13 TCR.beta. reverse primers, for
a total of 91 fusion reverse immune functionality primers. The
final result is that the overlap between any pair of TCR.beta. and
immune functionality minor amplicons has a melting temperature of
approximately 55-65.degree. C., such that each minor amplicon acts
as a primer for the paired amplicon. In the final reaction
mixtures, the outer primers are diluted to a final concentration of
0.1 .mu.M, and the inner primers are diluted to 0.01 .mu.M, such
that the inner primers are limiting reagents.
Example 8
T Cell Analysis and Latent Tuberculosis Diagnosis
[0205] Latent tuberculosis (TB) is a major global epidemic,
affecting as many as 2 billion people worldwide. There is currently
no reliable test for clinical diagnosis of latent TB. This
technology gap has severe clinical consequences, since reactivated
TB is the only reliable hallmark of latent TB. Furthermore,
clinical trials for vaccines and therapies lack biomarkers for
latent TB, and therefore must follow cohorts over many years to
prove efficacy.
[0206] The major current vaccine for tuberculosis, bacillus
Calmette-Guerin (BCG), is an unreliable prophylactic. In a
meta-analysis of dozens of epidemiological studies, the overall
effect of BCG was 50% against TB infections, 78% against pulmonary
TB, 64% against TB meningitis, and 71% against death due to TB
infection (Colditz et al., 1994 JAMA 271:698-702). Additionally,
the rapid rise in multidrug resistant TB has increased the need for
new vaccine and immunotherapy approaches. Up to 90% of infected,
immunocompetent individuals never progress to disease, resulting in
the huge global latent TB reservoir (Kaufmann, 2005 Trends in
Immunology 26:660-67).
[0207] Since tuberculosis is a facultative intracellular pathogen,
immunity is almost entirely mediated through T cells. Interferon-g
expressing T helper 1 (Th1) cells elicit primary TB response, with
some involvement by T helper 2 cells (Th2). After primary response,
the bacteria become latent, controlled by regulatory T cell (Treg)
and memory T cells (Tmem). Recently, eleven new vaccine candidates
have entered clinical trials (Kaufmann, 2005 Trends in Immunology
26:660-67). These vaccines are all "post-exposure" vaccines, i.e.,
they target T cell responses to latent TB and are intended to
prevent disease reactivation. Because of the partial failure of BCG
to induce full immunity, rational design and validation of future
TB vaccines should include systematic analysis of the specific
immune response to both TB and the new vaccines.
[0208] For decades, the standard of care for diagnosis of latent
tuberculosis has been the tuberculin skin test (TST) (Pai et al.,
2004 Lancet Infectious Disease 4:761-76). More recently, two
commercial in vitro interferon-g assays have been developed: the
QuantiFERON-TB assay and the T SPOT-TB assay. These assays measure
cell-mediated immunity by quantifying interferon-g released from T
cells when challenged with a cocktail of tuberculosis antigens.
Unfortunately, neither the TST nor the newer interferon-g tests is
effective at distinguishing latent from cleared TB (Diel et al.,
2007 American Journal of Respir Crit. Care Med 177:1164-70). This
is a significant problem because patients without clinical evidence
of latent TB (i.e., visualization of granulomas) but with positive
TST or interferon-g test typically receive 6-9 months of isoniazide
therapy, even though this empiric intervention is unnecessary in
patients who have cleared primary infection and can cause serious
complications such as liver failure.
[0209] Prior work has demonstrated that T cell responses are used
to distinguish latent from active TB (Schuck et al., 2009 PLoS One
4:e5590). The premise of this prior work is that immune cells
directed against TB antigens will be expanded in the memory T cell
population if the TB is latent, but expanded in a helper T cell
fraction if the TB is active. Functional T cell sequencing is used
to distinguish latent TB from cleared TB. The protocol involves:
(i) capture of single T cells in emulsion microdroplets; (ii)
microdroplet reverse transcription and amplification at target
loci; (iii) microdroplet synthesis of fusion complexes between two
or more target loci; and (iv) reversing emulsions and sequencing
major amplicons with bulk sequencing. Sequence specific PCR is used
after overlap extension RT-PCR to detect the presence of a
particular biomarker for latent TB.
Example 9
T Cell Analysis and Diagnosing or Monitoring Disease
[0210] Similarly, functional T cell monitoring is used for
diagnosis and monitoring of nearly any human disease. These
diseases, include but are not limited, to systemic lupus
erythmatosis (SLE), allergy, autoimmune disease, heart transplants,
liver transplants, bone marrow transplants, lung transplants, solid
tumors, liquid tumors, myelodysplastic syndrome (MDS), chronic
infection, acute infection, hepatitis, human papilloma virus (HPV),
herpes simplex virus, cytomegalovirus (CMV), and human
immunodeficiency virus (HIV). Such monitoring includes individual
diagnosis and monitoring or population monitoring for
epidemiological studies.
[0211] T cell monitoring is used for research purposes using any
non-human model system, such as zebrafish, mouse, rat, or rabbit. T
cell monitoring also is used for research purposes using any human
model system, such as primary T cell lines or immortal T cell
lines.
Example 10
B Cell Analysis
[0212] Antibodies are produced by recombined genomic immunoglobulin
(Ig) sequences in B lineage cells. Immunoglobulin light chains are
derived from either .kappa. or .lamda. genes. The .lamda. genes are
comprised of four constant (C) region genes and approximately
thirty variable (V) region genes. In contrast, the .kappa. genes
are comprised of one C region gene and 250 V region genes. The
heavy chain gene family is comprised of several hundred V gene
segments, fifteen D gene segments, and four joining (J) gene
segments. Somatic recombination during B cell differentiation
randomly chooses one V-D-J combination in the heavy chain and one
V-J combination in either .kappa. or .lamda. light chain. Because
there are so many gene segments, millions of unique combinations
are possible. The V regions also undergo somatic hypermutation
after recombination, generating further diversity. Despite this
underlying complexity, it is possible to use dozens of primers
targeting conserved sequences to sequence the full heavy and light
chain complement in several multiplexed reactions (van Dongen et
al., 2003 Leukemia 17: 2257-2317).
[0213] Any of the individual immunoglobulin subunits are linked to
immune functionality molecules that indicate B cell activity or
subpopulations. A first target nucleic sequence, a second target
nucleic acid sequence or both target nucleic acid sequences can
comprise an immunoglobulin sequence. Alternatively the first target
nucleic acid sequence can comprise an immunoglobulin sequence, and
the second sequence can comprise a second molecule associated with
immune cell function. Examples of functional B cell marker
molecules include, but are not limited to, major histocompatibility
complex (MHC), cluster of differentiation 19 (CD19), interleukin 7
receptor (IL-17 receptor), cluster of differentiation 10 (CD 10),
cluster of differentiation 20 (CD20), cluster of differentiation 22
(CD22), cluster of differentiation 34 (CD34), cluster of
differentiation 27 (CD27), cluster of differentiation 5 (CD5), and
cluster of differentiation 45 (CD45), cluster of differentiation 38
(CD38), cluster of differentiation 78 (CD78), interleukin-6
receptor, Interferon regulatory factor 4 (IRF4), and cluster of
differentiation 138 (CD138). A primer pool that amplifies the full
IgH complement of B cells is combined with a single B cell marker
primer pair. This assays all of the B cell clonotypes in a
particular functional group, such as Bmem. Alternatively, a primer
pool that amplifies the full IgH complement of B cells is combined
with dozens of B cell marker primer pairs. This assay provides the
full phenotype for each clonotype in the cell mixture.
[0214] A method is provided for linking IgH and Ig.kappa.. IgH and
Ig.lamda. are linked in single cells to immune functionality
molecules that indicate B cell activity or subpopulations. The vast
majority of diversity in the B cell repertoire is comprised of the
V-D-J regions of IgH and V-J regions of Ig.kappa. (Sandberg et al.,
2005 Journal of Molecular Diagnostics 7:495-503; Boyd et al., 2009
Science Translational Med 1:12ra23). Previously-reported primer
pools (van Dongen et al., 2003 Leukemia 17: 2257-2317) are used to
amplify these regions of IgH and Ig.kappa.. Five primer pools in
separate reactions are used to amplify the IgH and Ig.kappa.
complement of a healthy human. The amplified material sequenced
with bulk sequencing. To analyze the bulk sequencing results, the
IgBLAST algorithm and database is used to determine the V-D and D-J
junctions of IgH and align the IgH and Ig.kappa. sequences to germ
line gene segments. Overall, this method is more highly
parallelized than previously-reported methods for single cell Ig
analysis (U.S. Pat. No. 7,749,697).
Example 11
B Cell Analysis and Drug Discovery
[0215] Antibody therapeutics are increasingly used by
pharmaceutical companies to treat intractable diseases such as
cancer (Carter 2006 Nature Reviews Immunology 6:343-357). However,
the process of antibody drug discovery is expensive and tedious,
requiring the identification of an antigen, and then the isolation
and production of monoclonal antibodies with activity against the
antigen. Individuals that have been exposed to disease produce
antibodies against antigens associated with that disease, so it is
possible mine patient immune repertoires for antibodies that could
be used for pharmaceutical development. However, a functional
monoclonal antibody requires both heavy and light chain
immunoglobulins. Overlap extension PCR and/or overlap extension
RT-PCR in single cell emulsion microdroplets is used to capture
functional antibody sequences from patient B cell repertoires.
Briefly, the method involves the following steps: (i) isolation of
single B cells in aqueous-in-oil microreactors using a microfluidic
device; (ii) molecular linkage between heavy and light chain
immunoglobulin (IgH and Ig.kappa.) amplicons inside the single cell
microreactors; and (iii) reversal of the emulsions followed by bulk
sequencing of the linked polynucleic acid sequences. This produces
heavy and light chain pairings from millions of single B cells
analyzed in parallel, which are mined as potential therapeutic
agents.
[0216] The fusion primer sequences for overlap extension PCR and
overlap extension RT-PCR are identical to the independent IgH and
Ig.kappa. primers, except certain primers contain additional
polynucleotide sequences for overlap extension: (i) the forward
primer of the IgH locus has a random 10-20 nt sequence with no
complementarity to either target; (ii) the reverse primer of the
IgH loci has a 10-20 nt sequence with complementarity to the
forward primer of Ig.kappa., and (iii) the forward primer of
Ig.kappa. has complementarity to the reverse primers for the IgH
locus. In the final reaction mixtures, the outer primers are
diluted to a final concentration of 0.1 .mu.M, and the inner
primers are diluted to 0.01 .mu.M, such that the inner primers will
be a limiting reagent. This drives formation of the major
amplicon.
Example 12
B Cell Analysis and Monitoring Immunity
[0217] Humoral memory B cells (Bmem) help mammalian immune systems
retain certain kinds of immunity. After exposure to an antigen and
expansion of antibody-producing cells, Bmem cells survive for many
years and contribute to the secondary immune response upon
re-introduction of an antigen. Such immunity is typically measured
in a cellular or antibody-based in vitro assay. In some cases, it
is beneficial to detect immunity by amplifying, linking, and
detecting IgH and light chain immunoglobulin variable regions in
single B cells. Such a method is more specific and sensitive than
current methods. Massively parallel B cell repertoire sequencing is
used as described in Example 13 to screen for Bmem cells that
contain a certain heavy and light chain pairing which is indicative
of immunity. In another exemplary method, single cell heavy and
light chain pairing are combined with functional B cell sequencing,
i.e., developing overlap extension RT-PCR primers that target RNA
transcripts that are overrepresented in Bmem cells (i.e., CD27). By
combining light and heavy immunoglobulin amplification with gene
expression of Bmem or plasma cell immune function transcripts,
sorting cells by FACS or other tedious methods are avoided.
Example 13
B Cell Analysis and Diagnosing and Monitoring Disease
[0218] B cell monitoring is used for diagnosis and monitoring of
nearly any human disease. These diseases include, but are not
limited to, systemic lupus erythmatosis (SLE), allergy, autoimmune
disease, heart transplants, liver transplants, bone marrow
transplants, lung transplants, solid tumors, liquid tumors,
myelodysplastic syndrome (MDS), chronic infection, acute infection,
hepatitis, human papilloma virus (HPV), herpes simplex virus (HSV),
cytomegalovirus (CMV), and human immunodeficiency virus (HIV). Such
monitoring could include individual diagnosis and monitoring or
population monitoring for epidemiological studies.
[0219] B cell monitoring is also used for research purposes using
any non-human model system, such as zebrafish, mouse, rat, or
rabbit. B cell monitoring is used for research purposes using any
human model system, such as primary B cell lines or immortal B cell
lines.
Example 14
Methods for Noninvasive Prenatal Diagnosis
[0220] In the absence of prenatal diagnosis, approximately 2% of
babies have serious physical or mental handicaps, approximately
3.3% of babies have some form of congenital malformation, and
approximately 0.5% have a phenotypically-significant chromosome
abnormality. Current clinical methods for prenatal diagnosis are
invasive and carry significant risks to the fetus, restricting
their use to patients of advanced maternal age. Noninvasive,
accurate technologies are needed for first trimester prenatal
genetic diagnosis. Most current preclinical methods for noninvasive
prenatal diagnosis capture and diagnose circulating fetal cells.
These methods rely on cell surface proteins and/or cell morphology
to enrich for particular populations of fetal cells. Such flawed
approaches have failed to reach the clinic despite decades of
intense research and development.
[0221] Isolation of circulating fetal nucleated red blood cells
(FNRBCs) from maternal blood is one approach to noninvasive
prenatal diagnosis. Nucleated red blood cells are among the first
hematopoietic cell types produced during fetal development. These
cells cross the placenta and are detectable at low concentrations
in maternal blood during the first trimester (Ganshirt et al., 1994
Lancet 343:1038-9). Another attractive feature of FNRBCs is their
short lifespan compared to other circulating fetal cell types
(Pearson, 1967 Journal of Pediatrics 70:166-71), making them
unlikely to persist in maternal blood from previous
pregnancies.
[0222] The scarcity of circulating fetal cells, estimated at one
fetal cell per 10.sup.5-10.sup.9 maternal cells (Price et al., 1991
Am J Obstet Gynecol 165:1731-7; Ganshirt-Ahlert et al., 1994 Clin
Genet. 38:38-43), necessitates the use of sensitive and specific
fetal cell enrichment methods prior to diagnosis. Widely-adopted
enrichment methods include combinations of density gradient
centrifugation (Samura et al., 2000 Prenat Diagn 20:281-6),
fluorescence activating cell sorting (FACS), and magnetic cell
sorting (MACS) (Busch et al., 1994 Ann NY Acad Sci 731: 144-6).
Despite the development of these methods, none have been
commercialized.
[0223] i. Methods for Noninvasive Prenatal Diagnosis of Single Gene
Disorders
[0224] LCR or padlock probes are used to capture and amplify
paternal-specific alleles in an allele-specific manner and to
perform overlap extension PCR to detect disease alleles (FIGS.
26-30). The method involves the following steps: (i) parental
genotyping to find paternal-specific polymorphisms; (ii) isolation
of single mononuclear cells from maternal blood into emulsion
microdroplets; (iii) amplification of disease and paternal-specific
"linker" loci by a modified LCR/PCR protocol in emulsion
microdroplet reactors; (iv) overlap extension amplification of
complexes between disease and linker loci in microdroplet reactors;
(v) recovery of linked complexes by emulsion reversal; and (vi)
massively parallel sequencing. The massively parallel sequencing
data are analyzed to quantify instances of linked genotypes. Only
microdroplet reactors that contain single fetal cells yield linked
complexes between the disease locus and the paternal-specific
allele. Both alleles amplify from the fetal cell, providing the
physician with status as a carrier, homozygous normal, or
homozygous affected.
[0225] LCR probes are designed to target a locus associated with a
disease and a linker SNP locus. The LCR probes are 20-30
nucleotides long and have melting temperatures (Tm) of
approximately 55-65.degree. C. The 5' nucleotides are
phosphorylated, and probes are designed to minimize probe
self-complementarity, as well as complementarity between probes. In
addition to regions of complementarity to target loci, three of the
probes include polynucleotide sequences that enable amplification
after ligation: (i) the 5' probe for the disease locus have a
random 10-20 nt sequence with no complementarity to either target
locus; (ii) the 3' probe for the disease locus has a 10-20
nucleotide sequence with complementarity to the 5' end of the
linker SNP locus; and (iii) the 5' probe for the linker SNP locus
have complementarity to the 3' end of the disease locus (FIGS.
26-30).
[0226] For each disease and linker locus pair, a reaction mixture
is formulated using cell line genomic DNA, the LCR probes, the PCR
primers, Ampligase (Epicentre), Stoffel fragment DNA polymerase
(Life Technologies), and reaction buffer (after Hardenbol et al.,
2005; 20 mM Tris-HCl, 25 mM KCl, 10 mM MgCl.sub.2, 0.5 mM NAD,
0.01% Triton X-100). The "inner" probes are added at 1/10.sup.th of
the concentration of the other oligonucleotides in the reaction.
For the initial annealing and ligation, the mixtures are incubated
for 4 minutes at 20.degree. C., 5 minutes at 95.degree. C., and 15
minutes at 60.degree. C. Then, standard PCR thermocycling
conditions are used to amplify the minor and major amplicons (e.g.,
95.degree. C., 5 minutes; [95.degree. C., 30 seconds; 60.degree.
C., 30 seconds; 72.degree. C., 30 seconds].times.30 cycles).
[0227] After bulk sequencing of the major amplicons, disease and
unaffected alleles are analyzed to diagnose the fetus as homozygous
normal, heterozygous carriers, or homozygous affected. In
heterozygous carriers, major amplicons linked to the
paternal-specific allele comprise approximately 50% disease alleles
and 50% normal alleles. Similarly, in homozygous carriers, major
amplicons linked to the paternal-specific allele comprise of nearly
100% disease alleles. This method can be extended beyond single
nucleotide mutations to find paternal-allele specific gene
expression patterns and/or multiplexed analysis of many germline
mutations in circulating fetal cells.
[0228] Examples of genes that are often mutated and are of interest
in prenatal diagnostics include, but are not limited to, cystic
fibrosis transmembrane receptor (CFTR), aspartoacylase (ASPA),
Fanconi anemia, complementation group C (FANCC),
Glucose-6-phosphatase (G6CP), Glucocerebrosidase (GBA),
Hexosaminidase A (HEXA), hemoglobin beta (HBB), Frataxin (FXN), low
density lipoprotein receptor (LDLR), and methyl CpG binding protein
2 (MECP2).
[0229] For example, in FIG. 26, single cell sequence linkage by
ligase chain reaction combined with overlap extension polymerase
chain reaction is illustrated, as applied to a method for
noninvasive prenatal diagnosis. The target nucleic acid (g) is a
paternal-specific allele, the target nucleic acid (h) is a first
disease allele, and the target nucleic acid (i) is a second disease
allele. Notably, both alleles (h) and (i) are amplified in any cell
(j) that contains the paternal-specific variant, and no major
amplicons are produced in cells that lack the paternal-specific
nucleotide variant. Primer (a) is a forward LCR probe and primer
(b) is a reverse LCR probe for amplifying target nucleic acid (g).
Primer (e) is a forward PCR primer and primer (f) is a reverse PCR
primer for both disease alleles (h) and (i). The forward primer
targeting the disease locus has a region of complementarity to the
reverse probe targeting the paternal-specific nucleotide variant.
The process can be carried out in an emulsion droplet or reaction
container (k). FIG. 27 also shows an example of hybridization of
primers and target nucleic acids in a single cell sequence linkage
by ligase chain reaction combined with overlap extension polymerase
chain reaction, as applied to a method for noninvasive prenatal
diagnosis, according to one embodiment of the invention. The
process is carried out in an emulsion droplet or reaction container
(k).
[0230] Moreover, FIG. 28 shows an example of resulting amplicons
produced in a single cell sequence linkage by ligase chain reaction
combined with overlap extension polymerase chain reaction, as
applied to a method for noninvasive prenatal diagnosis, according
to one embodiment of the invention. FIG. 29 shows hybridization of
overlapping complementary regions of the resulting amplicons, and
overlap extension polymerase chain reaction, as applied to a method
for noninvasive prenatal diagnosis, according to one embodiment of
the invention. FIG. 30 illustrates the resulting amplicons that are
produced from the overlap extension polymerase chain reaction, as
applied to a method for noninvasive prenatal diagnosis. The end
product is a library of "major amplicons," or linked loci, which
can then be sequenced in bulk.
[0231] ii. Methods for Noninvasive Prenatal Molecular
Karyotyping
[0232] Methods for genetic disease detection are adapted for
noninvasive prenatal molecular karyotyping. Such a method involves
the following steps: (i) parental genotyping to find
paternal-specific polymorphisms; (ii) isolation of single
mononuclear cells from maternal blood into emulsion microdroplets;
(iii) amplification of disease and paternal-specific "linker" loci
by a modified LCR/PCR protocol in emulsion microdroplet reactors;
(iv) overlap extension amplification of complexes between tens to
thousands to hundreds of thousands of chromosomal probes and linker
loci in microdroplet reactors; (v) recovery of linked complexes by
emulsion reversal; and (vi) massively parallel sequencing. The
massively parallel sequencing data are analyzed to quantify
instances of linked genotypes. Only microdroplet reactors that
contain single fetal cells yield linked complexes between the
chromosomal probes and the paternal-specific allele. The
chromosomal probes are used to quantify the number of chromosomes
or chromosome segments present in the fetal cells, and, by
association, the fetus. Chromosome copy number is quantified by
comparing sequence counts from an unknown chromosome to sequence
counts from a known reference chromosome within a single
experiment, or by looking for allelic imbalance (Johnson et al.,
2010 Human Reproduction 25:1066-75). This method is also used to
detect a variety of chromosome disorders, including aneuploidy,
unbalanced structural chromosome disorders, microdeletions,
microinsertions, and other kinds of congenital disorders. Examples
of disorders of interest include Trisomy 13, Trisomy 18, and
Trisomy 21.
Example 15
Methods of Noninvasive Cancer Diagnosis
[0233] The medical community has long sought noninvasive diagnosis
and monitoring of cancer patients, and there is already an
FDA-approved method (CellSearch, Veridex) for quantification of
circulating tumor cells for breast and prostate cancer patients.
Noninvasive methods for diagnosis can enable molecular staging of
tumors prior to biopsy, which can both reduce cost and lead to
better clinical outcomes. After treatment, noninvasive methods are
used to assess the success of the treatment regimen without the
need for invasive and expensive re-biopsy. There is general
consensus among clinicians that noninvasive methods for
characterization of tumors would greatly benefit patients and
increase the probability of favorable outcomes.
[0234] Single cell overlap extension PCR, LCR, padlock probes,
and/or RT-PCR are used to specifically analyze only tumor cells in
heterogeneous cell populations, such as cerebrospinal fluid (CSF)
or blood (FIGS. 18-25). Unlike current methods, this approach
completely bypasses the complexities caused by differences in cell
surface markers and morphology. Such methods are particularly
useful in cancers where a biopsy is invasive and expensive, and the
treatment decisions, such as pharmacological therapy decisions,
would benefit from molecular analysis of the tumor. The technology
is used for any kind of tumor or any kind of genetic problem or
combination of genetic problems in tumors.
[0235] The methods described above in Sections I and II also are
used to detect a gene or SNP associated with cancer. Single cell
overlap extension PCR, LCR, padlock probes, and/or RT-PCR is used
to amplify a first nucleic acid or a second nucleic acid that is
associated with cancer. The first target nucleic acid includes a
rare somatic mutation and the second target is a gene transcript
associated with cancer. Alternatively, one sequence is a molecular
barcode and the second sequence is either a rare mutation sequence
or a gene transcript associated with cancer. In either alternative,
higher levels of multiplexing produce single-cell expression
patterns for 10, 100, 1000, 10,000 transcripts or even all
transcripts in the cell. Higher levels of multiplexing also can
produce mutation profiles for entire genes, or many entire genes,
or even the entire genome. The rare gene sequence is present in
fewer than 5% of the cells, fewer than 1% of the cells, or fewer
than 0.1% of the cells. The rare gene sequence results from a
genetic mutation. The genetic mutation can be a somatic mutation.
The genetic mutation can be a mutation in a gene selected from the
group consisting of: epidermal growth factor receptor (EGFR),
phosphatase and tensin homolog (PTEN), tumor protein 53 (p53), MutS
homolog 2 (MSH2), multiple endocrine neoplasia 1 (MEN1),
adenomatous polyposis coli (APC), Fas receptor (FASR),
retinoblastoma protein (Rb1), Janus kinase 2 (JAK2), (ETS)-like
transcription factor 1 (ELK1), v-ets avian erythroblastosis virus
E26 oncogene homolog 1 (ETS1), breast cancer 1 (BRCA1), breast
cancer 2 (BRCA2), hepatocyte growth factor receptor (MET), ret
protoco-oncogene (RET), V-erb-b2 erythroblastic leukemia viral
oncogene homolog 2 (HER2), V-Ki-ras2 Kirsten rat sarcoma viral
oncogene homolog (KRAS), B-cell lymphoma 2 (BCL2), V-myc
myelocytomatosis viral oncogene homolog (MYC), neurofibromatosis
type 2 gene (NF2), v-myb myeloblastosis viral oncogene homolog
(MYB), and mutS homolog 6 (E. coli) (MSH6). The cancer-associated
transcript is a gene selected from the group consisting of
epidermal cell adhesion molecule (EpCAM), V-erb-b2 erythroblastic
leukemia viral oncogene homolog 2 (HER2), estrogen receptor (ER),
Signal transducer and activator of transcription 3 (STAT3),
CCAAT-enhancer-binding proteins (C/EBP), prostate-specific antigen
(PSA), androgen receptor (AR), progesterone receptor (PR), Jun B
(JUNB), Ras-related protein Rab-31 (RAB31), Early growth response
protein 1 (EGR1), B-cell lymphoma 2 (BCL2), Protein C-ets-1 (ETS1),
FBJ murine osteosarcoma viral oncogene homolog (c-Fos), and
Insulin-like growth factor 1 (IGF-1). Signal transducer and
activator of transcription 2 (STAT2) (Irgon et al., 2010 BMC Cancer
10: 319).
[0236] The cancer-associated transcripts can multiplexed to produce
a signal from 10, 100, 1000, 10,000 transcripts, or all of the
transcripts in the cell, which is analyzed by next-generation
sequencing to identify a mutation. The mutation is associated with
cancer. The cancer is selected from the group consisting of lung
carcinoma, non-small cell lung cancer, small cell lung cancer,
uterine cancer, thyroid cancer, breast carcinoma, prostate
carcinoma, pancreas carcinoma, colon carcinoma, lymphoma, Burkitt
lymphoma, Hodgkin lymphoma, myeloid leukemia, leukemia, sarcoma,
blastoma, melanoma, seminoma, brain cancer, glioma, glioblastoma,
cerebellar astrocytoma, cutaneous T-cell lymphoma, gastric cancer,
liver cancer, ependymona, laryngeal cancer, neck cancer, stomach
cancer, kidney cancer, pancreatic cancer, bladder cancer,
esophageal cancer, testicular cancer, medulloblastoma, vaginal
cancer, ovarian cancer, cervical cancer, basal cell carcinoma,
pituitary adenoma, rhabdomyosarcoma, and Kaposi sarcoma.
[0237] The methods in this Example can be applied in an assay using
intact mammalian cell mixtures to detect cancer cells. The
non-small cell lung carcinoma cells CRL-5908 (ATCC) is used as a
cancer model and Jurkat cells are used as a stand-in for primary
lymphocytes. CRL-5908 has an L858R point mutation in EGFR, and
expresses EpCAM. Jurkat does not express EpCAM (Landolin et al.,
2010). Cell mixtures are created at six CRL-5908:Jurkat ratios
between of 0% and 1%. Cells are encapsulated from the mixtures with
beads into a lysis mix, and then merged with a stream containing a
RT-PCR mix using the methods described above. The cells are diluted
such that the cell distribution follows Poisson statistics with
.lamda.=1.5, and .about.44% of the droplets with cells have
multiple cells. Using this method, >1 million droplets are
generated in each of six replicate experiments for each cell
mixture. A fast-speed camera is used to obtain bead and cell
encapsulation rates. The major amplicons are purified by gel
electrophoresis and sequenced by next-generation sequencing to
obtain at least 10 million sequence tags for each library.
[0238] Detecting cancer cells in these cell mixtures requires a
special analytical framework. Sequencing generates counts of
mutated EGFR and EpCAM linked to each barcode, and the barcodes are
traced back to cells. If each droplet contains a single cell only,
then these counts are used to directly quantify the percentage of
CRL-5908 in the cell mixture. However, there may be an arbitrary
number of cells encapsulated in droplets according to a Poisson
distribution, resulting in many droplets with multiple cells.
[0239] Therefore, for such analysis, an algorithm is used that
computes the number of cancer cells in a sample given counts of
cancer markers such as mutated EGFR or EpCAM and statistics for
cell encapsulation Poisson .lamda.. To test the validity of this
algorithm and to estimate the limits of detection that
encapsulation of multiple cells per droplet imposes, the process of
encapsulation is simulated, and the ratio of cancer marker
expression in cancer cells to normal cells is determined. A Poisson
distribution for the cell encapsulation rate is assumed,
log-normally distributed expression levels over a fixed background,
and the signal-to-noise ratio (SNR) is defined as the ratio of the
mean expression level to the mean background. This simulation
indicates a <1% error rate in a scenario where .about.44% of
droplets containing cells will have multiple cells (.lamda.=1.5)
and SNR=10.
Example 16
Noninvasive Gene Expression Analysis in Glioblastoma Multiforme
[0240] Certain genes are co-expressed specifically only in
circulating tumor cells, so linkage of two tumor-specific
transcripts in the same cell is a potentially powerful method for
detection of circulating tumor cells in peripheral blood or CSF.
The method enables noninvasive molecular staging of glioblastoma
multiforme (GBM). GBM is the most common type of primary malignant
brain tumor, with an incidence of 16,000 new cases per year in the
United States. After characterization by magnetic resonance imaging
(MRI) and clinical work-up, molecular characterization of biopsies
is often performed to guide treatment regimens. There is growing
consensus that distinct molecular categories of tumor should be
subjected to distinct targeted treatment regimens (Mischel et al.,
2003 Cancer Biol Ther 2:242-247). Prior GBM research has indicated
that poor prognosis is indicated by coexpression of the genes
C/EBP.beta. and STAT3 (Carro et al., 2010 Nature 463:318-26). These
transcripts are not coexpressed in normal tissues. However,
biopsies of GBM are highly invasive and expensive, so there is
clinical demand for minimally invasive methods for molecular
staging.
[0241] The method involves the following steps: (i) isolation of
mononuclear cells from CSF (Spriggs 1954; Journal of Clinical
Pathology 7:122) with emulsion microdroplet technology; (ii)
reverse transcriptase polymerase chain reaction targeting
C/EBP.beta., STAT3, and a linker barcode sequence unique to each
microdroplet; (iii) overlap extension amplification of complexes
between C/EBP.beta., STAT3, and the linker sequence; (iv) recovery
of linked complexes by emulsion reversal; and (v) digital
quantification of fusion complexes using next-generation
sequencing. Only microdroplet reactors that contain tumor cells
co-expressing C/EBP.beta. and STAT3 yield large numbers of complete
linked complexes. Though next-generation sequencing pools all
analytes from all cells, linker barcode sequences enable the trace
back of gene expression to single cells. The final result is
digital quantification of multiple linked transcripts that are
traced back to millions of single cells analyzed in parallel.
[0242] The method also provides cDNA synthesis and PCR in emulsion
microdroplets without buffer exchange or reagent addition between
the molecular steps. Thermostable reverse transcriptase (RT)
enzymes are used that withstand temperatures >95.degree. C.,
such as ThermoScript RT (Lucigen) and GeneAmp Thermostable rTth
(Life Technologies). In addition to primer regions targeting
C/EBP.beta. and STAT3 (FIGS. 18-25), three of the primers in the
set include polynucleotide sequences that enable amplification of a
fusion complex: (i) the 5' primer of the C/EBP.beta. locus has a
random 10-20 nt sequence with no complementarity to either target
locus; (ii) the 3' primer of the C/EBP.beta. locus has a 10-20 nt
sequence with complementarity to the 5' end of the linker barcode
oligonucleotide; (iii) the 5' probe of the STAT3 locus has
complementarity to the 3' end of the linker. Two more
oligonucleotides act as forward and reverse PCR primers to
specifically amplify the linker barcode oligonucleotide. The
"inner" primers of the STAT3 and C/EBP.beta. loci (i.e., the
reverse primer for C/EBP.beta. and the forward primer for STAT3)
are at limiting concentration, i.e., 0.01 .mu.M for the inner
primers and 0.1 .mu.M for all other primers. This drives
amplification of the major amplicon preferentially over the minor
amplicons.
[0243] After emulsion reversal, the major amplicons are subjected
to bulk sequencing. The barcode is linked to C/EBP.beta. and STAT3
sequences, and are used to trace back the major amplicons to a
single cell (FIGS. 18-25). With trace back of each sequence to an
original single cell, it is possible to tabulate genetic data for
each single cell, which then enables single cell transcript
quantification, i.e., single cell gene expression levels which are
translated to a clinically actionable diagnosis.
Example 17
Molecular Karyotyping
[0244] Often structural chromosome changes, such as loss of
heterozygosity (LOH) or gain of full chromosomes or segments
thereof, will lead to progression of a tumor (Parsons et al., 2008
Science 321:1807-1812). Clinicians often examine the karyotype of a
tumor to formulate a prognosis and treatment regimen. The methods
outlined above are adapted to analyze both gene expression and
detect chromosome abnormalities for any tumor type in a single
multiplexed reaction.
[0245] A mutant cancer sequence is linked to probes to determine
chromosome copy number or structural chromosome aberrations. Such a
method involves the following steps: (i) isolation of single
mononuclear cells from blood into emulsion microdroplets; (ii)
amplification of chromosome probes and cancer mutation "linker"
loci by a modified LCR/PCR protocol in emulsion microdroplet
reactors; (iii) overlap extension amplification of complexes
between chromosomal probes and mutant linker loci in microdroplet
reactors; (iv) recovery of linked complexes by emulsion reversal;
and (v) massively parallel sequencing.
[0246] The massively-parallel sequencing data is analyzed to
quantify instances of linked genotypes. Only microdroplet reactors
that contain cells with cancer mutations yield linked complexes
between the chromosomal probes and the cancer-specific sequence.
The chromosomal probes are used to quantify the number of
chromosomes or chromosome segments present in circulating cancer
cells, and, by association, the tumor. Chromosome copy number is
quantified by comparing sequence counts from an unknown chromosome
to sequence counts from a known reference chromosome within a
single experiment, or by looking for allelic imbalance (Johnson et
al., 2010 Human Reproduction 25:1066-75). This method is also used
to detect a variety of chromosome disorders, including aneuploidy,
unbalanced structural chromosome disorders, microdeletions,
microinsertions, and other kinds of congenital disorders. The
chromosome probes are linked to a barcode sequence rather than a
cancer mutation, such that massively parallel sequencing measures
chromosomal disorders in all of the cells in the assay rather than
just cells that harbor a particular mutation.
Example 18
Somatic Cell Mutations
[0247] Often somatic cell mutations, i.e., in tumor promoter genes
such as p53, p16, and/or EGFR, contribute to the progression of
cancer (Parsons et al., 2008 Science 321:1807-1812). Clinicians
often analyze tumors for such known somatic cell mutations to
formulate a prognosis and treatment regimen. In particular, somatic
cell mutations are often indicative of progression to more
aggressive stages of a tumor. The methods described above are
adapted to analyze gene expression, somatic cell mutations, and/or
chromosomal changes for any tumor type in multiplexed emulsion
microdroplet reactions on millions of single cells in parallel. If
somatic cell mutations are known, a molecular barcode is not
necessary because allele-specific LCR or padlock probes are used to
specifically amplify major amplicons only in cells that harbor the
somatic cell mutation.
[0248] Any combination of gene expression, molecular karyotyping,
and somatic cell mutation analysis is carried out in single tumor
cells in heterogeneous cell populations. For example, LCR or
padlock probes are used to affect allele-specific locus capture and
major amplicon amplification only in cells with a particular
somatic cell mutation. This method is an alternative to the
molecular barcode method described above at least at Section B.6),
achieving tumor cell-specific genetic analysis in a highly
heterogeneous mixed background of cells. The allele-specific
somatic cell mutation amplification are linked to RNA transcripts
associated with disease outcomes and/or probes for quantification
of loss of heterozygosity (LOH) or regional duplications in
chromosome. The method is used to analyze co-expression of two or
more microRNA sequences in single cells, or co-expression of a
microRNA with another transcript, a methylated DNA sequence, or
somatic cell mutation.
Example 19
Methods of Chimeric Cell Population Analysis
[0249] Certain applications require multiplexed analysis of cell
populations that are chimers between two organisms. For example,
after hematopoietic stem cell (HSC) transplantation, the host's T
and B cells are chimeric between the host and graft. PCR
amplification in a chimeric cell population of a variable genetic
locus combined with some kind of functional genetic locus, such as
an RNA transcript, enables analysis of the functional genetic locus
in an individual-specific manner.
[0250] The methods described herein are applied to nonmyeloablative
hematopoietic stem cell transplantation. Physicians lack powerful
tools for monitoring patients after nonmyeloablative allogeneic
hematopoietic stem cell (HSC) transplants (Pollack et al., 2009
American Journal of Clinical Oncology 32:618-28). After
nonmyeloablative transplantation, the host immune system is a
chimera between host and graft T cells. The chimera is a poorly
characterized tissue, and chimeric instability is associated with
poor outcome. The balance of donor-recipient immune reconstitution
appears to influence a number of transplant immunological outcomes,
including graft-versus-tumor effect (GVT), graft-versus-host
disease (GVHD), and susceptibility to infection. T cells appear to
play a major role in mediating each of these processes through
adaptive immunity and T cell receptor (TCR) antigen recognition.
Doctors currently lack tools for monitoring host and graft T cell
identity after HSC transplant. Such methods are used to directly
monitor GVT, GVHD, and response to infections (Kristt et al., 2007
Bone Marrow Transplantation 39:255-68).
[0251] A method is used to monitor chimeric T cell populations. For
T cell chimerism analysis, TCR.beta. and host- and graft-specific
single nucleotide polymorphisms (SNPs) are linked by overlap
extension PCR or overlap extension RT-PCR in single cell
microdroplets. This method involves the following steps: (i)
genotyping to find SNPs specific to the graft and host; (ii)
post-transplant isolation of single cells from host blood in
emulsion microdroplets; (iii) overlap extension PCR amplification
of fusion complexes between SNPs and TCR.beta. in microdroplet
reactors; and (iv) recovery and sequencing of SNP-TCR.beta. linkage
complexes by emulsion reversal. The result is a library of
TCR.beta. sequences with linkage to host or graft. The TCR.beta.
sequences are correlated with clinical outcomes over time.
[0252] Similar types of analysis are carried out using LCR,
multi-probe circularization, or padlock probes, or any combination
thereof. Also, other types of variant sequences, such as STRs, are
also useful to indicate cell source in a chimeric population of
cells. The T cell chimerism analysis is adaptable to applications
such as B cell analysis or any other subpopulation of mononuclear
cells in blood. Additionally, the method is combinable with
functional T cell sequencing to indicate the immune activity of
particular T cell clones.
[0253] There are many applications for chimeric cell population
analysis outside of the field of medicine. For example, an
investigator may create chimeric organisms, such as fruit flies,
mice, or rats, which are chimers between multiple individuals with
different genetic backgrounds, or even between multiple species.
Chimeric cell populations for RNA transcripts, DNA methylation,
somatic cell mutations, presence of a recombinant gene, or a
variable DNA region are also capable of analysis with this method.
Thus methods for analysis of chimeric T and B cell populations are
adapted to other organisms and other kinds of cell populations.
Additionally, such methods are used for allogeneic or autologous
cellular therapeutics. Currently physicians lack powerful tools for
monitoring patients after immune cells have been introduced either
from a donor or as previously harvested from the patient. T cells,
B cells, or NK cells are monitored to establish characteristics and
efficacy of therapy.
Example 20
Methods for Gene Regulatory Sequence Analysis
[0254] Variants in regulatory DNA have an impact on expression
levels of RNA transcripts (Brown et al., 2007 Science 317:1557-60).
Functional screens of regulatory variants are time-consuming and
expensive. In one exemplary method, the method includes
mutagenizing cells, capturing single cells in aqueous-in-oil
microdroplets, and then fusing an amplified putative regulatory
locus with RNA transcripts from the nearby gene. In this way,
mutations in regulatory sequences could be linked with gene
expression levels.
[0255] Often an investigator wishes to understand how genomic
nucleic acid sequences impact expression of transcripts. Because
many nucleotides impact gene expression, these experiments are
tedious. Ideally, an investigator would want to analyze
quantitative gene expression at the single cell level as a function
of mutagenized regulatory sequences. Suspected regulatory sequences
are mutagenized to create a library of variable regulatory
sequences. Then, a combination of overlap extension PCR and overlap
extension RT-PCR in single cell emulsion microdroplets is used to
link regulatory DNA sequence to RNA transcript levels. In this way,
the effect of regulatory sequence mutagenesis on RNA transcript
levels is measured in single cells.
Example 21
Methods for Molecular Haplotyping
[0256] Many kinds of genetic analysis, such as PGD or whole genome
association studies, benefit from haplotype linkage of several
genetic loci in DNA derived from a single sperm cell. In one
exemplary method, single sperm cells are captured in aqueous-in-oil
microdroplets, and then several variable genetic loci are fused in
the cells, such as SNPs or STRs. This enables massively parallel
molecular phasing.
[0257] An method for phasing of two loci is provided. Haplotypes
millions of single sperm are analyzed in parallel. The method
involves the following steps: (i) isolation of single sperm cells
using emulsion microdroplet technology; (ii) amplification of two
genetic variants by PCR in microdroplet reactors; (iii) overlap
extension PCR amplification of fusion complexes between the
variants in microdroplet reactors; and (iv) recovery of linked
complexes by emulsion reversal. The result is a library of phased
haplotypes, which are then sequenced using next-generation
sequencing.
[0258] An alternate method for phasing of multiple loci is provided
in this paragraph. In some cases, phasing of only two loci is not
adequate for improvement of whole genome association studies or
other kinds of analysis. In such situations, molecular methods such
as LCR or padlock probes, which enable higher probe multiplexing,
are used as an alternative. Additionally, a variety of PCR primer
pairs are affixed to beads, such that thousands of PCR primer pairs
are distributed to emulsion microdroplets that contain a single
bead and a single sperm cell.
Example 22
Methods of Detecting Directed Molecular Evolution
[0259] Some kinds of industrial applications require improved
enzymes and/or biological strains to optimize engineered
biosystems. For example, enzymes that degrade a particular kind of
industrial waste might not be found in nature, but in vitro
evolution of existing enzymes might result in an optimized enzyme.
Many such processes benefit from molecular genetic analysis of
multiple loci in millions of single cells analyzed in parallel.
[0260] Yeast Evolution
[0261] Industrial in vitro evolution often involves mutagenesis of
cells followed by growth in selective media. In an exemplary
method, yeast cells are mutagenized and grown on special media
containing xylose as the primary food source. The single yeast
cells are captured in aqueous-in-oil microdroplets, and then
several metabolic pathway genes are sequenced. At least one company
(Microbiogen, Sydney, AUS) is developing yeast strains for growth
on xylose, but is using slow, traditional screening methods.
[0262] Other Applications
[0263] Many groups are currently researching methods for improving
natural strains of algae and bacteria for the purpose of biofuel
production. The methods for linked genotyping and/or single cell
gene expression analysis are used to enable in vitro evolution of
these organisms for the purpose of biofuel or other kinds of energy
production.
Example 23
Other Applications and Derivative Methods
[0264] Agriculture
[0265] All of the clinical methods described above (e.g., T cell
sequencing and B cell sequencing) are applicable to animals. These
animals include, but are not limited to, cows, pigs, chickens, or
salmon, etc. In particular, livestock and other agricultural
animals suffer from infectious disease, which results in
considerable economic hardships. The methods described herein are
adaptable to improve monitoring and detection of infectious disease
in an agricultural setting.
[0266] Metagenomics
[0267] Metagenomics is a method of studying genetic diversity in
ecosystems in which environmental samples are directly sequenced.
In an exemplary method, cells such as algae in environmental
samples such as seawater are separated into single cell emulsion
microdroplets, and then analyzed for at least two genetic loci. For
example, an investigator may be interested to find a particular
species of algae that expresses a particular form of chlorophyll
and belongs to a particular algal species. Genotyping by LCR is
used to amplify major amplicons only algal cells from a particular
species that harbor that particular form of chlorophyll. One
skilled in the art can also appreciate that such a method are also
useful to sample chlorophyll diversity in a particular class,
species, or genus of algae by linking species-specific LCR or
padlock probes with PCR amplification of chlorophyll exons. Algae
and chlorophyll are only one specific example; the cells are from
any species, and there are many kinds of target genetic loci,
including RNA transcripts, genomic variants, and mitochondrial
DNA.
[0268] Detection of DNA Methylation
[0269] DNA methylation is a type of epigenetic modifier that helps
cells control RNA transcription and other cellular processes
(Brunner et al., 2009 Genome Research 19:1044-56). For example,
blood lymphocytes can suffer aberrant DNA methylation, leading to
liquid tumors. The methods described above are useful for analyzing
DNA methylation in single cells (e.g., multiple DNA methylation
loci in single cells, or at least one DNA methylation locus with an
RNA transcript target or DNA sequence target). DNA methylation is
analyzed by methylation-specific restriction enzymes, bisulfate
conversion, or precipitation with anti-methylcytosine. Most of
these analyses would require multiple inputs of reaction buffers if
using a microfluidic chip to create emulsion microdroplets. For
example, performing bisulfite conversion requires a buffer that is
inappropriate for PCR, LCR, RT-PCR, or padlock probes. In an
exemplary method, single cells are encapsulated in emulsion
microdroplets using a standard bisulfite conversion buffer. Then,
after bisulfite conversion, the microdroplets are merged with a
second aqueous buffer. This second buffer dilutes the bisulfite
conversion buffer, enabling PCR, LCR, RT-PCR, or padlock probe
methods. Similar approaches are useful for anti-methylcytosine or
methylation sensitive restriction digestion.
[0270] Chromatin Immunoprecipitation
[0271] Chromatin immunoprecipitation is a method in which DNA is
crosslinked to proteins in cell nuclei (Johnson et al., 2007
Science 316:1497-502). An antibody directed against a DNA binding
protein of interest is then used to specifically precipitate
DNA-protein complexes, and then the DNA is sequenced or analyzed
with a DNA microarray. The molecular linkage methods described
above are used to analyze multiple DNA-protein binding loci in
single cells, or at least one DNA-protein binding locus with an RNA
transcript target or DNA sequence target. Most of these analyses
require multiple inputs of reaction buffers if using a microfluidic
chip to create emulsion microdroplets. For example, performing
chromatin immunoprecipitation requires a buffer that is
inappropriate for PCR, LCR, RT-PCR, or padlock probes. In an
exemplary method, single cells are encapsulated in emulsion
microdroplets using a standard immunoprecipitation buffer. Then,
after precipitation, the microdroplets are merged with a second
aqueous buffer. This second buffer dilutes the precipitation
buffer, enabling PCR, LCR, RT-PCR, or padlock probe methods.
[0272] While the invention has been particularly shown and
described with reference to a preferred s and various alternate
embodiments, it will be understood by persons skilled in the
relevant art that various changes in form and details can be made
therein without departing from the spirit and scope of the
invention.
[0273] All references, issued patents and patent applications cited
within the body of the instant specification are hereby
incorporated by reference in their entirety, for all purposes.
TABLE-US-00002 TABLE 2 INFORMAL SEQUENCE LISTING OVERLAP SEQ ID NO
NAME GENOME TARGETING REGION SEQUENCE DESCRIPTION SEQ ID NO: 1
TRBV2.F TCAAATTTCACTCTGAAGATCCGGTCCACAA outer forward SEQ ID NO: 2
TRBV3-1.F GCTCACTTAAATCTTCACATCAATTCCCTGG outer forward SEQ ID NO:
3 TRBV4-1.F CTTAAACCTTCACCTACACGCCCTGC outer forward SEQ ID NO: 4
TRBV4-2_4-3.F CTTATTCCTTCACCTACACACCCTGC outer forward SEQ ID NO: 5
TRBV5-1.F GCTCTGAGATGAATGTGAGCACCTTG outer forward SEQ ID NO: 6
TRBV5-3.F GCTCTGAGATGAATGTGAGTGCCTTG outer forward SEQ ID NO: 7
TRBV_5- GCTCTGAGCTGAATGTGAACGCCTTG outer forward 4_5-5_5-
6_5-7_5-8.F SEQ ID NO: 8 TRBV6-1.F TCGCTCAGGCTGGAGTCGGCTG outer
forward SEQ ID NO: 9 TRBV6-2_6-3.F GCTGGGGTTGGAGTCGGCTG outer
forward SEQ ID NO: 10 TRBV6-4.F CCCTCACGTTGGCGTCTGCTG outer forward
SEQ ID NO: 11 TRBV6-5.F GCTCAGGCTGCTGTCGGCTG outer forward SEQ ID
NO: 12 TRBV6-6.F CGCTCAGGCTGGAGTTGGCTG outer forward SEQ ID NO: 13
TRBV6-7.F CCCCTCAAGCTGGAGTCAGCTG outer forward SEQ ID NO: 14
TRBV6-8.F CACTCAGGCTGGTGTCGGCTG outer forward SEQ ID NO: 15
TRBV6-9.F CGCTCAGGCTGGAGTCAGCTG outer forward SEQ ID NO: 16
TRBV7-1.F CCACTCTGAAGTTCCAGCGCACAC outer forward SEQ ID NO: 17
TRBV7-2.F CACTCTGACGATCCAGCGCACAC outer forward SEQ ID NO: 18
TRBV7-3.F CTCTACTCTGAAGATCCAGCGCACAG outer forward SEQ ID NO: 19
TRBV7-4.F CCACTCTGAAGATCCAGCGCACAG outer forward SEQ ID NO: 20
TRBV7-6.F CACTCTGACGATCCAGCGCACAG outer forward SEQ ID NO: 21
TRBV7-7.F CCACTCTGACGATTCAGCGCACAG outer forward SEQ ID NO: 22
TRBV7-8.F CCACTCTGAAGATCCAGCGCACAC outer forward SEQ ID NO: 23
TRBV7-9.F CACCTTGGAGATCCAGCGCACAG outer forward SEQ ID NO: 24
TRBV9.F GCACTCTGAACTAAACCTGAGCTCTCTG outer forward SEQ ID NO: 25
TRBV10-1.F CCCCTCACTCTGGAGTCTGCTG outer forward SEQ ID NO: 26
TRBV10-2.F CCCCCTCACTCTGGAGTCAGCTA outer forward SEQ ID NO: 27
TRBV10-3.F CCCCCTCACTCTGGAGTCAGCTA outer forward SEQ ID NO: 28
TRBV11-1_11-3.F CCACTCTCAAGATCCAGCCTGCAG outer forward SEQ ID NO:
29 TRBV11-2.F CTCCACTCTCAAGATCCAGCCTGCAA outer forward SEQ ID NO:
30 TRBV12- CCACTCTGAAGATCCAGCCCTCAG outer forward 3_12-4_12-5.F SEQ
ID NO: 31 TRBV13.F CATTCTGAACTGAACATGAGCTCCTTGG outer forward SEQ
ID NO: 32 TRBV14.F CTACTCTGAAGGTGCAGCCTGCAG outer forward SEQ ID
NO: 33 TRBV15.F GATAACTTCCAATCCAGGAGGCCGAACA outer forward SEQ ID
NO: 34 TRBV16.F CTGTAGCCTTGAGATCCAGGCTACGA outer forward SEQ ID NO:
35 TRBV17.F CTTCCACGCTGAAGATCCATCCCG outer forward SEQ ID NO: 36
TRBV18.F GCATCCTGAGGATCCAGCAGGTAG outer forward SEQ ID NO: 37
TRBV19.F CCTCTCACTGTGACATCGGCCC outer forward SEQ ID NO: 38
TRBV20-1.F CTTGTCCACTCTGACAGTGACCAGTG outer forward SEQ ID NO: 39
TRBV23-1.F CAGCCTGGCAATCCTGTCCTCAG outer forward SEQ ID NO: 40
TRBV24-1.F CTCCCTGTCCCTAGAGTCTGCCAT outer forward SEQ ID NO: 41
TRBV25-1.F CCCTGACCCTGGAGTCTGCCA outer forward SEQ ID NO: 42
TRBV27.F CCCTGATCCTGGAGTCGCCCA outer forward SEQ ID NO: 43 TRBV28.F
CTCCCTGATTCTGGAGTCCGCCA outer forward SEQ ID NO: 44 TRBV29-1.F
CTAACATTCTCAACTCTGACTGTGAGCAACA outer forward SEQ ID NO: 45
TRBV30.F CGGCAGTTCATCCTGAGTTCTAAGAAGC SEQ ID NO: 46 TRBJ1-1.R
TTACCTACAACTGTGAGTCTGGTGCCTTGTC GCTCATCTGGC inner reverse CAAA
ATAATTCTCCT SEQ ID NO: 47 TRBJ1-2.R ACCTACAACGGTTAACCTGGTCCCCGAACCG
GCTCATCTGGC inner reverse AA ATAATTCTCCT SEQ ID NO: 48 TRBJ1-3.R
ACCTACAACAGTGAGCCAACTTCCCTCTCCA GCTCATCTGGC inner reverse AA
ATAATTCTCCT SEQ ID NO: 49 TRBJ1-4.R CCAAGACAGAGAGCTGGGTTCCACTGCCAAA
GCTCATCTGGC inner reverse ATAATTCTCCT SEQ ID NO: 50 TRBJ1-6.R
CTGTCACAGTGAGCCTGGTCCCGTTCCCAAA GCTCATCTGGC inner reverse
ATAATTCTCCT SEQ ID NO: 51 TRBJ2-1.R CGGTGAGCCGTGTCCCTGGCCCGAA
GCTCATCTGGC inner reverse ATAATTCTCCT SEQ ID NO: 52 TRBJ2-2.R
CCAGTACGGTCAGCCTAGAGCCTTCTCCAAA GCTCATCTGGC inner reverse
ATAATTCTCCT SEQ ID NO: 53 TRBJ2-3.R ACTGTCAGCCGGGTGCCTGGGCCAAA
GCTCATCTGGC inner reverse ATAATTCTCCT SEQ ID NO: 54 TRBJ2-4.R
AGAGCCGGGTCCCGGCGCCGAA GCTCATCTGGC inner reverse ATAATTCTCCT SEQ ID
NO: 55 TRBJ2-5.R GGAGCCGCGTGCCTGGCCCGAA GCTCATCTGGC inner reverse
ATAATTCTCCT SEQ ID NO: 56 TRBJ2-6.R GTCAGCCTGCTGCCGGCCCCGAA
GCTCATCTGGC inner reverse ATAATTCTCCT SEQ ID NO: 57 TRBJ2-7.R
GTGAGCCTGGTGCCCGGCCCGAA GCTCATCTGGC inner reverse ATAATTCTCCT SEQ
ID NO: 58 IL2.F TCACCAGGATGCTCACATTTAAGT AGGAGAATTAT inner forward
GCCAGATGAGC SEQ ID NO: 59 IL2.F GAGGTTTGAGTTCTTCTTCTAGACACTGA outer
reverse SEQ ID NO: 60 IL4.F CCACGGACACAAGTGCGATA AGGAGAATTAT inner
forward GCCAGATGAGC SEQ ID NO: 61 IL4.R CCCTGCAGAAGGTTTCCTTCT outer
reverse SEQ ID NO: 62 INFG.F TCAGCTCTGCATCGTTTTGG AGGAGAATTAT inner
forward GCCAGATGAGC SEQ ID NO: 63 INFG.R GTTCCATTATCCGCTACATCTGAA
outer reverse SEQ ID NO: 64 TNFA.F GCCCAGGCAGTCAGATCATC AGGAGAATTAT
inner forward GCCAGATGAGC SEQ ID NO: 65 TNFA.R
GGGTTTGCTACAACATGGGCT outer reverse SEQ ID NO: 66 FOXP3.F
AACAGCACATTCCCAGAGTTCCT AGGAGAATTAT inner forward GCCAGATGAGC SEQ
ID NO: 67 FOXP3.R CATTGAGTGTCCGCTGCTTCT outer reverse SEQ ID NO: 68
TBX21.F GTCCAACAATGTGACCCAGAT AGGAGAATTAT inner forward GCCAGATGAGC
SEQ ID NO: 69 TBX21.R GCTGGTACTTATGGAGGGACTG outer reverse SEQ ID
NO: 70 TBX21.F AGCTGACTCACGCCGTCC AGGAGAATTAT inner forward
GCCAGATGAGC SEQ ID NO: 71 TBX21.F CACAGAAACCCTCGCACAAGCC outer
reverse SEQ ID NO: 72 IL2.F CTGGAATAGCCAATACTGATTACCTG AGGAGAATTAT
inner forward GCCAGATGAGC SEQ ID NO: 73 IL2.R
CATGAATTTTATACCTTAGGAGACGG outer reverse
Sequence CWU 1
1
75131DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1tcaaatttca ctctgaagat ccggtccaca a
31231DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 2gctcacttaa atcttcacat caattccctg g
31326DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 3cttaaacctt cacctacacg ccctgc 26426DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
4cttattcctt cacctacaca ccctgc 26526DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5gctctgagat gaatgtgagc accttg 26626DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
6gctctgagat gaatgtgagt gccttg 26726DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7gctctgagct gaatgtgaac gccttg 26822DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8tcgctcaggc tggagtcggc tg 22920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9gctggggttg gagtcggctg
201021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10ccctcacgtt ggcgtctgct g 211120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
11gctcaggctg ctgtcggctg 201221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 12cgctcaggct ggagttggct g
211322DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13cccctcaagc tggagtcagc tg 221421DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
14cactcaggct ggtgtcggct g 211521DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 15cgctcaggct ggagtcagct g
211624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 16ccactctgaa gttccagcgc acac 241723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
17cactctgacg atccagcgca cac 231826DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 18ctctactctg aagatccagc
gcacag 261924DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 19ccactctgaa gatccagcgc acag
242023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20cactctgacg atccagcgca cag 232124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21ccactctgac gattcagcgc acag 242224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
22ccactctgaa gatccagcgc acac 242323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
23caccttggag atccagcgca cag 232428DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 24gcactctgaa ctaaacctga
gctctctg 282522DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 25cccctcactc tggagtctgc tg
222623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 26ccccctcact ctggagtcag cta 232723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27cctcctcact ctggagtccg cta 232824DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 28ccactctcaa gatccagcct
gcag 242926DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 29ctccactctc aagatccagc ctgcaa 263024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
30ccactctgaa gatccagccc tcag 243128DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31cattctgaac tgaacatgag ctccttgg 283224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32ctactctgaa ggtgcagcct gcag 243328DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33gataacttcc aatccaggag gccgaaca 283426DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
34ctgtagcctt gagatccagg ctacga 263524DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
35cttccacgct gaagatccat cccg 243624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
36gcatcctgag gatccagcag gtag 243722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
37cctctcactg tgacatcggc cc 223826DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 38cttgtccact ctgacagtga
ccagtg 263923DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 39cagcctggca atcctgtcct cag
234024DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 40ctccctgtcc ctagagtctg ccat 244121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
41ccctgaccct ggagtctgcc a 214221DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 42ccctgatcct ggagtcgccc a
214323DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 43ctccctgatt ctggagtccg cca 234431DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
44ctaacattct caactctgac tgtgagcaac a 314528DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
45cggcagttca tcctgagttc taagaagc 284635DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46ttacctacaa ctgtgagtct ggtgccttgt ccaaa 354733DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
47acctacaacg gttaacctgg tccccgaacc gaa 334833DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
48acctacaaca gtgagccaac ttccctctcc aaa 334931DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
49ccaagacaga gagctgggtt ccactgccaa a 315031DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
50ctgtcacagt gagcctggtc ccgttcccaa a 315125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
51cggtgagccg tgtccctggc ccgaa 255231DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52ccagtacggt cagcctagag ccttctccaa a 315326DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
53actgtcagcc gggtgcctgg gccaaa 265422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
54agagccgggt cccggcgccg aa 225522DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 55ggagccgcgt gcctggcccg aa
225623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 56gtcagcctgc tgccggcccc gaa 235723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
57gtgagcctgg tgcccggccc gaa 235824DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 58tcaccaggat gctcacattt
aagt 245929DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 59gaggtttgag ttcttcttct agacactga
296020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 60ccacggacac aagtgcgata 206121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
61ccctgcagaa ggtttccttc t 216220DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 62tcagctctgc atcgttttgg
206324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 63gttccattat ccgctacatc tgaa 246420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
64gcccaggcag tcagatcatc 206521DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 65gggtttgcta caacatgggc t
216623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 66aacagcacat tcccagagtt cct 236721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
67cattgagtgt ccgctgcttc t 216821DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 68gtccaacaat gtgacccaga t
216922DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 69gctggtactt atggagggac tg 227018DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
70agctgactca cgccgtcc 187122DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 71cacagaaacc ctcgcacaag cc
227226DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 72ctggaatagc caatactgat tacctg 267326DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
73catgaatttt ataccttagg agacgg 267422DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 74gctcatctgg cataattctc ct 227522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 75aggagaatta tgccagatga gc 22
* * * * *