U.S. patent number 10,844,348 [Application Number 16/465,774] was granted by the patent office on 2020-11-24 for microorganism of the genus corynebacterium producing 5'-xanthosine monophosphate and method for preparing 5'-xanthosine monophosphate using the same.
This patent grant is currently assigned to CJ CHEILJEDANG CORPORATION. The grantee listed for this patent is CJ CHEILJEDANG CORPORATION. Invention is credited to Min Ji Baek, Jaeho Jeong, Jeong Eun Lee, Ji Hye Lee, Boram Lim, Su-bin Lim, Byoung Hoon Yoon.
United States Patent |
10,844,348 |
Baek , et al. |
November 24, 2020 |
Microorganism of the genus Corynebacterium producing 5'-xanthosine
monophosphate and method for preparing 5'-xanthosine monophosphate
using the same
Abstract
The present disclosure relates to a microorganism of the genus
Corynebacterium producing 5'-xanthosine monophosphate and a method
for producing 5'-xanthosine monophosphate using the same.
Inventors: |
Baek; Min Ji (Gyeonggi-do,
KR), Lee; Ji Hye (Gyeonggi-do, KR), Lim;
Boram (Gyeonggi-do, KR), Yoon; Byoung Hoon
(Seoul, KR), Lee; Jeong Eun (Daegu, KR),
Lim; Su-bin (Gyeonggi-do, KR), Jeong; Jaeho
(Gyeonggi-do, KR) |
Applicant: |
Name |
City |
State |
Country |
Type |
CJ CHEILJEDANG CORPORATION |
Seoul |
N/A |
KR |
|
|
Assignee: |
CJ CHEILJEDANG CORPORATION
(Seoul, KR)
|
Family
ID: |
1000005201308 |
Appl.
No.: |
16/465,774 |
Filed: |
June 21, 2018 |
PCT
Filed: |
June 21, 2018 |
PCT No.: |
PCT/KR2018/007027 |
371(c)(1),(2),(4) Date: |
May 31, 2019 |
PCT
Pub. No.: |
WO2019/235680 |
PCT
Pub. Date: |
December 12, 2019 |
Prior Publication Data
|
|
|
|
Document
Identifier |
Publication Date |
|
US 20200263126 A1 |
Aug 20, 2020 |
|
Foreign Application Priority Data
|
|
|
|
|
Jun 7, 2018 [KR] |
|
|
10-2018-0065681 |
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N
15/77 (20130101); C12N 15/67 (20130101); C12N
1/20 (20130101); C12P 19/40 (20130101) |
Current International
Class: |
C12N
1/20 (20060101); C12N 15/77 (20060101); C12N
15/67 (20060101); C12P 19/40 (20060101) |
References Cited
[Referenced By]
U.S. Patent Documents
Foreign Patent Documents
|
|
|
|
|
|
|
10-0620092 |
|
Sep 2006 |
|
KR |
|
10-2009-0080654 |
|
Jul 2009 |
|
KR |
|
10-2010-0070219 |
|
Jun 2010 |
|
KR |
|
10-2011-0105662 |
|
Sep 2011 |
|
KR |
|
Other References
GenBank Accession No. WP_088859234, MFS transporter
[Corynebacterium stationis], Jul. 7, 2017, 1 Page. cited by
applicant .
Noguchi et al., "31P NMR studies of energy metabolism in
xanthosine-5'-monophosphate overproducing Corynebacterium
ammoniagenes", Eur. J. Biochem., 2003, vol. 270, pp. 2622-2626.
cited by applicant .
Van der Rest et al., "A heat shock following electroporation
induces highly efficient transformation of Corynebacterium
glutamicum with xenogeneic plasmid DNA", Appl Microbiol Biotechnol,
1999, vol. 52, pp. 541-545. cited by applicant .
Communication pursuant to Article 94(3) EPC dated Sep. 10, 2020 for
corresponding European Application No. 18899009.7, 4 pages. cited
by applicant .
Corynebacterium stationis strain LMG 21670, complete genome,
Accession No. CP019963, cited in Lee et al., "The whole genome
sequencing and assembly of Corynebacterium stationis LMG 2160T
strain", Mar. 11, 2017, retrieved inline from EBI accession No.
EM_STD:CP019963 Database accession No. CP019963. cited by applicant
.
Corynebacterium stationis strain ATCC 21170, genome, Accession No.
CP016326, cited in Yang et al., Genome sequence of Corynebacterium
stationis ATCC 21170, Jul. 7, 2017, retrieved online from EBI
accession No. EM_STD: CP016326 Database accession No. CP016326.
cited by applicant.
|
Primary Examiner: Saidha; Tekchand
Attorney, Agent or Firm: MH2 Technology Law Group, LLP
Claims
The invention claimed is:
1. A microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate, wherein activity of a protein
comprising the amino acid sequence of SEQ ID NO: 2 is enhanced.
2. The microorganism of the genus Corynebacterium of claim 1,
wherein the protein is encoded by a gene comprising the nucleotide
sequence of SEQ ID NO: 1.
3. The microorganism of the genus Corynebacterium of claim 1,
wherein the enhancement of activity is achieved by an increase in
the number of copies of polynucleotides encoding the protein,
enhancement of promoter activity, substitution of a start codon, or
a combination thereof.
4. The microorganism of the genus Corynebacterium of claim 1,
wherein the microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate is Corynebacterium stationis.
5. A method for producing 5'-xanthosine monophosphate, comprising:
culturing the microorganism of the genus Corynebacterium of claim 1
in a culture medium; and recovering the 5'-xanthosine monophosphate
from the microorganism or the culture medium.
6. The method for producing 5'-xanthosine monophosphate of claim 5,
wherein the microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate is Corynebacterium stationis.
7. A method for producing 5'-xanthosine monophosphate, comprising:
culturing the microorganism of the genus Corynebacterium of claim 2
in a culture medium; and recovering the 5'-xanthosine monophosphate
from the microorganism or the culture medium.
8. A method for producing 5'-xanthosine monophosphate, comprising:
culturing the microorganism of the genus Corynebacterium of claim 3
in a culture medium; and recovering the 5'-xanthosine monophosphate
from the microorganism or the culture medium.
9. A method for producing 5'-xanthosine monophosphate, comprising:
culturing the microorganism of the genus Corynebacterium of claim 4
in a culture medium; and recovering the 5'-xanthosine monophosphate
from the microorganism or the culture medium.
10. The method for producing 5'-xanthosine monophosphate of claim
7, wherein the microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate is Corynebacterium stationis.
11. The method for producing 5'-xanthosine monophosphate of claim
8, wherein the microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate is Corynebacterium stationis.
12. The method for producing 5'-xanthosine monophosphate of claim
9, wherein the microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate is Corynebacterium stationis.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a U.S. National Stage application of
PCT/KR2018/007027 filed 21 Jun. 2018, which claims priority to
Korean Patent Application No. 10-2018-0065681 filed 7 Jun. 2018,
the entire disclosures of which are herein incorporated by
reference.
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been
submitted electronically in ASCII format and is hereby incorporated
by reference in its entirety. Said ASCII copy, created on 23 May
2019, is named 0312_0004-US_SL.txt and is 11 Kilobytes in size.
TECHNICAL FIELD
The present disclosure relates to a microorganism producing
5'-xanthosine monophosphate and a method for producing
5'-xanthosine monophosphate using the same.
BACKGROUND ART
5'-Xanthosine monophosphate (XMP) not only has physiological
significance in animals and plants as an intermediate in nucleic
acid biosynthesis and metabolic systems, but is also used for
various purposes: foods, medicine, and various medical uses. In
particular, when used together with monosodium glutamate (MSG),
there is a synergistic effect in enhancing flavors. Accordingly,
XMP is one of the nucleic acid-based flavor enhancers that have
drawn attention as a seasoning.
Further, 5'-xanthosine monophosphate is an intermediate in purine
nucleotide biosynthesis metabolism, and is an important raw
material for the production of 5'-guanosine monophosphate (GMP). A
well-known method for preparing guanosine monophosphate that has
high commercial value and affects in increasing the taste intensity
is fermentation of a microorganism, which involves producing
5'-xanthosine monophosphate and enzymatically converting the same
to 5'-guanosine monophosphate. As this method is the most
economical, 5'-xanthosine monophosphate is needed as much as
5'-guanosine monophosphate.
As the methods for preparing 5'-xanthosine monophosphate, (1)
chemical synthesis, (2) deamination of the prepared 5'-xanthosine
monophosphate, (3) fermentative production by adding xanthine as a
precursor in the culture medium, (4) direct fermentation of a
mutant strain of a microorganism producing 5'-xanthosine
monophosphate, etc. are known. Among the various methods, the
direct fermentation of 5'-xanthosine monophosphate by a mutant
microorganism strain is the most advantageous economically.
Nevertheless, research on methods for producing 5'-xanthosine
monophosphate in a high yield is still in demand.
DETAILED DISCLOSURE
Technical Problem
The present inventors made extensive efforts to develop
microorganisms capable of producing a high yield of 5'-xanthosine
monophosphate, and as a result, they found that the production
yield of 5'-xanthosine monophosphate increases when activity of a
particular protein is enhanced, thereby completing the present
disclosure.
Technical Solution
An object of the present disclosure is to provide a microorganism
of the genus Corynebacterium producing 5'-xanthosine monophosphate,
in which activity of a protein comprising an amino acid sequence of
SEQ ID NO: 2 is enhanced.
Another object of the present disclosure is to provide a method for
producing 5'-xanthosine monophosphate using the microorganism.
Advantageous Effects
The microorganism of the genus Corynebacterium of the present
disclosure has enhanced activity of a protein that exports
5'-xanthosine monophosphate, thereby having increased 5'-xanthosine
monophosphate production, and this can significantly contribute to
reduction of the production cost of 5'-xanthosine
monophosphate.
BEST MODE
Hereinbelow, the present disclosure is described in more detail.
Meanwhile, each description and exemplary embodiment disclosed in
the present disclosure can be applied to other descriptions and
exemplary embodiments. That is, all combinations of the various
elements disclosed in the present disclosure fall within the scope
of the present disclosure. Additionally, the scope of the present
disclosure cannot be construed as being limited by the specific
description below.
As an aspect to achieve the above objects, the present disclosure
provides a microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate, in which activity of a protein
comprising an amino acid sequence of SEQ ID NO: 2 is enhanced.
As used herein, the term "5'-xanthosine monophosphate" refers to a
compound named 5'-xanthylic acid, xanthosine, etc. In the present
disclosure, the 5'-xanthosine monophosphate can be interchangeably
used with "XMP".
As used herein, the term "protein comprising an amino acid sequence
of SEQ ID NO: 2" refers to a protein endogenously present in a
microorganism of the genus Corynebacterium, encoded by a major
facilitator superfamily transporter (MFS transporter) gene
exporting 5'-xanthosine monophosphate from the microorganism.
Specifically, it may be an MFS transporter protein including the
amino acid sequence of SEQ ID NO: 2, which is endogenously present
in the microorganism of the genus Corynebacterium. Further, the
protein may be a protein consisting of or composed of the amino
acid sequence of SEQ ID NO: 2, but is not limited thereto. The MFS
transporter protein in the present disclosure may be called "xmpE"
or "xmpE protein".
As used herein, "protein comprising an amino acid sequence of a
particular SEQ ID NO", as long as it has activity identical or
corresponding to a protein including the same SEQ ID NO, may
include an addition of a sequence which has no alter the function
of the proteinat the front of the end of the amino acid sequence; a
naturally occurring mutation; or a silent mutation thereof. In the
case of proteins having such sequence addition or mutation, it is
apparent that they are also included within the scope of the
present disclosure.
Further, the protein of the present disclosure may comprise the
amino acid sequence of SEQ ID NO: 2, but also that having at least
60% homology or identity to SEQ ID NO: 2. The protein comprising
the amino acid sequence having at least 60% homology or identity to
SEQ ID NO: 2 may be a protein including an amino acid sequence
having at least 60%, specifically 70%, more specifically 80%, even
more specifically 83%, 84%, 85%, 88%, 90%, 93%, 95%, or 97%
homology or identity to SEQ ID NO: 2. The amino acid sequence
having the homology or identity may exclude that having 100%
identity from said range or be that having identity of less than
100%. It is obvious that as long as the amino acid sequence, as a
sequence having the sequence homology or identity, substantially
has biological activity identical or corresponding to that of SEQ
ID NO: 2, it is included in the scope of the present disclosure
even if part of the sequence has deletion, modification,
substitution, or addition of an amino acid sequence.
Additionally, a nucleotide sequence of a gene encoding the protein
comprising the amino acid sequence of SEQ ID NO: 2 can be obtained
from a known database such as NCBI GenBank, but is not limited
thereto. Specifically, the protein comprising the amino acid
sequence of SEQ ID NO: 2 may be encoded by a gene including a
nucleotide sequence of SEQ ID NO: 1, as well as a gene consisting
of or composed of the nucleotide sequence of SEQ ID NO: 1, but is
not limited thereto.
Further, the nucleotide sequence of SEQ ID NO: 1 may include not
only the nucleotide sequence of SEQ ID NO: 1 itself but also a
nucleotide sequence having at least 80% homology or identity to SEQ
ID NO: 1.
Specifically, any nucleotide sequence capable of encoding an amino
acid sequence having at least 80% homology or identity to SEQ ID
NO: 2 is included within the scope of the present disclosure, but
the protein may be encoded by a gene including a nucleotide
sequence having at least 80%, specifically 83%, 84%, 85%, 88%, 90%,
93%, 95%, or 97% homology or identity to SEQ ID NO: 1. However, it
is obvious that a nucleotide sequence is included within the scope
of the present disclosure without limitation as long as it encodes
a protein having activity corresponding to that of the protein
including the amino acid sequence of SEQ ID NO: 2.
Additionally, it is obvious that due to genetic code degeneracy, a
polynucleotide which can be translated to a protein including the
same amino acid sequence or a protein having homology or identity
thereto can be included within the scope of the present disclosure.
Further, a probe which can be prepared from a known gene sequence,
e.g., any sequence encoding a protein having activity of a protein
including the amino acid sequence of SEQ ID NO: 2 by hybridizing
the whole or a part of the nucleotide sequence with its complement
sequence under stringent conditions can be included without
limitation. The "stringent conditions" refer to conditions enabling
specific hybridization between polynucleotides. The conditions are
described in detail in the reference (J. Sambrook et al., Molecular
Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor
Laboratory press, Cold Spring Harbor, N.Y., 1989); for example, a
condition in which genes having high homology or identity of at
least 40%, specifically 85%, specifically 90%, more specifically
95%, more specifically 97%, and particularly specifically 99% are
hybridized and those having lower homology or identity are not
hybridized; or a condition of conventional Southern hybridization,
that is, washing once, specifically two to three times at a
temperature and salt concentration equivalent to 60.degree. C.,
1.times.SSC, 0.1% SDS, specifically 60.degree. C., 0.1.times.SSC,
0.1% SDS, more specifically 68.degree. C., 0.1.times.SSC, 0.1% SDS.
Although the hybridization may allow mismatch between bases
depending on the degree of stringency, it requires two nucleic
acids to have a complementary sequence to each other. As used
herein, the term "complementary" is used for describing the
relation between nucleotide bases capable of hybridization with
each other. With respect to DNA, for example, adenosine is
complementary to thymine, and cytosine is complementary to guanine.
Accordingly, the present disclosure may also include an isolated
nucleic acid fragment complementary to not only a substantially
similar nucleic acid sequence but also the entire sequence.
Specifically, the polynucleotide having homology or identity can be
detected using a hybridization condition including a hybridization
step at a T.sub.m value of 55.degree. C. and the above-described
conditions. Further, the T.sub.m value may be 60.degree. C.,
63.degree. C., or 65.degree. C., but is not limited thereto and can
be appropriately adjusted by a person skilled in the art.
An appropriate degree of stringency of polynucleotide hybridization
is dependent on the length and degree of complementarity of the
polynucleotide, and variables are well known in the corresponding
technical field (see Sambrook et al., supra, 9.50-9.51,
11.7-11.8).
As used herein, the term "homology" refers to the degree of
identity between two given amino acid sequences or nucleotide
sequences and can be expressed as a percentage. In the present
specification, the homologous sequence having the same or similar
activity with the given amino acid sequence or polynucleotide
sequence may be indicated in terms of "% homology".
As used herein, the term "identity" refers to the degree of
sequence relatedness between amino acid or nucleotide sequences,
and in some cases, it may be determined by a match between the
strings of such sequences.
The terms "homology" and "identity" are often used interchangeably
with each other.
Sequence homology or identity of conserved polynucleotides or
polypeptides may be determined by standard alignment algorithms and
used with a default gap penalty established by a program being
used. Substantially, homologous or identical polynucleotides or
polypeptides are generally expected to hybridize under moderate or
high stringency, along at least about 50%, 60%, 70%, 80%, or 90% of
the entire length of all or target polynucleotides or polypeptides.
Polynucleotides that contain degenerate codons instead of codons in
the hybridizing polypeptides are also considered.
Whether any two polynucleotide or polypeptide sequences have a
homology or identity of, for example, at least 50%, 55%, 60%, 65%
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% may be
determined using a known computer algorithm such as the "FASTA"
program (e.g., Pearson et al., (1988) Proc. Natl. Acad. Sci. USA
85: 2444) using default parameters. Alternatively, it may be
determined using the Needleman-Wunsch algorithm (Needleman and
Wunsch, 1970, J. Mol. Biol. 48: 443-453), which is performed in the
Needleman program of the EMBOSS package (EMBOSS: The European
Molecular Biology Open Software Suite, Rice et al., 2000, Trends
Genet. 16: 276-277) (preferably, version 5.0.0 or later).
(Including GCG program package (Devereux, J., et al., Nucleic Acids
Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.]
[F.,] [ET AL., J MOLEC BIOL 215]: 403 (1990); Guide to Huge
Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,
1994, and [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073). For
example, the homology or identity may be determined using BLAST or
ClustalW of the National Center for Biotechnology Information
(NCBI).
The homology or identity of polynucleotide or polypeptide may be
determined by comparing sequence information as published (e.g.,
Smith and Waterman, Adv. Appl. Math (1981) 2:482), for example,
using the GAP computer program as disclosed in Needleman et al.
(1970), J Mol Biol. 48: 443. In summary, the GAP program defines
the homology or identity as a value obtained by dividing the number
of similarly aligned symbols (i.e., nucleotides or amino acids) by
the total number of symbols in the shorter of the two sequences.
Default parameters for the GAP program may include (1) a unary
comparison matrix (containing a value of 1 for identities and 0 for
non-identities) and the weighted comparison matrix of Gribskov et
al. (1986), Nucl. Acids Res. 14:6745, as disclosed in Schwartz and
Dayhoff, eds., Atlas of Protein Sequence and Structure, National
Biomedical Research Foundation, pp. 353-358, 1979; (2) a penalty of
3.0 for each gap and an additional 0.10 penalty for each symbol in
each gap (or a gap opening penalty of 10 and a gap extension
penalty of 0.5); and (3) no penalty for end gaps. Accordingly, as
used herein, the term "homology" or "identity" refers to a
relevance between polypeptides or polynucleotides.
The microorganism of the genus Corynebacterium producing
5'-xanthosine monophosphate in the present disclosure may have
enhanced activity of the protein including the amino acid sequence
of SEQ ID NO: 2.
The enhancement of activity of the protein including the amino acid
sequence of SEQ ID NO: 2 can be interchangeably used with the
enhancement of activity of xmpE or that of a protein encoded by a
gene including the nucleotide sequence of SEQ ID NO: 1.
As used herein, the term "enhanced activity of a protein comprising
the amino acid sequence of SEQ ID NO: 2" refers to enhanced
expression of the protein compared to its parent strain or that of
the protein including the amino acid sequence of SEQ ID NO: 2
compared to an unmodified strain; enhanced activity thereof with
equivalent expression; or enhanced activity and expression thereof.
The term also refers to enhanced activity of the protein compared
to its endogenous activity, and enhanced expression or activity of
xmpE compared to the parent strain or unmodified strain
thereof.
In the present disclosure, the enhancement of protein activity can
be achieved by applying various methods known in the art. For
example, the enhancement of activity may be achieved by increasing
the copy number of polynucleotides encoding the protein, enhancing
the promoter activity, substitution of a start codon, or a
combination thereof; specifically, 1) increasing the copy number of
polynucleotide encoding the protein; 2) modifying a sequence of an
expression regulator (promoter, operator, etc.) so as to increase
the expression of the polynucleotide; 3) modifying a sequence of
the gene (start codon, etc.) on a chromosome so as to enhance the
protein activity, or a combination thereof, but is not limited
thereto.
Specifically, with respect to the enhancement of the protein
activity, the method for modifying a sequence of an expression
regulator can be achieved by applying various methods known in the
art. For example, the modification can be carried out to enhance
the activity of the expression regulator sequence by inducing a
modification by deletion, insertion, or non-conservative or
conservative substitution, or a combination thereof in the
regulatory sequence; or substituting the nucleotide sequence with a
nucleotide sequence having more enhanced activity. The expression
regulator includes a promoter, an enhancer, an operator, a
ribosome-binding site, and a sequence which regulates termination
of transcription and translation, but is not limited thereto.
Additionally, the method for modifying the sequence of the gene can
be carried out to enhance the protein activity by inducing a
modification by deletion, insertion, or non-conservative or
conservative substitution, or a combination thereof in the
sequence; or substituting the gene sequence with a modified gene
sequence having more enhanced activity, but is not limited
thereto.
In a specific exemplary embodiment, the enhancement of the protein
activity can be achieved by increasing the copy number of xmpE;
replacing a promoter of xmpE with another promoter having enhanced
activity; substituting the start codon of xmpE; or a combination
thereof.
As used herein, the term "vector" refers to a DNA construct
comprising the nucleotide sequence of the polynucleotide encoding
the target protein operably linked to the proper regulatory
sequence to express the target protein in the proper host. The
regulatory sequence can include the promoter which can initiate
transcription, any operator sequence to control the transcription,
the sequence to encode the appropriate mRNA ribosome binding site,
and the sequence to control the termination of transcription and
translation. The vector may be transfected into a suitable host,
and then may be replicated or function independently from the host
genome, and may be integrated into the genome itself.
As used herein, the term "transformation" refers to the
introduction of a vector including a polynucleotide encoding a
target protein into a host cell so that the protein encoded by the
polynucleotide can be expressed in the host cell. As long as it can
be expressed in the host cell, the transformed polynucleotide can
be either integrated into and placed in the chromosome of the host
cell or located extrachromosomally. Further, the polynucleotide
includes DNA and RNA encoding the target protein. The
polynucleotide may be introduced in any form as long as it can be
introduced into the host cell and expressed therein. For example,
the polynucleotide may be introduced into the host cell in the form
of an expression cassette, which is a polynucleotide construct
including all elements required for its autonomous expression. The
expression cassette may include a promoter operably linked to the
gene, a transcription termination signal, a ribosome-binding site,
and a translation termination signal. The expression cassette may
be in the form of a self-replicable expression vector. In addition,
the polynucleotide may be introduced into the host cell as is and
operably linked to a sequence required for the expression in the
host cell.
As used herein, the term "microorganism producing 5'-xanthosine
monophosphate" or "microorganism having abilities to produce
5'-xanthosine monophosphate" refers to a microorganism naturally
having abilities to produce 5'-xanthosine monophosphate or a
microorganism in which ability to produce 5'-xanthosine
monophosphate is endowed to a parent strain having no ability to
produce 5'-xanthosine monophosphate. Specifically, it may be a
microorganism having abilities to produce 5'-xanthosine
monophosphate, in which the activity of a protein including the
amino acid sequence of SEQ ID NO: 2 or xmpE protein is
enhanced.
Further, considering the object of the present disclosure, the
ability to produce 5'-xanthosine monophosphate of the microorganism
may be improved/enhanced due to the enhancement of 5'-xanthosine
monophosphate-exporting ability.
Specifically, the terms "ability to produce" and "exporting
ability" can be interchangeably used. Further, the microorganism
can be interchangeably used with "microorganism exporting
5'-xanthosine monophosphate" or "microorganism having 5'-xanthosine
monophosphate-exporting ability". It may refer to a microorganism
naturally having 5'-xanthosine monophosphate-exporting ability or a
microorganism in which 5'-xanthosine monophosphate-exporting
ability is endowed to a parent strain having no 5'-xanthosine
monophosphate-exporting ability.
Specifically, the microorganism of the genus Corynebacterium
producing 5'-xanthosine monophosphate may be Corynebacterium
stationis or Corynebacterium glutamicum, or Corynebacterium
ammoniagenes; and more specifically may be Corynebacterium
stationis, but is not limited thereto.
As another aspect, the present disclosure provides a method for
producing 5'-xanthosine monophosphate, comprising culturing the
microorganism of the genus Corynebacterium in a culture medium; and
recovering the 5'-xanthosine monophosphate from the microorganism
or the culture medium.
The microorganism and 5'-xanthosine monophosphate according to the
present disclosure are the same as previously described.
The microorganism of the genus Corynebacterium in the present
disclosure may be Corynebacterium stationis, but is not limited
thereto.
With respect to the method of the present disclosure, the
microorganism of the genus Corynebacterium may be cultured using
any culturing conditions and methods known in the art.
As used herein, the term "culture" refers to cultivation of the
microorganism under moderately artificially controlled
environmental conditions. The culturing process of the present
disclosure can be carried out according to a suitable culture
medium and culture conditions known in the art. Further, the
culture method includes a batch culture, a continuous culture, and
a fed-batch culture; specifically, a batch process or a fed batch
or a repeated fed batch process can be continuously cultured, but
the culture method is not limited thereto.
The medium used for culture shall meet the requirements of specific
strains in a proper manner. The culture medium for the
microorganism of the genus Corynebacterium is known in the art
(e.g., Manual of Methods for General Bacteriology by the American
Society for Bacteriology, Washington D.C., USA, 1981).
Specifically, sugar sources which may be used for the medium
include saccharides and carbohydrates such as glucose, saccharose,
lactose, fructose, maltose, starch, cellulose, etc.; oils and fats
such as soybean oil, sunflower oil, castor oil, coconut oil, etc.;
fatty acids such as palmitic acid, stearic acid, linoleic acid,
etc.; glycerol; alcohols such as ethanol; and organic acids such as
acetic acid. These substances can be used individually or as a
mixture, but are not limited thereto.
Carbon sources which may be used may be crude sucrose or glucose,
or molasses containing a large amount of sucrose; and specifically
may be purified glucose, but are not limited thereto. Other various
carbon sources may be used.
Nitrogen sources which may be used include peptone, yeast extract,
beef extract, malt extract, corn steep liquor, soybean meal, and
urea or inorganic compounds, for example, ammonium sulfate,
ammonium chloride, ammonium phosphate, ammonium carbonate, and
ammonium nitrate. The nitrogen sources can also be used
individually or as a mixture, but are not limited thereto.
Phosphate sources which may be used include potassium dihydrogen
phosphate, dipotassium hydrogen phosphate, or corresponding
sodium-containing salts.
Further, the culture medium may contain metallic salts such as
magnesium sulfate or iron sulfate. In addition to the above
materials, essential growth substances such as amino acids and
vitamins may be used. Appropriate precursors may also be used for
the culture medium. The raw materials described above may be added
batch-wise or continuously to an incubator in an appropriate
manner.
A pH of the culture medium may be adjusted by using a basic
compound such as sodium hydroxide, potassium hydroxide, and
ammonia; or an acidic compound such as phosphoric acid and sulfuric
acid in an appropriate manner. Additionally, foam formation may be
suppressed by using an antifoaming agent such as fatty acid
polyglycol ester. Oxygen or an oxygen-containing gas (e.g., air)
may be injected into the culture medium to maintain an aerobic
condition.
Specifically, the culturing temperature is normally 30.degree. C.
to 37.degree. C., more specifically 32.degree. C. to 33.degree. C.
The culturing may continue until a desired amount of 5'-xanthosine
monophosphate is obtained, but specifically may be performed for 40
hours to 120 hours.
The separation of 5'-xanthosine monophosphate from the culture may
be carried out by a conventional method known in the art; e.g.,
centrifugation, filtration, ion-exchange chromatography,
crystallization, etc. For example, the culture may be centrifuged
at a low speed to remove biomass, and then, the obtained
supernatant may be separated through ion-exchange chromatography.
However, the separation is not limited thereto.
The recovery step may further include a purifications process.
MODE FOR INVENTION
Hereinafter, the present disclosure will be described in more
detail with reference to the following exemplary embodiments.
However, these Examples are for illustrative purposes only, and the
present disclosure is not intended to be limited by these
Examples.
Example 1: Discovery of 5'-Xanthosine Monophosphate (XMP)-Exporting
Protein
To identify membrane protein of Corynebacterium involved in XMP
export, a genomic DNA library of Corynebacterium stationis
(ATCC6872) was prepared. A genomic DNA of ATCC6872 strain (i.e.,
wild type of Corynebacterium stationis) was extracted using G-spin
Total DNA Extraction Minin Kit by Intron (Cat. No. 17045) according
to the protocol provided therein. The membrane protein library was
prepared using the extracted genomic DNA as a template.
To investigate which protein has the export function, the prepared
genomic DNA library was introduced into the Corynebacterium
KCCM-10530 strain used as a parent strain in KR Patent No.
10-2011-0105662.
XMP was then additionally added to the minimal culture medium
containing 1.7% agar to establish a screening condition in which
the KCCM-10530 strain shows growth inhibition. The KCCM-10530
strain was transformed by electroporation with A genomic library
plasmid of a membrane protein of ATCC6872 strain, and colonies were
selected which normally grow in a condition where an excessive
amount of XMPs are added to the culture medium. A plasmid was
obtained from the selected colony and its nucleotide sequence was
analyzed by a nucleotide sequence analysis method. One type of
membrane protein involved in removing the growth inhibition under
the condition of an excessive amount of XMP added was identified
from the experiment above.
The Corynebacterium membrane protein was confirmed to have the
nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of
SEQ ID NO: 2 (NCBI GenBank: NZ_CP014279.1, WP 066795121, MFS
transporter). The membrane protein is known as an MFS transporter,
but its function is not clearly identified. Besides, it is not
known to have the function of exporting XMP. In the present
disclosure, the membrane protein is named as "xmpE".
Example 2: Identification of xmpE
Example 2-1: Preparation of xmpE-Deficient Vector
A Deficient vector was prepared to confirm whether the
XMP-exporting ability decreases when xmpE, the protein involved in
removing growth inhibition due to the XMP identified in Example 1,
is deleted from the XMP-producing strain.
A gene fragment for the vector preparation was obtained by PCR
using the genomic DNA of the ATCC6872 strain as a parent strain.
Specifically, the PCR was performed for the xmpE using primers of
SEQ ID NOS: 3 and 4. The primers that were used were prepared based
on the information on Corynebacterium stationis (ATCC6872) genes
registered in the National Institutes of Health (NIH) GenBank (NCBI
Genbank: NZ_CP014279.1) and the surrounding nucleotide sequence
thereof.
The PCR was performed under the following conditions: denaturation
at 94.degree. C. for 5 minutes; 25 cycles of denaturation at
94.degree. C. for 30 seconds, annealing at 52.degree. C. for 30
seconds, and polymerization at 72.degree. C. for 1 minute. Final
polymerization was then performed at 72.degree. C. for 5 minutes.
As an xmpE gene fragment amplified using the primers of SEQ ID NOS:
3 and 4, a polynucleotide template of about 1.0 kbp was obtained.
The obtained gene fragment was cloned using a T vector (Solgent) to
obtain a TOPO-.DELTA.xmpE vector.
Example 2-2: Preparation of xmpE-Deficient Strain
The KCCM-10530 strain was transformed by electroporation with the
vector prepared in example 2-1 (using the transformation method
according to Appl. Microbiol. Biotechnol. (1999) 52:541-545), and
the strain having the vector inserted on a chromosome due to the
homologous sequence recombination was selected from a culture
medium containing 25 mg/L kanamycin. The selected xmpE-deficient
strain was named as "KCCM-10530_.DELTA.xmpE", and its ability to
produce XMP was evaluated.
The parent strain Corynebacterium stationis KCCM-10530 and the
strain KCCM-10530_.DELTA.xmpE were inoculated into a 14 mL tube
including 3 mL of the seed culture medium below and cultured at
30.degree. C. for 24 hours with shaking at 170 rpm. Then, the seed
cultures were added in an amount of 0.7 mL to 32 mL of the
following production culture medium (24 mL of main culture medium+8
mL of additional sterile culture medium) in respective 250 mL
corner-baffle flasks, followed by culturing at 30.degree. C. for 72
hours with shaking at 170 rpm. HPLC analysis was performed to
measure the amount of XMP produced after completion of the culture.
The constitution of the culture medium and the result of XMP
concentrations in the culture medium are as shown in Table 1
below.
XMP Minimal Culture Medium
glucose 2%, sodium sulfate 0.3%, monopotassium phosphate 0.1%,
dipotassium phosphate 0.3%, magnesium sulfate 0.3%, calcium
chloride 10 mg/L, iron sulfate 10 mg/L, zinc sulfate 1 mg/L,
manganese chloride 3.6 mg/L, L-cysteine 20 mg/L, calcium
pantothenate 10 mg/L, thiamine hydrochloride 5 mg/L, biotin 30
.mu.g/L, adenine 20 mg/L, guanine 20 mg/L, pH 7.3
XMP Nutritional Culture Medium
peptone 1%, beef extract 0.5%, sodium chloride 0.25%, yeast extract
1%, urea 0.3%, adenine 50 mg/L, guanine 50 mg/L, agar 2%, pH
7.2
XMP Flask Seed Culture Medium
glucose 20 g/L, peptone 10 g/L, yeast extract 10 g/L, sodium
chloride 2.5 g/L, urea 3 g/L, adenine 150 mg/L, guanine 150 mg/L,
pH 7.0
XMP Flask Production Culture Medium (Main Culture Medium)
glucose 50 g/L, magnesium sulfate 10 g/L, calcium chloride 100
mg/L, iron sulfate 20 mg/L, manganese sulfate 10 mg/L, zinc sulfate
10 mg/L, copper sulfate 0.8 mg/L, histidine 20 mg/L, cysteine 15
mg/L, beta-alanine 15 mg/L, biotin 100 .mu.g/L, thiamine 5 mg/L,
adenine 50 mg/L, guanine 25 mg/L, niacin 5 mg/L, pH 7.0
XMP Flask Production Culture Medium (Additional Sterile Culture
Medium
monopotassium phosphate 18 g/L, dipotassium phosphate 42 g/L, urea
7 g/L, ammonium sulfate 5 g/L
TABLE-US-00001 TABLE 1 Strain No. XMP (g/L) Yield (%) KCCM-10530
11.8 23.6 KCCM-10530-.DELTA.xmpE 1.6 3.2
The XMP concentrations in the culture media of the parent strain
KCCM-10530 and the xmpE-deficient strain KCCM-10530-.DELTA.xmpE
were compared; as a result, as shown in Table 1 above, the XMP
concentration of the KCCM-10530-.DELTA.xmpE strain decreased at
least about 10 g/L compared to the parent strain under the same
conditions.
Accordingly, xmpE was confirmed to be a protein involved in the XMP
export.
Example 3: Enhancement of xmpE Protein Activity
The activity of the xmpE protein in the strain was enhanced
according to the following Examples, and the strain with enhanced
xmpE activity was examined with respect to whether its ability to
produce/export XMP was increased.
Example 3-1: Increase in Copy Number of xmpE
Example 3-1-1: Preparation of Vector for Increasing Copy Number of
xmpE
In order to confirm whether the XMP-exporting ability increases
when the activity of xmpE, which is predicted to be involved in the
XMP-exporting ability, is enhanced, a vector was prepared for
enhancing an xmpE gene. Using a method for increasing the copy
number as the enhancement method, the following experiment was
performed.
The gene fragment for preparing the vector was obtained through PCR
using genomic DNA of the ATCC6872 strain as a template.
Specifically, the xmpE gene was amplified so as to contain upstream
484 bp of the xmpE gene using a pair of the primers of SEQ ID NOS:
5 and 6. The amplified xmpE gene fragment was treated with
restriction enzymes XbaI and SpeI. The cloning was performed on the
XbaI site of pDZ vector (KR patent No. 10-0924065 and International
Publication No. 2008-033001) to prepare a pDZ-xmpE vector. PCR was
then performed on the xmpE gene using a pair of the primers of SEQ
ID NOS: 6 and 7 in order to prepare the vector containing two
copies. Each DNA fragment thus obtained was cleaved with the DNA
restriction enzyme SpeI, and cloned into the pDZ-xmpE vector
cleaved by the DNA restriction enzyme XbaI so as to prepare a
vector. The vector containing two copies of the xmpE gene was named
as "pDZ-xmpEX2".
Example 3-1-2: Evaluation of Ability to Produce XMP of the Strain
Having an Increased Copy Number of xmpE
The KCCM-10530 strain was transformed by electroporation with the
pDZ-xmpEX2 vector prepared in Example 3-1-1 (using the
transformation method according to Appl. Microbiol. Biotechnol.
(1999) 52:541-545), and the strain having the vector inserted on
the chromosome due to the homologous sequence recombination was
selected from a culture medium containing 25 mg/L kanamycin. The
strain into which a target gene is inserted was selected by
secondary crossover of the selected primary strain. The successful
insertion of the gene of the ultimate transformed strain was
confirmed by PCR using a pair of the primers of SEQ ID NOS: 8 and
9. The selected strain with an increased copy number of xmpE was
named as "KCCM-10530-xmpEX2", and its ability to produce XMP was
evaluated.
In order to measure the ability to produce XMP of the strain, the
same method as in Example 2-2 was used. HPLC analysis was performed
to measure the amount of XMP produced after completion of the
culture, and the result is as shown in Table 2 below.
TABLE-US-00002 TABLE 2 Strain No. XMP (g/L) Yield (%) KCCM-10530
11.8 23.6 KCCM-10530-xmpEX2 13.1 26.1
The XMP concentrations in the culture media of the parent strain
Corynebacterium stationis KCCM-10530 and the KCCM-10530-xmpEX2
strain having an increased copy number of xmpE were compared; as a
result, as shown in Table 2 above, the XMP concentration of the
KCCM-10530-xmpEX2 strain was 1.3 g/L, indicating a concentration
increase of about 11% compared to the parent strain under the same
conditions.
This can be understood as a very meaningful result through which
such increase in the amount of XMP produced is confirmed to be due
to the enhanced xmpE protein activity.
Example 3-2: Enhancement of xmpE Expression Through Substitution of
Promoter
Example 3-2-1: Preparation of Vector for Replacing xmpE
Promoter
In order to confirm whether the XMP-exporting ability increases
when the activity of xmpE, which is predicted to be involved in the
XMP-exporting ability, is enhanced, a vector was prepared in which
the promoter of xmpE gene is substituted with a promoter capable of
strong expression. A gene fragment for preparing the vector was
obtained by PCR using genomic DNA of the ATCC6872 strain as a
template.
Pcj7, which is reported to be strongly expressed in Corynebacterium
stationis in KR patent No. 10-0620092, was used as a promoter.
In order to amplify a fragment of Pcj7 gene, a pair of the primers
of SEQ ID NOS: 10 and 11 was used using the genomic DNA of the
ATCC6872 strain as a template. Each xmpE gene was amplified by PCR
using a pair of the primers of SEQ ID NOS: 12 and 13; and 14 and
15, respectively. The PCR reaction was performed under the
following conditions: denaturation at 94.degree. C. for 5 minutes;
25 cycles of denaturation at 94.degree. C. for 30 seconds,
annealing at 52.degree. C. for 30 seconds, and polymerization at
72.degree. C. for 1 minute. Final polymerization was then performed
at 72.degree. C. for 5 minutes. A 2.3 kbp polynucleotide template
was obtained by performing overlapping polymerase chain reaction
using the three amplified gene fragments Pcj7, xmpE-1, and xmpE-2
as templates. The obtained gene fragment was cleaved by a
restriction enzyme XbaI, and was cloned into the linear pDZ vector
cleaved with XbaI using T4 ligase to prepare a "pDZ-Pcj7/xmpE"
vector.
Example 3-2-2: Preparation of Strain Having Substituted xmpE
Promoter and Evaluation of its Ability to Produce XMP
The KCCM10530 strain was transformed by electroporation with The
pDZ-Pcj7/xmpE vector prepared in Example 3-2-1 (using the
transformation method according to Appl. Microbiol. Biotechnol.
(1999) 52:541-545), and the strain having the vector inserted on
the chromosome due to the homologous sequence recombination was
selected from a culture medium containing 25 mg/L kanamycin. The
strain into which a target gene is enhanced was selected by
secondary crossover of the selected primary strain. The successful
insertion of the gene promoter of the ultimate transformed strain
was confirmed by PCR using a pair of the primers of SEQ ID NOS: 16
and 17. The strain in which the promoter is substituted with a
stronger promoter was named as "KCCM-10530-Pcj7/xmpE", and its
ability to produce XMP was evaluated.
In order to measure the ability to produce XMP of the strain, the
same method as in Example 2-2 was used. HPLC analysis was performed
to measure the amount of XMP produced after completion of the
culture, and the result is as shown in Table 3 below.
TABLE-US-00003 TABLE 3 Strain No. XMP (g/L) Yield (%) KCCM-10530
11.8 23.6 KCCM-10530-Pcj7/xmpE 12.5 25.0
The XMP concentrations in the culture media of the parent strain
Corynebacterium stationis KCCM-10530 and the KCCM-10530-Pcj7/xmpE
strain having an enhanced xmpE expression due to the stronger
promoter were compared; as a result, as shown in Table 3 above, the
XMP concentration of the KCCM-10530-Pcj7/xmpE strain was 0.7 g/L,
indicating a concentration increase of about 6% compared to the
parent strain under the same conditions.
This can be understood as a very meaningful result through which
such increase in the amount of XMP produced is confirmed to be due
to the enhanced xmpE protein activity.
Example 3-3: Substitution of Start Codon of xmpE
Example 3-3-1: Preparation of Vector for Substituting Start Codon
of xmpE
In order to confirm whether the XMP-excreting ability increases
when the expression of the xmpE protein, which is predicted to be
involved in the XMP-excreting ability, is enhanced, a vector was
prepared in which the start codon gtg is substituted with atg. A
gene fragment for preparing the vector was obtained by PCR using a
genomic DNA of the ATCC6872 strain as a template. In order to
prepare a vector having the start codon gtg substituted with atg,
two gene fragments A and B were obtained using pairs of the primers
of SEQ ID NOS: 18 and 19, and 20 and 21, respectively. The PCR
reaction was performed under the following conditions: 25 cycles of
denaturation at 94.degree. C. for 5 minutes; denaturation at
94.degree. C. for 30 seconds; annealing at 52.degree. C. for 30
seconds; and polymerization at 72.degree. C. for 1 minute. Final
polymerization was then performed at 72.degree. C. for 5 minutes.
As a result, about 0.7 kbp and 1 kbp polynucleotides were obtained
for fragments A and B, respectively. Using the two fragments as
templates, PCR was conducted using a pair of the primers of SEQ ID
NOS: 18 and 21 to obtain a PCR resultant of about 1.7 kbp
(hereinafter, "g1a fragment"). The polymerization was performed
under the following conditions: 25 cycles of denaturation at
94.degree. C. for 5 minutes; denaturation at 94.degree. C. for 30
seconds; annealing at 55.degree. C. for 30 seconds; and
polymerization at 72.degree. C. for 120 seconds. Final
polymerization was then performed at 72.degree. C. for 7
minutes.
The obtained gene fragment was cleaved by a restriction enzyme
XbaI, and was cloned into the linear pDZ vector cleaved with XbaI
using T4 ligase to prepare a "pDZ-xmpE (g1a)" vector.
Example 3-3-2: Preparation of Strain Having Substituted xmpE Start
Codon and Evaluation of its Ability to Produce XMP
The KCCM-10530 strain was transformed by electroporation with the
pDZ-xmpE(g1a) vector prepared in Example 3-3-1 (using the
transformation method according to Appl. Microbiol. Biotechnol.
(1999) 52:541-545), and the strain having the vector inserted on
the chromosome due to the homologous sequence recombination was
selected from a culture medium containing 25 mg/L kanamycin. The
strain into which a target gene is enhanced was selected by
secondary crossover of the selected primary strain. The successful
insertion of the gene promoter of the ultimate transformed strain
was confirmed by PCR using a pair of the primers of SEQ ID NOS: 18
and 21, followed by analyzing the nucleotide sequence substituted
by a nucleotide sequence analysis method. The selected strain in
which xmpE start codon is substituted with atg was named as
CJX1662, and its ability to produce XMP was evaluated.
In order to measure the ability to produce XMP of the strain, the
same method as in Example 2-2 was used. HPLC analysis was performed
to measure the amount of XMP produced after completion of the
culture, and the result is as shown in Table 4 below.
TABLE-US-00004 TABLE 4 Strain No. XMP (g/L) Yield (%) KCCM-10530
11.8 23.6 CJX1662 14.1 28.2
The XMP concentrations in the culture media of the parent strain
Corynebacterium stationis KCCM-10530 and the CJX1662 strain having
the substituted start codon of xmpE were compared; as a result, as
shown in Table 4 above, the XMP concentration of the CJX1662 strain
was 2.3 g/L, indicating a concentration increase of about 20%
compared to the parent strain under the same conditions.
This can be understood as a very meaningful result through which
such increase in the amount of XMP produced is confirmed to be due
to the enhanced xmpE protein activity.
Further, the CJX1662 strain prepared above was deposited at the
Korean Culture Center of Microorganisms (KCCM), an international
depositary authority under the Budapest Treaty on Apr. 11, 2018, as
Accession No. KCCM12248P.
Example 3-4 Preparation of Strain Having Enhanced xmpE Based on
Wild-Type XMP-Producing Cell Line
Example 3-4-1: Preparation of Strain Having Enhanced xmpE Based on
Wild-Type XMP-Producing Cell Line
A strain having ability to produce XMP productivity was prepared by
weakening activities of adenylosuccinate synthetase and XMP
dehydrogenase, which belong to the XMP decomposition pathways, in a
wild-type ATCC6872 strain. In order to attenuate the activities of
the two enzymes, a strain was prepared in which `a`, the first
nucleotide of the nucleotide sequence of purA and guaA, the genes
respectively encoding the two enzymes, is substituted with `t`.
More specifically, the strain prepared by weakening the expression
of the two genes in the ATCC6872 strain was named as CJX1663.
The prepared CJX1663 strain was transformed by electroporation with
the pDZ-xmpE(g1a) vector prepared in Example 3-3-2, and the strain
having the vector inserted on the chromosome due to the homologous
sequence recombination was selected from a culture medium
containing 25 mg/L kanamycin. The strain into which a target gene
is enhanced was selected by secondary crossover of the selected
primary strain. The successful insertion of the gene promoter of
the ultimate transformed strain was confirmed by PCR using a pair
of the primers of SEQ ID NOS: 18 and 21.
The strain in which the selected xmpE start codon is substituted
with atg was named as "CJX1663_xmpE(g1a)", and its ability to
produce XMP was evaluated.
HPLC analysis was performed to measure the amount of XMP produced
after completion of the culture, and the result is as shown in
Table 5 below.
TABLE-US-00005 TABLE 5 Strain No. XMP (g/L) Yield (%) CJX1663 2.1
4.2 CJX1663_xmpE(g1a) 2.8 5.6
The XMP concentrations in the culture media of the parent strain
Corynebacterium stationis CJX1663 and the CJX1663_xmpE(g1a) strain
having the substituted start codon of xmpE were compared; as a
result, as shown in Table 5 above, the XMP concentration of the
CJX1663_xmpE(g1a) strain was 2.8 g/L, indicating a concentration
increase of about 33% compared to the parent strain under the same
conditions.
It was confirmed from the result that by enhancing the activity of
the protein (xmpE) of the present disclosure, which exports
5'-xanthosine monophosphate, the XMP productivity can be
increased.
Meanwhile, the primer sequences used in the present disclosure are
as shown in Table 6.
TABLE-US-00006 TABLE 6 SEQ ID NO Sequence 3 GTCAAACTCTTTACGCCGACG 4
CGACAACACCAACAGATACTGC 5 ATGCTCTAGACTAGATCTTCTCGACGGGCAG 6
ATGATACTAGTCCTTGGGGACTTCGCGTGTCG 7 ATGATACTAGTCTAGATCTTCTCGACGGGCAG
8 TTCGGCTCAGCATTTTCCAC 9 CAATAGTGGTCGCGATGACG 10
GCAGTAAGGAGAATCAGAAACATCCCAGCGCTACTA 11
ACCTCTTCGGTTGTGTGCACGAGTGTTTCCTTTCGTTGGG 12
ATGCTCTAGATCCAGTGTGGTTAAGAAGTCG 13
CGCTGGGATGTTTCTGATTCTCCTTACTGCAGT 14
GTACCCAACGAAAGGAAACACTCGTGCACACAACCGAAGAGGT 15
ATGCTCTAGATTATTGAGCCAGAACCATGG 16 CTAGATCTTCTCGACGGGCAG 17
CAATAGTGGTCGCGATGACG 18 ATGCTCTAGATCCAGTGTGGTTAAGAAGTCG 19
GACCTCTTCGGTTGTGTGCATGATTCTCCTTACTGCAGTTA 20
TAACTGCAGTAAGGAGAATCATGCACACAACCGAAGAGGTC 21
ATGCTCTAGACTCGCTCTTGTCGACAACAC
Those of ordinary skill in the art will recognize that the present
disclosure may be embodied in other specific forms without
departing from its spirit or essential characteristics. In this
regard, the described embodiments are to be considered in all
respects only as illustrative and not restrictive. The scope of the
present disclosure is therefore indicated by the appended claims
rather than by the foregoing description. All changes which come
within the meaning and range of equivalency of the claims are to be
embraced within the scope of the present disclosure.
SEQUENCE LISTINGS
1
2111242DNACorynebacterium sp. 1gtgcacacaa ccgaagaggt caaactcttt
acgccgacgt ttatcatggg gtgggtcgcc 60aacttcctgc agttcttggt gttctacttc
ctcatcacca cgatggcgct ctacgcaacc 120aaggaattca gcgcatcgga
aaccgaagca ggctttgccg ccagtgcgat tgttatcggt 180gcggtctttt
cccgtttggt ttccggatac attattgacc gcttcggtcg ccgcaaaatt
240gtggtggtct ccgtcatcgc gaccactatt gcgtgcgcgc tatatatccc
gatcgattct 300ttggggctgc tctacgctga ccgcttcttc cacggtgtag
cttatgcctt tgcgtgcacc 360gcgattatgg cgatggtcca ggaactcatt
ccttctgcac gccgctccga aggcactggc 420tacctggctt tgggtaccac
cgtttcggct gctatcggac cagcgctagc gctatttttg 480ctgggttctt
tcaactacga agtcctcttc gttgtcgtcc tcggcatttc gattgtctct
540ttgatcgctt cgctagtcat ctatttccgc acctccgacc cagagccaga
gctggatgaa 600aacggcaatg ctgctgagcc cattaagttc agcttcaagt
ccatcattaa ccctaaagtc 660ttgccgattg gcctcttcat gctgctggta
gcctttgcct actccggcgt gatcgcacat 720atcaacgctt ttgctgaaaa
ccgcgacgtt gttactggcg caggcctatt ctttatcgct 780tacgccatct
ccatgttcgt gatgcgctcc taccttggta aattgcaaga ccgccggggc
840gataacagcg ttatctactt tggtctcgta ttctttgtta tctcatttat
cgtgctctcg 900ctttctaccg ccaactggca tgtcgttgtc gctggcgtgc
tagcaggtct gggctacggc 960accttgatgc cagctgctca agcagtatct
gttggtgttg tcgacaagag cgagttcggc 1020tcagcatttt ccaccttgtt
ccttttcgtt gacctcggct tcggcttcgg cccagtcatc 1080cttggtgcag
tggtttccgc gattggctac ggttcgatgt atgcagtgct cgtcggcgtc
1140ggcgttattg ctggcatcta ctacctgttc acccacgcac gcaccgagcg
cgcaaagcac 1200ggcgtagtca agcatgtaga aaccatggtt ctggctcaat aa
12422413PRTCorynebacterium sp. 2Val His Thr Thr Glu Glu Val Lys Leu
Phe Thr Pro Thr Phe Ile Met1 5 10 15Gly Trp Val Ala Asn Phe Leu Gln
Phe Leu Val Phe Tyr Phe Leu Ile 20 25 30Thr Thr Met Ala Leu Tyr Ala
Thr Lys Glu Phe Ser Ala Ser Glu Thr 35 40 45Glu Ala Gly Phe Ala Ala
Ser Ala Ile Val Ile Gly Ala Val Phe Ser 50 55 60Arg Leu Val Ser Gly
Tyr Ile Ile Asp Arg Phe Gly Arg Arg Lys Ile65 70 75 80Val Val Val
Ser Val Ile Ala Thr Thr Ile Ala Cys Ala Leu Tyr Ile 85 90 95Pro Ile
Asp Ser Leu Gly Leu Leu Tyr Ala Asp Arg Phe Phe His Gly 100 105
110Val Ala Tyr Ala Phe Ala Cys Thr Ala Ile Met Ala Met Val Gln Glu
115 120 125Leu Ile Pro Ser Ala Arg Arg Ser Glu Gly Thr Gly Tyr Leu
Ala Leu 130 135 140Gly Thr Thr Val Ser Ala Ala Ile Gly Pro Ala Leu
Ala Leu Phe Leu145 150 155 160Leu Gly Ser Phe Asn Tyr Glu Val Leu
Phe Val Val Val Leu Gly Ile 165 170 175Ser Ile Val Ser Leu Ile Ala
Ser Leu Val Ile Tyr Phe Arg Thr Ser 180 185 190Asp Pro Glu Pro Glu
Leu Asp Glu Asn Gly Asn Ala Ala Glu Pro Ile 195 200 205Lys Phe Ser
Phe Lys Ser Ile Ile Asn Pro Lys Val Leu Pro Ile Gly 210 215 220Leu
Phe Met Leu Leu Val Ala Phe Ala Tyr Ser Gly Val Ile Ala His225 230
235 240Ile Asn Ala Phe Ala Glu Asn Arg Asp Val Val Thr Gly Ala Gly
Leu 245 250 255Phe Phe Ile Ala Tyr Ala Ile Ser Met Phe Val Met Arg
Ser Tyr Leu 260 265 270Gly Lys Leu Gln Asp Arg Arg Gly Asp Asn Ser
Val Ile Tyr Phe Gly 275 280 285Leu Val Phe Phe Val Ile Ser Phe Ile
Val Leu Ser Leu Ser Thr Ala 290 295 300Asn Trp His Val Val Val Ala
Gly Val Leu Ala Gly Leu Gly Tyr Gly305 310 315 320Thr Leu Met Pro
Ala Ala Gln Ala Val Ser Val Gly Val Val Asp Lys 325 330 335Ser Glu
Phe Gly Ser Ala Phe Ser Thr Leu Phe Leu Phe Val Asp Leu 340 345
350Gly Phe Gly Phe Gly Pro Val Ile Leu Gly Ala Val Val Ser Ala Ile
355 360 365Gly Tyr Gly Ser Met Tyr Ala Val Leu Val Gly Val Gly Val
Ile Ala 370 375 380Gly Ile Tyr Tyr Leu Phe Thr His Ala Arg Thr Glu
Arg Ala Lys His385 390 395 400Gly Val Val Lys His Val Glu Thr Met
Val Leu Ala Gln 405 410321DNAArtificial SequenceDescription of
Artificial Sequence Synthetic xmpE del F sequence 3gtcaaactct
ttacgccgac g 21422DNAArtificial SequenceDescription of Artificial
Sequence Synthetic xmpE del R sequence 4cgacaacacc aacagatact gc
22531DNAArtificial SequenceDescription of Artificial Sequence
Synthetic xmpE 2copy F (xbaI) sequence 5atgctctaga ctagatcttc
tcgacgggca g 31632DNAArtificial SequenceDescription of Artificial
Sequence Synthetic xmpE 2copy R (speI) sequence 6atgatactag
tccttgggga cttcgcgtgt cg 32732DNAArtificial SequenceDescription of
Artificial Sequence Synthetic xmpE 2copy F (speI) sequence
7atgatactag tctagatctt ctcgacgggc ag 32820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic xmpE 2copy CF
sequence 8ttcggctcag cattttccac 20920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic xmpE 2copy CR
sequence 9caatagtggt cgcgatgacg 201036DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Pcj7 F
sequence 10gcagtaagga gaatcagaaa catcccagcg ctacta
361140DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Pcj7 R sequence 11acctcttcgg ttgtgtgcac gagtgtttcc
tttcgttggg 401231DNAArtificial SequenceDescription of Artificial
Sequence Synthetic xmpE P 1 sequence 12atgctctaga tccagtgtgg
ttaagaagtc g 311333DNAArtificial SequenceDescription of Artificial
Sequence Synthetic xmpE P 2 sequence 13cgctgggatg tttctgattc
tccttactgc agt 331443DNAArtificial SequenceDescription of
Artificial Sequence Synthetic xmpE P 3 sequence 14gtacccaacg
aaaggaaaca ctcgtgcaca caaccgaaga ggt 431530DNAArtificial
SequenceDescription of Artificial Sequence Synthetic xmpE P 4
sequence 15atgctctaga ttattgagcc agaaccatgg 301621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Pcj7/xmpE CF
sequence 16ctagatcttc tcgacgggca g 211720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic Pcj7/xmpE CR
sequence 17caatagtggt cgcgatgacg 201831DNAArtificial
SequenceDescription of Artificial Sequence Synthetic xmpE atg 1
sequence 18atgctctaga tccagtgtgg ttaagaagtc g 311941DNAArtificial
SequenceDescription of Artificial Sequence Synthetic xmpE atg 2
sequence 19gacctcttcg gttgtgtgca tgattctcct tactgcagtt a
412041DNAArtificial SequenceDescription of Artificial Sequence
Synthetic xmpE atg 3 sequence 20taactgcagt aaggagaatc atgcacacaa
ccgaagaggt c 412130DNAArtificial SequenceDescription of Artificial
Sequence Synthetic xmpE atg 4 sequence 21atgctctaga ctcgctcttg
tcgacaacac 30
* * * * *