U.S. patent application number 17/544984 was filed with the patent office on 2022-09-29 for serum amyloid p component (apcs) irna compositions and methods of use thereof.
The applicant listed for this patent is Alnylam Pharmaceuticals, Inc.. Invention is credited to Kevin Fitzgerald, Gregory Hinkle.
Application Number | 20220305045 17/544984 |
Document ID | / |
Family ID | 1000006388189 |
Filed Date | 2022-09-29 |
United States Patent
Application |
20220305045 |
Kind Code |
A1 |
Fitzgerald; Kevin ; et
al. |
September 29, 2022 |
SERUM AMYLOID P COMPONENT (APCS) iRNA COMPOSITIONS AND METHODS OF
USE THEREOF
Abstract
The invention relates to iRNA, e.g., double stranded ribonucleic
acid (dsRNA), compositions targeting the serum amyloid P component
(APCS) gene, and methods of using such iRNA, e.g., dsRNA,
compositions to inhibit expression of an APCS gene and to treat
subjects having an APCS-associated disease, e.g., amyloidosis,
Alzheimer's disease or coronary atherosclerotic heart disease.
Inventors: |
Fitzgerald; Kevin;
(Brookline, MA) ; Hinkle; Gregory; (Plymouth,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Alnylam Pharmaceuticals, Inc. |
Cambridge |
MA |
US |
|
|
Family ID: |
1000006388189 |
Appl. No.: |
17/544984 |
Filed: |
December 8, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16877586 |
May 19, 2020 |
11229663 |
|
|
17544984 |
|
|
|
|
PCT/US2018/061906 |
Nov 20, 2018 |
|
|
|
16877586 |
|
|
|
|
62588506 |
Nov 20, 2017 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/113 20130101;
C12N 2310/315 20130101; C12N 2310/3515 20130101; C12N 2310/14
20130101; A61K 31/713 20130101; A61K 47/549 20170801 |
International
Class: |
A61K 31/713 20060101
A61K031/713; A61K 47/54 20060101 A61K047/54; C12N 15/113 20060101
C12N015/113 |
Claims
1. A double stranded ribonucleic acid (RNAi) agent for inhibiting
expression of a serum amyloid P component (APCS) gene, comprising a
sense strand and an antisense strand, wherein said sense strand
comprises at least 15 contiguous nucleotides differing by no more
than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1, and
said antisense strand comprises at least 15 contiguous nucleotides
differing by no more than 3 nucleotides from the nucleotide
sequence of SEQ ID NO:5.
2. A double stranded ribonucleic acid (RNAi) agent for inhibiting
expression of a serum amyloid P component (APCS) gene, comprising a
sense strand and an antisense strand, wherein the antisense strand
comprises a region of complementarity comprising at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
any one of the antisense sequences listed in any one of Tables 3A,
3B, 4A, 4B, 6, and 7.
3. A double stranded ribonucleic acid (RNAi) agent for inhibiting
expression of a serum amyloid P component (APCS) gene, comprising a
sense strand and an antisense strand, wherein said antisense strand
comprises a region complementary to part of an mRNA encoding SAP,
wherein each strand is about 14 to about 30 nucleotides in length,
wherein said sense strand is represented by formula (I): sense:
5'n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y -N.sub.b-(Z Z
Z).sub.j-N.sub.a-n.sub.q 3' (I) wherein: i and j are each
independently 0 or 1; p and q are each independently 0-6; N.sub.a
represents an oligonucleotide sequence comprising 0-25 nucleotides
which are either modified or unmodified or combinations thereof;
N.sub.b represents an oligonucleotide sequence comprising 0-10
nucleotides which are either modified or unmodified or combinations
thereof; each n.sub.p and n.sub.q, each of which may or may not be
present, independently represents an overhang nucleotide; XXX, YYY
and ZZZ each independently represent one motif of three identical
modifications on three consecutive nucleotides; modifications on
N.sub.b differ from the modification on Y; and wherein the sense
strand is conjugated to at least one ligand.
4.-10. (canceled)
11. The double stranded RNAi agent of claim 1, wherein the sense
and antisense strands comprise nucleotide sequences selected from
any of the nucleotide sequences in any one of Tables 3A, 3B, 4A,
4B, 6, and 7.
12. (canceled)
13. The double stranded RNAi agent of claim 1, wherein said RNAi
agent comprises at least one modified nucleotide.
14.-17. (canceled)
18. The double stranded RNAi agent of claim 13, further comprising
at least one phosphorothioate internucleotide linkage.
19. The double stranded RNAi agent of claim 1, wherein the region
of complementarity between said sense strand and said antisense
strand is at least 17 nucleotides in length; 19 to 30 nucleotides
in length; 21 nucleotides in length; 21 to 23 nucleotides in
length; or 19 nucleotides in length.
20.-23. (canceled)
24. The double stranded RNAi agent of claim 1, wherein each strand
is no more than 30 nucleotides in length; each strand is
independently 19-30 nucleotides in length; or each strand is
independently 19-25 nucleotides in length.
25. (canceled)
26. (canceled)
27. The double stranded RNAi agent of claim 24, wherein the sense
strand is 21 nucleotides in length and the antisense strand is 23
nucleotides in length.
28. The double stranded RNAi agent of claim 1, wherein at least one
strand comprises a 3' overhang of at least 1 nucleotide; or a 3'
overhang of at least 2 nucleotides.
29. (canceled)
30. The double stranded RNAi agent of claim 1, further comprising a
ligand.
31. (canceled)
32. The double stranded RNAi agent of claim 30, wherein the ligand
is an N-acetylgalactosamine (GalNAc) derivative.
33. The double stranded RNAi agent of claim 32, wherein the ligand
is ##STR00016##
34. The double stranded RNAi agent of claim 33, wherein the double
stranded RNAi agent is conjugated to the ligand as shown in the
following schematic ##STR00017## and wherein X is O or S.
35. The double stranded RNAi agent of claim 34, wherein the X is
O.
36. (canceled)
37. A cell containing the double stranded RNAi agent of claim
1.
38. (canceled)
39. A pharmaceutical composition for inhibiting expression of a
serum amyloid P component (APCS) gene comprising the double
stranded RNAi agent of claim 1.
40.-44. (canceled)
45. A method of inhibiting expression of a serum amyloid P
component (APCS) gene in a cell, the method comprising contacting
the cell with the double stranded RNAi agent of claim 1, thereby
inhibiting expression of the APCS gene in the cell.
46.-50. (canceled)
51. A method of treating a subject having a disease that would
benefit from reduction in serum amyloid P component (APCS) gene
expression, comprising administering to the subject a
therapeutically effective amount of the double stranded RNAi agent
of claim 1, thereby treating said subject.
52.-62. (canceled)
63. A method of inhibiting the expression of an APCS protein (SAP)
in a subject, the method comprising administering to said subject a
therapeutically effective amount of the double stranded RNAi agent
of claim 1, thereby inhibiting the expression of APCS in said
subject.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/877,586, filed May 19, 2020, which is a 35
.sctn. U.S.C. 111(a) continuation application which claims the
benefit of priority to PCT/US2018/061906, filed on Nov. 20, 2018,
which claims the benefit of priority to U.S. Provisional
Application No. 62/588,506, filed on Nov. 20, 2017. The entire
contents of each of the foregoing applications are incorporated
herein by reference.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Nov. 1, 2021, is named 121301_06504_SL.txt and is 276,286 bytes
in size.
BACKGROUND OF THE INVENTION
[0003] Serum amyloid P component (SAP), also referred to as as APCS
or pentraxin-2 (PTX-2), is a 25 kDa pentameric protein that is
identical to the amyloid P component (AP), but is located in the
serum. In humans, SAP is encoded by the APCS gene (amyloid P
component, serum). SAP is a glycoprotein that belongs to the
pentraxin family of proteins, members of which have a
characteristic pentameric organization.
[0004] Under normal conditions, SAP is thought to be synthesized
and secreted only in hepatocytes and has a half-life of
approximately 24 hours. In some diseases, SAP can also be generated
by macrophages and smooth muscle cells such as in the
atherosclerotic aortic intima.
[0005] SAP plays a role in protein aggregation and in regulating
immune response, as illustrated in FIG. 1. SAP is best known as a
constituent of in vivo pathological amyloid deposits. Amyloid
deposits are inherently stable structures consisting of fibrils
that are formed when normally soluble proteins assemble to form
insoluble fibers predominantly composed of .beta.-sheet structures
in a characteristic cross-.beta. conformation. The amyloid deposits
are deposited extracellularly in the tissues and are thought to
have a pathogenic effect.
[0006] SAP accounts for 14% of the dry mass of amyloid deposits. It
can be found in all types of amyloid deposits, in the glomerula
basement membranes and in elastic fibers in blood vessels, all of
which are characterized by the ordered aggregation of normal
globular proteins and peptides into insoluble fibers. SAP is
thought to contribute to amyloid deposit formation by decorating
and stabilizing protein aggregates, thereby preventing proteolytic
cleavage and inhibiting fibril removal via the normal protein
scavenging mechanisms (see Xi et al., Int. J. of Cardiol. 187,
20-26, 2015). SAP was also found to be present in atherosclerotic
lesions and plasma levels of SAP were found to be positively
associated with cardiovascular disease in the elderly. Further, it
was recently demonstrated that SAP deficiency mitigated
atherosclerotic lesions in a mouse model of atherosclerosis (Zheng
et al., Atherosclerosis 244, 179-187, 2016). Thus, SAP may
contribute to the pathogenesis of the diseases associated with
amyloid deposits, e.g., amyloidosis and Alzheimer's disease, and
cardiovascular diseases, e.g., atherosclerotic heart disease.
[0007] Amyloidosis is a rare, serious disease caused by
accumulation of amyloid deposits within the extracellular space in
the tissues of the body. The amyloid deposits disrupt the normal
tissue architecture, damaging the function of tissues and organs
and causing disease. In contrast to the normally efficient
clearance of abnormal debris from the tissues, amyloid deposits are
removed very slowly, if at all. There are many different types of
amyloidoses, each caused by formation of amyloid fibrils from
different soluble precursor proteins in different patients. About
30 different proteins are known to form amyloid fibrils in humans,
and amyloidosis is named and classified according to the identity
of the respective fibril protein. Amyloid deposits can be confined
to only one part of the body or a single organ system in "local
amyloidosis" or they can be widely distributed in organs and
tissues throughout the body in "systemic amyloidosis". The clinical
manifestations of amyloidosis are accordingly highly variable and
confirmation of the presence of amyloid in the tissues can be
challenging, so that diagnosis is often delayed. Broad
classification of amyloidosis includes primary (systemic AL)
amyloidosis, secondary (systemic AA) amyloidosis, dialysis-related
amyloidosis (DRA), familial (hereditary FA) amyloidosis, senile
systemic amyloidosis (SSA) and organ-specific amyloidosis. Primary
amyloidosis (AL) occurs without a known cause, but it has been seen
in people with a blood cancer called multiple myeloma. This is the
most common type of amyloidosis. "Systemic" means it affects the
entire body, and the most commonly affected body parts are the
kidney, heart, liver, intestines, and certain nerves. AL stands for
"amyloid light chains," which is the type of protein responsible
for this type of amyloidosis. Secondary amyloidosis (AA) is is the
result of another chronic inflammatory disease, such as lupus,
rheumatoid arthritis, tuberculosis, inflammatory bowel disease
(Crohn's disease and ulcerative colitis), and certain cancers. It
most commonly affects the spleen, kidneys, liver, adrenal gland,
and lymph nodes. AA means the amyloid type A protein causes this
type of amyloidosis. Dialysis-related amyloidosis (DRA) is more
common in older adults and people who have been on dialysis for
more than 5 years. This form of amyloidosis is caused by deposits
of beta-2 microglobulin that build up in the blood. Deposits can
occur in many different tissues, but most commonly affects bones,
joints, and tendons.
[0008] Familial, or hereditary, amyloidosis (AF) is a rare form
that is passed down through families. It is caused by an abnormal
amyloid transthyretin (TTR) protein, which is made in the liver.
This protein is responsible for the most common forms of hereditary
amyloidosis. Senile systemic amyloidosis (SSA) is caused deposits
of normal TTR in the heart and other tissues. It occurs most
commonly in older men. Organ-specific amyloidosis is caused by
deposits of amyloid protein in single organs, including the skin
(cutaneous amyloidosis).
[0009] Symptoms of amyloidosis may be varied and depend on the
organ most affected by the deposition of amyloid fibrils. For
example, symptoms of cardiac amyloidosis may include shortness of
breath, an irregular heartbeat, signs of heart failure; symptoms of
renal amyloidosis may include signs of renal failure and high
levels of urinary proteins; and symptoms of gastrointestinal
amyloidosis may include diarrhea, nausea, stomach pain, decreased
appetite and weight loss.
[0010] There is no cure for amyloidosis. Several treatments may be
used to slow the progression of the disease or to manage symptoms.
Some of the treatments used to manage the symptoms of amyloidosis
include chemotherapy, high-dose chemotherapy combined with stem
cell transplant; steroids, liver, heart and kidney transplants and
diuretics. It is therefore clear that new and effective treatment
for amyloid-related diseases, e.g., amyloidosis, are needed.
[0011] Accordingly, there is a need in the art for therapies for
subjects having a APCS-associated disease, e.g., amyloidosis,
Alzheimer's disease, or a cardiovascular disease, e.g.,
atherosclerotic heart disease.
SUMMARY OF THE INVENTION
[0012] The present invention provides iRNA compositions which
effect the RNA-induced silencing complex (RISC)-mediated cleavage
of RNA transcripts of an APCS gene. The APCS gene may be within a
cell, e.g., a cell within a subject, such as a human. The use of
these iRNA agents enables the selective targeted degradation of
mRNAs of the corresponding gene (the APCS gene) in mammals.
[0013] The present invention also provides methods and combination
therapies for treating a subject having a disease that would
benefit from inhibiting or reducing the expression of an APCS gene,
e.g., a APCS-associated disease. An APCS-associated disease may
include an amyloid-associated disease, e.g., amyloidosis, such as
primary (systemic AL) amyloidosis, secondary (systemic AA)
amyloidosis, dialysis-related amyloidosis (DRA), familial
(hereditary FA) amyloidosis, senile systemic amyloidosis (SSA) and
organ-specific amyloidosis; Alzheimer's disease; diabetes mellitus
type 2; Parkinson's disease; transmissible spongiform
encephalopathy (such as bovine spongiform encephalopathy); fatal
familial insomnia; Huntington's disease; medullary carcinoma of the
thyroid; cardiac arrhythmias; isolated atrial amyloidosis;
rheumatoid arthritis; aortic medial amyloid; prolactinoma; familial
amyloid polyneuropathy; lattice corneal dystrophy; cerebral amyloid
angiopathy; cerebral amyloid angiopathy (Icelandic type); sporadic
inclusion body myositis; or a cardiovascular disease, e.g.,
coronary atherosclerotic heart disease.
[0014] Accordingly, in some embodiments, the present invention
provides a double stranded ribonucleic acid (RNAi) agent for
inhibiting expression of a serum amyloid P component (APCS) gene,
comprising a sense strand and an antisense strand, wherein the
sense strand comprises at least 15 contiguous nucleotides differing
by no more than 3 nucleotides from the nucleotide sequence of SEQ
ID NO:1, and the antisense strand comprises at least 15 contiguous
nucleotides differing by no more than 3 nucleotides from the
nucleotide sequence of SEQ ID NO:5.
[0015] In some embodiments, the present invention also provides a
double stranded ribonucleic acid (RNAi) agent for inhibiting
expression of a serum amyloid P component (APCS) gene, comprising a
sense strand and an antisense strand, the antisense strand
comprising a region of complementarity which comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
any one of the antisense sequences listed in any one of Tables 3A,
3B, 4A, 4B, 6, and 7.
[0016] In some aspects, the present invention also provides a
double stranded ribonucleic acid (RNAi) agent for inhibiting
expression of a serum amyloid P component (APCS) gene, comprising a
sense strand and an antisense strand, wherein the antisense strand
comprises a region complementary to part of an mRNA encoding SAP,
wherein each strand is about 14 to about 30 nucleotides in length,
wherein the sense strand is represented by formula (I):
sense: 5'n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y-N.sub.b-(Z Z
Z).sub.j-N.sub.a-n.sub.q 3' (I)
[0017] wherein:
[0018] i and j are each independently 0 or 1;
[0019] p and q are each independently 0-6;
[0020] N.sub.a represents an oligonucleotide sequence comprising
0-25 nucleotides which are either modified or unmodified or
combinations thereof;
[0021] N.sub.b represents an oligonucleotide sequence comprising
0-10 nucleotides which are either modified or unmodified or
combinations thereof;
[0022] each n.sub.p and n.sub.q, each of which may or may not be
present, independently represents an overhang nucleotide;
[0023] XXX, YYY and ZZZ each independently represent one motif of
three identical modifications on three consecutive nucleotides;
[0024] modifications on N.sub.b differ from the modification on Y;
and
[0025] wherein the sense strand is conjugated to at least one
ligand.
[0026] In some embodiments, i is 0; j is 0; i is 1; j is 1; both i
and j are 0; or both i and j are 1.
[0027] In some aspects, the YYY motif occurs at or near the
cleavage site of the sense strand.
[0028] In a further embodiment, formula (I) is represented by
formula (Ia):
sense: 5'n.sub.p-N.sub.a-Y Y Y -N.sub.a-n.sub.q 3' (Ia).
[0029] In some aspects of the invention, the sense strand comprises
at least 15 contiguous nucleotides differing by no more than 3
nucleotides from the nucleotide sequence of nucleotides 61-83,
94-116, 163-185, 173-195, 194-216, 194-216, 197-219, 199-221,
204-226, 205-227, 237-259, 246-268, 258-280, 271-293, 309-331,
315-337, 316-338, 325-347, 326-348, 327-349, 328-350, 329-351,
330-352, 331-353, 332-354, 336-358, 338-360, 343-365, 353-375,
360-382, 364-386, 365-387, 371-393, 375-397, 380-402, 384-406,
387-409, 391-413, 395-417, 395-417, 396-418, 400-422, 403-425,
451-473, 455-477, 459-481, 527-549, 533-555, 536-558, 564-586,
651-673, 652-674, 653-675, 707-729, 708-730, 709-731, 710-732,
729-751, 734-756, 739-761, 778-800, 780-802, 784-806, 785-807,
793-815, 794-816, 796-818, 797-819, 798-820, 827-849, 852-874,
856-878, 858-880, 865-887, 866-888, 868-890, 870-892, 878-900,
881-903, 882-904, 883-905, 885-907, 911-933, 916-938 of SEQ ID NO:
1.
[0030] In some embodiments, the antisense strand comprises at least
15 contiguous nucleotides differing by no more than 3 nucleotides
from the antisense nucleotide sequence of a duplex selected from
the group consisting of AD-75708, AD-75723, AD-75694, AD-75692,
AD-75664, AD-75664.2, AD-75679, AD-75659, AD-75662, AD-75680,
AD-75687, AD-75657, AD-75699, AD-75727, AD-75731, AD-75728,
AD-75737, AD-75696, AD-75718, AD-75676, AD-75663, AD-75669,
AD-75666, AD-75735, AD-75686, AD-75736, AD-75674, AD-75717,
AD-75706, AD-75719, AD-75688, AD-75734, AD-75724, AD-75711,
AD-75703, AD-75721, AD-75712, AD-75697, AD-75726, AD-75730,
AD-75732, AD-75733, AD-75729, AD-75685, AD-75673, AD-75691,
AD-75670, AD-75739, AD-75738, AD-75722, AD-75714, AD-75681,
AD-75668, AD-75693, AD-75677, AD-75690, AD-75716, AD-75682,
AD-75720, AD-75725, AD-75695, AD-75665, AD-75661, AD-75658,
AD-75700, AD-75698, AD-75672, AD-75684, AD-75667, AD-75678,
AD-75660, AD-75701, AD-75707, AD-75675, AD-75671, AD-75683,
AD-75689, AD-75715, AD-75705, AD-75704, AD-75713, AD-75702,
AD-75709, AD-75710 as listed in Tables 3A, 3B, 4A and 4B.
[0031] In some embodiments, the sense strand comprises at least 15
contiguous nucleotides differing by no more than 3 nucleotides from
the nucleotide sequence of nucleotides 53-71; 68-86; 82-100;
90-108; 104-122; 118-136; 132-150; 148-166; 162-180; 170-188;
185-203; 200-218; 214-232; 228-246; 242-260; 248-266; 277-295;
283-301; 294-312; 309-327; 323-341; 352-370; 366-384; 377-395;
385-403; 461-479; 476-494; 491-509; 505-523; 750-768; 758-776;
773-791; 787-805; 854-872; 869-887; or 878-896 of SEQ ID NO: 1.
[0032] In other embodiments, the antisense strand comprises at
least 15 contiguous nucleotides differing by no more than 3
nucleotides from the antisense nucleotide sequence of a duplex
selected from the group consisting of AD-77752; AD-77753; AD-77754;
AD-77755; AD-77756; AD-77757; AD-77758; AD-77759; AD-77760;
AD-77761; AD-77762; AD-77763; AD-77764; AD-77765; AD-77766;
AD-77767; AD-77769; AD-77770; AD-77771; AD-77772; AD-77773;
AD-77775; AD-77776; AD-77777; AD-77778; AD-77783; AD-77784;
AD-77785; AD-77786; AD-77804; AD-77805; AD-77806; AD-77807;
AD-77812; AD-77813; and AD-77814 as listed in Tables 6 and 7.
[0033] In some embodiments, the sense and antisense strands
comprise nucleotide sequences selected from any of the nucleotide
sequences in any one of Tables 3A, 3B, 4A, 4B, 6, and 7.
[0034] In some embodiments, the sense and antisense strands consist
of nucleotide sequences selected from any of the nucleotide
sequences in any one of Tables 3A, 3B, 4A, 4B, 6, and 7.
[0035] In some embodiments, the double stranded RNAi agent
comprises at least one modified nucleotide. In some aspects,
substantially all of the nucleotides of the sense strand are
modified nucleotides; substantially all of the nucleotides of the
antisense strand are modified nucleotides; or substantially all of
the nucleotides of the sense strand and substantially all of the
nucleotides of the antisense strand are modified nucleotides. In a
further aspect, all of the nucleotides of the sense strand are
modified nucleotides; all of the nucleotides of the antisense
strand are modified nucleotides; or all of the nucleotides of the
sense strand and all of the nucleotides of the antisense strand are
modified nucleotides.
[0036] In some embodiments, at least one of said modified
nucleotides is selected from the group consisting of a
deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a
2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a
2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked
nucleotide, a conformationally restricted nucleotide, a constrained
ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified
nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified
nucleotide, 2'-hydroxyl-modified nucleotide, a 2'-methoxyethyl
modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino
nucleotide, a 5'-vinyl phosphate, a phosphoramidate, a non-natural
base comprising nucleotide, a tetrahydropyran modified nucleotide,
a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified
nucleotide, a nucleotide comprising a phosphorothioate group, a
nucleotide comprising a methylphosphonate group, a nucleotide
comprising a 5'-phosphate, and a nucleotide comprising a
5'-phosphate mimic. For example, at least one of the modified
nucleotides is selected from the group consisting of a 2'-O-methyl
modification, a 2'fluoro modification, a 5'-vinyl phosphate, and a
3'-terminal deoxy-thymine (dT) nucleotide.
[0037] In one aspect, the double stranded RNAi agent of the
invention comprises at least one phosphorothioate internucleotide
linkage.
[0038] In some embodiments, the region of complementarity between
the sense strand and the antisense strand is at least 17
nucleotides in length, e.g., 19 to 30 nucleotides in length; 21
nucleotides in length; 21 to 23 nucleotides in length; 19
nucleotides in length, or no more than 30 nucleotides in
length.
[0039] In some aspects, each strand is independently 19-30
nucleotides in length, e.g., 19-25 nucleotides in length.
[0040] In one embodiment, the sense strand has a total of 21
nucleotides and the antisense strand has a total of 23
nucleotides.
[0041] In some aspects, the at least one strand comprises a 3'
overhang of at least 1 nucleotide or at least 2 nucleotides.
[0042] In some embodiments, the double stranded RNAi agent of the
invention further comprises a ligand. In a further embodiment, the
ligand is conjugated to the 3' end of the sense strand of the
double stranded RNAi agent. In one embodiment, the ligand is an
N-acetylgalactosamine (GalNAc) derivative, e.g., the ligand is
##STR00001##
[0043] In an embodiment, the double stranded RNAi agent of the
invention is conjugated to the ligand as shown in the following
schematic
##STR00002##
[0044] and wherein X is O or S. In one embodiment, the X is O.
[0045] In some aspects, the double stranded RNAi agent is selected
from the group consisting of of any one of the agents listed in any
one of Tables 3A, 3B, 4A, 4B, 6, and 7.
[0046] In some aspects, the present invention also provides a cell
containing the double stranded RNAi agent of the invention and a
vector encoding at least one strand of the double stranded RNAi
agent of the invention.
[0047] In other aspects, the present invention also provides a
pharmaceutical composition for inhibiting expression of a serum
amyloid P component (APCS) gene comprising the double stranded RNAi
agent of the invention. In some embodiments, the RNAi agent is in
an unbuffered solution, e.g., in saline or water. In other
embodiments, the RNAi agent is with a buffer solution, e.g., a
buffer solution comprising acetate, citrate, prolamine, carbonate,
or phosphate or any combination thereof. In a specific embodiment,
the buffer solution is phosphate buffered saline (PBS).
[0048] In some embodiments, the present invention also provides a
method of inhibiting expression of a serum amyloid P component
(APCS) gene in a cell. The method includes contacting the cell with
an RNAi agent of the invention or a pharmaceutical composition of
the invention, thereby inhibiting expression of the SAP gene in the
cell. In one aspect, the cell is within a subject. In one aspect,
the subject is a human.
[0049] In some embodiments, the APCS expression is inhibited by at
least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or to below the level
of detection of APCS expression.
[0050] In one embodiments, the human suffers from an
APCS-associated disease, e.g., a disease selected from the group
consisting of amyloidosis, Alzheimer's disease, diabetes mellitus
type 2, Parkinson's disease, transmissible spongiform
encephalopathy, fatal familial insomnia, Huntington's disease,
medullary carcinoma of the thyroid, cardiac arrhythmias, isolated
atrial amyloidosis, rheumatoid arthritis, aortic medial amyloid,
prolactinoma, familial amyloid polyneuropathy, lattice corneal
dystrophy, cerebral amyloid angiopathy, cerebral amyloid angiopathy
(Icelandic type), sporadic inclusion body myositis, and a
cardiovascular disease.
[0051] In one aspect, the present invention provides a method of
treating a subject having a disease that would benefit from
reduction in serum amyloid P component (APCS) gene expression. The
method includes administering to the subject a therapeutically
effective amount of the double stranded RNAi agent of the
invention, or a pharmaceutical composition of the invention,
thereby treating the subject.
[0052] In another aspect, the present invention also provides a
method of preventing at least one symptom in a subject having a
disease that would benefit from reduction in serum amyloid P
component (APCS) gene expression. The method includes administering
to the subject a therapeutically effective amount of the double
stranded RNAi agent of the invention, or a pharmaceutical
composition of the invention, thereby preventing at least one
symptom in the subject having a disease that would benefit from
reduction in APCS expression.
[0053] In some embodiments, the disease is a APCS-associated
disease, e.g., a disease selected from the group consisting of
amyloidosis, Alzheimer's disease, diabetes mellitus type 2,
Parkinson's disease, transmissible spongiform encephalopathy, fatal
familial insomnia Huntington's disease, medullary carcinoma of the
thyroid, cardiac arrhythmias, isolated atrial amyloidosis,
rheumatoid arthritis, aortic medial amyloid, prolactinoma, familial
amyloid polyneuropathy, lattice corneal dystrophy, cerebral amyloid
angiopathy, cerebral amyloid angiopathy (Icelandic type), sporadic
inclusion body myositis and a cardiovascular disease.
[0054] In one embodiment, the subject is a human.
[0055] In some embodiments, the administration of the RNAi agent to
the subject causes a decrease in plasma levels of SAP protein. In
other embodiments, the administration of the RNAi agent to the
subject causes a decrease in amyloid load in the subject.
[0056] In some aspects, the RNAi agent is administered to the
subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about
0.5 mg/kg to about 50 mg/kg. In other aspects, the RNAi agent is
administered to the subject subcutaneously or intravenously.
[0057] In some embodiments, the methods of the invention further
comprise administering CPHPC and/or an anti-SAP antibody, or
antigen-binding fragment there, to the subject.
[0058] In one aspect, the present invention also provides a method
of inhibiting the expression of an APCS protein (SAP) in a subject.
The method includes administering to the subject a therapeutically
effective amount of the double stranded RNAi agent of the invention
or a pharmaceutical composition of the invention, thereby
inhibiting the expression of APCS in the subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0059] FIG. 1 is a schematic overview of the major functions of
serum amyloid P component (SAP).
DETAILED DESCRIPTION OF THE INVENTION
[0060] The present invention provides iRNA compositions, which
selectively effect the RNA-induced silencing complex
(RISC)-mediated cleavage of RNA transcripts of an APCS gene. The
gene may be within a cell, e.g., a cell within a subject, such as a
human. The use of these iRNAs enables the selective targeted
degradation of mRNAs of the APCS gene in mammals.
[0061] The RNAi agents of the invention have been designed to
potently and selectively target the corresponding human APCS gene.
Without intending to be limited by theory, it is believed that a
combination or sub-combination of the foregoing properties and the
specific target sites and/or the specific modifications in these
RNAi agents confer to the RNAi agents of the invention improved
efficacy, stability, potency, durability, and safety.
[0062] The iRNAs of the invention may include an RNA strand (the
antisense strand) having a region which is about 30 nucleotides or
less in length, e.g., 15-30, 15-29, 15-28, 15-27, 15-26, 15-25,
15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30,
18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21,
18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23,
19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,
20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or 21-22 nucleotides in length, which region
is substantially complementary to at least part of an mRNA
transcript of a human APCS gene.
[0063] In certain embodiments, the iRNAs of the invention include
an RNA strand (the antisense strand) which can include longer
lengths, for example up to 66 nucleotides, e.g., 36-66, 26-36,
25-36, 31-60, 22-43, 27-53 nucleotides in length with a region of
at least 19 contiguous nucleotides that is substantially
complementary to at least a part of an mRNA transcript of a APCS
gene. These iRNAs with the longer length antisense strands
preferably include a second RNA strand (the sense strand) of 20-60
nucleotides in length wherein the sense and antisense strands form
a duplex of 18-30 contiguous nucleotides.
[0064] It is believed that iRNAs targeting an APCS gene can
potently mediate RNAi, resulting in significant inhibition of
expression of an APCS gene. Thus, methods and compositions
including these iRNAs are useful for treating a subject having a
APCS-associated disease or disorder, e.g., amyloidosis, Alzheimer's
disease or coronary atherosclerotic heart disease.
[0065] Accordingly, the present invention provides methods and
combination therapies for treating a subject having a disorder that
would benefit from inhibiting or reducing the expression of a APCS
gene, e.g., a APCS-associated disease, such as amyloidosis,
Alzheimer's disease or coronary atherosclerotic heart disease,
using iRNA compositions which effect the RNA-induced silencing
complex (RISC)-mediated cleavage of RNA transcripts of a APCS
gene.
[0066] The present invention also provides methods for ameliorating
and/or preventing at least one symptom e.g., a symptom associated
with formation and/or deposition of amyloid deposits or
atherosclerotic lesions, in a subject having a disorder that would
benefit from inhibiting or reducing the expression of an APCS gene,
e.g., a APCS-associated disease, such as amyloidosis, Alzheimer's
disease or coronary atherosclerotic heart disease.
[0067] The following detailed description discloses how to make and
use compositions containing iRNAs to inhibit the expression of an
APCS gene, as well as compositions, uses, and methods for treating
subjects having diseases and disorders that would benefit from
inhibition and/or reduction of the expression of an APCS gene.
I. Definitions
[0068] In order that the present invention may be more readily
understood, certain terms are first defined. In addition, it should
be noted that whenever a value or range of values of a parameter
are recited, it is intended that values and ranges intermediate to
the recited values are also intended to be part of this
invention.
[0069] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element, e.g., a plurality of elements.
[0070] The term "including" is used herein to mean, and is used
interchangeably with, the phrase "including but not limited
to".
[0071] The term "or" is used herein to mean, and is used
interchangeably with, the term "and/or," unless context clearly
indicates otherwise.
[0072] The term "about" is used herein to mean within the typical
ranges of tolerances in the art. For example, "about" can be
understood as within about 2 standard deviations from the mean. In
certain embodiments, about means.+-.10%, .+-.9%, .+-.8%, .+-.7%,
.+-.6%, .+-.5%, .+-.4%, .+-.3%, .+-.2% or .+-.1%. When "about" is
present before a series of numbers or a range, it is understood
that "about" can modify each of the numbers in the series or
range.
[0073] The term "at least" prior to a number or series of numbers
is understood to include the number adjacent to the term "at
least", and all subsequent numbers or integers that could logically
be included, as clear from context. For example, the number of
nucleotides in a nucleic acid molecule must be an integer. For
example, "at least 18 nucleotides of a 21 nucleotide nucleic acid
molecule" means that 18, 19, 20, or 21 nucleotides have the
indicated property. When at least is present before a series of
numbers or a range, it is understood that "at least" can modify
each of the numbers in the series or range.
[0074] As used herein, "no more than" or "less than" is understood
as the value adjacent to the phrase and logical lower values or
integers, as logical from context, to zero. For example, a duplex
with an overhang of "no more than 2 nucleotides" has a 2, 1, or 0
nucleotide overhang. When "no more than" is present before a series
of numbers or a range, it is understood that "no more than" can
modify each of the numbers in the series or range. As used herein,
ranges include both the upper and lower limit.
[0075] As used herein, the term "Homo sapiens amyloid P component,
serum", used interchangeably with the term "APCS," refers to the
well-known gene and polypeptide, also known in the art as SAP. The
term "APCS" includes human APCS, the amino acid and nucleotide
sequence of which may be found in, for example, GenBank Accession
No. NM_001639 (GI:206597534) (SEQ ID NO: 1); cynomolgus monkey
APCS, the amino acid and nucleotide sequence of which may be found
in, for example, GenBank Accession No. XM_005541312 (GI:982224943)
(SEQ ID NO: 2); mouse APCS, the amino acid and nucleotide sequence
of which may be found in, for example, GenBank Accession No.
NM_011318 (GI:226958496) (SEQ ID NO: 3); and rat APCS, the amino
acid and nucleotide sequence of which may be found in, for example,
GenBank Accession No. NM_017170 (GI:148747487) (SEQ ID NO: 4).
[0076] The term"APCS," as used herein, also refers to naturally
occurring DNA sequence variations of the APCS gene. Numerous
sequence variations within the APCS gene have been identified and
may be found at, for example, NCBI dbSNP and UniProt (see, e.g.,
http://www.ncbi.nlm.nih.gov/gene/325, the entire contents of which
is incorporated herein by reference as of the date of filing this
application.
[0077] As used herein, "target sequence" refers to a contiguous
portion of the nucleotide sequence of an mRNA molecule formed
during the transcription of a APCS gene, including mRNA that is a
product of RNA processing of a primary transcription product. In
one embodiment, the target portion of the sequence will be at least
long enough to serve as a substrate for iRNA-directed cleavage at
or near that portion of the nucleotide sequence of an mRNA molecule
formed during the transcription of an APCS gene. In one embodiment,
the target sequence is within the protein coding region of an APCS
gene. In another embodiment, the target sequence is within the 3'
UTR of an APCS gene.
[0078] The target sequence may be from about 9-36 nucleotides in
length, e.g., about 15-30 nucleotides in length. For example, the
target sequence can be from about 15-30 nucleotides, 15-29, 15-28,
15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19,
15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24,
18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26,
19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28,
20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29,
21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in
length. In some embodiments, the target sequence is about 19 to
about 30 nucleotides in length. In other embodiments, the target
sequence is about 19 to about 25 nucleotides in length. In still
other embodiments, the target sequence is about 19 to about 23
nucleotides in length. In some embodiments, the target sequence is
about 21 to about 23 nucleotides in length. Ranges and lengths
intermediate to the above recited ranges and lengths are also
contemplated to be part of the invention.
[0079] As used herein, the term "strand comprising a sequence"
refers to an oligonucleotide comprising a chain of nucleotides that
is described by the sequence referred to using the standard
nucleotide nomenclature.
[0080] A "nucleoside" is a base-sugar combination. The "nucleobase"
(also known as "base") portion of the nucleoside is normally a
heterocyclic base moiety. "Nucleotides" are nucleosides that
further include a phosphate group covalently linked to the sugar
portion of the nucleoside. For those nucleosides that include a
pentofuranosyl sugar, the phosphate group can be linked to the 2',
3' or 5' hydroxyl moiety of the sugar.
[0081] "G," "C," "A," "T" and "U" each generally stand for a
nucleotide that contains guanine, cytosine, adenine, thymidine and
uracil as a base, respectively. However, it will be understood that
the term "ribonucleotide" or "nucleotide" can also refer to a
modified nucleotide, as further detailed below, or a surrogate
replacement moiety (see, e.g., Table 2). The skilled person is well
aware that guanine, cytosine, adenine, and uracil can be replaced
by other moieties without substantially altering the base pairing
properties of an oligonucleotide comprising a nucleotide bearing
such replacement moiety. For example, without limitation, a
nucleotide comprising inosine as its base can base pair with
nucleotides containing adenine, cytosine, or uracil. Hence,
nucleotides containing uracil, guanine, or adenine can be replaced
in the nucleotide sequences of dsRNA featured in the invention by a
nucleotide containing, for example, inosine. In another example,
adenine and cytosine anywhere in the oligonucleotide can be
replaced with guanine and uracil, respectively to form G-U Wobble
base pairing with the target mRNA. Sequences containing such
replacement moieties are suitable for the compositions and methods
featured in the invention.
[0082] "Polynucleotides," also referred to as "oligonucleotides,"
are formed through the covalent linkage of adjacent nucleosides to
one another, to form a linear polymeric oligonucleotide. Within the
polynucleotide structure, the phosphate groups are commonly
referred to as forming the internucleoside linkages of the
polynucleotide.
[0083] The terms "iRNA," "RNAi agent," "iRNA agent," "RNA
interference agent" as used interchangeably herein, refer to an
agent that contains RNA as that term is defined herein, and which
mediates the targeted cleavage of an RNA transcript via an
RNA-induced silencing complex (RISC) pathway. iRNA directs the
sequence-specific degradation of mRNA through a process known as
RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the
expression of an APCS gene in a cell, e.g., a cell within a
subject, such as a mammalian subject.
[0084] In one embodiment, an RNAi agent of the invention includes a
single stranded RNAi that interacts with a target RNA sequence,
e.g., an APCS target mRNA sequence, to direct the cleavage of the
target RNA. Without wishing to be bound by theory it is believed
that long double stranded RNA introduced into cells is broken down
into double stranded short interfering RNAs (siRNAs) comprising a
sense strand and an antisense strand by a Type III endonuclease
known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a
ribonuclease-III-like enzyme, processes these dsRNA into 19-23 base
pair short interfering RNAs with characteristic two base 3'
overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs
are then incorporated into an RNA-induced silencing complex (RISC)
where one or more helicases unwind the siRNA duplex, enabling the
complementary antisense strand to guide target recognition
(Nykanen, et al., (2001) Cell 107:309). Upon binding to the
appropriate target mRNA, one or more endonucleases within the RISC
cleave the target to induce silencing (Elbashir, et al., (2001)
Genes Dev. 15:188). Thus, in one aspect the invention relates to a
single stranded RNA (ssRNA) (the antisense strand of an siRNA
duplex) generated within a cell and which promotes the formation of
a RISC complex to effect silencing of the target gene, i.e., an
APCS gene. Accordingly, the term "siRNA" is also used herein to
refer to an RNAi as described above.
[0085] In another embodiment, the RNAi agent may be a
single-stranded RNA that is introduced into a cell or organism to
inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC
endonuclease, Argonaute 2, which then cleaves the target mRNA. The
single-stranded siRNAs are generally 15-30 nucleotides and are
chemically modified. The design and testing of single-stranded RNAs
are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012)
Cell 150: 883-894, the entire contents of each of which are hereby
incorporated herein by reference. Any of the antisense nucleotide
sequences described herein may be used as a single-stranded siRNA
as described herein or as chemically modified by the methods
described in Lima et al., (2012) Cell 150: 883-894.
[0086] In another embodiment, an "iRNA" for use in the
compositions, uses, and methods of the invention is a double
stranded RNA and is referred to herein as a "double stranded RNAi
agent," "double stranded RNA (dsRNA) molecule," "dsRNA agent," or
"dsRNA". The term "dsRNA" refers to a complex of ribonucleic acid
molecules, having a duplex structure comprising two anti-parallel
and substantially complementary nucleic acid strands, referred to
as having "sense" and "antisense" orientations with respect to a
target RNA, i.e., an APCS gene. In some embodiments of the
invention, a double stranded RNA (dsRNA) triggers the degradation
of a target RNA, e.g., an mRNA, through a post-transcriptional
gene-silencing mechanism referred to herein as RNA interference or
RNAi.
[0087] In general, the majority of nucleotides of each strand of a
dsRNA molecule are ribonucleotides, but as described in detail
herein, each or both strands can also include one or more
non-ribonucleotides, e.g., a deoxyribonucleotide and/or a modified
nucleotide. In addition, as used in this specification, an "RNAi
agent" may include ribonucleotides with chemical modifications.
Such modifications may include all types of modifications disclosed
herein or known in the art. Ant such modification, as used in an
RNAi agent are encompassed by iRNA for the purposes of the
specification and claims. In some embodiments, an RNAi agent
includes substantial modifications at multiple nucleotides.
[0088] As used herein, the term "modified nucleotide" refers to a
nucleotide having, independently, a modified sugar moiety, a
modified internucleotide linkage, and/or a modified nucleobase.
Thus, the term modified nucleotide encompasses substitutions,
additions or removal of, e.g., a functional group or atom, to
internucleoside linkages, sugar moieties, or nucleobases. The
modifications suitable for use in the agents of the invention
include all types of modifications disclosed herein or known in the
art. Any such modifications, as used in a siRNA type molecule, are
encompassed by "RNAi agent" for the purposes of this specification
and claims.
[0089] The duplex region may be of any length that permits specific
degradation of a desired target RNA through a RISC pathway, and may
range from about 9 to 36 base pairs in length, e.g., about 15-30
base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29,
15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20,
15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25,
18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27,
19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29,
20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30,
21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base
pairs in length. Ranges and lengths intermediate to the above
recited ranges and lengths are also contemplated to be part of the
invention.
[0090] The two strands forming the duplex structure may be
different portions of one larger RNA molecule, or they may be
separate RNA molecules. Where the two strands are part of one
larger molecule, and therefore are connected by an uninterrupted
chain of nucleotides between the 3'-end of one strand and the
5'-end of the respective other strand forming the duplex structure,
the connecting RNA chain is referred to as a "hairpin loop." A
hairpin loop can comprise at least one unpaired nucleotide. In some
embodiments, the hairpin loop can comprise at least 2, at least 3,
at least 4, at least 5, at least 6, at least 7, at least 8, at
least 9, at least 10, at least 20, at least 23 or more unpaired
nucleotides. In some embodiments, the hairpin loop can be 10 or
fewer nucleotides. In some embodiments, the hairpin loop can be 8
or fewer unpaired nucleotides. In some embodiments, the hairpin
loop can be 4-10 unpaired nucleotides. In some embodiments, the
hairpin loop can be 4-8 nucleotides.
[0091] Where the two substantially complementary strands of a dsRNA
are comprised of separate RNA molecules, those molecules need not,
but can be covalently connected. Where the two strands are
connected covalently by means other than an uninterrupted chain of
nucleotides between the 3'-end of one strand and the 5'-end of the
respective other strand forming the duplex structure, the
connecting structure is referred to as a "linker." The RNA strands
may have the same or a different number of nucleotides. The maximum
number of base pairs is the number of nucleotides in the shortest
strand of the dsRNA minus any overhangs that are present in the
duplex. In addition to the duplex structure, an RNAi may comprise
one or more nucleotide overhangs. In one embodiment of the RNAi
agent, at least one strand comprises a 3' overhang of at least 1
nucleotide. In another embodiment, at least one strand comprises a
3' overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9,
10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at
least one strand of the RNAi agent comprises a 5' overhang of at
least 1 nucleotide. In certain embodiments, at least one strand
comprises a 5' overhang of at least 2 nucleotides, e.g., 2, 3, 4,
5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other
embodiments, both the 3' and the 5' end of one strand of the RNAi
agent comprise an overhang of at least 1 nucleotide.
[0092] In one embodiment, an RNAi agent of the invention is a dsRNA
agent, each strand of which comprises 19-23 nucleotides that
interacts with a target RNA sequence, i.e., an APCS target mRNA
sequence, to direct the cleavage of the target RNA. Without wishing
to be bound by theory, long double stranded RNA introduced into
cells is broken down into siRNA by a Type III endonuclease known as
Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a
ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base
pair short interfering RNAs with characteristic two base 3'
overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs
are then incorporated into an RNA-induced silencing complex (RISC)
where one or more helicases unwind the siRNA duplex, enabling the
complementary antisense strand to guide target recognition
(Nykanen, et al., (2001) Cell 107:309). Upon binding to the
appropriate target mRNA, one or more endonucleases within the RISC
cleave the target to induce silencing (Elbashir, et al., (2001)
Genes Dev. 15:188). In one embodiment, an RNAi agent of the
invention is a dsRNA of 24-30 nucleotides that interacts with a
target RNA sequence, i.e., an APCS target mRNA sequence, to direct
the cleavage of the target RNA.
[0093] As used herein, the term "nucleotide overhang" refers to at
least one unpaired nucleotide that protrudes from the duplex
structure of an iRNA, e.g., a double-stranded RNA (dsRNA). For
example, when a 3'-end of one strand of a dsRNA extends beyond the
5'-end of the other strand, or vice versa, there is a nucleotide
overhang. A dsRNA can comprise an overhang of at least one
nucleotide; alternatively the overhang can comprise at least two
nucleotides, at least three nucleotides, at least four nucleotides,
at least five nucleotides or more. A nucleotide overhang can
comprise or consist of a nucleotide/nucleoside analog, including a
deoxynucleotide/nucleoside. The overhang(s) can be on the sense
strand, the antisense strand or any combination thereof.
Furthermore, the nucleotide(s) of an overhang can be present on the
5'-end, 3'-end or both ends of either an antisense or sense strand
of a dsRNA. In one embodiment of the dsRNA, at least one strand
comprises a 3' overhang of at least 1 nucleotide. In another
embodiment, at least one strand comprises a 3' overhang of at least
2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15
nucleotides. In other embodiments, at least one strand of the RNAi
agent comprises a 5' overhang of at least 1 nucleotide. In certain
embodiments, at least one strand comprises a 5' overhang of at
least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14,
or 15 nucleotides. In still other embodiments, both the 3' and the
5' end of one strand of the RNAi agent comprise an overhang of at
least 1 nucleotide.
[0094] In certain embodiments, the antisense strand of a dsRNA has
a 1-10 nucleotide, e.g., 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, e.g., a 1,
2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3'-end
and/or the 5'-end. In one embodiment, the sense strand of a dsRNA
has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10
nucleotide, overhang at the 3'-end and/or the 5'-end. In another
embodiment, one or more of the nucleotides in the overhang is
replaced with a nucleoside thiophosphate.
[0095] In certain embodiments, the overhang on the sense strand or
the antisense strand, or both, can include extended lengths longer
than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides,
10-30 nucleotides, or 10-15 nucleotides in length. In certain
embodiments, an extended overhang is on the sense strand of the
duplex. In certain embodiments, an extended overhang is present on
the 3'end of the sense strand of the duplex. In certain
embodiments, an extended overhang is present on the 5'end of the
sense strand of the duplex. In certain embodiments, an extended
overhang is on the antisense strand of the duplex. In certain
embodiments, an extended overhang is present on the 3'end of the
antisense strand of the duplex. In certain embodiments, an extended
overhang is present on the 5'end of the antisense strand of the
duplex. In certain embodiments, one or more of the nucleotides in
the overhang is replaced with a nucleoside thiophosphate. In
certain embodiments, the overhang includes a self-complementary
portion such that the overhang is capable of forming a hairpin
structure that is stable under physiological conditions.
[0096] "Blunt" or "blunt end" means that there are no unpaired
nucleotides at that end of the double stranded RNAi agent, i.e., no
nucleotide overhang. A "blunt ended" RNAi agent is a dsRNA that is
double stranded over its entire length, i.e., no nucleotide
overhang at either end of the molecule. The RNAi agents of the
invention include RNAi agents with nucleotide overhangs at one end
(i.e., agents with one overhang and one blunt end) or with
nucleotide overhangs at both ends.
[0097] The term "antisense strand" or "guide strand" refers to the
strand of an iRNA, e.g., a dsRNA, which includes a region that is
substantially complementary to a target sequence, e.g., an APCS
mRNA. As used herein, the term "region of complementarity" refers
to the region on the antisense strand that is substantially
complementary to a sequence, for example a target sequence, e.g.,
an APCS nucleotide sequence, as defined herein. Where the region of
complementarity is not fully complementary to the target sequence,
the mismatches can be in the internal or terminal regions of the
molecule. Generally, the most tolerated mismatches are in the
terminal regions, e.g., within 5, 4, 3, 2, or 1 nucleotides of the
5'- and/or 3'-terminus of the iRNA. In one embodiment, a double
stranded RNAi agent of the invention includes a nucleotide mismatch
in the antisense strand. In another embodiment, a double stranded
RNAi agent of the invention includes a nucleotide mismatch in the
sense strand. In one embodiment, the nucleotide mismatch is, for
example, within 5, 4, 3, 2, or 1 nucleotides from the 3'-terminus
of the iRNA. In another embodiment, the nucleotide mismatch is, for
example, in the 3'-terminal nucleotide of the iRNA.
[0098] The term "sense strand" or "passenger strand" as used
herein, refers to the strand of an iRNA that includes a region that
is substantially complementary to a region of the antisense strand
as that term is defined herein.
[0099] As used herein, the term "cleavage region" refers to a
region that is located immediately adjacent to the cleavage site.
The cleavage site is the site on the target at which cleavage
occurs. In some embodiments, the cleavage region comprises three
bases on either end of, and immediately adjacent to, the cleavage
site. In some embodiments, the cleavage region comprises two bases
on either end of, and immediately adjacent to, the cleavage site.
In some embodiments, the cleavage site specifically occurs at the
site bound by nucleotides 10 and 11 of the antisense strand, and
the cleavage region comprises nucleotides 11, 12 and 13.
[0100] As used herein, and unless otherwise indicated, the term
"complementary," when used to describe a first nucleotide sequence
in relation to a second nucleotide sequence, refers to the ability
of an oligonucleotide or polynucleotide comprising the first
nucleotide sequence to hybridize and form a duplex structure under
certain conditions with an oligonucleotide or polynucleotide
comprising the second nucleotide sequence, as will be understood by
the skilled person. Such conditions can, for example, be stringent
conditions, where stringent conditions can include: 400 mM NaCl, 40
mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. for
12-16 hours followed by washing (see, e.g., "Molecular Cloning: A
Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor
Laboratory Press). Other conditions, such as physiologically
relevant conditions as can be encountered inside an organism, can
apply. The skilled person will be able to determine the set of
conditions most appropriate for a test of complementarity of two
sequences in accordance with the ultimate application of the
hybridized nucleotides.
[0101] Complementary sequences within an iRNA, e.g., within a dsRNA
as described herein, include base-pairing of the oligonucleotide or
polynucleotide comprising a first nucleotide sequence to an
oligonucleotide or polynucleotide comprising a second nucleotide
sequence over the entire length of one or both nucleotide
sequences. Such sequences can be referred to as "fully
complementary" with respect to each other herein. However, where a
first sequence is referred to as "substantially complementary" with
respect to a second sequence herein, the two sequences can be fully
complementary, or they can form one or more, but generally not more
than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a
duplex up to 30 base pairs, while retaining the ability to
hybridize under the conditions most relevant to their ultimate
application, e.g., inhibition of gene expression via a RISC
pathway. However, where two oligonucleotides are designed to form,
upon hybridization, one or more single stranded overhangs, such
overhangs shall not be regarded as mismatches with regard to the
determination of complementarity. For example, a dsRNA comprising
one oligonucleotide 21 nucleotides in length and another
oligonucleotide 23 nucleotides in length, wherein the longer
oligonucleotide comprises a sequence of 21 nucleotides that is
fully complementary to the shorter oligonucleotide, can yet be
referred to as "fully complementary" for the purposes described
herein.
[0102] "Complementary" sequences, as used herein, can also include,
or be formed entirely from, non-Watson-Crick base pairs and/or base
pairs formed from non-natural and modified nucleotides, in so far
as the above requirements with respect to their ability to
hybridize are fulfilled. Such non-Watson-Crick base pairs include,
but are not limited to, G:U Wobble or Hoogstein base pairing.
[0103] The terms "complementary," "fully complementary" and
"substantially complementary" herein can be used with respect to
the base matching between the sense strand and the antisense strand
of a dsRNA, or between the antisense strand of an iRNA agent and a
target sequence, as will be understood from the context of their
use.
[0104] As used herein, a polynucleotide that is "substantially
complementary to at least part of" a messenger RNA (mRNA) refers to
a polynucleotide that is substantially complementary to a
contiguous portion of the mRNA of interest (i.e., an APCS gene).
For example, a polynucleotide is complementary to at least a part
of an APCS mRNA if the sequence is substantially complementary to a
non-interrupted portion of an mRNA encoding APCS.
[0105] Accordingly, in some embodiments, the sense strand
polynucleotides and the antisense polynucleotides disclosed herein
are fully complementary to the target APCS gene sequence.
[0106] In one embodiment, the antisense polynucleotides disclosed
herein are fully complementary to the target APCS sequence. In
other embodiments, the antisense polynucleotides disclosed herein
are substantially complementary to the target APCS sequence and
comprise a contiguous nucleotide sequence which is at least about
80% complementary over its entire length to the equivalent region
of the nucleotide sequence of any one of SEQ ID NO:1, or a fragment
of any one of SEQ ID NO:1, such as about 85%, about 86%, about 87%,
about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%,
about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%
complementary.
[0107] In other embodiments, the antisense polynucleotides
disclosed herein are substantially complementary to the target APCS
sequence and comprise a contiguous nucleotide sequence which is at
least about 80% complementary over its entire length to any one of
the sense strand nucleotide sequences in any one of Tables 3A, 3B,
4A, 4B, 6, and 7, or a fragment of any one of the sense strand
nucleotide sequences in any one of Tables 3A, 3B, 4A, 4B, 6, and 7,
such as about 85%, about 86%, about 87%, about 88%, about 89%,
about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98%, or about 99% complementary.
[0108] In one embodiment, an RNAi agent of the invention includes a
sense strand that is substantially complementary to an antisense
polynucleotide which, in turn, is complementary to a target APCS
sequence and comprises a contiguous nucleotide sequence which is at
least about 80% complementary over its entire length to any one of
the sense strand nucleotide sequences in any one of Tables 3A, 3B,
4A, 4B, 6, and 7, or a fragment of any one of the sense strand
nucleotide sequences in any one of Tables 3A, 3B, 4A, 4B, 6, and 7,
such as about 85%, about 86%, about 87%, about 88%, about 89%,
about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%,
about 96%, about 97%, about 98%, or about 99% complementary.
[0109] In one aspect of the invention, an agent for use in the
methods and compositions of the invention is a single-stranded
antisense RNA molecule that inhibits a target mRNA via an antisense
inhibition mechanism. The single-stranded antisense RNA molecule is
complementary to a sequence within the target mRNA. The
single-stranded antisense oligonucleotides can inhibit translation
in a stoichiometric manner by base pairing to the mRNA and
physically obstructing the translation machinery, see Dias, N. et
al., (2002) Mol Cancer Ther 1:347-355. The single-stranded
antisense RNA molecule may be about 15 to about 30 nucleotides in
length and have a sequence that is complementary to a target
sequence. For example, the single-stranded antisense RNA molecule
may comprise a sequence that is at least about 15, 16, 17, 18, 19,
20, or more contiguous nucleotides from any one of the antisense
sequences described herein.
[0110] As used herein, the term "APCS-associated disease" is a
disease or disorder that is caused by, or associated with the
expression of the APCS gene. The term "APCS-associated disease"
includes a disease, disorder or condition that would benefit from
reduction in APCS expression. An APCS-associated disease includes
amyloid-associated diseases, e.g., diseases that are characterized
by formation of amyloid deposits. Exemplary amyloid-associated
diseases include, but are not limited to, amyloidosis, Alzheimer's
disease; diabetes mellitus type 2; Parkinson's disease;
transmissible spongiform encephalopathy (such as bovine spongiform
encephalopathy); fatal familial insomnia; Huntington's disease;
medullary carcinoma of the thyroid; cardiac arrhythmias; isolated
atrial amyloidosis; rheumatoid arthritis; aortic medial amyloid;
prolactinoma; familial amyloid polyneuropathy; lattice corneal
dystrophy; cerebral amyloid angiopathy; cerebral amyloid angiopathy
(Icelandic type); sporadic inclusion body myositis.
[0111] In one embodiment, the amyloid-associated disease is
amyloidosis, e.g., primary (systemic AL) amyloidosis, secondary
(systemic AA) amyloidosis, dialysis-related amyloidosis (DRA),
familial (hereditary FA) amyloidosis, senile systemic amyloidosis
(SSA) and organ-specific amyloidosis.
[0112] An APCS-associated disease may also be a cardiovascular
disease, e.g., a coronary atherosclerotic heard disease.
[0113] "Therapeutically effective amount," as used herein, is
intended to include the amount of an RNAi agent that, when
administered to a subject having a APCS-associated disease, is
sufficient to effect treatment of the disease (e.g., by
diminishing, ameliorating or maintaining the existing disease or
one or more symptoms of disease). The "therapeutically effective
amount" may vary depending on the RNAi agent or antibody, or
antigen-binding fragment thereof, how the agent is administered,
the disease and its severity and the history, age, weight, family
history, genetic makeup, the types of preceding or concomitant
treatments, if any, and other individual characteristics of the
subject to be treated.
[0114] "Prophylactically effective amount," as used herein, is
intended to include the amount of an iRNA agent that, when
administered to a subject having a APCS-associated disease but not
yet (or currently) experiencing or displaying symptoms of the
disease, and/or a subject at risk of developing a APCS-associated
disease, e.g., a subject having multiple myeloma, a subject on
kidney dialysis or a subject with family history of amyloidosis, is
sufficient to prevent or ameliorate the disease or one or more
symptoms of the disease. Ameliorating the disease includes slowing
the course of the disease or reducing the severity of
later-developing disease. The "prophylactically effective amount"
may vary depending on the iRNA agent, how the agent is
administered, the degree of risk of disease, and the history, age,
weight, family history, genetic makeup, the types of preceding or
concomitant treatments, if any, and other individual
characteristics of the patient to be treated.
[0115] A "therapeutically effective amount" or "prophylactically
effective amount" also includes an amount of an RNAi agent that
produces some desired local or systemic effect at a reasonable
benefit/risk ratio applicable to any treatment. iRNA agents
employed in the methods of the present invention may be
administered in a sufficient amount to produce a reasonable
benefit/risk ratio applicable to such treatment.
[0116] As used herein, a "subject" is an animal, such as a mammal,
including a primate (such as a human, a non-human primate, e.g., a
monkey, and a chimpanzee), a non-primate (such as a cow, a pig, a
camel, a llama, a horse, a goat, a rabbit, a sheep, a hamster, a
guinea pig, a cat, a dog, a rat, a mouse, a horse, and a whale), or
a bird (e.g., a duck or a goose). In an embodiment, the subject is
a human, such as a human being treated or assessed for a disease,
disorder or condition that would benefit from reduction in APCS
expression; a human at risk for a disease, disorder or condition
that would benefit from reduction in APCS expression; a human
having a disease, disorder or condition that would benefit from
reduction in APCS expression; and/or human being treated for a
disease, disorder or condition that would benefit from reduction in
APCS expression as described herein.
II. iRNAs of the Invention
[0117] The present invention provides iRNAs which inhibit the
expression of an APCS gene. In one embodiment, the iRNA agent
includes double stranded ribonucleic acid (dsRNA) molecules for
inhibiting the expression of an APCS gene in a cell, such as a cell
within a subject, e.g., a mammal, such as a human having a
APCS-associated disease as described herein, e.g., amyloidosis,
Alzheimer's disease or coronary atherosclerotic heart disease. The
dsRNA includes an antisense strand having a region of
complementarity which is complementary to at least a part of an
mRNA formed in the expression of a target gene, i.e., APCS gene.
The region of complementarity is about 30 nucleotides or less in
length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19,
or 18 nucleotides or less in length). Upon contact with a cell
expressing the target gene, the iRNA selectively inhibits the
expression of the target gene (e.g., a human, a primate, a
non-primate, or a bird APCS gene) by at least about 10%, by at
least 30%, preferably at least 50% as assayed by, for example, a
PCR or branched DNA (bDNA)-based method, or by a protein-based
method, such as by immunofluorescence analysis, using, for example,
western blotting or flow cytometric techniques. In preferred
embodiments, inhibition of expression is determined by the
luciferase assay provided in the examples. For in vitro assessment
of activity, percent inhibition is determined using the methods
provided in Example 2 at a single dose at a 10 nM duplex final
concentration. For in vivo studies, the level after treatment can
be compared to, for example, an appropriate historical control or a
pooled population sample control to determine the level of
reduction, e.g., when a baseline value is no available for the
subject.
[0118] An RNAi agent is a dsRNA that includes two RNA strands that
are complementary and hybridize to form a duplex structure under
conditions in which the dsRNA will be used. One strand of a dsRNA
(the antisense strand) includes a region of complementarity that is
substantially complementary, and generally fully complementary, to
a target sequence. The target sequence can be derived from the
sequence of an mRNA formed during the expression of an APCS gene.
The other strand (the sense strand) includes a region that is
complementary to the antisense strand, such that the two strands
hybridize and form a duplex structure when combined under suitable
conditions. As described elsewhere herein and as known in the art,
the complementary sequences of a dsRNA can also be contained as
self-complementary regions of a single nucleic acid molecule, as
opposed to being on separate oligonucleotides.
[0119] Generally, the duplex structure is between 15 and 30 base
pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25,
15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30,
18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21,
18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23,
19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,
20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and
lengths intermediate to the above recited ranges and lengths are
also contemplated to be part of the invention.
[0120] Similarly, the region of complementarity to the target
sequence is between 15 and 30 nucleotides in length, e.g., between
15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21,
15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26,
18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28,
19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30,
20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21,
21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22
nucleotides in length. Ranges and lengths intermediate to the above
recited ranges and lengths are also contemplated to be part of the
invention.
[0121] In some embodiments, the sense and antisense strands of the
dsRNA are each independently about 15 to about 30 nucleotides in
length, or about 25 to about 30 nucleotides in length, e.g., each
strand is independently between 15-29, 15-28, 15-27, 15-26, 15-25,
15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30,
18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21,
18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23,
19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25,
20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or 21-22 nucleotides in length. In one
embodiment, an RNAi agent of the invention is a dsRNA of 24-30
nucleotides that interacts with a target RNA sequence, i.e., an
APCS target mRNA sequence, to direct the cleavage of the target
RNA. In general, the dsRNA is long enough to serve as a substrate
for the Dicer enzyme. For example, it is well-known in the art that
dsRNAs longer than about 21-23 nucleotides in length may serve as
substrates for Dicer. As the ordinarily skilled person will also
recognize, the region of an RNA targeted for cleavage will most
often be part of a larger RNA molecule, often an mRNA molecule.
Where relevant, a "part" of an mRNA target is a contiguous sequence
of an mRNA target of sufficient length to allow it to be a
substrate for RNAi-directed cleavage (i.e., cleavage through a RISC
pathway).
[0122] One of skill in the art will also recognize that the duplex
region is a primary functional portion of a dsRNA, e.g., a duplex
region of about 9 to 36 base pairs, e.g., about 10-36, 11-36,
12-36, 13-36, 14-36, 15-36, 9-35, 10-35, 11-35, 12-35, 13-35,
14-35, 15-35, 9-34, 10-34, 11-34, 12-34, 13-34, 14-34, 15-34, 9-33,
10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32,
12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32,
14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24,
15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29,
18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20,
19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22,
19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,
20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25,
21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, to the
extent that it becomes processed to a functional duplex, of e.g.,
15-30 base pairs, that targets a desired RNA for cleavage, an RNA
molecule or complex of RNA molecules having a duplex region greater
than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan
will recognize that in one embodiment, a miRNA is a dsRNA. In
another embodiment, a dsRNA is not a naturally occurring miRNA. In
another embodiment, an iRNA agent useful to target APCS expression
is not generated in the target cell by cleavage of a larger
dsRNA.
[0123] A RNAi agent as described herein can further include one or
more single-stranded nucleotide overhangs e.g., 1, 2, 3, or 4
nucleotides. RNAi agent having at least one nucleotide overhang can
have unexpectedly superior inhibitory properties relative to their
blunt-ended counterparts. A nucleotide overhang can comprise or
consist of a nucleotide/nucleoside analog, including a
deoxynucleotide/nucleoside. The overhang(s) can be on the sense
strand, the antisense strand or any combination thereof.
Furthermore, the nucleotide(s) of an overhang can be present on the
5'-end, 3'-end or both ends of either an antisense or sense strand
of the RNAi agent. In certain embodiments, longer, extended
overhangs are possible.
[0124] A dsRNA can be synthesized by standard methods known in the
art as further discussed below, e.g., by use of an automated DNA
synthesizer, such as are commercially available from, for example,
Biosearch, Applied Biosystems, Inc.
[0125] RNAi agents of the invention may be prepared using a
two-step procedure. First, the individual strands of the double
stranded RNA molecule are prepared separately. Then, the component
strands are annealed. The individual strands of the iRNA agent can
be prepared using solution-phase or solid-phase organic synthesis
or both. Organic synthesis offers the advantage that the
oligonucleotide strands comprising unnatural or modified
nucleotides can be easily prepared. Single-stranded
oligonucleotides of the invention can be prepared using
solution-phase or solid-phase organic synthesis or both.
[0126] In one aspect, an RNAi agent of the invention includes at
least two nucleotide sequences, a sense sequence and an anti-sense
sequence.
[0127] In one embodiment, the sense strand is selected from the
group of sequences provided in any one of Tables 3A, 3B, 4A, 4B, 6,
and 7, and the corresponding antisense strand of the sense strand
is selected from the group of sequences of any one of Tables 3A,
3B, 4A, 4B, 6, and 7. In this aspect, one of the two sequences is
complementary to the other of the two sequences, with one of the
sequences being substantially complementary to a sequence of an
mRNA generated in the expression of an APCS gene. As such, in this
aspect, a dsRNA will include two oligonucleotides, where one
oligonucleotide is described as the sense strand in any one of
Tables 3A, 3B, 4A, 4B, 6, and 7 and the second oligonucleotide is
described as the corresponding antisense strand of the sense strand
in any one of Tables 3A, 3B, 4A, 4B, 6, and 7. In one embodiment,
the substantially complementary sequences of the RNAi agent are
contained on separate oligonucleotides. In another embodiment, the
substantially complementary sequences of the RNAi agent are
contained on a single oligonucleotide.
[0128] It will be understood that, although some of the sequences
in Tables 3A, 3B, 4A, 4B, 6, and 7 are described as modified and/or
conjugated sequences, the RNA of the iRNA of the invention e.g., a
dsRNA of the invention, may comprise any one of the sequences set
forth in Tables 3A, 3B, 4A, 4B, 6, and 7 that is un-modified,
un-conjugated, and/or modified and/or conjugated differently than
described therein.
[0129] The skilled person is well aware that dsRNAs having a duplex
structure of between about 20 and 23 base pairs, e.g., 21, base
pairs have been hailed as particularly effective in inducing RNA
interference (Elbashir et al., EMBO 2001, 20:6877-6888). However,
others have found that shorter or longer RNA duplex structures can
also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al.
(2005) Nat Biotech 23:222-226). In the embodiments described above,
by virtue of the nature of the oligonucleotide sequences provided
in any one of Tables 3A, 3B, 4A, 4B, 6, and 7, the RNAi agents
described herein can include at least one strand of a length of
minimally 21 nucleotides. It can be reasonably expected that
shorter duplexes having one of the sequences of any one of Tables
3A, 3B, 4A, 4B, 6, and 7 minus only a few nucleotides on one or
both ends can be similarly effective as compared to the dsRNAs
described above. Hence, dsRNAs having a sequence of at least 15,
16, 17, 18, 19, 20, or more contiguous nucleotides derived from one
of the sequences of any one of Tables 3A, 3B, 4A, 4B, 6, and 7, and
differing in their ability to inhibit the expression of the target
gene by not more than about 5, 10, 15, 20, 25, or 30% inhibition
from a dsRNA comprising the full sequence, are contemplated to be
within the scope of the present invention.
[0130] In addition, the RNAs provided in any one of Tables 3A, 3B,
4A, 4B, 6, and 7 identify a site(s) in an APCS transcript that is
susceptible to RISC-mediated cleavage. As such, the present
invention further features iRNAs that target within one of these
sites. As used herein, an iRNA is said to target within a
particular site of an RNA transcript if the iRNA promotes cleavage
of the transcript anywhere within that particular site. Such an
iRNA will generally include at least about 15 contiguous
nucleotides from one of the sequences provided in any one of Tables
3A, 3B, 4A, 4B, 6, and 7 coupled to additional nucleotide sequences
taken from the region contiguous to the selected sequence in the
target gene.
[0131] While a target sequence is generally about 15-30 nucleotides
in length, there is wide variation in the suitability of particular
sequences in this range for directing cleavage of any given target
RNA. Various software packages and the guidelines set out herein
provide guidance for the identification of optimal target sequences
for any given gene target, but an empirical approach can also be
taken in which a "window" or "mask" of a given size (as a
non-limiting example, 21 nucleotides) is literally or figuratively
(including, e.g., in silico) placed on the target RNA sequence to
identify sequences in the size range that can serve as target
sequences. By moving the sequence "window" progressively one
nucleotide upstream or downstream of an initial target sequence
location, the next potential target sequence can be identified,
until the complete set of possible sequences is identified for any
given target size selected. This process, coupled with systematic
synthesis and testing of the identified sequences (using assays as
described herein or as known in the art) to identify those
sequences that perform optimally can identify those RNA sequences
that, when targeted with an RNAi agent, mediate the best inhibition
of target gene expression. Thus, while the sequences identified,
for example, in any one of Tables 3A, 3B, 4A, 4B, 6, and 7
represent effective target sequences, it is contemplated that
further optimization of inhibition efficiency can be achieved by
progressively "walking the window" one nucleotide upstream or
downstream of the given sequences to identify sequences with equal
or better inhibition characteristics.
[0132] Further, it is contemplated that for any sequence
identified, e.g., in any one of Tables 3A, 3B, 4A, 4B, 6, and 7,
further optimization could be achieved by systematically either
adding or removing nucleotides to generate longer or shorter
sequences and testing those sequences generated by walking a window
of the longer or shorter size up or down the target RNA from that
point. Again, coupling this approach to generating new candidate
targets with testing for effectiveness of iRNAs based on those
target sequences in an inhibition assay as known in the art and/or
as described herein can lead to further improvements in the
efficiency of inhibition. Further still, such optimized sequences
can be adjusted by, e.g., the introduction of modified nucleotides
as described herein or as known in the art, addition or changes in
overhang, or other modifications as known in the art and/or
discussed herein to further optimize the molecule (e.g., increasing
serum stability or circulating half-life, increasing thermal
stability, enhancing transmembrane delivery, targeting to a
particular location or cell type, increasing interaction with
silencing pathway enzymes, increasing release from endosomes) as an
expression inhibitor.
[0133] An iRNA as described herein can contain one or more
mismatches to the target sequence. In one embodiment, an iRNA as
described herein contains no more than 3 mismatches. If the
antisense strand of the iRNA contains mismatches to a target
sequence, it is preferable that the area of mismatch is not located
in the center of the region of complementarity. If the antisense
strand of the iRNA contains mismatches to the target sequence, it
is preferable that the mismatch be restricted to be within the last
5 nucleotides from either the 5'- or 3'-end of the region of
complementarity. For example, for a 23 nucleotide iRNA agent the
strand which is complementary to a region of, e.g., an APCS gene,
generally does not contain any mismatch within the central 13
nucleotides. The methods described herein or methods known in the
art can be used to determine whether an iRNA containing a mismatch
to a target sequence is effective in inhibiting the expression of a
target gene, e.g., an APCS gene. Consideration of the efficacy of
iRNAs with mismatches in inhibiting expression of a target gene is
important, especially if the particular region of complementarity
in a target gene is known to have polymorphic sequence variation
within the population.
III. Modified iRNAs of the Invention
[0134] In one embodiment, the RNA of the iRNA of the invention
e.g., a dsRNA, is un-modified, and does not comprise, e.g.,
chemical modifications and/or conjugations known in the art and
described herein. In another embodiment, the RNA of an iRNA of the
invention, e.g., a dsRNA, is chemically modified to enhance
stability or other beneficial characteristics. In certain
embodiments of the invention, substantially all of the nucleotides
of an iRNA of the invention are modified. In other embodiments of
the invention, all of the nucleotides of an iRNA of the invention
are modified iRNAs of the invention in which "substantially all of
the nucleotides are modified" are largely but not wholly modified
and can include not more than 5, 4, 3, 2, or 1 unmodified
nucleotides.
[0135] The nucleic acids featured in the invention can be
synthesized and/or modified by methods well established in the art,
such as those described in "Current protocols in nucleic acid
chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons,
Inc., New York, N.Y., USA, which is hereby incorporated herein by
reference. Modifications include, for example, end modifications,
e.g., 5'-end modifications (phosphorylation, conjugation, inverted
linkages) or 3'-end modifications (conjugation, DNA nucleotides,
inverted linkages, etc.); base modifications, e.g., replacement
with stabilizing bases, destabilizing bases, or bases that base
pair with an expanded repertoire of partners, removal of bases
(abasic nucleotides), or conjugated bases; sugar modifications
(e.g., at the 2'-position or 4'-position) or replacement of the
sugar; and/or backbone modifications, including modification or
replacement of the phosphodiester linkages. Specific examples of
iRNA compounds useful in the embodiments described herein include,
but are not limited to RNAs containing modified backbones or no
natural internucleoside linkages. RNAs having modified backbones
include, among others, those that do not have a phosphorus atom in
the backbone. For the purposes of this specification, and as
sometimes referenced in the art, modified RNAs that do not have a
phosphorus atom in their internucleoside backbone can also be
considered to be oligonucleosides. In some embodiments, a modified
iRNA will have a phosphorus atom in its internucleoside
backbone.
[0136] Modified RNA backbones include, for example,
phosphorothioates, chiral phosphorothioates, phosphorodithioates,
phosphotriesters, aminoalkylphosphotriesters, methyl and other
alkyl phosphonates including 3'-alkylene phosphonates and chiral
phosphonates, phosphinates, phosphoramidates including 3'-amino
phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates having normal
3'-5' linkages, 2'-5'-linked analogs of these, and those having
inverted polarity wherein the adjacent pairs of nucleoside units
are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed
salts and free acid forms are also included. In some embodiments of
the invention, the dsRNA agents of the invention are in a free acid
form. In other embodiments of the invention, the dsRNA agents of
the invention are in a salt form. In one embodiment, the dsRNA
agents of the invention are in a sodium salt form. In certain
embodiments, when the dsRNA agents of the invention are in the
sodium salt form, sodium ions are present in the agent as
counterions for substantially all of the phosphodiester and/or
phosphorothiotate groups present in the agent. Agents in which
substantially all of the phosphodiester and/or phosphorothioate
linkages have a sodium counterion include not more than 5, 4, 3, 2,
or 1 phosphodiester and/or phosphorothioate linkages without a
sodium counterion. In some embodiments, when the dsRNA agents of
the invention are in the sodium salt form, sodium ions are present
in the agent as counterions for all of the phosphodiester and/or
phosphorothiotate groups present in the agent.
[0137] Representative U.S. patents that teach the preparation of
the above phosphorus-containing linkages include, but are not
limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111;
5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445;
6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199;
6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167;
6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933;
7,321,029; and U.S. Pat. RE39464, the entire contents of each of
which are hereby incorporated herein by reference.
[0138] Modified RNA backbones that do not include a phosphorus atom
therein have backbones that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or
cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones; formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and
CH.sub.2 component parts.
[0139] Representative U.S. patents that teach the preparation of
the above oligonucleosides include, but are not limited to, U.S.
Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141;
5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677;
5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360;
5,677,437; and, 5,677,439, the entire contents of each of which are
hereby incorporated herein by reference.
[0140] In other embodiments, suitable RNA mimetics are contemplated
for use in iRNAs, in which both the sugar and the internucleoside
linkage, i.e., the backbone, of the nucleotide units are replaced
with novel groups. The base units are maintained for hybridization
with an appropriate nucleic acid target compound. One such
oligomeric compound, an RNA mimetic that has been shown to have
excellent hybridization properties, is referred to as a peptide
nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA
is replaced with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative U.S. patents that teach the
preparation of PNA compounds include, but are not limited to, U.S.
Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents
of each of which are hereby incorporated herein by reference.
Additional PNA compounds suitable for use in the iRNAs of the
invention are described in, for example, in Nielsen et al.,
Science, 1991, 254, 1497-1500.
[0141] Some embodiments featured in the invention include RNAs with
phosphorothioate backbones and oligonucleosides with heteroatom
backbones, and in particular --CH.sub.2--NH--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-[known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--N(CH.sub.3)--CH.sub.2--CH.sub.2--[wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above-referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above-referenced U.S. Pat. No. 5,602,240. In some
embodiments, the RNAs featured herein have morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0142] Modified RNAs can also contain one or more substituted sugar
moieties. The iRNAs, e.g., dsRNAs, featured herein can include one
of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-,
S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein
the alkyl, alkenyl and alkynyl can be substituted or unsubstituted
C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and
alkynyl. Exemplary suitable modifications include
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub..nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. In other embodiments, dsRNAs include one of
the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl,
substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl,
SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3,
SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an RNA cleaving group, a
reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an iRNA, or a group for improving the
pharmacodynamic properties of an iRNA, and other substituents
having similar properties. In some embodiments, the modification
includes a 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also
known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv.
Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another
exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples herein below, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2.
[0143] Other modifications include 2'-methoxy (2'-OCH.sub.3),
2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and
2'-fluoro (2'-F). Similar modifications can also be made at other
positions on the RNA of an iRNA, particularly the 3' position of
the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs
and the 5' position of 5' terminal nucleotide. iRNAs can also have
sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative U.S. patents that teach the
preparation of such modified sugar structures include, but are not
limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080;
5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;
5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053;
5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain
of which are commonly owned with the instant application. The
entire contents of each of the foregoing are hereby incorporated
herein by reference.
[0144] The RNA of an iRNA of the invention can also include
nucleobase (often referred to in the art simply as "base")
modifications or substitutions. As used herein, "unmodified" or
"natural" nucleobases include the purine bases adenine (A) and
guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and
uracil (U). Modified nucleobases include other synthetic and
natural nucleobases such as deoxy-thymine (dT) 5-methylcytosine
(5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and
guanine, 2-propyl and other alkyl derivatives of adenine and
guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine,
5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo
uracil, cytosine and thymine, 5-uracil (pseudouracil),
4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl
anal other 8-substituted adenines and guanines, 5-halo,
particularly 5-bromo, 5-trifluoromethyl and other 5-substituted
uracils and cytosines, 7-methylguanine and 7-methyladenine,
8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine
and 3-deazaguanine and 3-deazaadenine. Further nucleobases include
those disclosed in U.S. Pat. No. 3,687,808, those disclosed in
Modified Nucleosides in Biochemistry, Biotechnology and Medicine,
Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise
Encyclopedia Of Polymer Science And Engineering, pages 858-859,
Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed
by Englisch et al., Angewandte Chemie, International Edition, 1991,
30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA
Research and Applications, pages 289-302, Crooke, S. T. and Lebleu,
B., Ed., CRC Press, 1993. Certain of these nucleobases are
particularly useful for increasing the binding affinity of the
oligomeric compounds featured in the invention. These include
5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6
substituted purines, including 2-aminopropyladenine,
5-propynyluracil and 5-propynylcytosine. 5-methylcytosine
substitutions have been shown to increase nucleic acid duplex
stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and
Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca
Raton, 1993, pp. 276-278) and are exemplary base substitutions,
even more particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0145] Representative U.S. patents that teach the preparation of
certain of the above noted modified nucleobases as well as other
modified nucleobases include, but are not limited to, the above
noted U.S. Pat. Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066;
5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908;
5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091;
5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197;
6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438;
7,045,610; 7,427,672; and 7,495,088, the entire contents of each of
which are hereby incorporated herein by reference.
[0146] The RNA of an iRNA can also be modified to include one or
more locked nucleic acids (LNA). A locked nucleic acid is a
nucleotide having a modified ribose moiety in which the ribose
moiety comprises an extra bridge connecting the 2' and 4' carbons.
This structure effectively "locks" the ribose in the 3'-endo
structural conformation. The addition of locked nucleic acids to
siRNAs has been shown to increase siRNA stability in serum, and to
reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids
Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther
6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research
31(12):3185-3193).
[0147] In some embodiments, the iRNA of the invention comprises one
or more monomers that are UNA (unlocked nucleic acid) nucleotides.
UNA is unlocked acyclic nucleic acid, wherein any of the bonds of
the sugar has been removed, forming an unlocked "sugar" residue. In
one example, UNA also encompasses monomer with bonds between
C1'-C4' have been removed (i.e., the covalent carbon-oxygen-carbon
bond between the C1' and C4' carbons). In another example, the
C2'-C3' bond (i.e. the covalent carbon-carbon bond between the CT
and C3' carbons) of the sugar has been removed (see Nuc. Acids
Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst.,
2009, 10, 1039 hereby incorporated by reference).
[0148] The RNA of an iRNA can also be modified to include one or
more bicyclic sugar moities. A "bicyclic sugar" is a furanosyl ring
modified by the bridging of two atoms. A "bicyclic nucleoside"
("BNA") is a nucleoside having a sugar moiety comprising a bridge
connecting two carbon atoms of the sugar ring, thereby forming a
bicyclic ring system. In certain embodiments, the bridge connects
the 4'-carbon and the 2'-carbon of the sugar ring. Thus, in some
embodiments an agent of the invention may include one or more
locked nucleic acids (LNA). A locked nucleic acid is a nucleotide
having a modified ribose moiety in which the ribose moiety
comprises an extra bridge connecting the 2' and 4' carbons. In
other words, an LNA is a nucleotide comprising a bicyclic sugar
moiety comprising a 4'-CH.sub.2-O-2' bridge. This structure
effectively "locks" the ribose in the 3'-endo structural
conformation. The addition of locked nucleic acids to siRNAs has
been shown to increase siRNA stability in serum, and to reduce
off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research
33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther
6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research
31(12):3185-3193). Examples of bicyclic nucleosides for use in the
polynucleotides of the invention include without limitation
nucleosides comprising a bridge between the 4' and the 2' ribosyl
ring atoms. In certain embodiments, the antisense polynucleotide
agents of the invention include one or more bicyclic nucleosides
comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged
bicyclic nucleosides, include but are not limited to
4'-(CH.sub.2)--O-2' (LNA); 4'-(CH.sub.2)--S-2';
4'-(CH.sub.2).sub.2-O-2' (ENA); 4'-CH(CH.sub.3)--O-2' (also
referred to as "constrained ethyl" or "cEt") and
4'-CH(CH.sub.2OCH.sub.3)--O-2' (and analogs thereof; see, e.g.,
U.S. Pat. No. 7,399,845); 4'-C(CH.sub.3)(CH.sub.3)--O-2' (and
analogs thereof; see e.g., U.S. Pat. No. 8,278,283);
4'-CH.sub.2--N(OCH.sub.3)-2' (and analogs thereof; see e.g., U.S.
Pat. No. 8,278,425); 4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g.,
U.S. Patent Publication No. 2004/0171570); 4'-CH.sub.2--N(R)-O-2',
wherein R is H, C1-C12 alkyl, or a protecting group (see, e.g.,
U.S. Pat. No. 7,427,672); 4'-CH.sub.2--C(H)(CH.sub.3)-2' (see,
e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and
4'-CH.sub.2--C(.dbd.CH.sub.2)-2' (and analogs thereof; see, e.g.,
U.S. Pat. No. 8,278,426). The entire contents of each of the
foregoing are hereby incorporated herein by reference.
[0149] Additional representative U.S. Patents and US Patent
Publications that teach the preparation of locked nucleic acid
nucleotides include, but are not limited to, the following: U.S.
Pat. Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499;
6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672;
7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426;
8,278,283; US 2008/0039618; and US 2009/0012281, the entire
contents of each of which are hereby incorporated herein by
reference.
[0150] Any of the foregoing bicyclic nucleosides can be prepared
having one or more stereochemical sugar configurations including
for example .alpha.-L-ribofuranose and .beta.-D-ribofuranose (see
WO 99/14226).
[0151] The RNA of an iRNA can also be modified to include one or
more constrained ethyl nucleotides. As used herein, a "constrained
ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a
bicyclic sugar moiety comprising a 4'-CH(CH.sub.3)--O-2' bridge. In
one embodiment, a constrained ethyl nucleotide is in the S
conformation referred to herein as "S-cEt."
[0152] An iRNA of the invention may also include one or more
"conformationally restricted nucleotides" ("CRN"). CRN are
nucleotide analogs with a linker connecting the C2' and C4' carbons
of ribose or the C3 and --C5' carbons of ribose. CRN lock the
ribose ring into a stable conformation and increase the
hybridization affinity to mRNA. The linker is of sufficient length
to place the oxygen in an optimal position for stability and
affinity resulting in less ribose ring puckering.
[0153] Representative publications that teach the preparation of
certain of the above noted CRN include, but are not limited to, US
Patent Publication No. 2013/0190383; and PCT publication WO
2013/036868, the entire contents of each of which are hereby
incorporated herein by reference.
[0154] Potentially stabilizing modifications to the ends of RNA
molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol
(Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6),
N-(acetyl-4-hydroxyprolinol (Hyp-NHAc),
thymidine-2'-O-deoxythymidine (ether),
N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino),
2-docosanoyl-uridine-3''-phosphate, inverted base dT(idT) and
others. Disclosure of this modification can be found in PCT
Publication No. WO 2011/005861.
[0155] Other modifications of the nucleotides of an iRNA of the
invention include a 5' phosphate or 5' phosphate mimic, e.g., a
5'-terminal phosphate or phosphate mimic on the antisense strand of
an RNAi agent. Suitable phosphate mimics are disclosed in, for
example U.S. Patent Publication No. 2012/0157511, the entire
contents of which are incorporated herein by reference.
[0156] A. Modified iRNAs Comprising Motifs of the Invention
[0157] In certain aspects of the invention, the double stranded
RNAi agents of the invention include agents with chemical
modifications as disclosed, for example, in U.S. Provisional
Application No. 61/561,710, filed on Nov. 18, 2011, or in
PCT/US2012/065691, filed on Nov. 16, 2012, the entire contents of
each of which are incorporated herein by reference.
[0158] As shown herein, in Provisional Application No. 61/561,710,
and in PCT/US2012/065691, a superior result may be obtained by
introducing one or more motifs of three identical modifications on
three consecutive nucleotides into a sense strand and/or antisense
strand of a RNAi agent, particularly at or near the cleavage site.
In some embodiments, the sense strand and antisense strand of the
RNAi agent may otherwise be completely modified. The introduction
of these motifs interrupts the modification pattern, if present, of
the sense and/or antisense strand. The RNAi agent may be optionally
conjugated with a GalNAc derivative ligand, for instance on the
sense strand. The resulting RNAi agents present superior gene
silencing activity.
[0159] More specifically, it has been surprisingly discovered that
when the sense strand and antisense strand of the double stranded
RNAi agent are modified to have one or more motifs of three
identical modifications on three consecutive nucleotides at or near
the cleavage site of at least one strand of an RNAi agent, the gene
silencing activity of the RNAi agent was superiorly enhanced.
[0160] In one embodiment, the RNAi agent is a double ended bluntmer
of 19 nucleotides in length, wherein the sense strand contains at
least one motif of three 2'-F modifications on three consecutive
nucleotides at positions 7, 8, 9 from the 5'end. The antisense
strand contains at least one motif of three 2'-O-methyl
modifications on three consecutive nucleotides at positions 11, 12,
13 from the 5'end.
[0161] In another embodiment, the RNAi agent is a double ended
bluntmer of 20 nucleotides in length, wherein the sense strand
contains at least one motif of three 2'-F modifications on three
consecutive nucleotides at positions 8, 9, 10 from the 5'end. The
antisense strand contains at least one motif of three 2'-O-methyl
modifications on three consecutive nucleotides at positions 11, 12,
13 from the 5'end.
[0162] In yet another embodiment, the RNAi agent is a double ended
bluntmer of 21 nucleotides in length, wherein the sense strand
contains at least one motif of three 2'-F modifications on three
consecutive nucleotides at positions 9, 10, 11 from the 5'end. The
antisense strand contains at least one motif of three 2'-O-methyl
modifications on three consecutive nucleotides at positions 11, 12,
13 from the 5'end.
[0163] In one embodiment, the RNAi agent comprises a 21 nucleotide
sense strand and a 23 nucleotide antisense strand, wherein the
sense strand contains at least one motif of three 2'-F
modifications on three consecutive nucleotides at positions 9, 10,
11 from the 5'end; the antisense strand contains at least one motif
of three 2'-O-methyl modifications on three consecutive nucleotides
at positions 11, 12, 13 from the 5'end, wherein one end of the RNAi
agent is blunt, while the other end comprises a 2 nucleotide
overhang. Preferably, the 2 nucleotide overhang is at the 3'-end of
the antisense strand. When the 2 nucleotide overhang is at the
3'-end of the antisense strand, there may be two phosphorothioate
internucleotide linkages between the terminal three nucleotides,
wherein two of the three nucleotides are the overhang nucleotides,
and the third nucleotide is a paired nucleotide next to the
overhang nucleotide. In one embodiment, the RNAi agent additionally
has two phosphorothioate internucleotide linkages between the
terminal three nucleotides at both the 5'-end of the sense strand
and at the 5'-end of the antisense strand. In one embodiment, every
nucleotide in the sense strand and the antisense strand of the RNAi
agent, including the nucleotides that are part of the motifs are
modified nucleotides. In one embodiment each residue is
independently modified with a 2'-O-methyl or 3'-fluoro, e.g., in an
alternating motif. Optionally, the RNAi agent further comprises a
ligand (preferably GalNAc3).
[0164] In one embodiment, the RNAi agent comprises sense and
antisense strands, wherein the RNAi agent comprises a first strand
having a length which is at least 25 and at most 29 nucleotides and
a second strand having a length which is at most 30 nucleotides
with at least one motif of three 2'-O-methyl modifications on three
consecutive nucleotides at position 11, 12, 13 from the 5' end;
wherein the 3' end of the first strand and the 5' end of the second
strand form a blunt end and the second strand is 1-4 nucleotides
longer at its 3' end than the first strand, wherein the duplex
region region which is at least 25 nucleotides in length, and the
second strand is sufficiently complementary to a target mRNA along
at least 19 nucleotide of the second strand length to reduce target
gene expression when the RNAi agent is introduced into a mammalian
cell, and wherein dicer cleavage of the RNAi agent preferentially
results in an siRNA comprising the 3' end of the second strand,
thereby reducing expression of the target gene in the mammal.
Optionally, the RNAi agent further comprises a ligand.
[0165] In one embodiment, the sense strand of the RNAi agent
contains at least one motif of three identical modifications on
three consecutive nucleotides, where one of the motifs occurs at
the cleavage site in the sense strand.
[0166] In one embodiment, the antisense strand of the RNAi agent
can also contain at least one motif of three identical
modifications on three consecutive nucleotides, where one of the
motifs occurs at or near the cleavage site in the antisense
strand
[0167] For an RNAi agent having a duplex region of 17-23
nucleotides in length, the cleavage site of the antisense strand is
typically around the 10, 11 and 12 positions from the 5'-end. Thus
the motifs of three identical modifications may occur at the 9, 10,
11 positions; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13,
14 positions; or 13, 14, 15 positions of the antisense strand, the
count starting from the 1.sup.st nucleotide from the 5'-end of the
antisense strand, or, the count starting from the 1.sup.st paired
nucleotide within the duplex region from the 5'-end of the
antisense strand. The cleavage site in the antisense strand may
also change according to the length of the duplex region of the
RNAi from the 5'-end.
[0168] The sense strand of the RNAi agent may contain at least one
motif of three identical modifications on three consecutive
nucleotides at the cleavage site of the strand; and the antisense
strand may have at least one motif of three identical modifications
on three consecutive nucleotides at or near the cleavage site of
the strand. When the sense strand and the antisense strand form a
dsRNA duplex, the sense strand and the antisense strand can be so
aligned that one motif of the three nucleotides on the sense strand
and one motif of the three nucleotides on the antisense strand have
at least one nucleotide overlap, i.e., at least one of the three
nucleotides of the motif in the sense strand forms a base pair with
at least one of the three nucleotides of the motif in the antisense
strand. Alternatively, at least two nucleotides may overlap, or all
three nucleotides may overlap.
[0169] In one embodiment, the sense strand of the RNAi agent may
contain more than one motif of three identical modifications on
three consecutive nucleotides. The first motif may occur at or near
the cleavage site of the strand and the other motifs may be a wing
modification. The term "wing modification" herein refers to a motif
occurring at another portion of the strand that is separated from
the motif at or near the cleavage site of the same strand. The wing
modification is either adjacent to the first motif or is separated
by at least one or more nucleotides. When the motifs are
immediately adjacent to each other then the chemistry of the motifs
are distinct from each other and when the motifs are separated by
one or more nucleotide than the chemistries can be the same or
different. Two or more wing modifications may be present. For
instance, when two wing modifications are present, each wing
modification may occur at one end relative to the first motif which
is at or near cleavage site or on either side of the lead
motif.
[0170] Like the sense strand, the antisense strand of the RNAi
agent may contain more than one motifs of three identical
modifications on three consecutive nucleotides, with at least one
of the motifs occurring at or near the cleavage site of the strand.
This antisense strand may also contain one or more wing
modifications in an alignment similar to the wing modifications
that may be present on the sense strand.
[0171] In one embodiment, the wing modification on the sense strand
or antisense strand of the RNAi agent typically does not include
the first one or two terminal nucleotides at the 3'-end, 5'-end or
both ends of the strand.
[0172] In another embodiment, the wing modification on the sense
strand or antisense strand of the RNAi agent typically does not
include the first one or two paired nucleotides within the duplex
region at the 3'-end, 5'-end or both ends of the strand.
[0173] When the sense strand and the antisense strand of the RNAi
agent each contain at least one wing modification, the wing
modifications may fall on the same end of the duplex region, and
have an overlap of one, two or three nucleotides.
[0174] When the sense strand and the antisense strand of the RNAi
agent each contain at least two wing modifications, the sense
strand and the antisense strand can be so aligned that two
modifications each from one strand fall on one end of the duplex
region, having an overlap of one, two or three nucleotides; two
modifications each from one strand fall on the other end of the
duplex region, having an overlap of one, two or three nucleotides;
two modifications one strand fall on each side of the lead motif,
having an overlap of one, two or three nucleotides in the duplex
region.
[0175] In one embodiment, every nucleotide in the sense strand and
antisense strand of the RNAi agent, including the nucleotides that
are part of the motifs, may be modified. Each nucleotide may be
modified with the same or different modification which can include
one or more alteration of one or both of the non-linking phosphate
oxygens and/or of one or more of the linking phosphate oxygens;
alteration of a constituent of the ribose sugar, e.g., of the 2'
hydroxyl on the ribose sugar; wholesale replacement of the
phosphate moiety with "dephospho" linkers; modification or
replacement of a naturally occurring base; and replacement or
modification of the ribose-phosphate backbone.
[0176] As nucleic acids are polymers of subunits, many of the
modifications occur at a position which is repeated within a
nucleic acid, e.g., a modification of a base, or a phosphate
moiety, or a non-linking 0 of a phosphate moiety. In some cases the
modification will occur at all of the subject positions in the
nucleic acid but in many cases it will not. By way of example, a
modification may only occur at a 3' or 5' terminal position, may
only occur in a terminal region, e.g., at a position on a terminal
nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a
strand. A modification may occur in a double strand region, a
single strand region, or in both. A modification may occur only in
the double strand region of an RNA or may only occur in a single
strand region of a RNA. For example, a phosphorothioate
modification at a non-linking 0 position may only occur at one or
both termini, may only occur in a terminal region, e.g., at a
position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10
nucleotides of a strand, or may occur in double strand and single
strand regions, particularly at termini. The 5' end or ends can be
phosphorylated.
[0177] It may be possible, e.g., to enhance stability, to include
particular bases in overhangs, or to include modified nucleotides
or nucleotide surrogates, in single strand overhangs, e.g., in a 5'
or 3' overhang, or in both. For example, it can be desirable to
include purine nucleotides in overhangs. In some embodiments all or
some of the bases in a 3' or 5' overhang may be modified, e.g.,
with a modification described herein. Modifications can include,
e.g., the use of modifications at the 2' position of the ribose
sugar with modifications that are known in the art, e.g., the use
of deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl
modified instead of the ribosugar of the nucleobase, and
modifications in the phosphate group, e.g., phosphorothioate
modifications. Overhangs need not be homologous with the target
sequence.
[0178] In one embodiment, each residue of the sense strand and
antisense strand is independently modified with LNA, HNA, CeNA,
2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy,
2'-hydroxyl, or 2'-fluoro. The strands can contain more than one
modification. In one embodiment, each residue of the sense strand
and antisense strand is independently modified with 2'-O-methyl or
2'-fluoro.
[0179] At least two different modifications are typically present
on the sense strand and antisense strand. Those two modifications
may be the 2'-O-methyl or 2'-fluoro modifications, or others.
[0180] In one embodiment, the N.sub.a and/or N.sub.b comprise
modifications of an alternating pattern. The term "alternating
motif" as used herein refers to a motif having one or more
modifications, each modification occurring on alternating
nucleotides of one strand. The alternating nucleotide may refer to
one per every other nucleotide or one per every three nucleotides,
or a similar pattern. For example, if A, B and C each represent one
type of modification to the nucleotide, the alternating motif can
be "ABABABABABAB . . . ," "AABBAABBAABB . . . ," "AABAABAABAAB . .
. ," "AAABAAABAAAB . . . ," "AAABBBAAABBB . . . ," or "ABCABCABCABC
. . . ," etc.
[0181] The type of modifications contained in the alternating motif
may be the same or different. For example, if A, B, C, D each
represent one type of modification on the nucleotide, the
alternating pattern, i.e., modifications on every other nucleotide,
may be the same, but each of the sense strand or antisense strand
can be selected from several possibilities of modifications within
the alternating motif such as "ABABAB . . . ", "ACACAC . . . "
"BDBDBD . . . " or "CDCDCD . . . ," etc.
[0182] In one embodiment, the RNAi agent of the invention comprises
the modification pattern for the alternating motif on the sense
strand relative to the modification pattern for the alternating
motif on the antisense strand is shifted. The shift may be such
that the modified group of nucleotides of the sense strand
corresponds to a differently modified group of nucleotides of the
antisense strand and vice versa. For example, the sense strand when
paired with the antisense strand in the dsRNA duplex, the
alternating motif in the sense strand may start with "ABABAB" from
5'-3' of the strand and the alternating motif in the antisense
strand may start with "BABABA" from 5'-3' of the strand within the
duplex region. As another example, the alternating motif in the
sense strand may start with "AABBAABB" from 5'-3' of the strand and
the alternating motif in the antisense strand may start with
"BBAABBAA" from 5'-3' of the strand within the duplex region, so
that there is a complete or partial shift of the modification
patterns between the sense strand and the antisense strand.
[0183] In one embodiment, the RNAi agent comprises the pattern of
the alternating motif of 2'-O-methyl modification and 2'-F
modification on the sense strand initially has a shift relative to
the pattern of the alternating motif of 2'-O-methyl modification
and 2'-F modification on the antisense strand initially, i.e., the
2'-O-methyl modified nucleotide on the sense strand base pairs with
a 2'-F modified nucleotide on the antisense strand and vice versa.
The 1 position of the sense strand may start with the 2'-F
modification, and the 1 position of the antisense strand may start
with the 2'-O-methyl modification.
[0184] The introduction of one or more motifs of three identical
modifications on three consecutive nucleotides to the sense strand
and/or antisense strand interrupts the initial modification pattern
present in the sense strand and/or antisense strand. This
interruption of the modification pattern of the sense and/or
antisense strand by introducing one or more motifs of three
identical modifications on three consecutive nucleotides to the
sense and/or antisense strand surprisingly enhances the gene
silencing acitivty to the target gene.
[0185] In one embodiment, when the motif of three identical
modifications on three consecutive nucleotides is introduced to any
of the strands, the modification of the nucleotide next to the
motif is a different modification than the modification of the
motif. For example, the portion of the sequence containing the
motif is " . . . N.sub.aYYYN.sub.b . . . ," where "Y" represents
the modification of the motif of three identical modifications on
three consecutive nucleotide, and "N.sub.a" and "N.sub.b" represent
a modification to the nucleotide next to the motif "YYY" that is
different than the modification of Y, and where N.sub.a and N.sub.b
can be the same or different modifications. Alternatively, N.sub.a
and/or N.sub.b may be present or absent when there is a wing
modification present.
[0186] The RNAi agent may further comprise at least one
phosphorothioate or methylphosphonate internucleotide linkage. The
phosphorothioate or methylphosphonate internucleotide linkage
modification may occur on any nucleotide of the sense strand or
antisense strand or both strands in any position of the strand. For
instance, the internucleotide linkage modification may occur on
every nucleotide on the sense strand and/or antisense strand; each
internucleotide linkage modification may occur in an alternating
pattern on the sense strand and/or antisense strand; or the sense
strand or antisense strand may contain both internucleotide linkage
modifications in an alternating pattern. The alternating pattern of
the internucleotide linkage modification on the sense strand may be
the same or different from the antisense strand, and the
alternating pattern of the internucleotide linkage modification on
the sense strand may have a shift relative to the alternating
pattern of the internucleotide linkage modification on the
antisense strand.
[0187] In one embodiment, the RNAi comprises a phosphorothioate or
methylphosphonate internucleotide linkage modification in the
overhang region. For example, the overhang region may contain two
nucleotides having a phosphorothioate or methylphosphonate
internucleotide linkage between the two nucleotides.
Internucleotide linkage modifications also may be made to link the
overhang nucleotides with the terminal paired nucleotides within
the duplex region. For example, at least 2, 3, 4, or all the
overhang nucleotides may be linked through phosphorothioate or
methylphosphonate internucleotide linkage, and optionally, there
may be additional phosphorothioate or methylphosphonate
internucleotide linkages linking the overhang nucleotide with a
paired nucleotide that is next to the overhang nucleotide. For
instance, there may be at least two phosphorothioate
internucleotide linkages between the terminal three nucleotides, in
which two of the three nucleotides are overhang nucleotides, and
the third is a paired nucleotide next to the overhang nucleotide.
These terminal three nucleotides may be at the 3'-end of the
antisense strand, the 3'-end of the sense strand, the 5'-end of the
antisense strand, and/or the 5'end of the antisense strand.
[0188] In one embodiment, the 2 nucleotide overhang is at the
3'-end of the antisense strand, and there are two phosphorothioate
internucleotide linkages between the terminal three nucleotides,
wherein two of the three nucleotides are the overhang nucleotides,
and the third nucleotide is a paired nucleotide next to the
overhang nucleotide. Optionally, the RNAi agent may additionally
have two phosphorothioate internucleotide linkages between the
terminal three nucleotides at both the 5'-end of the sense strand
and at the 5'-end of the antisense strand.
[0189] In one embodiment, the RNAi agent comprises mismatch(es)
with the target, within the duplex, or combinations thereof. A
"mismatch" may be non-canonical base pairing or other than
canonical pairing of nucleotides. The mismatch may occur in the
overhang region or the duplex region. The base pair may be ranked
on the basis of their propensity to promote dissociation or melting
(e.g., on the free energy of association or dissociation of a
particular pairing, the simplest approach is to examine the pairs
on an individual pair basis, though next neighbor or similar
analysis can also be used). In terms of promoting dissociation: A:U
is preferred over G:C; G:U is preferred over G:C; and I:C is
preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or
other than canonical pairings (as described elsewhere herein) are
preferred over canonical (A:T, A:U, G:C) pairings; and pairings
which include a universal base are preferred over canonical
pairings. A "universal base" is a base that exhibits the ability to
replace any of the four normal bases (G, C, A, and U) without
significantly destabilizing neighboring base-pair interactions or
disrupting the expected functional biochemical utility of the
modified oligonucleotide. Non-limiting examples of universal bases
include 2'-deoxyinosine (hypoxanthine deoxynucleotide) or its
derivatives, nitroazole analogues, and hydrophobic aromatic
non-hydrogen-bonding bases.
[0190] In one embodiment, the RNAi agent comprises at least one of
the first 1, 2, 3, 4, or 5 base pairs within the duplex regions
from the 5'-end of the antisense strand independently selected from
the group of: A:U, G:U, I:C, and mismatched pairs, e.g.,
non-canonical or other than canonical pairings or pairings which
include a universal base, to promote the dissociation of the
antisense strand at the 5'-end of the duplex.
[0191] In one embodiment, the nucleotide at the 1 position within
the duplex region from the 5'-end in the antisense strand is
selected from the group consisting of A, dA, dU, U, and dT.
Alternatively, at least one of the first 1, 2 or 3 base pair within
the duplex region from the 5'-end of the antisense strand is an AU
base pair. For example, the first base pair within the duplex
region from the 5'-end of the antisense strand is an AU base
pair.
[0192] In another embodiment, the nucleotide at the 3'-end of the
sense strand is deoxy-thymine (dT). In another embodiment, the
nucleotide at the 3'-end of the antisense strand is deoxy-thymine
(dT). In one embodiment, there is a short sequence of deoxy-thymine
nucleotides, for example, two dT nucleotides on the 3'-end of the
sense and/or antisense strand.
[0193] In one embodiment, the sense strand sequence may be
represented by formula (I):
5'n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y -N.sub.b-(Z Z
Z).sub.j--N.sub.a-n.sub.q 3' (I)
[0194] wherein:
[0195] i and j are each independently 0 or 1;
[0196] p and q are each independently 0-6;
[0197] each N.sub.a independently represents an oligonucleotide
sequence comprising 0-25 modified nucleotides, each sequence
comprising at least two differently modified nucleotides;
[0198] each N.sub.b independently represents an oligonucleotide
sequence comprising 0-10 modified nucleotides;
[0199] each n.sub.p and n.sub.q independently represent an overhang
nucleotide;
[0200] wherein Nb and Y do not have the same modification; and
[0201] XXX, YYY and ZZZ each independently represent one motif of
three identical modifications on three consecutive nucleotides.
Preferably YYY is all 2'-F modified nucleotides.
[0202] In one embodiment, the N.sub.a and/or N.sub.b comprise
modifications of alternating pattern.
[0203] In one embodiment, the YYY motif occurs at or near the
cleavage site of the sense strand. For example, when the RNAi agent
has a duplex region of 17-23 nucleotides in length, the YYY motif
can occur at or the vicinity of the cleavage site (e.g.: can occur
at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or
11, 12, 13) of - the sense strand, the count starting from the
1.sup.st nucleotide, from the 5'-end; or optionally, the count
starting at the 1.sup.st paired nucleotide within the duplex
region, from the 5'-end.
[0204] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1,
or both i and j are 1. The sense strand can therefore be
represented by the following formulas:
5'n.sub.p-N.sub.a-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q 3' (Ib);
5'n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.a-n.sub.q 3' (Ic); or
5'n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.b-ZZZ-N.sub.a-n.sub.q 3'
(Id).
[0205] When the sense strand is represented by formula (Ib),
N.sub.b represents an oligonucleotide sequence comprising 0-10,
0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a
independently can represent an oligonucleotide sequence comprising
2-20, 2-15, or 2-10 modified nucleotides.
[0206] When the sense strand is represented as formula (Ic),
N.sub.b represents an oligonucleotide sequence comprising 0-10,
0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each
N.sub.a can independently represent an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0207] When the sense strand is represented as formula (Id), each
N.sub.b independently represents an oligonucleotide sequence
comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides.
Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6 Each N.sub.a can
independently represent an oligonucleotide sequence comprising
2-20, 2-15, or 2-10 modified nucleotides.
[0208] Each of X, Y and Z may be the same or different from each
other.
[0209] In other embodiments, i is 0 and j is 0, and the sense
strand may be represented by the formula:
5'n.sub.p-N.sub.a-YYY-N.sub.a-n.sub.q 3' (Ia).
[0210] When the sense strand is represented by formula (Ia), each
N.sub.a independently can represent an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0211] In one embodiment, the antisense strand sequence of the RNAi
may be represented by formula (II):
5'
n.sub.q'-N.sub.a'-(Z'Z'Z').sub.k-N.sub.b'-Y'Y'Y'-N.sub.b'-(X'X'X').su-
b.t-N'.sub.a-n.sub.p'3' (II)
[0212] wherein:
[0213] k and 1 are each independently 0 or 1;
[0214] p' and q' are each independently 0-6;
[0215] each N.sub.a' independently represents an oligonucleotide
sequence comprising 0-25 modified nucleotides, each sequence
comprising at least two differently modified nucleotides;
[0216] each N.sub.b' independently represents an oligonucleotide
sequence comprising 0-10 modified nucleotides;
[0217] each n.sub.p' and n.sub.q' independently represent an
overhang nucleotide;
[0218] wherein N.sub.b' and Y' do not have the same
modification;
[0219] and
[0220] X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one
motif of three identical modifications on three consecutive
nucleotides.
[0221] In one embodiment, the N.sub.a' and/or N.sub.b' comprise
modifications of alternating pattern.
[0222] The Y'Y'Y' motif occurs at or near the cleavage site of the
antisense strand. For example, when the RNAi agent has a duplex
region of 17-23 nucleotide in length, the Y'Y'Y' motif can occur at
positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14,
15 of the antisense strand, with the count starting from the
1.sup.st nucleotide, from the 5'-end; or optionally, the count
starting at the 1.sup.st paired nucleotide within the duplex
region, from the 5'-end. Preferably, the Y'Y'Y' motif occurs at
positions 11, 12, 13.
[0223] In one embodiment, Y'Y'Y' motif is all 2'-OMe modified
nucleotides.
[0224] In one embodiment, k is 1 and 1 is 0, or k is 0 and 1 is 1,
or both k and 1 are 1.
[0225] The antisense strand can therefore be represented by the
following formulas:
5' n.sub.q'-N.sub.a'-Z'Z'Z'-N.sub.b'-Y'Y'Y'-N.sub.a'-n.sub.p'3'
(IIb);
5' n.sub.q'-N.sub.a'-Y'Y'Y'-N.sub.b'-X'X'X'-n.sub.p'3' (IIc);
or
5'n.sub.q'-N.sub.a'-Z'Z'Z'-N.sub.b'-Y'Y'Y'-N.sub.b'-X'X'X'-N.sub.a'-n.su-
b.p'3' (IId).
[0226] When the antisense strand is represented by formula (IIb),
N.sub.b' represents an oligonucleotide sequence comprising 0-10,
0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each
N.sub.a' independently represents an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0227] When the antisense strand is represented as formula (IIc),
N.sub.b' represents an oligonucleotide sequence comprising 0-10,
0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each
N.sub.a' independently represents an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0228] When the antisense strand is represented as formula (lid),
each N.sub.b' independently represents an oligonucleotide sequence
comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified
nucleotides. Each N.sub.a' independently represents an
oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified
nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.
[0229] In other embodiments, k is 0 and 1 is 0 and the antisense
strand may be represented by the formula:
5'n.sub.p'-N.sub.a'-Y'Y'Y'-N.sub.a'-n.sub.q'3' (Ia).
[0230] When the antisense strand is represented as formula (IIa),
each N.sub.a' independently represents an oligonucleotide sequence
comprising 2-20, 2-15, or 2-10 modified nucleotides.
[0231] Each of X', Y' and Z' may be the same or different from each
other.
[0232] Each nucleotide of the sense strand and antisense strand may
be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl,
2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For
example, each nucleotide of the sense strand and antisense strand
is independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y,
Z, X', Y' and Z', in particular, may represent a 2'-O-methyl
modification or a 2'-fluoro modification.
[0233] In one embodiment, the sense strand of the RNAi agent may
contain YYY motif occurring at 9, 10 and 11 positions of the strand
when the duplex region is 21 nt, the count starting from the
1.sup.st nucleotide from the 5'-end, or optionally, the count
starting at the 1.sup.st paired nucleotide within the duplex
region, from the 5'-end; and Y represents 2'-F modification. The
sense strand may additionally contain XXX motif or ZZZ motifs as
wing modifications at the opposite end of the duplex region; and
XXX and ZZZ each independently represents a 2'-OMe modification or
2'-F modification.
[0234] In one embodiment the antisense strand may contain Y'Y'Y'
motif occurring at positions 11, 12, 13 of the strand, the count
starting from the 1.sup.st nucleotide from the 5'-end, or
optionally, the count starting at the 1.sup.st paired nucleotide
within the duplex region, from the 5'-end; and Y' represents
2'-O-methyl modification. The antisense strand may additionally
contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the
opposite end of the duplex region; and X'X'X' and Z'Z'Z' each
independently represents a 2'-OMe modification or 2'-F
modification.
[0235] The sense strand represented by any one of the above
formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense
strand being represented by any one of formulas (IIa), (IIb),
(IIc), and (IId), respectively.
[0236] Accordingly, the RNAi agents for use in the methods of the
invention may comprise a sense strand and an antisense strand, each
strand having 14 to 30 nucleotides, the RNAi duplex represented by
formula (III):
sense: 5'n.sub.p-N.sub.a-(X X X).sub.i-N.sub.b-Y Y Y-N.sub.b-(Z Z
Z).sub.j--N.sub.a-n.sub.q 3'
antisense: 3'
n.sub.p'-N.sub.a'-(X'X'X').sub.k-N.sub.b'-Y'Y'Y'-N.sub.b'-(Z'Z'Z').sub.l--
N.sub.a'-n.sub.q'5' (III)
[0237] wherein:
[0238] j, k, and 1 are each independently 0 or 1;
[0239] p, p', q, and q' are each independently 0-6;
[0240] each N.sub.a and N.sub.a' independently represents an
oligonucleotide sequence comprising 0-25 modified nucleotides, each
sequence comprising at least two differently modified
nucleotides;
[0241] each N.sub.b and N.sub.b' independently represents an
oligonucleotide sequence comprising 0-10 modified nucleotides;
[0242] wherein
[0243] each n.sub.p', n.sub.p, n.sub.q', and n.sub.q, each of which
may or may not be present, independently represents an overhang
nucleotide; and
[0244] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently
represent one motif of three identical modifications on three
consecutive nucleotides.
[0245] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0;
or i is 0 and j is 1; or both i and j are 0; or both i and j are 1.
In another embodiment, k is 0 and 1 is 0; or k is 1 and 1 is 0; k
is 0 and 1 is 1; or both k and 1 are 0; or both k and 1 are 1.
[0246] Exemplary combinations of the sense strand and antisense
strand forming a RNAi duplex include the formulas below:
5'n.sub.p-N.sub.a-Y Y Y-N.sub.a-n.sub.q 3'
3' n.sub.p'-N.sub.a'-Y'Y'Y'-N.sub.a'n.sub.q'5' (IIIa)
5'n.sub.p-N.sub.a-Y Y Y-N.sub.b-ZZZ-N.sub.a-n.sub.q 3'
3' n.sub.p'-N.sub.a'-Y'Y'Y'-N.sub.b'-Z'Z'Z'-N.sub.a'n.sub.q'5'
(IIIb)
5'n.sub.p-N.sub.a-X X X-N.sub.b-Y Y Y -N.sub.a-n.sub.q 3'
3' n.sub.p'-N.sub.a'-X'X'X'-N.sub.b'-Y'Y'Y'-N.sub.a'-n.sub.q'5'
(IIIc)
5'n.sub.p-N.sub.a-XXX-N.sub.b-YYY-N.sub.b-Z Z Z-N.sub.a-n.sub.q
3'
3'
n.sub.p'-N.sub.a'-X'X'X'-N.sub.b'-Y'Y'Y'-N.sub.b'-Z'Z'Z'-N.sub.a-n.su-
b.q'5' (IIId)
5'-N.sub.a-Y Y Y -N.sub.a-3'
3' n.sub.p'-N.sub.a'-Y'Y'Y'-N.sub.a'5' (IIIe)
When the RNAi agent is represented by formula (IIIa), each N.sub.a
independently represents an oligonucleotide sequence comprising
2-20, 2-15, or 2-10 modified nucleotides.
[0247] When the RNAi agent is represented by formula (IIIb), each
N.sub.b independently represents an oligonucleotide sequence
comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N.sub.a
independently represents an oligonucleotide sequence comprising
2-20, 2-15, or 2-10 modified nucleotides.
[0248] When the RNAi agent is represented as formula (IIIc), each
N.sub.b, N.sub.b' independently represents an oligonucleotide
sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0
modified nucleotides. Each N.sub.a independently represents an
oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified
nucleotides.
[0249] When the RNAi agent is represented as formula (IIId), each
N.sub.b, N.sub.b' independently represents an oligonucleotide
sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0
modified nucleotides. Each N.sub.a, N.sub.a' independently
represents an oligonucleotide sequence comprising 2-20, 2-15, or
2-10 modified nucleotides. Each of N.sub.a, N.sub.a', N.sub.b and
N.sub.b' independently comprises modifications of alternating
pattern.
[0250] When the RNAi agent is represented as formula (IIId), each
N.sub.b, N.sub.b' independently represents an oligonucleotide
sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0
modified nucleotides. Each N.sub.a, N.sub.a' independently
represents an oligonucleotide sequence comprising 2-20, 2-15, or
2-10 modified nucleotides. Each of N.sub.a, N.sub.a', N.sub.b and
N.sub.b' independently comprises modifications of alternating
pattern.
[0251] When the RNAi agent is represented as formula (IIIe), each
N.sub.a and N.sub.a' independently represents an oligonucleotide
sequence comprising 0-25 nucleotides which are either modified or
unmodified or combinations thereof, each sequence comprising at
least two differently modified nucleotides.
[0252] Each of X, Y and Z in formulas (III), (IIIa), (IIIb),
(IIIc), (IIId), and (IIIe) may be the same or different from each
other.
[0253] When the RNAi agent is represented by formula (III), (IIIa),
(IIIb), (IIIc), (IIId), and (IIIe) at least one of the Y
nucleotides may form a base pair with one of the Y' nucleotides.
Alternatively, at least two of the Y nucleotides form base pairs
with the corresponding Y' nucleotides; or all three of the Y
nucleotides all form base pairs with the corresponding Y'
nucleotides.
[0254] When the RNAi agent is represented by formula (IIIb) or
(IIId), at least one of the Z nucleotides may form a base pair with
one of the Z' nucleotides. Alternatively, at least two of the Z
nucleotides form base pairs with the corresponding Z' nucleotides;
or all three of the Z nucleotides all form base pairs with the
corresponding Z' nucleotides.
[0255] When the RNAi agent is represented as formula (IIIc) or
(IIId), at least one of the X nucleotides may form a base pair with
one of the X' nucleotides. Alternatively, at least two of the X
nucleotides form base pairs with the corresponding X' nucleotides;
or all three of the X nucleotides all form base pairs with the
corresponding X' nucleotides.
[0256] In one embodiment, the modification on the Y nucleotide is
different than the modification on the Y' nucleotide, the
modification on the Z nucleotide is different than the modification
on the Z' nucleotide, and/or the modification on the X nucleotide
is different than the modification on the X' nucleotide.
[0257] In one embodiment, when the RNAi agent is represented by
formula (IIId), the N.sub.a modifications are 2'-O-methyl or
2'-fluoro modifications. In another embodiment, when the RNAi agent
is represented by formula (IIId), the N.sub.a modifications are
2'-O-methyl or 2'-fluoro modifications and n.sub.p'>0 and at
least one n.sub.p' is linked to a neighboring nucleotide a via
phosphorothioate linkage. In yet another embodiment, when the RNAi
agent is represented by formula (IIId), the N.sub.a modifications
are 2'-O-methyl or 2'-fluoro modifications, n.sub.p'>0 and at
least one n.sub.p' is linked to a neighboring nucleotide via
phosphorothioate linkage, and the sense strand is conjugated to one
or more GalNAc derivatives attached through a monovalent, a
bivalent or a trivalent branched linker. In another embodiment,
when the RNAi agent is represented by formula (IIId), the N.sub.a
modifications are 2'-O-methyl or 2'-fluoro modifications,
n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring
nucleotide via phosphorothioate linkage, the sense strand comprises
at least one phosphorothioate linkage, and the sense strand is
conjugated to one or more GalNAc derivatives attached through a
monovalent, a bivalent or a trivalent branched linker.
[0258] In one embodiment, when the RNAi agent is represented by
formula (Ma), the N.sub.a modifications are 2'-O-methyl or
2'-fluoro modifications, n.sub.p'>0 and at least one n.sub.p' is
linked to a neighboring nucleotide via phosphorothioate linkage,
the sense strand comprises at least one phosphorothioate linkage,
and the sense strand is conjugated to one or more GalNAc
derivatives attached through a monovalent, a bivalent or a
trivalent branched linker.
[0259] In one embodiment, the RNAi agent is a multimer containing
at least two duplexes represented by formula (III), (IIIa), (IIIb),
(IIIc), (IIId), and (IIIe), wherein the duplexes are connected by a
linker. The linker can be cleavable or non-cleavable. Optionally,
the multimer further comprises a ligand. Each of the duplexes can
target the same gene or two different genes; or each of the
duplexes can target same gene at two different target sites.
[0260] In one embodiment, the RNAi agent is a multimer containing
three, four, five, six or more duplexes represented by formula
(III), (IIIa), (IIIb), (IIIc), (IIId), and (IIIe), wherein the
duplexes are connected by a linker. The linker can be cleavable or
non-cleavable. Optionally, the multimer further comprises a ligand.
Each of the duplexes can target the same gene or two different
genes; or each of the duplexes can target same gene at two
different target sites.
[0261] In one embodiment, two RNAi agents represented by formula
(III), (IIIa), (IIIb), (IIIc), (IIId), and (IIIe) are linked to
each other at the 5' end, and one or both of the 3' ends and are
optionally conjugated to to a ligand. Each of the agents can target
the same gene or two different genes; or each of the agents can
target same gene at two different target sites.
[0262] Various publications describe multimeric RNAi agents that
can be used in the methods of the invention. Such publications
include WO2007/091269, U.S. Pat. No. 7,858,769, WO2010/141511,
WO2007/117686, WO2009/014887 and WO2011/031520 the entire contents
of each of which are hereby incorporated herein by reference.
[0263] The RNAi agent that contains conjugations of one or more
carbohydrate moieties to a RNAi agent can optimize one or more
properties of the RNAi agent. In many cases, the carbohydrate
moiety will be attached to a modified subunit of the RNAi agent.
For example, the ribose sugar of one or more ribonucleotide
subunits of a dsRNA agent can be replaced with another moiety,
e.g., a non-carbohydrate (preferably cyclic) carrier to which is
attached a carbohydrate ligand. A ribonucleotide subunit in which
the ribose sugar of the subunit has been so replaced is referred to
herein as a ribose replacement modification subunit (RRMS). A
cyclic carrier may be a carbocyclic ring system, i.e., all ring
atoms are carbon atoms, or a heterocyclic ring system, i.e., one or
more ring atoms may be a heteroatom, e.g., nitrogen, oxygen,
sulfur. The cyclic carrier may be a monocyclic ring system, or may
contain two or more rings, e.g. fused rings. The cyclic carrier may
be a fully saturated ring system, or it may contain one or more
double bonds.
[0264] The ligand may be attached to the polynucleotide via a
carrier. The carriers include (i) at least one "backbone attachment
point," preferably two "backbone attachment points" and (ii) at
least one "tethering attachment point." A "backbone attachment
point" as used herein refers to a functional group, e.g. a hydroxyl
group, or generally, a bond available for, and that is suitable for
incorporation of the carrier into the backbone, e.g., the
phosphate, or modified phosphate, e.g., sulfur containing,
backbone, of a ribonucleic acid. A "tethering attachment point"
(TAP) in some embodiments refers to a constituent ring atom of the
cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from
an atom which provides a backbone attachment point), that connects
a selected moiety. The moiety can be, e.g., a carbohydrate, e.g.
monosaccharide, disaccharide, trisaccharide, tetrasaccharide,
oligosaccharide and polysaccharide. Optionally, the selected moiety
is connected by an intervening tether to the cyclic carrier. Thus,
the cyclic carrier will often include a functional group, e.g., an
amino group, or generally, provide a bond, that is suitable for
incorporation or tethering of another chemical entity, e.g., a
ligand to the constituent ring.
[0265] The RNAi agents may be conjugated to a ligand via a carrier,
wherein the carrier can be cyclic group or acyclic group;
preferably, the cyclic group is selected from pyrrolidinyl,
pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl,
piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl,
isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl,
quinoxalinyl, pyridazinonyl, tetrahydrofuryl and and decalin;
preferably, the acyclic group is selected from serinol backbone or
diethanolamine backbone.
[0266] In certain specific embodiments, the RNAi agent for use in
the methods of the invention is an agent selected from the group of
agents listed in any one of Tables 3A, 3B, 4A, 4B, 6, and 7. These
agents may further comprise a ligand.
IV. iRNAs Conjugated to Ligands
[0267] Another modification of the RNA of an iRNA of the invention
involves chemically linking to the RNA one or more ligands,
moieties or conjugates that enhance the activity, cellular
distribution or cellular uptake of the iRNA. Such moieties include
but are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:
6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let.,
1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309;
Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a
thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992,
20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl
residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118;
Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al.,
Biochimie, 1993, 75:49-54), a phospholipid, e.g.,
di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995,
14:969-973), or adamantane acetic acid (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra
et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an
octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke
et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0268] In one embodiment, a ligand alters the distribution,
targeting or lifetime of an iRNA agent into which it is
incorporated. In preferred embodiments a ligand provides an
enhanced affinity for a selected target, e.g., molecule, cell or
cell type, compartment, e.g., a cellular or organ compartment,
tissue, organ or region of the body, as, e.g., compared to a
species absent such a ligand. Preferred ligands will not take part
in duplex pairing in a duplexed nucleic acid.
[0269] Ligands can include a naturally occurring substance, such as
a protein (e.g., human serum albumin (HSA), low-density lipoprotein
(LDL), or globulin); carbohydrate (e.g., a dextran, pullulan,
chitin, chitosan, inulin, cyclodextrin, N-acetylgalactosamine, or
hyaluronic acid); or a lipid. The ligand can also be a recombinant
or synthetic molecule, such as a synthetic polymer, e.g., a
synthetic polyamino acid. Examples of polyamino acids include
polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly
L-glutamic acid, styrene-maleic acid anhydride copolymer,
poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic
anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer
(HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA),
polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide
polymers, or polyphosphazine. Example of polyamines include:
polyethylenimine, polylysine (PLL), spermine, spermidine,
polyamine, pseudopeptide-polyamine, peptidomimetic polyamine,
dendrimer polyamine, arginine, amidine, protamine, cationic lipid,
cationic porphyrin, quaternary salt of a polyamine, or an alpha
helical peptide.
[0270] Ligands can also include targeting groups, e.g., a cell or
tissue targeting agent, e.g., a lectin, glycoprotein, lipid or
protein, e.g., an antibody, that binds to a specified cell type
such as a kidney cell. A targeting group can be a thyrotropin,
melanotropin, lectin, glycoprotein, surfactant protein A, Mucin
carbohydrate, multivalent lactose, monovalent or multivalent
galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent
mannose, multivalent fucose, glycosylated polyaminoacids,
transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid,
cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A,
biotin, or an RGD peptide or RGD peptide mimetic. In certain
embodiments, ligands include monovalent or multivalent galactose.
In certain embodiments, ligands include cholesterol.
[0271] Other examples of ligands include dyes, intercalating agents
(e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C),
porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic
hydrocarbons (e.g., phenazine, dihydrophenazine), artificial
endonucleases (e.g. EDTA), lipophilic molecules, e.g., cholesterol,
cholic acid, adamantane acetic acid, 1-pyrene butyric acid,
dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl
group, hexadecylglycerol, borneol, menthol, 1,3-propanediol,
heptadecyl group, palmitic acid, myristic
acid,O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid,
dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g.,
antennapedia peptide, Tat peptide), alkylating agents, phosphate,
amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino,
alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens
(e.g. biotin), transport/absorption facilitators (e.g., aspirin,
vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole,
bisimidazole, histamine, imidazole clusters, acridine-imidazole
conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl,
HRP, or AP.
[0272] Ligands can be proteins, e.g., glycoproteins, or peptides,
e.g., molecules having a specific affinity for a co-ligand, or
antibodies e.g., an antibody, that binds to a specified cell type
such as a hepatic cell. Ligands can also include hormones and
hormone receptors. They can also include non-peptidic species, such
as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent
lactose, multivalent galactose, N-acetyl-galactosamine,
N-acetyl-gulucosamine multivalent mannose, or multivalent fucose.
The ligand can be, for example, a lipopolysaccharide, an activator
of p38 MAP kinase, or an activator of NF-.kappa.B.
[0273] The ligand can be a substance, e.g., a drug, which can
increase the uptake of the iRNA agent into the cell, for example,
by disrupting the cell's cytoskeleton, e.g., by disrupting the
cell's microtubules, microfilaments, and/or intermediate filaments.
The drug can be, for example, taxon, vincristine, vinblastine,
cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin,
swinholide A, indanocine, or myoservin.
[0274] In some embodiments, a ligand attached to an iRNA as
described herein acts as a pharmacokinetic modulator (PK
modulator). PK modulators include lipophiles, bile acids, steroids,
phospholipid analogues, peptides, protein binding agents, PEG,
vitamins etc. Exemplary PK modulators include, but are not limited
to, cholesterol, fatty acids, cholic acid, lithocholic acid,
dialkylglycerides, diacylglyceride, phospholipids, sphingolipids,
naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that
comprise a number of phosphorothioate linkages are also known to
bind to serum protein, thus short oligonucleotides, e.g.,
oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases,
comprising multiple of phosphorothioate linkages in the backbone
are also amenable to the present invention as ligands (e.g. as PK
modulating ligands). In addition, aptamers that bind serum
components (e.g. serum proteins) are also suitable for use as PK
modulating ligands in the embodiments described herein.
[0275] Ligand-conjugated oligonucleotides of the invention may be
synthesized by the use of an oligonucleotide that bears a pendant
reactive functionality, such as that derived from the attachment of
a linking molecule onto the oligonucleotide (described below). This
reactive oligonucleotide may be reacted directly with
commercially-available ligands, ligands that are synthesized
bearing any of a variety of protecting groups, or ligands that have
a linking moiety attached thereto.
[0276] The oligonucleotides used in the conjugates of the present
invention may be conveniently and routinely made through the
well-known technique of solid-phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is also known to use similar techniques to prepare
other oligonucleotides, such as the phosphorothioates and alkylated
derivatives.
[0277] In the ligand-conjugated oligonucleotides and
ligand-molecule bearing sequence-specific linked nucleosides of the
present invention, the oligonucleotides and oligonucleosides may be
assembled on a suitable DNA synthesizer utilizing standard
nucleotide or nucleoside precursors, or nucleotide or nucleoside
conjugate precursors that already bear the linking moiety,
ligand-nucleotide or nucleoside-conjugate precursors that already
bear the ligand molecule, or non-nucleoside ligand-bearing building
blocks.
[0278] When using nucleotide-conjugate precursors that already bear
a linking moiety, the synthesis of the sequence-specific linked
nucleosides is typically completed, and the ligand molecule is then
reacted with the linking moiety to form the ligand-conjugated
oligonucleotide. In some embodiments, the oligonucleotides or
linked nucleosides of the present invention are synthesized by an
automated synthesizer using phosphoramidites derived from
ligand-nucleoside conjugates in addition to the standard
phosphoramidites and non-standard phosphoramidites that are
commercially available and routinely used in oligonucleotide
synthesis.
[0279] A. Lipid Conjugates
[0280] In one embodiment, the ligand or conjugate is a lipid or
lipid-based molecule. Such a lipid or lipid-based molecule
preferably binds a serum protein, e.g., human serum albumin (HSA).
An HSA binding ligand allows for distribution of the conjugate to a
target tissue, e.g., a non-kidney target tissue of the body. For
example, the target tissue can be the liver, including parenchymal
cells of the liver. Other molecules that can bind HSA can also be
used as ligands. For example, naproxen or aspirin can be used. A
lipid or lipid-based ligand can (a) increase resistance to
degradation of the conjugate, (b) increase targeting or transport
into a target cell or cell membrane, and/or (c) can be used to
adjust binding to a serum protein, e.g., HSA.
[0281] A lipid based ligand can be used to inhibit, e.g., control
the binding of the conjugate to a target tissue. For example, a
lipid or lipid-based ligand that binds to HSA more strongly will be
less likely to be targeted to the kidney and therefore less likely
to be cleared from the body. A lipid or lipid-based ligand that
binds to HSA less strongly can be used to target the conjugate to
the kidney.
[0282] In a preferred embodiment, the lipid based ligand binds HSA.
Preferably, it binds HSA with a sufficient affinity such that the
conjugate will be preferably distributed to a non-kidney tissue.
However, it is preferred that the affinity not be so strong that
the HSA-ligand binding cannot be reversed.
[0283] In another preferred embodiment, the lipid based ligand
binds HSA weakly or not at all, such that the conjugate will be
preferably distributed to the kidney. Other moieties that target to
kidney cells can also be used in place of or in addition to the
lipid based ligand.
[0284] In another aspect, the ligand is a moiety, e.g., a vitamin,
which is taken up by a target cell, e.g., a proliferating cell.
These are particularly useful for treating disorders characterized
by unwanted cell proliferation, e.g., of the malignant or
non-malignant type, e.g., cancer cells. Exemplary vitamins include
vitamin A, E, and K. Other exemplary vitamins include are B
vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or
other vitamins or nutrients taken up by target cells such as liver
cells. Also included are HSA and low density lipoprotein (LDL).
[0285] B. Cell Permeation Agents
[0286] In another aspect, the ligand is a cell-permeation agent,
preferably a helical cell-permeation agent. Preferably, the agent
is amphipathic. An exemplary agent is a peptide such as tat or
antennopedia. If the agent is a peptide, it can be modified,
including a peptidylmimetic, invertomers, non-peptide or
pseudo-peptide linkages, and use of D-amino acids. The helical
agent is preferably an alpha-helical agent, which preferably has a
lipophilic and a lipophobic phase.
[0287] The ligand can be a peptide or peptidomimetic. A
peptidomimetic (also referred to herein as an oligopeptidomimetic)
is a molecule capable of folding into a defined three-dimensional
structure similar to a natural peptide. The attachment of peptide
and peptidomimetics to iRNA agents can affect pharmacokinetic
distribution of the iRNA, such as by enhancing cellular recognition
and absorption. The peptide or peptidomimetic moiety can be about
5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40,
45, or 50 amino acids long.
[0288] A peptide or peptidomimetic can be, for example, a cell
permeation peptide, cationic peptide, amphipathic peptide, or
hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or
Phe). The peptide moiety can be a dendrimer peptide, constrained
peptide or crosslinked peptide. In another alternative, the peptide
moiety can include a hydrophobic membrane translocation sequence
(MTS). An exemplary hydrophobic MTS-containing peptide is RFGF
having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 9). An
RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:
10) containing a hydrophobic MTS can also be a targeting moiety.
The peptide moiety can be a "delivery" peptide, which can carry
large polar molecules including peptides, oligonucleotides, and
protein across cell membranes. For example, sequences from the HIV
Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 11) and the Drosophila
Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 12) have been
found to be capable of functioning as delivery peptides. A peptide
or peptidomimetic can be encoded by a random sequence of DNA, such
as a peptide identified from a phage-display library, or
one-bead-one-compound (OBOC) combinatorial library (Lam et al.,
Nature, 354:82-84, 1991). Examples of a peptide or peptidomimetic
tethered to a dsRNA agent via an incorporated monomer unit for cell
targeting purposes is an arginine-glycine-aspartic acid
(RGD)-peptide, or RGD mimic. A peptide moiety can range in length
from about 5 amino acids to about 40 amino acids. The peptide
moieties can have a structural modification, such as to increase
stability or direct conformational properties. Any of the
structural modifications described below can be utilized.
[0289] An RGD peptide for use in the compositions and methods of
the invention may be linear or cyclic, and may be modified, e.g.,
glycosylated or methylated, to facilitate targeting to a specific
tissue(s). RGD-containing peptides and peptidiomimemtics may
include D-amino acids, as well as synthetic RGD mimics. In addition
to RGD, one can use other moieties that target the integrin ligand.
Preferred conjugates of this ligand target PECAM-1 or VEGF.
[0290] A "cell permeation peptide" is capable of permeating a cell,
e.g., a microbial cell, such as a bacterial or fungal cell, or a
mammalian cell, such as a human cell. A microbial cell-permeating
peptide can be, for example, a .alpha.-helical linear peptide
(e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide
(e.g., .alpha.-defensin, .beta.-defensin or bactenecin), or a
peptide containing only one or two dominating amino acids (e.g.,
PR-39 or indolicidin). A cell permeation peptide can also include a
nuclear localization signal (NLS). For example, a cell permeation
peptide can be a bipartite amphipathic peptide, such as MPG, which
is derived from the fusion peptide domain of HIV-1 gp41 and the NLS
of SV40 large T antigen (Simeoni et al., Nucl. Acids Res.
31:2717-2724, 2003).
[0291] C. Carbohydrate Conjugates
[0292] In some embodiments of the compositions and methods of the
invention, an iRNA oligonucleotide further comprises a
carbohydrate. The carbohydrate conjugated iRNA are advantageous for
the in vivo delivery of nucleic acids, as well as compositions
suitable for in vivo therapeutic use, as described herein. As used
herein, "carbohydrate" refers to a compound which is either a
carbohydrate per se made up of one or more monosaccharide units
having at least 6 carbon atoms (which can be linear, branched or
cyclic) with an oxygen, nitrogen or sulfur atom bonded to each
carbon atom; or a compound having as a part thereof a carbohydrate
moiety made up of one or more monosaccharide units each having at
least six carbon atoms (which can be linear, branched or cyclic),
with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
Representative carbohydrates include the sugars (mono-, di-, tri-
and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9
monosaccharide units), and polysaccharides such as starches,
glycogen, cellulose and polysaccharide gums. Specific
monosaccharides include C5 and above (e.g., C5, C6, C7, or C8)
sugars; di- and trisaccharides include sugars having two or three
monosaccharide units (e.g., C5, C6, C7, or C8).
[0293] In one embodiment, a carbohydrate conjugate for use in the
compositions and methods of the invention is a monosaccharide. In
another embodiment, a carbohydrate conjugate for use in the
compositions and methods of the invention is selected from the
group consisting of:
##STR00003## ##STR00004## ##STR00005## ##STR00006##
[0294] In one embodiment, the monosaccharide is an
N-acetylgalactosamine, such as
##STR00007##
[0295] Another representative carbohydrate conjugate for use in the
embodiments described herein includes, but is not limited to,
##STR00008##
[0296] when one of X or Y is an oligonucleotide, the other is a
hydrogen.
[0297] In certain embodiments of the invention, the GalNAc or
GalNAc derivative is attached to an iRNA agent of the invention via
a monovalent linker. In some embodiments, the GalNAc or GalNAc
derivative is attached to an iRNA agent of the invention via a
bivalent linker. In yet other embodiments of the invention, the
GalNAc or GalNAc derivative is attached to an iRNA agent of the
invention via a trivalent linker.
[0298] In one embodiment, the double stranded RNAi agents of the
invention comprise one GalNAc or GalNAc derivative attached to the
iRNA agent. In another embodiment, the double stranded RNAi agents
of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6)
GalNAc or GalNAc derivatives, each independently attached to a
plurality of nucleotides of the double stranded RNAi agent through
a plurality of monovalent linkers.
[0299] In some embodiments, for example, when the two strands of an
iRNA agent of the invention are part of one larger molecule
connected by an uninterrupted chain of nucleotides between the
3'-end of one strand and the 5'-end of the respective other strand
forming a hairpin loop comprising, a plurality of unpaired
nucleotides, each unpaired nucleotide within the hairpin loop may
independently comprise a GalNAc or GalNAc derivative attached via a
monovalent linker. The hairpin loop may also be formed by an
extended overhang in one strand of the duplex.
[0300] In some embodiments, the carbohydrate conjugate further
comprises one or more additional ligands as described above, such
as, but not limited to, a PK modulator and/or a cell permeation
peptide.
[0301] Additional carbohydrate conjugates suitable for use in the
present invention include those described in PCT Publication Nos.
WO 2014/179620 and WO 2014/179627, the entire contents of each of
which are incorporated herein by reference.
[0302] D. Linkers
[0303] In some embodiments, the conjugate or ligand described
herein can be attached to an iRNA oligonucleotide with various
linkers that can be cleavable or non-cleavable.
[0304] The term "linker" or "linking group" means an organic moiety
that connects two parts of a compound, e.g., covalently attaches
two parts of a compound. Linkers typically comprise a direct bond
or an atom such as oxygen or sulfur, a unit such as NRB, C(O),
C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but
not limited to, substituted or unsubstituted alkyl, substituted or
unsubstituted alkenyl, substituted or unsubstituted alkynyl,
arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl,
heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl,
heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl,
heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl,
alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl,
alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl,
alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl,
alkylheteroarylalkenyl, alkylheteroarylalkynyl,
alkenylheteroarylalkyl, alkenylheteroarylalkenyl,
alkenylheteroarylalkynyl, alkynylheteroarylalkyl,
alkynylheteroarylalkenyl, alkynylheteroarylalkynyl,
alkylheterocyclylalkyl, alkylheterocyclylalkenyl,
alkylhererocyclylalkynyl, alkenylheterocyclylalkyl,
alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl,
alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl,
alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl,
alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or
more methylenes can be interrupted or terminated by O, S, S(O),
SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl,
substituted or unsubstituted heteroaryl, substituted or
unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic
or substituted aliphatic. In one embodiment, the linker is between
about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18
atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
[0305] A cleavable linking group is one which is sufficiently
stable outside the cell, but which upon entry into a target cell is
cleaved to release the two parts the linker is holding together. In
a preferred embodiment, the cleavable linking group is cleaved at
least about 10 times, 20, times, 30 times, 40 times, 50 times, 60
times, 70 times, 80 times, 90 times or more, or at least about 100
times faster in a target cell or under a first reference condition
(which can, e.g., be selected to mimic or represent intracellular
conditions) than in the blood of a subject, or under a second
reference condition (which can, e.g., be selected to mimic or
represent conditions found in the blood or serum).
[0306] Cleavable linking groups are susceptible to cleavage agents,
e.g., pH, redox potential or the presence of degradative molecules.
Generally, cleavage agents are more prevalent or found at higher
levels or activities inside cells than in serum or blood. Examples
of such degradative agents include: redox agents which are selected
for particular substrates or which have no substrate specificity,
including, e.g., oxidative or reductive enzymes or reductive agents
such as mercaptans, present in cells, that can degrade a redox
cleavable linking group by reduction; esterases; endosomes or
agents that can create an acidic environment, e.g., those that
result in a pH of five or lower; enzymes that can hydrolyze or
degrade an acid cleavable linking group by acting as a general
acid, peptidases (which can be substrate specific), and
phosphatases.
[0307] A cleavable linkage group, such as a disulfide bond can be
susceptible to pH. The pH of human serum is 7.4, while the average
intracellular pH is slightly lower, ranging from about 7.1-7.3.
Endosomes have a more acidic pH, in the range of 5.5-6.0, and
lysosomes have an even more acidic pH at around 5.0. Some linkers
will have a cleavable linking group that is cleaved at a preferred
pH, thereby releasing a cationic lipid from the ligand inside the
cell, or into the desired compartment of the cell.
[0308] A linker can include a cleavable linking group that is
cleavable by a particular enzyme. The type of cleavable linking
group incorporated into a linker can depend on the cell to be
targeted. For example, a liver-targeting ligand can be linked to a
cationic lipid through a linker that includes an ester group. Liver
cells are rich in esterases, and therefore the linker will be
cleaved more efficiently in liver cells than in cell types that are
not esterase-rich. Other cell-types rich in esterases include cells
of the lung, renal cortex, and testis.
[0309] Linkers that contain peptide bonds can be used when
targeting cell types rich in peptidases, such as liver cells and
synoviocytes.
[0310] In general, the suitability of a candidate cleavable linking
group can be evaluated by testing the ability of a degradative
agent (or condition) to cleave the candidate linking group. It will
also be desirable to also test the candidate cleavable linking
group for the ability to resist cleavage in the blood or when in
contact with other non-target tissue. Thus, one can determine the
relative susceptibility to cleavage between a first and a second
condition, where the first is selected to be indicative of cleavage
in a target cell and the second is selected to be indicative of
cleavage in other tissues or biological fluids, e.g., blood or
serum. The evaluations can be carried out in cell free systems, in
cells, in cell culture, in organ or tissue culture, or in whole
animals. It can be useful to make initial evaluations in cell-free
or culture conditions and to confirm by further evaluations in
whole animals. In preferred embodiments, useful candidate compounds
are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80,
90, or about 100 times faster in the cell (or under in vitro
conditions selected to mimic intracellular conditions) as compared
to blood or serum (or under in vitro conditions selected to mimic
extracellular conditions).
[0311] i. Redox Cleavable Linking Groups
[0312] In one embodiment, a cleavable linking group is a redox
cleavable linking group that is cleaved upon reduction or
oxidation. An example of reductively cleavable linking group is a
disulphide linking group (--S--S--). To determine if a candidate
cleavable linking group is a suitable "reductively cleavable
linking group," or for example is suitable for use with a
particular iRNA moiety and particular targeting agent one can look
to methods described herein. For example, a candidate can be
evaluated by incubation with dithiothreitol (DTT), or other
reducing agent using reagents know in the art, which mimic the rate
of cleavage which would be observed in a cell, e.g., a target cell.
The candidates can also be evaluated under conditions which are
selected to mimic blood or serum conditions. In one, candidate
compounds are cleaved by at most about 10% in the blood. In other
embodiments, useful candidate compounds are degraded at least about
2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster
in the cell (or under in vitro conditions selected to mimic
intracellular conditions) as compared to blood (or under in vitro
conditions selected to mimic extracellular conditions). The rate of
cleavage of candidate compounds can be determined using standard
enzyme kinetics assays under conditions chosen to mimic
intracellular media and compared to conditions chosen to mimic
extracellular media.
[0313] ii. Phosphate-Based Cleavable Linking Groups
[0314] In another embodiment, a cleavable linker comprises a
phosphate-based cleavable linking group. A phosphate-based
cleavable linking group is cleaved by agents that degrade or
hydrolyze the phosphate group. An example of an agent that cleaves
phosphate groups in cells are enzymes such as phosphatases in
cells. Examples of phosphate-based linking groups are
--O--P(O)(ORk)-O--, --O--P(S)(ORk)-O--, --O--P(S)(SRk)-O--,
--S--P(O)(ORk)-O--, --O--P(O)(ORk)-S--, --S--P(O)(ORk)-S--,
--O--P(S)(ORk)-S--, --S--P(S)(ORk)-O--, --O--P(O)(Rk)-O--,
--O--P(S)(Rk)-O--, --S--P(O)(Rk)-O--, --S--P(S)(Rk)-O--,
--S--P(O)(Rk)-S--, --O--P(S)(Rk)-S--. Preferred embodiments are
--O--P(O)(OH)--O--, --O--P(S)(OH)--O--, --O--P(S)(SH)--O--,
--S--P(O)(OH)--O--, --O--P(O)(OH)--S--, --S--P(O)(OH)--S--,
--O--P(S)(OH)--S--, --S--P(S)(OH)--O--, --O--P(O)(H)--O--,
--O--P(S)(H)--O--, --S--P(O)(H)--O, --S--P(S)(H)--O--,
--S--P(O)(H)--S--, --O--P(S)(H)--S--. A preferred embodiment is
--O--P(O)(OH)--O--. These candidates can be evaluated using methods
analogous to those described above.
[0315] iii. Acid Cleavable Linking Groups
[0316] In another embodiment, a cleavable linker comprises an acid
cleavable linking group. An acid cleavable linking group is a
linking group that is cleaved under acidic conditions. In preferred
embodiments acid cleavable linking groups are cleaved in an acidic
environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75,
5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can
act as a general acid. In a cell, specific low pH organelles, such
as endosomes and lysosomes can provide a cleaving environment for
acid cleavable linking groups. Examples of acid cleavable linking
groups include but are not limited to hydrazones, esters, and
esters of amino acids. Acid cleavable groups can have the general
formula --C.dbd.NN--, C(O)O, or -OC(O). A preferred embodiment is
when the carbon attached to the oxygen of the ester (the alkoxy
group) is an aryl group, substituted alkyl group, or tertiary alkyl
group such as dimethyl pentyl or t-butyl. These candidates can be
evaluated using methods analogous to those described above.
[0317] iv. Ester-Based Linking Groups
[0318] In another embodiment, a cleavable linker comprises an
ester-based cleavable linking group. An ester-based cleavable
linking group is cleaved by enzymes such as esterases and amidases
in cells. Examples of ester-based cleavable linking groups include
but are not limited to esters of alkylene, alkenylene and
alkynylene groups. Ester cleavable linking groups have the general
formula --C(O)O--, or -OC(O)--. These candidates can be evaluated
using methods analogous to those described above.
[0319] v. Peptide-Based Cleaving Groups
[0320] In yet another embodiment, a cleavable linker comprises a
peptide-based cleavable linking group. A peptide-based cleavable
linking group is cleaved by enzymes such as peptidases and
proteases in cells. Peptide-based cleavable linking groups are
peptide bonds formed between amino acids to yield oligopeptides
(e.g., dipeptides, tripeptides etc.) and polypeptides.
Peptide-based cleavable groups do not include the amide group
(--C(O)NH--). The amide group can be formed between any alkylene,
alkenylene or alkynelene. A peptide bond is a special type of amide
bond formed between amino acids to yield peptides and proteins. The
peptide based cleavage group is generally limited to the peptide
bond (i.e., the amide bond) formed between amino acids yielding
peptides and proteins and does not include the entire amide
functional group. Peptide-based cleavable linking groups have the
general formula --NHCHRAC(O)NHCHRBC(O)--, where RA and RB are the R
groups of the two adjacent amino acids. These candidates can be
evaluated using methods analogous to those described above.
[0321] In one embodiment, an iRNA of the invention is conjugated to
a carbohydrate through a linker. Non-limiting examples of iRNA
carbohydrate conjugates with linkers of the compositions and
methods of the invention include, but are not limited to,
##STR00009## ##STR00010## ##STR00011##
[0322] when one of X or Y is an oligonucleotide, the other is a
hydrogen.
[0323] In certain embodiments of the compositions and methods of
the invention, a ligand is one or more "GalNAc"
(N-acetylgalactosamine) derivatives attached through a bivalent or
trivalent branched linker.
[0324] In one embodiment, a dsRNA of the invention is conjugated to
a bivalent or trivalent branched linker selected from the group of
structures shown in any of formula (XXXII)-(XXXV):
##STR00012##
wherein:
[0325] q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent
independently for each occurrence 0-20 and wherein the repeating
unit can be the same or different;
[0326] P.sup.2A, P.sup.2B, P.sup.3A, P.sup.3B, P.sup.4A, P.sup.4B,
P.sup.5A, P.sup.5B, P.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A,
T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each
independently for each occurrence absent, CO, NH, O, S, OC(O),
NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2P;
[0327] Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B,
Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence
absent, alkylene, substituted alkylene wherein one or more
methylenes can be interrupted or terminated by one or more of O, S,
S(O), SO.sub.2, N(R.sup.N), C(R').dbd.C(R''), CC or C(O);
[0328] R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B,
R.sup.5A, R.sup.5B, R.sup.5C are each independently for each
occurrence absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH,
NHCH(R.sup.a)C(O), --C(O)--CH(R.sup.a)--NH--, CO, CH.dbd.N--O,
##STR00013##
or heterocyclyl;
[0329] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B,
L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each
independently for each occurrence a monosaccharide (such as
GalNAc), disaccharide, trisaccharide, tetrasaccharide,
oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid
side chain. Trivalent conjugating GalNAc derivatives are
particularly useful for use with RNAi agents for inhibiting the
expression of a target gene, such as those of formula (XXXV):
##STR00014##
[0330] wherein L.sup.5A, L.sup.5B and L.sup.5C represent a
monosaccharide, such as GalNAc derivative.
[0331] Examples of suitable bivalent and trivalent branched linker
groups conjugating GalNAc derivatives include, but are not limited
to, the structures recited above as formulas II, VII, XI, X, and
XIII.
[0332] Representative U.S. patents that teach the preparation of
RNA conjugates include, but are not limited to, U.S. Pat. Nos.
4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730;
5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802;
5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046;
4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941;
4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963;
5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469;
5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241,
5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785;
5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726;
5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664;
6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022,
the entire contents of each of which are hereby incorporated herein
by reference.
[0333] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications can be incorporated in a single
compound or even at a single nucleoside within an iRNA. The present
invention also includes iRNA compounds that are chimeric
compounds.
[0334] "Chimeric" iRNA compounds or "chimeras," in the context of
this invention, are iRNA compounds, preferably dsRNAs, which
contain two or more chemically distinct regions, each made up of at
least one monomer unit, i.e., a nucleotide in the case of a dsRNA
compound. These iRNAs typically contain at least one region wherein
the RNA is modified so as to confer upon the iRNA increased
resistance to nuclease degradation, increased cellular uptake,
and/or increased binding affinity for the target nucleic acid. An
additional region of the iRNA can serve as a substrate for enzymes
capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example,
RNase H is a cellular endonuclease which cleaves the RNA strand of
an RNA:DNA duplex. Activation of RNase H, therefore, results in
cleavage of the RNA target, thereby greatly enhancing the
efficiency of iRNA inhibition of gene expression. Consequently,
comparable results can often be obtained with shorter iRNAs when
chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs
hybridizing to the same target region. Cleavage of the RNA target
can be routinely detected by gel electrophoresis and, if necessary,
associated nucleic acid hybridization techniques known in the
art.
[0335] In certain instances, the RNA of an iRNA can be modified by
a non-ligand group. A number of non-ligand molecules have been
conjugated to iRNAs in order to enhance the activity, cellular
distribution or cellular uptake of the iRNA, and procedures for
performing such conjugations are available in the scientific
literature. Such non-ligand moieties have included lipid moieties,
such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm.,
2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem.
Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan
et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol
(Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic
chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et
al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990,
259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res.,
1990, 18:3777), a polyamine or a polyethylene glycol chain
(Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or
adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995,
36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta,
1995, 1264:229), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277:923). Representative United States
patents that teach the preparation of such RNA conjugates have been
listed above. Typical conjugation protocols involve the synthesis
of an RNAs bearing an aminolinker at one or more positions of the
sequence. The amino group is then reacted with the molecule being
conjugated using appropriate coupling or activating reagents. The
conjugation reaction can be performed either with the RNA still
bound to the solid support or following cleavage of the RNA, in
solution phase. Purification of the RNA conjugate by HPLC typically
affords the pure conjugate.
V. Delivery of an iRNA of the Invention
[0336] The delivery of an iRNA of the invention to a cell e.g., a
cell within a subject, such as a human subject (e.g., a subject in
need thereof, such as a subject having a APCS-associated disease as
described herein) can be achieved in a number of different ways.
For example, delivery may be performed by contacting a cell with an
iRNA of the invention either in vitro or in vivo. In vivo delivery
may also be performed directly by administering a composition
comprising an iRNA, e.g., a dsRNA, to a subject. Alternatively, in
vivo delivery may be performed indirectly by administering one or
more vectors that encode and direct the expression of the iRNA.
These alternatives are discussed further below.
[0337] In general, any method of delivering a nucleic acid molecule
(in vitro or in vivo) can be adapted for use with an iRNA of the
invention (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell.
Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by
reference in their entireties). For in vivo delivery, factors to
consider in order to deliver an iRNA molecule include, for example,
biological stability of the delivered molecule, prevention of
non-specific effects, and accumulation of the delivered molecule in
the target tissue. The non-specific effects of an iRNA can be
minimized by local administration, for example, by direct injection
or implantation into a tissue or topically administering the
preparation. Local administration to a treatment site maximizes
local concentration of the agent, limits the exposure of the agent
to systemic tissues that can otherwise be harmed by the agent or
that can degrade the agent, and permits a lower total dose of the
iRNA molecule to be administered. Several studies have shown
successful knockdown of gene products when an iRNA is administered
locally. For example, intraocular delivery of a VEGF dsRNA by
intravitreal injection in cynomolgus monkeys (Tolentino, M J., et
al (2004) Retina 24:132-138) and subretinal injections in mice
(Reich, S J., et al (2003) Mol. Vis. 9:210-216) were both shown to
prevent neovascularization in an experimental model of age-related
macular degeneration. In addition, direct intratumoral injection of
a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol.
Ther. 11:267-274) and can prolong survival of tumor-bearing mice
(Kim, W J., et al (2006) Mol. Ther. 14:343-350; Li, S., et al
(2007) Mol. Ther. 15:515-523). RNA interference has also shown
success with local delivery to the CNS by direct injection (Dorn,
G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005)
Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18;
Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E
R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275;
Akaneya, Y., et al (2005) J. Neurophysiol. 93:594-602) and to the
lungs by intranasal administration (Howard, K A., et al (2006) Mol.
Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem.
279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For
administering an iRNA systemically for the treatment of a disease,
the RNA can be modified or alternatively delivered using a drug
delivery system; both methods act to prevent the rapid degradation
of the dsRNA by endo- and exo-nucleases in vivo. Modification of
the RNA or the pharmaceutical carrier can also permit targeting of
the iRNA composition to the target tissue and avoid undesirable
off-target effects. iRNA molecules can be modified by chemical
conjugation to lipophilic groups such as cholesterol to enhance
cellular uptake and prevent degradation. For example, an iRNA
directed against ApoB conjugated to a lipophilic cholesterol moiety
was injected systemically into mice and resulted in knockdown of
apoB mRNA in both the liver and jejunum (Soutschek, J., et al
(2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer
has been shown to inhibit tumor growth and mediate tumor regression
in a mouse model of prostate cancer (McNamara, J O., et al (2006)
Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the
iRNA can be delivered using drug delivery systems such as a
nanoparticle, a dendrimer, a polymer, liposomes, or a cationic
delivery system. Positively charged cationic delivery systems
facilitate binding of an iRNA molecule (negatively charged) and
also enhance interactions at the negatively charged cell membrane
to permit efficient uptake of an iRNA by the cell. Cationic lipids,
dendrimers, or polymers can either be bound to an iRNA, or induced
to form a vesicle or micelle (see e.g., Kim S H., et al (2008)
Journal of Controlled Release 129(2):107-116) that encases an iRNA.
The formation of vesicles or micelles further prevents degradation
of the iRNA when administered systemically. Methods for making and
administering cationic-iRNA complexes are well within the abilities
of one skilled in the art (see e.g., Sorensen, D R., et al (2003)
J. Mol. Biol 327:761-766; Verma, U N., et al (2003) Clin. Cancer
Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens.
25:197-205, which are incorporated herein by reference in their
entirety). Some non-limiting examples of drug delivery systems
useful for systemic delivery of iRNAs include DOTAP (Sorensen, D
R., et al (2003), supra; Verma, U N., et al (2003), supra),
Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T
S., et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y., et
al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int
J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E., et al
(2008) Pharm. Res. Aug. 16 Epub ahead of print; Aigner, A. (2006)
J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S.
(2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A.,
et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999)
Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a
complex with cyclodextrin for systemic administration. Methods for
administration and pharmaceutical compositions of iRNAs and
cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is
herein incorporated by reference in its entirety.
[0338] A. Vector Encoded iRNAs of the Invention
[0339] iRNA targeting a APCS gene can be expressed from
transcription units inserted into DNA or RNA vectors (see, e.g.,
Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al.,
International PCT Publication No. WO 00/22113, Conrad,
International PCT Publication No. WO 00/22114, and Conrad, U.S.
Pat. No. 6,054,299). Expression can be transient (on the order of
hours to weeks) or sustained (weeks to months or longer), depending
upon the specific construct used and the target tissue or cell
type. These transgenes can be introduced as a linear construct, a
circular plasmid, or a viral vector, which can be an integrating or
non-integrating vector. The transgene can also be constructed to
permit it to be inherited as an extrachromosomal plasmid (Gassmann,
et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
[0340] The individual strand or strands of an iRNA can be
transcribed from a promoter on an expression vector. Where two
separate strands are to be expressed to generate, for example, a
dsRNA, two separate expression vectors can be co-introduced (e.g.,
by transfection or infection) into a target cell. Alternatively
each individual strand of a dsRNA can be transcribed by promoters
both of which are located on the same expression plasmid. In one
embodiment, a dsRNA is expressed as inverted repeat polynucleotides
joined by a linker polynucleotide sequence such that the dsRNA has
a stem and loop structure.
[0341] iRNA expression vectors are generally DNA plasmids or viral
vectors. Expression vectors compatible with eukaryotic cells,
preferably those compatible with vertebrate cells, can be used to
produce recombinant constructs for the expression of an iRNA as
described herein. Eukaryotic cell expression vectors are well known
in the art and are available from a number of commercial sources.
Typically, such vectors are provided containing convenient
restriction sites for insertion of the desired nucleic acid
segment. Delivery of iRNA expressing vectors can be systemic, such
as by intravenous or intramuscular administration, by
administration to target cells ex-planted from the patient followed
by reintroduction into the patient, or by any other means that
allows for introduction into a desired target cell.
[0342] iRNA expression plasmids can be transfected into target
cells as a complex with cationic lipid carriers (e.g.,
Oligofectamine) or non-cationic lipid-based carriers (e.g.,
Transit-TKO.TM.). Multiple lipid transfections for iRNA-mediated
knockdowns targeting different regions of a target RNA over a
period of a week or more are also contemplated by the invention.
Successful introduction of vectors into host cells can be monitored
using various known methods. For example, transient transfection
can be signaled with a reporter, such as a fluorescent marker, such
as Green Fluorescent Protein (GFP). Stable transfection of cells ex
vivo can be ensured using markers that provide the transfected cell
with resistance to specific environmental factors (e.g.,
antibiotics and drugs), such as hygromycin B resistance.
[0343] Viral vector systems which can be utilized with the methods
and compositions described herein include, but are not limited to,
(a) adenovirus vectors; (b) retrovirus vectors, including but not
limited to lentiviral vectors, moloney murine leukemia virus, etc.;
(c) adeno-associated virus vectors; (d) herpes simplex virus
vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g)
papilloma virus vectors; (h) picornavirus vectors; (i) pox virus
vectors such as an orthopox, e.g., vaccinia virus vectors or
avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or
gutless adenovirus. Replication-defective viruses can also be
advantageous. Different vectors will or will not become
incorporated into the cells' genome. The constructs can include
viral sequences for transfection, if desired. Alternatively, the
construct can be incorporated into vectors capable of episomal
replication, e.g. EPV and EBV vectors. Constructs for the
recombinant expression of an iRNA will generally require regulatory
elements, e.g., promoters, enhancers, etc., to ensure the
expression of the iRNA in target cells. Other aspects to consider
for vectors and constructs are further described below.
[0344] Vectors useful for the delivery of an iRNA will include
regulatory elements (promoter, enhancer, etc.) sufficient for
expression of the iRNA in the desired target cell or tissue. The
regulatory elements can be chosen to provide either constitutive or
regulated/inducible expression.
[0345] Expression of the iRNA can be precisely regulated, for
example, by using an inducible regulatory sequence that is
sensitive to certain physiological regulators, e.g., circulating
glucose levels, or hormones (Docherty et al., 1994, FASEB J.
8:20-24). Such inducible expression systems, suitable for the
control of dsRNA expression in cells or in mammals include, for
example, regulation by ecdysone, by estrogen, progesterone,
tetracycline, chemical inducers of dimerization, and
isopropyl-beta-D1-thiogalactopyranoside (IPTG). A person skilled in
the art would be able to choose the appropriate regulatory/promoter
sequence based on the intended use of the iRNA transgene.
[0346] Viral vectors that contain nucleic acid sequences encoding
an iRNA can be used. For example, a retroviral vector can be used
(see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These
retroviral vectors contain the components necessary for the correct
packaging of the viral genome and integration into the host cell
DNA. The nucleic acid sequences encoding an iRNA are cloned into
one or more vectors, which facilitate delivery of the nucleic acid
into a patient. More detail about retroviral vectors can be found,
for example, in Boesen et al., Biotherapy 6:291-302 (1994), which
describes the use of a retroviral vector to deliver the mdr1 gene
to hematopoietic stem cells in order to make the stem cells more
resistant to chemotherapy. Other references illustrating the use of
retroviral vectors in gene therapy are: Clowes et al., J. Clin.
Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and
Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114
(1993). Lentiviral vectors contemplated for use include, for
example, the HIV based vectors described in U.S. Pat. Nos.
6,143,520; 5,665,557; and 5,981,276, which are herein incorporated
by reference.
[0347] Adenoviruses are also contemplated for use in delivery of
iRNAs of the invention. Adenoviruses are especially attractive
vehicles, e.g., for delivering genes to respiratory epithelia.
Adenoviruses naturally infect respiratory epithelia where they
cause a mild disease. Other targets for adenovirus-based delivery
systems are liver, the central nervous system, endothelial cells,
and muscle. Adenoviruses have the advantage of being capable of
infecting non-dividing cells. Kozarsky and Wilson, Current Opinion
in Genetics and Development 3:499-503 (1993) present a review of
adenovirus-based gene therapy. Bout et al., Human Gene Therapy
5:3-10 (1994) demonstrated the use of adenovirus vectors to
transfer genes to the respiratory epithelia of rhesus monkeys.
Other instances of the use of adenoviruses in gene therapy can be
found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et
al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest.
91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al.,
Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing
an iRNA featured in the invention, a method for constructing the
recombinant AV vector, and a method for delivering the vector into
target cells, are described in Xia H et al. (2002), Nat. Biotech.
20: 1006-1010.
[0348] Adeno-associated virus (AAV) vectors may also be used to
delivery an iRNA of the invention (Walsh et al., Proc. Soc. Exp.
Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one
embodiment, the iRNA can be expressed as two separate,
complementary single-stranded RNA molecules from a recombinant AAV
vector having, for example, either the U6 or H1 RNA promoters, or
the cytomegalovirus (CMV) promoter. Suitable AAV vectors for
expressing the dsRNA featured in the invention, methods for
constructing the recombinant AV vector, and methods for delivering
the vectors into target cells are described in Samulski R et al.
(1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J.
Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63:
3822-3826; U.S. Pat. Nos. 5,252,479; 5,139,941; International
Patent Application No. WO 94/13788; and International Patent
Application No. WO 93/24641, the entire disclosures of which are
herein incorporated by reference.
[0349] Another viral vector suitable for delivery of an iRNA of the
invention is a pox virus such as a vaccinia virus, for example an
attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC,
an avipox such as fowl pox or canary pox.
[0350] The tropism of viral vectors can be modified by pseudotyping
the vectors with envelope proteins or other surface antigens from
other viruses, or by substituting different viral capsid proteins,
as appropriate. For example, lentiviral vectors can be pseudotyped
with surface proteins from vesicular stomatitis virus (VSV),
rabies, Ebola, Mokola, and the like. AAV vectors can be made to
target different cells by engineering the vectors to express
different capsid protein serotypes; see, e.g., Rabinowitz J E et
al. (2002), J Virol 76:791-801, the entire disclosure of which is
herein incorporated by reference.
[0351] The pharmaceutical preparation of a vector can include the
vector in an acceptable diluent, or can include a slow release
matrix in which the gene delivery vehicle is imbedded.
Alternatively, where the complete gene delivery vector can be
produced intact from recombinant cells, e.g., retroviral vectors,
the pharmaceutical preparation can include one or more cells which
produce the gene delivery system.
VI. Pharmaceutical Compositions of the Invention
[0352] The present invention also includes pharmaceutical
compositions and formulations which include the iRNAs of the
invention. In one embodiment, provided herein are pharmaceutical
compositions containing an iRNA, as described herein, and a
pharmaceutically acceptable carrier. The pharmaceutical
compositions containing the iRNA are useful for treating a disease
or disorder associated with the expression or activity of an APCS
gene, e.g. an APCS-associated disease as descried herein. Such
pharmaceutical compositions are formulated based on the mode of
delivery. One example is compositions that are formulated for
systemic administration via parenteral delivery, e.g., by
subcutaneous (SC), intramuscular (IM), or intravenous (IV)
delivery. Another example is compositions that are formulated for
direct delivery into the brain parenchyma, e.g., by infusion into
the brain, such as by continuous pump infusion. The pharmaceutical
compositions of the invention may be administered in dosages
sufficient to inhibit expression of the target gene.
[0353] The pharmaceutical compositions of the present invention can
be administered in a number of ways depending upon whether local or
systemic treatment is desired and upon the area to be treated.
Administration can be topical (e.g., by a transdermal patch),
pulmonary, e.g., by inhalation or insufflation of powders or
aerosols, including by nebulizer; intratracheal, intranasal,
epidermal and transdermal, oral or parenteral. Parenteral
administration includes intravenous, intraarterial, subcutaneous,
intraperitoneal or intramuscular injection or infusion; subdermal,
e.g., via an implanted device; or intracranial, e.g., by
intraparenchymal, intrathecal or intraventricular,
administration.
[0354] The iRNA can be delivered in a manner to target a particular
tissue, such as the liver (e.g., the hepatocytes of the liver).
[0355] In some embodiments, the pharmaceutical compositions of the
invention are suitable for intramuscular administration to a
subject. In other embodiments, the pharmaceutical compositions of
the invention are suitable for intravenous administration to a
subject. In some embodiments of the invention, the pharmaceutical
compositions of the invention are suitable for subcutaneous
administration to a subject, e.g., using a 29 g or 30 g needle.
[0356] The pharmaceutical compositions of the invention may include
an RNAi agent of the invention in an unbuffered solution, such as
saline or water, or in a buffer solution, such as a buffer solution
comprising acetate, citrate, prolamine, carbonate, or phosphate or
any combination thereof.
[0357] In one embodiment, the pharmaceutical compositions of the
invention, e.g., such as the compositions suitable for subcutaneous
administration, comprise an RNAi agent of the invention in
phosphate buffered saline (PBS). Suitable concentrations of PBS
include, for example, 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4
mM, 4.5 mM, 5 mM, 6.5 mM, 7 mM, 7.5 mM, 9 mM, 8.5 mM, 9 mM, 9.5 mM,
or about 10 mM PBS. In one embodiment of the invention, a
pharmaceutical composition of the invention comprises an RNAi agent
of the invention dissolved in a solution of about 5 mM PBS (e.g.,
0.64 mM NaH.sub.2PO.sub.4, 4.36 mM Na.sub.2HPO.sub.4, 85 mM NaCl).
Values intermediate to the above recited ranges and values are also
intended to be part of this invention. In addition, ranges of
values using a combination of any of the above recited values as
upper and/or lower limits are intended to be included.
[0358] The pH of the pharmaceutical compositions of the invention
may be between about 5.0 to about 8.0, about 5.5 to about 8.0,
about 6.0 to about 8.0, about 6.5 to about 8.0, about 7.0 to about
8.0, about 5.0 to about 7.5, about 5.5 to about 7.5, about 6.0 to
about 7.5, about 6.5 to about 7.5, about 5.0 to about 7.2, about
5.25 to about 7.2, about 5.5 to about 7.2, about 5.75 to about 7.2,
about 6.0 to about 7.2, about 6.5 to about 7.2, or about 6.8 to
about 7.2. Ranges and values intermediate to the above recited
ranges and values are also intended to be part of this
invention.
[0359] The osmolality of the pharmaceutical compositions of the
invention may be suitable for subcutaneous administration, such as
no more than about 400 mOsm/kg, e.g., between 50 and 400 mOsm/kg,
between 75 and 400 mOsm/kg, between 100 and 400 mOsm/kg, between
125 and 400 mOsm/kg, between 150 and 400 mOsm/kg, between 175 and
400 mOsm/kg, between 200 and 400 mOsm/kg, between 250 and 400
mOsm/kg, between 300 and 400 mOsm/kg, between 50 and 375 mOsm/kg,
between 75 and 375 mOsm/kg, between 100 and 375 mOsm/kg, between
125 and 375 mOsm/kg, between 150 and 375 mOsm/kg, between 175 and
375 mOsm/kg, between 200 and 375 mOsm/kg, between 250 and 375
mOsm/kg, between 300 and 375 mOsm/kg, between 50 and 350 mOsm/kg,
between 75 and 350 mOsm/kg, between 100 and 350 mOsm/kg, between
125 and 350 mOsm/kg, between 150 and 350 mOsm/kg, between 175 and
350 mOsm/kg, between 200 and 350 mOsm/kg, between 250 and 350
mOsm/kg, between 50 and 325 mOsm/kg, between 75 and 325 mOsm/kg,
between 100 and 325 mOsm/kg, between 125 and 325 mOsm/kg, between
150 and 325 mOsm/kg, between 175 and 325 mOsm/kg, between 200 and
325 mOsm/kg, between 250 and 325 mOsm/kg, between 300 and 325
mOsm/kg, between 300 and 350 mOsm/kg, between 50 and 300 mOsm/kg,
between 75 and 300 mOsm/kg, between 100 and 300 mOsm/kg, between
125 and 300 mOsm/kg, between 150 and 300 mOsm/kg, between 175 and
300 mOsm/kg, between 200 and 300 mOsm/kg, between 250 and 300,
between 50 and 250 mOsm/kg, between 75 and 250 mOsm/kg, between 100
and 250 mOsm/kg, between 125 and 250 mOsm/kg, between 150 and 250
mOsm/kg, between 175 and 350 mOsm/kg, between 200 and 250 mOsm/kg,
e.g., about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110,
120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180,
185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245,
250, 255, 260, 265, 270, 275, 280, 285, 295, 300, 305, 310, 320,
325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385,
390, 395, or about 400 mOsm/kg. Ranges and values intermediate to
the above recited ranges and values are also intended to be part of
this invention.
[0360] The pharmaceutical compositions of the invention comprising
the RNAi agents of the invention, may be present in a vial that
contains about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4,
1.5, 1.6, 1.7, 1.8, 1.9, or about 2.0 mL of the pharmaceutical
composition. The concentration of the RNAi agents in the
pharmaceutical compositions of the invention may be about 10, 15,
20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,
100, 105, 110, 115, 130, 125, 130, 135, 140, 145, 150, 175, 180,
185, 190, 195, 200, 205, 210, 215, 230, 225, 230, 235, 240, 245,
250, 275, 280, 285, 290, 295, 300, 305, 310, 315, 330, 325, 330,
335, 340, 345, 350, 375, 380, 385, 390, 395, 400, 405, 410, 415,
430, 425, 430, 435, 440, 445, 450, 475, 480, 485, 490, 495, or
about 500 mg/mL. In one embodiment, the concentration of the RNAi
agents in the pharmaceutical compositions of the invention is about
100 mg/mL. Values intermediate to the above recited ranges and
values are also intended to be part of this invention.
[0361] The pharmaceutical compositions of the invention may
comprise a dsRNA agent of the invention in a free acid form. In
other embodiments of the invention, the pharmaceutical compositions
of the invention may comprise a dsRNA agent of the invention in a
salt form, such as a sodium salt form. In certain embodiments, when
the dsRNA agents of the invention are in the sodium salt form,
sodium ions are present in the agent as counterions for
substantially all of the phosphodiester and/or phosphorothiotate
groups present in the agent. Agents in which substantially all of
the phosphodiester and/or phosphorothioate linkages have a sodium
counterion include not more than 5, 4, 3, 2, or 1 phosphodiester
and/or phosphorothioate linkages without a sodium counterion. In
some embodiments, when the dsRNA agents of the invention are in the
sodium salt form, sodium ions are present in the agent as
counterions for all of the phosphodiester and/or phosphorothiotate
groups present in the agent.
[0362] Pharmaceutical compositions and formulations for topical
administration can include transdermal patches, ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder, or oily
bases, thickeners and the like can be necessary or desirable.
Coated condoms, gloves and the like can also be useful. Suitable
topical formulations include those in which the iRNAs featured in
the invention are in admixture with a topical delivery agent such
as lipids, liposomes, fatty acids, fatty acid esters, steroids,
chelating agents and surfactants. Suitable lipids and liposomes
include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine,
dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl
choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG),
and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and
dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the
invention can be encapsulated within liposomes or can form
complexes thereto, in particular to cationic liposomes.
Alternatively, iRNAs can be complexed to lipids, in particular to
cationic lipids. Suitable fatty acids and esters include but are
not limited to arachidonic acid, oleic acid, eicosanoic acid,
lauric acid, caprylic acid, capric acid, myristic acid, palmitic
acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate,
1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or
a C1-20 alkyl ester (e.g., isopropylmyristate 1PM), monoglyceride
or diglyceride or pharmaceutically acceptable salt thereof. Topical
formulations are described in detail in U.S. Pat. No. 6,747,014,
which is incorporated herein by reference.
[0363] A. iRNA Formulations Comprising Membranous Molecular
Assemblies
[0364] An iRNA for use in the compositions and methods of the
invention can be formulated for delivery in a membranous molecular
assembly, e.g., a liposome or a micelle. As used herein, the term
"liposome" refers to a vesicle composed of amphiphilic lipids
arranged in at least one bilayer, e.g., one bilayer or a plurality
of bilayers. Liposomes include unilamellar and multilamellar
vesicles that have a membrane formed from a lipophilic material and
an aqueous interior. The aqueous portion contains the iRNA
composition. The lipophilic material isolates the aqueous interior
from an aqueous exterior, which typically does not include the iRNA
composition, although in some examples, it may. Liposomes are
useful for the transfer and delivery of active ingredients to the
site of action. Because the liposomal membrane is structurally
similar to biological membranes, when liposomes are applied to a
tissue, the liposomal bilayer fuses with bilayer of the cellular
membranes. As the merging of the liposome and cell progresses, the
internal aqueous contents that include the iRNA are delivered into
the cell where the iRNA can specifically bind to a target RNA and
can mediate RNAi. In some cases the liposomes are also specifically
targeted, e.g., to direct the iRNA to particular cell types.
[0365] A liposome containing an RNAi agent can be prepared by a
variety of methods. In one example, the lipid component of a
liposome is dissolved in a detergent so that micelles are formed
with the lipid component. For example, the lipid component can be
an amphipathic cationic lipid or lipid conjugate. The detergent can
have a high critical micelle concentration and may be nonionic.
Exemplary detergents include cholate, CHAPS, octylglucoside,
deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is
then added to the micelles that include the lipid component. The
cationic groups on the lipid interact with the RNAi agent and
condense around the RNAi agent to form a liposome. After
condensation, the detergent is removed, e.g., by dialysis, to yield
a liposomal preparation of RNAi agent.
[0366] If necessary a carrier compound that assists in condensation
can be added during the condensation reaction, e.g., by controlled
addition. For example, the carrier compound can be a polymer other
than a nucleic acid (e.g., spermine or spermidine). pH can also
adjusted to favor condensation.
[0367] Methods for producing stable polynucleotide delivery
vehicles, which incorporate a polynucleotide/cationic lipid complex
as structural components of the delivery vehicle, are further
described in, e.g., WO 96/37194, the entire contents of which are
incorporated herein by reference. Liposome formation can also
include one or more aspects of exemplary methods described in
Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417,
1987; U.S. Pat. Nos. 4,897,355; 5,171,678; Bangham, et al. M. Mol.
Biol. 23:238, 1965; Olson, et al. Biochim. Biophys. Acta 557:9,
1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew,
et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et al. Biochim.
Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol.
115:757, 1984. Commonly used techniques for preparing lipid
aggregates of appropriate size for use as delivery vehicles include
sonication and freeze-thaw plus extrusion (see, e.g., Mayer, et al.
Biochim. Biophys. Acta 858:161, 1986). Microfluidization can be
used when consistently small (50 to 200 nm) and relatively uniform
aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta
775:169, 1984). These methods are readily adapted to packaging RNAi
agent preparations into liposomes.
[0368] Liposomes fall into two broad classes. Cationic liposomes
are positively charged liposomes which interact with the negatively
charged nucleic acid molecules to form a stable complex. The
positively charged nucleic acid/liposome complex binds to the
negatively charged cell surface and is internalized in an endosome.
Due to the acidic pH within the endosome, the liposomes are
ruptured, releasing their contents into the cell cytoplasm (Wang et
al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
[0369] Liposomes which are pH-sensitive or negatively-charged,
entrap nucleic acids rather than complex with it. Since both the
nucleic acid and the lipid are similarly charged, repulsion rather
than complex formation occurs. Nevertheless, some nucleic acid is
entrapped within the aqueous interior of these liposomes.
pH-sensitive liposomes have been used to deliver nucleic acids
encoding the thymidine kinase gene to cell monolayers in culture.
Expression of the exogenous gene was detected in the target cells
(Zhou et al., Journal of Controlled Release, 1992, 19,
269-274).
[0370] One major type of liposomal composition includes
phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from
dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl
phosphatidylcholine (DPPC). Anionic liposome compositions generally
are formed from dimyristoyl phosphatidylglycerol, while anionic
fusogenic liposomes are formed primarily from dioleoyl
phosphatidylethanolamine (DOPE). Another type of liposomal
composition is formed from phosphatidylcholine (PC) such as, for
example, soybean PC, and egg PC. Another type is formed from
mixtures of phospholipid and/or phosphatidylcholine and/or
cholesterol.
[0371] Examples of other methods to introduce liposomes into cells
in vitro and in vivo include U.S. Pat. Nos. 5,283,185; 5,171,678;
WO 94/00569; WO 93/24640; WO 91/16024; Felgner, J. Biol. Chem.
269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993;
Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143,
1993; and Strauss EMBO J. 11:417, 1992.
[0372] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome.TM. I
(glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether)
and Novasome.TM. II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver cyclosporin-A into the dermis of mouse skin. Results
indicated that such non-ionic liposomal systems were effective in
facilitating the deposition of cyclosporine A into different layers
of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4(6) 466).
[0373] Liposomes also include "sterically stabilized" liposomes, a
term which, as used herein, refers to liposomes comprising one or
more specialized lipids that, when incorporated into liposomes,
result in enhanced circulation lifetimes relative to liposomes
lacking such specialized lipids. Examples of sterically stabilized
liposomes are those in which part of the vesicle-forming lipid
portion of the liposome (A) comprises one or more glycolipids, such
as monosialoganglioside G.sub.M1, or (B) is derivatized with one or
more hydrophilic polymers, such as a polyethylene glycol (PEG)
moiety. While not wishing to be bound by any particular theory, it
is thought in the art that, at least for sterically stabilized
liposomes containing gangliosides, sphingomyelin, or
PEG-derivatized lipids, the enhanced circulation half-life of these
sterically stabilized liposomes derives from a reduced uptake into
cells of the reticuloendothelial system (RES) (Allen et al., FEBS
Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53,
3765).
[0374] Various liposomes comprising one or more glycolipids are
known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci.,
1987, 507, 64) reported the ability of monosialoganglioside
G.sub.M1, galactocerebroside sulfate and phosphatidylinositol to
improve blood half-lives of liposomes. These findings were
expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A.,
1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to
Allen et al., disclose liposomes comprising (1) sphingomyelin and
(2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester.
U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes
comprising sphingomyelin. Liposomes comprising
1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499
(Lim et al).
[0375] In one embodiment, cationic liposomes are used. Cationic
liposomes possess the advantage of being able to fuse to the cell
membrane. Non-cationic liposomes, although not able to fuse as
efficiently with the plasma membrane, are taken up by macrophages
in vivo and can be used to deliver RNAi agents to macrophages.
[0376] Further advantages of liposomes include: liposomes obtained
from natural phospholipids are biocompatible and biodegradable;
liposomes can incorporate a wide range of water and lipid soluble
drugs; liposomes can protect encapsulated RNAi agents in their
internal compartments from metabolism and degradation (Rosoff, in
"Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.),
1988, volume 1, p. 245). Important considerations in the
preparation of liposome formulations are the lipid surface charge,
vesicle size and the aqueous volume of the liposomes.
[0377] A positively charged synthetic cationic lipid,
N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride
(DOTMA) can be used to form small liposomes that interact
spontaneously with nucleic acid to form lipid-nucleic acid
complexes which are capable of fusing with the negatively charged
lipids of the cell membranes of tissue culture cells, resulting in
delivery of RNAi agent (see, e.g., Felgner, P. L. et al., Proc.
Natl. Acad. Sci., USA 8:7413-7417, 1987 and U.S. Pat. No. 4,897,355
for a description of DOTMA and its use with DNA).
[0378] A DOTMA analogue,
1,2-bis(oleoyloxy)-3-(trimethylammonia)propane (DOTAP) can be used
in combination with a phospholipid to form DNA-complexing vesicles.
Lipofectin.TM. Bethesda Research Laboratories, Gaithersburg, Md.)
is an effective agent for the delivery of highly anionic nucleic
acids into living tissue culture cells that comprise positively
charged DOTMA liposomes which interact spontaneously with
negatively charged polynucleotides to form complexes. When enough
positively charged liposomes are used, the net charge on the
resulting complexes is also positive. Positively charged complexes
prepared in this way spontaneously attach to negatively charged
cell surfaces, fuse with the plasma membrane, and efficiently
deliver functional nucleic acids into, for example, tissue culture
cells. Another commercially available cationic lipid,
1,2-bis(oleoyloxy)-3,3-(trimethylammonia)propane ("DOTAP")
(Boehringer Mannheim, Indianapolis, Ind.) differs from DOTMA in
that the oleoyl moieties are linked by ester, rather than ether
linkages.
[0379] Other reported cationic lipid compounds include those that
have been conjugated to a variety of moieties including, for
example, carboxyspermine which has been conjugated to one of two
types of lipids and includes compounds such as
5-carboxyspermylglycine dioctaoleoylamide ("DOGS")
(Transfectam.TM., Promega, Madison, Wis.) and
dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide
("DPPES") (see, e.g., U.S. Pat. No. 5,171,678).
[0380] Another cationic lipid conjugate includes derivatization of
the lipid with cholesterol ("DC-Chol") which has been formulated
into liposomes in combination with DOPE (See, Gao, X. and Huang,
L., Biochim. Biophys. Res. Commun. 179:280, 1991). Lipopolylysine,
made by conjugating polylysine to DOPE, has been reported to be
effective for transfection in the presence of serum (Zhou, X. et
al., wBiochim. Biophys. Acta 1065:8, 1991). For certain cell lines,
these liposomes containing conjugated cationic lipids, are said to
exhibit lower toxicity and provide more efficient transfection than
the DOTMA-containing compositions. Other commercially available
cationic lipid products include DMRIE and DMRIE-HP (Vical, La
Jolla, Calif.) and Lipofectamine (DOSPA) (Life Technology, Inc.,
Gaithersburg, Md.). Other cationic lipids suitable for the delivery
of oligonucleotides are described in WO 98/39359 and WO
96/37194.
[0381] Liposomal formulations are particularly suited for topical
administration, liposomes present several advantages over other
formulations. Such advantages include reduced side effects related
to high systemic absorption of the administered drug, increased
accumulation of the administered drug at the desired target, and
the ability to administer RNAi agent into the skin. In some
implementations, liposomes are used for delivering RNAi agent to
epidermal cells and also to enhance the penetration of RNAi agent
into dermal tissues, e.g., into skin. For example, the liposomes
can be applied topically. Topical delivery of drugs formulated as
liposomes to the skin has been documented (see, e.g., Weiner et
al., Journal of Drug Targeting, 1992, vol. 2, 405-410 and du
Plessis et al., Antiviral Research, 18, 1992, 259-265; Mannino, R.
J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T.
et al. Gene 56:267-276. 1987; Nicolau, C. et al. Meth. Enz.
149:157-176, 1987; Straubinger, R. M. and Papahadjopoulos, D. Meth.
Enz. 101:512-527, 1983; Wang, C. Y. and Huang, L., Proc. Natl.
Acad. Sci. USA 84:7851-7855, 1987).
[0382] Non-ionic liposomal systems have also been examined to
determine their utility in the delivery of drugs to the skin, in
particular systems comprising non-ionic surfactant and cholesterol.
Non-ionic liposomal formulations comprising Novasome I (glyceryl
dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and
Novasome II (glyceryl
distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used
to deliver a drug into the dermis of mouse skin. Such formulations
with RNAi agent are useful for treating a dermatological
disorder.
[0383] Liposomes that include iRNA can be made highly deformable.
Such deformability can enable the liposomes to penetrate through
pore that are smaller than the average radius of the liposome. For
example, transfersomes are a type of deformable liposomes.
Transferosomes can be made by adding surface edge activators,
usually surfactants, to a standard liposomal composition.
Transfersomes that include RNAi agent can be delivered, for
example, subcutaneously by infection in order to deliver RNAi agent
to keratinocytes in the skin. In order to cross intact mammalian
skin, lipid vesicles must pass through a series of fine pores, each
with a diameter less than 50 nm, under the influence of a suitable
transdermal gradient. In addition, due to the lipid properties,
these transferosomes can be self-optimizing (adaptive to the shape
of pores, e.g., in the skin), self-repairing, and can frequently
reach their targets without fragmenting, and often
self-loading.
[0384] Other formulations amenable to the present invention are
described in PCT Publication No. WO 2008/042973.
[0385] Transfersomes are yet another type of liposomes, and are
highly deformable lipid aggregates which are attractive candidates
for drug delivery vehicles. Transfersomes can be described as lipid
droplets which are so highly deformable that they are easily able
to penetrate through pores which are smaller than the droplet.
Transfersomes are adaptable to the environment in which they are
used, e.g., they are self-optimizing (adaptive to the shape of
pores in the skin), self-repairing, frequently reach their targets
without fragmenting, and often self-loading. To make transfersomes
it is possible to add surface edge-activators, usually surfactants,
to a standard liposomal composition. Transfersomes have been used
to deliver serum albumin to the skin. The transfersome-mediated
delivery of serum albumin has been shown to be as effective as
subcutaneous injection of a solution containing serum albumin.
[0386] Surfactants find wide application in formulations such as
emulsions (including microemulsions) and liposomes. The most common
way of classifying and ranking the properties of the many different
types of surfactants, both natural and synthetic, is by the use of
the hydrophile/lipophile balance (HLB). The nature of the
hydrophilic group (also known as the "head") provides the most
useful means for categorizing the different surfactants used in
formulations (Rieger, in "Pharmaceutical Dosage Forms", Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
[0387] If the surfactant molecule is not ionized, it is classified
as a nonionic surfactant. Nonionic surfactants find wide
application in pharmaceutical and cosmetic products and are usable
over a wide range of pH values. In general their HLB values range
from 2 to about 18 depending on their structure. Nonionic
surfactants include nonionic esters such as ethylene glycol esters,
propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic
alkanolamides and ethers such as fatty alcohol ethoxylates,
propoxylated alcohols, and ethoxylated/propoxylated block polymers
are also included in this class. The polyoxyethylene surfactants
are the most popular members of the nonionic surfactant class.
[0388] If the surfactant molecule carries a negative charge when it
is dissolved or dispersed in water, the surfactant is classified as
anionic. Anionic surfactants include carboxylates such as soaps,
acyl lactylates, acyl amides of amino acids, esters of sulfuric
acid such as alkyl sulfates and ethoxylated alkyl sulfates,
sulfonates such as alkyl benzene sulfonates, acyl isethionates,
acyl taurates and sulfosuccinates, and phosphates. The most
important members of the anionic surfactant class are the alkyl
sulfates and the soaps.
[0389] If the surfactant molecule carries a positive charge when it
is dissolved or dispersed in water, the surfactant is classified as
cationic. Cationic surfactants include quaternary ammonium salts
and ethoxylated amines. The quaternary ammonium salts are the most
used members of this class.
[0390] If the surfactant molecule has the ability to carry either a
positive or negative charge, the surfactant is classified as
amphoteric. Amphoteric surfactants include acrylic acid
derivatives, substituted alkylamides, N-alkylbetaines and
phosphatides.
[0391] The use of surfactants in drug products, formulations and in
emulsions has been reviewed (Rieger, in "Pharmaceutical Dosage
Forms", Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).
[0392] The iRNA for use in the methods of the invention can also be
provided as micellar formulations. "Micelles" are defined herein as
a particular type of molecular assembly in which amphipathic
molecules are arranged in a spherical structure such that all the
hydrophobic portions of the molecules are directed inward, leaving
the hydrophilic portions in contact with the surrounding aqueous
phase. The converse arrangement exists if the environment is
hydrophobic.
[0393] A mixed micellar formulation suitable for delivery through
transdermal membranes may be prepared by mixing an aqueous solution
of the siRNA composition, an alkali metal C.sub.8 to C.sub.22 alkyl
sulphate, and a micelle forming compounds. Exemplary micelle
forming compounds include lecithin, hyaluronic acid,
pharmaceutically acceptable salts of hyaluronic acid, glycolic
acid, lactic acid, chamomile extract, cucumber extract, oleic acid,
linoleic acid, linolenic acid, monoolein, monooleates,
monolaurates, borage oil, evening of primrose oil, menthol,
trihydroxy oxo cholanyl glycine and pharmaceutically acceptable
salts thereof, glycerin, polyglycerin, lysine, polylysine,
triolein, polyoxyethylene ethers and analogues thereof, polidocanol
alkyl ethers and analogues thereof, chenodeoxycholate,
deoxycholate, and mixtures thereof. The micelle forming compounds
may be added at the same time or after addition of the alkali metal
alkyl sulphate. Mixed micelles will form with substantially any
kind of mixing of the ingredients but vigorous mixing in order to
provide smaller size micelles.
[0394] In one method a first micellar composition is prepared which
contains the siRNA composition and at least the alkali metal alkyl
sulphate. The first micellar composition is then mixed with at
least three micelle forming compounds to form a mixed micellar
composition. In another method, the micellar composition is
prepared by mixing the siRNA composition, the alkali metal alkyl
sulphate and at least one of the micelle forming compounds,
followed by addition of the remaining micelle forming compounds,
with vigorous mixing.
[0395] Phenol and/or m-cresol may be added to the mixed micellar
composition to stabilize the formulation and protect against
bacterial growth. Alternatively, phenol and/or m-cresol may be
added with the micelle forming ingredients. An isotonic agent such
as glycerin may also be added after formation of the mixed micellar
composition.
[0396] For delivery of the micellar formulation as a spray, the
formulation can be put into an aerosol dispenser and the dispenser
is charged with a propellant. The propellant, which is under
pressure, is in liquid form in the dispenser. The ratios of the
ingredients are adjusted so that the aqueous and propellant phases
become one, i.e., there is one phase. If there are two phases, it
is necessary to shake the dispenser prior to dispensing a portion
of the contents, e.g., through a metered valve. The dispensed dose
of pharmaceutical agent is propelled from the metered valve in a
fine spray.
[0397] Propellants may include hydrogen-containing
chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl
ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2
tetrafluoroethane) may be used.
[0398] The specific concentrations of the essential ingredients can
be determined by relatively straightforward experimentation. For
absorption through the oral cavities, it is often desirable to
increase, e.g., at least double or triple, the dosage for through
injection or administration through the gastrointestinal tract.
[0399] B. Lipid Particles
[0400] iRNAs, e.g., dsRNAs of in the invention may be fully
encapsulated in a lipid formulation, e.g., a LNP, or other nucleic
acid-lipid particle.
[0401] As used herein, the term "LNP" refers to a stable nucleic
acid-lipid particle. LNPs typically contain a cationic lipid, a
non-cationic lipid, and a lipid that prevents aggregation of the
particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful
for systemic applications, as they exhibit extended circulation
lifetimes following intravenous (i.v.) injection and accumulate at
distal sites (e.g., sites physically separated from the
administration site). LNPs include "pSPLP," which include an
encapsulated condensing agent-nucleic acid complex as set forth in
PCT Publication No. WO 00/03683. The particles of the present
invention typically have a mean diameter of about 50 nm to about
150 nm, more typically about 60 nm to about 130 nm, more typically
about 70 nm to about 110 nm, most typically about 70 nm to about 90
nm, and are substantially nontoxic. In addition, the nucleic acids
when present in the nucleic acid-lipid particles of the present
invention are resistant in aqueous solution to degradation with a
nuclease. Nucleic acid-lipid particles and their method of
preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567;
5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No.
2010/0324120 and PCT Publication No. WO 96/40964.
[0402] In one embodiment, the lipid to drug ratio (mass/mass ratio)
(e.g., lipid to dsRNA ratio) will be in the range of from about 1:1
to about 50:1, from about 1:1 to about 25:1, from about 3:1 to
about 15:1, from about 4:1 to about 10:1, from about 5:1 to about
9:1, or about 6:1 to about 9:1. Ranges intermediate to the above
recited ranges are also contemplated to be part of the
invention.
[0403] The cationic lipid can be, for example,
N,N-dioleyl-N,N-dimethylammonium chloride (DODAC),
N,N-distearyl-N,N-dimethylammonium bromide (DDAB),
N-(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride
(DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium
chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA),
1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA),
1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA),
1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP),
1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC),
1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA),
1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP),
1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA),
1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP),
1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt
(DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride
salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane
(DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP),
3-(N,N-Dioleylamino)-1,2-propanedio (DOAP),
1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane
(DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane
(DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane
(DLin-K-DMA) or analogs thereof,
(3aR,5s,6aS)--N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydr-
o-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100),
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl4-(dimethylamino)bu-
tanoate (MC3),
1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)ami-
no)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or
a mixture thereof. The cationic lipid can comprise from about 20
mol % to about 50 mol % or about 40 mol % of the total lipid
present in the particle.
[0404] In another embodiment, the compound
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to
prepare lipid-siRNA nanoparticles. Synthesis of
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in
U.S. provisional patent application No. 61/107,998 filed on Oct.
23, 2008, which is herein incorporated by reference.
[0405] In one embodiment, the lipid-siRNA particle includes 40% 2,
2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40%
Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of
63.0.+-.20 nm and a 0.027 siRNA/Lipid Ratio.
[0406] The ionizable/non-cationic lipid can be an anionic lipid or
a neutral lipid including, but not limited to,
distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine
(DOPC), dipalmitoylphosphatidylcholine (DPPC),
dioleoylphosphatidylglycerol (DOPG),
dipalmitoylphosphatidylglycerol (DPPG),
dioleoyl-phosphatidylethanolamine (DOPE),
palmitoyloleoylphosphatidylcholine (POPC),
palmitoyloleoylphosphatidylethanolamine (POPE),
dioleoyl-phosphatidylethanolamine
4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal),
dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine (DMPE),
distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE,
16-O-dimethyl PE, 18-1-trans PE,
1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or
a mixture thereof. The non-cationic lipid can be from about 5 mol %
to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol
is included, of the total lipid present in the particle. The
conjugated lipid that inhibits aggregation of particles can be, for
example, a polyethyleneglycol (PEG)-lipid including, without
limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl
(DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture
thereof. The PEG-DAA conjugate can be, for example, a
PEG-dilauryloxypropyl (Ci.sub.2), a PEG-dimyristyloxypropyl
(Ci.sub.4), a PEG-dipalmityloxypropyl (Ci.sub.6), or a
PEG-distearyloxypropyl (C]8). The conjugated lipid that prevents
aggregation of particles can be from 0 mol % to about 20 mol % or
about 2 mol % of the total lipid present in the particle.
[0407] In some embodiments, the nucleic acid-lipid particle further
includes cholesterol at, e.g., about 10 mol % to about 60 mol % or
about 48 mol % of the total lipid present in the particle.
[0408] In one embodiment, the lipidoid ND98.4HCl (MW 1487) (see
U.S. patent application Ser. No. 12/056,230, filed Mar. 26, 2008,
which is incorporated herein by reference), Cholesterol
(Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be
used to prepare lipid-dsRNA nanoparticles (i.e., LNP01 particles).
Stock solutions of each in ethanol can be prepared as follows:
ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100
mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions
can then be combined in a, e.g., 42:48:10 molar ratio. The combined
lipid solution can be mixed with aqueous dsRNA (e.g., in sodium
acetate pH 5) such that the final ethanol concentration is about
35-45% and the final sodium acetate concentration is about 100-300
mM. Lipid-dsRNA nanoparticles typically form spontaneously upon
mixing. Depending on the desired particle size distribution, the
resultant nanoparticle mixture can be extruded through a
polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a
thermobarrel extruder, such as Lipex Extruder (Northern Lipids,
Inc). In some cases, the extrusion step can be omitted. Ethanol
removal and simultaneous buffer exchange can be accomplished by,
for example, dialysis or tangential flow filtration. Buffer can be
exchanged with, for example, phosphate buffered saline (PBS) at
about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about
pH 7.2, about pH 7.3, or about pH 7.4.
##STR00015##
[0409] LNP01 formulations are described, e.g., in International
Application Publication No. WO 2008/042973, which is hereby
incorporated by reference.
[0410] Additional exemplary lipid-dsRNA formulations are described
in Table 1.
TABLE-US-00001 TABLE 1 cationic lipid/non-cationic
lipid/cholesterol/PEG conjugate Ionizable/Cationic Lipid
Lipid:siRNA ratio SNALP-1
1,2-Dilinolenyloxy-N,N-dimethylaminopropane
DLinDMA/DPPC/Cholesterol/PEG-cDMA (DLinDMA) (57.1/7.1/34.4/1.4)
lipid:siRNA~7:l 2-XTC
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-diox
XTC/DPPC/Cholesterol/PEG-cDMA (XTC) 57.1/7.1/34.4/1.4
lipid:siRNA~7:1 LNP05
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-diox
XTC/DSPC/Cholesterol/PEG-DMG (XTC) 57.5/7.5/31.5/3.5
lipid:siRNA~6:1 LNP06
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-diox
XTC/DSPC/Cholesterol/PEG-DMG (XTC) 57.5/7.5/31.5/3.5
lipid:siRNA~11:1 LNP07
2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-diox
XTC/DSPC/Cholesterol/PEG-DMG (XTC) 60/7.5/31/1.5, lipid:siRNA~6:1
LNP08 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-diox
XTC/DSPC/Cholesterol/PEG-DMG (XTC) 60/7.5/31/1.5, lipid:siRNA~11:1
LNP09 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-diox
XTC/DSPC/Cholesterol/PEG-DMG (XTC) 50/10/38.5/1.5 Lipid:siRNA 10:1
LNP10 (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-oc
ALN100/DSPC/Cholesterol/PEG-DMG
9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]d 50/10/38.5/1.5 amine
(ALN100) Lipid:siRNA 10:1 LNP11
(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetra
MC-3/DSPC/Cholesterol/PEG-DMG 4-(dimethylamino)butanoate (MC3)
50/10/38.5/1.5 Lipid:siRNA 10:1 LNP12
1,1'-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino) Tech
G1/DSPC/Cholesterol/PEG-DMG hydroxydodecyl)amino)ethyl)piperazin-1-
50/10/38.5/1.5 yl)ethylazanediyl)didodecan-2-ol (Tech G1)
Lipid:siRNA 10:1 LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5
Lipid:siRNA: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5
Lipid:siRNA: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG-DSG/GalNAc-PEG-DSG
50/10/35/4.5/0.5 Lipid:siRNA: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG
50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG
50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG
50/10/38.5/1.5 Lipid:siRNA: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG
50/10/35/5 Lipid:siRNA: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG
50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP21 C12-200
C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP22 XTC
XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 DSPC:
distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine
PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with
avg mol wt of 2000); PEG-DSG: PEG-distyryl glycerol (C18-PEG, or
PEG-C18) (PEG with avg mol wt of 2000); PEG-cDMA:
PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of
2000); SNALP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane
(DLinDMA)) comprising formulations are described in International
Publication No. WO2009/127060, filed Apr. 15, 2009, which is hereby
incorporated by reference. XTC comprising formulations are
described in PCT Publication No. WO 2010/088537, the entire
contents of which are hereby incorporated herein by reference. MC3
comprising formulations are described, e.g., in U.S. Publication
No. 2010/0324120, filed Jun. 10, 2010, the entire contents of which
are hereby incorporated by reference. ALNY-100 comprising
formulations are described in PCT Publication No. WO 2010/054406,
the entire contents of which are hereby incorporated herein by
reference. C12-200 comprising formulations are described in PCT
Publication No. WO 2010/129709, the entire contents of which are
hereby incorporated herein by reference. indicates data missing or
illegible when filed
[0411] Compositions and formulations for oral administration
include powders or granules, microparticulates, nanoparticulates,
suspensions or solutions in water or non-aqueous media, capsules,
gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring agents, diluents, emulsifiers, dispersing aids or binders
can be desirable. In some embodiments, oral formulations are those
in which dsRNAs featured in the invention are administered in
conjunction with one or more penetration enhancer surfactants and
chelators. Suitable surfactants include fatty acids and/or esters
or salts thereof, bile acids and/or salts thereof. Suitable bile
acids/salts include chenodeoxycholic acid (CDCA) and
ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic
acid, deoxycholic acid, glucholic acid, glycholic acid,
glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid,
sodium tauro-24,25-dihydro-fusidate and sodium
glycodihydrofusidate. Suitable fatty acids include arachidonic
acid, undecanoic acid, oleic acid, lauric acid, caprylic acid,
capric acid, myristic acid, palmitic acid, stearic acid, linoleic
acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin,
glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an
acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or
a pharmaceutically acceptable salt thereof (e.g., sodium). In some
embodiments, combinations of penetration enhancers are used, for
example, fatty acids/salts in combination with bile acids/salts.
One exemplary combination is the sodium salt of lauric acid, capric
acid and UDCA. Further penetration enhancers include
polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
RNAi agents featured in the invention can be delivered orally, in
granular form including sprayed dried particles, or complexed to
form micro or nanoparticles. RNAi complexing agents include
poly-amino acids; polyimines; polyacrylates; polyalkylacrylates,
polyoxethanes, polyalkylcyanoacrylates; cationized gelatins,
albumins, starches, acrylates, polyethyleneglycols (PEG) and
starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines,
pollulans, celluloses and starches. Suitable complexing agents
include chitosan, N-trimethylchitosan, poly-L-lysine,
polyhistidine, polyornithine, polyspermines, protamine,
polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE),
polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate),
poly(ethylcyanoacrylate), poly(butylcyanoacrylate),
poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate),
DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide,
DEAE-albumin and DEAE-dextran, polymethylacrylate,
polyhexylacrylate, poly(D,L-lactic acid),
poly(DL-lactic-co-glycolic acid (PLGA), alginate, and
polyethyleneglycol (PEG). Oral formulations for dsRNAs and their
preparation are described in detail in U.S. Pat. No. 6,887,906, US
Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which
is incorporated herein by reference.
[0412] Compositions and formulations for parenteral,
intraparenchymal (into the brain), intrathecal, intraventricular or
intrahepatic administration can include sterile aqueous solutions
which can also contain buffers, diluents and other suitable
additives such as, but not limited to, penetration enhancers,
carrier compounds and other pharmaceutically acceptable carriers or
excipients.
[0413] Pharmaceutical compositions of the present invention
include, but are not limited to, solutions, emulsions, and
liposome-containing formulations. These compositions can be
generated from a variety of components that include, but are not
limited to, preformed liquids, self-emulsifying solids and
self-emulsifying semisolids. Particularly preferred are
formulations that target the liver when treating hepatic disorders
such as hepatic carcinoma.
[0414] The pharmaceutical formulations of the present invention,
which can conveniently be presented in unit dosage form, can be
prepared according to conventional techniques well known in the
pharmaceutical industry. Such techniques include the step of
bringing into association the active ingredients with the
pharmaceutical carrier(s) or excipient(s). In general, the
formulations are prepared by uniformly and intimately bringing into
association the active ingredients with liquid carriers or finely
divided solid carriers or both, and then, if necessary, shaping the
product.
[0415] The compositions of the present invention can be formulated
into any of many possible dosage forms such as, but not limited to,
tablets, capsules, gel capsules, liquid syrups, soft gels,
suppositories, and enemas. The compositions of the present
invention can also be formulated as suspensions in aqueous,
non-aqueous or mixed media. Aqueous suspensions can further contain
substances which increase the viscosity of the suspension
including, for example, sodium carboxymethylcellulose, sorbitol
and/or dextran. The suspension can also contain stabilizers.
[0416] C. Additional Formulations
[0417] i. Emulsions
[0418] The compositions of the present invention can be prepared
and formulated as emulsions. Emulsions are typically heterogeneous
systems of one liquid dispersed in another in the form of droplets
usually exceeding 0.1 .mu.m in diameter (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335;
Higuchi et al., in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often
biphasic systems comprising two immiscible liquid phases intimately
mixed and dispersed with each other. In general, emulsions can be
of either the water-in-oil (w/o) or the oil-in-water (o/w) variety.
When an aqueous phase is finely divided into and dispersed as
minute droplets into a bulk oily phase, the resulting composition
is called a water-in-oil (w/o) emulsion. Alternatively, when an
oily phase is finely divided into and dispersed as minute droplets
into a bulk aqueous phase, the resulting composition is called an
oil-in-water (o/w) emulsion. Emulsions can contain additional
components in addition to the dispersed phases, and the active drug
which can be present as a solution in either the aqueous phase,
oily phase or itself as a separate phase. Pharmaceutical excipients
such as emulsifiers, stabilizers, dyes, and anti-oxidants can also
be present in emulsions as needed. Pharmaceutical emulsions can
also be multiple emulsions that are comprised of more than two
phases such as, for example, in the case of oil-in-water-in-oil
(o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex
formulations often provide certain advantages that simple binary
emulsions do not. Multiple emulsions in which individual oil
droplets of an o/w emulsion enclose small water droplets constitute
a w/o/w emulsion. Likewise, a system of oil droplets enclosed in
globules of water stabilized in an oily continuous phase provides
an o/w/o emulsion.
[0419] Emulsions are characterized by little or no thermodynamic
stability. Often, the dispersed or discontinuous phase of the
emulsion is well dispersed into the external or continuous phase
and maintained in this form through the means of emulsifiers or the
viscosity of the formulation. Either of the phases of the emulsion
can be a semisolid or a solid, as is the case of emulsion-style
ointment bases and creams. Other means of stabilizing emulsions
entail the use of emulsifiers that can be incorporated into either
phase of the emulsion. Emulsifiers can broadly be classified into
four categories: synthetic surfactants, naturally occurring
emulsifiers, absorption bases, and finely dispersed solids (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
199).
[0420] Synthetic surfactants, also known as surface active agents,
have found wide applicability in the formulation of emulsions and
have been reviewed in the literature (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker,
Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are
typically amphiphilic and comprise a hydrophilic and a hydrophobic
portion. The ratio of the hydrophilic to the hydrophobic nature of
the surfactant has been termed the hydrophile/lipophile balance
(HLB) and is a valuable tool in categorizing and selecting
surfactants in the preparation of formulations. Surfactants can be
classified into different classes based on the nature of the
hydrophilic group: nonionic, anionic, cationic and amphoteric (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
285).
[0421] Naturally occurring emulsifiers used in emulsion
formulations include lanolin, beeswax, phosphatides, lecithin and
acacia. Absorption bases possess hydrophilic properties such that
they can soak up water to form w/o emulsions yet retain their
semisolid consistencies, such as anhydrous lanolin and hydrophilic
petrolatum. Finely divided solids have also been used as good
emulsifiers especially in combination with surfactants and in
viscous preparations. These include polar inorganic solids, such as
heavy metal hydroxides, nonswelling clays such as bentonite,
attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum
silicate and colloidal magnesium aluminum silicate, pigments and
nonpolar solids such as carbon or glyceryl tristearate.
[0422] A large variety of non-emulsifying materials are also
included in emulsion formulations and contribute to the properties
of emulsions. These include fats, oils, waxes, fatty acids, fatty
alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and antioxidants (Block, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
[0423] Hydrophilic colloids or hydrocolloids include naturally
occurring gums and synthetic polymers such as polysaccharides (for
example, acacia, agar, alginic acid, carrageenan, guar gum, karaya
gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic
polymers (for example, carbomers, cellulose ethers, and
carboxyvinyl polymers). These disperse or swell in water to form
colloidal solutions that stabilize emulsions by forming strong
interfacial films around the dispersed-phase droplets and by
increasing the viscosity of the external phase.
[0424] Since emulsions often contain a number of ingredients such
as carbohydrates, proteins, sterols and phosphatides that can
readily support the growth of microbes, these formulations often
incorporate preservatives. Commonly used preservatives included in
emulsion formulations include methyl paraben, propyl paraben,
quaternary ammonium salts, benzalkonium chloride, esters of
p-hydroxybenzoic acid, and boric acid. Antioxidants are also
commonly added to emulsion formulations to prevent deterioration of
the formulation. Antioxidants used can be free radical scavengers
such as tocopherols, alkyl gallates, butylated hydroxyanisole,
butylated hydroxytoluene, or reducing agents such as ascorbic acid
and sodium metabisulfite, and antioxidant synergists such as citric
acid, tartaric acid, and lecithin.
[0425] The application of emulsion formulations via dermatological,
oral and parenteral routes and methods for their manufacture have
been reviewed in the literature (see e.g., Ansel's Pharmaceutical
Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G.,
and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.),
New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y., volume 1, p. 199). Emulsion formulations for oral delivery
have been very widely used because of ease of formulation, as well
as efficacy from an absorption and bioavailability standpoint (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.;
Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins
and high fat nutritive preparations are among the materials that
have commonly been administered orally as o/w emulsions.
[0426] ii. Microemulsions
[0427] In one embodiment of the present invention, the compositions
of iRNAs and nucleic acids are formulated as microemulsions. A
microemulsion can be defined as a system of water, oil and
amphiphile which is a single optically isotropic and
thermodynamically stable liquid solution (see e.g., Ansel's
Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V.,
Popovich N G., and Ansel H C., 2004, Lippincott Williams &
Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage
Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker,
Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions
are systems that are prepared by first dispersing an oil in an
aqueous surfactant solution and then adding a sufficient amount of
a fourth component, generally an intermediate chain-length alcohol
to form a transparent system. Therefore, microemulsions have also
been described as thermodynamically stable, isotropically clear
dispersions of two immiscible liquids that are stabilized by
interfacial films of surface-active molecules (Leung and Shah, in:
Controlled Release of Drugs: Polymers and Aggregate Systems,
Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215).
Microemulsions commonly are prepared via a combination of three to
five components that include oil, water, surfactant, cosurfactant
and electrolyte. Whether the microemulsion is of the water-in-oil
(w/o) or an oil-in-water (o/w) type is dependent on the properties
of the oil and surfactant used and on the structure and geometric
packing of the polar heads and hydrocarbon tails of the surfactant
molecules (Schott, in Remington's Pharmaceutical Sciences, Mack
Publishing Co., Easton, Pa., 1985, p. 271).
[0428] The phenomenological approach utilizing phase diagrams has
been extensively studied and has yielded a comprehensive knowledge,
to one skilled in the art, of how to formulate microemulsions (see
e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery
Systems, Allen, L V., Popovich N G., and Ansel H C., 2004,
Lippincott Williams & Wilkins (8th ed.), New York, N.Y.;
Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1,
p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.,
volume 1, p. 335). Compared to conventional emulsions,
microemulsions offer the advantage of solubilizing water-insoluble
drugs in a formulation of thermodynamically stable droplets that
are formed spontaneously.
[0429] Surfactants used in the preparation of microemulsions
include, but are not limited to, ionic surfactants, non-ionic
surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol
fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol
monooleate (M0310), hexaglycerol monooleate (P0310), hexaglycerol
pentaoleate (P0500), decaglycerol monocaprate (MCA750),
decaglycerol monooleate (M0750), decaglycerol sequioleate (S0750),
decaglycerol decaoleate (DA0750), alone or in combination with
cosurfactants. The cosurfactant, usually a short-chain alcohol such
as ethanol, 1-propanol, and 1-butanol, serves to increase the
interfacial fluidity by penetrating into the surfactant film and
consequently creating a disordered film because of the void space
generated among surfactant molecules. Microemulsions can, however,
be prepared without the use of cosurfactants and alcohol-free
self-emulsifying microemulsion systems are known in the art. The
aqueous phase can typically be, but is not limited to, water, an
aqueous solution of the drug, glycerol, PEG300, PEG400,
polyglycerols, propylene glycols, and derivatives of ethylene
glycol. The oil phase can include, but is not limited to, materials
such as Captex 300, Captex 355, Capmul MCM, fatty acid esters,
medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated glyceryl fatty acid esters, fatty alcohols,
polyglycolized glycerides, saturated polyglycolized C8-C10
glycerides, vegetable oils and silicone oil.
[0430] Microemulsions are particularly of interest from the
standpoint of drug solubilization and the enhanced absorption of
drugs. Lipid based microemulsions (both o/w and w/o) have been
proposed to enhance the oral bioavailability of drugs, including
peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802;
7,157,099; Constantinides et al., Pharmaceutical Research, 1994,
11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993,
13, 205). Microemulsions afford advantages of improved drug
solubilization, protection of drug from enzymatic hydrolysis,
possible enhancement of drug absorption due to surfactant-induced
alterations in membrane fluidity and permeability, ease of
preparation, ease of oral administration over solid dosage forms,
improved clinical potency, and decreased toxicity (see e.g., U.S.
Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099;
Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho
et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions
can form spontaneously when their components are brought together
at ambient temperature. This can be particularly advantageous when
formulating thermolabile drugs, peptides or iRNAs. Microemulsions
have also been effective in the transdermal delivery of active
components in both cosmetic and pharmaceutical applications. It is
expected that the microemulsion compositions and formulations of
the present invention will facilitate the increased systemic
absorption of iRNAs and nucleic acids from the gastrointestinal
tract, as well as improve the local cellular uptake of iRNAs and
nucleic acids.
[0431] Microemulsions of the present invention can also contain
additional components and additives such as sorbitan monostearate
(Grill 3), Labrasol, and penetration enhancers to improve the
properties of the formulation and to enhance the absorption of the
iRNAs and nucleic acids of the present invention. Penetration
enhancers used in the microemulsions of the present invention can
be classified as belonging to one of five broad
categories--surfactants, fatty acids, bile salts, chelating agents,
and non-chelating non-surfactants (Lee et al., Critical Reviews in
Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these
classes has been discussed above.
[0432] iii. Microparticles
[0433] An RNAi agent of the invention may be incorporated into a
particle, e.g., a microparticle. Microparticles can be produced by
spray-drying, but may also be produced by other methods including
lyophilization, evaporation, fluid bed drying, vacuum drying, or a
combination of these techniques.
[0434] iv. Penetration Enhancers
[0435] In one embodiment, the present invention employs various
penetration enhancers to effect the efficient delivery of nucleic
acids, particularly iRNAs, to the skin of animals. Most drugs are
present in solution in both ionized and nonionized forms. However,
usually only lipid soluble or lipophilic drugs readily cross cell
membranes. It has been discovered that even non-lipophilic drugs
can cross cell membranes if the membrane to be crossed is treated
with a penetration enhancer. In addition to aiding the diffusion of
non-lipophilic drugs across cell membranes, penetration enhancers
also enhance the permeability of lipophilic drugs.
[0436] Penetration enhancers can be classified as belonging to one
of five broad categories, i.e., surfactants, fatty acids, bile
salts, chelating agents, and non-chelating non-surfactants (see
e.g., Malmsten, M. Surfactants and polymers in drug delivery,
Informa Health Care, New York, N.Y., 2002; Lee et al., Critical
Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of
the above mentioned classes of penetration enhancers are described
below in greater detail. Such compounds are well known in the
art.
[0437] v. Carriers
[0438] Certain compositions of the present invention also
incorporate carrier compounds in the formulation. As used herein,
"carrier compound" or "carrier" can refer to a nucleic acid, or
analog thereof, which is inert (i.e., does not possess biological
activity per se) but is recognized as a nucleic acid by in vivo
processes that reduce the bioavailability of a nucleic acid having
biological activity by, for example, degrading the biologically
active nucleic acid or promoting its removal from circulation. The
coadministration of a nucleic acid and a carrier compound,
typically with an excess of the latter substance, can result in a
substantial reduction of the amount of nucleic acid recovered in
the liver, kidney or other extracirculatory reservoirs, presumably
due to competition between the carrier compound and the nucleic
acid for a common receptor. For example, the recovery of a
partially phosphorothioate dsRNA in hepatic tissue can be reduced
when it is coadministered with polyinosinic acid, dextran sulfate,
polycytidic acid or
4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et
al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA
& Nucl. Acid Drug Dev., 1996, 6, 177-183.
[0439] vi. Excipients
[0440] In contrast to a carrier compound, a "pharmaceutical
carrier" or "excipient" is a pharmaceutically acceptable solvent,
suspending agent or any other pharmacologically inert vehicle for
delivering one or more nucleic acids to an animal. The excipient
can be liquid or solid and is selected, with the planned manner of
administration in mind, so as to provide for the desired bulk,
consistency, etc., when combined with a nucleic acid and the other
components of a given pharmaceutical composition. Typical
pharmaceutical carriers include, but are not limited to, binding
agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and
other sugars, microcrystalline cellulose, pectin, gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen
phosphate, etc.); lubricants (e.g., magnesium stearate, talc,
silica, colloidal silicon dioxide, stearic acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene
glycols, sodium benzoate, sodium acetate, etc.); disintegrants
(e.g., starch, sodium starch glycolate, etc.); and wetting agents
(e.g., sodium lauryl sulphate, etc).
[0441] Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can also be used to
formulate the compositions of the present invention. Suitable
pharmaceutically acceptable carriers include, but are not limited
to, water, salt solutions, alcohols, polyethylene glycols, gelatin,
lactose, amylose, magnesium stearate, talc, silicic acid, viscous
paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the
like.
[0442] Formulations for topical administration of nucleic acids can
include sterile and non-sterile aqueous solutions, non-aqueous
solutions in common solvents such as alcohols, or solutions of the
nucleic acids in liquid or solid oil bases. The solutions can also
contain buffers, diluents and other suitable additives.
Pharmaceutically acceptable organic or inorganic excipients
suitable for non-parenteral administration which do not
deleteriously react with nucleic acids can be used.
[0443] Suitable pharmaceutically acceptable excipients include, but
are not limited to, water, salt solutions, alcohol, polyethylene
glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid, viscous paraffin, hydroxymethylcellulose,
polyvinylpyrrolidone and the like.
vii. Other Components
[0444] The compositions of the present invention can additionally
contain other adjunct components conventionally found in
pharmaceutical compositions, at their art-established usage levels.
Thus, for example, the compositions can contain additional,
compatible, pharmaceutically-active materials such as, for example,
antipruritics, astringents, local anesthetics or anti-inflammatory
agents, or can contain additional materials useful in physically
formulating various dosage forms of the compositions of the present
invention, such as dyes, flavoring agents, preservatives,
antioxidants, opacifiers, thickening agents and stabilizers.
However, such materials, when added, should not unduly interfere
with the biological activities of the components of the
compositions of the present invention. The formulations can be
sterilized and, if desired, mixed with auxiliary agents, e.g.,
lubricants, preservatives, stabilizers, wetting agents,
emulsifiers, salts for influencing osmotic pressure, buffers,
colorings, flavorings and/or aromatic substances and the like which
do not deleteriously interact with the nucleic acid(s) of the
formulation.
[0445] Aqueous suspensions can contain substances which increase
the viscosity of the suspension including, for example, sodium
carboxymethylcellulose, sorbitol and/or dextran. The suspension can
also contain stabilizers.
[0446] In some embodiments, pharmaceutical compositions featured in
the invention include (a) one or more iRNA agents of the invention
and (b) one or more agents which function by a non-RNAi mechanism
and which are useful in treating a APCS-associated disease or
disorder, e.g., amyloidosis, Alzheimer's disease or coronary
atherosclerotic heart disease.
[0447] Toxicity and therapeutic efficacy of iRNA agents of the
invention can be determined by standard pharmaceutical procedures
in cell cultures or experimental animals, e.g., for determining the
LD50 (the dose lethal to 50% of the population) and the ED50 (the
dose therapeutically effective in 50% of the population). The dose
ratio between toxic and therapeutic effects is the therapeutic
index and it can be expressed as the ratio LD.sub.50/ED.sub.50.
Compounds that exhibit high therapeutic indices are preferred.
[0448] The data obtained from cell culture assays and animal
studies can be used in formulating a range of dosage for use in
humans. The dosage of compositions featured herein in the invention
lies generally within a range of circulating concentrations that
include the ED.sub.50 with little or no toxicity. The dosage can
vary within this range depending upon the dosage form employed and
the route of administration utilized. For any compound used in the
methods featured in the invention, the therapeutically effective
dose can be estimated initially from cell culture assays. A dose
can be formulated in animal models to achieve a circulating plasma
concentration range of the compound or, when appropriate, of the
polypeptide product of a target sequence (e.g., achieving a
decreased concentration of the polypeptide) that includes the
IC.sub.50 (i.e., the concentration of the test compound which
achieves a half-maximal inhibition of symptoms) as determined in
cell culture. Such information can be used to more accurately
determine useful doses in humans. Levels in plasma can be measured,
for example, by high performance liquid chromatography.
[0449] In addition to their administration, as discussed above, the
iRNAs featured in the invention can be administered in combination
with other known agents effective in treatment of pathological
processes mediated by APCS expression. In any event, the
administering physician can adjust the amount and timing of iRNA
administration on the basis of results observed using standard
measures of efficacy known in the art or described herein.
VII. Methods for Inhibiting APCS Expression
[0450] The present invention provides methods of inhibiting
expression of an APCS gene as described herein. In one aspect, the
present invention provides methods of inhibiting expression of APCS
in a cell. The methods include contacting a cell with an RNAi
agent, e.g., a double stranded RNAi agent, in an amount effective
to inhibit expression of the APCS in the cell, thereby inhibiting
expression of the APCS in the cell.
[0451] Contacting of a cell with an RNAi agent, e.g, a double
stranded RNAi agent, may be done in vitro or in vivo. Contacting a
cell in vivo with the RNAi agent includes contacting a cell or
group of cells within a subject, e.g., a human subject, with the
RNAi agent. Combinations of in vitro and in vivo methods of
contacting a cell or a group of cells are also possible. Contacting
a cell or a group of cells may be direct or indirect. Thus, for
example, the RNAi agent may be put into physical contact with the
cell by the individual performing the method, or alternatively, the
RNAi agent may be put into a situation that will permit or cause it
to subsequently come into contact with the cell. Furthermore,
contacting a cell or a group of cells may be accomplished via a
targeting ligand, including any ligand described herein or known in
the art. In preferred embodiments, the targeting ligand is a
carbohydrate moiety, e.g., a GalNAc3 ligand, or any other ligand
that directs the RNAi agent to a site of interest, e.g., the liver
of a subject.
[0452] Contacting a cell in vitro may be done, for example, by
incubating the cell with the RNAi agent. Contacting a cell in vivo
may be done, for example, by injecting the RNAi agent into or near
the tissue where the cell is located, or by injecting the RNAi
agent into another area, e.g., the bloodstream or the subcutaneous
space, such that the agent will subsequently reach the tissue where
the cell to be contacted is located. For example, the RNAi agent
may contain and/or be coupled to a ligand, e.g., GalNAc3, that
directs the RNAi agent to a site of interest, e.g., the liver.
Combinations of in vitro and in vivo methods of contacting are also
possible. For example, a cell may also be contacted in vitro with
an RNAi agent and subsequently transplanted into a subject. The
term "inhibiting," as used herein, is used interchangeably with
"reducing," "silencing," "downregulating", "suppressing", and other
similar terms, and includes any level of inhibition. Preferably
inhibiting includes a statistically significant or clinically
significant inhibition.
[0453] The phrase "inhibiting expression of a APCS gene" is
intended to refer to inhibition of expression of any APCS gene
(such as, e.g., a mouse APCS gene, a rat APCS gene, a monkey APCS
gene, or a human APCS gene) as well as variants or mutants of an
APCS gene.
[0454] The phrase "inhibiting expression of a APCS gene" is
intended to refer to inhibition of expression of any APCS gene
(such as, e.g., a mouse APCS gene, a rat APCS gene, a monkey APCS
gene, or a human APCS gene) as well as variants or mutants of an
APCS gene. Thus, the APCS gene may be a wild-type APCS gene, a
mutant APCS gene, or a transgenic APCS gene in the context of a
genetically manipulated cell, group of cells, or an organism.
[0455] "Inhibiting expression of an APCS gene" includes any level
of inhibition of an APCS gene, e.g., at least partial suppression
of the expression of an APCS gene. The expression of the APCS gene
may be assessed based on the level, or the change in the level, of
any variable associated with APCS gene expression, e.g., APCS mRNA
level, APCS protein level (SAP), or the severity of an
APCS-associated disease. This level may be assessed in an
individual cell or in a group of cells, including, for example, a
sample derived from a subject.
[0456] In some embodiments of the methods of the invention,
expression of an APCS gene, is inhibited by at least about 5%, at
least about 10%, at least about 15%, at least about 20%, at least
about 25%, at least about 30%, at least about 35%, at least about
40%, at least about 45%, at least about 50%, at least about 55%, at
least about 60%, at least about 65%, at least about 70%, at least
about 75%, at least about 80%, at least about 85%, at least about
90%, at least about 91%, at least about 92%, at least about 93%, at
least about 94%. at least about 95%, at least about 96%, at least
about 97%, at least about 98%, or at least about 99%%, or to below
the level of detection of the assay. In some embodiments, the
inhibition of expression of an APCS gene results in normalization
of the level of the APCS gene, such that the difference between the
level before treatment and a normal control level is reduced by at
least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, or 95%. In some embodiments, the inhibition is a clinically
relevant inhibition.
[0457] Inhibition of the expression of the target gene, e.g., an
APCS gene may be manifested by a reduction of the amount of mRNA
expressed by a first cell or group of cells (such cells may be
present, for example, in a sample derived from a subject) in which
a target gene is transcribed and which has or have been treated
(e.g., by contacting the cell or cells with an RNAi agent of the
invention, or by administering an RNAi agent of the invention to a
subject in which the cells are or were present) such that the
expression of a target gene is inhibited, as compared to a second
cell or group of cells substantially identical to the first cell or
group of cells but which has not or have not been so treated
(control cell(s)). In preferred embodiments, the inhibition is
assessed by the rtPCR method, with in vitro assays being performed
in an appropriately matched cell line with the duplex at a 10 nM
concentration, and expressing the level of mRNA in treated cells as
a percentage of the level of mRNA in control cells, using the
following formula:
( mRNA .times. in .times. control .times. cells ) - ( mRNA .times.
in .times. treated .times. cells ) ( mRNA .times. in .times.
control .times. cells ) .times. 100 .times. % ##EQU00001##
[0458] Alternatively, inhibition of the expression of an APCS gene
may be assessed in terms of a reduction of a parameter that is
functionally linked to APCS gene expression, e.g., APCS protein
expression. APCS gene silencing may be determined in any cell
expressing an APCS gene, either constitutively or by genomic
engineering, and by any assay known in the art.
[0459] Inhibition of the expression of an APCS gene may be
manifested by a reduction in the level of the protein encoded by
the APCS gene (SAP) that is produced by a cell or group of cells
(e.g., the level of protein produced in a sample derived from a
subject). As explained above for the assessment of mRNA
suppression, the inhibition of protein expression levels in a
treated cell or group of cells may similarly be expressed as a
percentage of the level of protein in a control cell or group of
cells.
[0460] A control cell or group of cells that may be used to assess
the inhibition of the expression of a target gene includes a cell
or group of cells that has not yet been contacted with an RNAi
agent of the invention. For example, the control cell or group of
cells may be derived from an individual subject (e.g., a human or
animal subject) prior to treatment of the subject with an RNAi
agent. In alternative embodiments, the level may be compared to an
appropriate control sample, e.g., a known population control
sample.
[0461] The level of APCS mRNA that is expressed by a cell or group
of cells may be determined using any method known in the art for
assessing mRNA expression. In one embodiment, the level of
expression of APCS in a sample is determined by detecting a
transcribed polynucleotide, or portion thereof, e.g., mRNA of the
APCS gene. RNA may be extracted from cells using RNA extraction
techniques including, for example, using acid phenol/guanidine
isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA
preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland).
Typical assay formats utilizing ribonucleic acid hybridization
include nuclear run-on assays, RT-PCR, RNase protection assays
(Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in
situ hybridization, and microarray analysis. Circulating APCS mRNA
may be detected using methods the described in PCT Publication No.
WO 2012/177906, the entire contents of which are hereby
incorporated herein by reference.
[0462] In one embodiment, the level of expression of APCS is
determined using a nucleic acid probe. The term "probe", as used
herein, refers to any molecule that is capable of selectively
binding to a specific APCS. Probes can be synthesized by one of
skill in the art, or derived from appropriate biological
preparations. Probes may be specifically designed to be labeled.
Examples of molecules that can be utilized as probes include, but
are not limited to, RNA, DNA, proteins, antibodies, and organic
molecules.
[0463] Isolated mRNA can be used in hybridization or amplification
assays that include, but are not limited to, Southern or Northern
analyses, polymerase chain reaction (PCR) analyses and probe
arrays. One method for the determination of mRNA levels involves
contacting the isolated mRNA with a nucleic acid molecule (probe)
that can hybridize, e.g., specifically hybridize, to APCS mRNA. In
one embodiment, the mRNA is immobilized on a solid surface and
contacted with a probe, for example by running the isolated mRNA on
an agarose gel and transferring the mRNA from the gel to a
membrane, such as nitrocellulose. In an alternative embodiment, the
probe(s) are immobilized on a solid surface and the mRNA is
contacted with the probe(s), for example, in an Affymetrix gene
chip array. A skilled artisan can readily adapt known mRNA
detection methods for use in determining the level of APCS
mRNA.
[0464] An alternative method for determining the level of
expression of APCS in a sample involves the process of nucleic acid
amplification and/or reverse transcriptase (to prepare cDNA) of for
example mRNA in the sample, e.g., by RT-PCR (the experimental
embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202),
ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA
88:189-193), self sustained sequence replication (Guatelli et al.
(1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional
amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA
86:1173-1177), Q-Beta Replicase (Lizardi et al. (1988)
Bio/Technology 6:1197), rolling circle replication (Lizardi et al.,
U.S. Pat. No. 5,854,033) or any other nucleic acid amplification
method, followed by the detection of the amplified molecules using
techniques well known to those of skill in the art. These detection
schemes are especially useful for the detection of nucleic acid
molecules if such molecules are present in very low numbers. In
particular aspects of the invention, the level of expression of
APCS is determined by quantitative fluorogenic RT-PCR (i.e., the
TaqMan.TM. System).
[0465] The expression levels of APCS mRNA may be monitored using a
membrane blot (such as used in hybridization analysis such as
Northern, Southern, dot, and the like), or microwells, sample
tubes, gels, beads or fibers (or any solid support comprising bound
nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305,
5,677,195 and 5,445,934, which are incorporated herein by
reference. The determination of APCS expression level may also
comprise using nucleic acid probes in solution.
[0466] In preferred embodiments, the level of APCS mRNA expression
is assessed using branched DNA (bDNA) assays or real time PCR
(qPCR).
[0467] The level of APCS protein (SAP) expression may be determined
using any method known in the art for the measurement of protein
levels. Such methods include, for example, electrophoresis,
capillary electrophoresis, high performance liquid chromatography
(HPLC), thin layer chromatography (TLC), hyperdiffusion
chromatography, fluid or gel precipitin reactions, absorption
spectroscopy, a colorimetric assays, spectrophotometric assays,
flow cytometry, immunodiffusion (single or double),
immunoelectrophoresis, Western blotting, radioimmunoassay (RIA),
enzyme-linked immunosorbent assays (ELISAs), immunofluorescent
assays, electrochemiluminescence assays, and the like.
[0468] In some embodiments, the efficacy of the methods of the
invention can be monitored by detecting or monitoring a reduction
in a symptom of an APCS-associated disease. Symptoms may be
assessed in vitro or in vivo using any method known in the art. For
example, efficacy of the methods of the invention in treating an
APCS-associated disease, such as amyloidosis, may be assessed by
measuring levels of SAP in plasma collected from a subject
suffering from an APCS-associated disease; measuring an amyloid
load by using, e.g., whole-body .sup.123I-SAP scintigraphy;
measuring the expansion of the extracellular volume by systemic
amyloid deposits by using, e.g., equilibrium magnetic resonance
imaging (MRI); or measuring liver stiffnessif the amyloidosis has
hepatic involvement (see Richards et al., N. Engl. J. Med. 373(12),
1106-1114, 2015). In another example, efficacy of the methods of
the invention in treating an APCS-associated disease, such as a
cardiovascular disease, e.g., coronary atherosclerotic heart
disease, may be assessed by measuring the size of atherosclerotic
lesions.
[0469] The term "sample" as used herein refers to a collection of
similar fluids, cells, or tissues isolated from a subject, as well
as fluids, cells, or tissues present within a subject. Examples of
biological fluids include blood, serum and serosal fluids, plasma,
lymph, urine, cerebrospinal fluid, saliva, ocular fluids, and the
like. Tissue samples may include samples from tissues, organs or
localized regions. For example, samples may be derived from
particular organs, parts of organs, or fluids or cells within those
organs. In certain embodiments, samples may be derived from the
liver (e.g., whole liver or certain segments of liver or certain
types of cells in the liver, such as, e.g., hepatocytes), the
retina or parts or parts of the retina (e.g., retinal pigment
epithelium), the central nervous system or parts of the central
nervous system (e.g., ventricles or choroid plexus), or the
pancreas or certain cells or parts of the pancreas. In preferred
embodiments, a "sample derived from a subject" refers to blood
drawn from the subject or plasma derived therefrom. In further
embodiments, a "sample derived from a subject" refers to liver
tissue (or subcomponents thereof) or retinal tissue (or
subcomponents thereof) derived from the subject.
[0470] In some embodiments of the methods of the invention, the
RNAi agent is administered to a subject such that the RNAi agent is
delivered to a specific site within the subject. The inhibition of
expression of APCS may be assessed using measurements of the level
or change in the level of APCS mRNA and/or APCS protein in a sample
derived from fluid or tissue from the specific site within the
subject. In preferred embodiments, the site is sthe liver. The site
may also be a subsection or subgroup of cells from any one of the
aforementioned sites. The site may also include cells that express
a particular type of receptor.
VIII. Methods for Treating or Preventing an APCS-Associated Disease
or Disorder
[0471] The present invention provides therapeutic and prophylactic
methods which include administering to a subject having an
APCS-associated disease, as described herein, e.g., amyloidosis,
Alzheimer's disease or coronary atherosclerotic heart disease, an
iRNA agent, pharmaceutical composition comprising an iRNA agent, or
vector comprising an iRNA of the invention.
[0472] In one aspect, the present invention provides methods of
treating a subject having a disorder that would benefit from
reduction in APCS expression, e.g., an APCS-associated disease,
e.g., amyloidosis, Alzheimer's disease or coronary atherosclerotic
heart disease. The treatment methods (and uses) of the invention
include administering to the subject, e.g., a human, a
therapeutically effective amount of an iRNA agent targeting an APCS
gene or a pharmaceutical composition comprising an iRNA agent
targeting an APCS gene, thereby treating the subject having a
disorder that would benefit from reduction in APCS expression.
[0473] In one aspect, the invention provides methods of preventing
at least one symptom in a subject having a disorder that would
benefit from reduction in APCS expression, e.g., an
amyloid-associated disease, e.g., amyloidosis, Alzheimer's disease
or coronary atherosclerotic heart disease. The methods include
administering to the subject a therapeutically effective amount of
the iRNA agent, e.g., dsRNA, or vector of the invention, thereby
preventing at least one symptom in the subject having a disorder
that would benefit from reduction in APCS expression. For example,
the invention provides methods for preventing formation of, or
reducing the size of amyloid deposits or atherosclerotic lesions in
a subject suffering from a disorder that would benefit from
reduction in APCS expression, e.g., amyloidosis, Alzheimer's
disease or coronary atherosclerotic heart disease.
[0474] In another aspect, the present invention provides uses of a
therapeutically effective amount of an iRNA agent of the invention
for treating a subject, e.g., a subject that would benefit from a
reduction and/or inhibition of APCS expression.
[0475] In yet another aspect, the present invention provides uses
of an iRNA agent, e.g., a dsRNA, of the invention targeting an APCS
gene or a pharmaceutical composition comprising an iRNA agent
targeting an APCS gene in the manufacture of a medicament for
treating a subject, e.g., a subject that would benefit from a
reduction and/or inhibition of APCS expression, such as a subject
having a disorder that would benefit from reduction in APCS
expression, e.g., amyloidosis, Alzheimer's disease or coronary
atherosclerotic heart disease.
[0476] In another aspect, the invention provides uses of an iRNA,
e.g., a dsRNA, of the invention for preventing at least one symptom
in a subject suffering from a disorder that would benefit from a
reduction and/or inhibition of APCS expression, such as an
APCS-associated disease, e.g., amyloidosis, Alzheimer's disease or
coronary atherosclerotic heart disease.
[0477] In a further aspect, the present invention provides uses of
an iRNA agent of the invention in the manufacture of a medicament
for preventing at least one symptom in a subject suffering from a
disorder that would benefit from a reduction and/or inhibition of
APCS expression, such as an APCS-associated disease, e.g.,
amyloidosis, Alzheimer's disease or coronary atherosclerotic heart
disease.
[0478] In one embodiment, an iRNA agent targeting APCS is
administered to a subject having an APCS-associated disease such
that the expression of a APCS gene, e.g., in a cell, tissue, blood
or other tissue or fluid of the subject is reduced by at least
about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%,
22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%,
35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%,
48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%,
61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%,
74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at
least about 99% or more, or to a level below the level of detection
of the assay, when the dsRNA agent is administered to the
subject.
[0479] The methods and uses of the invention include administering
a composition described herein such that expression of the target
APCS gene is decreased for an extended duration, e.g., at least one
month, preferably at least three months.
[0480] Administration of the dsRNA according to the methods and
uses of the invention may result in a reduction of the severity,
signs, symptoms, and/or markers of such diseases or disorders in a
patient with an APCS-associated disease. By "reduction" in this
context is meant a statistically or clinically significant decrease
in such level. The reduction can be, for example, at least about
5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
[0481] Efficacy of treatment or prevention of disease can be
assessed, for example by measuring disease progression, disease
remission, symptom severity, reduction in pain, quality of life,
dose of a medication required to sustain a treatment effect, level
of a disease marker or any other measurable parameter appropriate
for a given disease being treated or targeted for prevention. It is
well within the ability of one skilled in the art to monitor
efficacy of treatment or prevention by measuring any one of such
parameters, or any combination of parameters. Comparison of the
later readings with the initial readings, or historically relevant
population controls, provide a physician an indication of whether
the treatment is effective. It is well within the ability of one
skilled in the art to monitor efficacy of treatment or prevention
by measuring any one of such parameters, or any combination of
parameters. In connection with the administration of an iRNA
targeting an APCS or pharmaceutical composition thereof, "effective
against" an APCS-associated disease indicates that administration
in a clinically appropriate manner results in a beneficial effect
for at least a statistically significant fraction of patients, such
as improvement of symptoms, a cure, a reduction in disease,
extension of life, improvement in quality of life, or other effect
generally recognized as positive by medical doctors familiar with
treating an APCS-associated disease and the related causes.
[0482] A treatment or preventive effect is evident when there is a
statistically significant improvement in one or more parameters of
disease status, or by a failure to worsen or to develop symptoms
where they would otherwise be anticipated. As an example, a
favorable change of at least 10% in a measurable parameter of
disease, and preferably at least 20%, 30%, 40%, 50% or more can be
indicative of effective treatment. Efficacy for a given iRNA drug
or formulation of that drug can also be judged using an
experimental animal model for the given disease as known in the
art. When using an experimental animal model, efficacy of treatment
is evidenced when a statistically significant reduction in a marker
or symptom is observed.
[0483] Subjects can be administered a therapeutic amount of iRNA,
such as about 0.01 mg/kg to about 200 mg/kg. Values and ranges
intermediate to the recited values are also intended to be part of
this invention. Typically, a suitable dose of an iRNA of the
invention will be in the range of about 0.1 mg/kg to about 5.0
mg/kg, preferably about 0.3 mg/kg and about 3.0 mg/kg.
[0484] The iRNA can be administered by intravenous infusion over a
period of time, on a regular basis, e.g., once per month, once
every other month, once per quarter.
[0485] In certain embodiments, one or more loading doses is
administered.
[0486] Administration of the iRNA can reduce the presence of an
APCS protein (SAP), e.g., in a cell, tissue, blood, serum, plasma,
urine or other compartment of the patient by at least about 5%, 6%,
7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%,
21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%,
34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%,
47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%,
60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%,
73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
at least about 99% or more, or below the level of detection of the
assay method used.
[0487] Before administration of a full dose of the iRNA, patients
can be administered a smaller dose, such as a 5% infusion, and
monitored for adverse effects, such as an allergic reaction. In
another example, the patient can be monitored for unwanted
immunostimulatory effects, such as increased cytokine (e.g.,
TNF-alpha or INF-alpha) levels.
[0488] Owing to the inhibitory effects on APCS gene expression, a
composition according to the invention or a pharmaceutical
composition prepared therefrom can enhance the quality of life.
[0489] An iRNA of the invention may be administered in "naked"
form, where the modified or unmodified iRNA agent is directly
suspended in aqueous or suitable buffer solvent, as a "free iRNA."
A free iRNA is administered in the absence of a pharmaceutical
composition. The free iRNA may be in a suitable buffer solution.
The buffer solution may comprise acetate, citrate, prolamine,
carbonate, or phosphate, or any combination thereof. In one
embodiment, the buffer solution is phosphate buffered saline (PBS).
The pH and osmolarity of the buffer solution containing the iRNA
can be adjusted such that it is suitable for administering to a
subject.
[0490] Alternatively, an iRNA of the invention may be administered
as a pharmaceutical composition, such as a dsRNA liposomal
formulation.
[0491] Subjects that would benefit from a reduction and/or
inhibition of APCS gene expression are those having an
APCS-associated disease or disorder as described herein.
[0492] Treatment of a subject that would benefit from a reduction
and/or inhibition of APCS gene expression includes therapeutic and
prophylactic treatment.
[0493] Subjects that would benefit from a reduction and/or
inhibition of APCS gene expression are those having an
APCS-associated disease or disorder as described herein. In one
embodiment, an APCS-associated disease is an amyloid-associated
disease, such as amyloidosis, e.g., such as primary (systemic AL)
amyloidosis, secondary (systemic AA) amyloidosis, dialysis-related
amyloidosis (DRA), familial (hereditary FA) amyloidosis, senile
systemic amyloidosis (SSA) or organ-specific amyloidosis.
[0494] In another embodiment, the amyloid-associated disease is
Alzheimer's disease.
[0495] In another embodiment, the amyloid associated disease is
diabetes mellitus type 2; Parkinson's disease; transmissible
spongiform encephalopathy (such as bovine spongiform
encephalopathy); fatal familial insomnia; Huntington's disease;
medullary carcinoma of the thyroid; cardiac arrhythmias; isolated
atrial amyloidosis; rheumatoid arthritis; aortic medial amyloid;
prolactinoma; familial amyloid polyneuropathy; lattice corneal
dystrophy; cerebral amyloid angiopathy; cerebral amyloid angiopathy
(Icelandic type); sporadic inclusion body myositis
[0496] In another embodiment, an APCS-associated disease is a
cardiovascular disease, e.g., coronary atherosclerotic heart
disease.
[0497] The invention further provides methods and uses of an iRNA
agent or a pharmaceutical composition thereof for treating a
subject that would benefit from reduction and/or inhibition of APCS
gene expression, e.g., a subject having an APCS-associated disease,
in combination with other pharmaceuticals and/or other therapeutic
methods, e.g., with known pharmaceuticals and/or known therapeutic
methods, such as, for example, those which are currently employed
for treating these disorders.
[0498] Accordingly, in some aspects of the invention, the methods
which include either a single iRNA agent of the invention, further
include administering to the subject one or more additional
therapeutic agents.
[0499] The iRNA agent and an additional therapeutic agent and/or
treatment may be administered at the same time and/or in the same
combination, e.g., parenterally, or the additional therapeutic
agent can be administered as part of a separate composition or at
separate times and/or by another method known in the art or
described herein.
[0500] Additional therapeutics and therapeutic methods suitable for
treating a subject that would benefit from reduction in APCS
expression, e.g., a subject having an APCS-associated disease, may
include (R-1-[6-[R-2-carboxy-pyrrolidin-1-yl]-6-oxo-hexanoyl]
pyrrolidine-2-carboxylic acid) (CPHPC), a proline-derived small
molecule that is bound by SAP in the circulation to form stable
complexes of pairs of native pentameric SAP molecules cross-linked
by the drug. These complexes are immediately cleared by the liver,
leading to almost complete depletion of plasma SAP for the duration
of drug administration (Al-Shawi et al., Open Biol. 6: 150202).
[0501] Additional therapeutics and therapeutic methods suitable for
treating a subject that would benefit from reduction in APCS
expression, e.g., a subject having an APCS-associated disease, may
also include an antibody targeting SAP, such as an anti-SAP
antibody, e.g., a monoclonal IgG1 anti-SAP antibody. It is believed
that an anti-SAP antibody may activate macrophage destruction of
the SAP-containing amyloid deposits in tissues (Al-Shawi et al.,
Open Biol. 6: 150202).
[0502] Additional therapeutics and therapeutic methods suitable for
treating a subject that would benefit from reduction in APCS
expression, e.g., a subject having an APCS-associated disease, may
also include one or more chemotherapeutic agents, e.g., bortezomib,
dexamethasone, melphalan, or combinations thereof.
[0503] Additional therapeutics and therapeutic methods suitable for
treating a subject that would benefit from reduction in APCS
expression, e.g., a subject having an APCS-associated disease, may
also include one or more agents useful for treating cardiovascular
disease, e.g., statins, such as atorvastatin (Lipitor), fluvastatin
(Lescol), lovastatin, pitavastatin (Livalo), pravastatin
(Pravachol), rosuvastatin (Crestor) and simvastatin (Zocor);
anti-platelet medications, such as aspirin; beta blockers, such as
acebutolol (Sectral), atenolol (Tenormin), bisoprolol (Zebeta),
metoprolol (Lopressor, Toprol-XL), Nadolol (Corgard), nebivolol
(Bystolic) and propranolol (Inderal LA, InnoPran XL);
angiotensin-converting enzyme (ACE) inhibitors, such as benazepril
(Lotensin, Lotensin Hct), captopril (Capoten), enalapril (Vasotec),
fosinopril (Monopril), Lisinopril (Prinivil, Zestril), moexipril
(Univasc), perindopril (Aceon) and quinapril (Accupril); calcium
channel blockers, such as amlodipine (Norvasc), diltiazem
(Cardizem, Tiazac), felodipine, isradipine, nicardipine, nifedipine
(Adalat CC, Afeditab CR, Procardia), nisoldipine (Sular) and
verapamil (Calan, Verelan); diuretics, or combinations thereof.
[0504] Additional therapeutics and therapeutic methods suitable for
treating a subject that would benefit from reduction in APCS
expression, e.g., a subject having an APCS-associated disease, may
also include one or more agents useful for treating Alzheimer's
disease, e.g., donepezil (Aricept), galantamine (Razadyne),
memantine (Namenda), rivastigmine (Exelon), or combinations
thereof, e.g., a combination of donepezil and memantine
(Namzaric).
[0505] Accordingly, in one aspect, the present invention provides
methods of treating a subject having a disorder that would benefit
from reduction in APCS expression, e.g., amyloidosis or Alzheimer's
disease, which include administering to the subject, e.g., a human,
a therapeutically effective amount of an iRNA agent targeting an
APCS gene or a pharmaceutical composition comprising an iRNA agent
targeting an APCS gene, and an additional therapeutic agent, such
as CPHPC and/or an anti-SAP antibody, or antigen-binding fragment
thereof, thereby treating the subject having a disorder that would
benefit from reduction in APCS expression.
[0506] In another aspect, the invention provides methods of
preventing at least one symptom in a subject having a disorder that
would benefit from reduction in APCS expression, e.g., an
APCS-associated disease, e.g., amyloidosis, Alzheimer's disease or
coronary atherosclerotic heart disease. The methods include
administering to the subject a therapeutically effective amount of
the iRNA agent, e.g., dsRNA, or vector of the invention, and an
additional therapeutic agent, such as CPHPC and/or an anti-SAP
antibody, or antigen-binding fragment thereof, thereby preventing
at least one symptom in the subject having a disorder that would
benefit from reduction in APCS expression.
[0507] In another aspect, the present invention provides uses of a
therapeutically effective amount of an iRNA agent of the invention
and an additional therapeutic agent, such as CPHPC and/or an
anti-SAP antibody, or antigen-binding fragment thereof, for
treating a subject, e.g., a subject that would benefit from a
reduction and/or inhibition of APCS expression.
[0508] In another aspect, the present invention provides uses of an
iRNA agent, e.g., a dsRNA, of the invention targeting a APCS gene
or a pharmaceutical composition comprising an iRNA agent targeting
a APCS gene in the manufacture of a medicament for use in
combination with an additional therapeutic agent, such as CPHPC
and/or an anti-SAP antibody, or antigen-binding fragment thereof,
for treating a subject, e.g., a subject that would benefit from a
reduction and/or inhibition of APCS expression, e.g., an
APCS-associated disease, e.g., amyloidosis, Alzheimer's disease or
coronary atherosclerotic heart disease.
[0509] In yet another aspect, the invention provides uses of an
iRNA agent, e.g., a dsRNA, of the invention, and an additional
therapeutic agent, such as CPHPC and/or an anti-SAP antibody, or
antigen-binding fragment thereof, for preventing at least one
symptom in a subject suffering from a disorder that would benefit
from a reduction and/or inhibition of APCS expression, such as an
APCS-associated disease, e.g., amyloidosis, Alzheimer's disease or
coronary atherosclerotic heart disease.
[0510] In a further aspect, the present invention provides uses of
an iRNA agent of the invention in the manufacture of a medicament
for use in combination with an additional therapeutic agent, such
as CPHPC and/or an anti-SAP antibody, or antigen-binding fragment
thereof, for preventing at least one symptom in a subject suffering
from a disorder that would benefit from a reduction and/or
inhibition of APCS expression, such as an APCS-associated disease,
e.g., amyloidosis, Alzheimer's disease or coronary atherosclerotic
heart disease.
[0511] In one embodiment, an iRNA agent targeting APCS is
administered to a subject having an APCS-associated disease as
described herein such that APCS levels, e.g., in a cell, tissue,
blood, urine or other tissue or fluid of the subject are reduced by
at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%,
20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%,
33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%,
46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%,
59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%,
72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%,
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, or at least about 99% or more and, subsequently, an additional
therapeutic is administered to the subject.
[0512] The additional therapeutic, e.g., CPHPC and/or an anti-SAP
antibody, or antigen-binding fragment thereof, may be administered
to the subject at the same time as the iRNA agent targeting APCS or
at a different time.
[0513] Moreover, the additional therapeutic, e.g., CPHPC and/or an
anti-SAP antibody, or antigen-binding fragment thereof, may be
administered to the subject in the same formulation as the iRNA
agent targeting APCS or in a different formulation as the iRNA
agent targeting APCS.
[0514] The methods and uses of the invention include administering
a composition described herein such that expression of the target
APCS gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8,
12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76,
or about 80 hours. In one embodiment, expression of the target gene
is decreased for an extended duration, e.g., at least about two,
three, four, five, six, seven days or more, e.g., about one week,
two weeks, three weeks, or about four weeks or longer.
[0515] The present invention also provides methods of using an iRNA
agent of the invention and/or a composition containing an iRNA
agent of the invention to reduce and/or inhibit APCS expression in
a subject.
[0516] In other aspects, use of an iRNA of the invention and/or a
composition comprising an iRNA of the invention for the manufacture
of a medicament for reducing and/or inhibiting APCS gene expression
in a subject are provided.
[0517] Reduction in gene expression can be assessed by any methods
known in the art. For example, a reduction in the expression of an
APCS gene may be determined by determining the mRNA expression
level of APCS using methods routine to one of ordinary skill in the
art, e.g., Northern blotting, qRT-PCR, by determining the protein
level of APCS using methods routine to one of ordinary skill in the
art, such as Western blotting, immunological techniques, flow
cytometry methods, ELISA, and/or by determining a biological
activity of APCS.
[0518] APCS gene expression may be inhibited in the cell by at
least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%,
17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%,
30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%,
43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%,
56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%,
69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99%, or about 100%, or below the level of
detection of the assay method used.
[0519] APCS protein (SAP) production may be inhibited in the cell
by at least about 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%,
16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99%, or about 100%, or below the level of
detection of the assay method used.
[0520] The in vivo methods and uses of the invention may include
administering to a subject a composition containing an iRNA, where
the iRNA includes a nucleotide sequence that is complementary to at
least a part of an RNA transcript of the APCS gene of the mammal to
be treated. When the organism to be treated is a human, the
composition can be administered by any means known in the art
including, but not limited to subcutaneous, intravenous, oral,
intraperitoneal, or parenteral routes, including intracranial
(e.g., intraventricular, intraparenchymal and intrathecal),
intramuscular, transdermal, airway (aerosol), nasal, rectal, and
topical (including buccal and sublingual) administration. In
certain embodiments, the compositions are administered by
subcutaneous or intravenous infusion or injection. In one
embodiment, the compositions are administered by subcutaneous
injection. In some embodiments, the compositions are administered
by intravenous infusion.
[0521] In some embodiments, the administration is via a depot
injection. A depot injection may release the iRNA in a consistent
way over a prolonged time period. Thus, a depot injection may
reduce the frequency of dosing needed to obtain a desired effect,
e.g., a desired inhibition of APCS, or a therapeutic or
prophylactic effect. A depot injection may also provide more
consistent serum concentrations. Depot injections may include
subcutaneous injections or intramuscular injections. In preferred
embodiments, the depot injection is a subcutaneous injection.
[0522] In some embodiments, the administration is via a pump. The
pump may be an external pump or a surgically implanted pump. In
certain embodiments, the pump is a subcutaneously implanted osmotic
pump. In other embodiments, the pump is an infusion pump. An
infusion pump may be used for intravenous, subcutaneous, arterial,
or epidural infusions. In preferred embodiments, the infusion pump
is a subcutaneous infusion pump. In other embodiments, the pump is
a surgically implanted pump that delivers the iRNA to the
subject.
[0523] The mode of administration may be chosen based upon whether
local or systemic treatment is desired and based upon the area to
be treated. The route and site of administration may be chosen to
enhance targeting.
[0524] In one aspect, the present invention also provides methods
for inhibiting the expression of an APCS gene in a subject, such as
a mammal, e.g., a human. The present invention also provides a
composition comprising an iRNA, e.g., a dsRNA, that targets an APCS
gene in a cell of a subject, such as a mammal, for use in
inhibiting expression of the APCS gene in the subject, such as a
mammal. In another aspect, the present invention provides use of an
iRNA, e.g., a dsRNA, that targets a APCS gene in a cell of a
subject, such as a mammal, in the manufacture of a medicament for
inhibiting expression of an APCS gene in the subject, such as a
mammal.
[0525] The methods and uses include administering to a subject,
such as a mammal, e.g., a human, a composition comprising an iRNA,
e.g., a dsRNA, that targets an APCS gene in a cell of the subject,
e.g., a mammal, and maintaining the mammal for a time sufficient to
obtain degradation of the mRNA transcript of the APCS gene, thereby
inhibiting expression of the APCS gene in the mammal.
[0526] In one embodiment, verification of RISC medicated cleavage
of target in vivo following administration of iRNA agent is done by
performing 5'-RACE or modifications of the protocol as known in the
art (Lasham A et al., (2010) Nucleic Acid Res., 38 (3) p-e19)
(Zimmermann et al. (2006) Nature 441: 111-4).
[0527] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the iRNAs and
methods featured in the invention, suitable methods and materials
are described below. All publications, patent applications,
patents, and other references mentioned herein are incorporated by
reference in their entirety. In case of conflict, the present
specification, including definitions, will control. In addition,
the materials, methods, and examples are illustrative only and not
intended to be limiting.
EXAMPLES
Example 1. iRNA Synthesis
Source of Reagents
[0528] Where the source of a reagent is not specifically given
herein, such reagent can be obtained from any supplier of reagents
for molecular biology at a quality/purity standard for application
in molecular biology.
Bioinformatics
[0529] A set of siRNAs targeting the human SAP or APCS, "amyloid P
component, serum" (human: NCBI refseqID NM_001639; NCBI GeneID:
325) as well as toxicology-species APCS orthologs (cynomolgus
monkey: XM_005541312; mouse: NM_011318; rat: NM_017170) were
designed using custom R and Python scripts. The human NM_001639
REFSEQ mRNA, version 3, has a length of 960 bases. The rationale
and method for the set of siRNA designs is as follows: the
predicted efficacy for every potential 19mer siRNA from position 10
through the end was determined with a linear model derived the
direct measure of mRNA knockdown from more than 20,000 distinct
siRNA designs targeting a large number of vertebrate genes. A
subset of the APCS siRNAs was designed with perfect or near-perfect
matches between human and cynomolgus monkey. A further subset was
designed with perfect or near-perfect matches between mouse and rat
APCS orthologs. A further subset was designed with perfect matches
to human APCS. For each strand of the siRNA, a custom Python script
was used in a brute force search to measure the number and
positions of mismatches between the siRNA and all potential
alignments in the target species transcriptome. Extra weight was
given to mismatches in the seed region, defined here as positions
2-9 of the antisense oligonucleotide, as well the cleavage site of
the siRNA, defined here as positions 10-11 of the antisense
oligonucleotide. The relative weight of the mismatches was 2.8;
1.2:1 for seed mismatches, cleavage site, and other positions up
through antisense position 19. Mismatches in the first position
were ignored. A specificity score was calculated for each strand by
summing the value of each weighted mismatch. Preference was given
to siRNAs whose antisense score in human was >=2.2 and predicted
efficacy was >=50% knockdown.
[0530] A detailed list of the unmodified SAP sense and antisense
strand sequences is shown in Tables 3A and 3B. A detailed list of
the modified SAP sense and antisense strand sequences is shown in
Table 4A and 4B.
TABLE-US-00002 TABLE 2 Abbreviations of nucleotide monomers used in
nucleic acid sequence representation. It will be understood that
these monomers, when present in an oligonucleotide, are mutually
linked by 5'-3'-phosphodiester bonds. Abbreviation Nucleotide(s) A
Adenosine-3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs
2'-fluoroadenosine-3'-phosphorothioate As
adenosine-3'-phosphorothioate C cytidine-3'-phosphate Cf
2'-fluorocytidine-3'-phosphate Cfs
2'-fluorocytidine-3'-phosphorothioate Cs
cytidine-3'-phosphorothioate G guanosine-3'-phosphate Gf
2'-fluoroguanosine-3'-phosphate Gfs
2'-fluoroguanosine-3'-phosphorothioate Gs
guanosine-3'-phosphorothioate T 5'-methyluridine-3'-phosphate Tf
2'-fluoro-5-methyluridine-3'-phosphate Tfs
2'-fluoro-5-methyluridine-3'-phosphorothioate Ts
5-methyluridine-3'-phosphorothioate U Uridine-3'-phosphate Uf
2'-fluorouridine-3'-phosphate Ufs
2'-fluorouridine-3'-phosphorothioate Us uridine-3'-phosphorothioate
N any nucleotide (G, A, C, T or U) a
2'-O-methyladenosine-3'-phosphate as
2'-O-methyladenosine-3'-phosphorothioate c
2'-O-methylcytidine-3'-phosphate cs
2'-O-methylcytidine-3'-phosphorothioate g
2'-O-methylguanosine-3'-phosphate gs
2'-O-methylguanosine-3'-phosphorothioate t
2'-O-methyl-5-methyluridine-3'-phosphate ts
2'-O-methyl-5-methyluridine-3'-phosphorothioate u
2'-O-methyluridine-3'-phosphate us
2'-O-methyluridine-3'-phosphorothioate s phosphorothioate linkage
dT 2'-deoxythymidine-3'-phosphate dTs
2'-deoxythymidine-3'-phosphorothioate L96
N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4- hydroxyprolinol
Hyp-(GalNAc-alkyl)3 5'-VP 5'-vinyl phosphate
In Vitro Screen
[0531] Dual-Glo.RTM. Luciferase Assay
[0532] Cos7 cells (ATCC, Manassas, Va.) were grown to near
confluence at 37.degree. C. in an atmosphere of 5% CO2 in DMEM
(ATCC) supplemented with 10% FBS, before being released from the
plate by trypsinization. siRNA and psiCHECK2-APCS plasmid
transfection was carried out by adding 5 .mu.l of siRNA duplexes
and 5 .mu.l of psiCHECK2-APCS plasmid per well along with 5 .mu.l
of Opti-MEM plus 0.1 .mu.l of Lipofectamine 2000 per well
(Invitrogen, Carlsbad Calif. cat #13778-150) and then incubated at
room temperature for 15 minutes. The mixture was then added to the
cells which were re-suspended in 35 .mu.l of fresh complete media.
The transfected cells were incubated at 37.degree. C. in an
atmosphere of 5% CO2.
[0533] Forty-eight hours after the siRNAs and psiCHECK2-APCS
plasmid were transfected; Firefly (transfection control) and
Renilla (fused to ANGPTL4 target sequence) luciferase were
measured. First, media was removed from cells. Then Firefly
luciferase activity was measured by adding 20 .mu.l of
Dual-Glo.RTM. Luciferase Reagent equal to the culture medium volume
to each well and mix. The mixture was incubated at room temperature
for 30 minutes before luminescence (500 nm) was measured on a
Spectramax (Molecular Devices) to detect the Firefly luciferase
signal. Renilla luciferase activity was measured by adding 20 .mu.l
of room temperature of Dual-Glo.RTM. Stop & Glo.RTM. Reagent to
each well and the plates were incubated for 10-15 minutes before
luminescence was again measured to determine the Renilla luciferase
signal. The Dual-Glo.RTM. Stop & Glo.RTM. Reagent, quenches the
firefly luciferase signal and sustained luminescence for the
Renilla luciferase reaction. siRNA activity was determined by
normalizing the Renilla (HBV) signal to the Firefly (control)
signal within each well. The magnitude of siRNA activity was then
assessed relative to cells that were transfected with the same
vector but were not treated with siRNA or were treated with a
non-targeting siRNA. All transfections were done at n=2 or greater.
Table 5A shows the results of a single dose screen of the indicated
agents at 10 nm or 0.1 nm and Table 5B shows the results of a
single dose screen of the indicated agents at 10 nM, 1 nM, or 0.1
nM. Data are expressed as percent of mRNA remaining relative to
untreated Cos7 cells.
TABLE-US-00003 TABLE 3A APCS iRNAs - Unmodified Sequences Duplex
SEQ ID SEQ ID Range Name Sense Sequence 5' to 3' NO: Antisnse
Sequence 5' to 3' NO: IN NM-001639.3 AD-75708 ACUGCUUCUGCUAUAACAGCA
13 UGCUGUUAUAGCAGAAGCAGUGA 97 61-83 AD-75723 UAUGAACAAGCCGCUGCUUUA
14 UAAAGCAGCGGCUUGUUCAUAUU 98 94-116 AD-75694 CAGUGGGAAGGUGUUUGUAUA
15 UAUACAAACACCUUCCCACUGAG 99 163-185 AD-75692
GUGUUUGUAUUUCCUAGAGAA 16 UUCUCUAGGAAAUACAAACACCU 100 173-195
AD-75664 UCUGUUACUGAUCAUGUAAAA 17 UUUUACAUGAUCAGUAACAGAUU 101
194-216 AD-75664.2 UCUGUUACUGAUCAUGUAAAA 18 UUUUACAUGAUCAGUAACAGAUU
102 194-216 AD-75679 GUUACUGAUCAUGUAAACUUA 19
UAAGUUUACAUGAUCAGUAACAG 103 197-219 AD-75659 UACUGAUCAUGUAAACUUGAA
20 UUCAAGUUUACAUGAUCAGUAAC 104 199-221 AD-75662
AUCAUGUAAACUUGAUCACAA 21 UUGUGAUCAAGUUUACAUGAUCA 105 204-226
AD-75680 UCAUGUAAACUUGAUCACACA 22 UGUGUGAUCAAGUUUACAUGAUC 106
205-227 AD-75687 CUCUACAGAACUUUACCUUGA 23 UCAAGGUAAAGUUCUGUAGAGGC
107 237-259 AD-75657 ACUUUACCUUGUGUUUUCGAA 24
UUCGAAAACACAAGGUAAAGUUC 108 246-268 AD-75699 GUUUUCGAGCCUAUAGUGAUA
25 UAUCACUAUAGGCUCGAAAACAC 109 258-280 AD-75727
GAAACUGAUCAUGUGAAGCUA 26 UAGCUUCACAUGAUCAGUUUCAG 110 271-293
AD-75731 ACCUCUGCAGAAUUUUACACA 27 UGUGUAAAAUUCUGCAGAGGUUU 111
309-331 AD-75728 GCAGAAUUUUACACUGUGUUA 28 UAACACAGUGUAAAAUUCUGCAG
112 315-337 AD-75737 CAGAAUUUUACACUGUGUUUA 29
UAAACACAGUGUAAAAUUCUGCA 113 316-338 AD-75696 UAAUGAGCUACUAGUUUAUAA
30 UUAUAAACUAGUAGCUCAUUAUC 114 325-347 AD-75718
AAUGAGCUACUAGUUUAUAAA 31 UUUAUAAACUAGUAGCUCAUUAU 115 326-348
AD-75676 AUGAGCUACUAGUUUAUAAAA 32 UUUUAUAAACUAGUAGCUCAUUA 116
327-349 AD-75663 UGAGCUACUAGUUUAUAAAGA 33 UCUUUAUAAACUAGUAGCUCAUU
117 328-350 AD-75669 GAGCUACUAGUUUAUAAAGAA 34
UUCUUUAUAAACUAGUAGCUCAU 118 329-351 AD-75666 AGCUACUAGUUUAUAAAGAAA
35 UUUCUUUAUAAACUAGUAGCUCA 119 330-352 AD-75735
UGUUUCCGAACCUACAGUGAA 36 UUCACUGUAGGUUCGGAAACACA 120 331-353
AD-75686 CUACUAGUUUAUAAAGAAAGA 37 UCUUUCUUUAUAAACUAGUAGCU 121
332-354 AD-75736 CCGAACCUACAGUGACCUUUA 38 UAAAGGUCACUGUAGGUUCGGAA
122 336-358 AD-75674 GUUUAUAAAGAAAGAGUUGGA 39
UCCAACUCUUUCUUUAUAAACUA 123 338-360 AD-75717 UAAAGAAAGAGUUGGAGAGUA
40 UACUCUCCAACUCUUUCUUUAUA 124 343-365 AD-75706
GUUGGAGAGUAUAGUCUAUAA 41 UUAUAGACUAUACUCUCCAACUC 125 353-375
AD-75719 AGUAUAGUCUAUACAUUGGAA 42 UUCCAAUGUAUAGACUAUACUCU 126
360-382 AD-75688 UAGUCUAUACAUUGGAAGACA 43 UGUCUUCCAAUGUAUAGACUAUA
127 364-386 AD-75734 AGAGUCUUUUCUCCUACAGUA 44
UACUGUAGGAGAAAAGACUCUGA 128 365-387 AD-75724 UACAUUGGAAGACACAAAGUA
45 UACUUUGUGUCUUCCAAUGUAUA 129 371-393 AD-75711
UUGGAAGACACAAAGUUACAA 46 UUGUAACUUUGUGUCUUCCAAUG 130 375-397
AD-75703 AGACACAAAGUUACAUCCAAA 47 UUUGGAUGUAACUUUGUGUCUUC 131
380-402 AD-75721 ACAAAGUUACAUCCAAAGUUA 48 UAACUUUGGAUGUAACUUUGUGU
132 384-406 AD-75712 AAGUUACAUCCAAAGUUAUCA 49
UGAUAACUUUGGAUGUAACUUUG 133 387-409 AD-75697 UACAUCCAAAGUUAUCGAAAA
50 UUUUCGAUAACUUUGGAUGUAAC 134 391-413 AD-75726
UCCAAAGUUAUCGAAAAGUUA 51 UAACUUUUCGAUAACUUUGGAUG 135 395-417
AD-75730 GAGACAAUGAGCUACUAAUUA 52 UAAUUAGUAGCUCAUUGUCUCUG 136
395-417 AD-75732 AGACAAUGAGCUACUAAUUUA 53 UAAAUUAGUAGCUCAUUGUCUCU
137 396-418 AD-75733 AAUGAGCUACUAAUUUAUAAA 54
UUUAUAAAUUAGUAGCUCAUUGU 138 400-422 AD-75729 GAGCUACUAAUUUAUAAAGAA
55 UUCUUUAUAAAUUAGUAGCUCAU 139 403-425 AD-75685
CUCAUCAGGUAUUGCUGAAUA 56 UAUUCAGCAAUACCUGAUGAGGA 140 451-473
AD-75673 UCAGGUAUUGCUGAAUUUUGA 57 UCAAAAUUCAGCAAUACCUGAUG 141
455-477 AD-75691 GUAUUGCUGAAUUUUGGAUCA 58 UGAUCCAAAAUUCAGCAAUACCU
142 459-481 AD-75670 GAAGCUCAGCCCAAGAUUGUA 59
UACAAUCUUGGGCUGAGCUUCUA 143 527-549 AD-75739 GCAUUGUUGAAUUUUGGGUCA
60 UGACCCAAAAUUCAACAAUGCCA 144 533-555 AD-75738
UUGUUGAAUUUUGGGUCAAUA 61 UAUUGACCCAAAAUUCAACAAUG 145 536-558
AD-75722 AUUCCUAUGGGGGCAAGUUUA 62 UAAACUUGCCCCCAUAGGAAUCC 146
564-586 AD-75714 AAAAUAUCCUGUCUGCCUAUA 63 UAUAGGCAGACAGGAUAUUUUCU
147 651-673 AD-75681 AAAUAUCCUGUCUGCCUAUCA 64
UGAUAGGCAGACAGGAUAUUUUC 148 652-674 AD-75668 AAUAUCCUGUCUGCCUAUCAA
65 UUGAUAGGCAGACAGGAUAUUUU 149 653-675 AD-75693
CAGGCUCUGAACUAUGAAAUA 66 UAUUUCAUAGUUCAGAGCCUGCC 150 707-729
AD-75677 AGGCUCUGAACUAUGAAAUCA 67 UGAUUUCAUAGUUCAGAGCCUGC 151
708-730 AD-75690 GGCUCUGAACUAUGAAAUCAA 68 UUGAUUUCAUAGUUCAGAGCCUG
152 709-731 AD-75716 GCUCUGAACUAUGAAAUCAGA 69
UCUGAUUUCAUAGUUCAGAGCCU 153 710-732 AD-75682 GAGGAUAUGUCAUCAUCAAAA
70 UUUUGAUGAUGACAUAUCCUCUG 154 729-751 AD-75720
UAUGUCAUCAUCAAACCCUUA 71 UAAGGGUUUGAUGAUGACAUAUC 155 734-756
AD-75725 CAUCAUCAAACCCUUGGUGUA 72 UACACCAAGGGUUUGAUGAUGAC 156
739-761 AD-75695 AACGAGAGCACUUGAAAAUGA 73 UCAUUUUCAAGUGCUCUCGUUGA
157 778-800 AD-75665 CGAGAGCACUUGAAAAUGAAA 74
UUUCAUUUUCAAGUGCUCUCGUU 158 780-802 AD-75661 AGCACUUGAAAAUGAAAUGAA
75 UUCAUUUCAUUUUCAAGUGCUCU 159 784-806 AD-75658
GCACUUGAAAAUGAAAUGACA 76 UGUCAUUUCAUUUUCAAGUGCUC 160 785-807
AD-75700 AAAUGAAAUGACUGUCUAAGA 77 UCUUAGACAGUCAUUUCAUUUUC 161
793-815 AD-75698 AAUGAAAUGACUGUCUAAGAA 78 UUCUUAGACAGUCAUUUCAUUUU
162 794-816 AD-75672 UGAAAUGACUGUCUAAGAGAA 79
UUCUCUUAGACAGUCAUUUCAUU 163 796-818 AD-75684 GAAAUGACUGUCUAAGAGAUA
80 UAUCUCUUAGACAGUCAUUUCAU 164 797-819 AD-75667
AAAUGACUGUCUAAGAGAUCA 81 UGAUCUCUUAGACAGUCAUUUCA 165 798-820
AD-75678 CAACUGGAUACUAGAUCUUAA 82 UUAAGAUCUAGUAUCCAGUUGCU 166
827-849 AD-75660 GCAGCUCUUUCUUCUUUGAAA 83 UUUCAAAGAAGAAAGAGCUGCAG
167 852-874 AD-75701 CUCUUUCUUCUUUGAAUUUCA 84
UGAAAUUCAAAGAAGAAAGAGCU 168 856-878 AD-75707 CUUUCUUCUUUGAAUUUCCUA
85 UAGGAAAUUCAAAGAAGAAAGAG 169 858-880 AD-75675
CUUUGAAUUUCCUAUCUGUAA 86 UUACAGAUAGGAAAUUCAAAGAA 170 865-887
AD-75671 UUUGAAUUUCCUAUCUGUAUA 87 UAUACAGAUAGGAAAUUCAAAGA 171
866-888 AD-75683 UGAAUUUCCUAUCUGUAUGUA 88 UACAUACAGAUAGGAAAUUCAAA
172 868-890 AD-75689 AAUUUCCUAUCUGUAUGUCUA 89
UAGACAUACAGAUAGGAAAUUCA 173 870-892 AD-75715 AUCUGUAUGUCUGCCUAAUUA
90 UAAUUAGGCAGACAUACAGAUAG 174 878-900 AD-75705
UGUAUGUCUGCCUAAUUAAAA 91 UUUUAAUUAGGCAGACAUACAGA 175 881-903
AD-75704 GUAUGUCUGCCUAAUUAAAAA 92 UUUUUAAUUAGGCAGACAUACAG 176
882-904 AD-75713 UAUGUCUGCCUAAUUAAAAAA 93 UUUUUUAAUUAGGCAGACAUACA
177 883-905 AD-75702 UGUCUGCCUAAUUAAAAAAAA 94
UUUUUUUUAAUUAGGCAGACAUA 178 885-907 AD-75709 UUGUAUUAUGCUACCUGCAAA
95 UUUGCAGGUAGCAUAAUACAAUA 179 911-933 AD-75710
UUAUGCUACCUGCAAAAAAAA 96 UUUUUUUUGCAGGUAGCAUAAUA 180 916-938
TABLE-US-00004 TABLE 3B APCS iRNAs - Unmodified Sequences Duplex
Sense Sequence 5'-3' SEQ ID Range in Name Antisense Sequence 5'-3'
Range in NM_011318.2 NO NM_011318.2 AD-197584.1
CAAUGAGCUACUAAUUUAUAA NM_011318.2_401-421_s 401-421_s
UUAUAAAUUAGUAGCUCAUUGUC NM_011318.2_399-421_as 399-421_as
AD-197510.1 AUUUUACACUGUGUUUCCGAA NM_011318.2_322-342_s 322-342_s
UUCGGAAACACAGUGUAAAAUUC NM_011318.2_320-342_as 320-342_as
AD-197583.1 ACAAUGAGCUACUAAUUUAUA NM_011318.2_400-420_s 400-420_s
UAUAAAUUAGUAGCUCAUUGUCU NM_011318.2_398-420_as 398-420_as
AD-75728.3 GCAGAAUUUUACACUGUGUUA NM_011318.2_319-338_s 319-338_s
UAACACAGUGUAAAAUUCUGCAG NM_011318.2_317-338_as 317-338_as
AD-197508.1 GAAUUUUACACUGUGUUUCCA NM_011318.2_320-340_G21A_s
320-340_G21A_s UGGAAACACAGUGUAAAAUUCUG NM_011318.2_318-340_C1U_as
318-340_C1U_as AD-75737.3 CAGAAUUUUACACUGUGUUUA
NM_011318.2_320-339_C21A_s 320-339_C21A_s UAAACACAGUGUAAAAUUCUGCA
NM_011318.2_318-339_C21A_as 318-339_C21A_as AD-197550.1
CUCAGAGUCUUUUCUCCUACA NM_011318.2_364-384_s 364-384_s
UGUAGGAGAAAAGACUCUGAGAG NM_011318.2_362-384_as 362-384_as
AD-197582.1 GACAAUGAGCUACUAAUUUAA NM_011318.2_399-419_s 399-419_s
UUAAAUUAGUAGCUCAUUGUCUC NM_011318.2_397-419_as 397-419_as
AD-75732.3 AGACAAUGAGCUACUAAUUUA NM_011318.2_400-419_s 400-419_s
UAAAUUAGUAGCUCAUUGUCUCU NM_011318.2_398-419_as 398-419_as
AD-197726.1 AUGGAAAGCCUUGGGUAAAAA NM_011318.2_556-576_s 556-576_s
UUUUUACCCAAGGCUUUCCAUUG NM_011318.2_554-576_as 554-576_as
AD-197544.1 CCCGCUCUCAGAGUCUUUUCA NM_011318.2_358-378_s 358-378_s
UGAAAAGACUCUGAGAGCGGGAA NM_011318.2_356-378_as 356-378_as
AD-197551.1 UCAGAGUCUUUUCUCCUACAA NM_011318.2_365-385_G21A_s
365-385_G21A_s UUGUAGGAGAAAAGACUCUGAGA NM_011318.2_363-385_C1U_as
363-385_C1U_as AD-75730.2 GAGACAAUGAGCUACUAAUUA
NM_011318.2_399-418_s 399-418_s UAAUUAGUAGCUCAUUGUCUCUG
NM_011318.2_397-418_as 397-418_as AD-197410.1 UUCACCAGCCUUCUUUCAGAA
NM_011318.2_198-218_s 198-218_s UUCUGAAAGAAGGCUGGUGAAGA
NM_011318.2_196-218_as 196-218_as AD-197556.1 UCUUUUCUCCUACAGUGUCAA
NM_011318.2_371-391_s 371-391_s UUGACACUGUAGGAGAAAAGACU
NM_011318.2_369-391_as 369-391_as AD-197534.1 AGUGACCUUUCCCGCUCUCAA
NM_011318.2_348-368_G21A_s 348-368_G21A_s UUGAGAGCGGGAAAGGUCACUGU
NM_011318.2_346-368_C1U_as 346-368_C1U_as AD-75734.2
AGAGUCUUUUCUCCUACAGUA NM_011318.2_369-388_G21A_s 369-388_G21A_s
UACUGUAGGAGAAAAGACUCUGA NM_011318.2_367-388_G21A_as 367-388_G21A_as
AD-197503.1 CUCUGCAGAAUUUUACACUGA NM_011318.2_313-333_s 313-333_s
UCAGUGUAAAAUUCUGCAGAGGU NM_011318.2_311-333_as 311-333_as
AD-197406.1 UGUCUUCACCAGCCUUCUUUA NM_011318.2_194-214_C21A_s
194-214_C21A_s UAAAGAAGGCUGGUGAAGACAAA NM_011318.2_192-214_G1U_as
192-214_G1U_as AD-197416.1 AGCCUUCUUUCAGAAGCCUUA
NM_011318.2_204-224_s 204-224_s UAAGGCUUCUGAAAGAAGGCUGG
NM_011318.2_202-224_as 202-224_as AD-197725.1 AAUGGAAAGCCUUGGGUAAAA
NM_011318.2_555-575_s 555-575_s UUUUACCCAAGGCUUUCCAUUGA
NM_011318.2_553-575_as 553-575_as AD-197546.1 CGCUCUCAGAGUCUUUUCUCA
NM_011318.2_360-380_C21A_s 360-380_C21A_s UGAGAAAAGACUCUGAGAGCGGG
NM_011318.2_358-380_G1U_as 358-380_G1U_as AD-197724.1
CAAUGGAAAGCCUUGGGUAAA NM_011318.2_554-574_s 554-574_s
UUUACCCAAGGCUUUCCAUUGAC NM_011318.2_552-574_as 552-574_as
AD-197408.1 UCUUCACCAGCCUUCUUUCAA NM_011318.2_196-216_G21A_s
196-216_G21A_s UUGAAAGAAGGCUGGUGAAGACA NM_011318.2_194-216_C1U_as
194-216_C1U_as AD-197548.1 CUCUCAGAGUCUUUUCUCCUA
NM_011318.2_362-382_s 362-382_s UAGGAGAAAAGACUCUGAGAGCG
NM_011318.2_360-382_as 360-382_as AD-197565.1 CAGAGACAAUGAGCUACUAAA
NM_011318.2_397-416_s 397-416_s UUUAGUAGCUCAUUGUCUCUGCC
NM_011318.2_395-416_as 395-416_as AD-197581.1 AGAGACAAUGAGCUACUAAUA
NM_011318.2_396-416_s 396-416_s UAUUAGUAGCUCAUUGUCUCUGC
NM_011318.2_394-416_as 394-416_as AD-197552.1 CAGAGUCUUUUCUCCUACAGA
NM_011318.2_366-386_s 366-386_s UCUGUAGGAGAAAAGACUCUGAG
NM_011318.2_364-386_as 364-386_as AD-197549.1 UCUCAGAGUCUUUUCUCCUAA
NM_011318.2_363-383_C21A_s 363-383_C21A_s UUAGGAGAAAAGACUCUGAGAGC
NM_011318.2_361-383_G1U_as 361-383_G1U_as AD-197529.1
CCUACAGUGACCUUUCCCGCA NM_011318.2_343-363_s 343-363_s
UGCGGGAAAGGUCACUGUAGGUU NM_011318.2_341-363_as 341-363_as
AD-197417.1 GCCUUCUUUCAGAAGCCUUUA NM_011318.2_205-225_s 205-225_s
UAAAGGCUUCUGAAAGAAGGCUG NM_011318.2_203-225_as 203-225_as
AD-197543.1 UCCCGCUCUCAGAGUCUUUUA NM_011318.2_357-377_C21A_s
357-377_C21A_s UAAAAGACUCUGAGAGCGGGAAA NM_011318.2_355-377_G1U_as
355-377_G1U_as AD-197555.1 GUCUUUUCUCCUACAGUGUCA
NM_011318.2_370-390_s 370-390_s UGACACUGUAGGAGAAAAGACUC
NM_011318.2_368-390_as 368-390_as AD-197530.1 CUACAGUGACCUUUCCCGCUA
NM_011318.2_344-364_C21A_s 344-364_C21A_s UAGCGGGAAAGGUCACUGUAGGU
NM_011318.2_342-364_G1U_as 342-364_G1U_as AD-197554.1
AGUCUUUUCUCCUACAGUGUA NM_011318.2_369-389_C21A_s 369-389_C21A_s
UACACUGUAGGAGAAAAGACUCU NM_011318.2_367-389_G1U_as 367-389_G1U_as
AD-197532.1 ACAGUGACCUUUCCCGCUCUA NM_011318.2_346-366_C21A_s
346-366_C21A_s UAGAGCGGGAAAGGUCACUGUAG NM_011318.2_344-366_G1U_as
344-366_G1U_as AD-197412.1 CACCAGCCUUCUUUCAGAAGA
NM_011318.2_200-220_C21A_s 200-220_C21A_s UCUUCUGAAAGAAGGCUGGUGAA
NM_011318.2_198-220_G1U_as 198-220_G1U_as AD-197713.1
GAAUUUUGGGUCAAUGGAAAA NM_011318.2_543-563_s 543-563_s
UUUUCCAUUGACCCAAAAUUCAA NM_011318.2_541-563_as 541-563_as
AD-197411.1 UCACCAGCCUUCUUUCAGAAA NM_011318.2_199-219_G21A_s
199-219_G21A_s UUUCUGAAAGAAGGCUGGUGAAG NM_011318.2_197-219_C1U_as
197-219_C1U_as AD-197557.1 CUUUUCUCCUACAGUGUCAAA
NM_011318.2_372-392_G21A_s 372-392_G21A_s UUUGACACUGUAGGAGAAAAGAC
NM_011318.2_370-392_C1U_as 370-392_C1U_as AD-197528.1
ACCUACAGUGACCUUUCCCGA NM_011318.2_342-362_C21A_s 342-362_C21A_s
UCGGGAAAGGUCACUGUAGGUUC NM_011318.2_340-362_G1U_as 340-362_G1U_as
AD-197631.1 UCAAAAGUCACAGUCCGUGGA NM_011318.2_459-479_s 459-479_s
UCCACGGACUGUGACUUUUGAUU NM_011318.2_457-479_as 457-479_as
AD-197541.1 UUUCCCGCUCUCAGAGUCUUA NM_011318.2_355-375_s 355-375_s
UAAGACUCUGAGAGCGGGAAAGG NM_011318.2_353-375_as 353-375_as
AD-197533.1 CAGUGACCUUUCCCGCUCUCA NM_011318.2_347-367_s 347-367_s
UGAGAGCGGGAAAGGUCACUGUA NM_011318.2_345-367_as 345-367_as
AD-197632.1 CAAAAGUCACAGUCCGUGGUA NM_011318.2_460-480_s 460-480_s
UACCACGGACUGUGACUUUUGAU NM_011318.2_458-480_as 458-480_as
AD-197542.1 UUCCCGCUCUCAGAGUCUUUA NM_O 1 1 318 .2_356-376_s
356-376_s UAAAGACUCUGAGAGCGGGAAAG NM_011318.2_354-376_as 354-376_as
AD-197629.1 AAUCAAAAGUCACAGUCCGUA NM_011318.2_457-477_G21A_s
457-477_G21A_s UACGGACUGUGACUUUUGAUUGU NM_011318.2_455-477_C1U_as
455-477_C1U_as
TABLE-US-00005 TABLE 4A APCS iRNAs - Modified Sequences Duplex Name
Sense Sequence 5' to 3' SEQ ID NO Antisense Sequence 5' to 3' SEQ
ID NO mRNA target sequence SEQ ID NO AD-75708
ascsugcuUfcUfGfCfuauaacagcaL96 181
VPusGfscugUfuAfUfagcaGfaAfgcagusgsa 265 UCACUGCUUCUGCUAUAACAGCC 349
AD-75723 usasugaaCfaAfGfCfcgcugcuuuaL96 182
VPusAfsaagCfaGfCfggcuUfgUfucauasusu 266 AAUAUGAACAAGCCGCUGCUUUG 350
AD-75694 csasguggGfaAfGfGfuguuuguauaL96 183
VPusAfsuacAfaAfCfaccuUfcCfcacugsasg 267 CUCAGUGGGAAGGUGUUUGUAUU 351
AD-75692 gsusguuuGfuAfUfUfuccuagagaaL96 184
VPusUfscucUfaGfGfaaauAfcAfaacacscsu 268 AGGUGUUUGUAUUUCCUAGAGAA 352
AD-75664 uscsuguuAfcUfGfAfucauguaaaaL96 185
VPusUfsuuaCfaUfGfaucaGfuAfacagasusu 269 AAUCUGUUACUGAUCAUGUAAAC 353
AD-75664.2 uscsuguuAfcUfGfAfucauguaaaaL96 186
VPusUfsuuaCfaUfGfaucaGfuAfacagasusu 270 AAUCUGUUACUGAUCAUGUAAAC 354
AD-75679 gsusuacuGfaUfCfAfuguaaacuuaL96 187
VPusAfsaguUfuAfCfaugaUfcAfguaacsasg 271 CUGUUACUGAUCAUGUAAACUUG 355
AD-75659 usascugaUfcAfUfGfuaaacuugaaL96 188
VPusUfscaaGfuUfUfacauGfaUfcaguasasc 272 GUUACUGAUCAUGUAAACUUGAU 356
AD-75662 asuscaugUfaAfAfCfuugaucacaaL96 189
VPusUfsgugAfuCfAfaguuUfaCfaugauscsa 273 UGAUCAUGUAAACUUGAUCACAC 357
AD-75680 uscsauguAfaAfCfUfugaucacacaL96 190
VPusGfsuguGfaUfCfaaguUfuAfcaugasusc 274 GAUCAUGUAAACUUGAUCACACC 358
AD-75687 csuscuacAfgAfAfCfuuuaccuugaL96 191
VPusCfsaagGfuAfAfaguuCfuGfuagagsgsc 275 GCCUCUACAGAACUUUACCUUGU 359
AD-75657 ascsuuuaCfcUfUfGfuguuuucgaaL96 192
VPusUfscgaAfaAfCfacaaGfgUfaaagususc 276 GAACUUUACCUUGUGUUUUCGAG 360
AD-75699 gsusuuucGfaGfCfCfuauagugauaL96 193
VPusAfsucaCfuAfUfaggcUfcGfaaaacsasc 277 GUGUUUUCGAGCCUAUAGUGAUC 361
AD-75727 gsasaacuGfaUfCfAfugugaagcuaL96 194
VPusAfsgcuUfcAfCfaugaUfcAfguuucsasg 278 CUGAAACUGAUCAUGUGAAGCUG 362
AD-75731 ascscucuGfcAfGfAfauuuuacacaL96 195
VPusGfsuguAfaAfAfuucuGfcAfgaggususu 279 AAACCUCUGCAGAAUUUUACACU 363
AD-75728 gscsagaaUfuUfUfAfcacuguguuaL96 196
VPusAfsacaCfaGfUfguaaAfaUfucugcsasg 280 CUGCAGAAUUUUACACUGUGUUU 364
AD-75737 csasgaauUfuUfAfCfacuguguuuaL96 197
VPusAfsaacAfcAfGfuguaAfaAfuucugscsa 281 UGCAGAAUUUUACACUGUGUUUC 365
AD-75696 usasaugaGfcUfAfCfuaguuuauaaL96 198
VPusUfsauaAfaCfUfaguaGfcUfcauuasusc 282 GAUAAUGAGCUACUAGUUUAUAA 366
AD-75718 asasugagCfuAfCfUfaguuuauaaaL96 199
VPusUfsuauAfaAfCfuaguAfgCfucauusasu 283 AUAAUGAGCUACUAGUUUAUAAA 367
AD-75676 asusgagcUfaCfUfAfguuuauaaaaL96 200
VPusUfsuuaUfaAfAfcuagUfaGfcucaususa 284 UAAUGAGCUACUAGUUUAUAAAG 368
AD-75663 usgsagcuAfcUfAfGfuuuauaaagaL96 201
VPusCfsuuuAfuAfAfacuaGfuAfgcucasusu 285 AAUGAGCUACUAGUUUAUAAAGA 369
AD-75669 gsasgcuaCfuAfGfUfuuauaaagaaL96 202
VPusUfscuuUfaUfAfaacuAfgUfagcucsasu 286 AUGAGCUACUAGUUUAUAAAGAA 370
AD-75666 asgscuacUfaGfUfUfuauaaagaaaL96 203
VPusUfsucuUfuAfUfaaacUfaGfuagcuscsa 287 UGAGCUACUAGUUUAUAAAGAAA 371
AD-75735 usgsuuucCfgAfAfCfcuacagugaaL96 204
VPusUfscacUfgUfAfgguuCfgGfaaacascsa 288 UGUGUUUCCGAACCUACAGUGAC 372
AD-75686 csusacuaGfuUfUfAfuaaagaaagaL96 205
VPusCfsuuuCfuUfUfauaaAfcUfaguagscsu 289 AGCUACUAGUUUAUAAAGAAAGA 373
AD-75736 cscsgaacCfuAfCfAfgugaccuuuaL96 206
VPusAfsaagGfuCfAfcuguAfgGfuucggsasa 290 UUCCGAACCUACAGUGACCUUUC 374
AD-75674 gsusuuauAfaAfGfAfaagaguuggaL96 207
VPusCfscaaCfuCfUfuucuUfuAfuaaacsusa 291 UAGUUUAUAAAGAAAGAGUUGGA 375
AD-75717 usasaagaAfaGfAfGfuuggagaguaL96 208
VPusAfscucUfcCfAfacucUfuUfcuuuasusa 292 UAUAAAGAAAGAGUUGGAGAGUA 376
AD-75706 gsusuggaGfaGfUfAfuagucuauaaL96 209
VPusUfsauaGfaCfUfauacUfcUfccaacsusc 293 GAGUUGGAGAGUAUAGUCUAUAC 377
AD-75719 asgsuauaGfuCfUfAfuacauuggaaL96 210
VPusUfsccaAfuGfUfauagAfcUfauacuscsu 294 AGAGUAUAGUCUAUACAUUGGAA 378
AD-75688 usasgucuAfuAfCfAfuuggaagacaL96 211
VPusGfsucuUfcCfAfauguAfuAfgacuasusa 295 UAUAGUCUAUACAUUGGAAGACA 379
AD-75734 asgsagucUfuUfUfCfuccuacaguaL96 212
VPusAfscugUfaGfGfagaaAfaGfacucusgsa 296 UCAGAGUCUUUUCUCCUACAGUG 380
AD-75724 usascauuGfgAfAfGfacacaaaguaL96 213
VPusAfscuuUfgUfGfucuuCfcAfauguasusa 297 UAUACAUUGGAAGACACAAAGUU 381
AD-75711 ususggaaGfaCfAfCfaaaguuacaaL96 214
VPusUfsguaAfcUfUfugugUfcUfuccaasusg 298 CAUUGGAAGACACAAAGUUACAU 382
AD-75703 asgsacacAfaAfGfUfuacauccaaaL96 215
VPusUfsuggAfuGfUfaacuUfuGfugucususc 299 GAAGACACAAAGUUACAUCCAAA 383
AD-75721 ascsaaagUfuAfCfAfuccaaaguuaL96 216
VPusAfsacuUfuGfGfauguAfaCfuuugusgsu 300 ACACAAAGUUACAUCCAAAGUUA 384
AD-75712 asasguuaCfaUfCfCfaaaguuaucaL96 217
VPusGfsauaAfcUfUfuggaUfgUfaacuususg 301 CAAAGUUACAUCCAAAGUUAUCG 385
AD-75697 usascaucCfaAfAfGfuuaucgaaaaL96 218
VPusUfsuucGfaUfAfacuuUfgGfauguasasc 302 GUUACAUCCAAAGUUAUCGAAAA 386
AD-75726 uscscaaaGfuUfAfUfcgaaaaguuaL96 219
VPusAfsacuUfuUfCfgauaAfcUfuuggasusg 303 CAUCCAAAGUUAUCGAAAAGUUC 387
AD-75730 gsasgacaAfuGfAfGfcuacuaauuaL96 220
VPusAfsauuAfgUfAfgcucAfuUfgucucsusg 304 CAGAGACAAUGAGCUACUAAUUU 388
AD-75732 asgsacaaUfgAfGfCfuacuaauuuaL96 221
VPusAfsaauUfaGfUfagcuCfaUfugucuscsu 305 AGAGACAAUGAGCUACUAAUUUA 389
AD-75733 asasugagCfuAfCfUfaauuuauaaaL96 222
VPusUfsuauAfaAfUfuaguAfgCfucauusgsu 306 ACAAUGAGCUACUAAUUUAUAAA 390
AD-75729 gsasgcuaCfuAfAfUfuuauaaagaaL96 223
VPusUfscuuUfaUfAfaauuAfgUfagcucsasu 307 AUGAGCUACUAAUUUAUAAAGAA 391
AD-75685 csuscaucAfgGfUfAfuugcugaauaL96 224
VPusAfsuucAfgCfAfauacCfuGfaugagsgsa 308 UCCUCAUCAGGUAUUGCUGAAUU 392
AD-75673 uscsagguAfuUfGfCfugaauuuugaL96 225
VPusCfsaaaAfuUfCfagcaAfuAfccugasusg 309 CAUCAGGUAUUGCUGAAUUUUGG 393
AD-75691 gsusauugCfuGfAfAfuuuuggaucaL96 226
VPusGfsaucCfaAfAfauucAfgCfaauacscsu 310 AGGUAUUGCUGAAUUUUGGAUCA 394
AD-75670 gsasagcuCfaGfCfCfcaagauuguaL96 227
VPusAfscaaUfcUfUfgggcUfgAfgcuucsusa 311 UAGAAGCUCAGCCCAAGAUUGUC 395
AD-75739 gscsauugUfuGfAfAfuuuugggucaL96 228
VPusGfsaccCfaAfAfauucAfaCfaaugcscsa 312 UGGCAUUGUUGAAUUUUGGGUCA 396
AD-75738 ususguugAfaUfUfUfugggucaauaL96 229
VPusAfsuugAfcCfCfaaaaUfuCfaacaasusg 313 CAUUGUUGAAUUUUGGGUCAAUG 397
AD-75722 asusuccuAfuGfGfGfggcaaguuuaL96 230
VPusAfsaacUfuGfCfccccAfuAfggaauscsc 314 GGAUUCCUAUGGGGGCAAGUUUG 398
AD-75714 asasaauaUfcCfUfGfucugccuauaL96 231
VPusAfsuagGfcAfGfacagGfaUfauuuuscsu 315 AGAAAAUAUCCUGUCUGCCUAUC 399
AD-75681 asasauauCfcUfGfUfcugccuaucaL96 232
VPusGfsauaGfgCfAfgacaGfgAfuauuususc 316 GAAAAUAUCCUGUCUGCCUAUCA 400
AD-75668 asasuaucCfuGfUfCfugccuaucaaL96 233
VPusUfsgauAfgGfCfagacAfgGfauauususu 317 AAAAUAUCCUGUCUGCCUAUCAG 401
AD-75693 csasggcuCfuGfAfAfcuaugaaauaL96 234
VPusAfsuuuCfaUfAfguucAfgAfgccugscsc 318 GGCAGGCUCUGAACUAUGAAAUC 402
AD-75677 asgsgcucUfgAfAfCfuaugaaaucaL96 235
VPusGfsauuUfcAfUfaguuCfaGfagccusgsc 319 GCAGGCUCUGAACUAUGAAAUCA 403
AD-75690 gsgscucuGfaAfCfUfaugaaaucaaL96 236
VPusUfsgauUfuCfAfuaguUfcAfgagccsusg 320 CAGGCUCUGAACUAUGAAAUCAG 404
AD-75716 gscsucugAfaCfUfAfugaaaucagaL96 237
VPusCfsugaUfuUfCfauagUfuCfagagcscsu 321 AGGCUCUGAACUAUGAAAUCAGA 405
AD-75682 gsasggauAfuGfUfCfaucaucaaaaL96 238
VPusUfsuugAfuGfAfugacAfuAfuccucsusg 322 CAGAGGAUAUGUCAUCAUCAAAC 406
AD-75720 usasugucAfuCfAfUfcaaacccuuaL96 239
VPusAfsaggGfuUfUfgaugAfuGfacauasusc 323 GAUAUGUCAUCAUCAAACCCUUG 407
AD-75725 csasucauCfaAfAfCfccuugguguaL96 240
VPusAfscacCfaAfGfgguuUfgAfugaugsasc 324 GUCAUCAUCAAACCCUUGGUGUG 408
AD-75695 asascgagAfgCfAfCfuugaaaaugaL96 241
VPusCfsauuUfuCfAfagugCfuCfucguusgsa 325 UCAACGAGAGCACUUGAAAAUGA 409
AD-75665 csgsagagCfaCfUfUfgaaaaugaaaL96 242
VPusUfsucaUfuUfUfcaagUfgCfucucgsusu 326 AACGAGAGCACUUGAAAAUGAAA 410
AD-75661 asgscacuUfgAfAfAfaugaaaugaaL96 243
VPusUfscauUfuCfAfuuuuCfaAfgugcuscsu 327 AGAGCACUUGAAAAUGAAAUGAC 411
AD-75658 gscsacuuGfaAfAfAfugaaaugacaL96 244
VPusGfsucaUfuUfCfauuuUfcAfagugcsusc 328 GAGCACUUGAAAAUGAAAUGACU 412
AD-75700 asasaugaAfaUfGfAfcugucuaagaL96 245
VPusCfsuuaGfaCfAfgucaUfuUfcauuususc 329 GAAAAUGAAAUGACUGUCUAAGA 413
AD-75698 asasugaaAfuGfAfCfugucuaagaaL96 246
VPusUfscuuAfgAfCfagucAfuUfucauususu 330 AAAAUGAAAUGACUGUCUAAGAG 414
AD-75672 usgsaaauGfaCfUfGfucuaagagaaL96 247
VPusUfscucUfuAfGfacagUfcAfuuucasusu 331 AAUGAAAUGACUGUCUAAGAGAU 415
AD-75684 gsasaaugAfcUfGfUfcuaagagauaL96 248
VPusAfsucuCfuUfAfgacaGfuCfauuucsasu 332 AUGAAAUGACUGUCUAAGAGAUC 416
AD-75667 asasaugaCfuGfUfCfuaagagaucaL96 249
VPusGfsaucUfcUfUfagacAfgUfcauuuscsa 333 UGAAAUGACUGUCUAAGAGAUCU 417
AD-75678 csasacugGfaUfAfCfuagaucuuaaL96 250
VPusUfsaagAfuCfUfaguaUfcCfaguugscsu 334 AGCAACUGGAUACUAGAUCUUAC 418
AD-75660 gscsagcuCfuUfUfCfuucuuugaaaL96 251
VPusUfsucaAfaGfAfagaaAfgAfgcugcsasg 335 CUGCAGCUCUUUCUUCUUUGAAU 419
AD-75701 csuscuuuCfuUfCfUfuugaauuucaL96 252
VPusGfsaaaUfuCfAfaagaAfgAfaagagscsu 336 AGCUCUUUCUUCUUUGAAUUUCC 420
AD-75707 csusuucuUfcUfUfUfgaauuuccuaL96 253
VPusAfsggaAfaUfUfcaaaGfaAfgaaagsasg 337 CUCUUUCUUCUUUGAAUUUCCUA 421
AD-75675 csusuugaAfuUfUfCfcuaucuguaaL96 254
VPusUfsacaGfaUfAfggaaAfuUfcaaagsasa 338 UUCUUUGAAUUUCCUAUCUGUAU 422
AD-75671 ususugaaUfuUfCfCfuaucuguauaL96 255
VPusAfsuacAfgAfUfaggaAfaUfucaaasgsa 339 UCUUUGAAUUUCCUAUCUGUAUG 423
AD-75683 usgsaauuUfcCfUfAfucuguauguaL96 256
VPusAfscauAfcAfGfauagGfaAfauucasasa 340 UUUGAAUUUCCUAUCUGUAUGUC 424
AD-75689 asasuuucCfuAfUfCfuguaugucuaL96 257
VPusAfsgacAfuAfCfagauAfgGfaaauuscsa 341 UGAAUUUCCUAUCUGUAUGUCUG 425
AD-75715 asuscuguAfuGfUfCfugccuaauuaL96 258
VPusAfsauuAfgGfCfagacAfuAfcagausasg 342 CUAUCUGUAUGUCUGCCUAAUUA 426
AD-75705 usgsuaugUfcUfGfCfcuaauuaaaaL96 259
VPusUfsuuaAfuUfAfggcaGfaCfauacasgsa 343 UCUGUAUGUCUGCCUAAUUAAAA 427
AD-75704 gsusauguCfuGfCfCfuaauuaaaaaL96 260
VPusUfsuuuAfaUfUfaggcAfgAfcauacsasg 344 CUGUAUGUCUGCCUAAUUAAAAA 428
AD-75713 usasugucUfgCfCfUfaauuaaaaaaL96 261
VPusUfsuuuUfaAfUfuaggCfaGfacauascsa 345 UGUAUGUCUGCCUAAUUAAAAAA
429
AD-75702 usgsucugCfcUfAfAfuuaaaaaaaaL96 262
VPusUfsuuuUfuUfAfauuaGfgCfagacasusa 346 UAUGUCUGCCUAAUUAAAAAAAU 430
AD-75709 ususguauUfaUfGfCfuaccugcaaaL96 263
VPusUfsugcAfgGfUfagcaUfaAfuacaasusa 347 UAUUGUAUUAUGCUACCUGCAAA 431
AD-75710 ususaugcUfaCfCfUfgcaaaaaaaaL96 264
VPusUfsuuuUfuUfGfcaggUfaGfcauaasusa 348 UAUUAUGCUACCUGCAAAAAAAA
432
TABLE-US-00006 TABLE 4B APCS iRNAs--Modified Sequences Sense
Sequence 5'-3' Duplex Name Antisense Sequence 5'-3' SEQ ID NO:
Range in NM_011318.2 AD-197584.1 csasaugaGfcUfAfCfuaauuuauaaL96
NM_011318.2_401-421_s VPusUfsauaAfaUfUfaguaGfcUfcauugsusc
NM_011318.2_399-421_as AD-197510.1 asusuuuaCfaCfUfGfuguuuccgaaL96
NM_011318.2_322-342_s VPusUfscggAfaAfCfacagUfgUfaaaaususc
NM_011318.2_320-342_as AD-197583.1 ascsaaugAfgCfUfAfcuaauuuauaL96
NM_011318.2_400-420_s VPusAfsuaaAfuUfAfguagCfuCfauuguscsu
NM_011318.2_398-420_as AD-75728.3 gscsagaaUfuUfUfAfcacuguguuaL96
NM_011318.2_319-338_s VPusAfsacaCfaGfUfguaaAfaUfucugcsasg
NM_011318.2_317-338_as AD-197508.1 gsasauuuUfaCfAfCfuguguuuccaL96
NM_011318.2_320-340_G21A_s VPusGfsgaaAfcAfCfagugUfaAfaauucsusg
NM_011318.2_318-340_C1U_as AD-75737.3
csasgaauUfuUfAfCfacuguguuuaL96 NM_011318.2_320-339_C21A_s
VPusAfsaacAfcAfGfuguaAfaAfuucugscsa NM_011318.2_318-339_C21A_as
AD-197550.1 csuscagaGfuCfUfUfuucuccuacaL96 NM_011318.2_364-384_s
VPusGfsuagGfaGfAfaaagAfcUfcugagsasg NM_011318.2_362-384_as
AD-197582.1 gsascaauGfaGfCfUfacuaauuuaaL96 NM_011318.2_399-419_s
VPusUfsaaaUfuAfGfuagcUfcAfuugucsusc NM_011318.2_397-419_as
AD-75732.3 asgsacaaUfgAfGfCfuacuaauuuaL96 NM_011318.2_400-419_s
VPusAfsaauUfaGfUfagcuCfaUfugucuscsu NM_011318.2_398-419_as
AD-197726.1 asusggaaAfgCfCfUfuggguaaaaaL96 NM_011318.2_556-576_s
VPusUfsuuuAfcCfCfaaggCfuUfuccaususg NM_011318.2_554-576_as
AD-197544.1 cscscgcuCfuCfAfGfagucuuuucaL96 NM_011318.2_358-378_s
VPusGfsaaaAfgAfCfucugAfgAfgcgggsasa NM_011318.2_356-378_as
AD-197551.1 uscsagagUfcUfUfUfucuccuacaaL96
NM_011318.2_365-385_G21A_s VPusUfsguaGfgAfGfaaaaGfaCfucugasgsa
NM_011318.2_363-385_C1U_as AD-75730.2
gsasgacaAfuGfAfGfcuacuaauuaL96 NM_011318.2_399-418_s
VPusAfsauuAfgUfAfgcucAfuUfgucucsusg NM_011318.2_397-418_as
AD-197410.1 ususcaccAfgCfCfUfucuuucagaaL96 NM_011318.2_198-218_s
VPusUfscugAfaAfGfaaggCfuGfgugaasgsa NM_011318.2_196-218_as
AD-197556.1 uscsuuuuCfuCfCfUfacagugucaaL96 NM_011318.2_371-391_s
VPusUfsgacAfcUfGfuaggAfgAfaaagascsu NM_011318.2_369-391_as
AD-197534.1 asgsugacCfuUfUfCfccgcucucaaL96
NM_011318.2_348-368_G21A_s VPusUfsgagAfgCfGfggaaAfgGfucacusgsu
NM_011318.2_346-368_C1U_as AD-75734.2
asgsagucUfuUfUfCfuccuacaguaL96 NM_011318.2_369-388_G21A_s
VPusAfscugUfaGfGfagaaAfaGfacucusgsa NM_011318.2_367-388_G21A_as
AD-197503.1 csuscugcAfgAfAfUfuuuacacugaL96 NM_011318.2_313-333_s
VPusCfsaguGfuAfAfaauuCfuGfcagagsgsu NM_011318.2_311-333_as
AD-197406.1 usgsucuuCfaCfCfAfgccuucuuuaL96
NM_011318.2_194-214_C21A_s VPusAfsaagAfaGfGfcuggUfgAfagacasasa
NM_011318.2_192-214_G1U_as AD-197416.1
asgsccuuCfuUfUfCfagaagccuuaL96 NM_011318.2_204-224_s
VPusAfsaggCfuUfCfugaaAfgAfaggcusgsg NM_011318.2_202-224_as
AD-197725.1 asasuggaAfaGfCfCfuuggguaaaaL96 NM_011318.2_555-575_s
VPusUfsuuaCfcCfAfaggcUfuUfccauusgsa NM_011318.2_553-575_as
AD-197546.1 csgscucuCfaGfAfGfucuuuucucaL96
NM_011318.2_360-380_C21A_s VPusGfsagaAfaAfGfacucUfgAfgagcgsgsg
NM_011318.2_358-380_G1U_as AD-197724.1
csasauggAfaAfGfCfcuuggguaaaL96 NM_011318.2_554-574_s
VPusUfsuacCfcAfAfggcuUfuCfcauugsasc NM_011318.2_552-574_as
AD-197408.1 uscsuucaCfcAfGfCfcuucuuucaaL96
NM_011318.2_196-216_G21A_s VPusUfsgaaAfgAfAfggcuGfgUfgaagascsa
NM_011318.2_194-216_C1U_as AD-197548.1
csuscucaGfaGfUfCfuuuucuccuaL96 NM_011318.2_362-382_s
VPusAfsggaGfaAfAfagacUfcUfgagagscsg NM_011318.2_360-382_as
AD-197565.1 csasgagaCfaAfUfGfagcuacuaaaL96 NM_011318.2_397-416_s
VPusUfsuagUfaGfCfucauUfgUfcucugscsc NM_011318.2_395-416_as
AD-197581.1 asgsagacAfaUfGfAfgcuacuaauaL96 NM_011318.2_396-416_s
VPusAfsuuaGfuAfGfcucaUfuGfucucusgsc NM_011318.2_394-416_as
AD-197552.1 csasgaguCfuUfUfUfcuccuacagaL96 NM_011318.2_366-386_s
VPusCfsuguAfgGfAfgaaaAfgAfcucugsasg NM_011318.2_364-386_as
AD-197549.1 uscsucagAfgUfCfUfuuucuccuaaL96
NM_011318.2_363-383_C21A_s VPusUfsaggAfgAfAfaagaCfuCfugagasgsc
NM_011318.2_361-383_G1U_as AD-197529.1
cscsuacaGfuGfAfCfcuuucccgcaL96 NM_011318.2_343-363_s
VPusGfscggGfaAfAfggucAfcUfguaggsusu NM_011318.2_341-363_as
AD-197417.1 gscscuucUfuUfCfAfgaagccuuuaL96 NM_011318.2_205-225_s
VPusAfsaagGfcUfUfcugaAfaGfaaggcsusg NM_011318.2_203-225_as
AD-197543.1 uscsccgcUfcUfCfAfgagucuuuuaL96
NM_011318.2_357-377_C21A_s VPusAfsaaaGfaCfUfcugaGfaGfcgggasasa
NM_011318.2_355-377_G1U_as AD-197555.1
gsuscuuuUfcUfCfCfuacagugucaL96 NM_011318.2_370-390_s
VPusGfsacaCfuGfUfaggaGfaAfaagacsusc NM_011318.2_368-390_as
AD-197530.1 csusacagUfgAfCfCfuuucccgcuaL96
NM_011318.2_344-364_C21A_s VPusAfsgcgGfgAfAfagguCfaCfuguagsgsu
NM_011318.2_342-364_G1U_as AD-197554.1
asgsucuuUfuCfUfCfcuacaguguaL96 NM_011318.2_369-389_C21A_s
VPusAfscacUfgUfAfggagAfaAfagacuscsu NM_011318.2_367-389_G1U_as
AD-197532.1 ascsagugAfcCfUfUfucccgcucuaL96
NM_011318.2_346-366_C21A_s VPusAfsgagCfgGfGfaaagGfuCfacugusasg
NM_011318.2_344-366_G1U_as AD-197412.1
csasccagCfcUfUfCfuuucagaagaL96 NM_011318.2_200-220_C21A_s
VPusCfsuucUfgAfAfagaaGfgCfuggugsasa NM_011318.2_198-220_G1U_as
AD-197713.1 gsasauuuUfgGfGfUfcaauggaaaaL96 NM_011318.2_543-563_s
VPusUfsuucCfaUfUfgaccCfaAfaauucsasa NM_011318.2_541-563_as
AD-197411.1 uscsaccaGfcCfUfUfcuuucagaaaL96
NM_011318.2_199-219_G21A_s VPusUfsucuGfaAfAfgaagGfcUfggugasasg
NM_011318.2_197-219_C1U_as AD-197557.1
csusuuucUfcCfUfAfcagugucaaaL96 NM_011318.2_372-392_G21A_s
VPusUfsugaCfaCfUfguagGfaGfaaaagsasc NM_011318.2_370-392_C1U_as
AD-197528.1 ascscuacAfgUfGfAfccuuucccgaL96
NM_011318.2_342-362_C21A_s VPusCfsgggAfaAfGfgucaCfuGfuaggususc
NM_011318.2_340-362_G1U_as AD-197631.1
uscsaaaaGfuCfAfCfaguccguggaL96 NM_011318.2_459-479_s
VPusCfscacGfgAfCfugugAfcUfuuugasusu NM_011318.2_457-479_as
AD-197541.1 ususucccGfcUfCfUfcagagucuuaL96 NM_011318.2_355-375_s
VPusAfsagaCfuCfUfgagaGfcGfggaaasgsg NM_011318.2_353-375_as
AD-197533.1 csasgugaCfcUfUfUfcccgcucucaL96 NM_011318.2_347-367_s
VPusGfsagaGfcGfGfgaaaGfgUfcacugsusa NM_011318.2_345-367_as
AD-197632.1 csasaaagUfcAfCfAfguccgugguaL96 NM_011318.2_460-480_s
VPusAfsccaCfgGfAfcuguGfaCfuuuugsasu NM_011318.2_458-480_as
AD-197542.1 ususcccgCfuCfUfCfagagucuuuaL96 NM_011318.2_356-376_s
VPusAfsaagAfcUfCfugagAfgCfgggaasasg NM_011318.2_354-376_as
AD-197629.1 asasucaaAfaGfUfCfacaguccguaL96
NM_011318.2_457-477_G21A_s VPusAfscggAfcUfGfugacUfuUfugauusgsu
NM_011318.2_455-477_C1U_as
TABLE-US-00007 TABLE 5A APCS Single Dose Screen in Cos7 cells 10 nM
0.1 nM Avg [% Avg [% message message Duplex ID remaining] SD
remaining] SD AD-75727.1 39.3 3.8 92.0 8.5 AD-75729.1 49.7 9.1
101.7 24.5 AD-75730.1 30.7 5.9 98.1 11.8 AD-75739.1 24.1 16.8 86.0
9.9 AD-75738.1 86.2 6.8 91.1 15.9 AD-75728.1 121.2 7.5 109.0 3.9
AD-75737.1 106.3 17.9 115.5 13.0 AD-75733.1 23.2 7.5 59.0 15.4
AD-75732.1 16.1 3.3 62.7 18.2 AD-75736.1 72.7 18.7 101.5 21.4
AD-75731.1 124.0 18.6 106.2 7.8 AD-75666.1 7.2 1.0 31.4 3.3
AD-75734.1 122.9 14.4 101.0 8.3 AD-75735.1 86.5 7.3 104.2 10.6
AD-75663.1 5.3 1.7 41.4 10.8 AD-75677.1 25.9 5.3 74.7 6.8
AD-75696.1 8.8 0.5 32.4 0.9 AD-75676.1 15.3 6.9 50.0 14.8
AD-75669.1 8.3 1.0 47.4 14.6 AD-75718.1 11.0 2.9 36.5 9.9
AD-75693.1 20.8 2.5 79.2 8.5 AD-75667.1 14.2 3.2 67.8 10.7
AD-75678.1 12.7 1.9 48.4 1.8 AD-75691.1 9.5 2.0 35.0 5.0 AD-75717.1
14.0 3.1 67.7 9.4 AD-75697.1 8.4 1.3 39.5 9.9 AD-75692.1 4.8 0.4
20.9 3.3 AD-75720.1 7.3 1.4 54.0 5.8 AD-75706.1 9.0 1.8 42.7 14.2
AD-75694.1 9.7 2.8 51.2 15.5 AD-75679.1 3.0 0.7 28.1 5.5 AD-75684.1
11.3 3.0 63.5 1.4 AD-75686.1 7.0 1.5 32.6 2.7 AD-75687.1 5.7 1.3
51.4 6.0 AD-75674.1 8.2 1.7 54.8 5.3 AD-75723.1 13.0 3.0 61.3 13.6
AD-75685.1 8.6 1.6 52.1 5.6 AD-75681.1 28.9 5.1 85.1 11.4
AD-75675.1 5.9 1.8 28.2 1.1 AD-75671.1 3.8 0.5 20.4 5.5 AD-75689.1
4.5 0.6 20.8 3.8 AD-75657.1 7.5 0.2 32.3 6.4 AD-75659.1 9.6 1.6
38.1 12.2 AD-75714.1 12.1 2.5 85.6 11.8 AD-75665.1 9.9 2.7 44.2 6.6
AD-75664.2 7.8 1.8 56.7 8.2 AD-75660.1 8.8 1.7 29.4 1.0 AD-75708.1
11.3 1.8 69.9 8.9 AD-75658.1 7.8 1.0 36.0 7.5 AD-75680.1 7.7 1.7
58.9 6.5 AD-75690.1 26.5 2.5 74.7 7.4 AD-75688.1 15.2 2.1 63.2 9.4
AD-75683.1 19.5 2.7 51.8 6.2 AD-75716.1 11.1 3.3 66.0 9.9
AD-75673.1 9.4 1.2 57.9 4.1 AD-75707.1 6.1 0.5 53.4 13.1 AD-75713.1
12.4 2.1 44.4 5.5 AD-75672.1 9.3 1.8 59.3 6.5 AD-75699.1 7.9 0.6
37.0 4.2 AD-75703.1 14.8 4.2 56.3 7.7 AD-75719.1 6.0 0.9 30.6 7.0
AD-75704.1 10.8 1.6 34.9 6.4 AD-75661.1 9.6 1.2 40.5 2.5 AD-75712.1
13.6 4.6 39.0 7.3 AD-75705.1 8.8 1.3 17.8 6.0 AD-75702.1 8.0 1.1
25.7 3.4 AD-75722.1 71.6 8.6 99.6 22.2 AD-75670.1 16.6 5.3 67.0 7.6
AD-75700.1 8.7 1.7 24.8 5.0 AD-75701.1 6.0 1.8 28.5 2.4 AD-75668.1
33.5 2.3 71.7 11.0 AD-75709.1 17.2 3.5 55.6 4.1 AD-75711.1 10.4 1.6
47.5 2.9 AD-75726.1 18.3 2.4 48.3 12.8 AD-75662.1 7.0 3.2 35.2 4.6
AD-75721.1 17.5 2.7 55.4 9.9 AD-75695.1 13.1 0.8 48.5 6.4
AD-75664.1 11.6 2.7 53.8 5.5 AD-75682.1 12.4 3.2 53.8 6.8
AD-75710.1 78.0 11.2 101.4 6.3 AD-75698.1 11.4 0.8 31.3 11.0
AD-75724.1 26.6 4.4 81.6 17.6 AD-75725.1 30.4 2.4 79.0 11.5
AD-75715.1 9.3 1.5 53.2 5.1
TABLE-US-00008 TABLE 5B APCS Single Dose Screen in Cos7 cells 10 nM
1 nM 0.1 nM Avg Avg Avg [% [% [% message message message Duplex ID
remaining] SD remaining] SD remaining] SD AD-197584.1 10.0 1.0 9.6
1.3 33.8 1.9 AD-197510.1 3.4 0.2 6.6 1.2 34.9 5.0 AD-197583.1 7.3
0.5 8.6 0.4 35.9 3.2 AD-75728.3 8.8 2.6 11.4 1.9 39.4 6.8
AD-197508.1 5.4 0.5 10.2 3.2 46.1 5.6 AD-75737.3 11.7 1.3 18.1 1.2
48.7 3.4 AD-197550.1 5.6 1.2 17.0 8.3 49.3 10.0 AD-197582.1 9.7 0.8
15.4 1.4 49.9 5.0 AD-75732.3 9.7 0.5 14.3 2.0 54.8 6.3 AD-197726.1
20.3 3.8 23.0 3.8 58.9 3.1 AD-197544.1 13.1 0.7 23.7 2.8 60.9 7.6
AD-197551.1 7.9 0.9 15.5 0.8 64.1 9.8 AD-75730.2 8.1 0.7 22.6 2.9
65.3 4.5 AD-197410.1 10.6 0.3 21.7 1.0 65.4 11.2 AD-197556.1 12.1
0.7 25.1 2.7 65.5 8.9 AD-197534.1 14.1 0.8 21.5 3.4 66.8 10.1
AD-75734.2 18.0 0.8 36.7 4.4 67.9 5.8 AD-197503.1 10.1 0.8 20.5 3.1
68.1 2.3 AD-197406.1 8.0 0.6 24.6 5.7 68.4 6.8 AD-197416.1 8.3 2.2
23.1 2.0 69.2 6.1 AD-197725.1 25.2 3.1 25.2 1.7 69.6 11.6
AD-197546.1 12.9 1.6 23.6 2.8 71.1 5.5 AD-197724.1 18.4 1.5 45.3
11.2 71.5 9.2 AD-197408.1 16.1 0.4 37.4 7.7 72.9 5.5 AD-197548.1
9.0 0.7 24.5 7.4 72.9 7.1 AD-197565.1 17.0 2.1 26.9 4.2 73.7 5.5
AD-197581.1 17.0 0.6 34.1 6.8 75.4 3.3 AD-197552.1 6.0 1.1 19.8 5.3
75.7 7.5 AD-197549.1 8.6 0.6 24.3 3.5 76.5 7.4 AD-197529.1 18.0 1.3
43.8 8.1 76.9 4.0 AD-197417.1 13.6 2.1 30.4 3.4 77.3 4.2
AD-197543.1 17.2 0.8 37.1 6.3 77.4 6.1 AD-197555.1 12.8 1.5 27.2
1.0 78.0 11.6 AD-197530.1 16.8 1.1 31.5 2.3 79.0 3.4 AD-197554.1
15.8 1.4 35.3 4.0 79.2 3.8 AD-197532.1 17.4 1.3 33.8 3.1 80.5 1.5
AD-197412.1 16.4 1.5 27.9 6.4 80.9 9.5 AD-197713.1 35.5 6.0 41.6
4.5 83.5 8.5 AD-197411.1 21.8 1.3 41.8 2.2 83.6 8.8 AD-197557.1
32.4 2.6 53.2 9.5 84.0 8.9 AD-197528.1 15.4 1.8 51.9 10.6 84.5 4.7
AD-197631.1 38.1 4.3 53.2 6.4 87.2 10.0 AD-197541.1 27.6 1.1 61.0
6.5 87.2 10.1 AD-197533.1 23.4 0.5 43.4 11.0 87.9 5.4 AD-197632.1
31.4 1.3 56.9 5.4 88.8 5.4 AD-197542.1 21.3 4.3 41.1 4.3 91.3 4.1
AD-197629.1 15.5 0.9 40.9 5.3 91.8 5.4
Example 2. iRNA Design, Synthesis, Selection, and In Vitro
Evaluation
Bioinformatics
[0534] An additional set of siRNAs targeting the human APCS (SAP),
"amyloid P component, serum" (human: NCBI refseqID NM_001639.3;
NCBI GeneID: 325) as well the toxicology-species APCS ortholog from
cynomolgus monkey: XM_005541312.2) was designed using custom R and
Python scripts. All the siRNA designs are a perfect match to the
human APCS transcript and a subset have either perfect or
near-perfect matches to the cynomolgus monkey ortholog. The human
NM_001639 REFSEQ mRNA, version 3, has a length of 960 bases.
[0535] A detailed list of the unmodified SAP sense and antisense
strand sequences is shown in Table 6. A detailed list of the
modified SAP sense and antisense strand sequences is shown in Table
7.
In Vitro Screen
[0536] Dual-Glo.RTM. Luciferase Assay
[0537] Cos7 cells (ATCC, Manassas, Va.) were grown to near
confluence at 37.degree. C. in an atmosphere of 5% CO2 in DMEM
(ATCC) supplemented with 10% FBS, before being released from the
plate by trypsinization. siRNA and psiCHECK2-APCS plasmid
transfection was carried out by adding 5 .mu.l of siRNA duplexes
and 5 .mu.l of psiCHECK2-APCS plasmid per well along with 5 .mu.l
of Opti-MEM plus 0.1 .mu.l of Lipofectamine 2000 per well
(Invitrogen, Carlsbad Calif. cat #13778-150) and then incubated at
room temperature for 15 minutes. The mixture was then added to the
cells which were re-suspended in 35 .mu.l of fresh complete media.
The transfected cells were incubated at 37.degree. C. in an
atmosphere of 5% CO2.
[0538] Forty-eight hours after the siRNAs and psiCHECK2-APCS
plasmid were transfected; Firefly (transfection control) and
Renilla (fused to ANGPTL4 target sequence) luciferase were
measured. First, media was removed from cells. Then Firefly
luciferase activity was measured by adding 20 .mu.l of
Dual-Glo.RTM. Luciferase Reagent equal to the culture medium volume
to each well and mix. The mixture was incubated at room temperature
for 30 minutes before luminescence (500 nm) was measured on a
Spectramax (Molecular Devices) to detect the Firefly luciferase
signal.
[0539] Renilla luciferase activity was measured by adding 20 .mu.l
of room temperature of Dual-Glo.RTM. Stop & Glo.RTM. Reagent to
each well and the plates were incubated for 10-15 minutes before
luminescence was again measured to determine the Renilla luciferase
signal. The Dual-Glo.RTM. Stop & Glo.RTM. Reagent, quenches the
firefly luciferase signal and sustained luminescence for the
Renilla luciferase reaction. siRNA activity was determined by
normalizing the Renilla (HBV) signal to the Firefly (control)
signal within each well. The magnitude of siRNA activity was then
assessed relative to cells that were transfected with the same
vector but were not treated with siRNA or were treated with a
non-targeting siRNA. All transfections were done at n=2 or greater.
Table 8 shows the results of a single dose screen. Data are
expressed as percent of mRNA remaining relative to untreated Cos7
cells.
TABLE-US-00009 TABLE 6 APCS iRNAs - Unmodified Sequences Duplex SEQ
ID Range in Name transSeq SEQ ID NO: transSeq NO: NM_001639.3
AD-77749 AAUAUCAGACGCUAGGGGA 433 UCCCCUAGCGUCUGAUAUU 501 7-25
AD-77750 GGGGGACAGCCACUGUGUU 434 AACACAGUGGCUGUCCCCC 502 22-40
AD-77751 UUGUCUGCUACCCUCAUCA 435 UGAUGAGGGUAGCAGACAA 503 39-57
AD-77752 CAUCCUGGUCACUGCUUCU 436 AGAAGCAGUGACCAGGAUG 504 53-71
AD-77753 UUCUGCUAUAACAGCCCUA 437 UAGGGCUGUUAUAGCAGAA 505 68-86
AD-77754 CCCUAGGCCAGGAAUAUGA 438 UCAUAUUCCUGGCCUAGGG 506 82-100
AD-77755 CAGGAAUAUGAACAAGCCA 439 UGGCUUGUUCAUAUUCCUG 507 90-108
AD-77756 AGCCGCUGCUUUGGAUCUA 440 UAGAUCCAAAGCAGCGGCU 508 104-122
AD-77757 AUCUCUGUCCUCACCAGCA 441 UGCUGGUGAGGACAGAGAU 509 118-136
AD-77758 CAGCCUCCUGGAAGCCUUU 442 AAAGGCUUCCAGGAGGCUG 510 132-150
AD-77759 UUUGCUCACACAGACCUCA 443 UGAGGUCUGUGUGAGCAAA 511 148-166
AD-77760 CCUCAGUGGGAAGGUGUUU 444 AAACACCUUCCCACUGAGG 512 162-180
AD-77761 GGAAGGUGUUUGUAUUUCA 445 UGAAAUACAAACACCUUCC 513 170-188
AD-77762 UUCCUAGAGAAUCUGUUAA 446 UUAACAGAUUCUCUAGGAA 514 185-203
AD-77763 UUACUGAUCAUGUAAACUU 447 AAGUUUACAUGAUCAGUAA 515 200-218
AD-77764 AACUUGAUCACACCGCUGA 448 UCAGCGGUGUGAUCAAGUU 516 214-232
AD-77765 GCUGGAGAAGCCUCUACAA 449 UUGUAGAGGCUUCUCCAGC 517 228-246
AD-77766 UACAGAACUUUACCUUGUA 450 UACAAGGUAAAGUUCUGUA 518 242-260
AD-77767 ACUUUACCUUGUGUUUUCA 451 UGAAAACACAAGGUAAAGU 519 248-266
AD-77768 UUCGAGCCUAUAGUGAUCU 452 AGAUCACUAUAGGCUCGAA 520 263-281
AD-77769 GAUCUCUCUCGUGCCUACA 453 UGUAGGCACGAGAGAGAUC 521 277-295
AD-77770 UCUCGUGCCUACAGCCUCU 454 AGAGGCUGUAGGCACGAGA 522 283-301
AD-77771 CAGCCUCUUCUCCUACAAU 455 AUUGUAGGAGAAGAGGCUG 523 294-312
AD-77772 CAAUACCCAAGGCAGGGAU 456 AUCCCUGCCUUGGGUAUUG 524 309-327
AD-77773 GGGAUAAUGAGCUACUAGU 457 ACUAGUAGCUCAUUAUCCC 525 323-341
AD-77774 UAGUUUAUAAAGAAAGAGU 458 ACUCUUUCUUUAUAAACUA 526 338-356
AD-77775 AGAGUUGGAGAGUAUAGUA 459 UACUAUACUCUCCAACUCU 527 352-370
AD-77776 UAGUCUAUACAUUGGAAGA 460 UCUUCCAAUGUAUAGACUA 528 366-384
AD-77777 UUGGAAGACACAAAGUUAA 461 UUAACUUUGUGUCUUCCAA 529 377-395
AD-77778 CACAAAGUUACAUCCAAAG 462 CUUUGGAUGUAACUUUGUG 530 385-403
AD-77779 AAAGUUAUCGAAAAGUUCA 463 UGAACUUUUCGAUAACUUU 531 400-418
AD-77780 GUUCCCGGCUCCAGUGCAA 464 UUGCACUGGAGCCGGGAAC 532 414-432
AD-77781 UGCACAUCUGUGUGAGCUA 465 UAGCUCACACAGAUGUGCA 533 428-446
AD-77782 AGCUGGGAGUCCUCAUCAA 466 UUGAUGAGGACUCCCAGCU 534 442-460
AD-77783 GUAUUGCUGAAUUUUGGAU 467 AUCCAAAAUUCAGCAAUAC 535 461-479
AD-77784 GGAUCAAUGGGACACCUUU 468 AAAGGUGUCCCAUUGAUCC 536 476-494
AD-77785 CUUUGGUGAAAAAGGGUCU 469 AGACCCUUUUUCACCAAAG 537 491-509
AD-77786 GGUCUGCGACAGGGUUACU 470 AGUAACCCUGUCGCAGACC 538 505-523
AD-77787 UUUGUAGAAGCUCAGCCCA 471 UGGGCUGAGCUUCUACAAA 539 523-541
AD-77788 GCCCAAGAUUGUCCUGGGA 472 UCCCAGGACAAUCUUGGGC 540 537-555
AD-77789 UGGGGCAGGAACAGGAUUA 473 UAAUCCUGUUCCUGCCCCA 541 551-569
AD-77790 UCCUAUGGGGGCAAGUUUA 474 UAAACUUGCCCCCAUAGGA 542 568-586
AD-77791 UUUGAUAGGAGCCAGUCCU 475 AGGACUGGCUCCUAUCAAA 543 583-601
AD-77792 GUCCUUUGUGGGAGAGAUU 476 AAUCUCUCCCACAAAGGAC 544 597-615
AD-77793 AGAUUGGGGAUUUGUACAU 477 AUGUACAAAUCCCCAAUCU 545 611-629
AD-77794 UUUGUACAUGUGGGACUCU 478 AGAGUCCCACAUGUACAAA 546 621-639
AD-77795 AUGUGGGACUCUGUGCUGA 479 UCAGCACAGAGUCCCACAU 547 628-646
AD-77796 CUGCCCCCAGAAAAUAUCA 480 UGAUAUUUUCUGGGGGCAG 548 643-661
AD-77797 UAUCCUGUCUGCCUAUCAA 481 UUGAUAGGCAGACAGGAUA 549 657-675
AD-77798 CCUAUCAGGGUACCCCUCU 482 AGAGGGGUACCCUGAUAGG 550 668-686
AD-77799 CUCUCCCUGCCAAUAUCCU 483 AGGAUAUUGGCAGGGAGAG 551 683-701
AD-77800 UCCUGGACUGGCAGGCUCU 484 AGAGCCUGCCAGUCCAGGA 552 698-716
AD-77801 UGGCAGGCUCUGAACUAUA 485 UAUAGUUCAGAGCCUGCCA 553 706-724
AD-77802 UAUGAAAUCAGAGGAUAUA 486 UAUAUCCUCUGAUUUCAUA 554 721-739
AD-77803 UAUGUCAUCAUCAAACCCU 487 AGGGUUUGAUGAUGACAUA 555 736-754
AD-77804 ACCCUUGGUGUGGGUCUGA 488 UCAGACCCACACCAAGGGU 556 750-768
AD-77805 UGUGGGUCUGAGGUCUUGA 489 UCAAGACCUCAGACCCACA 557 758-776
AD-77806 UUGACUCAACGAGAGCACU 490 AGUGCUCUCGUUGAGUCAA 558 773-791
AD-77807 GCACUUGAAAAUGAAAUGA 491 UCAUUUCAUUUUCAAGUGC 559 787-805
AD-77808 AAUGACUGUCUAAGAGAUA 492 UAUCUCUUAGACAGUCAUU 560 801-819
AD-77809 AGAUCUGGUCAAAGCAACU 493 AGUUGCUUUGACCAGAUCU 561 815-833
AD-77810 CAAAGCAACUGGAUACUAA 494 UUAGUAUCCAGUUGCUUUG 562 824-842
AD-77811 CUAGAUCUUACAUCUGCAA 495 UUGCAGAUGUAAGAUCUAG 563 839-857
AD-77812 GCAGCUCUUUCUUCUUUGA 496 UCAAAGAAGAAAGAGCUGC 564 854-872
AD-77813 UUGAAUUUCCUAUCUGUAU 497 AUACAGAUAGGAAAUUCAA 565 869-887
AD-77814 CUAUCUGUAUGUCUGCCUA 498 UAGGCAGACAUACAGAUAG 566 878-896
AD-77815 CCUAAUUAAAAAAAUAUAU 499 AUAUAUUUUUUUAAUUAGG 567 893-911
AD-77816 UAUAUAUUGUAUUAUGCUA 500 UAGCAUAAUACAAUAUAUA 568
907-925
TABLE-US-00010 TABLE 7 APCS iRNAs - Modified Sequences sense- SEQ
antis- SEQ SEQ Duplex Oligo ID Oligo ID mRNA ID Name Name oligoSeq
NO: Name oligoSeq NO: target sequence NO: AD-77749 A-156212
AAUAUCAGACGCUAGGGGAdTdT 569 A-156213 UCCCCUAGCGUCUGAUAUUdTdT 637
AAUAUCAGACGCUAGGGGG 705 AD-77750 A-156214 GGGGGACAGCCACUGUGUUdTdT
570 A-156215 AACACAGUGGCUGUCCCCCdTdT 638 GGGGGACAGCCACUGUGUU 706
AD-77751 A-156216 UUGUCUGCUACCCUCAUCAdTdT 571 A-156217
UGAUGAGGGUAGCAGACAAdTdT 639 UUGUCUGCUACCCUCAUCC 707 AD-77752
A-156218 CAUCCUGGUCACUGCUUCUdTdT 572 A-156219
AGAAGCAGUGACCAGGAUGdTdT 640 CAUCCUGGUCACUGCUUCU 708 AD-77753
A-156220 UUCUGCUAUAACAGCCCUAdTdT 573 A-156221
UAGGGCUGUUAUAGCAGAAdTdT 641 UUCUGCUAUAACAGCCCUA 709 AD-77754
A-156222 CCCUAGGCCAGGAAUAUGAdTdT 574 A-156223
UCAUAUUCCUGGCCUAGGGdTdT 642 CCCUAGGCCAGGAAUAUGA 710 AD-77755
A-156224 CAGGAAUAUGAACAAGCCAdTdT 575 A-156225
UGGCUUGUUCAUAUUCCUGdTdT 643 CAGGAAUAUGAACAAGCCG 711 AD-77756
A-156226 AGCCGCUGCUUUGGAUCUAdTdT 576 A-156227
UAGAUCCAAAGCAGCGGCUdTdT 644 AGCCGCUGCUUUGGAUCUC 712 AD-77757
A-156228 AUCUCUGUCCUCACCAGCAdTdT 577 A-156229
UGCUGGUGAGGACAGAGAUdTdT 645 AUCUCUGUCCUCACCAGCC 713 AD-77758
A-156230 CAGCCUCCUGGAAGCCUUUdTdT 578 A-156231
AAAGGCUUCCAGGAGGCUGdTdT 646 CAGCCUCCUGGAAGCCUUU 714 AD-77759
A-156232 UUUGCUCACACAGACCUCAdTdT 579 A-156233
UGAGGUCUGUGUGAGCAAAdTdT 647 UUUGCUCACACAGACCUCA 715 AD-77760
A-156234 CCUCAGUGGGAAGGUGUUUdTdT 580 A-156235
AAACACCUUCCCACUGAGGdTdT 648 CCUCAGUGGGAAGGUGUUU 716 AD-77761
A-156236 GGAAGGUGUUUGUAUUUCAdTdT 581 A-156237
UGAAAUACAAACACCUUCCdTdT 649 GGAAGGUGUUUGUAUUUCC 717 AD-77762
A-156238 UUCCUAGAGAAUCUGUUAAdTdT 582 A-156239
UUAACAGAUUCUCUAGGAAdTdT 650 UUCCUAGAGAAUCUGUUAC 718 AD-77763
A-156240 UUACUGAUCAUGUAAACUUdTdT 583 A-156241
AAGUUUACAUGAUCAGUAAdTdT 651 UUACUGAUCAUGUAAACUU 719 AD-77764
A-156242 AACUUGAUCACACCGCUGAdTdT 584 A-156243
UCAGCGGUGUGAUCAAGUUdTdT 652 AACUUGAUCACACCGCUGG 720 AD-77765
A-156244 GCUGGAGAAGCCUCUACAAdTdT 585 A-156245
UUGUAGAGGCUUCUCCAGCdTdT 653 GCUGGAGAAGCCUCUACAG 721 AD-77766
A-156246 UACAGAACUUUACCUUGUAdTdT 586 A-156247
UACAAGGUAAAGUUCUGUAdTdT 654 UACAGAACUUUACCUUGUG 722 AD-77767
A-156248 ACUUUACCUUGUGUUUUCAdTdT 587 A-156249
UGAAAACACAAGGUAAAGUdTdT 655 ACUUUACCUUGUGUUUUCG 723 AD-77768
A-156250 UUCGAGCCUAUAGUGAUCUdTdT 588 A-156251
AGAUCACUAUAGGCUCGAAdTdT 656 UUCGAGCCUAUAGUGAUCU 724 AD-77769
A-156252 GAUCUCUCUCGUGCCUACAdTdT 589 A-156253
UGUAGGCACGAGAGAGAUCdTdT 657 GAUCUCUCUCGUGCCUACA 725 AD-77770
A-156254 UCUCGUGCCUACAGCCUCUdTdT 590 A-156255
AGAGGCUGUAGGCACGAGAdTdT 658 UCUCGUGCCUACAGCCUCU 726 AD-77771
A-156256 CAGCCUCUUCUCCUACAAUdTdT 591 A-156257
AUUGUAGGAGAAGAGGCUGdTdT 659 CAGCCUCUUCUCCUACAAU 727 AD-77772
A-156258 CAAUACCCAAGGCAGGGAUdTdT 592 A-156259
AUCCCUGCCUUGGGUAUUGdTdT 660 CAAUACCCAAGGCAGGGAU 728 AD-77773
A-156260 GGGAUAAUGAGCUACUAGUdTdT 593 A-156261
ACUAGUAGCUCAUUAUCCCdTdT 661 GGGAUAAUGAGCUACUAGU 729 AD-77774
A-156262 UAGUUUAUAAAGAAAGAGUdTdT 594 A-156263
ACUCUUUCUUUAUAAACUAdTdT 662 UAGUUUAUAAAGAAAGAGU 730 AD-77775
A-156264 AGAGUUGGAGAGUAUAGUAdTdT 595 A-156265
UACUAUACUCUCCAACUCUdTdT 663 AGAGUUGGAGAGUAUAGUC 731 AD-77776
A-156266 UAGUCUAUACAUUGGAAGAdTdT 596 A-156267
UCUUCCAAUGUAUAGACUAdTdT 664 UAGUCUAUACAUUGGAAGA 732 AD-77777
A-156268 UUGGAAGACACAAAGUUAAdTdT 597 A-156269
UUAACUUUGUGUCUUCCAAdTdT 665 UUGGAAGACACAAAGUUAC 733 AD-77778
A-156270 CACAAAGUUACAUCCAAAGdTdT 598 A-156271
CUUUGGAUGUAACUUUGUGdTdT 666 CACAAAGUUACAUCCAAAG 734 AD-77779
A-156272 AAAGUUAUCGAAAAGUUCAdTdT 599 A-156273
UGAACUUUUCGAUAACUUUdTdT 667 AAAGUUAUCGAAAAGUUCC 735 AD-77780
A-156274 GUUCCCGGCUCCAGUGCAAdTdT 600 A-156275
UUGCACUGGAGCCGGGAACdTdT 668 GUUCCCGGCUCCAGUGCAC 736 AD-77781
A-156276 UGCACAUCUGUGUGAGCUAdTdT 601 A-156277
UAGCUCACACAGAUGUGCAdTdT 669 UGCACAUCUGUGUGAGCUG 737 AD-77782
A-156278 AGCUGGGAGUCCUCAUCAAdTdT 602 A-156279
UUGAUGAGGACUCCCAGCUdTdT 670 AGCUGGGAGUCCUCAUCAG 738 AD-77783
A-156280 GUAUUGCUGAAUUUUGGAUdTdT 603 A-156281
AUCCAAAAUUCAGCAAUACdTdT 671 GUAUUGCUGAAUUUUGGAU 739 AD-77784
A-156282 GGAUCAAUGGGACACCUUUdTdT 604 A-156283
AAAGGUGUCCCAUUGAUCCdTdT 672 GGAUCAAUGGGACACCUUU 740 AD-77785
A-156284 CUUUGGUGAAAAAGGGUCUdTdT 605 A-156285
AGACCCUUUUUCACCAAAGdTdT 673 CUUUGGUGAAAAAGGGUCU 741 AD-77786
A-156286 GGUCUGCGACAGGGUUACUdTdT 606 A-156287
AGUAACCCUGUCGCAGACCdTdT 674 GGUCUGCGACAGGGUUACU 742 AD-77787
A-156288 UUUGUAGAAGCUCAGCCCAdTdT 607 A-156289
UGGGCUGAGCUUCUACAAAdTdT 675 UUUGUAGAAGCUCAGCCCA 743 AD-77788
A-156290 GCCCAAGAUUGUCCUGGGAdTdT 608 A-156291
UCCCAGGACAAUCUUGGGCdTdT 676 GCCCAAGAUUGUCCUGGGG 744 AD-77789
A-156292 UGGGGCAGGAACAGGAUUAdTdT 609 A-156293
UAAUCCUGUUCCUGCCCCAdTdT 677 UGGGGCAGGAACAGGAUUC 745 AD-77790
A-156294 UCCUAUGGGGGCAAGUUUAdTdT 610 A-156295
UAAACUUGCCCCCAUAGGAdTdT 678 UCCUAUGGGGGCAAGUUUG 746 AD-77791
A-156296 UUUGAUAGGAGCCAGUCCUdTdT 611 A-156297
AGGACUGGCUCCUAUCAAAdTdT 679 UUUGAUAGGAGCCAGUCCU 747 AD-77792
A-156298 GUCCUUUGUGGGAGAGAUUdTdT 612 A-156299
AAUCUCUCCCACAAAGGACdTdT 680 GUCCUUUGUGGGAGAGAUU 748 AD-77793
A-156300 AGAUUGGGGAUUUGUACAUdTdT 613 A-156301
AUGUACAAAUCCCCAAUCUdTdT 681 AGAUUGGGGAUUUGUACAU 749 AD-77794
A-156302 UUUGUACAUGUGGGACUCUdTdT 614 A-156303
AGAGUCCCACAUGUACAAAdTdT 682 UUUGUACAUGUGGGACUCU 750 AD-77795
A-156304 AUGUGGGACUCUGUGCUGAdTdT 615 A-156305
UCAGCACAGAGUCCCACAUdTdT 683 AUGUGGGACUCUGUGCUGC 751 AD-77796
A-156306 CUGCCCCCAGAAAAUAUCAdTdT 616 A-156307
UGAUAUUUUCUGGGGGCAGdTdT 684 CUGCCCCCAGAAAAUAUCC 752 AD-77797
A-156308 UAUCCUGUCUGCCUAUCAAdTdT 617 A-156309
UUGAUAGGCAGACAGGAUAdTdT 685 UAUCCUGUCUGCCUAUCAG 753 AD-77798
A-156310 CCUAUCAGGGUACCCCUCUdTdT 618 A-156311
AGAGGGGUACCCUGAUAGGdTdT 686 CCUAUCAGGGUACCCCUCU 754 AD-77799
A-156312 CUCUCCCUGCCAAUAUCCUdTdT 619 A-156313
AGGAUAUUGGCAGGGAGAGdTdT 687 CUCUCCCUGCCAAUAUCCU 755 AD-77800
A-156314 UCCUGGACUGGCAGGCUCUdTdT 620 A-156315
AGAGCCUGCCAGUCCAGGAdTdT 688 UCCUGGACUGGCAGGCUCU 756 AD-77801
A-156316 UGGCAGGCUCUGAACUAUAdTdT 621 A-156317
UAUAGUUCAGAGCCUGCCAdTdT 689 UGGCAGGCUCUGAACUAUG 757 AD-77802
A-156318 UAUGAAAUCAGAGGAUAUAdTdT 622 A-156319
UAUAUCCUCUGAUUUCAUAdTdT 690 UAUGAAAUCAGAGGAUAUG 758 AD-77803
A-156320 UAUGUCAUCAUCAAACCCUdTdT 623 A-156321
AGGGUUUGAUGAUGACAUAdTdT 691 UAUGUCAUCAUCAAACCCU 759 AD-77804
A-156322 ACCCUUGGUGUGGGUCUGAdTdT 624 A-156323
UCAGACCCACACCAAGGGUdTdT 692 ACCCUUGGUGUGGGUCUGA 760 AD-77805
A-156324 UGUGGGUCUGAGGUCUUGAdTdT 625 A-156325
UCAAGACCUCAGACCCACAdTdT 693 UGUGGGUCUGAGGUCUUGA 761 AD-77806
A-156326 UUGACUCAACGAGAGCACUdTdT 626 A-156327
AGUGCUCUCGUUGAGUCAAdTdT 694 UUGACUCAACGAGAGCACU 762 AD-77807
A-156328 GCACUUGAAAAUGAAAUGAdTdT 627 A-156329
UCAUUUCAUUUUCAAGUGCdTdT 695 GCACUUGAAAAUGAAAUGA 763 AD-77808
A-156330 AAUGACUGUCUAAGAGAUAdTdT 628 A-156331
UAUCUCUUAGACAGUCAUUdTdT 696 AAUGACUGUCUAAGAGAUC 764 AD-77809
A-156332 AGAUCUGGUCAAAGCAACUdTdT 629 A-156333
AGUUGCUUUGACCAGAUCUdTdT 697 AGAUCUGGUCAAAGCAACU 765 AD-77810
A-156334 CAAAGCAACUGGAUACUAAdTdT 630 A-156335
UUAGUAUCCAGUUGCUUUGdTdT 698 CAAAGCAACUGGAUACUAG 766 AD-77811
A-156336 CUAGAUCUUACAUCUGCAAdTdT 631 A-156337
UUGCAGAUGUAAGAUCUAGdTdT 699 CUAGAUCUUACAUCUGCAG 767 AD-77812
A-156338 GCAGCUCUUUCUUCUUUGAdTdT 632 A-156339
UCAAAGAAGAAAGAGCUGCdTdT 700 GCAGCUCUUUCUUCUUUGA 768 AD-77813
A-156340 UUGAAUUUCCUAUCUGUAUdTdT 633 A-156341
AUACAGAUAGGAAAUUCAAdTdT 701 UUGAAUUUCCUAUCUGUAU 769 AD-77814
A-156342 CUAUCUGUAUGUCUGCCUAdTdT 634 A-156343
UAGGCAGACAUACAGAUAGdTdT 702 CUAUCUGUAUGUCUGCCUA 770 AD-77815
A-156344 CCUAAUUAAAAAAAUAUAUdTdT 635 A-156345
AUAUAUUUUUUUAAUUAGGdTdT 703 CCUAAUUAAAAAAAUAUAU 771 AD-77816
A-156346 UAUAUAUUGUAUUAUGCUAdTdT 636 A-156347
UAGCAUAAUACAAUAUAUAdTdT 704 UAUAUAUUGUAUUAUGCUA 772
TABLE-US-00011 TABLE 8 APCS Single Dose Screen in Cos7 cells 10 nM
avg [% message Duplex ID remaining] stdev AD-77749 55.2 5.0
AD-77750 40.8 4.4 AD-77751 78.6 6.4 AD-77752 11.2 2.5 AD-77753 13.0
3.2 AD-77754 17.9 4.4 AD-77755 20.1 3.3 AD-77756 16.1 2.4 AD-77757
13.2 1.6 AD-77758 11.4 1.5 AD-77759 9.5 1.0 AD-77760 19.8 6.8
AD-77761 4.8 1.0 AD-77762 9.3 3.1 AD-77763 24.6 6.2 AD-77764 13.2
1.8 AD-77765 11.0 1.1 AD-77766 9.4 3.4 AD-77767 10.2 1.8 AD-77768
59.3 4.8 AD-77769 13.2 1.5 AD-77770 21.9 2.1 AD-77771 21.3 5.2
AD-77772 18.7 4.6 AD-77773 11.0 2.0 AD-77774 59.4 6.2 AD-77775 12.2
1.2 AD-77776 16.1 1.1 AD-77777 10.6 1.3 AD-77778 17.3 1.5 AD-77779
30.4 2.2 AD-77780 78.7 18.9 AD-77781 38.2 5.4 AD-77782 21.0 3.2
AD-77783 12.3 7.1 AD-77784 8.2 2.0 AD-77785 14.2 2.6 AD-77786 21.9
5.5 AD-77787 39.3 3.4 AD-77788 33.6 12.3 AD-77789 35.9 6.6 AD-77790
27.3 3.4 AD-77791 77.0 8.1 AD-77792 25.5 2.7 AD-77793 29.1 3.4
AD-77794 62.8 9.0 AD-77795 19.6 3.7 AD-77796 51.6 8.2 AD-77797 29.7
2.7 AD-77798 17.7 0.9 AD-77799 33.1 4.4 AD-77800 38.6 1.7 AD-77801
20.4 2.0 AD-77802 17.1 1.7 AD-77803 78.0 4.6 AD-77804 18.1 1.9
AD-77805 10.8 1.7 AD-77806 11.3 2.5 AD-77807 10.3 1.7 AD-77808 34.2
1.4 AD-77809 25.5 11.9 AD-77810 27.1 15.7 AD-77811 31.6 14.4
AD-77812 18.9 10.7 AD-77813 13.6 6.8 AD-77814 19.7 12.2 AD-77815
27.5 7.5 AD-77816 23.0 10.3
TABLE-US-00012 Informal Sequence Listing SEQ ID NO: 1
>gi|206597534|ref|NM_001639.3| Homo sapiens amyloid P component,
serum (APCS), mRNA
GGGCATGAATATCAGACGCTAGGGGGACAGCCACTGTGTTGTCTGCTACCCTCATCCTGGTCACTGCTTC
TGCTATAACAGCCCTAGGCCAGGAATATGAACAAGCCGCTGCTTTGGATCTCTGTCCTCACCAGCCTCCT
GGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGATCAT
GTAAACTTGATCACACCGCTGGAGAAGCCTCTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATC
TCTCTCGTGCCTACAGCCTCTTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGA
AAGAGTTGGAGAGTATAGTCTATACATTGGAAGACACAAAGTTACATCCAAAGTTATCGAAAAGTTCCCG
GCTCCAGTGCACATCTGTGTGAGCTGGGAGTCCTCATCAGGTATTGCTGAATTTTGGATCAATGGGACAC
CTTTGGTGAAAAAGGGTCTGCGACAGGGTTACTTTGTAGAAGCTCAGCCCAAGATTGTCCTGGGGCAGGA
ACAGGATTCCTATGGGGGCAAGTTTGATAGGAGCCAGTCCTTTGTGGGAGAGATTGGGGATTTGTACATG
TGGGACTCTGTGCTGCCCCCAGAAAATATCCTGTCTGCCTATCAGGGTACCCCTCTCCCTGCCAATATCC
TGGACTGGCAGGCTCTGAACTATGAAATCAGAGGATATGTCATCATCAAACCCTTGGTGTGGGTCTGAGG
TCTTGACTCAACGAGAGCACTTGAAAATGAAATGACTGTCTAAGAGATCTGGTCAAAGCAACTGGATACT
AGATCTTACATCTGCAGCTCTTTCTTCTTTGAATTTCCTATCTGTATGTCTGCCTAATTAAAAAAATATA
TATTGTATTATGCTACCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SEQ ID NO: 2
>gi|982224943|ref|XM_005541312.2| PREDICTED: Macaca fascicularis
amyloid P component, serum (APCS), mRNA
AATAGCCTGAAGTCTAAGGGCGTGAATATCAGACGCTAGGGGGACAGCCACTGTGTTATCTGCTGCCCTC
ATCCTGGTCACTGCTCCTGCTATAATAGCCCTAGGCCAGGAATATGAACAAGCTGCTGCTTTGGGTCTCT
GTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAG
AATCTGTTACTGATCATGTAAACTTGATCACACAGCTGGAGAAGCCTCTGCAGAACTTTACCTTGTGTTT
TCGAGCCTACACTGATCTCTCCCGTCCCTACAGCCTCTTCTCCTACAATACCCAGGGAAAGGATAATGAG
CTAGTAGTTTATAAAGAAAGAGTTGGAGATTATAGTCTCTACATTGGAAGACAAAAAGTTACATTCAAAG
TTATTGAAAAGTTCCCGGCTCCAGTGCACATCTGTGTTAGCTGGGAGTCCTCATCAGGTATTGCTGAATT
TTGGATCAATGGGACACCTTTGGTGAAAAAGGGTCTGCGACAGGGTTACTCTGTGGAAGCTCATCCCAAG
ATTGTCCTGGGGCAGGAGCAGGATTCCTATGGCGGCAAGTTTGATAAGAGCCAGTCTTTTGTGGGAGAGA
TTGGGGATTTGTACATGTGGAACTCTGTACTGCCCCCAGAAGAGATCCTGTCTGCCTATCAGGGTACCCC
AGTCCCTGCCAATATCCTGGACTGGCGGGCTCTGAACTATGAAATCAAAGGATATGTCATCATCAAACCC
CTGGTGTGGGTCTGAGGTCTTGACTCAACAAGATCACTTGAAAATGAAATGACCGTCTAAGAGATCTGCT
CAAAGCAACTGGATACTAGATCTTATACCTGCAGCTCTTTCTTCTTTGAATTCCCTATCTGTATGTCTGC
CGAATTAAAAACTGTATATTGTATTATGCTACCTGCATTTGTTTAGTGCTTATCATAGTCCCATATCTTT
ATCTTATATCTACTACTTATCTATCTGCTACTTATCTGGTAATTGGTGTTTCATTATCCTGAACAATCAA
ATTGCCAAGTATGGGGAGGAAAACCTATAAGTAACTAGAAAGGTGTATCACAAAACCAGGGCACTCAATG
AGCAGGACAGTGGCAATACTTAAAAGCTACTAACAATCATTTTAATAACGATTCAAAATATGTGTGGAAT
TGCAATCACAATTCTTCTGTTTTTCCAGCTACAAATCGATCAAAAAGATGTCTGAGGTTGCATCAGGGAG
ACAACTATAATGAAATAAGTAAGCAATAGTTGAGAACCTAACAGCAAGTAATGAGACAGGAAGAATAAAA
CTAGAAGTCAGAATGAAAACCAAAAAAGTATGAGACTGGGATAGTTTTGTATGAAGACAAACATAACTTT
ATGTCTCAAAAACCTCAGTAGGACTGTACAATGCTTGATTTTCATAACGCTGTCCTGATGTCATCAAAAA
ATGTTATACTCTGAATATTGCTTACATGAATATGCTGTCTGAAATTATTCCATGGATTCACACTTCTTAC
AGGACGTGATTTAAACCTCTAAATATGACATTGCCCTCCATAACCTGGTCCCACTTACTCTCTGAAATGT
ACACAGAGAATACACACAGAATACTCTCCGAAATGGACTTTCCATGTACATTTCAGATACAACTGTTAGC
AGAGCAAGTGACATCCTAACTATCACACTGCAAAATAATTGTCAGCTGCTATTACTAGTAGTTATTTTTA
TGGTTATGAAAAGCATGGAACACAGTGCCTGGCTCATCATCAACAGATATGAGTTGCATTCCCAGGGAAG
CAAGGATCCCAGAGGGAGTTCAGGCTATATATATTTGAAATAAGACAGGCTTTTCTCACTGATAATAAGT
AGAGCATGATGTCAGTGGAATCAGAAAGATAGCATCCAGAACAGTTTCAGGATGGTAACCAATGTGATGA
TTTCAAACTCATGAGGCCATTTGGCCAGAATGAACAGAGGCAGTAGCCAGATATGAAGAAATAGGATAGA
ATCTAGAAACTCCATAATGGGGCAATGGGGTAGAAGCAGAGAGGACCAGACAGCACCTGTGAAGACTTGC
TGAAGTACTTAAATGGAGCAGCAGGGGCTTCATAAGAACATTTCAACCTCATTTCTGGTGAGGTGGTAAG
ATGGTTTGGATATGGTTTGTTTGCCTCCACCAAACTTCATCTTGAACTTTTATTCTCAATATGGTGTTGT
TGGAAGGTGAGTCCTAGTGAAAGGCATTTGAGCTATGGGGGTGGGTCTCTCATGAATGTTTTGGTGCAGT
TCTCACGGTAATGAGTGAGTTCTCACTCTTATGAAAGTACATTAACTCTTGTGGGATCAGATTGGTTCTT
GCCAGATTTAGCTGTTATAAAACCAGGGTGTCCTTTAGGTTTTGTTTTCTTTGCACATGTTCACTTCCCT
TTTGACTTTCTCCACCATGTTTTGATACAACACAAAAACCCTCACCAGAAGCCAGAGGCGTGATCTTGAA
CTTCTCAGCCTGCAGAGCAATGAGCTAAATAAACCTCTTTT SEQ ID NO: 3
>gi|226958496|ref|NM_011318.2| Mus musculus serum amyloid
P-component (Apcs), mRNA
GCAGAACGAAGGAGGATCTGGGAGTACCTCACATGGTATTACTTCTCTCCACCCTTCATTGTCATCCAAG
GTACATACAAAACCTGAAATCTGAAAAGCATAGGCAGACACCACACTTTTGTTCCACACCCAAGTAACAG
CTGCTGCTGTCATACCCTGGACCAAGCATGGACAAGCTACTGCTTTGGATGTTTGTCTTCACCAGCCTTC
TTTCAGAAGCCTTTTGTCAGACAGACCTCAAGAGGAAAGTATTTGTGTTCCCCAGAGAATCTGAAACTGA
TCATGTGAAGCTGATCCCACATCTAGAGAAACCTCTGCAGAATTTTACACTGTGTTTCCGAACCTACAGT
GACCTTTCCCGCTCTCAGAGTCTTTTCTCCTACAGTGTCAAGGGCAGAGACAATGAGCTACTAATTTATA
AAGAAAAAGTTGGAGAATACAGCCTATACATCGGACAATCAAAAGTCACAGTCCGTGGTATGGAAGAATA
CCTTTCTCCAGTACACCTATGTACCACTTGGGAGTCCTCCTCTGGCATTGTTGAATTTTGGGTCAATGGA
AAGCCTTGGGTAAAAAAGTCTCTGCAGAGGGAATACACTGTGAAAGCCCCACCCAGTATAGTCCTGGGAC
AGGAGCAGGATAACTACGGAGGAGGGTTTCAAAGGTCACAGTCCTTTGTAGGAGAGTTTTCAGATTTATA
CATGTGGGACTATGTGCTGACCCCACAAGACATTCTATTTGTGTACAGAGATTCCCCTGTCAATCCTAAT
ATTTTGAATTGGCAGGCTCTTAACTATGAAATAAATGGCTACGTAGTCATCAGGCCCCGTGTCTGGGATT
GAGATCTTACAACAAAACCTCATGGACATCAGATGGCCGATGTGTAAGAGGTCAAGGCAGCAGAATTCAC
TCTATCTGGAGCTTTTTCTTCTTTGTGAACATCTTGTATACATATCTGCCAAATAAAAATCCTCTCCAAT
TCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA SEQ ID NO: 4
>gi|148747487|ref|NM_017170.2| Rattus norvegicus amyloid P
component, serum (Apcs), mRNA
ATGGACAAGCTGCTGCTTTGGATGTCTGTCTTCACCAGCCTTCTTTCAGAAGCCTTTGCTCAGACAGACC
TCAATCAGAAGGTATTTGTGTTCCCCAGAGAATCTGAAACTGATTATGTGAAGCTGATCCCATGGCTAGA
AAAACCGCTGCAGAATTTTACACTGTGTTTCCGAGCCTACAGTGACCTTTCCCGCTCTCAGAGTCTTTTC
TCCTACAGTGTCAACAGCAGAGACAATGAGCTACTAATTTATAAAGACAAAGTTGGACAATATAGCCTAT
ACATTGGAAATTCAAAAGTCACAGTCCGTGGTTTAGAAGAATTCCCTTCTCCAATACATTTCTGTACCAG
CTGGGAGTCCTCCTCTGGTATTGCTGAATTTTGGGTCAATGGAAAGCCTTGGGTAAAAAAGGGTTTGCAG
AAGGGATACACTGTGAAATCCTCACCCAGTATTGTCCTGGGACAGGAGCAGGATACGTATGGAGGAGGGT
TTGATAAGACACAGTCCTTTGTGGGAGAGATTGCAGATTTGTACATGTGGGACAGTGTGCTGACCCCAGA
GAACATTCATTCTGTGGACAGAGGTTTCCCACCCAATCCTAATATTTTGGATTGGCGGGCCCTGAATTAT
GAAATAAATGGTTATGTAGTCATCAAGCCCCGTATGTGGGACAACAAAAGCTCATGA SEQ ID
NO: 5 Reverse complement of SEQ ID NO: 1
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAGGTAGCATAATACAATATATATTTTTTTAATTAGGCAG
ACATACAGATAGGAAATTCAAAGAAGAAAGAGCTGCAGATGTAAGATCTAGTATCCAGTTGCTTTGACCAG
ATCTCTTAGACAGTCATTTCATTTTCAAGTGCTCTCGTTGAGTCAAGACCTCAGACCCACACCAAGGGTTTG
ATGATGACATATCCTCTGATTTCATAGTTCAGAGCCTGCCAGTCCAGGATATTGGCAGGGAGAGGGGTACCC
TGATAGGCAGACAGGATATTTTCTGGGGGCAGCACAGAGTCCCACATGTACAAATCCCCAATCTCTCCCACA
AAGGACTGGCTCCTATCAAACTTGCCCCCATAGGAATCCTGTTCCTGCCCCAGGACAATCTTGGGCTGAGCT
TCTACAAAGTAACCCTGTCGCAGACCCTTTTTCACCAAAGGTGTCCCATTGATCCAAAATTCAGCAATACCT
GATGAGGACTCCCAGCTCACACAGATGTGCACTGGAGCCGGGAACTTTTCGATAACTTTGGATGTAACTTTG
TGTCTTCCAATGTATAGACTATACTCTCCAACTCTTTCTTTATAAACTAGTAGCTCATTATCCCTGCCTTGG
GTATTGTAGGAGAAGAGGCTGTAGGCACGAGAGAGATCACTATAGGCTCGAAAACACAAGGTAAAGTTCTGT
AGAGGCTTCTCCAGCGGTGTGATCAAGTTTACATGATCAGTAACAGATTCTCTAGGAAATACAAACACCTTC
CCACTGAGGTCTGTGTGAGCAAAGGCTTCCAGGAGGCTGGTGAGGACAGAGATCCAAAGCAGCGGCTTGTTC
ATATTCCTGGCCTAGGGCTGTTATAGCAGAAGCAGTGACCAGGATGAGGGTAGCAGACAACACAGTGGCTGT
CCCCCTAGCGTCTGATATTCATGCCC SEQ ID NO: 6 Reverse complement of SEQ
ID NO: 2
AATAGCCTGAAGTCTAAGGGCGTGAATATCAGACGCTAGGGGGACAGCCACTGTGTTATCTGCTGCCCTCATCC-
T
GGTCACTGCTCCTGCTATAATAGCCCTAGGCCAGGAATATGAACAAGCTGCTGCTTTGGGTCTCTGTCCTCACC-
A
GCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGAT-
C
ATGTAAACTTGATCACACAGCTGGAGAAGCCTCTGCAGAACTTTACCTTGTGTTTTCGAGCCTACACTGATCTC-
T
CCCGTCCCTACAGCCTCTTCTCCTACAATACCCAGGGAAAGGATAATGAGCTAGTAGTTTATAAAGAAAGAGTT-
G
GAGATTATAGTCTCTACATTGGAAGACAAAAAGTTACATTCAAAGTTATTGAAAAGTTCCCGGCTCCAGTGCAC-
A
TCTGTGTTAGCTGGGAGTCCTCATCAGGTATTGCTGAATTTTGGATCAATGGGACACCTTTGGTGAAAAAGGGT-
C
TGCGACAGGGTTACTCTGTGGAAGCTCATCCCAAGATTGTCCTGGGGCAGGAGCAGGATTCCTATGGCGGCAAG-
T
TTGATAAGAGCCAGTCTTTTGTGGGAGAGATTGGGGATTTGTACATGTGGAACTCTGTACTGCCCCCAGAAGAG-
A
TCCTGTCTGCCTATCAGGGTACCCCAGTCCCTGCCAATATCCTGGACTGGCGGGCTCTGAACTATGAAATCAAA-
G
GATATGTCATCATCAAACCCCTGGTGTGGGTCTGAGGTCTTGACTCAACAAGATCACTTGAAAATGAAATGACC-
G
TCTAAGAGATCTGCTCAAAGCAACTGGATACTAGATCTTATACCTGCAGCTCTTTCTTCTTTGAATTCCCTATC-
T
GTATGTCTGCCGAATTAAAAACTGTATATTGTATTATGCTACCTGCATTTGTTTAGTGCTTATCATAGTCCCAT-
A
TCTTTATCTTATATCTACTACTTATCTATCTGCTACTTATCTGGTAATTGGTGTTTCATTATCCTGAACAATCA-
A
ATTGCCAAGTATGGGGAGGAAAACCTATAAGTAACTAGAAAGGTGTATCACAAAACCAGGGCACTCAATGAGCA-
G
GACAGTGGCAATACTTAAAAGCTACTAACAATCATTTTAATAACGATTCAAAATATGTGTGGAATTGCAATCAC-
A
ATTCTTCTGTTTTTCCAGCTACAAATCGATCAAAAAGATGTCTGAGGTTGCATCAGGGAGACAACTATAATGAA-
A
TAAGTAAGCAATAGTTGAGAACCTAACAGCAAGTAATGAGACAGGAAGAATAAAACTAGAAGTCAGAATGAAAA-
C
CAAAAAAGTATGAGACTGGGATAGTTTTGTATGAAGACAAACATAACTTTATGTCTCAAAAACCTCAGTAGGAC-
T
GTACAATGCTTGATTTTCATAACGCTGTCCTGATGTCATCAAAAAATGTTATACTCTGAATATTGCTTACATGA-
A
TATGCTGTCTGAAATTATTCCATGGATTCACACTTCTTACAGGACGTGATTTAAACCTCTAAATATGACATTGC-
C
CTCCATAACCTGGTCCCACTTACTCTCTGAAATGTACACAGAGAATACACACAGAATACTCTCCGAAATGGACT-
T
TCCATGTACATTTCAGATACAACTGTTAGCAGAGCAAGTGACATCCTAACTATCACACTGCAAAATAATTGTCA-
G
CTGCTATTACTAGTAGTTATTTTTATGGTTATGAAAAGCATGGAACACAGTGCCTGGCTCATCATCAACAGATA-
T
GAGTTGCATTCCCAGGGAAGCAAGGATCCCAGAGGGAGTTCAGGCTATATATATTTGAAATAAGACAGGCTTTT-
C
TCACTGATAATAAGTAGAGCATGATGTCAGTGGAATCAGAAAGATAGCATCCAGAACAGTTTCAGGATGGTAAC-
C
AATGTGATGATTTCAAACTCATGAGGCCATTTGGCCAGAATGAACAGAGGCAGTAGCCAGATATGAAGAAATAG-
G
ATAGAATCTAGAAACTCCATAATGGGGCAATGGGGTAGAAGCAGAGAGGACCAGACAGCACCTGTGAAGACTTG-
C
TGAAGTACTTAAATGGAGCAGCAGGGGCTTCATAAGAACATTTCAACCTCATTTCTGGTGAGGTGGTAAGATGG-
T
TTGGATATGGTTTGTTTGCCTCCACCAAACTTCATCTTGAACTTTTATTCTCAATATGGTGTTGTTGGAAGGTG-
A
GTCCTAGTGAAAGGCATTTGAGCTATGGGGGTGGGTCTCTCATGAATGTTTTGGTGCAGTTCTCACGGTAATGA-
G
TGAGTTCTCACTCTTATGAAAGTACATTAACTCTTGTGGGATCAGATTGGTTCTTGCCAGATTTAGCTGTTATA-
A
AACCAGGGTGTCCTTTAGGTTTTGTTTTCTTTGCACATGTTCACTTCCCTTTTGACTTTCTCCACCATGTTTTG-
A
TACAACACAAAAACCCTCACCAGAAGCCAGAGGCGTGATCTTGAACTTCTCAGCCTGCAGAGCAATGAGCTAAA-
T AAACCTCTTTT SEQ ID NO: 7 Reverse complement of SEQ ID NO: 3
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAATTGGAGAGGATTTTTATTTGGCAGATATGTATACAAGATGT-
T
CACAAAGAAGAAAAAGCTCCAGATAGAGTGAATTCTGCTGCCTTGACCTCTTACACATCGGCCATCTGATGTCC-
A
TGAGGTTTTGTTGTAAGATCTCAATCCCAGACACGGGGCCTGATGACTACGTAGCCATTTATTTCATAGTTAAG-
A
GCCTGCCAATTCAAAATATTAGGATTGACAGGGGAATCTCTGTACACAAATAGAATGTCTTGTGGGGTCAGCAC-
A
TAGTCCCACATGTATAAATCTGAAAACTCTCCTACAAAGGACTGTGACCTTTGAAACCCTCCTCCGTAGTTATC-
C
TGCTCCTGTCCCAGGACTATACTGGGTGGGGCTTTCACAGTGTATTCCCTCTGCAGAGACTTTTTTACCCAAGG-
C
TTTCCATTGACCCAAAATTCAACAATGCCAGAGGAGGACTCCCAAGTGGTACATAGGTGTACTGGAGAAAGGTA-
T
TCTTCCATACCACGGACTGTGACTTTTGATTGTCCGATGTATAGGCTGTATTCTCCAACTTTTTCTTTATAAAT-
T
AGTAGCTCATTGTCTCTGCCCTTGACACTGTAGGAGAAAAGACTCTGAGAGCGGGAAAGGTCACTGTAGGTTCG-
G
AAACACAGTGTAAAATTCTGCAGAGGTTTCTCTAGATGTGGGATCAGCTTCACATGATCAGTTTCAGATTCTCT-
G
GGGAACACAAATACTTTCCTCTTGAGGTCTGTCTGACAAAAGGCTTCTGAAAGAAGGCTGGTGAAGACAAACAT-
C
CAAAGCAGTAGCTTGTCCATGCTTGGTCCAGGGTATGACAGCAGCAGCTGTTACTTGGGTGTGGAACAAAAGTG-
T
GGTGTCTGCCTATGCTTTTCAGATTTCAGGTTTTGTATGTACCTTGGATGACAATGAAGGGTGGAGAGAAGTAA-
T ACCATGTGAGGTACTCCCAGATCCTCCTTCGTTCTGC SEQ ID NO: 8 Reverse
complement of SEQ ID NO: 4
TCATGAGCTTTTGTTGTCCCACATACGGGGCTTGATGACTACATAACCATTTATTTCATAATTCAGGGCCCGCC-
A
ATCCAAAATATTAGGATTGGGTGGGAAACCTCTGTCCACAGAATGAATGTTCTCTGGGGTCAGCACACTGTCCC-
A
CATGTACAAATCTGCAATCTCTCCCACAAAGGACTGTGTCTTATCAAACCCTCCTCCATACGTATCCTGCTCCT-
G
TCCCAGGACAATACTGGGTGAGGATTTCACAGTGTATCCCTTCTGCAAACCCTTTTTTACCCAAGGCTTTCCAT-
T
GACCCAAAATTCAGCAATACCAGAGGAGGACTCCCAGCTGGTACAGAAATGTATTGGAGAAGGGAATTCTTCTA-
A
ACCACGGACTGTGACTTTTGAATTTCCAATGTATAGGCTATATTGTCCAACTTTGTCTTTATAAATTAGTAGCT-
C
ATTGTCTCTGCTGTTGACACTGTAGGAGAAAAGACTCTGAGAGCGGGAAAGGTCACTGTAGGCTCGGAAACACA-
G
TGTAAAATTCTGCAGCGGTTTTTCTAGCCATGGGATCAGCTTCACATAATCAGTTTCAGATTCTCTGGGGAACA-
C
AAATACCTTCTGATTGAGGTCTGTCTGAGCAAAGGCTTCTGAAAGAAGGCTGGTGAAGACAGACATCCAAAGCA-
G CAGCTTGTCCAT
Sequence CWU 1
1
9601960DNAHomo sapiens 1gggcatgaat atcagacgct agggggacag ccactgtgtt
gtctgctacc ctcatcctgg 60tcactgcttc tgctataaca gccctaggcc aggaatatga
acaagccgct gctttggatc 120tctgtcctca ccagcctcct ggaagccttt
gctcacacag acctcagtgg gaaggtgttt 180gtatttccta gagaatctgt
tactgatcat gtaaacttga tcacaccgct ggagaagcct 240ctacagaact
ttaccttgtg ttttcgagcc tatagtgatc tctctcgtgc ctacagcctc
300ttctcctaca atacccaagg cagggataat gagctactag tttataaaga
aagagttgga 360gagtatagtc tatacattgg aagacacaaa gttacatcca
aagttatcga aaagttcccg 420gctccagtgc acatctgtgt gagctgggag
tcctcatcag gtattgctga attttggatc 480aatgggacac ctttggtgaa
aaagggtctg cgacagggtt actttgtaga agctcagccc 540aagattgtcc
tggggcagga acaggattcc tatgggggca agtttgatag gagccagtcc
600tttgtgggag agattgggga tttgtacatg tgggactctg tgctgccccc
agaaaatatc 660ctgtctgcct atcagggtac ccctctccct gccaatatcc
tggactggca ggctctgaac 720tatgaaatca gaggatatgt catcatcaaa
cccttggtgt gggtctgagg tcttgactca 780acgagagcac ttgaaaatga
aatgactgtc taagagatct ggtcaaagca actggatact 840agatcttaca
tctgcagctc tttcttcttt gaatttccta tctgtatgtc tgcctaatta
900aaaaaatata tattgtatta tgctacctgc aaaaaaaaaa aaaaaaaaaa
aaaaaaaaaa 96022561DNAMacaca fascicularis 2aatagcctga agtctaaggg
cgtgaatatc agacgctagg gggacagcca ctgtgttatc 60tgctgccctc atcctggtca
ctgctcctgc tataatagcc ctaggccagg aatatgaaca 120agctgctgct
ttgggtctct gtcctcacca gcctcctgga agcctttgct cacacagacc
180tcagtgggaa ggtgtttgta tttcctagag aatctgttac tgatcatgta
aacttgatca 240cacagctgga gaagcctctg cagaacttta ccttgtgttt
tcgagcctac actgatctct 300cccgtcccta cagcctcttc tcctacaata
cccagggaaa ggataatgag ctagtagttt 360ataaagaaag agttggagat
tatagtctct acattggaag acaaaaagtt acattcaaag 420ttattgaaaa
gttcccggct ccagtgcaca tctgtgttag ctgggagtcc tcatcaggta
480ttgctgaatt ttggatcaat gggacacctt tggtgaaaaa gggtctgcga
cagggttact 540ctgtggaagc tcatcccaag attgtcctgg ggcaggagca
ggattcctat ggcggcaagt 600ttgataagag ccagtctttt gtgggagaga
ttggggattt gtacatgtgg aactctgtac 660tgcccccaga agagatcctg
tctgcctatc agggtacccc agtccctgcc aatatcctgg 720actggcgggc
tctgaactat gaaatcaaag gatatgtcat catcaaaccc ctggtgtggg
780tctgaggtct tgactcaaca agatcacttg aaaatgaaat gaccgtctaa
gagatctgct 840caaagcaact ggatactaga tcttatacct gcagctcttt
cttctttgaa ttccctatct 900gtatgtctgc cgaattaaaa actgtatatt
gtattatgct acctgcattt gtttagtgct 960tatcatagtc ccatatcttt
atcttatatc tactacttat ctatctgcta cttatctggt 1020aattggtgtt
tcattatcct gaacaatcaa attgccaagt atggggagga aaacctataa
1080gtaactagaa aggtgtatca caaaaccagg gcactcaatg agcaggacag
tggcaatact 1140taaaagctac taacaatcat tttaataacg attcaaaata
tgtgtggaat tgcaatcaca 1200attcttctgt ttttccagct acaaatcgat
caaaaagatg tctgaggttg catcagggag 1260acaactataa tgaaataagt
aagcaatagt tgagaaccta acagcaagta atgagacagg 1320aagaataaaa
ctagaagtca gaatgaaaac caaaaaagta tgagactggg atagttttgt
1380atgaagacaa acataacttt atgtctcaaa aacctcagta ggactgtaca
atgcttgatt 1440ttcataacgc tgtcctgatg tcatcaaaaa atgttatact
ctgaatattg cttacatgaa 1500tatgctgtct gaaattattc catggattca
cacttcttac aggacgtgat ttaaacctct 1560aaatatgaca ttgccctcca
taacctggtc ccacttactc tctgaaatgt acacagagaa 1620tacacacaga
atactctccg aaatggactt tccatgtaca tttcagatac aactgttagc
1680agagcaagtg acatcctaac tatcacactg caaaataatt gtcagctgct
attactagta 1740gttattttta tggttatgaa aagcatggaa cacagtgcct
ggctcatcat caacagatat 1800gagttgcatt cccagggaag caaggatccc
agagggagtt caggctatat atatttgaaa 1860taagacaggc ttttctcact
gataataagt agagcatgat gtcagtggaa tcagaaagat 1920agcatccaga
acagtttcag gatggtaacc aatgtgatga tttcaaactc atgaggccat
1980ttggccagaa tgaacagagg cagtagccag atatgaagaa ataggataga
atctagaaac 2040tccataatgg ggcaatgggg tagaagcaga gaggaccaga
cagcacctgt gaagacttgc 2100tgaagtactt aaatggagca gcaggggctt
cataagaaca tttcaacctc atttctggtg 2160aggtggtaag atggtttgga
tatggtttgt ttgcctccac caaacttcat cttgaacttt 2220tattctcaat
atggtgttgt tggaaggtga gtcctagtga aaggcatttg agctatgggg
2280gtgggtctct catgaatgtt ttggtgcagt tctcacggta atgagtgagt
tctcactctt 2340atgaaagtac attaactctt gtgggatcag attggttctt
gccagattta gctgttataa 2400aaccagggtg tcctttaggt tttgttttct
ttgcacatgt tcacttccct tttgactttc 2460tccaccatgt tttgatacaa
cacaaaaacc ctcaccagaa gccagaggcg tgatcttgaa 2520cttctcagcc
tgcagagcaa tgagctaaat aaacctcttt t 256131012DNAMus musculus
3gcagaacgaa ggaggatctg ggagtacctc acatggtatt acttctctcc acccttcatt
60gtcatccaag gtacatacaa aacctgaaat ctgaaaagca taggcagaca ccacactttt
120gttccacacc caagtaacag ctgctgctgt cataccctgg accaagcatg
gacaagctac 180tgctttggat gtttgtcttc accagccttc tttcagaagc
cttttgtcag acagacctca 240agaggaaagt atttgtgttc cccagagaat
ctgaaactga tcatgtgaag ctgatcccac 300atctagagaa acctctgcag
aattttacac tgtgtttccg aacctacagt gacctttccc 360gctctcagag
tcttttctcc tacagtgtca agggcagaga caatgagcta ctaatttata
420aagaaaaagt tggagaatac agcctataca tcggacaatc aaaagtcaca
gtccgtggta 480tggaagaata cctttctcca gtacacctat gtaccacttg
ggagtcctcc tctggcattg 540ttgaattttg ggtcaatgga aagccttggg
taaaaaagtc tctgcagagg gaatacactg 600tgaaagcccc acccagtata
gtcctgggac aggagcagga taactacgga ggagggtttc 660aaaggtcaca
gtcctttgta ggagagtttt cagatttata catgtgggac tatgtgctga
720ccccacaaga cattctattt gtgtacagag attcccctgt caatcctaat
attttgaatt 780ggcaggctct taactatgaa ataaatggct acgtagtcat
caggccccgt gtctgggatt 840gagatcttac aacaaaacct catggacatc
agatggccga tgtgtaagag gtcaaggcag 900cagaattcac tctatctgga
gctttttctt ctttgtgaac atcttgtata catatctgcc 960aaataaaaat
cctctccaat tccaaaaaaa aaaaaaaaaa aaaaaaaaaa aa 10124687DNARattus
norvegicus 4atggacaagc tgctgctttg gatgtctgtc ttcaccagcc ttctttcaga
agcctttgct 60cagacagacc tcaatcagaa ggtatttgtg ttccccagag aatctgaaac
tgattatgtg 120aagctgatcc catggctaga aaaaccgctg cagaatttta
cactgtgttt ccgagcctac 180agtgaccttt cccgctctca gagtcttttc
tcctacagtg tcaacagcag agacaatgag 240ctactaattt ataaagacaa
agttggacaa tatagcctat acattggaaa ttcaaaagtc 300acagtccgtg
gtttagaaga attcccttct ccaatacatt tctgtaccag ctgggagtcc
360tcctctggta ttgctgaatt ttgggtcaat ggaaagcctt gggtaaaaaa
gggtttgcag 420aagggataca ctgtgaaatc ctcacccagt attgtcctgg
gacaggagca ggatacgtat 480ggaggagggt ttgataagac acagtccttt
gtgggagaga ttgcagattt gtacatgtgg 540gacagtgtgc tgaccccaga
gaacattcat tctgtggaca gaggtttccc acccaatcct 600aatattttgg
attggcgggc cctgaattat gaaataaatg gttatgtagt catcaagccc
660cgtatgtggg acaacaaaag ctcatga 6875960DNAHomo sapiens 5tttttttttt
tttttttttt tttttttttt gcaggtagca taatacaata tatatttttt 60taattaggca
gacatacaga taggaaattc aaagaagaaa gagctgcaga tgtaagatct
120agtatccagt tgctttgacc agatctctta gacagtcatt tcattttcaa
gtgctctcgt 180tgagtcaaga cctcagaccc acaccaaggg tttgatgatg
acatatcctc tgatttcata 240gttcagagcc tgccagtcca ggatattggc
agggagaggg gtaccctgat aggcagacag 300gatattttct gggggcagca
cagagtccca catgtacaaa tccccaatct ctcccacaaa 360ggactggctc
ctatcaaact tgcccccata ggaatcctgt tcctgcccca ggacaatctt
420gggctgagct tctacaaagt aaccctgtcg cagacccttt ttcaccaaag
gtgtcccatt 480gatccaaaat tcagcaatac ctgatgagga ctcccagctc
acacagatgt gcactggagc 540cgggaacttt tcgataactt tggatgtaac
tttgtgtctt ccaatgtata gactatactc 600tccaactctt tctttataaa
ctagtagctc attatccctg ccttgggtat tgtaggagaa 660gaggctgtag
gcacgagaga gatcactata ggctcgaaaa cacaaggtaa agttctgtag
720aggcttctcc agcggtgtga tcaagtttac atgatcagta acagattctc
taggaaatac 780aaacaccttc ccactgaggt ctgtgtgagc aaaggcttcc
aggaggctgg tgaggacaga 840gatccaaagc agcggcttgt tcatattcct
ggcctagggc tgttatagca gaagcagtga 900ccaggatgag ggtagcagac
aacacagtgg ctgtccccct agcgtctgat attcatgccc 96062561DNAMacaca
fascicularis 6aatagcctga agtctaaggg cgtgaatatc agacgctagg
gggacagcca ctgtgttatc 60tgctgccctc atcctggtca ctgctcctgc tataatagcc
ctaggccagg aatatgaaca 120agctgctgct ttgggtctct gtcctcacca
gcctcctgga agcctttgct cacacagacc 180tcagtgggaa ggtgtttgta
tttcctagag aatctgttac tgatcatgta aacttgatca 240cacagctgga
gaagcctctg cagaacttta ccttgtgttt tcgagcctac actgatctct
300cccgtcccta cagcctcttc tcctacaata cccagggaaa ggataatgag
ctagtagttt 360ataaagaaag agttggagat tatagtctct acattggaag
acaaaaagtt acattcaaag 420ttattgaaaa gttcccggct ccagtgcaca
tctgtgttag ctgggagtcc tcatcaggta 480ttgctgaatt ttggatcaat
gggacacctt tggtgaaaaa gggtctgcga cagggttact 540ctgtggaagc
tcatcccaag attgtcctgg ggcaggagca ggattcctat ggcggcaagt
600ttgataagag ccagtctttt gtgggagaga ttggggattt gtacatgtgg
aactctgtac 660tgcccccaga agagatcctg tctgcctatc agggtacccc
agtccctgcc aatatcctgg 720actggcgggc tctgaactat gaaatcaaag
gatatgtcat catcaaaccc ctggtgtggg 780tctgaggtct tgactcaaca
agatcacttg aaaatgaaat gaccgtctaa gagatctgct 840caaagcaact
ggatactaga tcttatacct gcagctcttt cttctttgaa ttccctatct
900gtatgtctgc cgaattaaaa actgtatatt gtattatgct acctgcattt
gtttagtgct 960tatcatagtc ccatatcttt atcttatatc tactacttat
ctatctgcta cttatctggt 1020aattggtgtt tcattatcct gaacaatcaa
attgccaagt atggggagga aaacctataa 1080gtaactagaa aggtgtatca
caaaaccagg gcactcaatg agcaggacag tggcaatact 1140taaaagctac
taacaatcat tttaataacg attcaaaata tgtgtggaat tgcaatcaca
1200attcttctgt ttttccagct acaaatcgat caaaaagatg tctgaggttg
catcagggag 1260acaactataa tgaaataagt aagcaatagt tgagaaccta
acagcaagta atgagacagg 1320aagaataaaa ctagaagtca gaatgaaaac
caaaaaagta tgagactggg atagttttgt 1380atgaagacaa acataacttt
atgtctcaaa aacctcagta ggactgtaca atgcttgatt 1440ttcataacgc
tgtcctgatg tcatcaaaaa atgttatact ctgaatattg cttacatgaa
1500tatgctgtct gaaattattc catggattca cacttcttac aggacgtgat
ttaaacctct 1560aaatatgaca ttgccctcca taacctggtc ccacttactc
tctgaaatgt acacagagaa 1620tacacacaga atactctccg aaatggactt
tccatgtaca tttcagatac aactgttagc 1680agagcaagtg acatcctaac
tatcacactg caaaataatt gtcagctgct attactagta 1740gttattttta
tggttatgaa aagcatggaa cacagtgcct ggctcatcat caacagatat
1800gagttgcatt cccagggaag caaggatccc agagggagtt caggctatat
atatttgaaa 1860taagacaggc ttttctcact gataataagt agagcatgat
gtcagtggaa tcagaaagat 1920agcatccaga acagtttcag gatggtaacc
aatgtgatga tttcaaactc atgaggccat 1980ttggccagaa tgaacagagg
cagtagccag atatgaagaa ataggataga atctagaaac 2040tccataatgg
ggcaatgggg tagaagcaga gaggaccaga cagcacctgt gaagacttgc
2100tgaagtactt aaatggagca gcaggggctt cataagaaca tttcaacctc
atttctggtg 2160aggtggtaag atggtttgga tatggtttgt ttgcctccac
caaacttcat cttgaacttt 2220tattctcaat atggtgttgt tggaaggtga
gtcctagtga aaggcatttg agctatgggg 2280gtgggtctct catgaatgtt
ttggtgcagt tctcacggta atgagtgagt tctcactctt 2340atgaaagtac
attaactctt gtgggatcag attggttctt gccagattta gctgttataa
2400aaccagggtg tcctttaggt tttgttttct ttgcacatgt tcacttccct
tttgactttc 2460tccaccatgt tttgatacaa cacaaaaacc ctcaccagaa
gccagaggcg tgatcttgaa 2520cttctcagcc tgcagagcaa tgagctaaat
aaacctcttt t 256171012DNAMus musculus 7tttttttttt tttttttttt
tttttttttg gaattggaga ggatttttat ttggcagata 60tgtatacaag atgttcacaa
agaagaaaaa gctccagata gagtgaattc tgctgccttg 120acctcttaca
catcggccat ctgatgtcca tgaggttttg ttgtaagatc tcaatcccag
180acacggggcc tgatgactac gtagccattt atttcatagt taagagcctg
ccaattcaaa 240atattaggat tgacagggga atctctgtac acaaatagaa
tgtcttgtgg ggtcagcaca 300tagtcccaca tgtataaatc tgaaaactct
cctacaaagg actgtgacct ttgaaaccct 360cctccgtagt tatcctgctc
ctgtcccagg actatactgg gtggggcttt cacagtgtat 420tccctctgca
gagacttttt tacccaaggc tttccattga cccaaaattc aacaatgcca
480gaggaggact cccaagtggt acataggtgt actggagaaa ggtattcttc
cataccacgg 540actgtgactt ttgattgtcc gatgtatagg ctgtattctc
caactttttc tttataaatt 600agtagctcat tgtctctgcc cttgacactg
taggagaaaa gactctgaga gcgggaaagg 660tcactgtagg ttcggaaaca
cagtgtaaaa ttctgcagag gtttctctag atgtgggatc 720agcttcacat
gatcagtttc agattctctg gggaacacaa atactttcct cttgaggtct
780gtctgacaaa aggcttctga aagaaggctg gtgaagacaa acatccaaag
cagtagcttg 840tccatgcttg gtccagggta tgacagcagc agctgttact
tgggtgtgga acaaaagtgt 900ggtgtctgcc tatgcttttc agatttcagg
ttttgtatgt accttggatg acaatgaagg 960gtggagagaa gtaataccat
gtgaggtact cccagatcct ccttcgttct gc 10128687DNARattus norvegicus
8tcatgagctt ttgttgtccc acatacgggg cttgatgact acataaccat ttatttcata
60attcagggcc cgccaatcca aaatattagg attgggtggg aaacctctgt ccacagaatg
120aatgttctct ggggtcagca cactgtccca catgtacaaa tctgcaatct
ctcccacaaa 180ggactgtgtc ttatcaaacc ctcctccata cgtatcctgc
tcctgtccca ggacaatact 240gggtgaggat ttcacagtgt atcccttctg
caaacccttt tttacccaag gctttccatt 300gacccaaaat tcagcaatac
cagaggagga ctcccagctg gtacagaaat gtattggaga 360agggaattct
tctaaaccac ggactgtgac ttttgaattt ccaatgtata ggctatattg
420tccaactttg tctttataaa ttagtagctc attgtctctg ctgttgacac
tgtaggagaa 480aagactctga gagcgggaaa ggtcactgta ggctcggaaa
cacagtgtaa aattctgcag 540cggtttttct agccatggga tcagcttcac
ataatcagtt tcagattctc tggggaacac 600aaataccttc tgattgaggt
ctgtctgagc aaaggcttct gaaagaaggc tggtgaagac 660agacatccaa
agcagcagct tgtccat 687916PRTUnknownsource/note="Description of
Unknown RFGF peptide" 9Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu
Ala Leu Leu Ala Pro1 5 10 151011PRTUnknownsource/note="Description
of Unknown RFGF analogue peptide" 10Ala Ala Leu Leu Pro Val Leu Leu
Ala Ala Pro1 5 101113PRTHuman immunodeficiency virus 11Gly Arg Lys
Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln1 5 101216PRTDrosophila sp.
12Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys1
5 10 151321RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 13acugcuucug
cuauaacagc a 211421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 14uaugaacaag
ccgcugcuuu a 211521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 15cagugggaag
guguuuguau a 211621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 16guguuuguau
uuccuagaga a 211721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 17ucuguuacug
aucauguaaa a 211821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 18ucuguuacug
aucauguaaa a 211921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 19guuacugauc
auguaaacuu a 212021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 20uacugaucau
guaaacuuga a 212121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 21aucauguaaa
cuugaucaca a 212221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 22ucauguaaac
uugaucacac a 212321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 23cucuacagaa
cuuuaccuug a 212421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 24acuuuaccuu
guguuuucga a 212521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 25guuuucgagc
cuauagugau a 212621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 26gaaacugauc
augugaagcu a 212721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 27accucugcag
aauuuuacac a 212821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 28gcagaauuuu
acacuguguu a 212921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 29cagaauuuua
cacuguguuu a 213021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 30uaaugagcua
cuaguuuaua a 213121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 31aaugagcuac
uaguuuauaa a 213221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 32augagcuacu
aguuuauaaa a 213321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 33ugagcuacua
guuuauaaag a 213421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 34gagcuacuag
uuuauaaaga a 213521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 35agcuacuagu
uuauaaagaa a 213621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 36uguuuccgaa
ccuacaguga a 213721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 37cuacuaguuu
auaaagaaag a 213821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 38ccgaaccuac
agugaccuuu a 213921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 39guuuauaaag
aaagaguugg a 214021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 40uaaagaaaga
guuggagagu a 214121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 41guuggagagu
auagucuaua a 214221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 42aguauagucu
auacauugga a 214321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 43uagucuauac
auuggaagac a 214421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 44agagucuuuu
cuccuacagu a 214521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 45uacauuggaa
gacacaaagu a 214621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 46uuggaagaca
caaaguuaca a 214721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 47agacacaaag
uuacauccaa a 214821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 48acaaaguuac
auccaaaguu a 214921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 49aaguuacauc
caaaguuauc a 215021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 50uacauccaaa
guuaucgaaa a 215121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 51uccaaaguua
ucgaaaaguu a 215221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 52gagacaauga
gcuacuaauu a 215321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 53agacaaugag
cuacuaauuu a 215421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 54aaugagcuac
uaauuuauaa a 215521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 55gagcuacuaa
uuuauaaaga a 215621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 56cucaucaggu
auugcugaau a 215721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 57ucagguauug
cugaauuuug a 215821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 58guauugcuga
auuuuggauc a 215921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 59gaagcucagc
ccaagauugu a 216021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 60gcauuguuga
auuuuggguc a 216121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 61uuguugaauu
uugggucaau a 216221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 62auuccuaugg
gggcaaguuu a 216321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 63aaaauauccu
gucugccuau a 216421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 64aaauauccug
ucugccuauc a 216521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 65aauauccugu
cugccuauca a 216621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 66caggcucuga
acuaugaaau a 216721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 67aggcucugaa
cuaugaaauc a 216821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 68ggcucugaac
uaugaaauca a 216921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 69gcucugaacu
augaaaucag a 217021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 70gaggauaugu
caucaucaaa a 217121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 71uaugucauca
ucaaacccuu a 217221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 72caucaucaaa
cccuuggugu a 217321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 73aacgagagca
cuugaaaaug a 217421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 74cgagagcacu
ugaaaaugaa a 217521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 75agcacuugaa
aaugaaauga a 217621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 76gcacuugaaa
augaaaugac a 217721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 77aaaugaaaug
acugucuaag a 217821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 78aaugaaauga
cugucuaaga a 217921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 79ugaaaugacu
gucuaagaga a 218021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 80gaaaugacug
ucuaagagau a 218121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 81aaaugacugu
cuaagagauc a 218221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 82caacuggaua
cuagaucuua a 218321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 83gcagcucuuu
cuucuuugaa a 218421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 84cucuuucuuc
uuugaauuuc a 218521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 85cuuucuucuu
ugaauuuccu a 218621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 86cuuugaauuu
ccuaucugua a 218721RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 87uuugaauuuc
cuaucuguau a 218821RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 88ugaauuuccu
aucuguaugu a 218921RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 89aauuuccuau
cuguaugucu a 219021RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 90aucuguaugu
cugccuaauu a 219121RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 91uguaugucug
ccuaauuaaa a 219221RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 92guaugucugc
cuaauuaaaa a 219321RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 93uaugucugcc
uaauuaaaaa a 219421RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 94ugucugccua
auuaaaaaaa a 219521RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 95uuguauuaug
cuaccugcaa a 219621RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 96uuaugcuacc
ugcaaaaaaa a 219723RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 97ugcuguuaua
gcagaagcag uga 239823RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 98uaaagcagcg
gcuuguucau auu 239923RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 99uauacaaaca
ccuucccacu gag 2310023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 100uucucuagga aauacaaaca ccu 2310123RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 101uuuuacauga ucaguaacag auu 2310223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 102uuuuacauga ucaguaacag auu 2310323RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 103uaaguuuaca ugaucaguaa cag 2310423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 104uucaaguuua caugaucagu aac 2310523RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 105uugugaucaa guuuacauga uca 2310623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 106ugugugauca aguuuacaug auc 2310723RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 107ucaagguaaa guucuguaga ggc 2310823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 108uucgaaaaca caagguaaag uuc 2310923RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 109uaucacuaua ggcucgaaaa cac 2311023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 110uagcuucaca ugaucaguuu cag 2311123RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 111uguguaaaau ucugcagagg uuu 2311223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 112uaacacagug uaaaauucug cag 2311323RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 113uaaacacagu guaaaauucu gca 2311423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 114uuauaaacua guagcucauu auc 2311523RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 115uuuauaaacu aguagcucau uau 2311623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 116uuuuauaaac uaguagcuca uua 2311723RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 117ucuuuauaaa cuaguagcuc auu 2311823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 118uucuuuauaa acuaguagcu cau 2311923RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 119uuucuuuaua aacuaguagc uca 2312023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 120uucacuguag guucggaaac aca 2312123RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 121ucuuucuuua uaaacuagua gcu 2312223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 122uaaaggucac uguagguucg gaa 2312323RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 123uccaacucuu ucuuuauaaa cua 2312423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 124uacucuccaa cucuuucuuu aua 2312523RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 125uuauagacua uacucuccaa cuc 2312623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 126uuccaaugua uagacuauac ucu 2312723RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 127ugucuuccaa uguauagacu aua 2312823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 128uacuguagga gaaaagacuc uga 2312923RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 129uacuuugugu cuuccaaugu aua 2313023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 130uuguaacuuu gugucuucca aug
2313123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 131uuuggaugua acuuuguguc uuc
2313223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 132uaacuuugga uguaacuuug ugu
2313323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 133ugauaacuuu ggauguaacu uug
2313423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 134uuuucgauaa cuuuggaugu aac
2313523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 135uaacuuuucg auaacuuugg aug
2313623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 136uaauuaguag cucauugucu cug
2313723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 137uaaauuagua gcucauuguc ucu
2313823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 138uuuauaaauu aguagcucau ugu
2313923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 139uucuuuauaa auuaguagcu cau
2314023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 140uauucagcaa uaccugauga gga
2314123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 141ucaaaauuca gcaauaccug aug
2314223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 142ugauccaaaa uucagcaaua ccu
2314323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 143uacaaucuug ggcugagcuu cua
2314423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 144ugacccaaaa uucaacaaug cca
2314523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 145uauugaccca aaauucaaca aug
2314623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 146uaaacuugcc cccauaggaa ucc
2314723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 147uauaggcaga caggauauuu ucu
2314823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 148ugauaggcag acaggauauu uuc
2314923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 149uugauaggca gacaggauau uuu
2315023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 150uauuucauag uucagagccu gcc
2315123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 151ugauuucaua guucagagcc ugc
2315223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 152uugauuucau aguucagagc cug
2315323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 153ucugauuuca uaguucagag ccu
2315423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 154uuuugaugau gacauauccu cug
2315523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 155uaaggguuug augaugacau auc
2315623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 156uacaccaagg guuugaugau gac
2315723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 157ucauuuucaa gugcucucgu uga
2315823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 158uuucauuuuc aagugcucuc guu
2315923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 159uucauuucau uuucaagugc ucu
2316023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 160ugucauuuca uuuucaagug cuc
2316123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 161ucuuagacag ucauuucauu uuc
2316223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 162uucuuagaca gucauuucau uuu
2316323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 163uucucuuaga cagucauuuc auu
2316423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 164uaucucuuag acagucauuu cau
2316523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 165ugaucucuua gacagucauu uca
2316623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 166uuaagaucua guauccaguu gcu
2316723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 167uuucaaagaa gaaagagcug cag
2316823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 168ugaaauucaa agaagaaaga gcu
2316923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 169uaggaaauuc aaagaagaaa gag
2317023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 170uuacagauag gaaauucaaa gaa
2317123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 171uauacagaua ggaaauucaa aga
2317223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 172uacauacaga uaggaaauuc aaa
2317323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 173uagacauaca gauaggaaau uca
2317423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 174uaauuaggca gacauacaga uag
2317523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 175uuuuaauuag gcagacauac aga
2317623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 176uuuuuaauua ggcagacaua cag
2317723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 177uuuuuuaauu aggcagacau aca
2317823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 178uuuuuuuuaa uuaggcagac aua
2317923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 179uuugcaggua gcauaauaca aua
2318023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 180uuuuuuuugc agguagcaua aua
2318121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 181acugcuucug cuauaacagc a
2118221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 182uaugaacaag ccgcugcuuu a
2118321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 183cagugggaag guguuuguau a
2118421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 184guguuuguau uuccuagaga a
2118521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 185ucuguuacug aucauguaaa a
2118621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 186ucuguuacug aucauguaaa a
2118721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 187guuacugauc auguaaacuu a
2118821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 188uacugaucau guaaacuuga a
2118921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 189aucauguaaa cuugaucaca a
2119021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 190ucauguaaac uugaucacac a
2119121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 191cucuacagaa cuuuaccuug a
2119221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 192acuuuaccuu guguuuucga a
2119321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 193guuuucgagc cuauagugau a
2119421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 194gaaacugauc augugaagcu a
2119521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 195accucugcag aauuuuacac a
2119621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 196gcagaauuuu acacuguguu a
2119721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 197cagaauuuua cacuguguuu a
2119821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 198uaaugagcua cuaguuuaua a
2119921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 199aaugagcuac uaguuuauaa a
2120021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 200augagcuacu aguuuauaaa a
2120121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 201ugagcuacua guuuauaaag a
2120221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 202gagcuacuag uuuauaaaga a
2120321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 203agcuacuagu uuauaaagaa a
2120421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 204uguuuccgaa ccuacaguga a
2120521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 205cuacuaguuu auaaagaaag a
2120621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 206ccgaaccuac agugaccuuu a
2120721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 207guuuauaaag aaagaguugg a
2120821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 208uaaagaaaga guuggagagu a
2120921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 209guuggagagu auagucuaua a
2121021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 210aguauagucu auacauugga a
2121121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 211uagucuauac auuggaagac a
2121221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 212agagucuuuu cuccuacagu a
2121321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 213uacauuggaa gacacaaagu a
2121421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 214uuggaagaca caaaguuaca a
2121521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 215agacacaaag uuacauccaa a
2121621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 216acaaaguuac auccaaaguu a
2121721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 217aaguuacauc caaaguuauc a
2121821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 218uacauccaaa guuaucgaaa a
2121921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 219uccaaaguua ucgaaaaguu a
2122021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 220gagacaauga gcuacuaauu a
2122121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 221agacaaugag cuacuaauuu a
2122221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 222aaugagcuac uaauuuauaa a
2122321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 223gagcuacuaa uuuauaaaga a
2122421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 224cucaucaggu auugcugaau a
2122521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 225ucagguauug cugaauuuug a
2122621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 226guauugcuga auuuuggauc a
2122721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 227gaagcucagc ccaagauugu a
2122821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 228gcauuguuga auuuuggguc a
2122921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 229uuguugaauu uugggucaau a
2123021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 230auuccuaugg gggcaaguuu a
2123121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 231aaaauauccu gucugccuau a
2123221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 232aaauauccug ucugccuauc a
2123321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 233aauauccugu cugccuauca a
2123421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 234caggcucuga acuaugaaau a
2123521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 235aggcucugaa cuaugaaauc a
2123621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 236ggcucugaac uaugaaauca a
2123721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 237gcucugaacu augaaaucag a
2123821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 238gaggauaugu caucaucaaa a
2123921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 239uaugucauca ucaaacccuu a
2124021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 240caucaucaaa cccuuggugu a
2124121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 241aacgagagca cuugaaaaug a
2124221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 242cgagagcacu ugaaaaugaa a
2124321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 243agcacuugaa aaugaaauga a
2124421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 244gcacuugaaa augaaaugac a
2124521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 245aaaugaaaug acugucuaag a
2124621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 246aaugaaauga cugucuaaga a
2124721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 247ugaaaugacu gucuaagaga a
2124821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 248gaaaugacug ucuaagagau a
2124921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 249aaaugacugu cuaagagauc a
2125021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 250caacuggaua cuagaucuua a
2125121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 251gcagcucuuu cuucuuugaa a
2125221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 252cucuuucuuc uuugaauuuc a
2125321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 253cuuucuucuu ugaauuuccu a
2125421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 254cuuugaauuu ccuaucugua a
2125521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 255uuugaauuuc cuaucuguau a
2125621RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 256ugaauuuccu aucuguaugu a
2125721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 257aauuuccuau cuguaugucu a
2125821RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 258aucuguaugu cugccuaauu a
2125921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 259uguaugucug ccuaauuaaa a
2126021RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 260guaugucugc cuaauuaaaa a
2126121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 261uaugucugcc uaauuaaaaa a
2126221RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 262ugucugccua auuaaaaaaa a
2126321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 263uuguauuaug cuaccugcaa a
2126421RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 264uuaugcuacc ugcaaaaaaa a
2126523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 265ugcuguuaua gcagaagcag uga
2326623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 266uaaagcagcg gcuuguucau auu
2326723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 267uauacaaaca ccuucccacu gag
2326823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 268uucucuagga aauacaaaca ccu
2326923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 269uuuuacauga ucaguaacag auu
2327023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 270uuuuacauga ucaguaacag auu
2327123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 271uaaguuuaca ugaucaguaa cag
2327223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 272uucaaguuua caugaucagu aac
2327323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 273uugugaucaa guuuacauga uca
2327423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 274ugugugauca aguuuacaug auc
2327523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 275ucaagguaaa guucuguaga ggc
2327623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 276uucgaaaaca caagguaaag uuc
2327723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 277uaucacuaua ggcucgaaaa cac
2327823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 278uagcuucaca ugaucaguuu cag
2327923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 279uguguaaaau ucugcagagg uuu
2328023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 280uaacacagug uaaaauucug cag
2328123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 281uaaacacagu guaaaauucu gca
2328223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 282uuauaaacua guagcucauu auc
2328323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 283uuuauaaacu aguagcucau uau
2328423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 284uuuuauaaac uaguagcuca uua
2328523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 285ucuuuauaaa cuaguagcuc auu
2328623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 286uucuuuauaa acuaguagcu cau
2328723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 287uuucuuuaua aacuaguagc uca
2328823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 288uucacuguag guucggaaac aca
2328923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 289ucuuucuuua uaaacuagua gcu
2329023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 290uaaaggucac uguagguucg gaa
2329123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 291uccaacucuu ucuuuauaaa cua
2329223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 292uacucuccaa cucuuucuuu aua
2329323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 293uuauagacua uacucuccaa cuc
2329423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 294uuccaaugua uagacuauac ucu
2329523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 295ugucuuccaa uguauagacu aua
2329623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 296uacuguagga gaaaagacuc uga
2329723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 297uacuuugugu cuuccaaugu aua
2329823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 298uuguaacuuu gugucuucca aug
2329923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 299uuuggaugua acuuuguguc uuc
2330023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 300uaacuuugga uguaacuuug ugu
2330123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 301ugauaacuuu ggauguaacu uug
2330223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 302uuuucgauaa cuuuggaugu aac
2330323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 303uaacuuuucg auaacuuugg aug
2330423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 304uaauuaguag cucauugucu cug
2330523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 305uaaauuagua gcucauuguc ucu
2330623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 306uuuauaaauu aguagcucau ugu
2330723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 307uucuuuauaa auuaguagcu cau
2330823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 308uauucagcaa uaccugauga gga
2330923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 309ucaaaauuca gcaauaccug aug
2331023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 310ugauccaaaa uucagcaaua ccu
2331123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 311uacaaucuug ggcugagcuu cua
2331223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 312ugacccaaaa uucaacaaug cca
2331323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 313uauugaccca aaauucaaca aug
2331423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 314uaaacuugcc cccauaggaa ucc
2331523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 315uauaggcaga caggauauuu ucu
2331623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 316ugauaggcag acaggauauu uuc
2331723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 317uugauaggca gacaggauau uuu
2331823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 318uauuucauag uucagagccu
gcc
2331923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 319ugauuucaua guucagagcc ugc
2332023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 320uugauuucau aguucagagc cug
2332123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 321ucugauuuca uaguucagag ccu
2332223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 322uuuugaugau gacauauccu cug
2332323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 323uaaggguuug augaugacau auc
2332423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 324uacaccaagg guuugaugau gac
2332523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 325ucauuuucaa gugcucucgu uga
2332623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 326uuucauuuuc aagugcucuc guu
2332723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 327uucauuucau uuucaagugc ucu
2332823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 328ugucauuuca uuuucaagug cuc
2332923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 329ucuuagacag ucauuucauu uuc
2333023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 330uucuuagaca gucauuucau uuu
2333123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 331uucucuuaga cagucauuuc auu
2333223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 332uaucucuuag acagucauuu cau
2333323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 333ugaucucuua gacagucauu uca
2333423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 334uuaagaucua guauccaguu gcu
2333523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 335uuucaaagaa gaaagagcug cag
2333623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 336ugaaauucaa agaagaaaga gcu
2333723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 337uaggaaauuc aaagaagaaa gag
2333823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 338uuacagauag gaaauucaaa gaa
2333923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 339uauacagaua ggaaauucaa aga
2334023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 340uacauacaga uaggaaauuc aaa
2334123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 341uagacauaca gauaggaaau uca
2334223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 342uaauuaggca gacauacaga uag
2334323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 343uuuuaauuag gcagacauac aga
2334423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 344uuuuuaauua ggcagacaua cag
2334523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 345uuuuuuaauu aggcagacau aca
2334623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 346uuuuuuuuaa uuaggcagac aua
2334723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 347uuugcaggua gcauaauaca aua
2334823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 348uuuuuuuugc agguagcaua aua
2334923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 349ucacugcuuc ugcuauaaca gcc
2335023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 350aauaugaaca agccgcugcu uug
2335123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 351cucaguggga agguguuugu auu
2335223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 352agguguuugu auuuccuaga gaa
2335323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 353aaucuguuac ugaucaugua aac
2335423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 354aaucuguuac ugaucaugua aac
2335523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 355cuguuacuga ucauguaaac uug
2335623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 356guuacugauc auguaaacuu gau
2335723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 357ugaucaugua aacuugauca cac
2335823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 358gaucauguaa acuugaucac acc
2335923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 359gccucuacag aacuuuaccu ugu
2336023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 360gaacuuuacc uuguguuuuc gag
2336123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 361guguuuucga gccuauagug auc
2336223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 362cugaaacuga ucaugugaag cug
2336323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 363aaaccucugc agaauuuuac acu
2336423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 364cugcagaauu uuacacugug uuu
2336523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 365ugcagaauuu uacacugugu uuc
2336623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 366gauaaugagc uacuaguuua uaa
2336723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 367auaaugagcu acuaguuuau aaa
2336823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 368uaaugagcua cuaguuuaua aag
2336923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 369aaugagcuac uaguuuauaa aga
2337023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 370augagcuacu aguuuauaaa gaa
2337123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 371ugagcuacua guuuauaaag aaa
2337223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 372uguguuuccg aaccuacagu gac
2337323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 373agcuacuagu uuauaaagaa aga
2337423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 374uuccgaaccu acagugaccu uuc
2337523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 375uaguuuauaa agaaagaguu gga
2337623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 376uauaaagaaa gaguuggaga gua
2337723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 377gaguuggaga guauagucua uac
2337823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 378agaguauagu cuauacauug gaa
2337923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 379uauagucuau acauuggaag aca
2338023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 380ucagagucuu uucuccuaca gug
2338123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 381uauacauugg aagacacaaa guu
2338223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 382cauuggaaga cacaaaguua cau
2338323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 383gaagacacaa aguuacaucc aaa
2338423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 384acacaaaguu acauccaaag uua
2338523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 385caaaguuaca uccaaaguua ucg
2338623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 386guuacaucca aaguuaucga aaa
2338723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 387cauccaaagu uaucgaaaag uuc
2338823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 388cagagacaau gagcuacuaa uuu
2338923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 389agagacaaug agcuacuaau uua
2339023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 390acaaugagcu acuaauuuau aaa
2339123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 391augagcuacu aauuuauaaa gaa
2339223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 392uccucaucag guauugcuga auu
2339323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 393caucagguau ugcugaauuu ugg
2339423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 394agguauugcu gaauuuugga uca
2339523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 395uagaagcuca gcccaagauu guc
2339623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 396uggcauuguu gaauuuuggg uca
2339723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 397cauuguugaa uuuuggguca aug
2339823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 398ggauuccuau gggggcaagu uug
2339923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 399agaaaauauc cugucugccu auc
2340023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 400gaaaauaucc ugucugccua uca
2340123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 401aaaauauccu gucugccuau cag
2340223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 402ggcaggcucu gaacuaugaa auc
2340323RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 403gcaggcucug aacuaugaaa uca
2340423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 404caggcucuga acuaugaaau cag
2340523RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 405aggcucugaa cuaugaaauc aga
2340623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 406cagaggauau gucaucauca aac
2340723RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 407gauaugucau caucaaaccc uug
2340823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 408gucaucauca aacccuuggu gug
2340923RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 409ucaacgagag cacuugaaaa uga
2341023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 410aacgagagca cuugaaaaug aaa
2341123RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 411agagcacuug aaaaugaaau gac
2341223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 412gagcacuuga aaaugaaaug acu
2341323RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 413gaaaaugaaa ugacugucua aga 2341423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 414aaaaugaaau gacugucuaa gag 2341523RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 415aaugaaauga cugucuaaga gau 2341623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 416augaaaugac ugucuaagag auc 2341723RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 417ugaaaugacu gucuaagaga ucu 2341823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 418agcaacugga uacuagaucu uac 2341923RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 419cugcagcucu uucuucuuug aau 2342023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 420agcucuuucu ucuuugaauu ucc 2342123RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 421cucuuucuuc uuugaauuuc cua 2342223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 422uucuuugaau uuccuaucug uau 2342323RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 423ucuuugaauu uccuaucugu aug 2342423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 424uuugaauuuc cuaucuguau guc 2342523RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 425ugaauuuccu aucuguaugu cug 2342623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 426cuaucuguau gucugccuaa uua 2342723RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 427ucuguauguc ugccuaauua aaa 2342823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 428cuguaugucu gccuaauuaa aaa 2342923RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 429uguaugucug ccuaauuaaa aaa 2343023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 430uaugucugcc uaauuaaaaa aau 2343123RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 431uauuguauua ugcuaccugc aaa 2343223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 432uauuaugcua ccugcaaaaa aaa 2343319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 433aauaucagac gcuagggga 1943419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 434gggggacagc cacuguguu 1943519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 435uugucugcua cccucauca 1943619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 436cauccugguc acugcuucu 1943719RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 437uucugcuaua acagcccua 1943819RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 438cccuaggcca ggaauauga 1943919RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 439caggaauaug aacaagcca 1944019RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 440agccgcugcu uuggaucua 1944119RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 441aucucugucc ucaccagca 1944219RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 442cagccuccug gaagccuuu 1944319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 443uuugcucaca cagaccuca 1944419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 444ccucaguggg aagguguuu 1944519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 445ggaagguguu uguauuuca 1944619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 446uuccuagaga aucuguuaa 1944719RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 447uuacugauca uguaaacuu 1944819RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 448aacuugauca caccgcuga 1944919RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 449gcuggagaag ccucuacaa 1945019RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 450uacagaacuu uaccuugua 1945119RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 451acuuuaccuu guguuuuca 1945219RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 452uucgagccua uagugaucu 1945319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 453gaucucucuc gugccuaca 1945419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 454ucucgugccu acagccucu 1945519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 455cagccucuuc uccuacaau 1945619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 456caauacccaa ggcagggau 1945719RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 457gggauaauga gcuacuagu 1945819RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 458uaguuuauaa agaaagagu 1945919RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 459agaguuggag aguauagua 1946019RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 460uagucuauac auuggaaga 1946119RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 461uuggaagaca caaaguuaa 1946219RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 462cacaaaguua cauccaaag 1946319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 463aaaguuaucg aaaaguuca 1946419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 464guucccggcu ccagugcaa 1946519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 465ugcacaucug ugugagcua 1946619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 466agcugggagu ccucaucaa 1946719RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 467guauugcuga auuuuggau 1946819RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 468ggaucaaugg gacaccuuu 1946919RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 469cuuuggugaa aaagggucu 1947019RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 470ggucugcgac aggguuacu 1947119RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 471uuuguagaag cucagccca 1947219RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 472gcccaagauu guccuggga 1947319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 473uggggcagga acaggauua 1947419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 474uccuaugggg gcaaguuua 1947519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 475uuugauagga gccaguccu 1947619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 476guccuuugug ggagagauu 1947719RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 477agauugggga uuuguacau 1947819RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 478uuuguacaug ugggacucu 1947919RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 479augugggacu cugugcuga 1948019RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 480cugcccccag aaaauauca 1948119RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 481uauccugucu gccuaucaa 1948219RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 482ccuaucaggg uaccccucu 1948319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 483cucucccugc caauauccu 1948419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 484uccuggacug gcaggcucu 1948519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 485uggcaggcuc ugaacuaua 1948619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 486uaugaaauca gaggauaua 1948719RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 487uaugucauca ucaaacccu 1948819RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 488acccuuggug ugggucuga 1948919RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 489ugugggucug aggucuuga 1949019RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 490uugacucaac gagagcacu 1949119RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 491gcacuugaaa augaaauga 1949219RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 492aaugacuguc uaagagaua 1949319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 493agaucugguc aaagcaacu 1949419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 494caaagcaacu ggauacuaa 1949519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 495cuagaucuua caucugcaa 1949619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 496gcagcucuuu cuucuuuga 1949719RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 497uugaauuucc uaucuguau 1949819RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 498cuaucuguau gucugccua 1949919RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 499ccuaauuaaa aaaauauau 1950019RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 500uauauauugu auuaugcua 1950119RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 501uccccuagcg ucugauauu 1950219RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 502aacacagugg cuguccccc 1950319RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 503ugaugagggu agcagacaa 1950419RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 504agaagcagug accaggaug 1950519RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 505uagggcuguu auagcagaa 1950619RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 506ucauauuccu ggccuaggg 1950719RNAArtificial
Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 507uggcuuguuc
auauuccug 1950819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 508uagauccaaa
gcagcggcu 1950919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 509ugcuggugag
gacagagau 1951019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 510aaaggcuucc
aggaggcug 1951119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 511ugaggucugu
gugagcaaa 1951219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 512aaacaccuuc
ccacugagg 1951319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 513ugaaauacaa
acaccuucc 1951419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 514uuaacagauu
cucuaggaa 1951519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 515aaguuuacau
gaucaguaa 1951619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 516ucagcggugu
gaucaaguu 1951719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 517uuguagaggc
uucuccagc 1951819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 518uacaagguaa
aguucugua 1951919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 519ugaaaacaca
agguaaagu 1952019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 520agaucacuau
aggcucgaa 1952119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 521uguaggcacg
agagagauc 1952219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 522agaggcugua
ggcacgaga 1952319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 523auuguaggag
aagaggcug 1952419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 524aucccugccu
uggguauug 1952519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 525acuaguagcu
cauuauccc 1952619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 526acucuuucuu
uauaaacua 1952719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 527uacuauacuc
uccaacucu 1952819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 528ucuuccaaug
uauagacua 1952919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 529uuaacuuugu
gucuuccaa 1953019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 530cuuuggaugu
aacuuugug 1953119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 531ugaacuuuuc
gauaacuuu 1953219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 532uugcacugga
gccgggaac 1953319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 533uagcucacac
agaugugca 1953419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 534uugaugagga
cucccagcu 1953519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 535auccaaaauu
cagcaauac 1953619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 536aaaggugucc
cauugaucc 1953719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 537agacccuuuu
ucaccaaag 1953819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 538aguaacccug
ucgcagacc 1953919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 539ugggcugagc
uucuacaaa 1954019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 540ucccaggaca
aucuugggc 1954119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 541uaauccuguu
ccugcccca 1954219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 542uaaacuugcc
cccauagga 1954319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 543aggacuggcu
ccuaucaaa 1954419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 544aaucucuccc
acaaaggac 1954519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 545auguacaaau
ccccaaucu 1954619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 546agagucccac
auguacaaa 1954719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 547ucagcacaga
gucccacau 1954819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 548ugauauuuuc
ugggggcag 1954919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 549uugauaggca
gacaggaua 1955019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 550agagggguac
ccugauagg 1955119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 551aggauauugg
cagggagag 1955219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 552agagccugcc
aguccagga 1955319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 553uauaguucag
agccugcca 1955419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 554uauauccucu
gauuucaua 1955519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 555aggguuugau
gaugacaua 1955619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 556ucagacccac
accaagggu 1955719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 557ucaagaccuc
agacccaca 1955819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 558agugcucucg
uugagucaa 1955919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 559ucauuucauu
uucaagugc 1956019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 560uaucucuuag
acagucauu 1956119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 561aguugcuuug
accagaucu 1956219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 562uuaguaucca
guugcuuug 1956319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 563uugcagaugu
aagaucuag 1956419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 564ucaaagaaga
aagagcugc 1956519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 565auacagauag
gaaauucaa 1956619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 566uaggcagaca
uacagauag 1956719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 567auauauuuuu
uuaauuagg 1956819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 568uagcauaaua
caauauaua 1956921DNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 569aauaucagac gcuaggggat t
2157021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 570gggggacagc
cacuguguut t 2157121DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 571uugucugcua cccucaucat t
2157221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 572cauccugguc
acugcuucut t 2157321DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 573uucugcuaua acagcccuat t
2157421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 574cccuaggcca
ggaauaugat t 2157521DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 575caggaauaug aacaagccat t
2157621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 576agccgcugcu
uuggaucuat t 2157721DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 577aucucugucc ucaccagcat t
2157821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 578cagccuccug
gaagccuuut t 2157921DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 579uuugcucaca cagaccucat t
2158021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 580ccucaguggg
aagguguuut t 2158121DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 581ggaagguguu uguauuucat t
2158221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 582uuccuagaga
aucuguuaat t 2158321DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 583uuacugauca uguaaacuut t
2158421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 584aacuugauca
caccgcugat t 2158521DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 585gcuggagaag ccucuacaat t
2158621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 586uacagaacuu
uaccuuguat t 2158721DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 587acuuuaccuu guguuuucat t
2158821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 588uucgagccua
uagugaucut t 2158921DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 589gaucucucuc gugccuacat t
2159021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA
Molecule Synthetic oligonucleotide" 590ucucgugccu acagccucut t
2159121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 591cagccucuuc
uccuacaaut t 2159221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 592caauacccaa ggcagggaut t
2159321DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 593gggauaauga
gcuacuagut t 2159421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 594uaguuuauaa agaaagagut t
2159521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 595agaguuggag
aguauaguat t 2159621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 596uagucuauac auuggaagat t
2159721DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 597uuggaagaca
caaaguuaat t 2159821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 598cacaaaguua cauccaaagt t
2159921DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 599aaaguuaucg
aaaaguucat t 2160021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 600guucccggcu ccagugcaat t
2160121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 601ugcacaucug
ugugagcuat t 2160221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 602agcugggagu ccucaucaat t
2160321DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 603guauugcuga
auuuuggaut t 2160421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 604ggaucaaugg gacaccuuut t
2160521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 605cuuuggugaa
aaagggucut t 2160621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 606ggucugcgac aggguuacut t
2160721DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 607uuuguagaag
cucagcccat t 2160821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 608gcccaagauu guccugggat t
2160921DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 609uggggcagga
acaggauuat t 2161021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 610uccuaugggg gcaaguuuat t
2161121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 611uuugauagga
gccaguccut t 2161221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 612guccuuugug ggagagauut t
2161321DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 613agauugggga
uuuguacaut t 2161421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 614uuuguacaug ugggacucut t
2161521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 615augugggacu
cugugcugat t 2161621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 616cugcccccag aaaauaucat t
2161721DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 617uauccugucu
gccuaucaat t 2161821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 618ccuaucaggg uaccccucut t
2161921DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 619cucucccugc
caauauccut t 2162021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 620uccuggacug gcaggcucut t
2162121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 621uggcaggcuc
ugaacuauat t 2162221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 622uaugaaauca gaggauauat t
2162321DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 623uaugucauca
ucaaacccut t 2162421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 624acccuuggug ugggucugat t
2162521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 625ugugggucug
aggucuugat t 2162621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 626uugacucaac gagagcacut t
2162721DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 627gcacuugaaa
augaaaugat t 2162821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 628aaugacuguc uaagagauat t
2162921DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 629agaucugguc
aaagcaacut t 2163021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 630caaagcaacu ggauacuaat t
2163121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 631cuagaucuua
caucugcaat t 2163221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 632gcagcucuuu cuucuuugat t
2163321DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 633uugaauuucc
uaucuguaut t 2163421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 634cuaucuguau gucugccuat t
2163521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 635ccuaauuaaa
aaaauauaut t 2163621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 636uauauauugu auuaugcuat t
2163721DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 637uccccuagcg
ucugauauut t 2163821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 638aacacagugg cuguccccct t
2163921DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 639ugaugagggu
agcagacaat t 2164021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 640agaagcagug accaggaugt t
2164121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 641uagggcuguu
auagcagaat t 2164221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 642ucauauuccu ggccuagggt t
2164321DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 643uggcuuguuc
auauuccugt t 2164421DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 644uagauccaaa gcagcggcut t
2164521DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 645ugcuggugag
gacagagaut t 2164621DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 646aaaggcuucc aggaggcugt t
2164721DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 647ugaggucugu
gugagcaaat t 2164821DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 648aaacaccuuc ccacugaggt t
2164921DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 649ugaaauacaa
acaccuucct t 2165021DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 650uuaacagauu cucuaggaat t
2165121DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 651aaguuuacau
gaucaguaat t 2165221DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 652ucagcggugu gaucaaguut t
2165321DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 653uuguagaggc uucuccagct t
2165421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 654uacaagguaa
aguucuguat t 2165521DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 655ugaaaacaca agguaaagut t
2165621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 656agaucacuau
aggcucgaat t 2165721DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 657uguaggcacg agagagauct t
2165821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 658agaggcugua
ggcacgagat t 2165921DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 659auuguaggag aagaggcugt t
2166021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 660aucccugccu
uggguauugt t 2166121DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 661acuaguagcu cauuauccct t
2166221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 662acucuuucuu
uauaaacuat t 2166321DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 663uacuauacuc uccaacucut t
2166421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 664ucuuccaaug
uauagacuat t 2166521DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 665uuaacuuugu gucuuccaat t
2166621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 666cuuuggaugu
aacuuugugt t 2166721DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 667ugaacuuuuc gauaacuuut t
2166821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 668uugcacugga
gccgggaact t 2166921DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 669uagcucacac agaugugcat t
2167021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 670uugaugagga
cucccagcut t 2167121DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 671auccaaaauu cagcaauact t
2167221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 672aaaggugucc
cauugaucct t 2167321DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 673agacccuuuu ucaccaaagt t
2167421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 674aguaacccug
ucgcagacct t 2167521DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 675ugggcugagc uucuacaaat t
2167621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 676ucccaggaca
aucuugggct t 2167721DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 677uaauccuguu ccugccccat t
2167821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 678uaaacuugcc
cccauaggat t 2167921DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 679aggacuggcu ccuaucaaat t
2168021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 680aaucucuccc
acaaaggact t 2168121DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 681auguacaaau ccccaaucut t
2168221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 682agagucccac
auguacaaat t 2168321DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 683ucagcacaga gucccacaut t
2168421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 684ugauauuuuc
ugggggcagt t 2168521DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 685uugauaggca gacaggauat t
2168621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 686agagggguac
ccugauaggt t 2168721DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 687aggauauugg cagggagagt t
2168821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 688agagccugcc
aguccaggat t 2168921DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 689uauaguucag agccugccat t
2169021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 690uauauccucu
gauuucauat t 2169121DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 691aggguuugau gaugacauat t
2169221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 692ucagacccac
accaagggut t 2169321DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 693ucaagaccuc agacccacat t
2169421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 694agugcucucg
uugagucaat t 2169521DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 695ucauuucauu uucaagugct t
2169621DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 696uaucucuuag
acagucauut t 2169721DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 697aguugcuuug accagaucut t
2169821DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 698uuaguaucca
guugcuuugt t 2169921DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 699uugcagaugu aagaucuagt t
2170021DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 700ucaaagaaga
aagagcugct t 2170121DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 701auacagauag gaaauucaat t
2170221DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 702uaggcagaca
uacagauagt t 2170321DNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic
oligonucleotide"source/note="Description of Combined DNA/RNA
Molecule Synthetic oligonucleotide" 703auauauuuuu uuaauuaggt t
2170421DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide"source/note="Description of
Combined DNA/RNA Molecule Synthetic oligonucleotide" 704uagcauaaua
caauauauat t 2170519RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 705aauaucagac
gcuaggggg 1970619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 706gggggacagc
cacuguguu 1970719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 707uugucugcua
cccucaucc 1970819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 708cauccugguc
acugcuucu 1970919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 709uucugcuaua
acagcccua 1971019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 710cccuaggcca
ggaauauga 1971119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 711caggaauaug
aacaagccg 1971219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 712agccgcugcu
uuggaucuc 1971319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 713aucucugucc
ucaccagcc 1971419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 714cagccuccug
gaagccuuu 1971519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 715uuugcucaca
cagaccuca 1971619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 716ccucaguggg
aagguguuu 1971719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 717ggaagguguu
uguauuucc 1971819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 718uuccuagaga
aucuguuac 1971919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 719uuacugauca
uguaaacuu 1972019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 720aacuugauca
caccgcugg 1972119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 721gcuggagaag
ccucuacag 1972219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 722uacagaacuu
uaccuugug 1972319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 723acuuuaccuu
guguuuucg 1972419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 724uucgagccua
uagugaucu 1972519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 725gaucucucuc
gugccuaca 1972619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 726ucucgugccu
acagccucu 1972719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 727cagccucuuc
uccuacaau 1972819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 728caauacccaa
ggcagggau 1972919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 729gggauaauga
gcuacuagu 1973019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 730uaguuuauaa
agaaagagu 1973119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 731agaguuggag
aguauaguc 1973219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 732uagucuauac
auuggaaga 1973319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 733uuggaagaca
caaaguuac 1973419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 734cacaaaguua
cauccaaag 1973519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 735aaaguuaucg
aaaaguucc 1973619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 736guucccggcu
ccagugcac 1973719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 737ugcacaucug
ugugagcug 1973819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 738agcugggagu
ccucaucag 1973919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 739guauugcuga
auuuuggau 1974019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 740ggaucaaugg
gacaccuuu 1974119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 741cuuuggugaa
aaagggucu 1974219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 742ggucugcgac
aggguuacu 1974319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 743uuuguagaag
cucagccca 1974419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 744gcccaagauu
guccugggg 1974519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 745uggggcagga
acaggauuc 1974619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 746uccuaugggg
gcaaguuug 1974719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 747uuugauagga
gccaguccu 1974819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 748guccuuugug
ggagagauu 1974919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 749agauugggga
uuuguacau 1975019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 750uuuguacaug
ugggacucu 1975119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 751augugggacu
cugugcugc 1975219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 752cugcccccag
aaaauaucc 1975319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 753uauccugucu
gccuaucag 1975419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 754ccuaucaggg
uaccccucu 1975519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 755cucucccugc
caauauccu 1975619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 756uccuggacug
gcaggcucu 1975719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 757uggcaggcuc
ugaacuaug 1975819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 758uaugaaauca
gaggauaug 1975919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 759uaugucauca
ucaaacccu 1976019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 760acccuuggug
ugggucuga 1976119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 761ugugggucug
aggucuuga 1976219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 762uugacucaac
gagagcacu 1976319RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 763gcacuugaaa
augaaauga 1976419RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 764aaugacuguc
uaagagauc 1976519RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 765agaucugguc
aaagcaacu 1976619RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 766caaagcaacu
ggauacuag 1976719RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 767cuagaucuua
caucugcag 1976819RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 768gcagcucuuu
cuucuuuga 1976919RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 769uugaauuucc
uaucuguau 1977019RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 770cuaucuguau
gucugccua 1977119RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 771ccuaauuaaa
aaaauauau 1977219RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 772uauauauugu
auuaugcua 1977321RNAArtificial Sequencesource/note="Description of
Artificial Sequence Synthetic oligonucleotide" 773caaugagcua
cuaauuuaua a 2177423RNAArtificial Sequencesource/note="Description
of Artificial Sequence Synthetic oligonucleotide" 774uuauaaauua
guagcucauu guc 2377521RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 775auuuuacacu guguuuccga a 2177623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 776uucggaaaca caguguaaaa uuc 2377721RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 777acaaugagcu acuaauuuau a 2177823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 778uauaaauuag uagcucauug ucu 2377921RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 779gcagaauuuu acacuguguu a 2178023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 780uaacacagug uaaaauucug cag 2378121RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 781gaauuuuaca cuguguuucc a 2178223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 782uggaaacaca guguaaaauu cug 2378321RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 783cagaauuuua cacuguguuu a 2178423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 784uaaacacagu guaaaauucu gca 2378521RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 785cucagagucu uuucuccuac a 2178623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 786uguaggagaa aagacucuga gag 2378721RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 787gacaaugagc uacuaauuua a 2178823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 788uuaaauuagu agcucauugu cuc 2378921RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 789agacaaugag cuacuaauuu a 2179023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 790uaaauuagua gcucauuguc ucu 2379121RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 791auggaaagcc uuggguaaaa a 2179223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 792uuuuuaccca aggcuuucca uug 2379321RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 793cccgcucuca gagucuuuuc a 2179423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 794ugaaaagacu cugagagcgg gaa 2379521RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 795ucagagucuu uucuccuaca a 2179623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 796uuguaggaga aaagacucug aga 2379721RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 797gagacaauga gcuacuaauu a 2179823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 798uaauuaguag cucauugucu cug 2379921RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 799uucaccagcc uucuuucaga a 2180023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 800uucugaaaga aggcugguga aga 2380121RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 801ucuuuucucc uacaguguca a 2180223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 802uugacacugu aggagaaaag acu 2380321RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 803agugaccuuu cccgcucuca a 2180423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 804uugagagcgg gaaaggucac ugu 2380521RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 805agagucuuuu cuccuacagu a 2180623RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 806uacuguagga gaaaagacuc uga 2380721RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 807cucugcagaa uuuuacacug a 2180823RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 808ucaguguaaa auucugcaga ggu 2380921RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 809ugucuucacc agccuucuuu a 2181023RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 810uaaagaaggc uggugaagac aaa 2381121RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 811agccuucuuu cagaagccuu a 2181223RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 812uaaggcuucu gaaagaaggc ugg 2381321RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 813aauggaaagc cuuggguaaa a 2181423RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 814uuuuacccaa ggcuuuccau uga 2381521RNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 815cgcucucaga gucuuuucuc a
2181623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 816ugagaaaaga cucugagagc ggg
2381721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 817caauggaaag ccuuggguaa a
2181823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 818uuuacccaag gcuuuccauu gac
2381921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 819ucuucaccag ccuucuuuca a
2182023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 820uugaaagaag gcuggugaag aca
2382121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 821cucucagagu cuuuucuccu a
2182223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 822uaggagaaaa gacucugaga gcg
2382321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 823cagagacaau gagcuacuaa a
2182423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 824uuuaguagcu cauugucucu gcc
2382521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 825agagacaaug agcuacuaau a
2182623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 826uauuaguagc ucauugucuc ugc
2382721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 827cagagucuuu ucuccuacag a
2182823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 828ucuguaggag aaaagacucu gag
2382921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 829ucucagaguc uuuucuccua a
2183023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 830uuaggagaaa agacucugag agc
2383121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 831ccuacaguga ccuuucccgc a
2183223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 832ugcgggaaag gucacuguag guu
2383321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 833gccuucuuuc agaagccuuu a
2183423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 834uaaaggcuuc ugaaagaagg cug
2383521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 835ucccgcucuc agagucuuuu a
2183623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 836uaaaagacuc ugagagcggg aaa
2383721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 837gucuuuucuc cuacaguguc a
2183823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 838ugacacugua ggagaaaaga cuc
2383921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 839cuacagugac cuuucccgcu a
2184023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 840uagcgggaaa ggucacugua ggu
2384121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 841agucuuuucu ccuacagugu a
2184223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 842uacacuguag gagaaaagac ucu
2384321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 843acagugaccu uucccgcucu a
2184423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 844uagagcggga aaggucacug uag
2384521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 845caccagccuu cuuucagaag a
2184623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 846ucuucugaaa gaaggcuggu gaa
2384721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 847gaauuuuggg ucaauggaaa a
2184823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 848uuuuccauug acccaaaauu caa
2384921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 849ucaccagccu ucuuucagaa a
2185023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 850uuucugaaag aaggcuggug aag
2385121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 851cuuuucuccu acagugucaa a
2185223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 852uuugacacug uaggagaaaa gac
2385321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 853accuacagug accuuucccg a
2185423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 854ucgggaaagg ucacuguagg uuc
2385521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 855ucaaaaguca caguccgugg a
2185623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 856uccacggacu gugacuuuug auu
2385721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 857uuucccgcuc ucagagucuu a
2185823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 858uaagacucug agagcgggaa agg
2385921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 859cagugaccuu ucccgcucuc a
2186023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 860ugagagcggg aaaggucacu gua
2386121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 861caaaagucac aguccguggu a
2186223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 862uaccacggac ugugacuuuu gau
2386321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 863uucccgcucu cagagucuuu a
2186423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 864uaaagacucu gagagcggga aag
2386521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 865aaucaaaagu cacaguccgu a
2186623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 866uacggacugu gacuuuugau ugu
2386721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 867caaugagcua cuaauuuaua a
2186823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 868uuauaaauua guagcucauu guc
2386921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 869auuuuacacu guguuuccga a
2187023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 870uucggaaaca caguguaaaa uuc
2387121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 871acaaugagcu acuaauuuau a
2187223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 872uauaaauuag uagcucauug ucu
2387321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 873gcagaauuuu acacuguguu a
2187423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 874uaacacagug uaaaauucug cag
2387521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 875gaauuuuaca cuguguuucc a
2187623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 876uggaaacaca guguaaaauu cug
2387721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 877cagaauuuua cacuguguuu a
2187823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 878uaaacacagu guaaaauucu gca
2387921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 879cucagagucu uuucuccuac a
2188023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 880uguaggagaa aagacucuga gag
2388121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 881gacaaugagc uacuaauuua a
2188223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 882uuaaauuagu agcucauugu cuc
2388321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 883agacaaugag cuacuaauuu a
2188423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 884uaaauuagua gcucauuguc ucu
2388521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 885auggaaagcc uuggguaaaa a
2188623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 886uuuuuaccca aggcuuucca uug
2388721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 887cccgcucuca gagucuuuuc a
2188823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 888ugaaaagacu cugagagcgg gaa
2388921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 889ucagagucuu uucuccuaca a
2189023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 890uuguaggaga aaagacucug aga
2389121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 891gagacaauga gcuacuaauu a
2189223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 892uaauuaguag cucauugucu cug
2389321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 893uucaccagcc uucuuucaga a
2189423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 894uucugaaaga aggcugguga aga
2389521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 895ucuuuucucc uacaguguca a
2189623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 896uugacacugu aggagaaaag acu
2389721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 897agugaccuuu cccgcucuca a
2189823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 898uugagagcgg gaaaggucac ugu
2389921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 899agagucuuuu cuccuacagu a
2190023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 900uacuguagga gaaaagacuc uga
2390121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 901cucugcagaa uuuuacacug a
2190223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 902ucaguguaaa auucugcaga ggu
2390321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 903ugucuucacc agccuucuuu a
2190423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 904uaaagaaggc uggugaagac aaa
2390521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 905agccuucuuu cagaagccuu a
2190623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 906uaaggcuucu gaaagaaggc ugg
2390721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 907aauggaaagc cuuggguaaa a
2190823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 908uuuuacccaa ggcuuuccau uga
2390921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 909cgcucucaga gucuuuucuc a
2191023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 910ugagaaaaga cucugagagc ggg
2391121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 911caauggaaag ccuuggguaa a
2191223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 912uuuacccaag gcuuuccauu gac
2391321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 913ucuucaccag ccuucuuuca a
2191423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 914uugaaagaag gcuggugaag aca
2391521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 915cucucagagu cuuuucuccu a
2191623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 916uaggagaaaa gacucugaga gcg
2391721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 917cagagacaau gagcuacuaa a
2191823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 918uuuaguagcu cauugucucu gcc
2391921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 919agagacaaug agcuacuaau a
2192023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 920uauuaguagc ucauugucuc ugc
2392121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 921cagagucuuu ucuccuacag a
2192223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 922ucuguaggag aaaagacucu gag
2392321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 923ucucagaguc uuuucuccua a
2192423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 924uuaggagaaa agacucugag agc
2392521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 925ccuacaguga ccuuucccgc a
2192623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 926ugcgggaaag gucacuguag guu
2392721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 927gccuucuuuc agaagccuuu a
2192823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 928uaaaggcuuc ugaaagaagg cug
2392921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 929ucccgcucuc agagucuuuu a
2193023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 930uaaaagacuc ugagagcggg aaa
2393121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 931gucuuuucuc cuacaguguc a
2193223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 932ugacacugua ggagaaaaga cuc
2393321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 933cuacagugac cuuucccgcu a
2193423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 934uagcgggaaa ggucacugua ggu
2393521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 935agucuuuucu ccuacagugu a
2193623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 936uacacuguag gagaaaagac ucu
2393721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 937acagugaccu uucccgcucu a
2193823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 938uagagcggga aaggucacug uag
2393921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 939caccagccuu cuuucagaag a
2194023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 940ucuucugaaa gaaggcuggu gaa
2394121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 941gaauuuuggg ucaauggaaa a
2194223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 942uuuuccauug acccaaaauu caa
2394321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 943ucaccagccu ucuuucagaa a
2194423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 944uuucugaaag aaggcuggug aag
2394521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 945cuuuucuccu acagugucaa a
2194623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 946uuugacacug uaggagaaaa gac
2394721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 947accuacagug accuuucccg a
2194823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 948ucgggaaagg ucacuguagg uuc
2394921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 949ucaaaaguca caguccgugg a
2195023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 950uccacggacu gugacuuuug auu
2395121RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 951uuucccgcuc ucagagucuu a
2195223RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 952uaagacucug agagcgggaa agg
2395321RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 953cagugaccuu ucccgcucuc a
2195423RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 954ugagagcggg aaaggucacu gua
2395521RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 955caaaagucac aguccguggu a
2195623RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 956uaccacggac ugugacuuuu gau
2395721RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 957uucccgcucu cagagucuuu a
2195823RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 958uaaagacucu gagagcggga aag
2395921RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 959aaucaaaagu cacaguccgu a
2196023RNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 960uacggacugu gacuuuugau ugu
23
* * * * *
References