U.S. patent application number 17/716273 was filed with the patent office on 2022-09-22 for bisdiazabicyclo compound for treating and/or preventing hepatitis virus-related diseases or disorders.
The applicant listed for this patent is HEALTHQUEST PHARMA INC., JIANGSU ASCENTAGE BIOMED DEVELOPMENT INC.. Invention is credited to Jinlin Hou, Dajun Yang, Yifan Zhai, Xiaoyong Zhang.
Application Number | 20220296571 17/716273 |
Document ID | / |
Family ID | 1000006381118 |
Filed Date | 2022-09-22 |
United States Patent
Application |
20220296571 |
Kind Code |
A1 |
Zhai; Yifan ; et
al. |
September 22, 2022 |
BISDIAZABICYCLO COMPOUND FOR TREATING AND/OR PREVENTING HEPATITIS
VIRUS-RELATED DISEASES OR DISORDERS
Abstract
Disclosed are a bisdiazabicyclo compound for treating and/or
preventing hepatitis virus-related diseases or disorders, a method
for treating and/or preventing hepatitis virus-related diseases or
disorders by using the bisdiazabicyclo compound, and a use of the
bisdiazabicyclo compound in the preparation of a drug for treating
and/or preventing hepatitis virus-related diseases or disorders,
and/or eliminating or mitigating hepatitis virus-related diseases
or disorders.
Inventors: |
Zhai; Yifan; (Guangzhou,
CN) ; Zhang; Xiaoyong; (Guangzhou, CN) ; Hou;
Jinlin; (Guangzhou, CN) ; Yang; Dajun;
(Taizhou, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
JIANGSU ASCENTAGE BIOMED DEVELOPMENT INC.
HEALTHQUEST PHARMA INC. |
Taizhou
Guangzhou |
|
CN
CN |
|
|
Family ID: |
1000006381118 |
Appl. No.: |
17/716273 |
Filed: |
April 8, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16624050 |
Dec 18, 2019 |
11298339 |
|
|
PCT/CN2018/116289 |
Nov 20, 2018 |
|
|
|
17716273 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61P 31/20 20180101;
A61K 31/407 20130101; A61K 47/54 20170801; A61K 47/55 20170801 |
International
Class: |
A61K 31/407 20060101
A61K031/407; A61K 47/55 20060101 A61K047/55; A61K 47/54 20060101
A61K047/54; A61P 31/20 20060101 A61P031/20 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 24, 2017 |
CN |
201711193388.1 |
Claims
1-35. (canceled)
36. A method of using a compound for treatment and/or prevention of
a disease or disorder associated with a hepatitis virus, wherein
the method comprises administering a therapeutically and/or
prophylactically effective amount of the compound to a patient
having the disease or disorder associated with a hepatitis virus,
and the compound is a bisdiazabicyclo compound or a
pharmaceutically acceptable salt thereof.
37. The method according to claim, 36, wherein the compound has the
following structure: ##STR00041## Wherein X is selected from:
##STR00042## and --SO.sub.2--; Y is selected from --O--, --S--, and
is absent when X is --SO.sub.2--; R is selected from ##STR00043##
and R.sub.1 is selected from ##STR00044## wherein Z is O, S or NH;
wherein the ring A is a C.sub.4-8 aliphatic ring; and B is phenyl,
naphthyl, pyridyl, pyridazinyl, pyrazinyl or pyrimidinyl, and is
optionally substituted by 1 to 4 groups independently selected from
halogen, --OCF.sub.3, --NO.sub.2, --CN, --NC, --OH, amino,
C.sub.1-10 alkyl, C.sub.1-10 alkyloxy, and C.sub.1-10
alkylamino
38. The method according to claim 37, wherein R is ##STR00045##
wherein p is 0 to 4.
39. The method according to claim 37, wherein R is ##STR00046##
wherein phenyl is optionally substituted by 1 to 4 groups
independently selected from halogen, --OCF.sub.3, --NO.sub.2, --CN,
--NC, --OH, amino, C.sub.1-10 alkyl, C.sub.1-10 alkylamino.
40. The method according to claim 39, wherein R is ##STR00047##
41. The method according to claim 37, wherein R.sub.1 i
##STR00048## wherein phenyl is optionally substituted by 1 to 4
groups independently selected from halogen, --OCF.sub.3,
--NO.sub.2, --NC, --OH, amino, C.sub.1-10 alkyl, C.sub.1-10
alkyloxy and C.sub.1-10 alkylamino.
42. The method according to claim 37, wherein R.sub.1 is
##STR00049## wherein phenyl is optionally substituted by 1 to 4
groups independently selected from halogen, --OCF.sub.3,
--NO.sub.2, --CN, --NC, --OH, amino, C.sub.1-10 alkyl
C.sub.1-10alkyloxy and C.sub.1-10 alkylamino.
43. The method according to claim 41, wherein R.sub.1 is
##STR00050##
44. The method according to claim 37, wherein X is ##STR00051## and
Y is --NC--.
45. The method according to claim 37, wherein X is ##STR00052## and
Y is --NH--.
46. The method according to claim 37, wherein X is ##STR00053## and
Y is --O--.
47. The method according to claim 37, wherein the compound is
selected from ##STR00054## ##STR00055## ##STR00056##
48. The method according to claim 37, wherein the compound is
selected from ##STR00057##
49. The method according to claim 37, wherein the compound is
selected from ##STR00058##
50. The method according to claim 36, wherein the disease or
disorder associated with hepatitis virus is a disease or disorder
associated with hepatitis A virus, hepatitis B virus or hepatitis C
virus.
51. The method according to claim 36, wherein the disease or
disorder associated with hepatitis A, hepatitis B, hepatitis C, and
liver cirrhosis.
52. The method according to claim 36, wherein the compound treats
and/or prevents the disease or disorder associated with hepatitis
virus by modulating an immune response.
53. The method according to claim 36, wherein the method comprises
using the compound in combination with a drug known to treat HBV.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 16/624,050, filed on Dec. 18, 2019, which is the U.S. national
stage application of PCT International Application No.
PCT/CN2018/116289, filed on Nov. 20, 2018, which claims the benefit
of foreign priority of Chinese Patent Application No.
201711193388.1, filed on Nov. 24, 2017. The entire contents of the
aforementioned applications are incorporated herein by
reference.
TECHNICAL FIELD
[0002] The present invention relates to a diazabicyclo compound for
the treatment and/or prevention of a disease or disorder associated
with a hepatitis virus, a method of using the same to treat and/or
prevent a disease or disorder associated with a hepatitis virus,
and a use of the same in the manufacture of a medicament for the
treatment and/or prevention of a disease or disorder associated
with a hepatitis virus or for the elimination and/or alleviation of
a disease or disorder associated with a hepatitis virus.
BACKGROUND ART
[0003] Hepatitis or liver disease is usually caused by hepatitis
virus. Hepatitis viruses generally are divided into the following
types: A, B, C, D, E and G, in which hepatitis B virus causes
chronic diseases that are currently distributed worldwide and a
considerable proportion of hepatitis B may turn into liver cancer
in the later stage of disease development if it is not improperly
controlled. There are currently an estimated 280,000,000 hepatitis
B patients (or HBV carriers) worldwide.
[0004] According to the Guideline of Prevention and Treatment for
Chronic Hepatitis B (CHB) 2015 version in China, the goal of
chronic hepatitis B treatment is to maximize the long-term
inhibition of HBV replication, reduce inflammatory necrosis of
liver cells and liver fibrosis, and delay and reduce liver failure
and decompensation of liver cirrhosis, HCC and other complications,
thereby improving quality of life and extending survival time. In
the treatment process, for some suitable patients, the clinical
cure of chronic hepatitis B should be pursued as much as possible,
that is, after the end of treatment, there should be continuous
virological response, HBsAg negative conversion or accompanied by
anti-HBs positive conversion, normal ALT, mild or no lesions of
liver tissues. The complete healing means that except antibodies,
HBV DNA, various antigens, and cccDNA are eliminated in body.
[0005] At present, many international guidelines for the prevention
and treatment of chronic hepatitis B take the negative conversion
of surface antigen (HBsAg) (also known as functional cure) as an
ideal target for CHB antiviral therapy. However, although the
existing antiviral drugs such as interferons (Interferon alpha,
IFN-.alpha.) and nucleos(t)ide analogues [NUCs] can inhibit viral
replication, the clearance or seroconversion of HBsAg may hardly
occur within a limited or long-term course of treatment. Currently,
there are 7 antiviral drugs approved by the FDA for the treatment
of chronic hepatitis B infection, including ordinary and pegylated
interferons and 5 oral nucleos(t)ide analogs (i.e., lamivudine,
adefovir dipivoxil, entecavir, telbivudine, and tenofovir
disoproxil fumarate (TDF)), in which entecavir (ETV) and tenofovir
disoproxil fumarate are recommended as therapeutic first-line drugs
(Liaw, Leung et al. 2008; Lok and McMahon 2009; Liu, Yang et al.
2014; Gish, Given et al. 2015). However, after the clinical use of
existing NUCs drugs for 5 years, the HBsAg negative conversion
ratio was less than 5%; and for those showing response after
receiving pegylated interferon (PEG-IFN) treatment, the HBsAg
negative conversion ratio was less than 10% during long-term
follow-up (Sundaram and Kowdley 2015). For the patients with CHB,
NUCs drugs can only inhibit the synthesis of the viral positive and
negative strands in nucleocapsids; during the antiviral therapy
thereof, the mainly disappeared thing is replication DNA, and there
is no direct effect on the cccDNA in the nucleus of liver cells and
the viral antigens transcribed and expressed thereby (Wong, Seto et
al. 2013). Another class of drugs, IFN.alpha., has both
immunoregulatory and direct antiviral effects, and can induce the
expression of APOBEC3A in HBV-infected liver cells, promote the
degradation of cccDNA through base editing, and exert direct
antiviral effects (Lucifora, Xia et al. 2014). However, it has been
confirmed that HBV can antagonize the IFN.alpha. signaling pathway,
resulting in poor therapeutic effect of IFN.alpha. drugs
(Bertoletti and Ferrari 2012). Therefore, given the limitations of
current antiviral drugs, other therapeutic strategies such as
stimulating and/or restoring antiviral immunity are currently
hot-spots in researches for the clearance of chronic HBV infection
(Lucifora and Trepo 2015).
[0006] A host-specific immune response is essential for HBV
clearance. The HBV-specific T-lymphocyte response is the most
important effector cell to clear HBV infection in liver cells.
After HBV infects and enters liver cells through sodium
ion/taurocholate cotransporting polypeptide receptor, the viral
genome can be repaired by host DNA polymerase to form a stable
covalently closed circular DNA (cccDNA) and parasitized in nucleus
of the liver cells. As the original template for viral replication
and gene expression in the liver, the difficulty in removal of
cccDNA microchromosomes is an important reason for the difficulty
of cure in clinical antiviral treatment (Nassal 2015). HBV effector
T cells can directly kill infected liver cells, induce target cell
apoptosis, and clear cccDNA and other viral products through the
killing effects of granzymes, perforin, or the cytotoxic pathway of
hepatocyte apoptosis induced by FasL (Hoh, Heeg et al. 2015). In
addition, cytokines such as IFN.gamma. and TNF.alpha. secreted by
effector T cells can also affect infected liver cells and induce
intracellular antiviral gene expression through non-cytolytic
pathway to inhibit viral replication and cccDNA synthesis
(Guidotti, Rochford et al. 1999). The latest research suggests that
the effector T cells can be anchored to the hepatic sinusoids
through platelets, and directly contact infected liver cells
presenting viral antigens through the endothelial cell gap, and
then secrete cytokines such as IFN.gamma. and TNF.alpha. to
directly induce the apoptosis of the infected liver cells so as to
clear HBV (Guidotti, Inverso et al. 2015). Furthermore, the B cells
also play a very important role in controlling HBV infection. In
acute HBV infection, the hepatitis B surface antigen antibody
(HBsAb) produced by B cells can neutralize and block HBV infection
of liver cells.
[0007] IAP proteins are a key class of apoptosis regulators and are
characterized by the presence of one or more BIR (baculovirus IAP
repeat) domains. Among IAPB, cellular IAP1 (cIAP1) and cIAP2 play a
key role in the regulation of death receptor-mediated apoptosis,
while X-linked IAP (XIAP) inhibits death receptor-mediated and
mitochondrial-mediated apoptosis by binding and inhibiting
caspase-3/7 and caspase-9 (three cysteine proteases that are
critical for performing apoptosis). These IAP proteins are highly
overexpressed in both cancer cell lines and human tumor tissues,
and have low expression in normal cells and tissues. Extensive
researches have shown that the overexpression of IAP proteins makes
cancer cells resistant to the apoptosis inducted by a variety of
anticancer drugs. A detailed discussion of IAP proteins and their
effects on cancer as well as apoptosis is described in U.S. Pat.
No. 7,960,372.
[0008] One category of central negative regulator for apoptosis is
inhibitor of apoptosis protein (TAP). This category includes
proteins such as XIAP, cIAP1, cIAP2, ML-IAP, HIAP, KIAP, TSIAP,
NAIP, survivin, livin, ILP-2, apollon, and BRUCE.
[0009] Small molecule inhibitors of IAP proteins are also known.
For example, U.S. Patent Publication No. 2005/0197403 and U.S. Pat.
No. 7,960,372 disclose dimeric Smac mimetic compounds. Among them,
bisdiazabicyclo compounds are a class of compounds that inhibit
IAP.
[0010] Studies have shown that peptide-based inhibitors are useful
tools to elucidate the anti-apoptotic function of IAP and the role
of IAP in the response of cancer cells to chemotherapeutic agents.
The prior art does not disclose or suggest that the bisdiazabicyclo
compounds are effective in inhibiting or eliminating hepatitis
viruses, especially HBV viruses.
Contents of the Invention
[0011] In the research, the inventors of the present application
unexpectedly found that the bisdiazabicyclo compounds are extremely
effective in inhibiting and/or eliminating hepatitis viruses,
especially HBV virus.
[0012] Accordingly, a first aspect of the present invention relates
to a bisdiazabicyclo compound for treatment and/or prevention of a
disease or disorder associated with a hepatitis virus, wherein the
compound is a bisdiazabicyclo compound. Further, the
bisdiazabicyclo compound is a compound having the following
structure or a pharmaceutically acceptable salt thereof:
##STR00001##
[0013] where X is selected from:
##STR00002##
and --SO.sub.2--;
[0014] Y is selected from --NH--, --O--, --S-- and is absent;
[0015] R is selected from
##STR00003##
(where the ring A is a C.sub.4-8 aliphatic ring), --C.sub.3-6
cycloalkylene
##STR00004##
(where the ring B is phenyl, naphthyl, pyridyl, pyridazinyl,
pyrazinyl, or pyrimidinyl, and the B ring is optionally
substituted);
[0016] R.sub.1 is selected from --(CH.sub.2).sub.4-10--,
##STR00005##
wherein Z is O, S, NH or
##STR00006##
[0017] where n is 0, 1 or 2, and wherein the ring B is phenyl,
naphthyl, pyridyl, pyridazinyl, pyrazinyl or pyrimidinyl, and the
ring B is optionally substituted.
[0018] Preferably, in the compound, R is
##STR00007##
[0019] Preferably, in the compound, R.sub.1 is
##STR00008##
[0020] Preferably, in the compound, X is SO.sub.2 and Y is
absent.
[0021] Preferably, the compound is
##STR00009##
[0022] Preferably, the compound is selected from:
##STR00010##
[0023] Further, the disease or disorder associated with hepatitis
virus is a disease or disorder associated with the late stage of
infection with hepatitis virus. Preferably, the disease or disorder
associated with hepatitis virus is a disease or disorder associated
with hepatitis A virus, hepatitis B virus or hepatitis C virus.
More preferably, the hepatitis virus-related disease or disorder
includes, but is not limited to: hepatitis A, hepatitis B,
hepatitis C, and liver cirrhosis. Further, the compound treats
and/or prevents a disease or disorder associated with hepatitis
virus by modulating an immune response.
[0024] A second aspect of the present invention relates to a use of
the compound as defined above in manufacture of a medicament for
treatment and/or prevention of a disease or disorder associated
with a hepatitis virus.
[0025] A third aspect of the present invention relates to a method
for treating and/or preventing a disease or disorder associated
with a hepatitis virus, comprising administering a therapeutically
and/or prophylactically effective amount of the compound to a
patient suffering from the disease or disorder associated with the
hepatitis virus, and the compound being a bisdiazabicyclo
compound.
[0026] A fourth aspect of the present invention relates to a
pharmaceutical composition comprising the compound as defined
above, wherein the pharmaceutic composition is useful in the
treatment and/or prevention of a disease or disorder associated
with a hepatitis virus.
DESCRIPTION OF FIGURES
[0027] FIG. 1 shows the effect of single-dose injection of Compound
1 on HBV in a C57BL/6J mouse model established by high-pressure
tail vein injection of pAAV-HBV1.2 plasmid. A: dynamic changes of
HBsAg in serum for each group; B: dynamic changes of HBV DNA in
serum for each group; C: HBcAg expression in liver tissue for each
group detected in 7 weeks by immunohistochemical staining; D: HBV
replication intermediate in liver for each group detected in 7
weeks by Southern Blot.
[0028] FIG. 2 shows the effect of the administration of Compound 1
in combination with tenofovir disoproxil fumarate (TDF) on HBV in a
C57BL/6J mouse model established by high-pressure tail vein
injection of pAAV-HBV1.2 plasmid. A: comparison of clearance rates
of HBsAg in serum for different groups at different time points; B:
comparison of clearance rates of HBV DNA in serum for different
groups at different time points.
[0029] FIG. 3 shows the effect of Compound 1 on hepatocyte
apoptosis in HBV-infected mice. A: dynamic changes of ALT and AST
in serum at different time points after Compound 1 injection for
the C57BL/6J mice subjected to high-pressure tail vein injection of
pAAV-HBV1.2 plasmid; B: expression changes of cIAPs in liver tissue
at different time points after Compound 1 injection: C: HE staining
of liver tissue sections of mice at different time points after
Compound 1 injection; D: apoptosis of HBV-infected liver cells
detected by HBcAg immunofluorescence and Tunnel double staining
method.
[0030] FIG. 4 shows the influential effect of Compound 1 treatment
on HBV immune response in mice. A: changes of total lymphocyte
count in liver after the viruses were cleared from the liver of the
mice in the Compound 1 treatment group; B: changes of counts of
infiltrated CD4+ T cells and CD8+ T cells in liver; C: function of
HBV-specific CD4+ T cells in term of secretion of IFN.gamma.,
TNF.alpha., IL-2; D: function of HBV-specific CD8+ T cells in term
of secretion of IFN.gamma., TNF.alpha., IL-2.
[0031] FIG. 5 shows the anti-HBV effect of the administration of
Compound 1 in combination with IFN.alpha.2a in a C57BL/6J mouse
model of chronic HBV infection. FIG. 5A: changes of individual
serum HBsAg level at different time points within 21 days after the
first administration for each group (Group A (0.9% saline injection
group): pAAV-HBV1.2+pKCMvint+0.9% NaCl; Group B (Compound 1 10mg/kg
intravenous injection group): pAAV-HBV1.2+pKCMvint+Compound 1
10mg/kg; Group C (IFN.alpha.-2a group): pAAV-HBV1.2+pKCMvint
IFN.alpha.-2a+0.9% NaCl; Group D (Compound 1 in combination with
IFN.alpha.-2a group): pAAV-HBV1.2+pKCMvint IFN.alpha.-2a+APG
10mg/kg). FIG. 5B: changes of individual serum HBeAg level at
different time points within 21 days after the first administration
for each group (Group A (0.9% saline injection group):
pAAV-HBV1.2+pKCMvint+0.9% NaCl; Group B (Compound 1 10mg/kg
intravenous injection group): pAAV-HBV1.2+pKCMvint+Compound 1
10mg/kg; Group C (IFN.alpha.-2a group): pAAV-HBV1.2+pKCMvint
IFN.alpha.-2a+0.9% NaCl; Group D (Compound 1 in combination with
IFN.alpha.-2a group): pAAV-HBV1.2+pKCMvint IFN.alpha.-2a+APG 10
mg/kg).
[0032] FIG. 6 shows the comparison of the anti-HBV effects of
Compound 1 and Birinapant in a chronic HBV-infected C57BL/6J mouse
model established by high-pressure tail vein injection of
pAAV-HBV1.2 plasmid. FIG. 6A: changes of overall serum HBsAg level
at different time points within five weeks after the first
administration for each group (Group A: 0.9% NaCl saline injection
group; Group B: Compound 1 20 mg/kg intravenous injection group;
Group C: Birinapant 20 mg/kg intravenous injection group); FIG. 6B:
changes of overall serum HBeAg level at different time points
within five weeks after the first administration for each group
(Group A: 0.9% NaCl saline injection group; Group B: Compound 1 20
mg/kg intravenous injection group; Group C: Birinapant 20 mg/kg
intravenous injection group); FIG. 6C: changes of individual serum
HBsAg level at different time points within five weeks after the
first administration for each group (Group A: 0.9% NaCl saline
injection group; Group B: Compound 1 20 mg/kg intravenous injection
group; Group C: Birinapant 20 mg/kg intravenous injection group);
FIG. 6D: changes of individual serum HBeAg level at different time
points within four weeks after the first administration for each
group (Group A: 0.9% NaCl saline injection group; Group B: Compound
1 20 mg/kg intravenous injection group; Group C: Birinapant 20
mg/kg intravenous injection group).
[0033] FIG. 7 shows the administration of anti-HBV effect of
Compound 1 in combination with anti-PD1 antibody in a chronic HBV
infection C57BL/6J mouse model established by high-pressure tail
vein injection of pAAV-HBV1.2 plasmid. FIG. 7A: changes of overall
serum HBsAg level at different time points within five weeks after
first administration for each group (Group A: 0.9% NaCl saline
injection group; Group B: Compound 1 20 mg/kg intravenous injection
group; Group C: anti-PD1 antibody intraperitoneal injection group;
Group D: Compound 1 in combination with anti-PD1 antibody group);
FIG. 7B: changes of overall serum HBeAg level at different time
points within five weeks after first administration for each group
(Group A: 0.9% NaCl saline injection group; Group B: Compound 1 20
mg/kg intravenous injection group; Group C: anti-PD1 antibody
intraperitoneal injection group; Group D: Compound 1 in combination
with anti-PD1 antibody group); FIG. 7C: changes of individual serum
HBsAg level at different time points within five weeks after first
administration for each group (Group A: 0.9% NaCl saline injection
group; Group B: Compound 1 20 mg/kg intravenous injection group;
Group C: anti-PD1 antibody intraperitoneal injection group; Group
D: Compound 1 in combination with anti-PD1 antibody group); FIG.
7D: changes of individual serum HBeAg level at different time
points within four weeks after first administration for each group
(Group A: 0.9% NaCl saline injection group; Group B: Compound 1 20
mg/kg intravenous injection group; Group C: anti-PD1 antibody
intraperitoneal injection group; Group D: Compound 1 in combination
with anti-PD1 antibody group).
[0034] FIG. 8 shows the anti-HBV effects of Compound 1 and SF18 in
a C57BL/6J mouse model established by tail vein injection of
rAAV8-HBV1.3 (ayw) virus. FIG. 8A: changes of individual HBsAg
level at different time points within four weeks after first
administration for each group (Group A: 0.9% NaCl saline injection
group; Group B: Compound 1 20 mg/kg intravenous injection group;
Group C: SF18 20 mg/kg intravenous injection Group); FIG. 8B:
changes of individual HBeAg level at different time points within
four weeks after first administration for each group (Group A: 0.9%
NaCl saline injection group; Group B: Compound 1 20 mg/kg
intravenous injection group; Group C: SF18 20 mg/kg intravenous
injection Group).
DETAILED DESCRIPTION OF THE INVENTION
[0035] Definition
[0036] The term "C.sub.4-8 aliphatic ring" as used herein refers to
a cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl or cyclooctyl
unsubstituted or substituted by 1 to 3 groups (e.g., C.sub.1-4
alkyl, halogen, trifluoromethyl, trifluoromethoxy, hydroxy, alkoxy,
nitro, cyano, alkylamino or amino).
[0037] The term "alkyl" as used herein refers to a saturated
C.sub.1-10 hydrocarbon group in form of straight- or
branched-chain, and its non-limiting examples include methyl,
ethyl, and propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl and
decyl in form of straight- or branched-chain.
[0038] The term "C.sub.3-6 cycloalkylene" refers to a disubstituted
cycloalkane having 3 to 6 carbon atoms, for example,
##STR00011##
"C.sub.3-6 cycloalkylene" may be unsubstituted or substituted with
1 to 3 groups, such as C.sub.1-4 alkyl, halogen, trifluoromethyl,
trifluoromethoxy , hydroxy, alkoxy, nitro, cyano, alkylamino or
amino.
[0039] The term "halogen" as used herein is defined as fluorine,
chlorine, bromine or iodine.
[0040] The term "hydroxy" as used herein is defined as --OH.
[0041] The term "alkoxy" as used herein is defined as --OR, where R
is alkyl.
[0042] The term "amino" as used herein is defined as --NH.sub.2,
and the term "alkylamino" is defined as --NR.sub.2, wherein at
least one R is an alkyl group and the second R is an alkyl group or
hydrogen.
[0043] The term "nitro" as used herein is defined as
--NO.sub.2.
[0044] The term "cyano" as used herein is defined as --CN.
[0045] The term "trifluoromethyl" as used herein is defined as
--CF.sub.3.
[0046] The term "trifluoromethoxy" as used herein is defined as
--OCF.sub.3.
[0047] The term "optionally substituted" as used herein means being
substituted with one or more, especially one to four, groups
independently selected from, for example, halogen, alkyl, alkenyl,
--OCF.sub.3, --NO.sub.2, --CN, --NC, --OH, alkoxy, amino,
alkylamino, --CO.sub.2H, --CO.sub.2alkyl, alkynyl, cycloalkyl,
nitro, mercapto, imino, amido, phosphonate, phosphinate, silyl,
alkylthio, sulfonyl, sulfonamido, aldehyde, heterocycloalkyl,
trifluoromethyl, aryl and heteroaryl.
[0048] The term "aryl" as used herein refers to a monocyclic or
polycyclic aromatic group, preferably a monocyclic or bicyclic
aromatic group, such as phenyl or naphthyl.
[0049] The term "heteroaryl" as used herein refers to a monocyclic
or bicyclic ring system containing one or two aromatic rings and
containing at least one and up to four nitrogen atoms in one of the
aromatic rings.
[0050] The term "disease" or "disorder" means a disordered and/or
abnormal condition that is generally considered as a pathological
state or function, and can manifest itself in the form of specific
signs, disorders, and/or malfunctions.
[0051] The term "treating" a disease or disorder means eliminating,
inhibiting, reducing or alleviating the disease or disorder, and
the term "preventing" means avoiding and obviate a disease or
disorder, or preventing the disease or disorder from occurring or
appearing.
[0052] The first aspect of the present invention relates to a
bisdiazabicyclo compound, the compound is used for treatment and/or
prevention, or elimination and/or alleviation of a disease or
disorder associated with a hepatitis virus, wherein the compound is
a bisdiazabicyclo compound.
[0053] Further, the bisdiazabicyclo compound is a compound having
the following structure or a pharmaceutically acceptable salt
thereof:
##STR00012##
[0054] where X is selected from:
##STR00013##
and --SO.sub.2--;
[0055] Y is selected from --NH--, --O--, --S-- and is absent;
[0056] R is selected from
##STR00014##
(where the ring A is a C.sub.4-8 aliphatic ring), --C.sub.3-6
cycloalkylene
##STR00015##
(where the ring B is phenyl, naphthyl, pyridyl, pyridazinyl,
pyrazinyl, or pyrimidinyl, and the B ring is optionally
substituted);
[0057] R.sub.1 is selected from
##STR00016##
wherein Z is O, S, NH or
##STR00017##
where n is 0, 1 or 2, and wherein the ring B is phenyl, naphthyl,
pyridyl, pyridazinyl, pyrazinyl or pyrimidinyl, and the ring B is
optionally substituted.
[0058] Preferably, in the compound, R is
##STR00018##
[0059] Preferably, in the compound, R.sub.1 is
##STR00019##
[0060] Preferably, in the compound, X is SO.sub.2 and Y is
absent.
[0061] Preferably, the compound is
##STR00020##
[0062] Further, the bisdiazabicyclo compound is a compound having
the following structure or a pharmaceutically acceptable salt
thereof:
##STR00021##
[0063] where X is selected from:
##STR00022##
and --SO.sub.2--;
[0064] Y is selected from --NH--, --O--, --S--, and is absent when
X is --SO.sub.2--;
[0065] R is selected from
##STR00023##
and --C.sub.3-6 cycloalkylene
##STR00024##
and
[0066] R.sub.1 is selected from
##STR00025##
wherein Z is O, S or NH;
[0067] wherein the ring A is a C.sub.4-8 aliphatic ring; and B is
phenyl, naphthyl, pyridyl, pyridazinyl, pyrazinyl or pyrimidinyl,
and is optionally substituted by 1 to 4 groups independently
selected from halogen, --OCF.sub.3, --NO.sub.2, --CN, --NC, --OH,
amino, C.sub.1-10 alkyl, C.sub.1-10 alkyloxy, and C.sub.1-10
alkylamino.
[0068] Preferably, in the compound, R is
##STR00026##
wherein p is 0 to 4.
[0069] Preferably, in the compound, R is
##STR00027##
wherein phenyl is optionally substituted by 1 to 4 groups
independently selected from halogen, --OCF.sub.3, --NO.sub.2, --CN,
--NC, --OH, amino, C.sub.1-10 alkyl, C.sub.1-10 alkyloxy and
C.sub.1-10 alkylamino.
[0070] Preferably, in the compound, R is
##STR00028##
[0071] Preferably, in the compound, R.sub.1 is
##STR00029##
wherein phenyl is optionally substituted by 1 to 4 groups
independently selected from halogen, --OCF.sub.3, --NO.sub.2, --CN,
--NC, --OH, amino, C.sub.1-10 alkyl, C.sub.1-10 alkyloxy and
C.sub.1-10 alkylamino.
[0072] Preferably, in the compound, R.sub.1 is
##STR00030##
wherein phenyl is optionally substituted by 1 to 4 groups
independently selected from halogen, --OCF.sub.3, --NO.sub.2, --CN,
--NC, --OH, amino, C.sub.1-10 alkyl , C.sub.1-10 alkyloxy and
C.sub.1-10 alkylamino.
[0073] Preferably, in the compound, X is
##STR00031##
and Y is --NH--.
[0074] Preferably, in the compound, X is
##STR00032##
and Y is --NH--.
[0075] Preferably, in the compound, X is
##STR00033##
and Y is O.
[0076] Preferably, the compound is selected from
##STR00034## ##STR00035## ##STR00036##
[0077] Preferably, the compound is
##STR00037##
[0078] Preferably, the compound is selected from
##STR00038##
[0079] Preferably, the compound is SF18, which has the following
structure:
##STR00039##
[0080] Preferably, the compound is Compound 1, that is,
1,3-benzene-di[7-(3S,5S,9aR)-5-((S)-2-methylamino-propionamido)-3-dipheny-
lmethylaminocarbonyl-4-oxo-3a,
7-diaza-decahydro-cyclopentanocyclooctene)]-sulfonamide, having the
following structure:
##STR00040##
[0081] According to the present invention, the compound is obtained
according to the preparation method disclosed in PCT/US2013/055384
(WO2014/031487), the entire contents of which are incorporated
herein by reference.
[0082] According to the present invention, the compound of the
present invention can be used in the form monomer or composition.
Further, the compound of the present invention can be administered
to a patient in need of treatment via intestinal, parenteral or
topical route. The intestinal route usually includes oral
administration, and the form of the compound of the present
invention for intestinal route use includes oral solutions,
tablets, capsules, granules, and suspensions. The parenteral route
usually includes subcutaneous, intramuscular, intraperitoneal,
intravenous routes, etc., and the form of the compound of the
present invention for parenteral route use includes injections and
lyophilized preparations. The form of the compound of the present
invention for topical use includes patches, pastes, ointments,
etc.
[0083] Further, the disease or disorder associated with hepatitis
virus is a disease or disorder associated with the late stage of
hepatitis virus infection; the disease or disorder associated with
hepatitis virus is a disease or disorder associated with hepatitis
A virus, hepatitis B virus, or hepatitis C virus; preferably, the
disease or disorder associated with hepatitis virus includes, but
is not limited to: hepatitis A, hepatitis B, hepatitis C, and/or
liver cirrhosis.
[0084] Further, the compound treats and/or prevents a disease or
disorder associated with a hepatitis virus by modulating an immune
response. Preferably, the immune response is involved in a specific
T-cell response to a hepatitis virus (including, but not limited
to, hepatitis A virus, hepatitis B virus, and hepatitis C virus,
particularly hepatitis B virus). More preferably, the immune
response is involved in the secretion of IFN.gamma., TNF.alpha.,
IL-2 in CD4+ T cells and CD8+ T cells.
[0085] The second aspect of the present invention relates to a use
of a bisdiazabicyclo compound in manufacture of a medicament for
treatment and/or prevention, or elimination and/or alleviation of a
disease or disorder associated with a hepatitis virus.
[0086] Further, the compound is a compound as defined above.
Furthermore, the medicament includes a known drug for treatment of
hepatitis virus, especially HBV, in which the drug includes, but is
not limited to: IFN.alpha.-2a, Birinapant, anti-PD1 antibody,
pegylated interferon .alpha.2b, pegylated interferon a2a,
lamivudine, adefovir, entecavir and/or tenofovir (in particular,
tenofovir disoproxil fumarate).
[0087] Further, the disease or disorder associated with a hepatitis
virus is a disease or disorder associated with the late stage of
hepatitis virus infection; the disease or disorder associated with
hepatitis virus is a disease or disorder associated with hepatitis
A virus, hepatitis B virus, or hepatitis C virus; preferably, the
disease or disorder associated with hepatitis virus includes, but
is not limited to: hepatitis A, hepatitis B, hepatitis C, and/or
liver cirrhosis.
[0088] Further, the medicament treats and/or prevents a disease or
disorder associated with a hepatitis virus by modulating an immune
response. Preferably, the immune response is involved in a specific
T-cell response to a hepatitis virus (including, but not limited
to, hepatitis A virus, hepatitis B virus, and hepatitis C virus,
particularly hepatitis B virus). More preferably, the immune
response is involved in the secretion of IFN.gamma., TNF.alpha.,
IL-2 in CD4+ T cells and CD8+ T cells.
[0089] The third aspect of the present invention relates to a
method for treating and/or preventing, or eliminating and/or
alleviating a disease or disorder associated with a hepatitis
virus, the method comprising administering a therapeutically and/or
prophylactically effective amount of the compound to a patient
suffering from the disease or disorder associated with the
hepatitis virus.
[0090] Further, the compound is a compound as defined above.
Furthermore, the compound can be further used in combination with a
known drug for treatment of hepatitis virus, especially HBV, in
which the known drug for treatment of hepatitis virus, especially
HBV, includes, but is not limited to: pegylated interferon
.alpha.2b, pegylated interferon .alpha.2a, lamivudine, adefovir (in
particular, adefovir dipivoxil), entecavir and/or tenofovir (in
particular, tenofovir disoproxil fumarate).
[0091] Further, when the compound is used in combination with the
drug known for treatment of hepatitis virus, especially HBV, the
compound and the drug known for treatment of hepatitis virus,
especially HBV, can be administered together, separately and
sequentially.
[0092] Further, the disease or disorder associated with a hepatitis
virus is a disease or disorder associated with the late stage of
hepatitis virus infection; the disease or disorder associated with
hepatitis virus is a disease or disorder associated with hepatitis
A virus, hepatitis B virus, or hepatitis C virus; preferably, the
disease or disorder associated with hepatitis virus includes, but
is not limited to: hepatitis A, hepatitis B, hepatitis C, and/or
liver cirrhosis.
[0093] Further, the compound treats and/or prevents a disease or
disorder associated with a hepatitis virus by modulating an immune
response. Preferably, the immune response is involved in a specific
T-cell response to a hepatitis virus (including, but not limited
to, hepatitis A virus, hepatitis B virus, and hepatitis C virus,
particularly hepatitis B virus). More preferably, the immune
response is involved in the secretion of IFN.gamma., TNF.alpha.,
IL-2 in CD4+ T cells and CD8+ T cells.
[0094] The fourth aspect of the present invention relates to a
pharmaceutical composition comprising a bisdiazabicyclo compound,
the pharmaceutical composition is used for treatment and/or
prevention, or elimination and/or alleviation of a disease or
disorder associated with a hepatitis virus.
[0095] Further, the bisdiazabicyclo compound is a compound as
defined above. Furthermore, the pharmaceutical composition can
further comprise a known drug for treatment of hepatitis virus,
especially HBV, in which the known drug includes, but is not
limited to: interferon a2b, interferon a2a, lamivudine, adefovir
(in particular, adefovir dipivoxil), entecavir and/or tenofovir (in
particular, tenofovir disoproxil fumarate).
[0096] Further, the disease or disorder associated with a hepatitis
virus is a disease or disorder associated with the late stage of
hepatitis virus infection; the disease or disorder associated with
hepatitis virus is a disease or disorder associated with hepatitis
A virus, hepatitis B virus, or hepatitis C virus; preferably, the
disease or disorder associated with hepatitis virus includes, but
is not limited to: hepatitis A, hepatitis B, hepatitis C, and/or
liver cirrhosis.
[0097] Further, the compound treats and/or prevents a disease or
disorder associated with a hepatitis virus by modulating an immune
response. Preferably, the immune response is involved in a specific
T-cell response to a hepatitis virus (including, but not limited
to, hepatitis A virus, hepatitis B virus, and hepatitis C virus,
particularly hepatitis B virus). More preferably, the immune
response is involved in the secretion of IFN.gamma., TNF.alpha.,
IL-2 in CD4+ T cells and CD8+ T cells.
Specific Models for Carrying Out the Present Invention
[0098] The following examples are used to further describe the
present invention, but are not intended to limit the present
invention in any way.
Example 1
[0099] Effect of Single Injection of Compound 1 on HBV in C57BL/6J
Mouse Model Established by High-Pressure Tail Vein Injection of
pAAV-HBV1.2 plasmid
[0100] 1.1 Experimental Methods
[0101] A chronic HBV infection mouse model was established using
C57BL/6J mice by high-pressure tail vein injection of pAAV-HBV1.2
plasmid to simulate chronic hepatitis B patients which could obtain
immune control spontaneously. Male C57/B6 mice (6-8 weeks of age,
body weight 20.+-.2 g) were selected to establish a high-pressure
tail vein injection mouse model, in which the tail of mice was
wiped with 75% alcohol, and then irradiated with a far-infrared
physiotherapy device for 2 to 3 minutes so that the tail vein of
mice was turgid and clearly visible. A needle was inserted in
parallel along the tail vein, until feeling empty or seeing blood
return, which indicated that the needle entered into the vein, and
then the injection was completed within 10s by gently pushing. Each
mouse was injected with 10 .mu.g of pAAV/HBV1.2 plasmid, and the
amount of injection liquid (PBS) was 10% of body weight (2 mL/20
g). On the 14.sup.th day after the injection, blood was collected
to detect HBsAg, and the successfully modeled mice with
HBsAg>500 IU/ml were selected for further experiments (Huang, Wu
et al. 2006; Chou, Chien et al. 2015). After C57BL/6J mice were
successfully modeled, they were divided into 4 groups: 0.9% NaCl
saline injection group (Group 1 in FIGS. 1A and 1B, black lines),
Compound 1 10 mg/kg intravenous injection group (Group 2 in FIGS.
1A and 1B, red lines), Compound 1 20 mg/kg intravenous injection
group (Group 3 in FIGS. 1A and 1B, blue lines). There were 6-8 mice
in each group, which were administered once a week for 4
consecutive times and observed for 7 weeks.
[0102] After the mice serum were diluted 20-fold with PBS, the
HBsAg and HBeAg titers of the serum were detected by using Abbott
i2000SR microparticle chemiluminescence automatic detector. The
serum HBV DNA was extracted by QlAamp DNA Mini Kit (Qiagen), the
HBV DNA level in serum was quantified by Realtime-PCR (LightCycler
480, Roche) using DNA Amplification SYBR Green Kit (Roche), and the
HBV plasmid PSM2 products with a series of concentration gradients
were used as standards. The HBV primers used in this experiment
were synthesized by Invitrogen (Shanghai) Trading Co., Ltd., and
the primer sequences were as follows: HBV Hope-F (5' to 3'
TACTAGGAGGCTGTAGGCATA) and HBV Hope-R (5' to 3'
GGAGACTCTAAGGCTTCCC). The liver tissues of mice were subjected to
conventional formalin-fixation and paraffin-embedding, the
resultant 4 .mu.m sections were baked at 65.degree. C. for 2 h,
dehydrated with conventional ethanol gradients, infiltrated with
hydrogen peroxide at room temperature for 30 min, washed with PBS
for 5 min/time, 3 times in total, and blocked at room temperature
for 1 h. After rabbit-anti-human HBcAg (B0586, DAKO) was added and
incubated in a wet box at room temperature for 1 h, a GTvision III
immunohistochemical detection kit of anti-rabbit anti-mice general
type (GK50075, Shanghai Gene Technology Co., Ltd.) was used for
incubation of secondary antibodies and development of color, and
pictures at 200.times.magnification were taken with a normal
optical upright microscope. 60 mg of liver tissue homogenate was
weighed, added with 900 .mu. of lysate (50 mmol/L Tris-HCl PH 7.5+1
mmol/L EDTA), placed on ice, and after all samples were processed,
5 .mu.l of NP-10 was added and lysis was performed on ice, and then
HBV DNA in liver tissue was extracted with phenol/chloroform,
dissolved by adding 15 .mu.l of RNase free water, run on a 1%
agarose gel, transferred to membrane; then a full-length HBV probe
labeled with digoxin was added, stood overnight at 46.degree. C.,
subjected to DIG Washing Buffer once for 5 min, added with
Anti-Digoxigenin-Ap Fab fragment (11093274910, Roche), and Image
Quant LAS 4000mini was used for exposure and detection.
[0103] Graphpad Prism 5.0 was used for mapping and relevant
statistical analysis, Kruskal-Wallis H test and Dunn's Multiple
Comparison test were used for multiple comparisons between groups
at the same time point, log-rank Mantel-Cox test was used to
compare the HBsAg and HBV DNA clearance rates in serum, *
represented P<0.05, ** represented p<0.01, and ***
represented p<0.001, in which P<0.05 indicated a
statistically significant difference.
[0104] 1.2 Experimental Results
[0105] As shown in FIG. 1, in comparison with the normal saline
injection control group, the Compound 1 injection groups showed
rapid decrease in serum HBsAg (FIG. 1A) and serum HBV DNA (FIG. 1B)
after administration, and both of the serum HBsAg and HBV DNA were
below the detection limit up to the 7.sup.th week, in which the
Compound 1 20 mg/kg injection group indicated that serum HBsAg and
HBV DNA were completely eliminated on the 5.sup.th week, which was
faster than that of the Compound 1 10 mg/kg dose group. The liver
tissue HBcAg immunohistochemical staining results showed that HBcAg
expression was not observed in the liver of the mice of the
Compound 1 injection groups after 7 weeks of administration, but
HBcAg expression in the liver of some mice in the normal saline
control group could still be detected (FIG. 1C). The results of HBV
DNA Southern blot in liver tissue 7 weeks after administration
showed that no HBV replication intermediate was detected in the
liver tissue of the Compound 1 injection group as compared with the
saline group (FIG. 1D).
[0106] The above results confirmed that four consecutive injections
of Compound 1 at 20 mg/kg could completely clear HBsAg and HBV DNA
in peripheral blood in the mice model infected with chronic HBV,
and completely clear HBcAg expression and HBV replication
intermediates in the liver on the 5.sup.th week. These results
showed that Compound 1 could completely eliminate viral antigens
and nucleic acid products in a subject with chronic HBV infection.
(*, p<0.05; **, p<0.01).
Example 2
[0107] Effect of Compound 1 in Combination with Tenofovir
Disoproxil Fumarate (TDF) on HBV in C57BL/6J Mouse Model
Established by High-Pressure Tail Vein Injection of pAAV-HBV1.2
Plasmid
[0108] 2.1 Experimental Methods
[0109] The C57BL/6J mouse model was established by pAAV-HBV1.2
plasmid high-pressure tail injection. C57BL/6J mice (6 to 8 weeks
of age, body weight 20.+-.2 g) were successfully modeled and
divided into 4 groups, i.e., 0.9% NaCl intravenous injection group
(Group 1 in FIGS. 2A and 2B, black lines), Compound 1 10 mg/kg
intravenous injection group (Group 2 in FIGS. 2A and 2B, red
lines), TDF 53 mg/kg gavage group (Group 3 in FIGS. 2A and 2B, blue
lines), Compound 1 10mg/kg in combination with TDF 53 mg/kg
administration group (Group 4 in FIGS. 2A and 2B, purple lines).
There were 6 to 8 mice in each group, Compound 1 was injected once
a week for 4 consecutive times, TDF was gavaged every day for a
total of 10 days, and the mice were observed for 7 weeks.
Serological HBsAg and HBV DNA detection methods were the same as
above.
[0110] 2.2 Experimental Results
[0111] As shown in FIG. 2, as to serum HBsAg clearance rate (FIG.
2A), the Compound 1 single group and the Compound 1 in combination
with TDF group showed statistically significant differences in
serum HBsAg clearance rate in comparison with the control group,
and the Compound 1 in combination with TDF group could clear HBsAg
in serum faster and showed a statistically significant difference
in comparison with the Compound 1 single group or the TDF single
group. The above results showed that Compound 1 in combination with
TDF could synergistically clear HBsAg in serum. With regard to
serum HBV DNA clearance rate (FIG. 2B), the Compound 1 group, the
TDF group and the Compound 1 in combination with TDF group showed
statistically significant differences in comparison with the
control group, and the Compound 1 in combination with TDF group
could clear serum HBV DNA faster than the TDF single group or the
Compound 1 single group.
[0112] The above results showed that Compound 1 in combination with
TDF could accelerate the elimination of serum HBV DNA, thereby
exerting a synergistic effect against virus. (*, p<0.05; **
p<0.01; *** p<0.001).
Example 3
Effect of Compound 1 on Aapoptosis of Liver Cells in HBV Infected
Mice
[0113] 3.1 Experimental Method
[0114] Chronic HBV infection mouse models were established by
high-pressure tail vein injection of pAAV-HBV1.2 plasmid or
recombinant virus rAAV8-1.3HBV injection of C57BL/6J mice (6 to 8
weeks of age, weight 20.+-.2g). After C57BL/6J mice were
successfully modeled by high-pressure tail vein injection of
pAAV-HBV1.2 plasmid, the mice were injected intravenously with
Compound 1 at 10 mg/kg, and serum and liver tissues of the mice
were collected at 12, 24, and 48 hours after injection.
Glutamic-oxalacetic transaminase (AST/GOT) kit (Nanjing Jiancheng,
C010-2) and glutamic-pyruvic transaminase (ALT/GPT) kit (Nanjing
Jiancheng, C009-2) were used to detect serum ALT and AST levels.
Western blot was used to detect the expression of cIAPs molecules
in liver tissues, and .beta.-actin was used as a control.
Intrahepatic inflammation and hepatocyte necrosis were detected by
HE staining of liver tissue sections. C57BL/6J mice were subjected
to conventional tail vein injection of rAAV8-1.3HBV (ayw) virus at
viral injection amount of 5.times.10.sup.5 v.g./mice (Yang, Liu et
al. 2014) to establish the rAAV8-HBV1.3 virus injection C57BL/6J
mouse model; the mice were sacrificed 12 hours after the
intravenous injection of Compound 1 at 20 mg/kg, and the
HBV-infected hepatocyte apoptosis was subjected to double staining
detection of HBcAg immunofluorescence and Tunnel method.
[0115] 3.2 Experimental Results
[0116] As shown in FIG. 3, after injection of Compound 1, the serum
transaminases ALT and AST, which reflected liver cell damage,
showed a transient increase, i.e., they rose to the highest values
at 12 hours, then slowly decreased, and returned to normal levels
around 48 hours (FIG. 3A). The detection of IAPB molecules in the
liver by Western blot revealed that Compound 1 had strong
inhibitory effect on cIAP2 in liver tissues, which reached the
strongest value at 12 h; it also had an inhibitory effect on cIAP1,
but was significantly weaker than that on cIAP2; while no
significant inhibitory effect was observed on XIAP (FIG. 3B). The
liver tissue HE staining also showed that 12 hours after the
injection, scattered necrotic lesions appeared in the vicinity of
the portal areas in the liver tissue, accompanied by lymphocyte
infiltration (FIG. 3C). The double staining experiment of Tunel
staining and HBcAg fluorescence was used to observe the apoptosis
of HBV-infected liver cells, and in combination with
double-staining 3D picture analysis, it was found that 12 h after
injection of Compound 1, the apoptosis of HBcAg-positive liver
cells could be induced (FIG. 3D).
[0117] The above results suggested that Compound 1 could
specifically induce the apoptosis of HBV-infected liver cells and
contribute to the clearance of virus; in addition, it only induced
transient intrahepatic inflammation and did not cause fulminant
hepatitis, thereby reducing adverse reactions possibly caused by
the treatment.
Example 4
Effect of Compound 1 on HBV Immune Response in Mice
[0118] 4.1 Experimental Methods
[0119] C57BL/6J mice (6-8 W week old, weight 20.+-.2 g) were
subjected to high-pressure tail vein injection of pAAV-HBV1.2
plasmid to establish a chronic HBV infection mouse model. After the
modeling was successful, the mice were divided into two groups:
Group A: 0.9% NaCl biological saline injection group; Group B:
Compound 1 20 mg/kg injection group. There were 5 to 6 mice in each
group, which were administered once a week for four consecutive
times, and sacrificed on the 7.sup.th week, the mice liver
lymphocytes were isolated, and cell counts and flow cytometry were
used to detect the expression of CD4 and CD8 molecules in
lymphocytes in the liver. The detection of HBV-specific T cell
response was performed by using HBV core monopeptide (Core93-100)
to stimulate lymphocytes, and the counts of CD4+ and CD8+ T cells
that secreted IFN.gamma., TNF.alpha. and IL-2 were detected by flow
cytometry cytokine intracellular staining method.
[0120] 4.2 Experimental Results
[0121] As shown in FIG. 4, after the virus was cleared from the
liver of the mice in the Compound 1 treatment group, the total
lymphocyte number in the liver was significantly higher than that
in the normal saline control group (FIG. 4A). Further analysis
revealed that compared with the control, the counts of infiltrated
CD4+ T cells and CD8+ T cells in the liver were significantly
increased (FIG. 4B). After stimulation with HBV core monopeptide
(Core93-100), the counts of CD4+ T cells that secreted IFN.gamma.,
TNF.alpha. and IL-2 increased significantly (FIG. 4C), and the
counts of CD8+ T cells that secreted IFN.gamma., TNF.alpha. and
IL-2 increased significantly (FIG. 4D).
[0122] The above results showed that after treatment with Compound
1 and clearance of virus, the specific T cell response function
against HBV in the liver was significantly enhanced, which was
conducive to the clearance of virus. Further, Compound 1 could
specifically induce the apoptosis of HBV-infected hepatocytes by
up-regulating HBV-specific T cell responses, thereby eliminating
viral antigens and other viral products.
Example 5
[0123] Anti-HBV Effect of the Administration of Compound 1 in
Combination with IFN.alpha.2a in Chronic HBV Infection C57BL/6J
Mouse Model
[0124] 5.1 Experimental Methods
[0125] Chronic HBV infection mouse model was established using
C57BL/6J mice (6 to 8 W, body weight 20.+-.2 g) that were subjected
to the high-pressure tail vein injection of a mixture of
pAAV-HBV1.2 plasmid and pKCMvint IFN.alpha.-2a plasmid or pKCMvint
control plasmid (6 .mu.g/mouse), and expressed IFN.alpha.2a. One
day after modeling, the mice were divided into 4 groups. Group A
(0.9% saline injection group): pAAV-HBV1.2+pKCMvint+0.9% NaCl;
Group B (Compound 1 10 mg/kg intravenous injection group):
pAAV-HBV1.2+pKCMvint+Compound 1 10mg/kg; Group C (IFN.alpha.-2a
group): pAAV-HBV1.2+pKCMvint IFN.alpha.-2a+0.9% NaCl; Group D
(Compound 1 in combination with IFN.alpha.-2a group):
pAAV-HBV1.2+pKCMvint IFN.alpha.-2a+APG 10 mg/kg. There were 5 mice
in each group (except Group D that included 7 mice), the
administration was performed for consecutive 3 times, i.e., on the
day 1 after modeling, and on the days 7 and 14 after modeling;
blood was collected once at orbital margin one day before the
administration, and serum HBsAg/HBeAg levels were detected using
Roche 601 instrument.
[0126] 5.2 Experimental Results
[0127] As shown in FIGS. 5A and 5B, the serum HBsAg and HBeAg
levels were statistically different between different treatment
groups on the 7.sup.th, 14.sup.th, and 21.sup.st days after
modeling. As shown in FIG. 5A, as compared Group B, Group C and
Group D with Group A, the former 3 groups showed statistically
significant differences in serum HBsAg on the 7.sup.th, 14.sup.th,
and 21.sup.st days, that was, the P value was 0.010 on the 7.sup.th
day, the P value was 0.008 on the 14.sup.th day, and the P value
was 0.004 on the 21.sup.st day, in which a statistical difference
between the groups was determined when P value was less than 0.05,
and wherein the decrease of serum HBsAg in the combined treatment
Group D was the most significant. On the 21.sup.st day, compared
with Group C, the serums of Group B and Group D decreased
significantly, and their P values were both 0.008, that was, the P
value of Group C compared to Group B was 0.008, and the P value of
Group C compared to Group D was 0.008 (the P values of separate
comparisons for the both were not shown in the figures). As shown
in FIG. 5B, as compared Group B, Group C and Group D with Group A,
the former 3 groups showed statistically significant differences in
serum HBeAg on the 7.sup.th, 14.sup.th, and 21.sup.st days, that
was, the P value was 0.004 on the 7.sup.th day, the P value was
0.021 on the 7.sup.th day, and the P value was 0.001 on the
21.sup.st day, in which a statistical difference between the groups
was determined when P value was less than 0.05, and wherein, the
decrease of HBeAg in the combined treatment group D was the most
significant. On the 21.sup.st day, compared with Group C and Group
B, the serum of Group D was significantly decreased, and the P
values were both 0.008, that was, the P value of Group D compared
to Group B was 0.008, and the P value of Group D compared to Group
C was 0.008 (the P values of separate comparisons for the both were
not shown in the figures).
[0128] The above results showed that the Compound 1 in combination
with IFN.alpha.2a group had the most significant effect in reducing
HBsAg/HBeAg. Therefore, the Compound 1 in combination with
IFN.alpha.2a group had anti-HBV effect in the chronic HBV infection
mouse model established in C57BL/6J mice by high-pressure tail vein
injection of the mixture of pAAV-HBV1.2 plasmid and pKCMvint
IFN.alpha.-2a plasmid or pKCMvint control plasmid.
Example 6
[0129] Comparison of Anti-HBV Effect of Compound 1 and Birinapant
in Chronic HBV Infection C57BL/6J Mouse Model Established by
High-Pressure Tail Vein Injection of pAAV-HBV1.2 Plasmid
[0130] 6.1 Experimental Method
[0131] C57BL/6J mice (6 to 8 weeks of age, weight 20.+-.2 g) were
subjected to high-pressure tail vein injection of pAAV-HBV1.2
plasmid to establish a chronic HBV infection mouse model. After
successful modeling, the mice were divided into 3 groups: Group A:
0.9% NaCl saline injection group; Group B: Compound 1 20 mg/kg
intravenous injection group, and Group C: Birinapant 20 mg/kg
intravenous injection group. Among them, there were 7 mice in each
of Group A and Group B, and 6 mice in Group C. Compound 1 and
Birinapant were administered once a week for five consecutive
weeks. Blood was collected at orbital margin each week before the
administration, and the HBsAg/HBeAg levels in supernatant were
detected using Roche 601 instrument.
[0132] 6.2 Experimental Results
[0133] From the changes in the overall levels of HBsAg and HBeAg in
plasma, as shown in FIG. 6A, as to the clearance effect of HBsAg,
there was a statistically significant difference between the
Compound 1 intravenous injection group and the saline injection
group. As shown in FIG. 6B, with regard to the clearance effect of
HBeAg, there was a statistically significant difference between the
Compound 1 intravenous group and the Birinapant group (*,
p<0.05).
[0134] From the change of individual levels of HBsAg and HBeAg in
plasma, as shown in FIG. 6C, after one week of drug treatment, the
serum HBsAg levels of the both drug treatment groups decreased
significantly, and the serum HBsAg level of the Compound 1 group
was significantly lower than that of the Brinapant group
(p=0.035).
[0135] After 4 weeks of administration, 86% of the mice in the
Compound 1 group had serum HBsAg levels below the lower limit of
detection, while the corresponding proportion of the Brinapant
group was 57%, and this value had been illustrated in FIG. 6A (data
were not shown).
[0136] The above results indicated that Compound 1 was superior to
Birinapant in terms of the clearance effect of HBsAg and HBeAg.
Therefore, in the same dosage and mode of administration, the
antiviral effect of Compound 1 was superior to that of
Birinapant.
Example 7
[0137] Anti-HBV Effect of the Administration of Compound 1 in
Combination with Anti-PD1 Antibody in Chronic HBV Infection
C57BL/6J Mouse Model Established by High-Pressure Tail Vein
Injection of pAAV-HBV1.2 Plasmid
[0138] 7.1 Experimental Methods
[0139] C57BL/6J mice (6-8 weeks of age, weight 20 .+-.2g) were
subjected to high-pressure tail vein injection of pAAV-HBV1.2
plasmid to establish a chronic HBV infection mouse model. After the
modeling was successful, the mice were divided into 4 groups: Group
A: 0.9% NaCl saline injection group; Group B: Compound 1 20 mg/kg
intravenous injection group; Group C: anti-PD1 antibody 200
.mu.g/mice/time peritoneal injection group; Group D: Compound 1 in
combination with anti-PD1 antibody group. Among them, there were 7
mice in each group. Compound 1 was administered intravenously once
per week, and anti-PD1 antibody was administered intraperitoneally
twice per week. Blood was collected from the orbital margin before
the administration of Compound 1 every week, and the HBsAg/HBeAg
levels in the supernatant were detected using a Roche 601
instrument.
[0140] 7.2 Experimental Results
[0141] From the changes in overall levels of HBsAg and HBeAg in
plasma, as shown in FIGS. 7A and 7B, the Compound 1 single group
and the Compound 1 in combination with anti-PD1 antibody
administration group could significantly reduce serum HBsAg/HBeAg
levels. The anti-PD1 antibody single group showed no significant
decrease in the HBsAg/HBeAg effect.
[0142] From the changes in individual levels of HBsAg and HBeAg in
plasma, as shown in FIG. 7C, as compared Group B, Group C and Group
D with Group A, the 3 groups of different drugs showed
statistically significant differences in serum HBsAg on the
2.sup.nd, 3.sup.rd and 4.sup.th weeks, that was, the P value was
0.035 on the 2.sup.nd week, the P value was 0.005 on the 3.sup.rd
week, and the P value was 0.013 on the 4.sup.th week, in which a
statistical difference between the groups was determined when P
value was less than 0.05, and wherein the decrease of serum HBsAg
in the combined treatment Group D was the most significant. As
compared with Group C, the serum HBsAg of Group D decreased more
significantly on the 2.sup.nd and 3.sup.rd weeks after
administration, and the P values were 0.015 and 0.037, respectively
(the P values of separate comparisons for the both in the weeks 2
and 3 were not shown in the figures). As shown in FIG. 7D, as
compared Group B, Group C and Group D with Group A, the 3 groups of
different drugs showed statistically significant differences in
serum HBeAg on the 1.sup.st and 2.sup.nd weeks, that was, the P
value was 0.029 on the 1.sup.st week, the P value was 0.009 on the
2.sup.nd week, and a statistical difference between the groups was
determined when P value was less than 0.05. As compared with Group
C, the serum HBeAg levels of Group B and Group D decreased more
significantly on the 1.sup.st and 2.sup.nd weeks after
administration, the P values on the 1.sup.st week were 0.016 and
0.007 respectively, and the P values on the 2.sup.nd week were
0.007 and 0.002 respectively (the P values of separate comparisons
for the both on the 1.sup.st and 2.sup.nd weeks were not shown in
the figures), but there was no statistical difference between Group
B and Group D.
[0143] The above results showed that Compound 1 and Compound 1 in
combination with anti-PD1 antibody had anti-HBV effect in the
chronic HBV infection C57BL/6J mouse model established by
high-pressure tail vein injection of pAAV-HBV1.2 plasmid.
Example 8
[0144] Anti-HBV Effect of Compound 1 and SF18 in C57BL/6J Mouse
Model Established by rAAV8-HBV1.3 (ayw) virus tail vein
injection
[0145] 8.1 Experimental Methods
[0146] C57BL/6J mice were subjected to conventional tail vein
injection of rAAV8-HBV1.3 (ayw) virus, the injection volume of
virus was 5)(10.sup.5 vg/mouse (Yang, Liu et al. 2014), and thus
rAAV8-HBV1.3 virus injection C57BL/6J mouse model was established.
After successful modeling, the mice were divided into three groups:
Group A: 0.9% NaCl saline injection group; Group B: Compound 1 20
mg/kg intravenous injection group, and Group C: SF18 20 mg/kg
intravenous injection group. Among them, there were 3 mice in each
group. Administration was carried out for consecutive four weeks,
blood was collected at orbital margin once per week, and
HBsAg/HBeAg levels in supernatant were detected by Roche 601
instrument.
[0147] 8.2 Experimental Results
[0148] As shown in FIGS. 8A and 8B, the decrease rates of
HBsAg/HBeAg in mice serum of the SF18 group were significantly
faster than those of the Compound 1 group, but one mice died on the
2.sup.nd week and 4.sup.th week of SF18 administration,
respectively.
[0149] The above results showed that both Compound 1 and SF18 had
anti-HBV effect, and the anti-HBV effect of SF18 was stronger than
that of Compound 1.
REFERENCES
[0150] Bertoletti, A. and C. Ferrari (2012). "Innate and adaptive
immune responses in chronic hepatitis B virus infections: towards
restoration of immune control of viral infection." Gut 61 (12):
1754-1764.
[0151] Chou, H H, W H Chien, L L Wu, C H Cheng, C H Chung, J H
Horng, Y H Ni, H T Tseng, D. Wu, X. Lu, H Y Wang, P J Chen and D S
Chen (2015). "Age-related immune clearance of hepatitis B virus
infection requires the establishment of gut microbiota." Proc Natl
Acad Sci USA 112 (7): 2175-2180.
[0152] European Association For The Study Of The, L. (2012). "EASL
clinical practice guidelines: Management of chronic hepatitis B
virus infection." J Hepatol 57 (1): 167-185.
[0153] Gish, RG, BD Given, C.-L. Lai, SA Locarnini, JYN Lau, DL
Lewis and T. Schluep (2015). "Chronic hepatitis B: Virology,
natural history, current management and a glimpse at future
opportunities." Antiviral Research 121: 47-58.
[0154] Guidotti, L G, D. Inverso, L. Sironi, P. Di Lucia, J.
Fioravanti, L. Ganzer, A. Fiocchi, M. Vacca, R. Aiolfi, S.
Sammicheli, M. Mainetti, T. Cataudella, A . Raimondi, G.
Gonzalez-Aseguinolaza, U. Protzer, Z M Ruggeri, F V Chisari, M.
Isogawa, G. Sitia and M. Iannacone (2015). "Immunosurveillance of
the liver by intravascular effector CD8 (+) T cells." Cell 161 (3):
486-500.
[0155] Guidotti, L. G., R. Rochford, J. Chung, M. Shapiro, R.
Purcell and F. V. Chisari (1999). "Viral clearance without
destruction of infected cells during acute HBV infection." Science
284 (5415): 825-829.
[0156] Hoh, A., M. Heeg, Y. Ni, A. Schuch, B. Binder, N. Hennecke,
HE Blum, M. Nassal, U. Protzer, M. Hofmann, S. Urban and R. Thimme
(2015) "Hepatitis B Virus-Infected HepG2hNTCP Cells Serve as a
Novel Immunological Tool To Analyze the Antiviral Efficacy of CD8 +
T Cells In Vitro." J Virol 89 (14): 7433-7438.
[0157] Huang, L. R., H. L. Wu, P. J. Chen and D. S. Chen (2006).
"An immunocompetent mouse model for the tolerance of human chronic
hepatitis B virus infection." Proc Natl Acad Sci U S A 103 (47):
17862-17867.
[0158] Liaw, Y F, N. Leung, J H Kao, T. Piratvisuth, E. Gane, K H
Han, R. Guan, GK Lau, S. Locarnini and BGWP ot A.-PA ft S. ot L.
Chronic Hepatitis (2008) "Asian-Pacific consensus statement on the
management of chronic hepatitis B: a 2008 update." Hepatol Int 2
(3): 263-283.
[0159] Liu, J., H I Yang, M H Lee, S N Lu, C L Jen, R.
Batrla-Utermann, L Y Wang, S L You, C K Hsiao, P J Chen, C J Chen
and REVEALHS Group (2014). "Spontaneous seroclearance of hepatitis
B seromarkers and subsequent risk of hepatocellular carcinoma." Gut
63 (10): 1648-1657.
[0160] Lok, A. S. and B. J. McMahon (2009). "Chronic hepatitis B:
update 2009." Hepatology 50 (3): 661-662.
[0161] Lucifora, J. and C. Trepo (2015). "Hepatitis: After HCV
cure, HBV cure?" Nat Rev Gastroenterol Hepatol 12 (7): 376-378.
[0162] Lucifora, J., Y. Xia, F. Reisinger, K. Zhang, D. Stadler, X.
Cheng, MF Sprinzl, H. Koppensteiner, Z. Makowska, T. Volz, C.
Remouchamps, W M Chou, W E Thasler, N. Huser, D. Durantel, T J
Liang, C. Munk, M H Heim, J L Browning, E. Dejardin, M. Dandri, M.
Schindler, M. Heikenwalder and U. Protzer (2014). "Specific and
nonhepatotoxic degradation of nuclear hepatitis B virus cccDNA."
Science 343 (6176): 1221-1228.
[0163] Nassal, M. (2015). "HBV cccDNA: viral persistence reservoir
and key obstacle for a cure of chronic hepatitis B." Gut 64 (12):
1972-1984.
[0164] Sundaram, V. and K. Kowdley (2015). "Management of chronic
hepatitis B infection." BMJ 351: h4263.
[0165] Wong, D. K., W. K. Seto, J. Fung, P. Ip, F. Y. Huang, C. L.
Lai and M. F. Yuen (2013). "Reduction of hepatitis B surface
antigen and covalently closed circular DNA by nucleos(t)ide
analogues of different potency." Clin Gastroenterol Hepatol 11(8):
1004-1010 e1001.
[0166] Yang, D., L. Liu, D. Zhu, H. Peng, L. Su, Y. X. Fu and L.
Zhang (2014). "A mouse model for HBV immunotolerance and
immunotherapy." Cell Mol Immunol 11(1): 71-78.
* * * * *