U.S. patent application number 17/100272 was filed with the patent office on 2022-09-15 for pharmaceuticals and methods for treating hypoxia and screening methods therefor.
This patent application is currently assigned to Dana Farber Cancer Insitute, Inc.. The applicant listed for this patent is Dana Farber Cancer Institute, Inc.. Invention is credited to Mircea IVAN, William G. KAELIN.
Application Number | 20220291216 17/100272 |
Document ID | / |
Family ID | 1000006364506 |
Filed Date | 2022-09-15 |
United States Patent
Application |
20220291216 |
Kind Code |
A1 |
KAELIN; William G. ; et
al. |
September 15, 2022 |
PHARMACEUTICALS AND METHODS FOR TREATING HYPOXIA AND SCREENING
METHODS THEREFOR
Abstract
Light-generating fusion proteins having a ligand binding site
and a light-generating polypeptide moiety and their use as
diagnostics, in drug screening and discovery, and as therapeutics,
are disclosed. The light-generating fusion protein has a feature
where the bioluminescence of the polypeptide moiety changes upon
binding of a ligand at the ligand binding site. The ligand may be,
for example, an enzyme present in an environment only under certain
conditions, e.g., ubiquitin ligase in a hypoxic state, such that
the light-generating fusion protein is "turned on" only under such
conditions.
Inventors: |
KAELIN; William G.; (Boston,
MA) ; IVAN; Mircea; (Indianapolis, IN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Dana Farber Cancer Institute, Inc. |
Boston |
MA |
US |
|
|
Assignee: |
Dana Farber Cancer Insitute,
Inc.
Boston
MA
|
Family ID: |
1000006364506 |
Appl. No.: |
17/100272 |
Filed: |
November 20, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16433992 |
Jun 6, 2019 |
|
|
|
17100272 |
|
|
|
|
15594454 |
May 12, 2017 |
10365278 |
|
|
16433992 |
|
|
|
|
14328588 |
Jul 10, 2014 |
9766240 |
|
|
15594454 |
|
|
|
|
13066033 |
Apr 4, 2011 |
8809011 |
|
|
14328588 |
|
|
|
|
11879300 |
Jul 17, 2007 |
7985563 |
|
|
13066033 |
|
|
|
|
11027273 |
Dec 30, 2004 |
|
|
|
11879300 |
|
|
|
|
10859935 |
Jun 2, 2004 |
|
|
|
11027273 |
|
|
|
|
10101812 |
Mar 19, 2002 |
6855510 |
|
|
10859935 |
|
|
|
|
60345132 |
Dec 20, 2001 |
|
|
|
60345131 |
Dec 20, 2001 |
|
|
|
60342598 |
Dec 20, 2001 |
|
|
|
60345200 |
Nov 9, 2001 |
|
|
|
60332493 |
Nov 9, 2001 |
|
|
|
60332334 |
Nov 9, 2001 |
|
|
|
60277440 |
Mar 20, 2001 |
|
|
|
60277431 |
Mar 20, 2001 |
|
|
|
60277425 |
Mar 20, 2001 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 2500/02 20130101;
G01N 2500/20 20130101; C12Y 114/11002 20130101; C12Q 1/26 20130101;
A61K 31/70 20130101; A61K 38/44 20130101; G01N 2500/04 20130101;
G01N 33/573 20130101; A61K 31/00 20130101; G01N 2333/90245
20130101; A61K 38/1709 20130101 |
International
Class: |
G01N 33/573 20060101
G01N033/573; A61K 31/00 20060101 A61K031/00; A61K 31/70 20060101
A61K031/70; A61K 38/44 20060101 A61K038/44; C12Q 1/26 20060101
C12Q001/26; A61K 38/17 20060101 A61K038/17 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under grant
number CA076120 awarded by The National Institutes of Health. The
government has certain rights in the invention.
Claims
1-14. (canceled)
15. A method of treating or preventing a hypoxic or ischemic
related disorder in a subject, comprising administering to a
subject in need thereof a compound which decreases prolyl
hydroxylase expression or activity, such that said hypoxic or
ischemic related disorder is treated, wherein the compound is
identified by an assay comprising the steps of: a) bringing into
contact a prolyl hydroxylase, a HIF1.alpha. polypeptide moiety
consisting of amino acids 555-575 of wild type HIF.alpha., numbered
in accordance with wild type HIF.alpha., and a putative modulator
compound under conditions where prolyl hydroxylase, in the absence
of modulator, is capable of acting on said HIF1.alpha. polypeptide
moiety; and b) measuring the degree of prolyl hydroxylase
inhibition caused by said modulator compound.
16-21. (canceled)
22. A method of increasing angiogenesis or vascularization in a
subject, comprising administering to a subject in need thereof a
compound which decreases prolyl hydroxylase expression or activity
identified by an assay comprising the steps of: a) bringing into
contact a prolyl hydroxylase, a HIF1.alpha. polypeptide moiety
consisting of amino acids 555-575 of wild type HIF.alpha., numbered
in accordance with wild type HIF.alpha., and a putative modulator
compound under conditions where prolyl hydroxylase, in the absence
of modulator, is capable of acting on said HIF1.alpha. polypeptide
moiety; and b) measuring the degree of prolyl hydroxylase
inhibition caused by said modulator compound.
23-54. (canceled)
55. The method of claim 15, wherein said assay further comprises
pVHL.
56. The method of claim 15, wherein the hypoxic or ischemic related
disorder is tissue ischemia.
57. The method of claim 22, wherein said assay further comprises
pVHL.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 16/433,992, filed Jun. 6, 2019, which is a continuation of U.S.
application Ser. No. 15/594,454, filed on May 12, 2017, now U.S.
Pat. No. 10,365,278, which is a continuation of U.S. application
Ser. No. 14/328,588, filed on Jul. 10, 2014, now U.S. Pat. No.
9,766,240; which is a continuation of U.S. application Ser. No.
13/066,033, filed on Apr. 4, 2011, now U.S. Pat. No. 8,809,011;
which is a continuation of U.S. application Ser. No. 11/879,300,
filed on Jul. 17, 2007, now U.S. Pat. No. 7,985,563; which is a
continuation of U.S. application Ser. No. 11/027,273, filed on Dec.
30, 2004, now abandoned; which is a continuation of U.S.
application Ser. No. 10/859,935, filed Jun. 2, 2004, now abandoned;
which is a continuation of U.S. application Ser. No. 10/101,812,
filed Mar. 19, 2002, now U.S. Pat. No. 6,855,510; which claims
priority to U.S. application Ser. Nos. 60/277,425, filed Mar. 20,
2001; 60/277,431, filed Mar. 20, 2001; 60/277,440, filed Mar. 20,
2001; 60/332,493, filed Nov. 9, 2001; 60/332,334, filed Nov. 9,
2001; 60/345,200, filed Nov. 9, 2001; 60/345,131 filed Dec. 20,
2001, 60/342,598, filed Dec. 20, 2001; and 60/345,132, filed Dec.
20, 2001 each of which are incorporated herein by reference in
their entireties.
BACKGROUND OF THE INVENTION
[0003] The invention relates to drug discovery. The invention
features the use of light emitting proteins as tools for diagnosis,
drug screening and discovery, and as pharmaceuticals for in vivo
treatment.
[0004] A key advance in the biomedical arts has been the discovery
of bioluminescent protein moieties, e.g., green fluorescent protein
(GFP) and luciferase, which can be expressed in diverse mammalian
cell types and thus act as detectable signals for biological signal
transduction pathways and events. An increased understanding of how
diverse biological processes are regulated by the actions of
cellular enzymes, e.g., kinases, proteases, and ubiquitin ligases,
has also been emerging. Alterations in the activity of these
enzymes may underlie the initiation and/or progression of diseases
such as cancer.
[0005] Methods of detecting biological activities and substances
using bioluminescent proteins have recently been developed. For
example, protein phosphorylation events can be detected using
fusion proteins containing GFP (see, e.g., U.S. Pat. No. 5,958,713)
or luciferase, aequorin and obelin (see, e.g., U.S. Pat. No.
5,683,888). Light-generating moieties have been introduced into
mammals to specifically localize events such as parasite infection
(see, e.g., U.S. Pat. No. 5,650,135).
[0006] How cells sense changes in ambient oxygen is a central
problem in biology. In mammalian cells, lack of oxygen, or hypoxia,
leads to the stabilization of a sequence-specific DNA-binding
transcription factor called HIF (hypoxia-inducible factor), which
transcriptionally activates a variety of genes linked to processes
such as angiogenesis and glucose metabolism.
[0007] Tissue ischemia is a major cause of morbidity and mortality.
Ischemia can result from chronic hypoxia brought on by lack of
blood supply to the tissue occurring from, for example, stroke,
deep vein thrombosis, pulmonary embolus, and renal failure.
Ischemic tissue is also found in tumors.
[0008] HIF binds to DNA as a heterodimer consisting of an alpha
subunit and a beta subunit (also called aryl hydrocarbon receptor
nuclear translocator or ARNT). The alpha subunit is rapidly
polyubiquitinated and degraded in the presence of oxygen whereas
the beta subunit is constitutively stable. von Hippel-Lindau (VHL)
disease is a hereditary cancer syndrome characterized by the
development of highly vascular tumors that overproduce
hypoxia-inducible mRNAs such as vascular endothelial growth factor
(VEGF). The product of the VHL tumor suppressor gene, pVHL, is a
component of multiprotein complex that contains elongin B, elongin
C, Cu12, and Rbx1. This complex bears structural and functional
similarity to SCF (Skp1/Cdc53 or CullinIF-box) ubiquitin ligases.
In the presence of oxygen pVHL binds directly to HIF.alpha.
subunits and targets them for polyubiquitination and destruction.
Cells lacking functional pVHL cannot degrade HIF and thus
overproduce mRNAs encoded by HIF target genes.
[0009] Progress has also been made in recent years towards
understanding the molecular mechanisms in control of cell
proliferation. Aberrant cell proliferation is a hallmark event in
the onset and progression of diseases such as cancer. Progression
through the mammalian cell-cycle is linked to the orchestrated
appearance and destruction of cyclins. Different cyclins are
associated with different cell-cycle transitions. For example,
cyclin E is active in late G1 and early S-phase, cyclin A is active
in S-phase, and cyclin B is active in mitosis. Cyclins bind to
cyclin-dependent kinases (cdks). In this context, cyclins activate
the catalytic activity of their partner cdk(s) and also play roles
in substrate recognition.
[0010] Some transcriptional regulatory proteins, such as the pRB
homologs p107 and p130, the E2F family members E2F1, E2F2, and
E2F3, the transcriptional coactivator p300, and NPAT (nuclear
protein mapped to the AT locus) form stable complexes with cyclin
A/cdk2 and/or cyclin E/cdk2. All of these proteins bind directly or
indirectly to DNA. Thus, such complexes might serve as vehicles for
increasing the concentration of cyclin A/cdk2 or cyclin E/cdk2 at
certain sites within the genome. As such, cyclin A/cdk2 and cyclin
E/cdk2 might play relatively direct roles in processes such as
transcription and DNA replication. These two processes are
fundamental in normal cell proliferation and are perturbed during
aberrant cell proliferation, such as in cancer.
SUMMARY OF THE INVENTION
[0011] The invention relates in part to the discovery of
light-generating fusion proteins (or a cell expressing the
light-generating fusion protein), wherein the light-generating
fusion protein features a ligand binding site and a
light-generating polypeptide moiety. The light-generating fusion
protein ("LGP") has a feature where the light generation of the
light-generating polypeptide moiety changes upon binding of a
ligand at the ligand binding site. The ligand may be active in an
environment only under certain conditions, e.g., in a hypoxic
state, such that the light-generating fusion protein is "turned" on
or off only under such conditions.
[0012] The light-generating fusion proteins of the invention may be
used for screening for modulators of activity or latency of (or
predisposition to) disorders such as hypoxia, cancer, diabetes,
heart disease or stroke. For example, a test compound may be
administered to a test animal at increased risk for such a
disorder, wherein the test animal recombinantly expresses a
light-generating fusion protein, allowing for localization of the
light-generating fusion protein, detecting the luminescence of the
light-generating polypeptide moiety in the test animal after
administering the test compound, and comparing the luminescence of
the light-generating polypeptide moiety in the test animal with the
luminescence of the light-generating polypeptide moiety in a
control animal not administered the test compound. A change in the
activity of the light-generating polypeptide moiety in the test
animal relative to the control animal indicates the test compound
may be a modulator of, e.g., prolyl hydroxylase.
[0013] The effects of an anti-hypoxic compound in vivo may be
determined in another embodiment, by administering to a subject,
e.g., mammalian, a light-generating fusion protein comprising an
ubiquitin ligase binding site and a light-generating polypeptide
moiety or a cell expressing the light-generating fusion protein,
allowing for localization of the light-generating fusion protein or
cell in hypoxic tissue in the subject; and measuring the
luminescence of the localized light-generating fusion protein from
the hypoxic tissue.
[0014] Methods in accordance with the invention are also provided
for determining the effects of an anti-cell proliferation compound
under study in a mammalian subject, by administering to a test
subject a light-generating fusion protein containing a cyclin/cdk
binding site or a cell expressing the light-generating fusion
protein of the invention, allowing for localization of the fusion
protein or cell, measuring luminescence from the localized
light-generating fusion protein; and imaging the localized
light-generating fusion protein, thereby determining the effects of
the anti-cell proliferation compound.
[0015] Cyclin/cdk activity may be assayed in another embodiment of
the invention wherein a test sample is contacted with a
light-generating fusion protein comprising a cyclin/cdk binding
site and a light-generating polypeptide moiety; and thereafter the
presence or amount of cyclin/cdk activity in said test sample is
determined by measuring the luminescence of the test sample.
[0016] The invention yet further relates to DNA constructs,
including an isolated DNA encoding a modified LGP wherein one or
more amino acids have been substituted, inserted or deleted to
provide a ligand binding site such as a ubiquitin ligase or
protease recognition site, wherein fluorescence of the LGP changes
upon binding of a ligand to the ligand binding site.
[0017] The invention also relates to light-generating fusion
proteins having a ligand binding site, such as a ubiquitin ligase
binding site, or a HIF1.alpha. polypeptide moiety; and a light
generating polypeptide moiety. Another embodiment features a
light-generating fusion protein with a cyclin/cdk binding site, a
suicide protein polypeptide moiety, and a light-generating
polypeptide moiety; and a light-generating fusion protein
comprising a protein dimerization domain and a light-generating
protein moiety. In a preferred embodiment, the light-generating
fusion proteins have the property that upon ligand binding to the
ligand binding site, the luminescence of the light-generating
polypeptide moiety is changed without altering the
phosphorylational state of the fusion protein.
[0018] The invention further relates to fusion proteins including a
HIF1.alpha. polypeptide moiety or cyclin/cdk binding site, and a
suicide protein polypeptide moiety. A light-generating polypeptide
moiety may optionally be included. These protein constructs may be
used to selectively target certain cells, e.g., hypoxic tumor
cells, for destruction. For example, the invention includes methods
of treating hypoxic or ischemic disorders by administering to a
subject an effective amount of a fusion protein comprising a
HIF.alpha. polypeptide moiety having a binding affinity for prolyl
hydroxylase, and a suicide polypeptide moiety, such that the
hypoxic or ischemic disorder is treated. Methods of killing hypoxic
tumor cells, wherein an effective amount of the fusion/suicide
protein is administered to a subject, such that the hypoxic tumor
cells are killed; and methods of treating cell-proliferating
disorders by administering to a subject an effective amount of a
fusion protein comprising a cyclin/cdk binding site and a suicide
protein polypeptide moiety, such that the cell-proliferating
disorder is treated, are also contemplated.
[0019] The treatment of cell-proliferating disorders may be
monitored by an embodiment of the invention, e.g., by administering
to a subject an effective amount of a fusion protein comprising a
HIF.alpha. polypeptide moiety having a binding affinity for prolyl
hydroxylase, a suicide polypeptide moiety, and a light-generating
polypeptide moiety, wherein the light generation of the
light-generating fusion protein changes upon binding of prolyl
hydroxylase to the HIF.alpha. polypeptide moiety, such that the
cell-proliferating disorder is treated, and monitoring the ability
of the fusion protein to inhibit cell proliferation by measuring
the light generated by the light-generating fusion protein.
Alternately, treatment of cell-proliferating disorders may be
monitored by administering to a subject an effective amount of a
light-generating fusion protein comprising a cyclin/cdk binding
site, a suicide protein polypeptide moiety, and a light-generating
polypeptide moiety, wherein the light generation of the light
generating fusion protein changes upon binding of a cyclin to the
cyclin/cdk binding site, such that said cell-proliferating disorder
is treated; and monitoring the ability of the fusion protein to
inhibit cell proliferation by measuring the light generated by the
light-generating fusion protein.
[0020] Other embodiments of the invention include a cyclin/cdk
binding site and a light generating polypeptide moiety; and a
protease binding site and a light-generating protein moiety.
Antibodies specific for a protein complex comprising HIF1.alpha.
and pVHL are also detailed as within the present invention.
BRIEF DESCRIPTION OF THE DRAWING
[0021] FIGS. 1A, 1B, 1C, and 1D are schematic representations of
different fusion proteins of the present invention.
[0022] FIGS. 2A and 2B are second schematic representations of
different fusion proteins of the invention.
[0023] FIGS. 3A, 3B, 3C, and 3D shows pVHL binding to a modified
form of HIF.
[0024] FIGS. 4A, 4B, 4C, and 4D shows pVHL binding to a
HIF1.alpha.-derived peptide if Leu562 and Pro564 are intact.
[0025] FIGS. 5A, 5B, and 5C shows ubiquitination and degradation of
HIF linked to Leu562 and Pro 564.
[0026] FIGS. 6A, 6B, 6C, and 6D depicts proline hydroxylation
linked to pVHL-binding.
[0027] FIGS. 7A, 7B, 7C, and 7D illustrates pVHL specifically
recognizing HIF1.alpha. with hydroxylated proline 564.
[0028] FIGS. 8A, 8B, and 8C illustrates the production of
TETr-cyclins A and E.
[0029] FIGS. 9A, 9B, and 9C shows DNA bound cyclins A and E
differentially affecting transcription.
[0030] FIGS. 10A, 10B, and 10C illustrates transcriptional
regulation by cyclins A and E dependent upon DNA binding.
[0031] FIGS. 11A, 11B, and 11C depicts cyclin box is required for
transcriptional repression by DNA bound cyclin A.
[0032] FIGS. 12A, 12B, and 12C illustrates that transcriptional
activation by cyclin E is linked to its ability to bind to cdk2 and
interact with substrates.
[0033] FIGS. 13A, 13B, and 13C shows that transcriptional
activation by DNA bound cyclin E depends on cdk2 catalytic
activity.
[0034] FIGS. 14A-1, 14A-2, 14A-3, 14A-4, 14A-5, 14A-6, 14A-7, 14B,
and 14C shows transcriptional effects mediated by cell-cycle
dependent changes in endogenous cyclins E and A.
[0035] FIGS. 15-18 illustrate the results obtained in Example
2.
[0036] FIG. 19 illustrates the wild type sequence of HIF1.alpha.,
Accession No. Q16665 (SEQ ID NO:23).
[0037] FIG. 20 is a schematic representation of a nucleic acid
encoding a light-generating fusion protein of the invention.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0038] "Light-generating" or "luminescent" includes the property of
generating light through a chemical reaction or through the
absorption of radiation, including phosphorescence, fluorescence,
and bioluminescence.
[0039] "Light" includes electromagnetic radiation having a
wavelength of between about 300 nm and about 1100 nm.
[0040] "Non-invasive" methods for detecting localization in a
subject does not include largely invasive methods such as
conventional surgery or biopsy.
[0041] "Light-generating fusion protein" includes proteins of the
invention having a light generating or luminescent portion, i.e., a
light-generating polypeptide moiety and a ligand binding site. In
general, when a ligand of interest binds to the ligand binding site
of the light-generating fusion protein, the light-generating
properties of the light-generating polypeptide moiety change,
either going from "dark" to "light", or vice versa.
[0042] "Light-generating polypeptide moiety" includes any protein
known to those of ordinary skill in the art to provide a readily
detectable source of light when present in stable form.
Non-limiting examples include light-generating proteins described
in U.S. Pat. Nos. 5,683,888, 5,958,713, and 5,650,135, e.g.,
ferredoxin IV, green fluorescent protein, red fluorescent protein,
yellow fluorescent protein, blue fluorescent protein, the
luciferase family and the aequorin family. In a preferred
embodiment, the light-generating polypeptide moiety is a protein
such as green fluorescent protein, red fluorescent protein, yellow
fluorescent protein and blue fluorescent protein.
[0043] "Colinear effector site" includes regions of the
light-generating polypeptide moiety that, when acted on by events
subsequent to ligand binding, cause the light-generating
polypeptide moiety to change its present light-emitting state
(i.e., on or off). These regions making up the colinear effector
site may do this by, e.g., conformational distortion, chemical
modification, e.g., ubiquitination of a residue or residues in the
colinear effector site, or by cleavage of a portion of all or part
of the colinear effector site.
[0044] "Having binding character for prolyl hydroxylase" refers to
a property making HIF.alpha. polypeptide moieties suitable for,
e.g., screening methods of the invention and includes HIF
polypeptide sequences suitable or adapted for prolyl hydroxylase
binding as well as native or wild-type HIF sequences to which pVHL
has recognized and bound.
[0045] "Having binding character for ubiquitin ligase" refers to a
property making HIF.alpha. polypeptide moieties suitable for, e.g.,
screening methods of the invention, e.g., including native HIF
polypeptide sequences having hydroxylated proline residues
hydroxylated by prolyl hydroxylase, or, e.g., "HIF1.alpha.
polypeptide moieties" as defined herein.
[0046] "Localization" includes determining the particular region of
the subject of an entity of interest, e.g., a tumor.
[0047] "Kemptide" includes a synthetic cAMP peptide substrate
corresponding to part of the phosphyorylation site sequence in
porcine liver pyruvate kinase. "Malantide" includes cAMP-dependent
protein kinase and protein kinase C substrate in various
tissues.
[0048] "Small molecule" includes compositions that have a molecular
weight of less than about 5 kD and most preferably less than about
4 kD. Small molecules can be, e.g., nucleic acids, peptides,
polypeptides, peptidomimetics, carbohydrates, lipids or other
organic or inorganic molecules. "Spread of infection" includes the
spreading and colonization by a pathogen of host sites other than
the initial infection site. The term can also include, however,
growth in size and/or number of the pathogen at the initial
infection site.
[0049] "Ligand" includes a molecule, a small molecule, a
biomolecule, a drug, a peptide, a polypeptide, a protein, a protein
complex, an antibody, a nucleic acid, or a cell.
[0050] "Ligand binding site" includes the location on the
light-generating fusion protein to which a ligand binds, whereupon
the light-generating polypeptide moiety is activated or inactivated
as a direct or indirect consequence of ligand binding Binding to
the ligand binding site may be direct or indirect, e.g., via
protein dimerization in conjunction with other proteins, as
described hereinbelow.
[0051] "Targeting moiety" includes moieties which allow the
light-generating fusion protein of the invention to be selectively
delivered to a target organ or organs. For example, if delivery of
a therapeutic compound to the brain is desired, the carrier
molecule may include a moiety capable of targeting the compound to
the brain, by either active or passive transport. Illustratively,
the carrier molecule may include a redox moiety, as described in,
for example, U.S. Pat. Nos. 4,540,564 and 5,389,623, both to Bodor.
These patents disclose drugs linked to dihydropyridine moieties
which can enter the brain, where they are oxidized to a charged
pyridinium species which is trapped in the brain. Thus, compound
accumulates in the brain. Many targeting moieties are known, and
include, for example, asialoglycoproteins (see, e.g. Wu, U.S. Pat.
No. 5,166,320) and other ligands which are transported into cells
via receptor-mediated endocytosis. Targeting moieties may be
covalently or non-covalently bound to a light-generating fusion
protein. The targeting moiety may also be attached to a vector.
[0052] "Bioluminescent" molecules or moieties include luminescent
substances which utilize chemical energy to produce light.
[0053] "Fluorescent" molecules or moieties include those which are
luminescent via a single electronically excited state, which is of
very short duration after removal of the source of radiation. The
wavelength of the emitted fluorescence light is longer than that of
the exciting illumination (Stokes' Law), because part of the
exciting light is converted into heat by the fluorescent
molecule.
[0054] "Entities" include, without limitation, small molecules such
as cyclic organic molecules; macromolecules such as proteins;
polymers; proteins; polysaccharides; nucleic acids; particles,
inert materials; organelles; microorganisms such as viruses,
bacteria, yeast and fungi; cells, e.g., eukaryotic cells; embryos;
prions; tumors; all types of pathogens and pathogenic substances;
and particles such as beads and liposomes. In another aspect,
entities may be all or some of the cells that constitute the
mammalian subject being imaged, e.g., diseased or damaged tissue,
or compounds or molecules produced by those cells, or by a
condition under study. Entities for which the invention has
particular utility include tumors, proliferating cells, pathogens,
and cellular environments comprising hypoxic tissue.
[0055] "Infectious agents" include parasites, viruses, fungi,
bacteria or prions.
[0056] "Promoter induction event" includes an event that results in
the direct or indirect induction of a selected inducible
promoter.
[0057] "Heterologous gene" includes a gene which has been
transfected into a host organism. Typically, a heterologous gene
refers to a gene that is not originally derived from the
transfected or transformed cells' genomic DNA.
[0058] "Opaque medium" includes a medium that is "traditionally"
opaque, not necessarily absolutely opaque. Accordingly, an opaque
medium includes a medium that is commonly considered to be neither
transparent nor translucent, and includes items such as a wood
board, and flesh and skin of a mammal.
[0059] "HIF.alpha. polypeptide moiety" includes all or part of the
amino acid sequence of HIF1.alpha., HIF2.alpha., or
HIF3.alpha..
[0060] "HIF1.alpha. polypeptide moiety" includes all or part of the
amino acid sequence of HIF1.alpha., e.g., SEQ ID NO: 23, the amino
acid sequence corresponding to the N-terminal residues 1-600 of
HIF1.alpha., numbered in accordance with wild-type HIF1.alpha.,
wherein either or both of residues 402 and 564 are proline or
hydroxylated proline, or an 80 to 120, 20 to 30, 12 to 14, or 4 to
12 amino acid sequence corresponding to the residues adjacent to
and/or surrounding residue 402 and/or 564, inclusive, of
HIF1.alpha., wherein residues 402 and/or 564 is proline or
hydroxylated proline.
[0061] The invention relates in part to methods and compositions
relating to detecting, localizing and quantifying enzyme activities
and protein-protein interactions in vivo, in vitro and in silico
using light-emitting fusion proteins. The fusion proteins contain
domains capable of binding by enzymes and other ligands, and of
being modified as a consequence of this binding. The light
generating domains include, without limitation, regions from
fluorescent proteins and bioluminescent proteins. Light emission is
detected by known methods, such as detection with suitable
instrumentation (such as a CCD camera) in vivo, in vitro or in
silico, such as in a living cell or intact organism, a cell culture
system, a tissue section, or an array.
[0062] Light-generating fusion proteins of the invention are
capable of taking part in a luminescent reaction whereby different
biological, biochemical, chemical and physical events are measured.
The light-generating fusion protein is capable of being modified
such that it does or does not emit light or cause light to be
emitted. Light-generating fusion proteins include a ligand binding
site and a light-generating polypeptide moiety, wherein the
bioluminescence of the polypeptide moiety changes upon binding of a
ligand at the ligand binding site.
[0063] Without wishing to be bound by interpretation, the ligand
binding site acts as in a sense as a "switch" for the
light-generating polypeptide moiety, i.e., when the ligand binds to
the ligand binding site, the light-generating polypeptide moiety
emits light, or alternately, ceases to do so upon ligand binding.
The "switching" on or off, in embodiment, may be done by means of a
"colinear effector site" which includes regions of the
light-generating polypeptide moiety that, when acted on by events
subsequent to ligand binding, cause the light-generating
polypeptide moiety to change its present light-emitting state
(i.e., on or off). The regions making up the colinear effector site
may do this by, e.g., conformational distortion, chemical
modification, e.g., ubiquitination of a residue or residues in the
colinear effector site, or by cleavage of a portion of all or part
of the colinear effector site.
[0064] The invention further provides methods for testing putative
inhibitor compounds for activity ("screening") in promoting HIF
stabilization, e.g.; contacting the compound, ischemic tissue, and
the fusion protein of the invention under conditions appropriate to
detect the fusion protein if the compound promotes HIF
stabilization. The method (also referred to herein as a "screening
assay") can be used for identifying modulators, i.e., candidate or
test compounds or agents (e.g., peptides, peptidomimetics, small
molecules or other drugs) that promote HIF stabilization. The
invention also includes compounds identified in the screening
assays described herein, and pharmaceutical compositions for
treatments as described herein.
[0065] Other screening methods are also part of the invention. For
example, modulators of activity or latency of, or predisposition to
disorders may be identified by administering a test compound to a
test animal at increased risk for a disorder (e.g., cancer,
diabetes, heart disease, stroke, or a hypoxia-related disorder),
wherein the test animal recombinantly expresses a light generating
fusion protein comprising a ligand binding site and a
light-generating polypeptide moiety, wherein the light generation
of the light-generating fusion protein changes upon binding of a
ligand at the ligand binding site, and the ligand binding site
recognizes a ligand on an entity associated with a disorder, or a
product of the disorder; allowing for localization of the
light-generating fusion protein and an entity, wherein contact
between the ligand binding site and a ligand associated with the
disorder causes a modification of a colinear effector site which
alters the light generation of the light-generating polypeptide
moiety; detecting the luminescence of the light-generating
polypeptide moiety in the test animal after administering the
compound; and comparing the luminescence of the light-generating
polypeptide moiety in the test animal with the luminescence of the
light-generating polypeptide moiety in a control animal, wherein a
change in the activity of the light-generating polypeptide moiety
in the test animal relative to the control indicates the test
compound is a modulator of latency of or predisposition to, the
disorder in question.
[0066] The invention advantageously may be used to non-invasively
determine the effects of an anti-hypoxic compound in vivo. A
light-generating fusion protein of the invention, or a cell
expressing same, comprising an ubiquitin ligase binding site and a
light-generating polypeptide moiety, wherein the light generation
of the light-generating fusion protein changes upon binding of a
ubiquitin ligase at the ubiquitin ligase binding site, the
ubiquitin ligase binding site recognizing a ubiquitin ligase
present in hypoxic conditions in hypoxic tissue is administered to
a subject. Localization of the light-generating fusion protein or
cell in hypoxic tissue in the subject (wherein contact between the
ubiquitin ligase binding site and a ubiquitin ligase causes a
modification of a colinear effector site which alters the light
generation of the light-generating polypeptide moiety) is allowed
to occur, and the ability of the candidate compound to inhibit
hypoxia is determined, by measuring the luminescence of the
localized light-generating fusion protein.
[0067] The invention further relates to methods of identifying or
detecting prolyl hydroxylation, wherein the substrate peptide (or
polypeptide) is contacted with pVHL, wherein the amount of pVHL
bound reflects the degree of hydroxylation. In one embodiment, the
peptide corresponds to HIF1a 555-575. The HIF peptide can be
immobilized (for example, on a nitrocellulose filter or at the
bottom of a 96 well plate) or free in solution. Binding to pVHL can
be monitored using a variety of standard methods familiar to those
skilled in the art.
[0068] In another embodiment, the invention relates to methods of
identifying or detecting prolyl hydroxylation, wherein the
substrate peptide or polypeptide is contacted with an antibody,
wherein the amount of antibody bound reflects the degree of
hydroxylation. In one embodiment, the peptide corresponds to
HIF1.alpha. 555-575. The HIF peptide may be immobilized (for
example, on a nitrocellulose filter or at the bottom of a 96 well
plate) or free in solution. Binding to the antibody can be
monitored using a variety of standard methods familiar to those
skilled in the art.
[0069] Yet another embodiment of the invention relates to methods
of identifying or detecting prolyl hydroxylation wherein a
polypeptide is translated in the presence of labeled, e.g.,
radioactive, proline and a prolyl hydroxylase, hydrolyzing the
resulting labeled polypeptide, and detecting labeled hydroxyproline
incorporation by analytical means, such as thin layer
chromatography.
[0070] A further embodiment of the invention relates to methods of
identifying or detecting prolyl hydroxylation wherein the substrate
peptide (or polypeptide) is contacted with a source of prolyl
hydroxylase in the presence or absence of putative inhibitors, and
the degree of prolyl hydroxylation is monitored as described in
anyone of the above three paragraphs. In one embodiment, the
peptide corresponds to HIF1.alpha. 555-575, and the prolyl
hydroxylase consists of a mammalian cell extract. In another
embodiment, the peptide corresponds to HIF1.alpha. 555-575 and the
prolyl hydroxylase consists of purified or partially purified Eg19.
Further, particularly useful embodiments relate to small molecule
inhibitors of prolyl hydroxylation such as identified using this
method, and use of the inhibitors to treat diseases characterized
by ischemia.
[0071] The test compounds of the invention can be obtained using
any of the numerous approaches in combinatorial library methods
known in the art, including: biological libraries; spatially
addressable parallel solid phase or solution phase libraries;
synthetic library methods requiring deconvolution; the "one-bead
one-compound" library method; and synthetic library methods using
affinity chromatography selection. The biological library approach
is limited to peptide libraries, while the other four approaches
are applicable to peptide, non-peptide oligomer or small molecule
libraries of compounds. See, e.g., Lam, 1997. Anticancer Drug
Design 12: 145.
[0072] Libraries of chemical and/or biological mixtures, such as
fungal, bacterial, or algal extracts, are known in the art and can
be screened with any of the assays of the invention. Examples of
methods for the synthesis of molecular libraries can be found in
the art, for example in: DeWitt, et al., 1993. Proc. Natl. Acad.
Sci. U.S.A. 90: 6909; Erb, et al., 1994. Proc. Natl. Acad. Sci.
U.S.A. 91: 11422; Zuckermann, et al., 1994. J. Med. Chem. 37: 2678;
Cho, et al., 1993. Science 261: 1303; Carrell, et al., 1994. Angew.
Chem. Int. Ed. Engl. 33:2059; Carell, et al., 1994. Angew. Chem.
Int. Ed. Engl. 33: 2061; and Gallop, et al., 1994. J. Med. Chem.
37: 1233.
[0073] Libraries of compounds may be presented in solution (e.g.,
Houghten, 1992. Biotechniques 13: 412-421), or on beads (Lam, 1991.
Nature 354: 82-84), on chips (Fodor, 1993. Nature 364: 555-556),
bacteria (Ladner, U.S. Pat. No. 5,223,409), spores (Ladner, U.S.
Pat. No. 5,233,409), plasmids (Cull, et al., 1992. Proc. Natl.
Acad. Sci. USA 89: 1865-1869) or on phage (Scott and Smith, 1990.
Science 249: 386-390; Devlin, 1990. Science 249:404-406; Cwirla, et
al., 1990. Proc. Natl. Acad. Sci. U.S.A. 87: 6378-6382; Felici,
1991. J. Mol. Biol. 222: 301-310; Ladner, U.S. Pat. No.
5,233,409.).
[0074] Modulation of prolyl hydroxylase has a variety of uses.
Inhibiting prolyl hydroxylase may facilitate cell cycle progression
and the production of a number of proteins which promote
angiogenesis and/or promote cellular survival or cellular function
in hypoxia, a desirable outcome in the treatment of certain
clinical conditions, particularly ischemic conditions such as
coronary, cerebral and vascular insufficiency.
[0075] VHL used in assays of the invention may be any suitable
mammalian VHL, particularly human VHL. Human VHL has been cloned
and sources of the gene can be readily identified by those of
ordinary skill in the art. Its sequence is available as Genbank
accession numbers AF010238 and L15409. Other mammalian VHLs are
also available, such as murine VHL (accession number U12570) and
rat (accession numbers U14746 and S80345). Non-mammalian homologues
include the VHL-like protein of C. elegans, accession number
F08G12. VHL gene sequences may also be obtained by routine cloning
techniques, for example by using all or part of the human VHL gene
sequence as a probe to recover and to determine the sequence of the
VHL gene in other species. A wide variety of techniques are
available for this, for example, PCR amplification and cloning of
the gene using a suitable source of mRNA (e.g., from an embryo or a
liver cell), obtaining a cDNA library from a mammalian, vertebrate,
invertebrate or fungal source, e.g., a cDNA library from one of the
above-mentioned sources, probing the library with a polynucleotide
of the invention under stringent conditions, and recovering a cDNA
encoding all or part of the VHL protein of that mammal. Suitable
stringent conditions include hybridization on a solid support
(filter) overnight incubation at 420.degree. C. in a solution
containing 50% formamide, 5.times.SSC (750 mM NaC1, 75 mM sodium
citrate), 50 mM sodium phosphate (pH 7.6), 5.times.Denhardt's
solution, 10% dextran sulfate and 20 .mu.g/m1 salmon sperm DNA,
followed by washing in 0.03 M sodium chloride and 0.03 M sodium
citrate (i.e. 0.2.times.SSC) at from about 50.degree. C. to about
60.degree. C.). Where a partial cDNA is obtained, the full length
coding sequence may be determined by primer extension
techniques.
[0076] It is not necessary to use the entire VHL protein (including
their mutants and other variants). Fragments of the VHL may be
used, provided such fragments retain the ability to interact with
the target domain of the HIF.alpha. subunit. Fragments of VHL may
be generated in any suitable way known to those of skill in the
art. Suitable ways include, but are not limited to, recombinant
expression of a fragment of the DNA encoding the VHL. Such
fragments may be generated by taking DNA encoding the VHL,
identifying suitable restriction enzyme recognition sites either
side of the portion to be expressed, and cutting out that portion
from the DNA. The portion may then be operably linked to a suitable
promoter in a standard commercially available expression system.
Another recombinant approach is to amplify the relevant portion of
the DNA with suitable PCR primers. Small fragments of the VHL (up
to about 20 or 30 amino acids) may also be generated using peptide
synthesis methods which are well known in the art. Generally
fragments will be at least 40, preferably at least 50, 60, 70, 80
or 100 amino acids in size.
[0077] The HIF.alpha. subunit protein may be any human or other
mammalian protein, or fragment thereof which has the ability to
bind to a wild type full length VHL protein, such that the binding
is able, in a normoxic cellular environment, to target the a
subunit for destruction.
[0078] A number of HIF.alpha. subunit proteins have been cloned.
These include HIF1.alpha., the sequence of which is available as
Genbank accession number U22431, HIF2.alpha., available as Genbank
accession number U81984 and HIF3.alpha., available as Genbank
accession numbers AC007193 and AC079154. These are all human
HIF.alpha. subunit proteins. HIF.alpha. subunit proteins from other
species, including murine HIF1.alpha. (accession numbers AF003695,
US9496 and X95580), rat HIF1.alpha. (accession number Y09507),
murine HIF2.alpha. (accession numbers U81983 and D89787) and murine
HIF3.alpha. (accession number AF060194). Other mammalian,
vertebrate, invertebrate or fungal homologues may be obtained by
techniques similar to those described above for obtaining VHL
homologues.
[0079] Variants of the HIF.alpha. subunits may be used, such as
synthetic variants which have at least 45% amino acid identity to a
naturally occurring HIF.alpha. subunit (particularly a human
HIF.alpha. subunit), preferably at least 50%, 60%, 70%, 80%, 90%,
95% or 98% identity.
[0080] Fragments of the HIF.alpha. subunit protein and its variants
may be used, provided that the fragments retain the ability to
interact with a wild-type VHL, preferably wild-type human VHL. Such
fragments are desirably at least 20, preferably at least 40, 50,
75, 100, 200, 250 or 400 amino acids in size. Alternately, such
fragments may be 12 to 14 amino acids in size, or as small as four
amino acids. Most desirably such fragments include the region
555-575 found in human HIF1.alpha. or its equivalent regions in
other HIF.alpha. subunit proteins. Optionally the fragments also
include one or more domains of the protein responsible for
transactivation. Reference herein to a HIF.alpha. subunit protein
includes the above mentioned mutants and fragments which are
functionally able to bind VHL protein unless the context is
explicitly to the contrary.
[0081] The percentage homology (also referred to as identity) of
DNA and amino acid sequences can be calculated using commercially
available algorithms. The following programs (provided by the
National Center for Biotechnology Information) may be used to
determine homologies: BLAST, gapped BLAST and PSI-BLAST, which may
be used with default parameters. The algorithm GAP (Genetics
Computer Group, Madison, Wis.) uses the Needleman and Wunsch
algorithm to align two complete sequences that maximizes the number
of matches and minimizes the number of gaps. Generally, the default
parameters are used, with a gap creation penalty=12 and gap
extension penalty=4. Use of either of the terms "homology" and
"homologous" herein does not imply any necessary evolutionary
relationship between compared sequences, in keeping for example
with standard use of terms such as "homologous recombination" which
merely requires that two nucleotide sequences are sufficiently
similar to recombine under the appropriate conditions.
[0082] The precise format of the screening assays may be varied
using routine skill and knowledge. The amount of VHL, HIF.alpha.
subunit and, where required, further components, may be varied
depending upon the scale of the assay. In general, the person of
skill in the art will select relatively equimolar amounts of the
two components, say from 1:10 to 100:1, preferably from 1:1 to 10:1
molar ratio of VHL to HIF.alpha. subunit. However there may be
particular assay formats which can be practiced outside this
range.
[0083] Where assays of the invention are performed within cells,
the cells may be treated to provide or enhance a normoxic
environment. By "normoxic" it is meant levels of oxygen similar to
those found in normal air, e.g. about 21% O.sub.2 and 5% CO.sub.2,
the balance being nitrogen. Of course, these exact proportions do
not have to be used, and may be varied independently of each other.
Generally a range of from 10-30% oxygen, 1-10% CO.sub.2 and a
balance of nitrogen or other relatively inert and non-toxic gas may
be used. Normoxia may be induced or enhanced in cells, for example
by culturing the cells in the presence of hydrogen peroxide as
described above.
[0084] Alternatively, or by way of controls, cells may also be
cultured under hypoxic conditions. By "hypoxic" it is meant an
environment with reduced levels of oxygen. Most preferably oxygen
levels in cell culture will be 0.1 to 1.0% for the provision of a
hypoxic state. Hypoxia may be induced in cells simply by culturing
the cells in the presence of lowered oxygen levels. The cells may
also be treated with compounds which mimic hypoxia and cause up
regulation of HIF.alpha. subunit expression. Such compounds include
iron chelators, cobalt (II), nickel (II) or manganese (II), all of
which may be used at a concentration of 20 to 500 .mu.M, such as
100 .mu.M. Iron chelators include desferrioxamine, O-phenanthroline
or hydroxypyridinones (e.g. 1,2-diethyl hydroxypyridinone (CP94) or
1,2-dimethyl hydroxypyridinone (CP20).
[0085] Cells in which assays of the invention may be preformed
include eukaryotic cells, such as yeast, insect, mammalian, primate
and human cells. Mammalian cells may be primary cells or
transformed cells, including tumor cell lines. The cells may be
modified to express or not to express other proteins which are
known to interact with HIF (x subunit proteins and VHL protein, for
example Elongin C and Elongin B proteins in the case of VHL and
ARNT protein, in the case of HIF.alpha. subunit protein.)
[0086] In cell free systems such additional proteins may be
included, for example by being provided by expression from suitable
recombinant expression vectors.
[0087] In assays performed in cells, it will be desirable to
achieve sufficient expression of VHL to recruit sufficient
HIF.alpha. subunit to a complex such that the effect of a putative
modulator compound may be measured. The level of expression of VHL
and HIF.alpha. subunit may be varied within fairly wide limits, so
that the intracellular levels of the two may vary by a wide ratio,
for example from 1:10 to 1000:1, preferably 1:1 to 100:1, molar
ratio of VHL to HIF.alpha. subunit.
[0088] The amount of putative modulator compound which may be added
to an assay of the invention will normally be determined by trial
and error depending upon the type of compound used. Typically, from
about 0.01 to 100 .mu.M concentrations of putative modulator
compound may be used, for example from 0.1 to 10 .mu.M. Modulator
compounds may be those which either agonize or antagonize the
interaction. Antagonists (inhibitors) of the interaction are
particularly desirable.
[0089] Modulator compounds which may be used may be natural or
synthetic chemical compounds used in drug screening programs.
Extracts of plants which contain several characterized or
uncharacterized components may also be used.
[0090] The invention provides methods for determining hypoxic
conditions, cancer or infection in an individual to thereby select
appropriate therapeutic or prophylactic agents for that individual
(referred to herein as "pharmacogenomics"). Pharmacogenomics allows
for the selection of agents (e.g., drugs) for therapeutic or
prophylactic treatment of an individual based on the genotype of
the individual (e.g., the genotype of the individual examined to
determine the ability of the individual to respond to a particular
agent.) Yet another aspect of the invention pertains to monitoring
the influence of agents (e.g., drugs, compounds) on hypoxic
conditions, cancer or infection in clinical trials.
[0091] Thus, the diagnostic methods described herein can
furthermore be utilized to identify subjects having or at risk of
developing a disease or disorder associated with hypoxic
conditions, cancer or infection. Furthermore, the prognostic assays
described herein can be used to determine whether a subject should
be administered an agent (e.g., an agonist, antagonist,
peptidomimetic, protein, peptide, nucleic acid, small molecule, or
other drug candidate) to treat a disease or disorder associated
with hypoxic conditions, cancer or infection.
[0092] The selection of a light-generating polypeptide moiety of
the light-generating fusion protein should be done so as to produce
light capable of penetrating animal tissue such that it can be
detected externally in a non-invasive manner. The ability of light
to pass through a medium such as animal tissue (composed mostly of
water) is determined primarily by the light's intensity and
wavelength.
[0093] The more intense the light produced in a unit volume, the
easier the light will be to detect. The intensity of light produced
in a unit volume depends on the spectral characteristics of
individual light-generating polypeptide moieties, and on the
concentration of those moieties in the unit volume. Accordingly,
schemes that place a high concentration of light-generating
polypeptide moieties in or on an entity (such as high-efficiency
loading of a liposome or high-level expression of a
light-generating fusion protein in a cell) typically produce
brighter light-generating fusion proteins (LGPs), which are easier
to detect through deeper layers of tissue, than schemes which
conjugate, for example, only a single LGM onto each entity.
[0094] A second factor governing detectability through a layer of
tissue is the wavelength of the emitted light. Water may be used to
approximate the absorption characteristics of animal tissue, since
most tissues are composed primarily of water. It is well known that
water transmits longer-wavelength light (in the red range) more
readily than it does shorter wavelength light.
[0095] Accordingly, light-generating polypeptide moieties which
emit light in the range of yellow to red (550-1100 nm) are
typically preferable to those which emit at shorter wavelengths.
However, excellent results can be achieved in practicing the
present invention with LGMs that emit in the range of 486 nm,
despite the fact that this is not an optimal emission
wavelength.
[0096] Fluorescence-Based Moieties.
[0097] Because fluorescent molecules require input of light in
order to luminesce, their use in the invention may be more involved
than the use of bioluminescent molecules. Precautions are typically
taken to shield the excitatory light so as not to contaminate the
fluorescence photon signal being detected from the subject. Obvious
precautions include the placement of an excitation filter at the
radiation source. An appropriately-selected excitation filter
blocks the majority of photons having a wavelength similar to that
of the photons emitted by the fluorescent moiety. Similarly, a
barrier filter is employed at the detector to screen out most of
the photons having wavelengths other than that of the fluorescence
photons. Filters such as those described above can be obtained from
a variety of commercial sources, including Omega Optical, Inc.
(Brattleboro, Vt.).
[0098] Alternatively, a laser producing high intensity light near
the appropriate excitation wavelength, but not near the
fluorescence emission wavelength, can be used to excite the
fluorescent moieties. An x-y translation mechanism may be employed
so that the laser can scan the subject, for example, as in a
confocal microscope.
[0099] As an additional precaution, the radiation source may be
placed behind the subject and shielded, such that the only
radiation photons reaching the site of the detector are those that
pass all the way through the subject. Furthermore, detectors may be
selected that have a reduced sensitivity to wavelengths of light
used to excite the fluorescent moiety.
[0100] An advantage of small fluorescent molecules is that they are
less likely to interfere with the bioactivity of the entity to
which they are attached than would a larger light-generating
moiety. In addition, commercially-available fluorescent molecules
can be obtained with a variety of excitation and emission spectra
that are suitable for use with the present invention. For example,
Molecular Probes (Eugene, Oreg.) sells a number of fluorophores,
including Lucifer Yellow (abs. at 428 nm, and emits at 535 nm) and
Nile Red (abs. at 551 nm and emits at 636 nm). Further, the
molecules can be obtained derivatized with a variety of groups for
use with various conjugation schemes (e.g., from Molecular
Probes).
[0101] Bioluminescence-Based Moieties.
[0102] The subjects of chemiluminescence (luminescence as a result
of a chemical reaction) and bioluminescence (visible luminescence
from living organisms) have, in many aspects, been thoroughly
studied.
[0103] An advantage of bioluminescent moieties over fluorescent
moieties is that there is virtually no background in the signal.
The only light detected is light that is produced by the exogenous
bioluminescent moiety. In contrast, the light used to excite a
fluorescent molecule often results in the fluorescence of
substances other than the intended target. This is particularly
true when the "background" is as complex as the internal
environment of a living animal.
[0104] Ligands include, in a preferred embodiment, enzymes which
are capable of modifying a light-generating polypeptide moiety such
that it does or ceases to emit light when modified. In use, this
happens when, e.g., the light-generating fusion protein comes in
contact with a ligand on an entity or produced by the entity, and
the ligand binds to the ligand binding site, altering the
light-generating properties of the light-generating polypeptide
moiety. Examples include the following.
[0105] In an especially useful embodiment of the present invention,
a light-generating fusion protein comprising a binding site for an
E3 ubiquitin ligase and a light-generating polypeptide moiety
capable of being modified by E3 at a modification site can be used
for diagnostic and treatment purposes. Ubiquitin ligases (e.g., E3)
bind to colinear `T` (see FIG. 1) present on their substrates.
Examples include the SCF (Skp1/Cdc53/F-box) ubiquitin ligases, the
VBC (pVHL/elongin B/elongin C) ubiquitin ligase, and the MDM2
ubiquitin ligase. It is already established that light-generating
proteins such as GFP and luciferase can be fused to heterologous
polypeptides without loss of activity. In some embodiments, the
light-generating polypeptide moiety may be modified to include a
surface exposed lysine residue accessible as a ubiquitin acceptor
site. In a First embodiment, a light-generating fusion protein of
the invention may be used to monitor ischemia in living tissues and
animals. The First embodiment comprises a polypeptide derived from
the HIF.alpha. (hypoxia-inducible factor 1.alpha.) which acts as a
binding site for VBC. This binding site is only recognized by VBC
in the presence of oxygen as a result of proline hydroxylation. The
light-generating fusion protein of the First embodiment is
advantageously stable in hypoxic cells, but unstable in well
oxygenated cells. In a related embodiment, the HIF-derived
polypeptide described above may be fused to a suicide moiety such
as a protein (such as HSV TK or an adenoviral protein like E1A),
which can be used in selective killing of ischemic cells (such as
in a solid tumor).
[0106] Binding and/or modification sites are well-known in the art
for a variety of kinases including cyclin-dependent kinases,
ATM/ATR, JNK kinases, and receptor tyrosine kinases. In one
embodiment, a light-generating fusion protein may be fused to a
binding site for a kinase of interest. In some embodiments, it is
useful to introduce one or more binding sites for a selected kinase
into the light-generating fusion protein. By way of example, since
phosphorylated serine, threonine, and tyrosine, by virtue of their
negative charges, frequently mimic aspartic acid and/or glutamic
acid residues, individual aspartic acid and glutamic acid residues
are replaced with serine, threonine, or tyrosine (in the context of
the kinase modification site). Such substitutions may be made
singly and in combination. In another embodiment, the modification
site can be empirically determined by carrying out a linker scan of
the light-generating protein using a linker encoding the kinase
modification site. In yet another embodiment the light-generating
polypeptide moiety is mutagenized (either random or targeted
mutagenesis) to generate modification sites in which the
light-generating polypeptide moiety is selectively inactivated or
activated by the kinase; this mutagenesis is performed using cells
(such as yeast) rendered conditional for the kinase. In still yet
another embodiment, a kinase modification site is designed in
silico based on comparison of the binding site of the selected
kinase to the primary sequence of the light-generating polypeptide
moiety, coupled with knowledge of the three dimensional structure
of the light-generating polypeptide moiety.
[0107] In an additional embodiment described below, a
light-generating polypeptide moiety is fused to a polypeptide
recognized by a cyclin/cdk2 complex. This enzyme phosphorylates
serine or threonine with an absolute requirement for proline in the
+1 position. By way of example, GFP contains 13 proline residues
including one threonine-proline site and two aspartic acid-proline
sites. In one embodiment, a light-generating protein (e.g., GFP) is
fused to a cyclin/cdk2 binding site such as
Y-Lys-X.sub.1-Leu-K-X.sub.2-Leu-Y' (SEQ ID NO.9). The
light-generating protein is phosphorylated and inactivated by
cyclin/cdk2, providing a detectable signal which is selectively off
in the presence of cyclin/cdk2. In another embodiment, the
light-generating polypeptide moiety is mutated so that it is not
phosphorylated and activated by cyclin/cdk2. An example of this
mutation would be to mutate the two aspartic acid-proline sites to
serine (or threonine)-prolines.
[0108] In this additional embodiment, the ligand binding site is a
polypeptide recognized by a cyclin/cdk2 complex, e.g., comprising
the amino acid sequence Y-Lys-X.sub.1-Leu-K-X.sub.2-Leu-Y', wherein
X.sub.1, X.sub.2, are independently any one or more amino acids;
and Y and Y' are independently present or absent and, if present,
independently comprise a peptide having from 1 to 600 amino
acids.
[0109] An example of such a target peptide is RB: PKPLKKLRFD (SEQ
ID NO: 1). In a related aspect of this additional embodiment, the
ligand binding site comprises the amino acid sequence
Y-X.sub.1-Arg-Arg-Leu-Y', wherein X.sub.1 is Lys or Cys; and Y and
Y' are independently present or absent and, if present,
independently comprise a peptide having from 1 to 600 amino acids.
Two non-limiting examples of the target peptide of this related
aspect of this additional embodiment are: E2F1: GRPPVKRRLDLE (SEQ
ID NO: 2); derived from the E2F1 protein, and p21: CCSKACRRLFGP
(SEQ ID NO: 3), derived from the p21 protein.
[0110] The fusion protein of this additional embodiment can be
produced by standard recombinant DNA techniques, discussed
supra.
[0111] The ligand binding site of the light-generating fusion
protein of this additional embodiment is derived from the
retinoblastoma (RB) protein. Adams, et al., 1999 Mol. Cell Biol.
19:1068 describes RB protein. An RB polypeptide comprises 928 amino
acid residues. As described in more detail below, this ligand
binding site comprises a unique cyclin binding domain derived from
RB. In the light-generating fusion protein described above, where
present, Y comprises between 1 and 900 amino acid residues,
preferably corresponding to the sequence of "N-terminal" RB amino
acid residues 1-868. Thus, in a preferred embodiment Y can
represent any sequence of N-terminal amino acids of RB, for example
residues 794-829, and so on up to and including residues 1-868. Y'
can also comprise between 1 and 600 amino acid residues, preferably
corresponding to the sequence of "C-terminal" RB amino acid
residues 879-928. Thus, in a preferred embodiment, Y' can represent
any sequence of C-terminal amino acids of RB, for example 879-910,
and so on up to and including residues 879-928. Y and Y' can also
contain conservative substitutions of amino acids present in the
N-terminal and C-terminal RB sequences described above. In a
further preferred embodiment, Y and Y' are absent.
[0112] The light-generating fusion protein of this additional
embodiment provides a way for detecting "cancerous tissue" or
tissue subject to aberrant cell proliferation and therefore at risk
for cancer. In addition to tissue that becomes cancerous due to an
in situ neoplasm, for example, the light-generating fusion protein
also provides a method of detecting cancerous metastatic tissue
present in distal organs and/or tissues. Thus such tissue may be
detected by contacting tissue suspected of being cancerous with the
light-generating fusion protein under appropriate conditions to
cause the phosphorylation of the light-generating fusion protein in
cancerous tissue, thereby detecting the presence of cancerous
tissue. The ligand binding site of the light-generating fusion
protein of this embodiment provides a binding site for
cyclin-cyclin-dependent kinase (cdk) complexes which phosphorylate
the protein, causing it to emit or not emit light in the presence
of active cycle-cdk complexes. Under appropriate conditions, the
light-generating fusion protein will therefore be phosphorylated or
inactive in tissue that is not cancerous, and unphosphorylated and
preserving its light-emitting properties in tissue that is
cancerous, e.g. primary and metastatic tissue.
[0113] In another useful embodiment, a light-generating polypeptide
moiety is fused to a polypeptide recognized by a cyclin/cdk2
complex. This enzyme phosphorylates serine or threonine with an
absolute requirement for proline in the +1 position. By way of
example, GFP contains 13 proline residues including one
threonine-proline site and two aspartic acid-proline sites. In one
embodiment, a light-generating protein (e.g., GFP) is fused to a
cyclin/cdk2 binding site such as Y-Lys-X.sub.1-Leu-K-X.sub.2-Leu-Y'
(SEQ ID NO.9). The light-generating protein is phosphorylated and
inactivated by cyclin/cdk2, providing a detectable signal which is
selectively off in the presence of cyclin/cdk2. In another
embodiment, the light-generating polypeptide moiety is mutated so
that it is not phosphorylated and activated by cyclin/cdk2. An
example of this mutation would be to mutate the two aspartic
acid-proline sites to serine (or threonine)-prolines.
[0114] Phosphorylation is one of the most important ways to
posttranslationally modify proteins, and it regulates diverse cell
physiological processes (transport, proliferation,
differentiation). For example, phosphorylation is involved in all
phases of cell division: in transition from G1 to S phase,
progression of cells during S phase and entry into M phase. The
physiological function of oncoproteins and tumor suppressor
proteins that are involved in gene expression and replication are
also regulated by phosphorylation. Many growth factors and their
receptors are encoded by oncogenes which are mutated or
overexpressed in a variety of human tumors. Mutation or
overexpression of these oncogenes leads to unchecked cell division,
and transformation of normal cells to malignant. In an embodiment
of the present invention, a light-generating fusion protein may
include a phosphatase binding site and a modification site, such as
a phosphorylated amino acid residue capable of being modified by a
protein "phosphatase".
[0115] For most proteases, the enzyme binding site and modification
site are largely congruent and can be encompassed in short
peptides. In an embodiment, a light-generating fusion protein may
include a protease binding site and a modification site capable of
being cleaved by the protease. The binding site and modification
site may be the same site or in two discrete regions. In one
embodiment, wherein the binding and modification site are
congruent, linker scanning mutagenesis of a given light-generating
protein is carried out using a linker that encodes the congruent
binding/modification site. Resulting mutants are those
light-generating fusion proteins containing a binding/modification
site that preserves light-emitting activity in protease deficient
cells and exhibits protease sensitivity in vitro and in vivo. In
the Third embodiment described herein, a light-generating fusion
protein containing an HIV protease site is especially useful for
monitoring the presence or absence of HIV (in this case, with
HIV-positive cells not emitting light). In an alternative
embodiment, the light-generating fusion protein is fused via a
linker to a protein that inhibits the light-emitting activity of
the light-generating polypeptide moiety. The linker includes a
binding/modification site for an HIV protease. Thus, cleavage at
the binding/modification site should remove the inhibiting protein
moiety, thus yielding a positive signal in cells that are HIV
positive.
[0116] As shown generally in FIG. 1A, an embodiment of the fusion
protein of the invention contains a ligand binding site "T", a
reporter domain (e.g., light-generating polypeptide moiety) "R",
and a modification site "X". Binding of enzyme "E" (the ligand) to
target site "T" results in a modification of modification site "X",
which causes the reporter domain "R" to either emit or not emit
light.
[0117] The site "T" and modification site "X" may be separate and
in cis on the fusion protein, as shown in FIG. 1B. Either "T" or
"X" can be proximal or distal to the amino terminus of the fusion
protein.
[0118] In another embodiment shown in FIG. 1C, wherein the "T" and
the "X" of the fusion protein are congruent within a domain of the
fusion protein. In related embodiments, the congruent "T/X" can be
at the amino terminus, the carboxy terminus, or at neither terminus
of the fusion protein.
[0119] In a further embodiment shown in FIG. 1D, the "T" is on a
protein associated with the fusion protein containing the "X". In a
related embodiment, target site "T" is on the fusion protein and
modification site "X" is on a protein that is physically associated
with the fusion protein, wherein modification of the associated
protein results in the fusion protein either emitting or not
emitting light. The depiction of site "T" and modification site "X"
are not intended to be limiting. "T" can be at the amino terminus,
the carboxy terminus, or at neither terminus of the fusion protein,
and "X" can be at the amino terminus, the carboxy terminus, or at
neither terminus of the associated protein.
[0120] The invention also includes a fusion protein in which the
ligand binding site sequence "T" is unknown. In this embodiment,
e.g., as shown in FIG. 2A, the fusion protein includes a first
hetero- or homo-dimerization domain ("HD1"). An enzyme "E" capable
of modifying modification site "X" on the fusion protein is fused
to a second hetero- or homo-dimerization domain "HD2" that
interacts with "HD1". In a related embodiment, the targeting site
"T" for an enzyme "E" can be generated by inserting one or more
polypeptide sequences derived from a random or non-random peptide
library into the fusion protein.
[0121] In a related embodiment (FIG. 2B), a binding domain of a
protein "A" containing an enzyme target site "T" interacts with a
binding domain "B" of a fusion protein, which results in enzyme "E"
modifying the reporter domain "R" of fusion protein "B" at
modification site "X" such that the fusion protein does or does not
emit light or cause light to be emitted. In the First embodiment,
the ligand binding site comprises a polypeptide derived from the
HIF1.alpha. (hypoxia-inducible factor 1.alpha.) which acts as a
binding site for VBC, e.g., the amino acid sequence
Y-X.sub.1-Leu-X.sub.2-Pro.sub.h-X.sub.3-X.sub.4-X.sub.5-X.sub.6--
Y', wherein Pro.sub.h is hydroxylated proline; X.sub.1, X.sub.2,
X.sub.3, X.sub.4, X.sub.5, and X.sub.6 are amino acids selected so
as to not modify or alter VHL binding properties. X.sub.1, X.sub.2,
X.sub.4, X.sub.5, and X.sub.6 are desirably independently Gly, Ala,
Val, Leu, Ile, Pro, Met, Phe, or Trp, and X.sub.3 is desirably Ser,
Thr, or Tyr; and Y and Y' are independently present or absent and,
if present, independently comprise a peptide having from 1 to 600
amino acids.
[0122] In a preferred embodiment, the ligand binding site comprises
the amino acid sequence corresponding to the N-terminal residues
1-600 of HIF1.alpha., wherein either or both of residues 402 and
564 are proline or hydroxylated proline. In a more preferred
embodiment, the ligand binding site comprises an 80 to 120, 20 to
30, 12 to 14, or 4 to 12 amino acid sequence corresponding to the
residues adjacent to and/or surrounding residue 402 and/or 564,
inclusive, of HIF1.alpha., wherein residues 402 and/or 564 is
proline or hydroxylated proline. "Residues adjacent to and/or
surrounding" is meant to include the relevant sequence of
HIF1.alpha. either before, after, or flanking, the specified
residue, e.g., residue 564.
[0123] Such proteins may be used effectively as oxygen-sensing
proteins. The fusion proteins may be produced by standard
recombinant DNA techniques. For example, DNA fragments coding for
the different polypeptide sequences are ligated together in-frame
in accordance with conventional techniques, e.g., by employing
blunt-ended or stagger-ended termini for ligation, restriction
enzyme digestion to provide for appropriate termini, filling-in of
cohesive ends as appropriate, alkaline phosphatase treatment to
avoid undesirable joining, and enzymatic ligation. In another
embodiment, the fusion gene can be synthesized by conventional
techniques including automated DNA synthesizers. Alternatively, PCR
amplification of gene fragments can be carried out using anchor
primers that give rise to complementary overhangs between two
consecutive gene fragments that can subsequently be annealed and
reamplified to generate a chimeric gene sequence (see, e.g.,
Ausubel et al. (eds.) CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John
Wiley & Sons, 1992).
[0124] The ligand binding site noted above is derived from
HIF1.alpha. protein. U.S. Pat. No. 6,222,018, describes HIF protein
and its preparation in substantially pure form. HIF is composed of
subunits HIF1.alpha. and an isoform HIF1.beta.. HIF1.alpha.
polypeptide comprises 826 amino acid residues. As described in more
detail below, the ligand binding sites of this particular fusion
protein comprises a unique ubiquitin ligase binding domain derived
from HIF1.alpha.. In this fusion protein, where present, Y
comprises between 1 and 600 amino acid residue, preferably
corresponding to the sequence of "N-terminal" HIF1.alpha. amino
acid residues 1-555. Thus, in a preferred embodiment Y can
represent any sequence of N-terminal amino acids of HIF1.alpha.,
for example residues 554-555, 553-555, 552-555, and so on up to and
including residues 1-555. Y' can also comprises between 1 and 600
amino acid residues, preferably corresponding to the sequence of
"C-terminal" HIF1.alpha. amino acid residues 576-826. Thus, in a
preferred embodiment, Y' can represent any sequence of C-terminal
amino acids of HIF1.alpha., for example 576-577, 576-578, 576-579,
and so on up to and including residues 576-826. Y and Y' can also
contain conservative substitutions of amino acids present in the
N-terminal and C-terminal HIF1.alpha. sequences described above. In
a preferred embodiment of the ligand binding site defined above, Y
and Y' are absent. In a further preferred embodiment, X.sub.1 is
Met, X.sub.2 is Leu, X.sub.3 is Ala, X.sub.4 is Tyr, X.sub.5 is
Pro, and X.sub.6 is Met. In a particularly preferred embodiment of
the fusion protein, the ligand binding site has the amino acid
sequence
Asp-Leu-Asp-Leu-Glu-Met-Leu-Ala-Pro.sub.h-Tyr-Ile-Pro-Met-Asp-Asp-Asp-Phe-
-Gln-Leu-Arg, corresponding to HIF1.alpha. amino acid residues
556-575, with a hydroxylated proline at amino acid residue 564.
[0125] The invention also provides a nucleic acid molecule encoding
the fusion protein or polypeptide of the invention. (As used
herein, the terms polypeptide and protein are interchangeable). An
"isolated" nucleic acid molecule is one that is separated from
other nucleic acid molecules that are present in the natural source
of the nucleic acid. Examples of isolated nucleic acid molecules
include, but are not limited to, recombinant DNA molecules
contained in a vector, recombinant DNA molecules maintained in a
heterologous host cell, partially or substantially purified nucleic
acid molecules, and synthetic DNA or RNA molecules. Moreover, an
"isolated" nucleic acid molecule, such as a cDNA molecule, can be
substantially free of other cellular material or culture medium
when produced by recombinant techniques, or of chemical precursors
or other chemicals when chemically synthesized.
[0126] A nucleic acid of the invention can be amplified using cDNA,
mRNA or alternatively, genomic DNA, as a template and appropriate
oligonucleotide primers according to standard PCR amplification
techniques. The nucleic acid so amplified can be cloned into an
appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to the nucleotide
sequences can be prepared by standard synthetic techniques, e.g.,
using an automated DNA synthesizer. The present invention therefore
also provides a vector comprising the nucleic acid of the
invention. In a preferred embodiment, the vector further comprises
a promoter operably linked to the nucleic acid molecule. In a
further preferred embodiment the invention provides a cell
containing the vector of the invention.
[0127] The light-generating fusion protein of, e.g., the First
embodiment provides a means for detecting hypoxic tissue or tissue
subject to chronic hypoxia and therefore at risk for ischemia. In
addition to tissue that becomes ischemic due to occurrence of a
stroke, heart attack or embolism, for example, the fusion protein
also provides a method of detecting ischemic tissue present in
tumors. Thus the invention may be used to detect such tissue by
contacting tissue suspected of being hypoxic with the
light-generating fusion protein under appropriate conditions to
cause the ubiquitination of the fusion protein in normoxic tissue,
thereby detecting the presence of hypoxic tissue. As described more
fully below, the ligand binding site of the light-generating fusion
protein also provides a binding site for ubiquitin ligases which
destroy the protein in the presence of oxygen. Under appropriate
conditions, the light-generating fusion protein of the invention
will therefore be "unstable" or destroyed in tissue that is not
hypoxic, i.e., that is well oxygenated, and "stable" or preserving
its light-emitting properties in tissue that is hypoxic, i.e. that
lacks sufficient oxygen.
[0128] The Third embodiment provides a means for detecting
"infected tissue" or tissue subject to contact with infectious
agents and therefore at risk for infection, e.g., monitoring the
presence or absence of HIV. The ligand binding site of the Third
embodiment comprises a binding site for a protease, such as an
infection-associated protease. For example, protease cleavage sites
of the human immunodeficiency virus (HIV-1) protein precursor Pr55
(gag) protein include p2/NC, NC/p1, and NC/TFP.
[0129] The ligand binding site of the light-generating fusion
protein of this Third embodiment may be derived from the HIV-1
protein. One non-limiting example of the target peptide of this
Third embodiment is: Y-GSGIF*LETSL-Y' (See Beck et al., (2000)
Virology 274(2):391-401). Y and Y' are independently present or
absent and, if present, independently comprise a peptide having
from 1 to 600 amino acids, and "*" indicates the cleavage site of
the fusion protein by a protease.
[0130] In addition to tissue that becomes infected due to an acute
or chronic infection by an infectious agent, for example, the
light-generating fusion protein may be used in detecting infected
tissue present in distal organs and/or tissues, e.g., by contacting
tissue suspected of being infected with the light-generating fusion
protein of the invention under appropriate conditions to cause the
proteolysis of the light-generating fusion protein in infected
tissue, thereby detecting the presence of infected tissue. The
ligand binding site of the light-generating fusion protein of this
Third embodiment provides a binding site for a protease which
degrades or modifies the protein, causing it to emit or not emit
light in the presence of one or more proteases. Under appropriate
conditions, the light-generating fusion protein will therefore be
proteolyzed or inactive in tissue that is infected (although there
may be cases where proteolysis leads to light generation), and
unproteolyzed and preserving its light-emitting properties in
tissue that is infected.
[0131] A Fourth embodiment of a light-generating fusion protein of
the invention comprises a light-generating protein moiety and a
ligand binding site, wherein the ligand binding site comprises an
amino acid sequence capable of binding to an "associated" protein.
The association can occur by covalent or non-covalent binding. This
associated protein may itself be a light-generating fusion protein,
comprising a binding polypeptide capable of binding to the
light-emitting light-generating fusion protein and an enzyme
capable of modifying the light-emitting light-generating fusion
protein.
[0132] A non-limiting example of the target peptide of this Fourth
embodiment is: HD1: WFHGKLSR (Amino acids 488-495 of Accession No.
P29353, human SHC1; SEQ ID NO: 4). This target polypeptide contains
an SH2 domain. Therefore, any associated protein with an SH2 domain
should interact with the target peptide of the Fourth embodiment. A
non-limiting example of the binding peptide of the associated
protein of this Fourth embodiment is: HD2: WNVGSSNR (Amino acids
624-631 of Accession No. P27986; human PI3K p85 subunit; SEQ ID NO:
5).
[0133] Another non-limiting example of the Fourth embodiment would
be to fuse the FK506 binding protein (FKBP12) domain moiety to GFP
and the FRAP domain moiety to Skp1 or elonginC. Therefore in the
presence of rapamycin, which promotes the high affinity interaction
of FKBP12 and FRAP, the core E3 ligase machinery would bind to and
destroy GFP, eliminating the bioluminescence wherever rapamycin is
present. The ligand binding site of the light-generating fusion
protein of this Fourth embodiment is derived from the human SHC1
proteinprotein. See Pelicci et al., (1992) Cell 70:93-104,
describes the SHC1 protein with an SH2 domain which is implicated
in mitogenic signal transduction. The light-generating fusion
protein of this Fourth embodiment provides a means for detecting
enzymatic activity where the enzyme binding site is undefined.
[0134] The pharmaceutical compositions of the invention comprise
the novel agents combined with a pharmaceutically acceptable
carrier. The term "pharmaceutically acceptable carrier" is intended
to include any and all solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the like, compatible with pharmaceutical
administration. Suitable carriers are described in the most recent
edition of Remington's Pharmaceutical Sciences, a standard
reference text in the field, which is incorporated herein by
reference. Preferred examples of such carriers or diluents include,
but are not limited to, water, saline, finger's solutions, dextrose
solution, and 5% human serum albumin. Liposomes and non-aqueous
vehicles such as fixed oils may also be used. The use of such media
and agents for pharmaceutically active substances is well known in
the art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions.
[0135] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation),
transdermal (i.e., topical), transmucosal, and rectal
administration. Solutions or suspensions used for parenteral,
intradermal, or subcutaneous application can include the following
components: a sterile diluent such as water for injection, saline
solution, fixed oils, polyethylene glycols, glycerine, propylene
glycol or other synthetic solvents; antibacterial agents such as
benzyl alcohol or methyl parabens; antioxidants such as ascorbic
acid or sodium bisulfate; chelating agents such as
ethylenediaminetetraacetic acid (EDTA); buffers such as acetates,
citrates or phosphates, and agents for the adjustment of tonicity
such as sodium chloride or dextrose. The pH can be adjusted with
acids or bases, such as hydrochloric acid or sodium hydroxide. The
parenteral preparation can be enclosed in ampoules, disposable
syringes or multiple dose vials made of glass or plastic.
[0136] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.TM.(BASF, Parsippany, N.J.) or
phosphate buffered saline (PBS). In all cases, the composition must
be sterile and should be fluid to the extent that easy
syringeability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyethylene glycol, and the like), and suitable
mixtures thereof The proper fluidity can be maintained, for
example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants.
[0137] Prevention of the action of microorganisms can be achieved
by various antibacterial and antifungal agents, for example,
parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the
like. In many cases, it will be preferable to include isotonic
agents, for example, sugars, polyalcohols such as manitol,
sorbitol, sodium chloride in the composition. Prolonged absorption
of the injectable compositions can be brought about by including in
the composition an agent which delays absorption, for example,
aluminum monostearate and gelatin.
[0138] Sterile injectable solutions can be prepared by
incorporating the active compound in the required amount in an
appropriate solvent with one or a combination of ingredients
enumerated above, as required, followed by filtered sterilization.
Generally, dispersions are prepared by incorporating the active
compound into a sterile vehicle that contains a basic dispersion
medium and the required other ingredients from those enumerated
above. In the case of sterile powders for the preparation of
sterile injectable solutions, methods of preparation are vacuum
drying and freeze-drying that yields a powder of the active
ingredient plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0139] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring.
[0140] For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from pressured container
or dispenser which contains a suitable propellant, e.g., a gas such
as carbon dioxide, or a nebulizer.
[0141] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art.
[0142] The compounds can also be prepared in the form of
suppositories (e.g., with conventional suppository bases such as
cocoa butter and other glycerides) or retention enemas for rectal
delivery.
[0143] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No.
4,522,811.
[0144] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated; each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. The specification for the dosage unit forms
of the invention are dictated by and directly dependent on the
unique characteristics of the active compound and the particular
therapeutic effect to be achieved, and the limitations inherent in
the art of compounding such an active compound for the treatment of
individuals.
[0145] The invention includes entities which may have been modified
or conjugated to include a light-generating fusion protein of the
invention. Such conjugated or modified entities are referred to as
light-emitting entities, or simply conjugates. The conjugates
themselves may take the form of, for example, molecules,
macromolecules, particles, microorganisms, or cells. The methods
used to conjugate a light-generating fusion protein to an entity
depend on the nature of the light-generating fusion protein and the
entity. Exemplary conjugation methods are discussed in the context
of the entities described below.
[0146] Small Molecules.
[0147] Small molecule entities which may be useful in the present
invention include compounds which specifically interact with a
pathogen or an endogenous ligand or receptor. Examples of such
molecules include, but are not limited to, drugs or therapeutic
compounds; toxins, such as those present in the venoms of poisonous
organisms, including certain species of spiders, snakes, scorpions,
dinoflagellates, marine snails and bacteria; growth factors, such
as NGF, PDGF, TGF and TNF; cytokines; and bioactive peptides.
[0148] The small molecules are preferably conjugated to
light-generating fusion proteins in a way that that the bioactivity
of the small molecule is not substantially affected. Conjugations
are typically chemical in nature, and can be performed by any of a
variety of methods known to those skilled in the art.
[0149] Small molecules conjugated to light-generating fusion
proteins of the present invention may be used either in animal
models of human conditions or diseases, or directly in human
subjects to be treated. For example, a small molecule which binds
with high affinity to receptor expressed on tumor cells may be used
in an animal model to localize and obtain size estimates of tumors,
and to monitor changes in tumor growth or metastasis following
treatment with a putative therapeutic agent. Such molecules may
also be used to monitor tumor characteristics, as described above,
in cancer patients.
[0150] Macromolecules.
[0151] Macromolecules, such as polymers and biopolymers, constitute
another example of entities useful in practicing the present
invention. Exemplary macromolecules include antibodies, antibody
fragments, light-generating fusion proteins and certain vector
constructs.
[0152] Antibodies or antibody fragments, purchased from commercial
sources or made by methods known in the art, can be used to
localize their antigen in a mammalian subject by conjugating the
antibodies to a light-generating polypeptide moiety, administering
the conjugate to a subject by, for example, injection, allowing the
conjugate to localize to the site of the antigen, and imaging the
conjugate.
[0153] Antibodies and antibody fragments have several advantages
for use as entities in the present invention. By their nature, they
constitute their own targeting moieties. Further, their size makes
them amenable to conjugation with several types of light-generating
fusion proteins, including small fluorescent molecules and
fluorescent and bioluminescent proteins, yet allows them to diffuse
rapidly relative to, for example, cells or liposomes.
[0154] The light-generating fusion proteins can be conjugated
directly to the antibodies or fragments, or indirectly by using,
for example, a fluorescent secondary antibody. Direct conjugation
can be accomplished by standard chemical coupling of, for example,
a fluorophore to the antibody or antibody fragment, or through
genetic engineering. Chimeras, or fusion proteins, can be
constructed which contain an antibody or antibody fragment coupled
to a fluorescent or bioluminescent protein. For example, Casadei,
et al., describe a method of making a vector construct capable of
expressing a fusion protein of aequorin and an antibody gene in
mammalian cells.
[0155] Conjugates containing antibodies can be used in a number of
applications of the present invention. For example, a labeled
antibody directed against E-selection, which is expressed at sites
of inflammation, can be used to localize the inflammation and to
monitor the effects of putative anti-inflammatory agents.
[0156] Vector constructs by themselves can also constitute
macromolecular entities applicable to the present invention. For
example, a eukaryotic expression vector can be constructed which
contains a therapeutic gene and a gene encoding a light-generating
molecule under the control of a selected promoter (i.e., a promoter
which is expressed in the cells targeted by the therapeutic gene).
Expression of the light-generating molecule, assayed using methods
of the present invention, can be used to determine the location and
level of expression of the therapeutic gene. This approach may be
particularly useful in cases where the expression of the
therapeutic gene has no immediate phenotype in the treated
individual or animal model.
[0157] Viruses.
[0158] Another entity useful for certain aspects of the invention
are viruses. As many viruses are pathogens which infect mammalian
hosts, the viruses may be conjugated to a light-generating fusion
protein and used to study the initial site and spread of infection.
In addition, viruses labeled with a light-generating fusion protein
may be used to screen for drugs which inhibit the infection or the
spread of infection.
[0159] A virus may be labeled indirectly, either with an antibody
conjugated to a light-generating fusion protein, or by, example,
biotinylating virions as known in the art and then exposing them to
streptavidin linked to a detectable moiety, such as a fluorescent
molecule.
[0160] Alternatively, virions may be labeled directly with a
fluorophore like rhodamine, using methods known in the art. The
virus can also be genetically engineered to express a
light-generating fusion protein. Labeled virus can be used in
animal models to localize and monitor the progression of infection,
as well as to screen for drugs effective to inhibit the spread of
infection. For example, while herpes virus infections are
manifested as skin lesions, this virus can also cause herpes
encephalitis. Such an infection can be localized and monitored
using a virus labeled by any of the methods described above, and
various antiviral agents can be tested for efficacy in central
nervous system (CNS) infections.
[0161] Particles.
[0162] Particles, including beads, liposomes and the like,
constitute another entity useful in the practice of the present
invention. Due to their larger size, particles may be conjugated
with a larger number of light-generating fusion proteins than, for
example, can small molecules. This results in a higher
concentration of light emission, which can be detected using
shorter exposures or through thicker layers of tissue. In addition,
liposomes can be constructed to contain an essentially pure
targeting moiety, or ligand, such as an antigen or an antibody, on
their surface. Further, the liposomes may be loaded with, for
example, light-generating protein molecules, to relatively high
concentrations.
[0163] Furthermore, two types of liposomes may be targeted to the
same cell type such that light is generated only when both are
present. For example, one liposome may carry luciferase, while the
other carries luciferin. The liposomes may carry targeting
moieties, and the targeting moieties on the two liposomes may be
the same or different. Viral proteins on infected cells can be used
to identify infected tissues or organs. Cells of the immune system
can be localized using a single or multiple cell surface
markers.
[0164] The liposomes are preferably surface-coated, e.g., by
incorporation of phospholipid-polyethyleneglycol conjugates, to
extend blood circulation time and allow for greater targeting via
the bloodstream. Liposomes of this type are well known.
[0165] Cells.
[0166] Cells, both prokaryotic and eukaryotic, constitute another
entity useful in the practice of the present invention. Like
particles, cells can be loaded with relatively high concentrations
of light-generating moieties, but have the advantage that the
light-generating moieties can be provided by, for example, a
heterologous genetic construct used to transfect the cells. In
addition, cells can be selected that express "targeting moieties",
or molecules effective to target them to desired locations within
the subject. Alternatively, the cells can be transfected with a
vector construct expressing an appropriate targeting moiety.
[0167] The cell type used depends on the application. For example,
bacterial cells can be used to study the infective process, and to
evaluate the effects of drugs or therapeutic agents on infective
process with a high level of temporal and spatial resolution.
Bacterial cells constitute effective entities. For example, they
can be easily transfected to express a high levels of a
light-generating fusion protein, as well as high levels of a
targeting protein. In addition, it is possible to obtain E. coli
libraries containing bacteria expressing surface-bound antibodies
which can be screened to identify a colony expressing an antibody
against a selected antigen (Stratagene, La Jolla, Calif.). Bacteria
from this colony can then be transformed with a second plasmid
containing a gene for a light-generating protein, and transformants
can be utilized in the methods of the present invention, as
described above, to localize the antigen in a mammalian host.
[0168] Pathogenic bacteria can be conjugated to a light-generating
fusion protein and used in an animal model to follow the infection
process in vivo and to evaluate potential anti-infective drugs,
such as new antibiotics, for their efficacy in inhibiting the
infection.
[0169] Eukaryotic cells are also useful as entities in aspects of
the present invention. Appropriate expression vectors, containing
desired regulatory elements, are commercially available. The
vectors can be used to generate constructs capable of expressing
desired light-generating proteins in a variety of eukaryotic cells,
including primary culture cells, somatic cells, lymphatic cells,
etc. The cells can be used in transient expression studies, or, in
the case of cell lines, can be selected for stable
transformants.
[0170] Expression of the light-generating protein in transformed
cells can be regulated using any of a variety of selected
promoters. For example, if the cells are to be used as
light-emitting entities targeted to a site in the subject by an
expressed ligand or receptor, a constitutively-active promoter,
such as the CMV or SV40 promoter may be used. Cells transformed
with such a construct can also be used to assay for compounds that
inhibit light generation, for example, by killing the cells.
[0171] Alternatively, the transformed cells may be administered
such they become uniformly distributed in the subject, and express
the light-generating fusion protein only under certain conditions,
such as upon infection by a virus or stimulation by a cytokine.
Promoters that respond to factors associated with these and other
stimuli are known in the art. In a related aspect, inducible
promoters, such as the Tet system can be used to transiently
activate expression of the light-generating protein.
[0172] For example, CD4+ lymphatic cells can be transformed with a
construct containing tat-responsive HIV LTR elements, and used as
an assay for infection by HIV. Cells transformed with such a
construct can be introduced into SCID-hu mice and used as model for
human HIV infection and AIDS.
[0173] Tumor cell lines transformed to express the light-generating
fusion protein, for example, with a constitutively-active promoter,
may be used to monitor the growth and metastasis of tumors.
Transformed tumor cells may be injected into an animal model,
allowed to form a tumor mass, and the size and metastasis of the
tumor mass monitored during treatment with putative growth or
metastasis inhibitors. Tumor cells may also be generated from cells
transformed with constructs containing regulatable promoters, whose
activity is sensitive to various infective agents, or to
therapeutic compounds.
[0174] Cell Transformation.
[0175] Transformation methods for both prokaryotic cells and
eukaryotic cells are well known in the art. Vectors containing the
appropriate regulatory elements and multiple cloning sites are
widely commercially available (e.g., Stratagene, La Jolla, Calif.,
or Clontech, Palo Alto, Calif.).
[0176] In another aspect, the present invention includes transgenic
animals containing a heterologous gene construct encoding a
light-generating fusion protein or complex of proteins. The
construct is driven by a selected promoter, and can include, for
example, various accessory proteins required for the functional
expression of the light-generating protein, as well as selection
markers and enhancer elements.
[0177] Activation of the promoter results in increased expression
of the genes encoding the light-generating fusion proteins and
accessory proteins. Activation of the promoter is achieved by the
interaction of a selected biocompatible entity, or parts of the
entity, with the promoter elements. If the activation occurs only
in a part of the animal, only cells in that part will express the
light-generating protein.
[0178] Light-generating fusion proteins are typically administered
to a subject by any of a variety of methods, allowed to localize
within the subject, and imaged. Since the imaging, or measuring
photon emission from the subject, may last up to tens of minutes,
the subject is desirably immobilized during the imaging process.
Imaging of the light-generating polypeptide moiety involves the use
of, e.g., a photodetector capable of detecting extremely low levels
of light--typically single photon events--and integrating photon
emission until an image can be constructed. Examples of such
sensitive photodetectors include devices that intensify the single
photon events before the events are detected by a camera, and
cameras (cooled, for example, with liquid nitrogen) that are
capable of detecting single photons over the background noise
inherent in a detection system.
[0179] Once a photon emission image is generated, it is typically
superimposed on a "normal" reflected light image of the subject to
provide a frame of reference for the source of the emitted photons
(i.e., localize the light-generating fusion proteins with respect
to the subject). Such a "composite" image is then analyzed to
determine the location and/or amount of a target in the
subject.
[0180] Light-generating fusion proteins that have localized to
their intended sites in a subject may be imaged in a number of
ways. Guidelines for such imaging, as well as specific examples,
are described below.
[0181] Localization of Light-Generating Fusion Proteins.
[0182] In the case of "targeted" conjugates, that is, conjugates
which contain a targeting moiety--a molecule or feature designed to
localize the conjugate within a subject or animal at a particular
site or sites, localization refers to a state when an equilibrium
between bound, "localized", and unbound, "free" entities within a
subject has been essentially achieved. The rate at which such an
equilibrium is achieved depends upon the route of administration.
For example, a conjugate administered by intravenous injection to
localize thrombi may achieve localization, or accumulation at the
thrombi, within minutes of injection. On the other hand, a
conjugate administered orally to localize an infection in the
intestine may take hours to achieve localization.
[0183] Alternatively, localization may simply refer to the location
of the entity within the subject or animal at selected time periods
after the entity is administered. In a related aspect, localization
of, for example, injected tumors cells expressing a
light-generating moiety, may consist of the cells colonizing a site
within the animal and forming a tumor mass.
[0184] By way of another example, localization is achieved when an
entity becomes distributed following administration. For example,
in the case of a conjugate administered to measure the oxygen
concentration in various organs throughout the subject or animal,
the conjugate becomes "localized", or informative, when it has
achieved an essentially steady-state of distribution in the subject
or animal.
[0185] In all of the above cases, a reasonable estimate of the time
to achieve localization may be made by one skilled in the art.
Furthermore, the state of localization as a function of time may be
followed by imaging the light-emitting conjugate according to the
methods of the invention.
[0186] The "photodetector device" used should have a high enough
sensitivity to enable the imaging of faint light from within a
mammal in a reasonable amount of time, and to use the signal from
such a device to construct an image.
[0187] In cases where it is possible to use light-generating
moieties which are extremely bright, and/or to detect
light-generating fusion proteins localized near the surface of the
subject or animal being imaged, a pair of "night-vision" goggles or
a standard high-sensitivity video camera, such as a Silicon
Intensified Tube (SIT) camera (e.g. Hammamatsu Photonic Systems,
Bridgewater, N.J.), may be used. More typically, however, a more
sensitive method of light detection is required.
[0188] In extremely low light levels the photon flux per unit area
becomes so low that the scene being imaged no longer appears
continuous. Instead, it is represented by individual photons which
are both temporally and spatially distinct form one another. Viewed
on a monitor, such an image appears as scintillating points of
light, each representing a single detected photon. By accumulating
these detected photons in a digital image processor over time, an
image can be acquired and constructed. In contrast to conventional
cameras where the signal at each image point is assigned an
intensity value, in photon counting imaging the amplitude of the
signal carries no significance. The objective is to simply detect
the presence of a signal (photon) and to count the occurrence of
the signal with respect to its position over time.
[0189] At least two types of photodetector devices, described
below, can detect individual photons and generate a signal which
can be analyzed by an image processor. Reduced-Noise Photodetection
Devices achieve sensitivity by reducing the background noise in the
photon detector, as opposed to amplifying the photon signal. Noise
is reduced primarily by cooling the detector array. The devices
include charge coupled device (CCD) cameras referred to as
"backthinned", cooled CCD cameras. In the more sensitive
instruments, the cooling is achieved using, for example, liquid
nitrogen, which brings the temperature of the CCD array to
approximately -120.degree. C. "Backthinned" refers to an ultra-thin
backplate that reduces the path length that a photon follows to be
detected, thereby increasing the quantum efficiency. A particularly
sensitive backthinned cryogenic CCD camera is the "TECH 512", a
series 200 camera available from Photometries, Ltd. (Tucson,
Ariz.).
[0190] "Photon amplification devices" amplify photons before they
hit the detection screen. This class includes CCD cameras with
intensifiers, such as microchannel intensifiers. A microchannel
intensifier typically contains a metal array of channels
perpendicular to and co-extensive with the detection screen of the
camera. The microchannel array is placed between the sample,
subject, or animal to be imaged, and the camera. Most of the
photons entering the channels of the array contact a side of a
channel before exiting. A voltage applied across the array results
in the release of many electrons from each photon collision. The
electrons from such a collision exit their channel of origin in a
"shotgun" pattern, and are detected by the camera.
[0191] Even greater sensitivity can be achieved by placing
intensifying microchannel arrays in series, so that electrons
generated in the first stage in turn result in an amplified signal
of electrons at the second stage. Increases in sensitivity,
however, are achieved at the expense of spatial resolution, which
decreases with each additional stage of amplification. An exemplary
microchannel intensifier-based single-photon detection device is
the C2400 series, available from Hamamatsu.
[0192] Image Processors process signals generated by photodetector
devices which count photons in order to construct an image which
can be, for example, displayed on a monitor or printed on a video
printer. Such image processors are typically sold as part of
systems which include the sensitive photon-counting cameras
described above, and accordingly, are available from the same
sources. The image processors are usually connected to a personal
computer, such as an IBM-compatible PC or an Apple Macintosh (Apple
Computer, Cupertino, Calif,), which may or may not be included as
part of a purchased imaging system. Once the images are in the form
of digital files, they can be manipulated by a variety of image
processing programs (such as "ADOBE PHOTOSHOP", Adobe Systems,
Adobe Systems, Mt. View, Calif.) and printed.
[0193] The Detection Field Of The Device is defined as the area
from which consistent measurements of photon emission can be
obtained. In the case of a camera using an optical lens, the
detection field is simply the field of view accorded to the camera
by the lens. Similarly, if the photodetector device is a pair of
"night vision" goggles, the detection field is the field of view of
the goggles.
[0194] Alternatively, the detection field may be a surface defined
by the ends of fiber-optic cables arranged in a tightly-packed
array. The array is constructed to maximize the area covered by the
ends of the cables, as opposed to void space between cables, and
placed in close proximity to the subject. For instance, a clear
material such as plexiglass can be placed adjacent the subject, and
the array fastened adjacent the clear material, opposite from the
subject.
[0195] The fiber-optic cable ends opposite the array can be
connected directly to the detection or intensifying device, such as
the input end of a microchannel intensifier, eliminating the need
for a lens. An advantage of this method is that scattering and/or
loss of photons is reduced by eliminating a large part of the air
space between the subject and the detector, and/or by eliminating
the lens. Even a high-transmission lens transmits only a fraction
of the light reaching the front lens element.
[0196] With higher-intensity LGPs, photodiode arrays may be used to
measure photon emission. A photodiode array can be incorporated
into a relatively flexible sheet, enabling the practitioner to
partially "wrap" the array around the subject. This approach also
minimizes photon loss, and in addition, provides a means of
obtaining three-dimensional images of the bioluminescence. Other
approaches may be used to generate three-dimensional images,
including multiple detectors placed around the subject or a
scanning detector or detectors.
[0197] It will be understood that the entire animal or subject need
not necessarily be in the detection field of the photodetection
device. For example, if one is measuring a light-emitting conjugate
known to be localized in a particular region of the subject, only
light from that region, and a sufficient surrounding "dark" zone,
need be measured to obtain the desired information.
[0198] Immobilizing the Subject.
[0199] In those cases where it is desired to generate a two
dimensional or three-dimensional image of the subject, the subject
may be immobilized in the detection field of the photodetection
devices during the period that photon emission is being measured.
If the signal is sufficiently bright that an image can be
constructed from photon emission measured in less than about 20
milliseconds, and the subject is not particularly agitated, no
special immobilization precautions may be required, except to
insure that the subject is in the field of the detection device at
the start of the measuring period.
[0200] If, on the other hand, the photon emission measurement takes
longer than about 20 msec, and the subject is agitated, precautions
to insure immobilization of the subject during photon emission
measurement, commensurate with the degree of agitation of the
subject, need to be considered to preserve the spatial information
in the constructed image. For example, in a case where the subject
is a person and photon emission measurement time is on the order of
a few seconds, the subject may simply be asked to remain as still
as possible during photon emission measurement (imaging). On the
other hand, if the subject is an animal, such as a mouse, the
subject can be immobilized using, for example, an anesthetic or a
mechanical restraining device.
[0201] In cases where it is desired to measure only the total
amount of light emanating from a subject or animal, the subject
does not necessarily need to be immobilized, even for long periods
of photon emission measurements. All that is required is that the
subject be confined to the detection field of the photodetector
during imaging. It will be appreciated, however, that immobilizing
the subject during such measuring may improve the consistency of
results obtained, because the thickness of tissue through which
detected photons pass will be more uniform from animal to
animal.
Further Considerations During Imaging
[0202] The visualization of fluorescent light-generating moieties
requires an excitation light source, as well as a photodetector.
Furthermore, it will be understood that the excitation light source
is turned on during the measuring of photon emission from the
light-generating moiety.
[0203] Appropriate selection of a fluorophore, placement of the
light source and selection and placement of filters, all of which
facilitate the construction of an informative image, are discussed
above, in the section on fluorescent light-generating moieties.
[0204] High-Resolution Imaging.
[0205] Photon scattering by tissue limits the resolution that can
be obtained by imaging LGMs through a measurement of total photon
emission. It will be understood that the present invention also
includes embodiments in which the light-generation of LGMs is
synchronized to an external source which can be focused at selected
points within the subject, but which does not scatter significantly
in tissue, allowing the construction of higher-resolution images.
For example, a focused ultrasound signal can be used to scan, in
three dimensions, the subject being imaged. Light-generation from
areas which are in the focal point of the ultrasound can be
resolved from other photon emission by a characteristic oscillation
imparted to the light by the ultrasound.
[0206] Constructing an Image of Photon Emission.
[0207] In cases where, due to an exceptionally bright
light-generating moiety and/or localization of light-generating
fusion proteins near the surface of the subject, a pair of
"night-vision" goggles or a high sensitivity video camera was used
to obtain an image, the image is simply viewed or displayed on a
video monitor. If desired, the signal from a video camera can be
diverted through an image processor, which can store individual
video frames in memory for analysis or printing, and/or can
digitize the images for analysis and printing on a computer.
[0208] Alternatively, if a photon counting approach is used, the
measurement of photon emission generates an array of numbers,
representing the number of photons detected at each pixel location,
in the image processor. These numbers are used to generate an
image, typically by normalizing the photon counts (either to a
fixed, pre-selected value, or to the maximum number detected in any
pixel) and converting the normalized number to a brightness
(greyscale) or to a color (pseudocolor) that is displayed on a
monitor. In a pseudocolor representation, typical color assignments
are as follows. Pixels with zero photon counts are assigned black,
low counts blue, and increasing counts colors of increasing
wavelength, on up to red for the highest photon count values. The
location of colors on the monitor represents the distribution of
photon emission, and, accordingly, the location of light-generating
fusion proteins.
[0209] In order to provide a frame of reference for the conjugates,
a greyscale image of the (still immobilized) subject from which
photon emission was measured is typically constructed. Such an
image may be constructed, for example, by opening a door to the
imaging chamber, or box, in dim room light, and measuring reflected
photons (typically for a fraction of the time it takes to measure
photon emission). The greyscale image may be constructed either
before measuring photon emission, or after. The image of photon
emission is typically superimposed on the greyscale image to
produce a composite image of photon emission in relation to the
subject.
[0210] If it is desired to follow the localization and/or the
signal from a light-emitting conjugate over time, for example, to
record the effects of a treatment on the distribution and/or
localization of a selected biocompatible moiety, the measurement of
photon emission, or imaging can be repeated at selected time
intervals to construct a series of images. The intervals can be as
short as minutes, or as long as days or weeks.
[0211] Analysis of Photon Emission Images
[0212] Images generated by methods and/or using compositions of the
present invention may be analyzed by a variety of methods. They
range from a simple visual examination, mental evaluation and/or
printing of a hardcopy, to sophisticated digital image analysis.
Interpretation of the information obtained from an analysis depends
on the phenomenon under observation and the entity being used.
[0213] Applications: Localization of Tumor Cells
[0214] The growth and metastatic spread of tumors in a subject may
be monitored using methods and compositions of the present
invention. In particular, in cases where an individual is diagnosed
with a primary tumor, LGPs directed against the cells of the tumor
can be used to both define the boundaries of the tumor, and to
determine whether cells from the primary tumor mass have migrated
and colonized distal sites. For example, LGPs, such as liposomes
containing antibodies directed against tumor antigens and loaded
with LGPs, can be administered to a subject, allowed to bind to
tumor cells in the subject, imaged, and the areas of photon
emission can be correlated with areas of tumor cells.
[0215] In a related aspect, images utilizing tumor-localizing LGPs,
such as those described above, may be generated at selected time
intervals to monitor tumor growth, progression and metastasis in a
subject over time. Such monitoring may be useful to record results
of anti-tumor therapy, or as part of a screen of putative
therapeutic compounds useful in inhibiting tumor growth or
metastasis.
[0216] In the practice of the invention, the tissue and the
light-generating fusion protein can be contacted in vitro, such as
where one or more biological samples (e.g., blood, serum, cells,
tissue) are arrayed on a substrate under tissue culture conditions
known by those in the art to preserve the viability of the tissue
and then the fusion protein is added to the tissue culture. In a
preferred embodiment of the methods of the invention the tissue is
mammalian tissue, in particular human tissue.
[0217] The methods of the invention can also be practiced in vivo
wherein the biological sample and the light-generating fusion
protein are contacted by administration of the fusion protein (or a
vector encoding the same) to a subject suspected of containing
ischemic tissue under conditions to allow detection of the fusion
protein in ischemic tissue present in the subject. The invention
thus also pertains to the field of predictive medicine in which
diagnostic assays, prognostic assays, pharmacogenomics, and
monitoring clinical trials are used for prognostic (predictive)
purposes to thereby treat an individual prophylactically.
Accordingly, one aspect of the invention relates to diagnostic
assays for determining the presence of ischemic tissue in a
biological sample to thereby determine whether an individual is
afflicted with a disease or disorder, or is at risk of developing a
disorder, associated with hypoxic conditions. The invention also
provides for prognostic (or predictive) assays for determining
whether an individual is at risk of developing conditions arising
from ischemia.
[0218] Referring now to the Drawings, FIG. 1A is a schematic
representation of different fusion proteins of the present
invention. "T" indicates the enzyme target site on the fusion
protein, "E" indicates the enzyme, "X" indicates the modification
site on the fusion protein, and "R" indicates the reporter domain
of the fusion protein. The modification at "X" by "E"results in the
fusion protein becoming active or inactive "On/Off". FIG. 1B shows
an embodiment wherein the "T" and the "X" are separate domains and
are in cis on the fusion protein. FIG. 1C shows an embodiment of
the invention wherein the "T" and the "X" of the fusion protein are
congruent within a domain of the fusion protein. FIG. 1D shows an
embodiment of the invention wherein the "T" is on a protein
associated with the fusion protein containing the "X".
[0219] FIG. 2 is a schematic representation of different fusion
proteins of the present invention. FIG. 2A is a schematic
representation of a fusion protein and associated protein of the
present invention in which a fusion protein and an associated
protein "A" contains a known homo- or hetero-dimerization domain
"HD" corresponding to the enzyme target site of an enzyme, where
binding of the enzyme-associated "A" to the HD on the fusion
protein results in modification of the fusion protein at "X". FIG.
2B is a related aspect of the invention in which a binding domain
of a protein "A" containing an enzyme target site "T" interacts
with a binding domain "B" of a fusion protein, which results in
enzyme "E" modifying the reporter domain "R" of fusion protein "B"
at modification site "X" such that the fusion protein does or does
not emit light or cause light to be emitted.
[0220] FIG. 3 shows pVHL binding to a modified form of HIF. (A)
shows pVHL-defective renal carcinoma cells treated with increasing
amounts of desferoxamine (2, 10, 100, 1000 .mu.m) or cobalt
choloride (2, 10, 100, 1000 .mu.m) and immunoprecipitated with
control (lane 1) or anti HIF2.alpha. antibody. Bound proteins were
detected by anti-HIF2.alpha. immunoblot (IB) or by farwestern (FW)
analysis with purified pVHL/elongin B/elongin C (VBC) complexes.
(B) shows VBC farwestern and anti-HIF2.alpha. immunoblot analysis
of ts20 cells grown at the restrictive temperature under hypoxic or
normoxic conditions. (C and D) depict GST-HIF1.alpha.(530-652),
containing the oxygen-dependent degradation domain (ODD), produced
in E. coli, recovered on glutathione Sepharose, and incubated with
rabbit reticulocyte lysate for 90 min at 30.degree. C. In (D, lane
3), the reticulocyte lysate was first heat inactivated for 20 min.
Following stringent washes the GST-ODD protein was subjected to VBC
farwestern and anti-GST immunoblot analysis.
[0221] FIG. 4 shows pVHL binding to a HIF1.alpha.-derived peptide
if Leu562 and Pro564 are intact. (A) shows binding of the indicated
.sup.35S-labeled Gal4-HIF1.alpha. fusion proteins to immobilized
GST-pVHL, elongin B, elongin C complexes. (B) shows binding of
.sup.35S-labeled pVHL to biotinylated HIF1.alpha. (556-575)
peptides with the indicated substitutions of residues 561-568. `+`
indicates preincubation of peptide with unprogrammed reticulocyte
lysate prior to addition of pVHL. (C and D) depict .sup.35S-labeled
wild-type (WT), Pro564Ala, and Leu562Ala full-length HA-HIF1.alpha.
(panel C) and Ga14-HA-HIF1.alpha.(530-652) (panel D) proteins
immunoprecipitated with anti-HA antibody or captured with
immobilized GST-VBC complexes. WG=wheat germ extract ; Retic=rabbit
reticulocyte lysate.
[0222] FIG. 5 shows ubiquitination and degradation of HIF linked to
Leu562 and Pro 564. (A) depicts in vitro ubiquitination of
.sup.35S-labeled wild-type, Leu562A, and Pro564A
Ga14-HA-HIF1.alpha.(530-652) in the presence of S100 extracts
prepared from pVHL-defective renal carcinoma cells stably
transfected to produce wild-type pVHL or with empty vector. (B)
shows in vitro degradation of .sup.35S-labeled wild-type,
Leu562Ala, and Pro564Ala in xenopus egg extracts. (C) is an anti-HA
immunoblot analysis of COS7 cells transiently transfected with 1.5
or 3.5 .mu.g of plasmids encoding wild-type or P564A HA-HIF.alpha.
in the absence or presence of desferoxamine.
[0223] FIG. 6 depicts proline hydroxylation linked to pVHL-binding.
(A) is a MALDI-TOF analysis of wild-type, Pro564Ala, and Leu562Ala
biotinylated HIF (556-575) peptides following incubation with
rabbit reticulocyte lysate. (B) shows Gal4-HA-HIF (555-575)
translated in vitro in the presence of 3H-Proline with rabbit
reticulocyte lysate or wheat germ extract and gel-band purified.
Following acid hydrolysis proline and hydroxyproline were separated
using thin layer chromatography. The dashed circle indicates
positions of ninhydrin stained proline and hydroxyproline
markers.
[0224] FIG. 7 illustrates that pVHL specifically recognizes
HIF1.alpha. with hydroxylated proline 564. (A and B) shows binding
of .sup.35S-labeled pVHL to biotinylated HIF.alpha. (556-575)
peptides with the indicated substitutions of residues 561-568. (C)
shows ts20 cells stably transfected to produce HA-pVHL grown at
restrictive (lane 1) or permissive (lanes 2-6) temperature and
immunoprecipitated anti-HIF1.alpha. (lane 1 and 2) or anti-HA
antibody (lanes 3-7). Bound proteins were eluted by boiling in
sample buffer (lane 1 and 2) or treatment with the indicated
peptides and then immunoblotted with anti-HIF1.alpha. antibody. (D)
shows pVHL-defective renal carcinoma cells stably transfected to
produce wild-type pVHL (WT8) or with empty vector (RC3)
metabolically labeled with .sup.35S methionine, lysed, and
incubated with immobilized biotinylated HIF1.alpha. (556-575)
peptides with the indicated substitutions of residue 564.
Specifically bound proteins were detected by autoradiography.
[0225] FIG. 8 illustrates the production of TETr-cyclins A and E.
(A) is a schematic of TETr-cyclin fusion protein. (B) shows
production of TETr-cyclin A and TETr-cyclin E. Cells transfected to
produce the indicated cyclin A or cyclin E proteins were lysed and
immunoblotted (IB) with the indicated antibodies. (C) shows
phosphorylation of pRB by TETr-cyclins A and E in SAOS-2 cells.
pRB-defective SAOS-2 cells transfected so as to produce HA-tagged
pRB along with the indicated cyclins were lysed and immunoblotted
with anti-HA antibody. The % of transfected cells in G1 and S phase
was determined by fluororescence activated cell sorting (FACS).
[0226] FIG. 9 shows DNA bound cyclins A and E differentially
affecting transcription. (A) is a schematic of reporter plasmid
(pUHC 13-3) that contains seven TETracycline operator sequences
(TETo) upstream of a minimal CMV promoter that includes a TATA box.
(B, C) show U20S cells were cotransfected with plasmids encoding
the indicated TETr fusion proteins along with the pUHC 13-3
reporter plasmid and a plasmid encoding .beta.-galactosidase.
Numbers shown at the bottom of the graph indicate the amount of
TETr plasmid (in .mu.g). 48 hours later luciferase activity,
normalized for .beta.-galactosidase, was determined. Fold
repression is the corrected luciferase value for TETr alone divided
by the corrected luciferase values for the indicated TETr fusion
proteins. Fold activation represents the corrected luciferase
values for the indicated TETr fusion proteins divided by the
corrected luciferase value for TETr alone.
[0227] FIG. 10 illustrates transcriptional regulation by cyclins A
and E dependent upon DNA binding. (A) shows U2OS cells
cotransfected with plasmids encoding the indicated TETr fusion
proteins along with the pUHC 13-3 reporter plasmid and a plasmid
encoding .beta.-galactosidase. 24 hours later doxycycline was added
to a final concentration of 2 .mu.g/ml where indicated by a `+`. 24
hours later, luciferase activity, corrected for
.beta.-galactosidase activity, was determined and expressed as fold
repression or activation relative to cells producing TETr alone.
(B) shows U2OS cells cotransfected with plasmids encoding the
indicated cyclins along with the pUHC 13-3 reporter plasmid and a
plasmid encoding .beta.-galactosidase. Fold repression and
activation was determined as in (A). (C) shows U2OS cells
cotransfected with plasmids encoding TETr or TETr-cyclin E, along
with a minimal HSV-TK promoter reporter plasmid containing the
indicated number of TETo binding sites and a plasmid encoding
.beta.-galactosidase. Doxycycline was added as in (A).
[0228] FIG. 11 illustrates that cyclin box is required for
transcriptional repression by DNA bound cyclin A. (A) U2OS cells
were cotransfected with plasmids encoding the indicated TETr-cyclin
A variants along with pUHC 13-3 reporter plasmid and a plasmid
encoding .beta.-galactosidase. Cell extracts were prepared and
luciferase activity, corrected for .beta.-galactosidase activity,
was expressed as fold repression relative to cells producing TETr
alone. (B) The indicated TETr-cyclin A variants were translated in
vitro in the presence of .sup.35S-methionine and incubated with
GST-cdk2 and glutathione Sepharose. Specifically bound proteins
were resolved by SDS-polyacrylamide gel electrophoresis and
detected by autoradiography. In parallel, 20% of the input proteins
were resolved by SDS-polyacrylamide gel electrophoresis and
detected by autoradiography. (c) pRB defective SAOS-2 cells
transfected so as to produce HA-tagged pRB along with the indicated
TETr-cyclin A variants were lysed and immunoblotted with anti-HA
antibody.
[0229] FIG. 12 shows transcriptional activation by cyclin E linked
to its ability to bind to cdk2 and interact with substrates. (A)
U2OS cells were cotransfected with plasmids encoding the indicated
TETr-cyclin E variants along with the pUHC 13-3 reporter plasmid
and a plasmid encoding .beta.-galactosidase. Cell extracts were
prepared, and luciferase activity, corrected for
.beta.-galactosidase activity, was expressed as fold activation
relative to cells producing TETr alone. (B) The indicated
TETr-cyclin E variants were translated in vitro in the presence of
.sup.35S-methionine and incubated with GST-cdk2 and glutathione
Sepharose. Specifically bound proteins were resolved by
SDS-polyacrylamide gel electrophoresis and detected by
autoradiography. In parallel, 20% of the input proteins were
resolved by SDS-polyacrylamide gel electrophoresis and detected by
autoradiography. (c) pRB defective SAOS-2 cells transfected so as
to produce HA-tagged pRB along with the indicated TETr-cyclin E
variants were lysed and immunoblotted with anti-HA antibody.
[0230] FIG. 13 shows transcriptional activation by DNA bound cyclin
E dependent on cdk2 catalytic activity. (A, B) U2OS cells were
transiently cotransfected with plasmids encoding TETr-cyclin A or E
and, where indicated, increasing amounts of a plasmid encoding a
dominant-negative (dn) form of cdk2. Cell extracts were prepared
and luciferase activity, corrected for .beta.-galactosidase
activity, was determined. Corrected luciferase values were
expressed as fold repression (A) or activation (B) relative to TETr
alone. (C) U2OS cells were transiently transfected with plasmids
encoding TETr-cdk2 or TETr-cdk2 (N132A) and a plasmid encoding
either cyclin A or E. Cell extracts were prepared and luciferase
activity, corrected for .beta.-galactosidase activity, was
determined. Corrected luciferase values were expressed as fold
activation relative to TETr alone.
[0231] FIG. 14 shows transcriptional effects mediated by cell-cycle
dependent changes in endogenous cyclins E and A. (A, B) 3T3 cells
stably transfected with a luciferase reporter plasmid containing 7
TETo sites (pUHC13-3) and a plasmid encoding TETr-cdk2 were
serum-starved for 72 hours and subsequently re-fed with serum. At
various timepoints thereafter aliquots of cells were removed and
either lysed for immunoblot analysis with the indicated antibodies
or analyzed for DNA content by propidium iodide staining followed
by fluorescence activated cell sorting (FACS). (C) 3T3 cells stably
transfected with a luciferase reporter plasmid containing 7 TETo
sites (pUHC13-3) in the absence (open circles) or presence of a
plasmid encoding TETr-cdk2 (closed squares) or TETr-cdk2 (N132A)
(open squares) were serum-starved for 72 hours and then re-fed with
serum in the presence or absence of doxycycline. At various
timepoints thereafter luciferase assays were performed. To correct
for general effects due to serum, the luciferase values at each
timepoint in the absence of doxycycline were corrected by
subtracting the luciferase assay obtained in the presence of
doxycycline. After correction, the luciferase values for the two
cell populations were expressed relative to the corresponding
luciferase values obtained at time 0. In parallel, the cells
producing TETr-cdk2 were lysed and immunoprecipitated with
anti-cyclin A or anti-cyclin E antibodies. The immunoprecipitates
were then used to phosphorylate Histone H1 in vitro.
[0232] Methods of Treating Hypoxia or Ischemia Related Tissue
Damage and Modulating Angiogenesis or Vascularization.
[0233] Tissue ischemia is a major cause of morbidity and mortality.
In principle, drugs that stabilize HIF may augment angiogenesis and
the adaptation of hypoxia. The activation of HIF by hypoxia is
complex and involves protein stability, nuclear localization, DNA
binding capability and transcriptional activation function. The
discovery that proline hydroxlaytion governs HIF turnover in the
presence of oxygen will facilitate the dissection of the mechanism
underlying the various aspects of HIF regulation.
[0234] The invention also provides various methods of treating,
i.e., reducing, preventing or delaying the onset of HIF-1 related
disorders, modulating angiogenesis or vascularization. Examples of
HIF-1 mediated disorders include chronic and acute hypoxia or
ischemia related disorders such as tissue damage and scarring.
Acute hypoxia or ischemia related disorders include for example
myocardial infarction, stroke, cancer and diabetes such as tissue
damage and scarring. Chronic hypoxia or ischemia related disorders
include for example, deep vein thrombosis, pulmonary embolus and
renal failure.
[0235] In one aspect the invention the invention provides methods
of treating or preventing a hypoxic or ischemic related disorder or
modulating angiogenesis or vascularization by administering to a
subject a compound that decreases prolyl hydroxylase, expression or
activity. Examples of prolyl hydroxylase include human Egl-9 or
homologs. (Epstein, et al Cell 107:43-54, 2001) The compound can be
a prolyl hydroxylase antibody, a nucleic acid that decreases the
expression of a nucleic acid that encodes a prolyl hydroxylase
polypeptides such as a prolyl hydroxylase anti-sense nucleic acid
or a compound identified by any of the methods of the invention.
Preferably, the half life of HIF in the subject is increased in the
presence of the compound as compared to the absence of the
compound.
[0236] In a further aspect the invention includes a method of
treating cancer in a subject by administering to the subject a
compound that increases prolyl hydroxylase expression or activity.
Preferably, the compound is a compound that has been identified by
the methods of the invention.
[0237] In another aspect the invention provides a method for
treating or preventing a hypoxia or ischemic related disorder in a
subject by administering to a subject a compound that which
modulates prolyl hydroxylation of HIF.
[0238] In still a further aspect the invention provides a method
for treating or preventing a HIF related disorder by administering
to a subject a compound that which modulates prolyl hydroxylation
of HIF such that the HIF related disorder is prevented reversed of
stabilized.
[0239] In yet another aspect the invention provides a method for
regulating HIF turnover in a subject by administering to a subject
a compound that which modulates prolyl hydroxylation.
[0240] By "modulates" is meant to increase or decrease the prolyl
hydroxylation of HIF. Compounds that inhibits prolyl hydroxylation
include several small molecule proline hydroxylase inhibitors which
have been developed as antifibrotic agents.
[0241] The subject is preferably a mammal. The mammal can be, e.g.,
a human, non-human primate, mouse, rat, dog, cat, horse, or cow. In
various aspects the subjects include patients with coronary,
cerebral, or peripheral arterial disease and patients with one or
more non-healing wounds.
EXAMPLES
Example 1. Characterization of Hypoxia-Responsive Polypeptides
[0242] In order to demonstrate the efficacy of the First embodiment
of the invention, e.g. employing a hypoxia-responsive LGP, the
interaction of pVHL and HIF was examined. A HIF1.alpha. polypeptide
that is sufficient to bind pVHL is disclosed herein. pVHL binds
directly to a region of HIF1.alpha. called the oxygen-dependent
degradation domain (ODD). pVHL recognizes HIF produced in rabbit
reticulocyte lysate but not HIF produced in wheat germ extracts or
in E. Coli. Furthermore, wheat germ or E. Coli-derived HIF binds to
pVHL following preincubation with a human, rabbit, or xenopus cell
extracts at 37.degree. C. For example, glutathione
S-transferase-ODD fusion proteins produced in E. Coli were not
recognized by VBC in farwestern assays (FIG. 3C). These proteins
were recognized, however, after pre-incubation with a rabbit
reticulocyte lysate. Similar results were obtained with GST-ODD
fusion proteins of various sizes, thus excluding the possibility
that the farwestern blot signal represents a spurious interaction
between VBC and a reticulocyte-derived protein. VBC did not
recognize GST-ODD fusion proteins incubated with a heat-inactivated
reticulocyte lysate (FIG. 3D). Gal4-HIF fusion proteins containing
HIF residues 555-575 bound specifically to immobilized GST-VHL,
elongin B, elongin C complexes (FIG. 4A). Coupled in vitro
transcription/translation of .sup.35S-labeled proteins was
conducted according to the manufacturer's instructions (TNT,
Promega). Also, a biotinylated peptide corresponding to HIF
residues 556-575 bound to pVHL following pre-incubation with
reticulocyte lysate (FIG. 4B). For peptide binding studies, 1 .mu.g
of biotinylated peptide was bound to 30 .mu.l of monomeric avidin
Sepharose (Pierce). Where indicated, the peptide was pre-incubated
with 50 .mu.l of rabbit reticulocyte lysate for 90 min at
30.degree. C. The Sepharose was then washed 3 times with NETN (20
mM Tris pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% non-idet P40) and used
in binding reactions containing 4 .mu.l .sup.35S-HA-pVHLin 500
.mu.l of EBC or 500 .mu.l .sup.35S-radiolabeled cell extract
(equivalent to cells from a subconfluent 100 mm dish). Following 1
hour incubation at 4.degree. C. with rocking the Sepharose was
washed 4 times with NETN. Bound proteins were eluted by boiling in
SDS-containing sample buffer and detected by autoradiography. This
region of HIF contains a highly conserved 8 mer (MLAPYIPM) which,
when mutated to 8 consecutive alanines, leads to HIF stabilization
in cells. An alanine scan of this region showed that Leu562 and
Pro564 were essential for specific binding to pVHL in this assay
(FIG. 4B). In contrast, mutation of the one potential
phosphoacceptor in this peptide, Tyr565, did not affect pVHL
binding, in keeping with an earlier study in which a Tyr565Phe
mutation did not affect HIF stability. In addition, the binding of
pVHL to GST-ODD in the assays described above was unaffected by
phosphatase treatment.
[0243] Binding of pVHL to HIF1.alpha. is critically dependent upon
residues Leu562 or Pro564 of HIF1.alpha.. Importantly, mutation of
either Leu562 or Pro564 in the context of full-length HIF1.alpha.
or a Gal4-ODD fusion protein also led to a loss of pVHL binding
activity (FIG. 4C and 4D, respectively). Gal4-ODD made with
reticulocyte lysate contained an electrophoretically distinct band
compared with Gal4-ODD made with wheat germ extract (FIG. 4D). This
electrophoretically distinct protein bound to VBC and was
undetectable among the Leu562Ala and Pro564Ala translation
products. The isoelectric points of the two arrowed bands in FIG.
4D were identical following 2-D gel electrophoresis indicating that
the putative modification did not involve a change in protein
charge.
[0244] Modification of HIF.alpha.by pVHL following binding is also
critically dependent upon residues Leu562 or Pro564 of HIFl.alpha..
Gal4-HIF fusion proteins with the Leu562Ala mutation or Pro564Ala
mutation displayed diminished pVHL-dependent polyubiquitination in
vitro relative to the corresponding wild-type protein (FIG. 5A).
Qualitatively similar results were obtained with the corresponding
full-length HIF1.alpha. species, although this assay is less robust
than with the Gal4-ODD fusion proteins. Likewise, HIF1.alpha.
Pro564Ala and HIF1.alpha. Leu562Ala were far more stable than
wild-type HIF1.alpha. in in vitro degradation assays performed with
xenopus extracts (FIG. 5B). Xenopus egg extracts were made as is
well known in the art and stored frozen until use. Degradation
reactions contained 8 .mu.l of egg extract, 0.1 .mu.l of 100 mg/ml
cyclohexamide, 0.25 .mu.l of energy regeneration mix, 0.25 .mu.l of
bovine ubiquitin, and 0.4 .mu.l of .sup.35S-radiolabeled HIF and
were carried out at room temperature. At the indicated timepoints 1
.mu.l aliquots were removed and placed in sample buffer. Samples
were resolved on 5-15% gradient gels and analyzed by
autoradiography. Biotinylated HIF (556-575) peptides were incubated
with rabbit reticulocyte lysate, washed, eluted with free biotin,
and analyzed by mass spectrometry. 1 .mu.l of HPLC-purified peptide
was bound to 30 .mu.l monomeric avidin Sepharose and incubated with
100 .mu.l of rabbit reticulocyte lysate at room temperature for 1
hour with tumbling. Following brief centrifugation the reticulocyte
lysate was removed, fresh reticulocyte lysate was added, and the
cycle was repeated 6 times. The Sepharose was then washed 4 times
with NETN and once with PBS. The modified peptide was eluted in 50
.mu.l of 20 mM ammonium acetate [pH 7.0], 2 mM biotin. In these
experiments Met561 and Met568 were converted to alanine to prevent
spurious oxidation of the methionine residues during analysis. This
double alanine substitution, like the corresponding single
substitutions, did not affect pVHL binding. Treatment of the HIF
(556-575) peptide with rabbit reticulocyte lysate led to the
appearance of a second peak in MALDI-TOF assays representing an
increase in molecular weight of 16 (FIG. 6A). This peak was not
detectable prior to incubation with reticulocyte lysate and was not
detected in the corresponding reticulocyte-treated Leu562Ala and
Pro564Ala peptides (FIG. 6A). Postsource decay analysis using the
same instrument placed the addition of +16 at Pro 564. Similarly,
electrospray ion trap mass spectrometry/mass spectrometry (MS/MS)
analysis was consistent with addition of +16 at Pro 564 and
excluded such a modification of Leu 562. Finally, MS/MS analysis of
the reticulocyte-treated HIF (556-575) peptide produced a pattern
of ions that was identical to the pattern obtained with a HIF
(556-575) peptide which was synthesized to contain hydroxyproline
at position 564. Next, Gal4-HIF (555-575) was translated in vitro
in the presence of .sup.3H-Proline using rabbit reticulocyte lysate
or wheat germ extract, gel-band purified, and subjected to acid
hydrolysis and thin layer chromatography. 2 ml of .sup.3H-P-labeled
Gal4-HIF (555-575) in vitro translate was immunoprecipitated with
50 .mu.g of anti-HA antibody (12CA5, Roche), resolved on a 12%
SDS-polyacrylamide gel, and transferred to a PVDF membrane.
Ga14-HIF (555-575) was visualized by autoradiography and the
corresponding region of PVDF was excised, hydrolyzed by incubation
in 100 .mu.l of 10 N HC1 at 105.degree. C. for 3 hours. Samples
were evaporated to dryness, resuspended in 20 .mu.l H.sub.2O
containing 10 .mu.g of unlabeled proline and 4-OH proline (Sigma),
and resolved by 2-D thin layer chromatography using
phenol-distilled H.sub.2O in the first dimension and
N-butanol-acetic acid-H.sub.2O in the second. Following
visualization of standards with ninhydrin radiolabeled proline was
detected by autoradiography. Gal4-HIF produced in rabbit
reticulocyte lysate, but not in wheat germ, contained
hydroxyproline (FIG. 6B).
[0245] pVHL specifically recognizes a proline hydroxylated
determinant. The HIF (556-575) peptide containing hydroxyproline at
position 564 bound to pVHL with or without pretreatment with
reticulocyte lysate (FIG. 7A). The mass spectrometry analysis of
the Leu562Ala peptide showed that Leu562 was required for HIF
modification (FIG. 6A). Indeed, pVHL bound to a HIF (556-575)
peptide with the Leu562Ala substition and hydroxyproline at residue
564 (FIG. 7B). This suggests that the primary role of Leu562 is to
allow for the hydroxylation of Pro564. Two approaches were used to
demonstrate that hydroxylated HIF peptide could interact with
cell-derived pVHL complexes. Ts20 cells were engineered to produce
HA-tagged pVHL which carry a temperature-sensitive mutation in the
El-ubiquitin activating enzyme. ts20 cells were transfected with
pIRES-HA-VHL, pIRES-HA-VHL (Y98H), or pIRES-Neo (Invitrogen) and
selected in the presence of 1 mg/ml G418. Individual G418-resistant
colonies were isolated using cloning cylinders and expanded. Cells
producing HA-VHL or HA-VHL (Y98H) were identified by anti-HA
immunoblot analysis. HIF coimmunoprecipitated with HA-pVHL at the
restrictive temperature. HIF bound to pVHL in this way could be
eluted by the hydroxylated HIF (556-575) peptide but not the
unmodified peptide (FIG. 7C). For the tests shown in FIG. 7C, ts20
cells were grown at the restrictive or permissive temperature for
14 hour, methionine-starved for 90 min, and then grown in the
methionine-free media supplemented with .sup.35S-met (500 mCi/ml)
for 90 min. Cells were washed once with cold PBS, lysed in EBC, and
immunoprecipitated with anti-HA (12CA5; Roche or anti-HIF1.alpha.
(NB100-105; Novus). Following 5 washes with NETN bound proteins
were eluted by boiling in sample buffer or by incubation in 65
.mu.l of PBS containing 7 .mu.g of the indicated peptide. Moreover,
HIF was not eluted by the HIF (556-575) Pro564Ala peptide or by a
poly-hydroxyproline peptide (FIG. 7C) Affinity chromatography was
performed with immobilized peptides and metabolically labeled
matched renal carcinoma cells which do (WT8) or do not (RC3)
produce HA-pVHL. 786-O subclones were starved for 1 hour, grown in
the methionine-free media supplemented with .sup.35S-met (500
mCi/ml) for 3 hr, washed once with ice cold PBS, and lysed in EBC.
The proline hydroxylated HIF (556-575) peptide specifically bound
to pVHL as well as proteins with the expected electrophoretic
mobilities of the pVHL-associated proteins elongin B, elongin C,
and Cu12 (FIG. 7D). The identity of pVHL in this experiment was
confirmed by western blot analysis. Likewise, the binding of
endogenous pVHL to the hydroxylated peptide was detected using 293
embryonic kidney cells. A HIF1.alpha. mutant in which Proline 564
was converted to alanine was stabilized in cells and insensitive to
the hypoxia-mimetic desferoxamine (FIG. 5C).
[0246] The HIF1.alpha. protein is stabilized in hypoxic conditions
and functions to inhibit, decrease and/or reverse hypoxia in
affected tissues, e.g. in a solid tumor, diabetic retinopathy or
ischemic heart tissue, in part by modulating pro-angiogenic
factors. A light-generating fusion protein containing a HIF1.alpha.
moiety will also be stabilized in hypoxic tissue. Destruction of a
HIF1.alpha. protein or a HIF1.alpha.-containing LGP via the pVHL
ubiquitin pathway occurs, e.g. during normoxia, when a prolyl
hydroxylase modifies the HIFla protein such that pVHL binds to and
modifies HIF1.alpha.. This modification process acts as a dynamic
switch to regulate the bioluminescence of the
HIF1.alpha.-containing light-generating fusion protein such as the
First embodiment of the invention. A HIF1.alpha.-containing
light-generating fusion protein is useful to dynamically image
hypoxic tissues, e.g. cancer, in situ, and to screen for or test
the efficacy of hypoxia-modulating compounds.
Example 2
[0247] The following example demonstrates the efficacy of
light-generating fusion proteins of the invention for imaging
hypoxic tissues.
[0248] The Oxygen-Dependent Degradation Domain (ODD) of
HIF1.alpha., renders HIF1.alpha. unstable in the presence of
oxygen. This region is recognized by pVHL. pVHL specifically binds
directly to peptidic determinants, corresponding to HIF1.alpha.
residues 555-575, located within the ODD. At the core of this
peptide there is a conserved proline residue (residue 564) which,
in the presence of oxygen, becomes enzymatically hydroxylated. This
residue serves as the signal for pVHL to bind. In sum, in the
presence of oxygen, the HIF peptide becomes hydroxylated and is
recognized by pVHL. In the absence of oxygen (hypoxia), the
modification does not take place and pVHL does not bind to HIF.
Construction of ODD-LUC plasmids
[0249] In a first set of experiments the ability of a small HIF
peptide (555-575) to function in cis to target a foreign protein
for pVHL-dependent proteolysis was evaluated. To this end, the HIF
cDNA encoding amino acids 555-575 (hereafter `ODD`) was PCR
amplified with oligonucleotides that introduced convenient
restriction sites, digested, and gel-band purified. The PCR
fragment was then subcloned, in-frame, 3' of a Firefly luciferase
cDNA contained in the pGL3 plasmid (Promega). The resulting
luciferase-ODD chimeric cDNA was subcloned into pcDNA3 (Invitrogen)
to facilitate in vitro translation and expression studies in
mammalian cells. In parallel a pcDNA3 plasmid encoding wild-type
Firefly luciferase and pcDNA3 plasmid encoding wild-type
HIF1.alpha. was used as controls.
VBC-GST Pulldown of ODD-Luciferase
[0250] To determine whether the ODD-luciferase protein could bind
to pVHL, GST-VHL, elongin B, and elongin C (`GST-VBC`) were
produced in E. Coli and recovered as a trimeric complex on
glutathione sepharose. Earlier work showed that pVHL does not fold
properly in the absence of elongin B and elongin C. HIF1.alpha.,
ODD-luciferase, and wild-type luciferase were translated in vitro
using rabbit reticulocyte lysate (RRL) or wheat germ extract (WG)
in the presence of .sup.35S methionine (FIG. 15). Aliquots from the
in vitro translation reactions were added to recombinant VBC-GST
prebound to glutathione sepharose and incubated for 1 hour. The
sepharose was then washed and bound proteins were resolved on a 12%
SDS polyacrylamide gel. The gel was then dried and exposed to film.
pVHL bound to reticulocyte-generated HIF1.alpha. and ODD-Luc, but
not Luc (compare lanes 4, 8 and, 12). Furthermore, pVHL did not
bind to wheat germ produced ODD-Luc, as wheat germ lacks the HIF
prolyl hydroxylase (compare lanes 6 and 8). Thus the data show that
ODD-Luc was specifically recognized by pVHL.
Peptide Competition Assay
[0251] The observation that pVHL bound to ODD-Luc produced in RRL,
but not WG, strongly suggested that the ODD-Luc, like HIF, needed
to undergo prolyl hydroxylation in order to be recognized by pVHL.
To study this further, the GST-VBC binding experiments were
repeated in the presence of synthetic HIF (555-575) peptides in
which Pro 564 was hydroxylated (P-OH) or was not hydroxylated (P).
GST-VBC was mixed with either the control (P) peptide or the P-OH
peptide in increasing concentrations (from 0-5 .mu.g). Next in
vitro translated (in retic lysate) Luc, ODD-Luc, or HIF1.alpha. was
then added to see if it could efficiently compete off any bound
P--OH. HIF and ODD-Luc were able to compete off the P--OH peptide
effectively at even very high concentrations of P--OH. Thus, the
results obtained with ODD-Luc recapitulated earlier binding studies
performed with authentic HIF. (FIG. 16.)
Luciferase Activity in Cells
[0252] In pilot experiments, it was confirmed that ODD-Luc in vitro
translate retained luciferase activity in vitro comparable to
wild-type luciferase. To begin to ask whether the ODD-Luc was
oxygen sensitive in cells, transient transfection assays were
performed. In the first set of experiments, 100 mm tissue culture
plates were seeded with 8.times.10.sup.5 HeLa cells per plate.
Eighteen hours later the cells were transiently transfected, using
lipofectamine (Gibco), with the pcDNA3 plasmids encoding ODD-Luc or
wild-type Luc along with an internal control plasmid encoding
Renilla luciferase. Twenty-four hours after transfection the cells
were split into 6 well plates and allowed to adhere and grow for
8-12 hours. At this point the hypoxia mimetics desferrioxamine
(DFO) or cobalt chloride (CoCl2) were added directly to the media
at final concentrations of 500 mM and 200 mM respectively, in
duplicate wells. In addition, some wells were not treated so as to
serve as controls. 12 hours after treatment with DFO and CoCl.sub.2
the cells were lysed with Passive Lysis Buffer (Promega), rocked at
room temperature for 20 minutes, and assayed for Firefly and
Renilla Luciferase according to the manufacturers instructions.
Results were obtained in duplicate and averaged. (FIG. 17).
[0253] In the untreated cells the luciferase values for ODD-Luc
were approximately 30% of the values obtained with wild-type Luc.
Note that HeLa cells have wild-type pVHL and these experiments were
conducted using cells grown in the presence of oxygen. The addition
of hypoxia-mimetics led to a marked increased in ODD-Luc luciferase
activity, whereas no such induction was detected with wild-type
luciferase. The induced levels of ODD-luciferase were comparable to
those obtained with wild-type luciferase. These results are
consistent with the idea that ODD-Luc is subject to pVHL-dependent
proteolysis in cells whereas wild-type Luc is not.
Imaging of ODD-Luc in Xenograft Tumors in Nude Mice.
[0254] To verify in a mammalian system that the ODD-Luc gene is
indeed regulated by hypoxia or hypoxia-mimetics, the following
experiment was conducted. Given the ease of subcutaneously
transplanting tumors and their ability to grow and vascularize, the
ability to image luciferase activity of tumors at the subcutaneous
level and assess ODD-Luc's response to hypoxia was tested as
follows.
[0255] Polyclonal Hela cells stably transfected with ODD-Luc and
Luc were generated. The clones were suspended in PBS and counted.
10.sup.6 cells per injection site were administered subcutaneously
in duplicate into the flanks of nude mice (FIG. 18). Upon growth of
palpable tumors (approximately 3-4 days) the mice were given
intraperitoneal injections of phenobarbital for anesthesia,
injected with a weight-adjusted dose of luciferin, and whole body
imaged with a Xenogen Camera. To ensure that the difference in
luciferase activity was not simply a function of tumor size alone,
bidimensional tumor measurements were taken and were approximately
equal.
[0256] FIG. 18 shows three different mice injected with ODD-Luc
(right) and Luc (left) in duplicate. The sites where ODD-Luc was
injected clearly have attenuated luciferase signal. As such, the
data show a real attenuation of luciferase activity, secondary
ubiquitination and destruction of ODD-Luc.
Example 3. Light-Generating Fusion Proteins Including a DNA Binding
Site
[0257] In order to demonstrate the efficacy of the Second
embodiment of the invention, a LGP capable of interacting with
nucleic acids in order to kinetically monitor gene transcription in
vivo, in vitro or in silico, the impact of cyclins on transcription
was examined. As it is useful to monitor either the induction or
repression of transcription, cyclins with specific affects on
transcription were investigated.
[0258] Fusion of a DNA-binding motif to a cyclin does not alter
cyclin binding to a cdk or the kinase activity of the cyclin/cdk
complex. Mammalian expression plasmids were generated that encode
fusion proteins consisting of the TET repressor DNA-binding domain
(TETr) (Gossen and Bujard, 1992) fused to cyclin A or cyclin E with
an intervening flexible linker consisting of Gly.sub.4-Ser repeats
(FIG. 8A). Both of these plasmids gave rise to stable proteins of
the expected size following transfection into mammalian cells (FIG.
8B). TETr-cyclin A and TETr-cyclin E, like their unfused
counterparts, bound to cdk2 (FIGS. 11 and 12) and could
phosphorylate p107 in vitro. Furthermore, both TETr-cyclin A and
TETr-cyclin E promoted pRB phosphorylation and bypassed a
pRB-induced G1/S block when cointroduced with wild-type pRB into
pRB-defective tumor cells (FIG. 8C).
[0259] Cyclin A and cyclin E dramatically affect transcription.
U2OS cells were transiently transfected with plasmids encoding
various TETr fusion proteins and a luciferase reporter plasmid
containing 7 TETo binding sites upstream of a TATA box derived from
the CMV promoter (FIG. 9A). TETr binds specifically to TETo sites.
As expected, TETr-RB repressed transcription from this reporter
plasmid whereas TETr-E2F1 activated the reporter (FIGS. 9B-C). The
basal activity observed with this reporter plasmid presumably
reflects the presence of cryptic enhancer sequences. In this and
subsequent assays, the TETr domain alone was essentially inert.
Surprisingly, TETr-cyclin A and TETr-cyclin E both dramatically
affected transcription in this assay and did so in opposite ways.
TETr-cyclin A decreased transcription approximately 80% (5-fold
repression) whereas TETr-cyclin E increased transcription 10-fold
(FIGS. 9B-C). Doxycycline prevents the binding of TETr to TETo and
completely blocked the transcriptional effects of TETr-cyclin A and
TETr-cyclin E (FIG. 10A). As expected, doxycycline also blocked the
transcriptional effects of TETr-RB and TETr-E2F1, which were tested
in parallel. Furthermore, unfused cyclin A and E had no effects on
the TETo-driven reporter plasmid (FIG. 10B). Experiments were
repeated using reporters containing 1, 2, 3, or 7 TETo in which the
CMV-derived TATA box was replaced with a minimal HSV TK promoter
(Gossen and Bujard, 1992) (FIG. 10C). TETr-cyclin E also activated
these reporters in doxycycline-inhibitable manner. The degree of
activation observed with the HSV TK series of reporters was lower
than with the CMV TATA-based reporter, in keeping with earlier
results obtained with these reporters and fused TETr to the HSV
VP16 transcriptional activation domain (Gossen and Bujard). The low
basal level of transcription from these reporters precluded
analysis of repression by cyclin A.
[0260] The specific domains of the cyclins that bind to the cdks
are critical for cyclin-mediated transcriptional regulation.
Plasmids encoding TETr fused to various colinear fragments of
cyclin A and E were used to determine which regions of these
molecules are required for transcriptional regulation (FIGS. 11 and
12). All of the resulting fusion proteins were expressed at
comparable levels in transient transfection experiments. Cyclin A
(1-310), like wild-type cyclin A, repressed transcription when
fused to TETr (FIG. 11A). This fragment of cyclin A does not bind
to cdk2 (FIG. 11B) and cannot direct the phosphorylation of pRB
when introduced into cells (FIG. 11C). Conversely, a cyclin A point
mutant (E220A) (Schulman et al.,1998) that measurably interacts
with cdk2 (FIG. 11B) and directs the phosphorylation of pRB (FIG.
11C) did not repress transcription in these assays (FIG. 1IA). This
mutation maps to the cyclin A cyclin box (FIG. 11A). TETr-cyclin A
also repressed transcription when tested in p107-/-; p130-/- mouse
fibroblasts and cyclin A (1-310) does not bind to either p107 or
p130. Only those cyclin E mutants that bind to cdk2 (FIG. 12B) and
could direct the phosphorylation of pRB (FIG. 12C) scored as
transcriptional activators (FIG. 12A). For example, Schulman et al
(1998) identified cyclin A residues that are critical for substrate
binding and assembly with cdk2. Mutation of analogous residues in
cyclin E produced a mutant (cyclin E L134A/Q174A) that likewise
failed to bind to cdk2 (FIG. 12B) and failed to phosphorylate pRB
(FIG. 12C). This mutant did not activate transcription (FIG. 12).
In keeping with these results, a dominant-negative form of cdk2
blocked transcriptional activation by cyclin E (FIG. 13B) but had
no effect on transcriptional repression by cyclin A (FIG. 13A).
Similarly, cyclin E, but not cyclin A, activated transcription in
concert with a TETr-cdk2 fusion provided the kinase domain was
intact (FIG. 13C). Comparable production of TETr-cdk2 and
kinase-defective TETr-cdk2(N132A) was confirmed by immunoblot
assay. Xenopus cyclin E (Jackson et al.,1995), like its human
counterpart, also activated transcription in these assays (data not
shown). This activity was specific as xenopus cyclin E variants
with point mutations affecting the cyclin box were inert.
[0261] The Second embodiment of the invention is useful to
dynamically image transcription in vivo. For example, cyclin E can
activate transcription under physiological conditions. 3T3 cells
were transfected with the plasmid containing a selectable marker
and TETo reporter plasmid with or without a plasmid encoding
TETr-cdk2. Following drug selection, the stable transfectants were
maintained as polyclonal pools and serum starved into quiescence.
At various timepoints after serum refeeding, cell lysates were
prepared and used in immunoblot, in vitro kinase, and luciferase
assays (FIG. 14). In parallel, aliquots of the cells were analyzed
for DNA content by FACS. In this system, S-phase entry began 18-20
hours following the addition of serum. As expected, luciferase
activity increased in the TETr-cdk2 producing cells coincident with
an increase in cyclin E protein levels and cyclin E-associated
kinase activity (FIGS. 14A-C). No such increase was observed in the
cells producing equivalent amounts of TETr-cdk2 (N132A) or
transfected with the reporter alone (FIG. 14C and data not shown).
Note that the amount of TETr-cdk2 in these cells was less than the
amount of endogenous cdk2 (FIG. 14B). Thus, the results are
unlikely to be an artifact of overproduction. Luciferase values
declined as cyclin E levels fell and cyclin A levels began to
rise.
[0262] The Second embodiment of the invention in part relates to
LGPs containing cyclin binding domains. Thus, these LGPs are useful
to dynamically quantify alterations in transcription of cell-cycle
associated genes, such as oncogenes and tumor suppressors. A LGP
containing a cyclin-binding moiety can be localized to regions
undergoing cell proliferation, such as a tumor, and can be used to
screen for and determine the efficacy of cell proliferation
modulating compounds.
MATERIALS AND METHODS
Cell Lines and Transfection
[0263] U2OS human osteosarcoma cells were grown in Dulbecco's
modified Eagle media (DMEM) supplemented with 10% heat-inactivated
fetalclone (Hyclone) (FC), 100 units/ml penicillin, 100 mg/ml
streptomycin, and 2 mM L-glutamine (PSG). SAOS-2 human osteosarcoma
cells and NIH 3T3 mouse fibroblast cells were grown in DMEM
supplemented with 10% heat-inactivated fetal bovine serum (FBS) and
PSG. NIH 3T3 stable subclones transfected with the pCMV-neo and
pUHC13-3 reporter plasmid alone or with pSG5-TETr-cdk2 or with
pSG5-TETr-cdk2(N132A) were maintained in 0.7 mg/ml of G418. Cells
were transfected using 2.times.Bes-buffered saline
(2.times.BBS)/calcium phosphate as described (Chen and Okayama,
1987). Where indicated doxycycline (Sigma) was added 24 hours after
transfection to a final concentration of 2 .mu.g/ml. Cells were
maintained in doxycycline for an additional 24 hours prior to
harvest.
Plasmids
[0264] pRcCMV-cdk2 dominant negative (van den Heuvel and Harlow,
1993) was a gift of Dr. Ed Harlow; pVL1393-cdk2(N132A) (Xu et al.,
1994) was a gift of Dr. Helen Piwnica-Worms; pCD19 (Tedder and
Isaacs, 1989) was a gift of Dr. Thomas Tedder and pUHC13-3;
ptet1-T81luc, ptet2-T81-luc, ptet3-T81-luc, and ptet7-T81-luc
(Gossen and Bujard, 1992) were gifts of Dr Manfred Gossen.
pSG5-TETr-E2F1, pSG5-TETr-RB, pSG5-HA-RB (Sellers, 1995),
pGEX-2TK-cdk2 (Adams et al., 1996) have been described previously.
To make pSG5-TETr-cyclin A, a protein phosphatase 1 (PP1) cDNA was
first PCR amplified with oligos
5'-GCGCTGATCAGGCGGAGGCGGATCAGGAGGAGGAGGATCAGGCGGAGGAGGATCAGGAT
CCATGTCCGACAGCGAGAA-3' (SEQ ID NO: 7) and
5'-GCGCGAATTCATTTCTTGGCTTTGGCAGA-3' (SEQ ID NO: 8). The PCR product
was cut with Bc1I and EcoRI and subcloned into pSG5-TETr cut with
BamHI and EcoRI to make pSG5-TETr-(G1Y.sub.4-Ser).sub.3-PP1. The
cyclin A open reading frame (ORP) was PCR amplified with primers
that introduced a 5' BamHI site and a 3' EcoRI site and subcloned
into pSP72 (Promega) cut with these two enzymes to make
pSP72-cyclin A. The PPI `suffer `from
pSG5-TETr-(Gly.sub.4-Ser).sub.3-PP1 was then excised by digestion
with BamHI and EcoRI and replaced with the cyclin A cDNA insert
from pSP72-cyclin A. To make pSG5-TETr-cyclin E, the cyclin E ORF
in pRcCMV-cyclin E was PCR amplified with primers that introduced a
5' BglII and 3' EcoRI site. The PCR product was cut with these two
enzymes and ligated into the BamHI-EcoRI backbone of pSG5-TETr-PP1.
In parallel, these restricted cyclin A and cyclin E PCR products
were subcloned into pSG5-HA cut with BamHI and EcoRI to make
pSG5-HA-cyclin A and pSG5-HA-cyclin E, respectively. Plasmids
encoding cyclin A and cyclin E N-terminal and C-terminal deletion
mutants were made in an analogous fashion by using PCR primers that
selectively amplified the desired coding regions. To make
pSG5-TETr-cdk2 and pSG5-TETr-cdk2 (N132A), the cdk2 ORF in
pRcCMV-cdk2 and pVL1393-cdk2 (N132A), respectively, were PCR
amplified with primers that introduced a 5' BamHI and 3' EcoRI
site. The PCR products were cut with these two enzymes and ligated
into the BamHI-EcoRI backbone of pSG5-TETr-PP1. All PCR reactions
were performed with Pfu DNA polymerase and the authenticity of
plasmids containing the entire cyclin A, cyclin E, or cdk2 open
reading frame was confirmed by direct DNA sequencing.
pSG5-TETr-cyclin A (E220A) and pSG5-TETr-cyclin E (L134A/Q174A)
were generated using Transformer Site-Directed Mutagenesis Kit
(Clontech) according to manufacture's instructions using
pSG5-TETr-cyclin A and pSG5-TETr-cyclin E as a template,
respectively, and confirmed by DNA sequencing.
[0265] Antibodies and Immunoblot Analysis
[0266] Monoclonal anti-TETr was purchased from Clontech and anti-HA
(12CA5) was purchased from Boehringer Mannheim. Polyclonal
anti-cyclin A (SC-751), monoclonal and polyclonal anti-cyclin E
(SC-247, SC-481), and polyclonal anti-cdk2 (SC-163) were purchased
from Santa Cruz. Cell extracts were made by lysis in EBC buffer
(50mM Tris [pH8], 120 mM NaCl, 0.5% Nonidet P-40). For immunoblot
analysis, .about.100 .mu.g of cell extract was loaded per lane.
Nitrocellulose filters were blocked in 4% powdered milk/1% goat
serum in TBS-T (10 mM Tris [pH 8], 0.05% Tween, 150 mM NaC1) for 1
hour at room temperature prior to incubation in primary antibody.
Anti-HA (12CA5) was used at a concentration of 1.0 .mu.g/ml,
anti-TETr antibody at 1:500 dilution (v/v), anti-cyclin A (SC-751)
at 1:1,000 dilution (v/v), anti-cyclin E (SC-247, SC-481) at
1:1,000 dilution (v/v) and anti-cdk2 (SC-163) at 1:1,000 dilution
(v/v). Following 4 washes with TBS/T, bound antibody was detected
using alkaline phosphatase-conjugated secondary antibodies.
[0267] GST Pull-Down Assay
[0268] Glutathione S-transferase pull-down assays were performed
basically as described previously (Kaelin et al., 1991). Binding
reactions contained 10 .mu.l of .sup.35S-radiolabelled in vitro
translates made with a TNT kit (Promega) and approximately 1 .mu.g
of the indicated GST fusion protein in 1 ml of NETN (20mM Tris [pH
8], 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40). Following 1 hour
incubation at 4.degree. C. with rocking, the Sepharose was washed 5
times with NETN. Bound proteins were eluted by boiling in
SDS-containing sample buffer and resolved by SDS-polyacrylamide gel
electrophoresis. Comparable loading of GST-fusion proteins was
confirmed by Coomassie brilliant blue staining and
.sup.35S-radiolabelled proteins were detected by fluorography.
[0269] FACS/Cell Cycle Analysis
[0270] Fluorescence activated cell sorting (FACS) was done
essentially as described (Qin et al., 1995). Briefly, subconfluent
SAOS-2 cells grown in 100 mm dishes were transfected with 2 .mu.g
of pCD19 and 10 .mu.g of pSG5-HA-RB together with plasmids encoding
the indicated cyclins. 72 hr later the cells were harvested with
trypsin-EDTA and stained with FITC-conjugated anti-CD19 antibody
(CALTAG) and propiodium iodide. Samples were analyzed by two-color
FACS with a FACScan (Becton Dickinson). For cell cycle
synchronization, cells were starved in serum-free DMEM for 72 hours
before being stimulated with 10% FBS.
[0271] Luciferase Reporter Gene Assay
[0272] For TETr-fusion transcriptional assay, subconfluent U2OS
cells were transiently transfected in 6-well plates in duplicate
with 1 .mu.g of pCMV-.mu.gal, 1 .mu.g of pUHC13-3 reporter plasmid,
and 3 .mu.g of the indicated plasmids encoding TETr-fusion
proteins. Sufficient parental pSG5-TETr was added so that each
reaction contained the same amount of pSG5-TETr backbone. 48 hours
after transfection luciferase activity and .beta.-galactosidase
activity was determined as described previously (Qin, 1995).
[0273] In Vitro Kinase Assay
[0274] 500 .mu.g of cell extract was incubated with protein A
Sepharose and 1 .mu.g of anti-cyclin E (SC-481) or anti-cyclin A
(SC-751) antibody for 1 hour at 4.degree. C. in a final volume of
0.5 mL. The Sepharose was then washed 5 times with NETN and 3 times
in IP kinase (IPK) buffer (50 mM Tris-HC1 [pH 7.5], 10 mM
MgCl.sub.2, 1 mM DTT). The Sepharose was then resuspended in 27
.mu.l of IPK buffer to which was added 2 .mu.l of histone H1 (1
mg/ml) and 1 .mu.l of [.gamma..sup.-32P] ATP (6,000 Ci/mmol, 10
mCi/ml) and incubated for 30 min at 30.degree. C. Reactions were
stopped by addition of Laemmli sample buffer, boiled, resolved by
SDS-polyacrylamidel gel electrophoresis, and subjected to
autoradiography.
References:
[0275] G. Semenza, Annu. Rev. Cell Dev. Biol. 15, 551-578
(1999).
R. Wenger, J Exper Biol. 203, 1253-1263 (2000).
G. Semenza, Cell 98, 281-4 (1999).
[0276] H. Zhu, F. Bunn, Resp. Phys. 115, 239-247 (1999).
M. Ivan, W. G. Kaelin, Current Opinion in Gen and Dev In Press
(2000).
E. Maher, W. G. Kaelin, Medicine 76, 381-91 (1997).
M. Tyers, R. Rottapel, Proc Nall Acad Sci USA 1999 Oct. 26;96(22):
12230-2 96, 12230-2 (1999).
W. Krek, Nat Cell Biol. 2000 July; 2(7):E121-3 2, E121-3
(2000).
C. E. Stebbins, W. G. Kaelin, N. P. Pavletich, Science 284, 455-461
(1999).
M. Ohh, et al., Nature Cell Biology 2, 423-427 (2000).
[0277] T. Kamura, et al., Proc. Natl. Acad. Sci. (USA) 97,
10430-10435 (2000). M. Cockman, et al., J Biol. Chem 275, 25733-41
(2000).
K. Tanimoto, Y. Makino, T. Pereira, L. Poellinger, EMBO J 19,
4298-4309 (2000).
P. Maxwell, et al., Nature 399, 271-5 (1999).
M. A. Goldberg, S. P. Dunning, H. F. Bunn, Science 242, 1412-1415
(1988).
G. Wang, G. Semenza, Blood 82, 3610-5 (1993).
V. Ho, H. Bunn, Biochem Biophys Res Commun 1996 Jun. 5;
223(1):175-80 223, 175-80 (1996).
D. Chowdary, J. Dermody, K. Jha, H. Ozer, Mol Cell Biol 14,
1997-2003 (1994).
L. E. Huang, J. Gu, M. Schau, H. F. Bunn, Proc Natl Acad Sci U S A
95, 7987-92 (1998).
[0278] C. Pugh, 1. O'Rourke, M. Nagao, J. Gleadle, P. Ratcliffe, J
Biol. Chem 272, 11205-14 (1997).
V. Srinivas, L. Zhang, X. Zhu, J. Caro, Biochem Biophys Res Commun
260, 557-61 (1999).
K. I. Kivirikko, J. Myllyharju, Matrix Biology 16, 357-368
(1998).
A. Winter, A. Page, Mol Cell Biol. 20, 4084-4093 (2000).
L. Friedman, et al., Proc Natl Acad Sci USA 97, 4736-41 (2000).
O Iliopoulos, A. Kibel, S. Gray, W. G. Kaelin, Nature Medicine 1,
822-826 (1995).
R. Deshaies, Annu Rev Cell Dev Biol 15, 435-67 (1999).
Y. Takahashi, S. Takahashi, Y. Shiga, T. Yoshimi, T. Miura, J Biol
Chem 275, 14139-46 (2000).
C. Levene, C. Bates, Biochim Biophys Acta 444, 446-52 (1976).
L. Huang, W. Willmore, J. Gu, M. Goldberg, H. Bunn, J Biol Chem
274, 9038-44 (1999).
Y. Liu, et al., J Biol Chem 273, 15257-62 (1998).
T. Morita, S. Kourembanas, J Clin Invest 96, 2676-82 (1995).
C. Sutter, E. Laughner, G. Semenza, Proc Natl Acad Sci USA 97,
4748-53 (2000).
G. Wang, B. Jiang, G. Semenza, Biochem Biophys Res Commun 1995 Nov.
13; 216(2):669-75 216, 669-75 (1995).
K. Sogawa, et al., Proc Natl Acad Sci U S A 1998 Jun. 23;
95(13):7368-73 95,7368-73 (1998).
S. Salceda, I. Beck, V. Srinivas, J. Caro, Kidney Int 1997
February; 51(2):556-9 51, 556-9 (1997).
J. Wingrove, P. O'Farrell, Cell 1999 Jul 9; 98(1):105-14 98, 105-14
(1999).
L. Palmer, G. Semenza, M. Stoler, R. Johns, Am J Physiol 274,
L212-9 (1998).
G. Melillo, et al., J Exp Med 1995 Dec. 1; 182(6):1683-93
182,1683-93 (1995).
M. Bickel, et al., Hepatology 28, 404-11 (1998).
T. Franklin, W. Morris, P. Edwards, M. Large, R. Stephenson,
Biochem J 353, 333-338 (2001).
[0279] Adams, P. D., Sellers, W. R., Sharma, S. K., Wu, A. D.,
Nalin, C. M. and Kaelin, W. G. (1996) Identification of a
Cyclin-cdk2 recognition motif present in substrates and p21-like
cdk inhibitors. Mol Cell. Biol. 16, 6623-6633 Adams, P. D., Li, X.,
Sellers, W. R., Baker, K. B., Leng, X., Harper, J. W., Taya, Y. and
Kaelin, W. G. (1999) The retinoblastoma protein contains a
C-terminal motif that targets it for phosphorylation by cyclin/cdk
complexes. Mol. Cell.Biol. 19, 1068-1080 Akoulitchev, S., Chuikov,
S., Reinberg, D. (2000) TFIIH is negatively regulated by
cdk8-containing mediator complexes. Nature, 407, 102-6 Bagby, S.,
Kim, S., Maldonado, E., Tong, K. I., Reinberg, D. and Ikura, M.
(1995) Solution structure of the C-terminal core domain of human
TFIIB : similarity to cyclin A and interaction with TATA-binding
protein. Cell 82, 857-867 Bandara, L. R., Adamczewski, J. P., Hunt,
T. and La Thangue, N. B. (1991) Cyclin A and the retinoblastoma
gene product complex with a common transcription factor. Nature
352, 249-251 Beijersbergen, R. L., Carlee, L., Kerkhoven, R. M. and
Bernards, R. (1995) Regulation of the retinoblastoma
protein-related p107 by G1 cyclin complexes. Genes Dev. 9,
1340-1353 Bieniasz, P. D., Grdina, T. A., Bogerd, H. P. and Cullen,
B. R. (1999) Recruitment of cyclin T1/P-TEFb to an HIV type 1 long
terminal repeat promoter proximal RNA target is both necessary and
sufficient for full activation of transcription. Proc. Natl. Acad.
Sci. USA 96, 7791-7796 Bochar, D. A., Pan, Z. Q., Knights, R.,
Fisher, R. P., Shilatifard, A. and Shiekhattar, R. (1999)
Inhibition of transcription by the trimeric cyclin-dependent kinase
7 complex. Biol. Chem. 274, 13162-13166 Chen, C. and Okayama, H.
(1987) High-efficiency transformation of mammalian cells by plasmid
DNA. Mol. Cell. Biol. 7, 2745-2752 Chen, J., Saha, P., Kornbluth,
S., Dynlacht, B. D. and Dutta, A. (1996) Cyclin-binding motifs are
essential for the function of p21 CIP1. Mol. Cell. Biol. 16,
4673-4682 Dahmus, M. E. (1996) Reversible phosphorylation of the
C-terminal domain of RNA polymerase II. J Biol. Chem. 271,
19009-19012 Devoto, S. H., Mudryj, M., Pines, J., Hunter, T. and
Nevins, J. R. (1992) A cyclin A protein kinase complex possesses
sequence specific DNA binding activity; p33cdk2 is a component of
the E2F-Cyclin A complex. Cell 68, 167-176 Dynlacht, B. D. (1997)
Regulation of transcription by proteins that control the cell
cycle. Nature 389, 149-152 Dynlacht, B. D., Brook, A., Dembski, M.,
Yenush, L. and Dyson, N. (1994) DNA-binding and trans-activation
properties of drosophila E2F and DP proteins. Proc. Natl. Acad.
Sci. USA 91, 6359-6363 Dynlacht, B. D., Moberg, K., Lees, J. A.,
Harlow, E. and Zhu, L. (1997) Specific regulation of E2F family
members by cyclin-dependent kinases. Mol. Cell. Biol. 17, 3867-3875
Ewen, M. E., Faha, B., Harlow, E. and Livingston, D. M. (1992)
Interaction of p107 with cyclin A independent of complex formation
with viral oncoproteins. Science 255, 85-87 Faha, B., Ewen, M.,
Tsai, L., Livingston, D. M. and Harlow, E. (1992) Interaction
between human cyclin A and adenovirus E1A-associated p107 Protein.
Science 255, 87-90 Felzen, L. K., Farrell, S., Betts, J. C.,
Mosavin, R. and Nabel, G. J. (1999) Specificity of cyclin-cdk2,
TFIIB, and E1A interactions with a common domain of the p300
coactivator. Mol. Cell. Biol. 19, 4241-4246 Fu, T. J., Peng, J.,
Lee, G., Price, D. H. and Flores, 0. (1999) Cyclin K functions as a
CDK9 regulatory subunit and participates in RNA polymerase II
transcription. J Biol. Chem. 274, 34527-34530 Gebara, M. M., Sayre,
M. H. and Corden, J. L. (1997) Phosphorylation of the
carboxy-terminal repeat domain in RNA polymerase II by
cyclin-dependent kinases is sufficient to inhibit transcription. J
Cell. Biochem. 64, 390-402 Gossen, M. and Bujard, H. (1992) Tight
control of gene expression in mammalian cells by
tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89,
5547-5551 Hannon, G. J., Demetrick, D. and Beach, D. (1993)
Isolation of the Rb-related p130 through its interactions with CDK2
and cyclins. Genes Dev. 7, 2378-2391 Hengartner, C. J., Myer, V.
E., Liao, S. M., J., W. C., Koh, S. S. and Young, R. A. (1998)
Temporal regulation of RNA polymerase II by Srb10 and Kin28
cyclin-dependent kinases. Mol. Cell 2, 43-53 Jackson, P. K.,
Chevalier, S., Philippe, M. and Kirschner, M. W. (1995) Early
events in DNA replication require cyclin E and are blocked by
p21CIP1. J Cell. Biol. 130, 755-69 Jeffrey, P., Gonna, S. and
Pavletich, N. (1995) Crystal structure of the tetramerization
domain of the p53 tumor suppressor at 1.7 angstroms. Science 267,
1498-1502 Jones, K. A. (1997) Taking a new TAK on Tat
transactivation. Genes Dev. 11, 2593-2599 Kaelin, W. G., Pallas, D.
C., DeCaprio, J. A., Kaye, F. J. and Livingston, D. M. (1991)
Identification of cellular proteins that can interact specifically
with the T/E1A-binding region of the retinoblastoma gene product.
Cell 64, 521-532 Kimmelman, J., Kaldis, P., Hengartner, C. J.,
Laff, G. M., Koh, S. S., Young, R. A. and Solomon, M. J. (1999)
Activating phosphorylation of the Kin28p subunit of yeast TFIIH by
Cak1p. Mol. Cell. Biol. 19, 4774-4787 Krek, W., Ewen, M.,
Shirodkar, S., Arany, Z., Kaelin, W. G. and Livingston, D. M.
(1994) Negative regulation of the growth-promoting transcription
Factor E2F-1 by a stably bound cyclin A-dependent protein kinase.
Cell 78, 1-20 Lania, L., Majello, B. and Napolitano, G. (1999)
Transcriptional control by cell-cycle regulators: a review. J Cell.
Physiol. 179, 134-141 Lee, M. H., Williams, B. O., Mulligan, G.,
Mukai, S., Bronson, R. T., Dyson, N., Harlow, E. and Jacks, T.
(1996) Targeted disruption of p107: functional overlap between p107
and Rb. Genes Dev. 10, 1621-1632 Lees, E., Faha, B., Dulic, V.,
Reed, S. I. and Harlow, E. (1992) Cyclin E/cdk2 and cyclin A/cdk2
kinases associate with p107 and E2F in a temporally distinct
manner. Genes Dev. 6, 1874-1885 Leresche, A., Wolf, V. J. and
Gottesfeld, J. M. (1996) Repression of RNA polymerase II and III
transcription during M phase of the cell cycle. Exp Cell Res. 229,
282-288 Ma, T., Van Tine, B. A., Wei, Y, Garrett, M. D., Nelson,
D., Adams, P. D., Wang, J., Qin, J., Chow, L. T., Harper, J. W.
(2000) Cell cycle-regulated phosphorylation of p220NPAT by cyclin
E/Cdk2 in Cajal bodies promotes histone gene transcription. Genes
Dev., 14, 2298-2313 Majello, B., Napolitano, G., Giordano, A. and
Lania, L. (1999) Transcriptional regulation by targeted recruitment
of cyclin-dependent CDK9 kinase in vivo. Oncogene, 18, 4598-4605
Mudryj, M., Devoto, S. H., Hiebert, S. W., Hunter, T., Pines, J.
and Nevins, J. R. (1991) Cell cycle regulation of the E2F
transcription factor involves an interactin with cyclin A. Cell 65,
1243-1253 Neuman, E., Ladha, M. H., Lin, N., Upton, T. M., Miller,
S. J., DiRenzo, J., Pestell, R. G., Hinds, P. W., Dowdy, S. F.,
Brown, M., Ewen, M.E. (1997) Cyclin D1 stimulation of estrogen
receptor transcriptional activity independent of cdk4. Mol Cell
Biol 17, 5338-47 Noble, M. E., Endicott, J. A., Brown, N. R. and
Johnson, L. N. (1997) The cyclin box fold: protein recognition in
cell-cycle and transcription control. Trends Biochem Sci. 22,
482-487 Peeper, D. S., Parker, L. L., Ewen, M. E., Toebes, M.,
Frederick, F. L., Xu, M., Zantema, A., van der Eb, A. J. and
Pinwica-Worms, H. (1993) A- and B- type cyclins differentially
modulate substrate specificity of cyclin-CDK complexes. EMBO J 112,
1947-1954 Perkins, N. D., Felzen, L. K., Betts, J. C., Leung, K.,
Beach, D. H. and N abel, G. J. (1997) Regulation of NF-kappaB by
cyclin-dependent Kinases associated with the p300 Coactivator.
Science 275, 523-527 Qin, X.-Q., Livingston, D. M., Ewen, M.,
Sellers, W. R., Arany, Z., and Kaelin, W. G. (1995) The
transcription factor E2F1 is a downstream target of RB action. Mol.
Biol. Cell. 15, 742-755 Rickert, P., Corden, J. L. and Lees, E.
(1999) Cyelin C/CDK8 and cyclin H/CDK7/p36 are biochemically
distinct CTD kinases. Oncogene 18, 1093-1102 Roberts, J. M. (1999)
Evolving ideas about cyclins. Cell 98, 129-132 Schulman, B.,
Lindstrom, D. and Harlow, E.: (1998) Substrate recruitment to
cyclin-dependent kinase 2 by a multipurpose docking site on cyclin
A. Proc. Natl. Acad. Sci. USA 95, 10453-10458 Schwarz, J. K.,
Devoto, S. H., Smith, E. J., Chellappan, S. P., Jakoi, L. and
Nevins, J. R. (1993) Interactions of the p107 and Rb proteins with
E2F during the cell proliferation response. EMBO J 1 12, 1013-1020
Sellers, W. R., Neuman, E. and Kaelin, W. G. (1995) The
Retinoblastoma protein contains a potent transrepression domain
which Induces a cell-cycle block when bound to DNA. Proc. Natl.
Acad. Sci. USA 92, 11544-11548 Shanahan, F., Seghezzi, W., Parry,
D., Mahony, D. and Lees, E. (1999) Cyclin E associates with BAF155
and BRG1, components of the mammalian SWI-SNF complex, and alters
the ability of BRG1 to induce growth arrest. Mol. Cell. Biol. 19,
1460-1469 Sherr, C J. (1996) Cancer Cell Cycles. Science, 274,
1672-1677 Smith, E. J., Leone, G. and Nevins, J. R. (1998) Distinct
mechanisms control the accumulation of the Rb-related p107 and p130
proteins during cell growth. Cell Growth Differ. 9, 297-303
Starostik, P., Chow, K. N, and Dean, D. C. (1996) Transcriptional
repression and growth suppression by the p107 pocket protein. Mol.
Cell. Biol. 16, 3606-3614 Tedder, T. F. and Isaacs, C. M. (1989)
Isolation of cDNAs Encoding the CD19 Antigen of Human and Mouse B
Lymphocytes. J. Immunology 143, 712-717 van den Heuvel, S. and
Harlow, E. (1993) Distinct roles for cyclin-dependent kinases in
cell cycle control. Science 262, 2050-2053 Weinberg, R. A. (1995)
The retinoblastoma protein and cell cycle control. Cell 81, 323-330
Xu, M., Sheppard, K. A., Peng, C-Y., Yee, A. S., and Piwnica-Worms,
H. (1994) Cyclin A/cdk2 binds directly to E2F1 and inhibits the
DNA-binding activity of E2F1/DP1 by phosphorylation. Mol. Cell.
Biol. 14, 8420-8431 Yankulov, K. Y. and Bentley, D. L. (1997)
Regulation of CDK7 substrate specificity by MAT1 and TFIIH. EMBO J.
16, 1638-1646 Zamanian, M. and La Thangue, N. B. (1993)
Transcriptional repression by the RB-related protein p107. Mol.
Biol. Cell 4, 389-396 Zhao, J., Dynlacht, B., lmai, T., Hon, T. and
Harlow, E. (1998) Expression of NPAT, a novel substrate of cyclin
E-CDK2, promotes S-phase entry. Genes Dev. 12, 456-461 Zhao, J.,
Kennedy, B. K., Lawrence, B. D., Barbie, D. A., Matera, A. G.,
Fletcher, J. A. and Harlow, E. (2000) NPAT links cyclin E-Cdk2 to
the regulation of replication-dependent histone gene transcription.
Genes and Dev. 14, 2283-2297 Zhu, L., Enders, G., Lees, J. A.,
Beijersbergen, R. L., Bernards, R. and Harlow, E. (1995a) The
pRB-related protein p107 contains two growth suppression domains:
Independent interactions with E2F and cyclin/cdk complexes. EMBO J.
14, 1904-1913 Zhu, L., Harlow, E. and Dynlacht, B. D. (1995b) p107
uses a p21/CIP1-related domain to bind cyclin/cdk2 and regulate
interactions with E2F. Genes Dev. 9, 1740-1752 Zhu, Y., Pe'ery, T.,
Peng, J., Ramanathan, Y., Marshall, N., Marshall, T., Amendt, B.,
Mathews, M.B. and Price, D.H. (1997) Transcription elongation
factor P-TEFb is required for HIV-1 tat transactivation in vitro.
Genes Dev. 11, 2622-2632 Zwijsen, R. M., Wientjens, E., Klompmaker,
R., van der Sman, J., Bernards, R., Michalides, R J. (1997)
CDK-independent activation of estrogen receptor by cyclin D1. Cell
88, 405-15 Zwijsen, R. M., Buckle, R. S., Hijmans, E. M., Loomans,
C. J., Bernards, R. (1998) Ligand-independent recruitment of
steroid receptor coactivators to estrogen receptor by cyclin D1.
Genes Dev. 12, 3488-98
EQUIVALENTS
[0280] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, numerous
equivalents to the specific procedures described herein. Such
equivalents are considered to be within the scope of the present
invention and are covered by the following claims. The contents of
all references, issued patents, and published patent applications
cited throughout this application are hereby incorporated by
reference. The appropriate components, processes, and methods of
those patents, applications and other documents may be selected for
the present invention and embodiments thereof.
Sequence CWU 1
1
23110PRTArtificial SequenceDescription of Artificial Sequence
Consensus Target Peptide 1Pro Lys Pro Leu Lys Lys Leu Arg Phe Asp1
5 10212PRTArtificial SequenceDescription of Artificial Sequence
Target peptide 2Gly Arg Pro Pro Val Lys Arg Arg Leu Asp Leu Glu1 5
10312PRTArtificial SequenceDescription of Artificial Sequence
Target peptide 3Cys Cys Ser Lys Ala Cys Arg Arg Leu Phe Gly Pro1 5
1048PRTArtificial SequenceDescription of Artificial Sequence Target
peptide 4Trp Phe His Gly Lys Leu Ser Arg1 558PRTArtificial
SequenceDescription of Artificial Sequence Target peptide 5Trp Asn
Val Gly Ser Ser Asn Arg1 561210PRTArtificial SequenceDescription of
Artificial Sequence Consensus Target PeptideVARIANT(1)Wherein Xaa
is any amino acid.VARIANT(2)..(600)Wherein Xaa is any amino acid or
nothing.VARIANT(611)Wherein Xaa is any amino
acid.VARIANT(612)..(1210)Wherein Xaa is any amino acid or nothing.
6Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5
10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa65 70 75 80Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 85 90 95Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 100 105 110Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 115 120 125Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135 140Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa145 150 155
160Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
165 170 175Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 180 185 190Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 195 200 205Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 210 215 220Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa225 230 235 240Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 245 250 255Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 260 265 270Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 275 280
285Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
290 295 300Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa305 310 315 320Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 325 330 335Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 340 345 350Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 355 360 365Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 370 375 380Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa385 390 395
400Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
405 410 415Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 420 425 430Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 435 440 445Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 450 455 460Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa465 470 475 480Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 485 490 495Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 500 505 510Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 515 520
525Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
530 535 540Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa545 550 555 560Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 565 570 575Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 580 585 590Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Gly Ser Gly Ile Phe Leu Glu Thr 595 600 605Ser Leu Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 610 615 620Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa625 630 635
640Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
645 650 655Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 660 665 670Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 675 680 685Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 690 695 700Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa705 710 715 720Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 725 730 735Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 740 745 750Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 755 760
765Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
770 775 780Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa785 790 795 800Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 805 810 815Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 820 825 830Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 835 840 845Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 850 855 860Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa865 870 875
880Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
885 890 895Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 900 905 910Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 915 920 925Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 930 935 940Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa945 950 955 960Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 965 970 975Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 980 985 990Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 995
1000 1005Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 1010 1015 1020Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa1025 1030 1035 1040Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1045 1050 1055Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1060 1065 1070Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1075
1080 1085Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 1090 1095 1100Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa1105 1110 1115 1120Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1125 1130 1135Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1140 1145 1150Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1155
1160 1165Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 1170 1175 1180Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa1185 1190 1195 1200Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 1205 1210778DNAArtificial SequenceDescription of
Artificial Sequence PCR Primer 7gcgctgatca ggcggaggcg gatcaggagg
aggaggatca ggcggaggag gatcaggatc 60catgtccgac agcgagaa
78829DNAArtificial SequenceDescription of Artificial Sequence PCR
Primer 8gcgcgaattc atttcttggc tttggcaga 2991206PRTArtificial
SequenceDescription of Artificial Sequence Consensus Target
PeptideVARIANT(1)Wherein Xaa is any amino
acid.VARIANT(2)..(600)Wherein Xaa is any amino acid or
nothing.VARIANT(602)Wherein Xaa is any amino
acid.VARIANT(605)Wherein Xaa is any amino acid.VARIANT(607)Wherein
Xaa is any amino acid.VARIANT(608)..(1206)Wherein Xaa is any amino
acid or nothing. 9Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa65 70 75 80Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 85 90 95Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 100 105 110Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 115 120 125Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135
140Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa145 150 155 160Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 165 170 175Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 180 185 190Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 195 200 205Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 210 215 220Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa225 230 235 240Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 245 250
255Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
260 265 270Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 275 280 285Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 290 295 300Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa305 310 315 320Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 325 330 335Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 340 345 350Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 355 360 365Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 370 375
380Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa385 390 395 400Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 405 410 415Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 420 425 430Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 435 440 445Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 450 455 460Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa465 470 475 480Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 485 490
495Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
500 505 510Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 515 520 525Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 530 535 540Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa545 550 555 560Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 565 570 575Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 580 585 590Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Lys Xaa Leu Lys Xaa Leu Xaa Xaa 595 600 605Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 610 615
620Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa625 630 635 640Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 645 650 655Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 660 665 670Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 675 680 685Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 690 695 700Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa705 710 715 720Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 725 730
735Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
740 745 750Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 755 760 765Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 770 775 780Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa785 790 795 800Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 805 810 815Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 820 825 830Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 835 840 845Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 850 855
860Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa865 870 875 880Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 885 890 895Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 900 905 910Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 915 920 925Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 930 935 940Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa945 950 955 960Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 965 970
975Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
980 985 990Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 995 1000
1005Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1010 1015 1020Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa1025 1030 1035 1040Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1045 1050 1055Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1060 1065 1070Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1075 1080
1085Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1090 1095 1100Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa1105 1110 1115 1120Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1125 1130 1135Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1140 1145 1150Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1155 1160
1165Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1170 1175 1180Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa1185 1190 1195 1200Xaa Xaa Xaa Xaa Xaa Xaa
120510826PRTArtificial SequenceDescription of Artificial Sequence
Consensus Target Peptide 10Met Glu Gly Ala Gly Gly Ala Asn Asp Lys
Lys Lys Ile Ser Ser Glu1 5 10 15Arg Arg Lys Glu Lys Ser Arg Asp Ala
Ala Arg Ser Arg Arg Ser Lys 20 25 30Glu Ser Glu Val Phe Tyr Glu Leu
Ala His Gln Leu Pro Leu Pro His 35 40 45Asn Val Ser Ser His Leu Asp
Lys Ala Ser Val Met Arg Leu Thr Ile 50 55 60Ser Tyr Leu Arg Val Arg
Lys Leu Leu Asp Ala Gly Asp Leu Asp Ile65 70 75 80Glu Asp Asp Met
Lys Ala Gln Met Asn Cys Phe Tyr Leu Lys Ala Leu 85 90 95Asp Gly Phe
Val Met Val Leu Thr Asp Asp Gly Asp Met Ile Tyr Ile 100 105 110Ser
Asp Asn Val Asn Lys Tyr Met Gly Leu Thr Gln Phe Glu Leu Thr 115 120
125Gly His Ser Val Phe Asp Phe Thr His Pro Cys Asp His Glu Glu Met
130 135 140Arg Glu Met Leu Thr His Arg Asn Gly Leu Val Lys Lys Gly
Lys Glu145 150 155 160Gln Asn Thr Gln Arg Ser Phe Phe Leu Arg Met
Lys Cys Thr Leu Thr 165 170 175Ser Arg Gly Arg Thr Met Asn Ile Lys
Ser Ala Thr Trp Lys Val Leu 180 185 190His Cys Thr Gly His Ile His
Val Tyr Asp Thr Asn Ser Asn Gln Pro 195 200 205Gln Cys Gly Tyr Lys
Lys Pro Pro Met Thr Cys Leu Val Leu Ile Cys 210 215 220Glu Pro Ile
Pro His Pro Ser Asn Ile Glu Ile Pro Leu Asp Ser Lys225 230 235
240Thr Phe Leu Ser Arg His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp
245 250 255Glu Arg Ile Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu
Leu Gly 260 265 270Arg Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser
Asp His Leu Thr 275 280 285Lys Thr His His Asp Met Phe Thr Lys Gly
Gln Val Thr Thr Gly Gln 290 295 300Tyr Arg Met Leu Ala Lys Arg Gly
Gly Tyr Val Trp Val Glu Thr Gln305 310 315 320Ala Thr Val Ile Tyr
Asn Thr Lys Asn Ser Gln Pro Gln Cys Ile Val 325 330 335Cys Val Asn
Tyr Val Val Ser Gly Ile Ile Gln His Asp Leu Ile Phe 340 345 350Ser
Leu Gln Gln Thr Glu Cys Val Leu Lys Pro Val Glu Ser Ser Asp 355 360
365Met Lys Met Thr Gln Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser
370 375 380Ser Leu Phe Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr
Leu Leu385 390 395 400Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu
Asp Phe Gly Ser Asn 405 410 415Asp Thr Glu Thr Asp Asp Gln Gln Leu
Glu Glu Val Pro Leu Tyr Asn 420 425 430Asp Val Met Leu Pro Ser Pro
Asn Glu Lys Leu Gln Asn Ile Asn Leu 435 440 445Ala Met Ser Pro Leu
Pro Thr Ala Glu Thr Pro Lys Pro Leu Arg Ser 450 455 460Ser Ala Asp
Pro Ala Leu Asn Gln Glu Val Ala Leu Lys Leu Glu Pro465 470 475
480Asn Pro Glu Ser Leu Glu Leu Ser Phe Thr Met Pro Gln Ile Gln Asp
485 490 495Gln Thr Pro Ser Pro Ser Asp Gly Ser Thr Arg Gln Ser Ser
Pro Glu 500 505 510Pro Asn Ser Pro Ser Glu Tyr Cys Phe Tyr Val Asp
Ser Asp Met Val 515 520 525Asn Glu Phe Lys Leu Glu Leu Val Glu Lys
Leu Phe Ala Glu Asp Thr 530 535 540Glu Ala Lys Asn Pro Phe Ser Thr
Gln Asp Thr Asp Leu Asp Leu Glu545 550 555 560Met Leu Ala Pro Tyr
Ile Pro Met Asp Asp Asp Phe Gln Leu Arg Ser 565 570 575Phe Asp Gln
Leu Ser Pro Leu Glu Ser Ser Ser Ala Ser Pro Glu Ser 580 585 590Ala
Ser Pro Gln Ser Thr Val Thr Val Phe Gln Gln Thr Gln Ile Gln 595 600
605Glu Pro Thr Ala Asn Ala Thr Thr Thr Thr Ala Thr Thr Asp Glu Leu
610 615 620Lys Thr Val Thr Lys Asp Arg Met Glu Asp Ile Lys Ile Leu
Ile Ala625 630 635 640Ser Pro Ser Pro Thr His Ile His Lys Glu Thr
Thr Ser Ala Thr Ser 645 650 655Ser Pro Tyr Arg Asp Thr Gln Ser Arg
Thr Ala Ser Pro Asn Arg Ala 660 665 670Gly Lys Gly Val Ile Glu Gln
Thr Glu Lys Ser His Pro Arg Ser Pro 675 680 685Asn Val Leu Ser Val
Ala Leu Ser Gln Arg Thr Thr Val Pro Glu Glu 690 695 700Glu Leu Asn
Pro Lys Ile Leu Ala Leu Gln Asn Ala Gln Arg Lys Arg705 710 715
720Lys Met Glu His Asp Gly Ser Leu Phe Gln Ala Val Gly Ile Gly Thr
725 730 735Leu Leu Gln Gln Pro Asp Asp His Ala Ala Thr Thr Ser Leu
Ser Trp 740 745 750Lys Arg Val Lys Gly Cys Lys Ser Ser Glu Gln Asn
Gly Met Glu Gln 755 760 765Lys Thr Ile Ile Leu Ile Pro Ser Asp Leu
Ala Cys Arg Leu Leu Gly 770 775 780Gln Ser Met Asp Glu Ser Gly Leu
Pro Gln Leu Thr Ser Tyr Asp Cys785 790 795 800Glu Val Asn Ala Pro
Ile Gln Gly Ser Arg Asn Leu Leu Gln Gly Glu 805 810 815Glu Leu Leu
Arg Ala Leu Asp Gln Val Asn 820 825111208PRTArtificial
SequenceDescription of Artificial Sequence Consensus Binding
PeptideVARIANT(1)Wherein Xaa is any amino
acid.VARIANT(2)..(600)Wherein Xaa is any amino acid or
nothing.VARIANT(601)Wherein Xaa is Gly, Ala, Val, Leu, Ile, Pro,
Met, Phe, or Trp.VARIANT(603)Wherein Xaa is Gly, Ala, Val, Leu,
Ile, Pro, Met, Phe, or Trp.VARIANT(605)Wherein Xaa is Ser, Thr, or
Tyr.VARIANT(606)..(608)Wherein Xaa is Gly, Ala, Val, Leu, Ile, Pro,
Met, Phe, or Trp.VARIANT(609)Wherein Xaa is any amino
acid.VARIANT(610)..(1208)Wherein Xaa is any amino acid or nothing.
11Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1
5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa65 70 75 80Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 85 90 95Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 100 105 110Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 115 120 125Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 130 135 140Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa145 150 155
160Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
165 170 175Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 180 185 190Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 195 200 205Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 210 215 220Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa225 230 235 240Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 245 250 255Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 260 265 270Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 275 280
285Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
290 295 300Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa305 310 315 320Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 325 330 335Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 340 345 350Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 355 360 365Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 370 375 380Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa385 390 395
400Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
405 410 415Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 420 425 430Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 435 440 445Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 450 455 460Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa465 470 475 480Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 485 490 495Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 500 505 510Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 515 520
525Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
530 535 540Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa545 550 555 560Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 565 570 575Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 580 585 590Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Leu Xaa Pro Xaa Xaa Xaa Xaa 595 600 605Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 610 615 620Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa625 630 635
640Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
645 650 655Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 660 665 670Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 675 680 685Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 690 695 700Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa705 710 715 720Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 725 730 735Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 740 745 750Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 755 760
765Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
770 775 780Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa785 790 795 800Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa 805 810 815Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa 820 825 830Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 835 840 845Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 850 855 860Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa865 870 875
880Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
885 890 895Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 900 905 910Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa 915 920 925Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa 930 935 940Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa945 950 955 960Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 965 970 975Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 980 985 990Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 995
1000 1005Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 1010 1015 1020Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa1025 1030 1035 1040Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1045 1050 1055Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1060 1065 1070Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1075
1080 1085Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 1090 1095 1100Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa1105 1110 1115 1120Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1125 1130 1135Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1140 1145 1150Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1155
1160 1165Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 1170 1175 1180Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa1185 1190 1195 1200Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa 1205128PRTArtificial SequenceDescription of Artificial Sequence
synthetic peptide 12Met Leu Ala Pro Tyr Ile Pro Met1
5138PRTArtificial SequenceDescription of Artificial Sequence
synthetic peptide 13Ala Leu Ala Pro Tyr Ile Pro Met1
5148PRTArtificial SequenceDescription of Artificial Sequence
synthetic peptide 14Met Ala Ala Pro Tyr Ile Pro Met1
5158PRTArtificial SequenceDescription of Artificial Sequence
synthetic peptide 15Met Leu Ala Ala Tyr Ile Pro Met1
5168PRTArtificial SequenceDescription of Artificial Sequence
synthetic peptide 16Met Leu Ala Pro Ala Ile Pro Met1
5178PRTArtificial SequenceDescription of Artificial Sequence
synthetic peptide 17Met Leu Ala Pro Tyr Ala Pro Met1
5188PRTArtificial SequenceDescription of Artificial Sequence
synthetic peptide 18Met Leu Ala Pro Tyr Ile Ala Met1
5198PRTArtificial SequenceDescription of Artificial Sequence
synthetic
peptide 19Met Leu Ala Pro Tyr Ile Pro Ala1 5208PRTArtificial
SequenceDescription of Artificial Sequence synthetic peptide 20Ala
Ala Ala Ala Ala Ala Ala Ala1 5218PRTArtificial
SequenceVARIANT(4)Wherein X is a hydroxylated prolineDescription of
Artificial Sequencesynthetic peptide 21Met Leu Ala Xaa Tyr Ile Pro
Met1 5228PRTArtificial SequenceVARIANT(4)Wherein Xaa is
hydroxylated prolineDescription of Artificial Sequencesynthetic
peptide 22Met Ala Ala Xaa Tyr Ile Pro Met1 523826PRTHomo sapiens
23Met Glu Gly Ala Gly Gly Ala Asn Asp Lys Lys Lys Ile Ser Ser Glu1
5 10 15Arg Arg Lys Glu Lys Ser Arg Asp Ala Ala Arg Ser Arg Arg Ser
Lys 20 25 30Glu Ser Glu Val Phe Tyr Glu Leu Ala His Gln Leu Pro Leu
Pro His 35 40 45Asn Val Ser Ser His Leu Asp Lys Ala Ser Val Met Arg
Leu Thr Ile 50 55 60Ser Tyr Leu Arg Val Arg Lys Leu Leu Asp Ala Gly
Asp Leu Asp Ile65 70 75 80Glu Asp Asp Met Lys Ala Gln Met Asn Cys
Phe Tyr Leu Lys Ala Leu 85 90 95Asp Gly Phe Val Met Val Leu Thr Asp
Asp Gly Asp Met Ile Tyr Ile 100 105 110Ser Asp Asn Val Asn Lys Tyr
Met Gly Leu Thr Gln Phe Glu Leu Thr 115 120 125Gly His Ser Val Phe
Asp Phe Thr His Pro Cys Asp His Glu Glu Met 130 135 140Arg Glu Met
Leu Thr His Arg Asn Gly Leu Val Lys Lys Gly Lys Glu145 150 155
160Gln Asn Thr Gln Arg Ser Phe Phe Leu Arg Met Lys Cys Thr Leu Thr
165 170 175Ser Arg Gly Arg Thr Met Asn Ile Lys Ser Ala Thr Trp Lys
Val Leu 180 185 190His Cys Thr Gly His Ile His Val Tyr Asp Thr Asn
Ser Asn Gln Pro 195 200 205Gln Cys Gly Tyr Lys Lys Pro Pro Met Thr
Cys Leu Val Leu Ile Cys 210 215 220Glu Pro Ile Pro His Pro Ser Asn
Ile Glu Ile Pro Leu Asp Ser Lys225 230 235 240Thr Phe Leu Ser Arg
His Ser Leu Asp Met Lys Phe Ser Tyr Cys Asp 245 250 255Glu Arg Ile
Thr Glu Leu Met Gly Tyr Glu Pro Glu Glu Leu Leu Gly 260 265 270Arg
Ser Ile Tyr Glu Tyr Tyr His Ala Leu Asp Ser Asp His Leu Thr 275 280
285Lys Thr His His Asp Met Phe Thr Lys Gly Gln Val Thr Thr Gly Gln
290 295 300Tyr Arg Met Leu Ala Lys Arg Gly Gly Tyr Val Trp Val Glu
Thr Gln305 310 315 320Ala Thr Val Ile Tyr Asn Thr Lys Asn Ser Gln
Pro Gln Cys Ile Val 325 330 335Cys Val Asn Tyr Val Val Ser Gly Ile
Ile Gln His Asp Leu Ile Phe 340 345 350Ser Leu Gln Gln Thr Glu Cys
Val Leu Lys Pro Val Glu Ser Ser Asp 355 360 365Met Lys Met Thr Gln
Leu Phe Thr Lys Val Glu Ser Glu Asp Thr Ser 370 375 380Ser Leu Phe
Asp Lys Leu Lys Lys Glu Pro Asp Ala Leu Thr Leu Leu385 390 395
400Ala Pro Ala Ala Gly Asp Thr Ile Ile Ser Leu Asp Phe Gly Ser Asn
405 410 415Asp Thr Glu Thr Asp Asp Gln Gln Leu Glu Glu Val Pro Leu
Tyr Asn 420 425 430Asp Val Met Leu Pro Ser Pro Asn Glu Lys Leu Gln
Asn Ile Asn Leu 435 440 445Ala Met Ser Pro Leu Pro Thr Ala Glu Thr
Pro Lys Pro Leu Arg Ser 450 455 460Ser Ala Asp Pro Ala Leu Asn Gln
Glu Val Ala Leu Lys Leu Glu Pro465 470 475 480Asn Pro Glu Ser Leu
Glu Leu Ser Phe Thr Met Pro Gln Ile Gln Asp 485 490 495Gln Thr Pro
Ser Pro Ser Asp Gly Ser Thr Arg Gln Ser Ser Pro Glu 500 505 510Pro
Asn Ser Pro Ser Glu Tyr Cys Phe Tyr Val Asp Ser Asp Met Val 515 520
525Asn Glu Phe Lys Leu Glu Leu Val Glu Lys Leu Phe Ala Glu Asp Thr
530 535 540Glu Ala Lys Asn Pro Phe Ser Thr Gln Asp Thr Asp Leu Asp
Leu Glu545 550 555 560Met Leu Ala Pro Tyr Ile Pro Met Asp Asp Asp
Phe Gln Leu Arg Ser 565 570 575Phe Asp Gln Leu Ser Pro Leu Glu Ser
Ser Ser Ala Ser Pro Glu Ser 580 585 590Ala Ser Pro Gln Ser Thr Val
Thr Val Phe Gln Gln Thr Gln Ile Gln 595 600 605Glu Pro Thr Ala Asn
Ala Thr Thr Thr Thr Ala Thr Thr Asp Glu Leu 610 615 620Lys Thr Val
Thr Lys Asp Arg Met Glu Asp Ile Lys Ile Leu Ile Ala625 630 635
640Ser Pro Ser Pro Thr His Ile His Lys Glu Thr Thr Ser Ala Thr Ser
645 650 655Ser Pro Tyr Arg Asp Thr Gln Ser Arg Thr Ala Ser Pro Asn
Arg Ala 660 665 670Gly Lys Gly Val Ile Glu Gln Thr Glu Lys Ser His
Pro Arg Ser Pro 675 680 685Asn Val Leu Ser Val Ala Leu Ser Gln Arg
Thr Thr Val Pro Glu Glu 690 695 700Glu Leu Asn Pro Lys Ile Leu Ala
Leu Gln Asn Ala Gln Arg Lys Arg705 710 715 720Lys Met Glu His Asp
Gly Ser Leu Phe Gln Ala Val Gly Ile Gly Thr 725 730 735Leu Leu Gln
Gln Pro Asp Asp His Ala Ala Thr Thr Ser Leu Ser Trp 740 745 750Lys
Arg Val Lys Gly Cys Lys Ser Ser Glu Gln Asn Gly Met Glu Gln 755 760
765Lys Thr Ile Ile Leu Ile Pro Ser Asp Leu Ala Cys Arg Leu Leu Gly
770 775 780Gln Ser Met Asp Glu Ser Gly Leu Pro Gln Leu Thr Ser Tyr
Asp Cys785 790 795 800Glu Val Asn Ala Pro Ile Gln Gly Ser Arg Asn
Leu Leu Gln Gly Glu 805 810 815Glu Leu Leu Arg Ala Leu Asp Gln Val
Asn 820 825
* * * * *