U.S. patent application number 17/661057 was filed with the patent office on 2022-08-25 for immune cells expressing engineered antigen receptors.
The applicant listed for this patent is BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM. Invention is credited to Katy REZVANI, Elizabeth J. SHPALL.
Application Number | 20220265718 17/661057 |
Document ID | / |
Family ID | |
Filed Date | 2022-08-25 |
United States Patent
Application |
20220265718 |
Kind Code |
A1 |
REZVANI; Katy ; et
al. |
August 25, 2022 |
IMMUNE CELLS EXPRESSING ENGINEERED ANTIGEN RECEPTORS
Abstract
Provided herein are immune cells expressing antigenic receptors,
such as a chimeric antigen receptor and a T cell receptor. Further
provided herein are methods of treating immune-related disorder by
administering the antigen-specific immune cells.
Inventors: |
REZVANI; Katy; (Houston,
TX) ; SHPALL; Elizabeth J.; (Houston, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BOARD OF REGENTS, THE UNIVERSITY OF TEXAS SYSTEM |
Austin |
TX |
US |
|
|
Appl. No.: |
17/661057 |
Filed: |
April 28, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16606700 |
Oct 18, 2019 |
11344578 |
|
|
PCT/US2018/028418 |
Apr 19, 2018 |
|
|
|
17661057 |
|
|
|
|
62487248 |
Apr 19, 2017 |
|
|
|
International
Class: |
A61K 35/17 20060101
A61K035/17; A61P 35/02 20060101 A61P035/02; A61K 9/00 20060101
A61K009/00; A61K 45/06 20060101 A61K045/06; C07K 14/54 20060101
C07K014/54; C07K 14/55 20060101 C07K014/55; C07K 14/725 20060101
C07K014/725; C07K 14/705 20060101 C07K014/705; C07K 16/28 20060101
C07K016/28; C07K 16/30 20060101 C07K016/30; C07K 16/32 20060101
C07K016/32; C12N 5/0783 20060101 C12N005/0783; C12N 5/0775 20060101
C12N005/0775; C12N 5/074 20060101 C12N005/074; C12N 9/22 20060101
C12N009/22; C12N 9/64 20060101 C12N009/64; C12N 15/11 20060101
C12N015/11 |
Claims
1. An immune cell engineered to express human IL-15 (hIL-15) and at
least two antigen receptors, wherein the at least two antigen
receptors comprise a chimeric antigen receptor (CAR) and/or a T
cell receptor (TCR).
2. The immune cell of claim 1, wherein the immune cell is
engineered to express hIL-15, the CAR, and the TCR.
3. The immune cell of claim 1, wherein the immune cell is
engineered to express hIL-15 and two CARs.
4. The immune cell of claim 1, wherein the immune cell is
engineered to express hIL-15 and two TCRs.
5. The immune cells of claim 1, wherein the immune cell is
engineered to express 3, 4, or 5 antigen receptors.
6. The immune cell of any one of claims 1-5, wherein the immune
cell is further defined as a T cell, peripheral blood lymphocyte,
NK cell, invariant NK cell, NKT cell, or stem cell.
7. The immune cell of any one of claims 1-5, wherein the immune
cell is a T cell.
8. The immune cell of any one of claims 1-5, wherein the immune
cell is an NK cell.
9. The immune cell of claim 6, wherein the stem cell is a
mesenchymal stem cell (MSC) or an induced pluripotent stem (iPS)
cell.
10. The immune cell of claim 1, wherein the immune cell is derived
from an iPS cell.
11. The immune cell of claim 7, wherein the T cell is a CD8.sup.+
cell, CD4.sup.+ T cell, or gamma-delta cell.
12. The immune cell of claim 7, wherein the T cell is a cytotoxic T
lymphocyte (CTL).
13. The immune cell of claim 6, wherein the immune cell is
allogeneic.
14. The immune cell of claim 6, wherein the immune cell is
autologous.
15. The immune cell of any of claims 1-13, wherein the immune cell
is engineered to express one or more additional cytokines.
16. The immune cell of claim 15, wherein the one or more additional
cytokines are IL-21 and/or IL-2.
17. The immune cell of any one of claims 1-13, wherein the immune
cell is engineered to have essentially no expression of
glucocorticoid receptor, TGF.beta. receptor, and/or CISH.
18. The immune cell of claim 17, wherein said immune cell is
engineered using one or more guide RNAs and a Cas9 enzyme.
19. The immune cell of claim 18, wherein the one or more guide RNAs
comprise SEQ ID NOs. 1-2.
20. The immune cell of claim 18, wherein the one or more guide RNAs
comprise SEQ ID NOs. 3-4.
21. The immune cell of claim 17, wherein the TGF.beta. receptor is
further defined as TGF.beta.-RII.
22. The immune cell of any one of claims 1-13, wherein the immune
cell is isolated from peripheral blood, cord blood, or bone
marrow.
23. The immune cell of any one of claims 1-13, wherein the immune
cell is isolated from cord blood.
24. The immune cell of claim 23, wherein the cord blood is pooled
from 2 or more individual cord blood units.
25. The immune cell of any one of claims 1-13, wherein the immune
cell further expresses a suicide gene.
26. The immune cell of claim 25, wherein the suicide gene is CD20,
CD52, EGFRv3, or inducible caspase 9.
27. The immune cell of claim 25, wherein the suicide gene is
inducible caspase 9.
28. The immune cell of claim 1, wherein DNA encoding the at least
two antigen receptors is integrated into the genome of the
cell.
29. The immune cell of claim 1, wherein DNA encoding the CAR and/or
TCR is integrated into the genome of the cell.
30. The immune cell of claim 1, wherein the at least two antigen
receptors comprise antigen binding regions selected from the group
consisting of F(ab')2, Fab', Fab, Fv, and scFv.
31. The immune cell of claim 30, wherein the antigen binding
regions of the at least two antigen receptors bind one or more
tumor associated antigens.
32. The immune cell of claim 31, wherein the tumor associated
antigens are CD19, CD319/CS1, ROR1, CD20, carcinoembryonic antigen,
alphafetoprotein, CA-125, MUC-1, epithelial tumor antigen,
melanoma-associated antigen, mutated p53, mutated ras, HER2/Neu,
ERBB2, folate binding protein, HIV-1 envelope glycoprotein gp120,
HIV-1 envelope glycoprotein gp41, GD2, CD123, CD23, CD30, CD56,
c-Met, mesothelin, GD3, HERV-K, IL-11Ralpha, kappa chain, lambda
chain, CSPG4, ERBB2, WT-1, EGFRvIII, TRAIL/DR4, and/or VEGFR2.
33. The immune cell of claim 30, wherein the antigen binding region
of a first antigen receptor is distinct from the antigen binding
region of a second antigen receptor.
34. The immune cell of claim 32, wherein the antigen binding region
of the first antigen receptor binds to a first antigen and the
antigen binding region of the second antigen receptor binds to a
second antigen.
35. The immune cell of claim 34, wherein first antigen is EGFRvIII
and the second antigen is NY-ESO.
36. The immune cell of claim 34, wherein first antigen is HER2/Neu
and the second antigen is MUC-1.
37. The immune cell of claim 34, wherein first antigen is CA-125
and the second antigen is MUC-1.
38. The immune cell of claim 34, wherein first antigen is CA-125
and the second antigen is WT-1.
39. The immune cell of claim 34, wherein first antigen is EGFRvIII
and the second antigen is Mage-A3, Mage-A4, or Mage-A10.
40. The immune cell of claim 34, wherein first antigen is EGFRvIII
and the second antigen is TRAIL/DR4.
41. The immune cell of claim 34, wherein first antigen is CEA-CAR
and the second antigen is Mage-A3-TCR, Mage-A4-TCR or Mage-A10.
42. The immune cell of claim 34, wherein first antigen is HER2/Neu,
CEA-CAR, and/or CA-125, EGFRvIII and the second antigen is MUC-1,
WT-1, TRAIL/DR4Mage-A3-TCR, Mage-A4-TCR and/or Mage-A10.
43. The immune cell of any one of claims 1-13, wherein the at least
two antigen receptors comprise one or more intracellular signaling
domains.
44. The immune cell of claim 42, wherein the one or more
intracellular signaling domains are T-lymphocyte activation
domains.
45. The immune cell of claim 42, wherein the one or more
intracellular signaling domains comprise CD3.xi., CD28, OX40/CD134,
4-1BB/CD137, Fc.epsilon.RI.gamma., ICOS/CD278, ILRB/CD122,
IL-2RG/CD132, DAP12, CD70, CD40, or a combination thereof.
46. The immune cell of claim 42, wherein the one or more
intracellular signaling domains comprise CD3.xi., CD28, 4-1BB-L,
and/or DAP12.
47. The immune cell of claim 1, wherein the at least two antigen
receptors comprise one or more transmembrane domains.
48. The immune cell of claim 47, wherein the one or transmembrane
domains comprise CD28 transmembrane domain, IgG4Fc hinge, Fc
regions, CD4 transmembrane domain, the CD3.xi. transmembrane
domain, cysteine mutated human CD3.xi. domain, CD16 transmembrane
domain, CD8 transmembrane domain, and/or erythropoietin receptor
transmembrane domain.
49. A pharmaceutical composition comprising an effective amount of
an immune cell of any one of claims 1-48.
50. A composition comprising an effective amount of an immune cell
of an immune cell of any one of claims 1-48 for the treatment of an
immune-related disorder in a subject.
51. The use of a composition comprising an effective amount of an
immune cell of an immune cell of any one of claims 1-48 for the
treatment of an immune-related disorder in a subject.
52. A method of treating an immune-related disorder in a subject
comprising administering an effective amount of immune cells of any
one of claims 1-48 to the subject.
53. The method of claim 52, wherein the immune-related disorder is
a cancer, autoimmune disorder, graft versus host disease, allograft
rejection, or inflammatory condition.
54. The method of claim 52, wherein the immune-related disorder is
an inflammatory condition and the immune cells have essentially no
expression of glucocorticoid receptor.
55. The method of claim 54, wherein the subject has been or is
being administered a steroid therapy.
56. The method of claim 52, wherein the immune cells are
autologous.
57. The method of claim 52, wherein the immune cells are
allogeneic.
58. The method of claim 52, wherein the immune-related disorder is
a cancer.
59. The method of claim 58, wherein the cancer is a solid cancer or
a hematologic malignancy.
60. The method of claim 58, wherein the cancer is ovarian cancer
and the immune cells have antigenic specificity for MUC-1, CA-125,
and/or WT-1.
61. The method of claim 58, wherein the cancer is lung cancer and
the immune cells have antigenic specificity for NY-ESO, EGFR-vIII,
Mage-A3, Mage-A4, Mage-A10, and/or TRAIL/DR4.
62. The method of claim 58, wherein the cancer is pancreatic cancer
or colon cancer and the immune cells have antigenic specificity for
Mage-A3, Mage-A4, Mage-A10, and/or CEA.
63. The method of claim 58, wherein the cancer is breast cancer and
the immune cells have antigenic specificity for MUC-1 and
HER2/Neu.
64. The method of claim 58, wherein the cancer is glioblastoma and
the immune cells have antigenic specificity for Mage-A3, Mage-A4,
Mage-A10v, and/or EGFRvIII.
65. The method of claim 58, wherein the cancer is sarcoma and the
immune cells have antigenic specificity for NY-ESO and
EGFR-vIII.
66. The method of claim 52, further comprising administering at
least a second therapeutic agent.
67. The method of claim 66, wherein the at least a second
therapeutic agent comprises chemotherapy, immunotherapy, surgery,
radiotherapy, or biotherapy.
68. The method of claim 66, wherein the immune cells and/or the at
least a second therapeutic agent are administered intravenously,
intraperitoneally, intratracheally, intratumorally,
intramuscularly, endoscopically, intralesionally, percutaneously,
subcutaneously, regionally, or by direct injection or perfusion.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Non-Provisional
patent application Ser. No. 16/606,700, filed Oct. 18, 2019, which
is a national phase application under 35 U.S.C. .sctn. 371 that
claims priority to International Application No. PCT/US2018/028418,
filed Apr. 19, 2018, which claims the priority benefit of U.S.
Provisional Application Ser. No. 62/487,248, filed Apr. 19, 2017,
all of which are incorporated herein by reference in their
entirety.
INCORPORATION OF SEQUENCE LISTING
[0002] The sequence listing that is contained in the file named
"MDACP1191USC1_ST25.txt", which is 2 KB (as measured in Microsoft
Windows) and was created on Apr. 26, 2022, is filed herewith by
electronic submission and is incorporated by reference herein.
BACKGROUND
1. Field
[0003] The present invention relates generally to the fields of
immunology and medicine. More particularly, it concerns immune
cells expressing antigenic receptors, such as chimeric antigen
receptors and T cell receptors, in the same cell type.
2. Description of Related Art
[0004] Despite technological advancements in the diagnosis and
treatment options available to patients diagnosed with cancer, the
prognosis still often remains poor and many patients cannot be
cured. Immunotherapy holds the promise of offering a potent, yet
targeted, treatment for patients diagnosed with various tumors with
the potential to eradicate the malignant tumor cells without
damaging normal tissues. In theory, the T cells of the immune
system are capable of recognizing protein patterns specific for
tumor cells and to mediate their destruction through a variety of
effector mechanisms. Adoptive T cell therapy is an attempt to
harness and amplify the tumor-eradicating capacity of a patient's
own T cells and then return these effectors to the patient in such
a state that they effectively eliminate residual tumor, however
without damaging healthy tissue. Although this approach is not new
to the field of tumor immunology, many drawbacks in the clinical
use of adoptive T cell therapy impair the full use of this approach
in cancer treatments.
[0005] Cell therapy using autologous or human leukocyte antigen
(HLA)-matched allogeneic donor cells is a promising therapy for
many types of diseases, including cancer, and for regenerative
medicine. A number of groups have explored strategies to redirect
the antigen-specificity of T cells by engineering them to express
high affinity artificial TCRs. However, the introduction of
additional TCR chains into T cells can result in the formation of
mixed dimers between the endogenous and introduced TCR chains, with
the potential to result in the generation of T cells with unknown
specificity and toxicity. This has significantly limited the
translation of this strategy to the clinic. Thus, there is a need
to develop improved methods of engineering immune cells for
adoptive cell therapy with enhanced specificity as well as dual
targeting of tumors.
SUMMARY
[0006] In a first embodiment, the present disclosure provides an
immune cell engineered to express human IL-15 (hIL-15) and at least
two antigen receptors, wherein the at least two antigen receptors
comprise a chimeric antigen receptor (CAR) and/or a T cell receptor
(TCR). In one embodiment, there is provided an immune cell
engineered to express a CAR, TCR, and hIL-15 or another cytokine
such as hIL-21, hIL-2 or hIL-18. In another embodiment, there is
provided an immune cell is engineered to express hIL-15 and two
CARs. In yet another embodiment, there is provided an immune cell
is engineered to express hIL-15 and two TCRs. In a further
embodiment, there is provided an immune cell is engineered to
express 3, 4, 5, or more antigen receptors. In some aspects, the
immune cell is allogeneic. In certain aspects, the immune cell is
autologous.
[0007] In some aspects, the immune cell is further defined as a T
cell, peripheral blood lymphocyte, NK cell, invariant NK cell, NKT
cell, or stem cell. In certain aspects, the stem cell is a
mesenchymal stem cell (MSC) or an induced pluripotent stem (iPS)
cell. In some aspects, the immune cell is derived from an iPS cell.
In particular aspects, the T cell is a CD8.sup.+ T cell, CD4.sup.+
T cell, or gamma-delta T cell. In one specific aspects, the T cell
is a cytotoxic T lymphocyte (CTL). In particular aspects, the
immune cell is a T cell or NK cell.
[0008] In certain aspects, the immune cell is engineered to express
one or more additional cytokines. In particular aspects, the one or
more additional cytokines are IL-21, IL-18 and/or IL-2.
[0009] In additional aspects, the immune cell is engineered to have
essentially no expression of glucocorticoid receptor (GR),
TGF.beta. receptor, and/or CISH. In some aspects, said immune cell
is engineered using one or more guide RNAs and a Cas9 enzyme. In
specific aspects, the one or more guide RNAs comprise SEQ ID NOs:
1-2, such as to silence GR. In particular aspects, the one or more
guide RNAs comprise SEQ ID NOs: 3-4, such as to silence TGF.beta..
In some aspects, the one or more guide RNAs comprise SEQ ID NOs.:
1-4, such as to target GR and TGF.beta.. In particular aspects, the
TGF.beta. receptor is further defined as TGF.beta.-RII.
[0010] In some aspects, the immune cell is isolated from peripheral
blood, cord blood, or bone marrow. In particular aspects, the
immune cell is isolated from cord blood, such as cord blood pooled
from 2 or more individual cord blood units.
[0011] In further aspects, the immune cell further expresses a
suicide gene. In certain aspects, the suicide gene is CD20, CD52,
EGFRv3, or inducible caspase 9. In particular aspects, the suicide
gene is inducible caspase 9.
[0012] In some aspects, the at least two antigen receptors, such as
CAR and/or TCR, comprise antigen binding regions selected from the
group consisting of F(ab')2, Fab', Fab, Fv, and scFv. In certain
aspects, the antigen binding regions of the at least two antigen
receptors, such as CAR and/or TCR, bind one or more tumor
associated antigens. In specific aspects, the tumor associated
antigens are CD19, CD319/CS1, ROR1, CD20, carcinoembryonic antigen,
alphafetoprotein, CA-125, MUC-1, epithelial tumor antigen,
melanoma-associated antigen, mutated p53, mutated ras, HER2/Neu,
ERBB2, folate binding protein, HIV-1 envelope glycoprotein gp120,
HIV-1 envelope glycoprotein gp41, GD2, CD123, CD99, CD33, CD5, CD7,
ROR1, CD23, CD30, CD56, c-Met, mesothelin, GD3, HERV-K,
IL-11Ralpha, kappa chain, lambda chain, CSPG4, ERBB2, WT-1,
EGFRvIII, TRAIL/DR4, and/or VEGFR2. In certain aspects, the antigen
binding region of the first antigen receptor, such as the CAR, is
distinct from the antigen binding region of the second antigen
receptor, such as the TCR. In some aspects, the antigen binding
region of the a first antigen receptor, such as a CAR, binds to a
first antigen and the antigen binding region of a second antigen
receptor, such as a TCR, binds to a second antigen. In specific
aspects, first antigen is EGFRvIII and the second antigen is
NY-ESO. In other aspects, first antigen is HER2/Neu and the second
antigen is MUC-1. In some aspects, first antigen is CA-125 and the
second antigen is MUC-1. In certain aspects, first antigen is
CA-125 and the second antigen is WT-1. In some aspects, first
antigen is EGFRvIII and the second antigen is Mage-A3, Mage-A4, or
Mage-A10. In particular aspects, first antigen is EGFRvIII and the
second antigen is TRAIL/DR4. In certain aspects, first antigen is
CEA-CAR and the second antigen is Mage-A3-TCR, Mage-A4-TCR or
Mage-A10. In some aspects, first antigen is HER2/Neu, CEA-CAR,
and/or CA-125, EGFRvIII and the second antigen is MUC-1, WT-1,
TRAIL/DR4Mage-A3-TCR, Mage-A4-TCR and/or Mage-A10.
[0013] In some aspects, the at least two antigen receptors, such as
CAR and/or TCR, comprise one or more intracellular signaling
domains. In particular aspects, the one or more intracellular
signaling domains are T-lymphocyte activation domains. In some
aspects, the one or more intracellular signaling domains comprise
CD3.xi., CD28, OX40/CD134, 4-1BB/CD137, Fc.epsilon.RI.gamma.,
ICOS/CD278, ILRB/CD122, IL-2RG/CD132, DAP12, CD70, CD40, or a
combination thereof. In some aspects, the one or more intracellular
signaling domains comprise CD3, CD28, 4-1BB-L, DAP10 and/or DAP12.
In specific aspects, the at least two antigen receptors, such as
CAR and/or TCR, comprise one or more transmembrane domains. In some
aspects, the one or transmembrane domains comprise CD28
transmembrane domain, IgG4Fc hinge, Fc regions, CD4 transmembrane
domain, the CD3 transmembrane domain, cysteine mutated human CD3
domain, CD16 transmembrane domain, CD8 transmembrane domain, and/or
erythropoietin receptor transmembrane domain. In some aspects, DNA
encoding the at least two antigen receptors, such as CAR and/or
TCR, is integrated into the genome of the cell.
[0014] A further embodiment provides a pharmaceutical composition
comprising an effective amount of an immune cell of the embodiments
(e.g., expressing at least two antigen receptors, such as CAR
and/or TCR). In another embodiment, there is provided a composition
comprising an effective amount of an immune cell of an immune cell
of the embodiments (e.g., expressing at least two antigen
receptors, such as CAR and/or TCR) for the treatment of an
immune-related disorder in a subject. In another embodiment there
is provided a method of treating an immune-related disorder in a
subject comprising administering an effective amount of immune
cells of the embodiments (e.g., expressing at least two antigen
receptors, such as CAR and/or TCR) to the subject.
[0015] In some aspects, the immune-related disorder is a cancer,
autoimmune disorder, graft versus host disease, allograft
rejection, or inflammatory condition. In certain aspects, the
immune-related disorder is an inflammatory condition and the immune
cells have essentially no expression of glucocorticoid receptor. In
some aspects, the subject has been or is being administered a
steroid therapy. In some aspects, the immune cells are autologous.
In certain aspects, the immune cells are allogeneic.
[0016] In certain aspects, the immune-related disorder is a cancer.
In particular aspects, the cancer is a solid cancer or a
hematologic malignancy. In some aspects, the cancer is ovarian
cancer and the immune cells have antigenic specificity for MUC-1,
CA-125, and/or WT-1. In certain aspects, the cancer is lung cancer
and the immune cells have antigenic specificity for NY-ESO,
EGFR-vIII, Mage-A3, Mage-A4, Mage-A10, and/or TRAIL/DR4. In
specific aspects, the cancer is pancreatic cancer or colon cancer
and the immune cells have antigenic specificity for Mage-A3,
Mage-A4, Mage-A10, and/or CEA. In some aspects, the cancer is
breast cancer and the immune cells have antigenic specificity for
MUC-1 and HER2/Neu. In certain aspects, the cancer is glioblastoma
and the immune cells have antigenic specificity for Mage-A3,
Mage-A4, Mage-A10v, and/or EGFRvIII. In some aspects, the cancer is
sarcoma and the immune cells have antigenic specificity for NY-ESO
and EGFR-vIII.
[0017] In additional aspects, the method further comprises
administering at least a second therapeutic agent. In some aspects,
the at least a second therapeutic agent comprises chemotherapy,
immunotherapy, surgery, radiotherapy, or biotherapy. In certain
aspects, the immune cells and/or the at least a second therapeutic
agent are administered intravenously, intraperitoneally,
intratracheally, intratumorally, intramuscularly, endoscopically,
intralesionally, percutaneously, subcutaneously, regionally, or by
direct injection or perfusion.
[0018] Other objects, features and advantages of the present
invention will become apparent from the following detailed
description. It should be understood, however, that the detailed
description and the specific examples, while indicating preferred
embodiments of the invention, are given by way of illustration
only, since various changes and modifications within the spirit and
scope of the invention will become apparent to those skilled in the
art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in
combination with the detailed description of specific embodiments
presented herein.
[0020] FIG. 1A-1C: Transduction efficiency of CS1 CAR in cord
blood-derived NK cells. (FIG. 1A) Flow cytometry of CAR expression
in NK cells from 2 different donors. (FIG. 1B)
iC9/CAR.CS1/IL-15-transduced NK cells exert superior killing of
CS1-expressing myeloma cell lines. (FIG. 1C)
iC9/CAR.CS1/IL-15-transduced NK cells produce more effector
cytokines in response to CS1-expressing myeloma cell lines.
[0021] FIGS. 2A-2B: IL-15 enhances NK-CAR mediated killing of tumor
(FIG. 2A) and prolongs survival (FIG. 2B).
[0022] FIG. 3: PCR based screening of glucocorticoid receptor (GR)
knockout in hematopoietic cells.
[0023] FIGS. 4A-4B: NK cells are sensitive to dexamethasone
killing. (FIG. 4A) Annexin V expression is shown after 4 hours of
dexamethasone treatment in NK cells from 3 different donors. (FIG.
4B) Annexin V expression is shown after 24 hours of dexamethasone
treatment in NK cells from 3 different donors. All cells were dead
at 24 hours of 500 .mu.M dexamethasone treatment.
[0024] FIG. 5: GR knockout in CAR NK cells protects against
dexamethasone killing. Annexin V staining of CAR NK controls cells
or cells with GR knockout treated with 200 .mu.M dexamethasone for
12 hours.
[0025] FIGS. 6A-6C: TFG.beta. CRISPR-mediated knockout renders CAR
NK cells resistant to immunosuppressive effect of exogenous
TGF.beta.. (FIG. 6A) Successful knockout of TGF.beta.-RII using
CRISPR/CAS9 technology (Cas9 plus gRNA targeting of Exon 3 of
TGF.beta.-RII). (FIG. 6B) Wild type and TGF-.beta.-RII knockout NK
cells were treated with 10 ng/ml of recombinant TGF-.beta. for 48
hrs and their response to K562 targets was assessed. TGF-.beta.-RII
knockout NK cells are resistant to the immunosuppressive effect of
exogenous TGF-.beta.. (FIG. 6C) TGF.beta.-RII knockout by
CRISPR/CAS9 technology abrogates downstream Smad-2/3
phosphorylation in response to 10 n g/ml of recombinant TGF-.beta.
compared to NK cells treated with CAS9 alone.
[0026] FIGS. 7A-7D: (FIG. 7A) Schematic depicting immune cells,
such as NK cell, with two CARs and hIL-15 expression. (FIG. 7B)
Schematic depicting immune cell, such as NK cell, with a CAR, TCR,
and hIL-15 expression. (FIG. 7C) Schematic depicting immune cell,
such as NK cell, with two TCRs and hIL-15 expression. (FIG. 7D)
Schematic of constructs expressing CAR-CAR, TCR-CAR, or TCR-TCR and
hIL-15.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0027] The present disclosure overcomes problems associated with
current technologies by providing antigen-specific immune cells
(e.g., T cells and NK cells) for immunotherapy, such as for the
treatment of immune-related diseases, including cancer and
autoimmune disorders, as well as infection including but not
limited to viruses, such as CMV, EBV, and HIV. In one embodiment,
the present disclosure provides NK cells which express one or more
T cell receptors (TCRs). To enhance signaling, the TCR transduced
in NK cells may be linked to a signaling domain. In contrast to
conventional antibody-directed target antigens, antigens recognized
by the TCR can include the entire array of potential intracellular
proteins, which are processed and delivered to the cell surface as
a peptide/MHC complex. As NK cells do not express endogenous TCR,
the introduction of high affinity TCRs in NK cells results in
redirection of their antigen specificity without the risk of
generating mixed dimers as seen with T cells which express
exogenous and endogenous TCRs. To generate a more potent receptor
that functions optimally in NK cells, the receptor may have a
costimulatory domain (including but not limited to CD28, 41BB
ligand, DAP12, DAP10 or any combination of these), as well as a CD3
signaling domain in the vector (FIG. 7D). Thus, the present
disclosure also provides methods for application of NK cell
immunotherapy to target antigens derived from tumors and pathogens
that are normally only recognized by T cells. Further, unlike T
cells, NK cells from an allogeneic source do not increase the risk
of inducing graft-versus-host disease; thus, the use of allogeneic
NK cells with TCRs provide a potential source of TCR-engineered NK
cells for adoptive therapy.
[0028] Moreover, the present disclosure further provides immune
cells, such as NK cells and T cells, comprising at least two
antigen receptors, such as a combination of CAR and TCR, two CARs,
or two TCRs, for dual targeting of tumors. This method of putting
both multiple antigen receptors, such as both TCR and CAR, into a
single cell type allows for the targeting of two or more antigens
using two completely different mechanisms of antigen recognition,
including surface antigen recognition via CAR and peptide/MHC
complex recognition through the TCR. To allow for the enhanced in
vivo persistence of NK cells, the cells may be engineered to
express IL-15 or another cytokine such as IL21, IL15 or IL-18.
Thus, the cells may express two CARs, one CAR+ one TCR, two TCRs,
or any combinations of CARs and TCRs which may further express
IL-15 or other cytokines. This method also allows for reduction in
the risk of antigen-negative tumor escape. The immune cells may be
derived from several sources including peripheral blood, cord
blood, bone marrow, stem cells, induced pluripotent stem cells
(iPSC cells), and NK cell lines, such as, but not limited to, the
NK-92 cell line.
[0029] Further embodiments concern the targeting of the
glucocorticoid receptor (GR), the TGF.beta. receptor 2
(TGF.beta.RII), and/or the immune checkpoint gene CISH by gene
editing to enhance the potency of immune cells, such as the CAR-
and/or TCR-engineered immune cells. In particular, targeting GR
renders the immune cells resistant to the lymphocytotoxic effect of
corticosteroids and targeting of TGF.beta.RII renders them
resistant to the immunosuppressive tumor microenvironment. For
example, the immune cells may be engineered to be
steroid-resistant, and/or TGFB-resistant using the CRISPR-CAS
system or other gene editing systems such as TALEN or zinc finger
nucleases.
[0030] In addition, the antigenic receptors used in the present
disclosure may contain IL15, such as human IL-15, or other
supportive cytokines including, but not limited, to IL-21, IL-18 or
IL-2. The antigenic receptor construct (TCR or CAR) can further
include co-stimulatory molecules such as CD3, 4-1BB-L, DAP12,
DAP10, or other costimulatory molecules. While the immune cells of
the present disclosure may be targeted to any combination of
antigens, exemplary antigens for the CAR and/or TCR include but are
not limited to CS1, BCMA, CD38, CD19, CD123, CD33, CD99, CLL1,
ROR1, CD5, CD7, mesothelin and ROR1. In particular aspects, the
immune cells are dually targeted to an antigen combination
including CD19-CAR and TCR against EBNA peptide (e.g., for EBV
lymphoma); WT1 and CD123 (e.g., for the treatment of myeloid
malignancies (e.g., AML, MDS, CML)); CD19 and ROR1 (for the
treatment of CLL or mantle cell lymphoma); NY-ESO TCR plus
EGFRvIII-NK-CAR (e.g., for sarcoma and lung cancer); Muc-1-TCR and
Her-2-neu-NK-CAR (e.g., for breast cancer); Muc-1-TCR and
CA-125-NK-CAR (e.g., for ovarian cancer); WT1-TCR and CA-125-NK-CAR
(e.g., for ovarian cancer); Mage-A3-TCR, Mage-A4-TCR or
Mage-A10-TCR plus EGFRVII-NK-CAR (e.g., for lung cancer and
glioblastoma); TRAIL/DR4-TCR plus EGFRv3-CAR (e.g., for lung
cancer); and Mage-A3-TCR, Mage-A4-TCR or Mage-A10-TCR plus CEA-CAR
(e.g., for colon cancer and pancreas cancer).
[0031] In further embodiments, immune cells, particularly NK cells,
are transduced with a vector carrying two CARs (e.g., CD99 and
CD33, or CD123 and CD33, or CD19 and ROR1, or CD38 and BCMA or CS1
or other combinations) to provide dual specificity to the immune
cell and IL-15 or another cytokine to enhance their in vivo
persistence. This method provides increased specificity of NK-CARs
by limiting the off-target toxicity, such that a signal is only
given to NK cells to kill when both antigens are expressed on the
tumor, as well as enhanced in vivo proliferation and persistence.
Thus, normal cells that express only one antigen will not be
targeted. This strategy is applicable to any subset of immune cells
including, but not limited to, NK cells, T cells, gamma delta T
cells, and iNKT cells.
[0032] Genetic reprogramming of immune cells, such as NK cells and
T cells, for adoptive cancer immunotherapy has clinically relevant
applications and benefits such as 1) innate anti-tumor surveillance
without prior need for sensitization 2) allogeneic efficacy without
graft versus host reactivity in the case of NK cells and 3) direct
cell-mediated cytotoxicity and cytolysis of target tumors.
Accordingly, the present disclosure also provides methods for
treating immune-related disorders, such as cancer, comprising
adoptive cell immunotherapy with any of the engineered immune cells
provided herein.
I. DEFINITIONS
[0033] As used herein, "essentially free," in terms of a specified
component, is used herein to mean that none of the specified
component has been purposefully formulated into a composition
and/or is present only as a contaminant or in trace amounts. The
total amount of the specified component resulting from any
unintended contamination of a composition is therefore well below
0.05%, preferably below 0.01%. Most preferred is a composition in
which no amount of the specified component can be detected with
standard analytical methods.
[0034] As used herein the specification, "a" or "an" may mean one
or more. As used herein in the claim(s), when used in conjunction
with the word "comprising," the words "a" or "an" may mean one or
more than one.
[0035] The use of the term "or" in the claims is used to mean
"and/or" unless explicitly indicated to refer to alternatives only
or the alternatives are mutually exclusive, although the disclosure
supports a definition that refers to only alternatives and
"and/or." As used herein "another" may mean at least a second or
more.
[0036] Throughout this application, the term "about" is used to
indicate that a value includes the inherent variation of error for
the device, the method being employed to determine the value, or
the variation that exists among the study subjects.
[0037] The term "exogenous," when used in relation to a protein,
gene, nucleic acid, or polynucleotide in a cell or organism refers
to a protein, gene, nucleic acid, or polynucleotide that has been
introduced into the cell or organism by artificial or natural
means; or in relation to a cell, the term refers to a cell that was
isolated and subsequently introduced to other cells or to an
organism by artificial or natural means. An exogenous nucleic acid
may be from a different organism or cell, or it may be one or more
additional copies of a nucleic acid that occurs naturally within
the organism or cell. An exogenous cell may be from a different
organism, or it may be from the same organism. By way of a
non-limiting example, an exogenous nucleic acid is one that is in a
chromosomal location different from where it would be in natural
cells, or is otherwise flanked by a different nucleic acid sequence
than that found in nature.
[0038] By "expression construct" or "expression cassette" is meant
a nucleic acid molecule that is capable of directing transcription.
An expression construct includes, at a minimum, one or more
transcriptional control elements (such as promoters, enhancers or a
structure functionally equivalent thereof) that direct gene
expression in one or more desired cell types, tissues or organs.
Additional elements, such as a transcription termination signal,
may also be included.
[0039] A "vector" or "construct" (sometimes referred to as a gene
delivery system or gene transfer "vehicle") refers to a
macromolecule or complex of molecules comprising a polynucleotide
to be delivered to a host cell, either in vitro or in vivo.
[0040] A "plasmid," a common type of a vector, is an
extra-chromosomal DNA molecule separate from the chromosomal DNA
that is capable of replicating independently of the chromosomal
DNA. In certain cases, it is circular and double-stranded.
[0041] An "origin of replication" ("ori") or "replication origin"
is a DNA sequence, e.g., in a lymphotrophic herpes virus, that when
present in a plasmid in a cell is capable of maintaining linked
sequences in the plasmid and/or a site at or near where DNA
synthesis initiates. As an example, an ori for EBV (Ebstein-Barr
virus) includes FR sequences (20 imperfect copies of a 30 bp
repeat), and preferably DS sequences; however, other sites in EBV
bind EBNA-1, e.g., Rep* sequences can substitute for DS as an
origin of replication (Kirshmaier and Sugden, 1998). Thus, a
replication origin of EBV includes FR, DS or Rep* sequences or any
functionally equivalent sequences through nucleic acid
modifications or synthetic combination derived therefrom. For
example, methods of the present disclosure may also use genetically
engineered replication origin of EBV, such as by insertion or
mutation of individual elements.
[0042] A "gene," "polynucleotide," "coding region," "sequence,"
"segment," "fragment," or "transgene" that "encodes" a particular
protein, is a nucleic acid molecule that is transcribed and
optionally also translated into a gene product, e.g., a
polypeptide, in vitro or in vivo when placed under the control of
appropriate regulatory sequences. The coding region may be present
in either a cDNA, genomic DNA, or RNA form. When present in a DNA
form, the nucleic acid molecule may be single-stranded (i.e., the
sense strand) or double-stranded. The boundaries of a coding region
are determined by a start codon at the 5' (amino) terminus and a
translation stop codon at the 3' (carboxy) terminus. A gene can
include, but is not limited to, cDNA from prokaryotic or eukaryotic
mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and
synthetic DNA sequences. A transcription termination sequence will
usually be located 3' to the gene sequence.
[0043] The term "control elements" refers collectively to promoter
regions, polyadenylation signals, transcription termination
sequences, upstream regulatory domains, origins of replication,
internal ribosome entry sites (IRES), enhancers, splice junctions,
and the like, which collectively provide for the replication,
transcription, post-transcriptional processing, and translation of
a coding sequence in a recipient cell. Not all of these control
elements need be present so long as the selected coding sequence is
capable of being replicated, transcribed, and translated in an
appropriate host cell.
[0044] The term "promoter" is used herein in its ordinary sense to
refer to a nucleotide region comprising a DNA regulatory sequence,
wherein the regulatory sequence is derived from a gene that is
capable of binding RNA polymerase and initiating transcription of a
downstream (3' direction) coding sequence. It may contain genetic
elements at which regulatory proteins and molecules may bind, such
as RNA polymerase and other transcription factors, to initiate the
specific transcription of a nucleic acid sequence. The phrases
"operatively positioned," "operatively linked," "under control,"
and "under transcriptional control" mean that a promoter is in a
correct functional location and/or orientation in relation to a
nucleic acid sequence to control transcriptional initiation and/or
expression of that sequence.
[0045] By "enhancer" is meant a nucleic acid sequence that, when
positioned proximate to a promoter, confers increased transcription
activity relative to the transcription activity resulting from the
promoter in the absence of the enhancer domain.
[0046] By "operably linked" or co-expressed" with reference to
nucleic acid molecules is meant that two or more nucleic acid
molecules (e.g., a nucleic acid molecule to be transcribed, a
promoter, and an enhancer element) are connected in such a way as
to permit transcription of the nucleic acid molecule. "Operably
linked" or "co-expressed" with reference to peptide and/or
polypeptide molecules means that two or more peptide and/or
polypeptide molecules are connected in such a way as to yield a
single polypeptide chain, i.e., a fusion polypeptide, having at
least one property of each peptide and/or polypeptide component of
the fusion. The fusion polypeptide is preferably chimeric, i.e.,
composed of heterologous molecules.
[0047] "Homology" refers to the percent of identity between two
polynucleotides or two polypeptides. The correspondence between one
sequence and another can be determined by techniques known in the
art. For example, homology can be determined by a direct comparison
of the sequence information between two polypeptide molecules by
aligning the sequence information and using readily available
computer programs. Alternatively, homology can be determined by
hybridization of polynucleotides under conditions that promote the
formation of stable duplexes between homologous regions, followed
by digestion with single strand-specific nuclease(s), and size
determination of the digested fragments. Two DNA, or two
polypeptide, sequences are "substantially homologous" to each other
when at least about 80%, preferably at least about 90%, and most
preferably at least about 95% of the nucleotides, or amino acids,
respectively match over a defined length of the molecules, as
determined using the methods above.
[0048] The term "cell" is herein used in its broadest sense in the
art and refers to a living body that is a structural unit of tissue
of a multicellular organism, is surrounded by a membrane structure
that isolates it from the outside, has the capability of
self-replicating, and has genetic information and a mechanism for
expressing it. Cells used herein may be naturally-occurring cells
or artificially modified cells (e.g., fusion cells, genetically
modified cells, etc.).
[0049] The term "stem cell" refers herein to a cell that under
suitable conditions is capable of differentiating into a diverse
range of specialized cell types, while under other suitable
conditions is capable of self-renewing and remaining in an
essentially undifferentiated pluripotent state. The term "stem
cell" also encompasses a pluripotent cell, multipotent cell,
precursor cell and progenitor cell. Exemplary human stem cells can
be obtained from hematopoietic or mesenchymal stem cells obtained
from bone marrow tissue, embryonic stem cells obtained from
embryonic tissue, or embryonic germ cells obtained from genital
tissue of a fetus. Exemplary pluripotent stem cells can also be
produced from somatic cells by reprogramming them to a pluripotent
state by the expression of certain transcription factors associated
with pluripotency; these cells are called "induced pluripotent stem
cells" or "iPScs or iPS cells".
[0050] An "embryonic stem (ES) cell" is an undifferentiated
pluripotent cell which is obtained from an embryo in an early
stage, such as the inner cell mass at the blastocyst stage, or
produced by artificial means (e.g. nuclear transfer) and can give
rise to any differentiated cell type in an embryo or an adult,
including germ cells (e.g. sperm and eggs).
[0051] "Induced pluripotent stem cells (iPScs or iPS cells)" are
cells generated by reprogramming a somatic cell by expressing or
inducing expression of a combination of factors (herein referred to
as reprogramming factors). iPS cells can be generated using fetal,
postnatal, newborn, juvenile, or adult somatic cells. In certain
embodiments, factors that can be used to reprogram somatic cells to
pluripotent stem cells include, for example, Oct4 (sometimes
referred to as Oct 3/4), Sox2, c-Myc, Klf4, Nanog, and Lin28. In
some embodiments, somatic cells are reprogrammed by expressing at
least two reprogramming factors, at least three reprogramming
factors, at least four reprogramming factors, at least five
reprogramming factors, at least six reprogramming factors, or at
least seven reprogramming factors to reprogram a somatic cell to a
pluripotent stem cell.
[0052] "Hematopoietic progenitor cells" or "hematopoietic precursor
cells" refers to cells which are committed to a hematopoietic
lineage but are capable of further hematopoietic differentiation
and include hematopoietic stem cells, multipotential hematopoietic
stem cells, common myeloid progenitors, megakaryocyte progenitors,
erythrocyte progenitors, and lymphoid progenitors. Hematopoietic
stem cells (HSCs) are multipotent stem cells that give rise to all
the blood cell types including myeloid (monocytes and macrophages,
granulocytes (neutrophils, basophils, eosinophils, and mast cells),
erythrocytes, megakaryocytes/platelets, dendritic cells), and
lymphoid lineages (T-cells, B-cells, NK-cells) (see e.g., Doulatov
et al., 2012; Notta et al., 2015). A "multilymphoid progenitor"
(MLP) is defined to describe any progenitor that gives rise to all
lymphoid lineages (B, T, and NK cells), but that may or may not
have other (myeloid) potentials (Doulatov et al., 2010) and is
CD45RA.sup.+, /CD10.sup.+/CD7.sup.-. Any B, T, and NK progenitor
can be referred to as an MLP. A "common myeloid progenitor" (CMP)
refers to CD45RA.sup.-/CD135.sup.+/CD10.sup.-/CD7.sup.- cells that
can give rise to granulocytes, monocytes, megakaryocytes and
erythrocytes.
[0053] "Pluripotent stem cell" refers to a stem cell that has the
potential to differentiate into all cells constituting one or more
tissues or organs, or preferably, any of the three germ layers:
endoderm (interior stomach lining, gastrointestinal tract, the
lungs), mesoderm (muscle, bone, blood, urogenital), or ectoderm
(epidermal tissues and nervous system).
[0054] As used herein, the term "somatic cell" refers to any cell
other than germ cells, such as an egg, a sperm, or the like, which
does not directly transfer its DNA to the next generation.
Typically, somatic cells have limited or no pluripotency. Somatic
cells used herein may be naturally-occurring or genetically
modified.
[0055] "Programming" is a process that alters the type of progeny a
cell can produce. For example, a cell has been programmed when it
has been altered so that it can form progeny of at least one new
cell type, either in culture or in vivo, as compared to what it
would have been able to form under the same conditions without
programming. This means that after sufficient proliferation, a
measurable proportion of progeny having phenotypic characteristics
of the new cell type are observed, if essentially no such progeny
could form before programming; alternatively, the proportion having
characteristics of the new cell type is measurably more than before
programming. This process includes differentiation,
dedifferentiation and transdifferentiation.
[0056] "Differentiation" is the process by which a less specialized
cell becomes a more specialized cell type. "Dedifferentiation" is a
cellular process in which a partially or terminally differentiated
cell reverts to an earlier developmental stage, such as
pluripotency or multipotency. "Transdifferentiation" is a process
of transforming one differentiated cell type into another
differentiated cell type. Typically, transdifferentiation by
programming occurs without the cells passing through an
intermediate pluripotency stage--i.e., the cells are programmed
directly from one differentiated cell type to another
differentiated cell type. Under certain conditions, the proportion
of progeny with characteristics of the new cell type may be at
least about 1%, 5%, 25% or more in order of increasing
preference.
[0057] As used herein, the term "subject" or "subject in need
thereof" refers to a mammal, preferably a human being, male or
female at any age that is in need of a cell or tissue
transplantation. Typically the subject is in need of cell or tissue
transplantation (also referred to herein as recipient) due to a
disorder or a pathological or undesired condition, state, or
syndrome, or a physical, morphological or physiological abnormality
which is amenable to treatment via cell or tissue
transplantation.
[0058] As used herein, a "disruption" or "alteration" of a gene
refers to the elimination or reduction of expression of one or more
gene products encoded by the subject gene in a cell, compared to
the level of expression of the gene product in the absence of the
alteration. Exemplary gene products include mRNA and protein
products encoded by the gene. Alteration in some cases is transient
or reversible and in other cases is permanent. Alteration in some
cases is of a functional or full length protein or mRNA, despite
the fact that a truncated or non-functional product may be
produced. In some embodiments herein, gene activity or function, as
opposed to expression, is disrupted. Gene alteration is generally
induced by artificial methods, i.e., by addition or introduction of
a compound, molecule, complex, or composition, and/or by alteration
of nucleic acid of or associated with the gene, such as at the DNA
level. Exemplary methods for gene alteration include gene
silencing, knockdown, knockout, and/or gene alteration techniques,
such as gene editing. Examples include antisense technology, such
as RNAi, siRNA, shRNA, and/or ribozymes, which generally result in
transient reduction of expression, as well as gene editing
techniques which result in targeted gene inactivation or
alteration, e.g., by induction of breaks and/or homologous
recombination. Examples include insertions, mutations, and
deletions. The alterations typically result in the repression
and/or complete absence of expression of a normal or "wild type"
product encoded by the gene. Exemplary of such gene alterations are
insertions, frameshift and missense mutations, deletions, knock-in,
and knock-out of the gene or part of the gene, including deletions
of the entire gene. Such alterations can occur in the coding
region, e.g., in one or more exons, resulting in the inability to
produce a full-length product, functional product, or any product,
such as by insertion of a stop codon. Such alterations may also
occur by alterations in the promoter or enhancer or other region
affecting activation of transcription, so as to prevent
transcription of the gene. Gene alterations include gene targeting,
including targeted gene inactivation by homologous
recombination.
[0059] An "immune disorder," "immune-related disorder," or
"immune-mediated disorder" refers to a disorder in which the immune
response plays a key role in the development or progression of the
disease. Immune-mediated disorders include autoimmune disorders,
allograft rejection, graft versus host disease and inflammatory and
allergic conditions.
[0060] An "immune response" is a response of a cell of the immune
system, such as a B cell, or a T cell, or innate immune cell to a
stimulus. In one embodiment, the response is specific for a
particular antigen (an "antigen-specific response").
[0061] As used herein, the term "antigen" is a molecule capable of
being bound by an antibody or T-cell receptor. An antigen may
generally be used to induce a humoral immune response and/or a
cellular immune response leading to the production of B and/or T
lymphocytes.
[0062] The terms "tumor-associated antigen," "tumor antigen" and
"cancer cell antigen" are used interchangeably herein. In each
case, the terms refer to proteins, glycoproteins or carbohydrates
that are specifically or preferentially expressed by cancer
cells.
[0063] An "epitope" is the site on an antigen recognized by an
antibody as determined by the specificity of the amino acid
sequence. Two antibodies are said to bind to the same epitope if
each competitively inhibits (blocks) binding of the other to the
antigen as measured in a competitive binding assay. Alternatively,
two antibodies have the same epitope if most amino acid mutations
in the antigen that reduce or eliminate binding of one antibody
reduce or eliminate binding of the other. Two antibodies are said
to have overlapping epitopes if each partially inhibits binding of
the other to the antigen, and/or if some amino acid mutations that
reduce or eliminate binding of one antibody reduce or eliminate
binding of the other.
[0064] An "autoimmune disease" refers to a disease in which the
immune system produces an immune response (for example, a B-cell or
a T-cell response) against an antigen that is part of the normal
host (that is, an autoantigen), with consequent injury to tissues.
An autoantigen may be derived from a host cell, or may be derived
from a commensal organism such as the micro-organisms (known as
commensal organisms) that normally colonize mucosal surfaces.
[0065] The term "Graft-Versus-Host Disease (GVHD)" refers to a
common and serious complication of bone marrow or other tissue
transplantation wherein there is a reaction of donated
immunologically competent lymphocytes against a transplant
recipient's own tissue. GVHD is a possible complication of any
transplant that uses or contains stem cells from either a related
or an unrelated donor. In some embodiments, the GVHD is chronic
GVHD (cGVHD).
[0066] A "parameter of an immune response" is any particular
measurable aspect of an immune response, including, but not limited
to, cytokine secretion (IL-6, IL-10, IFN-.gamma., etc.), chemokine
secretion, altered migration or cell accumulation, immunoglobulin
production, dendritic cell maturation, regulatory activity, number
of immune cells and proliferation of any cell of the immune system.
Another parameter of an immune response is structural damage or
functional deterioration of any organ resulting from immunological
attack. One of skill in the art can readily determine an increase
in any one of these parameters, using known laboratory assays. In
one specific non-limiting example, to assess cell proliferation,
incorporation of .sup.3H-thymidine can be assessed. A "substantial"
increase in a parameter of the immune response is a significant
increase in this parameter as compared to a control. Specific,
non-limiting examples of a substantial increase are at least about
a 50% increase, at least about a 75% increase, at least about a 90%
increase, at least about a 100% increase, at least about a 200%
increase, at least about a 300% increase, and at least about a 500%
increase. Similarly, an inhibition or decrease in a parameter of
the immune response is a significant decrease in this parameter as
compared to a control. Specific, non-limiting examples of a
substantial decrease are at least about a 50% decrease, at least
about a 75% decrease, at least about a 90% decrease, at least about
a 100% decrease, at least about a 200% decrease, at least about a
300% decrease, and at least about a 500% decrease. A statistical
test, such as a non-parametric ANOVA, or a T-test, can be used to
compare differences in the magnitude of the response induced by one
agent as compared to the percent of samples that respond using a
second agent. In some examples, p.ltoreq.0.05 is significant, and
indicates that the chance that an increase or decrease in any
observed parameter is due to random variation is less than 5%. One
of skill in the art can readily identify other statistical assays
of use.
[0067] "Treating" or treatment of a disease or condition refers to
executing a protocol, which may include administering one or more
drugs to a patient, in an effort to alleviate signs or symptoms of
the disease. Desirable effects of treatment include decreasing the
rate of disease progression, ameliorating or palliating the disease
state, and remission or improved prognosis. Alleviation can occur
prior to signs or symptoms of the disease or condition appearing,
as well as after their appearance. Thus, "treating" or "treatment"
may include "preventing" or "prevention" of disease or undesirable
condition. In addition, "treating" or "treatment" does not require
complete alleviation of signs or symptoms, does not require a cure,
and specifically includes protocols that have only a marginal
effect on the patient.
[0068] The term "therapeutic benefit" or "therapeutically
effective" as used throughout this application refers to anything
that promotes or enhances the well-being of the subject with
respect to the medical treatment of this condition. This includes,
but is not limited to, a reduction in the frequency or severity of
the signs or symptoms of a disease. For example, treatment of
cancer may involve, for example, a reduction in the size of a
tumor, a reduction in the invasiveness of a tumor, reduction in the
growth rate of the cancer, or prevention of metastasis. Treatment
of cancer may also refer to prolonging survival of a subject with
cancer.
[0069] The term "antibody" herein is used in the broadest sense and
specifically covers monoclonal antibodies (including full length
monoclonal antibodies), polyclonal antibodies, multispecific
antibodies (e.g., bispecific antibodies), and antibody fragments so
long as they exhibit the desired biological activity.
[0070] The term "monoclonal antibody" as used herein refers to an
antibody obtained from a population of substantially homogeneous
antibodies, e.g., the individual antibodies comprising the
population are identical except for possible mutations, e.g.,
naturally occurring mutations, that may be present in minor
amounts. Thus, the modifier "monoclonal" indicates the character of
the antibody as not being a mixture of discrete antibodies. In
certain embodiments, such a monoclonal antibody typically includes
an antibody comprising a polypeptide sequence that binds a target,
wherein the target-binding polypeptide sequence was obtained by a
process that includes the selection of a single target binding
polypeptide sequence from a plurality of polypeptide sequences. For
example, the selection process can be the selection of a unique
clone from a plurality of clones, such as a pool of hybridoma
clones, phage clones, or recombinant DNA clones. It should be
understood that a selected target binding sequence can be further
altered, for example, to improve affinity for the target, to
humanize the target binding sequence, to improve its production in
cell culture, to reduce its immunogenicity in vivo, to create a
multispecific antibody, etc., and that an antibody comprising the
altered target binding sequence is also a monoclonal antibody of
this invention. In contrast to polyclonal antibody preparations,
which typically include different antibodies directed against
different determinants (epitopes), each monoclonal antibody of a
monoclonal antibody preparation is directed against a single
determinant on an antigen. In addition to their specificity,
monoclonal antibody preparations are advantageous in that they are
typically uncontaminated by other immunoglobulins.
[0071] The phrases "pharmaceutical or pharmacologically acceptable"
refers to molecular entities and compositions that do not produce
an adverse, allergic, or other untoward reaction when administered
to an animal, such as a human, as appropriate. The preparation of a
pharmaceutical composition comprising an antibody or additional
active ingredient will be known to those of skill in the art in
light of the present disclosure. Moreover, for animal (e.g., human)
administration, it will be understood that preparations should meet
sterility, pyrogenicity, general safety, and purity standards as
required by FDA Office of Biological Standards.
[0072] As used herein, "pharmaceutically acceptable carrier"
includes any and all aqueous solvents (e.g., water,
alcoholic/aqueous solutions, saline solutions, parenteral vehicles,
such as sodium chloride, Ringer's dextrose, etc.), non-aqueous
solvents (e.g., propylene glycol, polyethylene glycol, vegetable
oil, and injectable organic esters, such as ethyloleate),
dispersion media, coatings, surfactants, antioxidants,
preservatives (e.g., antibacterial or antifungal agents,
anti-oxidants, chelating agents, and inert gases), isotonic agents,
absorption delaying agents, salts, drugs, drug stabilizers, gels,
binders, excipients, disintegration agents, lubricants, sweetening
agents, flavoring agents, dyes, fluid and nutrient replenishers,
such like materials and combinations thereof, as would be known to
one of ordinary skill in the art. The pH and exact concentration of
the various components in a pharmaceutical composition are adjusted
according to well-known parameters.
[0073] The term "T cell" refers to T lymphocytes, and includes, but
is not limited to, .gamma.:.delta..sup.+ T cells, NK T cells,
CD4.sup.+ T cells and CD8.sup.+ T cells. CD4.sup.+ T cells include
T.sub.H0, T.sub.H1 and T.sub.H2 cells, as well as regulatory T
cells (T.sub.reg). There are at least three types of regulatory T
cells: CD4.sup.+ CD25.sup.+ T.sub.reg, CD25 T.sub.H3 T.sub.reg, and
CD25 T.sub.R1 T.sub.reg. "Cytotoxic T cell" refers to a T cell that
can kill another cell. The majority of cytotoxic T cells are
CD8.sup.+ MHC class I-restricted T cells, however some cytotoxic T
cells are CD4.sup.+. In preferred embodiments, the T cell of the
present disclosure is CD4.sup.+ or CD8.sup.+.
[0074] The activation state of a T cell defines whether the T cell
is "resting" (i.e., in the Go phase of the cell cycle) or
"activated" to proliferate after an appropriate stimulus such as
the recognition of its specific antigen, or by stimulation with
OKT3 antibody, PHA or PMA, etc. The "phenotype" of the T cell
(e.g., naive, central memory, effector memory, lytic effectors,
help effectors (T.sub.H1 and T.sub.H2 cells), and regulatory
effectors), describes the function the cell exerts when activated.
A healthy donor has T cells of each of these phenotypes, and which
are predominately in the resting state. A naive T cell will
proliferate upon activation, and then differentiate into a memory T
cell or an effector T cell. It can then assume the resting state
again, until it gets activated the next time, to exert its new
function and may change its phenotype again. An effector T cell
will divide upon activation and antigen-specific effector
function.
[0075] The term "chimeric antigen receptors (CARs)," as used
herein, may refer to artificial T-cell receptors, chimeric T-cell
receptors, or chimeric immunoreceptors, for example, and encompass
engineered receptors that graft an artificial specificity onto a
particular immune effector cell. CARs may be employed to impart the
specificity of a monoclonal antibody onto a T cell, thereby
allowing a large number of specific T cells to be generated, for
example, for use in adoptive cell therapy. In specific embodiments,
CARs direct specificity of the cell to a tumor associated antigen,
for example. In some embodiments, CARs comprise an intracellular
activation domain, a transmembrane domain, and an extracellular
domain comprising a tumor associated antigen binding region. In
particular aspects, CARs comprise fusions of single-chain variable
fragments (scFv) derived from monoclonal antibodies, fused to
CD3-zeta a transmembrane domain and endodomain. The specificity of
other CAR designs may be derived from ligands of receptors (e.g.,
peptides) or from pattern-recognition receptors, such as Dectins.
In certain cases, the spacing of the antigen-recognition domain can
be modified to reduce activation-induced cell death. In certain
cases, CARs comprise domains for additional co-stimulatory
signaling, such as CD3.zeta., FcR, CD27, CD28, CD137, DAP10, DAP12
and/or OX40. In some cases, molecules can be co-expressed with the
CAR, including co-stimulatory molecules, reporter genes for imaging
(e.g., for positron emission tomography), gene products that
conditionally ablate the T cells upon addition of a pro-drug,
homing receptors, chemokines, chemokine receptors, cytokines, and
cytokine receptors.
[0076] The term "antigen presenting cells (APCs)" refers to a class
of cells capable of presenting one or more antigens in the form of
peptide-MHC complex recognizable by specific effector cells of the
immune system, and thereby inducing an effective cellular immune
response against the antigen or antigens being presented. APCs can
be intact whole cells such as macrophages, B cells, endothelial
cells, activated T cells, and dendritic cells; or other molecules,
naturally occurring or synthetic, such as purified MHC Class I
molecules complexed to .beta.2-microglobulin. While many types of
cells may be capable of presenting antigens on their cell surface
for T cell recognition, only dendritic cells have the capacity to
present antigens in an efficient amount to activate naive T cells
for cytotoxic T-lymphocyte (CTL) responses.
[0077] The term "culturing" refers to the in vitro maintenance,
differentiation, and/or propagation of cells in suitable media. By
"enriched" is meant a composition comprising cells present in a
greater percentage of total cells than is found in the tissues
where they are present in an organism.
[0078] An "anti-cancer" agent is capable of negatively affecting a
cancer cell/tumor in a subject, for example, by promoting killing
of cancer cells, inducing apoptosis in cancer cells, reducing the
growth rate of cancer cells, reducing the incidence or number of
metastases, reducing tumor size, inhibiting tumor growth, reducing
the blood supply to a tumor or cancer cells, promoting an immune
response against cancer cells or a tumor, preventing or inhibiting
the progression of cancer, or increasing the lifespan of a subject
with cancer.
II. IMMUNE CELLS
[0079] Certain embodiments of the present disclosure concern immune
cells which express a chimeric antigen receptor (CAR) and/or a T
cell receptor (TCR). The immune cells may be T cells (e.g.,
regulatory T cells, CD4.sup.+ T cells, CD8.sup.+ T cells, or
gamma-delta T cells), NK cells, invariant NK cells, NKT cells, stem
cells (e.g., mesenchymal stem cells (MSCs) or induced pluripotent
stem (iPSC) cells). In some embodiments, the cells are monocytes or
granulocytes, e.g., myeloid cells, macrophages, neutrophils,
dendritic cells, mast cells, eosinophils, and/or basophils. Also
provided herein are methods of producing and engineering the immune
cells as well as methods of using and administering the cells for
adoptive cell therapy, in which case the cells may be autologous or
allogeneic. Thus, the immune cells may be used as immunotherapy,
such as to target cancer cells.
[0080] The immune cells may be isolated from subjects, particularly
human subjects. The immune cells can be obtained from a subject of
interest, such as a subject suspected of having a particular
disease or condition, a subject suspected of having a
predisposition to a particular disease or condition, or a subject
who is undergoing therapy for a particular disease or condition.
Immune cells can be collected from any location in which they
reside in the subject including, but not limited to, blood, cord
blood, spleen, thymus, lymph nodes, and bone marrow. The isolated
immune cells may be used directly, or they can be stored for a
period of time, such as by freezing.
[0081] The immune cells may be enriched/purified from any tissue
where they reside including, but not limited to, blood (including
blood collected by blood banks or cord blood banks), spleen, bone
marrow, tissues removed and/or exposed during surgical procedures,
and tissues obtained via biopsy procedures. Tissues/organs from
which the immune cells are enriched, isolated, and/or purified may
be isolated from both living and non-living subjects, wherein the
non-living subjects are organ donors. In particular embodiments,
the immune cells are isolated from blood, such as peripheral blood
or cord blood. In some aspects, immune cells isolated from cord
blood have enhanced immunomodulation capacity, such as measured by
CD4- or CD8-positive T cell suppression. In specific aspects, the
immune cells are isolated from pooled blood, particularly pooled
cord blood, for enhanced immunomodulation capacity. The pooled
blood may be from 2 or more sources, such as 3, 4, 5, 6, 7, 8, 9,
10 or more sources (e.g., donor subjects).
[0082] The population of immune cells can be obtained from a
subject in need of therapy or suffering from a disease associated
with reduced immune cell activity. Thus, the cells will be
autologous to the subject in need of therapy. Alternatively, the
population of immune cells can be obtained from a donor, preferably
a histocompatibility matched donor. The immune cell population can
be harvested from the peripheral blood, cord blood, bone marrow,
spleen, or any other organ/tissue in which immune cells reside in
said subject or donor. The immune cells can be isolated from a pool
of subjects and/or donors, such as from pooled cord blood.
[0083] When the population of immune cells is obtained from a donor
distinct from the subject, the donor is preferably allogeneic,
provided the cells obtained are subject-compatible in that they can
be introduced into the subject. Allogeneic donor cells are may or
may not be human-leukocyte-antigen (HLA)-compatible. To be rendered
subject-compatible, allogeneic cells can be treated to reduce
immunogenicity.
[0084] A. T Cells
[0085] In some embodiments, the immune cells are T cells. Several
basic approaches for the derivation, activation and expansion of
functional anti-tumor effector cells have been described in the
last two decades. These include: autologous cells, such as
tumor-infiltrating lymphocytes (TILs); T cells activated ex-vivo
using autologous DCs, lymphocytes, artificial antigen-presenting
cells (APCs) or beads coated with T cell ligands and activating
antibodies, or cells isolated by virtue of capturing target cell
membrane; allogeneic cells naturally expressing anti-host tumor
TCR; and non-tumor-specific autologous or allogeneic cells
genetically reprogrammed or "redirected" to express tumor-reactive
TCR or chimeric TCR molecules displaying antibody-like tumor
recognition capacity known as "T-bodies". These approaches have
given rise to numerous protocols for T cell preparation and
immunization which can be used in the methods described herein.
[0086] In some embodiments, the T cells are derived from the blood,
bone marrow, lymph, umbilical cord, or lymphoid organs. In some
aspects, the cells are human cells. The cells typically are primary
cells, such as those isolated directly from a subject and/or
isolated from a subject and frozen. In some embodiments, the cells
include one or more subsets of T cells or other cell types, such as
whole T cell populations, CD4.sup.+ cells, CD8.sup.+ cells, and
subpopulations thereof, such as those defined by function,
activation state, maturity, potential for differentiation,
expansion, recirculation, localization, and/or persistence
capacities, antigen-specificity, type of antigen receptor, presence
in a particular organ or compartment, marker or cytokine secretion
profile, and/or degree of differentiation. With reference to the
subject to be treated, the cells may be allogeneic and/or
autologous. In some aspects, such as for off-the-shelf
technologies, the cells are pluripotent and/or multipotent, such as
stem cells, such as induced pluripotent stem cells (iPSCs). In some
embodiments, the methods include isolating cells from the subject,
preparing, processing, culturing, and/or engineering them, as
described herein, and re-introducing them into the same patient,
before or after cryopreservation.
[0087] Among the sub-types and subpopulations of T cells (e.g.,
CD4.sup.+ and/or CD8.sup.+ T cells) are naive T (T.sub.N) cells,
effector T cells (T.sub.EFF), memory T cells and sub-types thereof,
such as stem cell memory T (TSC.sub.M), central memory T
(TC.sub.M), effector memory T (T.sub.EM), or terminally
differentiated effector memory T cells, tumor-infiltrating
lymphocytes (TIL), immature T cells, mature T cells, helper T
cells, cytotoxic T cells, mucosa-associated invariant T (MAIT)
cells, naturally occurring and adaptive regulatory T (Treg) cells,
helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH17
cells, TH9 cells, TH22 cells, follicular helper T cells, alpha/beta
T cells, and delta/gamma T cells.
[0088] In some embodiments, one or more of the T cell populations
is enriched for or depleted of cells that are positive for a
specific marker, such as surface markers, or that are negative for
a specific marker. In some cases, such markers are those that are
absent or expressed at relatively low levels on certain populations
of T cells (e.g., non-memory cells) but are present or expressed at
relatively higher levels on certain other populations of T cells
(e.g., memory cells).
[0089] In some embodiments, T cells are separated from a PBMC
sample by negative selection of markers expressed on non-T cells,
such as B cells, monocytes, or other white blood cells, such as
CD14. In some aspects, a CD4.sup.+ or CD8.sup.+ selection step is
used to separate CD4.sup.+ helper and CD8.sup.+ cytotoxic T cells.
Such CD4.sup.+ and CD8.sup.+ populations can be further sorted into
sub-populations by positive or negative selection for markers
expressed or expressed to a relatively higher degree on one or more
naive, memory, and/or effector T cell subpopulations.
[0090] In some embodiments, CD8.sup.+ T cells are further enriched
for or depleted of naive, central memory, effector memory, and/or
central memory stem cells, such as by positive or negative
selection based on surface antigens associated with the respective
subpopulation.
[0091] In some embodiments, the T cells are autologous T cells. In
this method, tumor samples are obtained from patients and a single
cell suspension is obtained. The single cell suspension can be
obtained in any suitable manner, e.g., mechanically (disaggregating
the tumor using, e.g., a gentleMACS.TM. Dissociator, Miltenyi
Biotec, Auburn, Calif.) or enzymatically (e.g., collagenase or
DNase). Single-cell suspensions of tumor enzymatic digests are
cultured in interleukin-2 (IL-2).
[0092] The cultured T cells can be pooled and rapidly expanded.
Rapid expansion provides an increase in the number of
antigen-specific T-cells of at least about 50-fold (e.g., 50-, 60-,
70-, 80-, 90-, or 100-fold, or greater) over a period of about 10
to about 14 days. More preferably, rapid expansion provides an
increase of at least about 200-fold (e.g., 200-, 300-, 400-, 500-,
600-, 700-, 800-, 900-, or greater) over a period of about 10 to
about 14 days.
[0093] Expansion can be accomplished by any of a number of methods
as are known in the art. For example, T cells can be rapidly
expanded using non-specific T-cell receptor stimulation in the
presence of feeder lymphocytes and either interleukin-2 (IL-2) or
interleukin-15 (IL-15), with IL-2 being preferred. The non-specific
T-cell receptor stimulus can include around 30 ng/ml of OKT3, a
mouse monoclonal anti-CD3 antibody (available from
Ortho-McNeil.RTM., Raritan, N.J.). Alternatively, T cells can be
rapidly expanded by stimulation of peripheral blood mononuclear
cells (PBMC) in vitro with one or more antigens (including
antigenic portions thereof, such as epitope(s), or a cell) of the
cancer, which can be optionally expressed from a vector, such as an
human leukocyte antigen A2 (HLA-A2) binding peptide, in the
presence of a T-cell growth factor, such as 300 IU/ml IL-2 or
IL-15, with IL-2 being preferred. The in vitro-induced T cells are
rapidly expanded by re-stimulation with the same antigen(s) of the
cancer pulsed onto HLA-A2-expressing antigen-presenting cells.
Alternatively, the T-cells can be re-stimulated with irradiated,
autologous lymphocytes or with irradiated HLA-A2+ allogeneic
lymphocytes and IL-2, for example.
[0094] The autologous T-cells can be modified to express a T-cell
growth factor that promotes the growth and activation of the
autologous T-cells. Suitable T-cell growth factors include, for
example, interleukin (IL)-2, IL-7, IL-15, and IL-12. Suitable
methods of modification are known in the art. See, for instance,
Sambrook et al., Molecular Cloning: A Laboratory Manual, 3.sup.rd
ed., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 2001; and
Ausubel et al., Current Protocols in Molecular Biology, Greene
Publishing Associates and John Wiley & Sons, N Y, 1994. In
particular aspects, modified autologous T cells express the T cell
growth factor at high levels. T cell growth factor coding
sequences, such as that of IL-12, are readily available in the art,
as are promoters, the operable linkage of which to a T-cell growth
factor coding sequence promote high-level expression.
[0095] B. NK Cells
[0096] In some embodiments, the immune cells are NK cells. NK cells
are a subpopulation of lymphocytes that have spontaneous
cytotoxicity against a variety of tumor cells, virus-infected
cells, and some normal cells in the bone marrow and thymus. NK
cells are critical effectors of the early innate immune response
toward transformed and virus-infected cells. NK cells constitute
about 10% of the lymphocytes in human peripheral blood. When
lymphocytes are cultured in the presence of IL-2, strong cytotoxic
reactivity develops. NK cells are effector cells known as large
granular lymphocytes because of their larger size and the presence
of characteristic azurophilic granules in their cytoplasm. NK cells
differentiate and mature in the bone marrow, lymph nodes, spleen,
tonsils, and thymus. NK cells can be detected by specific surface
markers, such as CD16, CD56, and CD8 in humans. NK cells do not
express T cell antigen receptors, the pan T marker CD3, or surface
immunoglobulin B cell receptors.
[0097] Stimulation of NK cells is achieved through a cross-talk of
signals derived from cell surface activating and inhibitory
receptors. The activation status of NK cells is regulated by a
balance of intracellular signals received from an array of
germ-line-encoded activating and inhibitory receptors (Campbell,
2006). When NK cells encounter an abnormal cell (e.g., tumor or
virus-infected cell) and activating signals predominate, the NK
cells can rapidly induce apoptosis of the target cell through
directed secretion of cytolytic granules containing perforin and
granzymes or engagement of death domain-containing receptors.
Activated NK cells can also secrete type I cytokines, such as
interferon-.gamma., tumor necrosis factor-.alpha. and
granulocyte-macrophage colony-stimulating factor (GM-CSF), which
activate both innate and adaptive immune cells as well as other
cytokines and chemokines (Wu et al., 2003). Production of these
soluble factors by NK cells in early innate immune responses
significantly influences the recruitment and function of other
hematopoietic cells. Also, through physical contacts and production
of cytokines, NK cells are central players in a regulatory
crosstalk network with dendritic cells and neutrophils to promote
or restrain immune responses.
[0098] In certain embodiments, NK cells are derived from human
peripheral blood mononuclear cells (PBMC), unstimulated
leukapheresis products (PBSC), human embryonic stem cells (hESCs),
induced pluripotent stem cells (iPSCs), bone marrow, or umbilical
cord blood by methods well known in the art. Particularly,
umbilical CB is used to derive NK cells. In certain aspects, the NK
cells are isolated and expanded by the previously described method
of ex vivo expansion of NK cells (Shah et al., 2013). In this
method, CB mononuclear cells are isolated by ficoll density
gradient centrifugation and cultured in a bioreactor with IL-2 and
artificial antigen presenting cells (aAPCs). After 7 days, the cell
culture is depleted of any cells expressing CD3 and re-cultured for
an additional 7 days. The cells are again CD3-depleted and
characterized to determine the percentage of CD56.sup.+/CD3.sup.-
cells or NK cells. In other methods, umbilical CB is used to derive
NK cells by the isolation of CD34.sup.+ cells and differentiation
into CD56.sup.+/CD3.sup.- cells by culturing in medium contain SCF,
IL-7, IL-15, and IL-2.
[0099] C. Stem Cells
[0100] In some embodiments, the immune cells of the present
disclosure may be stem cells, such as induced pluripotent stem
cells (PSCs), mesenchymal stem cells (MSCs), or hematopoietic stem
cells (HSCs).
[0101] The pluripotent stem cells used herein may be induced
pluripotent stem (iPS) cells, commonly abbreviated iPS cells or
iPSCs. The induction of pluripotency was originally achieved in
2006 using mouse cells (Yamanaka et al. 2006) and in 2007 using
human cells (Yu et al. 2007; Takahashi et al. 2007) by
reprogramming of somatic cells via the introduction of
transcription factors that are linked to pluripotency. The use of
iPSCs circumvents most of the ethical and practical problems
associated with large-scale clinical use of ES cells, and patients
with iPSC-derived autologous transplants may not require lifelong
immunosuppressive treatments to prevent graft rejection.
[0102] With the exception of germ cells, any cell can be used as a
starting point for iPSCs. For example, cell types could be
keratinocytes, fibroblasts, hematopoietic cells, mesenchymal cells,
liver cells, or stomach cells. There is no limitation on the degree
of cell differentiation or the age of an animal from which cells
are collected; even undifferentiated progenitor cells (including
somatic stem cells) and finally differentiated mature cells can be
used as sources of somatic cells in the methods disclosed
herein.
[0103] Somatic cells can be reprogrammed to produce iPS cells using
methods known to one of skill in the art. One of skill in the art
can readily produce iPS cells, see for example, Published U.S.
Patent Application No. 2009/0246875, Published U.S. Patent
Application No. 2010/0210014; Published U.S. Patent Application No.
2012/0276636; U.S. Pat. Nos. 8,058,065; 8,129,187; PCT Publication
NO. WO 2007/069666 A1, U.S. Pat. Nos. 8,268,620; 8,546,140;
9,175,268; 8,741,648; U.S. Patent Application No. 2011/0104125, and
U.S. Pat. No. 8,691,574, which are incorporated herein by
reference. Generally, nuclear reprogramming factors are used to
produce pluripotent stem cells from a somatic cell. In some
embodiments, at least three, or at least four, of Klf4, c-Myc,
Oct3/4, Sox2, Nanog, and Lin28 are utilized. In other embodiments,
Oct3/4, Sox2, c-Myc and Klf4 are utilized or Oct3/4, Sox2, Nanog,
and Lin28.
[0104] Mouse and human cDNA sequences of these nuclear
reprogramming substances are available with reference to the NCBI
accession numbers mentioned in WO 2007/069666 and U.S. Pat. No.
8,183,038, which are incorporated herein by reference. Methods for
introducing one or more reprogramming substances, or nucleic acids
encoding these reprogramming substances, are known in the art, and
disclosed for example, in U.S. Pat. Nos. 8,268,620, 8,691,574,
8,741,648, 8,546,140, in published U.S. Pat. Nos. 8,900,871 and
8,071,369, which are both incorporated herein by reference.
[0105] Once derived, iPSCs can be cultured in a medium sufficient
to maintain pluripotency. The iPSCs may be used with various media
and techniques developed to culture pluripotent stem cells, more
specifically, embryonic stem cells, as described in U.S. Pat. No.
7,442,548 and U.S. Patent Pub. No. 2003/0211603. In the case of
mouse cells, the culture is carried out with the addition of
Leukemia Inhibitory Factor (LIF) as a differentiation suppression
factor to an ordinary medium. In the case of human cells, it is
desirable that basic fibroblast growth factor (bFGF) be added in
place of LIF. Other methods for the culture and maintenance of
iPSCs, as would be known to one of skill in the art, may be used
with the methods disclosed herein.
[0106] In certain embodiments, undefined conditions may be used;
for example, pluripotent cells may be cultured on fibroblast feeder
cells or a medium that has been exposed to fibroblast feeder cells
in order to maintain the stem cells in an undifferentiated state.
In some embodiments, the cell is cultured in the co-presence of
mouse embryonic fibroblasts treated with radiation or an antibiotic
to terminate the cell division, as feeder cells. Alternately,
pluripotent cells may be cultured and maintained in an essentially
undifferentiated state using a defined, feeder-independent culture
system, such as a TESR.TM. medium or E8.TM./Essential 8.TM.
medium.
[0107] Plasmids have been designed with a number of goals in mind,
such as achieving regulated high copy number and avoiding potential
causes of plasmid instability in bacteria, and providing means for
plasmid selection that are compatible with use in mammalian cells,
including human cells. Particular attention has been paid to the
dual requirements of plasmids for use in human cells. First, they
are suitable for maintenance and fermentation in E. coli, so that
large amounts of DNA can be produced and purified. Second, they are
safe and suitable for use in human patients and animals. The first
requirement calls for high copy number plasmids that can be
selected for and stably maintained relatively easily during
bacterial fermentation. The second requirement calls for attention
to elements such as selectable markers and other coding sequences.
In some embodiments, plasmids that encode a marker are composed of:
(1) a high copy number replication origin, (2) a selectable marker,
such as, but not limited to, the neo gene for antibiotic selection
with kanamycin, (3) transcription termination sequences, including
the tyrosinase enhancer and (4) a multicloning site for
incorporation of various nucleic acid cassettes; and (5) a nucleic
acid sequence encoding a marker operably linked to the tyrosinase
promoter. In particular aspects, the plasmids do not comprise a
tyrosinase enhancer or promoter. There are numerous plasmid vectors
that are known in the art for inducing a nucleic acid encoding a
protein. These include, but are not limited to, the vectors
disclosed in U.S. Pat. Nos. 6,103,470; 7,598,364; 7,989,425; and
6,416,998, and U.S. application Ser. No. 12/478,154 which are
incorporated herein by reference.
[0108] An episomal gene delivery system can be a plasmid, an
Epstein-Barr virus (EBV)-based episomal vector, a yeast-based
vector, an adenovirus-based vector, a simian virus 40 (SV40)-based
episomal vector, a bovine papilloma virus (BPV)-based vector, or a
lentiviral vector. A viral gene delivery system can be an RNA-based
or DNA-based viral vector.
[0109] D. Genetically Engineered Antigen Receptors
[0110] The immune cells (e.g., autologous or allogeneic T cells
(e.g., regulatory T cells, CD4.sup.+ T cells, CD8.sup.+ T cells, or
gamma-delta T cells), NK cells, invariant NK cells, NKT cells, stem
cells (e.g., MSCs or iPS cells) can be genetically engineered to
express antigen receptors such as engineered TCRs and/or CARs. For
example, the host cells (e.g., autologous or allogeneic T-cells)
are modified to express a TCR having antigenic specificity for a
cancer antigen. In particular embodiments, NK cells are engineered
to express a TCR. The NK cells may be further engineered to express
a CAR. Multiple CARs and/or TCRs, such as to different antigens,
may be added to a single cell type, such as T cells or NK
cells.
[0111] Suitable methods of modification are known in the art. See,
for instance, Sambrook and Ausubel, supra. For example, the cells
may be transduced to express a TCR having antigenic specificity for
a cancer antigen using transduction techniques described in
Heemskerk et al., 2008 and Johnson et al., 2009.
[0112] Electroporation of RNA coding for the full length TCR
.alpha. and .beta. (or .gamma. and .delta.) chains can be used as
alternative to overcome long-term problems with autoreactivity
caused by pairing of retrovirally transduced and endogenous TCR
chains. Even if such alternative pairing takes place in the
transient transfection strategy, the possibly generated
autoreactive T cells will lose this autoreactivity after some time,
because the introduced TCR .alpha. and .beta. chain are only
transiently expressed. When the introduced TCR .alpha. and .beta.
chain expression is diminished, only normal autologous T cells are
left. This is not the case when full length TCR chains are
introduced by stable retroviral transduction, which will never lose
the introduced TCR chains, causing a constantly present
autoreactivity in the patient.
[0113] In some embodiments, the cells comprise one or more nucleic
acids introduced via genetic engineering that encode one or more
antigen receptors, and genetically engineered products of such
nucleic acids. In some embodiments, the nucleic acids are
heterologous, i.e., normally not present in a cell or sample
obtained from the cell, such as one obtained from another organism
or cell, which for example, is not ordinarily found in the cell
being engineered and/or an organism from which such cell is
derived. In some embodiments, the nucleic acids are not naturally
occurring, such as a nucleic acid not found in nature (e.g.,
chimeric).
[0114] In some embodiments, the CAR contains an extracellular
antigen-recognition domain that specifically binds to an antigen.
In some embodiments, the antigen is a protein expressed on the
surface of cells. In some embodiments, the CAR is a TCR-like CAR
and the antigen is a processed peptide antigen, such as a peptide
antigen of an intracellular protein, which, like a TCR, is
recognized on the cell surface in the context of a major
histocompatibility complex (MEW) molecule.
[0115] Exemplary antigen receptors, including CARs and recombinant
TCRs, as well as methods for engineering and introducing the
receptors into cells, include those described, for example, in
international patent application publication numbers WO200014257,
WO2013126726, WO2012/129514, WO2014031687, WO2013/166321,
WO2013/071154, WO2013/123061 U.S. patent application publication
numbers US2002131960, US2013287748, US20130149337, U.S. Pat. Nos.
6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179,
6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353,
and 8,479,118, and European patent application number EP2537416,
and/or those described by Sadelain et al., 2013; Davila et al.,
2013; Turtle et al., 2012; Wu et al., 2012. In some aspects, the
genetically engineered antigen receptors include a CAR as described
in U.S. Pat. No. 7,446,190, and those described in International
Patent Application Publication No.: WO/2014055668 A1.
[0116] 1. Chimeric Antigen Receptors
[0117] In some embodiments, the CAR comprises: a) an intracellular
signaling domain, b) a transmembrane domain, and c) an
extracellular domain comprising an antigen binding region.
[0118] In some embodiments, the engineered antigen receptors
include CARs, including activating or stimulatory CARs,
costimulatory CARs (see WO2014/055668), and/or inhibitory CARs
(iCARs, see Fedorov et al., 2013). The CARs generally include an
extracellular antigen (or ligand) binding domain linked to one or
more intracellular signaling components, in some aspects via
linkers and/or transmembrane domain(s). Such molecules typically
mimic or approximate a signal through a natural antigen receptor, a
signal through such a receptor in combination with a costimulatory
receptor, and/or a signal through a costimulatory receptor
alone.
[0119] Certain embodiments of the present disclosure concern the
use of nucleic acids, including nucleic acids encoding an
antigen-specific CAR polypeptide, including a CAR that has been
humanized to reduce immunogenicity (hCAR), comprising an
intracellular signaling domain, a transmembrane domain, and an
extracellular domain comprising one or more signaling motifs. In
certain embodiments, the CAR may recognize an epitope comprising
the shared space between one or more antigens. In certain
embodiments, the binding region can comprise complementary
determining regions of a monoclonal antibody, variable regions of a
monoclonal antibody, and/or antigen binding fragments thereof. In
another embodiment, that specificity is derived from a peptide
(e.g., cytokine) that binds to a receptor.
[0120] It is contemplated that the human CAR nucleic acids may be
human genes used to enhance cellular immunotherapy for human
patients. In a specific embodiment, the invention includes a
full-length CAR cDNA or coding region. The antigen binding regions
or domain can comprise a fragment of the V.sub.H and V.sub.L chains
of a single-chain variable fragment (scFv) derived from a
particular human monoclonal antibody, such as those described in
U.S. Pat. No. 7,109,304, incorporated herein by reference. The
fragment can also be any number of different antigen binding
domains of a human antigen-specific antibody. In a more specific
embodiment, the fragment is an antigen-specific scFv encoded by a
sequence that is optimized for human codon usage for expression in
human cells.
[0121] The arrangement could be multimeric, such as a diabody or
multimers. The multimers are most likely formed by cross pairing of
the variable portion of the light and heavy chains into a diabody.
The hinge portion of the construct can have multiple alternatives
from being totally deleted, to having the first cysteine
maintained, to a proline rather than a serine substitution, to
being truncated up to the first cysteine. The Fc portion can be
deleted. Any protein that is stable and/or dimerizes can serve this
purpose. One could use just one of the Fc domains, e.g., either the
CH2 or CH3 domain from human immunoglobulin. One could also use the
hinge, CH2 and CH3 region of a human immunoglobulin that has been
modified to improve dimerization. One could also use just the hinge
portion of an immunoglobulin. One could also use portions of
CD8alpha.
[0122] In some embodiments, the CAR nucleic acid comprises a
sequence encoding other costimulatory receptors, such as a
transmembrane domain and a modified CD28 intracellular signaling
domain. Other costimulatory receptors include, but are not limited
to one or more of CD28, CD27, OX-40 (CD134), DAP10, DAP12, and
4-1BB (CD137). In addition to a primary signal initiated by
CD3.zeta., an additional signal provided by a human costimulatory
receptor inserted in a human CAR is important for full activation
of NK cells and could help improve in vivo persistence and the
therapeutic success of the adoptive immunotherapy.
[0123] In some embodiments, CAR is constructed with a specificity
for a particular antigen (or marker or ligand), such as an antigen
expressed in a particular cell type to be targeted by adoptive
therapy, e.g., a cancer marker, and/or an antigen intended to
induce a dampening response, such as an antigen expressed on a
normal or non-diseased cell type. Thus, the CAR typically includes
in its extracellular portion one or more antigen binding molecules,
such as one or more antigen-binding fragment, domain, or portion,
or one or more antibody variable domains, and/or antibody
molecules. In some embodiments, the CAR includes an antigen-binding
portion or portions of an antibody molecule, such as a single-chain
antibody fragment (scFv) derived from the variable heavy (VH) and
variable light (VL) chains of a monoclonal antibody (mAb).
[0124] In certain embodiments of the chimeric antigen receptor, the
antigen-specific portion of the receptor (which may be referred to
as an extracellular domain comprising an antigen binding region)
comprises a tumor associated antigen or a pathogen-specific antigen
binding domain. Antigens include carbohydrate antigens recognized
by pattern-recognition receptors, such as Dectin-1. A tumor
associated antigen may be of any kind so long as it is expressed on
the cell surface of tumor cells. Exemplary embodiments of tumor
associated antigens include CD19, CD20, carcinoembryonic antigen,
alphafetoprotein, CA-125, MUC-1, CD56, EGFR, c-Met, AKT, Her2,
Her3, epithelial tumor antigen, melanoma-associated antigen,
mutated p53, mutated ras, and so forth. In certain embodiments, the
CAR may be co-expressed with a cytokine to improve persistence when
there is a low amount of tumor-associated antigen. For example, CAR
may be co-expressed with IL-15.
[0125] The sequence of the open reading frame encoding the chimeric
receptor can be obtained from a genomic DNA source, a cDNA source,
or can be synthesized (e.g., via PCR), or combinations thereof.
Depending upon the size of the genomic DNA and the number of
introns, it may be desirable to use cDNA or a combination thereof
as it is found that introns stabilize the mRNA. Also, it may be
further advantageous to use endogenous or exogenous non-coding
regions to stabilize the mRNA.
[0126] It is contemplated that the chimeric construct can be
introduced into immune cells as naked DNA or in a suitable vector.
Methods of stably transfecting cells by electroporation using naked
DNA are known in the art. See, e.g., U.S. Pat. No. 6,410,319. Naked
DNA generally refers to the DNA encoding a chimeric receptor
contained in a plasmid expression vector in proper orientation for
expression.
[0127] Alternatively, a viral vector (e.g., a retroviral vector,
adenoviral vector, adeno-associated viral vector, or lentiviral
vector) can be used to introduce the chimeric construct into immune
cells. Suitable vectors for use in accordance with the method of
the present disclosure are non-replicating in the immune cells. A
large number of vectors are known that are based on viruses, where
the copy number of the virus maintained in the cell is low enough
to maintain the viability of the cell, such as, for example,
vectors based on HIV, SV40, EBV, HSV, or BPV.
[0128] In some aspects, the antigen-specific binding, or
recognition component is linked to one or more transmembrane and
intracellular signaling domains. In some embodiments, the CAR
includes a transmembrane domain fused to the extracellular domain
of the CAR. In one embodiment, the transmembrane domain that
naturally is associated with one of the domains in the CAR is used.
In some instances, the transmembrane domain is selected or modified
by amino acid substitution to avoid binding of such domains to the
transmembrane domains of the same or different surface membrane
proteins to minimize interactions with other members of the
receptor complex.
[0129] The transmembrane domain in some embodiments is derived
either from a natural or from a synthetic source. Where the source
is natural, the domain in some aspects is derived from any
membrane-bound or transmembrane protein. Transmembrane regions
include those derived from (i.e. comprise at least the
transmembrane region(s) of) the alpha, beta or zeta chain of the T-
cell receptor, CD28, CD3 zeta, CD3 epsilon, CD3 gamma, CD3 delta,
CD45, CD4, CD5, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80,
CD86, CD 134, CD137, CD154, ICOS/CD278, GITR/CD357, NKG2D, and DAP
molecules. Alternatively the transmembrane domain in some
embodiments is synthetic. In some aspects, the synthetic
transmembrane domain comprises predominantly hydrophobic residues
such as leucine and valine. In some aspects, a triplet of
phenylalanine, tryptophan and valine will be found at each end of a
synthetic transmembrane domain.
[0130] In certain embodiments, the platform technologies disclosed
herein to genetically modify immune cells, such as NK cells,
comprise (i) non-viral gene transfer using an electroporation
device (e.g., a nucleofector), (ii) CARs that signal through
endodomains (e.g., CD28/CD3-.zeta., CD137/CD3-.zeta., or other
combinations), (iii) CARs with variable lengths of extracellular
domains connecting the antigen-recognition domain to the cell
surface, and, in some cases, (iv) artificial antigen presenting
cells (aAPC) derived from K562 to be able to robustly and
numerically expand CAR' immune cells (Singh et al., 2008; Singh et
al., 2011).
[0131] 2. T Cell Receptor (TCR)
[0132] In some embodiments, the genetically engineered antigen
receptors include recombinant TCRs and/or TCRs cloned from
naturally occurring T cells. A "T cell receptor" or "TCR" refers to
a molecule that contains a variable a and .beta. chains (also known
as TCR.alpha. and TCR.beta., respectively) or a variable .gamma.
and .delta. chains (also known as TCR.gamma. and TCR.delta.,
respectively) and that is capable of specifically binding to an
antigen peptide bound to a MEW receptor. In some embodiments, the
TCR is in the .alpha..beta. form.
[0133] Typically, TCRs that exist in .alpha..beta. and
.gamma..delta. forms are generally structurally similar, but T
cells expressing them may have distinct anatomical locations or
functions. A TCR can be found on the surface of a cell or in
soluble form. Generally, a TCR is found on the surface of T cells
(or T lymphocytes) where it is generally responsible for
recognizing antigens bound to major histocompatibility complex
(MHC) molecules. In some embodiments, a TCR also can contain a
constant domain, a transmembrane domain and/or a short cytoplasmic
tail (see, e.g., Janeway et al, 1997). For example, in some
aspects, each chain of the TCR can possess one N-terminal
immunoglobulin variable domain, one immunoglobulin constant domain,
a transmembrane region, and a short cytoplasmic tail at the
C-terminal end. In some embodiments, a TCR is associated with
invariant proteins of the CD3 complex involved in mediating signal
transduction. Unless otherwise stated, the term "TCR" should be
understood to encompass functional TCR fragments thereof. The term
also encompasses intact or full-length TCRs, including TCRs in the
.alpha..beta. form or .gamma..delta. form.
[0134] Thus, for purposes herein, reference to a TCR includes any
TCR or functional fragment, such as an antigen-binding portion of a
TCR that binds to a specific antigenic peptide bound in an MHC
molecule, i.e. MHC-peptide complex. An "antigen-binding portion" or
antigen-binding fragment" of a TCR, which can be used
interchangeably, refers to a molecule that contains a portion of
the structural domains of a TCR, but that binds the antigen (e.g.
MHC-peptide complex) to which the full TCR binds. In some cases, an
antigen-binding portion contains the variable domains of a TCR,
such as variable a chain and variable .beta. chain of a TCR,
sufficient to form a binding site for binding to a specific
MHC-peptide complex, such as generally where each chain contains
three complementarity determining regions.
[0135] In some embodiments, the variable domains of the TCR chains
associate to form loops, or complementarity determining regions
(CDRs) analogous to immunoglobulins, which confer antigen
recognition and determine peptide specificity by forming the
binding site of the TCR molecule and determine peptide specificity.
Typically, like immunoglobulins, the CDRs are separated by
framework regions (FRs) (see, e.g., Jores et al., 1990; Chothia et
al., 1988; Lefranc et al., 2003). In some embodiments, CDR3 is the
main CDR responsible for recognizing processed antigen, although
CDR1 of the alpha chain has also been shown to interact with the
N-terminal part of the antigenic peptide, whereas CDR1 of the beta
chain interacts with the C-terminal part of the peptide. CDR2 is
thought to recognize the MHC molecule. In some embodiments, the
variable region of the .beta.-chain can contain a further
hypervariability (HV4) region.
[0136] In some embodiments, the TCR chains contain a constant
domain. For example, like immunoglobulins, the extracellular
portion of TCR chains (e.g., a-chain, .beta.-chain) can contain two
immunoglobulin domains, a variable domain (e.g., V.sub.a or Vp;
typically amino acids 1 to 116 based on Kabat numbering Kabat et
al., "Sequences of Proteins of Immunological Interest, US Dept.
Health and Human Services, Public Health Service National
Institutes of Health, 1991, 5.sup.th ed.) at the N-terminus, and
one constant domain (e.g., a-chain constant domain or C.sub.a,
typically amino acids 117 to 259 based on Kabat, .beta.-chain
constant domain or Cp, typically amino acids 117 to 295 based on
Kabat) adjacent to the cell membrane. For example, in some cases,
the extracellular portion of the TCR formed by the two chains
contains two membrane-proximal constant domains, and two
membrane-distal variable domains containing CDRs. The constant
domain of the TCR domain contains short connecting sequences in
which a cysteine residue forms a disulfide bond, making a link
between the two chains. In some embodiments, a TCR may have an
additional cysteine residue in each of the .alpha. and .beta.
chains such that the TCR contains two disulfide bonds in the
constant domains.
[0137] In some embodiments, the TCR chains can contain a
transmembrane domain. In some embodiments, the transmembrane domain
is positively charged. In some cases, the TCR chains contains a
cytoplasmic tail. In some cases, the structure allows the TCR to
associate with other molecules like CD3. For example, a TCR
containing constant domains with a transmembrane region can anchor
the protein in the cell membrane and associate with invariant
subunits of the CD3 signaling apparatus or complex.
[0138] Generally, CD3 is a multi-protein complex that can possess
three distinct chains (.gamma., .delta., and .epsilon.) in mammals
and the .zeta.-chain. For example, in mammals the complex can
contain a CD3.gamma. chain, a CD3.delta. chain, two CD3.epsilon.
chains, and a homodimer of CD3.zeta. chains. The CD3.gamma.,
CD3.delta., and CD3.epsilon. chains are highly related cell surface
proteins of the immunoglobulin superfamily containing a single
immunoglobulin domain. The transmembrane regions of the CD3.gamma.,
CD3.delta., and CD3.epsilon. chains are negatively charged, which
is a characteristic that allows these chains to associate with the
positively charged T cell receptor chains. The intracellular tails
of the CD3.gamma., CD3.delta., and CD3.epsilon. chains each contain
a single conserved motif known as an immunoreceptor tyrosine-based
activation motif or ITAM, whereas each CD3.zeta. chain has three.
Generally, ITAMs are involved in the signaling capacity of the TCR
complex. These accessory molecules have negatively charged
transmembrane regions and play a role in propagating the signal
from the TCR into the cell. The CD3- and .zeta.-chains, together
with the TCR, form what is known as the T cell receptor
complex.
[0139] In some embodiments, the TCR may be a heterodimer of two
chains .alpha. and .beta. (or optionally .gamma. and .delta.) or it
may be a single chain TCR construct. In some embodiments, the TCR
is a heterodimer containing two separate chains (.alpha. and .beta.
chains or .gamma. and .delta. chains) that are linked, such as by a
disulfide bond or disulfide bonds. In some embodiments, a TCR for a
target antigen (e.g., a cancer antigen) is identified and
introduced into the cells. In some embodiments, nucleic acid
encoding the TCR can be obtained from a variety of sources, such as
by polymerase chain reaction (PCR) amplification of publicly
available TCR DNA sequences. In some embodiments, the TCR is
obtained from a biological source, such as from cells such as from
a T cell (e.g. cytotoxic T cell), T cell hybridomas or other
publicly available source. In some embodiments, the T cells can be
obtained from in vivo isolated cells. In some embodiments, a
high-affinity T cell clone can be isolated from a patient, and the
TCR isolated. In some embodiments, the T cells can be a cultured T
cell hybridoma or clone. In some embodiments, the TCR clone for a
target antigen has been generated in transgenic mice engineered
with human immune system genes (e.g., the human leukocyte antigen
system, or HLA). See, e.g., tumor antigens (see, e.g., Parkhurst et
al., 2009 and Cohen et al., 2005). In some embodiments, phage
display is used to isolate TCRs against a target antigen (see,
e.g., Varela-Rohena et al., 2008 and Li, 2005). In some
embodiments, the TCR or antigen-binding portion thereof can be
synthetically generated from knowledge of the sequence of the
TCR.
[0140] 3. Antigen-Presenting Cells
[0141] Antigen-presenting cells, which include macrophages, B
lymphocytes, and dendritic cells, are distinguished by their
expression of a particular MHC molecule. APCs internalize antigen
and re-express a part of that antigen, together with the MHC
molecule on their outer cell membrane. The MHC is a large genetic
complex with multiple loci. The MHC loci encode two major classes
of MHC membrane molecules, referred to as class I and class II
MHCs. T helper lymphocytes generally recognize antigen associated
with MHC class II molecules, and T cytotoxic lymphocytes recognize
antigen associated with MHC class I molecules. In humans the MHC is
referred to as the HLA complex and in mice the H-2 complex.
[0142] In some cases, aAPCs are useful in preparing therapeutic
compositions and cell therapy products of the embodiments. For
general guidance regarding the preparation and use of
antigen-presenting systems, see, e.g., U.S. Pat. Nos. 6,225,042,
6,355,479, 6,362,001 and 6,790,662; U.S. Patent Application
Publication Nos. 2009/0017000 and 2009/0004142; and International
Publication No. WO2007/103009.
[0143] aAPC systems may comprise at least one exogenous assisting
molecule. Any suitable number and combination of assisting
molecules may be employed. The assisting molecule may be selected
from assisting molecules such as co-stimulatory molecules and
adhesion molecules. Exemplary co-stimulatory molecules include
CD86, CD64 (Fc.gamma.RI), 41BB ligand, and IL-21. Adhesion
molecules may include carbohydrate-binding glycoproteins such as
selectins, transmembrane binding glycoproteins such as integrins,
calcium-dependent proteins such as cadherins, and single-pass
transmembrane immunoglobulin (Ig) superfamily proteins, such as
intercellular adhesion molecules (ICAMs), which promote, for
example, cell-to-cell or cell-to-matrix contact. Exemplary adhesion
molecules include LFA-3 and ICAMs, such as ICAM-1. Techniques,
methods, and reagents useful for selection, cloning, preparation,
and expression of exemplary assisting molecules, including
co-stimulatory molecules and adhesion molecules, are exemplified
in, e.g., U.S. Pat. Nos. 6,225,042, 6,355,479, and 6,362,001.
[0144] 4. Interleukin-15
[0145] Interleukin-15 (IL-15) is tissue restricted and only under
pathologic conditions is it observed at any level in the serum, or
systemically. IL-15 possesses several attributes that are desirable
for adoptive therapy. IL-15 is a homeostatic cytokine that induces
development and cell proliferation of natural killer cells,
promotes the eradication of established tumors via alleviating
functional suppression of tumor-resident cells, and inhibits
AICD.
[0146] In one embodiments, the present disclosure concerns
co-modifying CAR and/or TCR immune cells with IL-15. In addition to
IL-15, other cytokines are envisioned. These include, but are not
limited to, cytokines, chemokines, and other molecules that
contribute to the activation and proliferation of cells used for
human application. NK or T cells expressing IL-15 are capable of
continued supportive cytokine signaling, which is critical to their
survival post-infusion.
[0147] In certain embodiments, K562 aAPC were developed, expressing
the desired antigen (e.g., CD19) along with costimulatory
molecules, such as CD28, IL-15, and CD3, to select for immune cells
(e.g., NK cells) in vitro that are capable of sustained
CAR-mediated propagation. This powerful technology allows the
manufacture of clinically relevant numbers (up to 10.sup.10) of
CAR.sup.+ NK cells suitable for human application. As needed,
additional stimulation cycles can be undertaken to generate larger
numbers of genetically modified NK cells. Typically, at least 90%
of the propagated NK cells express CAR and can be cryopreserved for
infusion. Furthermore, this approach can be harnessed to generate
NK cells to diverse tumor types by pairing the specificity of the
introduced CAR with expression of the tumor-associated antigen
(TAA) recognized by the CAR on the aAPC.
[0148] Following genetic modification the cells may be immediately
infused or may be stored. In certain aspects, following genetic
modification, the cells may be propagated for days, weeks, or
months ex vivo as a bulk population within about 1, 2, 3, 4, 5 days
or more following gene transfer into cells. In a further aspect,
the transfectants are cloned and a clone demonstrating presence of
a single integrated or episomally maintained expression cassette or
plasmid, and expression of the chimeric receptor is expanded ex
vivo. The clone selected for expansion demonstrates the capacity to
specifically recognize and lyse CD19 expressing target cells. The
recombinant immune cells may be expanded by stimulation with IL-2,
or other cytokines that bind the common gamma-chain (e.g., IL-7,
IL-12, IL-15, IL-21, and others). The recombinant immune cells may
be expanded by stimulation with artificial antigen presenting
cells. In a further aspect, the genetically modified cells may be
cryopreserved.
[0149] 5. Antigens
[0150] Among the antigens targeted by the genetically engineered
antigen receptors are those expressed in the context of a disease,
condition, or cell type to be targeted via the adoptive cell
therapy. Among the diseases and conditions are proliferative,
neoplastic, and malignant diseases and disorders, including cancers
and tumors, including hematologic cancers, cancers of the immune
system, such as lymphomas, leukemias, and/or myelomas, such as B,
T, and myeloid leukemias, lymphomas, and multiple myelomas. In some
embodiments, the antigen is selectively expressed or overexpressed
on cells of the disease or condition, e.g., the tumor or pathogenic
cells, as compared to normal or non-targeted cells or tissues. In
other embodiments, the antigen is expressed on normal cells and/or
is expressed on the engineered cells.
[0151] Any suitable antigen may find use in the present method.
Exemplary antigens include, but are not limited to, antigenic
molecules from infectious agents, auto-/self-antigens,
tumor-/cancer-associated antigens, and tumor neoantigens (Linnemann
et al., 2015). In particular aspects, the antigens include NY-ESO,
EGFRvIII, Muc-1, Her2, CA-125, WT-1, Mage-A3, Mage-A4, Mage-A10,
TRAIL/DR4, and CEA. In particular aspects, the antigens for the two
or more antigen receptors include, but are not limited to, CD19,
EBNA, WT1, CD123, NY-ESO, EGFRvIII, MUC1, HER2, CA-125, WT1,
Mage-A3, Mage-A4, Mage-A10, TRAIL/DR4, and/or CEA. The sequences
for these antigens are known in the art, for example, CD19
(Accession No. NG_007275.1), EBNA (Accession No. NG_002392.2), WT1
(Accession No. NG_009272.1), CD123 (Accession No. NC_000023.11),
NY-ESO (Accession No. NC_000023.11), EGFRvIII (Accession No.
NG_007726.3), MUC1 (Accession No. NG_029383.1), HER2 (Accession No.
NG_007503.1), CA-125 (Accession No. NG_055257.1), WT1 (Accession
No. NG_009272.1), Mage-A3 (Accession No. NG_013244.1), Mage-A4
(Accession No. NG_013245.1), Mage-A10 (Accession No. NC_000023.11),
TRAIL/DR4 (Accession No. NC_000003.12), and/or CEA (Accession No.
NC_000019.10).
[0152] Tumor-associated antigens may be derived from prostate,
breast, colorectal, lung, pancreatic, renal, mesothelioma, ovarian,
or melanoma cancers. Exemplary tumor-associated antigens or tumor
cell-derived antigens include MAGE 1, 3, and MAGE 4 (or other MAGE
antigens such as those disclosed in International Patent
Publication No. WO99/40188); PRAME; BAGE; RAGE, Lage (also known as
NY ESO 1); SAGE; and HAGE or GAGE. These non-limiting examples of
tumor antigens are expressed in a wide range of tumor types such as
melanoma, lung carcinoma, sarcoma, and bladder carcinoma. See,
e.g., U.S. Pat. No. 6,544,518. Prostate cancer tumor-associated
antigens include, for example, prostate specific membrane antigen
(PSMA), prostate-specific antigen (PSA), prostatic acid phosphates,
NKX3.1, and six-transmembrane epithelial antigen of the prostate
(STEAP).
[0153] Other tumor associated antigens include Plu-1, HASH-1,
HasH-2, Cripto and Criptin. Additionally, a tumor antigen may be a
self peptide hormone, such as whole length gonadotrophin hormone
releasing hormone (GnRH), a short 10 amino acid long peptide,
useful in the treatment of many cancers.
[0154] Tumor antigens include tumor antigens derived from cancers
that are characterized by tumor-associated antigen expression, such
as HER-2/neu expression. Tumor-associated antigens of interest
include lineage-specific tumor antigens such as the
melanocyte-melanoma lineage antigens MART-1/Melan-A, gp100, gp75,
mda-7, tyrosinase and tyrosinase-related protein. Illustrative
tumor-associated antigens include, but are not limited to, tumor
antigens derived from or comprising any one or more of, p53, Ras,
c-Myc, cytoplasmic serine/threonine kinases (e.g., A-Raf, B-Raf,
and C-Raf, cyclin-dependent kinases), MAGE-A1, MAGE-A2, MAGE-A3,
MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, MART-1, BAGE, DAM-6, -10,
GAGE-1, -2, -8, GAGE-3, -4, -5, -6, -7B, NA88-A, MART-1, MC1R,
Gp100, PSA, PSM, Tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, CEA,
Cyp-B, hTERT, hTRT, iCE, MUC1, MUC2, Phosphoinositide 3-kinases
(PI3Ks), TRK receptors, PRAME, P15, RU1, RU2, SART-1, SART-3,
Wilms' tumor antigen (WT1), AFP, -catenin/m, Caspase-8/m, CEA,
CDK-4/m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1,
MUM-2, MUM-3, Myosin/m, RAGE, SART-2, TRP-2/INT2, 707-AP, Annexin
II, CDC27/m, TPI/mbcr-abl, BCR-ABL, interferon regulatory factor 4
(IRF4), ETV6/AML, LDLR/FUT, Pml/RAR, Tumor-associated calcium
signal transducer 1 (TACSTD1) TACSTD2, receptor tyrosine kinases
(e.g., Epidermal Growth Factor receptor (EGFR) (in particular,
EGFRvIII), platelet derived growth factor receptor (PDGFR),
vascular endothelial growth factor receptor (VEGFR)), cytoplasmic
tyrosine kinases (e.g., src-family, syk-ZAP70 family),
integrin-linked kinase (ILK), signal transducers and activators of
transcription STAT3, STATS, and STATE, hypoxia inducible factors
(e.g., HIF-1 and HIF-2), Nuclear Factor-Kappa B (NF-B), Notch
receptors (e.g., Notch1-4), c-Met, mammalian targets of rapamycin
(mTOR), WNT, extracellular signal-regulated kinases (ERKs), and
their regulatory subunits, PMSA, PR-3, MDM2, Mesothelin, renal cell
carcinoma-5T4, SM22-alpha, carbonic anhydrases I (CAI) and IX
(CAIX) (also known as G250), STEAD, TEL/AML1, GD2, proteinase3,
hTERT, sarcoma translocation breakpoints, EphA2, ML-IAP, EpCAM, ERG
(TMPRSS2 ETS fusion gene), NA17, PAX3, ALK, androgen receptor,
cyclin B 1, polysialic acid, MYCN, RhoC, GD3, fucosyl GM1,
mesothelian, PSCA, sLe, PLAC1, GM3, BORIS, Tn, GLoboH, NY-BR-1,
RGsS, SART3, STn, PAX5, OY-TES1, sperm protein 17, LCK, HMWMAA,
AKAP-4, SSX2, XAGE 1, B7H3, legumain, TIE2, Page4, MAD-CT-1, FAP,
MAD-CT-2, fos related antigen 1, CBX2, CLDN6, SPANX, TPTE, ACTL8,
ANKRD30A, CDKN2A, MAD2L1, CTAG1B, SUNC1, LRRN1 and idiotype.
[0155] Antigens may include epitopic regions or epitopic peptides
derived from genes mutated in tumor cells or from genes transcribed
at different levels in tumor cells compared to normal cells, such
as telomerase enzyme, survivin, mesothelin, mutated ras, bcr/abl
rearrangement, Her2/neu, mutated or wild-type p53, cytochrome P450
1B1, and abnormally expressed intron sequences such as
N-acetylglucosaminyltransferase-V; clonal rearrangements of
immunoglobulin genes generating unique idiotypes in myeloma and
B-cell lymphomas; tumor antigens that include epitopic regions or
epitopic peptides derived from oncoviral processes, such as human
papilloma virus proteins E6 and E7; Epstein bar virus protein LMP2;
nonmutated oncofetal proteins with a tumor-selective expression,
such as carcinoembryonic antigen and alpha-fetoprotein.
[0156] In other embodiments, an antigen is obtained or derived from
a pathogenic microorganism or from an opportunistic pathogenic
microorganism (also called herein an infectious disease
microorganism), such as a virus, fungus, parasite, and bacterium.
In certain embodiments, antigens derived from such a microorganism
include full-length proteins.
[0157] Illustrative pathogenic organisms whose antigens are
contemplated for use in the method described herein include human
immunodeficiency virus (HIV), herpes simplex virus (HSV),
respiratory syncytial virus (RSV), cytomegalovirus (CMV),
Epstein-Barr virus (EBV), Influenza A, B, and C, vesicular
stomatitis virus (VSV), vesicular stomatitis virus (VSV),
polyomavirus (e.g., BK virus and JC virus), adenovirus,
Staphylococcus species including Methicillin-resistant
Staphylococcus aureus (MRSA), and Streptococcus species including
Streptococcus pneumoniae. As would be understood by the skilled
person, proteins derived from these and other pathogenic
microorganisms for use as antigen as described herein and
nucleotide sequences encoding the proteins may be identified in
publications and in public databases such as GENBANK.RTM.,
SWISS-PROT.RTM., and TREMBL.RTM..
[0158] Antigens derived from human immunodeficiency virus (HIV)
include any of the HIV virion structural proteins (e.g., gp120,
gp41, p17, p24), protease, reverse transcriptase, or HIV proteins
encoded by tat, rev, nef, vif, vpr and vpu.
[0159] Antigens derived from herpes simplex virus (e.g., HSV 1 and
HSV2) include, but are not limited to, proteins expressed from HSV
late genes. The late group of genes predominantly encodes proteins
that form the virion particle. Such proteins include the five
proteins from (UL) which form the viral capsid: UL6, UL18, UL35,
UL38 and the major capsid protein UL19, UL45, and UL27, each of
which may be used as an antigen as described herein. Other
illustrative HSV proteins contemplated for use as antigens herein
include the ICP27 (H1, H2), glycoprotein B (gB) and glycoprotein D
(gD) proteins. The HSV genome comprises at least 74 genes, each
encoding a protein that could potentially be used as an
antigen.
[0160] Antigens derived from cytomegalovirus (CMV) include CMV
structural proteins, viral antigens expressed during the immediate
early and early phases of virus replication, glycoproteins I and
III, capsid protein, coat protein, lower matrix protein pp65
(ppUL83), p52 (ppUL44), IE1 and 1E2 (UL123 and UL122), protein
products from the cluster of genes from UL128-UL150 (Rykman, et
al., 2006), envelope glycoprotein B (gB), gH, gN, and pp150. As
would be understood by the skilled person, CMV proteins for use as
antigens described herein may be identified in public databases
such as GENBANK.RTM., SWISS-PROT.RTM., and TREMBL.RTM. (see e.g.,
Bennekov et al., 2004; Loewendorf et al., 2010; Marschall et al.,
2009).
[0161] Antigens derived from Epstein-Ban virus (EBV) that are
contemplated for use in certain embodiments include EBV lytic
proteins gp350 and gp110, EBV proteins produced during latent cycle
infection including Epstein-Ban nuclear antigen (EBNA)-1, EBNA-2,
EBNA-3A, EBNA-3B, EBNA-3C, EBNA-leader protein (EBNA-LP) and latent
membrane proteins (LMP)-1, LMP-2A and LMP-2B (see, e.g., Lockey et
al., 2008).
[0162] Antigens derived from respiratory syncytial virus (RSV) that
are contemplated for use herein include any of the eleven proteins
encoded by the RSV genome, or antigenic fragments thereof: NS 1,
NS2, N (nucleocapsid protein), M (Matrix protein) SH, G and F
(viral coat proteins), M2 (second matrix protein), M2-1 (elongation
factor), M2-2 (transcription regulation), RNA polymerase, and
phosphoprotein P.
[0163] Antigens derived from Vesicular stomatitis virus (VSV) that
are contemplated for use include any one of the five major proteins
encoded by the VSV genome, and antigenic fragments thereof: large
protein (L), glycoprotein (G), nucleoprotein (N), phosphoprotein
(P), and matrix protein (M) (see, e.g., Rieder et al., 1999).
[0164] Antigens derived from an influenza virus that are
contemplated for use in certain embodiments include hemagglutinin
(HA), neuraminidase (NA), nucleoprotein (NP), matrix proteins M1
and M2, NS1, NS2 (NEP), PA, PB1, PB1-F2, and PB2.
[0165] Exemplary viral antigens also include, but are not limited
to, adenovirus polypeptides, alphavirus polypeptides, calicivirus
polypeptides (e.g., a calicivirus capsid antigen), coronavirus
polypeptides, distemper virus polypeptides, Ebola virus
polypeptides, enterovirus polypeptides, flavivirus polypeptides,
hepatitis virus (AE) polypeptides (a hepatitis B core or surface
antigen, a hepatitis C virus E1 or E2 glycoproteins, core, or
non-structural proteins), herpesvirus polypeptides (including a
herpes simplex virus or varicella zoster virus glycoprotein),
infectious peritonitis virus polypeptides, leukemia virus
polypeptides, Marburg virus polypeptides, orthomyxovirus
polypeptides, papilloma virus polypeptides, parainfluenza virus
polypeptides (e.g., the hemagglutinin and neuraminidase
polypeptides), paramyxovirus polypeptides, parvovirus polypeptides,
pestivirus polypeptides, picorna virus polypeptides (e.g., a
poliovirus capsid polypeptide), pox virus polypeptides (e.g., a
vaccinia virus polypeptide), rabies virus polypeptides (e.g., a
rabies virus glycoprotein G), reovirus polypeptides, retrovirus
polypeptides, and rotavirus polypeptides.
[0166] In certain embodiments, the antigen may be bacterial
antigens. In certain embodiments, a bacterial antigen of interest
may be a secreted polypeptide. In other certain embodiments,
bacterial antigens include antigens that have a portion or portions
of the polypeptide exposed on the outer cell surface of the
bacteria.
[0167] Antigens derived from Staphylococcus species including
Methicillin-resistant Staphylococcus aureus (MRSA) that are
contemplated for use include virulence regulators, such as the Agr
system, Sar and Sae, the Arl system, Sar homologues (Rot, MgrA,
SarS, SarR, SarT, SarU, SarV, SarX, SarZ and TcaR), the Srr system
and TRAP. Other Staphylococcus proteins that may serve as antigens
include Clp proteins, HtrA, MsrR, aconitase, CcpA, SvrA, Msa, CfvA
and CfvB (see, e.g., Staphylococcus: Molecular Genetics, 2008
Caister Academic Press, Ed. Jodi Lindsay). The genomes for two
species of Staphylococcus aureus (N315 and Mu50) have been
sequenced and are publicly available, for example at PATRIC
(PATRIC: The VBI PathoSystems Resource Integration Center, Snyder
et al., 2007). As would be understood by the skilled person,
Staphylococcus proteins for use as antigens may also be identified
in other public databases such as GenBank.RTM., Swiss-Prot.RTM.,
and TrEMBL.RTM..
[0168] Antigens derived from Streptococcus pneumoniae that are
contemplated for use in certain embodiments described herein
include pneumolysin, PspA, choline-binding protein A (CbpA), NanA,
NanB, SpnHL, PavA, LytA, Pht, and pilin proteins (RrgA; RrgB;
RrgC). Antigenic proteins of Streptococcus pneumoniae are also
known in the art and may be used as an antigen in some embodiments
(see, e.g., Zysk et al., 2000). The complete genome sequence of a
virulent strain of Streptococcus pneumoniae has been sequenced and,
as would be understood by the skilled person, S. pneumoniae
proteins for use herein may also be identified in other public
databases such as GENBANK.RTM., SWISS-PROT.RTM., and TREMBL.RTM..
Proteins of particular interest for antigens according to the
present disclosure include virulence factors and proteins predicted
to be exposed at the surface of the pneumococci (see, e.g., Frolet
et al., 2010).
[0169] Examples of bacterial antigens that may be used as antigens
include, but are not limited to, Actinomyces polypeptides, Bacillus
polypeptides, Bacteroides polypeptides, Bordetella polypeptides,
Bartonella polypeptides, Borrelia polypeptides (e.g., B.
burgdorferi OspA), Brucella polypeptides, Campylobacter
polypeptides, Capnocytophaga polypeptides, Chlamydia polypeptides,
Corynebacterium polypeptides, Coxiella polypeptides, Dermatophilus
polypeptides, Enterococcus polypeptides, Ehrlichia polypeptides,
Escherichia polypeptides, Francisella polypeptides, Fusobacterium
polypeptides, Haemobartonella polypeptides, Haemophilus
polypeptides (e.g., H. influenzae type b outer membrane protein),
Helicobacter polypeptides, Klebsiella polypeptides, L-form bacteria
polypeptides, Leptospira polypeptides, Listeria polypeptides,
Mycobacteria polypeptides, Mycoplasma polypeptides, Neisseria
polypeptides, Neorickettsia polypeptides, Nocardia polypeptides,
Pasteurella polypeptides, Peptococcus polypeptides,
Peptostreptococcus polypeptides, Pneumococcus polypeptides (i.e.,
S. pneumoniae polypeptides) (see description herein), Proteus
polypeptides, Pseudomonas polypeptides, Rickettsia polypeptides,
Rochalimaea polypeptides, Salmonella polypeptides, Shigella
polypeptides, Staphylococcus polypeptides, group A streptococcus
polypeptides (e.g., S. pyogenes M proteins), group B streptococcus
(S. agalactiae) polypeptides, Treponema polypeptides, and Yersinia
polypeptides (e.g., Y. pestis F1 and V antigens).
[0170] Examples of fungal antigens include, but are not limited to,
Absidia polypeptides, Acremonium polypeptides, Alternaria
polypeptides, Aspergillus polypeptides, Basidiobolus polypeptides,
Bipolaris polypeptides, Blastomyces polypeptides, Candida
polypeptides, Coccidioides polypeptides, Conidiobolus polypeptides,
Cryptococcus polypeptides, Curvalaria polypeptides, Epidermophyton
polypeptides, Exophiala polypeptides, Geotrichum polypeptides,
Histoplasma polypeptides, Madurella polypeptides, Malassezia
polypeptides, Microsporum polypeptides, Moniliella polypeptides,
Mortierella polypeptides, Mucor polypeptides, Paecilomyces
polypeptides, Penicillium polypeptides, Phialemonium polypeptides,
Phialophora polypeptides, Prototheca polypeptides, Pseudallescheria
polypeptides, Pseudomicrodochium polypeptides, Pythium
polypeptides, Rhinosporidium polypeptides, Rhizopus polypeptides,
Scolecobasidium polypeptides, Sporothrix polypeptides, Stemphylium
polypeptides, Trichophyton polypeptides, Trichosporon polypeptides,
and Xylohypha polypeptides.
[0171] Examples of protozoan parasite antigens include, but are not
limited to, Babesia polypeptides, Balantidium polypeptides,
Besnoitia polypeptides, Cryptosporidium polypeptides, Eimeria
polypeptides, Encephalitozoon polypeptides, Entamoeba polypeptides,
Giardia polypeptides, Hammondia polypeptides, Hepatozoon
polypeptides, Isospora polypeptides, Leishmania polypeptides,
Microsporidia polypeptides, Neospora polypeptides, Nosema
polypeptides, Pentatrichomonas polypeptides, Plasmodium
polypeptides. Examples of helminth parasite antigens include, but
are not limited to, Acanthocheilonema polypeptides,
Aelurostrongylus polypeptides, Ancylostoma polypeptides,
Angiostrongylus polypeptides, Ascaris polypeptides, Brugia
polypeptides, Bunostomum polypeptides, Capillaria polypeptides,
Chabertia polypeptides, Cooperia polypeptides, Crenosoma
polypeptides, Dictyocaulus polypeptides, Dioctophyme polypeptides,
Dipetalonema polypeptides, Diphyllobothrium polypeptides, Diplydium
polypeptides, Dirofilaria polypeptides, Dracunculus polypeptides,
Enterobius polypeptides, Filaroides polypeptides, Haemonchus
polypeptides, Lagochilascaris polypeptides, Loa polypeptides,
Mansonella polypeptides, Muellerius polypeptides, Nanophyetus
polypeptides, Necator polypeptides, Nematodirus polypeptides,
Oesophagostomum polypeptides, Onchocerca polypeptides, Opisthorchis
polypeptides, Ostertagia polypeptides, Parafilaria polypeptides,
Paragonimus polypeptides, Parascaris polypeptides, Physaloptera
polypeptides, Protostrongylus polypeptides, Setaria polypeptides,
Spirocerca polypeptides Spirometra polypeptides, Stephanofilaria
polypeptides, Strongyloides polypeptides, Strongylus polypeptides,
Thelazia polypeptides, Toxascaris polypeptides, Toxocara
polypeptides, Trichinella polypeptides, Trichostrongylus
polypeptides, Trichuris polypeptides, Uncinaria polypeptides, and
Wuchereria polypeptides. (e.g., P. falciparum circumsporozoite
(PfCSP)), sporozoite surface protein 2 (PfSSP2), carboxyl terminus
of liver state antigen 1 (PfLSA1 c-term), and exported protein 1
(PfExp-1), Pneumocystis polypeptides, Sarcocystis polypeptides,
Schistosoma polypeptides, Theileria polypeptides, Toxoplasma
polypeptides, and Trypanosoma polypeptides.
[0172] Examples of ectoparasite antigens include, but are not
limited to, polypeptides (including antigens as well as allergens)
from fleas; ticks, including hard ticks and soft ticks; flies, such
as midges, mosquitoes, sand flies, black flies, horse flies, horn
flies, deer flies, tsetse flies, stable flies, myiasis-causing
flies and biting gnats; ants; spiders, lice; mites; and true bugs,
such as bed bugs and kissing bugs.
[0173] 6. Suicide Genes
[0174] The CAR and/or TCR of the immune cells of the present
disclosure may comprise one or more suicide genes. The term
"suicide gene" as used herein is defined as a gene which, upon
administration of a prodrug, effects transition of a gene product
to a compound which kills its host cell. Examples of suicide
gene/prodrug combinations which may be used are Herpes Simplex
Virus-thymidine kinase (HSV-tk) and ganciclovir, acyclovir, or
FIAU; oxidoreductase and cycloheximide; cytosine deaminase and
5-fluorocytosine; thymidine kinase thymidilate kinase (Tdk::Tmk)
and AZT; and deoxycytidine kinase and cytosine arabinoside.
[0175] The E. coli purine nucleoside phosphorylase, a so-called
suicide gene which converts the prodrug 6-methylpurine
deoxyriboside to toxic purine 6-methylpurine. Other examples of
suicide genes used with prodrug therapy are the E. coli cytosine
deaminase gene and the HSV thymidine kinase gene.
[0176] Exemplary suicide genes include CD20, CD52, EGFRv3, or
inducible caspase 9. In one embodiment, a truncated version of EGFR
variant III (EGFRv3) may be used as a suicide antigen which can be
ablated by Cetuximab. Further suicide genes known in the art that
may be used in the present disclosure include Purine nucleoside
phosphorylase (PNP), Cytochrome p450 enzymes (CYP),
Carboxypeptidases (CP), Carboxylesterase (CE), Nitroreductase
(NTR), Guanine Ribosyltransferase (XGRTP), Glycosidase enzymes,
Methionine-.alpha.,.gamma.-lyase (MET), and Thymidine phosphorylase
(TP).
[0177] 7. Methods of Delivery
[0178] One of skill in the art would be well-equipped to construct
a vector through standard recombinant techniques (see, for example,
Sambrook et al., 2001 and Ausubel et al., 1996, both incorporated
herein by reference) for the expression of the antigen receptors of
the present disclosure. Vectors include but are not limited to,
plasmids, cosmids, viruses (bacteriophage, animal viruses, and
plant viruses), and artificial chromosomes (e.g., YACs), such as
retroviral vectors (e.g. derived from Moloney murine leukemia virus
vectors (MoMLV), MSCV, SFFV, MPSV, SNV etc), lentiviral vectors
(e.g. derived from HIV-1, HIV-2, SIV, BIV, FIV etc.), adenoviral
(Ad) vectors including replication competent, replication deficient
and gutless forms thereof, adeno-associated viral (AAV) vectors,
simian virus 40 (SV-40) vectors, bovine papilloma virus vectors,
Epstein-Barr virus vectors, herpes virus vectors, vaccinia virus
vectors, Harvey murine sarcoma virus vectors, murine mammary tumor
virus vectors, Rous sarcoma virus vectors, parvovirus vectors,
polio virus vectors, vesicular stomatitis virus vectors, maraba
virus vectors and group B adenovirus enadenotucirev vectors.
[0179] a. Viral Vectors
[0180] Viral vectors encoding an antigen receptor may be provided
in certain aspects of the present disclosure. In generating
recombinant viral vectors, non-essential genes are typically
replaced with a gene or coding sequence for a heterologous (or
non-native) protein. A viral vector is a kind of expression
construct that utilizes viral sequences to introduce nucleic acid
and possibly proteins into a cell. The ability of certain viruses
to infect cells or enter cells via receptor mediated-endocytosis,
and to integrate into host cell genomes and express viral genes
stably and efficiently have made them attractive candidates for the
transfer of foreign nucleic acids into cells (e.g., mammalian
cells). Non-limiting examples of virus vectors that may be used to
deliver a nucleic acid of certain aspects of the present invention
are described below.
[0181] Lentiviruses are complex retroviruses, which, in addition to
the common retroviral genes gag, pol, and env, contain other genes
with regulatory or structural function. Lentiviral vectors are well
known in the art (see, for example, U.S. Pat. Nos. 6,013,516 and
5,994,136).
[0182] Recombinant lentiviral vectors are capable of infecting
non-dividing cells and can be used for both in vivo and ex vivo
gene transfer and expression of nucleic acid sequences. For
example, recombinant lentivirus capable of infecting a non-dividing
cell--wherein a suitable host cell is transfected with two or more
vectors carrying the packaging functions, namely gag, pol and env,
as well as rev and tat--is described in U.S. Pat. No. 5,994,136,
incorporated herein by reference.
[0183] b. Regulatory Elements
[0184] Expression cassettes included in vectors useful in the
present disclosure in particular contain (in a 5'-to-3' direction)
a eukaryotic transcriptional promoter operably linked to a
protein-coding sequence, splice signals including intervening
sequences, and a transcriptional termination/polyadenylation
sequence. The promoters and enhancers that control the
transcription of protein encoding genes in eukaryotic cells are
composed of multiple genetic elements. The cellular machinery is
able to gather and integrate the regulatory information conveyed by
each element, allowing different genes to evolve distinct, often
complex patterns of transcriptional regulation. A promoter used in
the context of the present disclosure includes constitutive,
inducible, and tissue-specific promoters.
[0185] (i) Promoter/Enhancers
[0186] The expression constructs provided herein comprise a
promoter to drive expression of the antigen receptor. A promoter
generally comprises a sequence that functions to position the start
site for RNA synthesis. The best known example of this is the TATA
box, but in some promoters lacking a TATA box, such as, for
example, the promoter for the mammalian terminal deoxynucleotidyl
transferase gene and the promoter for the SV40 late genes, a
discrete element overlying the start site itself helps to fix the
place of initiation. Additional promoter elements regulate the
frequency of transcriptional initiation. Typically, these are
located in the region 30110 bp-upstream of the start site, although
a number of promoters have been shown to contain functional
elements downstream of the start site as well. To bring a coding
sequence "under the control of" a promoter, one positions the 5'
end of the transcription initiation site of the transcriptional
reading frame "downstream" of (i.e., 3' of) the chosen promoter.
The "upstream" promoter stimulates transcription of the DNA and
promotes expression of the encoded RNA.
[0187] The spacing between promoter elements frequently is
flexible, so that promoter function is preserved when elements are
inverted or moved relative to one another. In the tk promoter, the
spacing between promoter elements can be increased to 50 bp apart
before activity begins to decline. Depending on the promoter, it
appears that individual elements can function either cooperatively
or independently to activate transcription. A promoter may or may
not be used in conjunction with an "enhancer," which refers to a
cis-acting regulatory sequence involved in the transcriptional
activation of a nucleic acid sequence.
[0188] A promoter may be one naturally associated with a nucleic
acid sequence, as may be obtained by isolating the 5' non-coding
sequences located upstream of the coding segment and/or exon. Such
a promoter can be referred to as "endogenous." Similarly, an
enhancer may be one naturally associated with a nucleic acid
sequence, located either downstream or upstream of that sequence.
Alternatively, certain advantages will be gained by positioning the
coding nucleic acid segment under the control of a recombinant or
heterologous promoter, which refers to a promoter that is not
normally associated with a nucleic acid sequence in its natural
environment. A recombinant or heterologous enhancer refers also to
an enhancer not normally associated with a nucleic acid sequence in
its natural environment. Such promoters or enhancers may include
promoters or enhancers of other genes, and promoters or enhancers
isolated from any other virus, or prokaryotic or eukaryotic cell,
and promoters or enhancers not "naturally occurring," i.e.,
containing different elements of different transcriptional
regulatory regions, and/or mutations that alter expression. For
example, promoters that are most commonly used in recombinant DNA
construction include the .beta.lactamase (penicillinase), lactose
and tryptophan (trp-) promoter systems. In addition to producing
nucleic acid sequences of promoters and enhancers synthetically,
sequences may be produced using recombinant cloning and/or nucleic
acid amplification technology, including PCR.TM., in connection
with the compositions disclosed herein. Furthermore, it is
contemplated that the control sequences that direct transcription
and/or expression of sequences within non-nuclear organelles such
as mitochondria, chloroplasts, and the like, can be employed as
well.
[0189] Naturally, it will be important to employ a promoter and/or
enhancer that effectively directs the expression of the DNA segment
in the organelle, cell type, tissue, organ, or organism chosen for
expression. Those of skill in the art of molecular biology
generally know the use of promoters, enhancers, and cell type
combinations for protein expression, (see, for example Sambrook et
al. 1989, incorporated herein by reference). The promoters employed
may be constitutive, tissue-specific, inducible, and/or useful
under the appropriate conditions to direct high level expression of
the introduced DNA segment, such as is advantageous in the
large-scale production of recombinant proteins and/or peptides. The
promoter may be heterologous or endogenous.
[0190] Additionally, any promoter/enhancer combination (as per, for
example, the Eukaryotic Promoter Data Base EPDB, through world wide
web at epd.isb-sib.ch/) could also be used to drive expression. Use
of a T3, T7 or SP6 cytoplasmic expression system is another
possible embodiment. Eukaryotic cells can support cytoplasmic
transcription from certain bacterial promoters if the appropriate
bacterial polymerase is provided, either as part of the delivery
complex or as an additional genetic expression construct.
[0191] Non-limiting examples of promoters include early or late
viral promoters, such as, SV40 early or late promoters,
cytomegalovirus (CMV) immediate early promoters, Rous Sarcoma Virus
(RSV) early promoters; eukaryotic cell promoters, such as, e.g.,
beta actin promoter, GADPH promoter, metallothionein promoter; and
concatenated response element promoters, such as cyclic AMP
response element promoters (cre), serum response element promoter
(sre), phorbol ester promoter (TPA) and response element promoters
(tre) near a minimal TATA box. It is also possible to use human
growth hormone promoter sequences (e.g., the human growth hormone
minimal promoter described at Genbank, accession no. X05244,
nucleotide 283-341) or a mouse mammary tumor promoter (available
from the ATCC, Cat. No. ATCC 45007). In certain embodiments, the
promoter is CMV IE, dectin-1, dectin-2, human CD11c, F4/80, SM22,
RSV, SV40, Ad MLP, beta-actin, MHC class I or MHC class II
promoter, however any other promoter that is useful to drive
expression of the therapeutic gene is applicable to the practice of
the present disclosure.
[0192] In certain aspects, methods of the disclosure also concern
enhancer sequences, i.e., nucleic acid sequences that increase a
promoter's activity and that have the potential to act in cis, and
regardless of their orientation, even over relatively long
distances (up to several kilobases away from the target promoter).
However, enhancer function is not necessarily restricted to such
long distances as they may also function in close proximity to a
given promoter.
[0193] (ii) Initiation Signals and Linked Expression
[0194] A specific initiation signal also may be used in the
expression constructs provided in the present disclosure for
efficient translation of coding sequences. These signals include
the ATG initiation codon or adjacent sequences. Exogenous
translational control signals, including the ATG initiation codon,
may need to be provided. One of ordinary skill in the art would
readily be capable of determining this and providing the necessary
signals. It is well known that the initiation codon must be
"in-frame" with the reading frame of the desired coding sequence to
ensure translation of the entire insert. The exogenous
translational control signals and initiation codons can be either
natural or synthetic. The efficiency of expression may be enhanced
by the inclusion of appropriate transcription enhancer
elements.
[0195] In certain embodiments, the use of internal ribosome entry
sites (IRES) elements are used to create multigene, or
polycistronic, messages. IRES elements are able to bypass the
ribosome scanning model of 5' methylated Cap dependent translation
and begin translation at internal sites. IRES elements from two
members of the picornavirus family (polio and encephalomyocarditis)
have been described, as well an IRES from a mammalian message. IRES
elements can be linked to heterologous open reading frames.
Multiple open reading frames can be transcribed together, each
separated by an IRES, creating polycistronic messages. By virtue of
the IRES element, each open reading frame is accessible to
ribosomes for efficient translation. Multiple genes can be
efficiently expressed using a single promoter/enhancer to
transcribe a single message.
[0196] Additionally, certain 2A sequence elements could be used to
create linked- or co-expression of genes in the constructs provided
in the present disclosure. For example, cleavage sequences could be
used to co-express genes by linking open reading frames to form a
single cistron. An exemplary cleavage sequence is the F2A
(Foot-and-mouth diease virus 2A) or a "2A-like" sequence (e.g.,
Thosea asigna virus 2A; T2A).
[0197] (iii) Origins of Replication
[0198] In order to propagate a vector in a host cell, it may
contain one or more origins of replication sites (often termed
"ori"), for example, a nucleic acid sequence corresponding to oriP
of EBV as described above or a genetically engineered oriP with a
similar or elevated function in programming, which is a specific
nucleic acid sequence at which replication is initiated.
Alternatively a replication origin of other extra-chromosomally
replicating virus as described above or an autonomously replicating
sequence (ARS) can be employed.
[0199] c. Selection and Screenable Markers
[0200] In some embodiments, cells containing a construct of the
present disclosure may be identified in vitro or in vivo by
including a marker in the expression vector. Such markers would
confer an identifiable change to the cell permitting easy
identification of cells containing the expression vector.
Generally, a selection marker is one that confers a property that
allows for selection. A positive selection marker is one in which
the presence of the marker allows for its selection, while a
negative selection marker is one in which its presence prevents its
selection. An example of a positive selection marker is a drug
resistance marker.
[0201] Usually the inclusion of a drug selection marker aids in the
cloning and identification of transformants, for example, genes
that confer resistance to neomycin, puromycin, hygromycin, DHFR,
GPT, zeocin and histidinol are useful selection markers. In
addition to markers conferring a phenotype that allows for the
discrimination of transformants based on the implementation of
conditions, other types of markers including screenable markers
such as GFP, whose basis is colorimetric analysis, are also
contemplated. Alternatively, screenable enzymes as negative
selection markers such as herpes simplex virus thymidine kinase
(tk) or chloramphenicol acetyltransferase (CAT) may be utilized.
One of skill in the art would also know how to employ immunologic
markers, possibly in conjunction with FACS analysis. The marker
used is not believed to be important, so long as it is capable of
being expressed simultaneously with the nucleic acid encoding a
gene product. Further examples of selection and screenable markers
are well known to one of skill in the art.
[0202] d. Other Methods of Nucleic Acid Delivery
[0203] In addition to viral delivery of the nucleic acids encoding
the antigen receptor, the following are additional methods of
recombinant gene delivery to a given host cell and are thus
considered in the present disclosure.
[0204] Introduction of a nucleic acid, such as DNA or RNA, into the
immune cells of the current disclosure may use any suitable methods
for nucleic acid delivery for transformation of a cell, as
described herein or as would be known to one of ordinary skill in
the art. Such methods include, but are not limited to, direct
delivery of DNA such as by ex vivo transfection, by injection,
including microinjection); by electroporation; by calcium phosphate
precipitation; by using DEAE-dextran followed by polyethylene
glycol; by direct sonic loading; by liposome mediated transfection
and receptor-mediated transfection; by microprojectile bombardment;
by agitation with silicon carbide fibers; by Agrobacterium-mediated
transformation; by desiccation/inhibition-mediated DNA uptake, and
any combination of such methods. Through the application of
techniques such as these, organelle(s), cell(s), tissue(s) or
organism(s) may be stably or transiently transformed.
[0205] E. Modification of Gene Expression
[0206] In some embodiments, the immune cells of the present
disclosure are modified to have altered expression of certain genes
such as glucocorticoid receptor, TGF.beta. receptor (e.g.,
TGF.beta.-RII), and/or CISH. In one embodiment, the immune cells
may be modified to express a dominant negative TGF.beta. receptor
II (TGF.beta.RIIDN) which can function as a cytokine sink to
deplete endogenous TGF.beta..
[0207] Cytokine signaling is essential for the normal function of
hematopoietic cells. The SOCS family of proteins plays an important
role in the negative regulation of cytokine signaling, acting as an
intrinsic brake. CIS, a member of the SOCS family of proteins
encoded by the CISH gene, has been identified as an important
checkpoint molecule in NK cells in mice. Thus, in some embodiments,
the present disclosure concerns the knockout of CISH in immune
cells to improve cytotoxicity, such as in NK cells and CD8.sup.+ T
cells. This approach may be used alone or in combination with other
checkpoint inhibitors to improve anti-tumor activity.
[0208] In some embodiments, the altered gene expression is carried
out by effecting a disruption in the gene, such as a knock-out,
insertion, missense or frameshift mutation, such as biallelic
frameshift mutation, deletion of all or part of the gene, e.g., one
or more exon or portion therefore, and/or knock-in. For example,
the altered gene expression can be effected by sequence-specific or
targeted nucleases, including DNA-binding targeted nucleases such
as zinc finger nucleases (ZFN) and transcription activator-like
effector nucleases (TALENs), and RNA-guided nucleases such as a
CRISPR-associated nuclease (Cas), specifically designed to be
targeted to the sequence of the gene or a portion thereof.
[0209] In some embodiments, the alteration of the expression,
activity, and/or function of the gene is carried out by disrupting
the gene. In some aspects, the gene is modified so that its
expression is reduced by at least at or about 20, 30, or 40%,
generally at least at or about 50, 60, 70, 80, 90, or 95% as
compared to the expression in the absence of the gene modification
or in the absence of the components introduced to effect the
modification.
[0210] In some embodiments, the alteration is transient or
reversible, such that expression of the gene is restored at a later
time. In other embodiments, the alteration is not reversible or
transient, e.g., is permanent.
[0211] In some embodiments, gene alteration is carried out by
induction of one or more double-stranded breaks and/or one or more
single-stranded breaks in the gene, typically in a targeted manner.
In some embodiments, the double-stranded or single-stranded breaks
are made by a nuclease, e.g. an endonuclease, such as a
gene-targeted nuclease. In some aspects, the breaks are induced in
the coding region of the gene, e.g. in an exon. For example, in
some embodiments, the induction occurs near the N-terminal portion
of the coding region, e.g. in the first exon, in the second exon,
or in a subsequent exon.
[0212] In some aspects, the double-stranded or single-stranded
breaks undergo repair via a cellular repair process, such as by
non-homologous end-joining (NHEJ) or homology-directed repair
(HDR). In some aspects, the repair process is error-prone and
results in disruption of the gene, such as a frameshift mutation,
e.g., biallelic frameshift mutation, which can result in complete
knockout of the gene. For example, in some aspects, the disruption
comprises inducing a deletion, mutation, and/or insertion. In some
embodiments, the disruption results in the presence of an early
stop codon. In some aspects, the presence of an insertion,
deletion, translocation, frameshift mutation, and/or a premature
stop codon results in disruption of the expression, activity,
and/or function of the gene.
[0213] In some embodiments, gene alteration is achieved using
antisense techniques, such as by RNA interference (RNAi), short
interfering RNA (siRNA), short hairpin (shRNA), and/or ribozymes
are used to selectively suppress or repress expression of the gene.
siRNA technology is RNAi which employs a double-stranded RNA
molecule having a sequence homologous with the nucleotide sequence
of mRNA which is transcribed from the gene, and a sequence
complementary with the nucleotide sequence. siRNA generally is
homologous/complementary with one region of mRNA which is
transcribed from the gene, or may be siRNA including a plurality of
RNA molecules which are homologous/complementary with different
regions. In some aspects, the siRNA is comprised in a polycistronic
construct.
[0214] 1. ZFPs and ZFNs
[0215] In some embodiments, the DNA-targeting molecule includes a
DNA-binding protein such as one or more zinc finger protein (ZFP)
or transcription activator-like protein (TAL), fused to an effector
protein such as an endonuclease. Examples include ZFNs, TALEs, and
TALENs.
[0216] In some embodiments, the DNA-targeting molecule comprises
one or more zinc-finger proteins (ZFPs) or domains thereof that
bind to DNA in a sequence-specific manner. A ZFP or domain thereof
is a protein or domain within a larger protein that binds DNA in a
sequence-specific manner through one or more zinc fingers, regions
of amino acid sequence within the binding domain whose structure is
stabilized through coordination of a zinc ion. The term zinc finger
DNA binding protein is often abbreviated as zinc finger protein or
ZFP. Among the ZFPs are artificial ZFP domains targeting specific
DNA sequences, typically 9-18 nucleotides long, generated by
assembly of individual fingers.
[0217] ZFPs include those in which a single finger domain is
approximately 30 amino acids in length and contains an alpha helix
containing two invariant histidine residues coordinated through
zinc with two cysteines of a single beta turn, and having two,
three, four, five, or six fingers. Generally, sequence-specificity
of a ZFP may be altered by making amino acid substitutions at the
four helix positions (-1, 2, 3 and 6) on a zinc finger recognition
helix. Thus, in some embodiments, the ZFP or ZFP-containing
molecule is non-naturally occurring, e.g., is engineered to bind to
a target site of choice.
[0218] In some embodiments, the DNA-targeting molecule is or
comprises a zinc-finger DNA binding domain fused to a DNA cleavage
domain to form a zinc-finger nuclease (ZFN). In some embodiments,
fusion proteins comprise the cleavage domain (or cleavage
half-domain) from at least one Type liS restriction enzyme and one
or more zinc finger binding domains, which may or may not be
engineered. In some embodiments, the cleavage domain is from the
Type liS restriction endonuclease Fok I. Fok I generally catalyzes
double-stranded cleavage of DNA, at 9 nucleotides from its
recognition site on one strand and 13 nucleotides from its
recognition site on the other.
[0219] Many gene-specific engineered zinc fingers are available
commercially. For example, Sangamo Biosciences (Richmond, Calif.,
USA) has developed a platform (CompoZr) for zinc-finger
construction in partnership with Sigma-Aldrich (St. Louis, Mo.,
USA), allowing investigators to bypass zinc-finger construction and
validation altogether, and provides specifically targeted zinc
fingers for thousands of proteins (Gaj et al., Trends in
Biotechnology, 2013, 31(7), 397-405). In some embodiments,
commercially available zinc fingers are used or are custom
designed. (See, for example, Sigma-Aldrich catalog numbers CSTZFND,
CSTZFN, CTil-lKT, and PZD0020).
[0220] 2. TALs, TALEs and TALENs
[0221] In some embodiments, the DNA-targeting molecule comprises a
naturally occurring or engineered (non-naturally occurring)
transcription activator-like protein (TAL) DNA binding domain, such
as in a transcription activator-like protein effector (TALE)
protein, See, e.g., U.S. Patent Publication No. 2011/0301073,
incorporated by reference in its entirety herein.
[0222] A TALE DNA binding domain or TALE is a polypeptide
comprising one or more TALE repeat domains/units. The repeat
domains are involved in binding of the TALE to its cognate target
DNA sequence. A single "repeat unit" (also referred to as a
"repeat") is typically 33-35 amino acids in length and exhibits at
least some sequence homology with other TALE repeat sequences
within a naturally occurring TALE protein. Each TALE repeat unit
includes 1 or 2 DNA-binding residues making up the Repeat Variable
Diresidue (RVD), typically at positions 12 and/or 13 of the repeat.
The natural (canonical) code for DNA recognition of these TALEs has
been determined such that an HD sequence at positions 12 and 13
leads to a binding to cytosine (C), NG binds to T, NI to A, NN
binds to G or A, and NO binds to T and non-canonical (atypical)
RVDs are also known. In some embodiments, TALEs may be targeted to
any gene by design of TAL arrays with specificity to the target DNA
sequence. The target sequence generally begins with a
thymidine.
[0223] In some embodiments, the molecule is a DNA binding
endonuclease, such as a TALE nuclease (TALEN). In some aspects the
TALEN is a fusion protein comprising a DNA-binding domain derived
from a TALE and a nuclease catalytic domain to cleave a nucleic
acid target sequence.
[0224] In some embodiments, the TALEN recognizes and cleaves the
target sequence in the gene. In some aspects, cleavage of the DNA
results in double-stranded breaks. In some aspects the breaks
stimulate the rate of homologous recombination or non-homologous
end joining (NHEJ). Generally, NHEJ is an imperfect repair process
that often results in changes to the DNA sequence at the site of
the cleavage. In some aspects, repair mechanisms involve rejoining
of what remains of the two DNA ends through direct re-ligation or
via the so-called microhomology-mediated end joining. In some
embodiments, repair via NHEJ results in small insertions or
deletions and can be used to disrupt and thereby repress the gene.
In some embodiments, the modification may be a substitution,
deletion, or addition of at least one nucleotide. In some aspects,
cells in which a cleavage-induced mutagenesis event, i.e. a
mutagenesis event consecutive to an NHEJ event, has occurred can be
identified and/or selected by well-known methods in the art.
[0225] In some embodiments, TALE repeats are assembled to
specifically target a gene. (Gaj et al., 2013). A library of TALENs
targeting 18,740 human protein-coding genes has been constructed
(Kim et al., 2013). Custom-designed TALE arrays are commercially
available through Cellectis Bioresearch (Paris, France),
Transposagen Biopharmaceuticals (Lexington, Ky., USA), and Life
Technologies (Grand Island, N.Y., USA). Specifically, TALENs that
target CD38 are commercially available (See Gencopoeia, catalog
numbers HTN222870-1, HTN222870-2, and HTN222870-3). Exemplary
molecules are described, e.g., in U.S. Patent Publication Nos. US
2014/0120622, and 2013/0315884.
[0226] In some embodiments the TALEN s are introduced as trans
genes encoded by one or more plasmid vectors. In some aspects, the
plasmid vector can contain a selection marker which provides for
identification and/or selection of cells which received said
vector.
[0227] 3. RGENs (CRISPR/Cas Systems)
[0228] In some embodiments, the alteration is carried out using one
or more DNA-binding nucleic acids, such as alteration via an
RNA-guided endonuclease (RGEN). For example, the alteration can be
carried out using clustered regularly interspaced short palindromic
repeats (CRISPR) and CRISPR-associated (Cas) proteins. In general,
"CRISPR system" refers collectively to transcripts and other
elements involved in the expression of or directing the activity of
CRISPR-associated ("Cas") genes, including sequences encoding a Cas
gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or
an active partial tracrRNA), a tracr-mate sequence (encompassing a
"direct repeat" and a tracrRNA-processed partial direct repeat in
the context of an endogenous CRISPR system), a guide sequence (also
referred to as a "spacer" in the context of an endogenous CRISPR
system), and/or other sequences and transcripts from a CRISPR
locus.
[0229] The CRISPR/Cas nuclease or CRISPR/Cas nuclease system can
include a non-coding RNA molecule (guide) RNA, which
sequence-specifically binds to DNA, and a Cas protein (e.g., Cas9),
with nuclease functionality (e.g., two nuclease domains). One or
more elements of a CRISPR system can derive from a type I, type II,
or type III CRISPR system, e.g., derived from a particular organism
comprising an endogenous CRISPR system, such as Streptococcus
pyogenes.
[0230] In some aspects, a Cas nuclease and gRNA (including a fusion
of crRNA specific for the target sequence and fixed tracrRNA) are
introduced into the cell. In general, target sites at the 5' end of
the gRNA target the Cas nuclease to the target site, e.g., the
gene, using complementary base pairing. The target site may be
selected based on its location immediately 5' of a protospacer
adjacent motif (PAM) sequence, such as typically NGG, or NAG. In
this respect, the gRNA is targeted to the desired sequence by
modifying the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11, or 10
nucleotides of the guide RNA to correspond to the target DNA
sequence. In general, a CRISPR system is characterized by elements
that promote the formation of a CRISPR complex at the site of a
target sequence. Typically, "target sequence" generally refers to a
sequence to which a guide sequence is designed to have
complementarity, where hybridization between the target sequence
and a guide sequence promotes the formation of a CRISPR complex.
Full complementarity is not necessarily required, provided there is
sufficient complementarity to cause hybridization and promote
formation of a CRISPR complex.
[0231] The CRISPR system can induce double stranded breaks (DSBs)
at the target site, followed by disruptions or alterations as
discussed herein. In other embodiments, Cas9 variants, deemed
"nickases," are used to nick a single strand at the target site.
Paired nickases can be used, e.g., to improve specificity, each
directed by a pair of different gRNAs targeting sequences such that
upon introduction of the nicks simultaneously, a 5' overhang is
introduced. In other embodiments, catalytically inactive Cas9 is
fused to a heterologous effector domain such as a transcriptional
repressor or activator, to affect gene expression.
[0232] The target sequence may comprise any polynucleotide, such as
DNA or RNA polynucleotides. The target sequence may be located in
the nucleus or cytoplasm of the cell, such as within an organelle
of the cell. Generally, a sequence or template that may be used for
recombination into the targeted locus comprising the target
sequences is referred to as an "editing template" or "editing
polynucleotide" or "editing sequence". In some aspects, an
exogenous template polynucleotide may be referred to as an editing
template. In some aspects, the recombination is homologous
recombination.
[0233] Typically, in the context of an endogenous CRISPR system,
formation of the CRISPR complex (comprising the guide sequence
hybridized to the target sequence and complexed with one or more
Cas proteins) results in cleavage of one or both strands in or near
(e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base
pairs from) the target sequence. The tracr sequence, which may
comprise or consist of all or a portion of a wild-type tracr
sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63,
67, 85, or more nucleotides of a wild-type tracr sequence), may
also form part of the CRISPR complex, such as by hybridization
along at least a portion of the tracr sequence to all or a portion
of a tracr mate sequence that is operably linked to the guide
sequence. The tracr sequence has sufficient complementarity to a
tracr mate sequence to hybridize and participate in formation of
the CRISPR complex, such as at least 50%, 60%, 70%, 80%, 90%, 95%
or 99% of sequence complementarity along the length of the tracr
mate sequence when optimally aligned.
[0234] One or more vectors driving expression of one or more
elements of the CRISPR system can be introduced into the cell such
that expression of the elements of the CRISPR system direct
formation of the CRISPR complex at one or more target sites.
Components can also be delivered to cells as proteins and/or RNA.
For example, a Cas enzyme, a guide sequence linked to a tracr-mate
sequence, and a tracr sequence could each be operably linked to
separate regulatory elements on separate vectors. Alternatively,
two or more of the elements expressed from the same or different
regulatory elements, may be combined in a single vector, with one
or more additional vectors providing any components of the CRISPR
system not included in the first vector. The vector may comprise
one or more insertion sites, such as a restriction endonuclease
recognition sequence (also referred to as a "cloning site"). In
some embodiments, one or more insertion sites are located upstream
and/or downstream of one or more sequence elements of one or more
vectors. When multiple different guide sequences are used, a single
expression construct may be used to target CRISPR activity to
multiple different, corresponding target sequences within a
cell.
[0235] A vector may comprise a regulatory element operably linked
to an enzyme-coding sequence encoding the CRISPR enzyme, such as a
Cas protein. Non-limiting examples of Cas proteins include Cas1,
Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known
as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1,
Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4,
Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX,
Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or
modified versions thereof. These enzymes are known; for example,
the amino acid sequence of S. pyogenes Cas9 protein may be found in
the SwissProt database under accession number Q99ZW2.
[0236] The CRISPR enzyme can be Cas9 (e.g., from S. pyogenes or S.
pneumonia). The CRISPR enzyme can direct cleavage of one or both
strands at the location of a target sequence, such as within the
target sequence and/or within the complement of the target
sequence. The vector can encode a CRISPR enzyme that is mutated
with respect to a corresponding wild-type enzyme such that the
mutated CRISPR enzyme lacks the ability to cleave one or both
strands of a target polynucleotide containing a target sequence.
For example, an aspartate-to-alanine substitution (D10A) in the
RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from
a nuclease that cleaves both strands to a nickase (cleaves a single
strand). In some embodiments, a Cas9 nickase may be used in
combination with guide sequence(s), e.g., two guide sequences,
which target respectively sense and antisense strands of the DNA
target. This combination allows both strands to be nicked and used
to induce NHEJ or HDR.
[0237] In some embodiments, an enzyme coding sequence encoding the
CRISPR enzyme is codon optimized for expression in particular
cells, such as eukaryotic cells. The eukaryotic cells may be those
of or derived from a particular organism, such as a mammal,
including but not limited to human, mouse, rat, rabbit, dog, or
non-human primate. In general, codon optimization refers to a
process of modifying a nucleic acid sequence for enhanced
expression in the host cells of interest by replacing at least one
codon of the native sequence with codons that are more frequently
or most frequently used in the genes of that host cell while
maintaining the native amino acid sequence. Various species exhibit
particular bias for certain codons of a particular amino acid.
Codon bias (differences in codon usage between organisms) often
correlates with the efficiency of translation of messenger RNA
(mRNA), which is in turn believed to be dependent on, among other
things, the properties of the codons being translated and the
availability of particular transfer RNA (tRNA) molecules. The
predominance of selected tRNAs in a cell is generally a reflection
of the codons used most frequently in peptide synthesis.
Accordingly, genes can be tailored for optimal gene expression in a
given organism based on codon optimization.
[0238] In general, a guide sequence is any polynucleotide sequence
having sufficient complementarity with a target polynucleotide
sequence to hybridize with the target sequence and direct
sequence-specific binding of the CRISPR complex to the target
sequence. In some embodiments, the degree of complementarity
between a guide sequence and its corresponding target sequence,
when optimally aligned using a suitable alignment algorithm, is
about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%,
99%, or more.
[0239] Exemplary gRNA sequences for NR3CS (glucocorticoid receptor)
include Ex3 NR3C1 sG1 5-TGC TGT TGA GGA GCT GGA-3 (SEQ ID NO:1) and
Ex3 NR3C1 sG2 5-AGC ACA CCA GGC AGA GTT-3 (SEQ ID NO:2). Exemplary
gRNA sequences for TGF-beta receptor 2 include EX3 TGFBR2 sG1 5-CGG
CTG AGG AGC GGA AGA-3 (SEQ ID NO:3) and EX3 TGFBR2 sG2
5-TGG-AGG-TGA-GCA-ATC-CCC-3 (SEQ ID NO:4). The T7 promoter, target
sequence, and overlap sequence may have the sequence
TTAATACGACTCACTATAGG (SEQ ID NO:5)+target
sequence+gttttagagctagaaatagc (SEQ ID NO:6).
[0240] Optimal alignment may be determined with the use of any
suitable algorithm for aligning sequences, non-limiting example of
which include the Smith-Waterman algorithm, the Needleman-Wunsch
algorithm, algorithms based on the Burrows-Wheeler Transform (e.g.
the Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign
(Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP
(available at soap.genomics.org.cn), and Maq (available at
maq.sourceforge.net).
[0241] The CRISPR enzyme may be part of a fusion protein comprising
one or more heterologous protein domains. A CRISPR enzyme fusion
protein may comprise any additional protein sequence, and
optionally a linker sequence between any two domains. Examples of
protein domains that may be fused to a CRISPR enzyme include,
without limitation, epitope tags, reporter gene sequences, and
protein domains having one or more of the following activities:
methylase activity, demethylase activity, transcription activation
activity, transcription repression activity, transcription release
factor activity, histone modification activity, RNA cleavage
activity and nucleic acid binding activity. Non-limiting examples
of epitope tags include histidine (His) tags, V5 tags, FLAG tags,
influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and
thioredoxin (Trx) tags. Examples of reporter genes include, but are
not limited to, glutathione-5-transferase (GST), horseradish
peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta
galactosidase, beta-glucuronidase, luciferase, green fluorescent
protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow
fluorescent protein (YFP), and autofluorescent proteins including
blue fluorescent protein (BFP). A CRISPR enzyme may be fused to a
gene sequence encoding a protein or a fragment of a protein that
bind DNA molecules or bind other cellular molecules, including but
not limited to maltose binding protein (MBP), S-tag, Lex A DNA
binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and
herpes simplex virus (HSV) BP16 protein fusions. Additional domains
that may form part of a fusion protein comprising a CRISPR enzyme
are described in US 20110059502, incorporated herein by
reference.
III. METHODS OF USE
[0242] In some embodiments, the present disclosure provides methods
for immunotherapy comprising administering an effective amount of
the immune cells of the present disclosure. In one embodiments, a
medical disease or disorder is treated by transfer of an immune
cell population that elicits an immune response. In certain
embodiments of the present disclosure, cancer or infection is
treated by transfer of an immune cell population that elicits an
immune response. Provided herein are methods for treating or
delaying progression of cancer in an individual comprising
administering to the individual an effective amount an
antigen-specific cell therapy. The present methods may be applied
for the treatment of immune disorders, solid cancers, hematologic
cancers, and viral infections.
[0243] Tumors for which the present treatment methods are useful
include any malignant cell type, such as those found in a solid
tumor or a hematological tumor. Exemplary solid tumors can include,
but are not limited to, a tumor of an organ selected from the group
consisting of pancreas, colon, cecum, stomach, brain, head, neck,
ovary, kidney, larynx, sarcoma, lung, bladder, melanoma, prostate,
and breast. Exemplary hematological tumors include tumors of the
bone marrow, T or B cell malignancies, leukemias, lymphomas,
blastomas, myelomas, and the like. Further examples of cancers that
may be treated using the methods provided herein include, but are
not limited to, lung cancer (including small-cell lung cancer,
non-small cell lung cancer, adenocarcinoma of the lung, and
squamous carcinoma of the lung), cancer of the peritoneum, gastric
or stomach cancer (including gastrointestinal cancer and
gastrointestinal stromal cancer), pancreatic cancer, cervical
cancer, ovarian cancer, liver cancer, bladder cancer, breast
cancer, colon cancer, colorectal cancer, endometrial or uterine
carcinoma, salivary gland carcinoma, kidney or renal cancer,
prostate cancer, vulval cancer, thyroid cancer, various types of
head and neck cancer, and melanoma.
[0244] The cancer may specifically be of the following histological
type, though it is not limited to these: neoplasm, malignant;
carcinoma; carcinoma, undifferentiated; giant and spindle cell
carcinoma; small cell carcinoma; papillary carcinoma; squamous cell
carcinoma; lymphoepithelial carcinoma; basal cell carcinoma;
pilomatrix carcinoma; transitional cell carcinoma; papillary
transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant;
cholangiocarcinoma; hepatocellular carcinoma; combined
hepatocellular carcinoma and cholangiocarcinoma; trabecular
adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in
adenomatous polyp; adenocarcinoma, familial polyposis coli; solid
carcinoma; carcinoid tumor, malignant; branchiolo-alveolar
adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma;
acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma;
clear cell adenocarcinoma; granular cell carcinoma; follicular
adenocarcinoma; papillary and follicular adenocarcinoma;
nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma;
endometroid carcinoma; skin appendage carcinoma; apocrine
adenocarcinoma; sebaceous adenocarcinoma; ceruminous
adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma;
papillary cystadenocarcinoma; papillary serous cystadenocarcinoma;
mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring
cell carcinoma; infiltrating duct carcinoma; medullary carcinoma;
lobular carcinoma; inflammatory carcinoma; paget's disease,
mammary; acinar cell carcinoma; adenosquamous carcinoma;
adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian
stromal tumor, malignant; thecoma, malignant; granulosa cell tumor,
malignant; androblastoma, malignant; sertoli cell carcinoma; leydig
cell tumor, malignant; lipid cell tumor, malignant; paraganglioma,
malignant; extra-mammary paraganglioma, malignant;
pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic
melanoma; superficial spreading melanoma; lentigo malignant
melanoma; acral lentiginous melanomas; nodular melanomas; malignant
melanoma in giant pigmented nevus; epithelioid cell melanoma; blue
nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma,
malignant; myxosarcoma; liposarcoma; leiomyosarcoma;
rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar
rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant;
mullerian mixed tumor; nephroblastoma; hepatoblastoma;
carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant;
phyllodes tumor, malignant; synovial sarcoma; mesothelioma,
malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant;
struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant;
hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma;
hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma;
juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma,
malignant; mesenchymal chondrosarcoma; giant cell tumor of bone;
ewing's sarcoma; odontogenic tumor, malignant; ameloblastic
odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma;
pinealoma, malignant; chordoma; glioma, malignant; ependymoma;
astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma;
astroblastoma; glioblastoma; oligodendroglioma;
oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma;
ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory
neurogenic tumor; meningioma, malignant; neurofibrosarcoma;
neurilemmoma, malignant; granular cell tumor, malignant; malignant
lymphoma; hodgkin's disease; hodgkin's; paragranuloma; malignant
lymphoma, small lymphocytic; malignant lymphoma, large cell,
diffuse; malignant lymphoma, follicular; mycosis fungoides; other
specified non-hodgkin's lymphomas; B-cell lymphoma; low
grade/follicular non-Hodgkin's lymphoma (NHL); small lymphocytic
(SL) NHL; intermediate grade/follicular NHL; intermediate grade
diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic
NHL; high grade small non-cleaved cell NHL; bulky disease NHL;
mantle cell lymphoma; AIDS-related lymphoma; Waldenstrom's
macroglobulinemia; malignant histiocytosis; multiple myeloma; mast
cell sarcoma; immunoproliferative small intestinal disease;
leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia;
lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia;
eosinophilic leukemia; monocytic leukemia; mast cell leukemia;
megakaryoblastic leukemia; myeloid sarcoma; hairy cell leukemia;
chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia
(ALL); acute myeloid leukemia (AML); and chronic myeloblastic
leukemia.
[0245] Particular embodiments concern methods of treatment of
leukemia. Leukemia is a cancer of the blood or bone marrow and is
characterized by an abnormal proliferation (production by
multiplication) of blood cells, usually white blood cells
(leukocytes). It is part of the broad group of diseases called
hematological neoplasms. Leukemia is a broad term covering a
spectrum of diseases. Leukemia is clinically and pathologically
split into its acute and chronic forms.
[0246] In certain embodiments of the present disclosure, immune
cells are delivered to an individual in need thereof, such as an
individual that has cancer or an infection. The cells then enhance
the individual's immune system to attack the respective cancer or
pathogenic cells. In some cases, the individual is provided with
one or more doses of the immune cells. In cases where the
individual is provided with two or more doses of the immune cells,
the duration between the administrations should be sufficient to
allow time for propagation in the individual, and in specific
embodiments the duration between doses is 1, 2, 3, 4, 5, 6, 7, or
more days.
[0247] Certain embodiments of the present disclosure provide
methods for treating or preventing an immune-mediated disorder. In
one embodiment, the subject has an autoimmune disease. Non-limiting
examples of autoimmune diseases include: alopecia areata,
ankylosing spondylitis, antiphospholipid syndrome, autoimmune
Addison's disease, autoimmune diseases of the adrenal gland,
autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune
oophoritis and orchitis, autoimmune thrombocytopenia, Behcet's
disease, bullous pemphigoid, cardiomyopathy, celiac
spate-dermatitis, chronic fatigue immune dysfunction syndrome
(CFIDS), chronic inflammatory demyelinating polyneuropathy,
Churg-Strauss syndrome, cicatrical pemphigoid, CREST syndrome, cold
agglutinin disease, Crohn's disease, discoid lupus, essential mixed
cryoglobulinemia, fibromyalgia-fibromyositis, glomerulonephritis,
Graves' disease, Guillain-Barre, Hashimoto's thyroiditis,
idiopathic pulmonary fibrosis, idiopathic thrombocytopenia purpura
(ITP), IgA neuropathy, juvenile arthritis, lichen planus, lupus
erthematosus, Meniere's disease, mixed connective tissue disease,
multiple sclerosis, type 1 or immune-mediated diabetes mellitus,
myasthenia gravis, nephrotic syndrome (such as minimal change
disease, focal glomerulosclerosis, or mebranous nephropathy),
pemphigus vulgaris, pernicious anemia, polyarteritis nodosa,
polychondritis, polyglandular syndromes, polymyalgia rheumatica,
polymyositis and dermatomyositis, primary agammaglobulinemia,
primary biliary cirrhosis, psoriasis, psoriatic arthritis,
Raynaud's phenomenon, Reiter's syndrome, Rheumatoid arthritis,
sarcoidosis, scleroderma, Sjogren's syndrome, stiff-man syndrome,
systemic lupus erythematosus, lupus erythematosus, ulcerative
colitis, uveitis, vasculitides (such as polyarteritis nodosa,
takayasu arteritis, temporal arteritis/giant cell arteritis, or
dermatitis herpetiformis vasculitis), vitiligo, and Wegener's
granulomatosis. Thus, some examples of an autoimmune disease that
can be treated using the methods disclosed herein include, but are
not limited to, multiple sclerosis, rheumatoid arthritis, systemic
lupus erythematosis, type I diabetes mellitus, Crohn's disease;
ulcerative colitis, myasthenia gravis, glomerulonephritis,
ankylosing spondylitis, vasculitis, or psoriasis. The subject can
also have an allergic disorder such as Asthma.
[0248] In yet another embodiment, the subject is the recipient of a
transplanted organ or stem cells and immune cells are used to
prevent and/or treat rejection. In particular embodiments, the
subject has or is at risk of developing graft versus host disease.
GVHD is a possible complication of any transplant that uses or
contains stem cells from either a related or an unrelated donor.
There are two kinds of GVHD, acute and chronic. Acute GVHD appears
within the first three months following transplantation. Signs of
acute GVHD include a reddish skin rash on the hands and feet that
may spread and become more severe, with peeling or blistering skin.
Acute GVHD can also affect the stomach and intestines, in which
case cramping, nausea, and diarrhea are present. Yellowing of the
skin and eyes (jaundice) indicates that acute GVHD has affected the
liver. Chronic GVHD is ranked based on its severity: stage/grade 1
is mild; stage/grade 4 is severe. Chronic GVHD develops three
months or later following transplantation. The symptoms of chronic
GVHD are similar to those of acute GVHD, but in addition, chronic
GVHD may also affect the mucous glands in the eyes, salivary glands
in the mouth, and glands that lubricate the stomach lining and
intestines. Any of the populations of immune cells disclosed herein
can be utilized. Examples of a transplanted organ include a solid
organ transplant, such as kidney, liver, skin, pancreas, lung
and/or heart, or a cellular transplant such as islets, hepatocytes,
myoblasts, bone marrow, or hematopoietic or other stem cells. The
transplant can be a composite transplant, such as tissues of the
face. Immune cells can be administered prior to transplantation,
concurrently with transplantation, or following transplantation. In
some embodiments, the immune cells are administered prior to the
transplant, such as at least 1 hour, at least 12 hours, at least 1
day, at least 2 days, at least 3 days, at least 4 days, at least 5
days, at least 6 days, at least 1 week, at least 2 weeks, at least
3 weeks, at least 4 weeks, or at least 1 month prior to the
transplant. In one specific, non-limiting example, administration
of the therapeutically effective amount of immune cells occurs 3-5
days prior to transplantation.
[0249] In some embodiments, the subject can be administered
nonmyeloablative lymphodepleting chemotherapy prior to the immune
cell therapy. The nonmyeloablative lymphodepleting chemotherapy can
be any suitable such therapy, which can be administered by any
suitable route. The nonmyeloablative lymphodepleting chemotherapy
can comprise, for example, the administration of cyclophosphamide
and fludarabine, particularly if the cancer is melanoma, which can
be metastatic. An exemplary route of administering cyclophosphamide
and fludarabine is intravenously. Likewise, any suitable dose of
cyclophosphamide and fludarabine can be administered. In particular
aspects, around 60 mg/kg of cyclophosphamide is administered for
two days after which around 25 mg/m.sup.2 fludarabine is
administered for five days.
[0250] In certain embodiments, a growth factor that promotes the
growth and activation of the immune cells is administered to the
subject either concomitantly with the immune cells or subsequently
to the immune cells. The immune cell growth factor can be any
suitable growth factor that promotes the growth and activation of
the immune cells. Examples of suitable immune cell growth factors
include interleukin (IL)-2, IL-7, IL-15, and IL-12, which can be
used alone or in various combinations, such as IL-2 and IL-7, IL-2
and IL-15, IL-7 and IL-15, IL-2, IL-7 and IL-15, IL-12 and IL-7,
IL-12 and IL-15, or IL-12 and IL2.
[0251] Therapeutically effective amounts of immune cells can be
administered by a number of routes, including parenteral
administration, for example, intravenous, intraperitoneal,
intramuscular, intrasternal, or intraarticular injection, or
infusion.
[0252] The therapeutically effective amount of immune cells for use
in adoptive cell therapy is that amount that achieves a desired
effect in a subject being treated. For instance, this can be the
amount of immune cells necessary to inhibit advancement, or to
cause regression of an autoimmune or alloimmune disease, or which
is capable of relieving symptoms caused by an autoimmune disease,
such as pain and inflammation. It can be the amount necessary to
relieve symptoms associated with inflammation, such as pain, edema
and elevated temperature. It can also be the amount necessary to
diminish or prevent rejection of a transplanted organ.
[0253] The immune cell population can be administered in treatment
regimens consistent with the disease, for example a single or a few
doses over one to several days to ameliorate a disease state or
periodic doses over an extended time to inhibit disease progression
and prevent disease recurrence. The precise dose to be employed in
the formulation will also depend on the route of administration,
and the seriousness of the disease or disorder, and should be
decided according to the judgment of the practitioner and each
patient's circumstances. The therapeutically effective amount of
immune cells will be dependent on the subject being treated, the
severity and type of the affliction, and the manner of
administration. In some embodiments, doses that could be used in
the treatment of human subjects range from at least
3.8.times.10.sup.4, at least 3.8.times.10.sup.5, at least
3.8.times.10.sup.6, at least 3.8.times.10.sup.7, at least
3.8.times.10.sup.8, at least 3.8.times.10.sup.9, or at least
3.8.times.10.sup.10 immune cells/m.sup.2. In a certain embodiment,
the dose used in the treatment of human subjects ranges from about
3.8.times.10.sup.9 to about 3.8.times.10.sup.10 immune
cells/m.sup.2. In additional embodiments, a therapeutically
effective amount of immune cells can vary from about
5.times.10.sup.6 cells per kg body weight to about
7.5.times.10.sup.8 cells per kg body weight, such as about
2.times.10.sup.7 cells to about 5.times.10.sup.8 cells per kg body
weight, or about 5.times.10.sup.7 cells to about 2.times.10.sup.8
cells per kg body weight. The exact amount of immune cells is
readily determined by one of skill in the art based on the age,
weight, sex, and physiological condition of the subject. Effective
doses can be extrapolated from dose-response curves derived from in
vitro or animal model test systems.
[0254] The immune cells may be administered in combination with one
or more other therapeutic agents for the treatment of the
immune-mediated disorder. Combination therapies can include, but
are not limited to, one or more anti-microbial agents (for example,
antibiotics, anti-viral agents and anti-fungal agents), anti-tumor
agents (for example, fluorouracil, methotrexate, paclitaxel,
fludarabine, etoposide, doxorubicin, or vincristine),
immune-depleting agents (for example, fludarabine, etoposide,
doxorubicin, or vincristine), immunosuppressive agents (for
example, azathioprine, or glucocorticoids, such as dexamethasone or
prednisone), anti-inflammatory agents (for example, glucocorticoids
such as hydrocortisone, dexamethasone or prednisone, or
non-steroidal anti-inflammatory agents such as acetylsalicylic
acid, ibuprofen or naproxen sodium), cytokines (for example,
interleukin-10 or transforming growth factor-beta), hormones (for
example, estrogen), or a vaccine. In addition, immunosuppressive or
tolerogenic agents including but not limited to calcineurin
inhibitors (e.g., cyclosporin and tacrolimus); mTOR inhibitors
(e.g., Rapamycin); mycophenolate mofetil, antibodies (e.g.,
recognizing CD3, CD4, CD40, CD154, CD45, IVIG, or B cells);
chemotherapeutic agents (e.g., Methotrexate, Treosulfan, Busulfan);
irradiation; or chemokines, interleukins or their inhibitors (e.g.,
BAFF, IL-2, anti-IL-2R, IL-4, JAK kinase inhibitors) can be
administered. Such additional pharmaceutical agents can be
administered before, during, or after administration of the immune
cells, depending on the desired effect. This administration of the
cells and the agent can be by the same route or by different
routes, and either at the same site or at a different site.
[0255] A. Pharmaceutical Compositions
[0256] Also provided herein are pharmaceutical compositions and
formulations comprising immune cells (e.g., T cells or NK cells)
and a pharmaceutically acceptable carrier.
[0257] Pharmaceutical compositions and formulations as described
herein can be prepared by mixing the active ingredients (such as an
antibody or a polypeptide) having the desired degree of purity with
one or more optional pharmaceutically acceptable carriers
(Remington's Pharmaceutical Sciences 22.sup.nd edition, 2012), in
the form of lyophilized formulations or aqueous solutions.
Pharmaceutically acceptable carriers are generally nontoxic to
recipients at the dosages and concentrations employed, and include,
but are not limited to: buffers such as phosphate, citrate, and
other organic acids; antioxidants including ascorbic acid and
methionine; preservatives (such as octadecyldimethylbenzyl ammonium
chloride; hexamethonium chloride; benzalkonium chloride;
benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl
parabens such as methyl or propyl paraben; catechol; resorcinol;
cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less
than about 10 residues) polypeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids such as glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides,
disaccharides, and other carbohydrates including glucose, mannose,
or dextrins; chelating agents such as EDTA; sugars such as sucrose,
mannitol, trehalose or sorbitol; salt-forming counter-ions such as
sodium; metal complexes (e.g. Zn-- protein complexes); and/or
non-ionic surfactants such as polyethylene glycol (PEG). Exemplary
pharmaceutically acceptable carriers herein further include
insterstitial drug dispersion agents such as soluble neutral-active
hyaluronidase glycoproteins (sHASEGP), for example, human soluble
PH-20 hyaluronidase glycoproteins, such as rHuPH20 (HYLENEX.RTM.,
Baxter International, Inc.). Certain exemplary sHASEGPs and methods
of use, including rHuPH20, are described in US Patent Publication
Nos. 2005/0260186 and 2006/0104968. In one aspect, a sHASEGP is
combined with one or more additional glycosaminoglycanases such as
chondroitinases.
[0258] B. Combination Therapies
[0259] In certain embodiments, the compositions and methods of the
present embodiments involve an immune cell population in
combination with at least one additional therapy. The additional
therapy may be radiation therapy, surgery (e.g., lumpectomy and a
mastectomy), chemotherapy, gene therapy, DNA therapy, viral
therapy, RNA therapy, immunotherapy, bone marrow transplantation,
nanotherapy, monoclonal antibody therapy, or a combination of the
foregoing. The additional therapy may be in the form of adjuvant or
neoadjuvant therapy.
[0260] In some embodiments, the additional therapy is the
administration of small molecule enzymatic inhibitor or
anti-metastatic agent. In some embodiments, the additional therapy
is the administration of side-effect limiting agents (e.g., agents
intended to lessen the occurrence and/or severity of side effects
of treatment, such as anti-nausea agents, etc.). In some
embodiments, the additional therapy is radiation therapy. In some
embodiments, the additional therapy is surgery. In some
embodiments, the additional therapy is a combination of radiation
therapy and surgery. In some embodiments, the additional therapy is
gamma irradiation. In some embodiments, the additional therapy is
therapy targeting PBK/AKT/mTOR pathway, HSP90 inhibitor, tubulin
inhibitor, apoptosis inhibitor, and/or chemopreventative agent. The
additional therapy may be one or more of the chemotherapeutic
agents known in the art.
[0261] An immune cell therapy may be administered before, during,
after, or in various combinations relative to an additional cancer
therapy, such as immune checkpoint therapy. The administrations may
be in intervals ranging from concurrently to minutes to days to
weeks. In embodiments where the immune cell therapy is provided to
a patient separately from an additional therapeutic agent, one
would generally ensure that a significant period of time did not
expire between the time of each delivery, such that the two
compounds would still be able to exert an advantageously combined
effect on the patient. In such instances, it is contemplated that
one may provide a patient with the antibody therapy and the
anti-cancer therapy within about 12 to 24 or 72 h of each other
and, more particularly, within about 6-12 h of each other. In some
situations it may be desirable to extend the time period for
treatment significantly where several days (2, 3, 4, 5, 6, or 7) to
several weeks (1, 2, 3, 4, 5, 6, 7, or 8) lapse between respective
administrations.
[0262] Various combinations may be employed. For the example below
an immune cell therapy is "A" and an anti-cancer therapy is
"B":
TABLE-US-00001 A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B
B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B
A/A/A/B B/A/A/A A/B/A/A A/A/B/A
[0263] Administration of any compound or therapy of the present
embodiments to a patient will follow general protocols for the
administration of such compounds, taking into account the toxicity,
if any, of the agents. Therefore, in some embodiments there is a
step of monitoring toxicity that is attributable to combination
therapy.
[0264] 1. Chemotherapy
[0265] A wide variety of chemotherapeutic agents may be used in
accordance with the present embodiments. The term "chemotherapy"
refers to the use of drugs to treat cancer. A "chemotherapeutic
agent" is used to connote a compound or composition that is
administered in the treatment of cancer. These agents or drugs are
categorized by their mode of activity within a cell, for example,
whether and at what stage they affect the cell cycle.
Alternatively, an agent may be characterized based on its ability
to directly cross-link DNA, to intercalate into DNA, or to induce
chromosomal and mitotic aberrations by affecting nucleic acid
synthesis.
[0266] Examples of chemotherapeutic agents include alkylating
agents, such as thiotepa and cyclosphosphamide; alkyl sulfonates,
such as busulfan, improsulfan, and piposulfan; aziridines, such as
benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and
methylamelamines, including altretamine, triethylenemelamine,
trietylenephosphoramide, triethiylenethiophosphoramide, and
trimethylolomelamine; acetogenins (especially bullatacin and
bullatacinone); a camptothecin (including the synthetic analogue
topotecan); bryostatin; callystatin; CC-1065 (including its
adozelesin, carzelesin and bizelesin synthetic analogues);
cryptophycins (particularly cryptophycin 1 and cryptophycin 8);
dolastatin; duocarmycin (including the synthetic analogues, KW-2189
and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin;
spongistatin; nitrogen mustards, such as chlorambucil,
chlornaphazine, cholophosphamide, estramustine, ifosfamide,
mechlorethamine, mechlorethamine oxide hydrochloride, melphalan,
novembichin, phenesterine, prednimustine, trofosfamide, and uracil
mustard; nitrosureas, such as carmustine, chlorozotocin,
fotemustine, lomustine, nimustine, and ranimnustine; antibiotics,
such as the enediyne antibiotics (e.g., calicheamicin, especially
calicheamicin gammalI and calicheamicin omegaI1); dynemicin,
including dynemicin A; bisphosphonates, such as clodronate; an
esperamicin; as well as neocarzinostatin chromophore and related
chromoprotein enediyne antiobiotic chromophores, aclacinomysins,
actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin,
carabicin, carminomycin, carzinophilin, chromomycinis,
dactinomycin, daunorubicin, detorubicin,
6-diazo-5-oxo-L-norleucine, doxorubicin (including
morpholino-doxorubicin, cyanomorpholino-doxorubicin,
2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin,
esorubicin, idarubicin, marcellomycin, mitomycins, such as
mitomycin C, mycophenolic acid, nogalarnycin, olivomycins,
peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin,
streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and
zorubicin; anti-metabolites, such as methotrexate and
5-fluorouracil (5-FU); folic acid analogues, such as denopterin,
pteropterin, and trimetrexate; purine analogs, such as fludarabine,
6-mercaptopurine, thiamiprine, and thioguanine; pyrimidine analogs,
such as ancitabine, azacitidine, 6-azauridine, carmofur,
cytarabine, dideoxyuridine, doxifluridine, enocitabine, and
floxuridine; androgens, such as calusterone, dromostanolone
propionate, epitiostanol, mepitiostane, and testolactone;
anti-adrenals, such as mitotane and trilostane; folic acid
replenisher, such as frolinic acid; aceglatone; aldophosphamide
glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil;
bisantrene; edatraxate; defofamine; demecolcine; diaziquone;
elformithine; elliptinium acetate; an epothilone; etoglucid;
gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids,
such as maytansine and ansamitocins; mitoguazone; mitoxantrone;
mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin;
losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine;
PSKpolysaccharide complex; razoxane; rhizoxin; sizofiran;
spirogermanium; tenuazonic acid; triaziquone;
2,2',2''-trichlorotriethylamine; trichothecenes (especially T-2
toxin, verracurin A, roridin A and anguidine); urethan; vindesine;
dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman;
gacytosine; arabinoside ("Ara-C"); cyclophosphamide; taxoids, e.g.,
paclitaxel and docetaxel gemcitabine; 6-thioguanine;
mercaptopurine; platinum coordination complexes, such as cisplatin,
oxaliplatin, and carboplatin; vinblastine; platinum; etoposide
(VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine;
novantrone; teniposide; edatrexate; daunomycin; aminopterin;
xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase
inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids,
such as retinoic acid; capecitabine; carboplatin, procarbazine,
plicomycin, gemcitabien, navelbine, farnesyl-protein tansferase
inhibitors, transplatinum, and pharmaceutically acceptable salts,
acids, or derivatives of any of the above.
[0267] 2. Radiotherapy
[0268] Other factors that cause DNA damage and have been used
extensively include what are commonly known as y-rays, X-rays,
and/or the directed delivery of radioisotopes to tumor cells. Other
forms of DNA damaging factors are also contemplated, such as
microwaves, proton beam irradiation (U.S. Pat. Nos. 5,760,395 and
4,870,287), and UV-irradiation. It is most likely that all of these
factors affect a broad range of damage on DNA, on the precursors of
DNA, on the replication and repair of DNA, and on the assembly and
maintenance of chromosomes. Dosage ranges for X-rays range from
daily doses of 50 to 200 roentgens for prolonged periods of time (3
to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges
for radioisotopes vary widely, and depend on the half-life of the
isotope, the strength and type of radiation emitted, and the uptake
by the neoplastic cells.
[0269] 3. Immunotherapy
[0270] The skilled artisan will understand that additional
immunotherapies may be used in combination or in conjunction with
methods of the embodiments. In the context of cancer treatment,
immunotherapeutics, generally, rely on the use of immune effector
cells and molecules to target and destroy cancer cells. Rituximab
(RITUXAN.RTM.) is such an example. The immune effector may be, for
example, an antibody specific for some marker on the surface of a
tumor cell. The antibody alone may serve as an effector of therapy
or it may recruit other cells to actually affect cell killing. The
antibody also may be conjugated to a drug or toxin
(chemotherapeutic, radionuclide, ricin A chain, cholera toxin,
pertussis toxin, etc.) and serve as a targeting agent.
Alternatively, the effector may be a lymphocyte carrying a surface
molecule that interacts, either directly or indirectly, with a
tumor cell target. Various effector cells include cytotoxic T cells
and NK cells
[0271] Antibody-drug conjugates have emerged as a breakthrough
approach to the development of cancer therapeutics. Cancer is one
of the leading causes of deaths in the world. Antibody-drug
conjugates (ADCs) comprise monoclonal antibodies (MAbs) that are
covalently linked to cell-killing drugs. This approach combines the
high specificity of MAbs against their antigen targets with highly
potent cytotoxic drugs, resulting in "armed" MAbs that deliver the
payload (drug) to tumor cells with enriched levels of the antigen.
Targeted delivery of the drug also minimizes its exposure in normal
tissues, resulting in decreased toxicity and improved therapeutic
index. The approval of two ADC drugs, ADCETRIS.RTM. (brentuximab
vedotin) in 2011 and KADCYLA.RTM. (trastuzumab emtansine or T-DM1)
in 2013 by FDA validated the approach. There are currently more
than 30 ADC drug candidates in various stages of clinical trials
for cancer treatment (Leal et al., 2014). As antibody engineering
and linker-payload optimization are becoming more and more mature,
the discovery and development of new ADCs are increasingly
dependent on the identification and validation of new targets that
are suitable to this approach and the generation of targeting MAbs.
Two criteria for ADC targets are upregulated/high levels of
expression in tumor cells and robust internalization.
[0272] In one aspect of immunotherapy, the tumor cell must bear
some marker that is amenable to targeting, i.e., is not present on
the majority of other cells. Many tumor markers exist and any of
these may be suitable for targeting in the context of the present
embodiments. Common tumor markers include CD20, carcinoembryonic
antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis
Antigen, MucA, MucB, PLAP, laminin receptor, erb B, and p155. An
alternative aspect of immunotherapy is to combine anticancer
effects with immune stimulatory effects. Immune stimulating
molecules also exist including: cytokines, such as IL-2, IL-4,
IL-12, GM-CSF, gamma-IFN, chemokines, such as MIP-1, MCP-1, IL-8,
and growth factors, such as FLT3 ligand.
[0273] Examples of immunotherapies currently under investigation or
in use are immune adjuvants, e.g., Mycobacterium bovis, Plasmodium
falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Pat.
Nos. 5,801,005 and 5,739,169; Hui and Hashimoto, 1998;
Christodoulides et al., 1998); cytokine therapy, e.g., interferons
.alpha., .beta., and .gamma., IL-1, GM-CSF, and TNF (Bukowski et
al., 1998; Davidson et al., 1998; Hellstrand et al., 1998); gene
therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al., 1998;
Austin-Ward and Villaseca, 1998; U.S. Pat. Nos. 5,830,880 and
5,846,945); and monoclonal antibodies, e.g., anti-CD20,
anti-ganglioside GM2, and anti-p185 (Hollander, 2012; Hanibuchi et
al., 1998; U.S. Pat. No. 5,824,311). It is contemplated that one or
more anti-cancer therapies may be employed with the antibody
therapies described herein.
[0274] In some embodiments, the immunotherapy may be an immune
checkpoint inhibitor. Immune checkpoints either turn up a signal
(e.g., co-stimulatory molecules) or turn down a signal. Inhibitory
immune checkpoints that may be targeted by immune checkpoint
blockade include adenosine A2A receptor (A2AR), B7-H3 (also known
as CD276), B and T lymphocyte attenuator (BTLA), cytotoxic
T-lymphocyte-associated protein 4 (CTLA-4, also known as CD152),
indoleamine 2,3-dioxygenase (IDO), killer-cell immunoglobulin
(KIR), lymphocyte activation gene-3 (LAG3), programmed death 1
(PD-1), T-cell immunoglobulin domain and mucin domain 3 (TIM-3) and
V-domain Ig suppressor of T cell activation (VISTA). In particular,
the immune checkpoint inhibitors target the PD-1 axis and/or
CTLA-4.
[0275] The immune checkpoint inhibitors may be drugs such as small
molecules, recombinant forms of ligand or receptors, or, in
particular, are antibodies, such as human antibodies (e.g.,
International Patent Publication WO2015016718; Pardoll, Nat Rev
Cancer, 12(4): 252-64, 2012; both incorporated herein by
reference). Known inhibitors of the immune checkpoint proteins or
analogs thereof may be used, in particular chimerized, humanized or
human forms of antibodies may be used. As the skilled person will
know, alternative and/or equivalent names may be in use for certain
antibodies mentioned in the present disclosure. Such alternative
and/or equivalent names are interchangeable in the context of the
present disclosure. For example it is known that lambrolizumab is
also known under the alternative and equivalent names MK-3475 and
pembrolizumab.
[0276] In some embodiments, the PD-1 binding antagonist is a
molecule that inhibits the binding of PD-1 to its ligand binding
partners. In a specific aspect, the PD-1 ligand binding partners
are PDL1 and/or PDL2. In another embodiment, a PDL1 binding
antagonist is a molecule that inhibits the binding of PDL1 to its
binding partners. In a specific aspect, PDL1 binding partners are
PD-1 and/or B7-1. In another embodiment, the PDL2 binding
antagonist is a molecule that inhibits the binding of PDL2 to its
binding partners. In a specific aspect, a PDL2 binding partner is
PD-1. The antagonist may be an antibody, an antigen binding
fragment thereof, an immunoadhesin, a fusion protein, or
oligopeptide. Exemplary antibodies are described in U.S. Pat. Nos.
U.S. Pat. Nos. 8,735,553, 8,354,509, and 8,008,449, all
incorporated herein by reference. Other PD-1 axis antagonists for
use in the methods provided herein are known in the art such as
described in U.S. Patent Application No. US20140294898,
US2014022021, and US20110008369, all incorporated herein by
reference.
[0277] In some embodiments, the PD-1 binding antagonist is an
anti-PD-1 antibody (e.g., a human antibody, a humanized antibody,
or a chimeric antibody). In some embodiments, the anti-PD-1
antibody is selected from the group consisting of nivolumab,
pembrolizumab, and CT-011. In some embodiments, the PD-1 binding
antagonist is an immunoadhesin (e.g., an immunoadhesin comprising
an extracellular or PD-1 binding portion of PDL1 or PDL2 fused to a
constant region (e.g., an Fc region of an immunoglobulin sequence).
In some embodiments, the PD-1 binding antagonist is AMP-224.
Nivolumab, also known as MDX-1106-04, MDX-1106, ONO-4538,
BMS-936558, and OPDIVO.RTM., is an anti-PD-1 antibody described in
WO2006/121168. Pembrolizumab, also known as MK-3475, Merck 3475,
lambrolizumab, KEYTRUDA.RTM., and SCH-900475, is an anti-PD-1
antibody described in WO2009/114335. CT-011, also known as hBAT or
hBAT-1, is an anti-PD-1 antibody described in WO2009/101611.
AMP-224, also known as B7-DCIg, is a PDL2-Fc fusion soluble
receptor described in WO2010/027827 and WO2011/066342.
[0278] Another immune checkpoint that can be targeted in the
methods provided herein is the cytotoxic T-lymphocyte-associated
protein 4 (CTLA-4), also known as CD152. The complete cDNA sequence
of human CTLA-4 has the Genbank accession number L15006. CTLA-4 is
found on the surface of T cells and acts as an "off" switch when
bound to CD80 or CD86 on the surface of antigen-presenting cells.
CTLA4 is a member of the immunoglobulin superfamily that is
expressed on the surface of Helper T cells and transmits an
inhibitory signal to T cells. CTLA4 is similar to the T-cell
co-stimulatory protein, CD28, and both molecules bind to CD80 and
CD86, also called B7-1 and B7-2 respectively, on antigen-presenting
cells. CTLA4 transmits an inhibitory signal to T cells, whereas
CD28 transmits a stimulatory signal. Intracellular CTLA4 is also
found in regulatory T cells and may be important to their function.
T cell activation through the T cell receptor and CD28 leads to
increased expression of CTLA-4, an inhibitory receptor for B7
molecules.
[0279] In some embodiments, the immune checkpoint inhibitor is an
anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody,
or a chimeric antibody), an antigen binding fragment thereof, an
immunoadhesin, a fusion protein, or oligopeptide.
[0280] Anti-human-CTLA-4 antibodies (or VH and/or VL domains
derived therefrom) suitable for use in the present methods can be
generated using methods well known in the art. Alternatively, art
recognized anti-CTLA-4 antibodies can be used. For example, the
anti-CTLA-4 antibodies disclosed in: U.S. Pat. No. 8,119,129, WO
01/14424, WO 98/42752; WO 00/37504 (CP675,206, also known as
tremelimumab; formerly ticilimumab), U.S. Pat. No. 6,207,156;
Hurwitz et al. (1998) Proc Natl Acad Sci USA 95(17): 10067-10071;
Camacho et al. (2004) J Clin Oncology 22(145): Abstract No. 2505
(antibody CP-675206); and Mokyr et al. (1998) Cancer Res
58:5301-5304 can be used in the methods disclosed herein. The
teachings of each of the aforementioned publications are hereby
incorporated by reference. Antibodies that compete with any of
these art-recognized antibodies for binding to CTLA-4 also can be
used. For example, a humanized CTLA-4 antibody is described in
International Patent Application No. WO2001014424, WO2000037504,
and U.S. Pat. No. 8,017,114; all incorporated herein by
reference.
[0281] An exemplary anti-CTLA-4 antibody is ipilimumab (also known
as 10D1, MDX-010, MDX-101, and Yervoy.RTM.) or antigen binding
fragments and variants thereof (see, e.g., WO 01/14424). In other
embodiments, the antibody comprises the heavy and light chain CDRs
or VRs of ipilimumab. Accordingly, in one embodiment, the antibody
comprises the CDR1, CDR2, and CDR3 domains of the VH region of
ipilimumab, and the CDR1, CDR2 and CDR3 domains of the VL region of
ipilimumab. In another embodiment, the antibody competes for
binding with and/or binds to the same epitope on CTLA-4 as the
above-mentioned antibodies. In another embodiment, the antibody has
at least about 90% variable region amino acid sequence identity
with the above-mentioned antibodies (e.g., at least about 90%, 95%,
or 99% variable region identity with ipilimumab).
[0282] Other molecules for modulating CTLA-4 include CTLA-4 ligands
and receptors such as described in U.S. Pat. Nos. U.S. Pat. Nos.
5,844,905, 5,885,796 and International Patent Application Nos.
WO1995001994 and WO1998042752; all incorporated herein by
reference, and immunoadhesins such as described in U.S. Pat. No.
8,329,867, incorporated herein by reference.
[0283] 4. Surgery
[0284] Approximately 60% of persons with cancer will undergo
surgery of some type, which includes preventative, diagnostic or
staging, curative, and palliative surgery. Curative surgery
includes resection in which all or part of cancerous tissue is
physically removed, excised, and/or destroyed and may be used in
conjunction with other therapies, such as the treatment of the
present embodiments, chemotherapy, radiotherapy, hormonal therapy,
gene therapy, immunotherapy, and/or alternative therapies. Tumor
resection refers to physical removal of at least part of a tumor.
In addition to tumor resection, treatment by surgery includes laser
surgery, cryosurgery, electrosurgery, and
microscopically-controlled surgery (Mohs' surgery).
[0285] Upon excision of part or all of cancerous cells, tissue, or
tumor, a cavity may be formed in the body. Treatment may be
accomplished by perfusion, direct injection, or local application
of the area with an additional anti-cancer therapy. Such treatment
may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or
every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, or 12 months. These treatments may be of varying dosages as
well.
[0286] 5. Other Agents
[0287] It is contemplated that other agents may be used in
combination with certain aspects of the present embodiments to
improve the therapeutic efficacy of treatment. These additional
agents include agents that affect the upregulation of cell surface
receptors and GAP junctions, cytostatic and differentiation agents,
inhibitors of cell adhesion, agents that increase the sensitivity
of the hyperproliferative cells to apoptotic inducers, or other
biological agents. Increases in intercellular signaling by
elevating the number of GAP junctions would increase the
anti-hyperproliferative effects on the neighboring
hyperproliferative cell population. In other embodiments,
cytostatic or differentiation agents can be used in combination
with certain aspects of the present embodiments to improve the
anti-hyperproliferative efficacy of the treatments. Inhibitors of
cell adhesion are contemplated to improve the efficacy of the
present embodiments. Examples of cell adhesion inhibitors are focal
adhesion kinase (FAKs) inhibitors and Lovastatin. It is further
contemplated that other agents that increase the sensitivity of a
hyperproliferative cell to apoptosis, such as the antibody c225,
could be used in combination with certain aspects of the present
embodiments to improve the treatment efficacy.
IV. ARTICLES OF MANUFACTURE OR KITS
[0288] An article of manufacture or a kit is provided comprising
immune cells is also provided herein. The article of manufacture or
kit can further comprise a package insert comprising instructions
for using the immune cells to treat or delay progression of cancer
in an individual or to enhance immune function of an individual
having cancer. Any of the antigen-specific immune cells described
herein may be included in the article of manufacture or kits.
Suitable containers include, for example, bottles, vials, bags and
syringes. The container may be formed from a variety of materials
such as glass, plastic (such as polyvinyl chloride or polyolefin),
or metal alloy (such as stainless steel or hastelloy). In some
embodiments, the container holds the formulation and the label on,
or associated with, the container may indicate directions for use.
The article of manufacture or kit may further include other
materials desirable from a commercial and user standpoint,
including other buffers, diluents, filters, needles, syringes, and
package inserts with instructions for use. In some embodiments, the
article of manufacture further includes one or more of another
agent (e.g., a chemotherapeutic agent, and anti-neoplastic agent).
Suitable containers for the one or more agent include, for example,
bottles, vials, bags and syringes.
V. EXAMPLES
[0289] The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of
skill in the art that the techniques disclosed in the examples
which follow represent techniques discovered by the inventor to
function well in the practice of the invention, and thus can be
considered to constitute preferred modes for its practice. However,
those of skill in the art should, in light of the present
disclosure, appreciate that many changes can be made in the
specific embodiments which are disclosed and still obtain a like or
similar result without departing from the spirit and scope of the
invention.
Example 1--CAR-NK Cells Expressing IL-15
[0290] NK cells were derived from cord blood and their specificity
was redirected by genetically engineering them to express
tumor-specific chimeric antigen receptors (CARs) that could enhance
their anti-tumor activity without increasing the risk of
graft-versus-host disease (GVHD), thus providing an `off-the-shelf`
source of cells for therapy, such as immunotherapy of any cancer
expressing the target. For genetic modification, CB-NK cells were
transduced with a retroviral construct (iC9/CAR.CS1/IL-15) to
redirect their specificity to recognize the tumor antigen CS1 and
target myeloma. The transduction efficiency of the CB-NK cells
transduced with the retroviral vector was monitored and transgene
expression was found to be stable. The transduction efficiency of
CAR expression in NK cells from 2 different donors is shown in FIG.
1A. The transduced NK cells were observed to exert superior killing
of CS1-expressing myeloma cell lines (FIG. 1A) and to produce more
effector cytokines in response to CS1-expressing myeloma cells
lines (FIG. 1C).
[0291] To determine the anti-leukemic effect of the CAR-transduced
NK cells, they were infused into a "humanized" mouse model of
lymphoblastic leukemia, the luciferase-expressing Raji NSG mouse
model. To monitor the trafficking of CAR-CD191+ CB-NK cells to
tumor sites in vivo, the cells were labeled with the FFLuc vector,
enabling monitoring by bioluminescence imaging. Engrafted mice
received CS1.sup.+ Raji leukemic B cells (2.times.10.sup.6)
injected intravenously and labeled with the RLuc vector to monitor
tumor growth. Six to 10 days after tumor engraftment, mice were
infused intravenously with 2.times.10.sup.7 expanded CB-NK cells
that were unmodified or CD19-CD28-zeta-2A-IL15 CB-NK cells labeled
with FFLuc. All imaging was performed once a week for 3 weeks. Four
groups of animals (n=10 per group) were studied, and the spleens,
blood and lymph nodes of the mice were collected after they were
euthanized. The CAR-transduced cells resulted in strong anti-tumor
response, as evidenced by in vivo bioluminescence imaging. The
IL-15 was observed to increase the NK-CAR mediated killing of
tumors and prolong survival (FIGS. 2A-2B).
[0292] Because of concerns over autonomous, uncontrolled NK-cell
growth due to autocrine production of IL-15, a suicide gene based
on the inducible caspase-9 (IC9) gene was incorporated into the
construct. To test the inducible caspase-9 suicide gene that was
incorporated into the retroviral vector, 10 nM of CID AP20187 was
added to cultures of iC9/CS1/IL15+ NK cells. The AP20187 induced
apoptosis/necrosis of transgenic cells within 4 hours as assessed
by annexin-V-7AAD staining.
Example 2--Knockout of Glucocorticoid Receptor
[0293] To produce steroid-resistant immune cells, the CRISPR-CAS9
system was used to knockout glucocorticoid receptor in
hematopoietic cells using gRNA SEQ ID NOs:1-2. PCR based screening
of the glucocorticoid receptor knockout showed efficient knockdown
in T cells and NK cells (FIG. 3).
[0294] CAR-transduced NK cells were obtained from 3 different
donors and assessed for their sensitivity to dexamethasone killing.
After 4 and 24 hours of treatment at different doses of
dexamethasone, Annexin V staining was performed to assess cell
death. NK cells from all 3 donors were found to be sensitive to
dexamethasone and at 24 hours of 500 .mu.M dexamethasone treatment
all cells were dead (FIGS. 4A-4B). GR knockout in CAR NK cells was
found to protect against dexamethasone killing. Annexin V staining
of CAR NK controls cells or cells with GR knockout treated with 200
.mu.M dexamethasone for 12 hours is shown in FIG. 5. NK cells with
GR knockout were found to be significantly resistant to
dexamethasone killing as compared to the control NK cells (FIG. 5).
Thus, GR knockout using the CRISPR-CAS9 system was able to generate
steroid-resistant NK cells.
Example 3--Knockout of TGF.beta.-RII in Immune Cells
[0295] Next, CRISPR-CAS9 was used to knockout TGF.beta. in CAR NK
cells to render CAR NK cells resistant to the immunosuppressive
effect of exogenous TGF.beta.. (FIG. 6A) Successful knockout of
TGF.beta.-RII was achieved using CRISPR/CAS9 technology (Cas9 plus
gRNA targeting of Exon 3 of TGF.beta.-RII using gRNA SEQ ID
NOs:3-4) (FIG. 6A). Wild type and TGF-.beta.-RII knockout NK cells
were treated with 10 ng/ml of recombinant TGF-.beta. for 48 hrs and
their response to K562 targets was assessed. TGF-.beta.-RII
knockout NK cells were found to be resistant to the
immunosuppressive effect of exogenous TGF-.beta. (FIG. 6B).
TGF.beta.-RII knockout by CRISPR/CAS9 technology was also found to
abrogate downstream Smad-2/3 phosphorylation in response to 10n
g/ml of recombinant TGF-.beta. compared to NK cells treated with
CAS9 alone (FIG. 6C). Thus, CRISPR-CAS9-mediated knockout of
TGF.beta.-RII renders NK cells resistant to TGF.beta..
Example 4--Immune Cells Engineered to Express Multiple Antigen
Receptors
[0296] Immune cells, such as T cells or NK cells, are derived from
blood, such as cord blood, and genetically engineered to express
tumor-specific antigen receptors, such as CARs and/or TCRs (FIGS.
7A-7D). For genetic modification, the cells are transduced with a
retroviral construct (FIG. 7D) to redirect their specificity to
recognize two or more tumor antigens. The transduction efficiency
and transgene expression are monitored. In addition, the efficacy
of the immune cells at killing of antigen-specific target cells is
measured by cytotoxicity assays.
[0297] To determine the anti-cancer effect of the
receptor-transduced immune cells, there are infused into a mouse
model of cancer. The cells are labeled with a detectable moiety for
monitoring in vivo, such as by bioluminescence imaging. Engrafted
mice receive antigen-specific target cells (e.g., 2.times.10.sup.6)
injected intravenously and labeled with a vector, such as an RLuc
vector, to monitor tumor growth. After tumor engraftment, mice are
infused intravenously with expanded transduced immune cells that
are unmodified or express the antigen receptors. The animal are
monitored, such as by imaging once a week for 3 weeks. The spleens,
blood and lymph nodes of the mice are collected after they are
euthanized.
[0298] All of the methods disclosed and claimed herein can be made
and executed without undue experimentation in light of the present
disclosure. While the compositions and methods of this invention
have been described in terms of preferred embodiments, it will be
apparent to those of skill in the art that variations may be
applied to the methods and in the steps or in the sequence of steps
of the method described herein without departing from the concept,
spirit and scope of the invention. More specifically, it will be
apparent that certain agents which are both chemically and
physiologically related may be substituted for the agents described
herein while the same or similar results would be achieved. All
such similar substitutes and modifications apparent to those
skilled in the art are deemed to be within the spirit, scope and
concept of the invention as defined by the appended claims.
REFERENCES
[0299] The following references, to the extent that they provide
exemplary procedural or other details supplementary to those set
forth herein, are specifically incorporated herein by reference.
[0300] Austin-Ward and Villaseca, Revista Medica de Chile,
126(7):838-845, 1998. [0301] Ausubel et al., Current Protocols in
Molecular Biology, Greene Publishing Associates and John Wiley
& Sons, N Y, 1994. [0302] Bennekov et al., Mt. Sinai J Med. 71
(2): 86-93, 2004. [0303] Bukowski et al., Clinical Cancer Res.,
4(10):2337-2347, 1998. [0304] Camacho et al. J Clin Oncology
22(145): Abstract No. 2505 (antibody CP-675206), 2004. [0305]
Campbell, Curr. Top. Microbiol. Immunol., 298: 23-57, 2006. [0306]
Chothia et al., EMBO J. 7:3745, 1988. [0307] Christodoulides et
al., Microbiology, 144(Pt 11):3027-3037, 1998. [0308] Cohen et al.
J Immunol. 175:5799-5808, 2005. [0309] Davidson et al., J.
Immunother 21(5):389-398, 1998. [0310] Davila et al. PLoS ONE 8(4):
e61338, 2013. [0311] Doulatov et al., Cell Stem Cell. 10:120-36,
2012. [0312] European patent application number EP2537416 [0313]
Fedorov et al., Sci. Transl. Medicine, 5(215), 2013. [0314] Frolet
et al., BMC Microbiol. 10:190 (2010). [0315] Gaj et al., Trends in
Biotechnology 31(7), 397-405, 2013. [0316] Hanibuchi et al., Int.
J. Cancer, 78(4):480-485, 1998. [0317] Heemskerk et al. Hum Gene
Ther. 19:496-510, 2008. [0318] Hellstrand et al., Acta Oncologica,
37(4):347-353, 1998. [0319] Hollander, Front. Immun., 3:3, 2012.
[0320] Hubert et al., Proc. Natl. Acad. Sci. USA 96 14523-28, 1999.
[0321] Hui and Hashimoto, Infection Immun., 66(11):5329-5336, 1998.
[0322] Hurwitz et al. Proc Natl Acad Sci USA 95(17): 10067-10071,
1998. [0323] International Patent Publication No. WO 00/37504
[0324] International Patent Publication No. WO 01/14424 [0325]
International Patent Publication No. WO 2007/069666 [0326]
International Patent Publication No. WO 2007/069666 [0327]
International Patent Publication No. WO 98/42752 [0328]
International Patent Publication No. WO/2014055668 [0329]
International Patent Publication No. WO1995001994 [0330]
International Patent Publication No. WO1998042752 [0331]
International Patent Publication No. WO2000037504 [0332]
International Patent Publication No. WO200014257 [0333]
International Patent Publication No. WO2001014424 [0334]
International Patent Publication No. WO2006/121168 [0335]
International Patent Publication No. WO2007/103009 [0336]
International Patent Publication No. WO2009/101611 [0337]
International Patent Publication No. WO2009/114335 [0338]
International Patent Publication No. WO2010/027827 [0339]
International Patent Publication No. WO2011/066342 [0340]
International Patent Publication No. WO2012/129514 [0341]
International Patent Publication No. WO2013/071154 [0342]
International Patent Publication No. WO2013/123061 [0343]
International Patent Publication No. WO2013/166321 [0344]
International Patent Publication No. WO2013126726 [0345]
International Patent Publication No. WO2014/055668 [0346]
International Patent Publication No. WO2014031687 [0347]
International Patent Publication No. WO2015016718 [0348]
International Patent Publication No. WO99/40188 [0349] Janeway et
al, Immunobiology: The Immune System in Health and Disease,
3.sup.rd Ed., Current Biology Publications, p. 433, 1997. [0350]
Johnson et al. Blood 114:535-46, 2009. [0351] Jores et al., PNAS
U.S.A. 87:9138, 1990. [0352] Kim et al., Nature Biotechnology 31,
251-258, 2013. [0353] Kirchmaier and Sugden, J. Virol.,
72(6):4657-4666, 1998. [0354] Leal, M., Ann N Y Acad Sci 1321,
41-54, 2014. [0355] Lefranc et al., Dev. Comp. Immunol. 27:55,
2003. [0356] Li et al. Nat Biotechnol. 23:349-354, 2005. [0357] Li
et al. Proc. Natl. Acad. Sci. USA 89:4275-4279, 1992. [0358]
Linnemann, C. et al. Nat Med 21, 81-85, 2015. [0359] Lockey et al.,
Front. Biosci. 13:5916-27, 2008. [0360] Loewendorf et al., J.
Intern. Med. 267(5):483-501, 2010. [0361] Ludwig et al. Nature
Biotech., (2):185-187, 2006a. [0362] Ludwig et al. Nature Methods,
3(8):637-646, 2006b. [0363] Marschall et al., Future Microbiol.
4:731-42, 2009. [0364] Mokyr et al. Cancer Res 58:5301-5304, 1998.
[0365] Notta et al., Science, 218-221, 2011. [0366] Pardoll, Nat
Rev Cancer, 12(4): 252-64, 2012 [0367] Parkhurst et al. Clin Cancer
Res. 15: 169-180, 2009. [0368] Qin et al., Proc. Natl. Acad. Sci.
USA, 95(24):14411-14416, 1998. [0369] Rieder et al., J. Interferon
Cytokine Res. (9):499-509, 2009. [0370] Rykman, et al., J. Virol.
80(2):710-22, 2006. [0371] Sadelain et al., Cancer Discov. 3(4):
388-398, 2013. [0372] Sambrook et al., Molecular Cloning: A
Laboratory Manual, 3.sup.rd ed., Cold Spring Harbor Press, Cold
Spring Harbor, N.Y. 2001. [0373] Shah et al., PLoS One, 8:e776781,
2013. [0374] Singh et al., Cancer Research, 68:2961-2971, 2008.
[0375] Singh et al., Cancer Research, 71:3516-3527, 2011. [0376]
Takahashi et al., Cell, 126(4):663-76, 2007. [0377] Terakura et al.
Blood. 1:72-82, 2012. [0378] Turtle et al., Curr. Opin. Immunol.,
24(5): 633-39, 2012. [0379] U.S. Pat. No. 4,870,287 [0380] U.S.
Pat. No. 5,739,169 [0381] U.S. Pat. No. 5,760,395 [0382] U.S. Pat.
No. 5,801,005 [0383] U.S. Pat. No. 5,824,311 [0384] U.S. Pat. No.
5,830,880 [0385] U.S. Pat. No. 5,844,905 [0386] U.S. Pat. No.
5,846,945 [0387] U.S. Pat. No. 5,885,796 [0388] U.S. Pat. No.
5,994,136 [0389] U.S. Pat. No. 6,013,516 [0390] U.S. Pat. No.
6,103,470 [0391] U.S. Pat. No. 6,207,156 [0392] U.S. Pat. No.
6,225,042 [0393] U.S. Pat. No. 6,355,479 [0394] U.S. Pat. No.
6,362,001 [0395] U.S. Pat. No. 6,410,319 [0396] U.S. Pat. No.
6,416,998 [0397] U.S. Pat. No. 6,544,518 [0398] U.S. Pat. No.
6,790,662 [0399] U.S. Pat. No. 7,109,304 [0400] U.S. Pat. No.
7,442,548 [0401] U.S. Pat. No. 7,446,190 [0402] U.S. Pat. No.
7,598,364 [0403] U.S. Pat. No. 7,989,425 [0404] U.S. Pat. No.
8,008,449 [0405] U.S. Pat. No. 8,017,114 [0406] U.S. Pat. No.
8,058,065 [0407] U.S. Pat. No. 8,071,369 [0408] U.S. Pat. No.
8,119,129 [0409] U.S. Pat. No. 8,129,187 [0410] U.S. Pat. No.
8,183,038 [0411] U.S. Pat. No. 8,268,620 [0412] U.S. Pat. No.
8,329,867 [0413] U.S. Pat. No. 8,354,509 [0414] U.S. Pat. No.
8,546,140 [0415] U.S. Pat. No. 8,691,574 [0416] U.S. Pat. No.
8,735,553 [0417] U.S. Pat. No. 8,741,648 [0418] U.S. Pat. No.
8,900,871 [0419] U.S. Pat. No. 9,175,268 [0420] U.S. Patent
Publication No. 2010/0210014 [0421] U.S. patent Ser. No. 12/478,154
[0422] U.S. Patent Publication No. 2002131960 [0423] U.S. Patent
Publication No. 2003/0211603 [0424] U.S. Patent Publication No.
2005/0260186 [0425] U.S. Patent Publication No. 2006/0104968 [0426]
U.S. Patent Publication No. 2009/0004142 [0427] U.S. Patent
Publication No. 2009/0017000 [0428] U.S. Patent Publication No.
2009/0246875 [0429] U.S. Patent Publication No. 2011/0104125 [0430]
U.S. Patent Publication No. 2011/0301073 [0431] U.S. Patent
Publication No. 20110008369 [0432] U.S. Patent Publication No.
2012/0276636 [0433] U.S. Patent Publication No. 2013/0315884 [0434]
U.S. Patent Publication No. 20130149337 [0435] U.S. Patent
Publication No. 2013287748 [0436] U.S. Patent Publication No.
2014/0120622 [0437] U.S. Patent Publication No. 2014022021 [0438]
U.S. Patent Publication No. 20140294898 [0439] Varela-Rohena et al.
Nat Med. 14: 1390-1395, 2008. [0440] Wang et al. J Immunother
35(9):689-701, 2012. [0441] Wu et al., Adv. Cancer Res., 90:
127-56, 2003. [0442] Wu et al., Cancer, 18(2): 160-75, 2012. [0443]
Yamanaka et al., Cell, 131(5):861-72, 2007. [0444] Yu et al.,
Science, 318:1917-1920, 2007. [0445] Zysk et al., Infect. Immun.
68(6):3740-43, 2000.
Sequence CWU 1
1
6118DNAArtificial SequenceEx3 NR3C1 sG1 1tgctgttgag gagctgga
18218DNAArtificial SequenceEx3 NR3C1 sG2 2agcacaccag gcagagtt
18318DNAArtificial SequenceEX3 TGFBR2 sG1 3cggctgagga gcggaaga
18418DNAArtificial SequenceEX3 TGFBR2 sG2 4tggaggtgag caatcccc
18520DNAArtificial SequenceOverlap sequence 5ttaatacgac tcactatagg
20620DNAArtificial SequenceOverlap sequence 6gttttagagc tagaaatagc
20
* * * * *