U.S. patent application number 17/671789 was filed with the patent office on 2022-08-18 for compositions and methods for the selective detection of tumor-derived viral dna.
The applicant listed for this patent is The University of North Carolina at Chapel Hill. Invention is credited to Bhishamjit S. Chera, Gaorav Gupta, Sunil Kumar.
Application Number | 20220259681 17/671789 |
Document ID | / |
Family ID | |
Filed Date | 2022-08-18 |
United States Patent
Application |
20220259681 |
Kind Code |
A1 |
Gupta; Gaorav ; et
al. |
August 18, 2022 |
COMPOSITIONS AND METHODS FOR THE SELECTIVE DETECTION OF
TUMOR-DERIVED VIRAL DNA
Abstract
The present disclosure provides methods and compositions of
modified oligonucleotide primer and probe combinations,
structurally modified with locked nucleic acids, quenchers, and
dyes, effective to detect tumor-derived Human Papilloma Virus (HPV)
and tumor-derived Epstein-Barr virus (EBV) and, especially, to
distinguish viral DNA derived from tumors from viral DNA derived
from infectious viral particles.
Inventors: |
Gupta; Gaorav; (Chapel Hill,
NC) ; Chera; Bhishamjit S.; (Chapel Hill, NC)
; Kumar; Sunil; (Chapel Hill, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of North Carolina at Chapel Hill |
Chapel Hill |
NC |
US |
|
|
Appl. No.: |
17/671789 |
Filed: |
February 15, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
17203068 |
Mar 16, 2021 |
11254989 |
|
|
17671789 |
|
|
|
|
62990438 |
Mar 16, 2020 |
|
|
|
International
Class: |
C12Q 1/6888 20060101
C12Q001/6888; C12Q 1/70 20060101 C12Q001/70; C12Q 1/686 20060101
C12Q001/686; C12Q 1/6853 20060101 C12Q001/6853 |
Claims
1-20. (canceled)
21. A composition for detecting tumor-derived Human Papilloma Virus
type 18 (HPV18) in a sample from a subject, comprising at least a
triad of modified oligonucleotide primer/probe sets selected from
the group consisting of: Set 1: SEQ ID NO:80, SEQ ID NO:81, and SEQ
ID NO:82, Set 2: SEQ ID NO:83, SEQ ID NO:84, and SEQ ID NO:85, Set
3: SEQ ID NO:86, SEQ ID NO:87, and SEQ ID NO:88, Set 4: SEQ ID
NO:89, SEQ ID NO:90, and SEQ ID NO:91, Set 5: SEQ ID NO:92, SEQ ID
NO:93, and SEQ ID NO:94, Set 6: SEQ ID NO:95, SEQ ID NO:96, and SEQ
ID NO:97, Set 7: SEQ ID NO:98, SEQ ID NO:99, and SEQ ID NO:100, Set
8: SEQ ID NO:101, SEQ ID NO:102, and SEQ ID NO:103, Set 9: SEQ ID
NO:104, SEQ ID NO:105, and SEQ ID NO:106, Set 10: SEQ ID NO:107,
SEQ ID NO:108, and SEQ ID NO:109, Set 11: SEQ ID NO:110, SEQ ID
NO:111, and SEQ ID NO:112, Set 12: SEQ ID NO:113, SEQ ID NO:114,
and SEQ ID NO:115, Set 13: SEQ ID NO:116, SEQ ID NO:117, and SEQ ID
NO:118, Set 14: SEQ ID NO:119, SEQ ID NO:120, and SEQ ID NO:121,
Set 15: SEQ ID NO:122, SEQ ID NO:123, and SEQ ID NO:124, Set 16:
SEQ ID NO:125, SEQ ID NO:126, and SEQ ID NO:127, Set 17: SEQ ID
NO:128, SEQ ID NO:129, and SEQ ID NO:130, and Set 18: SEQ ID
NO:131, SEQ ID NO:132, and SEQ ID NO:133, wherein a first
primer/probe set of the triad is configured to produce a first
amplicon signal, wherein a second primer/probe set of the triad is
configured to produce a second amplicon signal, wherein a third
primer/probe set of the triad is configured to produce a third
amplicon signal, and wherein the primer/probe set of the triad with
the smallest set number corresponds to the first primer/probe set
and the primer/probe set of the triad with the largest set number
corresponds to the third primer/probe set.
22. The composition of claim 21, wherein the triad contains three
primer/probe sets of which no two primer/probe sets are
consecutive.
23. The composition of claim 21, wherein the triad contains three
non-consecutive primer/probe sets.
24. The composition of claim 21, comprising primer/probe sets 4, 7,
and 10.
25. The composition of claim 24, wherein detection probe 7 is
conjugated to reporter moiety FAM and detection probes 4 and 10 are
conjugated to reporter moiety HEX.
26. The composition of claim 24, wherein detection probe 7 is
conjugated to reporter moiety FAM, detection probe 4 is conjugated
to reporter moiety HEX, and detection probe 10 is conjugated to
reporter moiety Cy5.TM. or reporter moiety Cy5.5.
27. The composition of claim 21, comprising primer/probe sets 1, 3,
and 5, or primer/probe sets 1, 3, and 8.
28. The composition of claim 21, comprising primer/probe sets 4, 6,
and 9.
29. The composition of claim 21, comprising primer/probe sets 14,
16, and 18.
30. The composition of claim 21, comprising primer/probe sets 1, 2,
and 5.
31. The composition of claim 21, comprising primer/probe sets 10,
12, and 13.
32. The composition of claim 21, further comprising a reporter
moiety.
33. The composition of claim 32, wherein the reporter moiety
comprises a reporter dye.
34. The composition of claim 33, wherein the reporter dye comprises
FAM, HEX, VIC, Cy5.TM., or Cy5.5.
35. A method for detecting tumor-derived Human Papilloma Virus type
16 (HPV18) in a sample from a subject, the method comprising:
providing at least a triad of modified oligonucleotide primer/probe
sets of the composition of claim 21; fractionating a plurality of
HPV DNA fragments from the sample into droplets at a concentration
wherein only 0 or 1 molecule of the DNA fragments is present in
each droplet; amplifying HPV DNA in each droplet with the triad of
primer/probe sets to produce amplicon signals; and detecting in
each droplet any amplicon signals; wherein detection within a
droplet of the second amplicon, but not the first or third
amplicon, indicates that the HPV DNA fragment fractionated into the
droplet is a tumor-derived HPV DNA fragment.
36. The method of claim 35, wherein the DNA fragments are
fractionated into micro-droplets by emulsification.
37. The method of claim 35, wherein the DNA is amplified using a
PCR based method.
38. The method of claim 35, wherein the sample is a blood, saliva,
gargle, or urine sample.
39. The method of claim 38, wherein the sample is a blood sample.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is a Continuation of U.S. patent
application Ser. No. 17/203,068 filed Feb. 22, 2022, which claims
the benefit from U.S. Provisional Application Ser. No. 62/990,438,
filed on Mar. 16, 2020, all of which are incorporated herein by
their reference in its entirety.
SEQUENCE LISTING
[0002] This application contains a sequence listing filed in
electronic form as an ASCII.txt file entitled "921404-1050 Sequence
Listing_ST25" created on Apr. 16, 2021 and having 135,168 bytes.
The content of the sequence listing is incorporated herein in its
entirety.
FIELD
[0003] This disclosure relates to detecting viral nucleic acids in
bodily fluids for the purpose of cancer or pre-cancer
detection.
BACKGROUND
[0004] Viruses are known to promote the development of cancers. For
example, infection with high-risk strains of Human Papillomavirus
(HPV) is associated with cancers of the cervix, head/neck, anus,
vulva, or penis. Other examples of viruses associated with cancer
development include Hepatitis B Virus (HBV), Hepatitis C Virus
(HCV), Human T-Lymphotropic Virus 1 (HTLV1), Epstein-Barr Virus
(EBV), Cytomegalovirus (CMV), Human Endogenous Retrovirus type K
(HERV-K), Merkel Cell Virus, Human Immunodeficiency Virus (HIV),
and Kaposi's Sarcoma Herpes Virus (KSHV). Since circulating tumor
DNA (ctDNA) is released by dying cancer cells, these viral nucleic
acids may be detectable in the blood of patients with the
corresponding cancer type.
[0005] While there is significant interest in detecting viral
nucleic acids in bodily fluids for the purpose of cancer detection,
there are two major challenges associated with this concept. First,
the amount of circulating tumor-derived DNA (ctDNA) in blood, urine
or saliva is extremely low--often on the order of a few molecules
per mL of blood. Second, viral nucleic acids present in the
circulation are commonly not derived from tumor-associated viruses,
but from virions shed from non-tumor tissues. This is established
by the finding that DNA sequences from many different types of
viruses have been identified in the blood of healthy volunteers
(Moustafa et al., PLoS Pathog. 2017 13(3):e1006292). Given this
finding, the detection of viral sequences in the circulation is, on
its own, insufficient to conclude that a patient has a cancer
associated with that virus, since the detected viral sequence may
well be derived from normal, non-tumor tissues within the
patient.
[0006] For example, any viral sequence detected in a blood sample
could be associated merely with the viral infection itself and have
no relationship to tumor burden in the host. This major confounding
factor poses a significant challenge to using circulating viral DNA
as a specific marker for cancer detection. Individuals with
detectable viral DNA in the circulation could merely be infected
with the virus and not have a cancer or pre-cancer.
[0007] Consistent with this, PCR-based methods have been reported
for detecting HPV DNA in the circulation of patients with
HPV-associated preneoplasia or cancers, but these methods also
detect HPV DNA in the blood of a substantial proportion of patients
who do not have a diagnosis of HPV+ cancer (Bodaghi et al., J Clin
Microbiol. 2005 43(11):5428-5434; Cocuzza et al., PLoS One. 2017
12(11):e0188592; Ferreira et al., Pathol Res Pract. 2017
213(7):759-765; Chen et al., J Med Virol. 2009 81(10):1792-1796).
Thus, since the presence of HPV virus in the circulation of a
person could be due to infection of normal tissues, its detection
does not necessarily indicate that a person has an HPV-associated
cancer. Because currently available PCR detection methods are
unable to distinguish between tumor-derived HPV DNA and HPV DNA
deriving from normal tissue infected with the virus, they lack
sufficient specificity to allow early detection of HPV-associated
cancers.
[0008] For example, PCR-based methods for HPV detection have
demonstrated a sensitivity of only about 54% to detect patients
with HPV-associated cancers, which is insufficient to be clinically
useful to distinguish patients who need further evaluation from
those who do not need further evaluation (Jensen et al., Clin
Otolaryngol. 2018 May 15; Higginson et al., Int J Radiat Oncol Biol
Phys. 2015 93(3):S78-S-79; Cao et al., Int J Radiat Oncol Biol
Phys. 2012 82(3):e351-358; Dahlstrom et al., Cancer. 2015
121(19):3455-3464).
SUMMARY
[0009] The present disclosure provides methods and compositions of
DNA oligonucleotide primer and probe combinations, structurally
modified with locked nucleic acids, quenchers, and dyes, effective
to detect tumor-derived viral, e.g., HPV and EBV, DNA and,
especially, to distinguish viral DNA derived from tumors from viral
DNA derived from infectious viral particles.
[0010] The DNA amplification methods and structurally modified
primer/probe compositions disclosed herein quantitatively detect
tumor-derived viral DNA in a sample. The disclosed methods and
compositions distinguish between viral DNA derived from tumors and
viral DNA derived from non-tumor sources, e.g., from infectious
viral particles. In particular, disclosed herein are methods and
compositions of detecting or monitoring a human papilloma virus
(HPV)-associated malignancy or Epstein-Barr virus (EBV)-associated
malignancy in a subject, wherein the methods involve detecting a
presence or absence of at least one circulating tumor-derived HPV
or EBV DNA of a particular size range in a sample from the subject.
Compositions and kits for conducting these methods are also
provided.
[0011] In one aspect, the disclosure provides compositions for
detecting tumor-derived Human Papilloma Virus type 16 (HPV16),
HPV18, HPV31, HPV33, HPV35, or HPV45 in a sample from a subject,
wherein a composition includes at least (or consists of) a triad,
e.g., three, or can include four, five, six, seven, eight, nine,
ten, or more, of modified oligonucleotide primer/probe sets
selected from: primer/probe sets numbered 1 to 18 as shown in Table
14 for HPV16, primer/probe sets numbered 1 to 18 as shown in Table
15 for HPV18, primer/probe sets numbered 1 to 17 as shown in Table
16 for HPV31, primer/probe sets numbered 1 to 15 as shown in Table
17 for HPV33, primer/probe sets numbered 1 to 16 as shown in Table
18, for HPV35 or primer/probe sets numbered 1 to 17 as shown in
Table 19, for HPV45; wherein a first primer/probe set of the triad
is configured to produce a first amplicon signal, wherein a second
primer/probe set of the triad is configured to produce a second
amplicon signal, wherein a third primer/probe set of the triad is
configured to produce a third amplicon signal, and wherein the
primer/probe set of the triad with the smallest set number
corresponds to the first primer/probe set and the primer/probe set
of the triad with the largest set number corresponds to the third
primer/probe set.
[0012] For example, if one selects three primer/probe sets numbered
3, 5, and 7 from a table, e.g., Table 14, then set 3 is the "first
primer/probe set," set 5 is the "second primer/probe set," and 7 is
the "third primer/probe set." The smallest set number always
corresponds to the first set and the largest set number always
corresponds to the third set, and so the middle number always
corresponds to the second set.
[0013] In these compositions, the triad of modified oligonucleotide
primer/probe sets can be selected from primer/probe sets numbered 1
to 18 as shown in Table 14 for HPV16, or primer/probe sets numbered
1 to 18 as shown in Table 15 for HPV18, or primer/probe sets
numbered 1 to 17 as shown in Table 16 for HPV31, or primer/probe
sets numbered 1 to 15 as shown in Table 17 for HPV33, or
primer/probe sets numbered 1 to 16 as shown in Table 18 for HPV35,
or primer/probe sets numbered 1 to 17 as shown in Table 19 for
HPV45.
[0014] In some embodiments, the disclosure provides compositions
for detecting tumor-derived Human Papilloma Virus type 16 (HPV16)
in a sample from a subject, including a triad of modified
oligonucleotide primer/probe sets selected from primer/probe sets
numbered 1 to 18 as shown in Table 14 for HPV16, wherein a first
primer/probe set of the triad is configured to produce a first
amplicon signal, wherein a second primer/probe set of the triad is
configured to produce a second amplicon signal, wherein a third
primer/probe set of the triad is configured to produce a third
amplicon signal, and wherein the primer/probe set of the triad with
the smallest set number corresponds to the first primer/probe set
and the primer/probe set of the triad with the largest set number
corresponds to the third primer/probe set.
[0015] In another aspect, the disclosure provides compositions for
detecting tumor-derived Epstein-Barr virus (EBV) in a sample from a
subject, including a triad of modified oligonucleotide primer/probe
sets selected from primer/probe sets numbered 1 to 28 as shown in
Table 20 for EBV, wherein a first primer/probe set of the triad is
configured to produce a first amplicon signal, wherein a second
primer/probe set of the triad is configured to produce a second
amplicon signal, wherein a third primer/probe set of the triad is
configured to produce a third amplicon signal, and wherein the
primer/probe set of the triad with the smallest set number
corresponds to the first primer/probe set and the primer/probe set
of the triad with the largest set number corresponds to the third
primer/probe set.
[0016] In these compositions, the triad can contain three (or four
or more) primer/probe sets of which no two primer/probe sets are
consecutive, or the triad can contain three (or four or more)
non-consecutive primer/probe sets.
[0017] In certain embodiments, the primer/probe sets are numbered
3, 5, and 7 or 4, 7, and 10, as shown in Table 14 for HPV16, or 4,
7, and 10 as shown in Table 15 for HPV18, or 4, 7, and 10 as shown
in Table 16 for HPV31, or 4, 7, and 10 as shown in Table 17 for
HPV33, or 4, 7, and 10 as shown in Table 18, for HPV35, or 4, 7,
and 10 as shown in Table 19, for HPV45. In some embodiments, the
primer/probe sets are numbered 4, 5, and 6 as shown in Table 20 for
EPV.
[0018] In various embodiments, the compositions described herein
can further include one or more reporter moieties, such as reporter
dyes, e.g., FAM, HEX, VIC, Cy5.TM., or Cy5.5. For example, the
detection probe 5 of Table 14 can be conjugated to reporter moiety
HEX and detection probes 3 and 7 of Table 14 can be conjugated to
reporter moiety FAM. In another example, detection probe 7 of Table
14 can be conjugated to reporter moiety FAM and detection probes 4
and 10 of Table 14 can be conjugated to reporter moiety HEX.
[0019] In certain embodiments, the composition includes
primer/probe sets numbered 1, 3, and 5, or sets numbered 1, 3, and
8, or probe sets numbered 4, 6, and 9, or sets numbered 14, 16, and
18, or sets numbered 1, 2, and 5, or sets numbered 10, 12, and 13,
as shown in Table 14 for HPV16.
[0020] In another aspect, the disclosure provides methods for
detecting tumor-derived Human Papilloma Virus type 16 (HPV16),
HPV18, HPV31, HPV33, HPV35, or HPV45 in a sample from a subject,
the methods including providing triads of any of the modified
oligonucleotide primer/probe sets of any of the compositions
described herein as recited in Tables 14, 15, 16, 17, 18, and 19;
fractionating a plurality of HPV DNA fragments from the sample into
droplets at a concentration wherein only 0 or 1 molecule of the DNA
fragments is present in each droplet; amplifying HPV DNA in each
droplet with the triad of primer/probe sets to produce amplicon
signals; and detecting in each droplet any amplicon signals;
wherein detection within a droplet of the second amplicon, but not
the first or third amplicon, indicates that the HPV DNA fragment
fractionated into the droplet is a tumor-derived HPV DNA
fragment.
[0021] In these methods, the triad can contain three primer/probe
sets from Table 14 and the method detects tumor-derived HPV16, or
the triad can contain three primer/probe sets from Table 15 and the
method detects tumor-derived HPV18, or the triad can contain three
primer/probe sets from Table 16 and the method detects
tumor-derived HPV31, or the triad can contain three primer/probe
sets from Table 17 and the method detects tumor-derived HPV33, or
the triad can contain three primer/probe sets from Table 18 and the
method detects tumor-derived HPV35, or the triad can contain three
primer/probe sets from Table 19 and the method detects
tumor-derived HPV45.
[0022] In another aspect, the disclosure provides methods for
detecting tumor-derived Human Papilloma Virus type 16 (HPV16) in a
sample from a subject, the method including providing a triad of
modified oligonucleotide primer/probe sets of any of the
composition described herein as recited in Table 14; fractionating
a plurality of HPV DNA fragments from the sample into droplets at a
concentration wherein only 0 or 1 molecule of the DNA fragments is
present in each droplet; amplifying HPV DNA in each droplet with
the triad of primer/probe sets to produce amplicon signals; and
detecting in each droplet any amplicon signals; wherein detection
within a droplet of the second amplicon, but not the first or third
amplicon, indicates that the HPV DNA fragment fractionated into the
droplet is a tumor-derived HPV DNA fragment.
[0023] In another aspect, the disclosure provides methods for
detecting tumor-derived Epstein-Barr virus (EBV) in a sample from a
subject, the methods including providing triads of any of the
modified oligonucleotide primer/probe sets of any of the
compositions described herein as recited in Table 20; fractionating
a plurality of EBV DNA fragments from the sample into droplets at a
concentration wherein only 0 or 1 molecule of the DNA fragments is
present in each droplet; amplifying EBV DNA in each droplet with
the triad of primer/probe sets to produce amplicon signals; and
detecting in each droplet any amplicon signals; wherein detection
within a droplet of the second amplicon, but not the first or third
amplicon, indicates that the EBV DNA fragment fractionated into the
droplet is a tumor-derived EBV DNA fragment.
[0024] In all of the methods described herein, the DNA fragments
can be fractionated into micro-droplets by emulsification, and/or
the DNA can be amplified using a PCR based method.
[0025] In all of the methods described herein, the sample can be a
blood, saliva, gargle, or urine sample, e.g., a blood sample.
[0026] In other aspects, the disclosure provides methods for
detecting tumor-derived HPV16, HPV18, HPV31, HPV33, HPV35, or
HPV45, in a sample from a subject utilizing a composition of
oligonucleotides of primers and probes including any triad of
primer/probe sets from Table 14, 15, 16, 17, 18, or 19,
respectively, wherein a first primer/probe set, consisting of two
primers and one probe, is configured to produce a first amplicon
signal, wherein a second primer/probe set, consisting of two
primers and one probe, is configured to produce a second amplicon
signal, wherein a third primer/probe set, consisting of two primers
and one probe, is configured to produce a third amplicon signal;
fractionating DNA fragments from a sample from the subject into
droplets at a concentration wherein only 0 or 1 DNA fragments are
present in each droplet; amplifying the DNA in each droplet with
the series of primer/probe sets to produce the amplicon signals;
and detecting in each droplet the number of amplicon signals,
wherein detection of the second amplicon but not the first or third
amplicon is an indication that the subject has tumor-derived HPV16,
HPV18, HPV31, HPV33, HPV35, or HPV45.
[0027] Also disclosed are methods for detecting tumor-derived EBV
in a sample from a subject utilizing a composition consisting of
non-consecutive triad of primer/probe sets from Table 20, wherein a
first primer/probe set, consisting of two primers and one probe, is
configured to produce a first amplicon signal, wherein a second
primer/probe set, consisting of two primers and one probe, is
configured to produce a second amplicon signal, wherein a third
primer/probe set, consisting of two primers and one probe, is
configured to produce a third amplicon signal; fractionating DNA
fragments from a sample from the subject into droplets at a
concentration wherein only 0 or 1 DNA fragments are present in each
droplet; amplifying the DNA in each droplet with the series of
primer/probe sets to produce the amplicon signals; and detecting in
each droplet the number of amplicon signals, wherein detection of
the second amplicon but not the first or third amplicon is an
indication that the subject has tumor-derived EBV.
[0028] Methods for DNA fragmentation into droplets for digital PCR
are known, and include fractionation into micro-droplets by
emulsification. In some embodiments, the DNA is fractionated based
on size prior to performing emulsification into micro-droplets.
This can be done, for example, to isolate a range of DNA fragments
for quantification by size.
[0029] The DNA fragments can be amplified using any known method,
such as a PCR method or a non-PCR method.
[0030] In some embodiments, the subject has never been diagnosed
with or suffered from an HPV-associated or EBV-associated
malignancy. In other embodiments, the subject has previously
undergone treatment for an HPV-associated or EBV-associated
malignancy.
[0031] The disclosed methods can also be used to monitor treatment.
Therefore, also disclosed herein is a method of monitoring
HPV-associated or EBV-associated cancer or malignancy in a subject,
that involves quantifying tumor-derived cell-free HPV or EBV viral
DNA in blood samples collected at two or more time points during
treatment of a subject being treated for the HPV-associated or
EBV-associated malignancy using the disclosed methods. In some of
these embodiments, the presence of the tumor-derived cell-free HPV
or EBV viral DNA in samples collected at later points in time can
be indicative that the subject being treated for an HPV-associated
cancer or malignancy will have an increased likelihood for
recurrence of the HPV-associated or EBV-associated malignancy.
Likewise, in some of these embodiments, the rapid clearance of or
absence of said tumor-derived cell-free HPV or EBV viral DNA in
samples collected at later points in time can be indicative that
the subject being treated for the HPV-associated or EBV-associated
malignancy will have a decreased likelihood for recurrence the
HPV-associated or EBV-associated malignancy. In these cases, the
method can also further involve treating the subject with a
reduction in radiation therapy and/or chemotherapy if the subject
exhibits a rapid clearance of or an absence of the tumor-derived
cell-free DNA sequences of HPV or EBV in samples collected at later
points during the course of treatment.
[0032] According to aspects of the disclosed method, longitudinal
analysis of tumor-derived virus nucleic acids in the blood with the
disclosed method may be utilized for early detection of
virus-positive cancers in individuals who do not present any
symptoms related to their malignancy or in whom such symptoms have
not yet been identified by clinicians. As demonstrated herein, the
disclosed method allows previously unachievable levels of
sensitivity and specificity for detecting circulating tumor-derived
viral nucleic acids that is applicable to patients with HPV+ or
EBV+ cancers.
[0033] In some embodiments, the disclosed methods can be applied to
determine the likelihood of initial diagnosis or recurrence of a
virus-associated cancer comprising detecting the presence or
absence of at least one circulating tumor nucleic acid marker for
the relevant virus in blood samples collected from a subject at a
single time point or longitudinally over time.
[0034] In some embodiments, the disclosed methods can be applied
for selecting treatments for oropharyngeal squamous cell carcinoma
(OPSCC) or other virus-associated cancer comprising detecting the
presence or absence of at least one circulating tumor-derived human
papilloma virus (HPV) DNA in samples collected prior to starting
treatment and/or at various points in time during treatment from a
subject diagnosed with OPSCC or being treated for OPSCC, wherein
the presence and/or quantity of said circulating tumor-derived HPV
DNA in samples collected at later points in time is indicative that
the subject being treated for OPSCC will have an increased
likelihood for OPSCC recurrence. Alternatively, rapid clearance of
or absence of said circulating tumor-derived HPV DNA in samples
collected at later points in time is indicative that the subject
being treated for OPSCC will have a decreased likelihood for OPSCC
recurrence, and treating the subject with a reduction in radiation
therapy and/or chemotherapy if the subject exhibits a rapid
clearance of or an absence for said circulating tumor nucleic acid
marker for HPV at a specific point in time after initiating cancer
therapy.
[0035] Also disclosed herein are methods of determining a treatment
regimen for human papilloma virus (HPV)-associated cancer or
malignancy comprising detecting the presence or absence of at least
one circulating tumor-derived HPV DNA in samples collected at
different points in time during treatment from a subject diagnosed
with HPV-associated cancer or being treated for said HPV-associated
malignancy, wherein the absence of or the rapid clearance of said
circulating tumor-derived HPV DNA in samples collected at later
points in time during treatment is indicative that the subject can
be treated with a reduction in radiation therapy and/or
chemotherapy.
[0036] Also disclosed herein are methods of detecting, monitoring
and/or treating a HPV-associated or EBV-associated malignancy in a
subject, the method comprising detecting a presence or absence of
at least one circulating tumor-derived HPV or EBV DNA in samples
collected from the subject at various points in time during a
course of treatment, wherein the presence of the circulating
tumor-derived HPV or EBV DNA in samples collected at later points
in time during the course of treatment is indicative that the
subject has an HPV-associated or EBV-associated malignancy or an
increased likelihood for an HPV-associated or EBV-associated
malignancy recurrence, and the rapid clearance of or absence of
circulating tumor-derived HPV or EBV DNA in samples collected at
later points in time during the course of treatment is indicative
that the subject does not have an HPV-associated or EBV-associated
malignancy or has a decreased likelihood for an HPV-associated or
EBV-associated malignancy.
[0037] Also disclosed herein are methods for monitoring and/or
treating a HPV-associated or EBV-associated malignancy in a subject
comprising detecting levels of a circulating tumor-derived HPV or
EBV DNA in samples collected at various points in time from the
subject diagnosed with or being treated for the HPV-associated or
EBV-associated malignancy; determining a circulating tumor-derived
HPV or EBV DNA profile for the subject; and adjusting a treatment
regimen for the HPV-associated or EBV-associated malignancy
according to the circulating tumor-derived HPV or EBV DNA profile,
wherein a subject with a favorable circulating tumor-derived HPV or
EBV DNA profile is treated with a de-intensified treatment
regimen.
[0038] Also disclosed herein are kits including components and
compositions as described herein for detecting, monitoring, and/or
treating malignancies in a subject as described herein, and
instructions for the use thereof. For example, the kits can contain
primer/probe sets set forth in Tables 14 to 20, and instructions
for the use thereof.
[0039] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF DRAWINGS
[0040] FIGS. 1A and 1B: FIG. 1A) Dual fragment HPV16 assay to
detect tumor viral DNA. Shown are the digital PCR fluorescence
detection plots for simultaneous detection of two distinct
fragments of the HPV16 genome. Examples are shown for the single
positive controls, dual fragment positive control, intact HPV
genome control, and two patient plasma DNA samples. Gates used to
quantify single- and double-positive droplets are shown, as
described in the methods. FIG. 1B) Analysis of 12 plasma DNA
samples from patients with HPV+ oropharyngeal cancer using this
assay uniformly demonstrates the presence of tumor-derived viral
DNA--indicated by abundance of both fragments in single positive
droplets and very rare co-occupancy of both targets in the same
droplet (in contrast to the intact genome control).
[0041] FIG. 2: Analysis of a large cohort of patient blood samples
using the HPV blood assay described in Example 1. There was no HPV
tumor viral DNA detected in 30 healthy volunteers and 50 patients
with HPV negative cancers (breast and pancreatic). In contrast,
95/102 patients with a diagnosis of HPV positive oropharyngeal
cancer have pre-treatment circulating tumor HPV DNA in plasma using
the blood test described here. The observed number of copies of
HPVDNA detected by the assay is also indicated, highlighting the
dynamic range of the test. Based on this data, estimates for assay
specificity and sensitivity are 100% and 93%, respectively, at the
time of initial diagnosis.
[0042] FIGS. 3A-3D: FIG. 3A) Schematic of timepoints when blood was
sampled in a cohort of oropharyngeal cancer patients prior to,
during, and after receiving chemoradiotherapy (CRT). FIG. 3B) Two
patterns of plasma ctHPV16 profile observed after initiating CRT.
In some patients (red lines), ctHPVDNA levels are highest
pre-treatment and diminish after initiating therapy. In other cases
(blue lines), ctHPVDNA levels increase soon after starting
treatment, possibly due to a spike in cancer cell death. In all
cases, ctHPVDNA levels are markedly reduced at the end of CRT,
indicating that ctHPVDNA levels are correlated with the volume of
active cancer in patients. FIG. 3C) A subset of patients have rapid
clearance kinetics of ctHPVDNA during CRT, with >95% of ctHPVDNA
cleared by week 4 of CRT. FIG. 3D) Another subset of patients has
delayed kinetics of ctHPVDNA clearance after CRT, which may be
correlated with poor or delayed response to CRT.
[0043] FIG. 4A-F: A subset of 20 patients with HPV+ OPC had next
generation sequencing (NGS) analysis of their primary tumor as well
as ctHPVDNA analyses of their blood to investigate potential
correlation between these assays. FIG. 4A) There was a strong
correlation between the HPVDNA dPCR assay described in Example 1,
when applied to the tumor biopsy specimen, and tumor HPV copy
number assessed by NGS. This validates both the HPVDNA assay and
NGS using orthogonal assays on the same samples. FIG. 4B) There is
a statistically significant correlation between tumor HPV copy
number per cellular genome and pre-treatment ctHPVDNA in the blood,
normalized to tumor volume ("ctHPVDNA density"). This indicates
that the level of ctHPVDNA detected in blood is correlated with HPV
copy number in the associated tumor. FIG. 4C) A bioinformatics
analysis pipeline was developed to distinguish HPV+ HPV cancers
that have evidence of HPV integration into the human genome versus
those cancers that have purely episomal HPV, using the tumor NGS
data. FIG. 4D) A circos plot is shown demonstrated the observed
rearrangements in a cancer with episomal HPV (left) and integrated
HPV (right). The example with integrated HPV shown here has an
integration site that maps to a region on chromosome 8 (see the
dark black lines). FIG. 4E) Higher tumor HPV copy number correlates
with a greater likelihood of non-integrated (episomal only) HPV.
FIG. 4F) Higher ctHPVDNA levels in blood also correlate with a
higher likelihood of non-integrated (episomal only) HPV in the
associated cancer. Thus, ctHPVDNA can also provide information on
the status of the HPV genome in the associated cancer--i.e., if it
is integrated versus episomal.
[0044] FIG. 5A-B: FIG. 5A) A schematic for stratifying patients
based on their ctHPVDNA profile. Patients with abundant
pre-treatment ctHPV16DNA that is rapidly cleared (>95% by day
28) are classified as having a favorable ctHPVDNA profile. All
other patients are classified as having an unfavorable ctHPVDNA
profile. FIG. 5B) Favorable ctHPVDNA profile is observed in
.about.30% of patients with clinically favorable (<T4 and
<=10 pack-year smoking history) and in .about.30% of patients
with clinically unfavorable (T4 or >10 pack-year smoking
history) disease.
[0045] FIG. 6A-B: FIG. 6A) Proportion of patients in each subgroup
who had a positive post-treatment neck dissection (i.e., regionally
persistent disease), regional recurrence, and distant metastasis.
Patients who had unfavorable clinical risk factors and an
unfavorable ctHPVDNA profile had the highest risk of adverse
disease events. FIG. 6B) Kaplan-Meier analysis of regional disease
(persistent or recurrent) free survival stratified by clinical risk
and ctHPVDNA profiles. Patients with a Favorable ctHPV16DNA Profile
had 100% regional disease control, regardless of smoking history (5
patients were heavy smokers). In contrast, clinical higher risk
patients with an Unfavorable ctHPVDNA Profile had significantly
reduced regional disease control. P, two-tailed log rank test for a
trend.
[0046] FIG. 7: The ctHPVDNA test described here was applied to a
cohort of 73 patients who had completed treatment for HPV+
Oropharyngeal cancer. These patients had no evidence of disease and
were clinically asymptomatic. They were monitored with the ctHPVDNA
blood test at each follow up visit. 60 out of 73 patients had
undetectable ctHPVDNA at all follow up visits, and none of these
patients developed disease recurrence during the follow up period.
In contrast, 13 out of 73 patients developed a positive ctHPVDNA
blood test during the clinical follow up period. 9 out of these 13
patients have also developed clinically evident disease recurrence.
The ctHPVDNA blood test was positive up to 6 months prior to
identification of recurrent disease on a diagnostic radiology scan.
The remaining 4 patients who have a positive blood test are being
closely monitored for possible disease recurrence.
[0047] FIG. 8: Case example from the ctHPVDNA surveillance study.
This patient was clinically asymptomatic and believed to be
cancer-free. In June 2017 he developed a positive ctHPVDNA blood
test. Soon thereafter, he was examined by an oncologist and was
found to have no evidence of disease. Three months later, he was
again examined by a clinician who did not identify any evidence for
disease recurrence. However, the patient reported some
neck/shoulder pain, which was believed to be musculoskeletal in
nature. A neck/shoulder MRI was ordered, and on this exam--4 months
after the blood test was positive--an isolated abnormally enlarged
lymph node was identified that was subsequently biopsied and
consistent with recurrent HPV+ oropharyngeal cancer.
[0048] FIG. 9: Representative embodiment of method to detect
tumor-derived HPV viral DNA assay using the triad primer/probe sets
presented in Tables 14, 15, 16, 17, 18, 19, and 20. Shown are the
digital PCR fluorescence detection plots for a multiplexed digital
PCR reaction to detect tumor-derived HPV16 DNA in a patient blood
sample that includes modified primer probe sets 3, 5 and 7 from
Table 14, where detection probe 5 is conjugated to HEX and
detection probes 3 and 7 are conjugated to FAM.
DETAILED DESCRIPTION
[0049] Before the present disclosure is described in greater
detail, it is to be understood that this disclosure is not limited
to particular embodiments described, and as such may, of course,
vary. It is also to be understood that the terminology used herein
is for the purpose of describing particular embodiments only, and
is not intended to be limiting, since the scope of the present
disclosure will be limited only by the appended claims.
[0050] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limit of that range and any other stated or intervening
value in that stated range, is encompassed within the disclosure.
The upper and lower limits of these smaller ranges may
independently be included in the smaller ranges and are also
encompassed within the disclosure, subject to any specifically
excluded limit in the stated range. Where the stated range includes
one or both of the limits, ranges excluding either or both of those
included limits are also included in the disclosure.
[0051] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this disclosure belongs.
Although any methods and materials similar or equivalent to those
described herein can also be used in the practice or testing of the
present disclosure, useful methods and materials are now
described.
[0052] All publications and patents cited in this specification are
herein incorporated by reference in their entireties, as if each
individual publication or patent were specifically and individually
indicated to be incorporated by reference, and are incorporated
herein by reference to disclose and describe the methods and/or
materials in connection with which the publications are cited. The
citation of any publication is for its disclosure prior to the
filing date and should not be construed as an admission that the
present disclosure is not entitled to antedate such publication by
virtue of prior disclosure. Further, the dates of publication
provided could be different from the actual publication dates that
may need to be independently confirmed.
[0053] As will be apparent to those of skill in the art upon
reading this disclosure, each of the individual embodiments
described and illustrated herein has discrete components and
features which can be readily separated from or combined with the
features of any of the other several embodiments without departing
from the scope or spirit of the present disclosure. Any recited
method can be carried out in the order of events recited or in any
other order that is logically possible.
[0054] Embodiments of the present disclosure will employ, unless
otherwise indicated, techniques of chemistry, biology, and the
like, which are within the skill of the art.
[0055] The examples are put forth so as to provide those of
ordinary skill in the art with a complete disclosure and
description of how to perform the methods and how to make and use
the compositions and probes disclosed and claimed herein. Efforts
have been made to ensure accuracy with respect to numbers (e.g.,
amounts, temperature, etc.), but some errors and deviations should
be accounted for. Unless indicated otherwise, parts are parts by
weight, temperature is in .degree. C., and pressure is at or near
atmospheric. Standard temperature and pressure are defined as
20.degree. C. and 1 atmosphere.
[0056] Before the embodiments of the present disclosure are
described in detail, it is to be understood that, unless otherwise
indicated, the present disclosure is not limited to particular
materials, reagents, reaction materials, manufacturing processes,
or the like, as such can vary. It is also to be understood that the
terminology used herein is for purposes of describing particular
embodiments only, and is not intended to be limiting. It is also
possible in the present disclosure that steps can be executed in
different sequence where this is logically possible.
[0057] It must be noted that, as used in the specification and the
appended claims, the singular forms "a," "an," and "the" include
plural referents unless the context clearly dictates otherwise.
[0058] As used herein "human papilloma virus" or "HPV" refers to
small, non-enveloped, double-stranded DNA viruses that infect the
cutaneous and/or mucosal epithelium. As understood by those skilled
in the art, over 100 HPV genotypes are known to exist. Sexually
transmitted, mucosotropic HPVs are further subcategorized as high
risk (e.g. HPV16 and HPV18) or low risk (HPV6 and HPV11).
[0059] As used herein, HPV-associated malignancies include those of
the head and neck (larynx, oral cavity, oropharynx, tonsils, and
esophagus), respiratory tissue, breast, skin, cervix, vulva, penis
and anus. Malignancy and cancer are used interchangeably.
[0060] As used herein, "detecting" or "detection" means testing,
screening, or otherwise determining the presence and/or absence of
at least one tumor nucleic acid marker for HPV in a sample. Such
detecting or detection can be carried out by methods described
herein, including those known in the art as applicable to this
technology, for example, nucleic acid amplification,
hybridization-based detection, microarray, and next generation
sequencing.
[0061] Also as used herein, the terms "treat," "treating" or
"treatment" may refer to any type of action that imparts a
modulating effect, which, for example, can be a beneficial and/or
therapeutic effect, to a subject afflicted with a condition,
disorder, disease or illness, including, for example, improvement
in the condition of the subject (e.g., in one or more symptoms),
delay in the progression of the disorder, disease or illness, delay
of the onset of the disease, disorder, or illness, and/or change in
clinical parameters of the condition, disorder, disease or illness,
etc., as would be well known in the art.
[0062] As used herein, the term "monitoring" refers to assessing
the therapeutic efficacy of a treatment for patients with a cancer.
As used herein, the term "surveillance" refers to the detection of
a virus-associated malignancy in subjects, who may or may not have
a clinically diagnosed or symptomatic cancer.
[0063] As used herein, a subject has an "increased likelihood" of
some clinical feature or outcome (e.g., recurrence or progression)
if the probability of the subject having the feature or outcome
exceeds some reference probability or value. The reference
probability may be the probability of the feature or outcome across
the general relevant subject or patient population. For example, if
the probability of recurrence in the general oropharyngeal cancer
population is X % and a particular patient has been determined by
the methods to have a probability of recurrence of Y %, and if
Y>X, then the patient has an "increased likelihood" of
recurrence. Alternatively, a threshold or reference value may be
determined and a particular patient's probability of recurrence may
be compared to that threshold or reference.
[0064] As used herein, "sample" refers to a biological sample
containing a tumor nucleic acid marker for HPV. The sample may be
tissue, cells, or any fluid taken from the human body, e.g., blood,
plasma, urine, saliva, etc. In particular embodiments, the sample
is a blood-based sample. Accordingly, the sample may be whole blood
or components thereof such as serum or plasma.
[0065] Also disclosed herein are methods for detection, treatment,
and surveillance of human papilloma virus-associated malignancies
and kits for accomplishing the same.
[0066] Also disclosed herein are methods for quantifying viral
nucleic acids in the circulatory system that are specifically
derived from tumors, and for distinguishing these tumor-derived
viral nucleic acids from other sources of circulating viral nucleic
acids.
[0067] Disclosed herein are DNA amplification methods for
quantifying DNA fragments of a target DNA in a sample by size. This
can be used, for example, to detect tumor-derived viral DNA in
blood sample and distinguish it from larger viral DNA from
non-tumor sources. In particular, disclosed herein are methods of
detecting, monitoring, or treating a human papilloma virus
(HPV)-associated malignancy in a subject that involves detecting a
presence or absence of at least one circulating tumor-derived HPV
DNA in a sample from the subject. Kits for accomplishing the same
are also provided.
[0068] The disclosed method can be performed within thousands of
micro-droplets (also referred to herein as droplets) generated
through, for example, emulsification and/or water-in-oil droplet
partitioning, such as is described in Hindson et al., Anal Chem.
2011 Nov. 15; 83(22):8604-8610, Pinheiro et al., Anal Chem. 2012
Jan. 17; 84(2):1003-1011, and Kanagal-Shamanna, Methods Mol Biol.
2016; 1392:33-42, or any other method known to those versed in the
art to separate a sample into discrete and/or volumetrically
defined partitions for analysis of tumor derived versus non-tumor
derived DNA present in the partitions/sample. In the case of
micro-droplets, the size of the droplets can be micro-, nano-,
pico-, or femto-scale.
[0069] As disclosed herein, the micro-droplets are generated such
that they each contain at most a single targeted viral nucleic
acid. In embodiments where only two distinct regions of the viral
nucleic acid are detected, a micro-droplet containing the targeted
viral nucleic acid will be either single-positive, i.e., positive
for one of the detection signals, or double-positive, i.e.,
positive for both of the detection signals. As disclosed herein,
the relative numbers of the single-positive and double-positive
micro-droplets and double-positive droplets provide quantitative
information making it possible to quantitatively determine the
relative amounts of tumor-derived and non-tumor derived viral DNA
in the sample.
[0070] In embodiments where the PCR is used to detect two
physically distinct regions, included is a forward and reverse
primer pair corresponding to each detected region. In some
embodiments, the detection may be performed using digital PCR,
droplet digital PCR, emulsion PCR or micro-droplet PCR according to
procedures that would be appreciated by one of skill in the art. As
disclosed herein, micro-droplets containing tumor-derived
circulating viral nucleic acids have fewer positively detected
viral nucleic acid regions relative to micro-droplets containing
non-tumor-derived circulating viral nucleic acids. In the simplest
case where only 2 different regions in the viral nucleic acid are
targeted for detection, the disclosed method identifies
micro-droplets containing non-tumor-derived circulating viral DNA
as those that are positive for both of the detection signals
employed for the different targeted regions (double-positive); by
contrast, in this simplest case, micro-droplets containing
tumor-derived circulating viral nucleic acid are positive for only
one detection signal but not both signals simultaneously.
[0071] To take an illustrative example, if the target nucleic acid
regions for detection comprise fragments of .about.70-100 bp, two
or more target regions separated by 100 bp would never be present
on the same viral DNA molecule if the molecule was derived from
circulating tumor DNA. Under this scenario, the simultaneous
detection of both target fragments within the same micro-droplet
must be due to co-occupancy within the same micro-droplet of two
distinct target fragment molecules, each containing one of the
regions targeted for detection. Thus, if the analyzed samples
contain non tumor-derived viral DNA, there will be a higher
frequency of micro-droplets that test positive for two or more
target fragments than would be expected based on the frequencies of
each target region analyzed individually.
[0072] For example, one quantitative measurement of the proportion
of non-tumor-derived viral DNA fragments in the sample is
[fraction(droplets double-positive for both detection
signals)-fraction(droplets positive only for detection signal
1)*fraction(droplets positive only for detection signal 2)]. It
follows that the fraction of tumor-derived viral DNA in the sample
is [1-[fraction(droplets double-positive for both detection
signals)-fraction(droplets positive only for detection signal
1)*fraction(droplets positive only for detection signal 2)]]. The
corresponding quantitative measure of tumor-derived viral DNA would
be [#(droplets positive only for detection signal 1)+#(droplets
positive only for detection signal 2)]*[proportion of tumor-derived
viral DNA fragments]=[#(droplets positive only for detection signal
1)+#(droplets positive only for detection signal
2)][1-fraction(droplets positive for both detection
signals)+fraction(droplets positive only for detection signal
1)*fraction(droplets positive only for detection signal 2)]. These
formulae are provided as illustrative examples of how the raw
detection signal data can be converted into measurements of
tumor-derived and non-tumor-derived viral DNA in the sample, with
the understanding there are other formulae that could be utilized
for the same purpose.
[0073] The disclosed methods can also be applied in cases where 3
or more regions, each with its own detection signal, are detected
in each micro-droplet or other parallelized micro-reaction chamber.
In this context, the mathematical formula for quantification of
tumor-derived and non-tumor derived viral DNA can be generalized on
the basis of the reasoning provided above for 2 amplified
regions.
[0074] While the examples above considered detected viral DNA
regions of size .about.70-100 bp separated by at least about 50 bp,
about 60 bp, about 70 bp, about 80 bp, about 90 bp or about 100 bp,
it should be understood that both the size of the detected DNA
fragments and their distance may be varied and are not fixed in
relation to the disclosed methods.
[0075] Returning to the embodiment in which two different regions
are targeted for detection, double-positive micro-droplets may on
occasion arise from the co-incidence of two smaller fragments of
viral nucleic acid within a single micro-droplet, each fragment
containing just a single region targeted for detection, as opposed
to the desired measurement of one larger fragment encompassing both
of the regions targeted for detection. In some embodiments, this
possibility can be ruled out, or the extent to which it is
occurring quantified, by comparing the relative frequencies of
double-positive and single-positive droplets, and confirming that
the frequency of double-positive droplets is approximated by the
product of the frequencies of the single-positive droplets, and
reduces in prevalence by the square of the dilution factor when
re-analyzed at a lower concentration.
[0076] In some embodiments, nucleic acids isolated from blood
samples are emulsified into micro-droplets such that the vast
majority of micro-droplets contain either one or none of the viral
nucleic acids that are being targeted for detection. Experimental
methods for determining the correct micro-droplet volume and blood
sample dilution factors are provided herein. Subsequent to
emulsification, nucleic acid detection methods, which may include
PCR-based methods, are employed to detect two or more regions of
the targeted viral nucleic acid that are physically separated from
one another. In some embodiments, each viral region being targeted
detection is associated with a unique detection signal, for example
a unique fluorescent color.
[0077] Also disclosed herein are methods of detecting ctHPVDNA in
HPV-OPSCC patients. The methods generally involve detecting the
presence of tumor-derived viral DNA using a nucleic acid
amplification, such as polymerase chain reaction (PCR), in an
emulsified context in which least two distinct regions are
amplified to distinguish between tumor-derived viral DNA, which is
fragmented, and non-tumor-derived intact virions, whose DNA is not
fragmented. Also disclosed herein are nucleic acid probes and
nucleic acid primers, as well as kits comprising same, for use in a
said method.
[0078] Also disclosed herein are methods for identifying the
prognosis of individuals with HPV-associated OPSCC that can be
successfully treated by de-intensified chemo-radiotherapy (CRT),
methods for identifying tumor-specific biomarkers that are
predictive of HPV-associated OPSCC relapse or recurrence after
treatment, and methods of identifying the prognosis of individuals
with HPV-associated OPSCC who are at risk for relapse or recurrence
after treatment.
[0079] Subjects suitable to be treated by the disclosed methods
include, but are not limited to mammalian subjects. Mammals
include, but are not limited to, canines, felines, bovines,
caprines, equines, ovines, porcines, rodents (e.g., rats and mice),
lagomorphs, primates, humans and the like, and mammals in utero.
Any mammalian subject in need of being treated or desiring
treatment is suitable. Human subjects of any gender (for example,
male, female or transgender) and at any stage of development (i.e.,
neonate, infant, juvenile, adolescent, adult, elderly) may be
treated. Subjects may be of any race or ethnicity, including, but
not limited to, Caucasian, African-American, African, Asian,
Hispanic, Indian, etc., and combinations thereof. It should be
further noted that subject and patient are used
interchangeably.
[0080] In particular embodiments, the subject has never been
diagnosed with or suffered from a virus-associated malignancy. In
other embodiments, the subject may be diagnosed with, afflicted
with, suffering from or at risk for a virus-associated malignancy.
In some embodiments, the subject has previously undergone treatment
for a virus-associated malignancy. In other embodiments, the
subject may be in remission from a virus-associated malignancy. In
some embodiments, the subject is a smoker. In some embodiments, the
subject is a non-smoker.
[0081] Detection of ctHPVDNA
[0082] Methods for determining the level of biomarker nucleic acid,
for example, a ctHPVDNA, such as ctHPV16DNA, in a sample may
involve the process of nucleic acid amplification, e.g., by PCR,
ligase chain reaction (LCR), transcription-based amplification
systems, (TAS) self-sustained sequence replication (3SR), nucleic
acid sequence-based amplification (NASBA), strand displacement
amplification (SDA) and branched DNA (bDNA) amplification, Q-Beta
replicase, rolling circle replication, rolling circle
amplification, or any other nucleic acid amplification method,
followed by detection of the amplified molecules using any
technique as would be appreciated by one of skill in the art.
[0083] In some embodiments, the nucleic acid detection method may
be carried out in micro-droplets or other micro-reaction chamber so
that the detection method can be run in a highly parallelized
manner. In some embodiments, micro-droplets or micro-reaction
chambers may contain either 0 or 1 copies of the viral DNA region
targeted for detection.
[0084] In embodiments involving emulsion PCR, a target nucleic acid
or polynucleotide sequence is typically dispersed into
micro-droplets. In some embodiments, it is essential that the
target nucleic acids be emulsified at a concentration where each
micro-droplet (or droplet) contains either one or zero copies of
the target molecule. In the case of plasma or serum DNA isolated
from patient blood samples, the appropriate dilution level can be
recognized by assessing the abundance of a control genomic region
and assuring that the frequency of positive micro-droplets remain
less than 10% (<10%). The control genomic region detects human
(i.e., non-viral) DNA and serves as a quality control for the
sample (since many negative samples will not have any positive
signal in the assay), and will also be used to establish that the
concentration of DNA fragments is appropriate (not to low and not
too high).
[0085] Within each micro-droplet, the principles of conventional
PCR also apply, where the target molecule is amplified by reaction
with at least one oligonucleotide primer or pair of oligonucleotide
primers. The primer(s) hybridize to a complementary region of the
target nucleic acid and a DNA polymerase extends the primer(s) to
amplify the target sequence. Under conditions sufficient to provide
polymerase-based nucleic acid amplification products, a nucleic
acid fragment of one size dominates the reaction products (the
target polynucleotide sequence which is the amplification product).
The amplification cycle is repeated to increase the concentration
of the single target nucleic acid or polynucleotide sequence within
each micro-droplet. The reaction can be performed in any
thermocycler commonly used for PCR.
[0086] Methods for setting up a PCR reaction are well known to
those skilled in the art. Any known DNA polymerase, nucleoside
triphosphate, buffers, additives/reaction enhancers and conditions
for amplification (cycles of denaturation, annealing and
polymerization) as would be appreciated by one of skill in the art
may be used in the PCR reaction.
[0087] In some embodiments, the reaction includes a
sequence-specific, hydrolysis probe that is conjugated to both a
fluorescent molecule and a fluorescence-quenching molecule to the
reaction mixture to enable the detection of successful
amplification of the target molecule within each droplet. The
chemical composition of specific probes may vary, but follow an
established method for detecting synthesis-based nucleic acid
amplification by those skilled in the art.
[0088] The preparation of an emulsion of the PCR reaction can be
achieved in a variety of ways that are appreciated by those versed
in the art. One effective methodology utilizes a fabricated
microfluidic chip that mixes the aqueous PCR reaction with a lipid
solution at controlled pressure to generate micro-droplets of
uniform size. The disclosed method is applicable to any method for
achieving a partitioned PCR reaction mixture that allows the
simultaneous detection of two or more viral nucleic acid target
molecules.
[0089] Following preparation of a PCR reaction mixture that has
been appropriately emulsified or partitioned into droplets, the
reaction mixture is subjected to primer extension reaction
conditions ("conditions sufficient to provide polymerase-based
nucleic acid amplification products"), i.e., conditions that permit
for polymerase mediated primer extension by addition of nucleotides
to the end of the primer molecule using the template strand as a
template. Cycles of denaturation, annealing and polymerization may
be performed according to any conditions (e.g., number of cycles,
temperatures and duration in time) that would be appreciated by one
of skill in the art.
[0090] Cycles of denaturation, annealing and polymerization may be
performed using an automated device, typically known as a thermal
cycler. Thermal cyclers that may be employed are described
elsewhere herein as well as in U.S. Pat. Nos. 5,612,473; 5,602,756;
5,538,871; and 5,475,610.
[0091] In other embodiments, non-PCR based applications may be used
to detect a target nucleic acid sequence, for example, where such
target may be immobilized on a solid support. Methods of
immobilizing a nucleic acid sequence on a solid support are known
in the art and are described in Ausubel et al. Current Protocols in
Molecular Biology, John Wiley and Sons, Inc. and in protocols
provided by the manufacturers, e.g. for membranes: Pall
Corporation, Schleicher & Schuell, for magnetic beads: Dynal,
for culture plates: Costar, Nalgenunc, and for other supports.
[0092] Other nucleic acid amplification procedures will be
appreciated by one of skill in the art, such as, but not limited
to, LCR, TAS, 3SR, NASBA, SDA, bDNA, and isothermal amplification.
The disclosed method is not limited to the use of amplification by
PCR, but rather includes the use of any nucleic acid amplification
methods or any other procedures which may be useful in
amplification of the sequences for the detection and/or
quantification of the presence of or expression of one or more of
the particular nucleic acid sequences described herein.
[0093] Variations on the exact amounts of the various reagents and
on the conditions for the PCR or other suitable amplification
procedure (e.g., buffer conditions, cycling times, etc.) that lead
to similar amplification or detection/quantification results are
known to one of skill in the art and are considered to be
equivalents.
[0094] Detection of the presence of target molecules in a
sample/micro-droplet is not particularly limited, and may be
accomplished by any technique appreciated by one of skill in the
art. In some embodiments, detection may include hybridization of
the target molecule with a target-specific probe, such as a nucleic
acid probe, linked to a fluorescent marker. In other embodiments,
the marker may be a non-fluorescent marker. The nature of the
marker, fluorescent or non-fluorescent, is not particularly limited
and may be any marker or label as would be appreciated by of skill
in the art.
[0095] The detection and distinguishing of partitions (droplets)
that contain a target molecule from partitions that contain zero
target molecules is a critical step in digital PCR. This can be
achieved using a variety of established techniques. In some
embodiments, micro-droplets are analyzed individually using a
microfluidic channel and a fluorescence detector. Alternatively,
advanced microscopy techniques may be implemented to count positive
and negative droplets. The disclosed method may be embodied with
any nucleic acid detection method.
[0096] While some methods disclosed herein have been implementing
using digital PCR, the disclosed methods can in principle be
utilized with any nucleic acid detection method that is capable of
detecting single nucleic acids and distinguishing the size of the
detected fragments. For example, such methods may include,
hybridization of non-amplified target molecules with a fluorescent
or a non-fluorescent probe, and the like. In any such embodiments,
the disclosed methods can be applied to distinguish tumor-derived
viral nucleic acids in circulation from other non-malignant sources
of circulating viral nucleic acid and intact virions. Particular
aspects of the disclosed methods are the simultaneous detection in
a partitioned reaction of at least two fragments of DNA separated
by a defined distance in the viral genome, where the presence of
both targets in separate partitions is indicative of tumor viral
nucleic acid in a bodily fluid, such as the blood, wherein an
increased frequency of co-occupancy of both fragments in the same
partition is indicative of non-malignant viral nucleic acids.
[0097] The present invention is more particularly described in the
following examples that are intended as illustrative only since
numerous modifications and variations therein will be apparent and
understood to those skilled in the art. Examples of how the
application of this specific and sensitive method for detecting
tumor viral nucleic acids in a bodily fluid, such as blood, can be
used to predict patient prognosis during cancer treatment, and to
identify patients who are at the highest risk of disease recurrence
among a cohort of patients who are clinically asymptomatic and
thought to be in disease remission are provided below.
[0098] A number of embodiments of the invention have been
described. The disclosure is further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1: Digital PCR Assay to Detect HPV viral DNA in Circulating
Cell-Free DNA
[0099] Provided here is an embodiment of the disclosed methods that
uses digital emulsion PCR to detect tumor-derived viral HPV DNA in
the circulating cell-free DNA isolated from blood. The
methodological details described in this example, for example the
nucleic acid amplification and detection methods used, are included
solely to establish that the invention has been reduced to
practice. The methodological details provided in this example
related only to this particular embodiment are not to be construed
as limiting the invention, as described in the claims and summary
sections of this document.
Materials
[0100] Reagents: Cell-Free DNA BCT tubes, RUO (Streck catalog No.
#218962); QIAamp.TM. Circulating Nucleic Acid Kit, Catalog #55114;
dPCR Supermax.RTM. Bio-Rad catalog no #186-3024; Eppendorf.TM.
96-Well twin.tec.TM. PCR Plates; Fisher scientific catalog No.
#E951020362; Pipet tips (Bio-Rad catalog No. #186-4121 or
#186-4120); Cartridge (Bio-Rad catalog No. #186-4109 or #186-4108);
Sealing foil (Bio-Rad catalog No. #181-4040); Optional:
VacConnectors.RTM. (Qiagen Cat No./ID: 19407). This extra connector
is useful in case something goes wrong with connectors available in
QIAamp Circulating Nucleic Acid Kit, Catalog #55114; Bovine Serum
Albumin (BSA); Qubit.TM. dsDNA HS Assay Kit (Thermo Fisher
Scientific Catalog number: #Q32851); Qubit Assay Tubes (Thermo
Fisher Scientific Catalog number: #Q32856); Falcone 15 ml Conical
Centrifuge Tubes (Corning Catalog No. #352096); Falcon.TM. 50 ml
Conical Centrifuge Tubes (Corning Catalog No. #352098); Disposable
sterile 5 ml, 10 ml and 25 ml Serological Pipets (any good brand);
Sterile PCR tubes (Any good brand); Sterile filter tips for
capacity 2 .mu.l, 10 .mu.l, 200 .mu.l and 1200 .mu.l (any good
brand); primers and probes.
[0101] Instruments: Microcentrifuge (suitable for 1.5 ml Eppendorf
tubes, e.g. Eppendorf 5424 Microcentrifuge); Centrifuge (Suitable
for 15 ml falcon tubes, e.g. Eppendorf Centrifuge 5810 R); Qubit
Fluorimeter (Thermo Fisher Scientific Catalog No. #Q33226); Deep 96
well thermocycler (Bio-Rad's C1000 Touch.TM. Thermal Cycler with
96-Deep Well Reaction Module #1851197); Heating block for drying
1.5 ml Eppendorf tubes (Denville Scientific catalog No. #10540);
Water bath (should have sufficient space for incubating twenty-four
50 ml Conical Centrifuge Tubes as 24 samples can be processed at
one time); Automated droplet generator (Bio-Rad catalog No.
#186-4101); Bio-Rad QX200.TM. Droplet Reader Catalog No. #1864003;
Portable Pipet-Aide XP Pipette Controller (Drummond Scientific,
Catalog No. 4-000-101); Pipette (capacity: 2 .mu.l, 10 .mu.l, 20
.mu.l, 200 .mu.l and 1000 .mu.l; any good brand); 8-channel pipette
(any good brand, e.g. Eppendorf Catalog No. #3125000010).
Methods
[0102] Blood Collection: Blood is collected in Cell-Free DNA BCT
tubes, RUO (Streck catalog No. #218962).
[0103] Plasma Extraction: Collected blood from step I should
ideally be processed on the same day to extract plasma. Same tube
can be centrifuged at 2000.times.g for 10 min at room temperature
(RT). Supernatant is transferred to new Falcon.TM. 15 mL Conical
Centrifuge Tubes. Care should be taken to avoid taking middle
whitish layer below plasma. Centrifuge the tube again for 10 min at
2000.times.g at RT. Supernatant is then transferred to a new
Falcon.TM. 15 ml Conical Centrifuge Tubes. The plasma is at
-80.degree. C. freezer till further use. NOTE: sometimes 10 min.
centrifuge does not lead to clear separation of plasma layer. In
such situation, sample should be centrifuged for another 10 min
before taking out the plasma. Or, alternatively centrifugation at
first step can be done for 15-20 min. Record the sample if plasma
looks red. Sometimes extra processing of the sample is required
during PCR step because of the hemolysis. Blood should be discarded
in 10% bleach or autoclaved or according to any other
institution/company approved protocol.
[0104] Plasma cell free DNA (cfDNA) Extraction: The stored plasma
samples are thawed at 37.degree. C. in a water bath for about 5
min. A Qiagen kit (QIAamp Circulating Nucleic Acid Kit, Catalog
#55114) is used to extract DNA using manufacturer's protocol with
the following modifications: Standard vacuum available in
laboratory can be used in the protocol; The cfDNA is eluted in 2
steps--first with 100 .mu.l elution buffer and then 75 .mu.l
elution buffer if plasma volume is more than 3 ml. Elution can be
done in lower volume if the collected plasma volume is less to
avoid excessive dilution of the cfDNA; and it was observed that
incubation of the column for 3 min. after adding elution buffer (as
suggested in the protocol) does not lead to the complete extraction
of cfDNA. Generally, a 30 min to 1 h incubation at RT generally
follows both elution steps. The cfDNA is quantified on a Qubit
fluorimeter. (Note: Generally, 2 .mu.l of the eluate is sufficient
to be used for quantification purpose). The eluted cfDNA is stored
at -20.degree. C. freezer until further use. Note: The cfDNA
recovered at first elution is used for all experiments and
calculations. The cfDNA recovered in the second elution step is
used only if cfDNA at first elution is exhausted. If a more
concentrated cfDNA is required for any purpose like NGS, then the
sample can be concentrated using speed vacuum.
[0105] dPCR: The dPCR involve three steps--Droplet generation; PCR;
and droplet reading.
[0106] Droplet Generation: Prepare 25 .mu.l reaction for each
sample customized as per the following composition (Reagents: dPCR
Supermax.RTM. Bio-Rad catalog no #186-3024; any nuclease free PCR
grade water can be used; other reagents like forward primer,
reverse primer and probe are designed by user)
TABLE-US-00001 TABLE 1 Reaction Mixtures Working Final 1x 1x No
template Component stock Conc. (sample) control (NTC) Primers
Mixture 22.5 .mu.M 0.9 .mu.M 1 .mu.l 1 .mu.l (4) each each Probes
Mixture 6.25 .mu.M 0.125 .mu.M 0.5 .mu.l 0.5 .mu.l (2) each each
Albumin 10% 0.4% 1 .mu.l 1 .mu.l Betaine 5M 0.4 .mu.M 2 .mu.l 2
.mu.l Trehalose 1.25M 0.16M 3.2 .mu.l 3.2 .mu.l dPCR Supermix 2x 1x
12.5 .mu.l 12.5 .mu.l DNA sample 1x/Diluted N/A 4.3 .mu.l -- PCR
grade Adjustable N/A -- 4.3 .mu.l Water Total 25 .mu.l 25 .mu.l
[0107] The primer and probe sequences for the ctHPVDNA assay
described here are as follows:
TABLE-US-00002 TABLE 2 Primers and Probes Variant Primers/Probes
HPV16 283_HPV-16_F1 For: TGACTCTACGCTTCGGTTG (SEQ ID NO: 1)
Fragment 1 284_HPV-16_F1 Rev: GCCCATTAACAGGTCTTCC (SEQ ID NO: 2)
420_HPV-16_F1 Probe_FAM-ZEN_v2: CGTACAAAdCACACAGTAGACATTCGTAC (SEQ
ID NO: 3) HPV16 424_HPV16_F2_For: GGTTTGTAACATCCCAGGC (SEQ ID NO:
4) Fragment 2 425_HPV16_F2_Rev: GTGTATTTTTTAAGGGGATCTTCTT (SEQ ID
NO: 5) 421_HPV16_F2_HEX_LNA: CACCT(+C)(+C)A(+G)CACC (SEQ ID NO: 6)
''(+N)'' denotes LNA.TM. base
[0108] The Primers mixture working stock is assembled by combining
22.5 .mu.L each of the four primers (100 .mu.M concentration) into
a tube and adding 10 .mu.L nuclease-free water to achieve a final
concentration of 22.5 .mu.M for each primer.
[0109] The Probe mixture working stock is assembled by combining
6.25 .mu.L of each probe (100 .mu.M concentration) into a tube and
adding 87.5 .mu.L nuclease-free water to achieve a final
concentration of 6.25 .mu.L for each probe.
[0110] About 22-23 .mu.l of the above reaction mixture is loaded on
a 96 well plate (Eppendorf.TM. 96-Well twin.tec.TM. PCR Plates,
Fisher scientific catalog No. #E951020362) using Multichannel
Pipetors (Note: Instrument uses only 20 .mu.l from each well. An
extra volume is added to avoid any pipetting error) Droplets are
generated using automated droplet generator (Bio-Rad catalog No.
#186-4101) following manufacturer's protocol. Reagents required at
this step are pipet tips (Bio-Rad catalog No. #186-4121 or
#186-4120) and cartridges (Bio-Rad catalog No #186-4109 or
#186-4108). The sample plate is sealed with sealing foil (Bio-Rad
catalog No. #181-4040) following manufacturer's protocol. Note: The
volume of cfDNA+water should be 4.3 .mu.l. Generally, there is no
issue by using 4.3 .mu.l of cfDNA sample in the reaction but
sometimes the allele copy number is too high and it results in
streaking of the positive droplet across the axis and many dual
positive droplets. In such cases, the run should be repeated by
using less sample and remaining volume can be adjusted with water.
Dilution gives better quantification of allele frequency in such
cases. A linear relationship across 5 orders of magnitude has been
observed in HPV16 copy number ranging from 5 copies to 50,000
copies per 20 .mu.l reaction. Care should be taken to seal the
plate properly. If the plate is not sealed properly then it will
lead to sample evaporation during PCR step.
[0111] PCR: The PCR thermocycling was performed using the protocol
as described below.
TABLE-US-00003 TABLE 3 PCR conditions Temperature, Ramp Number of
Cycling step .degree. C. Time Rate Cycles Enzyme activation 95 10
sec 2.degree. C./sec 1 Denaturation 94 30 sec 40 Annealing 60 1 min
40 Extension 68 1 min 40 Enzyme 98 10 min 1 deactivation Hold
(optional) 4 Infinite 1 Use a heated lid set to 105.degree. C. and
set the sample volume to 40 .mu.l
[0112] All wells should be observed visually after PCR and before
reading the plate on droplet reader. The copy numbers observed
during droplet reading may not be real if there is any well where
sample is evaporated because of improper sealing. It is good to
leave the plate in the thermocycler for about 15-20 min after PCR
is done. It allows the temperature of the plate to come down at
more controlled way and it avoids droplet malformation. Sometimes
malformation of the droplets because of the static current can be
avoided by touching hand with other metallic surface before taking
out the plate from thermocycler. It should be made a routine
practice for better reproducibility of the results. The PCR plate
can be stored overnight after PCR and reading can be done next day
morning if time is limited. However, finishing everything in one
day is best practice.
[0113] Droplet Reading: The droplet reader (Bio-Rad QX200.TM.
Droplet Reader Catalog No. #1864003) is used to read signal in
droplets following the manufacturer's protocol. Note: Discarding
Oil waste: The composition of droplet reader oil is proprietary of
Bio-Rad. A typical waste profile contains fluorinated oils (95%),
water (5%), bleach (<0.5%), proteins, nucleic acids, and
fluorescent dye (<0.1%). A proper disposal should be planned
accordingly.
[0114] Data Analysis: The copy number calculations should be done
following the manufacturer's guidelines. An example of the dPCR
ctHPVDNA assay readout is shown in FIG. 1A. The following
parameters were set for calculation of FAM-single positive,
HEX-single positive, and FAM+HEX double positive droplets. In the
FAM channel, a cutoff of 700 is used to separate the negative from
positive droplets. Similarly in the HEX channel, a cutoff of 3000
is used to separate the negative from positive droplets. The
FAM+HEX double positive droplets are those with >700
fluorescence intensity in the FAM channel and >3000 fluorescence
intensity in the HEX channel. The double negative droplets have FAM
fluorescence <700 and HEX fluorescence <3000.
[0115] Poisson statistics is used to calculate the copies of each
fragment in the reaction individually, using the following
formula:
#copies=#total droplets*ln(#total droplets/#signal negative
droplets).
This is calculated first for fragment 1 (FAM positive) and for
fragment 2 (HEX positive).
[0116] Extensive control assays have been run to determine the
level of experimental noise. Based on these controls, the following
criteria were used to determine the number of copies of the target
fragment(s) in the assay reaction.
TABLE-US-00004 TABLE 4 Control Criteria HPV16 copies/ 20 .mu.l
reaction Considered as 0 Zero Below 3 False positive and should be
considered as zero 3-5 Assay should be repeated to confirm the
value Above 5 Considered as positive for HPV16 Any positive value
in Assay should be follow up patient when repeated to confirm
previous HPV16 the value values are negative
[0117] These copy number values can be used to calculate the
frequency of a droplet possessing the target fragment: Pr
(frag)=(#positive droplets/#total droplets). The frequency of
double-positive droplets that are expected if the sample consists
of fragmented, circulating tumor viral DNA is estimated as: Pr
(double positive)=Pr (frag1)*Pr (frag2). In contrast, if the Pr
(dual positive)>2*Pr (frag1)*Pf (frag2), then the sample was
considered to contain non-fragmented viral DNA that is not
tumor-derived. If Pr (double positive)>Pr (frag1) or Pr (double
positive)>Pr (frag2) it was interpret that the sample is
negative for circulating tumor-derived viral nucleic acids. If Pr
(frag1) AND Pr (frag2)>2*Pr (double positive), then the sample
was considered positive for circulating tumor-derived viral nucleic
acids, although there is evidence for coexistent non-tumor derived
viral nucleic acids. Raw data for this assay applied to
experimental controls and plasma DNA from a cohort of 12 patients
with HPV+ oropharyngeal cancer is shown in FIG. 1A-1B.
[0118] For the HPV16 F1 assay, cutoff of 700 was set on y-axis (FAM
channel). Any droplets above 700 are considered as positive
droplets for HPV16. For the HPV16 F2 assay, a cutoff of 3000 was
set on x-axis (Hex channel). Any droplet above 3000 was considered
as positive droplet for HPV16 F2. Occasionally, the patterns of the
dPCR readout look unusual. This can be because of a bad sample
(unanalyzable cfDNA) or a bad dPCR run. Such sample should be
repeated to fix the problem. Data from such samples cannot be used
for interpretation. If sample quality is not improved with any
available strategies then sample should be categorized as
unanalyzable DNA or bad sample. Some strategies to improve the
sample quality are as below. The presence of Heparin in the blood
sample can interfere with the dPCR reaction. Treating the sample
with Bacteroides Heparinase I (New England Biolabs cat no. #P0735S)
using manufacturer's protocol improves the quality of sample.
Excessive hemolysis sometimes interferes with the dPCR. An
improvement has been observed in the assay readout by adding 0.4%
bovine serum albumin Some of the representative dot plots from bad
samples are provided as separate file with suggested solutions.
[0119] Using an endogenous genomic sequence as a positive control
for the dPCR reaction is essential for validating sample quality.
dPCR-based detection of a target sequence in the ESR1 gene was
utilized as a positive control for sample quality. The assay is
described below:
TABLE-US-00005 TABLE 5 Variant Primers and Probes Genomic
132_CtrIESR1_F2: ATCTGTACAGCATGAAGTGCAAGA (SEQ ID Control NO: 7)
(ESR1 locus) 133_CtrIESR1_R2: CTAGTGGGCGCATGTAGGC (SEQ ID NO: 8)
094_CtrIESR1_LNA2-TET_probe_WT: T(+C)(+T(+A)T(+G)(+A)(+C)CTG (SEQ
ID NO: 9) ''(+N)'' denotes LNA.TM. base
TABLE-US-00006 TABLE 6 Setting PCR Reaction Component Working stock
Final conc. 1x (sample) 1x (NTC) Forward primer 22.5 .mu.M 0.9
.mu.M 1 .mu.l 1 .mu.l Reverse primer 22.5 .mu.M 0.9 .mu.M 1 .mu.l 1
.mu.l Probe 6.25 .mu.M 0.25 .mu.M 1 .mu.l 1 .mu.l BSA 10% 0.4% 1
.mu.l 1 .mu.l dPCR Supermix 2x 1x 12.5 .mu.l 12.5 .mu.l DNA sample
Neat/diluted N/A 8.5 .mu.l -- PCR grade Water Adjustable N/A -- 8.5
.mu.l Total 25 .mu.l 25 .mu.l
TABLE-US-00007 TABLE 7 PCR Conditions Temp, Ramp Number Cycling
step .degree. C. Time Rate of Cycles Enzyme activation 95 10 sec
2.degree. C./sec 1 Denaturation 94 30 sec 40 Annealing/Extension 60
1 min 40 Enzyme deactivation 98 10 min 1 Hold (optional) 4 Infinite
1 Use a heated lid set to 105.degree. C. and set the sample volume
to 40 .mu.l
[0120] Work Flow for the analysis of plasma DNA samples:
[0121] 1) Test samples using ESR1 genomic control dPCR assay, to
evaluate amplifiable DNA and sample concentration.
[0122] 2) Test the samples for the dual fragment HPV16 assay
(HPV16ZENv2)
[0123] 4) If sample is negative for HPV16 then perform the HPV
multiplexed assay (HPVmultiplexed_v1)
[0124] 5) Perform the duplex assay to know specific HPV variant
Example 2: Multiplexed dPCR Assay To Detect 5 Distinct HPV
Sub-Strains (HPVmultiplexed_v1)
[0125] The disclosed methods were applied to sub-strains of a given
virus. While the embodiment here relates to sub-strains of the HPV
virus, the method can be readily applied to other viral sub-strains
using established techniques known to those versed in the field.
Variants included in the described embodiment of the method are
HPV16, HPV18, HPV31, HPV33 and HPV35
[0126] HPV16 probe was tagged with FAM-Zen while others with HEX
(LNA version).
TABLE-US-00008 TABLE 8 Primers and Probes Variant Primers and
Probes HPV16 283_HPV-16_For: TGACTCTACGCTTCGGTTG (SEQ ID NO: 1)
284_HPV-16_Rev: GCCCATTAACAGGTCTTCC (SEQ ID NO: 2)
420_HPV-16_Probe_FAM-ZEN_v2: CGTACAAAGCACACACGTAGACATTCGTAC (SEQ ID
NO : 3) HPV18 401_HPV18_For: TGAAGCCAGAATTGAGCTAG (SEQ ID NO: 10)
422_HPV18_Rev_v2: AGGACAGGGTGTTCAGAA (SEQ ID NO: 11)
403_HPV18_LNA_HEX-Probe: CA(+G)A(+C)(+G)AC(+C)TTCG (SEQ ID NO: 12)
HPV31 404_HPV31_For: AGCACACAAGTAGATATTCGC (SEQ ID NO: 13)
405_HPV31_Rev: TAGTAGAACAGTTGGGGCA (SEQ ID NO: 14)
406_HPV31_LNA_HEX-Probe: TAA(+C)(+A)G(+C)T(+C)(+T)TG(+C) (SEQ ID
NO: 15) HPV33 407_HPV33_For: TAACACCACAGTTCGTTTATGT (SEQ ID NO: 16)
423_HPV33_Rev_v2: ACAATATTCACTGTGCCCATA (SEQ ID NO: 17)
418_HPV33_LNA_HEX-Probe_v2: TG(+A)C(+C)(+T)A(+C)G(+A)(+A)CC (SEQ ID
NO: 18) HPV35 410_HPV35_For: TGAGGCGACACTACGTC (SEQ ID NO: 19)
411_HPV35_Rev: GTGCCCATTAATAAATCTTCCAA (SEQ ID NO: 20)
419_HPV35_LNA_HEX-Probe_v2: AG(+A)G(+C)(+A)CA(+C)(+A)CAT (SEQ ID
NO: 21) ''(+N)'' denotes LNA.TM. base
[0127] Reaction Mixture
[0128] Primer mixture: Mix equal volume of 10 primers each at 100
.mu.M (each primer diluted 1:10 in the mixture). Probe mixture: Mix
6.25 .mu.l of each of five probes in a tube and add 68.75 .mu.l
water (final concentration will be 6.25 .mu.M each in 100 .mu.l
volume)
TABLE-US-00009 TABLE 9 Reaction Mixtures Working 1x 1x Component
stock Final Conc. (sample) (NTC) Primers Mixture 10 .mu.M each 0.9
.mu.M each 2.25 .mu.l 2.25 .mu.l Probes Mixture 6.25 .mu.M each
0.125 .mu.M each 0.5 .mu.l 0.5 .mu.l Albumin 10% 0.4% 1 .mu.l 1
.mu.l Betaine 5M 0.4 .mu.M 2 .mu.l 2 .mu.l Trehalose 1.25M 0.16M
3.2 .mu.l 3.2 .mu.l dPCR Supermix 2x 1x 12.5 .mu.l 12.5 .mu.l DNA
sample Neat/Diluted N/A 3.55 .mu.l -- PCR grade Water Adjustable
N/A -- 3.55 .mu.l Total 25 .mu.l 25 .mu.l
TABLE-US-00010 TABLE 10 PCR conditions Temperature, Ramp Number of
Cycling step .degree. C. Time Rate Cycles Enzyme activation 95 10
sec 2.degree. C./sec 1 Dentaturation 94 30 sec 40 Annealing 60 1
min 40 Extension 68 1 min 40 Enzyme 98 10 min 1 deactivation Hold
(optional) 4 Infinite 1 Use a heated lid set to 105.degree. C. and
set the sample volume to 40 .mu.l
[0129] Note: An LNA.TM.-FAM probe was also designed to amplify
common region in all known HPV16 variants with same primers (No.
283 & 285). This was not used in the multiplexed assay.
TABLE-US-00011 (SEQ ID NO: 22) 413_HPV16_LNA_FAM-CommonProbe:
CA(+C)A(+C)(+G)(+T)A(+G)(+A)CAT
Example 3: Duplex dPCR Assay to Detect Specific HPV Variants (HPV
18&33_v1 and HPV 31&35_v1)
[0130] This assay was designed to know the identity of specific HPV
variants in patient samples.
TABLE-US-00012 TABLE 11 Primers and Probes Variant Primers Probe
Set 1 HPV18 401_HPV18_For: TGAAGCCAGAATTGAGCTAG & (SEQ ID NO:
10) HPV33 422_HPV18_Rev_v2: AGGACAGGGTGTTCAGAA (SEQ ID NO: 11)
407_HPV33_For: TAACACCACAGTTCGTTTATGT (SEQ ID NO: 16)
423_HPV33_Rev_v2: ACAATATTCACTGTGCCCATA (SEQ ID NO: 17)
403_HPV18_LNA_HEX-Probe: CA(+G)A(+C)(+G)AC + CTTCG (SEQ ID NO: 12)
426_HPV33_LNA_FAM-Probe: TG(+A)C(+C)(+T)A(+C)G(+A)(+A)CC (SEQ ID
NO: 18) Set 2 HPV31 404_HPV31_For: AGCACACAAGTAGATATTCGC (SEQ ID
& NO: 13) HPV35 405_HPV31_Rev: TAGTAGAACAGTTGGGGCA (SEQ ID NO:
14) 410_HPV35_For: TGAGGCGACACTACGTC (SEQ ID NO: 19) 411_HPV35_Rev:
GTGCCCATTAATAAATCTTCCAA (SEQ ID NO: 20) 406_HPV31_LNA_HEX-Probe:
TAA(+C)(+A)G(+C)T(+C)(+T)TG(+C) (SEQ ID NO: 15)
427_HPV35_LNA_FAM-Probe: AG(+A)G(+)(+A(CA(+C)(+A)CAT (SEQ ID NO:
21) ''(+N)''denotes LNA.TM. base
[0131] Reaction Mixture
[0132] Primer mixture: Mix 22.5 .mu.l of each of the four primers
and add 10 .mu.l water (22.5 .mu.M each primer in the mixture).
Probe mixture: Mix 6.25 .mu.l of both probes in a tube and add 87.5
.mu.l water (final concentration will be 6.25 .mu.M each in 100
.mu.l volume).
TABLE-US-00013 TABLE 12 Reaction Conditions Working 1x 1x Component
stock Final Conc. (sample) (NTC) Primers Mixture 22.5 .mu.M each
0.9 .mu.M each 1 .mu.l 1 .mu.l Probes Mixture 6.25 .mu.M each 0.125
.mu.M each 0.5 .mu.l 0.5 .mu.l Albumin 10% 0.4% 1 .mu.l 1 .mu.l
Betaine 5M 0.4 .mu.M 2 .mu.l 2 .mu.l Trehalose 1.25M 0.16M 3.2
.mu.l 3.2 .mu.l dPCR Supermix 2x 1x 12.5 .mu.l 12.5 .mu.l DNA
sample Neat/Diluted N/A 4.3 .mu.l -- PCR grade Water Adjustable N/A
-- 4.3 .mu.l Total 25 .mu.l 25 .mu.l
TABLE-US-00014 TABLE 13 PCR conditions Temperature, Ramp Number of
Cycling step .degree. C. Time Rate Cycles Enzyme activation 95 10
sec 2.degree. C./sec 1 Dentaturation 94 30 sec 40 Annealing 60 1
min 40 Extension 68 1 min 40 Enzyme 98 10 min 1 deactivation Hold
(optional) 4 Infinite 1 Use a heated lid set to 105.degree. C. and
set the sample volume to 40 .mu.l
Example 4: Application to Patient Blood Samples in Prospective
Clinical Trials
[0133] Blood samples were analyzed from healthy volunteers,
non-virus associated cancer, and HPV+ cancer. Circulating tumor HPV
DNA copy numbers, as measured using the assay technology described
in Example 1, are shown in FIG. 2. These data indicate that the
ctHPVDNA blood test has 100% specificity and 93% sensitivity for
identifying patients with HPV+ cancer.
[0134] Blood samples were analyzed from patients enrolled in two
prospective phase II clinical trials. The disclosed method for
specifically detecting tumor-derived viral HPV DNA in the blood was
integrated into the design of both of these clinical trials. The
findings from these longitudinal clinical studies illustrate the
applicability and utility of the disclosed method both for
personalizing patient therapy and for cancer surveillance.
[0135] Summary of patient cohort and clinical trial design. Two
prospective phase II clinical trials were completed that evaluated
the efficacy of a de-intensified chemo-radiation therapy regimen in
low risk OPSCC. In LCCC 1120 (NCT01530997) 45 patients were treated
with de-intensified CRT. Eligible patients had HPV-positive and/or
p16-positive OPSCC, T0-T3, N0-N2c, MO, and <10 pack years of
smoking. Patients received 60 Gy of Intensity Modulated
Radiotherapy (IMRT) with concurrent weekly intravenous cisplatin
(30 mg/m.sup.2). All patients had biopsy of the primary site and
underwent a selective neck dissection to encompass nodal level(s)
that were positive pre-treatment, within 4 to 14 weeks after CRT.
The primary endpoint of LCCC 1120 was the rate of pCR, which was
86% (37/43) and the 3-year cancer control and overall survival was
100% and 95%, respectively. In addition to excellent cancer
control, patient had less toxicity and reported excellent quality
of life and lower symptom burden as compared to standard of care
CRT (70Gy). In a second-generation phase 2 study (LCCC 1413,
NCT02281955) a 12-week post-treatment PET/CT was used to guide the
use of biopsy/neck dissection (i.e. post CRT surgical evaluation
was not mandatory, but guided by imaging). Of the 113 patients
enrolled, 82 patients have had a minimum of 1-year follow-up and
the 2-year actuarial cancer control and overall survival in these
82 patients is 90% and 95% respectively (again excellent results).
Patients continue to report good recovery of quality of life at 1
year, and thus supports the concept that dose de-escalation can
improve the therapeutic ratio. A third generation phase 2 study
(LCCC 1612, NCT03077243) is currently being conducted, and has
enrolled 53 of an expected 120 patients. Blood samples from 113
patients were prospectively analyzed to detect tumor-derived plasma
viral HPV DNA.
[0136] Levels of tumor-derived viral HPV DNA in the blood, as
quantified by the disclosed method, correlate significantly with
HPV viral DNA in primary tumors. In 63 patients with HPV-OPSCC,
serial levels of tumor-derived viral HPV DNA (pre- and weekly
during-RT) were prospectively quantified in patient blood samples
using the disclosed method (FIG. 3A). 49 patients had detectable
tumor-derived viral HPV DNA in the circulation prior to treatment.
In all 49 patients, the levels of circulating HPV DNA had dropped
significantly by week 6 (FIG. 3B) following the initiating of
chemo-radiation therapy, diminishing to undetectable levels in a
majority (90%, n=44/49) of patients by the end of the therapeutic
regimen. Across patients, the peak levels of tumor-derived viral
HPV DNA in the blood, ranged from 10 copies/mL to .about.30,000
copies/mL. Moreover, distinct clearance kinetics of tumor-derived
viral HPV DNA was observed in the blood during CRT treatment. In
one group there was rapid clearance kinetics (FIG. 3C), with
>95% of the peak tumor-derived viral HPV DNA in the blood being
cleared by day 28 of therapy. In a second group there was delayed
clearance of tumor viral HPV DNA in the blood (FIG. 3D), which may
be associated with poor or delayed response to therapy.
[0137] The disclosed method was further validated by correlating
levels of tumor-derived viral HPV DNA in the blood with analysis of
matched primary tumors in a cohort of 20 patients (FIG. 4).
Normalized HPV DNA copies in tumor biopsy material correlates
strongly with HPV DNA copies as measured by next-generation
sequencing (FIG. 4A). Moreover, the quantity of tumor-derived viral
HPV DNA in blood correlates significantly with HPV DNA copy number
in the matched tumor biopsy, after normalizing to the overall tumor
burden in the patient (FIG. 4B). Using next-generation sequencing,
cancers with integration of HPV into the cancer cell genome were
identified (FIG. 4C-4D). Higher copy number of HPV DNA in tumor
biopsy material correlated with a high likelihood of episomal
(non-integrated) HPV DNA in the matched primary tumor (FIG. 4E).
Similarly, higher copy numbers of tumor-derived viral HPV DNA in
the blood correlated with a higher likelihood of episomal
(non-integrated) HPV DNA in the matched primary tumor (FIG. 4F).
These findings validate the disclosed methods by establishing that
the quantification of viral DNA in the blood using the disclosed
methods correlates significantly with measurements of viral DNA in
matched tumor tissue. These observations also demonstrate the
disclosed method can monitor the presence and clearance of
tumor-derived HPV viral DNA in longitudinal analysis of patient
blood samples.
[0138] Predict clinical risk in cancer patients. The disclosed
method was applied to monitor tumor-derived viral HPV DNA in the
blood before and during therapy in 63 patients enrolled in the
clinical trial described above. A Favorable Profile was defined as
having abundant ctHPV16DNA peak levels of tumor-derived viral HPV
DNA in the blood (>200 copies/mL) and rapid clearance kinetics
(.ltoreq.2% of the peak value by week 4) (FIG. 5A). 18 out of 63
evaluable patients (29%) had a Favorable Profile (FIG. 5B), and
none of these 18 patients have recurred (regardless of smoking
status) (FIG. 6A-B). An Unfavorable Profile was defined as (i)
undetectable pre-treatment tumor-derived viral HPV DNA in the
blood, (ii) low peak values of tumor-derived viral HPV DNA in the
blood (.ltoreq.200 copies/mL), or (iii) >2% of the peak value by
week 4 (40Gy) (FIG. 5A-B). Remarkably, patients with a Favorable
Profile exhibited 100% disease control in non-smokers (60Gy) and
heavy smokers (60-70Gy). In contrast, heavy smokers (>10 pack
year) with an Unfavorable Profile had a very poor regional disease
control rate of 45% at 12 months after completing therapy (FIG.
6A-B). These observations demonstrate the clinical utility of
applying the disclosed method to quantify tumor-derived viral DNA
in the blood as a biomarker to predict clinical risk among
virus-associated cancer patients. Moreover, these findings indicate
that a real-time assessment of circulating tumor-derived viral DNA
can be utilized to personalize the intensity of therapy for
patients based on their inferred risk.
[0139] Early detection of HPV-positive cancer recurrence in healthy
patients that are asymptomatic and considered disease-free using
existing clinical procedures. The typical surveillance schedule
after chemo-radiation therapy is clinical examinations (physical
examination and fiber optic nasopharyngolaryngoscopy) every 2 to 6
months for the first 5 years. Most head and neck oncologist also
obtain PET/CT every 6 to 12 months. There are currently no
available surveillance blood tests for patients with HPV-associated
OPSCC. The availability of highly sensitive blood-based
surveillance test would aide in early detection of cancer
recurrence (prior to clinical or radiographic findings) and improve
the value of cancer surveillance in this population by reducing the
frequency of office visits and the use of expensive radiological
imaging studies. To date 73 patients have been prospectively
surveilled with HPV-associated OPSCC (FIG. 7). Blood samples were
obtained with each follow-up visit regardless of clinical findings.
Plasma ctHPV16DNA has become detectable in follow up after
treatment in 13 patients (median copies/ml and range) of which 9
have had clinical/radiographic evidence of cancer recurrence. These
patients with detectable ctHPV16DNA after treatment were
asymptomatic and had radiographic examinations confirming very
early, low volume cancer recurrences. An illustrative case example
is presented in FIG. 8. Here, the patient had already completed
curative-intent therapy and was completely asymptomatic with no
evidence of disease. However, he developed a positive result for
tumor-derived viral HPV DNA in the blood in June 2017. Soon
thereafter, he was examined by an oncologist and determined to have
no evidence of disease. Three months later, he had another follow
up visit and the oncologist did not identify any evidence for
disease recurrence on physical exam. However, the patient reported
some neck/shoulder pain, which was believed to be musculoskeletal
in nature. A neck/shoulder MRI was ordered, and on this exam--4
months after the initially positive blood test--an isolated
abnormally enlarged lymph node was identified in the neck. This
abnormal mass was subsequently biopsied and proven to be recurrent
HPV+ oropharyngeal cancer.
[0140] There are 4 patients in the study who have detectable HPV
DNA in the blood using the disclosed methods, yet have no
clinical/radiographic evidence of disease and are being closely
followed for recurrence. No cancer recurrences have been detected
in patients with undetectable ctHPV16DNA. In summary the negative
predictive value and positive predictive value of the plasma
ctHPV16DNA assay in detecting cancer recurrence is 100% and 70%,
respectively. These observations suggest that plasma ctHPVDNA is
exquisitely specific and sensitive for the early detection of
HPV-associated cancer. Application of the disclosed method as part
of clinical care may improve the effectiveness and reducing the
cost of cancer surveillance for patients with HPV-associated
oropharyngeal cancer.
Example 5: Plasma Circulating Tumor HPV16DNA as a Biomarker for
Treatment of HPV-Associated OPSCC
[0141] The RTOG 0129 study demonstrated that exposures influence
clinical risk in oropharyngeal cancer. HPV-positive patients tend
to do well, and HPV-negative patients with extensive smoking
history do poorly. Most studies, including RTOG 0129, also
demonstrate an intermediate prognosis for HPV+ cancers that develop
in heavy smokers. This is shown in FIG. 8.
[0142] Genetic biomarkers can improve clinical risk stratification.
For example, a subset of tumors in HPV+ non-smokers may be
exceptionally sensitive to therapy, whereas, there may be smokers
with HPV+ cancers that have more HPV-like biology, and others that
may have more tobacco-like biology. Biomarkers may be able to
identify these subgroups better than clinical parameters alone.
[0143] Plasma ctHPVDNA is detected in a majority of HPV-OPSCC
patients. As such, ctHPV DNA can be a biomarker of tumor burden,
and as importantly, response kinetics. Plasma circulating tumor HPV
DNA can also inform decisions regarding who is appropriate for
de-escalated therapy of HPV-associated OPSSC.
[0144] A digital PCR assay has been developed for HPV16 DNA that
is: highly specific, in that the assay does not cross-detect
HPV-18, -31, -33, or 35, and has very low background signal; linear
over 5 orders of magnitude in copy number (5-50,000 copies);
precise and has exceptional reproducibility; and ultra-sensitive
and can detect as few as 6 copies of HPV16 with .about.80%
sensitivity. This is shown in FIGS. 1A and 1B. FIG. 1A shows an
example readout of this assay where positive droplets indicate the
presence of individual HPV16 DNA molecules, that are well separated
from the negative droplets in a reaction. FIG. 1B shows the 95%
confidence interval of a linear regression, demonstrating
incredible linearity and precision, with assay variability only
becoming an issue in the 10 target copy range. This assay can
detect as few as 6 target molecules of HPV16 DNA using an assay
threshold that gives no false positives.
[0145] A study population including 64 patients with biopsy-proven
HPV-positive OPSCC that overexpressed p16 (IHC) and/or were HPV ISH
positive. All patients received definitive chemo-radiation (no
induction chemo). 54 patients (84%) enrolled in a prospective CRT
de-intensification trial (60Gy IMRT+weekly Cisplatin 30
mg/m.sup.2). Of these, 46 patients were clinically favorable
(<T4 and 10 pack-years tobacco), and 18 were clinically
unfavorable (T4 or >10 pack-years tobacco). No patients had N3
or M1 disease. Research bloods were collected pre-treatment, weekly
during CRT, and at post-treatment clinic visits (-450 blood samples
analyzed).
[0146] Plasma ctHPV16DNA levels were measured during
chemo-radiotherapy. Plasma ctHPV16DNA is responsive to CRT and in
most cases is "cleared" after treatment. Its potential as a
biomarker of treatment efficacy, and correlation of peak-ctHPV16DNA
levels with smoking status, disease burden, and tumor HPV copy
number was evaluated. This regimen is shown in FIG. 10, and
normalized levels of ctHPV16DNA is depicted in FIG. 3A.
[0147] Plasma ctHPV16 DNA was detected in 77% of the patients, and
FIG. 11 indicates the peak value for each patient. As shown in FIG.
11, broad range of values was observed, with as few as 10 copies
per mL to as high as 30,000 copies per mL being observed. There
were also 23% of patients who did not have any detectable HPV16 DNA
in plasma. Furthermore, any significant correlation between the
amount of HPV16 in plasma and smoking status was not seen.
[0148] However, plasma ctHPV16 levels did not exhibit significant
correlation with disease burden, as shown in FIG. 3C. Many
different ways for a correlation between disease burden and peak
HPV16 DNA values were looked into, one could not be found. However,
by analyzing a 25 patient subset in whom tumor sequencing and
plasma HPV16 DNA had been matched, a modest but statistically
significant correlation between plasma circulating tumor HPV16 and
copy number of HPV16 in the tumor was identified, shown in FIG. 3D.
Thus, the number of HPV16 copies in plasma for a particular patient
may reflect HPV copy number in their tumor, and have prognostic
implications beyond disease stage and smoking history.
[0149] Attention was next turned to the HPV16 negative patients,
and digital PCR assays were developed for the 4 most common
alternative HPV strains. This analysis is shown in FIG. 12. Indeed
among the non-heavy smokers, all of the HPV16 negative patients had
detectable HPV 18/31/33 or 35 in their plasma. Among patients who
were heavy smokers a significantly different pattern was observed.
Slightly fewer patients were HPV16 positive. But among the HPV16
negative patients, only about 1/3rd had variant HPVs detectable,
with the remainder negative for all 5 HPV strains. Perhaps even
more concerning, 2 out of these four patients had a positive neck
dissection post-treatment, and one patient also tested positive for
a p53 mutation in the tumor. Among non-smokers no increased disease
events with alternative HPV strains were observed, however, among
smokers there were only 2 patients here but one of them developed
regional recurrence soon after completing CRT. Thus, there seems to
be an interactive effect of HPV16 negativity and smoking
status.
[0150] Variable clearance kinetics among patients who were high
expressers of HPV16 was also observed. As shown in FIG. 13, some
patients had exponential clearance of HPV16 DNA and others had a
more complex kinetic pattern with delayed clearance from plasma.
This was quantified by measuring how much plasma HPV DNA was
present at week 4 relative to the peak HPV value. For the top
patient, this value is 0%, and for the bottom it is 39%. The median
value of 5% was used to stratify patients as having either rapid
clearance or delayed clearance kinetics.
[0151] Putting this all together, plasma circulating tumor HPV16
based risk groups were defined. This is depicted in FIG. 14. The
favorable risk patients had abundant HPV16 and rapid clearance
kinetics. All other patients had unfavorable circulating tumor
HPV16 profiles either due to delayed kinetics, low copy number, due
to being positive for variant HPVs, or due to undetectable HPV. For
both non-smokers and smokers approximately 30% of patients had a
favorable circulating tumor HPV16 profile, and 70% were
unfavorable. Again noted here is the 20% subset of smokers in whom
the 5 most common HPV strains were not detected.
[0152] As shown in FIG. 4, patients with a favorable circulating
tumor HPV16 profile did not have any regional disease
events--regardless of smoking status. However, in cases of patients
having an unfavorable circulating tumor HPV profile, smoking status
had a major impact. Non-heavy smokers still did well, with 90%
regional disease control. However, heavy smokers or the minority
presenting with T4 disease had dismal regional disease control when
they also had unfavorable plasma circulating tumor HPV16
profiles.
[0153] In summary, plasma ctHPV16 DNA reveals genetic heterogeneity
among HPV-associated OPSCC patients 4/18 (22%) patients with >10
pack-years tobacco or T4 disease and p16+ OPSCC were negative for
HPV-16/18/31/33/35. Approximately 30% of HPV-associated OPSCC have
a favorable ctHPV16 Profile (i.e., .gtoreq.200 copies/mL and rapid
clearance kinetics) unfavorable ctHPV16 profiles (i.e.,
low/undetectable or delayed clearance) are strongly associated with
regional disease failure in heavy smokers. Assessment of ctHPV16
profiles can help guide treatment intensity in non-smokers and
smokers being treated for HPV-associated OPSCC.
Example 6: Application to Cancer Surveillance in a Longitudinal
Clinical Study of Patients that Do Not Exhibit Any Clinical
Evidence of Cancer Following Therapy
[0154] A prospective study was conducted of 73 patients who
previously were diagnosed with an HPV+ malignancy but were deemed
to have "no evidence of disease" after curative intent therapy. The
HPV blood test was applied to these patients during a routine
follow-up. None of the patients who tested negative in the HPV
blood test developed a new HPV+ cancer or recurrence of the prior
HPV+ cancer. In contrast, 9 out of 13 patients who tested positive
in the HPV blood test were diagnosed with an HPV+ cancer.
[0155] FIG. 7 depicts results of HPV blood tests. Negative samples
can be clearly distinguished from positive samples. FIG. 8 shows a
case summary for a patient who tested positive according to the HPV
blood test, but who exhibited no abnormality or evidence of disease
at a follow-up visit with the oncologist, and who had a recurrence
of disease several months after the follow-up.
[0156] A summary of the clinical results is shown in FIG. 7. These
results show the predictive effectiveness of the HPV blood test. Of
the 73 patients in the study, 60 tested negative according to the
HPV blood test, and of which none exhibited a recurrence of
disease. In contrast, of the 13 patients that tested positive
according to the HPV blood test, 9 had a recurrence of disease,
while the remaining 4 are being monitored closely for
recurrence.
Example 7: Modified Oligonucleotide Compositions and Methods for
Detection of Tumor-Derived HPV16
[0157] Provided in Table 14 below are primers and probes for
detection of tumor-derived HPV16, where the "+" signifies a locked
nucleic acid. Tumor derived HPV16 DNA can be detected and
distinguished from non-tumor sources using any three primer/probe
sets from Table 14 within a single multiplex digital PCR reaction,
where the central probe has a detection color distinct from both of
the other (boundary) probes. The two boundary probes may or may not
have the same color. The DNA of the primer/probe sets is modified
to include quenchers, dye moieties and locked nucleic acids. In
this example, droplets that are positive for the central probe's
detection label and negative for the boundary/distal probes
detection label contain tumor derived viral DNA.
[0158] FIG. 9 depicts the results of a multiplexed digital PCR
reaction to detect tumor-derived HPV16 DNA in a patient blood
sample that includes modified primer probe sets 3, 5 and 7 from
Table 14, where detection probe 5 is conjugated to HEX and
detection probes 3 and 7 are conjugated to FAM.
[0159] As another example, modified primer probe sets 4, 7, and 10
from Table 14 could be used for the multiplexed digital PCR
reaction to detect tumor-derived HPV16 DNA, where detection probe 7
is conjugated to FAM and detection probes 4 and 10 are conjugated
to HEX. Alternatively, detection 7 could be conjugated to FAM,
probe 4 conjugated to HEX, and probe 10 conjugated to a different
detection moiety.
[0160] In some embodiments, the primer/probe sets may be selected
so that no two sets are consecutive in Table 14. For illustration,
examples of triads in this embodiment with no consecutive primer
probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {14, 16,
18}. Examples of triads with a consecutive primer probe set include
{1, 2, 5} and {10, 12, 13}.
[0161] For the purposes of this application, digital PCR refers to
any method that will be understood to those versed in the art where
PCR reactions are partitioned into many sub-reactions for analysis.
The partition could be droplets or microwells or any other
partition used for digital PCR.
[0162] It is to be understood that HEX and FAM are used solely for
clarity and illustrative purposes in all the examples.
TABLE-US-00015 TABLE 14 Primers and Probes for HPV16 Amplicon
(size) Named Set (Assay) Detail as Sequence T.sub.M.sup.1 1 1A
Forward 1A_Primer1 5'TGC ACC AAA AGA GA+A CT3' 60.4 (70 bp) primer
(SEQ ID NO: 23) Reverse 1A_Primer2 5'GTG CAT AAC TGT GGT +AAC 60.5
primer T3'(SEQ ID NO: 24) TaqMan.RTM. 1A_Probe 5'/Dye/CT+G +TG+G
GTC +CT+G 68.2 probe A/Quencher/3'(SEQ ID NO: 25) 2 2A Forward
2A_Primer1 5'AGA GCT GCA AAC AAC TAT ACA3' 62 (78 bp) primer (SEQ
ID NO: 26) (E6) Reverse 2A_Primer2 5'TAT ACC TCA CGT CGC AGT3' 62.2
primer (SEQ ID NO: 27) TaqMan.RTM. 2A_Probe 5'/Dye/AGA ATG
TGT/Quencher- 67.5 probe 2/GTA CTG CAA GCA ACA GTT/Quencher-1/3'
(SEQ ID NO: 28) 3 3A Forward 3A_Primer1 5' CGT GAG GTA TAT GAC TTT
GCT 62.4 (75 bp) primer T 3' (SEQ ID NO: 29) Reverse 3A_Primer2 5'
TCA CAT ACA GCA TAT GGA TTC 62.1 primer C 3' (SEQ ID NO: 30)
TaqMan.RTM. 3A_Probe 5'/Dye/CG+G +GAT +TTA +T+G+C 69.4 probe
A/Quencher/3' (SEQ ID NO: 31) 4 4A Forward 4A_Primer1 5'GTT TTA TTC
TAA AAT TAG TGA+ 60.2 (75 bp) primer G+TA T3' (SEQ ID NO: 32)
Reverse 4A_Primer2 5'TTG TAT TGC TGT TCT A+AT GTT3' 59.9 primer
(SEQ ID NO: 33) TaqMan.RTM. 4A_Probe 5'/Dye/AGT T+T+G +TA+T+ 67.1
probe G+GA/Quencher/3' (SEQ ID NO: 34) 5 5A Forward 5A_Primer1 5'
CAA ACC GTT GTG TGA TTT GT 3' 61.9 (75 bp) primer (SEQ ID NO: 35)
Reverse 5A_Primer2 5' GAT GTC TTT GCT TTT CTT CAG 62 primer G 3'
(SEQ ID NO: 36) TaqMan.RTM. 5A_Probe 5'/Dye/AAG C+C+A +CTG+ 68.1
probe T+GT/Quencher/3' (SEQ ID NO: 37) 6 6A Forward 6A_Primer1 GGA
CAA AAA GCA A+AG3' 60.6 (75 bp) primer (SEQ ID NO: 38) Reverse
6A_Primer2 5'GA+T GAT CTG CAA CAA GAC3' 60.3 primer (SEQ ID NO: 39)
TaqMan.RTM. 6A_Probe 5'/Dye/TCC AC+C G+A+C CCCT/ 68 probe
Quencher/3' (SEQ ID NO: 40) 7 7A Forward 7A_Primer1 5' TGC ATG AAT
ATA TGT TAG ATT 61.9 (76 bp) primer TGC A 3' (SEQ ID NO: 41)
Reverse 7A_Primer2 5' TCC TCT GAG CTG TCA TTT AAT 61.9 primer T 3'
(SEQ ID NO: 42) TaqMan.RTM. 7A_Probe 5'/Dye/A+C+A A+C+T +GAT CT+CT/
68.2 probe Quencher/3' (SEQ ID NO: 43) 8 8A Forward 8A_Primer1
5'TGA +AAT AGA TGG TCC AGC3' 60 (74bp) primer (SEQ ID NO: 44)
Reverse 8A_Primer2 5'TGC AAC AAA AGG TTA CA+A 1A3' 60 primer (SEQ
ID NO: 45) TaqMan.RTM. 8A_Probe 5'/Dye/CAG +A+GC C+C+A T+T+A 68.1
probe C/Quencher/3' (SEQ ID NO: 46) 9 9A Forward 9A_Primer1 5'TGA
CTC TAC GCT TCG GTT G3' 63.6 (73bp) primer (SEQ ID NO: 47) (E7)
Reverse 9A_Primer2 5'GCC CAT TAA CAG GTC TTC C3' 62.3 primer (SEQ
ID NO: 48) TaqMan.RTM. 9A_Probe_v1 5'/Dye/TACAAAGCA/Quencher-2/CAC
68 probe ACG TAG ACA TTC GTA CTT/Quencher-1/3' (SEQ ID NO: 49)
9A_Probe_v2 5'/Dye/CGT ACA AAG/Quencher- 68.3 2/CAC ACA CGT AGA CAT
TCG TAC/Quencher-1/3' (SEQ ID NO: 50) 9A_Probe_v3
5'/Dye/CA+CA+C+G+TA+G+ACAT/ 67.7 Quencher/3' (SEQ ID NO: 51) 10 1B
Forward 1B_Primer1 5'ACT GCA ATG T+TT CAG G+A3' 60.2 (79 bp) primer
(SEQ ID NO: 52) Reverse 1B_Primer2 5'CAT +GTA +TAG +TTG ITT +GC3'
60.1 primer (SEQ ID NO: 53) TaqMan.RTM. 1B_Probe 5'/Dye/CGA CCC
AGA/Quencher- 68.3 probe 2/AAG TTA CCA CAG TTA TGC A/Quencher-1/3'
(SEQ ID NO: 54) 11 2B Forward 2B_Primer1 5'TTA GAA TGT GIG TAC TGC
+AA3' 60.2 (75 bp) primer (SEQ ID NO: 55) Reverse 2B_Primer2 5'CAT
AAA TCC +CGA AAA GCA3' 60.2 primer (SEQ ID NO: 56) TaqMan.RTM.
2B_Probe 5'/Dye/GCA ACA GTT/Quencher- 68.3 probe 2/ACT GCG ACG TGA
GGT AT/Quencher-1/3' (SEQ ID NO: 57) 12 3B Forward 3B_Primer1 5'CAT
A+GT ATA T+AG AG+A TGG 60.1 (75 bp) primer GA3' (SEQ ID NO: 58)
Reverse 3B_Primer2 5'TC+T ATA C+TC A+CT AAT TT+T 60.3 primer AG3'
(SEQ ID NO: 59) TaqMan.RTM. 3B_Probe 5'/Dye/A+T+C A+C+A TA+C+ 66.6
probe AGC/Quencher/3' (SEQ ID NO: 60) 13 4B Forward 4B_Primer1
5'CAT TAT TGT TAT A+G+T T+T+G 59.9 (73 bp) primer TA3' (SEQ ID NO:
61) 5'TAA TTA ACA AAT CAC A+CA ACG3' (SEQ ID NO: 62) Reverse
4B_Primer2 5'/Dye/TA+T +G+G+A A+CA A+CA 59.9 primer T/Quencher/3'
(SEQ ID NO: 63) TaqMan.RTM. 4B_Probe 5'TG+T ATT AA+C T+GT C+AA
AAG3' 67.6 probe (SEQ ID NO: 64) 14 5B Forward 5B_Primer1 5'GGA
+ATC TTT GCT -ITT +TGT3' 60.2 (70 bp) primer (SEQ ID NO: 65)
Reverse 5B_Primer2 5'/Dye/TG+T +GT+C +CT+G AAG 60.1 primer
A/Quencher/3' (SEQ ID NO: 66) TaqMan.RTM. 5B_Probe 5'ATA ATA TAA
GGG GTC G+GT G3' 68 probe (SEQ ID NO: 67) 15 6B Forward 6B_Primer1
5'AGC TGG GTT TCT CTA CG3' 60.1 (80 bp) primer (SEQ ID NO: 68)
Reverse 6B_Primer2 5'/Dye/CGG TCG ATG/Quencher- 60.4 primer 2/TAT
GTC TTG TTG CAG ATC ATC/Quencher-1/3' (SEQ ID NO: 69) TaqMan.RTM.
6B_Probe_v1 5'/Dye/CCG GTC GAT/Quencher- 68.4 probe 2/GTA TGT CTT
GTT GCA GAT/Quencher-1/3' (SEQ ID NO: 70) 6B_Probe_v2 5'TGC ATG GAG
ATA CAC CT3' 68.3 (SEQ ID NO: 71) 16 7B Forward 7B_Primer1 5'ACA
GTA G+AG ATC AGT TGT3' 59.7 (72 bp) primer (SEQ ID NO: 72) Reverse
7B_Primer2 5'/Dye/CC+A G+A+G A+C+A 59.9 primer A+CT/Quencher/3'
(SEQ ID NO: 73) TaqMan.RTM. 7B_Probe 5'TAT GAG CAA TTA A+A+T G+AC
68.4 probe A3' (SEQ ID NO: 74) 17 8B Forward 8B_Primer1 5'ATT GT+A
ATG GGC TCT GTC3' 60 (92 bp) primer (SEQ ID NO: 75) Reverse
8B_Primer2 5'/Dye/ATT T+C+A TC+C +T+C+C 59.9 primer T/Quencher/3'
(SEQ ID NO: 76) TaqMan.RTM. 8B_Probe 5'TAC +AAA GCA CAC ACG TAG3'
68.1 probe (SEQ ID NO: 77) 18 9B Forward 9B_Primer1 5'TT+A TGG ITT
CTG AGA ACA 60 (92 bp) primer GAT3' (SEQ ID NO: 78) Reverse
9B_Primer2 5'/Dye/TGG AAG ACC/Quencher- 60.4 primer 2/TGT TAA TGG
GCA CAC TaqMan.RTM. 9B_Probe T/Quencher-1/3' 68.1 probe (SEQ ID NO:
79) .sup.1''Dye'' stands for a fluorescent reporter dye. Any
reporter dyes such as FAM.TM., HEX.TM., VIC.RTM., Cy5.TM., and
Cy5.5.TM. that is compatible with the detection channels for the
instrument can be used. A quencher compatible with the respective
dye was used at 3' end of the probe (Quencher-1). A second quencher
(Quencher-2) such as ZEN was sometimes placed internally between
9.sup.th and 10.sup.th nucleotide base from the reporter dye to
enhance the overall dye quenching. .sup.2 These estimates of
melting temperature(T.sub.M) were calculated using IDT'S oligo
analyzer tools with following settings: (a) For primers: Target
type = DNA, Oligo concentration = 0.9 .mu.M, Na.sup.+ concentration
= 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration =
0.8 mM. (b) for Probe: Target type = DNA, Oligo concentration =
0.25 .mu.M, Na.sup.+ concentration = 50 mM, Mg.sup.++ concentration
= 3 mM, and dNTPs concentration = 0.8 mM. .sup.3 + = Locked nucleic
acid
Example 8: Modified Oligonucleotide Compositions and Methods for
Detection of Tumor-Derived HPV18
[0163] Provided in Table 15 below are primers and probes for
detection of tumor-derived HPV18, where the "+" signifies a locked
nucleic acid. Tumor derived HPV18 DNA can be detected and
distinguished from non-tumor sources using any three primer/probe
sets from Table 15 within a single multiplex digital PCR reaction,
where the central probe has a detection color distinct from both of
the other (boundary) probes. The two boundary probes may or may not
have the same color. The DNA of the primer/probe sets is modified
to include quenchers, dye moieties, and locked nucleic acids. In
this example, droplets that are positive for the central probe's
detection label and negative for the boundary/distal probes
detection label contain tumor derived viral DNA.
[0164] For example, modified primer probe sets 4, 7, and 10 from
Table 15 could be used for the multiplexed digital PCR reaction to
detect tumor-derived HPV18 DNA, where detection probe 7 is
conjugated to FAM and detection probes 4 and 10 are conjugated to
HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4
conjugated to HEX, and probe 10 conjugated to a different detection
moiety.
[0165] In some embodiments, the primer/probe sets may be selected
so that no two sets are consecutive in Table 15. For illustration,
examples of triads in this embodiment with no consecutive primer
probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {14, 16,
18}. Examples of triads with a consecutive primer probe set include
{1, 2, 5} and {10, 12, 13}.
[0166] For the purposes of this application, digital PCR refers to
any method that will be understood to those versed in the art where
PCR reactions are partitioned into many sub-reactions for analysis.
The partition could be droplets or microwells or any other
partition used for digital PCR.
[0167] It is to be understood that HEX and FAM are used solely for
clarity and illustrative purposes in all the examples.
TABLE-US-00016 TABLE 15 Primers and probes for HPV18 Amplicon
(size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1C
Forward primer 1C_Primer1 5'CGC TTT GAG GAT CCA AC3' 60 (70 bp)
(SEQ ID NO: 80) (E6) Reverse primer 1C_Primer2 5'GCA GTG AAG TGT
TCA GTT3' 60 (SEQ ID NO: 81) TaqMan.RTM. 1C_Probe 5'/Dye/ACC CTA
CAA/Quencher-2/GCT ACC TGA 67.6 probe TCT GTG C/Quencher-1/3' (SEQ
ID NO: 82) 2 2C Forward primer 2C_Primer1 5'AAG ACA +TAG AAA TAA
CCT +GT3' 60.2 (76 bp) (SEQ ID NO: 83) (E6) Reverse primer
2C_Primer2 5'TTA A+A+T +G+CA AAT TCA AAT3' 60.3 (SEQ ID NO: 84)
TaqMan.RTM. 2C_Probe 5'/Dye/TGC AAG ACA /Quencher-2/GTA TTG GAA
67.7 probe CTT ACA GAG GT/Quencher-1/3' (SEQ ID NO: 85) 3 3C
Forward primer 3C_Primer1 5'TTA T+TT GTG GTG TAT A+GA GA3' 59.8 (80
bp) (SEQ ID NO: 86) (E6) Reverse primer 3C_Primer2 5'AAT T+CT +CTA
ATT +CTA GAA TAA3' 59.8 (SEQ ID NO: 87) TaqMan probe 3C_Probe
5'/Dye/CA+T G+C+G +G+TA +TAC T/Quencher/3' 68.2 (SEQ ID NO: 88) 4
4C Forward primer 4C_Primer1 5'AAG AC+A TTA +TTC AGA C+TC T3' 60.2
(72 bp) (SEQ ID NO: 89) (E6) Reverse primer 4C_Primer2 5'AAT AAA
TTG +TAT AAC +C+CA3' 60.4 (SEQ ID NO: 90) TaqMan.RTM. 4C_Probe
5'/Dye/TG+G +AGA +C+A+C +ATT/Quencher/3' 67.6 probe (SEQ ID NO: 91)
5 5C Forward primer 5C_Primer1 5'AGAAACCGTT G AATCCAG3' 59.5 (71
bp) (SEQ ID NO: 92) (E6) Reverse primer 5C_Primer2 5'ATT TCA CAA
CAT AGC TGG G3' 60.1 (SEQ ID NO: 93) TaqMan.RTM. 5C_Probe
5'/Dye/AG+A CA+C +C+TT AA+T +GA/Quencher/3' 68.1 probe (SEQ ID NO:
94) 6 6C Forward primer 6C_Primer1 5'CCA GTG CCA TTC GTG C3' 60.8
(80 bp) (SEQ ID NO: 95) (E6) Reverse primer 6C_Primer2 5'TTA TA+C
TTG +TGT TTC TCT G3' 60.1 (SEQ ID NO: 96) TaqMan.RTM. 6C_Probe
5'/Dye/CAC GAC AGG /Quencher-2/AAC GAC 68.3 probe TCC AAC
GAC/Quencher-1/3' (SEQ ID NO: 97) 7 7C Forward primer 7C_Primer1
5'ATG GAC CTA AGG CAA CA3' 60.3 (72 bp) (SEQ ID NO: 98) (E7)
Reverse primer 7C_Primer2 5'TG+A CAT AGA AGG TCA ACC3' 60.2 (SEQ ID
NO: 99) TaqMan.RTM. 7C_Probe 5'/Dye/TT+T A+G+A +G+CC
+CC/Quencher/3' 68.2 probe (SEQ ID NO: 100) 8 8C Forward primer
8C_Primer1 5'CGA GCA A+TT AAG CGA CTC3' 60.2 (75 bp) (SEQ ID NO:
101) (E7) Reverse primer 8C_Primer2 5'CGG GCT GGT AAA TGT TGA3' 60
(SEQ ID NO: 102) TaqMan.RTM. 8C_Probe 5'/Dye/T+C+G +TTT T+CT T+C+C
T/Quencher/3' 68.1 probe (SEQ ID NO: 103) 9 9C(75 bp) Forward
primer 9C_Primer1 5'ACA ACG TCA CAC AAT GTT3' 60.1 (E7) (SEQ ID NO:
104) Reverse primer 9C_Primer2 5'TCT GCT GG CTT TCT ACT3' 60 (SEQ
ID NO: 105) TaqMan.RTM. 9C_Probe 5'/Dye/TGT ATG TGT /Quencher-2/TGT
AAG TGT 66.9 probe GAA GCC AGA AT/Quencher-1/3' (SEQ ID NO: 106) 10
10C Forward primer 10C_Primer1 5'ACC TTC GAG CAT TCC A3' 60.2 (74
bp) (SEQ ID NO: 107) (E7) Reverse primer 10C_Primer2
5TTACTGCTGGGATGCA3' 60.2 (SEQ ID NO: 108) TaqMan.RTM. 10C_Probe
5'/Dye/CTG AA+C +AC+C C+T+G T/Quencher/3' 68.2 probe (SEQ ID NO:
109) 11 1D Forward primer 1D_Primer1 5'CCC TAC AAG CTA CCT GAT3' 60
(83 bp) (SEQ ID NO: 110) (E6) Reverse primer 1D_Primer2 5'CAA TAT
A+CA +CAG +GT+T ATT T3' 60.1 (SEQ ID NO: 111) TaqMan.RTM. 1D_Probe
5'/Dye/CA+C +G+GA A+C+T GAA C/Quencher/3' 68.1 probe (SEQ ID NO:
112) 12 2D Forward primer 2D_Primer1 5TAT TT+G +AAT TT+G +CAT
+TTA3' 59.9 (92 bp) (SEQ ID NO: 113) (E6) Reverse primer 2D_Primer2
5'AAT +CTA TA+C +ATT TAT +GGC3' 59.9 (SEQ ID NO: 114) TaqMan.RTM.
2D_Probe 5'/Dye/AG+A C+AG +TA+T AC+C 67.9 probe +GC/Quencher/3'
(SEQ ID NO: 115) 13 3D Forward primer 3D_Primer1 5'CTA G+AA TTA
+G+A+G AAT T+AA GA3' 60.1 (74 bp) (SEQ ID NO: 116) (E6) Reverse
primer 3D_Primer2 5'AGT GTT AGT TAG TTT +TTC CAA T3' 60.1 (SEQ ID
NO: 117) TaqMan.RTM. 3D_Probe 5'/Dye/TC+A +G+A+C T+CT G+TG
T/Quencher/3' 68.4 probe (SEQ ID NO: 118) 14 4D Forward primer
4D_Primer1 5'ATT A+AT AAG GTG CC+T GC3' 60.2 (75 bp) (SEQ ID NO:
119) (E6) Reverse primer 4D_Primer2 5'TCG TTT TTC ATT A+AG GTG T3'
60 (SEQ ID NO: 120) TaqMan.RTM. 4D_Probe 5'/Dye/TGA AT+C +C+AG
C+A+G A/Quencher/3' 67.8 probe (SEQ ID NO: 121) 15 5D Forward
primer 5D_Primer1 5'ATT TCA CAA CAT AGC TGG G3' 60.1 (98 bp) (SEQ
ID NO: 122) (E6) Reverse primer 5D_Primer2 5'GTT TCT CTG CGT CGT
TG3' 60.4 (SEQ ID NO: 123) TaqMan.RTM. 5D_Probe 5'/Dye/AG+T G+C+C
+A+TT C+GT G/Quencher/3' 68.3 probe (SEQ ID NO: 124) 16 6D Forward
primer 6D_Primer1 5'ATT +GTA TTG CAT TTA GAG CC3' 59.8 (90 bp) (SEQ
ID NO: 125) (E7) Reverse primer 6D_Primer2 5'TTC ATC GTT TTC TTC
+CTC3' 59.9 (SEQ ID NO: 126) TaqMan.RTM. 6D_Probe 5'/Dye/CTA T+G+T
+CA+C +G+AG C/Quencher/3' 68.2 probe (SEQ ID NO: 127) 17 7D Forward
primer 7D_Primer1 5'ATA GAT G+GA GTT A+AT CAT CA3' 59.7 (82 bp)
(SEQ ID NO: 128) (E7) Reverse primer 7D_Primer2 5'AC+T TAC AAC ACA
+TAC ACA3' 60 (SEQ ID NO: 129) TaqMan.RTM. 7D_Probe 5'/Dye/CCG AAC
CAC /Quencher-2/AAC GTC ACA 67.8 probe CAA TGT T/Quencher-1/3' (SEQ
ID NO: 130) 18 8D Forward primer 8D_Primer1 5'TGA AGC CAG AAT TGA
GCT AG3' 61.9 (83 bp) (SEQ ID NO: 131) (E7) Reverse primer
8D_Primer2 5'AGG ACA GGG TGT TCA GAA3' 62.6 (SEQ ID NO: 132)
TaqMan.RTM. 8D_Probe 5'/Dye/CA+GA+C+GAC+CTTCG/Quencher/3' 65.9
probe (SEQ ID NO: 133) .sup.1"Dye" stands for a fluorescent
reporter dye. Any reporter dyes such as FAM.TM., HEX.TM., VIC.RTM.,
Cy5.TM., and Cy5.5.TM. that is compatible with the detection
channels for the instrument can be used. A quencher compatible with
the respective dye was used at 3' end of the probe (Quencher-1). A
second quencher (Quencher-2) such as ZEN was sometimes placed
internally between 9.sup.th and 10.sup.th nucleotide base from the
reporter dye to enhance the overall dye quenching. .sup.2These
estimates of melting temperature(T.sub.M) were calculated using
IDT'S oligo analyzer tools with following settings: (a) For
primers: Target type = DNA, Oligo concentration = 0.9 .mu.M,
Na.sup.+ concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and
dNTPs concentration = 0.8 mM. (b) for Probe: Target type = DNA,
Oligo concentration = 0.25 .mu.M, Na.sup.+ concentration = 50 mM,
Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM.
.sup.3+ = Locked nucleic acid
Example 9: Modified Oligonucleotide Compositions and Methods for
Detection of Tumor-Derived HPV31
[0168] Provided in Table 16 below are primers and probes for
detection of tumor-derived HPV31, where the "+" signifies a locked
nucleic acid. Tumor derived HPV31 DNA can be detected and
distinguished from non-tumor sources using any three primer/probe
sets from Table 16 within a single multiplex digital PCR reaction,
where the central probe has a detection color distinct from both of
the other (boundary) probes. The two boundary probes may or may not
have the same color. The DNA of the primer/probe sets is modified
to include quenchers, dye moieties and locked nucleic acids. In
this example, droplets that are positive for the central probe's
detection label and negative for the boundary/distal probes
detection label contain tumor derived viral DNA.
[0169] For example, modified primer probe sets 4, 7, and 10 from
Table 16 could be used for the multiplexed digital PCR reaction to
detect tumor-derived HPV31 DNA, where detection probe 7 is
conjugated to FAM and detection probes 4 and 10 are conjugated to
HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4
conjugated to HEX, and probe 10 conjugated to a different detection
moiety.
[0170] In some embodiments, the primer/probe sets may be selected
so that no two sets are consecutive in Table 16. For illustration,
examples of triads in this embodiment with no consecutive primer
probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {13, 15,
17}. Examples of triads with a consecutive primer probe set include
{1, 2, 5} and {10, 12, 13}.
[0171] For the purposes of this application, digital PCR refers to
any method that will be understood to those versed in the art where
PCR reactions are partitioned into many sub-reactions for analysis.
The partition could be droplets or microwells or any other
partition used for digital PCR.
[0172] It is to be understood that HEX and FAM are used solely for
clarity and illustrative purposes in all the examples.
TABLE-US-00017 TABLE 16 Primers and probes for HPV31 Amplicon
(size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1E
Forward primer 1E_Primer1 5'ATG TTC AAA AA+T CCT GCA3' 60 (75 bp)
(SEQ ID NO: 134) (E6) Reverse primer 1E_Primer2 5'TTC ATC GTA GGG
TAT +TTC C3' 60.2 (SEQ ID NO: 135) TaqMan.RTM. probe 1E_Probe
5'/Dye/AAC +T+AA G+C+T C+G+G C/Quencher/3' 68.3 (SEQ ID NO: 136) 2
2E Forward primer 2E_Primer1 5'CT+A AGA TTG A+AT TGT GT+C T3' 59.9
(75 bp) (SEQ ID NO: 137) (E6) Reverse primer 2E_Primer2 5'TAA ATC
+TGT AAA TGC AA+A ATC TA 3' 59.9 (SEQ ID NO: 138) TaqMan.RTM. probe
2E_Probe 5'/Dye/AC+A GA+A A+CA +G+AG 68.1 +GT/Quencher/3' (SEQ ID
NO: 139) 3 3E Forward primer 3E_Primer1 5'ACA ATA +GTA TAT AGG GAC
GAC3' 59.9 (75 bp) (SEQ ID NO: 140) (E6) Reverse primer 3E_Primer2
5'TTC ACT +TAC TTT TGA +ATA +AAA T3' 59.8 (SEQ ID NO: 141)
TaqMan.RTM. probe 3E_Probe 5'/Dye/AC+G +G+AG TG+T +GTA
C/Quencher/3' 68.1 (SEQ ID NO: 142) 4 4E Forward primer 4E_Primer1
5'TTT A+GA TG+G TAT AGA TAT AGT GT3' 60 (81 bp) (SEQ ID NO: 143)
(E6) Reverse primer 4E_Primer2 5'CC+T AAT TAA +C+AA ATC ACA TA3' 60
(SEQ ID NO: 144) TaqMan.RTM. probe 4E_Probe 5'/Dye/A+T+G +G+AA
+C+AA CAT T/Quencher/3' 67.7 (SEQ ID NO: 145) 5 5E Forward primer
5E_Primer1 5'TGT AT+A ACG TGT +CAA AGA C 60 (74 bp) (SEQ ID NO:
146) (E6) Reverse primer 5E_Primer2 5'TTG TGG AAT C+GT T+TC TTT3'
59.9 (SEQ ID NO: 147) TaqMan.RTM. probe 5E_Probe 5'/Dye/TGT +G+TC
+C+AG A+A+G A/Quencher/3' 68.4 (SEQ ID NO: 148) 6 6E Forward primer
6E_Primer1 CAT AGG AGG AAG GTG GAC 60.5 (70 bp) (SEQ ID NO: 149)
(E6) Reverse primer 6E_Primer2 5'TTA CAC TT+G GGT +TTC AG3' 60.2
(SEQ ID NO: 150) TaqMan.RTM. probe 6E_Probe 5'/Dye/CGT TGC ATA
/Quencher-2/GCA TGT 67.4 TGG AGA AGA CC/Quencher-1/3' (SEQ ID NO:
151) 7 7E Forward primer 7E_Primer1 5'CAA GA+C TAT GTG TTA +GAT T3'
59.9 (75 bp) (SEQ ID NO: 152) (E7) Reverse primer 7E_Primer2 5'TCA
TCT GAG CTG TC+G G+GT AAT T3' 60.1 (SEQ ID NO: 153) TaqMan.RTM.
probe 7E_Probe 5'/Dye/AAC TGA +C+C+T C+C+A C/Quencher/3' 68.3 (SEQ
ID NO: 154) 8 8E Forward primer 8E_Primer1 5'AGG ATG TCA TA+G ACA
GTC3' 59.8 (89 bp) (SEQ ID NO: 155) (E7) Reverse primer 8E_Primer2
5'TG+T AGA CTT ACA CTG ACA A3' 60.3 (SEQ ID NO: 156) TaqMan.RTM.
probe 8E_Probe 5'/Dye/CTG +G+AC A+AG +C+AG A/Quencher/3' 68 (SEQ ID
NO: 157) 9 9E Forward primer 9E_Primer1 5'AGC ACA CAA GTA GAT ATT
CGC3' 62.4 (79 bp) (SEQ ID NO: 158) (E7) Reverse primer 9E_Primer2
5'TAG TAG AAC AGT TGG GGC A3' 62.6 (SEQ ID NO: 159) TaqMan.RTM.
probe 9E_Probe 5'/Dye/TAA+C+AG+CT+C+TTG+C/Quencher/3' 65.3 (SEQ ID
NO: 160) 10 1F Forward primer 1F_Primer1 5'AAA TTG CAT G+AA CTA
+AGC3' 60.2 (82 bp) (SEQ ID NO: 161) (E6) Reverse primer 1F_Primer2
5'TT+A ACT GAC CTT TGC AGT3' 59.8 (SEQ ID NO: 162) TaqMan.RTM.
probe 1F_Probe 5'/Dye/CGG CAT TGG /Quencher-2/AAA TAC 68.1 CCT ACG
ATG AAC TAA/Quencher-1/3' (SEQ ID NO: 163) 11 2F Forward primer
2F_Primer1 5'CAG AA+A CAG AGG TAT TA+G AT3' 60.1 (90 bp) (SEQ ID
NO: 164) (E6) Reverse primer 2F_Primer2 5'TTA +AAC ATT TTG TAC A+CA
CT3' 59.8 (SEQ ID NO: 165) TaqMan.RTM. probe 2F_Probe 5'/Dye/AC+G
+A+CA +C+AC CAC A/Quencher/3' 68.1 (SEQ ID NO: 166) 12 3F Forward
primer 3F_Primer1 5'ATT T+TA TTC AA+A AGT A+AG TGA3' 59.8 (81 bp)
(SEQ ID NO: 167) (E6) Reverse primer 3F_Primer2 5'CCT +TTG TTT GTC
+AAT T+TT TC3' 60.1 (SEQ ID NO: 168) TaqMan.RTM. probe 3F_Probe
5'/Dye/TAG +T+G+T GTA +T+G+G A/Quencher/3' 68.7 (SEQ ID NO: 169) 13
4F Forward primer 4F_Primer1 5'TAT ATG TGA TTT GTT A+AT TA+G GT3'
60 (75 bp) (SEQ ID NO: 170) (E6) Reverse primer 4F_Primer2 5'TCC
AA+A TGT C+TT TGT TTT TC3' 60.1 (SEQ ID NO: 171) TaqMan.RTM. probe
4F_Probe 5'/Dye/CC+G TT+G T+G+T +C+CA G/Quencher/3' 68.1 (SEQ ID
NO: 172) 14 5F Forward primer 5F_Primer1 5'TAA AAA G+AA ACG ATT
+CCA C3' 60.1 (80 bp) (SEQ ID NO: 173) (E6) Reverse primer
5F_Primer2 5'TT+T CAG TAC GAG GTC TTC3' (SEQ ID NO: 174)
TaqMan.RTM. probe 5F_Probe 5'/Dye/AAG GTG GAC /Quencher-2/AGG ACG
66.5 TTG CA/Quencher-1/3' (SEQ ID NO: 175) 15 6F Forward primer
6F_Primer1 5'TGG AGA AAC ACC TAC GT3' 59.8 (74 bp) (SEQ ID NO: 176)
(E7) Reverse primer 6F_Primer2 5'TAA TTG CTC AT+A ACA GTG GA3' 60
(SEQ ID NO: 177) TaqMan.RTM. probe 6F_Probe 5'/Dye/AA+C +C+T+G AGG
CAA C/Quencher/3' 68.3 (SEQ ID NO: 178) 16 7F Forward primer
7F_Primer1 5'AGA TGA GGA GGA TGT C+AT3' 60.3 (74 bp) (SEQ ID NO:
179) (E7) Reverse primer 7F_Primer2 5'AG+G TAA +CGA TAT T+GT AAT
T3' 59.8 (SEQ ID NO: 180) TaqMan.RTM. probe 7F_Probe 5'/Dye/CA+A
+G+C+A G+AA C+CG/Quencher/3' 67.9 (SEQ ID NO: 181) 17 8F Forward
primer 8F_Primer1 5'TGT CAG T+GT AAG TC+T ACA3' 60.2 (90 bp) (SEQ
ID NO: 182) (E7) Reverse primer 8F_Primer2 5'TCC AAA TGA GCC C+AT
TAA3' 59.9 (SEQ ID NO: 183) TaqMan.RTM. probe 8F_Probe 5'/Dye/TGT
+A+C+A +GA+G CA+C A/Quencher/3' 68.2 (SEQ ID NO: 184) .sup.1"Dye"
stands for a fluorescent reporter dye. Any reporter dyes such as
FAM.TM., HEX.TM., VIC.RTM., Cy5.TM., and Cy5.5.TM. that is
compatible with the detection channels for the instrument can be
used. A quencher compatible with the respective dye was used at 3'
end of the probe (Quencher-1). A second quencher (Quencher-2) such
as ZEN was sometimes placed internally between 9.sup.th and
10.sup.th nucleotide base from the reporter dye to enhance the
overall dye quenching. .sup.2 These estimates of melting
temperature(TM) were calculated using IDT'S oligo analyzer tools
with following settings: (a) For primers: Target type = DNA, Oligo
concentration = 9 .mu.M, Na.sup.+ concentration = 50 mM, Mg.sup.++
concentration = 3 mM, and dNTPs concentration = 8 mM. (b) for
Probe: Target type = DNA, Oligo concentration .sup.3 + = Locked
nucleic acid
Example 10: Modified Oligonucleotide Compositions and Methods for
Detection of Tumor-Derived HPV33
[0173] Provided in Table 17 below are primers and probes for
detection of tumor-derived HPV33, where the "+" signifies a locked
nucleic acid. Tumor derived HPV33 DNA can be detected and
distinguished from non-tumor sources using any three primer/probe
sets from Table 17 within a single multiplex digital PCR reaction,
where the central probe has a detection color distinct from both of
the other (boundary) probes. The two boundary probes may or may not
have the same color. The DNA of the primer/probe sets is modified
to include quenchers, dye moieties and locked nucleic acids. In
this example, droplets that are positive for the central probe's
detection label and negative for the boundary/distal probes
detection label contain tumor derived viral DNA.
[0174] For example, modified primer probe sets 4, 7, and 10 from
Table 17 could be used for the multiplexed digital PCR reaction to
detect tumor-derived HPV33 DNA, where detection probe 7 is
conjugated to FAM and detection probes 4 and 10 are conjugated to
HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4
conjugated to HEX, and probe 10 conjugated to a different detection
moiety.
[0175] In some embodiments, the primer/probe sets may be selected
so that no two sets are consecutive in Table 17. For illustration,
examples of triads in this embodiment with no consecutive primer
probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {11, 13,
15}. Examples of triads with a consecutive primer probe set include
{1, 2, 5} and {10, 12, 13}.
[0176] For the purposes of this application, digital PCR refers to
any method that will be understood to those versed in the art where
PCR reactions are partitioned into many sub-reactions for analysis.
The partition could be droplets or microwells or any other
partition used for digital PCR.
[0177] It is to be understood that HEX and FAM are used solely for
clarity and illustrative purposes in all the examples.
TABLE-US-00018 TABLE 17 Primers and probes for HPV33 Amplicon
(size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1G (75
bp) Forward primer 1G_Primer1 5'TTC AAG ACA CTG AGG +AAA3' 59.9 (E6
assay) (SEQ ID NO: 185) Reverse primer 1G_Primer2 5'AAT GTT GT+G
TAT AGT T+GT CTC3' 60.2 (SEQ ID NO: 186) TaqMan.RTM. probe 1G_Probe
5'/Dye/AAC ATT GCA /Quencher-2/TGA TTT 67.6 GTG CCA AGC
ATT/Quencher-1 /3' (SEQ ID NO: 187) 2 2G (77 bp) Forward primer
2G_Primer1 5'AAT GCA AAA AAC CTT +TGC3' 60.1 (E6 assay) (SEQ ID NO:
188) Reverse primer 2G_Primer2 5'TCC C+TC TCT +ATA TAC A+AC T3'
60.2 (SEQ ID NO: 189) TaqMan.RTM. probe 2G_Probe 5'/Dye/CG+A TC+T
+G+AG G+T+A 67.1 T/Quencher/3' (SEQ ID NO: 190) 3 3G (83 bp)
Forward primer 3G_Primer1 5'AAT +CCA TTT G+GA ATA TG+T A3' 59.8 (E6
assay) (SEQ ID NO: 191) Reverse primer 3G_Primer2 5'CCA +TAT A+CA
+GAA T+AA TTA TAA 60 TG3' (SEQ ID NO: 192) TaqMan.RTM. probe
3G_Probe 5'/Dye/CT+G +T+GT TTG +C+GG 68.2 T/Quencher/3' (SEQ ID NO:
193) 4 4G (75 bp) Forward primer 4G_Primer1 5'TGA +A+AT ATT AAT
TA+G +GTG T3' 60 (E6 assay) (SEQ ID NO: 194) Reverse primer
4G_Primer2 5'TTT AAA TCC ACA TGT +CGT T3' 59.9 (SEQ ID NO: 195)
TaqMan.RTM. probe 4G_Probe 5'/Dye/TG+T GTC +C+T+C +AA+G 68
A/Quencher/3' (SEQ ID NO: 196) 5 5G (82 bp) Forward primer
5G_Primer1 5'CAA A+CG +ATT T+CA TAA TA+T T3' 59.9 (E6 assay) (SEQ
ID NO: 197) Reverse primer 5G_Primer2 5'CAG TGC AGT TTC TCT ACG3'
59.6 (SEQ ID NO: 198) TaqMan.RTM. probe 5G_Probe 5'/Dye/ACA +CG+C
CGC +ACA 68.1 G/Quencher/3' (SEQ ID NO: 199) 6 6G (75 bp) Forward
primer 6G_Primer1 5'ACA CAA GCC AAC GTT AAA3' 60.1 (E6 assay) (SEQ
ID NO: 200) Reverse primer 6G_Primer2 5'AAT TGC TCA TA+G CA+G TAT
A3' 59.9 (SEQ ID NO: 201) TaqMan.RTM. probe 6G_Probe 5'/Dye/ATC
+C+T+G AA+C +CAA 67.8 C/Quencher/3' (SEQ ID NO: 202) 7 7G (83 bp)
Forward primer 7G_Primer1 5'AAG TGA CAG CTC AGA TGA3' 60.3 (E7
assay) (SEQ ID NO: 203) Reverse primer 7G_Primer2 5'TTA CA+A TGT
AGT AA+T CAG CT3' 60.1 (SEQ ID NO: 204) TaqMan.RTM. probe 7G_Probe
5'/Dye/CG+G T+C+C AA+G CCT 67.8 T/Quencher/3' (SEQ ID NO: 205) 8 8G
(87 bp) Forward primer 8G_Primer1 5'TAACACC AC AGTT CGTTTATGT3'
62.4 (E7 assay) (SEQ ID NO: 206) Reverse primer 8G_Primer2
5'ACAATATTCACTGTGCCCATA3' 61.9 (SEQ ID NO: 207) TaqMan.RTM. probe
8G_Probe_v 5'/Dye/TG +AC+C +TA+CG 66.4 1 +A+ACC/Quencher/3' (SEQ ID
NO: 208) 8G_Probe_v 5'/Dye/CAG +TA+C +AG+C A+A+G 68.3 2
T/Quencher/3' (SEQ ID NO: 209) 9 1H (81 bp) Forward primer
1H_Primer1 5'CAA GCA TTG GAG AC+A ACT A3' 60.3 (E6 assay) (SEQ ID
NO: 210) Reverse primer 1H_Primer2 5'TAT ACC TCA GAT CG+T TGC3' 60
(SEQ ID NO: 211) TaqMan.RTM. probe 1H_Probe 5'/Dye/TC+C A+C+G CAC
+TG+T 68.6 A/Quencher/3' (SEQ ID NO: 212) 10 2H (75 bp) Forward
primer 2H_Primer1 5'TGA TT+T TGC ATT TGC AGA3' 60.1 (E6 assay) (SEQ
ID NO: 213) Reverse primer 2H_Primer2 5'CAA A+CA CA+G TTT A+CA
TAT3' 60 (SEQ ID NO: 214) TaqMan.RTM. probe 2H_Probe 5'/Dye/TT+C
+C+CT +C+T+C TAT 68 A/Quencher/3' (SEQ ID NO: 215) 11 3H (79 bp)
Forward primer 3H_Primer1 5'GTT +C+TT AT+C TAA AAT TA+G TG3' 59.7
(E6 assay) (SEQ ID NO: 216) Reverse primer 3H_Primer2 5'TTT AAC
TG+T TTG TTC +TAA TGT3' 60 (SEQ ID NO: 217) TaqMan.RTM. probe
3H_Probe_v 5'/Dye/TT+C +C+AT ATA +C+A+G 65 1 A/Quencher/3' (SEQ ID
NO: 218) 3H_Probe_v 5'/Dye/T+CT G+TA TA+T +G+G+A 65 2 A/Quencher/3'
(SEQ ID NO: 219) 12 4H (80 bp) Forward primer 4H_Primer1 5'AGG TGT
ATT ATA T+GT CAA A+GA3' 59.9 (E6 assay) (SEQ ID NO: 220) Reverse
primer 4H_Primer2 5'ATA TTA TGA AAT +C+G+T TTG TT3' 60.2 (SEQ ID
NO: 221) TaqMan.RTM. probe 4H_Probe_v 5'/Dye/TT+G T+GT +C+C+T CA+A
67.9 1 G/Quencher/3' (SEQ ID NO: 222) 4H_Probe_v 5'/Dye/CG+A +CAT
GT+G +G+AT 67 2 T/Quencher/3' (SEQ ID NO: 223) 13 5H (74 bp)
Forward primer 5H_Primer1 5'AG+G +AAT ATG T+TT TA+G ATT3' 60.1 (E6
assay) (SEQ ID NO: 224) Reverse primer 5H_Primer2 5'ATC TGA GCT GTC
ACT +TAA3' 60.2 (SEQ ID NO: 225) TaqMan.RTM. probe 5H_probe
5'/Dye/TG+A +C+C+T A+TA +CTG 68.1 C/Quencher/3' (SEQ ID NO: 226) 14
6H (77 bp) Forward primer 6H_Primer1 5'GAG GAT GAA GGC TTG GA3'
60.6 (E7 assay) (SEQ ID NO: 227) Reverse primer 6H_Primer2 5'TGA
CA+A CAG GTT A+CA AT3' 60.3 (SEQ ID NO: 228) TaqMan.RTM. probe
6H_probe 5'/Dye/CCA GAT GGA /Quencher-2/CAA 67.7 GCA CAA CCA
GC/Quencher-1/3' (SEQ ID NO: 229) 15 7H (77 bp) Forward primer
7H_Primer1 5'TGT CA+A CAG TAC AGC AA3' 60 (E7 assay) (SEQ ID NO:
230) Reverse primer 7H_Primer2 5'AGG TAG GGC ACA CAA TAT3' 60.2
(SEQ ID NO: 231) TaqMan.RTM. probe 7H_Probe 5'/Dye/AC+C +ATA +C+A+G
+CAA 68.1 C/Quencher/3' (SEQ ID NO: 232) .sup.1"Dye" stands for a
fluorescent reporter dye. Any reporter dyes such as FAM.TM.,
HEX.TM., VIC.RTM., Cy5.TM., and Cy5.5.TM. that is compatible with
the detection channels for the instrument can be used. A quencher
compatible with the respective dye was used at 3' end of the probe
(Quencher-1). A second quencher (Quencher-2) such as ZEN was
sometimes placed internally between 9.sup.th and 10.sup.th
nucleotide base from the reporter dye to enhance the overall dye
quenching. .sup.2 These estimates of melting temperature(T.sub.M)
were calculated using IDT'S oligo analyzer tools with following
settings: (a) For primers: Target type = DNA, Oligo concentration =
9 .mu.M, Na.sup.+ concentration = 50 mM, Mg.sup.++ concentration =
3 mM, and dNTPs concentration = 8 mM. (b) for Probe: Target type =
DNA, Oligo concentration .sup.3 + = Locked nucleic acid
Example 11: Modified Oligonucleotide Compositions and Methods for
Detection of Tumor-Derived HPV35
[0178] Provided in Table 18 below are primers and probes for
detection of tumor-derived HPV35, where the "+" signifies a locked
nucleic acid. Tumor derived HPV35 DNA can be detected and
distinguished from non-tumor sources using any three primer/probe
sets from Table 18 within a single multiplex digital PCR reaction,
where the central probe has a detection color distinct from both of
the other (boundary) probes. The two boundary probes may or may not
have the same color. The DNA of the primer/probe sets is modified
to include quenchers, dye moieties and locked nucleic acids. In
this example, droplets that are positive for the central probe's
detection label and negative for the boundary/distal probes
detection label contain tumor derived viral DNA.
[0179] For example, modified primer probe sets 4, 7, and 10 from
Table 18 could be used for the multiplexed digital PCR reaction to
detect tumor-derived HPV35 DNA, where detection probe 7 is
conjugated to FAM and detection probes 4 and 10 are conjugated to
HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4
conjugated to HEX, and probe 10 conjugated to a different detection
moiety.
[0180] In some embodiments, the primer/probe sets may be selected
so that no two sets are consecutive in Table 18. For illustration,
examples of triads in this embodiment with no consecutive primer
probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {12, 14,
16}. Examples of triads with a consecutive primer probe set include
{1, 2, 5} and {10, 12, 13}.
[0181] For the purposes of this application, digital PCR refers to
any method that will be understood to those versed in the art where
PCR reactions are partitioned into many sub-reactions for analysis.
The partition could be droplets or microwells or any other
partition used for digital PCR.
[0182] It is to be understood that HEX and FAM are used solely for
clarity and illustrative purposes in all the examples.
TABLE-US-00019 TABLE 18 Primers and probes for HPV35 Amplicon
(size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1I (78
bp) Forward primer 1I_Primer1 5'CTG A+AC G+AC CTT ACA AA31 59.9 (E6
assay) (SEQ ID NO: 233) Reverse primer 1I_Primer2 5'ATA CAC AAT
T+CA AA+C +AAA3' 60.3 (SEQ ID NO: 234) TaqMan.RTM. probe 1I_Probe
5'/Dye/TGA TTT GTG /Quencher-2/CAA CGA 67.5 GGT AGA AGA AAG
C/Quencher-1 /3' (SEQ ID NO: 235) 1I_probe_v 5'/Dye/CG+A G+G+T
+A+GA A+GA 67.4 2 A/Quencher/3' (SEQ ID NO: 236) 2 2I (72 bp)
Forward primer 2I_Primer1 5'CAA A+CA AGA A+TT AC+A GC3' 60 (E6
assay) (SEQ ID NO: 237) Reverse primer 2I_Primer2 5'CCT +T+CT +CTA
TAT A+CT ATA3' 59.9 (SEQ ID NO: 238) TaqMan.RTM. probe 2I_probe
5'/Dye/AG+T +C+A+T ATA +C+CT 67.5 CAC/Quencher/3' (SEQ ID NO: 239)
3 3I (80 bp) Forward primer 3I_Primer1 5'ATT +C+AA AAA TAA +G+TG
AAT3' 59.7 (E6 assay) (SEQ ID NO: 240) Reverse primer 3I_Primer2
5'TAA CTG TTT GTT +GCA TTG T3' 59.8 (SEQ ID NO: 241) TaqMan.RTM.
probe 3I_Probe 5'/Dye/TA+G +T+GT GTA +T+G+G 68.1 A/Quencher/3' (SEQ
ID NO: 242) 4 4I (75 bp) Forward primer 4I_Primer1 5'TGT CAT T+TA
+T+TA ATT +AGG T3' 60 (E6 assay) (SEQ ID NO: 243) Reverse primer
4I_Primer2 5'TTC TTC TAA +ATG T+CT TTG C3' 60 (SEQ ID NO: 244)
TaqMan.RTM. probe 4I_Probe 5'/Dye/TG+T +CAA AAA +C+C+G 68.4
C/Quencher/3' (SEQ ID NO: 245) 5 5I (74 bp) Forward primer
5I_Primer1 5'CGA TTC CAT AAC +ATC GGT3' 60 (E6 assay) (SEQ ID NO:
246) Reverse primer 5I_Primer2 5'TCG GTT TCT CTA CGT GT3' 59.7 (SEQ
ID NO: 247) TaqMan.RTM. probe 5I_Probe 5'/Dye/CG+G +T+G+T AT+G +TCC
68.1 T/Quencher/3' (SEQ ID NO: 248) 6 6I (75 bp) Forward primer
6I_Primer1 5'CAT GGA +GA+A ATA ACT A+CA3' 60 (E7 assay) (SEQ ID NO:
249) Reverse primer 6I_Primer2 5'CTC ATA ACA +GTA +TA+G GTC3' 60.2
(SEQ ID NO: 250) TaqMan.RTM. probe 6I_Probe 5'/Dye/TG+C AA+G A+C+T
A+T+G 67.5 T/Quencher/3' (SEQ ID NO: 251) 7 7I (79 bp) Forward
primer 7I_Primer1 5'AAT T+GT GTG ACA GCT CA3' 60.1 (E7 assay) (SEQ
ID NO: 252) Reverse primer 7I_Primer2 5'TAA TTG GAG GTG TCT GGT3'
60 (SEQ ID NO: 253) TaqMan.RTM. probe 7I_Probe 5'/Dye/TT+G +C+TT
+GTC +C+AG 68.1 C/Quencher/3' (SEQ ID NO: 254) 8 8I (92 bp) Forward
primer 8I_Primer1 5'TA+A TAT TGT AAC GT+C CTG T3' 60 (E7 assay)
(SEQ ID NO: 255) Reverse primer 8I_Primer2 5'AT+A A+AT CTT C+CA ATT
+TAC G3' 59.9 (SEQ ID NO: 256) TaqMan.RTM. probe 8I_Probe
5'/DyeDye/CA+C +TA+C +G+TC TG+T 67.4 G/Quencher/3' (SEQ ID NO: 257)
9 1J (72 bp) Forward primer 1J_Primer1 5'TGC ATG ATT TGT +GCA AC 3'
60.1 (E6 assay) (SEQ ID NO: 258) Reverse primer 1J_Primer2 5'CTT
G+TT TGC AGT A+TA CAC3' 60.1 (SEQ ID NO: 259) TaqMan.RTM. probe
1J_Probe 5'/D ye/AAA G+C+A T+C+C +AT+G 68.1 A/Quencher/3' (SEQ ID
NO: 260) 10 2J (95 bp) Forward primer 2J_Primer1 5'CAG CGG AGT GAG
GTA TAT3' 60 (E6 assay) (SEQ ID NO: 261) Reverse primer 2J_Primer2
5'AAT T+TT A+AA +CAT TT+C +ATG3' 60 (SEQ ID NO: 262) TaqMan.RTM.
probe 2J_Probe 5'/DyeDye/AG+A G+AA G+GC C+A+G 68 C/Quencher/3' (SEQ
ID NO: 263) 11 3J (76 bp) Forward primer 3J_Primer1 5'AAT +ATA +GAT
G+GT ATA +G+AT ATA3' 60 (E6 assay) (SEQ ID NO: 264) Reverse primer
3J_Primer2 5'AAT A+AA T+GA +CAT AAC T+GT TT3' 60.1 (SEQ ID NO: 265)
TaqMan.RTM. probe 3J_Probe 5'/DyeDye/TT+C +T+C+C A+TA +CAC 67.8
A/Quencher/3' (SEQ ID NO: 266) 12 4J (75 bp) Forward primer
4J_Primer1 5'AA+T TA+G GT+G TAT TAC A+TG3' 59.8 (E6 assay) (SEQ ID
NO: 267) Reverse primer 4J_Primer2 5'AAT +CGT TTT +TTT T+CT TCT3'
60 (SEQ ID NO: 268) TaqMan.RTM. probe 4J_Probe 5'/DyeDye/C+C+A
+G+TT +GAA AA+G 67.3 CA/Quencher/3' (SEQ ID NO: 269) 13 5J (74 bp)
Forward primer 5J_Primer1 5'CC+A TAA CAT CGG TGG AC3' 60.1 (E6
assay) (SEQ ID NO: 270) Reverse primer 5J_Primer2 5'AC+A CCT CGG
TTT CTC TA3' 60.1 (SEQ ID NO: 271) TaqMan.RTM. probe 5J_Probe
5'/DyeDye/TGT +ATG +T+C+C +TG+T 67.9 T/Quencher/3' (SEQ ID NO: 272)
14 6J (77 bp) Forward primer 6J_Primer1 5'TTT AGA TTT GGA +ACC
CGA3' 60 (E7 assay) (SEQ ID NO: 273) Reverse primer 6J_Primer2
5'TAT CTT CCT CCT +CCT CT3' 60.2 (SEQ ID NO: 274) TaqMan.RTM. probe
6J_Probe 5'/Dye/AC+T +G+A+C +CTA TA+C 68.3 T/Quencher/3' (SEQ ID
NO: 275) 15 7J (73 bp) Forward primer 7J_Primer1 5'CTA TTG ACG GTC
CAG CT3' 60.5 (E7 assay) (SEQ ID NO: 276) Reverse primer 7J_Primer2
5'CAT TTA C+AA C+AG GAC GTT3' 60 (SEQ ID NO: 277) TaqMan.RTM. probe
7J_Probe 5'/Dye/CCA +G+A+C +A+CC 68.7 +TCC/Quencher/3' (SEQ ID NO:
278) 16 8J (75 bp) Forward primer 8J_Primer1 5'TGA GGC GAC ACT ACG
TC3' 62.9 (E7 Assay) (SEQ ID NO: 279) Reverse primer 8J_Primer2
5'GTG CCC ATT AAT AAA TCT TCC AA3' 61.7 (SEQ ID NO: 280)
TaqMan.RTM. probe 8J_Probe 5'/Dye/AG+AG+C+ACA+C+ACAT/Quencher/3'
67.5 (SEQ ID NO: 281) Reverse primer 1I_Primer1 5'CTG A+AC G+AC CTT
ACA AA3' 59.9 (SEQ ID NO: 282) TaqMan.RTM. probe 1I_Primer2 5'ATA
CAC AAT T+CA AA+C +AAA3' 60.3 (SEQ ID NO: 283) .sup.1"Dye" stands
for a fluorescent reporter dye. Any reporter dyes such as FAM.TM.,
HEX.TM., VIC.RTM., Cy5.TM., and Cy5.5.TM. that is compatible with
the detection channels for the instrument can be used. A quencher
compatible with the respective dye was used at 3' end of the probe
(Quencher-1). A second quencher (Quencher-2) such as ZEN was
sometimes placed internally between 9.sup.th and 10.sup.th
nucleotide base from the reporter dye to enhance the overall dye
quenching. .sup.2 These estimates of melting temperature(T.sub.M)
were calculated using IDT'S oligo analyzer tools with following
settings: (a) For primers: Target type = DNA, Oligo concentration =
9 .mu.M, Na.sup.+ concentration = 50 mM, Mg.sup.++ concentration =
3 mM, and dNTPs concentration = 8 mM. (b) for Probe: Target type =
DNA, Oligo concentration .sup.3 + = Locked nucleic acid
Example 12: Modified Oligonucleotide Compositions and Methods for
Detection of Tumor-Derived HPV45
[0183] Provided in Table 19 below are primers and probes for
detection of tumor-derived HPV45, where the "+" signifies a locked
nucleic acid. Tumor derived HPV45 DNA can be detected and
distinguished from non-tumor sources using any three primer/probe
sets from Table 19 within a single multiplex digital PCR reaction,
where the central probe has a detection color distinct from both of
the other (boundary) probes. The two boundary probes may or may not
have the same color. The DNA of the primer/probe sets is modified
to include quenchers, dye moieties and locked nucleic acids. In
this example, droplets that are positive for the central probe's
detection label and negative for the boundary/distal probes
detection label contain tumor derived viral DNA.
[0184] For example, modified primer probe sets 4, 7, and 10 from
Table 19 could be used for the multiplexed digital PCR reaction to
detect tumor-derived HPV45 DNA, where detection probe 7 is
conjugated to FAM and detection probes 4 and 10 are conjugated to
HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4
conjugated to HEX, and probe 10 conjugated to a different detection
moiety.
[0185] In some embodiments, the primer/probe sets may be selected
so that no two sets are consecutive in Table 19. For illustration,
examples of triads in this embodiment with no consecutive primer
probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {13, 15,
17}. Examples of triads with a consecutive primer probe set include
{1, 2, 5} and {10, 12, 13}.
[0186] For the purposes of this application, digital PCR refers to
any method that will be understood to those versed in the art where
PCR reactions are partitioned into many sub-reactions for analysis.
The partition could be droplets or microwells or any other
partition used for digital PCR.
[0187] It is to be understood that HEX and FAM are used solely for
clarity and illustrative purposes in all the examples.
TABLE-US-00020 TABLE 19 Primers and probes for HPV45 Amplicon
(size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1K (74
bp) Forward primer 1K_Primer1 5'CGC TTT GAC GAT CCA AA3' 60 (E6
assay) (SEQ ID NO: 284) Reverse primer 1K_Primer2 5'TCT +TGT A+GT
GAT G+TA TTC3' 60.0 (SEQ ID NO: 285) TaqMan.RTM. probe 1K_Probe
5'/Dye/AG+C +TA+C +C+AG +ATT/Quencher/3' 68.4 (SEQ ID NO: 286) 2 2K
(85 bp) Forward primer 2K_Primer1 5'CGT ATC TA+T TGC CTG TGT A3'
60.4 (E6 assay) (SEQ ID NO: 287) Reverse primer 2K_Primer2 5'CAC
TAT A+C+A +TAA AT+C TTT AA3' 60 (SEQ ID NO: 288) TaqMan.RTM. probe
2K_Probe 5'/Dye/AGC AAC ATT /Quencher-2/GGA ACG 68.4 CAC AGA GGT
ATA TC/Quencher-1/3' (SEQ ID NO: 289) 3 3K (74bp) Forward primer
3K_Primer1 5'ATA GAG A+CT +GTA T+AG CA3' 60 (E6 assay) (SEQ ID NO:
290) Reverse primer 3K_Primer2 5'ATA T+CT TAA TT+C +T+CT AAT TC3'
60.1 (SEQ ID NO: 291) TaqMan.RTM. probe 3K_Probe 5'/Dye/TA+C +ATT
TA+T +G+G+C 66.2 AT/Quencher/3' (SEQ ID NO: 292) 4 4K (75 bp)
Forward primer 4K_Primer1 5'TAT T+CA AAC +T+CT GTA +TAT3' 60 (E6
assay) (SEQ ID NO: 293) Reverse primer 4K_Primer2 5'CAC +C+TT ATT
AA+C +AAA TTA T3' 59.9 (SEQ ID NO: 294) TaqMan.RTM. probe 4K_Probe
5'/Dye/TC+C +AGT G+T+C T+CT C/Quencher/3' 68.1 (SEQ ID NO: 295) 5
5K (70 bp) Forward primer 5K_Primer1 5'CCA GA+A ACC +ATT GAA CC3'
60 (E6 assay) (SEQ ID NO: 296) Reverse primer 5K_Primer2 5'AGC TAT
GCT GTG AA+A TCT3' 60.1 (SEQ ID NO: 297) TaqMan.RTM. probe 5K_Probe
5'/Dye/CG+T +AG+A +C+AC +CTT/Quencher/3' 67.4 (SEQ ID NO: 298) 6 6K
(70 bp) Forward primer 6K_Primer1 5'CGA GGG CAG TGT A+AT AC3' 60.3
(E6 assay) (SEQ ID NO: 299) Reverse primer 6K_Primer2 5'CTT GTG
T+TT CCC TAC GT3' 60.4 (SEQ ID NO: 300) TaqMan.RTM. probe 6K_Probe
5'/Dye/CC+T +GG+T +CAC +A+AC 67.5 v1 A/Quencher/3' (SEQ ID NO: 301)
6K_Probe 5'/Dye/TGA CCA GGC /Quencher-2/ACG 68.6 v2 GCA AGA AAG
A/Quencher-1/3' (SEQ ID NO: 302) 7 7K (73 bp) Forward primer
7K_Primer 5'AAC ACT GCA AGA AAT +TGT A3' 60.1 (E7 assay) 1 (SEQ ID
NO: 303) Reverse primer 7K_Primer2 5'CTC GTA ACA CA+A CAG GT3' 60.2
(SEQ ID NO: 304) TaqMan.RTM. probe 7K_Probe 5'/Dye/TGG AA+C +CT+C
A+G+A 68.3 A/Quencher/3' (SEQ ID NO: 305) 8 8K (71 bp) Forward
primer 8K_Primer1 5'CAA TTA AGC G+AG TCA GAG3' 60 (E7 assay) (SEQ
ID NO: 306) Reverse primer 8K_Primer2 5'GTC GGG CTG GTA GTT GT3'
58.8 (SEQ ID NO: 307) TaqMan.RTM. probe 8K_Probe 5'/Dye/CG+A +T+G+A
AGC +AG+A 68 T/Quencher/3' (SEQ ID NO: 308) 9 9K (85 bp) Forward
primer 9K_Primer1 5'AAT TTT GT+G +TGT ATG +TTG3' 59.8 (E7 assay)
(SEQ ID NO: 309) Reverse primer 9K_Primer2 5'CTG +CTG TAG T+GT TCT
AA3' 59.7 (SEQ ID NO: 310) TaqMan.RTM. probe 9K_Probe 5'/Dye/AC+G
+G+CA +G+AA +TTG 68 A/Quencher/3' (SEQ ID NO: 311) 10 1L (75 bp)
Forward primer 1L_Primer1 5'CCT ACA AGC +TAC CAG ATT3' 60.1 (E6
assay) (SEQ ID NO: 312) Reverse primer 1L_Primer2 5'TGC AAT ATA CAC
AGG C+AA3' 59.8 (SEQ ID NO: 313) TaqMan.RTM. probe 1L_Probe
5'/Dye/CA+C TA+C +AA+G +A+CG 67.8 T/Quencher/3' (SEQ ID NO: 314) 11
2L (75 bp) Forward primer 2L_Primer1 5'AAC ATT GGA ACG CAC AG3'
60.3 (E6 assay) (SEQ ID NO: 315) Reverse primer 2L_Primer2 5'TAT
GCT ATA CAG TCT C+TA TAC AC3' 60.3 (SEQ ID NO: 316) TaqMan.RTM.
probe 2L_Probe 5'/Dye/AG+G +T+AT A+T+C AAT TTG 67.8
+CTT/Quencher/3' (SEQ ID NO: 317) 12 3L (70 bp) Forward primer
3L_Primer1 5'CAT +GCC ATA +AAT GTA TAG +AC3' 60.1 (E6 assay) (SEQ
ID NO: 318) Reverse primer 3L_Primer2 5'CC+A TA+T ACA GA+G TTT GAA
T3' 59.7 (SEQ ID NO: 319) TaqMan.RTM. probe 3L_Probe 5'/Dye/T+C+C
+A+GA ATT A+G+A GA 68.3 (SEQ ID NO: 320) 13 4L (84 bp) Forward
primer 4L_Primer1 5'AAT AAC T+AA TA+C AG+A GTT GT3' 60.1 (E6 assay)
(SEQ ID NO: 321) Reverse primer 4L_Primer2 5'TGT CTA CGT TTT T+CT
GC3' 59.9 (SEQ ID NO: 322) TaqMan.RTM. probe 4L_Probe_v 5'/Dye/AA+C
+C+AT T+G+A +ACC 67.9 1 C/Quencher/3' (SEQ ID NO: 323) 4L_Probe_v
5'/Dye/TTG TTA ATA /Quencher-2/AGG 67.7 2 TGC CTG CGG
TGC/Quencher-1/3' (SEQ ID NO: 324) 14 5L (91 bp) Forward primer
5L_Primer1 5'TTA AGG A+CA AAC +GAA GAT3' 60 (E6 assay) (SEQ ID NO:
325) Reverse primer 5L_Primer2 5'AAG TCT TTC TTG CCG TG3' 59.6 (SEQ
ID NO: 326) TaqMan.RTM. probe 5L_Probe_v 5'/Dye/TGG ACA GTA
/Quencher-2/CCG 68.4 1 AGG GCA GTG TAA TA/Quencher-1/3' (SEQ ID NO:
327) 5L_Probe_v 5'/Dye/TAG CTG GAC /Quencher-2/AGT 68.7 2 ACC GAG
GGC A/Quencher-1/3' (SEQ ID NO: 328) 15 6L (75 bp) Forward primer
6L_Primer1 5'TCA GA+A TGA ATT +AGA TCC TG3' 60.1 (E7 assay) (SEQ ID
NO: 329) Reverse primer 6L_Primer2 5'TGC TTC ATC GTT TTC CTC3' 59.8
(SEQ ID NO: 330) TaqMan.RTM. probe 6L_Probe 5'/Dye/TGA +C+C+T +GTT
GT+G T/Quencher/3' 67.9 (SEQ ID NO: 331) 16 7L (75 bp) Forward
primer 7L_Primer1 5'TAG TCA TGC ACA ACT +ACC3' 59.7 (E7 assay) (SEQ
ID NO: 332) Reverse primer 7L_Primer2 5'TCA CAC TTA CAA CAT A+CA
C3' 59.8 (SEQ ID NO: 333) TaqMan.RTM. probe 7L_Probe 5'/Dye/CCG
A+CG +A+GC CGA/Quencher/3' 67.5 (SEQ ID NO: 334) 17 8L (90 bp)
Forward primer 8L_Primer1 5'CGG CAG AAT TGA GCT TAC A3' 62.4 (E7
assay) _v1 (SEQ ID NO: 335) 8L_Primer1 5'CGG CAG AAT TGA GCT TAC3'
60.4 _v2 (SEQ ID NO: 336) Reverse primer 8L_Primer2 5'GGA CAC ACA
AAG GAC AAG G3' 62.7 _v1 (SEQ ID NO: 337) 8L_Primer2 5'GGA CAC ACA
AAG GAC AAG3' 60.2 _v2 (SEQ ID NO: 338) TaqMan.RTM. probe
8L_Probe_v 5'/Dye/TCG GCA GA+G G+A+C 65.7 1 C/Quencher/3' (SEQ ID
NO: 339) 8L_Probe_v 5'/Dye/TCG GC+A GA+G G+A+C 68.3 2 C/Quencher/3'
(SEQ ID NO: 340) .sup.1"Dye" stands for a fluorescent reporter dye.
Any reporter dyes such as FAM.TM., HEX.TM., VIC.RTM., Cy5.TM., and
Cy5.5.TM. that is compatible with the detection channels for the
instrument can be used. A quencher compatible with the respective
dye was used at 3' end of the probe (Quencher-1). A second quencher
(Quencher-2) such as ZEN was sometimes placed internally between
9.sup.th and 10.sup.th nucleotide base from the reporter dye to
enhance the overall dye quenching. .sup.2 These estimates of
melting temperature(T.sub.M) were calculated using IDT'S oligo
analyzer tools with following settings: (a) For primers: Target
type = DNA, Oligo concentration = 9 .mu.M, Na.sup.+ concentration =
50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 8
mM. (b) for Probe: Target type = DNA, Oligo concentration .sup.3 +
= Locked nucleic acid
Example 13: Modified Oligonucleotide Compositions and Methods for
Detection of Tumor-Derived EBV
[0188] Provided in Table 20 below are primers and probes for
detection of tumor-derived EBV, where the "+" signifies a locked
nucleic acid. Tumor derived EBV DNA can be detected and
distinguished from non-tumor sources using any three consecutive
primer/probe sets from Table 20 within a single multiplex digital
PCR reaction, where the central probe has a detection color
distinct from both of the other (boundary) probes. The two boundary
probes may or may not have the same color. In this example,
droplets that are positive for the central probe's detection label
and negative for the boundary/distal probes detection label contain
tumor derived viral DNA.
[0189] For example, modified primer probe sets 4, 5, and 6 from
Table 20 could be used for the multiplexed digital PCR reaction to
detect tumor-derived EBV DNA, where detection probe 5 is conjugated
to FAM and detection probes 4 and 6 are conjugated to HEX.
Alternatively, detection 5 could be conjugated to FAM, probe 4
conjugated to HEX, and probe 6 conjugated to a different detection
moiety.
[0190] For illustration, examples of three consecutive primer probe
sets include {1, 2, 3}, {2, 3, 4}, {3, 4, 5}, . . . {15, 16,
17}.
[0191] For the purposes of this application, digital PCR refers to
any method that will be understood to those versed in the art where
PCR reactions are partitioned into many sub-reactions for analysis.
The partition could be droplets or microwells or any other
partition used for digital PCR.
[0192] It is to be understood that HEX and FAM are used solely for
clarity and illustrative purposes in all the examples.
TABLE-US-00021 TABLE 20 Primers and probes for Epstein-Barr virus
(EBV) Amplicon (size) Set (Assay) Detail Named as Sequence
T.sub.M.sup.1 1 1M (70 bp) Forward primer 1M_Primer1 5'GGG AGA CCG
AAG TGA A3' 59.9 (SEQ ID NO: 341) Reverse primer 1M_Primer2 5'TCC
ACT TAC CTC TGG C3' 59.7 (SEQ ID NO: 342) TaqMan.RTM. probe
1M_Probe 5'/Dye/CT+G GA+C C+A+A +CCC G/Quencher/3' 68 (SEQ ID NO:
343) 2 2M (80 bp) Forward primer 2M_Primer1 5'CTC GGA CAG CTC CTA
AG3' 60.3 (SEQ ID NO: 344) Reverse primer 2M_Primer2 5'ACC CTT CT+A
CGG ACT C3' 60.2 (SEQ ID NO: 345) TaqMan.RTM. probe 2M_Probe
5'/Dye/CG+C CCA GT+C +CT+A C/Quencher/3' 68.5 (SEQ ID NO: 346) 3 3M
(87 bp) Forward primer 3M_Primer1 5'TCT CTT AGA GAG +TGG CT3' 60.8
(SEQ ID NO: 347) Reverse primer 3M_Primer2 5'TTC TTC +TAT G+TA GAC
+AGA3' 60.4 (SEQ ID NO: 348) TaqMan.RTM. probe 3M_Probe 5'/Dye/CG+C
+ATT A+G+A +G+AC 68.5 C/Quencher/3' (SEQ ID NO: 349) 4 4M (78 bp)
Forward primer 4M_Primer1 5'TGC CTA C+AT +TCT +ATC TTG3' 59.9 (SEQ
ID NO: 350) Reverse primer 4M_Primer2 5'ACG GGT TTC CAA GAC TA3'
59.8 (SEQ ID NO: 351) TaqMan.RTM. probe 4M_Probe 5'/Dye/TA+T +G+TT
TG+T +CC+C 69.1 C/Quencher/3' (SEQ ID NO: 352) 5 5M (75 bp) Forward
primer 5M_Primer1 5'CAC TCT CAG TA+A TTC CCT C3' 60.2 (SEQ ID NO:
353) Reverse primer 5M_Primer2 5'CAA AGA +TT+G TTA GTG G+AA T3' 60
(SEQ ID NO: 354) TaqMan.RTM. probe 5M_Probe 5'/Dye/TCC +CTA +CC+A
+GG+A A/Quencher/3' 68.6 (SEQ ID NO: 355) 6 6M (76 bp) Forward
primer 6M_Primer1 5'CCG CTA GGA TAT GAC GT3' 59.9 (SEQ ID NO: 356)
Reverse primer 6M_Primer2 5'TTA CAA TAT +AAT TA+G +C+CA3' 59.9 (SEQ
ID NO: 357) TaqMan.RTM. probe 5M_Probe 5'/Dye/ACC TCT AGC
/Quencher-2/ATC TGC 68.2 TAT GCG AAT GC/Quencher-1/3' (SEQ ID NO:
358) 7 17M (81 Forward primer 7M_Primer1 5'GCT TAC CCC TCC ACA A3'
60.4 bp) (SEQ ID NO: 359) Reverse primer 7M_Primer2 5'GGC ACC GTT
AGT GTT G3' 59.7 (SEQ ID NO: 360) TaqMan.RTM. probe 7M_Probe
5'/Dye/TAC CCC TCC /Quencher-2/TAC CCC 68.5 TCT GCC/Quencher-1/3'
(SEQ ID NO: 361) 8 8M (91 bp) Forward primer 8M_Primer1 5'TAC CGA
ACT TCA ACC CA3' 60.1 (SEQ ID NO: 362) Reverse primer 8M_Primer2
5'TTG +ATG AGT AAG AGG GTG3' 59.9 (SEQ ID NO: 363) TaqMan.RTM.
probe 8M_Probe 5'/Dye/CC+A TCA C+CA +C+C+A 68.9 v1 C/Quencher/3'
(SEQ ID NO: 364) 8M_Probe 5'/Dye/TG+C +C+AG A+CC AAT 68.4 v2
C/Quencher/3' (SEQ ID NO: 365) 9 9M (75 bp) Forward primer
9M_Primer1 5'AGC ACC CCA +AAT GAT C3' 60.2 (SEQ ID NO: 366) Reverse
primer 9M_Primer2 5'TAA TGG +CAT AGG TGG AA3' 59.8 (SEQ ID NO: 367)
TaqMan.RTM. probe 9M_Probe 5'/Dye/TCC AGA ACC /Quencher-2/ACG GTC
68.1 CCC G/Quencher-1/3' (SEQ ID NO: 368) 10 10M (87 Forward primer
10M_Primer 5'ATC AAC GAC CAA CAA +TTA C3' 60 bp) 1 (SEQ ID NO: 369)
Reverse primer 10M_Primer 5'TTG AGT CTT AGA GGG T+TG3' 60.1 2 (SEQ
ID NO: 370) TaqMan.RTM. probe 10M_Probe 5'/Dye/CC+C +GAG +GG+T AG+A
T/Quencher/3' 68.8 (SEQ ID NO: 371) 11 11M (76 Forward primer
11M_Primer 5'TTG GAG ACC AGA GCC3' 59.6 bp) 1 (SEQ ID NO: 372)
Reverse primer 11M_Primer 5'TTG TCC CTG ATG AAG +AC3' 60.1 2 (SEQ
ID NO: 373) TaqMan.RTM. probe 11M_Probe 5'/Dye/GC+C +T+GA A+C+T
AA+G 67.8 T/Quencher/3' (SEQ ID NO: 374) 12 12M (86 Forward primer
12M_Primer 5'ACT CAC CAA CTC CTG G3' 60 bp) 1 (SEQ ID NO: 375)
Reverse primer 12M_Primer 5'TTC ATG TAT TG+G TGA AAC G3' 60.1 2
(SEQ ID NO: 376) TaqMan.RTM. probe 12M_Probe 5'/Dye/CAA TGC CGC
/Quencher-2/CCC CGT 68 TTG TAG/Quencher-1/3' (SEQ ID NO: 377) 13
13M (78 Forward primer 13M_Primer 5'CGG AGT CCC ATA +ATA GC3' 59.9
bp) 1 (SEQ ID NO: 378) Reverse primer 13M_Primer 5'GTC TGC GGG GTC
TAT AG3' 60.1 2 (SEQ ID NO: 379) TaqMan.RTM. probe 13M_Probe
5'/Dye/CA+G +AG+G +C+TC CCA T/Quencher/3' 68.7 (SEQ ID NO: 380) 14
14M (84 Forward primer 14M_Primer 5'AAA GTT GG+G ATT A+CA TTT3'
59.9 bp) 1 (SEQ ID NO: 381) Reverse primer 14M_Primer 5'GGC GAG GTC
TTT T+AC TG3' 60.4 2 (SEQ ID NO: 382) TaqMan.RTM. probe 14M_Probe
5'/Dye/TGA GAC AAC /Quencher-2/AGA ATC 68 TCC TAG CTC AGA
TGA/Quencher-1/3' (SEQ ID NO: 383) 15 15M (86 Forward primer
15M_Primer 5TAGGCCCACTTAACACTAC3' 60.6 bp) 1 (SEQ ID NO: 384)
Reverse primer 15M_Primer 5'GGAGGCCCTTAGACTTAC3' 60.5 2 (SEQ ID NO:
385) TaqMan.RTM. probe 15M_Probe
5'/Dye/CGCCTCTCCATTCATCATGTAACCCAC/ 68.4 Quencher/3' (SEQ ID NO:
386) 16 16M (85 Forward primer 16M_Primer 5'ATCCCTAGGATAATACCACAC3'
60.5 bp) 1 (SEQ ID NO: 387) Reverse primer 16M_Primer
5'CACGTAAAGCCACAAGC3' 60.8 2 (SEQ ID NO: 388) TaqMan.RTM. probe
16M_Probe 5'/Dye/AGCAGTGTAGTCCTGTCAATCTCCTGA/ 68.3 Quencher/3' (SEQ
ID NO: 389) 17 1N (93 bp) Forward primer 1N_Primer1 5'CTC CTA AGA
AGG +CAC C3' 60.4 (SEQ ID NO: 390) Reverse primer 1N_Primer2 5'CTC
CTC TTC TTG CTG GA3' 60.1 (SEQ ID NO: 391) TaqMan.RTM. probe
1N_Probe 5'/Dye/CA+A +G+AA C+C+C AG+A 68.9 C/Quencher/3' (SEQ ID
NO: 392) 18 2N (81 bp) Forward primer 2N_Primer1 5'ATT +AGA GAC
C+AC TTT +GAG3' 60.1 (SEQ ID NO: 393) Reverse primer 2N_Primer2
5'TTA GTC +TTC ATC CTC T+TC T3' 60.3 (SEQ ID NO: 394) TaqMan.RTM.
probe 2N_Probe 5'/Dye/CG+C C+AA T+C+T +G+TC 68.7 T/Quencher/3' (SEQ
ID NO: 395) 19 3N (83 bp) Forward primer 3N_Primer1 5'TCT AAT TGT
TGA CAC +GGA T3' 60.3 (SEQ ID NO: 396) Reverse primer 3N_Primer2
5'TGT CT+G ACA GTT GTT CC3' 60.4 (SEQ ID NO: 397) TaqMan.RTM. probe
3N_Probe 5'/Dye/CTT GGA AAC /Quencher-2/CCG TCA 68.1 CTC TCA GTA
ATT CC/Quencher-1/3' (SEQ ID NO: 398) 20 4N (84 bp) Forward primer
4N_Primer1 5'TCA CCT CTT GAT AGG GAT C3' 59.8 (SEQ ID NO: 399)
Reverse primer 4N_Primer2 5'ATT AGC CAT CCA AAG C+AT3' 60.3 (SEQ ID
NO: 400) TaqMan.RTM. probe 4N_Probe 5'/Dye/CGG GCA TGG
/Quencher-2/ACC TCT 67.7 AGC ATC T/Quencher-1/3' (SEQ ID NO: 401)
21 5N (89 bp) Forward primer 5N_Primer1 5'ATA TTG +TAA GA+C A+A+T
CAC3' 60.3 (SEQ ID NO: 402) Reverse primer 5N_Primer2 5'ATG TGG CTG
GAC CAA3' 60.1 (SEQ ID NO: 403) TaqMan.RTM. probe 5N_Probe
5'/Dye/CC+T G+AG +GGG C+TG T/Quencher/3' 68.4 (SEQ ID NO: 404) 22
6N (84 bp) Forward primer 6N_Primer1 5'CTC TAC GCC CGA CAG3' 60.2
(SEQ ID NO: 405) Reverse primer 6N_Primer2 5'TTG GTG GCA TC+A TGA
G3' 59.7 (SEQ ID NO: 406) TaqMan.RTM. probe 6N_Probe 5'/Dye/TGT CAC
CTC /Quencher-2/TGT CAC 67.7 AAC CGA GG/Quencher-1/3' (SEQ ID NO:
407) 23 7N (98 bp) Forward primer 7N_Primer1 5'ACC CAC ACC ACT ACT
C3' 59.6 (SEQ ID NO: 408) Reverse primer 7N_Primer2 5'TCT GGC ACA
TGC AAG +A3' 60.4 (SEQ ID NO: 409) TaqMan.RTM. probe 7N_Probe
5'/Dye/TAC CGA ACT /Quencher-2/TCA ACC 68.2 CAC ACC ATC
AC/Quencher-1/3' (SEQ ID NO: 410) 24 8N (86 bp) Forward primer
8N_Primer1 5'AAT CAA TGC ACC CTC +TTA3' 59.9 (SEQ ID NO: 411)
Reverse primer 8N_Primer2 5'AAT G+TT ATA AAA TAC AG+T +CG3' 60.2
(SEQ ID NO: 412) TaqMan.RTM. probe 8N_Probe 5'/Dye/TGA TCC AGA
/Quencher-2/TAG TCC 68.4 AGA ACC ACG GT/Quencher-1/3' (SEQ ID NO:
413) 25 9N (85 bp) Forward primer 9N_Primer1 5'ATT ACC CCC CTC ACA
AT3' 59.8 (SEQ ID NO: 414) Reverse primer 9N_Primer2 5'TAG ATG AT+G
TAA TTG TT+G GT3' 59.9 (SEQ ID NO: 415) TaqMan.RTM. probe 9N_Probe
5'/Dye/CAC CAC CAG /Quencher-2/CAG CAC 68.1 CAG C/Quencher-1/3'
(SEQ ID NO: 416) 26 10N (82 Forward primer 10N_Primer 5'ACA AGC AAC
GCA AGC3' 60.5 bp) 1 (SEQ ID NO: 417) Reverse primer 10N_Primer
5'AGG ACT GGA C+TT AGT TCA3' 60.7 2 (SEQ ID NO: 418) TaqMan.RTM.
probe 10N_Probe 5'/Dye/ACC TTG GAG /Quencher-2/ACC AGA 68 GCC AAA
CA/Quencher-1/3' (SEQ ID NO: 419) 27 11N (75 Forward primer
11N_Primer 5'CGT +TTG TAG AAA T+TC ACA C3' 60.2 bp) 1 (SEQ ID NO:
420) Reverse primer 11N_Primer 5'TCT GGG CTA TT+A TGG GA3' 60.1 2
(SEQ ID NO: 421) TaqMan.RTM. probe 11N_Probe 5'/Dye/TCA +C+C+A ATA
+C+AT 68 +GA/Quencher/3' (SEQ ID NO: 422) 28 12N (77 Forward primer
12N_Primer 5'CCA TTC TCT TCC CCG AT3' 60.3 bp) 1 (SEQ ID NO: 423)
Reverse primer 12N_Primer 5'AAA TGT AA+T CCC AA+C TTT3' 60.3 2 (SEQ
ID NO: 424) TaqMan.RTM. probe 12N_Probe 5'/Dye/CC+G +C+A+G ACT
+TA+G 67.7 A/Quencher/3' (SEQ ID NO: 425) .sup.1"Dye" stands for a
fluorescent reporter dye. Any reporter dyes such as FAM.TM.,
HEX.TM., VIC.RTM., Cy5.TM., and Cy5.5.TM. that is compatible with
the detection channels for the instrument can be used. A quencher
compatible with the respective dye was used at 3' end of the probe
(Quencher-1). A second quencher (Quencher-2) such as ZEN was
sometimes placed internally between 9.sup.th and 10.sup.th
nucleotide base from the reporter dye to enhance the overall dye
quenching. .sup.2 These estimates of melting temperature(T.sub.M)
were calculated using IDT'S oligo analyzer tools with following
settings: (a) For primers: Target type = DNA, Oligo concentration =
9 .mu.M, Na.sup.+ concentration = 50 mM, Mg.sup.++ concentration =
3 mM, and dNTPs concentration = 8 mM. (b) for Probe: Target type =
DNA, Oligo concentration .sup.3 + = Locked nucleic acid
Other Embodiments
[0193] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
425119DNAArtificial SequenceSynthetic Construct 1tgactctacg
cttcggttg 19219DNAArtificial SequenceSynthetic Construct
2gcccattaac aggtcttcc 19330DNAArtificial SequenceSynthetic
Construct 3cgtacaaagc acacacgtag acattcgtac 30419DNAArtificial
SequenceSynthetic Construct 4ggtttgtaac atcccaggc
19525DNAArtificial SequenceSynthetic Construct 5gtgtattttt
taaggggatc ttctt 25613DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic acid 6cacctccagc acc
13724DNAArtificial SequenceSynthetic Construct 7atctgtacag
catgaagtgc aaga 24819DNAArtificial SequenceSynthetic Construct
8ctagtgggcg catgtaggc 19911DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(4)locked nucleic
acidmisc_feature(5)..(7)locked nucleic acid 9tctatgacct g
111020DNAArtificial SequenceSynthetic Construct 10tgaagccaga
attgagctag 201118DNAArtificial SequenceSynthetic Construct
11aggacagggt gttcagaa 181213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(9)..(9)locked nucleic acid 12cagacgacct tcg
131321DNAArtificial SequenceSynthetic Construct 13agcacacaag
tagatattcg c 211419DNAArtificial SequenceSynthetic Construct
14tagtagaaca gttggggca 191513DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(9)..(10)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 15taacagctct tgc
131622DNAArtificial SequenceSynthetic Construct 16taacaccaca
gttcgtttat gt 221721DNAArtificial SequenceSynthetic Construct
17acaatattca ctgtgcccat a 211813DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 18tgacctacga acc
131917DNAArtificial SequenceSynthetic Construct 19tgaggcgaca
ctacgtc 172023DNAArtificial SequenceSynthetic Construct
20gtgcccatta ataaatcttc caa 232113DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 21agagcacaca cat
132213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(7)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 22cacacgtaga cat
132317DNAArtificial SequenceSynthetic
Constructmisc_feature(15)..(15)locked nucleic acid 23tgcaccaaaa
gagaact 172419DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 24gtgcataact
gtggtaact 192513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 25ctgtgggtcc tga
132621DNAArtificial SequenceSynthetic Construct 26agagctgcaa
acaactatac a 212718DNAArtificial SequenceSynthetic Construct
27tatacctcac gtcgcagt 182827DNAArtificial SequenceSynthetic
Construct 28agaatgtgtg tactgcaagc aacagtt 272922DNAArtificial
SequenceSynthetic Construct 29cgtgaggtat atgactttgc tt
223022DNAArtificial SequenceSynthetic Construct 30tcacatacag
catatggatt cc 223113DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(10)..(12)locked nucleic acid 31cgggatttat gca
133224DNAArtificial SequenceSynthetic
Constructmisc_feature(22)..(23)locked nucleic acid 32gttttattct
aaaattagtg agta 243321DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 33ttgtattgct
gttctaatgt t 213412DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(7)locked nucleic
acidmisc_feature(9)..(11)locked nucleic acid 34agtttgtatg ga
123520DNAArtificial SequenceSynthetic Construct 35caaaccgttg
tgtgatttgt 203622DNAArtificial SequenceSynthetic Construct
36gatgtctttg cttttcttca gg 223712DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(7)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 37aagccactgt gt
123818DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 38tctggacaaa
aagcaaag 183918DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic acid 39gatgatctgc
aacaagac 184013DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(8)..(9)locked nucleic acid 40tccaccgacc cct
134125DNAArtificial SequenceSynthetic Construct 41tgcatgaata
tatgttagat ttgca 254222DNAArtificial SequenceSynthetic Construct
42tcctctgagc tgtcatttaa tt 224313DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(3)locked nucleic
acidmisc_feature(5)..(7)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 43acaactgatc tct
134418DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic acid 44tgaaatagat
ggtccagc 184520DNAArtificial SequenceSynthetic
Constructmisc_feature(18)..(18)locked nucleic acid 45tgcaacaaaa
ggttacaata 204613DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(8)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 46cagagcccat tac
134719DNAArtificial SequenceSynthetic Construct 47tgactctacg
cttcggttg 194819DNAArtificial SequenceSynthetic Construct
48gcccattaac aggtcttcc 194930DNAArtificial SequenceSynthetic
Construct 49tacaaagcac acacgtagac attcgtactt 305030DNAArtificial
SequenceSynthetic Construct 50cgtacaaagc acacacgtag acattcgtac
305113DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(7)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 51cacacgtaga cat
135217DNAArtificial SequenceSynthetic
Constructmisc_feature(11)..(11)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 52actgcaatgt ttcagga
175317DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 53catgtatagt tgtttgc
175428DNAArtificial SequenceSynthetic Construct 54cgacccagaa
agttaccaca gttatgca 285520DNAArtificial SequenceSynthetic
Constructmisc_feature(19)..(19)locked nucleic acid 55ttagaatgtg
tgtactgcaa 205618DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic acid 56cataaatccc
gaaaagca 185726DNAArtificial SequenceSynthetic Construct
57gcaacagtta ctgcgacgtg aggtat 265820DNAArtificial
SequenceSynthetic Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 58catagtatat
agagatggga 205920DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 59tctatactca
ctaattttag 206012DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 60atcacataca gc
126120DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(15)locked nucleic
acidmisc_feature(17)..(18)locked nucleic acid 61cattattgtt
atagtttgta 206221DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 62taattaacaa
atcacacaac g 216313DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 63tatggaacaa cat
136418DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 64tgtattaact gtcaaaag
186518DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 65ggaatctttg ctttttgt
186613DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(9)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 66tgtgtcctga aga
136719DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 67ataatataag
gggtcggtg 196817DNAArtificial SequenceSynthetic Construct
68agctgggttt ctctacg 176930DNAArtificial SequenceSynthetic
Construct 69cggtcgatgt atgtcttgtt gcagatcatc 307027DNAArtificial
SequenceSynthetic Construct 70ccggtcgatg tatgtcttgt tgcagat
277117DNAArtificial SequenceSynthetic Construct 71tgcatggaga
tacacct 177218DNAArtificial SequenceSynthetic Construct
72acagtagaga tcagttgt 187312DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(8)..(9)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 73ccagagacaa ct
127419DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(15)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 74tatgagcaat
taaatgaca 197518DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic acid 75attgtaatgg
gctctgtc 187613DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(6)locked nucleic
acidmisc_feature(9)..(12)locked nucleic acid 76atttcatcct cct
137718DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic acid 77tacaaagcac
acacgtag 187821DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic acid 78ttatggtttc
tgagaacaga t 217925DNAArtificial SequenceSynthetic Construct
79tggaagacct gttaatgggc acact 258017DNAArtificial SequenceSynthetic
Construct 80cgctttgagg atccaac 178118DNAArtificial
SequenceSynthetic Construct 81gcagtgaagt gttcagtt
188225DNAArtificial SequenceSynthetic Construct 82accctacaag
ctacctgatc tgtgc 258320DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(19)..(19)locked nucleic acid 83aagacataga
aataacctgt 208418DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(8)locked nucleic acid 84ttaaatgcaa
attcaaat 188529DNAArtificial SequenceSynthetic Construct
85tgcaagacag tattggaact tacagaggt 298620DNAArtificial
SequenceSynthetic Constructmisc_feature(5)..(5)locked nucleic acid
86ttatttgtgg tgtatagaga 208721DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 87aattctctaa
ttctagaata a 218813DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 88catgcggtat act
138919DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 89aagacattat
tcagactct 199018DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic
acidmisc_feature(16)..(17)locked nucleic acid 90aataaattgt ataaccca
189112DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(7)..(10)locked nucleic acid 91tggagacaca tt
129218DNAArtificial SequenceSynthetic Construct 92agaaaccgtt
gaatccag 189319DNAArtificial SequenceSynthetic Construct
93atttcacaac atagctggg 199414DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(8)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 94agacacctta atga
149516DNAArtificial SequenceSynthetic Construct 95ccagtgccat tcgtgc
169619DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 96ttatacttgt
gtttctctg 199724DNAArtificial SequenceSynthetic Construct
97cacgacagga acgactccaa cgac 249817DNAArtificial SequenceSynthetic
Construct 98atggacctaa ggcaaca 179918DNAArtificial
SequenceSynthetic Constructmisc_feature(3)..(3)locked nucleic acid
99tgacatagaa ggtcaacc 1810011DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(8)locked nucleic
acidmisc_feature(10)..(10)locked
nucleic acid 100tttagagccc c 1110118DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic acid 101cgagcaatta
agcgactc 1810218DNAArtificial SequenceSynthetic Construct
102cgggctggta aatgttga 1810313DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(4)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 103tcgttttctt cct
1310418DNAArtificial SequenceSynthetic Construct 104acaacgtcac
acaatgtt 1810518DNAArtificial SequenceSynthetic Construct
105tctgctgagc tttctact 1810629DNAArtificial SequenceSynthetic
Construct 106tgtatgtgtt gtaagtgtga agccagaat 2910716DNAArtificial
SequenceSynthetic Construct 107accttcgagc attcca
1610816DNAArtificial SequenceSynthetic Construct 108ttactgctgg
gatgca 1610913DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 109ctgaacaccc tgt
1311018DNAArtificial SequenceSynthetic Construct 110ccctacaagc
tacctgat 1811119DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(13)..(13)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 111caatatacac
aggttattt 1911213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(8)..(9)locked nucleic acid 112cacggaactg aac
1311318DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(7)locked nucleic
acidmisc_feature(12)..(13)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 113tatttgaatt
tgcattta 1811418DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(9)..(10)locked nucleic
acidmisc_feature(16)..(6)locked nucleic acid 114aatctataca tttatggc
1811514DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 115agacagtata ccgc
1411620DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(10)..(12)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 116ctagaattag
agaattaaga 2011722DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 117agtgttagtt
agtttttcca at 2211813DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 118tcagactctg tgt
1311917DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 119attaataagg tgcctgc
1712019DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(14)locked nucleic acid 120tcgtttttca
ttaaggtgt 1912113DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(8)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 121tgaatccagc aga
1312219DNAArtificial SequenceSynthetic Construct 122atttcacaac
atagctggg 1912317DNAArtificial SequenceSynthetic Construct
123gtttctctgc gtcgttg 1712413DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(8)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 124agtgccattc gtg
1312520DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic acid 125attgtattgc
atttagagcc 2012618DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 126ttcatcgttt
tcttcctc 1812713DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(9)locked nucleic
acidmisc_feature(9)..(11)locked nucleic acid 127ctatgtcacg agc
1312820DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 128atagatggag
ttaatcatca 2012918DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 129acttacaaca
catacaca 1813025DNAArtificial SequenceSynthetic Construct
130ccgaaccaca acgtcacaca atgtt 2513120DNAArtificial
SequenceSynthetic Construct 131tgaagccaga attgagctag
2013218DNAArtificial SequenceSynthetic Construct 132aggacagggt
gttcagaa 1813313DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(9)..(9)locked nucleic acid 133cagacgacct tcg
1313418DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic acid 134atgttcaaaa
atcctgca 1813519DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 135ttcatcgtag
ggtatttcc 1913613DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(8)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 136aactaagctc ggc
1313719DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 137ctaagattga
attgtgtct 1913823DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 138taaatctgta
aatgcaaaat cta 2313914DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(11)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 139acagaaacag aggt
1414021DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic acid 140acaatagtat
atagggacga c 2114122DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(16)..(16)locked nucleic
acidmisc_feature(19)..(19)locked nucleic acid 141ttcacttact
tttgaataaa at 2214213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 142acggagtgtg tac
1314323DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(9)..(9)locked nucleic acid 143tttagatggt
atagatatag tgt 2314420DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 144cctaattaac
aaatcacata 2014513DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(5)locked nucleic
acidmisc_feature(7)..(8)locked nucleic acid 145atggaacaac att
1314619DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 146tgtataacgt
gtcaaagac 1914718DNAArtificial SequenceSynthetic
Constructmisc_feature(11)..(11)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 147ttgtggaatc
gtttcttt 1814813DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(7)..(8)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 148tgtgtccaga aga
1314918DNAArtificial SequenceSynthetic Construct 149cataggagga
aggtggac 1815017DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 150ttacacttgg gtttcag
1715126DNAArtificial SequenceSynthetic Construct 151cgttgcatag
catgttggag aagacc 2615219DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 152caagactatg
tgttagatt 1915322DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(14)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 153tcatctgagc
tgtcgggtaa tt 2215413DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 154aactgacctc cac
1315518DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic acid 155aggatgtcat
agacagtc 1815619DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic acid 156tgtagactta
cactgacaa 1915713DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 157ctggacaagc aga
1315821DNAArtificial SequenceSynthetic Construct 158agcacacaag
tagatattcg c 2115919DNAArtificial SequenceSynthetic Construct
159tagtagaaca gttggggca 1916013DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 160taacagctct tgc
1316118DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 161aaattgcatg
aactaagc 1816218DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic acid 162ttaactgacc
tttgcagt 1816330DNAArtificial SequenceSynthetic Construct
163cggcattgga aataccctac gatgaactaa 3016420DNAArtificial
SequenceSynthetic Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 164cagaaacaga
ggtattagat 2016520DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 165ttaaacattt
tgtacacact 2016613DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(7)..(8)locked nucleic acid 166acgacacacc aca
1316721DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(12)..(12)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 167attttattca
aaagtaagtg a 2116820DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(13)..(13)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 168cctttgtttg
tcaatttttc 2016913DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(6)locked nucleic
acidmisc_feature(10)..(12)locked nucleic acid 169tagtgtgtat gga
1317023DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic
acidmisc_feature(21)..(21)locked nucleic acid 170tatatgtgat
ttgttaatta ggt 2317120DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 171tccaaatgtc
tttgtttttc 2017213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(8)..(11)locked nucleic acid 172ccgttgtgtc cag
1317319DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(16)locked nucleic
acidmisc_feature(7)..(7)locked nucleic acid 173taaaaagaaa cgattccac
1917418DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic acid 174tttcagtacg
aggtcttc 1817520DNAArtificial SequenceSynthetic Construct
175aaggtggaca ggacgttgca 2017617DNAArtificial SequenceSynthetic
Construct 176tggagaaaca cctacgt 1717720DNAArtificial
SequenceSynthetic Constructmisc_feature(12)..(12)locked nucleic
acid 177taattgctca taacagtgga 2017813DNAArtificial
SequenceSynthetic Constructmisc_feature(3)..(6)locked nucleic acid
178aacctgaggc aac 1317918DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 179agatgaggag
gatgtcat 1818019DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 180aggtaacgat
attgtaatt 1918112DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 181caagcagaac cg
1218218DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 182tgtcagtgta
agtctaca 1818318DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(14)locked nucleic acid 183tccaaatgag
cccattaa 1818413DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 184tgtacagagc aca
1318518DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 185ttcaagacac
tgaggaaa 1818621DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 186aatgttgtgt
atagttgtct c 2118727DNAArtificial SequenceSynthetic Construct
187aacattgcat gatttgtgcc aagcatt 2718818DNAArtificial
SequenceSynthetic Constructmisc_feature(16)..(16)locked nucleic
acid 188aatgcaaaaa acctttgc 1818919DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 189tccctctcta
tatacaact 1919013DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(8)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 190cgatctgagg tat
1319119DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 191aatccatttg
gaatatgta 1919223DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 192ccatatacag
aataattata atg 2319313DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 193ctgtgtttgc ggt
1319419DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(15)..(16)locked nucleic acid 194tgaaatatta
attaggtgt 1919519DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 195tttaaatcca
catgtcgtt 1919613DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(7)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 196tgtgtcctca aga
1319719DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 197caaacgattt
cataatatt 1919818DNAArtificial SequenceSynthetic Construct
198cagtgcagtt tctctacg 1819913DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 199acacgccgca cag
1320018DNAArtificial SequenceSynthetic Construct 200acacaagcca
acgttaaa 1820119DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 201aattgctcat
agcagtata 1920213DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(6)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 202atcctgaacc aac
1320318DNAArtificial SequenceSynthetic Construct 203aagtgacagc
tcagatga 1820420DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 204ttacaatgta
gtaatcagct 2020513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(9)..(9)locked nucleic acid 205cggtccaagc ctt
1320622DNAArtificial SequenceSynthetic Construct 206taacaccaca
gttcgtttat gt 2220721DNAArtificial SequenceSynthetic Construct
207acaatattca ctgtgcccat a 2120813DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 208tgacctacga acc
1320913DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(6)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 209cagtacagca agt
1321019DNAArtificial SequenceSynthetic
Constructmisc_feature(15)..(15)locked nucleic acid 210caagcattgg
agacaacta 1921118DNAArtificial SequenceSynthetic
Constructmisc_feature(15)..(15)locked nucleic acid 211tatacctcag
atcgttgc 1821213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 212tccacgcact gta
1321318DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic acid 213tgattttgca
tttgcaga 1821418DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 214caaacacagt
ttacatat 1821513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(7)..(9)locked nucleic acid 215ttccctctct ata
1321620DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 216gttcttatct
aaaattagtg 2021721DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 217tttaactgtt
tgttctaatg t 2121813DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(10)..(12)locked nucleic acid 218ttccatatac aga
1321913DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(2)locked nucleic
acidmisc_feature(5)..(5)locked nucleic
acidmisc_feature(9)..(12)locked nucleic acid 219tctgtatatg gaa
1322021DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(14)locked nucleic
acidmisc_feature(20)..(20)locked nucleic acid 220aggtgtatta
tatgtcaaag a 2122120DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(15)locked nucleic acid 221atattatgaa
atcgtttgtt 2022213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(5)locked nucleic
acidmisc_feature(7)..(9)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 222ttgtgtcctc aag
1322313DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(9)..(11)locked nucleic acid 223cgacatgtgg att
1322418DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 224aggaatatgt
tttagatt 1822518DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 225atctgagctg
tcacttaa 1822613DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 226tgacctatac tgc
1322717DNAArtificial SequenceSynthetic Construct 227gaggatgaag
gcttgga 1722817DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 228tgacaacagg ttacaat
1722923DNAArtificial SequenceSynthetic Construct 229ccagatggac
aagcacaacc agc 2323017DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic acid 230tgtcaacagt
acagcaa 1723118DNAArtificial SequenceSynthetic Construct
231aggtagggca cacaatat 1823213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(7)..(10)locked nucleic acid 232accatacagc aac
1323317DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic acid 233ctgaacgacc ttacaaa
1723418DNAArtificial SequenceSynthetic
Constructmisc_feature(11)..(11)locked nucleic
acidmisc_feature(15)..(16)locked nucleic acid 234atacacaatt
caaacaaa 1823528DNAArtificial SequenceSynthetic Construct
235tgatttgtgc aacgaggtag aagaaagc 2823613DNAArtificial
SequenceSynthetic Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(8)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 236cgaggtagaa gaa
1323716DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 237caaacaagaa ttacag
1623818DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 238ccttctctat
atactata 1823915DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 239agtcatatac ctcac
1524018DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(13)..(14)locked nucleic acid 240attcaaaaat
aagtgaat 1824119DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(13)locked nucleic acid 241taactgtttg
ttgcattgt 1924213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(10)..(12)locked nucleic acid 242tagtgtgtat gga
1324319DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(11)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 243tgtcatttat
taattaggt 1924419DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 244ttcttctaaa
tgtctttgc 1924513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(10)..(12)locked nucleic acid 245tgtcaaaaac cgc
1324618DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(13)locked nucleic acid 246cgattccata
acatcggt 1824717DNAArtificial SequenceSynthetic Construct
247tcggtttctc tacgtgt 1724813DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 248cggtgtatgt cct
1324918DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 249catggagaaa
taactaca 1825018DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic
acidmisc_feature(13)..(13)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 250ctcataacag
tataggtc 1825113DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(8)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 251tgcaagacta tgt
1325217DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic acid 252aattgtgtga
cagctca 1725318DNAArtificial SequenceSynthetic Construct
253taattggagg tgtctggt 1825413DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 254ttgcttgtcc agc
1325519DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 255taatattgta
acgtcctgt 1925619DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(5)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 256ataaatcttc
caatttacg 1925713DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(6)..(7)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 257cactacgtct gtg
1325817DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(13)locked nucleic acid 258tgcatgattt
gtgcaac 1725918DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(14)..(4)locked nucleic acid 259cttgtttgca gtatacac
1826013DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(6)locked nucleic
acidmisc_feature(8)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 260aaagcatcca tga
1326118DNAArtificial SequenceSynthetic Construct 261cagcggagtg
aggtatat 1826218DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(15)..(16)locked nucleic acid 262aattttaaac
atttcatg 1826313DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 263agagaaggcc agc
1326421DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(11)..(11)locked
nucleic acidmisc_feature(16)..(17)locked nucleic acid 264aatatagatg
gtatagatat a 2126520DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 265aataaatgac
ataactgttt 2026613DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 266ttctccatac aca
1326718DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 267aattaggtgt
attacatg 1826818DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 268aatcgttttt
tttcttct 1826914DNAArtificial SequenceSynthetic
Constructmisc_feature(1)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 269ccagttgaaa agca
1427017DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic acid 270ccataacatc
ggtggac 1727117DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic acid 271acacctcggt
ttctcta 1727213DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(7)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 272tgtatgtcct gtt
1327318DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(13)locked nucleic acid 273tttagatttg
gaacccga 1827417DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(13)locked nucleic acid 274tatcttcctc
ctcctct 1727513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(7)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 275actgacctat act
1327617DNAArtificial SequenceSynthetic Construct 276ctattgacgg
tccagct 1727718DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 277catttacaac
aggacgtt 1827812DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 278ccagacacct cc
1227917DNAArtificial SequenceSynthetic Construct 279tgaggcgaca
ctacgtc 1728023DNAArtificial SequenceSynthetic Construct
280gtgcccatta ataaatcttc caa 2328113DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(2)locked nucleic
acidmisc_feature(5)..(6)locked nucleic
acidmisc_feature(9)..(10)locked nucleic acid 281agagcacaca cat
1328217DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic acid 282ctgaacgacc ttacaaa
1728318DNAArtificial SequenceSynthetic
Constructmisc_feature(11)..(11)locked nucleic
acidmisc_feature(15)..(16)locked nucleic acid 283atacacaatt
caaacaaa 1828417DNAArtificial SequenceSynthetic Construct
284cgctttgacg atccaaa 1728518DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 285tcttgtagtg
atgtattc 1828612DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(6)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 286agctaccaga tt
1228718DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic acid 287cgtatctatt
gcctgtgt 1828820DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(10)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 288cactatacat
aaatctttaa 2028929DNAArtificial SequenceSynthetic Construct
289agcaacattg gaacgcacag aggtatatc 2929017DNAArtificial
SequenceSynthetic Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 290atagagactg tatagca
1729120DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(12)..(14)locked nucleic acid 291atatcttaat
tctctaattc 2029214DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(9)..(12)locked nucleic acid 292tacatttatg gcat
1429318DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(10)..(11)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 293tattcaaact
ctgtatat 1829419DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(5)locked nucleic
acidmisc_feature(12)..(13)locked nucleic acid 294caccttatta
acaaattat 1929513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(8)..(9)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 295tccagtgtct ctc
1329617DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 296ccagaaacca ttgaacc
1729718DNAArtificial SequenceSynthetic
Constructmisc_feature(15)..(15)locked nucleic acid 297agctatgctg
tgaaatct 1829812DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(6)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 298cgtagacacc tt
1229917DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(14)locked nucleic acid 299cgagggcagt
gtaatac 1730017DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic acid 300cttgtgtttc
cctacgt 1730113DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(6)..(7)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 301cctggtcaca aca
1330222DNAArtificial SequenceSynthetic Construct 302tgaccaggca
cggcaagaaa ga 2230319DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 303aacactgcaa
gaaattgta 1930417DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic acid 304ctcgtaacac
aacaggt 1730513DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 305tggaacctca gaa
1330618DNAArtificial SequenceSynthetic
Constructmisc_feature(11)..(11)locked nucleic acid 306caattaagcg
agtcagag 1830717DNAArtificial SequenceSynthetic Construct
307gtcgggctgg tagttgt 1730813DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 308cgatgaagca gat
1330918DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(10)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 309aattttgtgt
gtatgttg 1831017DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 310ctgctgtagt gttctaa
1731113DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(7)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 311acggcagaat tga
1331218DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic acid 312cctacaagct
accagatt 1831318DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 313tgcaatatac
acaggcaa 1831413DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(7)locked nucleic
acidmisc_feature(9)..(11)locked nucleic acid 314cactacaaga cgt
1331517DNAArtificial SequenceSynthetic Construct 315aacattggaa
cgcacag 1731623DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 316tatgctatac
agtctctata cac 2331718DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(8)..(9)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 317aggtatatca
atttgctt 1831820DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(19)..(19)locked nucleic acid 318catgccataa
atgtatagac 2031918DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 319ccatatacag
agtttgaa 1832014DNAArtificial SequenceSynthetic
Constructmisc_feature(2)..(5)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 320tccagaatta gaga
1432120DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(12)..(12)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 321aataactaat
acagagttgt 2032217DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(14)locked nucleic acid 322tgtctacgtt
tttctgc 1732313DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(8)..(10)locked nucleic acid 323aaccattgaa ccc
1332424DNAArtificial SequenceSynthetic Construct 324ttgttaataa
ggtgcctgcg gtgc 2432518DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic acid 325ttaaggacaa
acgaagat 1832617DNAArtificial SequenceSynthetic Construct
326aagtctttct tgccgtg 1732726DNAArtificial SequenceSynthetic
Construct 327tggacagtac cgagggcagt gtaata 2632822DNAArtificial
SequenceSynthetic Construct 328tagctggaca gtaccgaggg ca
2232920DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 329tcagaatgaa
ttagatcctg 2033018DNAArtificial SequenceSynthetic Construct
330tgcttcatcg ttttcctc 1833113DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(7)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 331tgacctgttg tgt
1333218DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 332tagtcatgca
caactacc 1833319DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 333tcacacttac
aacatacac 1933412DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(7)..(8)locked nucleic acid 334ccgacgagcc ga
1233518DNAArtificial SequenceSynthetic Construct 335cggcagaatt
gagcttac 1833618DNAArtificial SequenceSynthetic Construct
336cggcagaatt gagcttac 1833719DNAArtificial SequenceSynthetic
Construct 337ggacacacaa aggacaagg 1933818DNAArtificial
SequenceSynthetic Construct 338ggacacacaa aggacaag
1833913DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 339tcggcagagg acc
1334013DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(11)..(12)locked nucleic acid 340tcggcagagg acc
1334116DNAArtificial SequenceSynthetic Construct 341gggagaccga
agtgaa 1634216DNAArtificial SequenceSynthetic Construct
342tccacttacc tctggc 1634313DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(6)..(6)locked nucleic
acidmisc_feature(8)..(10)locked nucleic acid 343ctggaccaac ccg
1334417DNAArtificial SequenceSynthetic Construct 344ctcggacagc
tcctaag 1734516DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic acid 345acccttctac
ggactc 1634613DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(9)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 346cgcccagtcc tac
1334717DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(13)locked nucleic acid 347tctcttagag
agtggct 1734818DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 348ttcttctatg
tagacaga 1834913DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(8)..(11)locked nucleic acid 349cgcattagag acc
1335018DNAArtificial SequenceSynthetic
Constructmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(13)..(13)locked nucleic acid 350tgcctacatt
ctatcttg 1835117DNAArtificial SequenceSynthetic Construct
351acgggtttcc aagacta 1735213DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(9)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 352tatgtttgtc ccc
1335318DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic acid 353cactctcagt
aattccct 1835419DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(9)..(9)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 354caaagattgt
tagtggaat 1935513DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(9)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 355tccctaccag gaa
1335617DNAArtificial SequenceSynthetic Construct 356ccgctaggat
atgacgt 1735718DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic
acidmisc_feature(15)..(17)locked nucleic acid 357ttacaatata
attagcca 1835826DNAArtificial SequenceSynthetic Construct
358acctctagca tctgctatgc gaatgc 2635916DNAArtificial
SequenceSynthetic Construct 359gcttacccct ccacaa
1636016DNAArtificial SequenceSynthetic Construct 360ggcaccgtta
gtgttg 1636121DNAArtificial SequenceSynthetic Construct
361tacccctcct acccctctgc c 2136217DNAArtificial SequenceSynthetic
Construct 362taccgaactt caaccca 1736318DNAArtificial
SequenceSynthetic Constructmisc_feature(4)..(4)locked nucleic acid
363ttgatgagta agagggtg 1836413DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(10)..(12)locked nucleic acid 364ccatcaccac cac
1336513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic acid 365tgccagacca atc
1336616DNAArtificial SequenceSynthetic
Constructmisc_feature(10)..(10)locked nucleic acid 366agcaccccaa
atgatc 1636717DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic acid 367taatggcata
ggtggaa 1736819DNAArtificial SequenceSynthetic Construct
368tccagaacca cggtccccg 1936919DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 369atcaacgacc
aacaattac 1937018DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 370ttgagtctta
gagggttg 1837113DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(10)..(10)locked nucleic
acidmisc_feature(12)..(12)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 371cccgagggta gat
1337215DNAArtificial SequenceSynthetic Construct 372ttggagacca
gagcc 1537317DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 373ttgtccctga
tgaagac 1737413DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(8)..(9)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 374gcctgaacta agt
1337516DNAArtificial SequenceSynthetic Construct 375actcaccaac
tcctgg 1637619DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic acid 376ttcatgtatt
ggtgaaacg 1937721DNAArtificial SequenceSynthetic Construct
377caatgccgcc cccgtttgta g 2137817DNAArtificial SequenceSynthetic
Constructmisc_feature(13)..(13)locked nucleic acid 378cggagtccca
taatagc 1737917DNAArtificial SequenceSynthetic Construct
379gtctgcgggg tctatag 1738013DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(4)locked nucleic
acidmisc_feature(6)..(8)locked nucleic acid 380cagaggctcc cat
1338118DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 381aaagttggga
ttacattt 1838217DNAArtificial SequenceSynthetic
Constructmisc_feature(14)..(14)locked nucleic acid 382ggcgaggtct
tttactg 1738330DNAArtificial SequenceSynthetic Construct
383tgagacaaca gaatctccta gctcagatga 3038419DNAArtificial
SequenceSynthetic Construct 384taggcccact taacactac
1938518DNAArtificial SequenceSynthetic Construct 385ggaggccctt
agacttac 1838627DNAArtificial SequenceSynthetic Construct
386cgcctctcca ttcatcatgt aacccac 2738721DNAArtificial
SequenceSynthetic Construct 387atccctagga taataccaca c
2138817DNAArtificial SequenceSynthetic Construct 388cacgtaaagc
cacaagc 1738927DNAArtificial SequenceSynthetic Construct
389agcagtgtag tcctgtcaat ctcctga 2739016DNAArtificial
SequenceSynthetic Constructmisc_feature(13)..(13)locked nucleic
acid 390ctcctaagaa ggcacc 1639117DNAArtificial SequenceSynthetic
Construct 391ctcctcttct tgctgga 1739213DNAArtificial
SequenceSynthetic Constructmisc_feature(3)..(5)locked nucleic
acidmisc_feature(8)..(8)locked nucleic
acidmisc_feature(12)..(12)locked nucleic acid 392caagaaccca gac
1339318DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(11)..(11)locked nucleic
acidmisc_feature(16)..(16)locked nucleic acid 393attagagacc
actttgag 1839419DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(17)..(17)locked nucleic acid 394ttagtcttca
tcctcttct 1939513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(5)locked nucleic
acidmisc_feature(8)..(11)locked nucleic acid 395cgccaatctg tct
1339619DNAArtificial SequenceSynthetic
Constructmisc_feature(16)..(16)locked nucleic acid 396tctaattgtt
gacacggat 1939717DNAArtificial SequenceSynthetic
Constructmisc_feature(6)..(6)locked nucleic acid 397tgtctgacag
ttgttcc 1739829DNAArtificial SequenceSynthetic Construct
398cttggaaacc cgtcactctc agtaattcc 2939919DNAArtificial
SequenceSynthetic Construct 399tcacctcttg atagggatc
1940018DNAArtificial SequenceSynthetic
Constructmisc_feature(17)..(17)locked nucleic acid 400attagccatc
caaagcat 1840122DNAArtificial SequenceSynthetic Construct
401cgggcatgga cctctagcat ct 2240218DNAArtificial SequenceSynthetic
Constructmisc_feature(7)..(7)locked nucleic
acidmisc_feature(12)..(12)locked nucleic
acidmisc_feature(14)..(15)locked nucleic acid 402atattgtaag
acaatcac 1840315DNAArtificial SequenceSynthetic Construct
403atgtggctgg accaa 1540413DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(3)locked nucleic
acidmisc_feature(5)..(5)locked nucleic
acidmisc_feature(7)..(7)locked nucleic
acidmisc_feature(11)..(11)locked nucleic acid 404cctgaggggc tgt
1340515DNAArtificial SequenceSynthetic Construct 405ctctacgccc
gacag 1540616DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic acid 406ttggtggcat
catgag 1640723DNAArtificial SequenceSynthetic Construct
407tgtcacctct gtcacaaccg agg 2340816DNAArtificial SequenceSynthetic
Construct 408acccacacca ctactc 1640916DNAArtificial
SequenceSynthetic Constructmisc_feature(16)..(16)locked nucleic
acid 409tctggcacat gcaaga 1641026DNAArtificial SequenceSynthetic
Construct 410taccgaactt caacccacac catcac 2641118DNAArtificial
SequenceSynthetic Constructmisc_feature(16)..(16)locked nucleic
acid 411aatcaatgca ccctctta 1841220DNAArtificial SequenceSynthetic
Constructmisc_feature(5)..(5)locked nucleic
acidmisc_feature(18)..(19)locked nucleic acid 412aatgttataa
aatacagtcg 2041326DNAArtificial SequenceSynthetic Construct
413tgatccagat agtccagaac cacggt 2641417DNAArtificial
SequenceSynthetic Construct 414attacccccc tcacaat
1741520DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic
acidmisc_feature(18)..(18)locked nucleic acid 415tagatgatgt
aattgttggt 2041619DNAArtificial SequenceSynthetic Construct
416caccaccagc agcaccagc 1941715DNAArtificial SequenceSynthetic
Construct 417acaagcaacg caagc 1541818DNAArtificial
SequenceSynthetic Constructmisc_feature(11)..(11)locked nucleic
acid 418aggactggac ttagttca 1841923DNAArtificial SequenceSynthetic
Construct 419accttggaga ccagagccaa aca 2342019DNAArtificial
SequenceSynthetic Constructmisc_feature(4)..(4)locked nucleic
acidmisc_feature(14)..(14)locked nucleic acid 420cgtttgtaga
aattcacac 1942117DNAArtificial SequenceSynthetic
Constructmisc_feature(12)..(12)locked nucleic acid 421tctgggctat
tatggga 1742214DNAArtificial SequenceSynthetic
Constructmisc_feature(4)..(6)locked nucleic
acidmisc_feature(10)..(11)locked nucleic acid 422tcaccaatac atga
1442317DNAArtificial SequenceSynthetic Construct 423ccattctctt
ccccgat 1742418DNAArtificial SequenceSynthetic
Constructmisc_feature(9)..(9)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 424aaatgtaatc
ccaacttt 1842513DNAArtificial SequenceSynthetic
Constructmisc_feature(3)..(6)locked nucleic
acidmisc_feature(13)..(13)locked nucleic
acidmisc_feature(15)..(15)locked nucleic acid 425ccgcagactt aga
13
* * * * *