U.S. patent application number 17/585765 was filed with the patent office on 2022-08-18 for compositions and methods for xi chromosome reactivation.
This patent application is currently assigned to University of Massachusetts. The applicant listed for this patent is University of Massachusetts. Invention is credited to Sanchita Bhatnagar, Michael R. Green.
Application Number | 20220259654 17/585765 |
Document ID | / |
Family ID | |
Filed Date | 2022-08-18 |
United States Patent
Application |
20220259654 |
Kind Code |
A1 |
Green; Michael R. ; et
al. |
August 18, 2022 |
COMPOSITIONS AND METHODS FOR XI CHROMOSOME REACTIVATION
Abstract
In some aspects, the disclosure relates to the reactivation of
inactive X chromosomes (Xi). In some embodiments, the disclosure
provides compositions and methods for the reactivation of inactive
X chromosomes. In some embodiments, the compositions and methods
described by the disclosure may be useful for the treatment of
dominant X-linked diseases.
Inventors: |
Green; Michael R.;
(Boylston, MA) ; Bhatnagar; Sanchita; (Free Union,
VA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Massachusetts |
Boston |
MA |
US |
|
|
Assignee: |
University of Massachusetts
Boston
MA
|
Appl. No.: |
17/585765 |
Filed: |
January 27, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16897549 |
Jun 10, 2020 |
11268150 |
|
|
17585765 |
|
|
|
|
15566533 |
Oct 13, 2017 |
10718022 |
|
|
PCT/US2016/027840 |
Apr 15, 2016 |
|
|
|
16897549 |
|
|
|
|
62148106 |
Apr 15, 2015 |
|
|
|
International
Class: |
C12Q 1/6883 20060101
C12Q001/6883; G01N 33/50 20060101 G01N033/50 |
Goverment Interests
FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under grant
number GM033977 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1. A method of inducing expression of an X-linked gene in a cell
having an inactive X chromosome, the method comprising delivering
to the cell an X chromosome inactivation factor (XCIF) inhibitor in
an amount effective for inducing expression of the X-linked gene,
optionally wherein the cell is of a subject having a dominant
X-linked disease.
2. (canceled)
3. The method of claim 1, wherein the X-linked gene is MECP2.
4. (canceled)
5. The method of claim 1, wherein the dominant X-linked disease is
selected from the group consisting of Rett Syndrome, X-linked
hypophosphatemia, incontinentia pigmenti type 2, Aicardi syndrome,
CDK5L syndrome, focal dermal hypoplasia, CHILD syndrome,
Lujan-Fryns syndrome, orofaciodigital syndrome 1, hereditary
nephritis (Alport syndrome), Giuffre-Tsukahara syndrome, Goltz
syndrome, Fragile X syndrome, Bazex-Dupre-Christol syndrome,
Charcot-Marie-Tooth disease, chondrodysplasia punctate,
erythropoietic protoporphyria, scapuloperoneal myopathy, and
craniofrontonasal dysplasia.
6. The method of claim 1, wherein the XCIF inhibitor selectively
inhibits activity of an X chromosome inactivation factor selected
from the group consisting of: ACVR1, AURKA, DNMT1, FBXO8, LAYN,
NF1, PI3K, PDPK1, PYGO1, RNF165, SGK1/2, SOX5, STC1, ZNF426 and
C17orf98.
7. The method of claim 6, wherein: (i) the X chromosome
inactivation factor is PI3K and the XCIF inhibitor is GNE-317 or
LY29400, or (ii) the X chromosome inactivation factor is PDPK1 and
the XCIF inhibitor is OSU-03012 or BX912; or, (iii) the X
chromosome inactivation factor is AURKA and the XCIF inhibitor is
VX680, CD532, or MLN8237; or, (iv) the X chromosome inactivation
factor is SGK1/2 and the XCIF inhibitor is GSK650394; or, (v) the X
chromosome inactivation factor is ACVR1 and the XCIF inhibitor is
K02288, dorsomorphin, or LDN193189.
8-11. (canceled)
12. The method of claim 1, wherein the XCIF inhibitor selectively
inhibits activity of mTOR, optionally wherein the inhibitor is
rapamycin, KU-0063794, or everolimus.
13. (canceled)
14. The method of claim 1, wherein the XCIF inhibitor is an
inhibitory oligonucleotide having a region of complementarity that
is complementary with at least 8 nucleotides of an mRNA encoded by
an XCIF gene, optionally wherein: (i) the inhibitory
oligonucleotide is selected from the group consisting of: antisense
oligonucleotide, siRNA, shRNA and miRNA; or, (ii) the inhibitory
oligonucleotide comprises one or more modified nucleotides, wherein
the one or more of the modified nucleotides is an LNA nucleotide;
or, (iii) inhibitory oligonucleotide comprises one or more modified
internucleoside linkages.
15-18. (canceled)
19. The method of claim 1 further comprising determining that the
cell has a mutant allele of the X-linked gene.
20. The method of claim 1 further comprising determining that
delivery of the XCIF inhibitor to the cell results in (i) induced
expression of the X-linked gene, or a wild-type allele of the
X-linked gene; or, (ii) determining that an X-chromosome is
reactivated; or (iii) determining that there is decreased
expression or activity of XIST.
21-23. (canceled)
24. The method of claim 1, wherein in the cell is in vitro or in a
subject.
25. (canceled)
26. A method of treating a subject having a dominant X-linked
disease, the method comprising: administering to the subject an X
chromosome inactivation factor (XCIF) inhibitor in an amount
effective for inducing expression a target X-linked gene.
27. The method of claim 26, wherein the dominant X-linked disease
results from a mutated allele of the X-linked gene, and wherein the
inhibitor is administered in an amount effective for inducing
expression of a wild-type allele of the X-linked gene.
28. The method of claim 26, wherein the X-linked gene is MECP2.
29. (canceled)
30. The method of claim 28, wherein the dominant X-linked disease
is selected from the group consisting of: Rett Syndrome, X-linked
hypophosphatemia, incontinentia pigmenti type 2, Aicardi syndrome,
CDK5L syndrome, focal dermal hypoplasia, CHILD syndrome,
Lujan-Fryns syndrome, orofaciodigital syndrome 1, hereditary
nephritis (Alport syndrome), Giuffre-Tsukahara syndrome, Goltz
syndrome, Fragile X syndrome, Bazex-Dupre-Christol syndrome,
Charcot-Marie-Tooth disease, chondrodysplasia punctate,
erythropoietic protoporphyria, scapuloperoneal myopathy, and
craniofrontonasal dysplasia.
31. The method of claim 26, wherein the XCIF inhibitor selectively
inhibits activity of an X chromosome inactivation factor selected
from the group consisting of: ACVR1, AURKA, DNMT1, FBXO8, LAYN,
NF1, PI3K, PDPK1, PYGO1, RNF165, SGK1/2, SOX5, STC1, ZNF426 and
C17orf98.
32. The method of claim 31, wherein: (i) the X chromosome
inactivation factor is PI3K and the XCIF inhibitor is GNE-317 or
LY29400, or (ii) the X chromosome inactivation factor is PDPK1 and
the XCIF inhibitor is OSU-03012 or BX912; or, (iii) the X
chromosome inactivation factor is AURKA and the XCIF inhibitor is
VX680, CD532, or MLN8237; or, (iv) the X chromosome inactivation
factor is SGK1/2 and the XCIF inhibitor is GSK650394; or (v) the X
chromosome inactivation factor is ACVR1 and the XCIF inhibitor is
K02288, dorsomorphin, or LDN193189.
33-36. (canceled)
37. The method of claim 26, wherein the XCIF inhibitor selectively
inhibits activity of mTOR, optionally wherein the inhibitor is
rapamycin, KU-0063794, or everolimus.
38. (canceled)
39. The method of claim 26, wherein the XCIF inhibitor is an
inhibitory oligonucleotide having a region of complementarity that
is complementary with at least 8 nucleotides of an mRNA encoded by
an XCIF gene, optionally wherein (i) the inhibitory oligonucleotide
is selected from the group consisting of: antisense
oligonucleotide, siRNA, shRNA and miRNA; or, (ii) the inhibitory
oligonucleotide comprises one or more modified nucleotides, wherein
the one or more modified nucleotides is an LNA nucleotide; or,
(iii) inhibitory oligonucleotide comprises one or more modified
internucleoside linkages.
40-43. (canceled)
44. The method of claim 26 further comprising determining that the
subject has a mutant allele of the X-linked gene.
45. The method of claim 26 further comprising determining that
delivery of the XCIF inhibitor to the cell results in (i) induced
expression of the X-linked gene, or a wild-type allele of the
X-linked gene; or, (ii) determining that an X-chromosome is
reactivated; or, (iii) determining that there is decreased
expression or activity of XIST.
46-48. (canceled)
Description
RELATED APPLICATIONS
[0001] This application is a continuation under 35 U.S.C. .sctn.
120 of U.S. application Ser. No. 15/566,533, filed Oct. 13, 2017,
entitled "COMPOSITIONS AND METHODS FOR XI CHROMOSOME REACTIVATION",
which is a National Stage Application of PCT/US2016/027840, filed
Apr. 15, 2016, entitled "COMPOSITIONS AND METHODS FOR XI CHROMOSOME
REACTIVATION", which claims the benefit under 35 U.S.C. .sctn.
119(e) of U.S. Provisional Application Ser. No. 62/148,106,
entitled "COMPOSITION AND METHODS FOR XI CHROMOSOME REACTIVATION",
filed Apr. 15, 2015, the entire contents of each of which are
incorporated by reference herein.
FIELD OF THE DISCLOSURE
[0003] The invention relates to methods for reactivating mammalian
inactive X chromosomes through genetic and pharmacological
means.
BACKGROUND OF THE DISCLOSURE
[0004] X chromosome inactivation (XCI), the random transcriptional
silencing of one X chromosome in somatic cells of female mammals,
is a mechanism that ensures equal expression of X-linked genes in
both sexes. XCI is initiated by Xist, a 17-kb non-coding RNA whose
expression during early embryogenesis is both necessary and
sufficient for silencing. Xist represses transcription in cis by
coating only the X chromosome from which it is produced. Once Xist
has been upregulated during early development or differentiation,
it continues to be expressed from the inactive X (Xi) even in fully
differentiated somatic cells. Prior to the initiation of XCI, Tsix,
an antisense repressor of Xist, blocks Xist upregulation on the
future active X chromosome (Xa).
[0005] An understanding of the factors and mechanisms involved in
XCI is directly relevant to certain human diseases (e.g., dominant
X-linked diseases). For example, loss-of-function mutations in the
X-linked methyl-CpG binding protein 2 (MECP2) gene lead to the
neurodevelopmental disorder Rett syndrome (RTT). Most RTT patients
are females who are heterozygous for MECP2 deficiency due to random
XCI. Therapeutic options for the treatment of dominant X-linked
diseases, such as Rett syndrome, remain limited.
[0006] Accordingly, there is a need for new compositions and
methods of treatment for dominant X-linked diseases.
SUMMARY OF THE DISCLOSURE
[0007] The instant disclosure relates to methods and compositions
for the reactivation of inactive X (Xi) chromosomes. In some
aspects, the methods and compositions described herein may be
useful for the treatment of dominant X-linked diseases, such as
Rett syndrome. The disclosure is based, in part, on the discovery
that inhibition of X chromosome inactivating factors (XCIFs) can
mediate reactivation of inactive X chromosomes, re-expression of
Xi-linked genes and/or reduce expression or activity of the
Xist.
[0008] Accordingly, in some aspects, the disclosure provides a
method of inducing expression of an X-linked gene in a cell having
an inactive X chromosome, the method comprising delivering to the
cell an X chromosome inactivation factor (XCIF) inhibitor in an
amount effective for inducing expression of the X-linked gene.
[0009] In some aspects, the disclosure provides a method of
treating a subject having a dominant X-linked disease, the method
comprising administering to the subject an X chromosome
inactivation factor (XCIF) inhibitor in an amount effective for
inducing expression a target X-linked gene. In some embodiments,
the dominant X-linked disease results from a mutated allele of the
X-linked gene, and wherein the inhibitor is administered in an
amount effective for inducing expression of a wild-type allele of
the X-linked gene.
[0010] In some embodiments, the cell is of a subject having a
dominant X-linked disease resulting from a mutated allele of the
X-linked gene. In some embodiments, the X-linked gene is MECP2. In
some embodiments, the X-linked gene is MECP2 and the X-linked
disease is Rett Syndrome.
[0011] In some embodiments, the dominant X-linked disease is
selected from the group consisting of: X-linked hypophosphatemia,
incontinentia pigmenti type 2, Aicardi syndrome, CDK5L syndrome,
focal dermal hypoplasia, CHILD syndrome, Lujan-Fryns syndrome,
orofaciodigital syndrome 1, hereditary nephritis (Alport syndrome),
Giuffre-Tsukahara syndrome, Goltz syndrome, Fragile X syndrome,
Bazex-Dupre-Christol syndrome, Charcot-Marie-Tooth disease,
chondrodysplasia punctate, erythropoietic protoporphyria,
scapuloperoneal myopathy, and craniofrontonasal dysplasia.
[0012] In some embodiments, the XCIF inhibitor selectively inhibits
activity of an X chromosome inactivation factor selected from the
group consisting of: ACVR1, AURKA, DNMT1, FBXO8, LAYN, NF1, PDPK1,
PYGO1, RNF165, SGK1/2, SOX5, STC1, ZNF426 and C17orf98. In some
embodiments, the X chromosome inactivation factor is PI3K and the
XCIF inhibitor is GNE-317 or LY29400. In some embodiments, the X
chromosome inactivation factor is PDPK1 and the XCIF inhibitor is
OSU-03012 or BX912. In some embodiments, the X chromosome
inactivation factor is AURKA and the XCIF inhibitor is VX680,
CD532, or MLN8237. In some embodiments, the X chromosome
inactivation factor is SGK1/2 and the XCIF inhibitor is GSK650394.
In some embodiments, the X chromosome inactivation factor is ACVR1
and the XCIF inhibitor is dorsomorphin, K02288 or LDN193189.
[0013] In some embodiments, the XCIF inhibitor selectively inhibits
activity of mammalian target of rapamycin (mTOR). In some
embodiments, the XCIF inhibitor is rapamycin, KU-0063794, or
everolimus.
[0014] In some embodiments, the XCIF inhibitor is an inhibitory
oligonucleotide having a region of complementarity that is
complementary with at least 8 nucleotides of an mRNA encoded by an
XCIF gene. In some embodiments, the inhibitory oligonucleotide is
selected from the group consisting of: antisense oligonucleotide,
siRNA, shRNA and miRNA. In some embodiments, the inhibitory
oligonucleotide is a modified inhibitory oligonucleotide. In some
embodiments, the modified inhibitory oligonucleotide comprises a
bridged nucleotide (e.g., a locked nucleic acid (LNA)),
phosphorothioate backbone, and/or a 2'-OMe modification.
[0015] In some embodiments, the method further comprises
determining that cell has a mutant allele of the X-linked gene. In
some embodiments, the method further comprises determining that
delivery of the XCIF inhibitor to the cell results in induced
expression of the X-linked gene. In some embodiments, the method
further comprises determining that delivery of the inhibitor to the
cell results in induced expression of a wild-type allele of the
X-linked gene. In some embodiments, the method further comprises
determining that delivery of the XCIF inhibitor to the cell results
in reactivation of an X chromosome. In some embodiments, the method
further comprises determining that delivery of the XCIF inhibitor
to the cell results in decreased expression or activity of XIST. In
some embodiments, the cell is in vitro. In some embodiments, the
cell is in a subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIGS. 1A-1C show identification of factors involved in
mammalian XCI. FIG. 1A shows a schematic summary of the shRNA
screen. The Xi is designated as such due to deletion of Xist on the
Xa. FIG. 1B shows H4SV cells expressing an shRNA against one of the
13 candidates or, as a control, a non-silencing (NS) shRNA were
FACS sorted and GFP-positive cells isolated. For each KD cell line,
the percent GFP-positive cells was expressed as the fold increase
relative to that obtained with the NS shRNA, which was set to 1.
FIG. 1C shows two-color RNA FISH monitoring expression of G6pdx and
Lamp2 (left) and Pgk1 and Mecp2 (right) in each of the 13 XCIF KD
BMSL2 cell lines. DAPI staining is shown in blue. The experiment
was performed at least twice, and representative images are shown
(top) and the results quantified (bottom) from one experiment.
[0017] FIGS. 2A-2D show XCIFs are involved in initiation of XCI in
mouse embryonic stem cells. FIG. 2A shows two-color RNA FISH
monitoring expression of G6pdx and Lamp2 (left) and Pgk1 and Mecp2
(right) in the 13 XCIF KD ES cell lines following differentiation.
DAPI staining is also shown. Representative images are shown (top)
and the results quantified (bottom). FIG. 2B shows percentage of
alkaline phosphatase-negative single cells in the 13 XCIF KD ES
cell lines before (top, undifferentiated) and after (bottom,
differentiated) treatment with RA. FIG. 2C shows qRT-PCR analysis
monitoring expression of Oct4 in the 13 XCIF KD ES cell lines
following treatment with RA. As a control, expression of Oct4 in
undifferentiated ES cells is shown and was set to 1. Error bars
indicate SD. FIG. 2D shows qRT-PCR analysis of XCIFs in
undifferentiated and differentiated mouse ES cells. Expression in
differentiated ES cells was normalized to that observed in
undifferentiated cells, which was set to 1. Error bars indicate
SD.
[0018] FIGS. 3A-3I show XCIFs function by promoting Xist expression
and/or localization, and DNMT1 is a transcriptional activator of
Xist on the Xi. FIG. 3A shows qRT-PCR analysis monitoring Xist
expression in the 13 XCIF KD ES cell lines following
differentiation. Expression in differentiated ES cells was
normalized to that obtained with the NS shRNA, which was set to 1.
Error bars indicate SE. FIG. 3B shows RNA FISH monitoring
localization of Xist in the 13 XCIF KD ES cell lines following
differentiation. Cells were categorized as having either a typical
Xist cloud or "other" pattern, which includes either the lack of a
detectable Xist signal or presence of two small Xist signals, as in
undifferentiated ES cells. FIG. 3C shows RNA FISH monitoring
expression of Xist (top) and Mecp2 (bottom) in BMSL2 cells treated
with an Xist locked nucleic acid antisense oligonucleotide (LNA
ASO) or a control LNA ASO. FIG. 3D shows ChIP analysis monitoring
binding of DNMT1 and POL2 to the Xist promoter and exon 2 in BMSL2
cells expressing a NS or Dnmt1 shRNA. Error bars indicate SD. FIG.
3E shows nuclear run-on assay monitoring transcription of Xist,
Hprt and Tbp in BMSL2 cells expressing a NS or DNMT1 shRNA. FIG. 3F
shows qRT-PCR analysis monitoring Xist levels in BMSL2 cells
expressing a NS or Dnmt1 shRNA following treatment with actinomycin
D. Actin mRNA was used as a normalization control. Error bars
indicate SD. FIG. 3G shows qRT-PCR analysis monitoring Xist
expression in MEFs isolated from female Dnmt1+/+ and Dnmt1-/-
embryos. Four different litters were analyzed (n=4 mice total per
genotype), and the results were averaged. Expression was normalized
to that observed in Dnmt1+/+ MEFs, which was set to 1. Error bars
indicate SD.*P<0.001 (Student's t-test). FIG. 3H shows qRT-PCR
monitoring levels of Xist and Tsix in H4SV cells expressing a NS or
DNMT1 shRNA. Expression was normalized to that obtained with the NS
shRNA, which was set to 1. Error bars indicate SD. FIG. 3I shows
qRT-PCR analysis monitoring Hprt and Xist expression in BMSL2 cells
treated in the absence or presence of 5-AZA. Expression was
normalized to that observed in the absence of 5-AZA, which was set
to 1. Error bars indicate SD.
[0019] FIGS. 4A-4I show reactivation of the Xi-linked Mecp2 gene by
small molecule XCIF inhibitors. FIGS. 4A-4B show two-color RNA FISH
monitoring expression of Xist and Mecp2 in differentiated mouse ES
cells treated with DMSO (control or -), OSU-03012 or LY294002 (FIG.
4A), and in BMSL2 cells treated with DMSO or GNE-317 (FIG. 4B).
Representative images are shown (top) using the higher
concentrations of the inhibitors, and the results quantified
(bottom). Yellow arrowheads indicate co-localizing Xist and Mecp2
signals; white arrowheads indicate Mecp2 signals not co-localizing
with Xist. FIG. 4C shows two-color RNA FISH monitoring Xist and
Mecp2 expression in mouse cortical neurons treated with DMSO
(control or -), OSU-03012, BX912 or LY294002. Representative images
are shown (top) and the results quantified (bottom). Arrowheads
indicate Mecp2 signals. FIG. 4D shows two-color RNA FISH monitoring
expression of Xist and Mecp2 in mouse BMSL2 fibroblasts treated
with DMSO (control or -) or GSK650394. Representative images are
shown (top) and the results quantified (bottom). Arrowheads
indicate Mecp2 signals. FIG. 4E shows qRT-PCR monitoring expression
of Xist (left) and Mecp2 (right) in BMSL2 cells treated with DMSO
or increasing concentrations of GSK650394 (2.5, 5 or 10 PM). FIG.
4F shows two-color RNA FISH monitoring expression of Xist and Mecp2
in BMSL2 cells treated with DMSO or K02288. Representative images
are shown (top) and the results quantified (bottom). Arrowheads
indicate Mecp2 signals. FIG. 4G shows qRT-PCR monitoring expression
of Xist (left) and Mecp2 (right) in BMSL2 cells treated with DMSO,
K02288 (0.5 .mu.M) or LDN193189 (0.5 .mu.M). FIG. 4H shows
Two-color RNA FISH monitoring Xist and Mecp2 expression in BMSL2
cells treated with DMSO (control or -), LY294002 or OSU-03012, and
at least 6 days following removal of the inhibitor. Representative
images are shown (top) and the results quantified (bottom).
Arrowheads indicate Mecp2 signals. FIG. 4I shows qRT-PCR monitoring
Xi-linked wild-type MECP2 expression in human RTT fibroblasts
treated with DMSO (-), 5-azacytidine (5-AZA), BX912, OSU-03012 or
VX680. As a control, Xa-linked wild-type MECP2 expression was
monitored in another clonal fibroblast cell line derived from the
same RTT patient (lane 1). The arrowhead indicates the wild-type
MECP2 qRT-PCR product. GAPDH was monitored as a loading control.
Bottom, schematic of the MECP2 wild-type (wt) and mutant (mut)
alleles.
[0020] FIGS. 5A-5B show defective XCI in female Stc1-/- MEFs. FIG.
5A shows two-color RNA FISH monitoring expression of G6pdx and
Lamp2 (top) and Pgk1 and Mecp2 (bottom) in female Stc1+/+ and
Stc1-/- MEFs, and as a control male Stc1-/- MEFs. Representative
images are shown (top) and the results quantified (bottom). FIG. 5B
shows qRT-PCR analysis monitoring Xist expression in MEFs isolated
from female Stc1+/+ and Stc1-/- embryos. Four different litters
were analyzed (n=4 mice total per genotype), and the results were
averaged. Expression was normalized to that of the ribosomal gene
RPL4, and Xist expression in Stc1+/+ MEFs was set to 1. Error bars
indicate SD. *P<0.001 (Student's t-test).
[0021] FIGS. 6A-6G show defective XCI in female Stc1-/- mice is not
accompanied by increased X-linked gene expression. FIG. 6A shows a
schematic of the RNA-Seq analysis pipeline. FIG. 6B shows
distribution of log 2 transformed ratio of X-linked gene expression
in MEFs from female Stc1-/- (KO) and Stc1+/+ (WT) embryos (n=3 per
genotype). FIG. 6C shows a box plot of X-linked gene expression
(log 2 transformed FPKM) in MEFs from female Stc1-/- and Stc1+/+
embryos (n=3 per genotype). Boxed areas span the first to the third
quartile. Whiskers represent 15.sup.th and 85.sup.th percentiles.
FIG. 6D shows qRT-PCR analysis monitoring expression of Mecp2 and
Hprt in MEFs from 2 different litters of female Stc1-/- and Stc1+/+
embryos (n=2 mice total per genotype). The results were normalized
to those obtained in Stc1+/+ MEFs, which was set to 1. Error bars
indicate SE. FIG. 6E shows an immunoblot showing MECP2 and STC1
levels in female Stc1+/+ and Stc1-/- MEFs (left) or brain tissue
female Stc1+/+ and Stc1-/- P1 mice (right) (n=3 per genotype).
(.alpha.-tubulin (TUBA) was monitored as a loading control. FIG. 6F
shows qRT-PCR analysis of Stc1, Xist, Mecp2 and Hprt expression in
BMSL2 cells expressing a NS or STC1 shRNA. The results were
normalized to those obtained with the NS shRNA, which was set to 1.
Error bars indicate SE. FIG. 6G shows an immunoblot showing MECP2
and STC1 levels in BMSL2 cells expressing a NS or Stc1 shRNA.
[0022] FIGS. 7A-7D show shRNAs targeting an XCIF reactivate the
Xi-linked Hprt gene and decrease mRNA levels of the targeted gene.
FIG. 7A shows bright field images showing growth of the 13 XCIF KD
H4SV cell lines following selection in HAT medium. FIG. 7B shows
qRT-PCR analysis monitoring target gene expression in the 13 XCIF
KD H4SV cell lines expressing the shRNA identified in the primary
screen. For each gene, knockdown efficiency was determined relative
to the level of target gene expression in the control cell line
expressing a non-silencing (NS) shRNA, which was set to 1. Error
bars indicate SD.
[0023] FIG. 7C shows bright field images showing growth of the 13
XCIF KD H4SV cell lines, expressing a second, unrelated shRNA to
that shown in FIG. 7A, following selection in HAT medium. FIG. 7D
shows qRT-PCR analysis monitoring target gene expression in the 13
XCIF KD H4SV cell lines expressing a second, unrelated shRNA to
that shown in FIG. 7B. Error bars indicate SD.
[0024] FIGS. 8A-8D show additional RNA FISH images and control
experiments related to FIGS. 1A-1C. FIG. 8A shows representative
two-color RNA FISH images showing expression of G6pdx and Lamp2
(top) and Pgk1 and Mecp2 (bottom) in each of the 13 XCIF KD BMSL2
cell lines. DAPI staining is also shown. FIG. 8B shows that in
BMSL2 cells the Xi and Xa encode two distinguishable Pgk1 alleles,
Pgk1a and Pgk1b, respectively, which differ by a single nucleotide
polymorphism within the mRNA. Allele-specific expression of the Xi-
and Xa-linked Pgk1 genes in each of the 13 XCIF KD BMSL2 cell lines
was analyzed using a single nucleotide primer-extension (SNuPE)
assay. The ratio of Pgk1a:Pgk1b expression was calculated and
normalized to that obtained with the NS shRNA, which was set to 1.
The results show that in each of the 13 XCIF KD BMSL2 cell lines
the ratio of Pgk1a to Pgk1b was increased, indicating that
knockdown of each of the 13 XCIFs reactivated the Xi-linked Pgk-1a
gene. FIG. 8C shows that in BMSL2 cells the Xi and Xa encode two
distinguishable Pgk1 alleles, Pgk1a and Pgk1b, respectively, which
differ by a single nucleotide polymorphism within the mRNA.
Allele-specific expression of the Xi- and Xa-linked Pgk1 genes in
six representative XCIF KD BMSL2 cell lines was analyzed using a
single nucleotide primer extension (SNuPE) assay. The data are
plotted as the function of .DELTA.Rn for each sample, which
represents the reporter fluorescence for each allele (VIC/FAM)
normalized to the passive dye. The results show that in each of the
six XCIF KD BMSL2 cell lines the Xi-linked Pgk1a gene was
reactivated. FIG. 7D shows X chromosome painting experiments in the
13 XCIF KD BMSL2 cell lines. The results show that the X chromosome
content of the XCIF KD BMSL2 cell lines was similar to that of the
control BMSL2 cell line expressing a NS shRNA. Thus, the
substantially increased bi-allelic expression of X-linked genes
observed by RNA FISH in the XCIF KD cell lines cannot be explained
by differences in X chromosome number.
[0025] FIGS. 9A-9C show additional RNA FISH images and control
experiments related to FIGS. 2A-2D. FIG. 9A shoes representative
two-color RNA FISH images monitoring expression of G6pdx and Lamp2
(top) and Pgk1 and Mecp2 (bottom) in the 13 XCIF KD ES cell lines
following differentiation. DAPI staining is also shown. FIG. 9B
shows X chromosome painting experiments in the 13 XCIF KD ES cell
lines following differentiation. FIG. 9C shows qRT-PCR analysis
monitoring expression of Eomes, Tcf7l2 and Cdx2 in the 13 XCIF KD
ES cell lines following treatment with RA. As a control, expression
of each gene in undifferentiated ES cells is shown and was set to
1. Error bars indicate SD.
[0026] FIGS. 10A-10C show RNA FISH images and control experiments
related to FIGS. 3A-3I. FIG. 10A shows RNA FISH images. In each of
the 13 XCIF KD ES cell lines following differentiation, the
majority of cells that lost the typical Xist localization pattern
lacked a detectable Xist signal (see FIG. 3B). However, some cells
that had lost the typical Xist localization pattern contained two
small Xist signals, reminiscent of undifferentiated ES cells.
Examples of this latter localization pattern are shown here.
Nuclear signals are indicated in red and denoted by arrowheads;
DAPI staining is also shown. FIG. 10B shows qRT-PCR analysis
monitoring expression of Xist (left), Tsix (middle) and Dnmt1
(right) in H4SV cells expressing a NS or one of two Dnmt1 shRNAs
(Dnmt1-1 or Dnmt1-2). For Xist and Tsix expression, a second,
unrelated Dnmt1 shRNA to that used in FIG. 3H. Expression was
normalized to that obtained with the control NS shRNA, which was
set to 1. Error bars indicate SD. FIG. 10C shows qRT-PCR analysis
monitoring expression of Xist (left), Tsix (middle) and Dnmt1
(right) in differentiated ES cells expressing a NS shRNA or one of
two Dnmt1 shRNAs (Dnmt1-1 or Dnmt1-2). Expression was normalized to
that obtained with the control NS shRNA, which was set to 1. Error
bars indicate SD.
[0027] FIGS. 11A-11C show additional RNA FISH images related to
FIGS. 4A-4E. FIG. 11A and FIG. 11B show two-color RNA FISH
monitoring expression of Xist and Mecp2 in differentiated ES cells
treated with DMSO (control), OSU-03012 (4 .mu.M) or LY294002 (10
.mu.M) (FIG. 11A), and in BMSL2 cells treated with DMSO or GNE-317
(5 .mu.M) (FIG. 11B). Yellow boxes indicate cells with
co-localizing Xist and Mecp2 signals; white boxes indicate cells
with biallelic expression of Mecp2 and complete loss of the Xist
signal. FIG. 11C shows two-color RNA FISH monitoring Xist and Mecp2
expression in BMSL2 cells treated with DMSO (control), OSU-03012
(2.5 .mu.M) or LY294002 (8 .mu.M), and at least 6 days following
removal of the inhibitor. White boxes indicate cells with biallelic
expression of Mecp2.
[0028] FIGS. 12A-12B show control experiment and RNA FISH images
related to FIG. 5. FIG. 12A shows X chromosome painting experiments
in female Stc1+/+ and Stc1-/- MEFs. The results show that the X
chromosome content of Stc1-/- MEFs was similar to that of Stc1+/+
MEFs. Thus, the substantially increased bi-allelic expression of
X-linked genes observed by RNA FISH in the Stc1-/- MEFs cannot be
explained by differences in X chromosome number. FIG. 12B shows
defective XCI in cortical neurons from brain sections of female
Stc1-/- mice. Two-color RNA FISH monitoring expression of Xist and
Mecp2 or G6pdx in cortical neurons from adjacent 5-.mu.m brain
sections of female Stc1-/- and Stc1+/+ mice (n=3 per genotype,
stage P1). Boxed regions denote cells with two Mecp2 or G6pdx
signals; yellow boxes indicate cells with co-localizing Xist and
Mecp2/G6pdx signals. All cells in the regions shown represent
neurons that, based on anatomical landmarks, are present in
post-hybridized sections.
[0029] FIGS. 13A-13E show additional experiments and data analyses
related to FIGS. 6A-6G. FIG. 13A shows a volcano plot showing
distribution of log 2 transformed ratio of X-linked gene expression
in MEFs isolated from Stc1-/- (KO) and Stc1+/+ (WT) embryos (n=3
per genotype). The genes are plotted against negative transformed
log of P value. Red circles represent genes with a >2-fold
change in expression and P<0.01. The results show that the
similarity of X-linked gene expression between female Stc1+/+ and
Stc1-/- MEFs was statistically significant. FIG. 13B shows box
plots displaying changes in autosomal gene expression (log 2
transformed FPKM) in Stc1-/- and Stc1+/+ MEFs. Boxed areas span the
first to the third quartile. Whiskers represent 15.sup.th and
85.sup.th percentiles; samples falling outside these percentiles
are shown as circles. FIG. 13C shows XCIFs are not generally
required for repression of imprinted genes. Primary female mouse
embryonic fibroblasts from the strain C57BL/6 (CAST7), which
contains chromosome 7 from Mus castaneus (Cast), were transduced
with shRNAs against each of the XCIFs and analyzed for
allele-specific expression of four genes located on chromosome 7
that are either paternally expressed, (Kcnq1ot1 and Peg3) or
maternally expressed (Ascl2 and Zim1). Expression of the two
alleles can be distinguished by allele-specific restriction enzyme
digestion following gene-specific RT-PCR. The sizes of the
undigested and digested bands are indicated, and the sizes of the
predicted digested fragments are shown in the table (bottom). If
knockdown of an XCIF results in reactivation of the normally
silenced allele, a mixture of the maternal and paternal
allele-specific digestion patterns would be observed. The results
show that in all 13 XCIF KD cell lines, all four genes displayed
only the expected allele-specific expression pattern, indicating
that the XCIFs are not generally required for repression of the
imprinted genes. FIG. 13D shows involvement of Polycomb subunits
EZH2 and BMI1 for repression of the X-linked Hprt gene. (Left)
qRT-PCR analysis monitoring Hprt expression in BMSL2 cells
expressing an Ezh2 or Bmi1 shRNA or, as a control, a NS shRNA.
(Right) qRT-PCR analysis confirming target gene knockdown in mouse
ES cells expressing an Ezh2 (left) or Bmi1 (right) shRNA. Error
bars indicate SD. FIG. 13E shows analysis of available datasets
from Yildirim et al. 2013 showing the distribution of log 2
transformed ratio of X-linked gene expression in hematopoietic
cells from female heterozygous (HET) Xist mutant mice and wild-type
(WT) mice. The data were downloaded from Gene Expression Omnibus
(GSE43961), normalized by RMA and filtered by detection above
background (DABG) (cutoff P-value<0.0001) using Bioconductor
package xps. The percentage of X-linked genes upregulated
>1.5-fold is shown.
[0030] FIG. 14 shows a schematic diagram of downstream targets of
3-phosphoinositide dependent protein kinase-1 (PDPK1).
[0031] FIG. 15 shows treatment of mouse fibroblasts with an mTOR
inhibitor reactivates the Xi-linked Mecp2 gene. Relative expression
of Xist and Mecp2 in mouse fibroblasts was measured after treatment
with rapamycin, KU-0063794, or everolimus (left). Mecp2 RNA was
measured by fluorescence in situ hybridization (FISH) and
percentage of nuclei stained was quantified (right).
[0032] FIG. 16 shows treatment of mouse fibroblasts with an mTOR
inhibitor (rapamycin, KU-0063794, everolimus) reactivates the
Xi-linked Hprt gene, as measured by a
hypoxanthine-aminopterin-thymidine (HAT) selection assay.
[0033] FIG. 17 shows inhibition of Aurora kinase A (AURKA)
reactivates Xi-linked genes. Relative expression of Xist and Mecp2
in mouse fibroblasts was measured after treatment with CD532 and
MLN8237. Mecp2 RNA was measured by fluorescence in situ
hybridization (FISH) and percentage of nuclei stained was
quantified (right). Results were confirmed using a HAT selection
assay.
[0034] FIG. 18 shows treatment of mouse fibroblasts with Activin
Receptor Type 1 (ACVR1) inhibitor reactivates Xi-linked genes.
Relative expression of Xist and Mecp2 in mouse fibroblasts was
measured after treatment with K02288, dorsomorphin, or LDN193189.
Mecp2 RNA was measured by fluorescence in situ hybridization (FISH)
and percentage of nuclei stained was quantified (right). Results
were confirmed using a HAT selection assay.
DETAILED DESCRIPTION
[0035] Aspects of the disclosure relate to the biological and
pharmacological inhibition or reversal of X chromosome
inactivation. The disclosure is based, in part, on the discovery
that inhibition of X chromosome inactivating factors (XCIFs) can
mediate reactivation of inactive X chromosomes, re-expression of
X-linked genes and/or reduce expression or activity of Xist.
[0036] In some aspects, the disclosure relates to a method of
inducing expression of an X-linked gene in a cell having an
inactive X chromosome, the method comprising delivering to the cell
an X chromosome inactivation factor (XCIF) inhibitor in an amount
effective for inducing expression of the X-linked gene. As used
herein, the term "X chromosome inactivation factor" refers to a
gene or gene product (e.g., a protein) that are required for or
involved in maintenance or establishment of X chromosome
inactivation. In some embodiments, inhibition of XCIF expression
and/or activity leads to reactivation of an inactivated X
chromosome or one or more genes residing thereon (Xi-linked genes).
Thirteen X chromosome inactivation factors (XCIFs) have been
identified herein (Table 1), and are indicated as being involved in
diverse processes including cell signaling (ACVR1, AURKA, NF1, LAYN
and PDPK1), cell metabolism (STC1), ubiquitin-dependent regulation
(FBXO8 and RNF165) and transcription (PYGO1, SOX5 and ZNF426), for
example, as disclosed in Bhatnagar et al., 2014, Proc Natl Acad Sci
USA 111:12591-12598.
XCIF Inhibitors
[0037] The disclosure relates in part to a discovery of inhibitors
of XCIFs that can reactivate expression of the Xi-linked genes.
Inhibitors of XCIFs can be peptides, proteins, antibodies, small
molecules, or nucleic acids. In some embodiments, an XCIF inhibitor
selectively inhibits activity of an X chromosome inactivation
factor selected from the group consisting of: ACVR1, AURKA, DNMT1,
FBXO8, LAYN, NF1, PIK3, PDPK1, PYGO1, RNF165, SOX5, STC1, ZNF426
and C17orf98.
[0038] Aspects of the disclosure relate to inhibition of Activin
Receptor Type 1 (ACVR1), an XCIF that encodes a receptor
serine-threonine kinase (also known as ALK2) that mediates
signaling by bone morphogenic proteins (BMPs). Gain-of-function
mutations in ACVR1 result in the autosomal dominant disease
fibrodysplasia ossificans progressiva (FOP) and have been found in
the childhood malignancy diffuse intrinsic pontine glioma (DIPG).
Several small molecule ACVR1 inhibitors are available, including
K02288 and LDN193189. K02288 is a potent and selective inhibitor of
BMP type 1 receptor signaling; strongly inhibiting ACVR1/ALK2,
ALK1, and ALK6, and weakly inhibiting the other ALKs and ActRIIA.
LDN 193189 is a selective BMP signally inhibitor that inhibits the
transcriptional activity of the BMP type I receptors ACVR1/ALK2 and
ALK3; it also exhibits 200-fold selectivity for BMP versus
TGF-.beta.. Further examples of ACVR1 inhibitors include LDN19318,
DMH-1, ML-347, BML-275, dorsomorphin, and LDN-212854.
[0039] Aspects of the disclosure relate to inhibition of Aurora
Kinase A (AURKA). In some embodiments, AURKA inhibitors are small
molecules. Examples of AURKA inhibitors include but are not limited
to VX-680, MLN8237, TAS-119, MLN8054, PF-03814735, SNS-314, BI
811283, AMG 900, AZD1152, AS703569, R763, PHA-739358, CD532, and
MK-0457. In some embodiments, the X chromosome inactivation factor
is AURKA and the XCIF inhibitor is VX680. In some embodiments, the
X chromosome inactivation factor is AURKA and the XCIF inhibitor is
CD532 or MLN8237.
[0040] Aspects of the disclosure relate to inhibition of DNA
(cytosine-5)-methyltransferase 1 (DNMT1). In some embodiments,
DNMT1 inhibitors are small molecules. Examples of DNMT1 inhibitors
include but are not limited to azacitadine, fazarabine, decitabine,
sinefungin, psammaplin A, disulfiram, zebularine, and SGI-1027.
[0041] Aspects of the disclosure relate to the inhibition of
PI3K/Akt signaling to reactivate Xi-linked genes. In some
embodiments, PI3K inhibitors are small molecules. Examples of PI3K
inhibitors include but are not limited to GNE317, LY294002,
Wortmannin, demethoxyviridin, BEZ235, BGT226, BKM120, BYL719,
XL765, XL147, GDC-0941, SF1126, GSK1059615, PX-866, CAL-101,
BAY80-6946, GDC-0032, IPI-145, VS-5584, ZSTK474, SAR245409, and
RP6530. In some embodiments, the XCIF is PI3K and the XCIF
inhibitor is GNE-317 or LY29400.
[0042] Aspects of the disclosure relate to inhibition of
3-phosphoinositide-dependent protein kinase 1 (PDPK1). In some
embodiments, PDPK1 inhibitors are small molecules. Examples of
PDPK1 inhibitors include but are not limited to OSU-03012, BAG-956,
BX-795, GSK-2334470, BX-912, and PHT-427. In some embodiments, the
XCIF is PDPK1 and the XCIF inhibitor is OSU-03012 or BX912.
[0043] The serum and glucocorticoid kinase (SGK) family of
serine/threonine kinases includes three distinct but highly
homologous isoforms (SGK1, SGK2, and SGK3) that share a similar
domain structure. All three are activated by PDPK1 and have been
implicated in a wide variety of cellular processes and small
molecule inhibitors with selectivity for SGKs over AKTs have been
developed. Examples of SGK1/2 inhibitors include GSK-650394 and
EMD638683.
[0044] In some embodiments, an XCIF inhibitor targets a downstream
substrate of PDPK1.
[0045] Examples of downstream substrates to PDPK1 include but are
not limited to AKT (also known as protein kinase B), ribosomal
protein S6 kinase beta-1 (S6K1), protein kinase C (PKC), ribosomal
s6 kinase (e.g., p70.sup.rsk S6 Kinase), rho-associated,
coiled-coil-containing protein kinase 1 (ROCK1), and mammalian
target of rapamycin (mTOR). In some embodiments, an XCIF inhibitor
targets mTOR. In some embodiments, an mTOR inhibitor is a small
molecule. Examples of mTOR inhibitors include but are not limited
to rapamycin, everolimus, sirolimus, temsirolimus, deforolimus, and
KU-0063794.
[0046] In some embodiments, the term "small molecule" refers to a
synthetic or naturally occurring chemical compound, for instance a
peptide or oligonucleotide that may optionally be derivatized,
natural product or any other low molecular weight (often less than
about 5 kDalton) organic, bioinorganic or inorganic compound, of
either natural or synthetic origin. Such small molecules may be a
therapeutically deliverable substance or may be further derivatized
to facilitate delivery.
[0047] As used herein the term "inhibitor" or "repressor" refers to
any agent that inhibits, suppresses, represses, or decreases a
specific activity, such as the activity of an X chromosome
inactivation factors.
[0048] In some embodiments, an XCIF inhibitor when delivered to a
cell reactivates an inactive X chromosome or one or more genes
residing thereon. In some embodiments, delivery of an XCIF
inhibitor to a cell results in an increase in the level of
expression of an Xi-linked gene (a gene residing on the inactive
X-chromosome) of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 100%, 200% or 500% compared with the level of expression of
the gene in a control cell that has not been delivered an XCIF
inhibitor. In some embodiments, delivery of an XCIF inhibitor to a
cell results in an increase in the level of expression of an
Xi-linked gene (a gene residing in the inactive X-chromosome) in a
range of 10% to 50%, 10% to 100%, 10% to 200%, 50% to 500% or more
compared with the level of expression of the gene in a control cell
that has not been delivered an XCIF inhibitor.
Inhibitory Oligonucleotides
[0049] In some embodiments, the XCIF inhibitor is an inhibitory
oligonucleotide. Inhibitory oligonucleotides may interfere with
gene expression, transcription and/or translation. Generally,
inhibitory oligonucleotides bind to a target polynucleotide via a
region of complementarity. For example, binding of inhibitory
oligonucleotide to a target polynucleotide can trigger RNAi
pathway-mediated degradation of the target polynucleotide (in the
case of dsRNA, siRNA, shRNA, etc.), or can block the translational
machinery (e.g., antisense oligonucleotides). In some embodiments,
inhibitory oligonucleotides have a region of complementarity that
is complementary with at least 8 nucleotides of an mRNA encoded by
an XCIF gene. Inhibitory oligonucleotides can be single-stranded or
double-stranded. In some embodiments, inhibitory oligonucleotides
are DNA or RNA. In some embodiments, the inhibitory oligonucleotide
is selected from the group consisting of: antisense
oligonucleotide, siRNA, shRNA and miRNA. In some embodiments,
inhibitory oligonucleotides are modified nucleic acids.
[0050] The term "nucleotide analog" or "altered nucleotide" or
"modified nucleotide" refers to a non-standard nucleotide,
including non-naturally occurring ribonucleotides or
deoxyribonucleotides. In some embodiments, nucleotide analogs are
modified at any position so as to alter certain chemical properties
of the nucleotide yet retain the ability of the nucleotide analog
to perform its intended function. Examples of positions of the
nucleotide which may be derivatized include the 5 position, e.g.,
5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine,
5-propenyl uridine, etc.; the 6 position, e.g., 6-(2-amino)propyl
uridine; the 8-position for adenosine and/or guanosines, e.g.,
8-bromo guanosine, 8-chloro guanosine, 8-fluoroguanosine, etc.
Nucleotide analogs also include deaza nucleotides, e.g.,
7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g.,
N6-methyl adenosine, or as otherwise known in the art) nucleotides;
and other heterocyclically modified nucleotide analogs such as
those described in Herdewijn, Antisense Nucleic Acid Drug Dev.,
2000 Aug. 10(4):297-310.
[0051] Nucleotide analogs may also comprise modifications to the
sugar portion of the nucleotides. For example the 2' OH-group may
be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH,
SR, NH.sub.2, NHR, NR.sub.2, COOR, or OR, wherein R is substituted
or unsubstituted C.sub.1-C.sub.6 alkyl, alkenyl, alkynyl, aryl,
etc. Other possible modifications include those described in U.S.
Pat. Nos. 5,858,988, and 6,291,438. A locked nucleic acid (LNA),
often referred to as inaccessible RNA, is a modified RNA
nucleotide. The ribose moiety of an LNA nucleotide is modified with
an extra bridge connecting the 2' oxygen and 4' carbon.
[0052] The phosphate group of the nucleotide may also be modified,
e.g., by substituting one or more of the oxygens of the phosphate
group with sulfur (e.g., phosphorothioates), or by making other
substitutions which allow the nucleotide to perform its intended
function such as described in, for example, Eckstein, Antisense
Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al.
Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein,
Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev
et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and
U.S. Pat. No. 5,684,143. Certain of the above-referenced
modifications (e.g., phosphate group modifications) preferably
decrease the rate of hydrolysis of, for example, polynucleotides
comprising said analogs in vivo or in vitro. In some embodiments,
the inhibitory oligonucleotide is a modified inhibitory
oligonucleotide. In some embodiments, the modified inhibitory
oligonucleotide comprises a locked nucleic acid (LNA),
phosphorothioate backbone, and/or a 2'-OMe modification.
Methods of Treatment
[0053] The disclosure relates, in some aspects, to methods useful
for the treatment of certain diseases, such as dominant X-linked
diseases. For example, loss-of-function mutations in the X-linked
methyl-CpG binding protein 2 (MECP2) gene lead to the
neurodevelopmental disorder Rett syndrome (RTT).
[0054] Accordingly, in some aspects, the disclosure provides a
method of treating a subject having a dominant X-linked disease,
the method comprising administering to the subject an X chromosome
inactivation factor (XCIF) inhibitor in an amount effective for
inducing expression a target X-linked gene.
[0055] Dominant X-linked diseases typically result from a mutated
allele of the X-linked gene. The disclosure relates, in part, to
XCIF inhibitors that are effective for inducing expression of a
wild-type allele of the X-linked gene. Examples of X-linked
diseases and their associated X-linked genes include Rett syndrome
(MECP2), X-linked hypophosphatemia (PHEX), incontinentia pigmenti
type 2 (IKBKG), Aicardi syndrome (de novo mutation of an X-linked
gene), CDK5L syndrome (CDKL5), focal dermal hypoplasia (PORCN),
CHILD syndrome (NSDHL), Lujan-Fryns syndrome (MED12),
orofaciodigital syndrome 1 (OFD1), hereditary nephritis or Alport
syndrome (COL4A3, COL4A4, COL4A5), Giuffre-Tsukahara syndrome
(Xp22.13-q21.33), Goltz syndrome (PORCN), Fragile X syndrome
(FMR1), Bazex-Dupre-Christol syndrome (Xq24-q27),
Charcot-Marie-Tooth disease (GJB1), chondrodysplasia punctata
(EBP), erythropoietic protoporphyria (ALAS2), scapuloperoneal
myopathy (FLH1), and craniofrontonasal dysplasia (EFNB1).
[0056] As used herein, a "subject" is interchangeable with a
"subject in need thereof", both of which may refer to a subject
having a dominant X-linked disease, or a subject having an
increased risk of developing such a disorder relative to the
population at large. A subject in need thereof may be a subject
having an inactive X chromosome. A subject can be a human,
non-human primate, rat, mouse, cat, dog, or other mammal.
[0057] In some aspects, the disclosure provides a method of
inducing expression of an X-linked gene in a cell having an
inactive X chromosome, the method comprising delivering to the cell
an X chromosome inactivation factor (XCIF) inhibitor in an amount
effective for inducing expression of the X-linked gene. In some
embodiments, the cell is in vitro. In some embodiments, the cell is
in a subject.
[0058] As used herein, the terms "treatment", "treating", and
"therapy" refer to therapeutic treatment and prophylactic or
preventative manipulations. The terms further include ameliorating
existing symptoms, preventing additional symptoms, ameliorating or
preventing the underlying causes of symptoms, preventing or
reversing causes of symptoms, for example, symptoms associated with
a dominant X-linked disease. Thus, the terms denote that a
beneficial result has been conferred on a subject with a disorder
(e.g., a dominant X-linked disease), or with the potential to
develop such a disorder. Furthermore, the term "treatment" is
defined as the application or administration of an agent (e.g.,
therapeutic agent or a therapeutic composition) to a subject, or an
isolated tissue or cell line from a subject, who may have a
disease, a symptom of disease or a predisposition toward a disease,
with the purpose to cure, heal, alleviate, relieve, alter, remedy,
ameliorate, improve or affect the disease, the symptoms of disease
or the predisposition toward disease.
[0059] Therapeutic agents or therapeutic compositions may include a
compound in a pharmaceutically acceptable form that prevents and/or
reduces the symptoms of a particular disease (e.g., a dominant
X-linked disease). For example a therapeutic composition may be a
pharmaceutical composition that prevents and/or reduces the
symptoms of a dominant X-linked disease. It is contemplated that
the therapeutic composition of the present invention will be
provided in any suitable form. The form of the therapeutic
composition will depend on a number of factors, including the mode
of administration as described herein. The therapeutic composition
may contain diluents, adjuvants and excipients, among other
ingredients as described herein.
Pharmaceutical Compositions
[0060] In some aspects, the disclosure relates to pharmaceutical
compositions comprising an XCIF inhibitor. In some embodiments, the
composition comprises an XCIF inhibitor and a pharmaceutically
acceptable carrier. As used herein the term "pharmaceutically
acceptable carrier" is intended to include any and all solvents,
dispersion media, coatings, antibacterial and antifungal agents,
isotonic and absorption delaying agents, and the like, compatible
with pharmaceutical administration. The use of such media and
agents for pharmaceutically active substances is well known in the
art. Except insofar as any conventional media or agent is
incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions. Pharmaceutical
compositions can be prepared as described below. The active
ingredients may be admixed or compounded with any conventional,
pharmaceutically acceptable carrier or excipient. The compositions
may be sterile.
[0061] Typically, pharmaceutical compositions are formulated for
delivering an effective amount of an agent (e.g., an XCIF
inhibitor). In general, an "effective amount" of an active agent
refers to an amount sufficient to elicit the desired biological
response (e.g., reactivation of the inactive X chromosome or one or
more genes residing thereon. An effective amount of an agent may
vary depending on such factors as the desired biological endpoint,
the pharmacokinetics of the compound, the disease being treated
(e.g., a dominant X-linked disease), the mode of administration,
and the patient.
[0062] A composition is said to be a "pharmaceutically acceptable
carrier" if its administration can be tolerated by a recipient
patient. Sterile phosphate-buffered saline is one example of a
pharmaceutically acceptable carrier. Other suitable carriers are
well-known in the art. See, for example, REMINGTON'S PHARMACEUTICAL
SCIENCES, 18th Ed. (1990).
[0063] It will be understood by those skilled in the art that any
mode of administration, vehicle or carrier conventionally employed
and which is inert with respect to the active agent may be utilized
for preparing and administering the pharmaceutical compositions of
the present disclosure. Illustrative of such methods, vehicles and
carriers are those described, for example, in Remington's
Pharmaceutical Sciences, 4th ed. (1970), the disclosure of which is
incorporated herein by reference. Those skilled in the art, having
been exposed to the principles of the disclosure, will experience
no difficulty in determining suitable and appropriate vehicles,
excipients and carriers or in compounding the active ingredients
therewith to form the pharmaceutical compositions of the
disclosure.
[0064] An effective amount, also referred to as a therapeutically
effective amount, of a compound (for example, an antisense nucleic
acid (e.g. oligonucleotide) or small molecule capable of inhibiting
an XCIF) is an amount sufficient to ameliorate at least one adverse
effect associated with expression, or reduced expression, of the
gene in a cell or in an individual in need of such modulation. The
therapeutically effective amount to be included in pharmaceutical
compositions depends, in each case, upon several factors, e.g., the
type, size and condition of the patient to be treated, the intended
mode of administration, the capacity of the patient to incorporate
the intended dosage form, etc. Generally, an amount of active agent
is included in each dosage form to provide from about 0.1 to about
250 mg/kg, and preferably from about 0.1 to about 100 mg/kg. One of
ordinary skill in the art would be able to determine empirically an
appropriate therapeutically effective amount.
[0065] Combined with the teachings provided herein, by choosing
among the various active compounds and weighing factors such as
potency, relative bioavailability, patient body weight, severity of
adverse side-effects and selected mode of administration, an
effective prophylactic or therapeutic treatment regimen can be
planned which does not cause substantial toxicity and yet is
entirely effective to treat the particular subject. The effective
amount for any particular application can vary depending on such
factors as the disease or condition being treated, the particular
therapeutic agent being administered, the size of the subject, or
the severity of the disease or condition. One of ordinary skill in
the art can empirically determine the effective amount of a
particular nucleic acid and/or other therapeutic agent without
necessitating undue experimentation.
[0066] In some cases, compounds of the disclosure are prepared in a
colloidal dispersion system. Colloidal dispersion systems include
lipid-based systems including oil-in-water emulsions, micelles,
mixed micelles, and liposomes. In some embodiments, a colloidal
system of the disclosure is a liposome. Liposomes are artificial
membrane vessels which are useful as a delivery vector in vivo or
in vitro. It has been shown that large unilamellar vesicles (LUVs),
which range in size from 0.2-4.0 m can encapsulate large
macromolecules. RNA, DNA and intact virions can be encapsulated
within the aqueous interior and be delivered to cells in a
biologically active form. Fraley et al. (1981) Trends Biochem Sci
6:77.
[0067] Liposomes may be targeted to a particular tissue by coupling
the liposome to a specific ligand such as a monoclonal antibody,
sugar, glycolipid, or protein. Ligands which may be useful for
targeting a liposome to, for example, an smooth muscle cell
include, but are not limited to: intact or fragments of molecules
which interact with smooth muscle cell specific receptors and
molecules, such as antibodies, which interact with the cell surface
markers of cancer cells. Such ligands may easily be identified by
binding assays well known to those of skill in the art. In still
other embodiments, the liposome may be targeted to a tissue by
coupling it to an antibody known in the art.
[0068] Lipid formulations for transfection are commercially
available from QIAGEN, for example, as EFFECTENE.TM. (a
non-liposomal lipid with a special DNA condensing enhancer) and
SUPERFECT.TM. (a novel acting dendrimeric technology).
[0069] Liposomes are commercially available from Gibco BRL, for
example, as LIPOFECTIN.TM. and LIPOFECTACE.TM., which are formed of
cationic lipids such as N-[1-(2, 3 dioleyloxy)-propyl]-N, N,
N-trimethylammonium chloride (DOTMA) and dimethyl
dioctadecylammonium bromide (DDAB). Methods for making liposomes
are well known in the art and have been described in many
publications. Liposomes also have been reviewed by Gregoriadis G
(1985) Trends Biotechnol 3:235-241.
[0070] Certain cationic lipids, including in particular N-[1-(2, 3
dioleoyloxy)-propyl]-N,N,N-trimethylammonium methyl-sulfate
(DOTAP), may be advantageous when combined with the XCIF inhibitors
of the disclosure.
[0071] In some aspects of the disclosure, the use of compaction
agents may also be desirable. Compaction agents also can be used
alone, or in combination with, a biological or chemical/physical
vector. A "compaction agent", as used herein, refers to an agent,
such as a histone, that neutralizes the negative charges on the
nucleic acid and thereby permits compaction of the nucleic acid
into a fine granule. Compaction of the nucleic acid facilitates the
uptake of the nucleic acid by the target cell. The compaction
agents can be used alone, e.g., to deliver an XCIF inhibitor in a
form that is more efficiently taken up by the cell or, in
combination with one or more of the above-described carriers.
[0072] Other exemplary compositions that can be used to facilitate
uptake of an XCIF inhibitor include calcium phosphate and other
chemical mediators of intracellular transport, microinjection
compositions, electroporation and homologous recombination
compositions (e.g., for integrating a nucleic acid into a
preselected location within the target cell chromosome).
[0073] The compounds may be administered alone (e.g., in saline or
buffer) or using any delivery vehicle known in the art. For
instance the following delivery vehicles have been described:
cochleates; Emulsomes; ISCOMs; liposomes; live bacterial vectors
(e.g., Salmonella, Escherichia coli, Bacillus Calmette-Gudrin,
Shigella, Lactobacillus); live viral vectors (e.g., Vaccinia,
adenovirus, Herpes Simplex); microspheres; nucleic acid vaccines;
polymers (e.g., carboxymethylcellulose, chitosan); polymer rings;
proteosomes; sodium fluoride; transgenic plants; virosomes; and,
virus-like particles.
[0074] The formulations of the disclosure are administered in
pharmaceutically acceptable solutions, which may routinely contain
pharmaceutically acceptable concentrations of salt, buffering
agents, preservatives, compatible carriers, adjuvants, and
optionally other therapeutic ingredients.
[0075] The term pharmaceutically-acceptable carrier means one or
more compatible solid or liquid filler, diluents or encapsulating
substances which are suitable for administration to a human or
other vertebrate animal. The term carrier denotes an organic or
inorganic ingredient, natural or synthetic, with which the active
ingredient is combined to facilitate the application. The
components of the pharmaceutical compositions also are capable of
being commingled with the compounds of the present disclosure, and
with each other, in a manner such that there is no interaction
which would substantially impair the desired pharmaceutical
efficiency.
[0076] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, polyvinyl pyrrolidone,
carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer
solutions, and suitable organic solvents or solvent mixtures.
Dyestuffs or pigments may be added to the tablets or dragee
coatings for identification or to characterize different
combinations of active compound doses.
[0077] In addition to the formulations described herein, the
compounds may also be formulated as a depot preparation. Such
long-acting formulations may be formulated with suitable polymeric
or hydrophobic materials (for example as an emulsion in an
acceptable oil) or ion exchange resins, or as sparingly soluble
derivatives, for example, as a sparingly soluble salt.
[0078] The pharmaceutical compositions also may comprise suitable
solid or gel phase carriers or excipients. Examples of such
carriers or excipients include but are not limited to calcium
carbonate, calcium phosphate, various sugars, starches, cellulose
derivatives, gelatin, and polymers such as polyethylene
glycols.
[0079] Suitable liquid or solid pharmaceutical preparation forms
are, for example, aqueous or saline solutions for inhalation,
microencapsulated, encochleated, coated onto microscopic gold
particles, contained in liposomes, nebulized, aerosols, pellets for
implantation into the skin, or dried onto a sharp object to be
scratched into the skin. The pharmaceutical compositions also
include granules, powders, tablets, coated tablets,
(micro)capsules, suppositories, syrups, emulsions, suspensions,
creams, drops or preparations with protracted release of active
compounds, in whose preparation excipients and additives and/or
auxiliaries such as disintegrants, binders, coating agents,
swelling agents, lubricants, flavorings, sweeteners or solubilizers
are customarily used as described above. The pharmaceutical
compositions are suitable for use in a variety of drug delivery
systems. For a brief review of methods for drug delivery, see
Langer R (1990) Science 249:1527-1533, which is incorporated herein
by reference.
[0080] The compounds may be administered per se (neat) or in the
form of a pharmaceutically acceptable salt. When used in medicine
the salts should be pharmaceutically acceptable, but
non-pharmaceutically acceptable salts may conveniently be used to
prepare pharmaceutically acceptable salts thereof. Such salts
include, but are not limited to, those prepared from the following
acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric,
maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric,
methane sulphonic, formic, malonic, succinic,
naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts
can be prepared as alkaline metal or alkaline earth salts, such as
sodium, potassium or calcium salts of the carboxylic acid
group.
[0081] Suitable buffering agents include: acetic acid and a salt
(1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a
salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
Suitable preservatives include benzalkonium chloride (0.003-0.03%
w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and
thimerosal (0.004-0.02% w/v).
[0082] The compositions may conveniently be presented in unit
dosage form and may be prepared by any of the methods well known in
the art of pharmacy. All methods include the step of bringing the
compounds into association with a carrier which constitutes one or
more accessory ingredients. In general, the compositions are
prepared by uniformly and intimately bringing the compounds into
association with a liquid carrier, a finely divided solid carrier,
or both, and then, if necessary, shaping the product. Liquid dose
units are vials or ampoules. Solid dose units are tablets, capsules
and suppositories.
Modes of Administration
[0083] The pharmaceutical compositions of the present disclosure
preferably contain a pharmaceutically acceptable carrier or
excipient suitable for rendering the compound or mixture
administrable orally as a tablet, capsule or pill, or parenterally,
intravenously, intradermally, intramuscularly or subcutaneously, or
transdermally.
[0084] The pharmaceutical compositions containing an XCIF inhibitor
and/or other compounds can be administered by any suitable route
for administering medications. A variety of administration routes
are available. The particular mode selected will depend, of course,
upon the particular agent or agents selected, the particular
condition being treated, and the dosage required for therapeutic
efficacy. The methods of this disclosure, generally speaking, may
be practiced using any mode of administration that is medically
acceptable, meaning any mode that produces therapeutic effect
without causing clinically unacceptable adverse effects. Various
modes of administration are discussed herein. For use in therapy,
an effective amount of the XCIF inhibitor and/or other therapeutic
agent can be administered to a subject by any mode that delivers
the agent to the desired surface, e.g., mucosal, systemic.
[0085] Administering the pharmaceutical composition of the present
disclosure may be accomplished by any means known to the skilled
artisan. Routes of administration include but are not limited to
oral, parenteral, intravenous, intramuscular, intraperitoneal,
intranasal, sublingual, intratracheal, inhalation, subcutaneous,
ocular, vaginal, and rectal. Systemic routes include oral and
parenteral. Several types of devices are regularly used for
administration by inhalation. These types of devices include
metered dose inhalers (MDI), breath-actuated MDI, dry powder
inhaler (DPI), spacer/holding chambers in combination with MDI, and
nebulizers.
[0086] For oral administration, the compounds can be formulated
readily by combining the active compound(s) with pharmaceutically
acceptable carriers well known in the art. Such carriers enable the
compounds of the disclosure to be formulated as tablets, pills,
dragees, capsules, liquids, gels, syrups, slurries, suspensions and
the like, for oral ingestion by a subject to be treated.
Pharmaceutical preparations for oral use can be obtained as solid
excipient, optionally grinding a resulting mixture, and processing
the mixture of granules, after adding suitable auxiliaries, if
desired, to obtain tablets or dragee cores. Suitable excipients
are, in particular, fillers such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose,
hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose,
and/or polyvinylpyrrolidone (PVP). If desired, disintegrating
agents may be added, such as the cross-linked polyvinyl
pyrrolidone, agar, or alginic acid or a salt thereof such as sodium
alginate. Optionally the oral formulations may also be formulated
in saline or buffers for neutralizing internal acid conditions or
may be administered without any carriers.
[0087] Pharmaceutical preparations which can be used orally include
push-fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push-fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active compounds may
be dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. All formulations for oral administration should
be in dosages suitable for such administration. For buccal
administration, the compositions may take the form of tablets or
lozenges formulated in conventional manner.
[0088] For administration by inhalation, the compounds for use
according to the present disclosure may be conveniently delivered
in the form of an aerosol spray presentation from pressurized packs
or a nebulizer, with the use of a suitable propellant, e.g.,
dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g., gelatin for use in an inhaler or insufflator
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0089] The compounds, when it is desirable to deliver them
systemically, may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion.
Formulations for injection may be presented in unit dosage form,
e.g., in ampoules or in multi-dose containers, with an added
preservative. The compositions may take such forms as suspensions,
solutions or emulsions in oily or aqueous vehicles, and may contain
formulatory agents such as suspending, stabilizing and/or
dispersing agents.
[0090] Pharmaceutical formulations for parenteral administration
include aqueous solutions of the active compounds in water-soluble
form. Additionally, suspensions of the active compounds may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances which increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents which increase the solubility of the compounds to allow for
the preparation of highly concentrated solutions.
[0091] Alternatively, the active compounds may be in powder form
for constitution with a suitable vehicle, e.g., sterile
pyrogen-free water, before use.
[0092] The compounds may also be formulated in rectal or vaginal
compositions such as suppositories or retention enemas, e.g.,
containing conventional suppository bases such as cocoa butter or
other glycerides.
[0093] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the compounds, increasing
convenience to the subject and the physician. Many types of release
delivery systems are available and known to those of ordinary skill
in the art. They include polymer base systems such as
poly(lactide-glycolide), copolyoxalates, polycaprolactones,
polyesteramides, polyorthoesters, polyhydroxybutyric acid, and
polyanhydrides. Microcapsules of the foregoing polymers containing
drugs are described in, for example, U.S. Pat. No. 5,075,109.
Delivery systems also include non-polymer systems that are: lipids
including sterols such as cholesterol, cholesterol esters and fatty
acids or neutral fats such as mono-, di-, and tri-glycerides;
hydrogel release systems; silastic systems; peptide-based systems;
wax coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and the like. Specific
examples include, but are not limited to: (a) erosional systems in
which an agent of the disclosure is contained in a form within a
matrix such as those described in U.S. Pat. Nos. 4,452,775,
4,675,189, and 5,736,152, and (b) diffusional systems in which an
active component permeates at a controlled rate from a polymer such
as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686.
In addition, pump-based hardware delivery systems can be used, some
of which are adapted for implantation.
[0094] In some embodiments, an inhibitory oligonucleotide can be
delivered to the cells via an expression vector engineered to
express the inhibitor oligonucleotide. An expression vector is one
into which a desired sequence may be inserted, e.g., by restriction
and ligation, such that it is operably joined to regulatory
sequences and may be expressed as an RNA transcript. An expression
vector typically contains an insert that is a coding sequence for a
protein or for a inhibitory oligonucleotide such as an shRNA, a
miRNA, or an miRNA. Vectors may further contain one or more marker
sequences suitable for use in the identification of cells that have
or have not been transformed or transfected with the vector.
Markers include, for example, genes encoding proteins that increase
or decrease either resistance or sensitivity to antibiotics or
other compounds, genes that encode enzymes whose activities are
detectable by standard assays or fluorescent proteins, etc.
[0095] As used herein, a coding sequence (e.g., protein coding
sequence, miRNA sequence, shRNA sequence) and regulatory sequences
are said to be "operably" joined when they are covalently linked in
such a way as to place the expression or transcription of the
coding sequence under the influence or control of the regulatory
sequences. If it is desired that the coding sequences be translated
into a functional protein, two DNA sequences are said to be
operably joined if induction of a promoter in the 5' regulatory
sequences results in the transcription of the coding sequence and
if the nature of the linkage between the two DNA sequences does not
(1) result in the introduction of a frame-shift mutation, (2)
interfere with the ability of the promoter region to direct the
transcription of the coding sequences, or (3) interfere with the
ability of the corresponding RNA transcript to be translated into a
protein. Thus, a promoter region would be operably joined to a
coding sequence if the promoter region were capable of effecting
transcription of that DNA sequence such that the resulting
transcript might be translated into the desired protein or
polypeptide. It will be appreciated that a coding sequence may
encode an miRNA, shRNA or miRNA.
[0096] The precise nature of the regulatory sequences needed for
gene expression may vary between species or cell types, but shall
in general include, as necessary, 5' non-transcribed and 5'
non-translated sequences involved with the initiation of
transcription and translation respectively, such as a TATA box,
capping sequence, CAAT sequence, and the like. Such 5'
non-transcribed regulatory sequences will include a promoter region
that includes a promoter sequence for transcriptional control of
the operably joined gene. Regulatory sequences may also include
enhancer sequences or upstream activator sequences as desired. The
vectors of the disclosure may optionally include 5' leader or
signal sequences.
[0097] In some embodiments, a virus vector for delivering a nucleic
acid molecule is selected from the group consisting of
adenoviruses, adeno-associated viruses, poxviruses including
vaccinia viruses and attenuated poxviruses, Semliki Forest virus,
Venezuelan equine encephalitis virus, retroviruses, Sindbis virus,
and Ty virus-like particle. Examples of viruses and virus-like
particles which have been used to deliver exogenous nucleic acids
include: replication-defective adenoviruses, a modified retrovirus,
a nonreplicating retrovirus, a replication defective Semliki Forest
virus, canarypox virus and highly attenuated vaccinia virus
derivative, non-replicative vaccinia virus, replicative vaccinia
virus, Venezuelan equine encephalitis virus, Sindbis virus,
lentiviral vectors and Ty virus-like particle. Another virus useful
for certain applications is the adeno-associated virus. The
adeno-associated virus is capable of infecting a wide range of cell
types and species and can be engineered to be
replication-deficient. It further has advantages, such as heat and
lipid solvent stability, high transduction frequencies in cells of
diverse lineages, including hematopoietic cells, and lack of
superinfection inhibition thus allowing multiple series of
transductions. The adeno-associated virus can integrate into human
cellular DNA in a site-specific manner, thereby minimizing the
possibility of insertional mutagenesis and variability of inserted
gene expression. In addition, wild-type adeno-associated virus
infections have been followed in tissue culture for greater than
100 passages in the absence of selective pressure, implying that
the adeno-associated virus genomic integration is a relatively
stable event. The adeno-associated virus can also function in an
extrachromosomal fashion.
[0098] In general, other useful viral vectors are based on
non-cytopathic eukaryotic viruses in which non-essential genes have
been replaced with the gene of interest. Non-cytopathic viruses
include certain retroviruses, the life cycle of which involves
reverse transcription of genomic viral RNA into DNA with subsequent
proviral integration into host cellular DNA. In general, the
retroviruses are replication-deficient (e.g., capable of directing
synthesis of the desired transcripts, but incapable of
manufacturing an infectious particle). Such genetically altered
retroviral expression vectors have general utility for the
high-efficiency transduction of genes in vivo. Standard protocols
for producing replication-deficient retroviruses (including the
steps of incorporation of exogenous genetic material into a
plasmid, transfection of a packaging cell lined with plasmid,
production of recombinant retroviruses by the packaging cell line,
collection of viral particles from tissue culture media, and
infection of the target cells with viral particles) are provided in
Kriegler, M., "Gene Transfer and Expression, A Laboratory Manual,"
W.H. Freeman Co., New York (1990) and Murry, E. J. Ed. "Methods in
Molecular Biology," vol. 7, Humana Press, Inc., Clifton, N.J.
(1991).
[0099] Various techniques may be employed for introducing nucleic
acid molecules of the disclosure into cells, depending on whether
the nucleic acid molecules are introduced in vitro or in vivo in a
host. Such techniques include transfection of nucleic acid
molecule-calcium phosphate precipitates, transfection of nucleic
acid molecules associated with DEAE, transfection or infection with
the foregoing viruses including the nucleic acid molecule of
interest, liposome-mediated transfection, and the like. Other
examples include: N-TER.TM. Nanoparticle Transfection System by
Sigma-Aldrich, FECTOFLY.TM. transfection reagents for insect cells
by Polyplus Transfection, Polyethylenimine "Max" by Polysciences,
Inc., Unique, Non-Viral Transfection Tool by Cosmo Bio Co., Ltd.,
LIPOFECTAMINE.TM. LTX Transfection Reagent by Invitrogen,
SATISFECTION.TM. Transfection Reagent by Stratagene,
LIPOFECTAMINE.TM. Transfection Reagent by Invitrogen, FUGENE.RTM.
HD Transfection Reagent by Roche Applied Science, GMP compliant IN
VIVO-JETPEI.TM. transfection reagent by Polyplus Transfection, and
Insect GENEJUICE.RTM. Transfection Reagent by Novagen.
EXAMPLES
[0100] The following examples are intended to illustrate the
disclosure. They are not meant to limit the disclosure in any
way.
[0101] Aspects of the present disclosure relate to the reactivation
of X chromosomes. As described herein, small molecule inhibitors of
XCIFs can, like RNAi knockdown, reactivate the expression of the
Xi-linked genes, which has implications for treatment of Rett
syndrome and other dominant X-linked diseases. Thirteen X
chromosome inactivation factors (XCIFs) have been identified (Table
1), and are involved in the transcriptional repression of X-linked
genes.
TABLE-US-00001 TABLE 1 Summary of X Chromosome Inactivation Factors
Chromosome Mouse gene Human gene Mouse symbol symbol Gene name
(human) Biological process Acvr1 ACVR1 activin A receptor, 2 (2)
Signal transduction type 1 Aurka AURKA aurora kinase A 2 (20) Cell
cycle regulation Dnmt1 DNMT1 DNA 9 (19) Chromatin modification
methyltransferase (cytosine-5) 1 Fbxo8 FBXO8 F-box protein 8 8 (4)
Unknown/Ubiquitin- dependent protein catabolic process Layn LAYN
Layilin 9 (11) Unknown/Receptor for hyaluronic acid Nf1 NF1
neurofibromatosis 1 11 (17) Signal transduction Pdpk1 PDPK1
3-phosphoinositide 17 (16) Signal transduction dependent protein
kinase-1 Pygo1 PYGO1 pygopus 1 9 (15) Transcriptional regulation
Rnf165 RNF165 ring finger protein 18 (18) Unknown 165 Sox5 SOX5
SRY-box containing 6 (12) Transcriptional gene 5 regulation Stc1
STC1 stanniocalcin 1 14 (8) Cell metabolism Zfp426 ZNF426 zinc
finger protein 9 (19) Transcriptional 426 regulation 1700001P01Rik
C17orf98 RIKEN cDNA 11 (17) Unknown 1700001P01 gene
Example 1: Identification of Factors Involved in Mammalian XCI
[0102] A previously derived female mouse embryonic fibroblast cell
line (H4SV) in which genes encoding green fluorescent protein (GFP)
and hypoxanthine guanine phosphoribosyltransferase (HPRT) are
present only on the Xi was used. Knockdown of a factor involved in
XCI is expected to reactivate expression of the Gfp and Hprt
reporter genes (FIG. 1A).
[0103] A genome-wide mouse shRNA library comprising 62,400 shRNAs
was divided into 10 pools, which were packaged into retrovirus
particles and used to transduce H4SV cells. GFP-positive cells were
selected by fluorescence-activated cell sorting (FACS), expanded,
and the shRNAs were identified by sequence analysis. To validate
the candidates, single shRNAs directed against each candidate gene
were transduced into H4SV cells and the number of GFP-positive
cells measured by FACS analysis. The results of these experiments
identified 13 candidate genes whose knockdown resulted in an
increased percentage of GFP-positive cells relative to that
obtained with a control, non-silencing (NS) shRNA (FIG. 1B). The
cell viability assay of FIG. 7A shows that knockdown of each
candidate enabled growth in HAT medium, indicating that the
Xi-linked Hprt gene was reactivated. As expected, the mRNA levels
of the 13 candidate genes were decreased in the corresponding KD
H4SV cell line (FIG. 7B). To rule out off-target effects, for all
13 candidates it was shown that a second, unrelated shRNA also
reactivated the Xi-linked Hprt gene (FIG. 7C) and decreased mRNA
levels of the targeted gene in the corresponding KD H4SV cell line
(FIG. 7D). The 13 X chromosome inactivation factors (XCIFs) are
listed in Table 1 and include proteins that are known, or
predicted, to be involved in diverse processes including cell
signaling (PDPK1, AURKA, LAYN, ACVR1 and NF1), transcription
(DNMT1, PYGO1, SOX5 and ZFP426) and ubiquitin-dependent regulation
(RNF165 and FBXO8). Significantly, DNMT1 has been previously shown
to be involved in XCI, validating the screening strategy.
[0104] To confirm these results, the expression of four X-linked
genes, G6pdx, Lamp2, Pgk1 and Mecp2 was analyzed, using two-color
RNA fluorescence in situ hybridization (FISH) in BMSL2 cells, an
unrelated female mouse fibroblast cell line. In BMSL2 cells
expressing a control NS shRNA, RNA FISH revealed, as expected, a
single nuclear signal for G6pdx, Lamp2, Pgk1 and Mecp2, indicative
of monoallelic expression (FIG. 1C and FIG. 8A). Knockdown of each
of the 13 XCIFs substantially increased the fraction of cells
containing two nuclear G6pdx, Lamp2, Pgk1 and Mecp2 signals,
indicative of biallelic expression. Reactivation of G6pdx, Pgk1,
Mecp2 and Hprt in the 13 XCIF KD BMSL2 cell lines was also
demonstrated by a 1.5-2-fold increase in mRNA levels as monitored
by qRT-PCR (FIG. 8B). Reactivation of the Xi-linked Pgk1 gene in
representative XCIF KD BMSL2 cell lines was also demonstrated using
a single nucleotide primer extension (SNuPE) assay (FIG. 8C), which
could distinguish expression of the Xi- and Xa-linked Pgk1 alleles
by virtue of a single nucleotide polymorphism. DNA FISH experiments
using an X chromosome-specific paint probe indicated that the X
chromosome content of the XCIF KD BMSL2 cell lines was similar to
that of the control BMSL2 cell line expressing a NS shRNA (FIG.
8D).
Example 2: The XCIFs are Involved in Initiation of XCI in Mouse
Embryonic Stem Cells
[0105] Undifferentiated female mouse PGK12.1 ES cells were
transduced with a retrovirus expressing an XCIF shRNA. Cells were
then treated with retinoic acid (RA), which induces predominantly,
but not exclusively, neuronal differentiation. X-linked gene
expression was monitored by two-color RNA FISH. FIG. 2A and FIG. 9A
show that biallelic expression of the X-linked G6pdx, Lamp2, Pgk1
and Mecp2 genes was substantially increased following knockdown of
each XCIF. As above, the X chromosome content of the XCIF KD ES
cells was similar to that of the control ES cell line expressing a
NS shRNA (FIG. 9B).
[0106] A possible explanation for the failure of one or more of the
13 XCIF KD ES cell lines to undergo XCI is that the XCIF is
involved in differentiation. Following RA treatment,
differentiation of the 13 XCIF KD ES cell lines was normal, as
evidenced by monitoring two well-established markers of
undifferentiated ES cells, alkaline phosphatase activity (FIG. 2B)
and Oct4 expression (FIG. 2C). Likewise, several markers of
differentiated cells that increase after RA treatment (Eomes
[neuronal], Tcf712 [mesoderm] and Cdx2 [epithelial]) were
unaffected by XCIF knockdown (FIG. 9C). Finally, the quantitative
real-time RT-PCR (qRT-PCR) results of FIG. 2D show that expression
of all 13 XCIFs was upregulated following differentiation,
explaining, at least in part, the selective onset of XCI following
differentiation.
Example 3: XCIFs Function by Promoting Xist Expression and/or
Localization to the Xi
[0107] Following knockdown of the 13 XCIFs in mouse ES cells, RA
was added to induce differentiation and XCI, and Xist expression
was analyzed by qRT-PCR. The results of FIG. 3A show that Xist
levels were reduced to varying extents in all XCIF KD ES cell
lines. In differentiated female ES cells, Xist is detected by RNA
FISH as a large, diffuse nuclear signal referred to as a "cloud"
that co-localizes with the Xi. FIG. 3B shows that knockdown of each
of the XCIFs reduced to varying extents the percentage of cells
with the Xist localization pattern characteristic of XCI (see also
FIG. 10A). Taken together, these results indicate that XCIFs
promote Xist expression and/or localization of Xist to the Xi.
[0108] Several previous studies have suggested that Xist is
required for the initiation but not maintenance of XCI. However,
the results of FIGS. 3A and B implied that Xist was also necessary
for maintenance of XCI. To provide independent evidence for this
model, the Xist function in mouse BMSL2 fibroblasts was abrogated
using an Xist antisense locked nucleic acid (LNA) oligonucleotide.
The results of FIG. 3C show, consistent with previous results, that
the Xist antisense LNA oligonucleotide perturbed the normal pattern
of Xist expression/localization. Most importantly, the Xist
antisense LNA oligonucleotide substantially increased biallelic
expression of X-linked Mecp2. Thus, Xist is involved in both the
initiation and maintenance of XCI.
Example 4: DNMT1 is a Transcriptional Activator of Xist on the
Xi
[0109] DNMT1, which typically functions as a transcriptional
repressor, was found to be involved in Xist expression and/or
localization to the Xi. To further investigate this finding,
chromatin immunoprecipitation (ChIP) experiments were performed in
BMSL2 cells in which the Xa harbors a deletion encompassing the
Xist promoter and several genes including Hprt. FIG. 3D shows that
DNMT1 and, as expected, RNA polymerase II (POL2) were bound near
the Xist transcription start-site on the Xi. The fact that DNMT1
was involved in Xist transcription and bound to the Xist promoter
suggested that DNMT1 might function as a direct transcriptional
activator of Xist. Consistent with this idea, following knockdown
of DNMT1 the level of POL2 bound to the Xist promoter substantially
decreased (FIG. 3D). Moreover, in a nuclear run-on assay DNMT1
knockdown reduced Xist transcription but increased Xi-linked Hprt
transcription, as expected (FIG. 3E). As a control, transcription
of the TATA-box-binding protein (Tbp) gene, which is not X-linked
and expressed constitutively, was unaffected by DNMT1 knockdown. In
addition, knockdown of DNMT1 did not affect the half-life of Xist
RNA (FIG. 3F) indicating the decreased levels of Xist RNA following
DNMT1 depletion were predominantly transcriptional. Finally, the
level of Xist transcripts was significantly lower in Dnmt1-/-
compared to Dnmt1+/+ mouse embryonic fibroblasts (MEFs) (FIG. 3G).
Collectively, these results indicate that DNMT1 is a
transcriptional activator of Xist on the Xi.
[0110] The possibility that DNMT1 indirectly activated Xist
transcription by repressing expression of Tsix, which negatively
regulates Xist was considered. However, knockdown of DNMT1 in
fibroblasts (FIG. 3H and FIG. 10B) or murine ES (FIG. 10C) cells
substantially decreased Xist expression but did not affect Tsix
levels. DNMT1-mediated methylation at the Xist promoter could block
the binding of a transcriptional repressor. Consistent with this
possibility, following addition of 5-azacytidine, which inhibits
DNMT1 enzymatic activity resulting in DNA demethylation, Xist
levels were markedly reduced whereas expression of the Xi-linked
Hprt gene increased, as expected (FIG. 3I). Collectively, these
results suggest that DNMT1 promotes Xist transcription by
antagonizing a repressor.
Example 5: Reactivation of the Xi-linked Mecp2 Gene by Small
Molecule XCIF Inhibitors
[0111] One of the XCIFs is PDPK1, a serine-threonine kinase that
regulates phosphatidylinositol-3-kinase (PI3K)/AKT signaling. FIG.
4A and FIG. 11A show that following treatment of differentiated
female mouse ES cells with a chemical inhibitor of either PDPK1
(OSU-03012) or PI3K (LY294002), there was a dose-dependent loss of
the Xist cloud and increased biallelic expression of Mecp2. Similar
results were obtained in BMSL2 cells using GNE-317 (FIG. 4B and
FIG. 11B), a PI3K inhibitor specifically designed to cross the
blood-brain barrier. As expected, with all three inhibitors the
majority of cells contained two Mecp2 RNA FISH signals and lacked a
detectable Xist cloud. Notably, however, in some cells one of the
two Mecp2 RNA FISH signals colocalized with a Xist cloud, which
marked the Xi. Similar results were obtained with post-mitotic
mouse cortical neurons using the PDPK1 inhibitors OSU-03012 and
BX912 or the PI3K inhibitor LY294002 (FIG. 4C).
[0112] PDPK1 has a number of known substrates, which are themselves
protein kinases, such as the family of serum- and
glucocorticoid-inducible kinases (SGKs). FIG. 4D shows that
treatment of BMLS2 cells with the SGK1/2 inhibitor GSK650394
resulted in loss of the Xist cloud and increased biallelic
expression of Mecp2. Consistent with these results, qRT-PCR
analysis shows that treatment of BMSL2 cells with GSK650394
resulted in a dose-dependent decrease in Xist expression and
increase in Mecp2 expression (FIG. 4E). Similar results were
obtained for two chemical inhibitors of another XCIF, ACVR1: K02288
and LDN193189 (FIGS. 4F and 4G).
[0113] BMSL2 cells were treated with PDPK1 inhibitor OSU-03012 or
PI3K inhibitor LY294002 resulting in biallelic expression of the
Xi-linked Mecp2 gene (FIG. 4H and FIG. 11C). Following removal of
the drug for at least six days, normal Xist expression and
localization, and monoallelic expression of Mecp2, was largely
restored, indicating that small molecule-mediated reactivation of
Xi-linked genes is reversible.
[0114] In a clonal fibroblast cell line from an RTT patient, the
Xa-linked mutant MECP2 allele contains a 32 bp deletion, enabling
selective detection of Xi-linked wild-type MECP2 mRNA in an RT-PCR
assay using a primer within the deleted region. Another clonal
fibroblast cell line derived from the same RTT patient in which the
wild-type MECP2 allele is on the Xa provided a control for the
correct RT-PCR product (FIG. 4I, lane 1). The results show, as
expected, that the Xi-linked wild-type MECP2 allele was not
expressed (lane 2) but could be reactivated by addition of the DNA
methyltransferase inhibitor 5-azacytidine (lane 3). Significantly,
addition of the PDPK1 inhibitors BX912 and OSU-03012 (lanes 4, 5),
or VX680 (lane 6), an inhibitor of AURKA, another XCIF (Table 1),
reactivated the Xi-linked wild-type MECP2 allele. Thus, XCIF
chemical inhibitors can reactivate the Xi-linked Mecp2/MECP2 gene
in murine fibroblasts, ES cells and cortical neurons, as well as
human RTT fibroblasts.
Example 6: Defective XCI in Female Stc1-/- Mice
[0115] One of the XCIFs isolated in the screen, STC1, is a
glycoprotein found in both the cytoplasm and nucleus. Stc1-/- mice
have no obvious phenotype and litters have the expected Mendelian
and male:female ratios. To determine whether STC1 is involved in
XCI in the mouse, Stc1+/- mice were intercrossed and the MEFs from
the resultant progeny were analyzed by two-color RNA FISH for
expression of G6pdx, Lamp2, Pgk1 and Mecp2. As expected, female
Stc1+/+ MEFs, and as a control male Stc1-/- MEFs, displayed
monoallelic expression of G6pdx, Lamp2, Pgk1 and Mecp2 (FIG. 5A).
By contrast, female Stc1-/- MEFs predominantly displayed biallelic
expression of the four genes, indicative of an XCI defect. qRT-PCR
analysis revealed reduced Xist levels in female Stc1-/- MEFs
compared to female Stc1+/+ MEFs (FIG. 5B). Notably, the X
chromosome content of female Stc1-/- and Stc1+/+ MEFs was
comparable (FIG. 12A).
[0116] To further validate these findings, Xist and Mecp2, or Xist
and G6pdx were analyzed in cortical neurons from brain sections of
Stc1-/- and Stc1+/+ post-natal female mice. In female Stc1-/- mice,
biallelic expression of Mecp2 and G6pdx was clearly evident in some
cortical neurons (FIG. 12B). Again, in some cells the
colocalization of Mecp2 and Xist, or G6pdx and Xist signals were
observed, indicative of reactivation of the Xi-linked Mecp2 and
G6pdx genes.
Example 7: Defective XCI in Female Stc1-/- Mice is not Accompanied
by Increased X-Linked Gene Expression
[0117] Transcriptome profiling (RNA-Seq) experiments were performed
to determine whether the expression levels of X-encoded genes were
elevated in female Stc1-/- MEFs. In these experiments, RNA was
prepared from three independent cultures of female Stc1+/+ or
Stc1-/- MEFs. RNA samples were processed and amplified followed by
high-throughput sequencing (Illumina Hiseq 2000) (FIG. 6A).
Sequences were aligned to the reference genome and bioinformatic
analysis of relative X-linked gene expression was performed. The
results of FIG. 6B shows that total expression levels of the vast
majority (98%) of X-linked genes were indistinguishable in Stc1+/+
and Stc1-/- MEFs. The similarity of X-linked gene expression
between Stc1+/+ and Stc1-/- MEFs was statistically significant
(FIG. 6C and FIG. 13A). Moreover, the vast majority (99%) of
autosomal genes were also expressed at statistically comparable
levels in female Stc1+/+ and Stc1-/- MEFs (FIG. 13B).
[0118] To support these RNA-seq-based results, the levels of
X-linked genes Mecp2 and Hprt were analyzed by qRT-PCR. FIG. 6D
shows that Mecp2 and Hprt mRNA levels were equivalent in female
Stc1+/+ and Stc1-/- MEFs, despite deficient XCI. Furthermore, the
immunoblot results of FIG. 6E show that the level of MECP2 protein
in Stc1+/+ female MEFs (left) and brain lysates (right) was
comparable to that in Stc1-/- females.
[0119] The experiments described above were performed in Stc1-/-
mice in which there was a long-term, stable impairment of XCI.
Long-term conditional depletion of Xist in mouse hematopoietic
cells was shown to not be accompanied by a general increase in the
expression of X-linked genes. To determine whether X-linked gene
expression was increased immediately following abrogation of XCI,
the expression of Mecp2 and Hprt was analyzed in mouse BMSL2
fibroblasts following shRNA-mediated knockdown of STC1. In STC1 KD
BMSL2 cells there was an approximate two-fold increase in Mecp2 and
Hprt expression, which was evident at both the mRNA (FIG. 6F and
see FIG. 8B) and protein (FIG. 6G) level. Collectively, these
results suggest the existence of a mechanism(s) that can compensate
for a persistent XCI deficiency to regulate X-linked gene
expression.
Example 8: Reactivation of the Xi-Linked Mecp2 Gene by Small
Molecule Inhibition of Downstream Targets of PDPK1
[0120] One of the XCIFs is PDPK1, a serine-threonine kinase that
regulates phosphatidylinositol-3-kinase (PI3K)/AKT signaling. PDPK1
has a number of known substrates, which are themselves protein
kinases, such as mammalian target of rapamycin (mTOR), Aurora
kinase A (AURKA), and Activin receptor type 1 (ACVR1), as shown in
FIG. 14. This example describes treatment with inhibitors of
downstream substrates of PDPK1 results in reactivation of Xi-linked
genes (e.g., Mecp2).
[0121] mTOR is a serine-threonine protein kinase that is a
downstream component in PI3K signaling pathways. Mouse fibroblasts
were treated with three mTOR inhibitors (rapamycin, KU-0063794, or
everolimus) and relative expression levels of Xist and Mecp2 were
measured. Treatment with each mTOR inhibitor resulted in a decrease
in the relative expression of Xist and an increase in relative
expression of Mecp2, indicating reactivation of the Xi-linked Mecp2
gene (FIG. 15). The IC50 of rapamycin, KU-0063794, or everolimus,
were measured at 0.1 nm, 10 nm, and 2.4 nm, respectively.
Expression of Mecp2 was also analyzed by FISH in BMSL2 cells. Two
Mcep2 signals were observed in cells treated with the mTOR
inhibitor, indicating biallelic expression of Mcep2. Thus,
treatment with each of the mTOR inhibitors reactivates Xi-linked
Mecp2 (FIG. 15).
[0122] To confirm these results, a
hypoxanthine-aminopterin-thymidine (HAT) selection assay was
performed. The HAT assay is a dual selection assay that requires
activation of the Xi-linked Hprt gene by an inhibitor with
sufficiently low cytotoxicity to allow cellular proliferation and
survival. Cells containing Xi-linked Hprt were treated with either
DMSO (negative control), rapamycin, KU-0063794, or everolimus, and
cellular growth was measured. Treatment with each mTOR inhibitor
but not DMSO resulted in cellular growth, indicating that mTOR
inhibitors reactivate Xi-linked Hprt gene (FIG. 16).
[0123] Aurora kinase A (AURKA) is a serine-threonine kinase that is
associated with regulation of cell division in the G2-M phases and
is a downstream substrate of PDPK1. The human Aurora kinase family
comprises three members, Aurora kinase A (AURKA), B (AURKB), and C
(AURKC). Here, the reactivation of Xi-linked genes using AURKA
inhibitors (e.g., VX680, CD532, and MLN 8237) is described.
[0124] Mouse fibroblasts were treated with CD532 or MLN 8237 (which
have greater selectivity for AURKA than VX680) and relative
expression levels of Xist and Mecp2 were measured. Treatment with
each AURKA inhibitor resulted in a decrease in the relative
expression of Xist and an increase in relative expression of Mecp2,
indicating reactivation of the Xi-linked Mecp2 gene (FIG. 17). The
IC50 of CD532 and MLN 8237 were 45 nm and 1.2 nm, respectively.
Expression of Mecp2 was also analyzed by FISH in BMSL2 cells. Two
Mcep2 signals were observed in cells treated with the AURKA
inhibitors, indicating biallelic expression of Mcep2. Results were
confirmed using HAT selection assay. Thus, treatment with each of
the AURKA inhibitors reactivates Xi-linked Mecp2 (FIG. 17).
[0125] Activin receptor type 1 (ACVR1, also known as ALK2) is a
receptor serine-threonine kinase that mediates signaling by bone
morphogenic proteins. ACVR1 is a downstream substrate of PDPK1.
Here, reactivation of Xi-linked genes using ACVR1 inhibitors (e.g.,
K02288, dorsomorphin, and LDN193189) is described.
[0126] Mouse fibroblasts were treated with K02288, dorsomorphin, or
LDN193189 and relative expression levels of Xist and Mecp2 were
measured. Treatment with each ACVR1 inhibitor resulted in a
decrease in the relative expression of Xist and an increase in
relative expression of Mecp2, indicating reactivation of the
Xi-linked Mecp2 gene (FIG. 18). The IC50 of K02288, dorsomorphin,
and LDN193189 were 1 nm, 200 nm, and 5 nm, respectively. Expression
of Mecp2 was also analyzed by FISH in BMSL2 cells. Two Mcep2
signals were observed in cells treated with the ACVR1 inhibitors,
indicating biallelic expression of Mcep2. Results were confirmed
using HAT selection assay. Thus, treatment with each of the ACVR1
inhibitors reactivates Xi-linked Mecp2 (FIG. 18).
Example 9: CRISPR/Cas9-Based Screen to Identify New XCIFs
[0127] A CRISPR/Cas9-based screen has been conducted to identify
new XCIFs. First, BMSL2 cells, female mouse fibroblasts stably
expressing Cas9 and selected for blasticidin resistance, were
infected with a mouse GeCKO v2 CRISPR library (including 100,000
guide RNAs) and then selecting for puromycin resistance. Next, the
clones were subjected to HAT selection for one week. Reactivation
of X chromosomes is caused by CRISPR-mediated inactivation of an
XCIF. Growth in HAT medium results from expression of functional
HPRT from a reactivated X chromosome. Guide RNAs were identified
and validated from positive clones.
Example 10: Materials and Methods
Cell Culture
[0128] H4SV cells, BMSL2 (HOBMSL2) cells and human RTT fibroblasts
were cultured as recommended by the supplier. PGK12.1 cells were
cultured as previously described and differentiated by replating,
on gelatinized plastic dishes, in the presence of 100 nM
alpha-retinoic acid (Sigma) and absence of leukemia inhibitory
factor for at least one week.
Isolation of MEFs, Brain Tissue and Cortical Neurons
[0129] MEFs were isolated from E8.5 (Dnmt1 mice; Jackson
Laboratories) or E14.5 (Stc1 mice, provided by D. Sheikh-Hamad)
embryos, and were PCR genotyped using gene-specific and SRY primers
(Table 2). Stc1+/+ and Stc1-/- P1 pup heads were embedded in O.C.T.
compound (Tissue-Tek) and frozen in liquid nitrogen. Brain tissue
cryo-sections (5 .mu.m thick) were mounted, fixed and hybridized
with FISH probes as described. Neurons were isolated from the
cerebral cortexes of E19.5 C57BL/6 embryos and cultured as
described.
Large-Scale shRNA Screen and Validation
[0130] The mouse shRNA.sup.mir library (release 2.16; Open
Biosystems/Thermo Scientific) was obtained. H4SV cells
(1.1.times.10.sup.6) were transduced at a multiplicity of infection
of 0.2 with the retroviral pools, generated as previously
described, and selected for resistance to puromycin for 7 days.
Cells were FACS sorted and GFP-positive cells were selected.
Candidate shRNAs were identified as described previously. To
validate the candidates, 3.times.10.sup.5 H4SV or BMSL2 cells were
transduced with single shRNAs and puromycin selected for 4 days.
For HAT selection, 3.times.10.sup.5 cells were plated in 6-well
plates and selected in medium containing 1.times.HAT (GIBCO) for 1
week, followed by live cell imaging using a Zeiss Axiovert 200
microscope.
RNA FISH
[0131] RNA FISH experiments were performed (see Table 2 for cDNA
template sources for probes). Cells were visualized on a Leica DM
IRE2 confocal microscope. For quantification, 100-500 cells total
from at least 10 different fields were counted and scored; only
cells with a detectable RNA FISH signal were included in the
analysis, with the exception of the experiment in FIG. 3A. Images
were adjusted consistently for contrast and brightness using
AxioVision Software (Zeiss). All RNA-FISH experiments were
performed at least twice, and representative images and
quantification are shown from one experiment.
Alkaline Phosphatase Assay
[0132] ES cells were treated in the presence or absence of retinoic
acid (see above) and analyzed using an Alkaline Phosphatase
Staining Kit (Stemgent).
Quantitative Real-Time RT-PCR (qRT-PCR)
[0133] Total RNA was isolated and reverse transcribed using
Superscript II Reverse Transcriptase (Invitrogen). qRT-PCR was
performed as described previously using primers listed in Table 2.
For the experiments shown in FIGS. 3F and 3H and FIGS. 10B and C,
strand specific cDNA synthesis of Xist and/or Tsix RNAs was
performed as described previously, and expression of Xist and Tsix
were normalized to that of Gapdh.
Locked Nucleic Acid (LNA) Nucleofection
[0134] Cy3-labeled Xist and control (scrambled) LNAs were added to
10.sup.4 BMSL2 cells at a final concentration of 1 .mu.M in OptiMem
using Lipofectamine (Invitrogen) every 6-8 hr for 48 hr.
ChIP Assay
[0135] ChIP assays were performed as described previously using
extracts prepared 7 days post-retroviral transduction and puromycin
selection, and antibodies against DNMT1 or POL2 (Abcam). Primer
sequences used for amplifying ChIP products are listed in Table
2.
Nuclear Run-on Assay
[0136] Assays were performed in the presence of [P.sup.32]UTP, and
radioactive RNA was isolated using TRIzol reagent. Samples were
hybridized to a nylon membrane immobilized with cDNA probes to Xist
(prepared from a plasmid containing Xist exons 1 and 6; (51)), Hprt
(prepared from a plasmid containing the Hprt coding region
PCR-amplified using forward 5'-TCCGCCTCCTCCTCTGCT-3' (SEQ ID NO:
114) and reverse 5'-GGGAATTTATTGATTTGCAT-3' (SEQ ID NO: 115)
(primers) and Tbp (prepared from a cloned Tbp cDNA; Open
Biosystems). After washing the membranes, filters were exposed to a
PhosphorImager screen and the signal was quantified on a Fujifilm
FLA-7000 imaging system using Image Gauge V4.22 Software.
Xist RNA Stability Assay
[0137] After treatment with DNase (Ambion), strand-specific Xist
RNA levels, and as a control Actin, were quantified by qRT-PCR (see
Table 2 for primer sequences).
Chemical Inhibitor Treatment
[0138] Differentiated mouse ES or BMSL2 cells were treated with
dimethyl sulfoxide (DMSO), LY294002 (Cayman Chemicals; 4 or 10
.mu.M), OSU-03012 (Selleck Chemicals; 2.5 or 4 .mu.M), GNE-317
(Genentech Inc., 1.25, 2.5 or 5 .mu.M), GSK650394 (Tocris
Bioscience, 5 .mu.M), K02288 (Cayman Chemical, 0.5 .mu.M), or
LDN192189 (Cayman Chemical, 0.5 .mu.M) for 3 days prior to RNA FISH
analysis. For XCI reversibility experiments, BMSL2 cells were
treated with 8 .mu.M LY294002 or 2.5 .mu.M OSU-03012 for 3 days,
washed twice with PBS, and then the media was replaced with fresh
media every day for at least 5 days prior to RNA FISH analysis.
[0139] Mouse cortical neurons, isolated as described above, were
treated with DMSO, 5 .mu.M BX912 (Axon Medchem), 0.4 .mu.M LY294002
or 2.5 .mu.M OSU-03012 for 4 days prior to RNA FISH analysis.
[0140] RTT fibroblasts were treated with either DMSO, 5-azacytidine
(Calbiochem; 10 .mu.M for 3 days), BX912 (10 .mu.M for 3 days),
OSU-03012 (10 .mu.M for 2 days followed by 5 .mu.M for 1 day) or
VX680 (ChemieTek; 10 .mu.M for 2 days followed by 3 .mu.M for 1
day). The wild-type MECP2 levels were analyzed as using primers
listed in Table 2.
RNA Sequencing and Data Analysis
[0141] Total RNA was isolated from MEFs from Stc1+/+ and Stc1-/-
embryos (n=3 for each genotype) using the RNeasy Plus Mini Kit
(Qiagen) and treated with RNase-free DNase I (Qiagen). mRNA
libraries were generated as described in the TruSeq RNA sample
preparation guide (Illumina).
[0142] Libraries were sequenced as 50-bp paired ends using an
Illumina HiSeq 2000. Raw reads (ranging from 47-92 million reads
per sample) were trimmed by removing adaptor sequences and
demultiplexed with barcodes. Reads with ambiguous nucleotides and
Phred quality scores <46 were removed before assembly.
Paired-end sequencing reads were aligned using TopHat (v2.0.6)
against mouse genome assembly NCBI38/mm10 (downloaded from
pre-built indexes at bowtie-bio.sourceforge.net/) by default
parameters, with the exception of expecting an inner distance
between mate pairs of 75 bp instead of the default value of 50 bp.
The reads aligned by TopHat were processed by Cufflinks (v2.0.1) to
assemble transcripts and to measure their relative abundances in
FPKM units (fragments per kilobase of exon per million fragments
mapped). Assembled transcripts from control and knockout samples
were compared with the transcriptome downloaded from Ensembl.org
and tested for differential expression using the Cuffcompare and
Cuffdiff utilities in the Cufflinks package. Cuffdiff was run with
classic-FPKM normalization and a false discovery rate (FDR)
threshold of 0.05. Genes with a >2-fold change in expression
between Stc1+/+ and Stc1-/- samples and P<0.05 (calculated using
Cufflinks) were considered significant.
[0143] The gene expression results measured by Cufflinks were
annotated based on a GTF file downloaded from Ensembl.org using
Bioconductor package ChIPpeakAnno (55). All figures were plotted
using R/Bioconductor (v2.15.2) software. The RNA-Seq data have been
deposited in NCBI's Gene Expression Omnibus (56) and are accessible
to reviewers through GEO Series accession number GSE47395
(ncbi.nlm.nih.gov/geo/query/acc.cgi?token=jtslncmggoemsro&acc=GSE47395).
Immunoblotting
[0144] Cell extracts were prepared and immunoblots proved using
antibodies against HPRT (Abcam), MECP2 (Abcam), STC1 (Santa Cruz
Biotechnology) and .alpha.-tubulin.
Single Nucleotide Primer Extension (SNuPE) Assay
[0145] A SNuPE assay for Pgk1 was carried out using a Tagman SNP
genotyping assay (Applied Biosystems) according to the
manufacturer's specifications. The following primers and reporters
were used for the assay: 5'-CCGGCCAAAATTGATGCTTTCC-3' (SEQ ID NO:
116), 5'-CAGTCCCAAAAGCATCATTGACAT-3' (SEQ ID NO: 117),
5'-CACTGTCCAAACTAGG-3' (SEQ ID NO: 118) and 5'-CACTGTCCACACTAGG-3'
(SEQ ID NO: 119). The data are plotted as the function of .DELTA.Rn
for each sample, which represents the reporter fluorescence for
each allele (VIC/FAM) normalized to the passive reference dye.
Imprinted Gene Analysis
[0146] Mouse embryonic fibroblasts from strain C57BL6 (CAST 7),
provided by M. Bartolomei, were cultured in DMEM supplemented with
10% fetal calf serum and 10% NEAA. Analysis of imprinted genes was
performed using mouse embryonic fibroblasts isolated from the
C57BL/6 (CAST7) strain, which contains chromosome 7 from the Mus
castaneus (Cast) strain in a C57BL/6 background. Briefly, total RNA
was extracted and cDNA synthesis was carried out as described
above. For PCR amplification, the cDNA was added to Ready-To-Go PCR
Beads (GE Life Sciences) together with 0.3 .mu.M gene-specific
primers (Table 2). Expression of the imprinted gene was analyzed by
allele-specific restriction enzyme digestion (StcI for Ascl2, StuI
for Kcnq1ot1, MnlI for Peg3, and FauI for Zim1) and digested PCR
products were resolved by polyacrylamide gel electrophoresis.
TABLE-US-00002 TABLE 2 List of primers used for qRT-PCR and RT-PCR
analysis, cDNA synthesis, ChIP assays, and mouse genotyping; oligo
ID numbers for shRNAs; and cDNAs used to prepare RNA FISH probes.
Primers qRT-PCR Forward primer (5' .fwdarw. 3') Reverse primer(s)
(5' .fwdarw. 3') Actin TTGCCGACAGGATGCAGAA GCCGATCCACACGGAGTACTT
(SEQ ID NO: 1) (SEQ ID NO: 43) Acvr1 (mouse) GGCCAGCAGTGTTTTTCTTC
TTCCCCTGCTCATAAACCTG (SEQ ID NO: 2) (SEQ ID NO: 44) ACVR1 (human)
TCAGGAAGTGGCTCTGGTCT CGTTTCCCTGAACCATGACT (SEQ ID NO: 3) (SEQ ID
NO: 45) Aurka (mouse) TAGGATACTGCTTGTTACTT CCTCCAACTGGAGCTGTA (SEQ
ID NO: 4) (SEQ ID NO: 46) AURKA (human) TGGAATATGCACCACTTGGA
ACTGACCACCCAAAATCTGC SEQ ID NO: 5 (SEQ ID NO: 47) Bmi1
AAATCAGGGGGTTGAAAAATCT GCTAACCACCAATCTTCCTTTG (SEQ ID NO: 6) (SEQ
ID NO: 48) Cdx2 GCCAAGTGAAAACCAGGACAAAAGAC GCTGCTGTTGCTGCTGCTGCTTC
(SEQ ID NO: 7) (SEQ ID NO: 49) Dnmt1 (mouse)
GGAAGGCTACCTGGCTAAAGTCAAG ACTGAAAGGGTGTCACTGTCCGAC (SEQ ID NO: 8)
(SEQ ID NO: 50) DNMT1 (human) GTGGGGGACTGTGTCTCTGT
TGAAAGCTGCATGTCCTCAC (SEQ ID NO: 9) (SEQ ID NO: 51) Eomes
CCTGGTGGTGTTTTGTTGTG TTTAATAGCACCGGGCACTC (SEQ ID NO: 10) (SEQ ID
NO: 52) Ezh2 CTAATTGGTACTTACTACGA ACTCTAAACTCATACACCTGTCTA TAACTTT
(SEQ ID NO: 11) CAT (SEQ ID NO: 53) Fbxo8 (mouse)
GCTGAGCCATTTTCTTCTCG ATGATGGTTTCTGGCCACTC (SEQ ID NO: 12) (SEQ ID
NO: 54) FBXO8 (human) CAAGGGTTGTGGAGAGTGGT ATGTCAATGCCTCCTTGGAC
(SEQ ID NO: 13) (SEQ ID NO: 55) Gapdh ATGGCCTTCCGTGTTCCTAC
ATAGGGCCTCTCTTGCTCAG (SEQ ID NO: 14) (SEQ ID NO: 56) G6pdx
TCAAAGCACACGCCCTCTT TAGCGCACAGCCAGTTTCC (SEQ ID NO: 15) (SEQ ID NO:
57) Hprt AAGCTTGCTGGTGAAAAGGA TTGCGCTCATCTTAGGCTTT (SEQ ID NO: 16)
(SEQ ID NO: 58) Layn (mouse) GCAAGGAGAGTGGATGGGTA
ACTTGTGATGCTGTGCTTGC (SEQ ID NO: 17) (SEQ ID NO: 59) LAYN (human)
CTACAGGCCGTGCTGCTG CTGACTAGCTGGCCTCCATC (SEQ ID NO: 18) (SEQ ID NO:
60) Mecp2 CATGGTAGCTGGGATGTTAGG GCAATCAATTCTACTTTAGA (SEQ ID NO:
19) GCG (SEQ ID NO: 61) Nf1 (mouse) GTAGCCACAGGTCCCTTGTC
CTGAGAACAAGTACACAGAGAGTGA (SEQ ID NO: 20) (SEQ ID NO: 62) NF1
(human) AATTCTGCCTCTGGGGTTTT GCTGTTTCCTTCAGGAGTCG (SEQ ID NO: 21)
(SEQ ID NO: 63) 0ct4 CTCACCCTGGGCGTTCTCT AGGCCTCGAAGCGACAGA (SEQ ID
NO: 22) (SEQ ID NO: 64) Pdpk1 (mouse) GGTCCAGTGGATAAGCGAAA
TTTCTGCACCACTTGTGAGC (SEQ ID NO: 23) (SEQ ID NO: 65) PDPK1 (human)
GACTCTTCCGTGCGTTCTTC GAGGAGAAAGGTGACCCACA (SEQ ID NO: 24) (SEQ ID
NO: 66) Pgk1 ATGTCGCTTTCCAACAAGCTG GCTCCATTGTCCAAGCAGAAT (SEQ ID
NO: 25) (SEQ ID NO: 67) Pygo1 (mouse) TAATGTCAGCGGAACAGGAC
TTATCTGGGCTTCCGAGTTG (SEQ ID NO: 26) (SEQ ID NO: 68) PYGO1 (human)
ATCCTGGCTTTGGAGGCTAT GTGGCCCAAAGTTAAAAGCA (SEQ ID NO: 27) (SEQ ID
NO: 69) Rnf165 (mouse) ATGCCTCCAGCTACAGCCTA GCCCAATGCTAACTGAGAGC
(SEQ ID NO: 28) (SEQ ID NO: 70) RNF165 AGGGAGAGCTGGAAAAGGAG
AGCCCTCCCTGGTTTAGTGT (human) (SEQ ID NO: 29) (SEQ ID NO: 71) Sox5
(mouse) GTGGAAGAGGAGGAGAGTGAGA AAATTCCTCAGAGTGAGGCTTG (SEQ ID NO:
30) (SEQ ID NO: 72) SOX5 (human) AGGGACTCCCGAGAGCTTAG
TTGTTCTTGTTGCTGCTTGG (SEQ ID NO: 31) (SEQ ID NO: 73) Stc1 (mouse)
AAGTCATACAGCAGCCCAATCA CCAGAAGGCTTCGGACAAGTC (SEQ ID NO: 32) (SEQ
ID NO: 74) STC1 (human) TGATCAGTGCTTCTGCAACC TCACAGGTGGAGTTTTCCAG
(SEQ ID NO: 33) (SEQ ID NO: 75) Tcf7l2 AAAACAGCTCCTCCGATTCC
TAAAGAGCCCTCCATCTTGC (SEQ ID NO: 34) (SEQ ID NO: 76) Tsix
CAATCTCGCAAGATCCGGTGA TCAAGATGCGTGGATATCTCGG (TSIX2F) (SEQ ID NO:
35) (P422R) (SEQ ID NO: 77) Xist CCCTGCTAGTTTCCCAATGA
GGAATTGAGAAAGGGCACAA (non-strand (SEQ ID NO: 36) (SEQ ID NO: 78)
specific) Xist (strand GATGCCAACGACACGTCTGA AAGGACTCCAAAGTAACAAT
specific) (XIST2281F) TCA (XIST2424R) (SEQ ID NO: 37) (SEQ ID NO:
79) XIST (human) ACGCTGCATGTGTCCTTAGT ATTTGGAGCCTCTTATAGCTG AGTC
(SEQ ID NO: 38) TTTG (SEQ ID NO: 80) Zfp426 ATGACCTTTCGCTCATGGAC
GGCAAGCTTTGCTTTAGTGC (mouse) (SEQ ID NO: 39) (SEQ ID NO: 81) ZNF426
CTGAGGTGGGTGGATCACTT CTCTGCTTCCTGGGTTCAAG (human) (SEQ ID NO: 40)
(SEQ ID NO: 82) 1700001P01Rik GCTGATGTCAACTGTTTCC
CGCAGAATCTTCCACCCT (mouse) (SEQ ID NO: 41) (SEQ ID NO: 83) Cl0orf98
TCGGGCAAGGACAAAGATAC CGATGGCTATGAAGGGAAAA (human) (SEQ ID NO: 42)
(SEQ ID NO: 84) RT-PCR Forward primer (5' .fwdarw. 3') Reverse
primer(s) (5' .fwdarw. 3') Mecp2 CCGATCTGTGCAGGAGACCG
TGGGGTCCTCGGAGCTCTCGGGCT (1.sup.st round) (SEQ ID NO: 85) (SEQ ID
NO: 91) Mecp2 GACCCGGGAGACGGTCAGCA AGCTCTCGGGCTCAGGTGGAGGT
(2.sup.nd round) (SEQ ID NO: 86) (SEQ ID NO: 92) Ascl2
TGAGCATCCCACCCCCCTA CCAAACATCAGCGTCAGTATAG (SEQ ID NO: 87) (SEQ ID
NO: 93) Kncq1ot1 ATTGGGAACTTGGGGTGGAGGC GGCACACGGTATGAGAAAAGATTG
(SEQ ID NO: 88) (SEQ ID NO: 94) Peg3 ATGCCCACTCCGTCAGCG
GCTCATCCTTGTGAACTTTG (SEQ ID NO: 89) (SEQ ID NO: 95) Zim1
CTTCAAGCAGAGCACAAAGC GTGGCACACGAAAGGTTTCTC (SEQ ID NO: 90) (SEQ ID
NO: 96) cDNA synthesis Xist AGAGCATTACAATTCAAGGCTC (XIST2688R) (SEQ
ID NO: 97) Tsix GATGCCAACGACACGTCTGA (TSIX2R) (SEQ ID NO: 98) Gapdh
TGTGAGGGAGATGCTCAGTG (GAPDR) (SEQ ID NO: 99) ChIP Forward primer
(5' .fwdarw. 3') Reverse primer(s)(5' .fwdarw. 3') Xist
TAAAGGTCCAATAAGATGTCAGAA GGAGAGAAACCACGGAAGAA (promoter) (SEQ ID
NO: 100) (SEQ ID NO: 102) Xist GTGCTCCTGCCTCAAGAAGAA
GCACTCTTCACTCCTCTAAATCCAG (exon 2) (SEQ ID NO: 101) (SEQ ID NO:
103) Mouse genotyping Forward primer (5' .fwdarw. 3') Reverse
primer(s) (5' .fwdarw. 3') Dnmt1+/+ CTTGGGCCTGGATCTTGGGGATC GGG
CCAGTTGTGTGACTTGG (SEQ ID NO: 104) (SEQ ID NO: 109) Dnmt1-/-
GGGAACTTCCTGACTAGGGG GGGCCAGTTGTGTGACTTGG (SEQ ID NO: 105) (SEQ ID
NO: 110) Stc1+/+ AGCGCACGAGGCGGAACAAA AGAGAGCCGCTGTGAGGCGT (SEQ ID
NO: 106) (SEQ ID NO: 111) Stc1-/- AAAAGCCAGAGGTGCAAGAA
TATGATCGGAATTCCTCGAC (SEQ ID NO: 107) (SEQ ID NO: 112) SRY
TTGTCTAGAGAGCATGGAGGGCC CCACTCCTCTGTGACACTTTAGC ATGTCAA (SEQ ID NO:
108) CCTCCGA (SEQ ID NO: 113) shRNAs Gene Oligo ID Acvr1 V2MM_75565
V2MM_76215 Aurka V2MM_188005 V2MM_71909 Bmi1 V2MM_10594 V2MM_2034
Dnmt1 V2MM_46797 V2LMM_43170 Ezh2 V2MM_35988 V2MM_30422 Fbxo8
V2MM_36526 V3LMM_494067 Layn V2MM_130482 V2MM_214085 Nf1
V2MM_194180 V2HS_76027 Pdpk1 V2MM_75859 V2MM_72465 Pygo1
V2MM_110610 V2MM_110609 Rnf165 V2MM_172866 TRCN0000135474 Sox5
V2MM_6385 V2HS_94936 Stc1 V2MM_22454 V2MM_26886 TRCN0000109921
Zfp426 V2MM_31994 TRCN0000085016 1700001P01Rik V2MM_100177
V2MM_205788 cDNAs Gene Clone number* G6pdx BAC clone RP23-13D21
Lamp2 BAC clone RP24-173A8 Mecp2 fosmid clone WI1-894A5 or
WI1-1269o10 Pgk1 BAC RP23-404E5 Xist -- *obtained from the BACPAC
Resources Center
OTHER EMBODIMENTS
[0147] The description of the specific embodiments of the
disclosure is presented for the purposes of illustration. It is not
intended to be exhaustive or to limit the scope of the disclosure
to the specific forms described herein. Although the disclosure
includes reference to several embodiments, it will be understood by
one of ordinary skill in the art that various modifications can be
made without departing from the spirit and the scope of the
disclosure.
[0148] All patents, patent applications, and publications
referenced herein are hereby incorporated by reference. Other
embodiments are in the claims.
Sequence CWU 1
1
119119DNAArtificial SequenceSynthetic Polynucleotide 1ttgccgacag
gatgcagaa 19220DNAMus musculus 2ggccagcagt gtttttcttc 20320DNAHomo
sapiens 3tcaggaagtg gctctggtct 20420DNAMus musculus 4taggatactg
cttgttactt 20520DNAHomo sapiens 5tggaatatgc accacttgga
20622DNAArtificial SequenceSynthetic Polynucleotide 6aaatcagggg
gttgaaaaat ct 22726DNAArtificial SequenceSynthetic Polynucleotide
7gccaagtgaa aaccaggaca aaagac 26825DNAMus musculus 8ggaaggctac
ctggctaaag tcaag 25920DNAHomo sapiens 9gtgggggact gtgtctctgt
201020DNAArtificial SequenceSynthetic Polynucleotide 10cctggtggtg
ttttgttgtg 201127DNAArtificial SequenceSynthetic Polynucleotide
11ctaattggta cttactacga taacttt 271220DNAMus musculus 12gctgagccat
tttcttctcg 201320DNAHomo sapiens 13caagggttgt ggagagtggt
201420DNAArtificial SequenceSynthetic Polynucleotide 14atggccttcc
gtgttcctac 201519DNAArtificial SequenceSynthetic Polynucleotide
15tcaaagcaca cgccctctt 191620DNAArtificial SequenceSynthetic
Polynucleotide 16aagcttgctg gtgaaaagga 201720DNAMus musculus
17gcaaggagag tggatgggta 201818DNAHomo sapiens 18ctacaggccg tgctgctg
181921DNAArtificial SequenceSynthetic Polynucleotide 19catggtagct
gggatgttag g 212020DNAMus musculus 20gtagccacag gtcccttgtc
202120DNAHomo sapiens 21aattctgcct ctggggtttt 202219DNAArtificial
SequenceSynthetic Polynucleotide 22ctcaccctgg gcgttctct
192320DNAMus musculus 23ggtccagtgg ataagcgaaa 202420DNAHomo sapiens
24gactcttccg tgcgttcttc 202521DNAArtificial SequenceSynthetic
Polynucleotide 25atgtcgcttt ccaacaagct g 212620DNAMus musculus
26taatgtcagc ggaacaggac 202720DNAHomo sapiens 27atcctggctt
tggaggctat 202820DNAMus musculus 28atgcctccag ctacagccta
202920DNAHomo sapiens 29agggagagct ggaaaaggag 203022DNAMus musculus
30gtggaagagg aggagagtga ga 223120DNAHomo sapiens 31agggactccc
gagagcttag 203222DNAMus musculus 32aagtcataca gcagcccaat ca
223320DNAHomo sapiens 33tgatcagtgc ttctgcaacc 203420DNAArtificial
SequenceSynthetic Polynucleotide 34aaaacagctc ctccgattcc
203521DNAArtificial SequenceSynthetic Polynucleotide 35caatctcgca
agatccggtg a 213620DNAArtificial SequenceSynthetic Polynucleotide
36ccctgctagt ttcccaatga 203720DNAArtificial SequenceSynthetic
Polynucleotide 37gatgccaacg acacgtctga 203824DNAHomo sapiens
38acgctgcatg tgtccttagt agtc 243920DNAMus musculus 39atgacctttc
gctcatggac 204020DNAHomo sapiens 40ctgaggtggg tggatcactt
204119DNAMus musculus 41gctgatgtca actgtttcc 194220DNAHomo sapiens
42tcgggcaagg acaaagatac 204321DNAArtificial SequenceSynthetic
Polynucleotide 43gccgatccac acggagtact t 214420DNAMus musculus
44ttcccctgct cataaacctg 204520DNAHomo sapiens 45cgtttccctg
aaccatgact 204618DNAMus musculus 46cctccaactg gagctgta
184720DNAHomo sapiens 47actgaccacc caaaatctgc 204822DNAArtificial
SequenceSynthetic Polynucleotide 48gctaaccacc aatcttcctt tg
224923DNAArtificial SequenceSynthetic Polynucleotide 49gctgctgttg
ctgctgctgc ttc 235024DNAMus musculus 50actgaaaggg tgtcactgtc cgac
245120DNAHomo sapiens 51tgaaagctgc atgtcctcac 205220DNAArtificial
SequenceSynthetic Polynucleotide 52tttaatagca ccgggcactc
205327DNAArtificial SequenceSynthetic Polynucleotide 53actctaaact
catacacctg tctacat 275420DNAMus musculus 54atgatggttt ctggccactc
205520DNAHomo sapiens 55atgtcaatgc ctccttggac 205620DNAArtificial
SequenceSynthetic Polynucleotide 56atagggcctc tcttgctcag
205719DNAArtificial SequenceSynthetic Polynucleotide 57tagcgcacag
ccagtttcc 195820DNAArtificial SequenceSynthetic Polynucleotide
58ttgcgctcat cttaggcttt 205920DNAMus musculus 59acttgtgatg
ctgtgcttgc 206020DNAHomo sapiens 60ctgactagct ggcctccatc
206123DNAArtificial SequenceSynthetic Polynucleotide 61gcaatcaatt
ctactttaga gcg 236225DNAMus musculus 62ctgagaacaa gtacacagag agtga
256320DNAHomo sapiens 63gctgtttcct tcaggagtcg 206418DNAArtificial
SequenceSynthetic Polynucleotide 64aggcctcgaa gcgacaga 186520DNAMus
musculus 65tttctgcacc acttgtgagc 206620DNAHomo sapiens 66gaggagaaag
gtgacccaca 206721DNAArtificial SequenceSynthetic Polynucleotide
67gctccattgt ccaagcagaa t 216820DNAMus musculus 68ttatctgggc
ttccgagttg 206920DNAHomo sapiens 69gtggcccaaa gttaaaagca
207020DNAMus musculus 70gcccaatgct aactgagagc 207120DNAHomo sapiens
71agccctccct ggtttagtgt 207222DNAMus musculus 72aaattcctca
gagtgaggct tg 227320DNAHomo sapiens 73ttgttcttgt tgctgcttgg
207421DNAMus musculus 74ccagaaggct tcggacaagt c 217520DNAHomo
sapiens 75tcacaggtgg agttttccag 207620DNAArtificial
SequenceSynthetic Polynucleotide 76taaagagccc tccatcttgc
207722DNAArtificial SequenceSynthetic Polynucleotide 77tcaagatgcg
tggatatctc gg 227820DNAArtificial SequenceSynthetic Polynucleotide
78ggaattgaga aagggcacaa 207923DNAArtificial SequenceSynthetic
Polynucleotide 79aaggactcca aagtaacaat tca 238025DNAHomo sapiens
80atttggagcc tcttatagct gtttg 258120DNAMus musculus 81ggcaagcttt
gctttagtgc 208220DNAHomo sapiens 82ctctgcttcc tgggttcaag
208318DNAMus musculus 83cgcagaatct tccaccct 188420DNAHomo sapiens
84cgatggctat gaagggaaaa 208520DNAArtificial SequenceSynthetic
Polynucleotide 85ccgatctgtg caggagaccg 208620DNAArtificial
SequenceSynthetic Polynucleotide 86gacccgggag acggtcagca
208719DNAArtificial SequenceSynthetic Polynucleotide 87tgagcatccc
accccccta 198822DNAArtificial SequenceSynthetic Polynucleotide
88attgggaact tggggtggag gc 228918DNAArtificial SequenceSynthetic
Polynucleotide 89atgcccactc cgtcagcg 189020DNAArtificial
SequenceSynthetic Polynucleotide 90cttcaagcag agcacaaagc
209124DNAArtificial SequenceSynthetic Polynucleotide 91tggggtcctc
ggagctctcg ggct 249223DNAArtificial SequenceSynthetic
Polynucleotide 92agctctcggg ctcaggtgga ggt 239322DNAArtificial
SequenceSynthetic Polynucleotide 93ccaaacatca gcgtcagtat ag
229424DNAArtificial SequenceSynthetic Polynucleotide 94ggcacacggt
atgagaaaag attg 249520DNAArtificial SequenceSynthetic
Polynucleotide 95gctcatcctt gtgaactttg 209621DNAArtificial
SequenceSynthetic Polynucleotide 96gtggcacacg aaaggtttct c
219722DNAArtificial SequenceSynthetic Polynucleotide 97agagcattac
aattcaaggc tc 229820DNAArtificial SequenceSynthetic Polynucleotide
98gatgccaacg acacgtctga 209920DNAArtificial SequenceSynthetic
Polynucleotide 99tgtgagggag atgctcagtg 2010024DNAArtificial
SequenceSynthetic Polynucleotide 100taaaggtcca ataagatgtc agaa
2410121DNAArtificial SequenceSynthetic Polynucleotide 101gtgctcctgc
ctcaagaaga a 2110220DNAArtificial SequenceSynthetic Polynucleotide
102ggagagaaac cacggaagaa 2010325DNAArtificial SequenceSynthetic
Polynucleotide 103gcactcttca ctcctctaaa tccag 2510423DNAMus
musculus 104cttgggcctg gatcttgggg atc 2310520DNAMus musculus
105gggaacttcc tgactagggg 2010620DNAMus musculus 106agcgcacgag
gcggaacaaa 2010720DNAMus musculus 107aaaagccaga ggtgcaagaa
2010830DNAMus musculus 108ttgtctagag agcatggagg gccatgtcaa
3010920DNAMus musculus 109gggccagttg tgtgacttgg 2011020DNAMus
musculus 110gggccagttg tgtgacttgg 2011120DNAMus musculus
111agagagccgc tgtgaggcgt 2011220DNAMus musculus 112tatgatcgga
attcctcgac 2011330DNAMus musculus 113ccactcctct gtgacacttt
agccctccga 3011418DNAArtificial SequenceSynthetic Polynucleotide
114tccgcctcct cctctgct 1811520DNAArtificial SequenceSynthetic
Polynucleotide 115gggaatttat tgatttgcat 2011622DNAArtificial
SequenceSynthetic Polynucleotide 116ccggccaaaa ttgatgcttt cc
2211724DNAArtificial SequenceSynthetic Polynucleotide 117cagtcccaaa
agcatcattg acat 2411816DNAArtificial SequenceSynthetic
Polynucleotide 118cactgtccaa actagg 1611916DNAArtificial
SequenceSynthetic Polynucleotide 119cactgtccac actagg 16
* * * * *