U.S. patent application number 17/574615 was filed with the patent office on 2022-07-21 for compounds for treatment of diseases related to dux4 expression.
This patent application is currently assigned to Facio Intellectual Property B.V.. The applicant listed for this patent is Facio Intellectual Property B.V.. Invention is credited to Joris De Maeyer, Monika Ermann, Marcus Geese, Timothy Robin James, Alexander Kaever, Sebastian Monecke, Martin Schneider.
Application Number | 20220226318 17/574615 |
Document ID | / |
Family ID | |
Filed Date | 2022-07-21 |
United States Patent
Application |
20220226318 |
Kind Code |
A1 |
De Maeyer; Joris ; et
al. |
July 21, 2022 |
Compounds for treatment of diseases related to DUX4 expression
Abstract
The present invention relates to compounds for the treatment of
diseases related to DUX4 expression, such as muscular dystrophies,
wherein the disease is facioscapulohumeral muscular dystrophy
(FSHD). It also relates to use of such compounds, or to methods of
use of such compounds.
Inventors: |
De Maeyer; Joris; (Mechelen,
BE) ; Geese; Marcus; (Gottingen, DE) ;
Schneider; Martin; (Gottingen, DE) ; Monecke;
Sebastian; (Gottingen, DE) ; Kaever; Alexander;
(Gottingen, DE) ; Ermann; Monika; (Abingdon,
GB) ; James; Timothy Robin; (Abingdon, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Facio Intellectual Property B.V. |
Leiden |
|
NL |
|
|
Assignee: |
Facio Intellectual Property
B.V.
Leiden
NL
|
Appl. No.: |
17/574615 |
Filed: |
January 13, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16771232 |
Jun 10, 2020 |
|
|
|
PCT/EP2018/084802 |
Dec 13, 2018 |
|
|
|
17574615 |
|
|
|
|
International
Class: |
A61K 31/506 20060101
A61K031/506; A61K 31/5025 20060101 A61K031/5025; A61K 31/4355
20060101 A61K031/4355; A61P 21/00 20060101 A61P021/00; A61K 31/4439
20060101 A61K031/4439; A61K 31/5377 20060101 A61K031/5377; A61K
31/437 20060101 A61K031/437 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 13, 2017 |
EP |
17207162.3 |
Claims
1. A casein kinase 1 inhibitor for use in the treatment of a
disease or condition associated with DUX4 expression, wherein the
casein kinase 1 inhibitor reduces DUX4 expression.
2. A casein kinase 1 inhibitor for use according to claim 1,
wherein said disease or condition associated with DUX4 expression
is a muscular dystrophy or cancer, preferably wherein said disease
or condition associated with DUX4 expression is a muscular
dystrophy, most preferably facioscapulohumeral muscular dystrophy
(FSHD).
3. A casein kinase 1 inhibitor for use according to claim 1 or 2,
characterized in that it is administered to a subject 4, 3, 2, or 1
times per day or less, preferably 1 time per day.
4. A casein kinase 1 inhibitor for use according to any one of
claims 1-3, wherein the casein kinase inhibitor inhibits at least
casein kinase 1.delta..
5. A casein kinase 1 inhibitor for use according to any one of
claims 1-4, characterized in that it is administered to a subject
in an amount ranging from 0.1 to 1500 mg/day, preferably from 0.1
to 400 mg/day, more preferably from 0.25 to 150 mg/day.
6. A casein kinase 1 inhibitor for use according to any one of
claims 1-5, characterized in that it is administered orally,
sublingually, intravascularly, intravenously, subcutaneously, or
transdermally, preferably orally.
7. A casein kinase 1 inhibitor for use according to any one of
claims 1-6, wherein DUX4 expression is reduced by at least 20%,
40%, 60%, 80%, or more.
8. A casein kinase 1 inhibitor for use according to any one of
claims 1-7, wherein the casein kinase 1 inhibitor reduces DUX4
expression in muscle cells, immune cells, or cancer cells.
9. A casein kinase 1 inhibitor for use according to any one of
claims 1-8, wherein the reduction of DUX4 expression is determined
using PCR or immunostaining.
10. A casein kinase 1 inhibitor for use according to any one of
claims 1-9, wherein the casein kinase 1 inhibitor is from the class
comprising an azole core.
11. A casein kinase 1 inhibitor for use according to any one of
claims 1-10, wherein the casein kinase 1 inhibitor is selected from
the group consisting of compounds A, B, C, D, E, F, G, H, I, J, K,
L, M, N, O, SR-3029, PF-670462, and PF-5006739.
12. A composition comprising at least one casein kinase 1 inhibitor
as defined in any one of claims 1-11, and a pharmaceutically
acceptable excipient, for use as defined in any one of claims
1-11.
13. A composition for use according to claim 12, wherein the
composition is formulated for oral, sublingual, parenteral,
intravascular, intravenous, subcutaneous, or transdermal
administration, preferably for oral administration.
14. An in vivo, in vitro, or ex vivo method for reducing DUX4
expression, the method comprising the step of contacting a cell
with a casein kinase 1 inhibitor as defined in any one of claims
1-11, or with a composition as defined in claim 12 or 13.
15. A method for reducing DUX4 expression in a subject in need
thereof, the method comprising the step of administering an
effective amount of a casein kinase 1 inhibitor as defined in any
one of claims 1-11, or a composition as defined in claim 12 or 13.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to compounds for the treatment
of diseases related to DUX4 expression, such as muscular
dystrophies, wherein the disease is facioscapulohumeral muscular
dystrophy (FSHD). It also relates to use of such compounds, or to
methods of use of such compounds.
BACKGROUND ART
[0002] Serine/threonine kinases (EC 2.7.11.1) are a class of
protein kinases that are promising drug targets for small molecule
inhibitors. Due to their involvement in signaling pathways in
eukaryotic cells, inhibition of serine/threonine kinases is likely
to have relevance to the treatment of diseases such as cancer,
diabetes, and a variety of inflammatory disorders.
[0003] Casein kinase 1 (CK1, also known as CSNK1) belongs to the
serine/threonine kinase family. CK1 isoforms are involved in Wnt
signaling, circadian rhythms, nucleo-cytoplasmic shuttling of
transcription factors, DNA repair, and DNA transcription (Eide E J,
Virshup D M (2001) doi:10.1081/CBI-100103963). In mammals, the
enzyme exists in seven isoforms: .alpha., .beta., .gamma.1,
.gamma.2, .gamma.3, .delta., and .epsilon., all having a similar
kinase domain. Through phosphorylation of different substrate
proteins, these isoforms are able to activate, stabilize,
inactivate, or destabilize the functions of these substrate
proteins, thus regulating their functions. For example, a tumor
suppressor factor p53 and an oncogene mdm2, which are both
important proteins for controlling abnormal cell growth, are
substrates of CK1.
[0004] Mammalian casein kinases such as casein kinase 1.gamma.,
casein kinase 1.delta., and casein kinase 1.epsilon. are important
regulators of various cellular growth and survival processes
including Wnt signaling, circadian rhythms, and DNA repair. They
have a kinase domain similar to those of other isoforms. However,
their N-terminal and C-terminal domains are different from those of
other isoforms. The C-terminal domain has a plurality of
autophosphorylation sites, and is considered to be involved in
regulation of autoenzyme activity. Phosphorylation of p53 by casein
kinases such as casein kinase 1.delta. or casein kinase 1.epsilon.
leads to a change in the interaction between p53 and mdm2. It has
also been known that casein kinase 1.delta. and casein kinase
1.epsilon. are involved as a regulatory protein associated with the
formation of a spindle as a central body during cell division, and
that casein kinase 1.delta. and casein kinase 1.epsilon. are
involved in apoptosis mediated by TRAIL (tumor necrosis
factor-related apoptosis inducing factor) and Fas. It has been
further reported that inhibition of casein kinase 1.delta. or
casein kinase 1.epsilon. by a nonselective CK1 inhibitory compound
IC261 reduces pancreatic tumor cell growth in vitro and in vivo
(Brockschmidt et al., 2008, DOI: 10.1136/gut.2007.123695). Hence,
CK1 inhibitors have been developed and investigated for various
important phenotypic and therapeutic effects.
[0005] WO2011051858 discloses CK1 inhibitors (both .delta. and
.epsilon.) useful in the treatment and/or prevention of diseases
and disorders associated with the central nervous system. These
inhibitors form a series of substituted imidazole compounds, more
specifically a series of
4-aryl-5-heteroaryl-1-heterocycloalkyl-imidazoles and related
analogs. Both their synthesis and IC.sub.50 values for CK1 .delta.
and .epsilon. are reported, the latter of which generally fall in
the nanomolar range. A closely related family of CK1 inhibitors is
disclosed in WO2012085721.
[0006] WO2015119579 discloses a family that also features an azole
core, namely a family of 2,4,5-tri-substituted azole compounds for
use as CK1 inhibitors. The inhibitors are used for inducing or
enhancing the differentiation of pluripotent stem cells into
cardiomyocytes via CK1 inhibition. Synthetic pathways for obtaining
the inhibitors are disclosed, and the inhibitors are shown to
generally have IC.sub.50 values in the nanomolar range as CK1
.delta. and .epsilon. inhibitors.
[0007] EP2949651 discloses a family of derivatives of substituted
benzothiazoles that act as CK1 inhibitors, and their use is coupled
to the treatment and/or prevention of diseases mediated by CK1,
especially inflammatory, neurological, psychiatric,
neurodegenerative and/or ophthalmic diseases and certain
regenerative processes. Methods of synthesis are provided, and the
inhibitors were shown to have nanomolar inhibitory activity on CK1
.delta. and .epsilon..
[0008] WO2009016286 discloses
6-cycloamino-3-(pyrid-4-yl)imidazo[1,2-b]pyridazine derivatives
useful as protein kinase inhibitors, particularly as CK1.delta. and
.epsilon. inhibitors. Their synthesis is described in detail, and
the capacity of the CK1 inhibitors to inhibit the phosphorylation
of casein by casein kinases 1.delta. and .epsilon. was evaluated
according to the procedure described in US2005/0131012, revealing
IC.sub.50 values in the nanomolar range.
[0009] WO2015195880 discloses a family with a similar core, namely
substituted bicyclic pyrazoles useful as protein kinase inhibitors.
Synthetic strategies for obtaining the inhibitors are described,
and the resulting CK1 inhibitors were shown to be effective on CK1
.delta. and .epsilon.. A particular relevance is indicated for the
treatment of cancer.
[0010] Facioscapulohumeral muscular dystrophy (FSHD) is the most
prevalent hereditary muscular dystrophy. Symptoms begin before the
age of 20, with weakness and atrophy of the muscles around the eyes
and mouth, shoulders, upper arms and lower legs. Later, weakness
can spread to abdominal muscles and sometimes hip muscles with
approximately 20% of patients eventually becoming wheelchair-bound.
Patients currently rely on treatment of symptoms like pain and
fatigue, involving the use of pain medication, cognitive therapy
and physical exercise, sometimes supplemented with medical devices
used to maintain the patient's mobility. Furthermore, increased
scapular function may be obtained by surgical treatment of the
scapula. At best, these interventions remain symptomatic in nature
and do not affect disease progression, illustrating the need for a
therapy that is able to modify disease progression.
[0011] Significant progress has been made in recent years in the
understanding of the molecular basis of FSHD. This resulted in the
identification and characterization of the fundamental genetic
lesions causing FSHD, giving rise to a new pathogenesis model in
which epigenetic de-repression of the Double Homeobox 4 (DUX4)
retrogene in muscle cells triggers pathology by initiating a
transcription deregulation cascade that causes muscle atrophy,
inflammation, and oxidative stress, which are key features of the
disease. DUX4 shares similarities with transcription factors and it
is normally abundantly expressed in germ cells of human testes,
while being epigenetically repressed in somatic tissues. There is
the wide support for the pathogenesis model in which
gain-of-function of the DUX4 gene in muscle cells underlies FSHD
etiology (Lemmers et al., 2010, DOI: 10.1126/science.1189044;
Sharma et al., 2016, DOI:10.4172/2157-7412.1000303, Snider et al.,
2010, DOI: 10.1371/journal.pgen.1001181; Tawil et al., 2014, DOI:
10.1186/2044-5040-4-12).
[0012] FSHD is sometimes divided in two subtypes, namely FSHD1 and
FSHD2. FSHD1 is associated with large deletions within a DNA tandem
array (D4Z4) that is located in the subtelomeric region of
chromosome 4q35. Each of the D4Z4 repeats contains a copy of the
DUX4 gene, which is normally silenced in somatic tissues of healthy
individuals. Healthy, genetically unaffected individuals are
defined as having between 10 and 100 D4Z4 repeat units on both 4q
chromosome arms, whereas individuals with FSHD1 have between 1 and
10 D4Z4 repeat units on one 4q chromosome arm. The deletions of
D4Z4 repeats that characterize FSHD remove a substantial portion of
regulatory chromatin from this region, including several hundreds
of histones and a significant amount of CpG-rich DNA. These
elements are essential in the establishment of DNA methylation and
heterochromatin and their loss significantly alters the epigenetic
status of the D4Z4 array. The contraction of D4Z4 is by itself not
pathogenic. Only when the contraction of D4Z4 occurs on a
disease-permissive 4qA allele, containing a polymorphism that could
affect the polyadenylation of the distal DUX4 transcript, the
altered epigenetic context is associated with alternative splicing
and increased expression of DUX4 in skeletal muscles of FSHD1
patients. In the much rarer form FSHD2, the cause is a mutated form
of an epigenetic factor such as SMCHD1 or DNMT3B. In this form as
well, the D4Z4 region is hypomethylated and muscle cells are
characterized by a de-repressed DUX4 protein. Both forms of FSHD
converge on undue DUX4 expression. It has therefore been suggested
that FSHD1 and FSHD2 are on a continuum, rather than being separate
(Van den Boogaard et al., 2016, DOI:
10.1016/j.ajhg.2016.03.013).
[0013] DUX4 acts as a transcription factor whose expression
initiates a transcription cascade resulting in progressive muscle
cell dysfunction and death, and ultimately to overt pathology
(Kowaljow et al., 2007, DOI: 10.1016/j.nmd.2007.04.002;
Vanderplanck et al., 2011, doi: 10.1371/journal.pone.0026820; Geng
et al., 2012, DOI: 10.1016/j.devcel.2011.11.013; Yao et al., 2014,
DOI: 10.1093/hmg/ddu251; Wallace et al., 2011, DOI:
10.1002/ana.22275). In healthy individuals, DUX4 is expressed in
the germline, but is epigenetically silenced in somatic tissues. In
FSHD patients, burst-like DUX4 expression in only a small fraction
of myofibers causes myocyte death ultimately leading to muscle
weakness and wasting (Lemmers et al., 2010). In the simplest terms,
DUX4-overexpression is a primary pathogenic insult underlying FSHD,
and its repression is a promising therapeutic approach for FSHD. In
support of this, short repeat sizes are generally associated with a
severe FSHD phenotype. Moderate repeat contractions have a milder
and more variable clinical severity. A very rare subtype of FSHD,
named FSHD2, is characterized by a moderate repeat contraction
(>10 repeats remaining), and is associated with mutations in the
SMCHD1 gene or in the DNMT3B gene. Also in FSHD2, the D4Z4 region
is hypomethylated and muscle cells are characterized by a
de-repressed DUX4 protein. Patients with less than 10 D4Z4 repeat
units that also have a mutation in SMCHD1 have a very severe
clinical phenotype, illustrating that a combination of repeat size
and activity of epigenetic modifiers, both contributing to
derepression of DUX4, determines the eventual disease severity in
FSHD.
[0014] Campbell et al. (2017, DOI 10.1186/s13395-017-0134-x)
screened a selection of chemical compounds with known epigenetic
activities as well as the Pharmakon 1600 library composed of
compounds that have reached clinical testing to identify molecules
that decrease DUX4 expression as monitored by the expression levels
of DUX4 target gene mRNAs in immortalized FSHD skeletal muscle cell
cultures. They identified several classes of molecules that include
inhibitors of the bromodomain and extra-terminal (BET) family of
proteins and agonists of the beta-2 adrenergic receptor. Their
studies suggest that compounds from these two classes suppress the
expression of DUX4 by blocking the activity of
bromodomain-containing protein 4 (BRD4) or by increasing cyclic
adenosine monophosphate (cAMP) levels, respectively.
[0015] Because of its causative role in FSHD, suppressing DUX4 is a
primary therapeutic approach for halting disease progression. This
approach could also be useful for treating other diseases, such as
cancers including acute lymphoblastic leukemia (Yasuda et al.,
2016, doi: 10.1038/ng.3535) and sarcomas (Oyama et al., 2017 DOI:
10.1038/s41598-017-04967-0, Bergerat et al., 2017, DOI:
10.1016/j.prp.2016.11.015), etc. However, the mechanisms behind
DUX4 expression are poorly understood and corresponding drug
targets are poorly defined. As a result, there is no treatment for
FSHD at present, and there is a need for compounds and compositions
that can be used to suppress DUX4 expression.
SUMMARY OF THE INVENTION
[0016] In a first aspect, the invention provides a casein kinase 1
inhibitor for use in the treatment of a disease or condition
associated with DUX4 expression, wherein the casein kinase 1
inhibitor reduces DUX4 expression. Preferably, the disease or
condition associated with DUX4 expression is a muscular dystrophy
or cancer, preferably wherein said disease or condition associated
with DUX4 expression is a muscular dystrophy, most preferably
facioscapulohumeral muscular dystrophy (FSHD). Preferably, the
casein kinase 1 inhibitor is characterized in that it is
administered to a subject 4, 3, 2, or 1 times per day or less,
preferably 1 time per day. Preferably, the casein kinase 1
inhibitor inhibits at least, and optionally is specific for, casein
kinase 1.delta.. Preferably, the CK1 inhibitor is characterized in
that it is administered to a subject in an amount ranging from 0.1
to 400 mg/day, preferably from 0.25 to 150 mg/day. Preferably, the
casein kinase 1 inhibitor is characterized in that it is
administered orally, sublingually, intravascularly, intravenously,
subcutaneously, or transdermally, preferably orally. Preferably,
DUX4 expression is reduced by at least 30%, 40%, 60%, 80%, or more.
Preferably, the casein kinase 1 inhibitor reduces DUX4 expression
in muscle cells, immune cells, or cancer cells. Preferably, the
reduction of DUX4 expression is determined using PCR or
immunostaining. Preferably, the casein kinase 1 inhibitor is from
the class comprising an azole core. Preferably, the casein kinase 1
inhibitor is selected from the group consisting of compounds A, B,
C, D, E, F, G, H, I, J, K, L, M, N, O, PF-670462, and
PF-5006739.
[0017] In a second aspect the invention provides a composition
comprising at least one casein kinase 1 inhibitor as defined in the
first embodiment, and a pharmaceutically acceptable excipient, for
use as defined in the first embodiment. Preferably, the composition
for use is formulated for oral, sublingual, parenteral,
intravascular, intravenous, subcutaneous, or transdermal
administration, preferably for oral administration.
[0018] In a third aspect, the invention provides an in vivo, in
vitro, or ex vivo method for reducing DUX4 expression, the method
comprising the step of contacting a cell with a casein kinase 1
inhibitor as defined in the first aspect, or with a composition as
defined in the second aspect. In a fourth aspect, the invention
provides a method for reducing DUX4 expression in a subject in need
thereof, the method comprising the step of administering an
effective amount of a casein kinase 1 inhibitor as defined in the
first aspect, or a composition as defined in the second aspect.
DESCRIPTION OF EMBODIMENTS
[0019] Following the central role of DUX4 in the consensus disease
hypothesis for FSHD, a therapeutic approach with a
disease-modifying potential is expected to rely on the inhibition
of DUX4. The inventors have surprisingly identified Caseine kinase
1 (CK1) as a novel drug target to achieve DUX4 repression in muscle
cells. This invention has been made using primary FSHD
patient-derived muscle cells. Because of the primate-specificity of
the FSHD locus and questionable relevance of recombinant,
immortalized, or tumorigenic cell or animal models to study
endogenous DUX4 regulatory mechanisms, primary patient-derived
muscle cells are the most relevant disease model available. Assays
based on immortalized cells bear the risk of altered epigenomes,
thereby limiting their relevance in studying the endogenous
regulation of DUX4 expression. Particularly the subtelomeric
location of D4Z4 and the importance of the D4Z4 epigenome in the
stability of DUX4 repression (Stadler et al., 2013, DOI:
10.1038/nsmb.2571) underscore the necessity of using primary muscle
cells to discover physiologically relevant drug targets that
regulate the expression of DUX4.
[0020] DUX4 has historically been regarded as being challenging to
detect in FSHD muscle. Its expression in primary myoblasts from
patients with FSHD has been shown to be stochastic. Studies have
reported that only 1 in 1000 or 1 in 200 nuclei is DUX4 positive in
proliferating FSHD myoblasts and during myoblast differentiation,
respectively. Due to this particularly low abundance of DUX4,
detection of DUX4 protein has been reported to be a technical
challenge. While primary FSHD muscle cells have been used
extensively in the FSHD literature, none of the reports appear to
be applicable beyond a bench scale level. The limitations posed by
using primary cells and the recognised complexity of detecting the
low levels of endogenous DUX4 illustrate the challenges associated
with applying primary FSHD muscle cells to higher throughput
formats. Although DUX4 expression increases upon in vitro
differentiation of proliferating FSHD myoblasts into multinucleated
myotubes, the levels remain low and the dynamic variability is
widely accepted to be extremely challenging for robust large-scale
screening approaches (Campbell et al., 2017).
Compound for Use
[0021] In a first aspect the invention provides a casein kinase 1
(CK1) inhibitor for use in the treatment of a disease or condition
associated with (undue) DUX4 expression, wherein the casein kinase
1 inhibitor reduces DUX4 expression. Such a CK1 inhibitor is
referred to herein as a CK1 inhibitor for use according to the
invention. CK1 inhibitors are known in the art and are described in
more detail later herein.
[0022] The medical use herein described is formulated as a compound
as defined herein for use as a medicament for treatment of the
stated condition(s) (e.g. by administration of an effective amount
of the compound), but could equally be formulated as i) a method of
treatment of the stated condition(s) using a compound as defined
herein comprising a step of administering to a subject an effective
amount of the compound, ii) a compound as defined herein for use in
the manufacture of a medicament to treat the stated condition(s),
wherein preferably the compound is to be administered in an
effective amount, and iii) use of a compound as defined herein for
the treatment of the stated condition(s), preferably by
administering an effective amount. Such medical uses are all
envisaged by the present invention. Preferred subjects are subjects
in need of treatment. Treatment preferably leads to delay,
amelioration, alleviation, stabilization, cure, or prevention of a
disease or condition. In other words, a compound for use according
to the invention can be a compound for the treatment, delay,
amelioration, alleviation, stabilization, cure, or prevention of
the stated disease or condition.
[0023] The CK1 inhibitor for use according to the invention reduces
DUX4 expression. This DUX4 expression is preferably the overall
DUX4 expression of the subject that is treated. DUX4 expression can
be determined using methods known in the art, or exemplified in the
examples. For example, DUX4 expression can be determined using PCR
techniques such as RT-PCR, or using immunostaining, mass
spectrometry, or ELISA, for example on a sample containing cells or
cell extracts, preferably obtained from the subject. In this
context, a reduction is preferably a reduction as compared to
either a predetermined value, or to a reference value. A preferred
reference value is a reference value obtained by determining DUX4
expression in an untreated sample containing cells or cell
extracts. This untreated sample can be from the same subject or
from a different and healthy subject, more preferably it is a
sample that was obtained in the same way, thus containing the same
type of cells. Conveniently, both the test sample and the reference
sample can be part of a single larger sample that was obtained.
Alternately, the test sample was obtained from the subject before
treatment commenced. A highly preferred reference value is the
expression level of DUX4 in a sample obtained from a subject prior
to the first administration of the casein kinase 1 inhibitor
according to the invention. Another preferred reference value is a
fixed value that represents an absence of DUX4 expression.
[0024] A reduction of DUX4 expression preferably means that
expression is reduced by at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, or 100%. If expression of DUX4 is reduced by for
example 100%, it may be that expression of DUX4 can no longer be
detected. Reduction can be assessed at the protein level, for
example through immunostaining, ELISA, or mass spectrometry, or it
can be assessed at the mRNA level, for example through PCR
techniques such as RT-PCR. In preferred embodiments, the invention
provides a casein kinase 1 inhibitor for use according to the
invention, wherein the reduction of DUX4 expression is determined
using PCR or immunostaining, wherein a preferred PCR technique is
RT-PCR. In preferred embodiments the invention provides a casein
kinase 1 inhibitor for use according to the invention, wherein DUX4
expression is reduced by at least 20%, 40%, 60%, 80%, or more, more
preferably by at least 30%, 40%, 60%, 80%, or more. In further
preferred embodiments, DUX4 expression is reduced by at least 10%.
In further preferred embodiments, DUX4 expression is reduced by at
least 20%. In further preferred embodiments, DUX4 expression is
reduced by at least 30%. In further preferred embodiments, DUX4
expression is reduced by at least 40%. In further preferred
embodiments, DUX4 expression is reduced by at least 50%. In further
preferred embodiments, DUX4 expression is reduced by at least 60%.
In further preferred embodiments, DUX4 expression is reduced by at
least 70%. In further preferred embodiments, DUX4 expression is
reduced by at least 80%. In further preferred embodiments, DUX4
expression is reduced by at least 90%. In further preferred
embodiments, DUX4 expression is reduced by at least 95%. In the
most preferred embodiments, DUX4 expression is reduced by about
100%, preferably by 100%.
[0025] In preferred embodiments, the invention provides a casein
kinase 1 inhibitor for use according to the invention, wherein the
casein kinase 1 inhibitor reduces DUX4 expression in muscle cells,
immune cells, or cancer cells, preferably in muscle cells or immune
cells, most preferably in muscle cells. Preferred muscle cells are
myoblasts, satellite cells, myotubes, and myofibers. Preferred
immune cells are B cells, T cells, dendritic cells, neutrophils,
natural killer cells, granulocytes, innate lymphoid cells,
megakaryocytes, myeloid-derived suppressor cells,
monocytes/macrophages, and thymocytes, and optionally mast cells.
Other preferred cells are platelets and red blood cells. In other
embodiments, DUX4 expression is reduced in cancer cells.
[0026] In preferred embodiments the invention provides the CK1
inhibitors for use according to the invention, wherein said disease
or condition associated with DUX4 expression is a muscular
dystrophy or cancer, preferably wherein said disease or condition
associated with DUX4 expression is a muscular dystrophy, most
preferably facioscapulohumeral muscular dystrophy (FSHD).
[0027] In this context, a preferred muscular dystrophy is FSHD; a
preferred cancer is prostate cancer (WO2014081923), multiple
myeloma (US20140221313), lung cancer (Lang et al., 2014, DOI:
10.14205/2310-8703.2014.02.01.1), colon cancer (Paz et al., 2003,
DOI: 10.1093/hmg/ddg226) sarcoma, or leukemia; a preferred sarcoma
is small round cell sarcoma (Oyama et al., 2017 DOI:
10.1038/s41598-017-04967-0; Bergerat et al., 2017, DOI:
10.1016/j.prp.2016.11.015; Chebib and Jo, 2016, DOI:
10.1002/cncy.21685); a preferred leukemia is acute lymphoblastic
leukemia (ALL), more particularly B-cell precursor ALL (Yasuda et
al., 2016, doi: 10.1038/ng.3535; Lilljebjorn & Fioretos, 2017,
DOI: 10.1182/blood-2017-05-742643; Zhang et al., 2017,
DOI:10.1038/ng.3691).
[0028] Accordingly, in preferred embodiments, the invention
provides the CK1 inhibitors for use according to the invention,
wherein said disease or condition associated with DUX4 expression
is a muscular dystrophy or cancer, preferably wherein said disease
or condition associated with DUX4 expression is FSHD, prostate
cancer, multiple myeloma, lung cancer, colon cancer (preferably
colorectal carcinoma), sarcoma (preferably small round cell
sarcoma), leukemia (preferably acute lymphoblastic leukemia, more
preferably B-cell precursor acute lymphoblastic leukemia),
preferably said disease or condition associated with DUX4
expression is FSHD. In more preferred embodiments, the invention
provides the CK1 inhibitors for use according to the invention,
wherein said disease or condition associated with DUX4 expression
is a muscular dystrophy or cancer, preferably wherein said disease
or condition associated with DUX4 expression is FSHD or cancer,
wherein cancer is preferably prostate cancer, multiple myeloma,
lung cancer, colon cancer (preferably colorectal carcinoma),
sarcoma (preferably small round cell sarcoma), leukemia (preferably
acute lymphoblastic leukemia, more preferably B-cell precursor
acute lymphoblastic leukemia), wherein cancer is more preferably
sarcoma, most preferably small round cell sarcoma.
[0029] In a preferred embodiment, the invention provides the CK1
inhibitors for use according to the invention, wherein said disease
or condition associated with DUX4 expression is cancer, wherein
cancer is preferably prostate cancer, multiple myeloma, lung
cancer, colon cancer (preferably colorectal carcinoma), sarcoma
(preferably small round cell sarcoma), leukemia (preferably acute
lymphoblastic leukemia, more preferably B-cell precursor acute
lymphoblastic leukemia), wherein cancer is more preferably sarcoma,
most preferably small round cell sarcoma.
[0030] Other DUX4 targets are known as "cancer testis antigens"
(CTAs), which are genes that are normally expressed only in testis,
but which are de-repressed in some cancers, eliciting an immune
response. These observations imply that DUX4 de-repression in
cancers mediates the activation of HSATII, CTAs and/or THE1B
promoters (Young et al., 2013, doi:10.1371/journal.pgen.1003947).
In line with this, Dmitriev et al. (2014, DOI: 10.1111/jcmm.12182)
demonstrate a similarity between FSHD and cancer cell expression
profiles, suggesting a common step in the pathogenesis of these
diseases.
Casein Kinase 1 Inhibitor
[0031] Casein kinase 1 inhibitors are known in the art. Preferably,
in the context of this invention, a casein kinase 1 inhibitor for
use according to the invention is of general structural formula
(1a), (1b), (2a), (2b), or (3):
##STR00001##
[0032] wherein X and Y are independently .dbd.N--, --NR.sup.1--,
CR.sup.1, or --S--, provided that at least one of X and Y is
CR.sup.1,
[0033] ring A is absent (so effectively it is two H) or is a 4- to
7-membered cycloalkyl or heterocycloalkyl or a 5- to 6-membered
heteroaryl, wherein up to 2 carbon atoms are replaced with a
heteroatom selected from .dbd.N--, --NR.sup.2--, --O--, --S-- and
any remaining carbon atom may be substituted with R.sup.3 as
valency allows; preferably, ring A is a 4- to 7-membered cycloalkyl
or heterocycloalkyl or a 5- to 6-membered heteroaryl, wherein up to
2 carbon atoms are replaced with a heteroatom selected from
.dbd.N--, --NR.sup.2--, --O--, --S-- and any remaining carbon atom
may be substituted with R.sup.3 as valency allows;
[0034] each R.sup.1 is independently H, C.sub.1-4alkyl,
C.sub.3-6cycloalkyl, --CF.sub.3, --(CH.sub.2).sub.1-3CF.sub.3, 4-
to 10-membered aryl, 4- to 10-membered heteroaryl, 4- to
10-membered heterocycloalkyl, wherein said aryl, heteroaryl, or
heterocycloalkyl may be substituted with one, two, or three
substituents independently selected from halogen, OH, oxo, cyano,
--SO.sub.2CH.sub.3, carboxylic acid that is optionally esterified
with methanol or ethanol, carboxamide, nitro, C.sub.1-6alkoxy,
C.sub.1-6alkyl, or C.sub.1-6alkyl-O--C.sub.1-6alkyl; preferably,
each R.sup.1 is independently H, C.sub.1-4alkyl,
C.sub.3-6cycloalkyl, --CF.sub.3, --(CH.sub.2).sub.1-3--CF.sub.3, 4-
to 10-membered heterocycloalkyl, wherein said heterocycloalkyl may
be substituted with up to two substituents independently selected
from halogen, OH, oxo, cyano, C.sub.1-6alkyl, or
C.sub.1-6alkyl-O--C.sub.1-6alkyl;
[0035] Each R.sup.2 is independently H, C.sub.1-6alkyl,
C.sub.4-10-bicycloalkyl, --(CH.sub.2).sub.t--CN,
--S02-C.sub.1-6alkyl,
--SO.sub.2(CH.sub.2).sub.tC.sub.3-6cycloalkyl,
--C.sub.1-6alkyl-O--C.sub.1-6alkyl,
--C.sub.1-6alkyl-C(O)O--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl-C(O)O--C.sub.1-6alkyl,
--C(O)--(O).sub.u--C.sub.1-6alkyl,
--C(O)--C.sub.1-6alkyl-O--C.sub.1-6alkyl,
--C(O)--(O).sub.u--(CH.sub.2).sub.t--(C.sub.6-10aryl),
--(CH.sub.2).sub.t--(C.sub.6-10aryl),
--C(O)--(O).sub.u--(CH.sub.2).sub.t-(5- to 10-membered heteroaryl),
--(CH.sub.2).sub.t--C(O)--NR.sup.5R.sup.6, --(CH.sub.2).sub.t-(5-
to 10-membered heteroaryl), --C(O)--(O).sub.u--(CH.sub.2).sub.t-(3-
to 10-membered heterocycloalkyl), --(CH.sub.2).sub.t-(4- to
10-membered heterocycloalkyl),
--C(O)--(O).sub.u--(CH.sub.2).sub.t-(3- to 10-membered cycloalkyl),
or --(CH.sub.2).sub.t-(3- to 10-membered cycloalkyl),
[0036] wherein said aryl, heteroaryl, cycloalkyl, and
heterocycloalkyl of R.sup.2 may be substituted with up to two
substituents independently selected from halogen, OH, cyano,
C.sub.1-6alkyl, or C.sub.1-6alkyl-O--C.sub.1-6alkyl,
[0037] and wherein any alkyl, cycloalkyl, and heterocycloalkyl of
R.sup.2 may be further substituted with oxo where valency
allows;
[0038] each R.sup.3 is independently absent, C.sub.1-3alkyl,
halogen, oxo, --NR.sup.5R.sup.6, or --OR.sup.5;
[0039] each R.sup.4 is independently halogen, --CF.sub.3,
C.sub.1-3alkyl, --(CH.sub.2).sub.t--C.sub.3-4cycloalkyl,
--(CH.sub.2).sub.t--O--C.sub.1-3alkyl, --(CH.sub.2).sub.t-cyano, or
--(CH.sub.2).sub.t-hydroxy, wherein a halogen is preferably F and
is preferably para to the five-membered ring comprising X and Y,
wherein C.sub.1-3alkyl is preferably methyl and is preferably meta
to the five-membered ring comprising X and Y; preferably, each
R.sup.4 is independently halogen, --CF.sub.3, C.sub.1-3alkyl,
--(CH.sub.2).sub.t--C.sub.3-4cycloalkyl,
--(CH.sub.2).sub.t--O--C.sub.1-3alkyl, --(CH.sub.2).sub.t-cyano, or
--(CH.sub.2).sub.t-hydroxy;
[0040] each R.sup.5 is independently H or C.sub.1-6alkyl;
[0041] each R.sup.6 is independently H or C.sub.1-6alkyl;
[0042] R.sup.7 is H, halogen, or C.sub.1-3alkyl;
[0043] n is 0, 1, or 2;
[0044] each t is independently 0, 1, or 2;
[0045] each u is independently 0 or 1; [0046] and wherein
[0047] A' is a 4- to 7-membered cycloalkyl, a nitrogen-containing
4- to 7-membered heterocycloalkyl, or alternatively A' can be
directly fused to the ring to which it is attached through
[0048] R'.sup.1; preferably, A' is a nitrogen-containing 4- to
7-membered heterocycloalkyl, or alternatively A' can be directly
fused to the ring to which it is attached through R'.sup.1;
[0049] L is C.sub.1-3alkyl;
[0050] R'.sup.1 is hydrogen, C.sub.1-3alkyl, or
C.sub.3-4cycloalkyl;
[0051] each R'.sup.2 is independently C.sub.1-3alkyl, fluorine,
hydroxyl, C.sub.1-3alkoxy, or cyano;
[0052] R'.sup.3 is hydrogen, C.sub.1-3alkyl, or
C.sub.3-4cycloalkyl;
[0053] R'.sup.4 is a 5- to 10-membered heteroaryl with 1 to 3
heteroatoms, optionally substituted with 1 to 3 R.sup.4
substituents;
[0054] R'.sup.5 is hydrogen or --N(R.sup.8).sub.2;
[0055] Z is N or --CR.sup.9;
[0056] each R.sup.8 is independently hydrogen or
C.sub.1-3alkyl;
[0057] R.sup.9 is hydrogen, C.sub.1-3alkyl, or halogen;
[0058] m is 0, 1 or 2;
[0059] q is 1, 2, or 3; [0060] and wherein
[0061] R''.sup.2 represents an aryl group optionally substituted
with one or more substituents selected from halogen,
C.sub.1-6alkyl, C.sub.1-6alkyloxy, C.sub.1-6alkylthio,
C.sub.1-6fluoroalkyl, C.sub.1-6fluoroalkyloxy and --CN;
[0062] R''.sup.3 represents H, C.sub.1-3alkyl,
--NR''.sup.4R''.sup.5, hydroxyl, or C.sub.1-4alkyloxy;
[0063] A'' represents C.sub.1-7-alkylene optionally substituted
with one or two R.sup.a;
[0064] B represents C.sub.1-7-alkylene optionally substituted with
R.sup.b;
[0065] L'' represents either N substituted with R.sup.c or R.sup.d,
or C substituted with R.sup.e1 and R.sup.d or with two groups
R.sup.e2;
[0066] the carbon atoms of A'' and B being optionally substituted
with one or more groups R.sup.1, which may be identical to or
different than each other;
[0067] R.sup.a, R.sup.b and R.sup.c are defined such that: [0068]
two groups R.sup.a may together form C.sub.1-6alkylene; [0069]
R.sup.a and R.sup.b may together form a bond or C.sub.1-6alkylene;
[0070] R.sup.a and R.sup.c may together form a bond or
C.sub.1-6alkylene; [0071] R.sup.b and R.sup.c may together form a
bond or C.sub.1-6alkylene;
[0072] R.sup.d represents a group selected from H, C.sub.1-6alkyl,
C.sub.3-7cycloalkyl, C.sub.3-7cycloalkyl-C.sub.1-6alkyl,
C.sub.1-6alkylthio-C.sub.1-6alkyl,
C.sub.1-6alkyloxy-C.sub.1-6alkyl, C.sub.1-6fluoroalkyl, benzyl,
C.sub.1-6acyl, and hydroxy-C.sub.1-6alkyl;
[0073] R.sup.e1 represents --NR''.sup.4R''.sup.5 or a cyclic
monoamine optionally comprising an oxygen atom, the cyclic
monoamine being optionally substituted with one or more
substituents selected from F, C.sub.1-6alkyl, C.sub.1-6alkyloxy,
and hydroxyl;
[0074] two groups R.sup.e2 form, with the carbon atom that bears
them, a cyclic monoamine optionally comprising an oxygen atom, this
cyclic monoamine being optionally substituted with one or more
R.sup.f, which may be identical to or different than each
other;
[0075] R.sup.f represents C.sub.1-6alkyl, C.sub.3-7cycloalkyl,
C.sub.3-7cycloalkyl C.sub.1-6alkyl,
C.sub.1-6alkyloxy-C.sub.1-6alkyl, hydroxy-C.sub.1-6alkyl,
C.sub.1-6fluoroalkyl or benzyl;
[0076] R''.sup.4 and R''.sup.5 each independently represent H,
C.sub.1-4alkyl, C.sub.3-7cycloalkyl, or
C.sub.3-7cycloalkyl-C.sub.1-6alkyl; [0077] and wherein
[0078] X.sup.1 is selected from O and NQ.sup.6; provided when
X.sup.1 is NQ.sup.6, Q.sup.5 and Q.sup.6 together with the nitrogen
atom and the adjacent carbon atom to which they are respectively
attached form a heterocyclic ring comprising carbon atoms and zero
to 3 additional heteroatoms selected from N, NQ.sup.8, O, S and
substituted with 1-5 Q.sup.10;
[0079] Q.sup.1 is C.sub.1-4alkyl optionally substituted with
halogen, OH, CN, and NQ.sup.aQ.sup.a, or Q.sup.1 is
--(CQ.sup.dQ.sup.d).sub.r-carbocyclyl substituted with 0-5
Q.sup.11, and --(CQ.sup.dQ.sup.d).sub.r-heterocyclyl comprising
carbon atoms and 1 to 4 heteroatoms selected from N, NQ.sup.9, O,
S, and substituted with 0-5 Q.sup.11;
[0080] Q.sup.2 is selected from H, C.sub.1-4alkyl, halogen, CN,
aryl, and heteroaryl;
[0081] Q.sup.3 is selected from H and C.sub.1-4alkyl;
[0082] Q.sup.4 is selected from H, C.sub.1-4alkyl halogen, and
CN;
[0083] Q.sup.5 is selected from H, C.sub.1-4alkyl substituted with
0-4 Q.sup.e, --(CH.sub.2).sub.rC.sub.3-6carbocyclyl substituted
with 0-4 Q.sup.e, and --(CH.sub.2).sub.r-heterocyclyl comprising
carbon atoms and 1 to 3 heteroatoms selected from N, O, S, and
substituted with 0-4 Q.sup.e;
[0084] Q.sup.7 is aryl substituted with 0-3 Q.sup.e;
[0085] Q.sup.8 is selected from H, C.sub.1-4alkyl substituted with
0-3 Q.sup.e, --(CH.sub.2).sub.rCN, --(CH.sub.2).sub.rOQ.sup.b,
--(CH.sub.2).sub.rS(O).sub.pQ.sup.C,
--(CH.sub.2).sub.rC(.dbd.O)Q.sup.b,
--(CH.sub.2).sub.rNQ.sup.aQ.sup.a,
--(CH.sub.2).sub.rC(.dbd.O)NQ.sup.aQ.sup.a,
--(CH.sub.2).sub.rC(.dbd.O)--C.sub.1-4alkyl substituted with 0-3
Q.sup.e, --(CH.sub.2).sub.rNQ.sup.aC(.dbd.O)Q.sup.b,
--(CH.sub.2).sub.rNQ.sup.aC(.dbd.O)OQ.sup.b,
--(CH.sub.2).sub.rOC(.dbd.O)NQ.sup.aQ.sup.a,
--(CH.sub.2).sub.rNQ.sup.aC(.dbd.O)NQ.sup.aQ.sup.a,
--(CH.sub.2).sub.rC(.dbd.O)OQ.sup.b,
--(CH.sub.2).sub.rS(O).sub.2NQ.sup.aQ.sup.a,
--(CH.sub.2).sub.rNQ.sup.aS(O).sub.2NQ.sup.aQ.sup.a,
--(CH.sub.2).sub.rNQ.sup.aS(O).sub.2Q.sup.c,
--(CH.sub.2).sub.r-carbocyclyl substituted with 0-3 Q.sup.e, and
--(CH.sub.2).sub.r-heterocyclyl substituted with 0-3 Q.sup.e;
[0086] Q.sup.9 is selected from H, --C(.dbd.O)Q.sup.b,
C.sub.1-6alkyl substituted with 0-5 Q.sup.e,
--(CH.sub.2).sub.rC.sub.3-6carbocyclyl substituted with 0-5
Q.sup.e, and --(CH.sub.2).sub.r-heterocyclyl substituted with 0-5
Q.sup.e;
[0087] Q.sup.10 is selected from H, C.sub.1-6alkyl substituted with
0-3 Q.sup.e, --(CH.sub.2).sub.rNQ.sup.aQ.sup.a,
--(CH.sub.2).sub.rC(.dbd.O)Q.sup.b,
--(CH.sub.2).sub.rC(.dbd.O)OQ.sup.b,
--(CH.sub.2).sub.rC(.dbd.O)NQ.sup.aQ.sup.a, --S(O).sub.pQ.sup.c,
--(CH.sub.2)C.sub.3-6carbocyclyl substituted with 0-3 Q.sup.e, and
--(CH.sub.2).sub.rheterocyclyl substituted with 0-3 Q.sup.e;
[0088] each Q.sup.11 is independently selected from H, halogen,
.dbd.O, CN, NO.sub.2, --OQ.sup.b, --S(O).sup.pQ.sup.c,
--C(.dbd.O)Q.sup.b, --(CQ.sup.dQ.sup.d).sub.rNQ.sup.aQ.sup.a,
--(CQ.sup.dQ.sup.d).sub.rC(.dbd.O)NQ.sup.aQ.sup.a,
--NQ.sup.aC(.dbd.O)Q.sup.b, --NQ.sup.aC(.dbd.O)OQ.sup.b,
--OC(.dbd.O)NQ.sup.aQ.sup.a, --NQ.sup.aC(.dbd.O)NQ.sup.aQ.sup.a,
--(CQ.sup.dQ.sup.d).sub.rC(.dbd.O)OQ.sup.b,
--S(O).sub.2NQ.sup.aQ.sup.a, --NQ.sup.aS(O).sub.2NQ.sup.aQ.sup.a,
--NQ.sup.aS(O).sub.2Q.sup.c, C.sub.1-6alkyl substituted with 0-5
Q.sup.e, --(CQ.sup.dQ.sup.d).sub.rC.sub.3-6carbocyclyl substituted
with 0-5 Q.sup.e, and --(CQ.sup.dQ.sup.d).sub.r-heterocyclyl
substituted with 0-5 Q.sup.e;
[0089] each Q.sup.a is independently selected from H, CN,
C.sub.1-6alkyl substituted with 0-5 Q.sup.e, C.sub.2-6alkenyl
substituted with 0-5 Q.sup.e, C.sub.2-6alkynyl substituted with 0-5
Q.sup.e, --(CH.sub.2).sub.rC.sub.3-10carbocyclyl substituted with
0-5 Q.sup.e, and --(CH.sub.2).sub.r-heterocyclyl substituted with
0-5 Q.sup.e; or two instances of Q.sup.a together with the nitrogen
atom to which they are both attached form a heterocyclic ring
substituted with 0-5 Q.sup.e;
[0090] each Q.sup.b is independently selected from H,
C.sub.1-6alkyl substituted with 0-5 Q.sup.e, C.sub.2-6alkenyl
substituted with 0-5 Q.sup.e, C.sub.2-6alkynyl substituted with 0-5
Q.sup.e, --(CH.sub.2).sub.rC.sub.3-10carbocyclyl substituted with
0-5 Q.sup.e, and --(CH.sub.2).sub.r-heterocyclyl substituted with
0-5 Q.sup.e;
[0091] each Q.sup.C is independently selected from C.sub.1-6alkyl
substituted with 0-5 Q.sup.e, C.sub.2-6alkenyl substituted with 0-5
Q.sup.e, C.sub.2-6alkynyl substituted with 0-5 Q.sup.e,
C.sub.3-6carbocyclyl substituted with 0-5 Q.sup.e, and heterocyclyl
substituted with 0-5 Q.sup.e;
[0092] each Q.sup.d is independently selected from H and
C.sub.1-4alkyl substituted with 0-5 Q.sup.e;
[0093] each Q.sup.e is independently selected from C.sub.1-6alkyl
substituted with 0-5 Q.sup.f, C.sub.2-6alkenyl, C.sub.2-6alkynyl,
--(CH.sub.2).sub.r--C.sub.3-6cycloalkyl, halogen, CN, NO.sub.2,
.dbd.O, C.sub.02H, --(CH.sub.2).sub.rOQ.sup.f, SQ.sup.f, and
--(CH.sub.2).sub.rNQ.sup.fQ.sup.f;
[0094] each Q.sup.f is independently selected from H, F,
C.sub.1-5alkyl, C.sub.3-6cycloalkyl, and phenyl, or two instances
of Q.sup.f together with the nitrogen atom to which they are both
attached form a heterocyclic ring optionally substituted with
C.sub.1-4alkyl;
[0095] each p is independently 0, 1, or 2; and
[0096] each r is independently 0, 1, 2, 3, or 4, [0097] and
wherein
[0098] X.sup.2 is selected from --NH--, --CH.sub.2--, --CH(Ph)-,
--CH.sub.2CH.sub.2--, --CH.sub.2CH(Ph)-, --CH.dbd.CH--,
--CH.sub.2OCH.sub.2--, --CH.sub.2NHC(O)--, --CH.sub.2NHC(O)CH(Ph)-
and --CH.sub.2NHC(O)CH.sub.2--,
[0099] Q'.sup.1 is selected from Q'.sup.6, halogen, --CF.sub.3,
--OCF.sub.3, --OQ'.sup.6, --CO.sub.2Q'.sup.6,
--SO.sub.2N(Q'.sup.6).sub.2, and --NO.sub.2;
[0100] Q'.sup.2, Q'.sup.3, Q'.sup.4 and Q'.sup.5 are independently
selected from H, halogen, C.sub.1-6alkoxy, --NH.sub.2,
--NHQ'.sup.6, --CN, --NO.sub.2, --OCF.sub.3, and
--CO.sub.2Q'.sup.6; wherein
[0101] Q'.sup.6 is selected from H and C.sub.1-6alkyl; and wherein
when X.sup.2 is --CH(Ph)-, --CH.sub.2CH(Ph)- or
--CH.sub.2NHC(O)CH(Ph)-, then Q'.sup.2, Q'.sup.3, Q'.sup.4 and
Q'.sup.5 are H,
[0102] or isomers or pharmaceutically acceptable salts thereof.
[0103] A CK1 inhibitor for use according to the invention can also
be SR-3029.
##STR00002##
[0104] In preferred embodiments, the CK1 inhibitor for use
according to the invention is of general formula (Ia) or (Ib), or
isomers or pharmaceutically acceptable salts thereof, wherein X, Y,
A, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7,
n, t, u, A', L, R'.sup.1, R'.sup.2, R'.sup.3, R'.sup.4, R'.sup.5,
Z, R.sup.8, R.sup.9, m, and q are as defined above.
[0105] In a further preferred embodiment, it is of general formula
(Ia), or isomers or pharmaceutically acceptable salts thereof,
wherein X, Y, A, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5,
R.sup.6, R.sup.7, n, t, u, A', L, R'.sup.1, R'.sup.2, R'.sup.3,
R'.sup.4, R'.sup.5, Z, R.sup.8, R.sup.9, m, and q are as defined
above. In a further preferred embodiment, it is of general formula
(Ib), or isomers or pharmaceutically acceptable salts thereof,
wherein X, Y, A, R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5,
R.sup.6, R.sup.7, n, t, u, A', L, R'.sup.1, R'.sup.2, R'.sup.3,
R'.sup.4, R'.sup.5, Z, R.sup.8, R.sup.9, m, and q are as defined
above. CK1 inhibitors of this class are known per se in the art and
have their structure and synthesis described in more detail in, for
example, WO2011051858, WO2012085721, and WO2015119579.
[0106] CK1 inhibitors of this class comprise an azole core. In
preferred embodiments of this aspect, the invention provides casein
kinase 1 inhibitor for use according to the invention, wherein the
casein kinase 1 inhibitor is from the class comprising an azole
core. More preferably, these CK1 inhibitors for use comprise a
4-aryl-5-heteroaryl-1-heterocycloalkyl-imidazole moiety.
Preferably, for these inhibitors, a single R.sup.4 is present, para
to the azole core; more preferably this R.sup.4 is F. Accordingly,
in further more preferred embodiments, the casein kinase 1
inhibitor for use according to the invention comprises an azole
core linked to a 4-halophenyl moiety, preferably a 4-fluorophenyl
moiety. Highly preferred compounds comprising an azole core are
compounds D, E, F, and G as shown in table 3; compound D is even
more preferred.
[0107] In preferred embodiments, the CK1 inhibitor for use
according to the invention is of general formula (2a) or (2b), or
isomers or pharmaceutically acceptable salts thereof, wherein
R.sup.5, R.sup.6, R''.sup.2, R''.sup.3, A''B, L'' R.sup.a, R.sup.b,
R.sup.c, R.sup.d, R.sup.e, R.sup.e2, R.sup.f, R''.sup.4, R''.sup.5,
X.sup.1, Q.sup.1, Q.sup.2, Q.sup.3, Q.sup.4, Q.sup.5, Q.sup.6,
Q.sup.7, Q.sup.8, Q.sup.9, Q.sup.10, Q.sup.11, Q.sup.a, Q.sup.b,
Q.sup.c, Q.sup.d, Q.sup.e Q.sup.f, r, and P are as defined above.
In a further preferred embodiment, it is of general formula (2a) or
isomers or pharmaceutically acceptable salts thereof, wherein
R.sup.5, R.sup.6, R''.sup.2, R''.sup.3, A'', B, L'' R.sup.a,
R.sup.b, R.sup.c, R.sup.d, R.sup.e, R.sup.e2, R.sup.f, R''.sup.4,
R''.sup.5, X.sup.1, Q.sup.1, Q.sup.2, Q.sup.3, Q.sup.4, Q.sup.5,
Q.sup.6, Q.sup.7, Q.sup.8, Q.sup.9, Q.sup.10, Q.sup.11, Q.sup.a
Q.sup.b, Q.sup.c, Q.sup.d, Q.sup.e Q.sup.f, P, and r are as defined
above. In a further preferred embodiment, it is of general formula
(2b) or isomers or pharmaceutically acceptable salts thereof,
wherein R.sup.5, R.sup.6, R''.sup.2, R''.sup.3, A'', B, L'',
R.sup.a, R.sup.b, R.sup.c, R.sup.d, R.sup.e, R.sup.e2, R.sup.f,
R''.sup.4, R''.sup.5, X.sup.1, Q.sup.1, Q.sup.2, Q.sup.3, Q.sup.4,
Q.sup.5, Q.sup.6, Q.sup.7, Q.sup.8, Q.sup.9, Q.sup.10, Q.sup.11,
Q.sup.a Q.sup.b, Q.sup.c, Q.sup.d, Q.sup.e Q.sup.f, P, and r are as
defined above. CK1 inhibitors of this class are known per se in the
art and have their structure and synthesis described in more detail
in, for example, WO2009016286 and WO2015195880.
[0108] CK1 inhibitors of this class comprise a
cyclo-3-pyrid-4-yl)imidazo[1,2-b]pyridazine core. In preferred
embodiments of this aspect, the invention provides casein kinase 1
inhibitor for use according to the invention, wherein the casein
kinase 1 inhibitor is from the class comprising a
cyclo-3-pyrid-4-yl)imidazo[1,2-b]pyridazine core. In further
preferred embodiments, the casein kinase 1 inhibitor for use
according to the invention comprises an azole core or comprises a
cyclo-3-pyrid-4-yl)imidazo[1,2-b]pyridazine core. In further
preferred embodiments, the casein kinase 1 inhibitor for use
according to the invention is of general formula (1a), (1 b), (2a),
or (2b), wherein X, Y, A, R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.5, R.sup.6, R.sup.7, n, t, u, A', L, R'.sup.1, R'.sup.2,
R'.sup.3, R'.sup.4, R'.sup.5, Z, R.sup.8, R.sup.9, m, q, R''.sup.2,
R''.sup.3, A'', B, L'', R.sup.a, R.sup.b, R.sup.c, R.sup.d,
R.sup.e, R.sup.e2, R.sup.f, R''.sup.4, R''.sup.5, X.sup.1, Q.sup.1,
Q.sup.2, Q.sup.3, Q.sup.4, Q.sup.5, Q.sup.6, Q.sup.7, Q.sup.8,
Q.sup.9, Q.sup.10, Q.sup.11, Q.sup.a, Q.sup.b, Q.sup.c, Q.sup.d,
Q.sup.e Q.sup.f, r, and P are as defined above.
[0109] In preferred embodiments, the CK1 inhibitor for use
according to the invention is of general formula (3) or isomers or
pharmaceutically acceptable salts thereof, wherein X.sup.2,
Q'.sup.1, Q.sup.12, Q.sup.13, Q'.sup.4, Q'.sub.5, and Q'.sup.6 are
as defined above. CK1 inhibitors of this class are known in the art
per se and have their structure and synthesis described in more
detail in, for example, EP2949651. When a Csk1 inhibitor is of
general formula (3), X.sup.2 is preferably --CH.sub.2--,
--CH.sub.2CH.sub.2--, --CH(Ph)-, or --NH--, most preferably
--CH.sub.2--; Q'.sup.1 is preferably --CF.sub.3, halogen, or
C.sub.1-6alkyl, more preferably --CF.sub.3; Q'.sup.2, Q.sup.13,
Q'.sup.4 and Q'.sup.5 are preferably independently selected from H,
halogen, and C.sub.1-5alkoxy. More preferably, when a CK1 inhibitor
is of general formula (3), X.sup.2 is --CH.sub.2-- and Q'.sup.1 is
--CF.sub.3.
[0110] Structures of exemplary CK1 inhibitors are shown in table 3.
In further preferred embodiments, the invention provides the CK1
inhibitor for use according to the invention, wherein the casein
kinase 1 inhibitor is selected from the group consisting of
compounds A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, SR-3029,
PF-670462, and PF-5006739. Compound O is also known as TA-01. More
preferably, the casein kinase 1 inhibitor is selected from the
group consisting of compounds A, B, C, D, E, F, G, H, O, SR-3029,
PF-670462, and PF-5006739. Even more preferably, the casein kinase
1 inhibitor is selected from the group consisting of compounds A,
D, F, G, H, O, SR-3029, PF-670462, and PF-5006739. Even more
preferably, the casein kinase 1 inhibitor is selected from the
group consisting of compounds A, D, F, G, H, SR-3029, PF-670462,
and PF-5006739. Most preferably, the casein kinase 1 inhibitor is
selected from the group consisting of compounds A, D, F, G, H,
SR-3029, and PF-5006739. It is also highly preferred that the
casein kinase 1 inhibitor be compound D. It is also highly
preferred that the casein kinase 1 inhibitor is selected from the
group consisting of compounds A, B, and H, more preferably it is
compound H.
[0111] In other embodiments, the CK1 inhibitor for use according to
the invention is an inhibitory antibody, an antisense
oligonucleotide, or an oligonucleotide that prevents expression of
CK1.
[0112] The various isoforms of casein kinase 1 are known to have
different functions. Within the set of known isoforms, CK1.delta.
and CK1.epsilon. are preferred targets for the CK1 inhibitors
according to the invention. These two isoforms are known to be
closely related to one another. For example, CK1.delta. and
CK1.epsilon. were thought to be generally redundant in circadian
cycle length and protein stability, but were later revealed to have
slightly different functions (Etchegaray J P et al., 2009,
DOI:10.1128/MCB.00338-09). Due to their physiological importance,
and the known efficacy of the CK1 inhibitors for use in the present
invention, preferred embodiments of the invention provide a casein
kinase 1 inhibitor for use according to the invention, wherein the
casein kinase inhibitor inhibits at least casein kinase 1.delta. or
casein kinase 1.epsilon.. Optionally, the casein kinase inhibitor
is specific for casein kinase 1.delta. or for casein kinase
1.epsilon.. Furthermore, in more preferred embodiments the
invention provides a casein kinase 1 inhibitor for use according to
the invention, wherein the casein kinase inhibitor at least
inhibits, and optionally is specific for, casein kinase 1.delta..
In other more preferred embodiments the invention provides a casein
kinase 1 inhibitor for use according to the invention, wherein the
casein kinase inhibitor at least inhibits, and optionally is
specific for, casein kinase 1.epsilon.. In other embodiments the
invention provides a casein kinase 1 inhibitor for use according to
the invention, wherein the casein kinase inhibitor at least
inhibits, and optionally is specific for, casein kinase 1.alpha..
In other embodiments the invention provides a casein kinase 1
inhibitor for use according to the invention, wherein the casein
kinase inhibitor at least inhibits, and optionally is specific for,
casein kinase 1.beta.. In other embodiments the invention provides
a casein kinase 1 inhibitor for use according to the invention,
wherein the casein kinase inhibitor at least inhibits, and
optionally is specific for, casein kinase 1.gamma.1, 1.gamma.2,
and/or 1.gamma.3. It is to be understood in this context that a CK1
inhibitor is specific for a particular isoform when it at least
partially inhibits that particular isoform. Preferably, it inhibits
that particular isoform more efficiently than other isoforms.
[0113] CK1 inhibitors suitable for use in the invention preferably
have an IC.sub.50 on a casein kinase of at most 650 nM, preferably
of at most 500 nM, more preferably of at most 400 nM, even more
preferably of at most 300 nM, still more preferably of at most 250
nM, still more preferably of at most 200 nM, most preferably of at
most 100 nM. In preferred embodiments, the CK1 inhibitor has an
IC.sub.50 on at least casein kinase 1.delta. or casein kinase
1.epsilon. of at most 450 nM, more preferably of at most 400 nM,
even more preferably of at most 350 nM, more preferably still of at
most 200 nM, even more preferably still of at most 100 nM, most
preferably of at most 50 nM. In most preferred embodiments the CK1
inhibitor has an IC.sub.50 on casein kinase 1.delta. of at most 350
nM, preferably at most 100 nM, more preferably at most 35 nM, most
preferably at most 25 nM. IC.sub.50 values for CK1 can be
determined using any method known in the art, for example as
described in WO2011051858, WO2015119579, EP2949651, or
US2005/0131012. Suitable assays can use a peptide substrate and a
readout method, for example using the Kinase-Glo assay (Promega,
part #V672A).
Composition
[0114] In a further aspect, the invention provides a composition
comprising at least one CK1 inhibitor, and a pharmaceutically
acceptable excipient, for use according to the invention. Such a
composition is referred to herein as a composition for use
according to the invention. Preferred compositions for use
according to the invention are pharmaceutical compositions. In
preferred embodiments, the composition for use according to the
invention is formulated for oral, sublingual, parenteral,
intravascular, intravenous, subcutaneous, or transdermal
administration, optionally for administration by inhalation;
preferably for oral administration. More features and definitions
of administration methods are provided in the section on
formulation and administration.
Formulation and Administration
[0115] The compositions comprising the compounds as described
above, can be prepared as a medicinal or cosmetic preparation or in
various other media, such as foods for humans or animals, including
medical foods and dietary supplements. A "medical food" is a
product that is intended for the specific dietary management of a
disease or condition for which distinctive nutritional requirements
exist. By way of example, but not limitation, medical foods may
include vitamin and mineral formulations fed through a feeding tube
(referred to as enteral administration). A "dietary supplement"
shall mean a product that is intended to supplement the human diet
and is typically provided in the form of a pill, capsule, tablet or
like formulation. By way of example, but not limitation, a dietary
supplement may include one or more of the following ingredients:
vitamins, minerals, herbs, botanicals; amino acids, dietary
substances intended to supplement the diet by increasing total
dietary intake, and concentrates, metabolites, constituents,
extracts or combinations of any of the foregoing. Dietary
supplements may also be incorporated into food, including, but not
limited to, food bars, beverages, powders, cereals, cooked foods,
food additives and candies; or other functional foods designed to
promote health or to prevent or halt the progression of a
degenerative disease associated with DUX4 expression or
activity.
[0116] The subject compositions thus may be compounded with other
physiologically acceptable materials that can be ingested
including, but not limited to, foods. In addition or alternatively,
the compositions for use as described herein may be administered
orally in combination with (the separate) administration of
food.
[0117] The compositions may be administered alone or in combination
with other pharmaceutical or cosmetic agents and can be combined
with a physiologically acceptable carrier thereof. In particular,
the compounds described herein can be formulated as pharmaceutical
or cosmetic compositions by formulation with additives such as
pharmaceutically or physiologically acceptable excipients carriers,
and vehicles. Suitable pharmaceutically or physiologically
acceptable excipients, carriers and vehicles include processing
agents and drug delivery modifiers and enhancers, such as, for
example, calcium phosphate, magnesium stearate, talc,
monosaccharides, disaccharides, starch, gelatin, cellulose, methyl
cellulose, sodium carboxymethyl cellulose, dextrose,
hydroxypropyl-P-cyclodextrin, polyvinylpyrrolidinone, low melting
waxes, ion exchange resins, and the like, as well as combinations
of any two or more thereof. Other suitable pharmaceutically
acceptable excipients are described in "Remington's Pharmaceutical
Sciences," Mack Pub. Co., New Jersey (1991), and "Remington: The
Science and Practice of Pharmacy," Lippincott Williams &
Wilkins, Philadelphia, 20th edition (2003), 21.sup.st edition
(2005) and 22.sup.nd edition (2012), incorporated herein by
reference.
[0118] It is known that many molecules that inhibit CK1 can also
inhibit p38. p38 mitogen-activated protein kinases are a class of
mitogen-activated protein kinases (MAPKs) that are responsive to
stress stimuli, such as cytokines, ultraviolet irradiation, heat
shock, and osmotic shock, and are involved in cell differentiation,
cytokine secretion, apoptosis and autophagy. Persistent activation
of the p38 MAPK pathway in muscle satellite cells (muscle stem
cells) due to ageing is known to impair muscle regeneration. In
preferred embodiments, the CK1 inhibitor is also a p38
inhibitor.
[0119] Due to the homology between p38 and CK1, the invention also
provides p38 inhibitors for use in the treatment of a disease or
condition associated with DUX4 expression, wherein the p38
inhibitor reduces DUX4 expression. This is referred to hereinafter
as a p38 inhibitor for use according to the invention. p38
inhibitors are known in the art. Except for exact molecular
structure, terms and features of use according to the invention are
as defined for the CK1 inhibitors for use according to the
invention.
[0120] Examples of suitable p38 inhibitors are ARRY-797
(CHEMBL1088750, CAS: 1036404-17-7), LOSMAPIMOD (CHEMBL1088752, CAS:
585543-15-3), AZD-7624 (CHEMBL9960, CAS: 1095004-78-6), DORAMAPIMOD
(CHEMBL103667), NEFLAMAPIMOD (CHEMBL119385, CAS: 209410-46-8),
TAK-715 (CHEMBL363648, CAS: 303162-79-0), TALMAPIMOD (CHEMBL514201,
CAS: 309913-83-5), PAMAPIMOD (CHEMBL1090089, CAS: 449811-01-2),
VX-702 (CHEMBL1090090, CAS: 745833-23-2), PH-797804 (CHEMBL1088751,
CAS: 586379-66-0), BMS-582949 (CHEMBL1230065, CAS: 623152-17-0),
PF-03715455 (CHEMBL1938400, CAS: 1056164-52-3), DILMAPIMOD
(CHEMBL2103838, CAS: 444606-18-2), SEMAPIMOD (CHEMBL2107779, CAS:
352513-83-8), RALIMETINIB (CHEMBL2364626, CAS: 862505-00-8), FX-005
(CHEMBL3545216, CAS: 2016822-86-7), ACUMAPIMOD (CHEMBL3545226, CAS:
836683-15-9), KC-706 (CHEMBL3545282, CAS: 896462-15-0), PG-760564
(CHEMBL3545398), RWJ-67657 (CHEMBL190333, CAS: 215303-72-3),
RO-3201195 (CHEMBL203567, CAS: 249937-52-8), AMG-548 (CHEMBL585902,
CAS: 864249-60-5), SD-0006 (CHEMBL1090173), SCIO-323
(CHEMBL1614702, CAS: 309913-51-7), R-1487 (CHEMBL1766582, CAS:
449808-64-4), AZD-6703 (CHEMBL2031465, CAS: 1083381-65-0), SC-80036
(CHEMBL3544930), GSK-610677 (CHEMBL3544968, CAS: 2016840-17-6),
LY-3007113 (CHEMBL3544998), LEO-15520 (CHEMBL3545074), AVE-9940
(CHEMBL3545117, CAS: 1201685-00-8), PS-516895 (CHEMBL3545139),
TA-5493 (CHEMBL3545201, CAS: 1073666-93-9), PEXMETINIB (ARRY614)
(CHEMBL3545297, CAS: 945614-12-0), SB-85635 (CHEMBL3545384), and
CK1 inhibitors.
[0121] Compositions for use according to the invention may be
manufactured by processes well known in the art; e.g., by means of
conventional mixing, dissolving, granulating, dragee-making,
levigating, emulsifying, encapsulating, entrapping or lyophilizing
processes, which may result in liposomal formulations, coacervates,
oil-in-water emulsions, nanoparticulate/microparticulate powders,
or any other shape or form. Compositions for use in accordance with
the invention thus may be formulated in a conventional manner using
one or more physiologically acceptable carriers comprising
excipients and auxiliaries that facilitate processing of the active
compounds into preparations which can be used pharmaceutically.
Proper formulation is dependent on the route of administration
chosen.
[0122] For injection, the CK1 inhibitors and compositions for use
according to the invention may be formulated in aqueous solutions,
preferably in physiologically compatible buffers such as Hanks's
solution, Ringer's solution, or physiological saline buffer. For
transmucosal administration, penetrants appropriate to the barrier
to be permeated are used in the formulation. Such penetrants are
generally known in the art.
[0123] Oral and parenteral administration may be used where the CK1
inhibitors and compositions for use are formulated by combining
them with pharmaceutically acceptable carriers well known in the
art, or by using them as a food additive. Such strategies enable
the CK1 inhibitors and compositions for use according to the
invention to be formulated as tablets, pills, dragees, capsules,
liquids, gels, syrups, slurries, suspensions and the like, for oral
ingestion by a subject to be treated.
[0124] Preparations or pharmacological preparations for oral use
may be made with the use of a solid excipient, optionally grinding
the resulting mixture, and processing the mixture of granules,
after adding suitable auxiliaries, if desired, to obtain tablets or
dragee cores. Suitable excipients are, in particular, fillers such
as sugars, including lactose, sucrose, mannitol, or sorbitol;
cellulose preparations such as, for example, maize starch, wheat
starch, rice starch, potato starch, gelatin, gum tragacanth, methyl
cellulose, hydroxypropylmethyl-cellulose, sodium
carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If
desired, disintegrating agents may be added, such as cross-linked
polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such
as sodium alginate. Additionally, coformulations may be made with
uptake enhancers known in the art.
[0125] Dragee cores are provided with suitable coatings. For this
purpose, concentrated sugar solutions may be used, which may
optionally contain gum arabic, talc, PVP, carbopol gel,
polyethylene glycol, and/or titanium dioxide, lacquer solution, and
suitable organic solvents or solvent mixtures. Polymethacrylates
can be used to provide pH-responsive release profiles so as to pass
the stomach. Dyestuffs or pigments may be added to the tablets or
dragee coatings for identification or to characterize different
combinations of active CK1 inhibitor doses.
[0126] CK1 inhibitors and compositions which can be administered
orally include push-fit capsules made of gelatin, as well as soft,
sealed capsules made of gelatin and a plasticizer, such as glycerol
or sorbitol. The push-fit capsules may contain the active
ingredients in admixture with a filler such as lactose, binders
such as starches, and/or lubricants such as talc or magnesium
stearate and, optionally, stabilizers. In soft capsules, the active
compounds may be dissolved or suspended in suitable liquids, such
as fatty oils, liquid paraffin, or liquid polyethylene glycols. In
addition, stabilizers may be added. All formulations for oral
administration should be in dosages suitable for such
administration.
[0127] For buccal administration, the CK1 inhibitors and
compositions for use according to the invention may be administered
in the form of tablets or lozenges formulated in a conventional
manner.
[0128] The CK1 inhibitors and compositions for use according to the
invention may be formulated for parenteral administration by
injection, e.g., by bolus injection or continuous infusion. In this
way it is also possible to target a particular organ, tissue, tumor
site, site of inflammation, etc. Formulations for infection may be
presented in unit dosage form, e.g., in ampoules or in multi-dose
container, with an added preservative. The compositions may take
such forms as suspensions, solutions or emulsions in oily or
aqueous vehicles, and may contain formulatory agents such as
suspending, stabilizing and/or dispersing agents. This formulation
is preferred because it enables specific targeting of muscle
tissue.
[0129] Compositions for parenteral administration include aqueous
solutions of the compositions in water soluble form. Additionally,
suspensions may be prepared as appropriate oily injection
suspensions. Suitable lipophilic solvents or vehicles include fatty
oils such as sesame oil, or synthetic fatty acid esters, such as
ethyl oleate or triglycerides, or liposomes. Aqueous injection
suspensions may contain substances which increase the viscosity of
the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran. Optionally, the suspension may also contain suitable
stabilizers or agents which increase the solubility of the
compositions to allow for the preparation of highly concentrated
solutions.
[0130] Alternatively, one or more components of the composition may
be in powder form for constitution with a suitable vehicle, e.g.,
sterile pyrogen-free water, before use.
[0131] The compositions for use according to the invention may also
be formulated in rectal compositions such as suppositories or
retention enemas, e.g., containing conventional suppository bases
such as cocoa butter or other glycerides.
[0132] In addition to the formulations described previously, the
CK1 inhibitors and compositions for use according to the invention
may also be formulated as a depot preparation. Such long acting
formulations may be administered by implantation (for example
subcutaneously or intramuscularly) or by intramuscular injection.
Thus, for example, they may be formulated with suitable polymeric
or hydrophobic materials (for example as an emulsion in an
acceptable oil), or as part of a solid or semi-solid implant that
may or may not be auto-degrading in the body, or ion exchange
resins, or one or more components of the composition can be
formulated as sparingly soluble derivatives, for example, as a
sparingly soluble salt. Examples of suitable polymeric materials
are known to the person skilled in the art and include PLGA and
polylactones such as polycaproic acid.
[0133] The compositions for use according to the invention also may
comprise suitable solid or gel phase carriers or excipients.
Examples of such carriers or excipients include but are not limited
to calcium carbonate, calcium phosphate, various sugars, starches,
cellulose derivatives, gelatin, and polymers such as polyethylene
glycols.
[0134] The compositions for use according to the invention may also
be comprised in a transdermal patch. Preferred transdermal patches
for use according to the invention are selected from single-layer
drug-in-adhesive patch, or multi-layer drug-in-adhesive patch, or
reservoir patch, or matrix patch, or vapour patch.
[0135] Compositions for use according to the invention include CK1
inhibitors and compositions wherein the active ingredients are
contained in an amount effective to achieve their intended
purposes. More specifically, a therapeutically effective amount
means an amount of compound effective to prevent, stabilize,
alleviate, revert, or ameliorate causes or symptoms of disease, or
prolong the survival, mobility, or independence of the subject
being treated. Determination of a therapeutically effective amount
is within the capability of those skilled in the art, especially in
light of the detailed disclosure provided herein. For any CK1
inhibitors and compositions used in the invention, the
therapeutically effective amount or dose can be estimated initially
from cell culture assays, for example as exemplified herein. Dosage
may vary within this range depending upon the dosage form employed
and the route of administration utilized. The exact formulation,
route of administration and dosage can be chosen by the individual
physician in view of the patient's condition. (See e.g., Fingl, et
al., 1975, in "The Pharmacological Basis of Therapeutics" Ch. 1 p.
1). The amount of CK1 inhibitors and compositions administered
will, of course, be dependent on the subject being treated, on the
subject's weight, the severity of the affliction, the manner of
administration and the judgment of the prescribing physician.
[0136] A composition for use according to the invention may be
supplied such that a CK1 inhibitor for use according to the
invention and one or more of the other components as defined herein
are in the same container, either in solution, in suspension, or in
powder form. A composition for use according to the invention may
also be provided with all components provided separately from one
another, for example to be mixed with one another prior to
administration, or for separate or sequential administration.
Various packaging options are possible and known to the ones
skilled in the art, depending, among others, on the route and
mechanism of administration. In light of the methods of
administration described above, the invention provides a casein
kinase 1 inhibitor for use according to the invention, or a
composition for use according to the invention, characterized in
that it is administered orally, sublingually, intravascularly,
intravenously, subcutaneously, or transdermally, or optionally by
inhalation; preferably orally.
[0137] An "effective amount" of a CK1 inhibitor or composition is
an amount which, when administered to a subject, is sufficient to
reduce or eliminate either one or more symptoms of a disease, or to
retard the progression of one or more symptoms of a disease, or to
reduce the severity of one or more symptoms of a disease, or to
suppress the manifestation of a disease, or to suppress the
manifestation of adverse symptoms of a disease. An effective amount
can be given in one or more administrations.
[0138] The "effective amount" of that may be combined with the
carrier materials to produce a single dosage form will vary
depending upon the host to which the active ingredient is
administered and the particular mode of administration. The unit
dosage chosen is usually fabricated and administered to provide a
desired final concentration of the compound in the blood.
[0139] The effective amount (i.e. the effective total daily dose),
preferably for adults, is herein defined as a total daily dose of
about 0.01 to 2000 mg, or about 0.01 to 1000 mg, or about 0.01 to
500 mg, or about 5 to 1000 mg, or about 20 to 800 mg, or about 30
to 800 mg or about 30 to 700 mg, or about 20 to 700 mg or about 20
to 600 mg, or about 30 to 600 mg, or about 30 to 500 mg, about 30
to 450 mg or about 30 to 400 mg, or about 30 to 350 mg or about 30
to 300 mg or about 50 to 600 mg, or about 50 to 500 mg, or about 50
to 450 mg, or about 50 to 400 mg or about 50 to 300 mg, or about 50
to 250 mg, or about 100 to 250 mg or about 150 to 250 mg. In the
most preferred embodiment, the effective amount is about 200 mg. In
preferred embodiments, the invention provides a casein kinase 1
inhibitor for use according to the invention, or a composition for
use according to the invention, characterized in that it is
administered to a subject in an amount ranging from 0.1 to 1500
mg/day, preferably from 0.1 to 1000 mg/day, more preferably from
0.1 to 400 mg/day, still more preferably from 0.25 to 150 mg/day,
such as about 100 mg/day.
[0140] Alternatively, the effective amount of the compound,
preferably for adults, preferably is administered per kg body
weight. The total daily dose, preferably for adults, is therefore
about 0.05 to about 40 mg/kg, about 0.1 to about 20 mg/kg, about
0.2 mg/kg to about 15 mg/kg, or about 0.3 mg/kg to about 15 mg/kg
or about 0.4 mg/kg to about 15 mg/kg or about 0.5 mg/kg to about 14
mg/kg or about 0.3 mg/kg to about 14 mg/kg or about 0.3 mg/kg to
about 13 mg/kg or about 0.5 mg/kg to about 13 mg/kg or about 0.5
mg/kg to about 11 mg/kg.
[0141] The total daily dose for children is preferably at most 200
mg. More preferably the total daily dose is about 0.1 to 200 mg,
about 1 to 200 mg, about 5 to 200 mg about 20 to 200 mg about 40 to
200 mg, or about 50 to 200 mg. Preferably, the total daily dose for
children is about 0.1 to 150 mg, about 1 to 150 mg, about 5 to 150
mg about 10 to 150 mg about 40 to 150 mg, or about 50 to 150 mg.
More preferably, the total daily dose is about 5 to 100 mg, about
10 to 100 mg, about 20 to 100 mg about 30 to 100 mg about 40 to 100
mg, or about 50 to 100 mg. Even more preferably, the total daily
dose is about 5 to 75 mg, about 10 to 75 mg, about 20 to 75 mg
about 30 to 75 mg about 40 to 75 mg, or about 50 to 75 mg.
[0142] Alternative examples of dosages which can be used are an
effective amount of the compounds for use according to the
invention within the dosage range of about 0.1 .mu.g/kg to about
300 mg/kg, or within about 1.0 .mu.g/kg to about 40 mg/kg body
weight, or within about 1.0 .mu.g/kg to about 20 mg/kg body weight,
or within about 1.0 .mu.g/kg to about 10 mg/kg body weight, or
within about 10.0 .mu.g/kg to about 10 mg/kg body weight, or within
about 100 .mu.g/kg to about 10 mg/kg body weight, or within about
1.0 mg/kg to about 10 mg/kg body weight, or within about 10 mg/kg
to about 100 mg/kg body weight, or within about 50 mg/kg to about
150 mg/kg body weight, or within about 100 mg/kg to about 200 mg/kg
body weight, or within about 150 mg/kg to about 250 mg/kg body
weight, or within about 200 mg/kg to about 300 mg/kg body weight,
or within about 250 mg/kg to about 300 mg/kg body weight. Other
dosages which can be used are about 0.01 mg/kg body weight, about
0.1 mg/kg body weight, about 1 mg/kg body weight, about 10 mg/kg
body weight, about 20 mg/kg body weight, about 30 mg/kg body
weight, about 40 mg/kg body weight, about 50 mg/kg body weight,
about 75 mg/kg body weight, about 100 mg/kg body weight, about 125
mg/kg body weight, about 150 mg/kg body weight, about 175 mg/kg
body weight, about 200 mg/kg body weight, about 225 mg/kg body
weight, about 250 mg/kg body weight, about 275 mg/kg body weight,
or about 300 mg/kg body weight.
[0143] Compounds or compositions for use according to the present
invention may be administered in a single daily dose, or the total
daily dosage may be administered in divided dosage of two, three or
four times daily.
[0144] In a preferred embodiment of the invention, "subject",
"individual", or "patient" is understood to be an individual
organism, preferably a vertebrate, more preferably a mammal, even
more preferably a primate and most preferably a human.
[0145] In a further preferred embodiment of the invention, the
human is an adult, e.g. a person that is 18 years or older. In
addition, it is herein understood that the average weight of an
adult person is 62 kg, although the average weight is known to vary
between countries. In another embodiment of the invention the
average weight of an adult person is therefore between about 50-90
kg. It is herein understood that the effective dose as defined
herein is not confined to subjects having an average weight.
Preferably, the subject has a BMI (Body Mass Index) between 18.0 to
40.0 kg/m.sup.2, and more preferably a BMI between 18.0 to 30.0
kg/m.sup.2.
[0146] Alternatively, the subject to be treated is a child, e.g. a
person that is 17 years or younger. In addition, the subject to be
treated may be a person between birth and puberty or between
puberty and adulthood. It is herein understood that puberty starts
for females at the age of 10-11 years and for males at the age of
11-12 year. Furthermore, the subject to be treated may be a neonate
(first 28 days after birth), an infant (0-1 year), a toddler (1-3
years), a preschooler (3-5 years); a school-aged child (5-12 years)
or an adolescent (13-18 years).
[0147] To maintain an effective range during treatment, the CK1
inhibitor or composition may be administered once a day, or once
every two, three, four, or five days. However preferably, the
compound may be administered at least once a day. Hence in a
preferred embodiment, the invention pertains to a casein kinase 1
inhibitor for use according to the invention, or a composition for
use according to the invention, characterized in that it is
administered to a subject 4, 3, 2, or 1 times per day or less,
preferably 1 time per day. The total daily dose may be administered
as a single daily dose. Alternatively, the compound is administered
at least twice daily. Hence, the compound as defined herein may be
administered once, twice, three, four or five times a day. As such,
the total daily dose may be divided over the several doses (units)
resulting in the administration of the total daily dose as defined
herein. In a preferred embodiment, the compound is administered
twice daily. It is further understood that the terms "twice daily",
"bid" and "bis in die" can be used interchangeable herein.
[0148] In a preferred embodiment, the total daily dose is divided
over several doses per day. These separate doses may differ in
amount. For example for each total daily dose, the first dose may
have a larger amount of the compound than the second dose or vice
versa. However preferably, the compound is administered in similar
or equal doses. Therefore in a most preferred embodiment, the
compound is administered twice daily in two similar or equal
doses.
[0149] In a further preferred embodiment of the invention, the
total daily dose of the compound as defined herein above is
administered in at least two separate doses. The interval between
the administration of the at least two separate doses is at least
about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 hours,
preferably the interval between the at least two separate doses is
at least about 4, 5, 6, 7, 8, 9, 10, 11 or 12 hours and more
preferably the interval between the at least two separate doses is
at least about 8, 9, 10, 11 or 12 hours.
Use
[0150] In one aspect of the invention, the use is provided of
either a CK1 inhibitor according to the invention, or of a
composition according to the invention. Said use is for the
treatment of a disease or condition associated with DUX4 expression
of a subject in need thereof, and comprises administration to the
subject of an effective dose of a CK1 inhibitor or composition
according to the invention, wherein the CK1 inhibitor or
composition are as defined earlier herein.
[0151] In one embodiment of this aspect, the use is provided of
either a CK1 inhibitor according to the invention, or of a
composition according to the invention. Said use is for the
treatment of muscular dystrophy or cancer in a subject in need
thereof, and comprises administration to the subject of an
effective dose of a CK1 inhibitor or composition according to the
invention, wherein the CK1 inhibitor or composition are as defined
earlier herein. Further features and definitions are preferably as
defined elsewhere herein, particularly for diseases or conditions
to be treated.
Method
[0152] One aspect of the invention provides an in vivo, in vitro,
or ex vivo method for reducing DUX4 expression, the method
comprising the step of contacting a cell with a CK1 inhibitor as
defined earlier herein, or with a composition as defined earlier
herein. Preferably, said method is for treating a disease or
condition associated with DUX4 expression, such as a muscular
dystrophy or cancer, most preferably said disease or condition is
facioscapulohumeral muscular dystrophy (FSHD). The method
preferably comprises use as defined earlier herein. Preferred
methods comprise contacting a cell with a CK1 inhibitor composition
as defined earlier herein. In the context of the invention,
contacting a cell with a CK1 inhibitor or a composition can
comprise adding such a CK1 inhibitor or composition to a medium in
which a cell is cultured. Contacting a cell with a CK1 inhibitor or
a composition can also comprise adding such a CK1 inhibitor or
composition to a medium, buffer, or solution in which a cell is
suspended, or which covers a cell. Other preferred methods of
contacting a cell comprise injecting a cell with a CK1 inhibitor or
composition, or exposing a cell to a material comprising a CK1
inhibitor or composition according to the invention. Further
methods for administration are defined elsewhere herein. Preferred
cells are cells known to express DUX4, cells suspected of
expressing DUX4, or cells known to be affected by a disease or
condition as defined earlier herein.
[0153] In one embodiment of this aspect, the method is an in vitro
method. In a further embodiment of this aspect, the method is an ex
vivo method. In a further embodiment of this aspect, the method is
an in vivo method. In a preferred embodiment of this aspect, the
method is an in vitro or an ex vivo method.
[0154] Within the embodiments of this aspect, the cell may be a
cell from a sample obtained from a subject. Such a sample may be a
sample that has been previously obtained from a subject. Within the
embodiments of this aspect, samples may have been previously
obtained from a human subject. Within the embodiments of this
aspect, samples may have been obtained from a non-human subject. In
a preferred embodiment of this aspect, obtaining the sample is not
part of the method according to the invention.
[0155] In preferred embodiments, the method according to the
invention is a method for reducing DUX4 expression in a subject in
need thereof, the method comprising the step of administering an
effective amount of a CK1 inhibitor as defined earlier herein, or a
composition as defined earlier herein. In more preferred
embodiments, the method is for the treatment of a disease or
condition associated with DUX4 expression, preferably a muscular
dystrophy or cancer, most preferably said disease or condition is
facioscapulohumeral muscular dystrophy (FSHD). Further features and
definitions are preferably as defined elsewhere herein.
General Definitions
[0156] In this document and in its claims, the verb "to comprise"
and its conjugations is used in its non-limiting sense to mean that
items following the word are included, but items not specifically
mentioned are not excluded. In addition the verb "to consist" may
be replaced by "to consist essentially of" meaning that a
combination or a composition as defined herein may comprise
additional component(s) than the ones specifically identified, said
additional component(s) not altering the unique characteristic of
the invention. In addition, reference to an element by the
indefinite article "a" or "an" does not exclude the possibility
that more than one of the element is present, unless the context
clearly requires that there be one and only one of the elements.
The indefinite article "a" or "an" thus usually means "at least
one".
[0157] When a structural formula or chemical name is understood by
the skilled person to have chiral centers, yet no chirality is
indicated, for each chiral center individual reference is made to
all three of either the racemic mixture, the pure R enantiomer, and
the pure S enantiomer.
[0158] Whenever a parameter of a substance is discussed in the
context of this invention, it is assumed that unless otherwise
specified, the parameter is determined, measured, or manifested
under physiological conditions. Physiological conditions are known
to a person skilled in the art, and comprise aqueous solvent
systems, atmospheric pressure, pH-values between 6 and 8, a
temperature ranging from room temperature to about 37.degree. C.
(from about 20.degree. C. to about 40.degree. C.), and a suitable
concentration of buffer salts or other components.
[0159] The use of a substance as a medicament as described in this
document can also be interpreted as the use of said substance in
the manufacture of a medicament. Similarly, whenever a substance is
used for treatment or as a medicament, it can also be used for the
manufacture of a medicament for treatment. Products for use as a
medicament described herein can be used in methods of treatments,
wherein such methods of treatment comprise the administration of
the product for use. CK1 inhibitors or compositions according to
this invention are preferably for use in methods or uses according
to this invention.
[0160] Throughout this application, expression is considered to be
the transcription of a gene into functional mRNA, leading to a
polypeptide such as an enzyme or transcription factor or for
example DUX4 polypeptide. A polypeptide can assert an effect or
have an activity. In this context, increased or decreased
expression of a polypeptide can be considered an increased or
decreased level of mRNA encoding said polypeptide, an increased or
decreased level or amount of polypeptide molecules, or an increased
or decreased total activity of said polypeptide molecules.
Preferably, an increased or decreased expression of a polypeptide
results in an increased or decreased activity of said polypeptide,
respectively, which can be caused by increased or decreased levels
or amounts of polypeptide molecules. More preferably, a reduction
of DUX4 expression is a reduction of transcription of a DUX4 gene,
destabilisation or degradation of DUX4 mRNA, reduction of the
amount of DUX4 polypeptide molecules, reduction of DUX4
polypeptides molecule activity, destabilisation or degradation of
DUX4 polypeptide, or combinations thereof. A destabilized mRNA
leads to lower expression of its encoded polypeptide, possibly it
cannot lead to such expression. A degraded mRNA is destroyed and
cannot lead to expression of its encoded polypeptide. A
destabilized polypeptide asserts less of an effect or has lower
activity than the same polypeptide that has not been destabilized,
possibly it asserts no effect or has no activity. A destabilized
polypeptide can be denatured or misfolded. A degraded polypeptide
is destroyed and does not assert an effect or have an activity.
[0161] In the context of this invention, a decrease or increase of
a parameter to be assessed means a change of at least 5% of the
value corresponding to that parameter. More preferably, a decrease
or increase of the value means a change of at least 10%, even more
preferably at least 20%, at least 30%, at least 40%, at least 50%,
at least 70%, at least 90%, or 100%. In this latter case, it can be
the case that there is no longer a detectable value associated with
the parameter.
[0162] The word "about" or "approximately" when used in association
with a numerical value (e.g. about 10) preferably means that the
value may be the given value (of 10) more or less 1% of the
value.
[0163] Each embodiment as identified herein may be combined
together unless otherwise indicated. The invention has been
described above with reference to a number of embodiments. A
skilled person could envision trivial variations for some elements
of the embodiments. These are included in the scope of protection
as defined in the appended claims. All patent and literature
references cited are hereby incorporated by reference in their
entirety.
SHORT DESCRIPTION OF DRAWINGS
[0164] FIG. 1--(A): Illustration of a DUX4 immunocytochemistry
staining in FSHD myotubes from 2 different donors after 3 days of
differentiation. DUX4-positive nuclei clusters are clearly stained,
while DUX4-negative nuclei are not stained. The histograms show the
intensity of the immunofluorescent signals (increasing intensity on
the X-axis) after staining with the DUX4 and secondary antibody
(top) or the secondary antibody alone (bottom); the arrows on top
show the background signal (leftward arrow) or specific DUX4 signal
(rightward arrow); (B): Illustration of a DUX4-stained FSHD myotube
after 3 days of differentiation. The dotted pattern results from
the applied filter settings to deplete the background from the
secondary antibody control. Note that the threshold settings
prohibit detection of the weaker DUX4 signal in the nuclei more
distant from the sentinel nucleus.
[0165] FIG. 2--Script-based image analysis includes nuclei
identification, myotube identification, detection of nuclei inside
or outside myotube borders (used to calculate fusion index), DUX4
positive nuclei and clusters, myotube area, myotube width, and
myotube skeleton length.
[0166] FIG. 3--Validation of the primary screening assay format in
384-well format. Three independent experiments are shown,
illustrating the assay window obtained using script-based
quantification of the number of DUX4-expressing nuclei in
differentiating primary myotubes after 3 days in differentiation
medium. The assay window is defined by the DUX4 signal and the
background signal of the secondary antibody (representing the
signal in total absence of DUX4).
[0167] FIG. 4--(A): Schematic representation of the screening assay
protocol. Myoblasts were seeded at day -1 and medium was changed to
differentiation medium at day zero. Cells were allowed to
differentiate for 3 days. Compounds were added 15 h prior to
fixation. (B): Correlation of duplicated results from primary
screening of an annotated compound library using 2 different
readouts for DUX4 expression (Number of DUX4-positive nuclei and
DUX4 intensity) and 2 different readouts to monitor potential
toxicity (fusion index, nuclei count). Hit calling thresholds (high
stringency) are indicated by a dashed line, and the upper right
quadrants contain the hit compounds for the different readouts.
Axes of the scatter plots are symmetrical.
[0168] FIG. 5--Concentration-response curves for various CK1
inhibitors for the different readouts. The DUX4 nuclei count, DUX4
intensity, fusion index, and total nucleus count were measured
after 15 hour of compound exposure. (A): results for PF-670462;
(B): results for PF-5006739; (C): results for compound C; (D):
results for compound D; (E): results for compound E; (F): results
for compound F; (G): results for compound G; Structural formulae
are shown in example 5.
[0169] FIG. 6--(A): Schematic representation of the assay protocol.
Myoblasts were seeded at day -1 and medium was changed to
differentiation medium at day zero. Cells were allowed to
differentiate for 3 days. Compounds were added for 15 h or 72 h
prior to fixation. For the 15 h treatment, compounds are
administered when differentiation already progressed significantly.
In case of 72 h treatment, compounds were incubated during the full
differentiation phase. The other panels show concentration-response
curves for a BET inhibitors (B, C) or for beta2 adrenoreceptor
agonists (D, E, F, G, H, I) for the different readouts. DUX4 nuclei
count, DUX4 intensity, fusion index, and total nuclei count were
assessed after 15 h or after 72 h of treatment. (B, C): (+)JQ1; (D,
E): formoterol; (F, G): salbutamol; (H, I): salmeterol; (J):
micrographs of myotubes after 72 hours in differentiation medium
while exposed to the a beta2 adrenoreceptor agonist (formoterol);
(K, L): results for both 15 hour and 72 hour exposure to a CK1
inhibitor (PF-670462).
EXAMPLES
Example 1--Primary FSHD Muscle Cells Express DUX4 in a Small
Fraction of Myonuclei
[0170] The inventors succeeded in establishing a sensitive DUX4
detection method in primary myotubes and used this to build a
high-content assay for quantitative assessment of endogenous DUX4
expression. The method was developed into a validated phenotypic
screening platform for automated detection and quantification of
endogenous DUX4 expression. Mechanisms underlying DUX4 repression
may involve many interacting proteins, favouring such a phenotypic
approach. Furthermore, it is pathway/target independent (and thus
not hypothesis-driven) and provides additional information on cell
toxicity or interference with muscle differentiation.
[0171] Significant differences in the levels of DUX4 expression
between cells obtained from different donors have been reported.
Therefore, muscle cell lines derived from different donors were
thoroughly characterised and an optimal cell line was selected for
primary screening. MyoD staining of myoblasts confirmed solid
myogenicity of all cell lines (Rudnicki et al., 1993; cell
75(7):1351-9). After optimisation of parameters, a DUX4 detection
procedure was established that could be applied in a screening
assay which resulted in the expected DUX4 pattern in FSHD cells,
but not in myotubes from healthy donors. As shown in FIG. 1, this
included a nuclear DUX4 localization, with only few positive cells,
and an intensity gradient through DUX4-positive nuclear clusters,
as also described by Rickard et al., (2015, DOI:
10.1093/hmg/ddv315).
Example 2--Screening Assay to Identify DUX4 Repression
[0172] A quantitative assay readout was developed based on
script-based image analysis. Cells were stained according to
example 1, also using DAPI to detect myonuclei and an antibody
against myosin heavy chain (MHC) to visualize the formation of
myotubes. To analyse the images, an automated script was developed,
enabling the detection of nuclei, myotube borders and DUX4 signals,
with the script also detecting artefacts to reduce false positive
signals. The script enabled multiple validated readouts including
the number of DUX4 positive nuclei and nuclei clusters, the fusion
index, myotube area, myotube width and myotube skeleton length (see
FIG. 2). Additionally, the total nuclei count was included as a
measure of cell loss or compound toxicity. The script was validated
by evaluating endogenous DUX4 expression in the primary myotubes,
and results were in line with literature values, with the number of
DUX4 expressing nuclei being <0.5%.
[0173] The assay has been further matured to make it suitable for
screening purposes. The assay quality was dependent on the donor
cell line. The number of DUX4 positive nuclei was characteristic
for each donor cell line, and was consistent between experiments.
The best performing cell lines in terms of number of DUX4
expressing nuclei, reproducibility and Z-factor have been selected
for miniaturization of the assay to a 384-well format, thus
allowing for automated screening of large compound libraries. A
cell line with 2 D4Z4 repeats was selected for the primary
screening, while a cell line with 6 D4Z4 repeats was selected for
later validation. The primary screening assay had a Z-factor of
0.6, which represents an excellent assay (Zhang et al., 1999,
doi:10.1177/108705719900400206; see FIG. 3).
[0174] A compound library containing approximately 5000 annotated
compounds was screened in the high-content assay. For this purpose,
primary myoblasts were seeded in 384 well plates after which the
growth medium was replaced with differentiation medium. After 3
days of differentiation, cells were treated with library compounds
(in duplicate on different screening plates) for 15 h, after which
they were fixed and stained with antibodies against DUX4,
antibodies against myosin heavy chain (MHC), and with DAPI
(4',6-diamidino-2-phenylindole). Script-based analysis provided
readouts for DUX4 expression (count of DUX4-positive nuclei or DUX4
intensity) and for potential toxicity (fusion index and nuclei
count). Results are shown in FIG. 4. The majority of the
approximately 200 hits was confirmed in an experiment using the
same assay and 5 replicates. These compounds were selected for
further concentration-response profiling.
[0175] Half of these hits were validated using RT-PCR. Based on
mRNA expression of DUX4 and the downstream target genes Trim43
& ZScan4, using housekeeping genes hGUSB, GAPDH, hRPL27 as a
reference, a very good correlation between DUX4 repression in the
immunocytochemistry assay (protein level) and the RT-PCR assay
(mRNA level) was observed. This suggests that the vast majority of
the hits have an upstream mode of action, i.e. they act by
inhibiting the expression of DUX4 (as opposed to accelerating
degradation of DUX4).
[0176] RT-PCR was performed as described by Lemmers et al., (2010,
DOI: 10.1126/science.1189044) using oligonucleotides ordered from
Applied Biosystems (Foster City, USA), possibly as part of assay
kits (for hGAPDH (app): AssayID Hs02758991_g1; for hTRIM43(app):
Assay ID Hs00299174_m1; for hMYH2_tv1-2(app): AssayID
Hs00430042_m1). Other oligonucleotides are shown in table 1.
TABLE-US-00001 TABLE 1 primers and probes for use in PCR Name
Sequence SEQ ID NO: hDUX4 forward CCCGGCTGACGTGCAA 1 hDUX4 reverse
AGCCAGAATTTCACGGAAGAAC 2 hDUX4 probe AGCTCGCTGGCCTCTCTGTGCC 3 hGUSB
forward TTCCCTCCAGCTTCAATGACA 4 hGUSB reverse CCACACCCAGCCGACAA 5
hGUSB probe AGGACTGGCGTCTGCGGCA 6 hRPL27 forward
TGTCCTGGCTGGACGCTACT 7 hRPL27 reverse GAGGTGCCATCATCAATGTTCTT 8
hRPL27 probe CGGACGCAAAGCTGTCATCGT 9 hZSCAN4 forward
AGGCAGGAATTGCAAAGACTTT 10 hZSCAN4 reverse AATTTCATCCTTGCTGTGCTTTT
11 hZSCAN4 probe TAGGATCTTTCACTCATGGCTGC 12 AACCA hMYOG forward
GCTCACGGCTGACCCTACA 13 hMYOG reverse CACTGTGATGCTGTCCACGAT 14 hMYOG
probe CCCACAACCTGCACTCCCTCACCT 15
Example 3--CK1 Inhibitors Act as DUX4 Repressors
[0177] The validated assay was used for screening an annotated
compound library containing approximately 5000 compounds, to
identify novel mechanisms of action for DUX4 repression. This
library contained compounds with annotated pharmacology, not only
entailing the primary pharmacology of the compounds but also
potential known polypharmacology. The primary screening achieved
multiple hits, identifying compounds that reduced the number of
DUX4 positive nuclei. Hits were further profiled by establishing
concentration-response curves. By applying a bioinformatics
approach on the screening and profiling dataset, the inventors
surprisingly discovered that compounds with a CK1 annotation were
significantly enriched in the phenotypically active compound
population, i.e. in the group of compounds inducing a repression of
DUX4. Interestingly, none of the original compounds with a CK1
annotation had CK1 as its primary pharmacological target, each
having other high potency targets from other protein families. Thus
the bioinformatics analysis was essential in identifying the
association between CK1 and DUX4 repression.
[0178] Profiled compounds were annotated as being phenotypically
active when they showed a concentration-dependent effect on DUX4
(inhibition or activation). Of these, compounds which showed
inhibition of the fusion index or of the total number of nuclei by
more than 10% were excluded unless the effect on these readouts was
at least 5-fold less potent than the effect on DUX4. As such, from
the 4790 unique compounds, 188 compounds were classified as being
phenotypically active, 162 of which were DUX4 inhibitors.
[0179] For the phenotypically active compounds, the original target
annotations were complemented with additional information that is
publically available (literature, patent applications, supplier
databases, etc.). All human proteins, and non-human orthologues
where a mapping to the human proteome can be established, were
considered. Each of the 4790 compounds was then evaluated against
these target annotations, classifying the target as being active or
inactive for a given compound. For the phenotypically active
compounds, the annotated targets were classified as being active if
the compound's potency on the target was <10 times the
phenotypic potency, otherwise the target was classified as
inactive. This analysis revealed that approximately 201 targets
were associated with phenotypic activity at a False Discovery Rate
of 0.05. An enrichment of compounds annotated as CK1 inhibitors was
detected in the group of phenotypically active compounds.
Example 4--CK1 Isoforms are Expressed in FSHD Primary Muscle
Cells
[0180] To confirm target expression in both healthy and FSHD muscle
cells, an RNA sequencing approach was followed to determine the
expression of the different CK1 isoforms in primary myotubes from 4
different FSHD donors and from 4 different healthy donors. The
results show expression of all CK1 isoforms, both in FSHD and in
healthy muscle cells. The highest expression is of CK1 .alpha., CK1
.delta. and CK1 .epsilon. (see table 2).
TABLE-US-00002 TABLE 2 expression of casein kinase 1 isoforms in 4
healthy primary cell lines, and in 4 FSHD primary cell lines as
determined by RNA sequencing of differentiated myotubes CSNK1A1
CSNK1D CSNK1E CSNK1G1 CSNK1G2 CSNK1G3 FSHD 134 159.1 160.1 49.9
81.8 37.9 FSHD 122.5 138.4 136.8 4.2 79.1 32.7 FSHD 176.7 170.6
120.5 69.8 65.8 41.3 FSHD 118.2 134 105.6 41.8 63.5 38.1 Healthy
138.9 168.5 188 45.8 75.9 35.8 Healthy 143.3 174.1 200.7 49.6 81.8
36.3 Healthy 139.2 192.8 176.1 51.9 71.4 33.2 Healthy 119.1 132.4
122.4 40.6 65.9 40.1
Example 5--Inhibition of CK1 Represses DUX4
[0181] The DUX4 repression of CK1 inhibitors was assayed following
the protocol of Example 2, illustrated in FIG. 4A. Table 3 shows
the structures of the CK1 inhibitors that are used in FIG. 5.
Compounds were incubated with primary FSHD cells for 15 hours, as
indicated by the arrow in FIG. 4A. Results are shown in FIG. 5,
while table 3 shows half maximal effective concentrations
(EC.sub.50) values. Table 3 also shows determined IC.sub.50 values
in nM for CK1.alpha., CK1.delta., CK1.epsilon., and p38.alpha.,
denoted as CK1 a, d, e, and p38a, respectively.
TABLE-US-00003 TABLE 3 Examplary CK1 inhibitors for use according
to the invention, along with half maximal effective concentrations
(EC.sub.50) ##STR00003## ##STR00004## ##STR00005## ##STR00006##
##STR00007## ##STR00008## ##STR00009## ##STR00010## ##STR00011##
##STR00012## ##STR00013## ##STR00014## ##STR00015## ##STR00016##
##STR00017## ##STR00018## ##STR00019## ##STR00020##
[0182] Several of these compounds were also tested in vivo in a
mouse model. The model was based on human FSHD-affected myoblasts
engrafted onto a mouse thigh muscle. These human FSHD myoblasts
then fused and developed into myotubes, which produce DUX4. This
model approximates natural FSHD biology as much as possible by
using primary FSHD-affected muscle cells. The diseases cells are
engrafted in one thigh, and healthy human myoblasts in the other
thigh, so that each mouse serves as its own control. The compounds
also showed repression of DUX4 in these in vivo models, as
established by RT-PCR and histological examination.
Example 6--CK1 Inhibitors do not Inhibit Myotube Fusion
[0183] Because DUX4 expression increases upon in vitro
differentiation of proliferating FSHD myoblasts into multinucleated
myotubes (Balog et al., 2015 Epigenetics. 2015; 10(12):1133-42),
inhibition of differentiation might lead to a false positive effect
on DUX4 repression.
[0184] Bromo- and Extra-Terminal domain (BET) inhibitors such as
the non-selective inhibitor (+)JQ1 or the BRD4-selective inhibitor
RVX-208 can inhibit the expression of DUX4 in immortalised
differentiated myotube cultures (see US2015087636A1). It was shown
there that when differentiating myotubes were exposed to (+)JQ1 at
the start of the differentiation process, i.e. from the moment when
the growth medium was changed to the differentiation medium, the
expression of myosin heavy chain (MYH2, a differentiation marker)
was decreased, suggesting that the inhibitor also impacted the
differentiation process. Both (+)JQ1 and RVX-208 have been
evaluated in the phenotypic assay described in this application.
Agonists of the beta2 adrenoreceptor have also been reported to
inhibit DUX4 expression in differentiating myotubes (Campbell et
al., 2017). We evaluated the effect of both BET inhibitors and
beta2 adrenoreceptor agonists on the fusion process and compared in
to the effect of a CK1 inhibitor.
[0185] FIG. 6A shows the experimental setup of Example 2. Compounds
are administered either 15 h before fixation, resembling the
original screening protocol, or 72 h before fixation (grey arrow).
In the latter case, compounds are present during the whole
differentiation process. The inventors found that early
administration of the BET inhibitor (+)JQ1 (FIG. 6B, C) and
agonists of the beta2 adrenoreceptor (FIGS. 6D, E, F, G, H, I)
inhibit the fusion process and the differentiation of myoblasts
into myotubes. FIG. 6J shows that no myotube formation can be
observed after treatment with a beta2 adrenoreceptor agonist
(formoterol). This leads to a false positive readout when assessing
the DUX4 signal. The BET inhibitor RVX-208 did not show any effect
on DUX4 expression, irrespective of treatment time (not shown).
While the fusion index did not appear to be affected at the 15 h
timepoint, also with this treatment time the myotube fusion process
was affected by these compounds as determined by RT-PCR showing
inhibition of the expression of the late differentiation marker
myosin heavy chain (Myh; not shown; primers were from hMYH2 kit
described above).
[0186] As illustrated in example 5, inhibition of CK1 inhibits
DUX4. This effect occurs without inhibiting myotube fusion, neither
after 15 h nor after 72 h of compound treatment (FIG. 6K, L).
Example 7--Ck1 Inhibitors Inhibition Profile
[0187] Compounds PF-670462, PF-5006739, Compound E, Compound F,
Compound D, Compound H, Compound A, and SR3029 were assayed for
their inhibition of CK1 .alpha., CK1 .delta., CK1 .epsilon., and of
p38, and their concurrent repression of DUX4. Table 4 shows
inhibitory results.
TABLE-US-00004 TABLE 4 inhibition of CK1 and p38 by CK1 inhibitors,
in nM IC.sub.50 PF- PF- SR- EC.sub.50 670462 5006739 E F D H A 3029
CK1 .alpha. 320 123 592 561 644 33 30 >10k CK1 .delta. 29 20 31
18 33.1 22 19 346 CK1 .epsilon. 100 27 84 72 51.6 16 12 381 p38 32
74 1110 677 569 25 13 >10k DUX4 470 820 1890 2590 1410 10 50 50
(n = 4) (n = 12) (n = 4) (n = 2) (n = 2) (n = 2) (n = 2)
REFERENCES
[0188] Balog et al., 2015 Epigenetics. 2015; 10(12):1133-42;
Bergerat et al., 2017, DOI: 10.1016/j.prp.2016.11.015; Van den
Boogaard et al., 2016, DOI: 10.1016/j.ajhg.2016.03.013;
Brockschmidt et al., 2008, DOI: 10.1136/gut.2007.123695; Campbell
et al., 2017, DOI: 10.1186/s13395-017-0134-x; Chebib and Jo, 2016,
DOI: 10.1002/cncy.21685; Eide E J, Virshup D M, 2001,
DOI:10.1081/CBI-100103963; Etchegaray J P et al., 2009,
DOI:10.1128/MCB.00338-09; Geng et al., 2012, DOI:
10.1016/j.devcel.2011.11.013; Kowaljow et al., 2007, DOI:
10.1016/j.nmd.2007.04.002; Lang et al., 2014, DOI:
10.14205/2310-8703.2014.02.01.1; Lemmers et al., 2010, DOI:
10.1126/science.1189044; Lilljebjorn & Fioretos, 2017, DOI:
10.1182/blood-2017-05-742643; Oyama et al., 2017 DOI:
10.1038/s41598-017-04967-0; Paz et al., 2003, DOI:
10.1093/hmg/ddg226; Rickard et al., 2015, DOI: 10.1093/hmg/ddv315;
Rudnicki et al., 1993; cell 75(7):1351-9; Sharma et al., 2016,
DOI:10.4172/2157-7412.1000303; Snider et al., 2010, DOI:
10.1371/journal.pgen.1001181; Stadler et al., 2013, DOI:
10.1038/nsmb.2571; Tawil et al., 2014, DOI: 10.1186/2044-5040-4-12;
Vanderplanck et al., 2011, doi: 10.1371/journal.pone.0026820;
Wallace et al., 2011, DOI: 10.1002/ana.22275; Yao et al., 2014,
DOI: 10.1093/hmg/ddu251; Yasuda et al., 2016, doi: 10.1038/ng.3535;
Young et al., 2013, doi:10.1371/journal.pgen.1003947; Zhang et al.,
1999, doi:10.1177/108705719900400206; Zhang et al., 2017,
DOI:10.1038/ng.3691
WO2011051858/WO2012085721/WO2015119579/EP2949651/WO2009016286/US2005/0131-
012/WO2015195880/WO2014081923/US20140221313/US2015087636A1
Sequence CWU 1
1
15116DNAArtificial SequencehDUX4 forward Primer for qPCR
1cccggctgac gtgcaa 16222DNAArtificial SequencehDUX4 reverse Primer
for qPCR 2agccagaatt tcacggaaga ac 22322DNAArtificial SequencehDUX4
probe Primer for qPCR 3agctcgctgg cctctctgtg cc 22421DNAArtificial
SequencehGUSB forward Primer for qPCR 4ttccctccag cttcaatgac a
21517DNAArtificial SequencehGUSB reverse Primer for qPCR
5ccacacccag ccgacaa 17619DNAArtificial SequencehGUSB probe Primer
for qPCR 6aggactggcg tctgcggca 19720DNAArtificial SequencehRPL27
forward Primer for qPCR 7tgtcctggct ggacgctact 20823DNAArtificial
SequencehRPL27 reverse Primer for qPCR 8gaggtgccat catcaatgtt ctt
23921DNAArtificial SequencehRPL27 probe Primer for qPCR 9cggacgcaaa
gctgtcatcg t 211022DNAArtificial SequencehZSCAN4 forward Primer for
qPCR 10aggcaggaat tgcaaagact tt 221123DNAArtificial SequencehZSCAN4
reverse Primer for qPCR 11aatttcatcc ttgctgtgct ttt
231228DNAArtificial SequencehZSCAN4 probe Primer for qPCR
12taggatcttt cactcatggc tgcaacca 281319DNAArtificial SequencehMYOG
forward Primer for qPCR 13gctcacggct gaccctaca 191421DNAArtificial
SequencehMYOG reverse Primer for qPCR 14cactgtgatg ctgtccacga t
211524DNAArtificial SequencehMYOG probe Primer for qPCR
15cccacaacct gcactccctc acct 24
* * * * *