U.S. patent application number 17/439344 was filed with the patent office on 2022-07-14 for production of dsrna in plant cells for pest protection via gene silencing.
This patent application is currently assigned to Tropic Biosciences UK Limited. The applicant listed for this patent is Tropic Biosciences UK Limited. Invention is credited to Angela CHAPARRO GARCIA, Yaron GALANTY, Eyal MAORI, Ofir MEIR, Cristina PIGNOCCHI.
Application Number | 20220220494 17/439344 |
Document ID | / |
Family ID | 1000006283319 |
Filed Date | 2022-07-14 |
United States Patent
Application |
20220220494 |
Kind Code |
A1 |
MAORI; Eyal ; et
al. |
July 14, 2022 |
PRODUCTION OF dsRNA IN PLANT CELLS FOR PEST PROTECTION VIA GENE
SILENCING
Abstract
A method of producing a long dsRNA molecule in a plant cell that
is capable of silencing a pest gene is provided, the method
comprising: (a) selecting m a genome of a plant a nucleic acid
sequence encoding a silencing molecule having a plant gene as a
target, the silencing molecule capable of recruiting RNA-dependent
RNA Polymerase (RdRp); and (b) modifying a nucleic acid sequence of
the plant gene so as to impart a silencing specificity towards the
pest gene, such that a transcript of the plant gene comprising the
silencing specificity forms base complementation with said
silencing molecule capable of recruiting said RdRp to produce the
long dsRNA molecule capable of silencing the pest gene, thereby
producing the long dsRNA molecule m the plant cell that is capable
of silencing the pest gene.
Inventors: |
MAORI; Eyal; (Cambridge,
GB) ; GALANTY; Yaron; (Coton, Cambridge, GB) ;
PIGNOCCHI; Cristina; (Hethersett, Norwich, GB) ;
CHAPARRO GARCIA; Angela; (Norwich, GB) ; MEIR;
Ofir; (Norwich, Norfolk, GB) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Tropic Biosciences UK Limited |
Colney, Norwich |
|
GB |
|
|
Assignee: |
Tropic Biosciences UK
Limited
Colney, Norwich
GB
|
Family ID: |
1000006283319 |
Appl. No.: |
17/439344 |
Filed: |
March 14, 2020 |
PCT Filed: |
March 14, 2020 |
PCT NO: |
PCT/IB2020/052245 |
371 Date: |
September 14, 2021 |
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/8283 20130101;
C12N 15/8218 20130101; C12N 9/22 20130101; C12N 15/8285 20130101;
C12N 2310/20 20170501; C12N 15/111 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 15/11 20060101 C12N015/11; C12N 9/22 20060101
C12N009/22 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 14, 2019 |
GB |
1903521.1 |
Claims
1. A method of producing a long dsRNA molecule in a plant cell that
is capable of silencing a pest gene, the method comprising: (a)
selecting in a genome of a plant a nucleic acid sequence encoding a
silencing molecule having a plant gene as a target, said silencing
molecule capable of recruiting RNA-dependent RNA Polymerase (RdRp);
(b) modifying a nucleic acid sequence of the plant gene so as to
impart a silencing specificity towards the pest gene, such that a
transcript of said plant gene comprising said silencing specificity
forms base complementation with said silencing molecule capable of
recruiting said RdRp to produce the long dsRNA molecule capable of
silencing the pest gene, thereby producing the long dsRNA molecule
in the plant cell that is capable of silencing the pest gene.
2. The method of claim 1, wherein said silencing molecule capable
of recruiting said RdRp comprises 21-24 nucleotides.
3. The method of any one of claims 1-2, wherein said silencing
molecule capable of recruiting said RdRp is selected from the group
consisting of: trans-acting siRNA (tasiRNA), phased small
interfering RNA (phasiRNA), microRNA (miRNA), small interfering RNA
(siRNA), short hairpin RNA (shRNA), Piwi-interacting RNA (piRNA),
transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA
(rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA),
repeat-derived RNA, autonomous and non-autonomous transposable
RNA.
4. The method of claim 3, wherein said miRNA comprises a 22
nucleotides mature small RNA,
5. The method of claim 3 or 4, wherein said miRNA is selected from
the group consisting of: miR-156a, miR-156c, miR-162a, miR-162b,
miR-167d, miR-169b, miR-173, miR-393a, miR-393b, miR-402, miR-403,
miR-447a, miR-447b, miR-447c, miR-472, miR-771, miR-777, miR-828,
miR-830, miR-831, miR-833a, miR-833a, miR-845b, miR-848, miR-850,
miR-853, miR-855, miR-856, miR-864, miR-2933a, miR-2933b, miR-2936,
miR-4221, miR-5024, miR-5629, miR-5648, miR-5996, miR-8166,
miR-8167a, miR-8167b, miR-8167c, miR-8167d, miR-8167e, miR-8167f,
miR-8177, and miR-8182.
6. The method of any one of claims 1-5, wherein said plant gene is
a non-protein coding gene.
7. The method of any one of claims 1-6, wherein the plant gene
encodes for a molecule having an intrinsic silencing activity
towards a native plant gene.
8. The method of any one of claims 1-7, wherein said modifying of
step (b) comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of said plant gene
towards said pest gene, said pest gene and a native plant gene
being distinct.
9. The method of claim 7 or 8, wherein said plant gene having said
intrinsic silencing activity is selected from the group consisting
of trans-acting siRNA (tasiRNA), phased small interfering RNA
(phasiRNA), microRNA (miRNA), small interfering RNA (siRNA), short
hairpin RNA (shRNA), Piwi-interacting RNA (piRNA), transfer RNA
(tRNA), small nuclear RNA (snRNA), ribosomal RNA (rRNA), small
nucleolar RNA (snoRNA), extracellular RNA (exRNA), autonomous and
non-autonomous transposable RNA.
10. The method of any one of claims 7-9, wherein said plant gene
having said intrinsic silencing activity encodes for a phased
secondary siRNA-producing molecule.
11. The method of any one of claims 7-9, wherein said plant gene
having said intrinsic silencing activity is a
trans-acting-siRNA-producing (TAS) molecule.
12. The method of any one of claims 1-11, wherein said silencing
specificity of said plant gene is determined by measuring a
transcript level of said pest gene.
13. The method of any one of claims 1-12, wherein said silencing
specificity of said plant gene is determined phenotypically.
14. The method of claim 13, wherein said determined phenotypically
is effected by determination of pest resistance of said plant.
15. The method of any one of claims 1-14, wherein said silencing
specificity of said plant gene is determined genotypically.
16. The method of claim 15, wherein a plant phenotype is determined
prior to a plant genotype.
17. The method of claim 15, wherein a plant genotype is determined
prior to a plant phenotype.
18. A method of producing a long dsRNA molecule in a plant cell
that is capable of silencing a pest gene, the method comprising:
(a) selecting a nucleic acid sequence of a plant gene exhibiting a
predetermined sequence homology to a nucleic acid sequence of the
pest gene; (b) modifying a plant endogenous nucleic acid sequence
encoding an RNA molecule so as to impart silencing specificity
towards said plant gene, such that small RNA molecules capable of
recruiting RNA-dependent RNA Polymerase (RdRp) processed from said
RNA molecule form base complementation with a transcript of said
plant gene to produce the long dsRNA molecule capable of silencing
the pest gene, thereby producing the long dsRNA molecule in the
plant cell that is capable of silencing the pest gene.
19. The method of claim 18, wherein said predetermined sequence
homology comprises 75-100% identity.
20. The method of any one of claims 18-19, wherein said small RNA
molecules capable of recruiting said RdRp comprise 21-24
nucleotides.
21. The method of any one of claims 18-20, wherein said small RNA
molecules capable of recruiting said RdRp are selected from the
group consisting of microRNA (miRNA), small interfering RNA
(siRNA), short hairpin RNA (shRNA), kiwi-interacting RNA (piRN),
trans-acting siRNA (tasiRNA), phased small interfering RNA
(phasiRNA), transfer RNA (tRNA), small nuclear RNA (snRNA),
ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular
RNA (exRNA), repeat-derived RNA, autonomous and non-autonomous
transposable RNA.
22. The method of any one of claims 18-21, wherein said RNA
molecule has an intrinsic silencing activity towards a native plant
gene.
23. The method of any one of claims 18-22, wherein said modifying
of step (b) comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of said RNA molecule
towards said plant gene, said plant gene and a native plant gene
being distinct.
24. The method of any one of claims 18-23, wherein said plant gene
exhibiting said predetermined sequence homology to said nucleic
acid sequence of the pest gene does not encode a silencing
molecule.
25. The method of any one of claims 18-24, wherein said silencing
specificity of said RNA molecule is determined by measuring a
transcript level of said plant gene or said pest gene.
26. The method of any one of claims 18-25, wherein said silencing
specificity of the RNA molecule is determined phenotypically.
27. The method of claim 26, wherein said determined phenotypically
is effected by determination of pest resistance of said plant.
28. The method of any one of claims 18-27, wherein said silencing
specificity of the RNA molecule is determined genotypically.
29. The method of claim 28, wherein a plant phenotype is determined
prior to a plant genotype.
30. The method of claim 28, wherein a plant genotype is determined
prior to a plant phenotype.
31. The method of any one of claim 8-17 or 23-30, wherein said DNA
editing agent comprises at least one sgRNA.
32. The method of any one of claim 8-17 or 23-31, wherein said DNA
editing agent does not comprise an endonuclease.
33. The method of any one of claim 8-17 or 23-31, wherein said DNA
editing agent comprises an endonuclease.
34. The method of any one of claims 8-17 or 23-33, wherein said DNA
editing agent is of a DNA editing system selected from the group
consisting of a meganuclease, a zinc finger nucleases (ZFN), a
transcription-activator like effector nuclease (TALEN),
CRISPR-endonuclease, dCRISPR-endonuclease and a homing
endonuclease.
35. The method of claim 33 or 34, wherein said endonuclease
comprises Cas9.
36. The method of any one of claim 8-17 or 23-35, wherein said DNA
editing agent is applied to the cell as DNA, RNA or RNP.
37. The method of any one of claims 1-36, wherein said plant cell
is a protoplast.
38. The method of any one of claims 1-37, wherein a dsRNA molecule
is processable by cellular RNAi processing machinery.
39. The method of any one of claims 1-38, wherein a dsRNA molecule
is processed into secondary small RNAs.
40. The method of any one of claims 1-39, wherein said dsRNA and/or
said secondary small RNAs comprise a silencing specificity towards
a pest gene.
41. A method of generating a pest tolerant or resistant plant, the
method comprising producing a long dsRNA molecule in a plant cell
capable of silencing a pest gene according to any one of claims
1-40.
42. The method of claim 41, wherein said pest is an
invertebrate.
43. The method of claim 41 or 42, wherein said pest is selected
from the group consisting of a virus, an ant, a termite, a bee, a
wasp, a caterpillar, a cricket, a locust, a beetle, a snail, a
slug, a nematode, a bug, a fly, a fruitfly, a whitefly, a mosquito,
a grasshopper, a planthopper, an earwig, an aphid, a scale, a
thrip, a spider, a mite, a psyllid, a tick, a moth, a worm, a
scorpion and a fungus.
44. A plant generated by the method of any one of claims 1-43.
45. The plant of claim 44, wherein the plant is selected from the
group consisting of a crop, a flower, a weed, and a tree.
46. The plant of claim 44 or 45, wherein said plant is
non-transgenic.
47. A cell of the plant of any one of claims 44-46.
48. A seed of the plant of any one of claims 44-46.
49. A method of producing a pest tolerant or resistant plant, the
method comprising: (a) breeding the plant of any one of claims
44-46; and (b) selecting for progeny plants that express the long
dsRNA molecule capable of suppressing the pest gene, and which do
not comprise said DNA editing agent, thereby producing said pest
tolerant or resistant plant.
50. A method producing a plant or plant cell of any one of claims
44-47 comprising growing the plant or plant cell under conditions
which allow propagation.
Description
RELATED APPLICATION/S
[0001] This application claims the benefit of priority of UK Patent
Application No. 1903521.1 filed on 14 Mar. 2019, the contents of
which are incorporated herein by reference in their entirety.
SEQUENCE LISTING STATEMENT
[0002] The ASCII file, entitled 81321 Sequence Listing.txt, created
on 12 Mar. 2020, comprising 73,728 bytes, submitted concurrently
with the filing of this application is incorporated herein by
reference.
FIELD AND BACKGROUND OF THE INVENTION
[0003] The present invention, in some embodiments thereof, relates
to generation and amplification of dsRNA molecules in a host cell
for silencing pest target genes.
[0004] Recent advances in genome editing techniques have made it
possible to alter DNA sequences in living cells by editing only a
few of the billions of nucleotides in their genome. In the past
decade, the tools and expertise for using genome editing, such as
in human somatic cells and pluripotent cells, have increased to
such an extent that the approach is now being developed widely as a
strategy to treat human disease. The fundamental process depends on
creating a site-specific DNA double-strand break (DSB) in the
genome and then allowing the cell's endogenous DSB repair machinery
to fix the break (such as by non-homologous end-joining (NHEJ) or
homologous recombination (HR) in which the latter can allow precise
one or more nucleotide changes to be made to the DNA sequence using
exogenously provided donor template [Porteus, Annu Rev Pharmacol
Toxicol. (2016) 56:163-90].
[0005] Three primary approaches use mutagenic genome editing (NHEJ)
of cells, such as for potential therapeutics: (a) knocking out
functional genetic elements by creating spatially precise
insertions or deletions, (b) creating insertions or deletions that
compensate for underlying frameshift mutations; hence reactivating
partly- or non-functional genes, and (c) creating defined genetic
deletions. Although several different applications use editing by
NHEJ, the broadest applications of editing will probably harness
genome editing by homologous recombination (HR), although a rare
event it is highly accurate as it relies on an exogenously provided
template to copy the correct sequence during the repair
process.
[0006] Currently the four major types of applications to
HR-mediated genome editing are: (a) gene correction (i.e.
correction of diseases that are caused by point mutations in single
genes), (b) functional gene correction (i.e. correction of diseases
that are caused by point mutations scattered throughout the gene),
(c) safe harbor gene addition (i.e. when precise regulation is not
required or when supra non-physiological levels of a transgene are
desired), and (d) targeted transgene addition (i.e. when precise
regulation is required) [Porteus (2016), supra].
[0007] Previous work on genome editing of RNA molecules in various
eukaryotic organisms (e.g. murine, human, shrimp, plants), focused
on knocking-out miRNA gene activity or changing their binding site
in target RNAs, for example:
[0008] With regard to genome editing in human cells, Jiang et al.
[Jiang et al., RNA Biology (2014) 11 (10): 1243-9] used CRISPR/Cas9
to deplete human miR-93 from a cluster by targeting its 5' region
in HeLa cells. Various small were induced in the targeted region
containing the Drosha processing site (i.e. the position at which
Drosha, a double-stranded RNA-specific RNase III enzyme, binds,
cleaves and thereby processes primary miRNAs (pri-miRNAs) into
pre-miRNA in the nucleus of a host cell) and seed sequences (i.e.
the conserved heptametrical sequences which are essential for the
binding of the miRNA to mRNA, typically situated at positions 2-7
from the miRNA 5'-end). According to Jiang et al. even a single
nucleotide deletion led to complete knockout of the target miRNA
with high specificity.
[0009] With regard to genome editing in murine species, Zhao et al.
[Zhao et al., Scientific Reports (2014) 4:3943] provided a miRNA
inhibition strategy employing the CRISPR-Cas9 system in murine
cells. Zhao used specifically designed sgRNAs to cut the miRNA gene
at a single site by the Cas9 nuclease, resulting in knockout of the
miRNA in these cells.
[0010] With regard to plant genome editing, Bortesi and Fischer
[Bortesi and Fischer, Biotechnology Advances (2015) 33: 41-52]
discussed the use of CRISPR-Cas9 technology in plants as compared
to ZFNs and TALENs, and Basak and Nithin [Basak and Nithin, Front
Plant Sci. (2015) 6: 1001] teach that CRISPR-Cas9 technology has
been applied for knockdown of protein-coding genes in model plants
such as Arabidopsis and tobacco and crops including wheat, maize,
and rice.
[0011] In addition to disruption of miRNA activity or target
binding sites, gene silencing using artificial miRNAs (amiRNAs)
mediated gene silencing of endogenous and exogenous target genes
has been achieved [Tiwari et al. Plant Mol Biol (2014) 86: 1].
Similar to miRNAs, amiRNAs are single-stranded, approximately 21
nucleotides (nt) long, and designed by replacing the mature miRNA
sequences of the duplex within pre-miRNAs [Tiwari et al. (2014)
supra]. These amiRNAs are introduced as a transgene within an
artificial expression cassette (including a promoter, terminator
etc.) [Carbonell et al., Plant Physiology (2014) pp.113.234989],
are processed via small RNA biogenesis and silencing machinery and
downregulate target expression. According to Schwab et al, [Schwab
et al, The Plant Cell (2006) Vol. 18, 1121-1133], amiRNAs are
active when expressed under tissue-specific or inducible promoters
and can be used for specific gene silencing in plants, especially
when several related, but not identical, target genes need to be
downregulated.
[0012] Senis et al. [Senis et al., Nucleic Acids Research (2017)
Vol. 45(1): e3] disclose engineering of a promoterless anti-viral
RNAi hairpin into an endogenous miRNA locus. Specifically, Senis et
al, insert an amiRNA precursor transgene (hairpin pri-amiRNA)
adjacent to a naturally occurring miRNA gene (e.g. miR122) by
homology-directed DNA recombination that is induced by
sequence-specific nuclease such as Cas9 or TALEN nucleases. This
approach uses promoter- and terminator-free amiRNAs by utilizing
transcriptionally active DNA locus that expresses a natural miRNA
(miR122), that is, the endogenous promoter and terminator drove and
regulated the transcription of the inserted amiRNA transgene.
[0013] Various DNA-free methods of introducing RNA and/or proteins
into cells have been previously described. For example, RNA
transfection using electroporation and lipofection has been
described in U.S. Patent Application No. 20160289675. Direct
delivery of Cas9/sgRNA ribonucleoprotein (RNPs) complexes to cells
by microinjection of the Cas9 protein and sgRNA complexes was
described by Cho [Cho et al., "Heritable gene knockout in
Caenorhabditis elegans by direct injection of Cas9-sgRNA
ribonucleoproteins," Genetics (2013) 195:1177-1180]. Delivery of
Cas9 protein/sgRNA complexes via electroporation was described by
Kim [Kim et al., "Highly efficient RNA-guided genome editing in
human cells via delivery of purified Cas9 ribonucleoproteins"
Genome Res. (2014) 24:1012-1019]. Delivery of Cas9
protein-associated sgRNA complexes via liposomes was reported by
Zuris [Zuris et al., "Cationic lipid-mediated delivery of proteins
enables efficient protein-based genome editing in vitro and in
vivo" Nat Biotechnol. (2014) doi: 10. 1038/nbt.3081].
SUMMARY OF THE INVENTION
[0014] According to an aspect of some embodiments of the present
invention there is provided a method of producing a long dsRNA.
molecule in a plant cell that is capable of silencing a pest gene,
the method comprising: (a) selecting in a genome of a plant a
nucleic acid sequence encoding a silencing molecule having a plant
gene as a target, the silencing molecule capable of recruiting
RNA-dependent RNA Polymerase (RdRp); and (b) modifying a nucleic
acid sequence of the plant gene so as to impart a silencing
specificity towards the pest gene, such that a transcript of the
plant gene comprising the silencing specificity forms base
complementation with the silencing molecule capable of recruiting
the RdRp to produce the long dsRNA molecule capable of silencing
the pest gene, thereby producing the long dsRNA molecule in the
plant cell that is capable of silencing the pest gene.
[0015] According to an aspect of some embodiments of the present
invention there is provided a method of producing a long dsRNA
molecule in a plant cell that is capable of silencing a pest gene
in a plant cell, the method comprising: (a) selecting in a genome
of a plant a nucleic acid sequence encoding a silencing molecule
having a plant gene as a target, the silencing molecule capable of
recruiting RNA-dependent RNA Polymerase (RdRp); (b) modifying a
nucleic acid sequence of the plant gene so as to impart a silencing
specificity towards the pest gene, such that a transcript of the
plant gene comprising the silencing specificity forms base
complementation with the silencing molecule capable of recruiting
the RdRp to produce the long dsRNA molecule capable of silencing
the pest gene, thereby producing the long dsRNA molecule in the
plant cell that is capable of silencing the pest gene in the plant
cell.
[0016] According to an aspect of some embodiments of the present
invention there is provided a method of producing a long dsRNA
molecule in a plant cell that is capable of silencing a pest gene,
the method comprising: (a) selecting a nucleic acid sequence of a
plant gene exhibiting a predetermined sequence homology to a
nucleic acid sequence of the pest gene; (b) modifying a plant
endogenous nucleic acid sequence encoding an RNA molecule so as to
impart silencing specificity towards the plant gene, such that
small RNA molecules capable of recruiting RNA-dependent RNA
Polymerase (RdRp) processed from the RNA molecule form base
complementation with a transcript of the plant gene to produce the
long dsRNA molecule capable of silencing the pest gene, thereby
producing the long dsRNA molecule in the plant cell that is capable
of silencing the pest gene.
[0017] According to an aspect of some embodiments of the present
invention there is provided a method of generating a pest tolerant
or resistant plant, the method comprising producing a long dsRNA
molecule in a plant cell capable of silencing a pest gene according
to some embodiments of the invention.
[0018] According to an aspect of some embodiments of the present
invention there is provided a plant generated by the method of some
embodiments of the invention.
[0019] According to an aspect of some embodiments of the present
invention there is provided a cell of the plant of some embodiments
of the invention.
[0020] According to an aspect of some embodiments of the present
invention there is provided a seed of the plant of some embodiments
of the invention.
[0021] According to an aspect of some embodiments of the present
invention there is provided a method of producing a pest tolerant
or resistant plant, the method comprising: (a) breeding the plant
of some embodiments of the invention; and (b) selecting for progeny
plants that express the long dsRNA molecule capable of suppressing
the pest gene, and which do not comprise the DNA editing agent,
thereby producing the pest tolerant or resistant plant.
[0022] According to an aspect of some embodiments of the present
invention there is provided a method producing a plant or plant
cell of some embodiments of the invention comprising growing the
plant or plant cell under conditions which allow propagation.
[0023] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 21-24
nucleotides.
[0024] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 21
nucleotides.
[0025] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 22
nucleotides.
[0026] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 23
nucleotides.
[0027] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 24
nucleotides.
[0028] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp consists of 21
nucleotides.
[0029] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp consists of 22
nucleotides.
[0030] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp consists of 2.3
nucleotides.
[0031] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp consists of 24
nucleotides.
[0032] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp is selected from
the group consisting of: trans-acting siRNA (tasiRNA), phased small
interfering RNA (phasiRNA), microRNA (miRNA), small interfering RNA
(siRNA), short hairpin RNA (shRNA), Piwi-interacting RNA (piRNA),
transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA
(rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA),
repeat-derived RNA, autonomous and non-autonomous transposable
RNA.
[0033] According to some embodiments of the invention, the miRNA
comprises a 22 nucleotides mature small RNA.
[0034] According to some embodiments of the invention, the miRNA is
selected from the group consisting of: miR-156a, miR-156c,
miR-162a, miR-162b, miR-167d, miR-169b, miR-173, miR-393a,
miR-393b, miR-402, miR-447a, miR-447b, miR-447c, miR-472, miR-771,
miR-777, miR-828, miR-830, miR-831, miR-831, miR-833a, miR-833a,
miR-840, miR-845b, miR-848, miR-850, miR-853, miR-855, miR-856,
miR-864, miR-2933a, miR-2933b, miR-2936, miR-4221, miR-5024,
miR-5629, miR-5648, miR-5996, miR-8166, miR-8167a, miR-8167b,
miR-8167c, miR-8167d, miR-8167e, miR-8167f, miR-8177 and
miR-8182.
[0035] According to some embodiments of the invention, the plant
gene is a non-protein coding gene.
[0036] According to some embodiments of the invention, the plant
gene is a coding gene.
[0037] According to some embodiments of the invention, the plant
gene does not encode for a molecule having an intrinsic silencing
activity.
[0038] According to some embodiments of the invention, the method
further comprises introducing into the plant cell a DNA editing
agent conferring a silencing specificity of the plant gene towards
the pest gene.
[0039] According to some embodiments of the invention, modifying of
step (b) comprises introducing into the plant cell a DNA editing
agent conferring the silencing specificity of the plant gene
towards the pest gene.
[0040] According to some embodiments of the invention, the plant
gene encodes for a molecule having an intrinsic silencing activity
towards a native plant gene.
[0041] According to some embodiments of the invention, the method
further comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of the plant gene
towards the pest gene, the pest gene and the native plant gene
being distinct.
[0042] According to some embodiments of the invention, the method
further comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of the plant gene
towards the pest gene, the pest gene and a native plant gene being
distinct.
[0043] According to some embodiments of the invention, modifying of
step (b) comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of the plant gene
towards the pest gene, the pest gene and a native plant gene being
distinct.
[0044] According to some embodiments of the invention, the plant
gene having the intrinsic silencing activity is selected from the
group consisting of trans-acting siRNA (tasiRNA), phased small
interfering RNA (phasiRNA), microRNA (miRNA), small interfering RNA
(siRNA), short hairpin RNA (shRNA), Piwi-interacting RNA (piRNA),
transfer RNA (tRNA), small nuclear RNA (snRNA), ribosomal RNA
(rRNA), small nucleolar RNA (snoRNA), extracellular RNA (exRNA),
autonomous and non-autonomous transposable RNA.
[0045] According to some embodiments of the invention, the plant
gene having the intrinsic silencing activity encodes for a phased
secondary siRNA-producing molecule.
[0046] According to some embodiments of the invention, the plant
gene having the intrinsic silencing activity is a
trans-acting-snRNA-producing (TAS) molecule.
[0047] According to some embodiments of the invention, the
silencing specificity of the plant gene is determined by measuring
a transcript level of the pest gene.
[0048] According to some embodiments of the invention, the
silencing specificity of the plant gene is determined
phenotypically.
[0049] According to some embodiments of the invention, determined
phenotypically is effected by determination of pest resistance of
the plant.
[0050] According to some embodiments of the invention, the
silencing specificity of the plant gene is determined
genotypically.
[0051] According to some embodiments of the invention, the plant
phenotype is determined prior to a plant genotype.
[0052] According to some embodiments of the invention, the plant
genotype is determined prior to a plant phenotype.
[0053] According to some embodiments of the invention, the
silencing specificity of the plant gene is determined by measuring
a transcript level of the pest gene.
[0054] According to some embodiments of the invention, the
determined phenotypically is effected by determination of pest
resistance of the plant.
[0055] According to some embodiments of the invention, the
predetermined sequence homology comprises 75-100% identity.
[0056] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp comprise 21-24
nucleotides.
[0057] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp comprise 21
nucleotides.
[0058] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp comprise 22
nucleotides.
[0059] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp comprise 23
nucleotides.
[0060] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp comprise 24
nucleotides.
[0061] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp consist of 21
nucleotides.
[0062] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp consist of 22
nucleotides.
[0063] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp consist of 23
nucleotides.
[0064] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp consist of 24
nucleotides.
[0065] According to some embodiments of the invention, the small
RNA molecules capable of recruiting the RdRp are selected from the
group consisting of microRNA (miRNA), small interfering RNA
(siRNA), short hairpin RNA (shRNA), Piwi-interacting RNA (piRNA),
transacting siRNA (tasiRNA), phased small interfering RNA
(phasiRNA), transfer RNA (tRNA), small nuclear RNA (snRNA),
ribosomal RNA (rRNA), small nucleolar RNA (snoRNA), extracellular
RNA (exRNA), repeat-derived RNA, autonomous and non-autonomous
transposable RNA.
[0066] According to some embodiments of the invention, the RNA
molecule does not have an intrinsic silencing activity.
[0067] According to some embodiments of the invention, the method
further comprises introducing into the plant cell a DNA editing
agent conferring a silencing specificity of the RNA molecule
towards the plant gene.
[0068] According to some embodiments of the invention, the RNA
molecule has an intrinsic silencing activity towards a native plant
gene.
[0069] According to some embodiments of the invention, the method
further comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of the RNA molecule
towards the plant gene, the plant gene and the native plant gene
being distinct.
[0070] According to some embodiments of the invention, modifying of
step (b) comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of the RNA molecule
towards the plant gene, the plant gene and a native plant gene
being distinct.
[0071] According to some embodiments of the invention, the plant
gene exhibiting the predetermined sequence homology to the nucleic
acid sequence of the pest gene does not encode a silencing
molecule.
[0072] According to some embodiments of the invention, the
silencing specificity of the RNA molecule is determined by
measuring a transcript level of the plant gene or the pest
gene.
[0073] According to some embodiments of the invention, the
silencing specificity of the RNA molecule is determined
phenotypically.
[0074] According to some embodiments of the invention, the
determined phenotypically is effected by determination of pest
resistance of the plant.
[0075] According to some embodiments of the invention, the
silencing specificity of the RNA molecule is determined
genotypically.
[0076] According to some embodiments of the invention, the plant
phenotype is determined prior to a plant genotype.
[0077] According to some embodiments of the invention, the plant
genotype is determined prior to a plant phenotype.
[0078] According to some embodiments of the invention, the DNA
editing agent comprises at least one sgRNA.
[0079] According to some embodiments of the invention, the DNA
editing agent comprises at least one sgRNA operatively linked to a
plant expressible promoter.
[0080] According to some embodiments of the invention, the DNA
editing agent does not comprise an endonuclease.
[0081] According to some embodiments of the invention, the DNA
editing agent comprises an endonuclease.
[0082] According to some embodiments of the invention, the DNA
editing agent is of a DNA editing system selected from the group
consisting of a meganuclease, a zinc finger nucleases (ZFN), a
transcription-activator like effector nuclease (TALEN),
CRISPR-endonuclease, dCRISPR-endonuclease and a homing
endonuclease.
[0083] According to some embodiments of the invention, the
endonuclease comprises Cas9.
[0084] According to some embodiments of the invention, the DNA
editing agent is applied to the cell as DNA, RNA or RNP.
[0085] According to some embodiments of the invention, the DNA
editing agent is linked to a reporter for monitoring expression in
a plant cell.
[0086] According to some embodiments of the invention, the reporter
is a fluorescent protein.
[0087] According to some embodiments of the invention, the plant
cell is a protoplast.
[0088] According to some embodiments of the invention, the dsRNA
molecule is processable by cellular RNAi processing machinery.
[0089] According to some embodiments of the invention, the dsRNA
molecule is processed into secondary small RNAs.
[0090] According to some embodiments of the invention, the dsRNA
and/or the secondary small RNAs comprise a silencing specificity
towards a pest gene.
[0091] According to some embodiments of the invention, the pest is
an invertebrate.
[0092] According to some embodiments of the invention, the pest is
selected from the group consisting of a virus, an ant, a termite, a
bee, a wasp, a caterpillar, a cricket, a locust, a beetle, a snail,
a slug, a nematode, a bug, a fly, a fruitfly, a whitefly, a
mosquito, a grasshopper, a planthopper, an earwig, an aphid, a
scale, a thrip, a spider, a mite, a psyllid, a tick, a moth, a
worm, a scorpion and a fungus.
[0093] According to some embodiments of the invention, the plant is
selected from the group consisting of a crop, a flower, a weed, and
a tree.
[0094] According to some embodiments of the invention, the plant is
non-transgenic.
[0095] According to some embodiments of the invention, the plant is
a transgenic plant.
[0096] According to some embodiments of the invention, the plant is
non-genetically modified (non-GMO).
[0097] According to some embodiments of the invention, the plant is
genetically modified (GMO).
[0098] Unless otherwise defined, all technical and/or scientific
terms used herein have the same meaning as commonly understood by
one of ordinary skill in the art to which the invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of
embodiments of the invention, exemplary methods and/or materials
are described below. In case of conflict, the patent specification,
including definitions, will control. In addition, the materials,
methods, and examples are illustrative only and are not intended to
be necessarily limiting.
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
[0099] Some embodiments of the invention are herein described, by
way of example only, with reference to the accompanying drawings.
With specific reference now to the drawings in detail, it is
stressed that the particulars shown are by way of example and for
purposes of illustrative discussion of embodiments of the
invention. In this regard, the description taken with the drawings
makes apparent to those skilled in the art how embodiments of the
invention may be practiced.
[0100] In the drawings:
[0101] FIG. 1 is a is a photograph illustrating the first proposed
model (referred to as Model 1) for target gene amplification by
Gene Editing induced Gene Silencing (GEiGS). According to this
model (see the corresponding numbers in the figures):
[0102] 1. The pest gene "X" is the target gene (when silenced, the
pest is controlled)
[0103] 2. A host-related gene-X is identified by homology search
(plant gene "X")
[0104] 3. GEiGS is performed to redirect the silencing specificity
of an amplifier small RNA (e.g. 22nt miRNAs) against the plant gene
"X".
[0105] 4. The amplifier small GEiGS RNA forms a RISC complex that
is associated with RdRp (the amplifying enzyme)
[0106] 5. The RdRp synthesizes a complementary antisense RNA strand
to the transcript of plant gene "X", forming dsRNA.
[0107] 6. The plant gene "X" dsRNA is processed into secondary
sRNAs by dicer(s) or dicer-like proteins.
[0108] 7. The plant gene "X" dsRNA is taken up by pests. Within the
pest, the plant dsRNA-X is processed into small RNAs that
down-regulate via RNAi the corresponding homologous pest gene
"X".
[0109] 8. Possibly, secondary sRNAs are taken up by pests, and
silence the target gene "X"
[0110] FIG. 2 is a photograph illustrating the second proposed
model (referred to as Model 2) for target gene amplification by
GEiGS. According to this model (see the corresponding numbers in
the figures):
[0111] 1. The pest gene "X" is the target gene (when silenced, the
pest is controlled)
[0112] 2. GEiGS is performed to redirect the silencing specificity
of naturally occurring amplified RNAi precursor against the pest
gene "X" (e.g. TAS; amplified and processed into tasiRNAs)
[0113] 3. A wild type amplifier sRNA forms a RISC complex that is
associated with RdRp (the amplifying enzyme)
[0114] 4. The RdRp synthesizes a complementary antisense RNA strand
to the transcript of the amplified GEiGS precursor, forming
dsRNA
[0115] 5. The amplified GEiGS dsRNA is processed into secondary
sRNAs by dicer(s)
[0116] 6. The GEiGS dsRNA is taken up by pests. Within the pest,
the plant GEiGS-dsRNA is processed into small RNAs that
down-regulate via RNAi the corresponding homologous pest gene
"X"
[0117] 7. Possibly, secondary sRNAs derived from the GEiGS-dsRNA
(e.g. tasiRNAs in the case of TAS precursor) are taken up as well
by the pest, and silence the target gene "X"
[0118] FIG. 3A illustrates identification of endogenous genes in
the plant with regions homologous to the pest sequence (per model
1). Specifically, blast alignment of AF502391.1 (H. glycines, SEQ
ID NO: 1) pest against NM_001037071.1 (A. thaliana, SEQ ID NO: 2)
plant gene.
[0119] FIG. 3B illustrates miRNA based GEiGS oligo designed
carrying siRNA sequences targeting a region downstream of the
region of homology in the plant (described in FIG. 3A). Top: GEiGS
oligo, SEQ ID NO: 3 (siRNA in red). Bottom: plant target gene
carrying homology to pest (SEQ ID NO: 4). Homologous pest sequence
in green (SEQ ID NO: 1). The sequence predicted to be targeted by
the GEiGS-siRNA is in red.
[0120] FIG. 4A illustrates identification of endogenous genes in
the plant with regions homologous to the pest sequence (per model
1). Specifically, blast alignment of AF500024.1 (H. glycines, SEQ
ID NO: 5) pest against NM_116351.7 (A. thaliana, SEQ ID NO: 6)
plant gene.
[0121] FIG. 4B illustrates miRNA based GEiGS oligo designed
carrying siRNA sequences targeting a region downstream of the
region of homology in the plant (described in FIG. 4A). Top: GEiGS
oligo, SEQ ID NO: 7 (siRNA in red). Bottom: target gene carrying
homology to pest (SEQ ID NO: 8). Homologous pest sequence in green
(SEQ ID NO: 5). The sequence predicted to be targeted by the
GEiGS-siRNA is in red.
[0122] FIG. 5A illustrates identification of endogenous genes in
the plant with regions homologous to the pest sequence (per model
1). Specifically, blast alignment of AF469060.1 (H. glycines, SEQ
ID NO: 9) pest against NM_001203752.2 (A. thaliana, SEQ ID NO: 10)
plant gene.
[0123] FIG. 5B illustrates miRNA based GEiGS oligo designed
carrying siRNA sequences targeting a region downstream of the
region of homology in the plant (described in FIG. 5A). Top: GEiGS
oligo, SEQ II) NO: 11 (siRNA in red). Bottom: target gene carrying
homology to pest (SEQ ID NO: 12). Homologous pest sequence in green
(SEQ ID NO: 9). The sequence predicted to be targeted by the
GEiGS-siRNA is in red.
[0124] FIG. 6 is an embodiment flow chart of computational pipeline
to generate GEiGS templates. The computational GeiGS pipeline
applies biological metadata and enables an automatic generation of
GeiGS DNA donor templates that are used to minimally edit
endogenous non-coding RNA genes (e.g. miRNA genes), leading to a
new gain of function, i.e. redirection of their silencing capacity
to target gene expression of interest.
[0125] FIG. 7 is an embodiment flow chart of Genome Editing induced
Gene Silencing (GEiGS) replacement of endogenous miRNA with siRNA
targeting the PDS gene, hence inducing gene silencing of the
endogenous PDS gene. To introduce the modification, a 2-component
system is being used. First, a CRISPR/CAS9 system, in a GIP
containing vector, generates a cleavage in the chosen loci, through
designed specific guide RNAs to promote homologous DNA repair (HDR)
in the site. Second, A DONOR sequence, with the desired
modification of the miRNA sequence, to target the newly assigned
genes, is introduced as a template for the HDR. This system is
being used in protoplast transformation, enriched by FACS due to
the GIP signal in the CRISPR/CAS9 vector, recovered, and
regenerated to plants.
[0126] FIGS. 8A-C are photographs illustrating that silencing of
the PDS gene causes photobleaching. Silencing of the PDS gene in
Nicotiana (FIGS. 8A-B) and Arahidopsis (FIG. 8C) plants causes
photobleaching in N. benthamiana (FIG. 8B) and Arahidopsis (FIG.
8C, right side). Photographs were taken 31/2 weeks after PDS
silencing.
[0127] FIG. 9A depicts a schematic representation of an example of
HDR-mediated genomic swaps in Col-0 cells and primers used for PCR
and genotyping of such swaps. The CRISPR/Cas9 and sgRNA targeted
the swap region, generating a dsDNA break. The DONOR templates
carried homologous arms for insertion by homology directed repair
(HDR) into that genomic locus (AtTAS1b or AtTAS3a), introducing the
desired swaps. Swap region: sequence that was modified to target
nematode genes. Short arrows represent the swap-specific or
wt-specific forward primer and unspecific reverse primer, common
for all reactions, used for PCR to demonstrate genomic swaps. The
reverse primer was designed to anneal further downstream the
recombination site, to avoid amplification of the DONOR template.
Swap-specific forward primers were designed in such a way that they
only allowed amplification if a swap took place. An additional
forward primer was designed for control PCR amplification on
wild-type (WT) sequence only. The dotted line represents the PCR
product. The oval indicates the reverse primer used for Sanger
sequencing reactions.
[0128] FIGS. 9B-C depict micrographs of electrophoresis of PCR
products generated with WT primers. The unspecific reverse primer
and a WT specific primer were used for PCR on DNA extracted from
all treatments described in Example 3. PCR products were run on
1.6% agarose gels. Small arrows and numbers indicate bands and
sizes for the expected PCR products. (FIG. 9B) represents PCR
reactions for AtTAS1b loci and (FIG. 9C) represents reactions for
AtTAS3a loci. Y25: Y25, beta subunit of COPI complex; Splicing:
Splicing factor; Ribo3a: Ribosomal protein 3a; Spliceo:
Spliceosomal SR protein; WT: wild-type. H.sub.2O: no template,
water negative PCR controls. MW: 1 kb plus molecular weight ladder
(NEB).
[0129] FIGS. 9D-E depict micrographs of electrophoresis of PCR
products generated with swap specific primers. The unspecific
reverse primer and a swap specific forward primer were used for PCR
on DNA extracted from all swap treatments in Example 3. As a
control for the specificity of the reaction WT DNA was also used as
template. PCR products were run on 1.6% agarose gels. Small arrows
and numbers indicate bands and sizes for the expected PCR products.
(FIG. 9D) represents PCR reactions for swaps at AtTAS1b (Tas1b)
loci and (FIG. 9E) represents reactions for swaps at AtTAS3a
(Tas3a) loci. Y25: Y25, beta subunit of COPT complex; Splicing:
Splicing factor; Ribo3a: Ribosomal protein 3a; Spliceo:
Spliceosomal SR protein; WT: wild-type. H.sub.2O: no template,
water negative PCR controls. MW: 1 kb plus molecular weight ladder
(NEB).
[0130] FIGS. 9F-G depict a scheme of a Sanger sequencing reaction
of PCR products. The unspecific reverse primer from FIG. 9A was
used for Sanger sequencing of each PCR product. Arrows represents
the specific forward primers used for PCR. amplification.
Additional nucleotide changes introduced following HDR event (not
originating from the primer used in the reaction) are displayed
highlighted and greyed out. Chromatograms show the sequences for
the PCR products, which were aligned against the predicted
sequences (upper line). (FIG. 9F) represents sequencing reactions
for swaps at AtTAS1b (Tas1b) loci and (FIG. 9G) represents
reactions for swaps at AtTAS3a (Tas3a) loci. Y25: Y25, beta subunit
of COPT complex; Splicing: Splicing factor; Ribo3a: Ribosomal
protein 3a; Spliceo: Spliceosomal SR protein; WT: wild-type.
[0131] FIGS. 10A-B depict schematic representations of a Sense
(FIG. 10A) and Anti-sense (FIG. 10B) strand of dsRNA generated
through HDR-mediated genomic swaps in Col-0 cells. Swap region:
sequence that was modified to target nematode genes. Short arrows
represent the unspecific primers used for reverse transcription PCR
(RT-PCR) and for cDNA generation. Additional short arrows represent
the swap-specific primer and unspecific primer, common for all
reactions, used for PCR (PCR) on cDNA to prove swap expression. PCR
reactions were designed in such a way that the length for all PCR
products was lower than 200 nucleotides. Specific primers were
designed in such a way that they only allowed amplification if a
swap took place. The dotted lines represent the expected PCR
products. The oval indicates the primers used for Sanger sequencing
reactions. Direction is indicated for transcripts from 5' to
3'.
[0132] FIGS. 10C-D depict micrographs of electrophoresis of PCR
products to examine expression of AtTAS1b Sense and Anti-sense RNA
strands to detect dsRNA containing swaps. RT-PCR reactions were
carried out to generate cDNA and subsequent PCR reactions were
carried out using the primers described in FIGS. 10A-B. PCR
products were run on 1.6% agarose gels. Small arrows and numbers
indicate bands and sizes for the expected PCR products. (FIG. 10C)
represents PCR reactions for AtTAS1b Sense RNA transcript and (FIG.
10D) represents PCR reactions for AtTAS1b Anti-sense RNA
transcripts. Y25: Y25, beta subunit of COPI complex; WT: wild-type;
H.sub.2O: no template, water negative PCR controls; MW: 1 kb plus
molecular weight ladder (NEB), +RT: PCR reactions using cDNA
amplified by reverse transcriptase as template. -RT: reverse
transcription controls--No reverse transcriptase was used and no
cDNA was generated.
[0133] FIGS. 10E-F depict micrographs of electrophoresis of PCR
products to examine expression of AtTAS3a Sense and Anti-sense RNA
strands to detect dsRNA containing swaps. RT-PCR reactions were
carried out to generate cDNA and subsequent PCR reactions were
carried out using the primers described in FIGS. 10A-B. PCR
products were run on 1.6% agarose gels. Small arrows and numbers
indicate bands and sizes for the expected PCR products. (FIG. 10E)
represents PCR reactions for AtTAS3a Sense RNA transcript and (FIG.
10F) represents PCR reactions for AtTAS3a Anti-sense RNA
transcripts. Ribo3a: Ribosomal protein 3a; WT: wild-type. H.sub.2O:
no template, water negative PCR controls. MW: 1 kb plus molecular
weight ladder (NEB). +RT: PCR reactions using cDNA, amplified by
reverse transcriptase, as template. -RT: reverse transcription
controls--No reverse transcriptase was used and no cDNA was
generated.
[0134] FIG. 10G depicts a scheme of a Sanger sequencing reaction of
PCR products that amplified the Sense strand of RNA with introduced
swaps. The unspecific forward primer from FIG. 10A was used for
Sanger sequencing of each PCR product. Arrows represent the
specific reverse primers used for PCR amplification. Additional
nucleotide changes introduced by DONOR template are displayed
highlighted and greyed out. Chromatograms show the sequences for
the PCR products, which were aligned against the predicted
sequences. Top panel represents sequencing reactions for expression
proof for swap in the AtTAS1b (Tas1b) loci and bottom panel is
represents reactions for expression proof for swap in the AtTAS3a
(Tas3a;) loci. Y25: Y25, beta subunit of COPI complex; Ribo3a:
Ribosomal protein 3a; WT: wild-type.
[0135] FIG. 10H depicts a scheme of a Sanger sequencing reaction of
PCR products that amplified the Anti-Sense strand of RNA with
introduced swaps. The unspecific reverse primer from FIG. 10B was
used for Sanger sequencing of each PCR product. Arrows represent
the specific forward primers used for PCR amplification. Additional
nucleotide changes introduced by DONOR template are displayed
highlighted and greyed out. Chromatograms show the sequences for
the PCR products, which were aligned against the predicted
sequences. Top row represents sequencing reactions for expression
proof for swap at AtTAS1b (Tas1b) loci and bottom row represents
reactions for expression proof for swap at AtTAS3a (Tas3a) loci.
Y25: Y25, beta subunit of COPI complex; Ribo3a: Ribosomal protein
3a; WT: wild-type.
[0136] FIG. 10I depicts a scheme of a Sanger sequencing reaction of
PCR products that amplified the Sense and Anti-Sense strands of
wild-type RNA transcribed from Tas1b and Tas3a. For sense
transcripts the unspecific forward primer from FIG. 10A was used
for Sanger sequencing of each PCR product. For antisense
transcripts the unspecific reverse primer from FIG. 10B was used
for Sanger sequencing of each PCR product. Arrows represent the
forward primers used for PCR amplification. Chromatograms show the
sequences for the PCR products, which were aligned against the
annotated WT sequences.
[0137] FIG. 11A provides in the lower panel a bar-graph depicting
levels of TuMV infection in leaves of N. Benthamiana following
inoculation with various treatments, as represented by measuring
relative expression through quantification of TuMV transcript
levels and GFP visualisation. Control and treatments were
infiltrated side-by-side on the same leaf. Left to right--(1) Leaf
was infiltrated with agrobacterium containing TuMV vector (n=3;
left side of the leaf) or agrobacterium without any vector (n=3;
right side of the leaf). (2) Leaf was infiltrated with
agrobacterium containing a vector overexpressing miR173 (n=3; left
side) or with agrobacterium containing no vector (n=3; right side).
(3) Leaf was infiltrated with a vector overexpressing the
GEiGS-dummy (n=3; left side) or GEiGS-TuMV (n=3; right side). (4)
Leaf was infiltrated with agrobacterium containing a vector
overexpressing the GEiGS-dummy (n=3; left side) or agrobacterium
containing a vector endocing the GEiGS-TuMV (n=2; tight side), both
co-infiltrated with agrobacterium containing a vector
overexpressing miR173. The micrographs in the upper panel are
representative pictures of the analysed samples. TuMV was monitored
through GFP signal, visualised under UV light. Bars indicate
average values; Error bars represent standard error;
*-p-value<0.05; **-p-value<0.01 according to One-way ANOVA
and post-hoc Tukey HSD test.
[0138] FIG. 11B provides photographs depicting whole N. benthamiana
leaves which have been co-infiltrated with agrobacterium containing
vectors overexpressing GEiGS-dummy and miR173 (centre) or
overexpressing GEiGS-TuMV and miR173 (right). Control leaf was
infiltrated with agrobacterium containing no vector (left). TuMV
was monitored through GFP signal, visualised under UV light.
[0139] FIG. 12A is a bar graph providing relative expression of
Ribosomal protein 3a in nematodes fed with total RNA extracted from
N. benthamiana leaves which were co-infiltrated with vectors
overexpressing miR390 and TAS3a which was modified to target
Ribosomal protein 3a. Nematodes fed with RNA from explants
overexpressing the TAS3a wt backbone and the miR390 amplifier were
used as control. Analysis was carried out on nematodes fed during 3
days with the RNA extract, by qRT-PCR, using actin as endogenous
normaliser gene, (Error bars represent standard error;
***-p-value<0.001).
[0140] FIG. 12B is a bar graph providing relative expression of
Spliceosomal SR protein in nematodes fed with total RNA extracted
from N. benthamiana leaves which were co-infiltrated with vectors
overexpressing miR390 and TAS3a which was modified to target
Spliceosomal SR protein. Nematodes fed with RNA from explants
overexpressing the TAS3a wt backbone and the miR390 amplifier were
used as control. Analysis was carried out on nematodes fed during 3
days with the RNA extract, by qRT-PCR, using actin as endogenous
normaliser gene. (Error bars represent standard error;
**-p-value<0.01).
[0141] FIGS. 13A-D depict RNA-seq analysis (FIGS. 13A and 13C) and
small RNA-seq analysis (FIGS. 13B and 13D) of N. benthamiana leaves
infiltrated with vectors expressing GEiGS designs against ribosomal
protein 3a (FIGS. 13A and 13B) and Spliceosomal SR protein (FIGS.
13C and 13D), and miR390, aligned to the GEiGS design, 48 to 72
hours post infiltration. Light grey rectangles in each plot
indicate the region of miR390 binding on the transcript. The black
squares in each plot indicate the homology region to the target
genes that give rise to the secondary siRNA that target the genes
in nematodes. Top chromatograms in each plot indicate the sense
strand while the bottom ones indicate the anti-sense.
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0142] The present invention, in some embodiments thereof, relates
to generation and amplification of dsRNA molecules in a host cell
for silencing pest target genes.
[0143] The principles and operation of the present invention may be
better understood with reference to the drawings and accompanying
descriptions.
[0144] Before explaining at least one embodiment of the invention
in detail, it is to be understood that the invention is not
necessarily limited in its application to the details set forth in
the following description or exemplified by the Examples. The
invention is capable of other embodiments or of being practiced or
carried out in various ways and in different organisms. Also, it is
to be understood that the phraseology and terminology employed
herein is for the purpose of description and should not be regarded
as limiting.
[0145] Previous work on genome editing of RNA molecules in various
organisms (e.g. murine, human, plants), focused on disruption of
miRNA activity or target binding sites using transgenesis. Genome
editing in plants has concentrated on the use of nucleases such as
CRISPR-Cas9 technology, ZFNs and TALENs, for knockdown of genes or
insertions in model plants. Furthermore, gene silencing in plants
using artificial miRNA transgenes to silence endogenous and
exogenous target genes has been described [Molnar A et al. Plant J.
(2009) 58(1)165-74. doi: 10.1111/j.1365-313X.2008.03767.x. Epub
2009 Jan. 19; Borges and Martienssen, Nature Reviews Molecular Cell
Biology| AOP, published online 4 Nov. 2015; doi:10.1038/nrm4085].
The artificial miRNA transgenes are introduced into plant cells
within an artificial expression cassette (including a promoter,
terminator, selection marker, etc.) and downregulate target
expression.
[0146] Recent advances in genome editing techniques have made it
possible to alter DNA sequences in living cells by editing one or
more a few nucleotides in cells of human patients such as by genome
editing (NHEJ and HR) following induction of site-specific
double-strand breaks (DSBs) at desired locations in the genome.
While NHEJ is mainly, if not exclusively, used for knockout
purposes, HR is used for introducing precision editing of specific
sites such as point mutations or correcting deleterious mutations
that are naturally occurring or hereditarily transmitted. p Mature
small RNAs (i.e. dicer products and non-dicer products) and dsRNA
(i.e. dicer substrates, e.g. small RNA precursors) can mediate
efficient cellular gene knockdown. The biogenesis of miRNAs
involves the presence of dsRNA structures (e,g. hairpin
precursors). However, the hairpin RNA may not be efficiently taken
up by pests because: (i) quantity is low due to its instability
(e.g. processed by dicer) and; (ii) the lack of RNA-RNA
amplification stage by RNA-dependent RNA-polymerases (RdRp).
Accordingly, pests are more susceptible to ingested small RNA
precursors (e.g. dsRNA).
[0147] While reducing the present invention to practice, the
present inventors have devised a gene editing technology directed
to generation of long dsRNA molecules in plant cells and tissues
for targeting of pest genes. Such dsRNA molecules can be mobile and
transferred among cells and tissues; hence can occur outside cells
once produced in cells. Furthermore, such dsRNA molecules can be
transferred between organisms through ingestion of material derived
from the dsRNA-expressing host (e.g. plant leaves and stems).
Specifically, the present inventors have developed a GEiGS system
that involves one of two models.
[0148] The below-described models are based in part on the Gene
Editing induced Gene Silencing (GEiGS) technology as described in
WO 2019/058255, which is hereby incorporated by reference in its
entirety. As used herein, the phrase "GEiGS is performed" relates
to use of the GEiGS technology in order to redirect silencing
specificity of a silencing RNA, which essentially includes
modifying a nucleic acid sequence encoding a silencing RNA, such
that the encoded silencing RNA targets a target of choice.
According to some embodiments, GEiGS is performed by inducing a
double-strand break in the nucleic acid sequence encoding the
silencing RNA in a cell (e.g. by expressing or introducing an
endonuclease into the cell, such as, but not limited to Cas9), and
providing a nucleic acid template which includes the desired
nucleotide changes in the nucleic acid sequence encoding the
silencing RNA. According to such embodiments, the nucleotide
changes are then introduced into the nucleic acid sequence encoding
the silencing RNA via Homology Dependent Recombination (HDR) as the
relevant part of the nucleic acid template is introduced. According
to some embodiments, the nucleic acid template introduces
nucleotides changes in the nucleic acid sequence encoding the
silencing RNA, such that the silencing RNA targets a target
sequence of choice. Examples of using GEiGS to change nucleotides
in a nucleic acid sequence encoding a miRNA or a tasiRNA are
exemplified herein below in Examples 1B and 3.
[0149] In the first model, a plant gene is identified which is
homologous to a pest target gene. GEiGS is performed to redirect
the silencing specificity of a small RNA molecule against the plant
gene (being homologous to the pest target gene). This small RNA
molecule (also referred to as an amplifier or primer small RNA)
forms a complex with RdRp, and RdRp synthesizes a complementary
anti-sense RNA strand to the transcript of the plant gene, forming
a dsRNA. The dsRNA is then further processed into secondary small
RNAs (sRNAs). Importantly, the primary small RNAs, dsRNA, as well
as the secondary small RNA molecules (i.e. the product of RNAi
processing of the newly generated dsRNAs, e.g. by Dicer-like) are
taken up by the pest and can mediate pest gene silencing.
Essentially, by re-directing the targeting specificity of an
amplifier small RNA molecule using GEiGS, the first model enables
formation of a novel long-dsRNA from a sequence which did not
previously form a long dsRNA, thus resulting in a phased-RNA
producing locus. As this locus carries a natural similarity to a
pest gene, a resulting long dsRNA harbors the capacity to silence
the corresponding gene within the pest.
[0150] In the second model, GEiGS is performed on a plant gene,
which is naturally converted into double stranded RNA form (a
naturally amplified locus which produces a long dsRNA and
phased-RNAs, e.g. a naturally occurring TAS), to redirect a
silencing specificity towards a pest target gene. Initially, a
native silencing RNA molecule (also referred to herein as an
amplifier or primer small RNA; e.g. 22 nt miRNA such as miR-173) is
selected which has the plant gene as a target and which is capable
of forming a complex with RdRp. RdRp synthesizes a complementary
anti-sense RNA strand to the transcript of the plant gene, forming
a long dsRNA. The long dsRNA is then further processed into
secondary sRNAs (i.e. the product of RNAi processing of the newly
generated dsRNAs, e.g. by Dicer-like). According to this model, the
long dsRNA as well as the secondary small RNA molecules are taken
up by the pest and can mediate pest gene silencing.
[0151] Thus, the present invention provides formation of
amplifiable dsRNA molecules in plant cells and tissues with
projected larger quantity as well as larger small RNA population
and hence with much higher silencing efficacy. Furthermore, the
multiple secondary small RNAs generated from the dsRNA molecules
increases the chances of efficient target knockdown. The dsRNA
molecules produced by the present methods are taken up efficiently
by pests enabling an efficient gene silencing and safe control of
pest genes without harming the plants. Furthermore, the gene
editing technology described herein does not implement the
classical molecular genetic and transgenic tools comprising
expression cassettes that have a promoter, terminator, selection
marker.
[0152] Thus, according to one aspect of the present invention there
is provided a method of producing a long dsRNA molecule in a plant
cell that is capable of silencing a pest gene, the method
comprising:
[0153] (a) selecting a nucleic acid sequence of a plant gene
exhibiting a predetermined sequence homology to a nucleic acid
sequence of the pest gene;
[0154] (b) modifying a plant endogenous nucleic acid sequence
encoding an RNA molecule so as to impart silencing specificity
towards the plant gene, such that small RNA molecules capable of
recruiting RNA.-dependent RNA Polymerase (RdRp) processed from the
RNA molecule form base complementation with a transcript of the
plant gene to produce the long dsRNA molecule capable of silencing
the pest gene,
[0155] thereby producing the long dsRNA molecule in the plant cell
that is capable of silencing the pest gene.
[0156] The term "long dsRNA molecule" as used herein refers to
double-stranded sequences of polyribonucleic acids having a first
strand (sense strand) and a second strand that is a reverse is
complement of the first strand (anti-sense strand), the
polyribonucleic acids held together by base pairing (e.g., two
sequences that are the reverse complement of each other in the
region of base pairing), wherein the double stranded
polyribonucleic acid can be a substrate for an enzyme from the
Dicer family, typically wherein the long dsRNA molecule is at least
26 bp or longer. The two strands can be of identical length or of
different lengths provided there is enough sequence homology
between the two strands that a stable double stranded structure is
formed with at least 80 %, 85%, 90%, 95%, 97%, 99% or 100%
complementarity over the entire length.
[0157] By use of the term "complementation", "complementarity" or
"complementary" is meant that the RNA molecules (or at least a
portion of it that is present in the processed small RNA form, or
at least one strand of a double-stranded polynucleotide or portion
thereof, or a portion of a single strand polynucleotide) hybridizes
under physiological conditions to the target RNA (e.g, transcript
of the plant gene), or a fragment thereof, to effect regulation or
function of RdRp mediated synthesis of the target gene. For
example, in some embodiments, a RNA molecule (e.g. small RNA
molecule) has 100% sequence identity or at least about 30, 40, 45,
50, 55, 60, 65, 70, 75, 80, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92,
93, 94, 95, 96, 97, 98, or 99% sequence identity when compared to a
sequence of 10, 11, 12, 13. 14, 15, 16, 17, 18, 19, 20, 21. 22, 23,
24, 25. 26, 27, 28, 29. 30, 31, 32 33, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500 or more
contiguous nucleotides in the target RNA (or family members of a
given target gene).
[0158] As used herein, a RNA molecule, or it's processed small RNA
forms (discussed in further detail hereinbelow), are said to
exhibit "complete complementarity" when every nucleotide of one of
the sequences read 5' to 3' is complementary to every nucleotide of
the other sequence when read 3' to 5'. A nucleotide sequence that
is completely complementary to a reference nucleotide sequence will
exhibit a sequence identical to the reverse complement sequence of
the reference nucleotide sequence.
[0159] Methods for determining sequence complementarity are well
known in the art and include, but are not limited to,
bioinformatics tools which are well known in the art (e.g. BLAST,
multiple sequence alignment).
[0160] According to one embodiment, the long dsRNA molecule is
longer than 20 bp.
[0161] According to one embodiment, the long dsRNA molecule is
longer than 21 bp.
[0162] According to one embodiment, the long dsRNA molecule is
longer than 22 bp.
[0163] According to one embodiment, the long dsRNA molecule is
longer than 23 bp.
[0164] According to one embodiment, the long dsRNA molecule is
longer than 24 bp.
[0165] According to one embodiment, the long dsRNA molecule
comprises 20-100,000 bp.
[0166] According to one embodiment, the long dsRNA molecule
comprises 20-10,000 bp.
[0167] According to one embodiment, the long dsRNA molecule
comprises 20-1,000 bp.
[0168] According to one embodiment, the long dsRNA molecule
comprises 20-500 bp.
[0169] According to one embodiment, the long dsRNA molecule
comprises 20-50 bp.
[0170] According to one embodiment, the long dsRNA molecules
comprise 200-5000 bp.
[0171] According to one embodiment, the long dsRNA molecules
comprise 200-1000 bp.
[0172] According to one embodiment, the long dsRNA molecules
comprise 200-500 bp.
[0173] According to one embodiment, the long dsRNA molecules
comprise 2000-100,000 bp.
[0174] According to one embodiment, the long dsRNA molecules
comprise 2000-10,000 bp.
[0175] According to one embodiment, the long dsRNA molecules
comprise 2000-5000 bp.
[0176] According to one embodiment, the long dsRNA molecules
comprise 10,000-100,000 bp.
[0177] According to one embodiment, the long dsRNA molecules
comprise 1,000-10,000 bp.
[0178] According to one embodiment, the long dsRNA molecules
comprise 100-10,000 bp.
[0179] According to one embodiment, the long dsRNA molecules
comprise 100-1,000 bp.
[0180] According to one embodiment, the long dsRNA molecules
comprise 10-1,000 bp.
[0181] According to one embodiment, the long dsRNA molecules
comprise 10-100 bp.
[0182] According to one embodiment, the long dsRNA molecule
comprises an overhang, i.e. a non-double stranded region of a dsRNA
molecule (i.e., single stranded RNA).
[0183] According to one embodiment, the long dsRNA molecule does
not comprise an overhang.
[0184] According to one embodiment, the long dsRNA molecule of the
invention can be processed into small RNA molecules capable of
engaging with RNA-induced silencing complex (RISC). Accordingly,
the long dsRNA molecule of the invention may serve as a substrate
for the intra-cellular RNAi processing machinery (i.e. may be a
precursor RNA molecule) and may be processed by ribonucleases,
including but not limited to, the DICER protein family (e.g. DCR1
and DCR2), DICER-LIKE protein family (e.g. DCL1, DCL2, DCL3, DCL4),
ARGONAUTE protein family (e.g. AGO1, AGO2, AGO3, AGO4), tRNA
cleavage enzymes (e.g. RNY1, ANGIOGENIN, RNase P, RNase P-like,
SLFN3, ELAC1 and ELAC2), and Piwi-interacting RNA (piRNA) related
proteins (e.g. AGO3, AUBERGINE, HIWI, HIWI2, HIWI3, PIWI, ALG1 and
ALG2) into small RNA molecules, as discussed in detail
hereinbelow.
[0185] The term "plant" as used herein encompasses whole plants, a
grafted plant, ancestors and progeny of the plants and plant parts,
including seeds, shoots, stems, roots (including tubers),
rootstock, scion, and plant cells, tissues and organs. The plant
may be in any form including suspension cultures, embryos,
meristematic regions, callus tissue, leaves, gametophytes,
sporophytes, pollen, and microspores. Plants that may be useful in
the methods of the invention include all plants which belong to the
superfamily Viridiplantee, in particular monocotyledonous and
dicotyledonous plants including a fodder or forage legume,
ornamental plant, food crop, tree, or shrub selected from the list
comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp.,
Agathis australis, Albizia amara, Alsophila tricolor, Andropogon
spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus
cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera
gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa,
Calliandra spp, Camellia sinensis, Cannabaceae, Cannabis indica,
Cannabis, Cannabis saliva, Hemp, industrial Hemp, Capsicum spp.,
Cassia spp., Centroema pubescens, Chacoomeles spp., Cinnamomum
cassia, Coffea arabica, Colophospermum mopane, Coronillia varia,
Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp.,
Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon
spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria,
Davallia divaricata, Desmodium spp., Dicksonia squarosa,
Dibeteropogon amplectens, Dioclea spp, Dolichos spp., Dorycnium
rectum, Echinochloa pyramidalis, Ehraffia spp., Eleusine coracana,
Eragrestis spp., Erythrina spp., Eucalypfus spp., Euclea schimperi,
Elealia vi/losa, Pagopyrum spp., Feijoa sellowlana, Fragaria spp.,
Fleminia spp, Freycinetia banksli, Geranium thunbergii, GinAgo
biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum,
Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemaffhia
altissima, Heteropogon contoffus, Hordeum vulgare, Hyparrhenia
rufa, Hypericum erectum, Hypeffhelia dissolute, Indigo incamata,
Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp.,
Leucaena leucocephala, Loudetia simplex, Lotonus bainesli, Lotus
spp., Macrotyloma axillare, Malus spp., Manihot esculents, Medicago
saliva, Metasequoia glyptostroboides, Musa sapientum, banana,
Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp.,
Peltophorum africanum, Pennisetum spp., Persia gratissima, Petunia
spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum,
Photinia spp., Picea glauca, Pinus spp., Pisum sativam, Podocarpus
totara, Pogonarthria fleckii, Pogonaffhria squarrosa, Populus spp.,
Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum,
Pyrus communis, Quercus spp., Rhaphiolepsis umbellata,
Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes
spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp.,
Schyzachytium sanguineum, Sciadopitys vefficillata, Sequoia
sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia
spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos
humilis, Tadehagi spp, Taxodium distichum, Themeda triandra,
Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp.,
Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia
aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli,
Brussels sprouts, cabbage, canola, carrot, cauliflower, celery,
collard greens, flax, kale, lentil, oilseed rape, okra, onion,
potato, rice, soybean, straw, sugar beet, sugar cane, sunflower,
tomato, squash tea, trees. Alternatively algae and other
non-Viridiplantae can be used for the methods of some embodiments
of the invention.
[0186] According to a specific embodiment, the plant is a crop, a
flower, a weed or a tree.
[0187] According to a specific embodiment, the plant is a woody
plant species e.g., Actinidia chinensis (Actinidiaceae),
Manihotesculenta (Euphorbiaceae), Firiodendron tulipifera
(Magnoliaceae), Populus (Salicaceae), Santalum album (Santalaceae),
Ulmus (Ulmaceae) and different species of the Rosaceae (Malus,
Prunus, Pyrus) and the Rutaceae (Citrus, Microcitrus), Gymnospermae
e.g., Picea glauca and Pinus taeda, forest trees (e.g., Betulaceae,
Fagaceae, Gymnospermae and tropical tree species), fruit trees,
shrubs or herbs, e.g., (banana, cocoa, coconut, coffee, date, grape
and tea) and oil palm.
[0188] According to a specific embodiment, the plant is of a
tropical crop e.g., coffee, macadamia, banana, pineapple, taro,
papaya, mango, barley, beans, cassava, chickpea, cocoa (chocolate),
cowpea, maize (corn), millet, rice, sorghum, sugarcane, sweet
potato, tobacco, taro, tea, yam.
[0189] "Grain," "seed," or "bean," refers to a flowering plant's
unit of reproduction, capable of developing into another such
plant. As used herein, the terms are used synonymously and
interchangeably.
[0190] According to a specific embodiment, the plant is a plant
cell e.g., plant cell in an embryonic cell suspension.
[0191] According to a specific embodiment, the plant cell is a
protoplast.
[0192] The protoplasts are derived from any plant tissue e.g.,
fruit, flowers, roots, leaves, embryos, embryonic cell suspension,
calli or seedling tissue.
[0193] According to a specific embodiment, the plant cell is an
embryogenic cell.
[0194] According to a specific embodiment, the plant cell is a
somatic embryogenic cell.
[0195] The term "plant gene" as used herein refers to any gene in
the plant, e.g., endogenous, that can be modified as to impart
silencing specificity towards a pest gene.
[0196] According to one embodiment, the plant gene is a non-coding
gene (e.g. non-protein coding gene).
[0197] According to one embodiment, the plant gene is a coding gene
(e.g. protein-coding gene).
[0198] According to one embodiment, the plant gene (i.e. exhibiting
said predetermined sequence homology to the nucleic acid sequence
of the pest gene) does not encode a silencing molecule.
[0199] According to one embodiment, the plant gene does not encode
for a molecule having an intrinsic silencing activity (e.g. RNA
molecule, e.g. non-coding RNA molecule, as discussed in detail
below).
[0200] According to one embodiment, the plant gene encodes for a
molecule having an intrinsic silencing activity (e.g. RNA molecule,
e.g. non-coding RNA molecule, as discussed in detail below).
[0201] As used herein the term "pest" refers to an organism which
directly or indirectly harms the plant. A direct effect includes,
for example, feeding on the plant leaves. Indirect effect includes,
for example, transmission of a disease agent (e.g. a virus,
bacteria, etc.) to the plant. In the latter case the pest serves as
a vector for pathogen transmission.
[0202] According to some embodiments, a pest is an invertebrate
pest, including an invertebrate pest which is susceptible to long
dsRNA via methods such as, but not limited to, ingestion and/or
soaking. Each possibility represents a separate embodiment of the
present invention. According to some embodiment, an invertebrate
pest which is susceptible to long dsRNA is susceptible to long
dsRNA of 26 bp and above, possibly of about 26-50 bp. Each
possibility represents a separate embodiment of the present
invention.
[0203] According to one embodiment, the pest is an invertebrate
organism.
[0204] Exemplary pests include, but are not limited to, insects,
nematodes, snails, slugs, spiders, caterpillars, scorpions, mites,
ticks, fungi, and the like.
[0205] Insect pests include, but are not limited to, insects
selected from the orders Coleoptera (e.g. beetles), Diptera (e.g.
flies, mosquitoes), Hymenoptera (e.g, sawflies, wasps, bees, and
ants), Lepidoptera (e.g. butterflies and moths), Mallophaga (e.g.
lice, e.g. chewing lice, biting lice and bird lice), Hemiptera
(e.g. true bugs), Homoptera including suborders Sternorrhyncha
(e.g. aphids, whiteflies, and scale insects), Auchenorrhyncha (e.g.
cicadas, leafhoppers, treehoppers, planthoppers, and spittlebugs),
and Coleorrhyncha (e.g. moss bugs and beetle bugs), Orthroptera
(e.g. grasshoppers, locusts and crickets, including katydids and
wetas), Thysanoptera (e.g. Thrips), Dermaptera Earwigs), Isoptera
(e.g. Termites), Anoplura (e.g. Sucking lice), Siphonaptera (e.g.
Flea), Trichoptera caddisflies), etc.
[0206] Insect pests of the invention include, but are not limited
to, Maize: Ostrinia nubilalis, European corn borer; Agrotis
ipsilon, black cutworm; Helicoverpa zea, corn earworm; Spodoptera
frugiperda, fall armyworm; Diatraea grandiosella, southwestern corn
borer; Elasmopalpus lignosellus, lesser cornstalk borer; Diatraea
saccharalis, surgarcane borer; Diabrotica virgifera, western corn
rootworm; Diabrotica longicornis barberi, northern corn rootworm;
Diabrotica undecimpunctata howardi, southern corn rootworm;
Melanotus spp., wireworms; Cyclocephala borealis, northern masked
chafer (white grub); Cyclocephala immaculata, southern masked
chafer (white grub); Popillia japonica, Japanese beetle;
Chaetocnema pulicaria, corn flea beetle; Sphenophorus maidis, maize
bilibug; Rhopalosiphum maidis, corn leaf aphid; Anuraphis
maidiradicis, corn root aphid; Blissus leucopterus leucopterus,
chinch bug; Melanoplus femurrubrum, redlegged grasshopper;
Melanoplus sanguinipes, migratory grasshopper; Hylemya platura,
seedcorn maggot; Agromyza parvicornis, corn blot leafminer;
Anaphothrips obscrurus, grass thrips; Solenopsis milesta, thief
ant; Tetranychus urticae, twospotted spider mite; Sorghum: Chilo
partellus,sorghum borer; Spodoptera frugiperda, fall armyworm;
Helicoverpa zea, corn earworm; Elasmopalpus lignosellus, lesser
cornstalk borer; Feltia subterranea, granulate cutworm; Phyllophaga
crinita, white grub; Eleodes, Conoderus, and Aeolus spp.,
wireworms; Oulema melanopus, cereal leaf beetle; Chaetocnema
pulicaria, corn flea beetle; Sphenophorus maidis, maize billbug;
Rhopalosiphum maidis; corn leaf aphid; Sipha flava, yellow
sugarcane aphid; Blissus leucopterus leucopterus, chinch bug;
Contarinia sorghicola, sorghum midge; Tetranychus cinnabarinus,
carmine spider mite; Tetranychus urticae, twospotted spider mite;
Wheat: Pseudaletia unipunctata, army worm; Spodoptera frugiperda,
fall armyworm; Elasmopalpus lignosellus, lesser cornstalk borer;
Agrotis orthogonia, western cutworm; Elasmopalpus lignoseltus,
lesser cornstalk borer; Oulema melanopus, cereal leaf beetle;
Hypera punctata, clover leaf weevil; Diabrotica undecimpunctata
howardi, southern corn rootworm; Russian wheat aphid; Schizaphis
graminum, greenbug; Macrosiphum avenae, English grain aphid;
Melanoplus femurrubrum, redlegged grasshopper; Melanoplus
differentialis, differential grasshopper; Melanoplus sanguinipes,
migratory grasshopper; Mayetiola destructor, Hessian fly;
Sitodiplosis mosellana, wheat midge; Meromyza americana, wheat
stern maggot; Hylemya coarctate, wheat bulb fly; Frankliniella
fusca, tobacco thrips; Cephus cinctus, wheat stem sawfly; Aceria
tulipae, wheat curl mite; Sunflower: Suleima helianthana, sunflower
bud moth; Homoeosoma electellum, sunflower moth; zygogramma
exclamationis, sunflower beetle; Bothyrus gibbosus, carrot beetle;
Neolasioptera murtfeldtiana, sunflower seed midge; Cotton:
Heliothis virescens, cotton budworm; Helicoverpa zea, cotton
bollworm; Spodoptera exigua, beet armyworm; Pectinophora
gossypiella, pink bollworm; Anthonomus grandis, boll weevil; Aphis
gossypii, cotton aphid; Pseudatomoscelis seriatus, cotton
fleahopper; Trialeurodes abutilonea, bandedwinged whitefly; Lygus
lineolaris, tarnished plant bug; Melanoplus femurrubrum, redlegged
grasshopper; Melanoplus differentialis, differential grasshopper;
Thrips tabaci, onion thrips; Franklinkiella fusca, tobacco thrips;
Tetranychus cinnabarinus, carmine spider mite; Tetranychus urticae,
twospotted spider mite; Rice: Diatraea saccharalis, sugarcane
borer; Spodoptera frugiperda, fall armyworm; Helicoverpa zea, corn
earworm; Colaspis brunnea, grape colaspis; Lissorhoptrus
oryzophilus, rice water weevil; Sitophilus oryzae, rice weevil;
Nephotettix nigropictus, rice leafhopper; Blissus leucopterus
leucopterus, chinch bug; Acrosternum hilare, green stink bug;
Soybean: Pseudoplusia includens, soybean looper; Anticarsia
gemmatalis, velvetbean caterpillar; Plathypena scabs, green
cloverworm; Ostrinia nubilalis, European corn borer; Agrotis
ipsilon, black cutworm; Spodoptera exigua, beet armyworm; Heliothis
virescens, cotton budworm; Helicoverpa zea, cotton bollworm;
Epilachna varivestis, Mexican bean beetle; Myzus persicae, green
peach aphid; Empoasca fabae, potato leafhopper; Acrosternum hilare,
green stink bug; Melanoplus femurrubrum, redlegged grasshopper;
Melanoplus differentialis, differential grasshopper; Hylemya
platura, seedcorn maggot; Sericothrips variabilis, soybean thrips;
Thrips tabaci, onion thrips; Tetranychus turkestani, strawberry
spider mite; Tetranychus urticae, twospotted spider mite; Barley:
Ostrinia nubilalis, European corn borer; Agrotis ipsilon, black
cutworm; Schizaphis graminum, greenbug; Blissus leucopterus
leucopterus, chinch bug; Acrosternum hilare, green stink bug;
Euschistus serous, brown stink bug; Delia platura, seedcorn maggot;
Mayetiola destructor, Hessian fly; Petrobia latens, brown wheat
mite; Oil Seed Rape: Brevicoryne brassicae, cabbage aphid;
Phyllotreta cruciferae, Flea beetle; Mamestra configurata, Bertha
armyworm; Plutella xylostella, Diamond-back moth; Delia ssp., Root
maggots.
[0207] Exemplary nematodes include, but are not limited to, the
burrowing nematode (Radopholus similis), Caenorhabditis elegans,
Radopholus arabocoffeae, Pratylenchus cofffeae, root-knot nematode
(Meloidogyne spp.), cyst nematode (Heterodera and Globodera spp.),
root lesion nematode (Pratylenehus spp.), the stem nematode
(Ditylenchus dipsaci), the pine wilt nematode (Bursaphelenchus
xylophilus), the reniform nematode (Rotylenchulus reniformis),
Xiphinema index, Nacobbus aberrans and Aphelenchoides besseyi.
[0208] Exemplary fungi include, but are not limited to, Fusarium
oxysporum, Leptosphaeria maculans (Phoma lingam), Sclerotinia
sclerotiorum, Pyricularia grisea, Gibberella funkuroi (Fusarium
moniliforme), Magnaporthe oryzae, Botrvtis cinereal, Puccinia spp.,
Fusarium graminearum, Blumeria graminis, Mycosphaerella
graminicola, Colletotrichum spp., Ustilago maydis, Melampsora lini,
Phakopsora pachyrhizi and Rhizoctonia solani.
[0209] According to a specific embodiment, the pest is an ant, a
termite, a bee, a wasp, a caterpillar, a cricket, a locust, a
beetle, a snail, a slug, a nematode, a bug, a fly, a fruitfly, a
whitefly, a mosquito, a grasshopper, a planthopper, an earwig, an
aphid, a scale, a thrip, a spider, a mite, a psyllid, a tick, a
moth, a worm, and a scorpion, in different stages of their
lifecycle an ant, a bee, a wasp, a caterpillar, a beetle, a snail,
a slug, a nematode, a bug, a fly, a whitefly, a mosquito, a
grasshopper, an earwig, an aphid, a scale, a thrip, a spider, a
mite, a psyllid, and a scorpion.
[0210] According to a specific embodiment, the pest is at any
lifecycle stage of its life.
[0211] According to one embodiment, the pest is a virus.
[0212] The phrase "silencing a pest gene" refers to reducing the
level of expression of a polynucleotide or the polypeptide encoded
thereby, by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%,
90%, 95%, 99% or by 100%, as compared to a pest gene not targeted
by the designed long dsRNA molecule of the invention.
[0213] Assays for measuring the expression level of a
polynucleotide or the polypeptide encoded thereby, include but are
not limited to, RT-PCR, Western blot, Immunohistochemistry and/or
flow cytometry, sequencing or any other detection methods (as
further discussed hereinbelow).
[0214] Preferably, silencing of the pest gene results in the
suppression, control, and/or killing of the pest which results in
limiting the damage that the pest causes to the plant. Controlling
a pest includes, but is not limited to, killing the pest,
inhibiting development of the pest, altering fertility or growth of
the pest in such a manner that the pest provides less damage to the
plant, decreasing the number of offspring produced, producing less
fit pests, producing pests more susceptible to predator attack, or
deterring the pests from eating the plant.
[0215] The term "pest gene" as used herein refers to any gene in
the pest that is essential for growth, development, reproduction or
infectivity. The gene may be expressed in any tissue of the pest,
however, in specific embodiments, the genes targeted for
suppression in the pest are expressed in cells of the gut tissue of
the pest, cells in the midgut of the pest, cells lining the gut
lumen or the midgut, cells of the pest gut microbiome and cells of
the pest immune system. Such target genes can be involved in, for
example, gut cell metabolism, growth, differentiation and immune
system.
[0216] Exemplary pest genes which may be targeted by the present
methods include, but are not limited to, the genes listed in Tables
1A-B, hereinbelow.
[0217] According to a specific embodiment, the nematode gene
comprises the Radophalus similis genes Calreticulin13 (CRT) or
collagen 5 (col-5).
[0218] According to a specific embodiment, the fungi gene comprises
the Fusarium oxysporum genes FOW2, FRP1, and OPR.
[0219] According to one embodiment, silencing a pest gene reduces
disease symptoms in a plant or reduces damage to the plant
(resulting from the pest) by at least about 10%, 20%, 30%, 40%,
50%, 60%, 70%, 80%, 90%, 95%, 99% or by 100%, as compared to a
plant harmed by the pest and not being subjected to the designed
long dsRNA molecule of the invention.
[0220] Assays measuring the control of a pest are commonly known in
the art, see, for example, U.S. Pat. No. 5,614,395, herein
incorporated by reference. Such techniques include, measuring over
time, the average lesion diameter, the pathogen biomass, and the
overall percentage of decayed plant tissues. See, for example,
Thomma et al. (1998) Plant Biology 95:15107-15111, herein
incorporated by reference. See, also Baum et al. (2007) Nature
Biotech 11:1322-1326 and WO 2007/035650 which provide both whole
plant feeding assays and corn root feeding assays.
[0221] According to one embodiment, the method comprises selecting
a nucleic acid sequence of a plant gene exhibiting a predetermined
sequence homology to a nucleic acid sequence of the pest gene.
[0222] According to one embodiment, the sequence homology between
the nucleic acid sequence of the plant gene and the nucleic acid
sequence of the pest gene comprises 60%-100%, 70%-80%, 70%-90%,
70%-100%, 75%-100%, 80%-90%, 80%-100%, 85%-100%, 90%-100% or
95%-100% identity,
[0223] According to a specific embodiment, the sequence homology
comprises 75%-100% identity between the nucleic acid sequence of
the plant gene and the nucleic acid sequence of the pest gene.
[0224] According to a specific embodiment, the sequence homology
comprises 85%-100% identity between the nucleic acid sequence of
the plant gene and the nucleic acid sequence of the pest gene.
[0225] According to a specific embodiment, the sequence homology
comprises 75%-100% identity between the nucleic acid sequence of
the plant gene and the nucleic acid sequence of the pest gene.
[0226] According to one embodiment, the sequence homology comprises
at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or 100% identity between the nucleic acid
sequence of the plant gene and the nucleic acid sequence of the
pest gene.
[0227] Homology (e.g., percent homology, sequence identity
+sequence similarity) can be determined using any homology
comparison software computing a pairwise sequence alignment.
[0228] As used herein, "sequence identity" or "identity" in the
context of two nucleic acid or polypeptide sequences includes
reference to the residues in the two sequences which are the same
when aligned. When percentage of sequence identity is used in
reference to proteins it is recognized that residue positions which
are not identical often differ by conservative amino acid
substitutions, where amino acid residues are substituted for other
amino acid residues with similar chemical properties (e.g. charge
or hydrophobicity) and therefore do not change the functional
properties of the molecule. Where sequences differ in conservative
substitutions, the percent sequence identity may be adjusted
upwards to correct for the conservative nature of the substitution.
Sequences which differ by such conservative substitutions are
considered to have "sequence similarity" or "similarity". Means for
making this adjustment are well-known to those of skill in the art.
Typically this involves scoring a conservative substitution as a
partial rather than a full mismatch, thereby increasing the
percentage sequence identity. Thus, for example, where an identical
amino acid is given a score of 1 and a non-conservative
substitution is given a score of zero, a conservative substitution
is given a score between zero and 1. The scoring of conservative
substitutions is calculated, e.g., according to the algorithm of
Henikoff S and Henikoff J G. [Amino acid substitution matrices from
protein blocks. Proc. Natl. Acad. Sci, U.S.A. 1992, 89(22):
10915-9].
[0229] Identity (e.g., percent homology) can be determined using
any homology comparison software, including for example, the BlastN
software of the National Center of Biotechnology Information (NCBI)
such as by using default parameters.
[0230] According to some embodiments of the invention, the identity
is a global identity, i.e., an identity over the entire amino acid
or nucleic acid sequences of the invention and not over portions
thereof.
[0231] According to some embodiments of the invention, the term
"homology" or "homologous" refers to identity of two or more
nucleic acid sequences; or identity of two or more amino acid
sequences; or the identity of an amino acid sequence to one or more
nucleic acid sequence.
[0232] According to some embodiments of the invention, the homology
is a global homology, i.e., a homology over the entire amino acid
or nucleic acid sequences of the invention and not over portions
thereof.
[0233] The degree of homology or identity between two or more
sequences can be determined using various known sequence comparison
tools. Following is a non-limiting description of such tools which
can be used along with some embodiments of the invention.
[0234] When starting with a polynucleotide sequence and comparing
to other polynucleotide sequences the EMBOSS-6.0.1 Needleman-Wunsch
algorithm (available from
emboss(dot)sourceforge(dot)net/apps/cvs/emboss/apps/needle(dot)html)
can be used with the following default parameters: (EMBOSS-6.0.1)
gapopen=10; gapextend=0.5; datafile=EDNAFULL; brief=YES.
[0235] According to some embodiments of the invention, the
parameters used with the EMBOSS-6.0.1 Needleman-Wunsch algorithm
are gapopen=10; gapextend=0.2; datafile=EDNAFULL; brief=YES.
[0236] According to some embodiments of the invention, the
threshold used to determine homology using the EMBOSS-6.0.1
Needleman-Wunsch algorithm for comparison of polynucleotides with
polynucleotides is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%,
89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0237] According to some embodiment, determination of the degree of
homology further requires employing the Smith-Waterman algorithm
(for protein-protein comparison or nucleotide-nucleotide
comparison).
[0238] Default parameters for GenCore 6.0 Smith-Waterman algorithm
include: model=sw.model.
[0239] According to some embodiments of the invention, the
threshold used to determine homology using the Smith-Waterman
algorithm is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0240] According to some embodiments of the invention, the global
homology is performed on sequences which are pre-selected by local
homology to the polypeptide or polynucleotide of interest (e.g.,
60% identity over 60% of the sequence length), prior to performing
the global homology to the polypeptide or polynucleotide of
interest (e.g., 80% global homology on the entire sequence). For
example, homologous sequences are selected using the BLAST software
with the Blastp and tBlastn algorithms as filters for the first
stage, and the needle (EMBOSS package) or Frame+algorithm alignment
for the second stage. Local identity (Blast alignments) is defined
with a very permissive cutoff -60% Identity on a span of 60% of the
sequences lengths because it is used only as a filter for the
global alignment stage. In this specific embodiment (when the local
identity is used), the default filtering of the Blast package is
not utilized (by setting the parameter "-F F").
[0241] In the second stage, homologs are defined based on a global
identity of at least 80% to the core gene polypeptide sequence.
According to some embodiments the homology is a local homology or a
local identity.
[0242] Local alignments tools include, but are not limited to the
BlastP, BlastN, BlastX or TBLASTN software of the National Center
of Biotechnology Information (NCBI), ASIA, and the Smith-Waterman
algorithm.
[0243] According to a specific embodiment, homology is determined
using BlastN with parameters: max target sequences=1000, expect
threshold=10, word size=11, match score=2, mismatch score=-3, gap
existence cost=5, gap extension cost=2.
[0244] According to a specific embodiment, selecting a nucleic acid
sequence of a plant gene exhibiting a predetermined sequence
homology to a nucleic acid sequence of the pest gene is effected by
identifying plant transcripts that have "homology stretches" to the
pest transcript. According to a specific embodiment, the homology
stretch is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 41,
42, 43, 44, 45, 46, 47. 48, 49, 50, 100, 150, 200, 250, 300, 400,
500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000,
4500, 5000, 5500, 6000, 7000, 8000, 9000, 10,000 or more
nucleotides (e.g. 20-50 nucleotides, 20-25 nucleotides, e.g. 21
nucleotides) over the whole plant transcript. Within the 20-50
nucleotides (e.g. 21 nucleotides), the homology of the plant
transcript to the pest transcript is preferably 75%, 80%, 85%, 90%,
95%, 99% or 100%.
[0245] According to a specific embodiment, when the pest is a
nematode (Heterodera glycines), the pest gene is as set forth in
accession no. AF469060.1 (Heterodera glycines ubiquitin extension
protein), the plant gene is as set forth in NM_001203752.2
(Arabidopsis thaliana ubiquitin 11 (UBQ11)).
[0246] According to a specific embodiment, when the pest is a
nematode (Heterodera glycines), the pest gene is as set forth in
accession no. AF500024.1 (Heterodera glycines putative gland
protein G8H07), the plant gene is as set forth in NM_116351.7
(Arabidopsis thaliana glycosyl transferase family 1 protein
(AT4G01210)).
[0247] According to a specific embodiment, when the pest is a
nematode (Heterodera glycines), the pest gene is as set forth in
accession no. AF502391.1 (Heterodera glycines putative gland
protein G10A06), the plant gene is as set forth in NM_001037071.1
(Arabidopsis thaliana bZIP transcription factor family protein
(TGA1)).
[0248] According to one embodiment, the method comprises modifying
a plant endogenous nucleic acid sequence encoding an RNA molecule
so as to impart silencing specificity towards the plant gene, such
that small RNA molecules capable of recruiting RNA-dependent RNA
Polymerase (RdRp) processed from the RNA molecule form base
complementation with a transcript of the plant gene to produce the
long dsRNA molecule capable of silencing the pest gene.
[0249] According to one embodiment, the RNA molecule is a
non-coding RNA molecule.
[0250] As used herein, the term "non-coding RNA molecule" refers to
a RNA sequence that is not translated into an amino acid sequence
and does not encode a protein.
[0251] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned in a non-coding gene (e.g.
non-protein coding gene). Exemplary non-coding parts of the genome
include, but are not limited to, introns, genes of non-coding RNAs,
DNA methylation regions, enhancers and locus control regions,
insulators, S/MAR sequences, non-protein-coding pseudogenes,
transposons, non-autonomous transposable elements (e.g. Alu, SINES
and mutated non-coding transposons and retrotransposons) and simple
repeats of centromeric and telomeric regions of chromosomes.
[0252] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned in a non-coding gene that
is ubiquitously expressed.
[0253] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned in a non-coding gene that
is expressed in a tissue-specific manner (e.g. in a leaf, fruit or
flower).
[0254] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned in a non-coding gene that
it is expressed in an inducible manner.
[0255] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned in a non-coding gene that
it is developmentally regulated.
[0256] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned between genes, i.e.
intergenic region.
[0257] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within an intron of a
non-coding gene.
[0258] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned in a coding gene (e.g.
protein-coding gene).
[0259] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within an exon of a coding
gene (e.g. protein-coding gene).
[0260] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within an exon encoding an
untranslated region (UTR) of a coding gene (e.g. protein-coding
gene).
[0261] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within a translated exon of
a coding gene (e.g. protein-coding gene).
[0262] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within an intron of a
coding gene (e.g. protein-coding gene).
[0263] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within a coding gene that
is ubiquitously expressed.
[0264] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within a coding gene that
is expressed in a tissue-specific manner (e.g. in a leaf, fruit or
flower).
[0265] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned within coding gene that it
is expressed in an inducible manner.
[0266] According to one embodiment, the nucleic acid sequence
encoding the RNA molecule is positioned in a coding gene that it is
developmentally regulated.
[0267] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is typically subject to the RNA silencing
processing mechanism or activity. However, also contemplated herein
are a few changes in nucleotides (e.g, for miRNA up to 24
nucleotides) which may elicit a processing mechanism that results
in recruitment of RdRP, in RNA interference or in translation
inhibition.
[0268] According to a specific embodiment, the RNA molecule is
endogenous (naturally occurring, e.g. native) to the plant cell. It
will be appreciated that the RNA molecule can also be exogenous to
the cell (i.e. externally added and which is not naturally
occurring in the plant cell).
[0269] According to some embodiments, the RNA molecule (e.g.
non-coding RNA molecule) comprises an intrinsic translational
inhibition activity.
[0270] According to some embodiments, the RNA molecule (e.g.
non-coding RNA molecule) comprises an intrinsic RNA interference
(RNAi) activity.
[0271] According to some embodiments, the RNA molecule (e.g.
non-coding RNA molecule) does not comprise an intrinsic
translational inhibition activity or an intrinsic RNAi activity
(i.e. the non-coding RNA molecule does not have an RNA silencing
activity).
[0272] According to an embodiment of the invention, the RNA
molecule (e.g, non-coding RNA molecule) is specific to a native
plant RNA (e.g., a natural plant RNA) and does not cross inhibit or
silence a pest RNA or plant RNA of interest (i.e. a transcript of
the plant gene) unless designed to do so (as discussed below)
exhibiting 100% or less global homology to the target gene, e.g.,
less than 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%,
88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% global homology to the
target gene; as determined at the RNA or protein level by RT-PCR,
Western blot, immunohistochemistry and/or flow cytometry,
sequencing or any other detection methods.
[0273] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a RNA silencing or RNA interference
(RNAi) molecule (also referred to as a "silencing molecule").
[0274] The term "RNA silencing" or RNAi refers to a cellular
regulatory mechanism in which non-coding RNA molecules (the "RNA
silencing molecule", "silencing molecule" or "RNAi molecule")
mediate, in a sequence specific manner, co- or post-transcriptional
inhibition of gene expression or translation.
[0275] As used herein, a "silencing molecule capable of recruiting
RNA-dependent RNA Polymerase (RdRp)" refers to a silencing molecule
which is able to engage RdRp to the site of its interaction with
the target transcript, thus enabling the formation of a long-dsRNA
based on another RNA molecule as a template. In a non-limiting
example, the silencing molecule capable of recruiting RdRp is a
miRNA, such as, but not limited to, a miRNA of 22 nt length, and a
TAS transcript serves as a template for the miRNA/RISC/RdRp
complex, thus resulting in a long dsRNA based on the TAS
transcript.
[0276] According to one embodiment, the RNA molecule (e.g. RNA
silencing molecule) is capable of mediating RNA repression during
transcription (co-transcriptional gene silencing).
[0277] According to a specific embodiment, co-transcriptional gene
silencing includes epigenetic silencing (e.g. chromatic state that
prevents functional gene expression).
[0278] According to one embodiment, the RNA molecule (e.g. RNA
silencing molecule) is capable of mediating RNA repression after
transcription (post-transcriptional gene silencing).
[0279] Post-transcriptional gene silencing (PIGS) typically refers
to the process (typically occurring in the cell cytoplasm) of
degradation or cleavage of messenger RNA (mRNA) molecules which
decrease their activity by preventing translation. For example, and
as discussed in detail below, a guide strand of a RNA silencing
molecule pairs with a complementary sequence in a mRNA molecule and
induces cleavage by e.g. Argonaute 2 (Ago2).
[0280] Co-transcriptional gene silencing typically refers to
inactivation of gene activity (i.e. transcription repression) and
typically occurs in the cell nucleus. Such gene activity repression
is mediated by epigenetic-related factors, such as e.g.
methyl-transferases, that methylate target DNA and histones. Thus,
in co-transcriptional gene silencing, the association of a small
RNA with a target RNA (small RNA-transcript interaction)
destabilizes the target nascent transcript and recruits DNA- and
histone-modifying enzymes (i.e. epigenetic factors) that induce
chromatin remodeling into a structure that repress gene activity
and transcription. Also, in co-transcriptional gene silencing,
chromatin-associated long non-coding RNA scaffolds may recruit
chromatin-modifying complexes independently of small RNAs. These
co-transcriptional silencing mechanisms form RNA surveillance
systems that detect and silence inappropriate transcription events,
and provide a memory of these events via self-reinforcing
epigenetic loops [as described in D. Hoch and. D. Moazed,
RNA-mediated epigenetic regulation of gene expression, Nat Rev
Genet. (2015) 16(2): 71-84].
[0281] According to an embodiment of the invention, the RNAi
biogenesis/processing machinery generates the RNA silencing
molecule.
[0282] According to an embodiment of the invention, the RNAi
biogenesis/processing machinery generates the RNA silencing
molecule, but no specific target has been identified.
[0283] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a capable of inducing RNA interference
(RNAi.).
[0284] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
from a precursor.
[0285] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
from a single stranded RNA (ssRNA) precursor.
[0286] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
from a duplex-structured single-stranded RNA precursor.
[0287] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
from a dsRNA precursor (e.g. comprising perfect and imperfect base
pairing).
[0288] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
from a non-structured RNA precursor.
[0289] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
from a protein-coding RNA precursor.
[0290] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
from a RNA precursor.
[0291] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
and engaged with RNA-induced silencing complex (RISC).
[0292] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule or the RNA silencing molecule) is processed
and engaged with RNAi processing machinery such as, for example,
with ribonucleases, including but not limited to, Dicer, Ago2, the
DICER protein family (e.g. DCR1 and DCR2), DICER-LIKE protein
family (e.g. DCL1, DCL2, DCL3, DCL4), ARGONAUTE protein family
(e.g. AGO1, AGO2, AGO3, AGO4), tRNA cleavage enzymes (e.g.
RNY1,ANGIOGENIN, RNase P, RNase P-like, SLFN3, ELAC1 and ELAC2),
and Piwi-interacting RNA (piRNA) related proteins (e.g. AGO3,
AUBERGINE, HIWI, HIWI2, HIWI3, PIWI, ALG1 and ALG2) (as further
discussed below).
[0293] According to one embodiment, the dsRNA can be derived from
two different complementary RNAs, or from a single RNA that folds
on itself to form dsRNA.
[0294] Following is a detailed description of RNA silencing
molecules (e.g. non-coding RNA molecules) which are engaged with
RNA-induced silencing complex (RISC) and comprise an intrinsic RNAi
activity (e.g. are RNA silencing molecules) that can be used
according to specific embodiments of the present invention.
[0295] Poled and imperfect based paired RNA (i.e. double stranded
RNA; dsRNA), siRNA and shRNA--The presence of long dsRNAs in cells
stimulates the activity of a ribonuclease III enzyme referred to as
dicer. Dicer (also known as endoribonuclease Dicer or helicase with
RNase motif) is an enzyme that in plants is typically referred to
as Dicer-like (DCL) protein. Different plants have different
numbers of DCL genes, thus for example, Arabidopsis genome
typically has four DCL genes, rice has eight DCL genes, and maize
genome has five DCL genes. Dicer is involved in the processing of
the dsRNA into short pieces of dsRNA known as short interfering
RNAs (siRNAs). siRNAs derived from dicer activity are typically
about 21 to about 23 nucleotides in length and comprise about 19
base pair duplexes with two 3' nucleotides overhangs.
[0296] According to one embodiment dsRNA precursors longer than 21
bp are used. Various studies demonstrate that long dsRNAs can be
used to silence gene expression without inducing the stress
response or causing significant off-target effects--see for example
[Surat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13
3803-3810; Bhargava. A et al. Brain Res. Protoc. 2004;13:115-125;
Diallo M., et al., Oligonucleotides. 2003;13:381-392; Paddison P.
J., et al., Proc. Natl Acad, Sci, USA. 2002;99:1443-1448; Tran N.,
et al., FEBS Lett, 2004;573:127-134].
[0297] The term "siRNA" refers to small inhibitory RNA duplexes
(generally between 18-30 base pairs) that induce the RNA
interference (RNAi) pathway. Typically, siRNAs are chemically
synthesized as 21 mers with a central 19 bp duplex region and
symmetric 2-base 3'-overhangs on the termini, although it has been
recently described that chemically synthesized RNA duplexes of
25-30 base length can have as much as a 100-fold increase in
potency compared with 21 mers at the same location. The observed
increased potency obtained using longer RNAs in triggering RNAi is
suggested to result from providing Dicer with a substrate (27 mer)
instead of a product (21 mer) and that this improves the rate or
efficiency of entry of the siRNA duplex into RISC.
[0298] It has been found that position, but not the composition, of
the 3'-overhang influences potency of a siRNA and asymmetric
duplexes having a 3'-overhang on the antisense strand are generally
more potent than those with the 3'-overhang on the sense strand
(Rose et al., 2005).
[0299] The strands of a double-stranded interfering RNA (e.g., a
siRNA) may be connected to form a hairpin or stem-loop structure
(e.g., a shRNA). Thus, as mentioned, the RNA silencing molecule of
some embodiments of the invention may also be a short hairpin RNA
(shRNA).
[0300] The term short hairpin RNA, "shRNA", as used herein, refers
to a RNA molecule having a stem-loop structure, comprising a first
and second region of complementary sequence, the degree of
complementarity and orientation of the regions being sufficient
such that base pairing occurs between the regions, the first and
second regions being joined by a loop region, the loop resulting
from a lack of base pairing between nucleotides (or nucleotide
analogs) within the loop region. The number of nucleotides in the
loop is a number between and including 3 to 23, or 5 to 15, or 7 to
13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can
be involved in base-pair interactions with other nucleotides in the
loop. Examples of oligonucleotide sequences that can be used to
form the loop include 5'-CAAGAGA-3' and 5'-UUACAA-3' (International
Patent Application Nos. WO2013126963 and WO2014107763). It will be
recognized by one of skill in the art that the resulting single
chain oligonucleotide forms a stem-loop or hairpin structure
comprising a double-stranded region capable of interacting with the
RNAi machinery.
[0301] The RNA silencing molecule of some embodiments of the
invention need not be limited to those molecules containing only
RNA, but further encompasses chemically-modified nucleotides and
non-nucleotides.
[0302] Various types of siRNAs are contemplated by the present
invention, including trans-acting siRNAs (TasiRNAs),
repeat-associated siRNAs (Ra-siRNAs) and natural-antisense
transcript-derived siRNAs (Nat-siRNAs).
[0303] According to a specific embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a phased small interfering RNA
(phasRNA) "PhasiRNAs" are derived from an mRNA converted to dsRNA
by RDR6 and processed by DCL4, exemplified by the category of
Arabidopsis trans-acting siRNAs (tasiRNAs) (Vazquez et al., 2004).
In an exceptional case, phasiRNAs may also be 24-nucleotide
products of DCL5 (previously known as DCL3b) in grass reproductive
tissues (Song et al., 2012). The trans-acting name (tasiRNAs) of
some phasiRNAs comes from their ability to function like miRNAs in
a homology-dependent manner, directing AGO1-dependent slicing of
mRNAs from genes other than that of their source mRNA (see
below).
[0304] According to a specific embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a tasiRNA. "TasiRNA" are a class of
secondary siRNAs generated from noncoding TAS transcripts by miRNA
triggers in a phased pattern (Peragine et al., 2004; Vazquez et
al., 2004; Allen et al., 2005; Yoshikawa et al., 2005). The term
"phased" indicates simply that the small RNAs are generated
precisely in a head-to-tail arrangement, starting from a specific
nucleotide; this arrangement results from miRNA-triggered
initiation followed by DCL4-catalyzed cleavage. The primary
proteins that participate in tasiRNA biogenesis include, but are
not limited to, RDR6, SUPPRESSOR OF GENE SILENCING3 (SGS3), AGO1,
AGO7, and DOUBLE-STRANDED RNA BINDING FACTOR4 (Peragine et al.,
2004; Vazquez et al., 2004; Xie et al., 2005; Adenot et al., 2006;
Montgomery et al., 2008a; Fukudome et al., 2011). Most importantly,
there are two mechanisms by which 21-nucleotide tasiRNAs are
produced, known as the "one-hit" or "two-hit" pathways. In the
one-hit mechanism, a single miRNA directs cleavage of the mRNA
target triggering the production of phasiRNAs in the fragment 39 to
(or downstream of) the target site (Allen et al., 2005). The
one-hit miRNA trigger is typically 22 nucleotides in length (Chen
et al., 2010; Cuperus et al., 2010). In the two-hit model, a pair
of 21-nucleotide miRNA target sites is employed, of which cleavage
occurs at only the 39 target site, triggering the production of
phasiRNAs fragment (or upstream of) the target site (Axtell et al.,
2006).
[0305] According to one embodiment, silencing RNA includes "piRNA"
which is a class of Piwi-interacting RNAs of about 26 and 31
nucleotides in length. piRNAs typically form RNA-protein complexes
through interactions with Piwi proteins, i.e. antisense piRNAs are
typically loaded into Piwi proteins (e.g. Piwi, Ago3 and Aubergine
(Aub)).
[0306] miRNA--According to another embodiment the RNA silencing
molecule may be a miRNA.
[0307] The term "microRNA", "miRNA", and "miR" are synonymous and
refer to a collection of non-coding single-stranded RNA molecules
of about 19-24 nucleotides in length, which regulate gene
expression, miRNAs are found in a wide range of organisms (e.g.
insects, mammals, plants, nematodes) and have been shown to play a
role in development, homeostasis, and disease etiology.
[0308] Initially the pre-miRNA is present as a long non-perfect
double-stranded stern loop RNA that is further processed by Dicer
into a siRNA-like duplex, comprising the mature guide strand
(miRNA) and a similar-sized fragment known as the passenger strand
(miRNA*). The miRNA and miRNA* may be derived from opposing arms of
the pri-miRNA and pre-miRNA. miRNA* sequences may be found in
libraries of cloned miRNAs but typically at lower frequency than
the miRNAs as it is, in most cases, not functional and degraded in
the cell.
[0309] Although initially present as a double-stranded species with
miRNA*, the miRNA eventually becomes incorporated as a
single-stranded RNA into a ribonucleoprotein complex known as the
RNA-induced silencing complex (RISC). Various proteins can form the
RISC, which can lead to variability in specificity for miRNA/miRNA*
duplexes, binding site of the target gene, activity of miRNA
(repress or activate), and which strand of the miRNA/miRNA* duplex
is loaded in to the RISC.
[0310] When the miRNA strand of the miRNA:miRNA* duplex is loaded
into the RISC, the miRNA* is removed and degraded. The strand of
the miRNA:miRNA* duplex that is loaded into the RISC is the strand
whose 5' end is less tightly paired. In cases where both ends of
the miRNA:miRNA* have roughly equivalent 5' pairing, both miRNA and
miRNA* may have gene silencing activity.
[0311] The RISC identifies target nucleic acids based on high
levels of complementarity between the miRNA and the mRNA,
especially by nucleotides 2-8 of the miRNA (referred as "seed
sequence").
[0312] A number of studies have looked at the base-pairing
requirement between miRNA and its mRNA target for achieving
efficient inhibition of translation (reviewed by Bartel 2004, Cell
116-281). Computational studies, analyzing miRNA binding on whole
genomes have suggested a specific role for bases 2-8 at the 5' of
the miRNA (also referred to as "seed sequence") in target binding
but the role of the first nucleotide, found usually to be "A" was
also recognized (Lewis et al. 2005 Cell 120-15). Similarly,
nucleotides 1-7 or 2-8 were used to identify and validate targets
by Krek et al. (2005, Nat Genet 37-495). The target sites in the
mRNA may be in the 5' UTR, the 3' UTR or in the coding region.
Interestingly, multiple miRNAs may regulate the same mRNA target by
recognizing the same or multiple sites. The presence of multiple
miRNA binding sites in most genetically identified targets may
indicate that the cooperative action of multiple RISCs provides the
most efficient translational inhibition.
[0313] miRNAs may direct the RISC to downregulate gene expression
by either of two mechanisms: mRNA cleavage or translational
repression. The miRNA may specify cleavage of the mRNA if the mRNA
has a certain degree of complementarity to the miRNA. When a miRNA
guides cleavage, the cut is typically between the nucleotides
pairing to residues 10 and 11 of the miRNA. Alternatively, the
miRNA may repress translation if the miRNA does not have the
requisite degree of complementarity to the miRNA. Translational
repression may be more prevalent in animals since animals may have
a lower degree of complementarity between the miRNA and binding
site.
[0314] It should be noted that there may be variability in the 5'
and 3' ends of any pair of miRNA and miRNA*. This variability may
be due to variability in the enzymatic processing of Drosha and
Dicer with respect to the site of cleavage. Variability at the 5'
and 3' ends of miRNA and miRNA* may also be due to mismatches in
the stem structures of the pri-miRNA and pre-miRNA. The mismatches
of the stern strands may lead to a population of different hairpin
structures. Variability in the stem structures may also lead to
variability in the products of cleavage by Drosha and Dicer.
[0315] According to one embodiment, miRNAs can be processed
independently of Dicer, e.g. by Argonaute 2.
[0316] It will be appreciated that the pre-miRNA sequence may
comprise from 45-90, 60-80 or 60-70 nucleotides while the pri-miRNA
sequence may comprise from 45-30,000, 50-25,000, 100-20,000,
1,000-1,500 or 80-100 nucleotides,
[0317] Antisense Antisense is a single stranded RNA designed to
prevent or inhibit expression of a gene by specifically hybridizing
to its mRNA. Downregulation of a target RNA can be effected using
an antisense polynucleotide capable of specifically hybridizing
with an mRNA transcript encoding the target RNA.
[0318] Transposable Element RNA
[0319] Transposable genetic elements (TEs) comprise a vast array of
DNA sequences, all having the ability to move to new sites in
genomes either directly by a cut-and-paste mechanism (transposons)
or indirectly through an RNA intermediate (retrotransposons). TEs
are divided into autonomous and non-autonomous classes depending on
whether they have ORFs that encode proteins required for
transposition. RNA-mediated gene silencing is one of the mechanisms
in which the genome control TEs activity and deleterious effects
derived from genome genetic and epigenetic instability.
[0320] As mentioned, the RNA molecule (e.g. non-coding RNA
molecule) may not comprise a canonical (intrinsic) RNAi activity
(e.g. is not a canonical RNA silencing molecule, or its target has
not been identified). Such non-coding RNA molecules include the
following:
[0321] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a transfer RNA (tRNA). The term "tRNA"
refers to a RNA molecule that serves as the physical link between
nucleotide sequence of nucleic acids and the amino acid sequence of
proteins, formerly referred to as soluble RNA or sRNA. tRNA is
typically about 76 to 90 nucleotides in length.
[0322] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a ribosomal RNA (rRNA). The term "rRNA"
refers to the RNA component of the ribosome i.e. of either the
small ribosomal subunit or the large ribosomal subunit.
[0323] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a small nuclear RNA (snRNA or U-RNA).
The terms "sRNA" or "U-RNA" refer to the small RNA molecules found
within the splicing speckles and Cajal bodies of the cell nucleus
in eukaryotic cells. snRNA is typically about 150 nucleotides in
length.
[0324] According to one embodiment, the RNA molecule (e.g,
non-coding RNA molecule) is a small nucleolar RNA (snoRNA). The
term "snoRNA" refers to the class of small RNA molecules that
primarily guide chemical modifications of other RNAs, e.g. rRNAs,
tRNAs and snRNAs. snoRNA is typically classified into one of two
classes: the C/D box snoRNAs are typically about 70-120 nucleotides
in length and are associated with methylation, and the H/ACA box
snoRNAs are typically about 100-200 nucleotides in length and are
associated with pseudouridylation.
[0325] Similar to snoRNAs are the scaRNAs (i.e. Small Cajal body
RNA genes) which perform a similar role in RNA maturation to
snoRNAs, but their targets are spliceosomal snRNAs and they perform
site-specific modifications of spliceosomal snRNA precursors (in
the Cajal bodies of the nucleus).
[0326] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is an extracellular RNA (exRNA). The term
"exRNA" refers to RNA species present outside of the cells from
which they were transcribed (e.g. exosomal RNA).
[0327] According to one embodiment, the RNA molecule non-coding RNA
molecule) is a repeat-derived RNA. The term "repeat-derived RNA"
refers to an RNA encoded by DNA derived from inverted genomic
repeats (such as, but not limited to, DNA generated by DNA
recombination, genomic loci duplication, transposition events
etc).
[0328] According to one embodiment, the RNA molecule (e.g.
non-coding RNA molecule) is a long non-coding RNA (lncRNA). The
term "lncRNA" or "long ncRNA" refers to non-protein coding
transcripts typically longer than 200 nucleotides.
[0329] According to a specific embodiment, non-limiting examples of
RNA molecules (e.g. non-coding RNA molecules) engaged with RISC
include, but are not limited to, microRNA (miRNA), piwi-interacting
RNA (piRNA), short interfering RNA (siRNA), short-hairpin RNA
(shRNA), phased small interfering RNA (phasiRNA), trans-acting
siRNA (tasiRNA), small nuclear RNA (snRNA or URNA), transposable
element RNA (e.g. autonomous and non-autonomous transposable RNA),
transfer RNA (tRNA), small nucleolar RNA (snoRNA), Small Cajal body
RNA (scaRNA), ribosomal RNA (rRNA), extracellular RNA (exRNA),
repeat-derived RNA, and long non-coding RNA (lncRNA).
[0330] According to a specific embodiment, non-limiting examples of
RNAi molecules engaged with RISC include, but are not limited to,
small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA
(miRNA), Wiwi-interacting RNA (piRNA), phased small interfering RNA
(phasiRNA), and trans-acting siRNA (tasiRNA).
[0331] According to one embodiment, small RNA molecules processed
from the RNA molecule (e.g. non-coding RNA molecule) of some
embodiments of the invention are capable of recruiting
RNA-dependent RNA Polymerase (RdRp).
[0332] The terms "processed" refer to the biogenesis by which RNA
molecules are cleaved into small RNA form capable of engaging with
RNA-induced silencing complex (RISC). For example, pre-miRNA is
processed into a mature miRNA e.g. by Dicer.
[0333] As used herein, the term "small RNA form" or "small RNAs" or
"small RNA molecules" refers to the mature small RNA being capable
of hybridizing with a target RNA e.g. transcript of the plant gene
(or fragment thereof).
[0334] According to one embodiment, the small RNAs comprise no more
than 250 nucleotides in length, e.g. comprise 20-250, 20-200,
20-150, 20-100, 20-50, 20-40, 20-30, 20-25, 20-26, 30-100, 30-80,
30-60, 30-50, 30-40, 50-150, 50-100, 50-80, 50-70, 100-250,
100-200, 100-150, 150-250, 150-200 nucleotides.
[0335] According to a specific embodiment, the small RNA molecules
comprise 20-50 nucleotides.
[0336] According to a specific embodiment, the small RNA molecules
comprise 20-30 nucleotides.
[0337] According to a specific embodiment, the small RNA molecules
comprise 21-29 nucleotides.
[0338] According to a specific embodiment, the small RNA molecules
comprise 21-24 nucleotides.
[0339] According to a specific embodiment, the small RNA molecules
comprise 21 nucleotides.
[0340] According to a specific embodiment, the small RNA molecules
comprise 22 nucleotides.
[0341] According to a specific embodiment, the small RNA molecules
comprise 23 nucleotides.
[0342] According to a specific embodiment, the small RNA molecules
comprise 24 nucleotides.
[0343] According to a specific embodiment, the small RNA molecules
consist of 20-50 nucleotides.
[0344] According to a specific embodiment, the small RNA molecules
consist of 20-30 nucleotides.
[0345] According to a specific embodiment, the small RNA molecules
consist of 21-29 nucleotides.
[0346] According to a specific embodiment, the small RNA molecules
consist of 21-24 nucleotides.
[0347] According to a specific embodiment, the small RNA molecules
consist of 21 nucleotides.
[0348] According to a specific embodiment, the small RNA molecules
consist of 22 nucleotides.
[0349] According to a specific embodiment, the small RNA molecules
consist of 23 nucleotides.
[0350] According to a specific embodiment, the small RNA molecules
consist of 24 nucleotides.
[0351] According to one embodiment, the small RNA molecules
comprise a silencing activity (i.e. are silencing molecules).
[0352] As mentioned, silencing molecules (e.g. RNA silencing
molecules) of some embodiments of the invention are capable of
recruiting RNA-dependent RNA Polymerase (RdRp).
[0353] The term "RNA-dependent RNA Polymerase" or "RdRp" refers to
the enzyme that catalyzes the replication of RNA from an RNA
template.
[0354] According to one embodiment, the small RNA molecule
comprises an amplifier or primer activity towards the RdRp.
[0355] According to a specific embodiment, the silencing molecule
capable of recruiting the RdRp is selected from microRNA (miRNA),
small interfering RNA (siRNA), short hairpin RNA (shRNA),
Piwi-interacting RNA (piRNA), trans-acting siRNA (tasiRNA), phased
small interfering RNA (phasiRNA), transfer RNA (tRNA), small
nuclear RNA (snRNA), ribosomal RNA (rRNA), small nucleolar RNA
(snoRNA), extracellular RNA (exRNA), a repeat-derived RNA,
autonomous and non-autonomous transposable RNA,
[0356] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 21-24
nucleotides.
[0357] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 21
nucleotides.
[0358] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 22
nucleotides.
[0359] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 23
nucleotides.
[0360] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp comprises 24
nucleotides.
[0361] According to some embodiments of the invention, the
silencing molecule capably: of recruiting the RdRp consists of 21
nucleotides.
[0362] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp consists of 22
nucleotides,
[0363] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp consists of 23
nucleotides.
[0364] According to some embodiments of the invention, the
silencing molecule capable of recruiting the RdRp consists of 24
nucleotides,
[0365] According to a specific embodiment, the silencing molecule
capable of recruiting the RdRp is miRNA.
[0366] According to a specific embodiment, the miRNA comprises a
21-25 nucleotides mature small RNA
[0367] According to a specific embodiment, the miRNA comprises a 21
nucleotides mature small RNA.
[0368] According to a specific embodiment, the miRNA comprises a 22
nucleotides mature small RNA.
[0369] According to a specific embodiment, the miRNA comprises a 23
nucleotides mature small RNA.
[0370] According to a specific embodiment, the miRNA comprises a 24
nucleotides mature small RNA.
[0371] According to a specific embodiment, the miRNA comprises a 25
nucleotides mature small RNA.
[0372] According to a specific embodiment, the miRNA is a 21-25
nucleotides mature small RNA.
[0373] According to a specific embodiment, the miRNA is a 21
nucleotides mature small RNA.
[0374] According to a specific embodiment, the miRNA comprises a 22
nucleotides mature small RNA.
[0375] According to a specific embodiment, the miRNA is a 23
nucleotides mature small RNA.
[0376] According to a specific embodiment, the miRNA is a 24
nucleotides mature small RNA.
[0377] According to a specific embodiment, the miRNA is a 25
nucleotides mature small RNA.
[0378] Exemplary miRNA include, but are not limited to, miR-156a,
miR-156c, miR-162a, miR-162b, miR-167d, miR-169b, miR-173,
miR-393a, miR-393b, miR-402, miR-403, miR-447a, miR-447b, miR-447c,
miR-472, miR-771, miR-777, miR-828, miR-830, miR-831, miR-831,
miR-833a, miR-833a, miR-840, miR-845b, miR-848, miR-850, miR-853,
miR-855, miR-856, miR-864, miR-2933a, miR-2933b, miR-2936,
miR-4221, miR-5024, miR-5629, miR-5648, miR-5996, miR-8166,
miR-8167a, miR-8167b, miR-8167c, miR-8167d, miR-8167e, miR-8167f,
miR-8177, and miR-8182.
[0379] As mentioned above, the method of some embodiments of the
invention comprises modifying a plant endogenous nucleic acid
sequence encoding an RNA molecule so as to impart silencing
specificity towards the plant gene.
[0380] According to one embodiment, when the RNA molecule does not
have an intrinsic silencing activity the method further comprises
introducing into the plant cell a DNA editing agent conferring a
silencing specificity of the RNA molecule towards the plant
gene.
[0381] According to one embodiment, when the RNA molecule has an
intrinsic silencing activity towards a native plant gene, the
method further comprises introducing into the plant cell a DNA
editing agent which redirects a silencing specificity of the RNA
molecule towards the plant gene, the plant gene and the native
plant gene being distinct.
[0382] Methods of modifying nucleic acid sequences are discussed in
detail hereinbelow.
[0383] According to some embodiments, e.g. the second model
described herein, a nucleic acid sequence of a plant gene is
modified so that is encodes a long dsRNA. molecule which imparts a
silencing specificity towards a pest gene. According to some
embodiments, this nucleic acid sequence encodes an RNA molecule
which has an intrinsic silencing activity towards a native plant
gene, such that this modification results with a silencing RNA
having a novel silencing activity (e.g. towards a pest gene) in
addition or instead to the intrinsic silencing activity. Each
possibility represents a separate embodiment of the present
invention.
[0384] Thus, according to another aspect of the present invention
there is provided a method of producing a long dsRNA molecule in a
plant cell that is capable of silencing a pest gene, the method
comprising:
[0385] (a) selecting in a genome of a plant a nucleic acid sequence
encoding a silencing molecule having a plant gene as a target, the
silencing molecule capable of recruiting RNA-dependent RNA
Polymerase (RdRp);
[0386] (b) modifying a nucleic acid sequence of the plant gene so
as to impart a silencing specificity towards the pest gene, such
that a transcript of the plant gene comprising the silencing
specificity forms base complementation with the silencing molecule
capable of recruiting the RdRp to produce the long dsRNA molecule
capable of silencing the pest gene,
[0387] thereby producing the long dsRNA molecule in the plant cell
that is capable of silencing the pest gene.
[0388] According to one embodiment, the plant gene does not encode
for a molecule having an intrinsic silencing activity.
[0389] According to one embodiment, when the plant gene does not
encode for a molecule having an intrinsic silencing activity, the
method further comprises introducing into the plant cell a DNA
editing agent conferring a silencing specificity of the plant gene
towards the pest gene.
[0390] According to one embodiment, the plant gene encodes for a
molecule having an intrinsic silencing activity towards a native
plant gene.
[0391] According to one embodiment, the plant gene having an
intrinsic silencing activity is selected from a microRNA (miRNA), a
small interfering RNA (siRNA), a short hairpin RNA (shRNA), a
Piwi-interacting RNA (piRNA), a trans-acting siRNA (tasiRNA), a
phased small interfering RNA (phasiRNA), a transfer RNA (tRNA), a
small nuclear RNA snRNA), a ribosomal RNA (rRNA), a small nucleolar
RNA (snoRNA), an extracellular RNA (exRNA), a repeat-derived RNA,
an autonomous and a non-autonomous transposable RNA.
[0392] According to some embodiments, the plant gene encoding for
an RNA having the intrinsic silencing activity encodes for a phased
secondary siRNA-producing molecules.
[0393] As used herein, the phrase "phased secondary siRNA-producing
molecule" refers to an RNA transcript which is capable of forming
base complementation with a primary silencing molecule (e.g a
miRNA) which recruits an RNA dependent RNA polymerase (RdRp), thus
being transcribed into a long dsRNA molecule that is, in turn,
processed to secondary silencing RNA molecules (i.e. phased RNAs).
According to some embodiments, the phased secondary siRNA-producing
molecule is selected from the group consisting of a tasiRNA and a
phasiRNA.
[0394] According to some embodiments, the phased secondary
siRNA-producing molecule is capable of being processed to a
plurality of secondary silencing RNA molecules, i.e. at least two
secondary silencing RNA molecules. According to some embodiments,
modifying the gene encoding the phased secondary siRNA-producing
molecule comprises modifying only part of the secondary silencing
RNA molecules formed by processing of this phased secondary
siRNA-producing molecule. According to a particular embodiment,
modifying the gene encoding the phased secondary siRNA-producing
molecule comprises modifying only one secondary silencing RNA
molecules formed by processing of this phased secondary
siRNA-producing molecule. According to some embodiments, modifying
the gene encoding the phased secondary siRNA-producing molecule
comprises modifying at least one secondary silencing RNA molecules
formed by processing of this phased secondary siRNA-producing
molecule. According to other embodiments, modifying the gene
encoding the phased secondary siRNA-producing molecule comprises
modifying all the secondary silencing RNA molecules formed by
processing of this phased secondary siRNA-producing molecule.
Without wishing to be bound by theory or mechanism, modifying a
gene encoding a phased secondary siRNA-producing molecule such that
the silencing specificity of only one of the secondary silencing
RNA molecules is directed towards a new target (e.g. a pest RNA) is
sufficient to induce at least partial silencing of this new
target.
[0395] According to some embodiments, the length of the secondary
silencing RNA molecule sequence to be modified is the length of
secondary silencing molecules within the pest of target (e.g. if a
tasiRNA is processed within a pest such that 24 nt secondary sRNAs
are formed, the sequence of the gene encoding the phased secondary
siRNA-producing molecule in a plant cell is modified such that at
least one 24 nt sequence targets the pest RNA of choice). According
to some embodiments, modifying a nucleic acid sequence of the plant
gene (e.g. a plant gene encoding a phased secondary siRNA-producing
molecule) so as to impart a silencing specificity towards a pest
gene comprises modifying a sequence of 21-30 nt, optionally 2.4 nt,
possibly 30 nt in the plant gene, so that the encoded sequence is
substantially complementary to an RNA encoded by the pest gene.
Each possibility represents a separate embodiment of the present
invention. Without wishing to be bound by theory or mechanism,
modifying a gene encoding a phased secondary siRNA-producing
molecule such that 30 nt of the encoded sequence are complementary
to the pest gene ensures that processing of the long dsRNA (which
might be different than the processing within the plant gene)
results in secondary RNA molecules with a functional silencing
activity in the pest.
[0396] According to a specific embodiment, the plant gene having
the intrinsic silencing activity is a trans-acting-siRNA-producing
(TAS) molecule.
[0397] According to a specific embodiment, the plant gene comprises
a binding site for the silencing molecule.
[0398] According to a specific embodiment, the plant gene comprises
a binding site for the miRNA molecule.
[0399] According to a specific embodiment, the miRNA includes, but
is not limited to, miR-156a, miR-156c, miR-162a, miR-162b,
miR-167d, miR-169b, miR-393a, miR-393b, miR-402, miR-403, miR-447a,
miR-447b, miR-447c, miR-472, miR-771, miR-777, miR-828, miR-830,
miR-831, miR-831, miR-833a, miR-833a, miR-840, miR-845b, miR-848,
miR-850 miR-853, miR-855, miR-856, miR-864, miR-2933a, miR-2933b,
miR-2936, miR-4221, miR-5024, miR-5629, miR-5648, miR-5996,
miR-8166, miR-8167a, miR-8167b, miR-8167c, miR-8167d, miR-8167e,
miR-8167f, miR-8177, and miR-8182.
[0400] According to one embodiment, when the plant gene encodes for
a molecule having an intrinsic silencing activity, the method
further comprises introducing into the plant cell a DNA editing
agent which redirects a silencing specificity of the plant gene
towards the pest gene, the pest gene and the native plant gene
being distinct.
[0401] As used herein, the term "redirects a silencing specificity"
refers to reprogramming the original specificity of the RNA
molecule or the transcript of the plant gene towards a non-natural
target of the RNA molecule or the transcript of the plant gene.
Accordingly, the original specificity of the RNA molecule or the
transcript of the plant gene is abolished (i.e. loss of function)
and the new specificity is towards a target distinct of the natural
target (i.e. RNA of a plant or a pest, respectively), i.e., gain of
function. It will be appreciated that only gain of function occurs
in cases that the RNA molecule or the transcript of the plant gene
has no intrinsic silencing activity.
[0402] As used herein, the term "native plant RNA" refers to a RNA
sequence naturally bound by a RNA molecule (e.g. non-coding RNA
molecule, e.g. silencing molecule). Thus, the native plant RNA
(i.e. transcript of a native plant gene) is considered by the
skilled artisan as a natural substrate (i.e. target) for the RNA
molecule (e.g. non-coding RNA, e.g. silencing molecule).
[0403] As used herein, the term "plant RNA" or "plant target RNA"
refers to a RNA sequence (coding or non-coding) not naturally bound
by a RNA molecule (e.g. non-coding RNA, e.g. silencing molecule).
Thus, the plant RNA (i.e. transcript of a plant gene) is not a
natural substrate (i.e. target) of the RNA molecule (e.g.
non-coding RNA, e.g. silencing molecule).
[0404] As used herein, the term "pest RNA" or "pest target RNA"
refers to a RNA sequence to be silenced by the designed plant RNA
and/or by the generated dsRNA molecules and secondary small RNAs
(generated by processing of the dsRNA). Thus, the pest RNA (i.e.
transcript of a pest gene) is not a natural substrate (i.e. target)
of the plant RNA or the dsRNA or the secondary small molecules.
[0405] As used herein, the phrase "silencing a gene" refers to the
absence or observable reduction in the level of mRNA and/or protein
products from the target gene (e.g. due to co- and/or
post-transcriptional gene silencing). Thus, silencing of a target
gene can be by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%
or 100% as compared to a gene not targeted by the designed RNA
molecules of the invention.
[0406] The consequences of silencing can be confirmed by
examination of the outward properties of a plant cell or whole
plant or other organism (e.g. pest) that take up the designed RNA
from the plant or by biochemical techniques (as further discussed
herein).
[0407] It will be appreciated that the designed RNA molecule of
some embodiments of the invention can have some off-target
specificity effect's provided that it does not affect an
agriculturally valuable trait (e.g., biomass, yield, growth, etc.
of the plant).
[0408] The specific binding of an RNA molecule (e.g. silencing
molecule) with a target RNA can be determined by computational
algorithms (such as BLAST) and verified by methods including e.g.
Northern blot, In Situ hybridization, QuantiGene Plex Assay
etc.
[0409] According to one embodiment, if the RNA molecule is or
processed into a siRNA., the complementarily is in the range of
90-100% (e.g. 100%) to its target sequence.
[0410] According to one embodiment, if the RNA molecule is or
processed into a miRNA or piRNA the complementarity is in the range
of 33-100% to its target sequence.
[0411] According to one embodiment, if the RNA molecule is a miRNA,
the seed sequence complementarity (i.e. nucleotides 2-8 from the
5') is in the range of 85-100% (e.g. 100%) to its target
sequence.
[0412] According to one embodiment, the complementarity to the
target sequence is at least about 33% of the processed small RNA
form (e.g. 33% of the 21-28 nt). Thus, for example, if the RNA
molecule is a miRNA, 33% of the mature miRNA sequence (e.g. 21 nt)
comprises seed complementation (e.g. 7 nt out of the 21 nt).
[0413] According to one embodiment, the complementarity to the
target sequence is at least about 45% of the processed small RNA
form (e.g. 45% of the 21-28 nt). Thus, for example, if the RNA
molecule is a miRNA, 45% of the mature miRNA sequence (e.g. 21 nt)
comprises seed complementation (e.g. 9-10 nt out of the 21 nt).
[0414] According to one embodiment, the RNA molecule or plant RNA
(i.e, prior to modification) is typically selected as one having
about 10%, 20%, 30%, 33%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%,
96%, 97%, 98% or up to 99% complementarity towards the sequence of
the plant RNA or pest RNA, respectively.
[0415] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 99% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0416] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 98% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0417] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 97% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0418] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 96% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0419] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 95% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0420] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 94% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0421] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 93% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0422] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 92% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0423] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 91% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0424] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 90% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0425] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 85% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0426] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 50% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0427] According to a specific embodiment, the RNA molecule or
plant RNA (i.e. prior to modification) is typically selected as one
having no more than 33% complementarity towards the sequence of the
plant RNA or pest RNA, respectively.
[0428] According to one embodiment, the RNA molecule (e.g. RNA
silencing molecule) or plant RNA is designed so as to comprise at
least about 33%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 85%, 90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% complementarity
towards the sequence of the plant RNA or pest RNA,
respectively.
[0429] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 33% complementarity towards the plant RNA or pest RNA,
respectively (e.g. 85-100% seed match).
[0430] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 40% complementarity towards the plant RNA or pest RNA,
respectively.
[0431] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 45% complementarity towards the plant RNA or pest RNA,
respectively.
[0432] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 50% complementarity towards the plant RNA or pest RNA,
respectively.
[0433] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 55% complementarity towards the plant RNA or pest RNA,
respectively.
[0434] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 60% complementarity towards the plant RNA or pest RNA,
respectively.
[0435] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 70% complementarity towards the plant RNA or pest RNA,
respectively.
[0436] According to a specific embodiment, the RNA molecule (e.g,
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 80% complementarity towards the plant RNA or pest RNA,
respectively.
[0437] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 85% complementarity towards the plant RNA or pest RNA,
respectively.
[0438] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 90% complementarity towards the plant RNA or pest RNA,
respectively.
[0439] According to a specific embodiment, the RNA molecule (e.g,
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 91% complementarity towards the plant RNA or pest RNA,
respectively.
[0440] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 92% complementarity towards the plant RNA or pest RNA,
respectively.
[0441] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 93% complementarity towards the plant RNA or pest RNA,
respectively.
[0442] According to a specific embodiment, the RNA molecule (e.g,
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 94% complementarity towards the plant RNA or pest RNA,
respectively.
[0443] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 95% complementarity towards the plant RNA or pest RNA,
respectively.
[0444] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 96% complementarity towards the plant RNA or pest RNA,
respectively.
[0445] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 97% complementarity towards the plant RNA or pest RNA,
respectively.
[0446] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 98% complementarity towards the plant RNA or pest RNA,
respectively.
[0447] According to a specific embodiment, the RNA molecule (e.g,
RNA silencing molecule) or plant RNA is designed so as to comprise
a minimum of 99% complementarity towards the plant RNA or pest RNA,
respectively.
[0448] According to a specific embodiment, the RNA molecule (e.g.
RNA silencing molecule) or plant RNA is designed so as to comprise
100% complementarity towards the plant RNA or pest RNA,
respectively.
[0449] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA the product synthesized by RdRp) is
designed so as to comprise at least about 33%, 40%, 45%, 50%, 55%,
60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or even 100% complementarity towards the sequence of the pest
RNA.
[0450] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g, the product synthesized by
RdRp) is designed so as to comprise a minimum of 33%
complementarity towards the sequence of the pest RNA. (e.g. 85-100%
seed match).
[0451] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant
[0452] RNA (e.g. the product synthesized by RdRp) is designed so as
to comprise a minimum of 40% complementarity towards the sequence
of the pest RNA.
[0453] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 45%
complementarily towards the sequence of the pest RNA.
[0454] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g, the product synthesized by
RdRp) is designed so as to comprise a minimum of 50%
complementarity towards the sequence of the pest RNA.
[0455] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 55%
complementarity towards the sequence of the pest RNA.
[0456] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 60%
complementarily towards the sequence of the pest RNA.
[0457] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 70%
complementarity towards the sequence of the pest RNA.
[0458] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 80%
complementarity towards the sequence of the pest RNA.
[0459] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 85%
complementarily towards the sequence of the pest RNA.
[0460] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 90%
complementarity towards the sequence of the pest RNA.
[0461] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 91%
complementarity towards the sequence of the pest RNA.
[0462] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 92%
complementarily towards the sequence of the pest RNA.
[0463] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 93%
complementarity towards the sequence of the pest RNA.
[0464] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 94%
complementarity towards the sequence of the pest RNA.
[0465] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant
[0466] RNA (e.g. the product synthesized by RdRp) is designed so as
to comprise a minimum of 95% complementarily towards the sequence
of the pest RNA.
[0467] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 96%
complementarity towards the sequence of the pest RNA.
[0468] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 97%
complementarity towards the sequence of the pest RNA.
[0469] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 98%
complementarity towards the sequence of the pest RNA.
[0470] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise a minimum of 99%
complementarity towards the sequence of the pest RNA.
[0471] According to a specific embodiment, the anti-sense strand of
the RNA molecule or plant RNA (e.g. the product synthesized by
RdRp) is designed so as to comprise 100% complementarity towards
the sequence of the pest RNA.
[0472] In order to induce silencing activity and/or specificity of
a RNA moleculeor a plant RNA or redirect a silencing activity
and/or specificity of a RNA molecule or a plant RNA (e.g. RNA
silencing molecule) towards a plant RNA or pest RNA, the gene
encoding a RNA molecule or the plant RNA (e.g. RNA silencing
molecule) is modified using a DNA editing agent.
[0473] Following is a description of various non-limiting examples
of methods and DNA editing agents used to introduce nucleic acid
alterations to a gene and agents for implementing same that can be
used according to specific embodiments of the present
disclosure.
[0474] Genome Editing using engineered endonucleases--this approach
refers to a reverse genetics method using artificially engineered
or modified naturally occurring nucleases to typically cut and
create specific double-stranded breaks (DSB) at a desired
location(s) in the genome, which are then repaired by cellular
endogenous processes such as, homologous recombination (HR) or
non-homologous end-joining (NHEJ). NHEJ directly joins the DNA ends
in a double-stranded break (DSB) with or without minimal ends
trimming, while HR utilizes a homologous donor sequence as a
template (i.e. the sister chromatid formed during S-phase) for
regenerating/copying the missing DNA sequence at the break site. In
order to introduce specific nucleotide modifications to the genomic
DNA, a donor DNA repair template containing the desired sequence
must be present during HR (exogenously provided single stranded or
double stranded DNA).
[0475] Genome editing cannot be performed using traditional
restriction endonucleases since most restriction enzymes recognize
a few base pairs on the DNA as their target and these sequences
often will be found in many locations across the genome resulting
in multiple cuts which are not limited to a desired location. To
overcome this challenge and create site-specific single- or
double-stranded breaks (DSBs), several distinct classes of
nucleases have been discovered and bioengineered to date. These
include the meganucleases, Zinc finger nucleases (ZFNs),
transcription-activator like effector nucleases (TALENs) and
CRISPR/Cas9 system.
[0476] Meganucleases--Meganucleases (also known as homing
endonucleases) are commonly grouped into at least five four
families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box
family and the HNH family and PD-(D/E)xK, which are related to
EDxHD enzymes and are considered by some as a separate family.
These families are characterized by structural motifs, which affect
catalytic activity and recognition sequence. For instance, members
of the LAGLIDADG family are characterized by having either one or
two copies of the conserved LAGLIDADG motif. The four families of
meganucleases are widely separated from one another with respect to
conserved structural elements and, consequently, DNA recognition
sequence specificity and catalytic activity. Meganucleases are
found commonly in microbial species and have the unique property of
having very long recognition sequences (>14 bp) thus making them
naturally very specific for cutting at a desired location.
[0477] This can be exploited to make site-specific double-stranded
breaks (DSBs) in genome editing. One of skill in the art can use
these naturally occurring meganucleases, however the number of such
naturally occurring meganucleases is limited. To overcome this
challenge, mutagenesis and high throughput screening methods have
been used to create meganuclease variants that recognize unique
sequences. For example, various meganucleases have been fused to
create hybrid enzymes that recognize a new sequence.
[0478] Alternatively, DNA interacting amino acids of the
meganuclease can be altered to design sequence specific
meganucleases e.g., U.S. Pat. No. 8,021,867). Meganucleases can be
designed using the methods described in Certo, MT et al. Nature
Methods (2012) 9:073-975; U.S. Pat. Nos. 8,304,222; 8,021,867;
8,119,381; 8,124,369; 8,129,134; 8,133,697; 8,143,015; 8,143,016;
8,148,098; or 8,163,514, the contents of each are incorporated
herein by reference in their entirety. Alternatively, meganucleases
with site specific cutting characteristics can be obtained using
commercially available technologies e.g., Precision Biosciences'
Directed Nuclease Editor.TM. genome editing technology.
[0479] ZFNs and TALENs--Two distinct classes of engineered
nucleases, zinc-finger nucleases (ZFNs) and transcription
activator-like effector nucleases (TALENs), have both proven to be
effective at producing targeted double-stranded breaks (DSBs)
(Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz
et al., 2011; Miller et al., 2010).
[0480] Basically, ZFNs and TALENs restriction endonuclease
technology utilizes a non-specific DNA cutting enzyme which is
linked to a specific DNA binding domain (either a series of zinc
finger domains or TALE repeats, respectively). Typically a
restriction enzyme whose DNA recognition site and cleaving site are
separate from each other is selected. The cleaving portion is
separated and then linked to a DNA binding domain, thereby yielding
an endonuclease with very high specificity for a desired sequence.
An exemplary restriction enzyme with such properties is Fokl.
Additionally Fokl has the advantage of requiring dimerization to
have nuclease activity and this means the specificity increases
dramatically as each nuclease partner recognizes a unique DNA
sequence. To enhance this effect, Fokl nucleases have been
engineered that can only function as heterodimers and have
increased catalytic activity. The heterodimer functioning nucleases
avoid the possibility of unwanted homodimer activity and thus
increase specificity of the double-stranded break (DSB).
[0481] Thus, for example to target a specific site, ZFNs and TALENs
are constructed as nuclease pairs, with each member of the pair
designed to bind adjacent sequences at the targeted site. Upon
transient expression in cells, the nucleases bind to their target
sites and the Fokl domains heterodimerize to create a
double-stranded break (DSB). Repair of these double-stranded breaks
(DSBs) through the non-homologous end-joining (NHEJ) pathway often
results in small deletions or small sequence insertions (Indels).
Since each repair made by NHEJ is unique, the use of a single
nuclease pair can produce an allelic series with a range of
different insertions or deletions at the target site.
[0482] In general NHEJ is relatively accurate (about 85% of DSBs in
human cells are repaired by NHEJ within about 30 min from
detection) in gene editing erroneous NHEJ is relied upon as when
the repair is accurate the nuclease will keep cutting until the
repair product is mutagenic and the recognition/cut site/PAM motif
is gone/mutated or that the transiently introduced nuclease is no
longer present.
[0483] The deletions typically range anywhere from a few base pairs
to a few hundred base pairs in length, but larger deletions have
been successfully generated in cell culture by using two pairs of
nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010).
In addition, when a fragment of DNA with homology to the targeted
region is introduced in conjunction with the nuclease pair, the
double-stranded break (DSB) can be repaired via homologous
recombination (HR) to generate specific modifications (Li et al.,
2011; Miller et al., 2010; Urnov et al., 2005).
[0484] Although the nuclease portions of both ZFNs and TALENs have
similar properties, the difference between these engineered
nucleases is in their DNA recognition peptide. ZFNs rely on
Cys2-His2 zinc fingers and. TALENs on TALEs. Both of these DNA
recognizing peptide domains have the characteristic that they are
naturally found in combinations in their proteins. Cys2-His2 Zinc
fingers are typically found in repeats that are 3 bp apart and are
found in diverse combinations in a variety of nucleic acid
interacting proteins. TALEs on the other hand are found in repeats
with a one-to-one recognition ratio between the amino acids and the
recognized nucleotide pairs. Because both zinc fingers and TALEs
happen in repeated patterns, different combinations can be tried to
create a wide variety of sequence specificities. Approaches for
making site-specific zinc finger endonucleases include, e.g.,
modular assembly (where Zinc fingers correlated with a triplet
sequence are attached in a row to cover the required sequence),
OPEN (low-stringency selection of peptide domains vs. triplet
nucleotides followed by high-stringency selections of peptide
combination vs. the final target in bacterial systems), and
bacterial one-hybrid screening of zinc finger libraries, among
others. ZFNs can also be designed and obtained commercially from
e.g., Sangamo Biosciences.TM. (Richmond, Calif.).
[0485] Method for designing and obtaining TALENs are described in
e.g. Reyon et al. Nature Biotechnology 2012 May; 30(5)460-5; Miller
et al. Nat Biotechnol. (2011) 29: 143-148; Cermak et al. Nucleic
Acids Research (2011) 39 (12): e82 and Zhang et al. Nature
Biotechnology (2011) 29 (2): 149-53. A recently developed web-based
program named Mojo Hand was introduced by Mayo Clinic for designing
TAL and TALEN constructs for genome editing applications (can be
accessed through www(dot)talendesign(dot)org). TALEN can also be
designed and obtained commercially from e.g., Sangamo
Biosciences.TM. (Richmond, Calif.).
[0486] T-GEE system (TargetGene's Genome Editing Engine)--A
programmable nucleoprotein molecular complex containing a
polypeptide moiety and a specificity conferring nucleic acid (SCNA)
which assembles in-vivo, in a target cell, and is capable of
interacting with the predetermined target nucleic acid sequence is
provided. The programmable nucleoprotein molecular complex is
capable of specifically modifying and/or editing a target site
within the target nucleic acid sequence and/or modifying the
function of the target nucleic acid sequence. Nucleoprotein
composition comprises (a) polynucleotide molecule encoding a
chimeric polypeptide and comprising (i) a functional domain capable
of modifying the target site, and (ii) a linking domain that is
capable of interacting with a specificity conferring nucleic acid,
and (b) specificity conferring nucleic acid (SCNA) comprising (i) a
nucleotide sequence complementary to a region of the target nucleic
acid flanking the target site, and (ii) a recognition region
capable of specifically attaching to the linking domain of the
polypeptide. The composition enables modifying a predetermined
nucleic acid sequence target precisely, reliably and
cost-effectively with high specificity and binding capabilities of
molecular complex to the target nucleic acid through base-pairing
of specificity-conferring nucleic acid and a target nucleic acid.
The composition is less genotoxic, modular in their assembly,
utilize single platform without customization, practical for
independent use outside of specialized core-facilities, and has
shorter development time frame and reduced costs.
[0487] CRISPR-Cas system and all its variants (also referred to
herein as "CRISPR")--Many bacteria and archea contain endogenous
RNA-based adaptive immune systems that can degrade nucleic acids of
invading phages and plasmids. These systems consist of clustered
regularly interspaced short palindromic repeat (CRISPR) nucleotide
sequences that produce RNA components and CRISPR associated (Cas)
genes that encode protein components. The CRISPR RNAs (crRNAs)
contain short stretches of homology to the DNA of specific viruses
and plasmids and act as guides to direct Cas nucleases to degrade
the complementary nucleic acids of the corresponding pathogen.
Studies of the type II CIUSPR/Cas system of Streptococcus pyogenes
have shown that three components form a RNA/protein complex and
together are sufficient for sequence-specific nuclease activity:
the Cas9 nuclease, a crRNA containing 20 base pairs of homology to
the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek
et al. Science (2012) 337: 816-821).
[0488] It was further demonstrated that a synthetic chimeric guide
RNA (gRNA) composed of a fusion between crRNA and tracrRNA could
direct Cas9 to cleave DNA targets that are complementary to the
crRNA in vitro. It was also demonstrated that transient expression
of Cas9 in conjunction with synthetic gRNAs can be used to produce
targeted double-stranded breaks (DSBs) in a variety of different
species (Cho et al, 2013; Cong et al., 2013; DiCarlo et al., 2013;
Hwang et al., 2013a,b; Jinek et al, 2013; Mali et al., 2013).
[0489] The CRISPR/Cas system for genome editing contains two
distinct components: a sgRNA and an endonuclease e.g. Cas9.
[0490] The gRNA (also referred to herein as short guide RNA
(sgRNA)) is typically a 20-nucleotide sequence encoding a
combination of the target homologous sequence (crRNA) and the
endogenous bacterial RNA that links the crRNA to the Cas9 nuclease
(tracrRNA) in a single chimeric transcript. The sgRNA/Cas9 complex
is recruited to the target sequence by the base-pairing between the
sgRNA sequence and the complement genomic DNA. For successful
binding of Cas9, the genomic target sequence must also contain the
correct Protospacer Adjacent Motif (PAM) sequence immediately
following the target sequence. The binding of the sgRNA/Cas9
complex localizes the Cas9 to the genomic target sequence so that
the Cas9 can cut both strands of the DNA causing a double-strand
break (DSB). Just as with ZFNs and TALENs, the double-stranded
breaks (DSBs) produced by CRISPR/Cas can undergo homologous
recombination or NHEJ and are susceptible to specific sequence
modification during DNA repair.
[0491] The Cas9 nuclease has two functional domains: RuvC and HNH,
each cutting a different DNA strand. When both of these domains are
active, the Cas9 causes double strand breaks (DSBs) in the genomic
DNA.
[0492] A significant advantage of CRISPR/Cas is that the high
efficiency of this system is coupled with the ability to easily
create synthetic gRNAs. This creates a system that can be readily
modified to target modifications at different genomic sites and/or
to target different modifications at the same site. Additionally,
protocols have been established which enable simultaneous targeting
of multiple genes. The majority of cells carrying the mutation
present biallelic mutations in the targeted genes.
[0493] However, apparent flexibility in the base-pairing
interactions between the sgRNA sequence and the genomic DNA target
sequence allows imperfect matches to the target sequence to be cut
by Cas9.
[0494] Modified versions of the Cas9 enzyme containing a single
inactive catalytic domain, either RuvC- or HNH-, are called
`nickases`. With only one active nuclease domain, the Cas9 nickase
cuts only one strand of the target DNA, creating a single-strand
break or `nick`. A single-strand break, or nick, is mostly repaired
by single strand break repair mechanism involving proteins such as
but not only, PARP (sensor) and XRCC1/LIG III complex (ligation).
If a single strand break (SSB) is generated by topoisomerase I
poisons or by drugs that trap PARP1 on naturally occurring SSBs
then these could persist and when the cell enters into S-phase and
the replication fork encounter such SSBs they will become single
ended DSBs which can only be repaired by HR. However, two proximal,
opposite strand nicks introduced by a Cas9 nickase are treated as a
double-strand break, in what is often referred to as a `double
nick` CRISPR system. A double-nick, which is basically non-parallel
DSB, can be repaired like other DSBs by HR or NHEJ depending on the
desired effect on the gene target and the presence of a donor
sequence and the cell cycle stage (HR is of much lower abundance
and can only occur in S and G2 stages of the cell cycle). Thus, if
specificity and reduced off-target effects are crucial, using the
Cas9 nickase to create a double-nick by designing two sgRNAs with
target sequences in close proximity and on opposite strands of the
genomic DNA would decrease off-target effect as either sgRNA alone
will result in nicks that are not likely to change the genomic DNA,
even though these events are not impossible.
[0495] Modified versions of the Cas9 enzyme containing two inactive
catalytic domains (dead Cas9, or dCas9) have no nuclease activity
while still able to bind to DNA based on sgRNA specificity. The
dCas9 can be utilized as a platform for DNA transcriptional
regulators to activate or repress gene expression by fusing the
inactive enzyme to known regulatory domains. For example, the
binding of dCas9 alone to a target sequence in genomic DNA can
interfere with gene transcription.
[0496] Additional variants of Cas9 which may be used by some
embodiments of the invention include, but are not limited to, CasX
and Cpf1. CasX enzymes comprise a distinct family of RNA-guided
genome editors which are smaller in size compared to Cas9 and are
found in bacteria (which is typically not found in humans), hence,
are less likely to provoke the immune system/response in a human.
Also, CasX utilizes a different PAM motif compared to Cas9 and
therefore can be used to target sequences in which Cas9 PAM motifs
are not found [see Liu J J et al., Nature. (2019)
566(7743):218-223.].Cpf1, also referred to as Cas12a, is especially
advantageous for editing AT rich regions in which Cas9 PAMs (NGG)
are much less abundant [see Li T et al., Biotechnol Adv. (2019)
37(0:21-27; Murugan K et al., Mol Cell (2017) 68(1):15-25].
[0497] According to another embodiment, the CRISPR system may be
fused with various effector domains, such as DNA cleavage domains.
The DNA cleavage domain can be obtained from any endonuclease or
exonuclease. Non-limiting examples of endonucleases from which a
DNA cleavage domain can be derived include, but are not limited to,
restriction endonucleases and homing endonucleases (see, for
example, New England Biolabs Catalog or Belfort et al. (1997)
Nucleic Acids Res.). In exemplary embodiments, the cleavage domain
of the CRISPR system is a Fokl endonuclease domain or a modified
Fokl endonuclease domain. In addition, the use of Homing
Endonucleases (HE) is another alternative. HEs are small proteins
(<300 amino acids) found in bacteria, archaea, and in
unicellular eukaryotes. A distinguishing characteristic of HEs is
that they recognize relatively long sequences (14-40 bp) compared
to other site-specific endonucleases such as restriction enzymes
(4-8 bp). HEs have been historically categorized by small conserved
amino acid motifs. At least five such families have been
identified: LAGLIDADG; GIY-YIG; HNH; His-Cys Box and PD-(D/E)xK,
which are related to EDxHD enzymes and are considered by some as a
separate family. At a structural level, the HNH and His-Cys Box
share a common fold (designated .beta..beta..alpha.-metal) as do
the PD-(D/E)xK and EDxHD enzymes. The catalytic and DNA recognition
strategies for each of the families vary and lend themselves to
different degrees to engineering for a variety of applications. See
e.g. Methods Mol Biol (2014) 1123:1-26. Exemplary Homing
Endonucleases which may be used according to some embodiments of
the invention include, without being limited to, I-CreI, I-TevI,
I-HmuI, I-PpoI and I-Ssp68031.
[0498] Modified versions of CRISPR, e.g. dead CRISPR
(dCRISPR-endonuclease), may also be utilized for CRISPR
transcription inhibition (CRISPRi) or CRISPR transcription
activation (CRISPRa) see e.g. Kampmann M., ACS Chem Biol. (2018)
13(2):406-416; La Russa M F and Qi L S., Mol Cell Biol (2015)
35(22):3800-9].
[0499] Other versions of CRISPR which may be used according to some
embodiments of the invention include genome editing using
components from CRISPR systems together with other enzymes to
directly install point mutations into cellular DNA or RNA.
[0500] Thus, according to one embodiment, the editing agent is DNA
or RNA editing agent.
[0501] According to one embodiment, the DNA or RNA editing agent
elicits base editing.
[0502] The term "base editing" as used herein refers to installing
point mutations into cellular DNA or RNA without making
double-stranded or single-stranded DNA breaks.
[0503] In base editing, DNA base editors typically comprise fusions
between a catalytically impaired Cas nuclease and a base
modification enzyme that operates on single-stranded DNA (ssDNA).
Upon binding to its target DNA locus, base pairing between the gRNA
and the target DNA strand leads to displacement of a small segment
of single-stranded DNA in an `R loop`. DNA bases within this ssDNA
bubble are modified by the base-editing enzyme (e.g. deaminase
enzyme). To improve efficiency in eukaryotic cells, the
catalytically disabled nuclease also generates a nick in the
non-edited DNA strand, inducing cells to repair the non-edited
strand using the edited strand as a template.
[0504] Two classes of DNA base editor have been described: cytosine
base editors (CBEs) convert a C-G base pair into a T-A base pair,
and adenine base editors (ABEs) convert an A-T base pair into a G-C
base pair. Collectively, CBEs and ABEs can mediate all four
possible transition mutations (C to T, A to G, T to C and G to A).
Similarly in RNA, targeted adenosine conversion to inosine utilizes
both antisense and Cas13-guided RNA--targeting methods.
[0505] According to one embodiment, the DNA or RNA editing agent
comprises a catalytically inactive endonuclease (e.g.
CRISPR-dCas).
[0506] According to one embodiment, the catalytically inactive
endonuclease is an inactive Cas9 (e.g. dCas9).
[0507] According to one embodiment, the catalytically inactive
endonuclease is an inactive Cas13 (e.g. dCas13).
[0508] According to one embodiment, the DNA or RNA editing agent
comprises an enzyme which is capable of epigenetic editing (i.e.
providing chemical changes to the DNA, the RNA or the histone
proteins).
[0509] Exemplary enzymes include, but are not limited to, DNA
methyltransferases, methylases, acetyltransferases. More
specifically, exemplary enzymes include e.g. DNA
(cytosine-5)-methyltransferase 3A (DNMT3a), Histone
acetyltransferase p300, Ten-eleven translocation methylcytosine
dioxygenase 1 (TET 1), Lysine (K)-specific demethylase 1A (LSD1)
and Calcium and integrin binding protein 1 (CIB1).
[0510] In addition to the catalytically disabled nuclease, the DNA
or RNA editing agents of the invention may also comprise a
nucleobase deaminase enzyme and/or a DNA glycosylase inhibitor.
[0511] According to a specific embodiment, the DNA or RNA editing
agents comprise BE1 (APOBEC1-XTEN-dCas9), BE2
(APOBEC1-XTEN-dCas9-UGI) or BE3 (APOBEC-XTEN-dCas9(A840H)-UGI),
along with sgRNA. APOBEC1 is a deaminase full length or
catalytically active fragment, XTEN is a protein linker, UGI is
uracil DNA glycosylase inhibitor to prevent the subsequent U:G
mismatch from being repaired back to a C:G base pair and dCas9
(A840H) is a nickase in which the dCas9 was reverted to restore the
catalytic activity of the HNH domain which nicks only the
non-edited strand, simulating newly synthesized DNA and leading to
the desired U:A product.
[0512] Additional enzymes which can be used for base editing
according to some embodiments of the invention are specified in
Rees and Liu, Nature Reviews Genetics (2018) 19:770-788,
incorporated herein by reference in its entirety.
[0513] There are a number of publicly available tools available to
help choose and/or design target sequences as well as lists of
bioinformatically determined unique sgRNAs for different genes in
different species such as, but not limited to, the Feng Zhang lab's
Target Finder, the Michael Boutros lab's Target Finder (E-CRISP),
the RGEN Tools: Cas-OFFinder, the CasFinder: Flexible algorithm for
identifying specific Cas9 targets in genomes and the CRISPR Optimal
Target Finder.
[0514] In order to use the CRISPR system, both sgRNA and a Cas
endonuclease (e.g. Cas9) should be expressed or present (e.g., as a
ribonucleoprotein complex) in a target cell. The insertion vector
can contain both cassettes on a single plasmid or the cassettes are
expressed from two separate plasmids. CRISPR plasmids are
commercially available such as the px330 plasmid from Addgene (75
Sidney St, Suite 550A. Cambridge, Mass. 02139). Use of clustered
regularly interspaced short palindromic repeats (CRISPR)-associated
(Cas)-guide RNA technology and a Cas endonuclease for modifying
plant genomes are also at least disclosed by Svitashev et al.,
2015, Plant Physiology, 169 (2): 931-945; Kumar and. Jain, 2015, J
Exp Bot 66: 47-57; and in U.S. Patent Application Publication No.
20150082478, which is specifically incorporated herein by reference
in its entirety. Cas endonucleases that can be used to effect DNA
editing with sgRNA include, but are not limited to, Cas9, Cpf1
(Zetsche et al., 2015, Cell. 163(3):759-71), C2c1, C2c2, and C2c3
(Shmakov et al., Mol Cell. 2015 Nov. 5;60(3):385-97).
[0515] "Hit and run" or "in-out"--involves a two-step recombination
procedure. In the first step, an insertion-type vector containing a
dual positive/negative selectable marker cassette is used to
introduce the desired sequence alteration. The insertion vector
contains a single continuous region of homology to the targeted
locus and is modified to carry the mutation of interest. This
targeting construct is linearized with a restriction enzyme at a
one site within the region of homology, introduced into the cells,
and positive selection is performed to isolate homologous
recombination mediated events. The DNA carrying the homologous
sequence can be provided as a plasmid, single or double stranded
oligo. These homologous recombinants contain a local duplication
that is separated by intervening vector sequence, including the
selection cassette. In the second step, targeted clones are
subjected to negative selection to identify cells that have lost
the selection cassette via intra-chromosomal recombination between
the duplicated sequences. The local recombination event removes the
duplication and, depending on the site of recombination, the allele
either retains the introduced mutation or reverts to wild type. The
end result is the introduction of the desired modification without
the retention of any exogenous sequences.
[0516] The "double-replacement" or "tag and exchange"
strategy--involves a two-step selection procedure similar to the
hit and run approach, but requires the use of two different
targeting constructs. In the first step, a standard targeting
vector with 3' and 5' homology arms is used to insert a dual
positive/negative selectable cassette near the location where the
mutation is to he introduced. After the system components have been
introduced to the cell and positive selection applied, HR mediated
events could be identified. Next, a second targeting vector that
contains a region of homology with the desired mutation is
introduced into targeted clones, and negative selection is applied
to remove the selection cassette and introduce the mutation. The
final allele contains the desired mutation while eliminating
unwanted exogenous sequences.
[0517] According to a specific embodiment, the DNA editing agent
comprises a DNA targeting module (e.g., sgRNA).
[0518] According to a specific embodiment, the DNA editing agent
does not comprise an endonuclease.
[0519] According to a specific embodiment, the DNA editing agent
comprises a nuclease (e.g. an endonuclease) and a DNA targeting
module (e.g., sgRNA).
[0520] According to a specific embodiment, the DNA editing agent is
CRISPR/Cas, e.g. sgRNA and Cas9.
[0521] According to a specific embodiment, the DNA editing agent is
TALEN.
[0522] According to a specific embodiment, the DNA editing agent is
ZFN.
[0523] According to a specific embodiment, the DNA editing agent is
meganuclease.
[0524] According to a specific embodiment, the DNA editing agent
comprises a CRISPR. endonuclease and an sgRNA directed at cutting
the plant gene.
[0525] According to a specific embodiment, an oligonucleotide
serving as a template for Homology Dependent Recombination (HDR) is
introduced to the cell together with the DNA editing agent, wherein
the oligonucleotide comprises a sequence of the plant gene with
nucleotide changes which enable modifying the nucleic acid sequence
of the plant gene so as to impart a silencing specificity towards
the pest gene.
[0526] According to one embodiment, the DNA editing agent is linked
to a reporter for monitoring expression in a plant cell.
[0527] According to one embodiment, the reporter is a fluorescent
reporter protein.
[0528] The term "a fluorescent protein" refers to a polypeptide
that emits fluorescence and is typically detectable by flow
cytometry, microscopy or any fluorescent imaging system, therefore
can be used as a basis for selection of cells expressing such a
protein.
[0529] Examples of fluorescent proteins that can be used as
reporters are, without being limited to, the Green Fluorescent
Protein (GFP), the Blue Fluorescent Protein (BFP) and the red
fluorescent proteins (e.g. dsRed, mCherry, RFP). A non-limiting
list of fluorescent or other reporters includes proteins detectable
by luminescence (e.g. luciferase) or colorimetric assay (e.g. GUS).
According to a specific embodiment, the fluorescent reporter is a
red fluorescent protein (e.g. dsRed, mCherry, RFP) or GFP.
[0530] A review of new classes of fluorescent proteins and
applications can be found in Trends in Biochemical Sciences
[Rodriguez, Erik A.; Campbell, Robert E; Lin, John Y.; Lin, Michael
Z.; Miyawaki, Atsushi; Palmer, Amy E.; Shu, Xiaokun; Zhang, Jim;
Tsien, Roger Y. "The Growing and Glowing Toolbox of Fluorescent and
Photoactive Proteins". Trends in Biochemical Sciences.
doi:10.10.16/j.tibs.2016.09.010].
[0531] According to another embodiment, the reporter is an
endogenous gene of a plant. An exemplary reporter is the phytoene
desaturase gene (PDS3) which encodes one of the important enzymes
in the carotenoid biosynthesis pathway. Its silencing produces an
albino/bleached phenotype. Accordingly, plants with reduced
expression of PDS3 exhibit reduced chlorophyll levels, up to
complete albino and dwarfism. Additional genes which can be used in
accordance with the present teachings include, but are not limited
to, genes which take part in crop protection.
[0532] According to another embodiment, the reporter is an
antibiotic selection marker. Examples of antibiotic selection
markers that can be used as reporters are, without being limited
to, neomycin phosphotransferase II (nptII) and hygromycin
phosphotransferase (hpt). Additional marker genes which can be used
in accordance with the present teachings include, but are not
limited to, gentamycin acetyltransferase (accC3) resistance and
bleomycin and phleomycin resistance genes.
[0533] It will be appreciated that the enzyme NPTII inactivates by
phosphorylation a number of aminoglycoside antibiotics such as
kanamycin, neomycin, geneticin (or G418) and paromomycin. Of these,
kanamycin, neomycin and paromomycin are used in a diverse range of
plant species.
[0534] According to another embodiment, the reporter is a toxic
selection marker. An exemplary toxic selection marker that can be
used as a reporter is, without being limited to, allyl alcohol
selection using the Alcohol dehydrogenase (ADH1) gene. ADH1,
comprising a group of dehydrogenase enzymes which catalyse the
interconversion between alcohols and aldehydes or ketones with the
concomitant reduction of NAD+ or NADP+, breaks down alcoholic toxic
substances within tissues. Plants harbouring reduced ADH1
expression exhibit increase tolerance to allyl alcohol.
Accordingly, plants with reduced ADH1 are resistant to the toxic
effect of allyl alcohol.
[0535] Regardless of the DNA editing agent used, the method of the
invention is employed such that the gene encoding the RNA molecule
or the plant gene (e.g. RNA silencing molecule) is modified by at
least one of a deletion, an insertion or a point mutation.
[0536] According to one embodiment, the modification is in a
structured region of a non-coding RNA molecule (e.g. RNA silencing
molecule).
[0537] According to one embodiment, the modification is in a stem
region of a non-coding RNA molecule (e.g. RNA silencing
molecule).
[0538] According to one embodiment, the modification is in a loop
region of a non-coding RNA molecule (e.g. RNA silencing
molecule).
[0539] According to one embodiment, the modification is in a stem
region and a loop region of a non-coding RNA molecule (e.g. RNA
silencing molecule).
[0540] According to one embodiment, the modification is in a
non-structured region of a non-coding RNA molecule (e.g. RNA
silencing molecule).
[0541] According to one embodiment, the modification is in a stem
region and a loop region and in non-structured region of a
non-coding RNA molecule (e.g. RNA silencing molecule).
[0542] According to a specific embodiment, the modification
comprises a modification of about 10-250 nucleotides, about 10-200
nucleotides, about 10-150 nucleotides, about 10-100 nucleotides,
about 10-50 nucleotides, about 1-50 nucleotides, about 1-10
nucleotides, about 50-150 nucleotides, about 50-100 nucleotides or
about 100-200 nucleotides (as compared to the native plant RNA or
native RNA molecule, e.g. RNA silencing molecule).
[0543] According to one embodiment, the modification comprises a
modification of at most 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42,
44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160,
170, 180, 190, 200 or at most 250 nucleotides (as compared to the
native plant RNA or native RNA molecule, e.g. RNA silencing
molecule).
[0544] According to one embodiment, the modification can be in a
consecutive nucleic acid sequence (e.g. at least 5, 10, 20, 30, 40,
50, 100, 150, 200 bases)
[0545] According to one embodiment, the modification can be in a
non-consecutive manner, e.g. throughout a 20, 50, 100, 150, 200,
500, 1000 nucleic acid sequence.
[0546] According to a specific embodiment, the modification
comprises a modification of at most 200 nucleotides.
[0547] According to a specific embodiment, the modification
comprises a modification of at most 150 nucleotides.
[0548] According to a specific embodiment, the modification
comprises a modification of at most 100 nucleotides.
[0549] According to a specific embodiment, the modification
comprises a modification of at most 50 nucleotides.
[0550] According to a specific embodiment, the modification
comprises a modification of at most 25 nucleotides.
[0551] According to a specific embodiment, the modification
comprises a modification of at most 20 nucleotides.
[0552] According to a specific embodiment, the modification
comprises a modification of at most 15 nucleotides.
[0553] According to a specific embodiment, the modification
comprises a modification of at most 10 nucleotides.
[0554] According to a specific embodiment, the modification
comprises a modification of at most 5 nucleotides.
[0555] According to one embodiment, the modification depends on the
structure of the RNA molecule (e.g. silencing molecule).
[0556] Accordingly, when the RNA molecule contains a non-essential
structure (i.e. a secondary structure of a RNA silencing molecule
which does not play a role in its proper biogenesis and/or
function) or is purely dsRNA (i.e. the RNA silencing molecule
having a perfect or almost perfect dsRNA), a few modifications
(e.g. 20-30 nucleotides, e.g. 1-10 nucleotides, e.g. 5 nucleotides)
are introduced in order to redirect the silence specificity of the
RNA molecule.
[0557] According to another embodiment, when the RNA molecule has
an essential structure (i.e. the proper biogenesis and/or activity
of the RNA silencing molecule is dependent on its secondary
structure), larger modifications (e.g. 10-200 nucleotides, e.g.
50-150 nucleotides, e.g., more than 30 nucleotides and not
exceeding 200 nucleotides, 30-200 nucleotides, 35-200 nucleotides,
35-150 nucleotides, 35-100 nucleotides) are introduced in order to
redirect the silence specificity of the RNA molecule.
[0558] According to one embodiment, the modification is such that
the recognition/cut site/PAM motif of the RNA silencing molecule is
modified to abolish the original PAM recognition site.
[0559] According to a specific embodiment, the modification is in
at least 1, 2., 4, 5, 6, 7, 8, 9, 10 or more nucleic acids in a PAM
motif.
[0560] According to one embodiment, the modification comprises an
insertion.
[0561] According to a specific embodiment, the insertion comprises
an insertion of about 10-250 nucleotides, about 10-200 nucleotides,
about 10-150 nucleotides, about 10-100 nucleotides, about 10-50
nucleotides, about 1-50 nucleotides, about 1-10 nucleotides, about
50-150 nucleotides, about 50-100 nucleotides or about 100-200
nucleotides (as compared to the native plant RNA or native RNA
molecule, e.g. RNA silencing molecule).
[0562] According to one embodiment, the insertion comprises an
insertion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42,
44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160,
170, 180, 190, 200 or at most 250 nucleotides (as compared to the
native plant RNA or native RNA molecule, e.g. RNA silencing
molecule).
[0563] According to a specific embodiment, the insertion comprises
an insertion of at most 200 nucleotides.
[0564] According to a specific embodiment, the insertion comprises
an insertion of at most 150 nucleotides.
[0565] According to a specific embodiment, the insertion comprises
an insertion of at most 100 nucleotides.
[0566] According to a specific embodiment, the insertion comprises
an insertion of at most 50 nucleotides.
[0567] According to a specific embodiment, the insertion comprises
an insertion of at most 25 nucleotides.
[0568] According to a specific embodiment, the insertion comprises
an insertion of at most 20 nucleotides.
[0569] According to a specific embodiment, the insertion comprises
an insertion of at most 15 nucleotides.
[0570] According to a specific embodiment, the insertion comprises
an insertion of at most 10 nucleotides.
[0571] According to a specific embodiment, the insertion comprises
an insertion of at most 5 nucleotides.
[0572] According to one embodiment, the modification comprises a
deletion.
[0573] According to a specific embodiment, the deletion comprises a
deletion of about 10-250 nucleotides, about 10-200 nucleotides,
about 10-150 nucleotides, about 10-100 nucleotides, about 10-50
nucleotides, about 1-50 nucleotides, about 1-10 nucleotides, about
50-150 nucleotides, about 50-100 nucleotides or about 100-200
nucleotides (as compared to the native plant RNA or native RNA
molecule, e.g. RNA silencing molecule).
[0574] According to one embodiment, the deletion comprises a
deletion of at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42,
44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160,
170, 180, 190, 200 or at most 250 nucleotides (as compared to the
native plant RNA or native RNA molecule, e.g. RNA silencing
molecule).
[0575] According to a specific embodiment, the deletion comprises a
deletion of at most 200 nucleotides.
[0576] According to a specific embodiment, the deletion comprises a
deletion of at most 150 nucleotides.
[0577] According to a specific embodiment, the deletion comprises a
deletion of at most 100 nucleotides.
[0578] According to a specific embodiment, the deletion comprises a
deletion of at most 50 nucleotides.
[0579] According to a specific embodiment, the deletion comprises a
deletion of at most 25 nucleotides.
[0580] According to a specific embodiment, the deletion comprises a
deletion of at most 20 nucleotides.
[0581] According to a specific embodiment, the deletion comprises a
deletion of at most 15 nucleotides.
[0582] According to a specific embodiment, the deletion comprises a
deletion of at most 10 nucleotides.
[0583] According to a specific embodiment, the deletion comprises a
deletion of at most 5 nucleotides.
[0584] According to one embodiment, the modification comprises a
point mutation,
[0585] According to a specific embodiment, the point mutation
comprises a point mutation of about 10-250 nucleotides, about
10-200 nucleotides, about 10-150 nucleotides, about 10-100
nucleotides, about 10-50 nucleotides, about 1-50 nucleotides, about
1-10 nucleotides, about 50-150 nucleotides, about 50-100
nucleotides or about 100-200 nucleotides (as compared to the native
plant RNA or native RNA molecule, e.g, RNA silencing molecule),
[0586] According to one embodiment, the point mutation comprises a
point mutation in at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38,
40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140,
150, 160, 170, 180, 190, 200 or at most 250 nucleotides (as
compared to the native plant RNA or native RNA molecule, e.g. RNA
silencing molecule).
[0587] According to a specific embodiment, the point mutation
comprises a point mutation in at most 200 nucleotides.
[0588] According to a specific embodiment, the point mutation
comprises a point mutation in at most 150 nucleotides.
[0589] According to a specific embodiment, the point mutation
comprises a point mutation in at most 100 nucleotides.
[0590] According to a specific embodiment, the point mutation
comprises a point mutation in at most 50 nucleotides.
[0591] According to a specific embodiment, the point mutation
comprises a point mutation in at most 25 nucleotides.
[0592] According to a specific embodiment, the point mutation
comprises a point mutation in at most 20 nucleotides.
[0593] According to a specific embodiment, the point mutation
comprises a point mutation in at most 15 nucleotides.
[0594] According to a specific embodiment, the point mutation
comprises a point mutation in at most 10 nucleotides.
[0595] According to a specific embodiment, the point mutation
comprises a point mutation in at most 5 nucleotides.
[0596] According to one embodiment, the modification comprises a
combination of any of a deletion, an insertion and/or a point
mutation.
[0597] According to one embodiment, the modification comprises
nucleotide replacement (e.g. nucleotide swapping).
[0598] According to a specific embodiment, the swapping comprises
swapping of about 10-250 nucleotides, about 10-200 nucleotides,
about 10-150 nucleotides, about 10-100 nucleotides, about 10-50
nucleotides, about 1-50 nucleotides, about 1-10 nucleotides, about
50-150 nucleotides, about 50-100 nucleotides or about 100-200
nucleotides (as compared to the native plant RNA or native RNA
molecule, e.g. RNA silencing molecule).
[0599] According to one embodiment, the nucleotide swap comprises a
nucleotide replacement in at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34,
36, 38, 40, 42, 44, 46, 48, 50, 60, 70, 80, 90, 100, 110, 120, 130,
140, 150, 160, 170, 180, 190, 200 or at most 250 nucleotides (as
compared to the native plant RNA or native RNA molecule, e.g. RNA
silencing molecule).
[0600] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 200 nucleotides.
[0601] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 150 nucleotides.
[0602] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 100 nucleotides.
[0603] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 50 nucleotides.
[0604] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 25 nucleotides.
[0605] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 20 nucleotides.
[0606] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 15 nucleotides.
[0607] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 10 nucleotides.
[0608] According to a specific embodiment, the nucleotide swapping
comprises a nucleotide replacement in at most 5 nucleotides.
[0609] According to one embodiment, the gene encoding the plant RNA
or RNA molecule (e.g. RNA silencing molecule) is modified by
swapping a sequence of an endogenous RNA silencing molecule (e.g.
miRNA) with a RNA silencing sequence of choice (e.g. siRNA).
[0610] According to one embodiment, the guide strand of the RNA
molecule (e.g. RNA silencing molecule such as miRNA precursors
(pri/pre-miRNAs) or siRNA precursors (dsRNA)) is modified to
preserve originality of structure and keep the same base pairing
profile.
[0611] According to one embodiment, the passenger strand of the RNA
molecule (e.g. RNA silencing molecule such as miRNA precursors
(pri/pre-miRNAs) or siRNA precursors (dsRNA)) is modified to
preserve originality of structure and keep the same base pairing
profile.
[0612] As used herein, the term "originality of structure" refers
to the secondary RNA structure (i.e. base pairing profile). Keeping
the originality of structure is important for correct and efficient
biogenesis/processing of the non-coding RNA (e.g. RNA silencing
molecule such as siRNA or miRNA) that is structure--and not purely
sequence-dependent.
[0613] According to one embodiment, the RNA (e.g. RNA silencing
molecule) is modified in the guide strand (silencing strand) as to
comprise about 50-100% complementarity to the target RNA (as
discussed above) while the passenger strand is modified to preserve
the original (unmodified) RNA (e.g. non-coding RNA) structure.
[0614] According to one embodiment, the RNA sequence (e.g. RNA
silencing molecule) is modified such that the seed sequence (e.g.
for miRNA nucleotides 2-8 from the 5' terminal) is complimentary to
the target sequence.
[0615] According to a specific embodiment, the RNA silencing
molecule (i.e. RNAi molecule) is designed such that a sequence of
the RNAi molecule is modified to preserve originality of structure
and to be recognized by cellular RNAi processing and executing
factors.
[0616] According to a specific embodiment, the RNA molecule e.g.
non-coding RNA molecule (i.e. rRNA, tRNA, lncRNA, snoRNA, etc.) is
designed such that a sequence of the RNAi molecule is modified to
be recognized by cellular RNAi processing and executing
factors.
[0617] It will be appreciated that additional mutations can be
introduced by additional events of editing (i.e., concomitantly or
sequentially).
[0618] The DNA editing agent of the invention may be introduced
into plant cells using DNA delivery methods (e.g. by expression
vectors) or using DNA-free methods.
[0619] According to one embodiment, the sgRNA (or any other DNA
recognition module used, dependent on the I)NA editing system that
is used) can be provided as RNA to the cell.
[0620] Thus, it will be appreciated that the present techniques
relate to introducing the DNA editing agent using transient DNA or
DNA-free methods such as RNA transfection (e.g. mRNA+sgRNA
transfection), or Ribonucleoprotein (RNP) transfection (e.g.
protein-RNA complex transfection, e.g. Cas9/sgRNA ribonucleoprotein
(RNP) complex transfection).
[0621] For example, Cas9 can be introduced as a DNA expression
plasmid, in vitro transcript (i.e. RNA), or as a recombinant
protein bound to the RNA portion in a ribonucleoprotein particle
(RNP). sgRNA., for example, can be delivered either as a DNA
plasmid or as an in vitro transcript (i.e. RNA).
[0622] Any method known in the art for RNA or RNP transfection can
be used in accordance with the present teachings, such as, but not
limited to microinjection [as described by Cho et al., "Heritable
gene knockout in Caenorhabditis elegans by direct injection of
Cas9-sgRNA ribonucleoproteins," Genetics (2013) 195:1177-1180,
incorporated herein by reference], electroporation [as described by
Kim et al., "Highly efficient RNA-guided genome editing in human
cells via delivery of purified Cas9 ribonucleoproteins" Genome Res.
(2014) 24:1012-1019, incorporated herein by reference], or
lipid-mediated transfection e.g. using liposomes [as described by
Zuris et al., "Cationic lipid-mediated delivery of proteins enables
efficient protein-based genome editing in vitro and in vivo" Nat
Bietechnol. (2014) doi: 10.1038/nbt.3081, incorporated herein by
reference]. Additional methods of RNA transfection are described in
U.S. Patent Application No. 20160289675, incorporated herein by
reference in its entirety.
[0623] One advantage of RNA transfection methods of the invention
is that RNA transfection is essentially transient and vector-free.
A RNA transgene can be delivered to a cell and expressed therein,
as a minimal expressing cassette without the need for any
additional sequences (e.g. viral sequences).
[0624] According to one embodiment, the DNA editing agent of the
invention is introduced into the plant cell using expression
vectors.
[0625] The "expression vector" (also referred to herein as "a
nucleic acid construct", "vector" or "construct") of some
embodiments of the invention includes additional sequences which
render this vector suitable for replication in prokaryotes,
eukaryotes, or preferably both (e.g., shuttle vectors).
[0626] Constructs useful in the methods according to some
embodiments of the invention may be constructed using recombinant
DNA technology well known to persons skilled in the art. The
nucleic acid sequences may be inserted into vectors, which may be
commercially available, suitable for transforming into plants and
suitable for transient expression of the gene of interest in the
transformed cells. The genetic construct can be an expression
vector wherein the nucleic acid sequence is operably linked to one
or more regulatory sequences allowing expression in the plant
cells.
[0627] According to one embodiment, in order to express a
functional DNA editing agent, in cases where the cleaving module
(nuclease) is not an integral part of the DNA recognition unit, the
expression vector may encode the cleaving module as well as the DNA
recognition unit (e.g. sgRNA in the case of CRISPR/Cas).
[0628] Alternatively, the cleaving module (nuclease) and the DNA
recognition unit (e.g. sgRNA) may be cloned into separate
expression vectors. In such a case, at least two different
expression vectors must be transformed into the same plant
cell.
[0629] Alternatively, when a nuclease is not utilized (i.e. not
administered from an exogenous source to the cell), the DNA
recognition unit (e.g. sgRNA) may be cloned and expressed using a
single expression vector.
[0630] Typical expression vectors may also contain a transcription
and translation initiation sequence, transcription and translation
terminator and optionally a polyadenylation signal.
[0631] According to one embodiment, the DNA editing agent comprises
a nucleic acid agent encoding at least one DNA recognition unit
(e.g. sgRNA) operatively linked to a cis-acting regulatory element
active in plant cells (e.g., promoter).
[0632] According to one embodiment, the nuclease (e.g.
endonuclease) and the DNA recognition unit (e.g. sgRNA) are encoded
from the same expression vector. Such a vector may comprise a
single cis-acting regulatory element active in plant cells (e.g.,
promoter) for expression of both the nuclease and the DNA
recognition unit. Alternatively, the nuclease and the DNA
recognition unit may each be operably linked to a cis-acting
regulatory element active in plant cells (e.g., promoter).
[0633] According to one embodiment, the nuclease (e.g.
endonuclease) and the DNA recognition unit (e.g. sgRNA) are encoded
from different expression vectors whereby each is operably linked
to a cis-acting regulatory element active in plant cells (e.g.,
promoter).
[0634] As used herein the phrase "plant-expressible" or "active in
plant cells" refers to a promoter sequence, including any
additional regulatory elements added thereto or contained therein,
that is at least capable of inducing, conferring, activating or
enhancing expression in a plant cell, tissue or organ, preferably a
monocotyledonous or dicotyledonous plant cell, tissue, or
organ.
[0635] The plant promoter employed can be a constitutive promoter,
a tissue specific promoter, an inducible promoter, a chimeric
promoter or a developmentally regulated promoter.
[0636] Examples of preferred promoters useful for the methods of
some embodiments of the invention are presented in Table I, II, III
and IV.
TABLE-US-00001 TABLE I Exemplary constitutive promoters for use in
the performance of some embodiments of the invention Gene Source
Expression Pattern Reference Actin constitutive McElroy et al,
Plant Cell, 2: 163-171, 1990 CAMV 35S constitutive Odell et al,
Nature, 313: 810-812, 1985 CaMV 19S constitutive Nilsson et al.,
Physiol. Plant 100: 456-462, 1997 GOS2 constitutive de Pater et al,
Plant J Nov; 2(6): 837-44, 1992 ubiquitin constitutive Christensen
et al, Plant Mol. Biol. 18: 675-689, 1992 Rice cyclophilin
constitutive Bucholz et al, Plant Mol Biol. 25(5): 837-43, 1994
Maize H3 histone constitutive Lepetit et al, Mol. Gen. Genet. 231:
276-285, 1992 Actin 2 constitutive An et al, Plant J. 10(1);
107121, 1996 CVMV (Cassava Vein Mosaic Virus constitutive Lawrenson
et al, Gen Biol 16: 258, 2015 U6 (AtU626; TaU6) constitutive
Lawrenson et al, Gen Biol 16: 258, 2015
TABLE-US-00002 TABLE II Exemplary seed-preferred promoters for use
in the performance of some embodiments of the invention Gene Source
Expression Pattern Reference Seed specific genes seed Simon, et
al., Plant Mol. Biol. 5. 191, 1985; Scofield, et al., J. Biol.
Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14:
633, 1990. Brazil Nut albumin seed Pearson' et al., Plant Mol.
Biol. 18: 235-245, 1992. legumin seed Ellis, et al. Plant Mol.
Biol. 10: 203-214, 1988 Glutelin (rice) seed Takaiwa, et al., Mol.
Gen. Genet. 208: 15-22, 1986; Takaiwa, et al., FEBS Letts. 221:
43-47, 1987 Zein seed Matzke et al Plant Mol Biol, 143). 323-32
1990 napA seed Stalberg, et al, Planta 199: 515-519, 1996 wheat LMW
and HMW endosperm Mol Gen Genet 216: 81-90, 1989; NAR 17: 461-2,
glutenin-1 Wheat SPA seed Albanietal, Plant Cell, 9: 171-184, 1997
wheat a, b and g gliadins endosperm EMBO3: 1409-15, 1984 Barley
ltrl promoter endosperm barley B1, C, D hordein endosperm Theor
Appl Gen 98: 1253-62, 1999; Plant J 4: 343-55, 1993; Mol Gen Genet
250: 750-60, 1996 Barley DOF endosperm Mena et al, The Plant
Journal, 116(1): 53-62, 1998 Biz2 endosperm EP99106056.7 Synthetic
promoter endosperm Vicente-Carbajosa et al., Plant J. 13: 629-640,
1998 rice prolamin NRP33 endosperm Wu et al, Plant Cell Physiology
39(8) 885-889, 1998 rice -globulin Glb-1 endosperm Wu et al, Plant
Cell Physiology 398) 885-889, 1998 rice OSH1 emryo Sato et al,
Proc. Nati. Acad. Sci. USA, 93: 8117-8122 rice alpha-globulin
endosperm Nakase et al. Plant Mol. Biol. 33: 513-S22, 1997
REB/OHP-1 rice ADP-glucose PP endosperm Trans Res 6: 157-68, 1997
maize ESR gene family endosperm Plant J 12: 235-46, 1997 sorgum
gamma- kafirin endosperm PMB 32: 1029-35, 1996 KNOX emryo
Postma-Haarsma ef al, Plant Mol. Biol. 39: 257-71, 1999 rice
oleosin Embryo and aleuton Wu et at, J. Biochem., 123: 386, 1998
sunflower oleosin Seed (embryo and dry seed) Cummins, et al., Plant
Mol. Biol. 19: 873-876, 1992
TABLE-US-00003 TABLE III Exemplary flower-specific promoters for
use in the performance of the invention Gene Source Expression
Pattern Reference AtPRP4 flowers www(dot)salus(dot)
medium(dot)edu/m mg/tierney/html chalene flowers Van der Meer, et
al., synthase (chsA) Plant Mol. Biol. 15, 95-109, 1990. LAT52
anther Twell et al Mol. Gen Genet. 217: 240-245 (1989) apetala- 3
flowers
TABLE-US-00004 TABLE IV Alternative rice promoters for use in the
performance of the invention PRO # Gene Expression PR00001
Metallothionein Mte transfer layer of embryo + calli PR00005
putative beta-amylase transfer layer of embryo PR00009 Putative
cellulose synthase Weak in roots PR00012 lipase (putative) PR00014
Transferase (putative) PR00016 peptidyl prolyl cis-trans isomerase
(putative) PR00019 unknown PR00020 prp protein (putative) PR00029
noduline (putative) PR00058 Proteinase inhibitor Rgpi9 seed PR00061
beta expansine EXPB9 Weak in young flowers PR00063 Structural
protein young tissues + calli + embryo PR00069 xylosidase
(putative) PR00075 Prolamine 10 Kda strong in endosperm PR00076
allergen RA2 strong in endosperm PR00077 prolamine RP7 strong in
endosperm PR00078 CBP80 PR00079 starch branching enzyme I PR00080
Metallothioneine-like ML2 transfer layer of embryo + calli PR00081
putative caffeoyl- CoA shoot 3-0 methyltransferase PR00087
prolamine RM9 strong in endosperm PR00090 prolamine RP6 strong in
endosperm PR00091 prolamine RP5 strong in endosperm PR00092
allergen RA5 PR00095 putative embryo methionine aminopeptidase
PR00098 ras-related GTP binding protein PR00104 beta expansine
EXPB1 PR00105 Glycine rich protein PR00108 metallothionein like
protein (putative) PR00110 RCc3 strong root PR00111 uclacyanin
3-like protein weak discrimination center/ shoot meristem PR00116
26S proteasome very weak meristem regulatory particle specific
non-ATPase subunit 11 PR00117 putative 40S ribosomal protein weak
in endosperm PR00122 chlorophyll a/lo-binding very weak in shoot
protein precursor (Cab27) PR00123 putative Strong leaves
protochlorophyllide reductase PR00126 metallothionein RiCMT strong
discrimination center shoot meristem PR00129 GOS2 Strong
constitutive PR00131 GOS9 PR00133 chitinase Cht-3 very weak
meristem specific PR00135 alpha- globulin Strong in endosperm
PR00136 alanine aminotransferase Weak in endosperm PR00138 Cyclin
A2 PR00139 Cyclin D2 PR00140 Cyclin D3 PR00141 Cyclophyllin 2 Shoot
and seed PR00146 sucrose synthase SS1 (barley) medium constitutive
PR00147 trypsin inhibitor ITR1 (barley) weak in endosperm PR00149
ubiquitine 2 with intron strong constitutive PR00151 WSI18 Embryo
and stress PR00156 HVA22 homologue (putative) PR00157 EL2 PR00169
aquaporine medium constitutive in young plants PR00170 High
mobility group protein Strong constitutive PR00171 reversibly
glycosylated weak constitutive protein RGP1 PR00173 cytosolic MDH
shoot PR00175 RAB21 Embryo and stress PR00176 CDPK7 PR00177 Cdc2-1
very weak in meristem PR00197 sucrose synthase 3 PRO0198 OsVP1
PRO0200 OSHI very weak in young plant meristem PRO0208 putative
chlorophyllase PRO0210 OsNRT1 PRO0211 EXP3 PRO0216 phosphate
transporter OjPT1 PRO0218 oleosin 18 kd aleurone + embryo PRO0219
ubiquitine 2 without intron PRO0220 RFL PRO0221 maize UBI delta
intron not detected PRO0223 glutelin-1 PRO0224 fragment of prolamin
RP6 promoter PRO0225 4xABRE PRO0226 glutelin OSGLUA3 PRO0227
BLZ-2_short (barley) PR00228 BLZ-2_long (barley)
[0637] The inducible promoter is a promoter induced in a specific
plant tissue, by a developmental stage or by a specific stimuli
such as stress conditions comprising, for example, light,
temperature, chemicals, drought, high salinity, osmotic shock,
oxidant conditions or in case of pathogenicity and include, without
being limited to, the light-inducible promoter derived from the pea
rbcS gene, the promoter from the alfalfa rbcS gene, the promoters
DRE, MYC, and MYB active in drought; the promoters INT, INPS,
prxEa, Ha hsp17.7G4 and RD21 active in high salinity and osmotic
stress, and the promoters hsr203J and str246C active in pathogenic
stress.
[0638] According to one embodiment the promoter is a
pathogen-inducible promoter. These promoters direct the expression
of genes in plants following infection with a pathogen such as
bacteria, fungi, viruses, nematodes and insects. Such promoters
include those from pathogenesis-related proteins (PR proteins),
which are induced following infection by a pathogen; e.g., PR
proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See,
for example. Redolfi et al. (1983) Neth. J. Plant Pathol
89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon
(1985) Plant Mol. Virol. 4:111-116.
[0639] According to one embodiment, when more than one promoter is
used in the expression vector, the promoters are identical (e.g.,
all identical, at least two identical).
[0640] According to one embodiment, when more than one promoter is
used in the expression vector, the promoters are different (e.g.,
at least two are different, all are different).
[0641] According to one embodiment, the promoter in the expression
vector includes, but is not limited to, CaMV 35S, 2x CaMV 35S, CaMV
19S, ubiquitin, AtU626 or TaU6.
[0642] According to a specific embodiment, the promoter in the
expression vector comprises a 35S promoter.
[0643] According to a specific embodiment, the promoter in the
expression vector comprises a U6 promoter.
[0644] Expression vectors may also comprise transcription and
translation initiation sequences, transcription and translation
terminator sequences and optionally a polyadenylation signal.
[0645] According to a specific embodiment, the expression vector
comprises a termination sequence, such as but not limited to, a G7
termination sequence, an AtuNos termination sequence or a CaMV-35S
terminator sequence.
[0646] Plant cells may be transformed stably or transiently with
the nucleic acid constructs of some embodiments of the invention.
In stable transformation, the nucleic acid molecule of some
embodiments of the invention is integrated into the plant genome
and as such it represents a stable and inherited trait. In
transient transformation, the nucleic acid molecule is expressed by
the cell transformed but it is not integrated into the genome and
as such it represents a transient trait.
[0647] There are various methods of introducing foreign genes into
both monocotyledonous and dicotyledonous plants (Potrykus, I.,
Annu. Rev. Plant. Physiol., Plant. Mol. Biol. (1991) 42:205-225;
Shimamoto et al., Nature (1989) 338:274-276).
[0648] The principle methods of causing stable integration of
exogenous DNA into plant genomic DNA include two main
approaches:
[0649] (i) Agrobacterium-mediated gene transfer: Klee et al. (1987)
Annu. Rev. Plant Physiol. 38:467-486; Klee and Rogers in Cell
Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular
Biology of Plant Nuclear Genes, eds. Schell, J., and Vasil, L. K.,
Academic Publishers, San Diego, Calif. (1989) p. 2-25; Gatenby, in
Plant Biotechnology, eds. Kung, S. and Arntzen, C. J., Butterworth
Publishers, Boston, Mass. (1989) p. 93-112.
[0650] (ii) direct DNA uptake: Paszkowski et al., in Cell Culture
and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of
Plant Nuclear Genes eds. Schell, J., and Vasil, L. K., Academic
Publishers, San Diego, Calif. (1989) p. 52-68; including methods
for direct uptake of DNA into protoplasts, Toriyama, K. et al.
(1988) Bio/Technology 6:1072-1074. DNA uptake induced by brief
electric shock of plant cells: Zhang et al. Plant Cell Rep. (1988)
7:379-384. Fromm et al. Nature (1986) 319:791-793. DNA injection
into plant cells or tissues by particle bombardment, Klein et al.
Bio/Technology (1988) 6:559-563; McCabe et al. Bio/Technology
(1988) 6:923-926; Sanford, Physiol. Plant. (1990) 79:206-209; by
the use of micropipette systems: Neuhaus et at., Theor. App. Genet.
(1987) 75:30-36; Neuhaus and Spangenberg, Physiol. Plant. (1990)
79:213-217; glass fibers or silicon carbide whisker transformation
of cell cultures, embryos or callus tissue, U.S. Pat. No. 5,464,765
or by the direct incubation of DNA with germinating pollen, DeWet
et al. in Experimental Manipulation of Ovule Tissue, eds. Chapman,
G. P. and Mantell, S. H. and Daniels, W. Longman, London, (1985) p.
197-209; and Ohta, Proc. Natl. Acad. Sci. USA. (0986)
83:715-719.
[0651] The Agrobacterium system includes the use of plasmid vectors
that contain defined DNA segments that integrate into the plant
genomic DNA. Methods of inoculation of the plant tissue vary
depending upon the plant species and the Agrobacterium delivery
system. A widely used approach is the leaf disc procedure which can
be performed with any tissue explant that provides a good source
for initiation of whole plant differentiation. Horsch et al. in
Plant Molecular Biology Manual A5, Kluwer Academic Publishers,
Dordrecht (1988) p. 1-9. A supplementary approach employs the
Agrobacterium delivery system in combination with vacuum
infiltration. The Agrobacterium system is especially viable in the
creation of transgenic dicotyledonous plants.
[0652] According to one embodiment, an agrobacterium-free
expression method is used to introduce foreign genes into plant
cells. According to one embodiment, the agrobacterium-free
expression method is transient. According to a specific embodiment,
a bombardment method is used to introduce foreign genes into plant
cells. According to another specific embodiment, bombardment of a
plant root is used to introduce foreign genes into plant cells. An
exemplary bombardment method which can be used in accordance with
some embodiments of the invention is discussed in the examples
section which follows.
[0653] Furthermore, various cloning kits or gene synthesis can be
used according to the teachings of some embodiments of the
invention.
[0654] According to one embodiment the nucleic acid construct is a
binary vector. Examples for binary vectors are pBIN19, pBI101,
pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or pPZP
(Hajukiewicz, P. et Plant Mol. Biol. 25, 989 (1994), and Hellens et
al, Trends in Plant Science 5, 446 (2000)).
[0655] Examples of other vectors to be used in other methods of
I)NA delivery (e.g. transfection, electroporation, bombardment,
viral inoculation as discussed below) are: pGE-sgRNA (Zhang et al.
Nat. Comms. 2016 7:12697), pJIT163-Ubi-Cas9 (Wang et al. Nat.
Biotechnol 2004 32, 947-951),
pICH47742:2x35S-5'UTR-hCas9(STOP)-NOST (Belhan et al. Plant Methods
2013 11;9(1):39), pAHC25 (Christensen, A. H. & P. H. Quail,
1996. Ubiquitin promoter-based vectors for high-level expression of
selectable and/or screenable marker genes in monocotyledonous
plants. Transgenic Research 5: 213-218), pHBT-sGFP(S65T)-NOS (Sheen
et al. Protein phosphatase activity is required for light-inducible
gene expression in maize, EMBO J. 12 (9), 3497-3505 (1993).
[0656] According to one embodiment, the method of some embodiments
of the invention further comprises introducing into the plant cell
donor oligonucleotides.
[0657] According to one embodiment, when the modification is an
insertion, the method further comprises introducing into the plant
cell donor oligonucleotides.
[0658] According to one embodiment, when the modification is a
deletion, the method further comprises introducing into the plant
cell donor oligonucleotides.
[0659] According to one embodiment, when the modification is a
deletion and insertion (e.g. swapping), the method further
comprises introducing into the plant cell donor
oligonucleotides.
[0660] According to one embodiment, when the modification is a
point mutation, the method further comprises introducing into the
plant cell donor oligonucleotides.
[0661] As used herein, the term "donor oligonucleotides" or "donor
oligos" refers to exogenous nucleotides, i.e. externally introduced
into the plant cell to generate a precise change in the genome.
According to one embodiment, the donor oligonucleotides are
synthetic.
[0662] According to one embodiment, the donor oligos are RNA
oligos.
[0663] According to one embodiment, the donor oligos are DNA
oligos.
[0664] According to one embodiment, the donor oligos are synthetic
oligos.
[0665] According to one embodiment, the donor oligonucleotides
comprise single-stranded donor oligonucleotides (ssODN).
[0666] According to one embodiment, the donor oligonucleotides
comprise double-stranded donor oligonucleotides (dsODN).
[0667] According to one embodiment, the donor oligonucleotides
comprise double-stranded DNA (dsDNA).
[0668] According to one embodiment, the donor oligonucleotides
comprise double-stranded DNA-RNA duplex (DNA-RNA duplex).
[0669] According to one embodiment, the donor oligonucleotides
comprise double-stranded DNA-RNA hybrid.
[0670] According to one embodiment, the donor oligonucleotides
comprise single-stranded DNA-RNA hybrid.
[0671] According to one embodiment, the donor oligonucleotides
comprise single-stranded DNA (ssDNA).
[0672] According to one embodiment, the donor oligonucleotides
comprise double-stranded RNA (dsRNA).
[0673] According to one embodiment, the donor oligonucleotides
comprise single-stranded RNA (ssRNA).
[0674] According to one embodiment, the donor oligonucleotides
comprise the DNA or RNA sequence for swapping (as discussed
above).
[0675] According to one embodiment, the donor oligonucleotides are
provided in a non-expressed vector format or oligo.
[0676] According to one embodiment, the donor oligonucleotides
comprise a DNA donor plasmid (e.g. circular or linearized
plasmid).
[0677] According to one embodiment, the donor oligonucleotides
comprise about 50-5000, about 100-5000, about 250-5000, about
500-5000, about 750-5000, about 1000-5000, about 1500-5000, about
2000-5000, about 2500-5000, about 3000-5000, about 4000-5000, about
50-4000, about 100-4000, about 250-4000, about 500-4000, about
750-4000, about 1000-4000, about 1500-4000, about 2000-4000, about
2500-4000, about 3000-4000, about 50-3000, about 100-3000, about
250-3000, about 500-3000, about 750-3000, about 1000-3000, about
1500-3000, about 2000-3000, about 50-2000, about 100-2000, about
250-2000, about 500-2000, about 750-2000, about 1000-2000, about
1500-2000, about 50-1000, about 100-1000, about 250-1000, about
500-1000, about 750-1000, about 50-750, about 150-750, about
250-750, about 500-750, about 50-500, about 150-500, about 200-500,
about 250-500, about 350-500, about 50-250, about 150-250, or about
200-250 nucleotides.
[0678] According to a specific embodiment, the donor
oligonucleotides comprising the ssODN (e.g. ssDNA or ssRNA)
comprise about 200-500 nucleotides.
[0679] According to a specific embodiment, the donor
oligonucleotides comprising the dsODN (e.g. dsDNA or dsRNA)
comprise about 250-5000 nucleotides.
[0680] According to one embodiment, for gene swapping of an
endogenous RNA silencing molecule (e.g. miRNA) with a RNA silencing
sequence of choice (e,g. siRNA), the expression vector, ssODN (e.g.
ssDNAA or ssRNA) or dsODN (e.g. dsDNA or dsRNA) does not have to be
expressed in a plant cell and could serve as a non-expressing
template. According to a specific embodiment, in such a case only
the DNA editing agent (e.g. Cas9/sgRNA modules) need to be
expressed if provided in a DNA form.
[0681] According to some embodiments, for gene editing of an
endogenous RNA molecule (e.g., RNA silencing molecule) without the
use of a nuclease, the DNA editing agent (e.g., sgRNA) may be
introduced into the eukaryotic cell with orour without (e.g.
oligonucleotide donor DNA or RNA, as discussed herein).
[0682] According to one embodiment, introducing into the plant cell
donor oligonucleotides is effected using any of the methods
described above (e.g. using the expression vectors or RNP
transfection).
[0683] According to one embodiment, the sgRNA and the DNA donor
oligonucleotides are co-introduced into the plant cell (e.g. via
bombardment). It will be appreciated that any additional factors
(e.g. nuclease) may be co-introduced therewith.
[0684] According to one embodiment, the sgRNA is introduced into
the plant cell prior to the DNA donor oligonucleotides (e.g. within
a few minutes or a few hours). It will be appreciated that any
additional factors (e.g. nuclease) may be introduced prior to,
concomitantly with, or following the sgRNA or the DNA donor
oligonucleotides.
[0685] According to one embodiment, the sgRNA is introduced into
the plant cell subsequent to the DNA donor oligonucleotides within
a few minutes or a few hours). It will be appreciated that any
additional factors (e.g. nuclease) may be introduced prior to,
concomitantly with, or following the sgRNA or the DNA donor
oligonucleotides.
[0686] According to one embodiment, there is provided a composition
comprising at least one sgRNA and DNA donor oligonucleotides for
genome editing.
[0687] According to one embodiment, there is provided a composition
comprising at least one sgRNA, a nuclease (e.g. endonuclease) and.
DNA donor oligonucleotides for genome editing.
[0688] There are various methods of direct DNA transfer into plant
cells and the skilled artisan will know which to select. In
electroporation, the protoplasts are briefly exposed to a strong
electric field. In microinjection, the DNA is mechanically injected
directly into the cells using very small micropipettes. In
microparticle bombardment, the DNA is adsorbed on microprojectiles
such as magnesium sulfate crystals or gold or tungsten particles,
and the microprojectiles are physically accelerated into
protoplasts, cells or plant tissues.
[0689] Thus, the delivery of nucleic acids may be introduced into a
plant cell in embodiments of the invention by any method known to
those of skill in the art, including, for example and without
limitation: by transformation of protoplasts (See, e.g., U.S. Pat.
No. 5,508,184); by desiccation/inhibition-mediated DNA uptake (See,
e.g., Potrykus et al. (1985) Mol. Gen. Genet, 199:183-8); by
electroporation (See, e.g., U.S. Pat. No. 5,384,253); by agitation
with silicon carbide fibers (See, e.g., U.S. Pat. Nos. 5,302,523
and 5,464,765); by Agrobacterium-mediated transformation (See,
e.g., U.S. Pat. Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877,
5,981,840, and 6,384,301); by acceleration of DNA-coated particles
(See, e.g., U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880,
6,160,208, 6,399,861, and 6,403,865) and by Nanoparticles,
nanocarriers and cell penetrating peptides (WO201126644A2,
WO2009046384A1; WO2008148223A1) in the methods to deliver DNA, RNA,
Peptides and/or proteins or combinations of nucleic acids and
peptides into plant cells.
[0690] Other methods of transfection include the use of
transfection reagents (e.g. Lipofectin, ThermoFisher), dendrimers
(Kukowska-Latallo, J. F. et al., 1996, Proc. Natl. Acad. Sci.
USA93, 4897-902), cell penetrating peptides (Mae et al., 2005,
Internalisation of cell-penetrating peptides into tobacco
protoplasts, Biochimica et Biophysica Acta 1669(2):101-7) or
polyamines (Zhang and Vinogradov, 2010, Short biodegradable
polyamines for gene delivery and transfection of brain capillary
endothelial cells, J Control Release, 143(3):359-366).
[0691] According to a specific embodiment, for introducing DNA into
plant cells (e.g. protoplasts) the method comprises polyethylene
glycol (PEG)-mediated DNA uptake. For further details see Karesch
et al. (1991) Plant Cell Rep. 9:575-578; Mathur et al. (1995) Plant
Cell Rep. 14:221-226; Negrutiu et al. (1987) Plant Cell Mol. Biol.
8:363-373. Plant cells (e.g. protoplasts) are then cultured under
conditions that allowed them to grow cell walls, start dividing to
form a callus, develop shoots and roots, and regenerate whole
plants.
[0692] Following stable transformation plant propagation is
exercised. The most common method of plant propagation is by seed.
Regeneration by seed propagation, however, has the deficiency that
due to heterozygosity there is a lack of uniformity in the crop,
since seeds are produced by plants according to the genetic
variances governed by Mendelian rules. Basically, each seed is
genetically different and each will grow with its own specific
traits. Therefore, it is preferred that the transformed plant be
produced such that the regenerated plant has the identical traits
and characteristics of the parent transgenic plant. Therefore, it
is preferred that the transformed plant be regenerated by
micropropagation which provides a rapid, consistent reproduction of
the genetically identical transformed plants.
[0693] Micropropagation is a process of growing new generation
plants from a single piece of tissue that has been excised from a
selected parent plant or cultivar. This process permits the mass
reproduction of plants having the desired trait. The new generated
plants are genetically identical to, and have all of the
characteristics of, the original plant. Micropropagation (or
cloning) allows mass production of quality plant material in a
short period of time and offers a rapid multiplication of selected
cultivars in the preservation of the characteristics of the
original transgenic or transformed plant. The advantages of cloning
plants are the speed of plant multiplication and the quality and
uniformity of plants produced.
[0694] Micropropagation is a multi-stage procedure that requires
alteration of culture medium or growth conditions between stages.
Thus, the micropropagation process involves four basic stages:
Stage one, initial tissue culturing; stage two, tissue culture
multiplication; stage three, differentiation and plant formation;
and stage four, greenhouse culturing and hardening. During stage
one, initial tissue culturing, the tissue culture is established
and certified contaminant-free. During stage two, the initial
tissue culture is multiplied until a sufficient number of tissue
samples are produced to meet production goals. During stage three,
the tissue samples grown in stage two are divided and grown into
individual plantlets. At stage four, the transformed plantlets are
transferred to a greenhouse for hardening where the plants'
tolerance to light is gradually increased so that it can be grown
in the natural environment.
[0695] Although stable transformation is presently preferred,
transient transformation of leaf cells, meristematic cells or the
whole plant is also envisaged by some embodiments of the
invention.
[0696] Transient transformation can be effected by any of the
direct DNA transfer methods described above or by viral infection
using modified plant viruses.
[0697] Viruses that have been shown to be useful for the
transformation of plant hosts include CaMV, TMV, TRV and BV.
Transformation of plants using plant viruses is described in U.S.
Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published
Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (B
V); and Gluzman, Y. et al., Communications in Molecular Biology:
Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189
(1988). Pseudovirus particles for use in expressing foreign DNA in
many hosts, including plants, is described in WO 87/06261.
[0698] Construction of plant RNA viruses for the introduction and
expression of non-viral exogenous nucleic acid sequences in plants
is demonstrated by the above references as well as by Dawson, W. O.
et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J.
(1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and
Takamatsu et al. FEBS Letters (1990) 269:73-76.
[0699] When the virus is a DNA virus, suitable modifications can be
made to the virus itself. Alternatively, the virus can first be
cloned into a bacterial plasmid for ease of constructing the
desired viral vector with the foreign DNA. The virus can then be
excised from the plasmid. If the virus is a DNA virus, a bacterial
origin of replication can be attached to the viral DNA, which is
then replicated by the bacteria. Transcription and translation of
this DNA will produce the coat protein which will encapsidate the
viral DNA. If the virus is a RNA virus, the virus is generally
cloned as a cDNA and inserted into a plasmid. The plasmid is then
used to make all of the constructions. The RNA virus is then
produced by transcribing the viral sequence of the plasmid and
translation of the viral genes to produce the coat protein(s) which
encapsidate the viral RNA.
[0700] Construction of plant RNA viruses for the introduction and
expression in plants of non-viral exogenous nucleic acid sequences
such as those included in the construct of some embodiments of the
invention is demonstrated by the above references as well as in
U.S. Pat. No. 5,316,931.
[0701] In one embodiment, a plant viral nucleicacid is provided in
which the native coat protein coding sequence has been deleted from
a viral nucleic acid, a non-native plant viral coat protein coding
sequence and a non-native promoter, preferably the subgenomic
promoter of the non-native coat protein coding sequence, capable of
expression in the plant host, packaging of the recombinant plant
viral nucleic acid, and ensuring a systemic infection of the host
by the recombinant plant viral nucleic acid, has been inserted.
Alternatively, the coat protein gene may be inactivated by
insertion of the non-native nucleic acid sequence within it, such
that a protein is produced. The recombinant plant viral nucleic
acid may contain one or more additional non-native subgenomic
promoters. Each non-native subgenomic promoter is capable of
transcribing or expressing adjacent genes or nucleic acid sequences
in the plant host and incapable of recombination with each other
and with native subgenomic promoters. Non-native (foreign) nucleic
acid sequences may be inserted adjacent the native plant viral
subgenomic promoter or the native and a non-native plant viral
subgenomic promoters if more than one nucleic acid sequence is
included. The non-native nucleic acid sequences are transcribed or
expressed in the host plant under control of the subgenomic
promoter to produce the desired products.
[0702] In a second embodiment, a recombinant plant viral nucleic
acid is provided as in the first embodiment except that the native
coat protein coding sequence is placed adjacent one of the
non-native coat protein subgenomic promoters instead of a
non-native coat protein coding sequence.
[0703] In a third embodiment, a recombinant plant viral nucleic
acid is provided in which the native coat protein gene is adjacent
its subgenomic promoter and one or more non-native subgenomic
promoters have been inserted into the viral nucleic acid. The
inserted non-native subgenomic promoters are capable of
transcribing or expressing adjacent genes in a plant host and are
incapable of recombination with each other and with native
subgenomic promoters. Non-native nucleic acid sequences may be
inserted adjacent the non-native subgenomic plant viral promoters
such that the sequences are transcribed or expressed in the host
plant under control of the subgenomic promoters to produce the
desired product.
[0704] In a fourth embodiment, a recombinant plant viral nucleic
acid is provided as in the third embodiment except that the native
coat protein coding sequence is replaced by a non-native coat
protein coding sequence.
[0705] The viral vectors are encapsidated by the coat proteins
encoded by the recombinant plant viral nucleic acid to produce a
recombinant plant virus. The recombinant plant viral nucleic acid
or recombinant plant virus is used to infect appropriate host
plants. The recombinant plant viral nucleic acid is capable of
replication in the host, systemic spread in the host, and
transcription or expression of foreign gene(s) (isolated nucleic
acid) in the host to produce the desired protein.
[0706] In addition to the above, the nucleic acid molecule of some
embodiments of the invention can also be introduced into a
chloroplast genome thereby enabling chloroplast expression.
[0707] A technique for introducing exogenous nucleic acid sequences
to the genome of the chloroplasts is known. This technique involves
the following procedures. First, plant cells are chemically treated
so as to reduce the number of chloroplasts per cell to about one.
Then, the exogenous nucleic acid is introduced via particle
bombardment into the cells with the aim of introducing at least one
exogenous nucleic acid molecule into the chloroplasts. The
exogenous nucleic acid is selected such that it is integratable
into the chloroplast's genome via homologous recombination which is
readily effected by enzymes inherent to the chloroplast. To this
end, the exogenous nucleic acid includes, in addition to a gene of
interest, at least one nucleic acid stretch which is derived from
the chloroplast's genome. In addition, the exogenous nucleic acid
includes a selectable marker, which serves by sequential selection
procedures to ascertain that all or substantially all of the copies
of the chloroplast genomes following such selection will include
the exogenous nucleic acid. Further details relating to this
technique are found in U.S. Pat. Nos. 4,945,050; and 5,693,507
which are incorporated herein by reference. A polypeptide can thus
be produced by the protein expression system of the chloroplast and
become integrated into the chloroplast's inner membrane.
[0708] Regardless of the transformation/infection method employed,
the present teachings further select transformed cells comprising a
genome editing event.
[0709] According to a specific embodiment, selection is carried out
such that only cells comprising a successful accurate modification
(e.g. swapping, insertion, deletion, point mutation) in the
specific locus are selected. Accordingly, cells comprising any
event that includes a modification (e.g. an insertion, deletion,
point mutation) in an unintended locus are not selected.
[0710] According to one embodiment, selection of modified cells can
be performed at the phenotypic level, by detection of a molecular
event, by detection of a fluorescent reporter, or by growth in the
presence of selection (e.g., antibiotic).
[0711] According to one embodiment, selection of modified cells is
performed by analyzing the biogenesis and occurrence of the newly
generated dsRNA molecule.
[0712] According to one embodiment, selection of modified cells is
performed by analyzing the biogenesis and occurrence of secondary
small RNAs (generated by further processing of the dsRNA).
[0713] According to one embodiment, selection of modified cells is
performed by analyzing the biogenesis and occurrence of the newly
edited RNA molecule (e.g. the presence of new miRNA version, the
presence of novel edited siRNAs, piRNAs, tasiRNAs etc).
[0714] According to one embodiment, selection of modified cells is
performed by analyzing the biogenesis and occurrence of the newly
edited plant RNA transcripts (i.e. of the modified plant gene).
[0715] According to one embodiment, selection of modified cells is
performed by analyzing the silencing activity and/or specificity of
the modified RNA molecule (e.g. RNA silencing molecule) or of the
modified plant RNA towards a plant RNA or pest RNA, respectively,
or the silencing activity and/or specificity of the dsRNA molecule
or secondary small RNAs processed therefrom towards a pest RNA, by
validating at least one phenotype in the plant (e.g. plant leaf
coloring, e.g. partial or complete loss of chlorophyll in leaves
and other organs (bleaching), presence/absence of necrotic
patterns, flower coloring, fruit traits (such as shelf life,
firmness and flavor), growth rate, plant size (e.g. dwarfism), crop
yield, biotic stress resistance) or in the pest (e.g. nematode
mortality, beetle's egg laying rate, or other resistant phenotypes
associated with any of bacteria, viruses, fungi, parasites,
insects, weeds, and cultivated or native plants).
[0716] According to one embodiment, the silencing specificity of
the RNA molecule, the plant RNA, the dsRNA, or the secondary small
RNAs processed therefrom, is determined genotypically, e.g. by
expression of a gene or lack of expression.
[0717] According to one embodiment, the silencing specificity of
the RNA molecule, the plant RNA, the dsRNA or secondary small RNAs
processed therefrom, is determined phenotypically.
[0718] According to one embodiment, a phenotype of the plant is
determined prior to a genotype.
[0719] According to one embodiment, a genotype of the plant is
determined prior to a phenotype.
[0720] According to one embodiment, selection of modified cells is
performed by analyzing the silencing activity and/or specificity of
the RNA molecule (e.g. RNA silencing molecule), the plant RNA, the
dsRNA or the secondary small RNAs processed therefrom, towards a
plant RNA or pest RNA by measuring a RNA level of the plant RNA or
pest RNA. This can be performed using any method known in the art,
e.g. by Northern blotting, Nuclease Protection Assays, In Situ
hybridization, or quantitative RT-PCR.
[0721] According to one embodiment, selection of modified cells is
performed by analyzing plant cells or clones comprising the DNA
editing event also referred to herein as "mutation" or "edit",
dependent on the type of editing sought e.g., insertion, deletion,
insertion-deletion andel), inversion, substitution and combinations
thereof.
[0722] Methods for detecting sequence alteration are well known in
the art and include, but not limited to, DNA and RNA sequencing
(e.g., next generation sequencing), electrophoresis, an
enzyme-based mismatch detection assay and a hybridization assay
such as PCR, RT-PCR, RNase protection, in-situ hybridization,
primer extension, Southern blot, Northern Blot and dot blot
analysis. Various methods used for detection of single nucleotide
polymorphisms (SNPs) can also be used, such as PCR based T7
endonuclease, Heteroduplex and Sanger sequencing, or PCR followed
by restriction digest to detect appearance or disappearance of
unique restriction site/s.
[0723] Another method of validating the presence of a DNA editing
event e.g., Indels comprises a mismatch cleavage assay that makes
use of a structure selective enzyme (e.g. endonuclease) that
recognizes and cleaves mismatched DNA.
[0724] According to one embodiment, selection of transformed cells
is effected by flow cytometry (FACS) selecting transformed cells
exhibiting fluorescence emitted by the fluorescent reporter.
Following FACS sorting, positively selected pools of transformed
plant cells, displaying the fluorescent marker are collected and an
aliquot can be used for testing the DNA editing event as discussed
above.
[0725] In cases where antibiotic selection marker was used,
following transformation plant cell clones are cultivated in the
presence of selection (e.g., antibiotic) until they develop into
colonies i.e., clones and micro-calli. A portion of the cells of
the calli are then analyzed (validated) for the DNA editing event,
as discussed above.
[0726] Thus, according to one embodiment of the invention, the
method further comprises validating in the transformed cells
complementarity of the RNA molecule (e.g. RNA silencing molecule),
the plant RNA, the dsRNA or the secondary small RNAs processed
therefrom, towards the plant RNA or pest RNA.
[0727] As mentioned above, following modification, the RNA molecule
(e.g. RNA silencing molecule) the plant RNA, the dsRNA (e.g. sense
or anti-sense strand thereof) or secondary small RNAs processed
therefrom, comprises at least about 30%, 33%, 40%, 50%, 60%, 70%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even
100% complementarity towards the target sequence of the plant RNA
or pest RNA.
[0728] The specific binding of designed RNA molecule with a target
plant RNA or pest RNA can be determined by any method known in the
art, such as by computational algorithms (e.g. BLAST) and verified
by methods including e,g. Northern blot, In Situ hybridization,
QuantiGene Plex Assay etc.
[0729] It will be appreciated that positive clones can be
homozygous or heterozygous for the DNA editing event. In case of a
heterozygous cell, the cell (e.g., when diploid) may comprise a
copy of a modified gene and a copy of a non-modified gene. The
skilled artisan will select the clone for further
culturing/regeneration according to the intended use.
[0730] According to one embodiment, when a transient method is
desired, clones exhibiting the presence of a DNA editing event as
desired are further analyzed and selected for the absence of the
DNA editing agent, namely, loss of DNA sequences encoding for the
DNA editing agent. This can be done, for example, by analyzing the
loss of expression of the DNA editing agent (e.g., at the mRNA,
protein) e.g., by fluorescent detection of CiFP or q-PCR, HPLC.
[0731] According to one embodiment, when a transient method is
desired, the cells may be analyzed for the absence of the nucleic
acid construct as described herein or portions thereof e.g.,
nucleic acid sequence encoding the DNA editing agent. This can be
affirmed by fluorescent microscopy, q-PCR, FACS, and or any other
method such as Southern blot, PCR, sequencing, HPLC).
[0732] According to one embodiment, the plant is crossed in order
to obtain a plant devoid of the DNA editing agent (e.g. of the
endonuclease), as discussed below.
[0733] Positive clones may be stored (e.g., cryopreserved).
[0734] Alternatively, plant cells (e.g., protoplasts) may be
regenerated into whole plants first by growing into a group of
plant cells that develops into a callus and then by regeneration of
shoots (callogenesis) from the callus using plant tissue culture
methods. Growth of protoplasts into callus and regeneration of
shoots requires the proper balance of plant growth regulators in
the tissue culture medium that must be customized for each species
of plant.
[0735] Protoplasts may also be used for plant breeding, using a
technique called protoplast fusion. Protoplasts from different
species are induced to fuse by using an electric field or a
solution of polyethylene glycol. This technique may be used to
generate somatic hybrids in tissue culture.
[0736] Methods of protoplast regeneration are well known in the
art. Several factors affect the isolation, culture, and
regeneration of protoplasts, namely the genotype, the donor tissue
and its pre-treatment, the enzyme treatment for protoplast
isolation, the method of protoplast culture, the culture, the
culture medium, and the physical environment. For a thorough review
see Maheshwari et al. 1986 Differentiation of Protoplasts and of
Transformed Plant Cells: 3-36. Springer-Verlag, Berlin.
[0737] The regenerated plants can be subjected to further breeding
and selection as the skilled artisan sees fit.
[0738] Thus, embodiments of the invention further relate to plants,
plant cells and processed product of plants comprising the dsRNA
molecule capable of silencing a pest gene according to the present
teachings.
[0739] According to one aspect of the invention, there is provided
a method of generating a pest tolerant or resistant plant, the
method comprising producing a long dsRNA molecule capable of
silencing a pest gene in a plant cell according to the method of
some embodiments of the invention.
[0740] According to one aspect of the invention, there is provided
a method of producing a pest tolerant or resistant plant, the
method comprising:
[0741] (a) breeding the plant some embodiments of the invention;
and
[0742] (b) selecting for progeny plants that express the long dsRNA
molecule capable of suppressing the pest gene, and which do not
comprise the DNA editing agent,
[0743] thereby producing the pest tolerant or resistant plant.
[0744] According to one aspect of the invention, there is provided
a method producing a plant or plant cell of some embodiments of the
invention comprising growing the plant or plant cell under
conditions which allow propagation.
[0745] According to one embodiment, breeding comprises crossing or
selfing.
[0746] The term "crossing" as used herein refers to the
fertilization of female plants (or gametes) by male plants (or
gametes). The term "gamete" refers to the haploid reproductive cell
(egg or sperm) produced in plants by mitosis from a gametophyte and
involved in sexual reproduction, during which two gametes of
opposite sex fuse to form a diploid zygote. The term generally
includes reference to a pollen (including the sperm cell) and an
ovule (including the ovum). "crossing" therefore generally refers
to the fertilization of ovules of one individual with pollen from
another individual, whereas "selfing" refers to the fertilization
of ovules of an individual with pollen from the same individual.
Crossing is widely used in plant breeding and results in a mix of
genomic information between the two plants crossed one chromosome
from the mother and one chromosome from the father. This will
result in a new combination of genetically inherited traits.
[0747] As mentioned above, the plant may be crossed in order to
obtain a plant devoid of undesired factors e.g. DNA editing agent
(e.g. endonuclease).
[0748] According to some embodiments of the invention, the plant is
non-transgenic.
[0749] According to some embodiments of the invention, the plant is
a transgenic plant.
[0750] According to one embodiment, the plant is non-genetically
modified (non-GMO).
[0751] According to one embodiment, the plant is genetically
modified (GMO).
[0752] According to one aspect of the invention, there is provided
a cell of the plant of some embodiments of the invention.
[0753] According to one aspect of the invention, there is provided
a seed of the plant of some embodiments of the invention.
[0754] According to one embodiment, the plants generated by the
present method are more resistant or tolerant to pests by at least
about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% as
compared to plants not generated by the present methods (i.e. as
compared to wild type plants).
[0755] Any method known in the art for assessing tolerance or
resistance to pests of a plant may be used in accordance with the
present invention. Exemplary methods include, but are not limited
to, reducing MYB46 expression in Arabidopsis which results in
enhanced resistance to Botrytis cinereal as described in Ramirez
V1, Garcia-Andrade J, Vera P., Plant Signal Behay. 2011
Jun.;6(6):911-3, Epub 2011 Jun. 1; or downregulation of HCT in
alfalfa promotes activation of defense response in the plant as
described in Gallego-Giraldo L. et al. New Phytologist (2011) 190:
627-639 doi: 10.1111/j.1469-8137.2010.03621.x), both incorporated
herein by reference.
[0756] According to further embodiments, there is provided a method
of producing a long dsRNA molecule in a plant cell, wherein the
long dsRNA is capable of silencing a target gene of interest, the
method comprising: (a) selecting a first nucleic acid sequence of a
plant gene exhibiting a predetermined sequence homology to a
nucleic acid sequence of the target gene of interest; and (b)
modifying a second plant endogenous nucleic acid sequence encoding
an RNA molecule so as to impart silencing specificity towards the
first plant gene, such that small RNA molecules capable of
recruiting RNA-dependent RNA Polymerase (RdRp) processed from the
RNA molecule form base complementation with a transcript of the
first plant gene to produce the long dsRNA molecule capable of
silencing the target gene of interest.
[0757] According to some embodiments, the first nucleic acid
sequence does not encode for a silencing RNA prior to use of the
above method. According to some embodiments, the long dsRNA is not
naturally produced from the first nucleic acid sequence prior to
use of the above method. Without wishing to be bound by theory or
mechanism, while the first nucleic acid sequence in the above
method does not necessarily produce long dsRNA naturally (or any
silencing RNA), modification of the second plant endogenous nucleic
acid sequence results in an RNA molecule (e.g. a miRNA) which acts
as an amplifier and engages RdRp to generate long dsRNA from an RNA
transcript of the first nucleic acid sequence. Thus, in effect, the
above method is able, according to some embodiments, to generate a
long dsRNA from a gene which previously did not produce one.
[0758] According to some embodiments, the target gene of interest
is an endogenous gene of the plant cell. According to other
embodiments, the target gene of interest is an exogenous gene to
the plant cell (e.g. a gene of a pest, e.g. invertebrate pest).
[0759] According to some embodiments, the RNA molecule encoded by
the second plant endogenous nucleic acid sequence is a miRNA.
[0760] According to some embodiments, the predetermined sequence
homology to a nucleic acid sequence of the target gene of interest
comprises homology of at least two stretches of at least 28 nt
each, each having at least 90% homology to the sequence of the
target gene of interest.
[0761] According to some embodiments, modifying a nucleic acid
sequence comprises using a DNA editing agent, such as, but not
limited to, a CRISPR-endonuclease (e.g. Cas9). According to some
embodiments, the DNA editing agent comprises a CRIPSR-endonuclease
and a guide RNA directed at cutting a nucleic acid sequence of
interest (e.g. the sequence of the second plant endogenous nucleic
acid). According to some embodiments, modifying a nucleic acid
sequence of interest comprises using a DNA editing agent (possibly
with a guide RNA directed at cutting the nucleic acid of interest)
and further introducing into the plant cell an additional nucleic
acid sequence which is similar to the nucleic acid sequence to be
modified but includes the desired nucleotide changes. Without
wishing to be bound by theory or mechanism, the DNA editing agent
cuts the nucleic acid sequence of interest and part of the
additional nucleic acid sequence (which includes the desired
nucleotide changes) is introduced into the nucleic acid sequence of
interest via. Homology Dependent Recombination (HDR).
[0762] As used herein the term "about" refers to .+-.10%.
[0763] The terms "comprises", "comprising", "includes",
"including", "having" and their conjugates mean "including but not
limited to".
[0764] The term "consisting of" means "including and limited
to".
[0765] The term "consisting essentially of" means that the
composition, method or structure may include additional
ingredients, steps and/or parts, but only if the additional
ingredients, steps and/or parts do not materially alter the basic
and novel characteristics of the claimed composition, method or
structure.
[0766] As used herein, the singular form "a", "an" and "the"
include plural references unless the context clearly dictates
otherwise. For example, the term "a compound" or "at least one
compound" may include a plurality of compounds, including mixtures
thereof.
[0767] Throughout this application, various embodiments of this
invention may be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2, 3,
4, 5, and 6. This applies regardless of the breadth of the
range.
[0768] Whenever a numerical range is indicated herein, it is meant
to include any cited numeral (fractional or integral) within the
indicated range. The phrases "ranging/ranges between" a first
indicate number and a second indicate number and "ranging/ranges
from" a first indicate number "to" a second indicate number are
used herein interchangeably and are meant to include the first and
second indicated numbers and all the fractional and integral
numerals therebetween.
[0769] As used herein the term "method" refers to manners, means,
techniques and procedures for accomplishing a given task including,
but not limited to, those manners, means, techniques and procedures
either known to, or readily developed from known manners, means,
techniques and procedures by practitioners of the chemical,
pharmacological, biological, biochemical and medical arts.
[0770] As used herein, the term "treating" includes abrogating,
substantially inhibiting, slowing or reversing the progression of a
condition, substantially ameliorating clinical or aesthetical
symptoms of a condition or substantially preventing the appearance
of clinical or aesthetical symptoms of a condition.
[0771] It is appreciated that certain features of the invention,
which are, for clarity, described in the context of separate
embodiments, may also be provided in combination in a single
embodiment. Conversely, various features of the invention, which
are, for brevity, described in the context of a single embodiment,
may also be provided separately or in any suitable subcombination
or as suitable in any other described embodiment of the invention.
Certain features described in the context of various embodiments
are not to be considered essential features of those embodiments,
unless the embodiment is inoperative without those elements.
[0772] Various embodiments and aspects of the present invention as
delineated hereinabove and as claimed in the claims section below
find experimental support in the following examples.
[0773] It is understood that any Sequence Identification Number
(SEQ ID NO) disclosed in the instant application can refer to
either a DNA sequence or a RNA sequence, depending on the context
where that SEQ ID NO is mentioned, even if that SEQ ID NO is
expressed only in a DNA sequence format or a RNA sequence format.
For example, SEQ ID NO: 1 is expressed in a DNA sequence format
(e.g., reciting T for thymine), but it can refer to either a DNA
sequence that corresponds to a nucleic acid sequence, or the RNA
sequence of an RNA molecule nucleic acid sequence. Similarly,
though some sequences are expressed in a RNA sequence format (e.g,
reciting U for uracil), depending on the actual type of molecule
being described, it can refer to either the sequence of a RNA
molecule comprising a dsRNA, or the sequence of a DNA molecule that
corresponds to the RNA sequence shown. In any event, both DNA and
RNA molecules having the sequences disclosed with any substitutes
are envisioned.
EXAMPLES
[0774] Reference is now made to the following examples, which
together with the above descriptions, illustrate the invention in a
non-limiting fashion.
[0775] Generally, the nomenclature used herein and the laboratory
procedures utilized in the present invention include molecular,
biochemical, microbiological, microscopy and recombinant DNA
techniques. Such techniques are thoroughly explained in the
literature. See, for example, "Molecular Cloning: A laboratory
Manual" Sambrook et al., (1989); "Current Protocols in Molecular
Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al.,
"Current Protocols in Molecular Biology", John Wiley and Sons,
Baltimore, Md. (1989); Perbal, "A Practical Guide to Molecular
Cloning", John Wiley & Sons, New York (1988); Watson et al.,
"Recombinant DNA", Scientific American Books, New York; Birren et
al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4,
Cold Spring Harbor Laboratory Press, New York (1998); methodologies
as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531;
5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook",
Volumes I-III Cellis, J. E., ed. (1994); "Current Protocols in
Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al.
(eds), "Basic and Clinical Immunology" (8th Edition), Appleton
& Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds),
"Selected. Methods in Cellular Immunology", W. H. Freeman and Co.,
New York (1980); available immunoassays are extensively described
in the patent and scientific literature, see, for example, U.S.
Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987;
3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345;
4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521;
"Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid
Hybridization" Hames, B. D., and Higgins S. J., eds. (1985);
"Transcription and Translation" Hames, B. D., and Higgins S. J.,
Eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986);
"Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical
Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in
Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To
Methods And Applications", Academic Press, San Diego, Calif.
(1990); Marshak et al., "Strategies for Protein Purification and
Characterization--A Laboratory Course Manual" CSHL Press (1996);
all of which are incorporated by reference as if fully set forth
herein. Other general references are provided throughout this
document. The procedures therein are believed to be well known in
the art and are provided for the convenience of the reader. All the
information contained therein is incorporated herein by
reference.
[0776] General Materials and Experimental Procedures
[0777] Computational Pipeline to Generate GEiGS Templates
[0778] The computational GEiGS pipeline applies biological metadata
and enables an automatic generation of GEiGS DNA templates that are
used to minimally edit non-coding RNA genes (e.g. miRNA genes),
leading to a new gain of function. i.e. redirection of their
silencing capacity to target sequence of interest.
[0779] As illustrated in FIG. 6, the pipeline starts with filling
and submitting input: a) target sequence to be silenced by GEiGS;
b) the host organism to be gene edited and to express the GEiGS; c)
one can choose whether the GEiGS would be expressed ubiquitously or
not. If specific GEiGS expression is required, one can choose from
a few options (expression specific to a certain tissue,
developmental stage, stress, heat/cold shock etc).
[0780] When all the required input is submitted, the computational
process begins with searching among miRNA datasets (e.g. small RNA
sequencing, microarray etc.) and filtering only relevant miRNAs
that match the input criteria. Next, the selected mature miRNA
sequences are aligned against the target sequence and miRNA with
the highest complementary levels are filtered. These naturally
target-complementary mature miRNA sequences are then modified to
perfectly match the target's sequence. Then, the modified mature
miRNA sequences are run through an algorithm that predicts siRNA
potency and the top 20 with the highest silencing score are
filtered. These final modified miRNA genes are then used to
generate 200-500 nt ssDNA or 250-5000 nt dsDNA sequences as
follows:
[0781] 200-500 nt ssDNA oligos and 250-5000 nt dsDNA fragments are
designed based on the genomic DNA sequence that flanks the modified
miRNA. The pre-miRNA sequence is located in the center of the
oligo. The modified miRNA's guide strand (silencing) sequence is
100% complementary to the target. However, the sequence of the
modified passenger miRNA strand is further modified to preserve the
original (unmodified) miRNA. structure, keeping the same base
pairing profile.
[0782] Next, differential sgRNAs are designed to specifically
target the original unmodified miRNA gene, and not the modified
swapping version. Finally, comparative restriction enzyme site
analysis is performed between the modified and the original miRNA
gene and differential restriction sites are summarized.
[0783] Therefore, the pipeline output includes:
[0784] a) 200-500 nt ssDNA oligo or 250-5000 nt dsDNA fragment
sequence with minimally modified miRNA
[0785] b) 2-3 differential sgRNAs that target specifically the
original miRNA gene and not the modified
[0786] c) List of differential restriction enzyme sites among the
modified and original miRNA gene.
[0787] Design of dsRNA by GEiGS
[0788] Model 1 (the numbers correspond to the numbers in FIG.
1):
[0789] 1. The pest gene "X" is the target gene (when silenced, the
pest is controlled)
[0790] 2. A host-related gene-X is identified by homology search to
pest gene "X" (plant gene "X"). According to some embodiments, the
plant gene X is identified according to model 1, if it comprises at
least two stretches of at least 28 nt, each having at least 90%
homology to the sequence of pest gene X.
[0791] 3. GEiGS is performed within plant cells in order to
redirect the silencing specificity of a small RNA molecule (e.g. 22
nt miRNAs) towards host-related gene-X, thereby the small RNA
molecule acts as an amplifier of RdRp-mediated transcription fur
the transcript of plant gene "X".
[0792] 4. The amplifier small RNA, whose silencing specificity has
been redirected using GEiGS (also referred to herein as "small
GEiGS RNA") forms a RISC complex that is associated with RdRp (the
amplifying enzyme)
[0793] 5. The RdRp synthesizes a complementary antisense RNA strand
to the transcript of plant gene "X", forming a long dsRNA.
[0794] 6. The long dsRNA is then at least partially processed into
secondary sRNAs by dicer(s) or other nucleases within the plant
cells. Out of these secondary sRNAs, the silencing specificity of
some of the secondary sRNA is towards pest gene X.
[0795] 7. The dsRNA is also at least partly taken up by pests,
possibly being processed in the pest to sRNAs, as described
above.
[0796] 8. Possibly, secondary sRNAs from the plant cells are also
taken up by pests and also silence the target gene "X", e.g. in
addition to the generated long dsRNA.
[0797] Model 2 (the numbers correspond to the numbers in FIG.
2):
[0798] 1. The pest gene "X" is the target gene (when silenced, the
pest is controlled)
[0799] 2. GEiGS is performed in plant cells to redirect the
silencing specificity of a naturally occurring RNAi precursor,
which is known to be amplified in its wild-type form (i.e. it
produces long-dsRNA), against the pest gene "X" (e.g. TAS gene;
which is amplified into long dsRNA and processed into tasiRNAs in
its wild-type form). This transcript is marked in FIG. 2 as
"Amplified GEiGS precursor". According to some embodiments, an RNAi
precursor which can be used with Model 2 is an RNAi precursor which
forms long-dsRNA and is processed to secondary small RNAs, such as,
but not limited to, a precursor processed to a trans-acting siRNA
(tasiRNA) or a phased small interfering RNA (phasiRNA). Gene
Editing induced Gene Silencing (GEiGS) is performed on the gene
encoding the RNAi precursor, by using an endonuclease (e.g. CAS9)
to induce a double strand break in the gene and providing a DNA
"GEiGS oligonucleotide" which introduces into the gene the
nucleotide changes required for specificity-redirection through use
of Homology Dependent Recombination (HDR). Thus, depending on the
"GEiGS oligonucleotide" that is used, the specificity of a portion
of the RNAi precursor (e.g. tTAS) will be changed to target pest
gene X. The redirected RNAi precursor will be processed by the
cellular Dicer into secondary small RNAs (e.g. tasiRNAs) which will
also match the pest gene X. In the example depicted in FIG. 2, only
one of the tasiRNAs will be altered, resulting in a TAS which is
processed to both the wild-type and altered tasiRNAs.
[0800] 3. A wild type amplifier small RNA forms a RISC complex that
is associated with RdRp (the amplifying enzyme).
[0801] 4. The RdRp synthesizes a complementary antisense RNA strand
to the transcript of the amplified GEiGS precursor, forming
long-dsRNA.
[0802] 5. The amplified GEiGS dsRNA is at least partly processed
into secondary sRNAs in the plant cell by dicer(s) or other
nucleases. Out of these secondary sRNAs, the silencing specificity
of the secondary small RNA that corresponds in location to where
GEiGS has taken place is towards pest gene X.
[0803] 6. least part of the non-processed GEiGS long dsRNA is taken
up by pests, possibly being processed in the pest to small RNAs, as
described above.
[0804] 7. Possibly, secondary sRNAs which have already been
generated within the plant cells (e.g. tasiRNAs in the case of TAS
precursor) are taken up as well by the pest, and silence the target
gene "X"
[0805] Tables 1A and 1B below provide exemplary pest genes which
may be targeted by the present methods, and in particular Model 1.
Table 2 below provides exemplary pest genes which may be targeted
by the present methods, and in particular Model 2. Table 2 also
provides suggested RNAi precursors to be targeted by GEiGS (denoted
"Backbone"), such as TAS RNA precursors. Table 2 provides suggested
small interfering RNAs (denoted "Desired siRNA"), which may be
introduced to the suggested backbone using GEiGS, thus enabling the
backbone to be processed into these siRNAs in the pests, effecting
silencing of the target genes.
TABLE-US-00005 TABLE 1A List of potemial pest-target genes and
their accession numbers (including plant homologous genes, as per
model 1) ncbi_ Plant Plant gene Model-1_ Pest_ Pest_ accesson_
description_ host_ homolog_ Plant gene homolog_ class organism pest
gene Pest gene organism accession description nematode Heterodera
AF469058.1 Heterodera glycines glycines cellulose binding protein
nematode Heterodera AF469060.1 Heterodera glycines Aa thaliana
NM_001203752.2 Arabidopsis thaliana glycines ubiquitin extension
ubiquitin 11 protein (UBQ11) nematode Heterodera AF500024.1
Heterodera glycines Aa thaliana NM_116351.7 Arabidopsis thaliana
glycosyl glycines putative gland transferase family 1 protein
protein G8H07 (AT4G01210) nematode Heterodera AF502391.1 Heterodera
glycines Aa thaliana NM_4001037071.1 Arabidopsis thaliana bZIP
glycines putative gland transcription factor family protein G10A06
protein (TGA1) nematode Caenorhabditis C52E4.1.1 Caenorhabditis
elegans elegans Cysteine Protease related nematode Meloidogyne
KF734590.1 Meloidogyne chitwoodi chitwoodi parasitism protein
16D10L (16D10L) whitefly Bemisia KF377800.1 Bemisia tabaci tabaci
aquaporin (aqp1) whitefly Bemisia KF377802.1 Bemisia tabaci tabaci
nicotinic acetylcholine receptor subunit alpha (nAChRa) whitefly
Bemisia K1377803.1 Bemisia tabaci alpha- tabaci 1 glucosidase
whitefly Bemisia KF377804.1 Bemisia tabaci heat tabaci shock
protein-70 (hsp -70) whitefly Bemisia KF442965.1 Bemisia tabaci
tabaci trehalase whitefly Bemisia KF442966.1 Bemisia tabaci tabaci
facilitated trehalose transporter-4
TABLE-US-00006 TABLE 1B List of potential pest-target genes and
their accession numbers Pest_class Pest_organism
ncbi_accession_pest gene description_Pest gene Plant host_organism
Coleoptera western corn rootworm (Diabrotica KR024028.1 vacuolar
ATPase Corn virgifera virgifera) A subunit Coleopters western corn
rootworm (Diabrotica Based on Snf7 Corn virgifera virgifera)
KX982003.1 Helicoverpa cotton bollworm (Helicoverpa armigera)
KR095600.1 cytochrome P450 Cotton monooxygenase (CYP6AE14)
Helicoverpa cotton bollworm (Helicoverpa armigera) AY058242
glulathione-S- Cotton transferase (GST) Diptera Anopholes gambiae
Chitin synthase 2 Coleoptera Diabrotica virgifera virgifera Snf 7
Hemiptera Acyrthosiphon pisum (pea aphid) NM_001145904.1 Aquaporin
Legumes Hemiptera Acyrthosiphon pisum (pea aphid) XM_001946489
V-ATPase E Legumes Lepidoptera Chilo infuscatellus (yellow top
borer) JN835468.1 CiHR3 moulting Sugarcane and other factor Poaceae
Lepidoptera Plutella xylostella (diamondback moth) AY061975.1 AchE
Cabbage and other (Acetylcholinesterase) cruciferous crops
Lepidoptera Plutella xylostella (diamondback moth) KX844829 CYP6BG1
Cabbage and other (cytochrome P450) cruciferous crops Lepidoptera
Spodoptera exigua (Beet armyworm) DQ062153.1 Chitin synthase A Beet
and many others Lepidoptera Spodoptera exigua (Beet army worm)
HQ829425.1 Beta1 integrin Beet and many others subunit
TABLE-US-00007 TABLE 2 Potential pest target genes and examples of
their tasiRNA based silencing using GEiGS-(per model 2) Backbone
Desired siRNA SEQ ID NO: Target organism Target Gene Accession #
CACAGTAAAATTGAACAAATA 13 Heterodera glycines AF_4058.1 ATTAS1A
AT2G27400 CACAGTAAAATTGAACAAATA 14 Heterodera glycines AF_469058.1
ATTAS1C AT2G39675 CACAGTAAAATTGAACAAATA 15 Heterodera glvcines
AF_469058.1 ATTAS3A AT3G17185 CACAGTAAAATTGAACAAATA 16 Heterodera
glycines AF_469058.1 ATTAS3C AT5G57735 CACAGTAAAATTGAACAAATA 17
Heterodera glycines AF_469058.1 ATTAS3B AT5G49615
CTGCGATGGCATGCAAATTTT 18 Heterodera glycines AF_469060.1 ATTAS1A
AT2G27400 CTGCGATGGCATGCAAATTTT 19 Heterodera glycines AF_469060.1
ATTAS1C AT2G39675 CTGCGATGGCATGCAAATTTT 20 Heterodera glycines
AF_469060.1 ATTAS3A AT3G17185 CTGCGATGGCATGCAAATTTT 21 Heterodera
glycines AF_469060.1 ATTAS3C AT5G57735 CTGCGATGGCATGCAAATTTT 22
Heterodera glycines AF_469060.1 ATTAS3B AT5G49615
TAAAATGGAAATAGACAATAT 23 Heterodera glycines AF_500024.1 ATTAS1A
AT2G27400 TAAAATGGAAATAGACAATAT 24 Heterodera glycines AF_500024.1
ATTAS1C AT2G39675 TAAAATGGAAATAGACAATAT 25 Heterodera glycines
AF_500024.1 ATTAS3A AT3G17185 TAAAATGGAAATAGACAATAT 26 Heterodera
glycines AF_500024.1 ATTAS3C AT5G57735 TAAAATGGAAATAGACAATAT 27
Heterodera glycines AF_500024.1 ATTAS3B AT5G49615
GAGAAGGAAAATACACAATTA 28 Heterodera glycines AF_502391.1 ATTAS1A
AT2G27400 GAGAAGGAAAATACACAATTA 29 Heterodera glycines AF_502391.1
ATTAS1C AT2G39675 GAGAAGGAAAATACACAATTA 30 Heterodera glycines
AF_502391.1 ATTAS3A AT3G17185 GAGAAGGAAAATACACAATTA 31 Heterodera
glycines AF_502391.1 ATTAS3C AT5G57735 GAGAAGGAAAATACACAATTA 32
Heterodera glycines AF_502391.1 ATTAS3B AT5G49615
TAGTTAGGAAATTTCAAATAA 33 Caenorhabditis elegans C52E4.1.1 ATTAS1A
AT2G27400 TAGTTAGGAAATTTCAAATAA 34 Caenorhabditis elegans C52E4.1.1
ATTAS1C AT2G39675 TAGTTAGGAAATTTCAAATAA 35 Caenorhabditis elegans
C52E4.1.1 ATTAS3A AT3G17185 TAGTTAGGAAATTTCAAATAA 36 Caenorhabditis
elegans C52E4.1.1 ATTAS3C AT5G57735 TAGTTAGGAAATTTCAAATAA 37
Caenorhabditis elegans C52E4.1.1 ATTAS3B AT5G19615
ATGGGAATATATTAAAACTTT 38 Meloidogyne chitwoodi parasitism
KF734590.1 ATTAS1A AT2G27400 ATGGGAATATATTAAAACTTT 39 Meloidogyne
chitwoodi parasitism KF734590.1 ATTAS1C AT2G39675
ATGGGAATATATTAAAACTTT 40 Meloidogyne chitwoodi parasitism
KF734590.1 ATTAS3A AT3G17185 ATGGGAATATATTAAAACTTT 41 Meloidogyne
chitwoodi parasitism KF734590.1 ATTAS3C AT5G57735
ATGGGAATATATTAAAACTTT 42 Meloidogyne chitwoodi parasitism
KF734590.1 ATTAS3B AT5G19615 TGGAGCAATCATTCTGAATGA 43 Bemisia
tabaci KF377800.1 SLTAS3 JX047545 TGGAGCAATCATTCTGAATGA 44 Bemisia
tabaci KF377800.1 SLTAS3(2) BE459870 CTCACTCCTTTTAAACAAATA 45
Bemisia tabaci KF377802.1 SLTAS3 JX047545 CTCACTCCTTTTAAACAAATA 46
Bemisia tabaci KF377802.1 SLTAS3(2) BE459870 ATACATATAGATTGATAACAA
47 Bemisia tabaci KF377803.1 SLTAS3 JX047545 ATACATATAGATTGATAACAA
48 Bemisia tabaci KF377803.1 SLTAS3(2) BE459870
CCAGGATTCCATGTAAAAAAA 49 Bemisia tabaci KF377804.1 SLTAS3 JX047545
CCAGGATTCCATGTAAAAAAA 50 Bemisia tabaci KF377804.1 SLTAS3(2)
BE459870 CAACCGCATGATAAACGTGAA 51 Bemisia tabaci KF442965.1 SLTAS3
JX047545 CAACCGCATGATAAACGIGAA 52 Bemisia tabici KF442965.1
SLTAS3(2) BE459870 CTGCATGTTCTTCATCCCCGA 53 Bemisia tabaci
KF442966.1 SLTAS3 JX047545 CTGCATGTTCTTCATCCCCGA 54 Bemisia tabaci
KF442966.1 SLTAS3(2) BE459870
[0806] Arabidopsis and Tomato Bombardment and Plant
Regeneration
[0807] Arabidopsis Root Preparation
[0808] Chlorine gas sterilized Arabidopsis (cv. Col-0) seeds are
sown on MS minus sucrose plates and vernalised for three days in
the dark at 4.degree. C., followed by germination vertically at
25.degree. C. in constant light. After two weeks, roots are excised
into 1 cm root segments and placed on Callus Induction Media (CIM:
1/2 MS with B5 vitamins, 2% glucose, pH 5.7, 0.8% agar, 2 mg/l IAA,
0.5 mg/l 2,4-D, 0.05 mg/l kinetin) plates. Following six days
incubation in the dark, at 25.degree. C., the root segments are
transferred onto filter paper discs and placed onto CIMM plates,
(1/2 MS without vitamins, 2% glucose, 0.4 M mannitol, pH 5.7 and
0.8% agar) for 4-6 hours, in preparation for bombardment.
[0809] Tomato Explant Preparation:
[0810] Tomato seeds are surface sterilized with commercial bleach
for 20 minutes, followed by washing with sterile water 3 times in
sterile conditions. The seeds are cultured on germination media
(MS+ vitamins, 0.6% agarose, pH=5.8) and placed in 25.degree. C.
with 16/8 hours light/dark cycles.
[0811] Cotyledons are cut from 8 days old tomato plants, to
approximately 1 cm.sup.2 and placed on pre-bombardment culture (MS+
vitamins, 3% sucrose, 0.6% agarose, pH=5.8, 1 mg/l BAP, 0.2 mg/l
IAA) for 2 days in the dark in 25.degree. C. Then, explants are
transferred to the center of a target plate (containing MS+
vitamins, 3% Mannitol, 0.6% agarose, pH=5.8) for 4 hours.
[0812] Bombardment
[0813] Plasmid constructs are introduced into the root tissue via
the PDS-1000/He Particle Delivery (Bio-Rad; PDS-1000/He System
#1652257), several preparative steps, outlined below, are required
for this procedure to be carried out.
[0814] Gold Stock Preparation
[0815] 40 mg of 0.6 .mu.m gold (Bio-Rad; Cat: 1652262) is mixed
with 1 ml of 100% ethanol, pulse centrifuged to pellet and the
ethanol is removed. This wash procedure is repeated two more
times.
[0816] Once washed, the pellet is resuspended in 1 ml of sterile
distilled water and dispensed into 1.5 ml tubes of 50 .mu.l aliquot
working volumes.
[0817] Bead Preparation
[0818] In short, the following is performed:
[0819] Typically, a single tube is sufficient gold to bombard 2
plates of Arabidopsis roots, (2 shots per plate), therefore each
tube is distributed between 4 (1,100 psi) Biolistic Rupture disks
(Bio-Rad).
[0820] Bombardments requiring multiple plates of the same sample,
tubes are combined and volumes of DNA and CaCl.sub.2/spermidine
mixture adjusted accordingly, in order to maintain sample
consistency and minimize overall preparations.
[0821] The following protocol summarizes the process of preparing
one tube of gold, these should be adjusted according to number of
tubes of gold used.
[0822] All subsequent processes are carried out at 4.degree. C. in
an Eppendorf thermomixer. Plasmid DNA samples are prepared, each
tube comprising 11 .mu.g of DNA added at a concentration of 1000
ng/.mu.l
[0823] 1) 493 .mu.l ddH2O is added to 1 aliquot (7 .mu.l) of
spermidine (Sigma-Aldrich), giving a final concentration of 0.1 M
spermidine. 1250 .mu.l 2.5M CaCl2 is added to the spermidine
mixture, vortexed and placed on ice.
[0824] 2) A tube of pre-prepared gold is placed into the
thermomixer, and rotated at a speed of 1400 rpm.
[0825] 3) 11 .mu.l of DNA is added to the tube, vortexed, and
placed back into the rotating thermomixer.
[0826] 4) To bind, DNA/gold particles, 70 .mu.l of spermidine
CaCl.sub.2 mixture is added to each tube (in the thermomixer).
[0827] 5) The tubes are vigorously vortexed for 15-30 seconds and
placed on ice for about 70-80 seconds.
[0828] 6) The mixture is centrifuged for 1 minute at 7000 rpm, the
supernatant is removed and placed on ice.
[0829] 7) 500 .mu.l 100% ethanol is added to each tube and the
pellet is resuspended by pipetting and vortexed.
[0830] 8) The tubes are centrifuged at 7000 rpm for 1 minute.
[0831] 9) The supernatant is removed and the pellet resuspended in
50 .mu.l 100% ethanol, and stored on ice.
[0832] Macro Carrier Preparation
[0833] The following is performed in a laminar flow cabinet:
[0834] 1) Macro carriers (Bio-Rad), stopping screens (Bio-Rad), and
macro carrier disk holders are sterilized and dried.
[0835] 2) Macro carriers are placed flatly into the macro carrier
disk holders.
[0836] 3) DNA coated gold mixture is vortexed and spread (5 .mu.l)
onto the center of each Biolistic Rupture disk.
[0837] Ethanol is allowed to evaporate.
[0838] PDS-1000 (Helium Particle Delivery System)
[0839] In short, the following is performed:
[0840] The regulator valve of the helium bottle is adjusted to at
least 1300 psi incoming pressure. Vacuum is created by pressing
vac/vent/hold switch and holding the fire switch for 3 seconds.
This ensured helium is bled into the pipework.
[0841] 1100 psi rupture disks are placed into isopropanol and mixed
to remove static.
[0842] 1) One rupture disk is placed into the disk retaining
cap.
[0843] 2) Microcarrier launch assembly is constructed (with a
stopping screen and a gold containing microcarrier).
[0844] 3) Petri dish Arabidopsis root callus is placed 6 cm below
the launch assembly.
[0845] 4) Vacuum pressure is set to 27 inches of Hg (mercury) and
helium valve is opened (at approximately 1100 psi).
[0846] 5) Vacuum is released; microcarrier launch assembly and the
rupture disk retaining cap are removed.
[0847] 6) Bombardment on the same tissue (i.e. each plate is
bombarded 2 times).
[0848] 7) Bombarded roots are subsequently placed on CIM plates, in
the dark, at 25.degree. C., for additional 24 hours.
[0849] Co-Bombardments
[0850] When bombarding GEiGS plasmids combinations, 5 .mu.g (1000
ng/.mu.l) of the sgRNA plasmid is mixed with 8.5 .mu.g (1000
ng/.mu.l) swap plasmid (e.g. DONOR) and 11 .mu.l of this mixture is
added to the sample. If bombarding with more GEiGS plasmids at the
same time, the concentration ratio of sgRNA plasmids to swap
plasmids (e.g. DONOR) used is 1:1.7 and 11 .mu.g (1000 ng/.mu.l) of
this mixture is added to the sample. If co-bombarding with plasmids
not associated with GEiGS swapping, equal ratios are mixed and 11
.mu.g (1000 ng/.mu.l) of the mixture is added to each sample.
[0851] Transfection of Col-0 Protoplasts
[0852] Arabidopsis thaliana (Col-0) protoplasts were transfected
with vectors coding for Crispr/Cas9 and a donor template to achieve
HDR-mediated swaps. The experiment was designed such that sequences
in the Tas1b (AtTAS1b_AT1G50055) or Tas3a (AtTAS3a_AT3G17185) genes
were swapped, generating sRNAs that target 30 bp sequences in the
above-described nematode target genes. Without wishing to be bound
by theory or mechanism, the rationale in generating a long dsRNA,
which targets 30 bp sequences in the nematode is to ensure that
when the dsRNA. is processed in the nematode to secondary silencing
RNAs it creates functional silencing RNA molecules even if the
length of secondary silencing RNAs formed in the nematode is
different than that formed in the plant.
[0853] Two swaps were designed in the TAS1b locus, and two swaps in
the TAS3a locus. Swaps are independent from each other. The DONOR
template (1 kb) were synthesised in plasmids (synthesised by Twist,
USA).
[0854] The protoplast concentration was determined using a
hemocytometer and viability using Trypan Blue (approx.: 30 .mu.l
protoplasts, 65 .mu.l mmg, 5 .mu.l Trypan blue). The protoplasts
were dilute or concentrated protoplasts to a final density of
2.times.10.sup.6 cells/ml.
[0855] For PEG transfection, the molar ratio of sgRNA Vector
(Crispr/Cas9, sgRNA, mCHERRY): DONOR vector was 1:20, which
translates into 3.9 .mu.g sgRNA Vector and approximately 21.61
.mu.g DONOR Vector per transfection. To 1 ml of protoplasts, 1 ml
of PEG solution was added slowly. PEG solution was made fresh (2 g
PEG 4000 (Sigma) per 5 ml, 0.2M mannitol, 0.5 ml of 1M CaCl2).
Tubes were incubated in the dark at room temperature for 20 min,
then 4 ml of W5 was added and tubes were mixed by inverting.
Protoplast centrifugated pellet was then resuspended in 5 ml. PCA
(Protoplast regeneration media) to allow the cells to divide,
favouring HDR.
[0856] Cell Analysis
[0857] 24-72 hours after plasmid delivery, cells are collected and
resuspended in D-PBS media. Half of the solution is used for
analysis of luciferase activity, and half is analyzed for small RNA
sequencing. Analysis of Dual luciferase assay is carried out using
Dual-Glo.RTM. Luciferase Assay System (Promega, USA) according to
the manufacturer's instructions. Total RNA is extracted with Total
RNA Purification Kit (Norgene Biotek Corp., Canada), according to
manufacturer's instructions. Small RNA sequencing is carried out
for the identification of the desired mature small RNA in these
samples.
[0858] Arabidopsis Plant Regeneration
[0859] For shoot regeneration, a modified protocol from Valvekens
et al. [Valvekens, D. et al., Proc Natl Acad Sci USA (1988) 85(15):
5536-5540] is carried out. Bombarded roots are placed on Shoot
Induction Media (SIM) plates, which included 1/2 MS with B5
vitamins, 2% glucose, pH 5.7, 0.8% agar, 5 mg/l 2 iP, 0.15 mg/l
IAA. Plates are left in 16 hours light at 25.degree. C.-8 hours
dark at 23.degree. C. cycles. After 10 days, plates are transferred
to MS plates with 3% sucrose, 0.8% agar for a week, then
transferred to fresh similar plates. Once plants regenerated, they
are excised from the roots and placed on MS plates with 3% sucrose,
0.8% agar, until analyzed.
[0860] Tomato Post-Bombardment Culture and Plant Regeneration
[0861] Bombarded explants are placed in the dark at 25.degree. C.
on MS media (MS+ vitamins, 3% sucrose, 0.4% agargel, pH=5.8, 1 mg/l
BAP, 0.2 mg/l IAA) for two days. Explants are transferred to 16/8
light/dark cycles, and sub cultured every 2 weeks. Regenerating
shoots are transferred to root induction media (MS+ vitamins, 3%
sucrose, 2.25% gelrite, pH=5.8, 2 mg/l IBA).
[0862] Rooting plants are washed in water, to take all agar
residues, put in soil and covered. After a week of acclimatization,
lid is gradually taken off and plants are hardened.
[0863] Genotyping
[0864] Tissue samples are treated, and amplicons amplified in
accordance with the manufacturer's recommendations using Phire
Plant Direct PCR Kit (Thermo Scientific). Oligos used for these
amplifications are designed to amplify the genomic region spanning
from a region in the modified sequence of the GEiGS system, to
outside of the region used as HDR template, to distinguish from DNA
incorporation. Different modifications in the modified loci are
identified through different digestion patterns of the amplicons,
given by specifically chosen restriction enzymes.
[0865] Genomic PCR Reactions
[0866] Cell samples (A, B, C, D, E, as discussed in Example 3,
below) were processed for genomic DNA using a RNA/DNA Purification
Kit (Norgen) according to the manufacturer's instructions. Samples
were quantified by Qubit and DNA was stored at -20.degree. C.
[0867] An unspecific primer flanking the swap region was used for
the Tas1b (AtTAS1b_AT1G50055) and Tas3a (AtTAS3a_AT3G17185)
sequences. As a negative control the same swap specific reactions
were carried out using wild-type (WT) DNA as template. As a
positive PCR control a specific PCR for WT DNA was carried out for
all samples. Q5.RTM. High-Fidelity 2X Master Mix was used for PCR
amplifications.
[0868] 5 .mu.l of each PCR reaction were run on 0.8% agarose gels.
Band sizes were estimated by comparison to a molecular weight
marker (MW): 1 kb Plus DNA Ladder (NEB).
[0869] To confirm swaps, a Nested PCR reaction was carried out. The
first genomic PCR comprised unspecific forward and reverse primers
flanking the HDR region. PCR products were diluted 1/100 with
mili-q ultrapure water and then the aforementioned specific swap
PCRs were carried out. Unspecific primers used for the first PCR in
the Nested approach have annealing sites flanking the annealing
sited for the nested primers.
[0870] Primers Used:
TABLE-US-00008 Unspecific primer for Tas1b:
Tas1b_WT_Nested_Non_Speeific_DNA_R: (SEQ ID NO: 63)
5'-accaatttgacccaaaaaggc-3' Swap-specific primers for Tas1b:
Tas1b_Splicing30_Nested_DNA_F: (SEQ ID NO: 64)
5'-GCAGCAGATCAATGAAATTCAACG-3' Tas1b_Y2530_Nested_DNA_F: (SEQ ID
NO: 65) 5'-agCCGCTCTGTGGATTCTTG-3' Unspecific primer for Tas3a:
Tas3A_WT_Nested_Non_Specific_DNA_R: (SEQ ID NO: 66)
5'-aaactcctcgcctcttggtg-3' Swap-specific primers for Tas3a:
Tas3a_Ribo3a30_Nested_DNA_F: (SEQ ID NO: 67)
5'-TCTTCAGCACCTTCACCTTACG-3' Tas3a_Spliceo30_Nested_DNA_F: (SEQ ID
NO: 68) 5'-TCCTTTTTGACCAACATTTGTTTGT-3'
[0871] Positive Control Reactions
TABLE-US-00009 WT Tas1b Specific:
Tas1b_WT_Nested_Non_Specific_DNA_R: (SEQ ID NO: 69)
5'-accaattttacccaaaaaggc-3' Tas1b_WT_Nested_DNA_F: (SEQ ID NO: 70)
5'-tggacttagaatatgctatgttggac-3' WT Tas3a Specific:
Tas3a_WT_Nested_Non_Specific_DNA_R (SEQ ID NO: 71)
5'-aaactcctcgcctcttggtg-3' Tas3a_WT_Nested_DNA_F (SEQ ID NO: 72)
5'-tctatctctacctctaattcgttcgag-3'
[0872] DNA and RNA Isolation
[0873] Samples are harvested into liquid nitrogen and stored in
-80.degree. C. until processed. Grinding of tissue is carried out
in tubes placed in dry ice, using plastic Tissue Grinder Pestles
(Axygen, US). Isolation of DNA and total RNA from ground tissue is
carried out using RNA/DNA Purification kit (Norgen Biotek Corp.,
Canada), according to manufacturer's instructions. In the case of
low 260/230 ratio (<1.6), of the RNA fraction, isolated RNA is
precipitated overnight in -20.degree. C., with 1 .mu.l glycogen
(Invitrogen, US) 10% V/V sodium acetate, 3 M pH 5.5 (Invitrogen,
US) and 3 times the volume of ethanol. The solution is centrifuged
for 30 minutes in maximum speed, at 4.degree. C. This is followed
by two washes with 70% ethanol, air-drying for 15 minutes and
resuspending in Nuclease-free water (Invitrogen, US).
[0874] RNA Extraction
[0875] Cell samples (A, B, C, D, E, as discussed in Example 3,
below) were processed for RNA purification using a RNA/DNA
Purification Kit (Norgen) according to the manufacturer's
instructions. Samples were quantified by Qubit. RNA was stored at
-80.degree. C.
[0876] DNAse Treatment of RNA Samples
[0877] An RT-PCR reaction followed by PCR was used to look
specifically for small dsRNA fragments containing the swaps
(<200 bp), in order to prove the biogenesis of dsRNA which is
capable of targeting nematode target genes. To do so, the Turbo
DNA-Free Kit (Invitrogen) was used according to the manufacturer's
instructions. A DNAse treatment was further performed and the
concentration of samples was normalised.
[0878] Reverse Transcription (RT) and Quantitative Real-Time PCR
(qRT-PCR)
[0879] One microgram of isolated total RNA is treated with DNase I
according to manufacturer's manual (AMPD1; Sigma-Aldrich, US). The
sample is reverse transcribed, following the instructor's manual of
High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems,
US).
[0880] For gene expression, Quantitative Real Time PCR (qRT-PCR)
analysis is carried out on CFX96 Touch.TM. Real-Time PCR Detection
System (BioRad, US) and SYBR.RTM. Green JumpStart.TM. Taq
ReadyMix.TM. (Sigma-Aldrich, US), according to manufacturer's'
protocols, and analyzed with Bio-RadCFX manager program (version
3.1).
[0881] RT-PCR of RNA Samples for Expression Analysis for Tas1b and
Tas3a Swaps in Col-0 Cells
[0882] For RT-PCR, cDNA was generated using unspecific primers for
Tas1b and Tas3a, by the qScript Flex cDNA Synthesis Kit (Quanta
BioSciences). One cDNA reaction was done for the sense strand and
another for the anti-sense of each of Tas1b and Tas3a. Samples to
treat contained 165 ng/.mu.l RNA.
[0883] A negative control was used with no Reverse Transcriptase
(-RT control) for all RT-PCR reactions (same treatment but with
H.sub.2O instead of Reverse Transcriptase). This was to make sure
amplification in downstream PCR reactions was not happening because
of DNA carry-over. A water negative control was performed for each
PCR reaction. A master mix was made with RNA for +RT/-RT for each
treatment. Additional Master mixes were made--(i) with Reverse
Transcriptase and Buffer (+RT) and (ii) water and Buffer (-RT) for
all samples. Final primer concentration: 1 .mu.M
[0884] Primers:
[0885] Tas1b
TABLE-US-00010 Tas1b Sense: Tas1b_RT_A_R: (SEQ ID NO: 93)
5'-TAACATAAAAATATTACAAATATCAITCCG-3' Tasib Antisense: Tas1b_RT_B_F:
(SEQ ID NO: 94) 5'-TCAGAGTAGTTATGATTGATAGGATGG-3'
[0886] These primers were used for treatments A, B, and E.
[0887] Tas3a
TABLE-US-00011 Tas3a Sense: Tas3a_RT_A_R: (SEQ ID NO: 95)
5'-GCTCAGGAGGGATAGACAAGG-3' Tas3a Antisense: Tas3a_RT_B_F: (SEQ ID
NO: 96) 5'-CTCGTTTTACAGATTCTATTCTATCTC-3'
[0888] These primers were used for treatments C, D and E.
[0889] PCR on cDNA to Detect Expression of Tas1b and Tas3a
Redirected Towards Nematode Targets
[0890] In order to detect dsRNA transcribed from Tas1b or Tas3a
genes which have been redirected to target nematode genes, PCR
reactions were carried out using the cDNA as a template with one
unspecific primer for Tas3a or Tas1b, and another primer which is
Swap specific (i.e. binds only the relevant Tas sequence in which
nucleotides have been swapped following GEiGS-mediated
redirection). Unspecific primer annealing site was located slightly
downstream the sequence used for making cDNA. Specific primer
annealing sites were located less than 200 bp dowstream from the
unspecific primer annealing site. The approach was the same for
analysing expression of both strands of the dsRNA: Sense and
Antisene. Reactions were carried out also for -RT cDNA reactions to
make sure amplification did not happen from residual DNA in the
sample after DNAse treatment. As a negative control each reaction
was carried out on WT DNA as well to prove that amplification is
Swap specific. A H.sub.2O )negative control was included for each
PCR reaction. 5 ul of each cDNA PCR reaction were used as
template.
[0891] Primers:
[0892] Tas3a Sense Strand Specific Reactions:
TABLE-US-00012 Ribosomal protein 3a specific:
Tas3a_RNA_Non_Specific_A_F: (SEQ ID NO: 97)
5'-TGACCTIGTAAGACCCCATCTC-3' Tas3a_RNA_Ribo3a30_Specific_A_R: (SEQ
ID NO: 98) 5'-AggagaaaATTCGTAAGGTGAAGG-3' WT Specific:
Tas3a_RNA_Non_Specific_A_F: (SEQ ID NO: 99)
5'-TGACCTTGTAAGACCCCATCTC-3' Tas3a_RNA_WT_Specific_A_R: (SEQ ID NO:
100) 5'-GGTAGGAGAAAATGACTCGAACG-3'
[0893] Tas3a Anti-Sense Strand Specific Reactions:
TABLE-US-00013 Ribosomal protein 3a specific:
Tas3a_RNA_Non_Specific_B_R: (SEQ ID NO: 101)
5'-CAACCATACATCAATAACAAACAAAAG-3' Tas3a_RNA_Ribo3a30_Specific_B_F:
(SEQ ID NO: 102) 5'-ATATAGAATAGATatCGGCTTCTTCAG-3' WT Specific:
Tas3a_RNA_Non_Specific_B_R: (SEQ ID NO: 103)
5'-CAACCATACATCAATAACAAACAAAAG-3' Tas3a_RNA_Spliceo30_Specific_B_F
(SEQ ID NO: 104) 5'-TCCTTTTTGACCAACATTTGTTTGT-3'
[0894] Tas1b Sense Strand Specific Reactions:
TABLE-US-00014 Y25, beta subunit of COPI complex specific:
Tas1b_RNA_Non_Specific_A_F: (SEQ ID NO: 105)
5'-GAGTCATTCATCGGTATCTAACC-3' Tas1b_RNA_Y2530_Specific_A_R: (SEQ ID
NO: 106) 5'-agCCGCTCTGTGGATTCTTG-3' WT Specific:
Tas1b_RNA_Non_Specific_A_F: (SEQ ID NO: 107)
5'-GAGTCATTCATCGGTATCTAACC-3' Tas1b_RNA_WT_Specific_A_R: (SEQ ID
NO: 108) 5'-TGGACTTAGAATATGCTATGTTGGAC-3'
[0895] Tas1b Anti-Sense Strand Specific Reactions:
TABLE-US-00015 Y25, beta subunit of CON complex specific:
Tas1b_RNA_Non_Specific_B_R: (SEQ ID NO: 109)
5'-GCATATCCTAAAATATGTTTCGTTAAC-3' Tas1b_RNA_Y2530_Specific_B_F:
(SEQ ID NO: 110) 5'-TCGCCAAGAATCCACAGAGC-3'; WT Specific:
Tas1b_RNA_Non_Specific_B_R: (SEQ ID NO: 111)
5'-GCATATCCTAAAATATGTTTCGTTAAC-3' Tas1b_RNA_WT_Specific_B_F: (SEQ
ID NO: 112) 5'-TAAGTCCAACATAGCATATTCTAAGTC-3'
[0896] Study of Silencing Activity of Long dsRNA in Nicotiana
Benthamiana Towards TuMV
[0897] Plant Material
[0898] Nicotiana benthamiana were grown on soil in long day
conditions 16 hours light, 8 hours dark) at 21.degree. C. for 4
weeks until treated.
[0899] TuMV-GFP Vector Cloning
[0900] TuMW-GFP cDNA cassette was amplified from the vector
described in Tourino, A., et al. (Tourino, A., Sanchez, F.,
Fereres, A. and Ponz, F. (2008). High expression of foreign
proteins from a biosafe viral vector derived from Turnip mosaic
virus. Spanish Journal of Agricultural Research, 6(S1), p.48).
Amplification was done using the primer set
5'-ATGTTTGAACGATCGGGCCCaagggacacgaagtgatccg-3' (SEQ ID NO: 113) and
5'-CTCCACCATGTTCCCGGGggcacagagtgttcaacccc-3' (SEQ ID NO: 114). The
amplicon was cloned into a binary vector, harbouring the NPTII
resistance gene, in the T-DNA region through In-Fusion reaction,
according to manufacturer's protocol. For the purpose of
agrobacterium infiltration the vector was subsequently transformed
into agrobacterium strain GV3101.
[0901] Agroinduction and Leaf Infiltration
[0902] 1. Liquid culture of agrobacterium was grown in LB
[0903] 2. The cells were spined down and washed once with MMA media
(10 mM MES, 10 mM MgCl2, and 200 .mu.M acetosyringone, pH=5.6)
[0904] 3. The cells were spined down and the sup was taken out.
Pellet was resuspended in MMA media to OD600=0.5.
[0905] 4. Culture was shaken gently in the dark for 6 hours.
[0906] 5. Cultures were combined as required (1:1 ratios between
bacteria containing different vectors, each agrobacterium
containing a vector that expresses a single gene). Total final
agrobacterium density--OD600=0.5. TuMV-GFP vector was added to a
final density of OD600=0. 0001.
[0907] 6. Leaves of a 4-weeks old N. benthamiana plant were
infiltrated with the induced cultures, using a needleless
syringe.
[0908] Gene Sequences Used for GEiGS-dsRNA Silencing
TABLE-US-00016 SEQ ID NO: 115 AtTAS1B (At1g50055) SEQ ID NO: 116
GEiGS-TuMV SEQ ID NO: 117 GEiGS-TuMV- mature siRNA SEQ ID NO: 118
GEiGS-dummy SEQ ID NO: 119 GEiGS-dummy- mature siRNA SEQ ID NO: 120
miR173_AT3G23125 SEQ ID NO: 121 miR173-mature miRNA
[0909] Study of Arabidopsis Protection from TuMV Infection and
Disease
[0910] Plant Material
[0911] Arabidopsis seeds, collected from plants harboring the
desired GEiGS sequence, are chlorine gas sterilized and sown 1
seed/well in MS-S agar plates. Two weeks old seedlings are
transferred to soil. Plants are grown in 24.degree. C. under 16
hours light/8 hours dark cycles. Wild type non-modified (plants)
are grown and treated in parallel, as control.
[0912] Plant Inoculation and Analysis
[0913] Procedures for the inoculation and analysis of plants with
TuMV vectors are well established in the art and were previously
described [Sardaru, P. et al., Molecular Plant Pathology (2018),
19:1984-1994]. Four weeks old Arabidopsis seedlings are inoculated
with TuMV as previously described [Sanchez, F. et al. (1998) Virus
Research, 55(2): 207-219] or TuMV-GFP as previously described
[Tourino, A., et al. (2008) Spanish Journal of Agricultural
Research, 6(S1), p.48] expressing viral vectors. Scoring of
symptoms, in the case of TuMV, takes place 10-28 days post
inoculation. Analysis of GFP signal, in the case of TuMV-GFP, takes
place 7-14 days post inoculation.
[0914] In addition, 14 days post inoculation, new leaves growing
above the inoculation site, are harvested, and total RNA is
extracted using Total RNA Purification Kit (Norgene Biotek Corp.,
Canada), according to manufacturer's instructions. Small RNA
analysis and RNA-seq is carried out for profiling of gene
expression and small RNA expression on these samples.
[0915] Study of Tomato Infection with Whitefly
[0916] Plant Material
[0917] Tomato plants are grown from seeds collected from plants
harboring the desired GEiGS sequence, at one plant per pot in
22.degree. C. under 16 hours light/8 hours dark cycles. Wild type
non-modified (plants) are grown and treated in parallel, as
control.
[0918] Whitefly Inoculation
[0919] Five female whiteflies are introduced to a 4 weeks old
tomato plant. The whiteflies are placed into a clip cage holding a
single leaf. After 5 days, dead and living whiteflies, as well as
eggs, are counted.
[0920] In addition, 5 days post inoculation, the infected leaf is
harvested, and total RNA is extracted. Dead and living whiteflies
are collected separately, and total RNA is extracted from them as
well. Small RNA analysis and RNA-seq is carried out for profiling
of gene expression and small RNA expression on these samples.
[0921] Study of dsRNA Targeting a Nematode Gene
[0922] Nematode
[0923] Plant-parasitic cyst nematodes Globodera rostochiensis
(pathotype Ro1, acquired from the James Hutton Institute
collection) were maintained at the University of Cambridge under
DEFRA licence 125034/359149/3. Nematodes were maintained on Solanum
tuberosum cultivar Desiree. Fifty cysts were combined with a 50:50
mix of sand:loam in a 7 inch diameter pot. One tuber was planted
per pot, and watered regularly for a period of 3 months at
20.degree. C. Plants were allowed to dry for 1 month, and cysts
were collected from the soil using flotation followed by nested
sieving. Juveniles were hatched from the cysts by incubation with
tomato root diffusate, replaced every 2-3 days for a period of up
to 14 days. Hatched juveniles were stored at 4.degree. C. in water
containing 0.01% Tween-20 for up to 1 week before being used in
subsequent assays.
[0924] Sequences Used [0925] AtTAS3a_AT3G17185--SEQ ID NO: 122
[0926] GEiGS-Ribosomal protein 3a-transcript--SEQ ID NO: 123 [0927]
GEiGS-Ribosomal protein 3a-transcript--SEQ ID NO: 124--indicates
region of homology to the target gene, generated through the GEiGS
design to generate siRNA in nematodes (i.e. the expected processed
siRNA) [0928] GEiGS-Spliceosomal SR protein-transcript--SEQ ID NO:
125 [0929] GEiGS-Spliceosomal SR protein-transcript--SEQ ID NO:
126--indicates region of homology to the target gene, generated
through the GEiGS design to generate siRNA in nematodes(i.e. the
expected processed siRNA) [0930] miR390_AT2G38325--SEQ ID NO:
127
[0931] RNA Preparation for Feeding
[0932] Total RNA from infiltrated N. benthamiana leaves was
extracted with Tri-Reagent (Sigma-Aldrich, USA), with two
chloroform washes, and overnight precipitation in isopropanol.
Recovered RNA was further cleaned with standard sodium acetate
precipitation.
[0933] All recovered RNA was cleaned using Amicon.RTM. Ultra 0.5 mL
Centrifugal Filters 3KD cut-off (Merck, USA), according to
manufacturer's instructions, and 3 washed with DDW. RNA was
quantified using nanodrop.
[0934] Nematode Feeding Protocol
[0935] RNA was diluted to 1.76 .mu.g/.mu.l in 1.times.M9 and 50 mM
Octopamine. 3500 J2 per repeat were pelleted in 1.5 ml Eppendorf to
approx volume of 5 .mu.l. 25 .mu.l of the RNA solution was added to
the nematodes and incubated at 20.degree. C. in a heat block and
rotation at 300 rpm (final RNA concentration was 1.47 .mu.g/.mu.l).
After 72 hours, washes were carried out by spinning down the
nematodes (10 k g 1 min), removal of supernatant. Washes were
repeated 3 times with 500 .mu.l RNAse free water. Pellet was snap
frozen in Liquid nitrogen and kept in -80.degree. C. until
treated.
[0936] Nematode RNA Extraction and Purification
[0937] RNA isolation was carried out using the Direct-zol RNA
Miniprep: Zymo Research Cat. No. R2052, as per manufacturer's
recommendations.
[0938] Using a microtube pestle, the frozen (liq N2 or Dry ice)
tissue samples (.ltoreq.25 mg) were crushed until powdered in
eppendorf, and 600 .mu.l TRI Reagent was added to sample and
grinding continued until fully homogenised. The following steps
were then performed at room temperature and centrifugation at
10,000-16,000.times.g for 30 seconds, unless specified:
[0939] 1. An equal volume of ethanol (95-100%) was added to a
sample lysed in TRI Reagent or similar1 and mixed thoroughly.
[0940] 2. The mixture was transfered into a Zymo-Spin.TM. IICR
Column2 in a Collection Tube and centrifuged. The column was
transferred into a new collection tube and the flow through
discarded.
[0941] 3. DNaseI treatment was carried out in column
[0942] (3a) 400 .mu.l RNA Wash Buffer were added to the column and
centrifuged.
[0943] (3b) In an RNase-free tube, 5 .mu.l DNase I (6 U/.mu.l) and
75 .mu.l DNA Digestion Buffer were added and mixed. The mix was
added directly to the column matrix.
[0944] (3c) Incubated at room temperature (20-30.degree. C.) for 15
minutes.
[0945] 4. 400 .mu.l Direct-zol.TM. RNA PreWash was added to the
column and centrifuged. The flow-through was discarded and step was
repeated.
[0946] 5. 700 .mu.l RNA Wash Buffer was added to the column and
centrifuged for 2 minutes to ensure complete removal of the wash
buffer. The column was transfered carefully into an RNase-free
tube.
[0947] 6. To elute RNA, 30 .mu.l of DNase/RNase-Free Water was
added directly to the column matrix and centrifuged.
[0948] 7. RNA was quantified using a NanoDrop
spectrophotometer/fluorometer or a Qubit fluorometer, RNA was
either used immediately or stored frozen at .ltoreq.-70.degree.
C.
[0949] qRT cDNA Library Preparation
[0950] (Quanta BIOSCIENCE: qScript Flex cDNA Synthesis Kit)
[0951] 1. All components (excluding enzyme) were thawed, mixed
thoroughly, and centrifuged (before use), and placed on ice (before
use).
[0952] 2. The following were added to a 0.2 mL thin-walled PCR tube
or 96-well PCR reaction plate sitting on ice:
[0953] 3.
TABLE-US-00017 Component volume RNA (1 .mu.g to 10 .mu.g total RNA)
variable Nuclease-free water variable Oligo dT 2 .mu.l Final volume
15.0 .mu.l Note: (For a mixed primer strategy, 2 .mu.l of Oligo dT
was used. For multiple first-strand reactions, a master mix was
prepared with the reaction mix and RT and dispensed 5 .mu.l into
each tube).
[0954] 4. Components were mixed by gentle vortexing and then
centrifuged 10s to collect contents
[0955] 5. Incubated for 5 min at 65.degree. C. and then snaped
chill in ice.
[0956] 6. The following were added to the primed RNA template
mixture:
TABLE-US-00018 Component volume qScript Flex Reaction Mix (5X) 4
.mu.l qScript Reverse Transcriptase 1 .mu.l final volume 20.0 .mu.l
Note: (For multiple first-strand reactions, a master mix was
prepared with the reaction mix and RT, and dispensed 5 .mu.l into
each tube).
[0957] 7. Components were mixed by gentle vortexing and then
incubated as follows: [0958] 60 min at 42.degree. C. [0959] 5 min
at 85.degree. C. [0960] Hold at 4.degree. C.
[0961] 8. After completion of cDNA synthesis, an additional 30
.mu.l of dH2O or TE buffer [10 mM Tris (pH 8.0), 0.1 mM EDTA] was
added, using 2-3 .mu.l for 20 .mu.l qRTPCR reactions. cDNA could be
stored at -20.degree. C.
[0962] SYBR Green Jump Start Taq Ready Reaction Protocol
[0963] 1. All components (except enzyme) were thawed, mixed
thoroughly, and centrifuged before use. Kept on ice before use.
[0964] 2. The following was added to a 0.2 mL thin-walled PCR tube
or 96-well PCR reaction plate sitting on ice:
TABLE-US-00019 Component volume 2X SYBR master mix 10 .mu.l
Specific Forward primer(10 uM) 1 .mu.l Specific Reverse primer(10
uM) 1 .mu.l cDNA template 2-3 .mu.l Nuclease free dH2O Variable
final volume 20 .mu.l
[0965] 3. Samples were incubated as follows: [0966] 94.degree. C. 2
min. [0967] 94.degree. C. 15 sec. [0968] 55-60.degree. C. 60 sec,
35-40 cycles read SYBR signal [0969] Melting curve: [0970]
95.degree. C.->65.degree. C. at 20.degree. C. per cycle collectd
signal continuously from 65.degree. C.->95.degree. C. per 0.2
sec
[0971] Reaction were run in technical triplicates, for both, the
gene of interest and the endogenous calibrator.
[0972] Primer Sequence
TABLE-US-00020 Spliceosomal SR protein: qRTSpSR_FWD SEQ ID NO: 128
GCTCAACTGACAAAGAATCTCTCAC qRTSpSR_REV SEQ ID NO: 129
TTGAAAATTGGGTCAAAGAAATGCG Ribosomal protein3a: qRTRib3a_FWD SEQ ID
NO: 130 GAACGGTCGCTACGATTACGA qRTRib3a_REV SEQ ID NO: 131
CAAACGCTCTGTTGAACAGGC Endogenous gene for normalization:
NEMAACTIN_09251_F SEQ ID NO: 132 TTCCAGCAGATGTGGATCAG
NEMAACTIN_09251_R SEQ ID NO: 133 CGGCCTTATTCTTCAAGCAC
[0973] Materials for bioinformatic analysis-
[0974] Small-RNA raw data in FASTQ format was processed using
cutadapt 2.8 with parameters "-m 18-u 4-a
NNNNTGGAATTCTCGGGTGCCAAGG" (SEQ IS NO: 138) to trim the sequencing
adapter, remove the random adapters, and keep only reads longer
than 18 nt. RNA-set raw data in FASTQ format was processed using
cutadapt 2.8 with parameters "-m 18-a
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" (SEQ IS NO: 139) to remove
sequencing adapters and keep reads longer than 18 nt.
[0975] An alignment index was created for a pseudo-genome composed
by the target sequences using STAR version 2.7.1a with parameter
"--genomeSAindexNbases 3" to accomodate the small
pseudo-genome.
[0976] Small-RNA adapter-trimmed reads were aligned to the
pseudo-genome using STAR 2.7.1a with parameters "--outSAMtype BAM
Unsorted--outFilterMismatchNmax 0--alignIntronMax 1--alignEndsType
EndToEnd--scoreDelOpen--10000--scoreInsOpen--10000". RNA-seq
adapter-trimmed reads where aligned using the same resources with
parameters "--outSAMtype BAM Unsorted--alignEndsType
EndToEnd--alignIntronMax 500",
[0977] A custom python script was used to filter aligned small-RNA
reads to lengths between 20 and 24 nucleotides, and RNA-seq reads
to lengths greater than 50 nucleotides.
[0978] Read coverage against the target sequences was calculated
using bedtools 2.29.2 with parameters "genomecov--bg--scale
{factor}" where the factor was calculated to normalise read counts
to reads per million (RPM).
[0979] Coverage plots were generated using the Sushi package for R,
version 1.25.0.
Example 1A
Genome Editing Induced Gene Silencing (GEiGS)
[0980] In order to design GEiGS oligos, template non-coding RNA
molecules (precursors) that are processed and give raise to
derivate small silencing RNA molecules (matures) are required. Two
sources of precursors and their corresponding mature sequences were
used for generating GEiGS oligos. For miRNAs, sequences were
obtained from the miRBase database [Kozomara, A. and
Griffiths-Jones, S., Nucleic Acids Res (2014) 42: D68,AiD73].
tasiRNA precursors and matures were obtained from the tasiRNAdb
database [Zhang, C. et al, Bioinformatics (2014) 30:
1045,Ai1046].
[0981] Silencing targets were chosen in a variety of host organisms
(data not shown). siRNAs were designed against these targets using
the siRNArules software [Holen, T., RNA (2006) 12: 620,Ai1625.].
Each of these siRNA molecules was used to replace the mature
sequences present in each precursor, generating "naive" GEiGS
oligos. The structure of these naive sequences was adjusted to
approach the structure of the wild type precursor as much as
possible using the ViennaRNA Package v2.6 [Lorenz, R. et al.,
ViennaRNA Package 2.0. Algorithms for Molecular Biology (2011) 6:
26]. After the structure adjustment, the number of sequences and
secondary structure changes between the wild type and the modified
oligo were calculated. These calculations are essential to identify
potentially functional GEiGS oligos that require minimal sequence
changes with respect to the wild type.
[0982] CRISPR/cas9 small guide RNAs (sgRNAs) against the wild type
precursors were generated using the CasOT software [Xiao, A. et
al., Bioinformatics (2014) 30: 1180, Ai11.82]. sgRNAs were selected
where the modifications applied to generate the GEiGS oligo affect
the PAM region of the sgRNA, rendering it ineffective against the
modified oligo.
Example 1B
Gene Silencing of Endogenous Plant Gene--PDS
[0983] In order to establish a high-throughput screening for
quantitative evaluation of endogenous gene silencing using Genome
Editing Induced Gene Silencing (GEiGS), the present inventors
considered several potential visual markers. The present inventors
chose to focus on genes involved in pigment accumulation, such as
those encoding for phytoene desaturase (PDS). Silencing of PDS
causes photobleaching (FIG. 8B) which allows to use it as robust
seedling screening after gene editing as proof-of-concept (POC).
FIGS. 8A-C show a representative experiment with N. benthamiana and
Arabidopsis plants silenced for PDS. Plants show the characteristic
photobleaching phenotype observed in plants with diminished amounts
of carotenoids.
[0984] In the POC experiment, choosing siRNAs was carried out as
follows:
[0985] In order to initiate the RNAi machinery in Arabidopsis or
Nicotiana benthamiana against the PDS gene using GEiGS application,
there is a need to identify effective 21-24 bp siRNA targeting PDS.
Two approaches are used in order to find active siRNA sequences: 1)
screening the literature--since PDS silencing is a well-known assay
in many plants, the present inventors are identifying well
characterized short siRNA sequences in different plants that might
be 100% match to the gene in Arabidopsis or Nicotiana benthamiana.
2) There are many public algorithms that are being used to predict
which siRNA will be effective in initiating gene silencing to a
given gene. Since the predictions of these algorithms are not 100%,
the present inventors are using only sequences that are the outcome
of at least two different algorithms.
[0986] In order to use siRNA sequences that silence the PDS gene,
the present inventors are swapping them with a known endogenous
non-coding RNA gene sequence using the CRISPR/Cas9 system (e.g.
changing a miRNA sequence, changing a long dsRNA sequence, creating
antisense RNA, changing tRNA etc.). There are many databases of
characterized non-coding RNAs e.g. miRNAs; the present inventors
are choosing several known Arabidopsis or Nicotiana benthamiana
endogenous non-coding RNAs e.g. miRNAs with different expression
profiles (e.g. low constitutive expression, highly expressed,
induced in stress etc.). For example, in order to swap the
endogenous miRNA sequence with siRNA targeting PDS gene, the
present inventors are using the RR approach (Homologous
Recombination). Using HR, two options are contemplated: using a
donor ssDNA oligo sequence of around 250-500 nt which includes, for
example, the modified miRNA sequence in the middle or using
plasmids carrying 1 Kb-4 Kb insert which comprises only minimal
changes with respect to the miRNA surrounding in the plant genome
except the 2.times.21 bp of the miRNA. and the *miRNA that is
changed to the siRNA of the PDS (500-2000 bp up and downstream the
siRNA, as illustrated in FIG. 7). The transfection includes the
following constructs: CRISPR:Cas9/GFP sensor to track and enrich
for positive transformed cells, gRNAs that guides the Cas9 to
produce a double stranded break (DSB) which is repaired by HR
depending on the insertion vector/oligo. The insertion vector/oligo
contains two continuous regions of homology surrounding the
targeted locus that are replaced (i.e. miRNA) and is modified to
carry the mutation of interest (i.e. siRNA). If plasmid is used,
the targeting construct comprises or is free from restriction
enzymes-recognition sites and is used as a template for homologous
recombination ending with the replacement of the miRNA with the
siRNA of choice. After transfection to protoplasts, FACS is used to
enrich for Cas9/sgRNA-transfected events, protoplasts are
regenerated to plants and bleached seedlings are screened and
scored (see FIG. 5). As control, protoplasts are transfected with
an oligo carrying a random non-PDS targeting sequence. The positive
edited plants are expected to produce siRNA sequences targeting PDS
and therefore PDS gene is silenced and seedling are seen as white
compared to the control with no gRNA. It is important to note that
after the swap, the edited miRNA will still be processed as miRNA
because the original base-pairing profile is kept. However, the
newly edited processed miRNA has a high complementary to the target
(e.g. 100%), and therefore, in practice, the newly edited small RNA
will act as siRNA.
Example 1C
Harboring Resistance of Arabidopsis Plants to TuMV Viral
Infection
[0987] Changes in the Arabidopsis genome are designed to introduce
silencing specificity in dysfunctional non-coding RNAs to target
the Turnip Mosaic Virus (TuMV). These sequences, together with
extended homologous arms in the context of the genomic loci, are
introduced in PUC57 vector, named DONOR. Guide RNAs are introduced
in the CRISPR/CAS9 vector system, in order to generate a DNA
cleavage in the desired loci. The CRISPR/CAS9 vector system is
co-introduced to the plants with the DONOR vectors via gene
bombardment protocol, to introduce desired modifications through
Homologous DNA Repair (HDR),
[0988] Arabidopsis seedlings with the desired changes in their
genome are identified through genotyping, and inoculated with
agrobacterium harboring either TuMV or TuMV-CGP and scored for
viral response.
Example 2
Harboring Resistance of Tomato Plants to Whitefly Infestation
[0989] Changes in the tomato genome are designed, to generate
non-coding RNAs, according to the GEiGS 2.0 pipeline (discussed
above in the `General Materials and Experimental Prosedures`
section above), to target the essential gene in whitefly. These
sequences, together with extended homologous arms in the context of
the genomic loci, are introduced in PUC57 vector, named DONOR.
Guide RNAs are introduced in the CRISPR/CAS9 vector system, in
order to generate a DNA cleavage in the desired loci. These are
co-introduced to the plants with the DONOR vectors via gene
bombardment protocol, to introduce desired modifications through
Homologous DNA Repair (HDR). Tomato plants, identified to harbor
the desired genomic changes through genotyping, are introduced with
whiteflies and scored for response.
Example 3
[0990] Using GEiGS on Trans Activating Silencing RNA in A. Thaliana
Protoplasts
[0991] In order to demonstrate Homology Dependant Recombination
(HDR) events in plant cells when using GEiGS to redirect the
silencing specificity of tasiRNA, a transfection assay in
Arabidopsis protoplasts was carried out using vectors expressing
the CRISPR/CAS9 endonuclease, an sgRNA to direct a DNA break, and a
"Donor" sequence (also referred to as the GEiGS Donor), to
introduce the desired nucleotide changes via GEiGS (also referred
to herein as "swaps"). The Donor sequence included a sequence
corresponding to the target sequence with the desired nucleotides
changes, flanked by homologous arms (about 500 base pairs upstream
and downstream of the changed sequences), to facilitate the
HDR.
[0992] GEiGS approach was essentially according to the principles
described above and in WO 2019/058255 (incorporated herein by
reference), and as exemplified herein below. Briefly, when a vector
comprising the GEiGS-donor is introduced to a cell together with an
endonuclease such as Cas9 and an sgRNA targeting the gene to be
edited, the GEiGS-oligo sequence is introduced into the genome of
the cell (mediated by HDR), such that the edited gene now includes
the desired changes (e.g. encodes a TAS gene which can be
transcribed to a long dsRNA whose silencing activity has been
redirected towards a target of choice).
[0993] Two genes were used as backbones for this manipulation, both
encoding trans-acting-siRNA-producing (TAS) molecules--TAS1b and
TAS3a (see below). The changes to be introduced using GEiGS were
chosen such that they would give rise to long dsRNA. and small
secondary tasiRNA that would target and silence essential genes in
the nematode Globodera rostochiensis. These target genes were
chosen based on previous publications that discussed negative
effects in a nematode when the genes were targeted using an RNAi
technology (Table 3, below), Since these genes were identified in a
different strain of nematodes, their homologues were identified
through a BLAST search in the Globodera rostochiensis publicly
available database
(www(dot)parasite(dot)wormbase(dot)org/Globodera_rostochiensis_prjeb13504-
/Info/Index/), using the chosen genes as queries.
TABLE-US-00021 TABLE 3 Target genes in nematodes Target Homologue
in gene Gene Host Globodera Nematode symbol species plant Phenotype
Reference rostochiensis 1 Splicing AW828516 M. Tobacco >90%
reduction Yadav et al., GROS_g05960 factor incognita in number of
2006 (SEQ ID NO: 55) established nematodes 2 Ribosomal CB379877 H.
Soybean 87% reduction Klink et at., GROS_g04462 protein 3a glycines
in number of 2009 (SEQ ID NO: 56) female cysts 3 Sliceosomal
BI451523 H. Soybean 88% reduction Klink et at., GROS_g04863 SR
glycines in number of 2009 (SEQ ID NO: 57) protein female cysts 4
Y25, beta CB824330 H. Soybean 81% reduction in Li et al.,
GROS_g00263 subunit of glycines number of 2010 a,b (SEQ ID NO: 58)
COPI nematode eggs complex
SiRNA target sites chosen in the gene sequences are depicted in the
below sequences:
TABLE-US-00022 (SEQ ID NO: 59) GROS_g05960:
TGGAGCAGCAGATCAATGAAATTCAACGAC (SEQ ID NO: 60) GROS_g04462:
ATTCGTAAGGTGAAGGTGCTGAAGAAGCCG (SEQ ID NO: 61) GROS_g04863:
AAAAACAAACAAATGTTGGTCAAAAAGGAT (SEQ ID NO: 62) GROS_g00263:
CCGCTCTGTGGATTCTTGGCGAATATTGCG
[0994] Transfection of Col-0 Protoplasts
[0995] As described above, Arabidopsis thaliana (Col-0) protoplasts
were transfected with a vector coding for Crispr/Cas9 and sgRNAs
and a vector containing the donor template to achieve HDR-mediated
swaps. The experiment was designed such that sequences in the Tas1b
(AtTAS1b_AT1G50055) or Tas3a (AtTAS3a_AT3G17185) genes were
swapped, generating long-dsRNA and small secondary RNAs that target
30 bp sequences in the above-described nematode target genes. Two
swaps were designed in the TAS1b locus, and two swaps in the TAS3a
locus. Swaps were independent from each other.
[0996] The various combination of vectors used in the different
experimental conditions is listed in Table 4 below. Different
combinations of TAS backbones and donor oligos were used. Negative
control transfections were carried out with no DNA (Treatment
E).
TABLE-US-00023 TABLE 4 Experimental conditions sgRNA Vector Exp.
(Crispr/Cas9, Condition sgRNA, mCHERRY) DONOR Vector A
sgRNA_AtTAS1b GEiGS-Y25-DONOR B sgRNA_AtTAS1b GEiGS-Splicing
factor-DONOR C sgRNA_AtTAS3a GEiGS- Ribosomal protein 3a -DONOR D
sgRNA_AtTAS3a GEiGS-Spliceosomal SR protein-DONOR E -- --
[0997] Genomic Evidence of Tas1b and Tas3a Swaps in Col-0 Cells
[0998] Only a small fraction of transfected cells was expected to
have successfully repaired DNA double strand breaks with an HDR
Donor template, generating a swap. This is due to the low frequency
of HDR events, as known in the art. Therefore, even the transfected
samples were expected to contain a significant number of cells in
which no swap took place.
[0999] In order to demonstrate that all the processed samples were
suitable for PCR amplification, PCR reactions were carried out
using WT specific primers on genomic DNA obtained from all
treatments (A to E). The forward primer was designed to anneal to
the region where swaps were intended to take place, while the
reverse primer was designed to anneal further downstream the
recombination site (FIG. 9A, primers denoted by arrows and the
expected PCT product depicted as a dashed line). One primer set was
designed for WT Tas1b and a different one for WT Tas3a. The
expected PCR products (594 bp long) were obtained for WT Tas1b, Y25
and Splicing factor swap treatments (WT=Treatment E). In a similar
way, the expected PCR products (574 bp long) were obtained for WT
Tas3a, Ribosomal protein 3a and Spliceosome SR protein swap
treatment. No amplification was obtained for negative controls, as
expected (water, no template) (FIGS. 9B-C).
[1000] Specific PCR reactions were then carried out with the same
unspecific reverse primer annealing further downstream the
recombination site (one unspecific primer for WT Tas1b and a
different one for WT Tas3a) and a swap-specific forward primer
(FIG. 9A). As a control for the specificity of the PCR reaction WT
DNA was used for a negative control for each primer pair (FIGS.
9E-F). The expected specific PCR products were obtained for Y25
(587 bp long) and Splicing factor (584 bp long) swap treatments for
Tas1b. In a similar way, the expected specific PCR products were
obtained for Ribosomal protein 3a (568 bp long) and Spliceosome SR
protein (574 bp long) swap treatments (FIGS. 9D-E). No
amplification was obtained when WT DNA was used as a template for
all PCR reactions, further demonstrating the specificity of swap
specific primers. Furthermore, no amplification was obtained for
negative controls, as expected (water, no template).
[1001] Crude PCR products were further Sanger sequenced (Eurofins)
using the unspecific reverse primer. Sequencing results were
analysed using Snapgene software. It was expected to detect some
mutations introduced by the HDR swaps (and not introduced by the
primers used) right before the specific primer binding sites.
Sequencing reactions confirmed the identity and location of such
mutations. WT specific products were also sent for sequencing, both
for Tas1b and Tas3a, following a similar approach and identity of
WT sequences could also be confirmed (FIG. 9F). Results confirmed
that sgRNA guides were active and HDR swaps took place for all
treatments, both for Tas1b and Tas3a loci and using different donor
oligos.
[1002] Similar results were obtained when following a nested PCR
approach in which an unspecific PCR reaction was carried out before
doing a nested, specific PCR reactions using the same sets of
primers that were used for the main approach.
[1003] Genomic PCR
[1004] Cell samples (A, B, C, D, E) were processed for genomic DNA
using a RNA/DNA Purification Kit (as discussed above).
[1005] As noted above, an unspecific primer flanking the swap
region was used for the Tas1b (AtTAS1b_AT1G50055) and Tas3a
(AtTAS3a_A T3G17185) sequences. As a negative control the same swap
specific reactions were carried out using wild-type (WT) DNA as
template. No amplification was expected. As a positive PCR control
a specific PCR for WT DNA was carried out for all samples.
[1006] A similar alternative approach was also followed to confirm
swaps. Instead of a single PCR reaction, a Nested PCR reaction was
carried out. The first genomic PCR comprised unspecific forward and
reverse primers flanking the HDR region. Unspecific primers used
for the first PCR in the Nested approach have annealing sites
flanking the annealing sited for the nested primers.
[1007] Genes and Sequences
[1008] Table 5 below lists (for each combination of TAS backbone
and nematode target gene) the region of the GEiGS-oligo within the
GEiGS donor, which includes the intended swaps, and will give rise
to the siRNA that will target the gene in the nematode. The
sequences of the wild-type TAS backbones, the sgRNAs used and the
GEiGS donor designs are listed below.
[1009] Homologous regions in the GEiGS designs (i.e. regions which
are intended to swap the wild type region in order to redirect the
silencing activity and specificity of the TAS long dsRNA towards
silencing of the target gene) are shown underlined. In the
sequences below, the donor sequence inserted in the donor vector
and containing the swapped nucleotides with homology arms is
termed, for example, GEiGS-Splicing factor-DONOR. The long dsRNA
transcripts of the TAS genes after the swap event, that will target
the genes in the nematode, are termed, for example, GEiGS-Splicing
factor-transcript.
TABLE-US-00024 TABLE 5 Swapped oligos Homologous region in the
GEiGS-oligo name target gene Backbone GEiGS design Amplifier
GEiGS-Splicing factor Splicing factor atTAS1b (e.g.
GTCGTTGAATTTCATTGATCT miR173 AtTAS1b_AT1 GCTGCTCCA (SEQ ID NO: 76)
G50055 - SEQ ID NO: 73) GEiGS-Spliceosomal Spliceosomal SR atTAS3a
(e.g. ATCCTTTTTGACCAACATTTG miR390 SR protein protein AtTAS3a_AT3
TTTGTTTTT (SEQ ID NO: 90) G17185 - SEQ ID NO: 83) GEiGS-Y25 Y25,
beta subunit atTAS1b (e.g. CGCAATATTCGCCAAGAATC miR173 of COPI
complex A1TAS1b_AT1 CACAGAGCGG (SEQ ID NO: G50055 - SEQ 80) ID NO:
73) GEiGS-Ribosomal Ribosomal protein atTAS3a (e.g.
CGGCTTCTTCAGCACCTTCA miR390 protein 3a 3a AtITAS3a_AT3 CCTTACGAAT
(SEQ ID NO: G17185 - SEQ 86) ID NO: 83)
[1010] Additional Sequences per Table 5: [1011]
AtTAS1b_AT1G50055--SEQ ID NO: 73 [1012] sgRNA_AtTAS1b (including
PAM)--SEQ ID NO: 74 [1013] GEiGS-Splicing factor-transcript--SEQ ID
NO: 75 [1014] Homologous region in the GEiGS design of
GEiGS-Splicing factor-transcript--SEQ ID NO: 76 [1015]
GEiGS-Splicing factor-DONOR--SEQ ID NO: 77 [1016] Homologous region
in the GEiGS design of GEiGS-Splicing factor-DONOR--SEQ ID NO: 78
[1017] GEiGS-Y25-transcript--SEQ ID NO: 79 [1018] Homologous region
in the GEiGS design of GEiGS-Y25-transcript--SEQ ID NO: 80 [1019]
Y25-DONOR--SEQ ID NO: 81 [1020] Homologous region in the GEiGS
design of Y25-DONOR--SEQ ID NO: 82 [1021] AtTAS3a_AT3G17185--SEQ ID
NO: 83 [1022] sgRNA_AtTAS3a (including PAM)--SEQ ID NO: 84 [1023]
GEiGS-Ribosomal protein 3a-transcript--SEQ ID NO: 85 [1024]
Homologous region in the GEiGS design of GEiGS-Ribosomal protein
3a-transcript--SEQ ID NO: 86 [1025] GEiGS-Ribosomal protein 3a
-DONOR--SEQ ID NO: 87 [1026] Homologous region in the GEiGS design
of GEiGS-Ribosomal protein 3a-DONOR--SEQ ID NO: 88 [1027]
GEiGS-Spliceosomal SR protein-transcript--SEQ ID NO: 89 [1028]
Homologous region in the GEiGS design of GEiGS-Spliceosomal SR
protein-transcript--SEQ ID NO: 90 [1029] GEiGS-Spliceosomal SR
protein-DONOR--SEQ ID NO: 91 [1030] Homologous region in the GEiGS
design of GEiGS-Spliceosomal SR protein-DONOR--SEQ ID NO: 92
Example 4
Long Double-Stranded RNA in Cells Expressing a TAS Gene Modified by
GEiGS
[1031] In order to demonstrate that modifying a nucleic acid
sequence of a plant gene encoding a long dsRNA results in a
modified dsRNA in the cell, RNA originating from the protoplasts
analysed in Example 3 was used. RNA was reverse transcribed using
specific primers to the target tested loci (on a region that was
not designed to be swapped). Then, using primers specific to the
swap region (to specifically amplify a swapped sequence or a wt
sequence), the presence of long dsRNA, as a sense and anti-sense of
the predicted RNA transcript, was studied.
[1032] RNA was extracted from all treatments and treated with DNAse
to remove traces of DNA. RNA samples were then subjected to RT-PCR
using an unspecific primer to generate cDNA. Two different
independent RT-PCR (+RT) reactions were carried out to generate
cDNA from the Sense and Anti-sense strand of Tas DNA, respectively.
The approach was followed both for Tas1b and Tas3a. Reverse
transcription controls (-RT) were carried out with all the same
reagents but water was added instead of Reverse Transcriptase. If
there was no reverse transcriptase in the reaction mix no cDNA was
generated so any PCR products obtained in subsequent PCR reactions
were necessarily amplified from carry-over DNA that remained intact
after DNAse treatment of samples.
[1033] Specific PCR reactions were carried out with an unspecific
forward primer and a swap-specific reverse primer (for the Sense
cDNA) (FIG. 10A) or an unspecific reverse primer and a
swap-specific forward primer (for the Antisense cDNA) (FIG. 10B).
PCR reactions were designed in such a way that the length for all
PCR products was lower than 200 nucleotides (FIGS. 10A-B).
[1034] WT specific PCR reactions for Tas1b (FIGS. 10C-D, right
panels) and Tas3a sequences (FIGS. 10E-F, right panels) showed that
RNA from treated samples was suitable for PCR amplification.
Expected PCR products were obtained for the wt loci (Tas1b and
Tas3a genes) both for Sense (105 bp for Tas1b, 133 bp for Tas3a)
and Anti-sense strand (147 bp for Tas1b, 101 bp for Tas3a), in the
treated samples, showing their coexistence and thus the presence of
dsRNA in the samples. Clean -RT reactions indicated that traces of
DNA were successfully removed from the RNA samples by DNAse
treatment.
[1035] Swap specific RT-PCR reactions were carried out for treated
RNA, and specific differentially amplified PCR products were
obtained for Y25 Sense (98 bp) and Anti-sense treatments (149 bp)
(FIGS. 10C-D, left panels). In the same manner specific
differentially amplified PCR products were obtained for Ribosomal
protein 3a Sense (130 bp) and Anti-sense treatments (118 bp) (FIGS.
10E-F, left panels). No amplification was obtained in negative
controls using water and no RT template. As a negative control for
each specific PCR reaction, the same master mixes were used for PCR
using RNA from non treated cells as a template (treatment E). Lack
of strong bands of the expected sizes showed the specificity for
the swap specific primers, demonstrating RNA expression from the
swapped loci.
[1036] Crude PCR products were Sanger sequenced using the
unspecific forward primer in the case of the Sense approach (FIG.
10G) and the unspecific reverse primer in the case of the
Anti-sense approach (FIG. 10H). It was expected to detect some
mutations introduced by the HDR swaps (and not introduced by the
printers used) right before the specific primer binding sites.
Sequencing reactions confirmed the identity and location of such
mutations for Tas1b Y25 swap and Tas3a Ribosomal protein 3a swaps
(FIGS. 10G-H). WT specific products were also sent for sequencing,
both for Tas1b and Tas3a, following a similar approach and identity
of WT sequences could also be confirmed (FIG. 10I).
[1037] Thus, existence of dsRNA transctipts containing swaps was
successfully proven within the cells treated using treatments A and
C of Example 3 (i.e. a dsRNA of Tas1b containing swaps targeting it
towards the Y25 target gene, and a dsRNA of Tas3a containing swaps
targeting it towards the Ribosomal protein 3a target gene).
Example 5
[1038] Silencing Activity of Long-dsRNA with Altered Targeting
Specificity in Nicotiana Benthamiana
[1039] The following experiment demonstrated silencing activity
towards a target gene of choice when using dsRNA in which targeting
specificity (of small RNAs processed from it) has been redirected
towards the gene of choice (e.g. using the GEiGS approach of
HDR-mediated redirection of silencing specificity). To do so, a
transient expression system was used through infiltration of
Nicotiana benthamiana leaves with: (1) a Turnip mosaic virus (TuMV)
vector with GFP marker, and (2) a vector for overexpression of the
"GEiGS design"--a TAS gene encoding for a transcript based on TAS1b
with nucleotide changes necessary for targeting TuMV, which could
be generated by using GEiGS to introduce the nucleotide changes
into the TAS1b gene backbone in the Arabidopsis genome (also
referred to below as "GEiGS-TuMV"). Infiltration was carried out by
introducing agrobacterium bacteria of strain GV3101, which have
been transformed with the various vectors, into the leaves.
[1040] The oligonucleotides which are required to generate "GEiGS
design" using the GEiGS approach, as described above for A.
thaliana, and in particular--(1) the sgRNA which are used to cut
TAS1b, (2) the siRNA sequence that targets TuMV (which are
introduced into the TAS1b backbone by the GEiGS donor using an
HDR-mediated swap), (3) the GEiGS donor which includes the desired
changes to the TAS1b backbone, are as follows:
[1041] (1) The sgRNA which would have been used to cut TAS1b SEQ ID
NO: 134
[1042] (2) The siRNA sequence that targets TuMV (which would have
been introduced into the TAS1b backbone by the GEiGS donor using an
HDR-mediated swap)--SEQ ID NO: 135
[1043] (3) The GEiGS donor which included the desired changes to
the TAS1b backbone--SEQ ID NO: 136
[1044] (4) The GEiGS oligo Which would have been expressed in
Arabidopsis following GEiGS with the donor of (3) (designed to
introduce the mature siRNA sequence of (1) into the TAS1b
sequence)--SEQ ID NO: 137.
[1045] The incorporation of a fluorescent GFP reporter gene into a
replication component of the TuMV enabled to monitor the growth and
spread of the TuMV in the leaf and thus the silencing efficacy of
TuMV specific silencing molecules on the virus.
[1046] The amplifier for generating RdRp-dependent transcription of
TAS1b is miR173. Therefore, the TuMV-GFP vector was co-infiltrated
with/without the miR173 amplifier, expecting to see silencing
activity of the TuMV-targeting dsRNA when the amplifier is
present.
[1047] As a negative control, a vector for overexpressing a "GEiGS
design" with no specific known target (also referred to as "dummy"
or "GEiGS-Dummy") was infiltrated into leaves e. dsRNA based on
TAS1b with nucleotide changes in locations corresponding to those
changed in the "GEiGS-TuMV" but which do not correspond with any
known gene in Nicotiana benthamiana). Both the vectors expressing
the dummy control or the "GEiGS-TuMV" dsRNA were infiltrated into
the leaves with or without the amplifier. In order to maintain the
level of infiltrated inoculums constant between treatments, empty
agrobacterium were used in treatments without certain components
(see Table 6, below).
TABLE-US-00025 TABLE 6 N. benthamiana leaf infiltration (side by
side assay) Left side Right side Vector #1 Vector #2 Vector #3
Vector #1 Vector #2 Vector #3 1 No vector No vector TuMV-GFP No
vector No vector No vector 2 No vector miR173 TuMV-GFP No vector No
vector TuMV-GFP 3 GEiGS-Dummy No vector TuMV-GFP GEiGS-TuMV No
vector TuMV-GFP 4 GEiGS-Dummy miR173 TuMV-GFP GEiGS-TuMV miR173
TuMV-GFP
[1048] As can be seen in FIG. 11A, two different treatments were
infiltrated into each leaf, side by side, measuring the GFP level
(corresponding to TuMV level) in each side of the leaf (the
observations have been further confirmed by a qRT-PCR analysis).
Each treatment was repeated at least 3 times, observed under UV
light, and one was sacrificed for photography.
[1049] In one leaf (leaf 1), a vector expressing (+TuMV) was
infiltrated, comparing the GFP levels with a treatment in which
TuMV was not infiltrated (-TuMV). As expected, there was no
background fluorescence when no virus was present. In a second leaf
(leaf 2), the TuMV-GFP virus was infiltrated with the amplifier,
miR173 (+miR173), or without (-miR173), demonstrating that miR173
by itself had no effect on the replication of the virus (as it did
not have a significant effect on the measurement of relative
expression by qRT-PCT). In a third leaf (leaf 3) and a fourth leaf
(leaf 4), the vector expressing the TuMV virus was infiltrated with
a construct expressing either dsRNA not targeting a known gene
(GEiGS-Dummy), or with the dsRNA altered such that it targets the
virus (GEiGS-TuMV). This was done either without the amplifier
(leaf 3) or with (leaf 4).
[1050] In the presence of the amplifier (leaf 4), a clear
significant reduction in TuMV transcript, compared to the dummy
treatment, as well as a visual GFP signal reduction, was observed,
as noted by the relative expression in FIG. 11A. The slight
decrease in GFP level observed in leaf 3 when infiltrating the
GEiGS-TuMV construct (without the amplifier) was determined by a
qRT-PCR analysis to be too variable to be considered
significant.
[1051] Infiltration of whole leaves (FIG. 11B) has been carried out
using the system described above, by infiltrating the vector
expressing the TuMV-GFP fusion, the amplifier and a vector
expressing a dsRNA construct (either the "GEiGS-TuMV", targeting
TuMV or the "GEiGS-Dummy", not targeting a known gene, see Table 7
below). As a control, a leaf infiltrated by agrobacterium with no
vector was used. A clear reduction of GFP levels was observed when
using the GEiGS-TuMV dsRNA but not the GEiGS-Dummy. This emphasised
the effect of the GEiGS design and amplifier gene on TuMV
replication.
TABLE-US-00026 TABLE 7 N. benthamiana leaf infiltration (whole leaf
assay) Vector #1 Vector #2 Vector #3 1 No vector No vector No
vector 2 GEiGS-Dummy miR173 TuMV-GFP 3 GEiGS-TuMV miR173
TuMV-GFP
[1052] These results confirmed the role of the TAS gene and the
amplifier in inducing silencing, as expected from the accepted
model of an amplifier-dependent tali-RNA pathway. The results
further confirmed the feasibility of expressing a dsRNA altered
using GEiGS in a plant in order to silence gene expression of a
target of choice in a pest (e.g. by introducing desired nucleotide
changes into a gene encoding the dsRNA, thus redirecting the dsRNA
to silence a target of choice).
Example 6
Expression of Long-dsRNA Targeting a Nematode Gene In-Planta
Induces Silencing of its Target Gene in Nematode
[1053] This experiment was intended to demonstrate that a silencing
dsRNA molecule (such as that expressed from a TAS gene), which is
expressed in a plant and which has been redirected to target a pest
gene (e.g. a nematode gene) can induce silencing of its target gene
in the pest (e.g. nematode).
[1054] In order to so, a transient expression system was used to
express the tested dsRNA molecules in Nicotiana benthamiana leaves,
introducing them into the leaves by agrobacterium-mediated
infiltration to the leaves, as described above. Then nematodes were
fed with a leaf extraction, as described below, and the effect on
target gene expression was examined.
[1055] The analysis has been carried out through targeting the
Ribosomal protein 3a and the Spliceosomal SR protein genes in the
nematode Globodera rostochiensis. In particular, Nicotiana
benthamiana leaves were infiltrated with agrobacterium containing a
vector that overexpressed a TAS3a transcript into which nucleotide
changes have been introduced. The nucleotide changes at least
partially redirected the silencing specificity of the TAS3a
transcript towards one of these nematode genes. Corresponding
changes could be introduced into the TAS3a gene in a plant cell
using Gene Editing induced Gene Silencing (GEiGS), by inducing a
DNA break in the gene (e,g. using an endonuclease such as Cas9 and
a specific sgRNA) and introducing the changes into the gene via
Homology Dependent Recombination (HDR) with a GEiGS-donor
oligonucleotide that contained the desired nucleotide changes.
Sequences of a GEiGS oligo and a sgRNA sequence that may be used to
introduce specificity against Ribosomal protein 3a into the TAS3a
gene are provided in Example 3 above.
[1056] As a control, leaves were also infiltrated with a wild-type
transcript of TAS3a. Both leaves infiltrated by the control TAS3a
and the TAS3a modified to target the nematode genes were further
infiltrated with the amplifier miR390.
[1057] After 48 and 72 hours, leaves were collected, and total RNA
was extracted and cleaned on Amicon.RTM. Ultra 0.5 mL Centrifugal
Filters 3KD cut-off (Merck, USA). Globodera rostochiensis Nematodes
were fed with this total RNA for 72 hours as described below and
collected. RNA was extracted and gene expression analysis was
carried out with qRT-PCR, using Actin as an endogenous normaliser
gene. Ribosomal Protein 3a (FIG. 12A) and Spliceosomal SR protein
(FIG. 12B), both, have shown to be substantially reduced in their
expression levels in the in-planta fed nematode tests. The
expression of Ribosomal protein 3a was shown to be reduced with a
T-test significance of 7.times.10-5 and the expression of
Spiceosomal SR protein with a T-test significance of
1.72.times.10-3, indicating the targeted genes have been
significantly silenced and should show reduction in nematode growth
in the following generation.
[1058] These results demonstrate that modifications made on Tas3a,
that led to the formation of dsRNA which targets nematode genes,
can target pathogens that are sensitive to such a dsRNA.
[1059] RNA extract that was used for the feeding of nematodes, was
also analysed through RNA-seq and small RNA-seq (Cambridge Genomic
Services, Cambridge, UK; FIGS. 13A-D). Analysis was carried out as
described in methods. Sequence reads were aligned against the
sequence of the GEiGS designs that aimed to target ribosomal
protein 3a (FIGS. 13A and 13B), and spliceosomal SR protein (FIGS.
13C and 13D). Alignment was carried out on both strands, sense and
antisense. Analyses have confirmed the presence of both strands of
the transcript, with the capability of generating a long double
stranded RNA through analysis of long RNAseq reads (FIGS. 13A and
13C) and short small RNAseq reads (FIGS. 13B and 13D). Since
RNA-seq analysis has been carried out using reads longer than 50
nucleotides, this analysis identified long double stranded RNA. In
addition, the small RNA analysis was carried out through filtering
sequences of 20 to 24 nucleotides, thus demonstrating the phased
processing of the long-dsRNA, confirming the formation of the
secondary siRNA (FIGS. 13B and 13D).
[1060] Although the invention has been described in conjunction
with specific embodiments thereof, it is evident that many
alternatives, modifications and variations will be apparent to
those skilled in the art. Accordingly, it is intended to embrace
all such alternatives, modifications and variations that fall
within the spirit and broad scope of the appended claims.
[1061] All publications, patents and patent applications mentioned
in this specification are herein incorporated in their entirety by
into the specification, to the same extent as if each individual
publication, patent or patent application was specifically and
individually indicated to be incorporated herein by reference. In
addition, citation or identification of any reference in this
application shall not be construed as an admission that such
reference is available as prior art to the present invention. To
the extent that section headings are used, they should not be
construed as necessarily limiting.
[1062] In addition, any priority document(s) of this application
is/are hereby incorporated herein by reference in its/their
entirety.
REFERENCES
[1063] Yadav, B., Veluthambi, K. and Subramaniam, K. (2006).
Host-generated double stranded RNA induces RNAi in plant-parasitic
nematodes and protects the host from infection. Molecular and
Biochemical Parasitology, 148(2), pp. 219-222.
[1064] Klink, V., Kim, K., Martins, V., MacDonald, M., Beard, H.,
Alkharouf, N., Lee, S., Park, S. and Matthews, B. (2009). A
correlation between host-mediated expression of parasite genes as
tandem inverted repeats and abrogation of development of female
Heterodera glycines cyst formation during infection of Glycine max.
Planta, 230(1), pp. 53-71.
[1065] Li, J., Todd, T., Oakley, T., Lee, J. and Trick, H. (2010).
Host-derived suppression of nematode reproductive and fitness genes
decreases fecundity of Heterodera glycines Ichinohe. Planta,
232(3), pp. 775-785.
[1066] Li, J., Todd, T. and Trick, H. (2009). Rapid in planta
evaluation of root expressed transgenes in chimeric soybean plants.
Plant Cell Reports, 29(2), pp. 113-123.
Sequence CWU 1
1
139127DNAArtificial sequenceQuery - pest seq (AF502391.1)
1aaatgaagaa aatgcacaga cctcaaa 27227DNAArtificial sequenceHit -
plant seq (NM_001037071.1) 2aaatgaagaa aatggaaaga cctcaaa
273102DNAArtificial sequenceAth-MIR173 based GEiGS molecule
3gaaggacuuu guaaacaauu ucagaauuac ugaggacaaa aauguuguag uacacuuaaa
60gucgcaaacc gcggugauuu gaauuuguuu guaaagaccu uc
10241591DNAArabidopsis thaliana 4acaccttcca aacactattg gggaaatggc
ttcttctctt ttttccggtg taggtttaag 60gttttagatt tgaaggcgga tggtgaggag
tttgtgttga tgaaatgggt gatttgaatt 120gaggaaaaca tgaattcgac
atcgacacat tttgtgccac cgagaagagt tggtatatac 180gaacctgtcc
atcaattcgg tatgtggggg gagagtttca aaagcaatat tagcaatggg
240actatgaaca caccaaacca cataataata ccgaataatc agaaactaga
caacaacgtg 300tcagaggata cttcccatgg aacagcagga actcctcaca
tgttcgatca agaagcttca 360acgtctagac atcccgataa gatacaaaga
cggcttgctc aaaaccgcga ggctgctagg 420aaaagtcgct tgcgcaagaa
ggcttatgtt cagcaactgg aaacaagcag gttgaagcta 480attcaattag
agcaagaact cgatcgtgct agacaacagg gattctatgt aggaaacgga
540atagatacta attctctcgg tttttcggaa accatgaatc cagggattgc
tgcatttgaa 600atggaatatg gacattgggt tgaagaacag aacagacaga
tatgtgaact aagaacagtt 660ttacacggac acattaacga tatcgagctt
cgttcgctag tcgaaaacgc catgaaacat 720tactttgagc ttttccggat
gaaatcgtct gctgccaaag ccgatgtctt cttcgtcatg 780tcagggatgt
ggagaacttc agcagaacga ttcttcttat ggattggcgg atttcgaccc
840tccgatcttc tcaaggttct tttgccacat tttgatgtct tgacggatca
acaacttcta 900gatgtatgca atctaaaaca atcgtgtcag caagcagaag
acgcgttgac tcaaggtatg 960gagaagctgc aacacaccct tgcggactgc
gttgcagcgg gacaactcgg tgaaggaagt 1020tacattcctc aggtgaattc
tgctatggat agattagaag ctttggtcag tttcgtaaat 1080caggctgatc
acttgagaca tgaaacattg caacaaatgt atcggatatt gacaacgcga
1140caagcggctc gaggattatt agctcttggt gagtattttc aacggcttag
agccttgagc 1200tcaagttggg caactcgaca tcgtgaacca acgtaggttt
gagttatttt gtaacaacca 1260aatgaagaaa atggaaagac ctcaaaaaat
gaagaatgag tgcatctgaa aacagaggac 1320tactctgaat aaatagaggg
gttgctgctg atatttattt ttactctgcg gcggaattag 1380aaaatttgaa
aaacatcatg tattgataag ttgtaaatat cagaaaaagg tgggggtgca
1440aaaatttgta ctttttagct tttgaaagag gcaagttttt cgaatgtttg
tttgatttgt 1500aaacaatttc agaattatat aaacttggtt ccaaatcccc
tgtaataatg tcgagctatc 1560tgcaatttga aaactatagg ggctttactt a
1591528DNAArtificial sequenceQuery pest seq AF500024.1 5cagcaacaac
agaatcagga acagcaac 28628DNAArtificial sequenceHit - plant seq
(NM_116351.7) 6cagcaacaac agcaacagca acagcaac 287123DNAArtificial
sequenceAth-MIR156a based GEiGS molecule 7caagagaaac gcaaagauaa
agauugaacu gggguaucac acaaaggcaa gaugcagacc 60agugcaguug cuucgcuugc
gugaugcuca ugguuuuaau uuuaauccgg ugccgaucuc 120uuc
12383676DNAArabidopsis thaliana 8aaattaaatt atgcgtctaa gttgtaacat
ataataaaag gataatatat ttttcagtca 60caccaaaaaa aaaattgata agaaagaaaa
aaaaagagtg aaaattagaa agacagagaa 120gcaaagattc ttgctccctg
cgaatccgca gctgcttcga aacgcaaatc cgatttgtag 180tctcctttga
ttcttccatt gacgatacag cttctctttc tctcttctct ctgcttactt
240tgctttttac taagctcaca agaatctacg catctgtact gttattatgc
tgatgctctc 300tacttaatca tcaccaccgc acgcagttcg agatttctgg
aattttctgt gtcggatgcg 360tttgagattc atcgaatcta cttggttata
gattggaaat ttaggtgggg atttgagttg 420cttagcttgt ggtaggttac
attttcttgt ttgagattca gtgaatctct ccagagttgc 480atgtatagaa
atgggttctt tggaatctgg gattccgacg aagcgagata acggcggcgt
540aagaggtgga agacagcaac aacagcaaca gcaacagcaa cagttcttct
tgcagagaaa 600cagatcgaga ctctccagat tctttctatt gaagagtttt
aattacctcc tatggatttc 660tataatttgt gtcttcttct tcttcgctgt
gctgttccag atgtttttgc cgggtttggt 720gattgataaa tcggataaac
catggattag taaggagatt ttgccacctg atttggttgg 780ttttagggag
aaagggtttt tggattttgg tgatgatgtt agaattgagc ccaccaagct
840tctgatgaaa ttccaaagag atgctcatgg ttttaatttt acatcttctt
ctctcaatac 900cactctgcag cgttttggat tcagaaagcc taagctagct
ctggtttttg gcgatttgtt 960agctgatcca gaacaggtgt taatggtgtc
tctctccaag gcactgcaag aggttggcta 1020tgcaattgag gtttactcgc
ttgaagatgg tccagtgaat agtatttggc agaaaatggg 1080agttccagtc
acaatactca agcctaatca ggaatcgagt tgtgttatcg actggctctc
1140ctatgatggc ataattgtga actctctccg agctaggagt atgtttactt
gcttcatgca 1200agaacctttc aaatctttgc ctcttatttg ggtcatcaat
gaagaaactc ttgctgttcg 1260gtctagacag tacaactcaa cagggcagac
tgaactcctc actgactgga aaaagatttt 1320cagccgggca tcggttgtag
tcttccataa ttatctcctt ccgatactct acaccgagtt 1380tgatgctggc
aacttctatg tgattcccgg atctcctgaa gaagtatgta aagcaaagaa
1440tctagagttt cctccacaga aagatgatgt ggtcatttcc attgtgggaa
gtcagttctt 1500gtacaagggt caatggctgg aacatgccct gcttctgcaa
gctctacggc ctttattttc 1560gggcaattac cttgaaagtg ataattccca
tctcaagatc atagttttag gtggagagac 1620agcgtccaac tacagcgtag
ctattgagac aatttcccag aacttgacat atccaaaaga 1680ggctgtgaag
cacgtaagag ttgcggggaa tgttgataag attcttgaaa gttctgatct
1740tgttatatat ggatcatttc ttgaggagca gtcttttcca gaaattttga
tgaaggccat 1800gtccttgggg aaacctatag ttgcaccaga cctcttcaac
attagaaaat atgttgacga 1860cagggttact gggtatctct tccccaagca
gaatcttaaa gttctatcgc aagttgtgct 1920tgaagtgata acagaaggga
agatatctcc attggctcag aagattgcca tgatggggaa 1980aacaactgtt
aaaaatatga tggctcggga aaccatagaa ggttatgcag ctctactaga
2040gaatatgctc aagttttctt cggaagttgc ttctcctaag gatgtacaaa
aagttcctcc 2100agaactgaga gaagagtgga gttggcatcc gtttgaagct
tttatggata catcgcctaa 2160taatagaata gcaagaagtt atgagttctt
agcgaaggtt gaggggcatt ggaattatac 2220cccaggagaa gctatgaaat
ttggagctgt taatgatgat tcgttcgtgt atgaaatttg 2280ggaagaagag
agatatcttc aaatgatgaa tagtaaaaaa agacgagaag acgaggagct
2340gaaaagcaga gtcttgcagt atcgtgggac atgggaagat gtatataaaa
gcgccaaaag 2400ggcagaccga agtaagaatg atctacatga gagggatgaa
ggggagctgc taagaaccgg 2460tcaaccttta tgcatatatg aaccctattt
tggtgaagga acctggtcgt ttctacatca 2520agatcccctc tatcgtgggg
ttggcctgtc agttaaagga cgtagaccta ggatggatga 2580tgtcgatgca
tcatcacgtc ttccgctttt caacaatccg tactatcgcg atgctcttgg
2640tgactttgga gctttttttg caatctcaaa caagattgat cggttacaca
agaattcatg 2700gattgggttt cagtcctgga gagcgactgc caggaaggaa
tctttatcca agattgctga 2760agacgcatta cttaatgcta tacaaacacg
aaaacacgga gatgccttat atttttgggt 2820tcgcatggac aaagatccca
gaaatcctct gcagaaaccc ttttggtcgt tctgtgatgc 2880cataaatgct
gggaattgca ggtttgctta caacgaaact ttgaagaaaa tgtacagtat
2940caagaacttg gactcattgc caccaatgcc cgaggatggg gatacatggt
ctgtgatgca 3000gagctgggca ttgccaacaa gatccttctt agagtttgtc
atgttctcaa ggatgtttgt 3060ggattcacta gatgcacaga tatatgaaga
gcatcatcga acaaaccgtt gctatctgag 3120tttaaccaaa gacaagcatt
gctattcgcg ggtactagag cttctggtga acgtatgggc 3180ttaccacagt
gcaagacgca ttgtctacat agatcctgag actggtttga tgcaagagca
3240acacaaacag aagaaccggc gagggaaaat gtgggtgaag tggttcgatt
acacaactct 3300gaaaacaatg gacgaagatc tagctgaaga agccgactca
gaccgtcgtg tgggtcactg 3360gctatggcca tggactggcg agatcgtgtg
gcgcggtaca ttagagaaag agaagcaaaa 3420gaagaattta gagaaagagg
agaagaagaa gaagagtcga gataagctga gtagaatgag 3480aagtagaagt
ggtcgtcaga aagtgatcgg aaaatatgta aaaccaccgc ctgagaacga
3540aactgttacc ggaaattcca ctttgttaaa tgtagtagac gcataaaaga
aaacaaatta 3600aaattgcttc tttttttgtt aggtcactaa tttgtttcat
tcattgtttt tggaaagatt 3660actgtataaa aggtct 36769231DNAArtificial
sequencePest Query AF469060.1 9tggcatgcaa attttcgtga agacattgac
gggcaaaacg atcactttgg aggtggagag 60ctcggacact gtggacaatg tgaaggagaa
gatccaagag aaggagggca ttccgccgga 120tcagcaacgg ctgatcttcg
ccggcaaaca gctcgaggac ggacgaacgt tggccgacta 180caacatacag
aaggagtcca cgctccactt ggtcctccgt ctccggggcg g 23110231DNAArtificial
sequencePlant hit NM_001203752.2 10tggtatgcag attttcgtta aaaccctaac
gggaaagacg attactcttg aggtggagag 60ctctgacacc attgacaacg tcaaggccaa
gatccaagat aaggagggca ttcctccgga 120ccagcagcgt ctcatcttcg
ctggaaagca gcttgaggat ggacgtactt tggccgacta 180caacatccag
aaggagtcta ctcttcactt ggtcctccgt ctccgtggtg g 23111104DNAArtificial
sequenceAth-MIR156c based GEiGS molecule 11cgcacagaaa gggugauaau
ggcuugguug cacuaaggca cguugcaugg ccgaugcaua 60ugcuucucua gcgcaaccaa
guucauguau cguuuauucc cgca 10412901DNAArabidopsis thaliana
12caaatctctc aaccgtgatc aaggtagatt tctgagttct tattgtattt cttcgatttg
60tttcgttcga tcgcaattta ggctctgttc tttgattttg atctcgttaa tctctgatcg
120gaggcaaatt acatagtttc atcgttagat ctcttcttat ttctcgatta
ggatgcagat 180cttcgttaag actctcaccg gaaagactat caccctcgag
gtggaaagct ctgacaccat 240cgacaacgtt aaggccaaga tccaggataa
ggaaggtatt cctccggatc agcagaggct 300tatcttcgcc ggaaagcagt
tggaggatgg ccgcacgttg gcggattaca atatccagaa 360ggaatccacc
ctccacttgg ttctcaggct ccgtggtggt atgcagattt tcgttaaaac
420cctaacggga aagacgatta ctcttgaggt ggagagctct gacaccattg
acaacgtcaa 480ggccaagatc caagataagg agggcattcc tccggaccag
cagcgtctca tcttcgctgg 540aaagcagctt gaggatggac gtactttggc
cgactacaac atccagaagg agtctactct 600tcacttggtc ctccgtctcc
gtggtggttt ctaaaccttg tctctctctc ttatggttac 660tgaaccaagt
tcatgtatcg tttcatctag tactttggtg gtttatgttt tggggccatg
720tacagcctct gataaataat tgatcgacta tgtttccgtt tctttcatct
ctcttttctt 780tcaaacaaca aatcgaactt attctctatt gcaattatct
ctttcgattc acttttgtca 840tcgttgtctc tttatatgat gtgcttagtt
tgatgagtgt gagaagtaca gagtctctat 900c 9011321DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
13cacagtaaaa ttgaacaaat a 211421DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 14cacagtaaaa
ttgaacaaat a 211521DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 15cacagtaaaa ttgaacaaat a
211621DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 16cacagtaaaa ttgaacaaat a 211721DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
17cacagtaaaa ttgaacaaat a 211821DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 18ctgcgatggc
atgcaaattt t 211921DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 19ctgcgatggc atgcaaattt t
212021DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 20ctgcgatggc atgcaaattt t 212121DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
21ctgcgatggc atgcaaattt t 212221DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 22ctgcgatggc
atgcaaattt t 212321DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 23taaaatggaa atagacaata t
212421DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 24taaaatggaa atagacaata t 212521DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
25taaaatggaa atagacaata t 212621DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 26taaaatggaa
atagacaata t 212721DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 27taaaatggaa atagacaata t
212821DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 28gagaaggaaa atacacaatt a 212921DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
29gagaaggaaa atacacaatt a 213021DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 30gagaaggaaa
atacacaatt a 213121DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 31gagaaggaaa atacacaatt a
213221DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 32gagaaggaaa atacacaatt a 213321DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
33tagttaggaa atttcaaata a 213421DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 34tagttaggaa
atttcaaata a 213521DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 35tagttaggaa atttcaaata a
213621DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 36tagttaggaa atttcaaata a 213721DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
37tagttaggaa atttcaaata a 213821DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 38atgggaatat
attaaaactt t 213921DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 39atgggaatat attaaaactt t
214021DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 40atgggaatat attaaaactt t 214121DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
41atgggaatat attaaaactt t 214221DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 42atgggaatat
attaaaactt t 214321DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 43tggagcaatc attctgaatg a
214421DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 44tggagcaatc attctgaatg a 214521DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
45ctcactcctt ttaaacaaat a 214621DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 46ctcactcctt
ttaaacaaat a 214721DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 47atacatatag attgataaca a
214821DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 48atacatatag attgataaca a 214921DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
49ccaggattcc atgtaaaaaa a 215021DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 50ccaggattcc
atgtaaaaaa a 215121DNAArtificial sequencesuggested small
interfering RNAs nucleic acid sequence 51caaccgcatg ataaacgtga a
215221DNAArtificial sequencesuggested small interfering RNAs
nucleic acid sequence 52caaccgcatg ataaacgtga a 215321DNAArtificial
sequencesuggested small interfering RNAs nucleic acid sequence
53ctgcatgttc ttcatccccg a 215421DNAArtificial sequencesuggested
small interfering RNAs nucleic acid sequence 54ctgcatgttc
ttcatccccg a 21552397DNAMeloidogyne incognita 55atggcacaag
agccgcccct gcaaattgtg atcccgaaat tagacgaagg caagacgatg 60gcaatgcgtc
ggctgccgcc tccggcacaa ccggcggctg cggtgccgtc cgccgaacgc
120gtgtccaatc gggacgagga cgcgcagaac accgagccgt caatgagcgg
caagcaaatc 180gtcggattga tcatcccacc accagacatc cgaacgattg
tggacaaaac ggcccttttc 240gtcgctcgca acggtttgga atttgagttg
aaaatcaaag agcgcgaggc gtccaacatg 300cgcttcaact tcctcaaccc
caccgacccg tactttgcct actaccggaa taaggtcaac 360gaattcgaga
cgggcgtcgc ttcagccgac acacaatcta gcgtgaagat gccggaagcc
420atccgtgaac acgtgaaacg ggcagagttc attccacgac agccgcccaa
accgttcgaa 480ttctgtgccg aaccgtcaac gctgaacgcc ttcgatttag
acctcatcca tttgaccgct 540ttgtttgttg cgcgaaacgg gcgccaattc
ctcacacagc tgatgaaccg cgaagtgcgt 600aactttcaat tcgactttct
gaagccgcag cactccaatt tccaatactt caccaagctg 660gtcgagcagt
acacaaaggt gctgatccct tccaaaaaca ttgtggacga gttgcgtgca
720cagctcagtc agcacaaaat tgtggaggat gtgcgctatc gcgtcggttg
ggaccggcat 780caaaaggcgc tgaaggaccg cgaggaccag gcggtggaga
aggagcgcat cgcgtacaac 840caaatcgatt ggcacgagtt cgtcgtggtc
caaacggtgg actttcagcc cagcgaaacg 900ctgaatttgc cgcatttgtg
cacgccaaag gacgtcggag cgcgcatttt gctgcaacag 960cgcacggatg
cggccaaagc ggcggcggag agtgtggcta tggaggtcga atctgacgag
1020gagggtggcg gctcggagtc gggtggcgag gagacggacg aacgcggcgt
cgccgaggcg 1080gacaacgcgg cggttgagct gcgccagcac ctgaacattg
ggacggagaa gcagcacacc 1140ggctccacgc taacacaacc ggcgcccgca
gcgccgaacg ttggcagcgt tataatccgc 1200gattacgacc ccaaaaaggc
tcgcagcggt ccagtggcca aaactaccgc ctcctccgcg 1260gagaagtaca
tcatttcgcc gctgaccaac gagcgcattc cggcggacaa actgcacgag
1320catgtgcgct acaacactgt ggacccgcag
ttcaaagagc aacgagaccg cgaacatatg 1380gatcgtcagg acgaggactt
aggtatggcg cccggggcgg agatcagccg taacattgcc 1440aagttggccg
aacggcggac ggacattttt ggcattgggg agaagggtgt cgagcagaca
1500atcattggca aaaaattggg ggaggaggag cgccaaatgc cgcgttcgga
cccgaagacc 1560atttgggacg gccaacagtc gaccatcgac gcgaccactc
gcgcagccca gcagagcgtg 1620tcgttggagc agcagatcaa tgaaattcaa
cgacagcacg ggtacttgcc gaaccccgct 1680gcggaacgaa tggcaccttc
gatgccgcca acttcggcac cttcgcaaca gtttggccaa 1740ccgccgacat
cgacggcgat ggctccgccg caccgtcccc cggctcattc gaccggcggt
1800ggaagcgttc aaaaaatcgt ctctctgccg ccccatcctc aacatcagca
aatgcgcccg 1860ccgatgccgc cgcacttcat gccctcgggc cagcgtccgc
atttgccacc accgcatatg 1920ggcatgccgc cacacggcgt tatgggagga
atacaaatgc ctccgcatat gcaacctggc 1980atgccgggaa tgcccccgcc
ggggatgatg cgtccgcccc atggcgcctt tatgcctccg 2040cccccctctt
tcggcggcga tgagcctccg agcaaacgtc cgcgtgagga gacgttggaa
2100tcggaagagc gttggctgca aaaggttcgc ggtcaaatca ctgtgcaggt
gtgcacgcca 2160cagaacgagg agtggaactt gaagggcgac tccatccaag
tcttgttgga catcagttcg 2220tcggtaactg cacttaaatc gatgatccaa
gagcaaatcg gcgttgctgc aggcaaacag 2280aaattggttt atgagggtat
tttcatgaaa gacaaccaaa cgttggccta ttacaacttt 2340atgccaaacg
cggctgtcca acttcagctg aaggaacgtg gaggccgaaa gaaatga
239756789DNAHeterodera glycines 56atggcagtcg gaaagaataa gaaaatgggc
aaaaagggag ccaagaagaa ggctgtcgat 60ccgttcacac gcaaagaatg gtacgacatc
aaagcgccgg cgatgttcac acatcgaaac 120gtcggcaaaa cgttggtcaa
ccgtactcag ggaacgcgca tttcgagcga ctttctaaaa 180ggccgcgttt
acgaagtgtc actgggtgac cttaacagca ctgacgccga ctttcgaaag
240ttccgcctga tctgtgaaga ggtacagggc aagatttgcc tgaccaactt
tcacggaatg 300tcgttcactc gggacaaact gtgctctatt gtcaagaagt
ggcacacgct cattgaggcg 360aatgtggcag tgaagactac cgacggtttc
atgctccgac tcttttgtat cggctttacc 420aagcgaaatg ccaatcaaat
taagaagacg agctatgcaa aagcctctca ggtgcggatg 480attcgtgcca
aaatggtgga gatcatgcag aaagaggtct cttccggcga tctgaaggaa
540gtagtcaaca agctgatccc ggattcgatc ggcaaagaca tagagaaggc
gtgctccttc 600tactaccctc tgcaggacgt ttacattcgt aaggtgaagg
tgctgaagaa gccgaagttc 660gagctgggca aactattgga gatgcatggg
gagggtgccg gaacggtcgc tacgattacg 720acggccgccg gtgaaaaaat
tgagagccgt ccggatgcgt acgaaccgcc tgttcaacag 780agcgtttga
789572496DNAHeterodera glycines 57atggttggta ttgatcaaac gactagtgat
gaaattattc aagataaaga gcagttaaag 60tggaagatgg acaatttgca ttggtttcct
gaagatgagc ttccgccgaa cgactttccg 120cctgcgctaa gtatggaaag
tgagggaagc tcattcaaca acaatgtgaa cgcggaaatg 180gacgaggaaa
tgatggggga agatacaatg caccatgaag acgatcagcc ggtattgggc
240agcgacgagg atgaacagga ggatccaaaa gactacaaga aaggcggtta
ccaccctgtg 300caaattggcg atgtcttcaa acatggacga taccatgtca
tccgaaaatt gggctggggc 360catttctcca ccgtttggct tagttgggac
atcgacgtga aacgatttgt cgctatgaaa 420atagtcaaat cggctgagca
ttacacagag gcagcgttgg acgaaataaa attgctcgaa 480tgtgtgaggg
attctgatcc agccgacgct tcacttcaga gagttgtcca actgctcgat
540catttcacag tcagcggcgt caacggtgcc catgtttgta tggtttttga
ggttctcggg 600tgcaatttgt tgaagcttat cattcgtagc agctacgagg
gcttgccgat aaacctggtc 660aaaaggataa cgaaacaggt tctcgaagga
cttcactatt tgcatgagaa atgtcatatc 720attcatacgg acataaaacc
cgagaatgtt ttgatcacca tgagtcatga agagatcaaa 780aagatggcgg
aagatgcgat tttggcggga aaggcgggga atgccatgtc cggttctgct
840gtttgcagct cgaagagggc cttcaagaag atggaggaaa cgcttacaaa
gaacaaaaag 900aagaagctga agaagaaacg gaagagacat cgcgacattc
ttgaacagca gctcaaagaa 960gttgagggaa tgagtgtgga aattaccagc
ccaatcagtg aacagaatcc atttcgcatc 1020aaccaccaac ggcacgatgg
cgtttattcc tcggacgaca acgaggagga cggagagagt 1080tgtagggaaa
acgacgctca actgacaaag aatctctcac ttttggagaa aatcaaaatt
1140ccgcgcattt ctttgaccca attttcaact aacaattcgc accaaaacaa
cactaataac 1200agcaataata ataacaacga acaacaacaa cagcagcagc
agcaacaaca actccaattg 1260ggggaggagg gcacgaagaa tgggaaaagg
gttgctgcgt ctggcagacc atcgaagttg 1320gtcaattcga cccaaaaatc
ttgcgccaga agcgaaaatg atgagcaaaa accggtcaaa 1380aaggaaccgt
cggtgacggg aaatgccgaa ccgggccaat cgtcggacgc actgccgaaa
1440cgaattggca aaaagaaaaa gacgggcaaa aacaaacaaa tgttggtcaa
aaaggataag 1500agagacgatt caccctcgcc tcctatcaaa agggaggaag
aggaggccat gggacccgaa 1560gaggacgaca ccaaagagtc gccgacaaag
gggaaaacgg ccaaactgtc gaatgagtcg 1620gacgatggca aaacgatggg
ttatgatggg atgggaaaag gaggcgaaga agcagcggaa 1680aatgtcaaag
tgaatgcgca gcagcgagag gggcaggaag aagattcaat ttcgaagggg
1740aaaaagaaga aagcgaagcg aaagaataag aagaagctca agcaacaagc
gtatgcacaa 1800gaagaagatg aggagttgcg agaaatcgac aaaagtgatg
gtgttcacca tcaaagcatg 1860gtcgactcgg ggcagaacaa ggagctaaaa
acagaggaag attatcaaca gctgagtcca 1920atggagcagg agatgtcgtt
cgaacacgaa aaccacgaaa agcaaatgct cgacaaaata 1980attgccaaga
aatttgatgt gaaaattgcg gacctgggca atgcttgttg gacctaccat
2040cacttcaccg aggacatcca gacgcgtcag tacagagctt tggaagtcat
catcggcgcg 2100ggctacgata cgtctgccga catttggagt gtcgcctgta
tggcttttga attggcgacc 2160ggcgactatt tattcgagcc gcacagcgga
ggcacttaca gcagggacga ggaccatctt 2220gcgcatgtaa tcgagctgtt
gggaagcatt ccgccgaccg ttttcaaaaa gggcgagcat 2280tggcgcgagt
ttttccataa gaatggtcgt ctgcttcaca taccgaacct gaagccttgg
2340tcactggtcg aagttcttac gcagaagtac caatggcctt tcgagcaagc
cagatcgttc 2400gcggcatttt tgtttcctat gcttaactat gaaccggctg
aacgcgtcac tgcagcacag 2460tgtctaaagc ataattggct caaaaacata gaatga
2496582946DNAHeterodera glycines 58atgagttctt ctggtgaaca accctgttac
gcgctgattc atgtcgcaaa cgacgtcgaa 60tttccgtctg aagggcaatt aaaggacaaa
tttgagcacg gggacacaaa atccaagacg 120gatgcactga aaaagctgat
tttgatgatc caggcgggcg agaaggtcac cagccagcta 180atgatgtacg
tgatccgttt ttgtctacca acatccgatc attatctgaa gaagttgctg
240ctgatattct gggaggtcgt cccgaagaca aatcaagagg gcaaactgtt
gcacgaaatg 300attttagtct gcgacgcgta ccgcaaagat ttgcagcatc
cgaacgaata catacgcggc 360tcgaccttgc gattcctttg taaactaaaa
gagcccgagt tgctcgagcc gttgatgccg 420tcgattcgga agtgcttgga
gcatcgccat tcctacgtac gccgcaattc cattttggca 480atctacacaa
tttacaaaaa tttcgagttt ttgattcccg atgcgcccga attgatccaa
540caactgctag agaccgagca ggacgcctcc tgcaagcgca acgcgttcat
tatgcttcta 600cacgttgacc ggcagcgggc cttggattat ttgtccggtt
gtattgagca ggttgcgcag 660ttcggcgaca tccttcagct tatcattgtg
gagctgatct acaaagtctg tcacaacaac 720ccggcggaac gcaatcgctt
cattcgttgt gtgtacaatt tgctgcagtc gcagtcgggc 780gccgttcgct
acgaggcggc tggcacactt gtgacgctta gcaccgcgcc gacggcggtg
840aaagcggccg caaccgctta cattgagctg atcgtcaaag agtcggacaa
caatgttaag 900ctgattgtac tcgatcgtct ggtatgccta cgcgaggttt
tgcccaacga caaagtgctg 960caggatttgg taatggacat tctgcgtgtt
ctgtccacaa cggactacga agtgcgccga 1020aagatcctgc agttggcgct
tgaactggtc tcatcgcgca acgttcatga gatggtgatg 1080tttttgcgca
aggagatcga caaaacaaac aacgacacgc aagaggacac cggccggtac
1140agacagttgc tggtccgcac cctgcacagt gcgacaatca aattcccgga
cgtggccatt 1200caaatcttcc cagtgctaat ggagtttttg tcagatcaga
acgaaagtgc ggcgttggat 1260gtgttagtgt ttgtgcgtga ggcgattcaa
cgactgccgc acctgcgcca tcacatcacc 1320aaccaattgc tggaagtttt
tccgaccatc cgaaacgcgt ccatttttcg atccgctctg 1380tggattcttg
gcgaatattg cgagaattct gaggcaattg gtcgtttatt cgttttggtc
1440aagttgtcgg tgggtgaatt gcctattgtc gagtcggaga gtcgggaccg
agatggtgga 1500gcagcaaagg acgaggcatc ggcacctaga aagagtggag
tcgatggcaa gaccagccag 1560cagaaactga tcaccgcgga tggcacttac
gccaaacaat cggctatctt ttctgccgct 1620tcgaacgccg ttagtgcggc
tgacgataaa ccaattttgc gcagttttct actcgatggg 1680aacttcttta
ttgcgtcagc gttggccaac actttggcga agttggtgct tcgttatgcg
1740gaactgaata aaggtgtagc gtcaaccgtt aacaaattgg cgagcgaagc
gctgctgctt 1800atcgcatcca ttattcacct cggcaagtcc ggcatgtgca
aacaggcgat aactgaggac 1860gatctggacc gtctctccac cacagtgcgt
ttgatcgtgg accaatggcc tgatgcagtg 1920catgtattcc tgaatgagtg
tcgttcgtca cttgagcgca tgttaatggc caaaggtgat 1980gtggaccggc
acgagcgcga gaccaaggcg ccgaagaaaa agattcctga caagactatc
2040atgttcacgc aactgtccac ccgagtttcg gagaatgtca cagataccaa
tcttttcgac 2100ctttcgttgt ctcaagcgct tggcacggca cccaaaacta
ccaaatacaa ctttgctagt 2160tccaaacttg gcaaagtgat ccagctggcc
ggcttctcag accccgtcta tgcggaagcg 2220tacgtcaacg tcaaccagta
cgacattgtt ttggatgtgc tcgtggtcaa ccaaaccagc 2280gacacactgc
agaatctgac gctggagctg tcgactgtgg gcgacttgaa actggtggac
2340aaaccatctc caattacatt ggcgcccaat gacttcacca acatcaaagc
caccgtcaaa 2400gtgtcgtcca ccgaaaatgg agtaattttt tcgaccattg
cttacgatgt gcgcggatca 2460acatcggatc ggaactgtgt gtacctggag
gacatccaca ttgacataat ggattacatt 2520gtgccgggaa cttgcactga
cacggagttt cgcaaaatgt gggccgaatt tgagtgggaa 2580aacaaggttg
gcgttgtgac gccgatcacg gaccttcgcc agtatctgga ccatttgtcg
2640gctcaaacaa acatgaagct gttgaccacg gatgccgcat tagagggcga
ctgcggtttt 2700ttggcggcca acttttgtgc ccactccatt tttggtgagg
acgcattggc caatgtttcc 2760attgagaagg cggacccgct tgacccgatg
agtgccatca ttggacacat tcggatcagg 2820gcgaagtccc aggggatggc
actttcattg ggggacaaga taaaccacgc gcaaaaggag 2880cgcaaaccgg
tggagagggg tggggcaaga gcggctatga atgccgctgc cgccgccgca 2940aaataa
29465930DNAArtificial sequencesiRNA target site 59tggagcagca
gatcaatgaa attcaacgac 306030DNAArtificial sequencesiRNA target site
60attcgtaagg tgaaggtgct gaagaagccg 306130DNAArtificial
sequencesiRNA target site 61aaaaacaaac aaatgttggt caaaaaggat
306230DNAArtificial sequencesiRNA target site 62ccgctctgtg
gattcttggc gaatattgcg 306321DNAArtificial sequenceSingle strand DNA
oligonucleotide 63accaatttga cccaaaaagg c 216424DNAArtificial
sequenceSingle strand DNA oligonucleotide 64gcagcagatc aatgaaattc
aacg 246520DNAArtificial sequenceSingle strand DNA oligonucleotide
65agccgctctg tggattcttg 206620DNAArtificial sequenceSingle strand
DNA oligonucleotide 66aaactcctcg cctcttggtg 206722DNAArtificial
sequenceSingle strand DNA oligonucleotide 67tcttcagcac cttcacctta
cg 226825DNAArtificial sequenceSingle strand DNA oligonucleotide
68tcctttttga ccaacatttg tttgt 256921DNAArtificial sequenceSingle
strand DNA oligonucleotide 69accaatttga cccaaaaagg c
217026DNAArtificial sequenceSingle strand DNA oligonucleotide
70tggacttaga atatgctatg ttggac 267120DNAArtificial sequenceSingle
strand DNA oligonucleotide 71aaactcctcg cctcttggtg
207227DNAArtificial sequenceSingle strand DNA oligonucleotide
72tctatctcta cctctaattc gttcgag 2773839DNAArtificial
sequenceAtTAS1b_AT1G50055 73aaatctaaac ctaagcggct aagcctgacg
tcatttaaca aaaagagtaa acatgagcgc 60cgtcaagctc tgcaactacg atctgtaact
ccatcttaac acaaaagttg agataggttc 120ttagatcagg ttccgctgtt
aaatcgagtc atggtcttgt ctcatagaaa ggtactttct 180tttacttctc
ttgagtagct tctatagcta gattgagatt gaggttttga gatattaggt
240tcgatgtccc ggtctatttg tcaccagcca tgtgtcagtt tcgaccagtc
ccgtgctctc 300tgtatttggt tttatcggaa tacggagatc tattttcagg
aggagacaac tttgttttct 360tgtgattttt ctcaacaagc gaatgagtca
ttcatcggta tctaaccatt caccatatta 420tcagagtagt tatgattgat
aggatggtag aagaatattc taagtccaac atagcatatt 480ctaagtccaa
catagcgtaa aaaattggga gatatccgga atgatattat acgtaaaaaa
540aaatgggaga tgtccggaat gatatttgta atatttttat gttaacgaaa
catattttag 600gatatgcaaa aaaaagtaga tgttggtatt cttgttttgc
aagatttgta atgggagttg 660tgtagtcttt ttatgatgtg tcatgaagtc
taccgccaat tacatacatc attcactttg 720taattaaatt gtcttcaagt
ttgtaatttt atttttgttt tatgtaccaa aatctaaatt 780cagttgttta
caacttgata acaaaaaaaa agttatacat tacttatgtt ttcacactc
8397423DNAArtificial sequencesgRNA_AtTAS1b (including PAM)
74ggacttagaa tatgctatgt tgg 2375839DNAArtificial
sequenceGEiGS-Splicing factor-transcript 75aaatctaaac ctaagcggct
aagcctgacg tcatttaaca aaaagagtaa acatgagcgc 60cgtcaagctc tgcaactacg
atctgtaact ccatcttaac acaaaagttg agataggttc 120ttagatcagg
ttccgctgtt aaatcgagtc atggtcttgt ctcatagaaa ggtactttct
180tttacttctc ttgagtagct tctatagcta gattgagatt gaggttttga
gatattaggt 240tcgatgtccc ggtctatttg tcaccagcca tgtgtcagtt
tcgaccagtc ccgtgctctc 300tgtatttggt tttatcggaa tacggagatc
tattttcagg aggagacaac tttgttttct 360tgtgattttt ctcaacaagc
gaatgagtca ttcatcggta tctaaccatt caccatatta 420tcagagtagt
tatgattgat aggatggtag aaggtcgttg aatttcattg atctgctgct
480ccaagtccaa catagcgtaa aaaattggga gatatccgga atgatattat
acgtaaaaaa 540aaatgggaga tgtccggaat gatatttgta atatttttat
gttaacgaaa catattttag 600gatatgcaaa aaaaagtaga tgttggtatt
cttgttttgc aagatttgta atgggagttg 660tgtagtcttt ttatgatgtg
tcatgaagtc taccgccaat tacatacatc attcactttg 720taattaaatt
gtcttcaagt ttgtaatttt atttttgttt tatgtaccaa aatctaaatt
780cagttgttta caacttgata acaaaaaaaa agttatacat tacttatgtt ttcacactc
8397630DNAArtificial sequenceHomologous region in the GEiGS design
of GEiGS-Splicing factor-transcript 76gtcgttgaat ttcattgatc
tgctgctcca 30771000DNAArtificial sequenceGEiGS-Splicing
factor-DONOR 77gttgttgttg ctaaatgaat gatattaatc cactacagtt
gtaaactaca aatatacaaa 60gcagtaaaaa tccatgtatg atgattaata agaagctttc
gaatggatat agaaaaaact 120tgaatcattg agtgtgaaaa cataagtaat
gtataacttt ttttttgtta tcaagttgta 180aacaactgaa tttagatttt
ggtacataaa acaaaaataa aattacaaac ttgaagacaa 240tttaattaca
aagtgaatga tgtatgtaat tggcggtaga cttcatgaca catcataaaa
300agactacaca actcccatta caaatcttgc aaaacaagaa taccaacatc
tacttttttt 360tgcatatcct aaaatatgtt tcgttaacat aaaaatatta
caaatatcat tccggacatc 420tcccattttt ttttacgtat aatatcattc
cggatatctc ccaatttttt acgctatgtt 480ggacttggag cagcagatca
atgaaattca acgaccttct accatcctat caatcataac 540tactctgata
atatggtgaa tggttagata ccgatgaatg actcattcgc ttgttgagaa
600aaatcacaag aaaacaaagt tgtctcctcc tgaaaataga tctccgtatt
ccgataaaac 660caaatacaga gagcacggga ctggtcgaaa ctgacacatg
gctggtgaca aatagaccgg 720gacatcgaac ctaatatctc aaaacctcaa
tctcaatcta gctatagaag ctactcaaga 780gaagtaaaag aaagtacctt
tctatgagac aagaccatga ctcgatttaa cagcggaacc 840tgatctaaga
acctatctca acttttgtgt taagatggag ttacagatcg tagttgcaga
900gcttgacggc gctcatgttt actctttttg ttaaatgacg tcaggcttag
ccgcttaggt 960ttagatttat gaggtcggta atgagtgact tgggtttata
10007830DNAArtificial sequenceHomologous region in the GEiGS design
of GEiGS-Splicing factor-DONOR 78tggagcagca gatcaatgaa attcaacgac
3079839DNAArtificial sequenceGEiGS-Y25-transcript 79aaatctaaac
ctaagcggct aagcctgacg tcatttaaca aaaagagtaa acatgagcgc 60cgtcaagctc
tgcaactacg atctgtaact ccatcttaac acaaaagttg agataggttc
120ttagatcagg ttccgctgtt aaatcgagtc atggtcttgt ctcatagaaa
ggtactttct 180tttacttctc ttgagtagct tctatagcta gattgagatt
gaggttttga gatattaggt 240tcgatgtccc ggtctatttg tcaccagcca
tgtgtcagtt tcgaccagtc ccgtgctctc 300tgtatttggt tttatcggaa
tacggagatc tattttcagg aggagacaac tttgttttct 360tgtgattttt
ctcaacaagc gaatgagtca ttcatcggta tctaaccatt caccatatta
420tcagagtagt tatgattgat aggatggtag cgcaatattc gccaagaatc
cacagagcgg 480ctaagtccaa catagcgtaa aaaattggga gatatccgga
atgatattat acgtaaaaaa 540aaatgggaga tgtccggaat gatatttgta
atatttttat gttaacgaaa catattttag 600gatatgcaaa aaaaagtaga
tgttggtatt cttgttttgc aagatttgta atgggagttg 660tgtagtcttt
ttatgatgtg tcatgaagtc taccgccaat tacatacatc attcactttg
720taattaaatt gtcttcaagt ttgtaatttt atttttgttt tatgtaccaa
aatctaaatt 780cagttgttta caacttgata acaaaaaaaa agttatacat
tacttatgtt ttcacactc 8398030DNAArtificial sequenceHomologous region
in the GEiGS design of GEiGS-Y25-transcript 80cgcaatattc gccaagaatc
cacagagcgg 30811000DNAArtificial sequenceY25-DONOR 81gttgttgttg
ctaaatgaat gatattaatc cactacagtt gtaaactaca aatatacaaa 60gcagtaaaaa
tccatgtatg atgattaata agaagctttc gaatggatat agaaaaaact
120tgaatcattg agtgtgaaaa cataagtaat gtataacttt ttttttgtta
tcaagttgta 180aacaactgaa tttagatttt ggtacataaa acaaaaataa
aattacaaac ttgaagacaa 240tttaattaca aagtgaatga tgtatgtaat
tggcggtaga cttcatgaca catcataaaa 300agactacaca actcccatta
caaatcttgc aaaacaagaa taccaacatc tacttttttt 360tgcatatcct
aaaatatgtt tcgttaacat aaaaatatta caaatatcat tccggacatc
420tcccattttt ttttacgtat aatatcattc cggatatctc ccaatttttt
acgctatgtt 480ggacttagcc gctctgtgga ttcttggcga atattgcgct
accatcctat caatcataac 540tactctgata atatggtgaa tggttagata
ccgatgaatg actcattcgc ttgttgagaa 600aaatcacaag aaaacaaagt
tgtctcctcc tgaaaataga tctccgtatt ccgataaaac 660caaatacaga
gagcacggga ctggtcgaaa ctgacacatg gctggtgaca aatagaccgg
720gacatcgaac ctaatatctc aaaacctcaa tctcaatcta gctatagaag
ctactcaaga 780gaagtaaaag aaagtacctt tctatgagac aagaccatga
ctcgatttaa cagcggaacc 840tgatctaaga acctatctca acttttgtgt
taagatggag ttacagatcg tagttgcaga 900gcttgacggc gctcatgttt
actctttttg ttaaatgacg tcaggcttag ccgcttaggt 960ttagatttat
gaggtcggta atgagtgact tgggtttata 10008230DNAArtificial
sequenceHomologous region in the GEiGS design of Y25-DONOR
82ccgctctgtg gattcttggc gaatattgcg 3083947DNAArtificial
sequenceAtTAS3a_AT3G17185 83atcccaccgt ttcttaagac tctctctctt
tctgttttct atttctctct ctctcaaatg 60aaagagagag aagagctccc atggatgaaa
ttagcgagac cgaagtttct ccaaggtgat 120atgtctatct gtatatgtga
tacgaagagt tagggttttg tcatttcgaa gtcaattttt 180gtttgtttgt
caataatgat atctgaatga tgaagaacac gtaactaaga tatgttactg
240aactatataa tacatatgtg tgtttttctg tatctatttc tatatatatg
tagatgtagt 300gtaagtctgt tatatagaca ttattcatgt gtacatgcat
tataccaaca taaatttgta 360tcaatactac
ttttgattta cgatgatgga tgttcttaga tatcttcata cgtttgtttc
420cacatgtatt tacaactaca tatatatttg gaatcacata tatacttgat
tattatagtt 480gtaaagagta acaagttctt ttttcaggca ttaaggaaaa
cataacctcc gtgatgcata 540gagattattg gatccgctgt gctgagacat
tgagtttttc ttcggcattc cagtttcaat 600gataaagcgg tgttatccta
tctgagcttt tagtcggatt ttttcttttc aattattgtg 660ttttatctag
atgatgcatt tcattattct ctttttcttg accttgtaag gccttttctt
720gaccttgtaa gaccccatct ctttctaaac gttttattat tttctcgttt
tacagattct 780attctatctc ttctcaatat agaatagata tctatctcta
cctctaattc gttcgagtca 840ttttctccta ccttgtctat ccctcctgag
ctaatctcca catatatctt ttgtttgtta 900ttgatgtatg gttgacataa
attcaataaa gaagttgacg tttttct 9478423DNAArtificial
sequencesgRNA_AtTAS3a (including PAM) 84aaatgactcg aacgaattag agg
2385947DNAArtificial sequenceGEiGS-Ribosomal protein 3a-transcript
85atcccaccgt ttcttaagac tctctctctt tctgttttct atttctctct ctctcaaatg
60aaagagagag aagagctccc atggatgaaa ttagcgagac cgaagtttct ccaaggtgat
120atgtctatct gtatatgtga tacgaagagt tagggttttg tcatttcgaa
gtcaattttt 180gtttgtttgt caataatgat atctgaatga tgaagaacac
gtaactaaga tatgttactg 240aactatataa tacatatgtg tgtttttctg
tatctatttc tatatatatg tagatgtagt 300gtaagtctgt tatatagaca
ttattcatgt gtacatgcat tataccaaca taaatttgta 360tcaatactac
ttttgattta cgatgatgga tgttcttaga tatcttcata cgtttgtttc
420cacatgtatt tacaactaca tatatatttg gaatcacata tatacttgat
tattatagtt 480gtaaagagta acaagttctt ttttcaggca ttaaggaaaa
cataacctcc gtgatgcata 540gagattattg gatccgctgt gctgagacat
tgagtttttc ttcggcattc cagtttcaat 600gataaagcgg tgttatccta
tctgagcttt tagtcggatt ttttcttttc aattattgtg 660ttttatctag
atgatgcatt tcattattct ctttttcttg accttgtaag gccttttctt
720gaccttgtaa gaccccatct ctttctaaac gttttattat tttctcgttt
tacagattct 780attctatctc ttctcaatat agaatagata tcggcttctt
cagcaccttc accttacgaa 840ttttctccta ccttgtctat ccctcctgag
ctaatctcca catatatctt ttgtttgtta 900ttgatgtatg gttgacataa
attcaataaa gaagttgacg tttttct 9478630DNAArtificial
sequenceHomologous region in the GEiGS design of GEiGS-Ribosomal
protein 3a-transcript 86cggcttcttc agcaccttca ccttacgaat
30871000DNAArtificial sequenceGEiGS- Ribosomal protein 3a -DONOR
87tgtacatgca ttataccaac ataaatttgt atcaatacta cttttgattt acgatgatgg
60atgttcttag atatcttcat acgtttgttt ccacatgtat ttacaactac atatatattt
120ggaatcacat atatacttga ttattatagt tgtaaagagt aacaagttct
tttttcaggc 180attaaggaaa acataacctc cgtgatgcat agagattatt
ggatccgctg tgctgagaca 240ttgagttttt cttcggcatt ccagtttcaa
tgataaagcg gtgttatcct atctgagctt 300ttagtcggat tttttctttt
caattattgt gttttatcta gatgatgcat ttcattattc 360tctttttctt
gaccttgtaa ggccttttct tgaccttgta agaccccatc tctttctaaa
420cgttttatta ttttctcgtt ttacagattc tattctatct cttctcaata
tagaatagat 480atcggcttct tcagcacctt caccttacga attttctcct
accttgtcta tccctcctga 540gctaatctcc acatatatct tttgtttgtt
attgatgtat ggttgacata aattcaataa 600agaagttgac gtttttctta
tttgattttt gttgttgttg gttatattat tgcaacaaaa 660ttaaaggggg
taaggaaggt ctcgctatca aggggactgg caaaaggtaa tgaataagga
720aacgggcaaa aagaattatg cctttactct ctcttttaag gctttggaca
ggaatttagt 780tttgttttat gtgttgtgtt gtttgtttgg gtctgactga
ccccaaaggg caaagccaaa 840ccagagaaga ctcttattaa atattccctc
agaatcattt attgcctcta tctttatctc 900tctctttctc acactcgtga
ctgtttctca ccttatgtat gtactagtaa tagtttttac 960cactttcaac
ttttacaaat agcatttgtt tctgtttaaa 10008830DNAArtificial
sequenceHomologous region in the GEiGS design of GEiGS-Ribosomal
protein 3a -DONOR 88cggcttcttc agcaccttca ccttacgaat
3089947DNAArtificial sequenceGEiGS-Spliceosomal SR
protein-transcript 89atcccaccgt ttcttaagac tctctctctt tctgttttct
atttctctct ctctcaaatg 60aaagagagag aagagctccc atggatgaaa ttagcgagac
cgaagtttct ccaaggtgat 120atgtctatct gtatatgtga tacgaagagt
tagggttttg tcatttcgaa gtcaattttt 180gtttgtttgt caataatgat
atctgaatga tgaagaacac gtaactaaga tatgttactg 240aactatataa
tacatatgtg tgtttttctg tatctatttc tatatatatg tagatgtagt
300gtaagtctgt tatatagaca ttattcatgt gtacatgcat tataccaaca
taaatttgta 360tcaatactac ttttgattta cgatgatgga tgttcttaga
tatcttcata cgtttgtttc 420cacatgtatt tacaactaca tatatatttg
gaatcacata tatacttgat tattatagtt 480gtaaagagta acaagttctt
ttttcaggca ttaaggaaaa cataacctcc gtgatgcata 540gagattattg
gatccgctgt gctgagacat tgagtttttc ttcggcattc cagtttcaat
600gataaagcgg tgttatccta tctgagcttt tagtcggatt ttttcttttc
aattattgtg 660ttttatctag atgatgcatt tcattattct ctttttcttg
accttgtaag gccttttctt 720gaccttgtaa gaccccatct ctttctaaac
gttttattat tttctcgttt tacagattct 780attctatctc ttctcaatat
agaatagata tcctttttga ccaacatttg tttgttttta 840ttttctccta
ccttgtctat ccctcctgag ctaatctcca catatatctt ttgtttgtta
900ttgatgtatg gttgacataa attcaataaa gaagttgacg tttttct
9479030DNAArtificial sequenceHomologous region in the GEiGS design
of GEiGS-Spliceosomal SR protein-transcript 90atcctttttg accaacattt
gtttgttttt 30911000DNAArtificial sequenceGEiGS-Spliceosomal SR
protein-DONOR 91tgtacatgca ttataccaac ataaatttgt atcaatacta
cttttgattt acgatgatgg 60atgttcttag atatcttcat acgtttgttt ccacatgtat
ttacaactac atatatattt 120ggaatcacat atatacttga ttattatagt
tgtaaagagt aacaagttct tttttcaggc 180attaaggaaa acataacctc
cgtgatgcat agagattatt ggatccgctg tgctgagaca 240ttgagttttt
cttcggcatt ccagtttcaa tgataaagcg gtgttatcct atctgagctt
300ttagtcggat tttttctttt caattattgt gttttatcta gatgatgcat
ttcattattc 360tctttttctt gaccttgtaa ggccttttct tgaccttgta
agaccccatc tctttctaaa 420cgttttatta ttttctcgtt ttacagattc
tattctatct cttctcaata tagaatagat 480atcctttttg accaacattt
gtttgttttt attttctcct accttgtcta tccctcctga 540gctaatctcc
acatatatct tttgtttgtt attgatgtat ggttgacata aattcaataa
600agaagttgac gtttttctta tttgattttt gttgttgttg gttatattat
tgcaacaaaa 660ttaaaggggg taaggaaggt ctcgctatca aggggactgg
caaaaggtaa tgaataagga 720aacgggcaaa aagaattatg cctttactct
ctcttttaag gctttggaca ggaatttagt 780tttgttttat gtgttgtgtt
gtttgtttgg gtctgactga ccccaaaggg caaagccaaa 840ccagagaaga
ctcttattaa atattccctc agaatcattt attgcctcta tctttatctc
900tctctttctc acactcgtga ctgtttctca ccttatgtat gtactagtaa
tagtttttac 960cactttcaac ttttacaaat agcatttgtt tctgtttaaa
10009230DNAArtificial sequenceHomologous region in the GEiGS design
of GEiGS-Spliceosomal SR protein-DONOR 92atcctttttg accaacattt
gtttgttttt 309330DNAArtificial sequenceSingle strand DNA
oligonucleotide 93taacataaaa atattacaaa tatcattccg
309427DNAArtificial sequenceSingle strand DNA oligonucleotide
94tcagagtagt tatgattgat aggatgg 279521DNAArtificial sequenceSingle
strand DNA oligonucleotide 95gctcaggagg gatagacaag g
219627DNAArtificial sequenceSingle strand DNA oligonucleotide
96ctcgttttac agattctatt ctatctc 279722DNAArtificial sequenceSingle
strand DNA oligonucleotide 97tgaccttgta agaccccatc tc
229824DNAArtificial sequenceSingle strand DNA oligonucleotide
98aggagaaaat tcgtaaggtg aagg 249922DNAArtificial sequenceSingle
strand DNA oligonucleotide 99tgaccttgta agaccccatc tc
2210023DNAArtificial sequenceSingle strand DNA oligonucleotide
100ggtaggagaa aatgactcga acg 2310127DNAArtificial sequenceSingle
strand DNA oligonucleotide 101caaccataca tcaataacaa acaaaag
2710227DNAArtificial sequenceSingle strand DNA oligonucleotide
102atatagaata gatatcggct tcttcag 2710327DNAArtificial
sequenceSingle strand DNA oligonucleotide 103caaccataca tcaataacaa
acaaaag 2710425DNAArtificial sequenceSingle strand DNA
oligonucleotide 104tcctttttga ccaacatttg tttgt 2510523DNAArtificial
sequenceSingle strand DNA oligonucleotide 105gagtcattca tcggtatcta
acc 2310620DNAArtificial sequenceSingle strand DNA oligonucleotide
106agccgctctg tggattcttg 2010723DNAArtificial sequenceSingle strand
DNA oligonucleotide 107gagtcattca tcggtatcta acc
2310826DNAArtificial sequenceSingle strand DNA oligonucleotide
108tggacttaga atatgctatg ttggac 2610927DNAArtificial sequenceSingle
strand DNA oligonucleotide 109gcatatccta aaatatgttt cgttaac
2711020DNAArtificial sequenceSingle strand DNA oligonucleotide
110tcgccaagaa tccacagagc 2011127DNAArtificial sequenceSingle strand
DNA oligonucleotide 111gcatatccta aaatatgttt cgttaac
2711227DNAArtificial sequenceSingle strand DNA oligonucleotide
112taagtccaac atagcatatt ctaagtc 2711340DNAArtificial
sequenceSingle strand DNA oligonucleotide 113atgtttgaac gatcgggccc
aagggacacg aagtgatccg 4011438DNAArtificial sequenceSingle strand
DNA oligonucleotide 114ctccaccatg ttcccggggg cacagagtgt tcaacccc
381151038DNAArtificial sequenceAtTAS1B (At1g50055) 115ttgacccaaa
aaggctttgt actctttaca taacaaaaaa ggtcaaatag ggaaaacgat 60gggactttat
aaacccaagt cactcattac cgacctcata aatctaaacc taagcggcta
120agcctgacgt catttaacaa aaagagtaaa catgagcgcc gtcaagctct
gcaactacga 180tctgtaactc catcttaaca caaaagttga gataggttct
tagatcaggt tccgctgtta 240aatcgagtca tggtcttgtc tcatagaaag
gtactttctt ttacttctct tgagtagctt 300ctatagctag attgagattg
aggttttgag atattaggtt cgatgtcccg gtctatttgt 360caccagccat
gtgtcagttt cgaccagtcc cgtgctctct gtatttggtt ttatcggaat
420acggagatct attttcagga ggagacaact ttgttttctt gtgatttttc
tcaacaagcg 480aatgagtcat tcatcggtat ctaaccattc accatattat
cagagtagtt atgattgata 540ggatggtaga agaatattct aagtccaaca
tagcatattc taagtccaac atagcgtaaa 600aaattgggag atatccggaa
tgatattata cgtaaaaaaa aatgggagat gtccggaatg 660atatttgtaa
tatttttatg ttaacgaaac atattttagg atatgcaaaa aaaagtagat
720gttggtattc ttgttttgca agatttgtaa tgggagttgt gtagtctttt
tatgatgtgt 780catgaagtct accgccaatt acatacatca ttcactttgt
aattaaattg tcttcaagtt 840tgtaatttta tttttgtttt atgtaccaaa
atctaaattc agttgtttac aacttgataa 900caaaaaaaaa gttatacatt
acttatgttt tcacactcaa tgattcaagt tttttctata 960tccattcgaa
agcttcttat taatcatcat acatggattt ttactgcttt gtatatttgt
1020agtttacaac tgtagtgg 10381161039DNAArtificial sequenceGEiGS-TuMV
116tttgacccaa aaaggctttg tactctttac ataacaaaaa aggtcaaata
gggaaaacga 60tgggacttta taaacccaag tcactcatta ccgacctcat aaatctaaac
ctaagcggct 120aagcctgacg tcatttaaca aaaagagtaa acatgagcgc
cgtcaagctc tgcaactacg 180atctgtaact ccatcttaac acaaaagttg
agataggttc ttagatcagg ttccgctgtt 240aaatcgagtc atggtcttgt
ctcatagaaa ggtactttct tttacttctc ttgagtagct 300tctatagcta
gattgagatt gaggttttga gatattaggt tcgatgtccc ggtctatttg
360tcaccagcca tgtgtcagtt tcgaccagtc ccgtgctctc tgtatttggt
tttatcggaa 420tacggagatc tattttcagg aggagacaac tttgttttct
tgtgattttt ctcaacaagc 480gaatgagtca ttcatcggta tctaaccatt
caccatatta tcagagtagt tatgattgat 540aggatggtag aagaatattc
taagtccaac atagcataac ttgctcacac actcgactga 600aaaattggga
gatatccgga atgatattat acgtaaaaaa aaatgggaga tgtccggaat
660gatatttgta atatttttat gttaacgaaa catattttag gatatgcaaa
aaaaagtaga 720tgttggtatt cttgttttgc aagatttgta atgggagttg
tgtagtcttt ttatgatgtg 780tcatgaagtc taccgccaat tacatacatc
attcactttg taattaaatt gtcttcaagt 840ttgtaatttt atttttgttt
tatgtaccaa aatctaaatt cagttgttta caacttgata 900acaaaaaaaa
agttatacat tacttatgtt ttcacactca atgattcaag ttttttctat
960atccattcga aagcttctta ttaatcatca tacatggatt tttactgctt
tgtatatttg 1020tagtttacaa ctgtagtgg 103911721DNAArtificial
sequenceGEiGS-TuMV- mature siRNA 117acttgctcac acactcgact g
211181039DNAArtificial sequenceGEiGS-dummy 118tttgacccaa aaaggctttg
tactctttac ataacaaaaa aggtcaaata gggaaaacga 60tgggacttta taaacccaag
tcactcatta ccgacctcat aaatctaaac ctaagcggct 120aagcctgacg
tcatttaaca aaaagagtaa acatgagcgc cgtcaagctc tgcaactacg
180atctgtaact ccatcttaac acaaaagttg agataggttc ttagatcagg
ttccgctgtt 240aaatcgagtc atggtcttgt ctcatagaaa ggtactttct
tttacttctc ttgagtagct 300tctatagcta gattgagatt gaggttttga
gatattaggt tcgatgtccc ggtctatttg 360tcaccagcca tgtgtcagtt
tcgaccagtc ccgtgctctc tgtatttggt tttatcggaa 420tacggagatc
tattttcagg aggagacaac tttgttttct tgtgattttt ctcaacaagc
480gaatgagtca ttcatcggta tctaaccatt caccatatta tcagagtagt
tatgattgat 540aggatggtag aagaatattg gaggggtaat gccattgctt
ctaagtccaa catagcgtaa 600aaaattggga gatatccgga atgatattat
acgtaaaaaa aaatgggaga tgtccggaat 660gatatttgta atatttttat
gttaacgaaa catattttag gatatgcaaa aaaaagtaga 720tgttggtatt
cttgttttgc aagatttgta atgggagttg tgtagtcttt ttatgatgtg
780tcatgaagtc taccgccaat tacatacatc attcactttg taattaaatt
gtcttcaagt 840ttgtaatttt atttttgttt tatgtaccaa aatctaaatt
cagttgttta caacttgata 900acaaaaaaaa agttatacat tacttatgtt
ttcacactca atgattcaag ttttttctat 960atccattcga aagcttctta
ttaatcatca tacatggatt tttactgctt tgtatatttg 1020tagtttacaa
ctgtagtgg 103911921DNAArtificial sequenceGEiGS-dummy- mature siRNA
119ttggaggggt aatgccattg c 21120102DNAArtificial sequencemiR173_
AT3G23125 120taagtacttt cgcttgcaga gagaaatcac agtggtcaaa aaagttgtag
ttttcttaaa 60gtctctttcc tctgtgattc tctgtgtaag cgaaagagct tg
10212122DNAArtificial sequencemiR173-mature miRNA 121ttcgcttgca
gagagaaatc ac 22122947DNAArtificial sequenceAtTAS3a_AT3G17185
122atcccaccgt ttcttaagac tctctctctt tctgttttct atttctctct
ctctcaaatg 60aaagagagag aagagctccc atggatgaaa ttagcgagac cgaagtttct
ccaaggtgat 120atgtctatct gtatatgtga tacgaagagt tagggttttg
tcatttcgaa gtcaattttt 180gtttgtttgt caataatgat atctgaatga
tgaagaacac gtaactaaga tatgttactg 240aactatataa tacatatgtg
tgtttttctg tatctatttc tatatatatg tagatgtagt 300gtaagtctgt
tatatagaca ttattcatgt gtacatgcat tataccaaca taaatttgta
360tcaatactac ttttgattta cgatgatgga tgttcttaga tatcttcata
cgtttgtttc 420cacatgtatt tacaactaca tatatatttg gaatcacata
tatacttgat tattatagtt 480gtaaagagta acaagttctt ttttcaggca
ttaaggaaaa cataacctcc gtgatgcata 540gagattattg gatccgctgt
gctgagacat tgagtttttc ttcggcattc cagtttcaat 600gataaagcgg
tgttatccta tctgagcttt tagtcggatt ttttcttttc aattattgtg
660ttttatctag atgatgcatt tcattattct ctttttcttg accttgtaag
gccttttctt 720gaccttgtaa gaccccatct ctttctaaac gttttattat
tttctcgttt tacagattct 780attctatctc ttctcaatat agaatagata
tctatctcta cctctaattc gttcgagtca 840ttttctccta ccttgtctat
ccctcctgag ctaatctcca catatatctt ttgtttgtta 900ttgatgtatg
gttgacataa attcaataaa gaagttgacg tttttct 947123947DNAArtificial
sequenceGEiGS-Ribosomal protein 3a-transcript 123atcccaccgt
ttcttaagac tctctctctt tctgttttct atttctctct ctctcaaatg 60aaagagagag
aagagctccc atggatgaaa ttagcgagac cgaagtttct ccaaggtgat
120atgtctatct gtatatgtga tacgaagagt tagggttttg tcatttcgaa
gtcaattttt 180gtttgtttgt caataatgat atctgaatga tgaagaacac
gtaactaaga tatgttactg 240aactatataa tacatatgtg tgtttttctg
tatctatttc tatatatatg tagatgtagt 300gtaagtctgt tatatagaca
ttattcatgt gtacatgcat tataccaaca taaatttgta 360tcaatactac
ttttgattta cgatgatgga tgttcttaga tatcttcata cgtttgtttc
420cacatgtatt tacaactaca tatatatttg gaatcacata tatacttgat
tattatagtt 480gtaaagagta acaagttctt ttttcaggca ttaaggaaaa
cataacctcc gtgatgcata 540gagattattg gatccgctgt gctgagacat
tgagtttttc ttcggcattc cagtttcaat 600gataaagcgg tgttatccta
tctgagcttt tagtcggatt ttttcttttc aattattgtg 660ttttatctag
atgatgcatt tcattattct ctttttcttg accttgtaag gccttttctt
720gaccttgtaa gaccccatct ctttctaaac gttttattat tttctcgttt
tacagattct 780attctatctc ttctcaatat agaatagata tcggcttctt
cagcaccttc accttacgaa 840ttttctccta ccttgtctat ccctcctgag
ctaatctcca catatatctt ttgtttgtta 900ttgatgtatg gttgacataa
attcaataaa gaagttgacg tttttct 94712430DNAArtificial
sequenceGEiGS-Ribosomal protein 3a-transcript - the expected
processed siRNA 124cggcttcttc agcaccttca ccttacgaat
30125947DNAArtificial sequenceGEiGS-Spliceosomal SR
protein-transcript 125atcccaccgt ttcttaagac tctctctctt tctgttttct
atttctctct ctctcaaatg 60aaagagagag aagagctccc atggatgaaa ttagcgagac
cgaagtttct ccaaggtgat 120atgtctatct gtatatgtga tacgaagagt
tagggttttg tcatttcgaa gtcaattttt 180gtttgtttgt caataatgat
atctgaatga tgaagaacac gtaactaaga tatgttactg 240aactatataa
tacatatgtg tgtttttctg tatctatttc tatatatatg tagatgtagt
300gtaagtctgt tatatagaca ttattcatgt gtacatgcat tataccaaca
taaatttgta 360tcaatactac ttttgattta cgatgatgga tgttcttaga
tatcttcata cgtttgtttc 420cacatgtatt tacaactaca tatatatttg
gaatcacata tatacttgat tattatagtt 480gtaaagagta acaagttctt
ttttcaggca ttaaggaaaa cataacctcc gtgatgcata 540gagattattg
gatccgctgt gctgagacat tgagtttttc ttcggcattc cagtttcaat
600gataaagcgg tgttatccta tctgagcttt tagtcggatt ttttcttttc
aattattgtg 660ttttatctag atgatgcatt tcattattct ctttttcttg
accttgtaag gccttttctt 720gaccttgtaa gaccccatct ctttctaaac
gttttattat
tttctcgttt tacagattct 780attctatctc ttctcaatat agaatagata
tcctttttga ccaacatttg tttgttttta 840ttttctccta ccttgtctat
ccctcctgag ctaatctcca catatatctt ttgtttgtta 900ttgatgtatg
gttgacataa attcaataaa gaagttgacg tttttct 94712630DNAArtificial
sequenceGEiGS-Spliceosomal SR protein-transcript - the expected
processed siRNA 126atcctttttg accaacattt gtttgttttt
30127107DNAArtificial sequencemiR390_ AT2G38325 127gtagagaaga
atctgtaaag ctcaggaggg atagcgccat gatgatcaca ttcgttatct 60attttttggc
gctatccatc ctgagtttca ttggctcttc ttactac 10712825DNAArtificial
sequenceSingle strand DNA oligonucleotide 128gctcaactga caaagaatct
ctcac 2512925DNAArtificial sequenceSingle strand DNA
oligonucleotide 129ttgaaaattg ggtcaaagaa atgcg 2513021DNAArtificial
sequenceSingle strand DNA oligonucleotide 130gaacggtcgc tacgattacg
a 2113121DNAArtificial sequenceSingle strand DNA oligonucleotide
131caaacgctct gttgaacagg c 2113220DNAArtificial sequenceSingle
strand DNA oligonucleotide 132ttccagcaga tgtggatcag
2013320DNAArtificial sequenceSingle strand DNA oligonucleotide
133cggccttatt cttcaagcac 2013423DNAArtificial sequencesgRNA which
would have been used to cut TAS1b 134ccaacatagc gtaaaaaatt ggg
2313521DNAArtificial sequencesiRNA sequence that targets TuMV
(which would have been introduced into the TAS1b backbone by the
GEiGS donor using an HDR-mediated swap) 135acttgctcac acactcgact g
211361200DNAArtificial sequenceGEiGS donor which included the
desired changes to the TAS1b backbone 136atacatacca atttgaccca
aaaaggcttt gtactcttta cataacaaaa aaggtcaaat 60agggaaaacg atgggacttt
ataaacccaa gtcactcatt accgacctca taaatctaaa 120cctaagcggc
taagcctgac gtcatttaac aaaaagagta aacatgagcg ccgtcaagct
180ctgcaactac gatctgtaac tccatcttaa cacaaaagtt gagataggtt
cttagatcag 240gttccgctgt taaatcgagt catggtcttg tctcatagaa
aggtactttc ttttacttct 300cttgagtagc ttctatagct agattgagat
tgaggttttg agatattagg ttcgatgtcc 360cggtctattt gtcaccagcc
atgtgtcagt ttcgaccagt cccgtgctct ctgtatttgg 420ttttatcgga
atacggagat ctattttcag gaggagacaa ctttgttttc ttgtgatttt
480tctcaacaag cgaatgagtc attcatcggt atctaaccat tcaccatatt
atcagagtag 540ttatgattga taggatggta gaagaatatt ctaagtccaa
catagcataa cttgctcaca 600cactcgactg aaaaattggg agatatccgg
aatgatatta tacgtaaaaa aaaatgggag 660atgtccggaa tgatatttgt
aatattttta tgttaacgaa acatatttta ggatatgcaa 720aaaaaagtag
atgttggtat tcttgttttg caagatttgt aatgggagtt gtgtagtctt
780tttatgatgt gtcatgaagt ctaccgccaa ttacatacat cattcacttt
gtaattaaat 840tgtcttcaag tttgtaattt tatttttgtt ttatgtacca
aaatctaaat tcagttgttt 900acaacttgat aacaaaaaaa aagttataca
ttacttatgt tttcacactc aatgattcaa 960gttttttcta tatccattcg
aaagcttctt attaatcatc atacatggat ttttactgct 1020ttgtatattt
gtagtttaca actgtagtgg attaatatca ttcatttagc aacaacaaca
1080ctcgttaagt ttgctcactt gtcataatta taaaccaacg catgcatcac
atatataagt 1140aaatgcaaaa cctatgcagc tattatcaaa gtcttcactt
ctcaaacgtg cttcaatcac 12001371039DNAArtificial sequenceGEiGS oligo
which would have been expressed in Arabidopsis following GEiGS with
the donor of (3) (designed to introduce the mature siRNA sequence
of (1) into the TAS1b sequence) 137tttgacccaa aaaggctttg tactctttac
ataacaaaaa aggtcaaata gggaaaacga 60tgggacttta taaacccaag tcactcatta
ccgacctcat aaatctaaac ctaagcggct 120aagcctgacg tcatttaaca
aaaagagtaa acatgagcgc cgtcaagctc tgcaactacg 180atctgtaact
ccatcttaac acaaaagttg agataggttc ttagatcagg ttccgctgtt
240aaatcgagtc atggtcttgt ctcatagaaa ggtactttct tttacttctc
ttgagtagct 300tctatagcta gattgagatt gaggttttga gatattaggt
tcgatgtccc ggtctatttg 360tcaccagcca tgtgtcagtt tcgaccagtc
ccgtgctctc tgtatttggt tttatcggaa 420tacggagatc tattttcagg
aggagacaac tttgttttct tgtgattttt ctcaacaagc 480gaatgagtca
ttcatcggta tctaaccatt caccatatta tcagagtagt tatgattgat
540aggatggtag aagaatattc taagtccaac atagcataac ttgctcacac
actcgactga 600aaaattggga gatatccgga atgatattat acgtaaaaaa
aaatgggaga tgtccggaat 660gatatttgta atatttttat gttaacgaaa
catattttag gatatgcaaa aaaaagtaga 720tgttggtatt cttgttttgc
aagatttgta atgggagttg tgtagtcttt ttatgatgtg 780tcatgaagtc
taccgccaat tacatacatc attcactttg taattaaatt gtcttcaagt
840ttgtaatttt atttttgttt tatgtaccaa aatctaaatt cagttgttta
caacttgata 900acaaaaaaaa agttatacat tacttatgtt ttcacactca
atgattcaag ttttttctat 960atccattcga aagcttctta ttaatcatca
tacatggatt tttactgctt tgtatatttg 1020tagtttacaa ctgtagtgg
103913825DNAArtificial sequenceparameters for
FASTQmisc_feature(1)..(4)n is a, c, g, t or u 138nnnntggaat
tctcgggtgc caagg 2513967DNAArtificial sequenceparameters for FASTQ
139agatcggaag agcacacgtc tgaactccag tcaaagatcg gaagagcgtc
gtgtagggaa 60agagtgt 67
* * * * *