Restoration Of The Cftr Function By Splicing Modulation

Abstract

The present invention provides oligonucleotides capable of binding to and modulating the splicing of the pre-mRNA of the CFTR gene, including compositions comprising the oligonucleotides, and uses thereof, such as for suppressing the inclusion of a cryptic exon between exon 22 and 23 as a result of the mutation 3849 +10 Kb C-to-T, optionally in combination with additional CF therapeutics.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 62/843,469 titled "RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION", filed May 5, 2019, the contents of which are incorporated herein by reference in their entirety.

FIELD OF THE INVENTION

[0002] The present invention relates to oligonucleotides capable of binding to a Cystic Fibrosis Trans-membrane conductance Regulator (CFTR) pre-mRNA, and methods of using same, such as for suppressing the inclusion of a cryptic exon between exon 22 and 23 as a result of the mutation 3849 +10 Kb C-to-T, and for treating Cystic Fibrosis (CF).

BACKGROUND

[0003] Cystic fibrosis (CF) is a common, severe autosomal recessive disease caused by mutations in the CFTR gene. The CFTR gene encodes for a chloride channel responsible for chloride transport in epithelial cells. The major manifestations of CF are in the lungs, with more than 90% mortality related to the respiratory disease. The disease in the respiratory tract is linked to the insufficient CFTR function in the airway epithelium.

[0004] As of today, approximately 2000 different mutations disrupting the CFTR functions have been identified worldwide, grouped into five distinct classes based on their effect on the CFTR function. Class I includes mutations that lead to non-functional CFTR (large deletions and stop codon mutations). Class II mutations (including the common .DELTA.F508) lead to aberrantly folded CFTR protein that is recognized by the cell quality control mechanism and subsequently degraded, resulting in the absence of mature CFTR protein at the apical cell membrane. Class III mutations lead to full-length CFTR protein being incorporated into the cell membrane, but with defective regulation so that no CFTR function is present. These three classes usually lead to a classic CF phenotype with pancreatic insufficiency, although the severity of lung disease is highly variable. CFTR mutations leading to defective chloride conductance are grouped into Class IV. Class V mutations involve transcription dysregulation, resulting in a decreased amount of otherwise normal CFTR. The latter two classes are often associated with a milder phenotype and pancreatic sufficiency. Specifically, CFTR that results from a class IV mutation inserts into the plasma membrane but exhibits reduced single-channel chloride ion conductance because of reduced chloride permeation and open channel probability. Found in <1% of patients with CF, class V mutations produce normal plasma membrane CFTR. The quantity, however, is generally reduced as a result of transcriptional dysregulation. Class V mutations are frequently influence by the splicing machinery and generate both aberrantly and correctly spliced mRNA, the levels of which vary among different patients and even among different organs of the same patients. Ultimately, the splice variants result in a reduced number of functioning CFTR in the plasma membrane.

[0005] About 10-15% of CFTR mutations affect the correct splicing of the gene transcripts. Among these is the splicing mutation 3849 +10 kb C-to-T which leads to inclusion of an 84 base pair cryptic exon in the mature messenger RNA (mRNA) (denoted "intron 22 cryptic exon inclusion" mutation). This mutation is the 12th most common CFTR mutation in the world, which occurs in hundreds of CF patients worldwide (Kerem et al., 1997). Correction of the aberrant splicing of the CFTR gene by "anti-sense" oligonucleotides (AOs) was attempted by Friedman et al, 1999 and recently described in international PCT Application Publication WO 2014/045283 to the present inventors.

[0006] Anti-sense oligonucleotides (AOs or ASOs) administration is one of the most promising therapeutic approaches for the treatment of genetic disorders caused by splicing mutations. AOs are short synthetic molecules which can anneal to motifs predicted to be involved in the pre-mRNA splicing. The method is based on splice-switching. The AOs binding to selected sites is expected to mask the targeted region and promote normal splicing. AOs are highly specific for their targets and do not affect any other sequences in the cells. Several types of chemically modified AO molecules are commonly used including: 2'-O-methyl-phosphorothioate (2'OMP), phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acids (PNAs), 2-methoxyethyl phosphorothioate (MOE), constrained ethyl (cET), LIgand-Conjugated Antisense (LICA) and alternating locked nucleic acids (LNAs).

[0007] The AOs modifications maintain their stabilization, improve their target affinity, and provide favorable pharmacokinetic properties and biological stability. It has been conclusively shown that splice-switching AOs can redirect dystrophin pre-mRNA processing in murine models for Duchenne Muscular Dystrophy (DMD) so that an exon carrying a premature protein termination signal (nonsense mutation) can be excluded from the mature gene transcript resulting in a shorter but still functional dystrophin isoform. Progress in dystrophin exon skipping has been rapid, with proof-of-concept studies being reported, and with the publication of results from systemic administration to patients in both 2OMP and PMO chemistries. In 2016, the FDA granted accelerated approval to first drug for Duchenne muscular dystrophy (eteplirsen), which is a PMO AO for exon 51 skipping.

[0008] In addition to induced exon skipping, AOs can be designed to mask splice-silencing elements that reduce exon recognition and subsequent inclusion in the mature mRNA. Spinal Muscular Atrophy (SMA) is a common autosomal recessive condition caused by the loss of the SMN1 gene together with a C>T variation in SMN2 exon 7, leading to abnormal splicing in which SMN2 exon 7 is skipped, resulting in a non-functional gene product. AOs have been designed to mask nearby flanking SMN2 splice silencer elements to promote synthesis of full-length transcripts. An intrathecally administration of morpholino oligomer to neonatal mouse pups with severe SMA was highly successful, significantly extending their survival.

[0009] This led to the development of an AO-based drug, Spinraza (Nusinersen), that was recently approved by the US Food and Drug Administration (FDA) and the European Medicines Agency (EMA). The approval followed a very successful completion of a phase-III clinical trial in patients with infantile-onset SMA. The treated infants experienced a statistically significant improvement in the achievement of motor milestones. The results of this study demonstrate the great potential of AO-based splicing modulation for the treatment of genetic diseases and emphasize the importance of local delivery for efficient treatment with minimal toxicity.

[0010] There remains a constant need in the field of Cystic Fibrosis management for novel, potent therapeutics, designed to overcome the numerous mutations in the CFTR gene identified thus far, and restore CFTR function.

SUMMARY

[0011] The present invention provides compositions comprising oligonucleotides capable of binding to a CFTR pre-mRNA, thereby modulating splicing and restoring or enhancing the function of the CFTR gene product. The present invention thus identifies sequences within the CFTR pre-mRNA which are targeted in order to modulate the splicing cascade of the CFTR pre-mRNA. Modulating CFTR pre-mRNA splicing, as demonstrated in the present invention, can avoid improper recognition of intron sequences as exons. As a result of the modulation of splicing, a functional CFTR protein is produced in sufficient levels by an otherwise aberrant CFTR allele. The present invention, in some embodiments thereof, further provides modified oligonucleotides for modulating splicing and restoring or enhancing the function of the CFTR gene product.

[0012] The present invention is based, in part, on the finding that artificial "anti-sense" oligonucleotide molecules are able to target and bind predetermined sequences at the pre-mRNA molecule of the CFTR gene, and that the binding can modulate the splicing of the pre-mRNA molecule into a mature mRNA which is subsequently translated into a functional CFTR protein in sufficient levels. The targets within a CFTR pre-mRNA molecule are those discovered to be involved in splicing, either indirectly, by affecting the splicing of adjacent as well as more remote sequences, or directly, by affecting their own splicing.

[0013] Advantageously, the present invention provides anti-sense oligonucleotide molecules with improved efficacy. The oligonucleotides are highly effective in raising the percentage of correctly spliced CFTR mRNA. The oligonucleotides are short, having no more than 21 nucleotides, having advantages such as improved cell/tissue penetrating capacity.

[0014] According to a first aspect, there is provided a synthetic oligonucleotide molecule consisting of 17-21 consecutive bases having at least 80% complementarity to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation, and characterized by at least partly suppressing the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, increasing the percentage of correctly spliced mature CFTR mRNA by at least about 10%; and decreasing the level of aberrantly spliced mature CFTR mRNA by at least about 20%.

[0015] According to another aspect, there is provided a pharmaceutical composition comprising the synthetic oligonucleotide molecule of the invention, and a pharmaceutically acceptable carrier.

[0016] According to another aspect, there is provided a method for treating CF in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a synthetic oligonucleotide, wherein the synthetic oligonucleotide suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, increases the percentage of correctly spliced mature CFTR mRNA by at least about 10%; and decreases the level of aberrantly spliced mature CFTR mRNA by at least about 20%, thereby treating CF in the subject.

[0017] According to another aspect, there is provided a kit comprising: (a) at least one synthetic oligonucleotide molecule; and at least one of: (b) at least one CFTR modifier; or (c) at least one CF drug, wherein the synthetic oligonucleotide is selected from the group consisting of SEQ ID Nos. 1-25, and 41-44, and wherein the CFTR modifier is selected from the group consisting of: CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier.

[0018] In some embodiments, the synthetic oligonucleotide molecule has at least 80% complementarity to a nucleotide sequence within SEQ ID NO: 37.

[0019] In some embodiments, the synthetic oligonucleotide molecule has 100% complementarity to a nucleotide sequence within SEQ ID NO: 37.

[0020] The synthetic oligonucleotide molecule of any one of claims 1 to 3, consisting of 19 consecutive nucleotide bases.

[0021] In some embodiments, the synthetic oligonucleotide molecule consists of 18 consecutive nucleotide bases.

[0022] In some embodiments, the synthetic oligonucleotide molecule comprises a chemically modified comprising: a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, an alternating locked nucleic acid backbone, constrained ethyl backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-.beta.-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, and a combination thereof.

[0023] In some embodiments, the synthetic oligonucleotide molecule comprises a backbone comprising a 2'-O-Methyl phosphorothioate (2'OMP) modification or a 2'-Methoxy Ethyl (2'MOE) modification.

[0024] In some embodiments, the synthetic oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID Nos.: 1-25, and 41-44.

[0025] In some embodiments, the synthetic oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID Nos.: 1-5, and 41.

[0026] In some embodiments, the synthetic oligonucleotide molecule comprises the sequence GAUGGAAGA (SEQ ID NO: 38).

[0027] In some embodiments, the pharmaceutical composition is formulated for oral, nasal, inhalation, abdominal, subcutaneous, intra-peritoneal or intravenous administration.

[0028] In some embodiments, the pharmaceutical composition is for use in the treatment of cystic fibrosis (CF), in a subject in need thereof.

[0029] In some embodiments, the method further comprising administering to the subject a therapeutically effective amount of one or more CFTR modifiers.

[0030] In some embodiments, the CFTR modifier is selected from the group consisting of: a CFTR-splicing-modulating agent, Translational Read-Through agent, a CFTR amplifier, a CFTR potentiator, and a CFTR corrector.

[0031] In some embodiments, the CFTR modifier is selected from the group consisting of: a different synthetic oligonucleotide molecule capable of suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA, Ataluren, ELX-02, ivacaftor, QBW251, PTI-808, VX-561, lumacaftor, tezacaftor, elexacaftor, VX-659, VX-445, VX-152 and VX-440, GLPG2222, FDL169, PTI-801, and any combination thereof.

[0032] In some embodiments, the CFTR modifier is ivacaftor, lumacaftor, tezacaftor, elexacaftor, VX-659, VX-152, or VX-440, or any combination thereof.

[0033] In some embodiments, the subject comprises a 3849 +10 Kb C-to-T mutation in the CFTR gene.

[0034] In some embodiments, the subject is heterozygous to the 3849 +10 Kb C-to-T mutation.

[0035] In some embodiments, treating comprises improving at least one clinical parameter of CF selected from the group consisting of: lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, and the need for antibiotic therapy for sinopulmonary signs or symptoms.

[0036] In some embodiments, the CF drug is an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof.

[0037] Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0038] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE FIGURES

[0039] FIG. 1 is an illustration showing the effect of the 3849 +10 kb C to T mutation in intron 22 of the CFTR gene. Top--upon normal splicing, exon 22 and exon 23 become adjacent. Bottom--a splicing mutation in intron 22 (denoted "3849 +10 kb C-to-T" mutation) leads to inclusion of an excess of 84 bases in the mature CFTR mRNA (denoted "intron 22 cryptic exon"). The mutation creates a premature in-frame stop codon, leading to mRNA degradation by the nonsense mediated mRNA decay (NMD) mechanism.

[0040] FIG. 2 is an illustration showing the binding sites (underlined) of oligonucleotides SPL84-1--SPL84-26 within the CFTR allele carrying the 3849 +10 kb C to T mutation.

[0041] FIG. 3A is a vertical bar graph showing the change in levels of aberrantly spliced CFTR transcripts in FRT 3849 mut cells following antisense oligonucleotide (ASO) transfection (10 nM). Following a 24-hour treatment with the indicated ASO, RNA was extracted and the levels of aberrantly spliced CFTR transcripts were measured by qRT-PCR. The values shown are the average fold change (mean.+-.s.e.m.) relative to cells treated with control ASO from 2-7 independent experiments. Values are normalized against transcripts of HPRT gene.

[0042] FIG. 3B is a vertical bar graph showing the percentage of correctly spliced CFTR transcripts in FRT 3849 mut cells following ASO transfection (10 nM). Following a 24-hour treatment with the indicated ASO, RNA was extracted and the ratio between the correctly and aberrantly spliced CFTR transcripts were measured by RT-PCR. The values shown are the average percentage of correctly spliced transcripts (mean.+-.s.e.m.) from 3-8 independent experiments.

[0043] FIG. 4A is a vertical bar graph showing the change in levels of aberrantly spliced CFTR transcripts in FRT 3849 mut cells following ASO transfection (2.5 nM), compared to the ASOs described in Friedman et al., 1999. Following a 24-hour treatment with the indicated ASO, RNA was extracted and the levels of aberrantly spliced CFTR transcripts were measured by qRT-PCR. The values shown are the average fold change relative to cells treated with control ASO (mean.+-.s.e.m.) from 3 independent experiments. Values were normalized against transcripts of HPRT gene.

[0044] FIG. 4B is a vertical bar graph showing the percentage of correctly spliced CFTR transcripts in FRT 3849 mut cells following ASO transfection (2.5 nM), compared to the ASOs described in Friedman et al., 1999. Following a 24-hour treatment with the indicated ASO, RNA was extracted and the levels of correctly and aberrantly spliced CFTR transcripts were measured by RT-PCR. The values shown are the percentage of correctly spliced transcripts (mean.+-.s.e.m.) from 3 independent experiments.

[0045] FIG. 5A is a vertical bar graph showing the change in levels of aberrantly spliced CFTR transcripts in FRT 3849 mut cells following ASO transfection (10 nM), compared to the ASOs described in WO 2014/045283. Following a 24-hour treatment with the indicated ASO, RNA was extracted and the levels of aberrantly spliced CFTR transcripts were measured by qRT-PCR. The values shown are the average fold change relative to cells treated with control ASO (mean.+-.s.e.m.) from 3 independent experiments. Values were normalized against transcripts of HPRT gene.

[0046] FIG. 5B is a vertical bar showing the percentage of correctly spliced CFTR transcripts in FRT 3849 mut cells following ASO transfection (10 nM), compared to the ASOs described in WO 2014/045283. Following a 24-hour treatment with the indicated ASO, RNA was extracted and the levels of correctly and aberrantly spliced CFTR transcripts were measured by RT-PCR. The values shown are the percentage of correctly spliced transcripts (mean.+-.s.e.m.) from 3 independent experiments.

[0047] FIG. 6 is a graph showing the effect of different ASOs in different concentrations on the aberrantly spliced CFTR transcripts in FRT 3849 mut cells following a 24-hour treatment with the indicated ASO at the indicated concentration, RNA was extracted and the levels of aberrantly spliced CFTR transcripts were measured by qRT-PCR. The values shown are the average fold change relative to cells treated with control ASO (mean.+-.s.e.m.). Values were normalized against transcripts of HPRT gene.

[0048] FIGS. 7A-7B are micrographs of western blot analyses showing the effect of different ASOs on the formation of full length mature CFTR protein. (7A) FRT 3849 mut cells were transfected with the indicated ASO. (7B) HEK 293T cells transiently expressing the CFTR cDNA mutated with the 3849 +10 Kb C-to-T mutation and containing the flanking intronic regions were transfected with the indicated ASO. The M3A7 antibody recognizes the C terminal of the protein allowing identification of only full length CFTR proteins.

[0049] FIG. 8A is a graph showing a representative Fluorescent Imaging Plate Reader (FLIPR) trace demonstrating CFTR activation induced by the effect of ASO SPL84-17 in FRT 3849 mut cells.

[0050] FIG. 8B is a vertical bar graph showing the average effect of certain ASOs on CFTR function. The activity of the CFTR channel was analyzed using the FLIPR assay in FRT 3849 mut cells following transfection with the indicated ASO (10 nM). mean.+-.s.e.m.

[0051] FIG. 9A includes curves showing the effect of ASOs on CFTR activation in primary Human Nasal Epithelial (HNE) cells from the heterozygous CF patient with the genotype 3849 +10 Kb C-to-T/F508del. Representative traces of electrophysiological responses in Ussing chamber following free uptake of the indicated ASO.

[0052] FIG. 9B is a scatter dot plot of absolute values of .DELTA.I.sub.SCCFTRinh172(.mu.A/cm.sup.2) from Ussing chamber following free uptake of the indicated ASO in the same HNE cells as in FIG. 9A. The grey thick horizontal line is marking the median. .DELTA.I.sub.SCCFTRinh172 was calculated for: 4 filters treated with SPL84-22, SPL84-23 and SPL84-17 derived from 2 samples obtained from the patient, 2 filters treated with SPL84-2 and one filter treated with SPL84-25 (marked with *). The horizontal dashed line indicates 50% of the level of mean .DELTA.I.sub.SCCFTRinh172 in HNE cultures from healthy WT/WT individuals.

[0053] FIG. 10A includes curves showing the effect of ASO on CFTR activation in primary HNE cells from a patient homozygote for the 3849 +10 Kb C-to-T mutation. Representative traces of electrophysiological responses in Ussing chamber following treatment with the indicated ASOs.

[0054] FIG. 10B is a scatter dot plot of absolute values of .DELTA.I.sub.SCCFTRinh172(.mu.A/cm.sup.2) from Ussing chamber following free uptake of the indicated ASO in the same HNE cells as in FIG. 10A. The grey thick horizontal line is marking the median. .DELTA.I.sub.SCCFTRinh172 was calculated for: 2 filters, except for one filter treated with SPL84-2 (marked with *). The horizontal dashed line indicates the level of mean .DELTA.I.sub.SCCFTRinh172 in HNE cultures from healthy WT/WT individuals.

[0055] FIG. 11 is a vertical bar graph showing the summary of activation of CFTR in heterozygote patients. Mean(.+-.SEM) values of % of WT (.DELTA.I.sub.SCCFTRinh172-Patient*100/Average.DELTA..sub.SCCFTRinh172-WT- ) were calculated from median values of .DELTA.I.sub.SCCFTRinh172 per patient. The level of WT was set according to the mean .DELTA.I.sub.SCFSK/I in HNE cultures from healthy WT/WT individuals. The values are calculated from 9 filters treated with SPL84-17 and SPL84-22 derived from 3 patients, 24 filters treated with SPL84-23 derived from 5 patients, 5 filters treated with SPL84-2 derived from 2 patients and 1 filter treated with SPL84-25 derived from 1 patient.

[0056] FIGS. 12A-12B include a vertical bar graph and a micrograph of gel electrophoresis showing the effect of ASO SPL84-23 on the splicing pattern of 3849 +10 kb C>T mutation. HNE cells from patients homozygous (N=1) or heterozygous (N=4) for the 3849 +10 kb C-to-T mutation were treated with 200 nM SPL84-23. RNA was extracted and the levels of aberrantly and correctly spliced CFTR transcripts were measured. FIG. 12A shows qRT-PCR analysis for the effect of SPL84-23 on aberrantly spliced CFTR transcripts. The values shown are the average fold change (mean.+-.SEM) relative to cells treated with control ASO. Values were normalized against transcripts of GUSb gene. Statistical analysis was performed using student's t-test (1 tail, paired). ***p<0.001. FIG. 12B shows RT-PCR on the homozygous samples in agarose gels.

[0057] FIG. 13 is a graph showing the effect of chemical modifications on ASO SPL84-23 on the splicing pattern of 3849 +10 kb C>T mutation. Scatter dot plot of absolute values of .DELTA.I.sub.SCCFTRinh172(.mu.A/cm.sup.2). The horizontal lines are marking the medians. .DELTA.I.sub.SCCFTRinh172 was calculated for cells treated with the indicated concentrations of ASO modified with the 2'OMP or 2'MOE. The horizontal dashed line indicates the level of mean .DELTA.I.sub.SCCFTRinh172 in HNE cultures sampled from healthy WT/WT individuals.

[0058] FIG. 14 is a vertical bar graph showing optimization of the ASO length on aberrantly spliced variants of CFTR transcripts. Short versions of AS084-23 were screened for their effect on splicing by free uptake on primary patient HNE cells (SPL84-23-1-SPL84-23-9). On average in the three 3849 heterozygote patients analyzed, the effect of SPL84-23-1 (19 mer) was comparable to SPL84-23.

[0059] FIGS. 15A-15B are graphs showing optimization of the ASO length. Primary HNE cells were obtained from an heterozygous patient (3849/F508del). SPL84-23-1 (19 mer) has a similar effect on the CFTR function as the longer SPL84-23 ASO in primary HNE cells. (15A) represents absolute values of .DELTA.I.sub.SCCFTRinh172(.mu.A/cm.sup.2), and (15B) represents the ratio compared to the WT (% of WT (I.sub.SCCFTRinh172)).

[0060] FIGS. 16A-16B are graphs showing optimization of the ASO length. Primary HBE cells were obtained from an heterozygous patient (3849/F508del). SPL84-23-1 (19 mer) has a similar effect on the CFTR function as the longer SPL84-23 ASO in primary HNE cells. (16A) represents absolute values of .DELTA.I.sub.SCCFTRinh172(.mu.A/cm.sup.2), and (16B) represents the ratio compared to the WT (% of WT (I.sub.SCCFTRinh172)).

DETAILED DESCRIPTION

[0061] In some embodiments, there is provided a synthetic oligonucleotide molecule consisting of 18-21 consecutive bases having at least 80% complementarity to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation, and characterized by at least partly suppressing the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, increasing the percentage of correctly spliced mature CFTR mRNA by at least about 10%; and decreasing the level of aberrantly spliced mature CFTR mRNA by at least about 20%.

[0062] In some embodiments, there is provided a method for treating CF in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the synthetic oligonucleotide of the invention, thereby treating CF in the subject.

[0063] In some embodiments, the treating comprises: suppressing the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, increasing the percentage of correctly spliced mature CFTR mRNA by at least about 10%, decreasing the level of aberrantly spliced mature CFTR mRNA by at least about 20%, or any combination thereof.

[0064] The present invention provides oligonucleotides and compositions comprising same, capable of binding to a CFTR pre-mRNA, thereby modulating splicing and restoring the function of the CFTR gene product. The present invention thus identifies sequences within the CFTR pre-mRNA which are targeted in order to modulate the splicing cascade of the CFTR pre-mRNA. Modulating CFTR pre-mRNA splicing, as demonstrated in the present invention, can avoid improper recognition of intron sequences as exons. As a result of the modulation of splicing, a functional CFTR protein is produced by an otherwise aberrant CFTR allele.

[0065] In some embodiments, the herein disclosed oligonucleotide is a synthetic oligonucleotide.

[0066] The present invention stems in part from the finding that artificial "anti-sense" polynucleotide molecules are able to target and bind predetermined sequences at the pre-mRNA molecule of the CFTR gene, and that the binding modulates the splicing of the pre-mRNA molecule into mature mRNA, which subsequently translates into a functional CFTR protein. The targets within a CFTR pre-mRNA molecule are those discovered to be involved in splicing, either indirectly, by affecting the splicing of adjacent as well as remote sequences, or directly, by affecting their own splicing.

[0067] The present invention provides, in one aspect, a synthetic oligonucleotide molecule, consisting of 17-21 consecutive bases that are complementary to a pre-mRNA transcript of a CFTR gene, wherein the synthetic oligonucleotide molecule at least partly suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, increases the percentage of correctly spliced mature CFTR mRNA by at least about 10%; and decreases the level of aberrantly spliced mature CFTR mRNA by at least about 20%.

[0068] In another aspect, the present invention provides a synthetic oligonucleotide molecule consisting of 17-21 consecutive bases that are complementary to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation, wherein the synthetic oligonucleotide molecule at least partly suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, decreases the level of aberrantly spliced mature CFTR mRNA by at least about 20%.

[0069] In some embodiments, the oligonucleotide increases the percentage of correctly spliced mature CFTR mRNA by at least about 12%. In some embodiments, the oligonucleotide increases the percentage of correctly spliced mature CFTR mRNA by at least about 10%.

[0070] The present invention provides, in additional aspect, a synthetic oligonucleotide molecule, consisting of 17-21 consecutive bases that are complementary to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation, wherein the synthetic oligonucleotide molecule at least partly suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, increases the percentage of correctly spliced mature CFTR mRNA by at least about 10%; and decreases the level of aberrantly spliced mature CFTR mRNA by at least about 20%, wherein the oligonucleotide comprises a 2'-O-methyl-phosphorothioate backbone and/or 2'-Methoxy Ethyl (2'MOE) backbone. The phrase "suppress intron 22 cryptic exon inclusion" as used herein refers to lowering the occurrence of the addition of 84 nucleotides (SEQ ID NO: 35) found within intron 22 of the CFTR gene to the mature CFTR mRNA.

[0071] The phrase "increases the percentage of correctly spliced mature CFTR mRNA" as used herein refers to the percentage of correctly spliced mature CFTR mRNA compared to the 100% of correctly spliced mature CFTR mRNA found in a healthy cell or subject not having a mutation in either alleles of the CFTR gene. For example, an increase from 1% before treatment by the ASOs provided by the present invention to 11% after the treatment by the ASOs provided by the present invention is considered an increase of 10%. An increase from 10% before treatment by the ASOs provided by the present invention to 11% after the treatment by the ASOs provided by the present invention is considered an increase of 1%.

[0072] In certain embodiments, the CFTR transcript comprises a mutation that increases inclusion of an intron 22 cryptic exon. In certain embodiments, the mutation is a 3849 +10 Kb C to T mutation. In some embodiments, the intron 22 cryptic exon comprises the sequence of SEQ ID NO: 35 or a fragment thereof.

[0073] In certain embodiments, the oligonucleotide molecule is complementary to a nucleotide sequence within SEQ ID NO: 37. In some embodiments, the oligonucleotide molecule is complementary to a nucleotide sequence not more than 1000, 900, 800, 700, 600, 500, 400, 300, 200 or 100 bases upstream of a mutation that increase inclusion of an intron 22 cryptic exon. Each possibility represents a separate embodiment of the invention. In some embodiments, the oligonucleotide molecule is complementary to a nucleotide sequence not more than 1000, 900, 800, 700, 600, 500, 400, 300, 200 or 100 bases downstream of a mutation that increase inclusion of an intron 22 cryptic exon. Each possibility represents a separate embodiment of the invention.

[0074] In some embodiments, the oligonucleotide has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementarity to a nucleotide sequence within SEQ ID NO: 37.

[0075] In certain embodiments, the oligonucleotide molecule is complementary to a nucleotide sequence corresponding to pre-mRNA molecule comprising a sequence about 100 base pairs before the intron 22 cryptic exon to about 100 base pairs after the intron 22 cryptic exon transcribed from a CFTR gene having a 3849 +10 Kb C-to-T mutation. In certain embodiments, the oligonucleotide molecule is complementary to a nucleotide sequence within SEQ ID NO: 37.

[0076] The terms "complementary" or "complementarity" refer to the ability of nucleic acids, e.g., oligonucleotide, polynucleotide, etc., to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated.

[0077] In certain embodiments, the oligonucleotide molecule increases the percentage of correctly spliced mature CFTR mRNA by about 20%. In certain embodiments, the oligonucleotide molecule increases the percentage of correctly spliced mature CFTR mRNA by about 30%. In certain embodiments, the oligonucleotide molecule increases the percentage of correctly spliced mature CFTR mRNA by about 40%. In certain embodiments, the oligonucleotide molecule increases the percentage of correctly spliced mature CFTR mRNA by about 50%. In certain embodiments, the oligonucleotide molecule increases the percentage of correctly spliced mature CFTR mRNA by about 60%.

[0078] The phrase "increases the level of correctly spliced mature CFTR mRNA" as used herein refers to the increase in the level of correctly spliced mature CFTR mRNA after treatment by the ASOs provided by the present invention compared to the level before treatment or after mock-treatment. In certain embodiments, the increase in the level of correctly spliced mature CFTR mRNA is compared to mock-treatment by a control ASO. In certain embodiments, the control ASO consists of the nucleotide sequence in SEQ ID NO: 33.

[0079] In certain embodiments, the oligonucleotide molecule decreases the level of aberrantly spliced mature CFTR mRNA by about 30%. In certain embodiments, the oligonucleotide molecule decreases the level of aberrantly spliced mature CFTR mRNA by about 40%. In certain embodiments, the oligonucleotide molecule decreases the level of aberrantly spliced mature CFTR mRNA by about 50%. In certain embodiments, the oligonucleotide molecule decreases the level of aberrantly spliced mature CFTR mRNA by about 60%. In certain embodiments, the oligonucleotide molecule decreases the level of aberrantly spliced mature CFTR mRNA by about 70%. In certain embodiments, the oligonucleotide molecule decreases the level of aberrantly spliced mature CFTR mRNA by about 80%.

[0080] The phrase "decreases the level of aberrantly spliced mature CFTR mRNA" as used herein refers to the percentage decrease in the level of aberrantly spliced mature CFTR mRNA after treatment by the ASOs provided by the present invention compared to the level before treatment or after mock-treatment. In certain embodiments, the decrease in the level of aberrantly spliced mature CFTR mRNA is compared to mock-treatment by a control ASO. In certain embodiments, the control ASO consists of the nucleotide sequence in SEQ ID NO: 33. The phrase "increases the percentage of correctly spliced mature CFTR mRNA" as used herein refers to the percent increase in the ratio of correctly spliced to aberrantly spliced CFTR mRNA compared to untreated or mock-treatment.

[0081] In certain embodiments, the oligonucleotide molecule consists of 18 or 19 consecutive nucleotide bases. In certain embodiments, the oligonucleotide molecule consists of 18 consecutive nucleotide bases. In certain embodiments, the oligonucleotide molecule consists of 19 consecutive nucleotide bases. In certain embodiments, the oligonucleotide molecule consists of 20 consecutive nucleotide bases. In certain embodiments, the oligonucleotide molecule consists of 21 consecutive nucleotide bases.

[0082] In certain embodiments, the base is selected from the group consisting of adenine, guanine, cytosine, uracil and optionally thymine. In other certain embodiments, the base is selected from the group consisting of adenine, guanine, cytosine, and uracil. Each possibility represents a separate embodiment of the present invention.

[0083] In some embodiments, the oligonucleotide is chemically modified. In some embodiments, the chemical modification is a modification of a backbone of the oligonucleotide. In some embodiments, the chemical modification is a modification of a sugar of the oligonucleotide. In some embodiments, the chemical modification is a modification of a nucleobase of the oligonucleotide. In some embodiments, the chemical modification increases stability of the oligonucleotide in a cell. In some embodiments, the chemical modification increases stability of the oligonucleotide in vivo. In some embodiments, the chemical modification increases the oligonucleotide's ability to modulate splicing. In some embodiments, the chemical modification increases the oligonucleotide's ability to induce suppress the inclusion of intron 22 cryptic exon. In some embodiments, the chemical modification increases the half-life of the oligonucleotide. In some embodiments, the chemical modification inhibits polymerase extension from the 3' end of the oligonucleotide. In some embodiments, the chemical modification inhibits recognition of the oligonucleotide by a polymerase. In some embodiments, the chemical modification inhibits double-strand trigged degradation. In some embodiments, the chemically modified oligonucleotide does not trigger nucleic acid double-stranded degradation upon binding a CFTR pre-mRNA. In some embodiments, the chemical modification inhibits RISC-mediated degradation. In some embodiments, the chemical modification inhibits RISC-mediated degradation or any parallel nucleic acid degradation pathway.

[0084] In some embodiments, the oligonucleotide is devoid of a labeling moiety. In some embodiments, the oligonucleotide is not labeled. In some embodiments, the oligonucleotide does not emit a detectable signal or does not comprise moieties capable of being recognized so as to enable nucleic acid detection (e.g., digoxigenin and fluorescently labeled anti-DIG antibody). In some embodiments, a detectable signal comprises a dye or an emitting energy which provides detection of a compound, e.g., a polynucleotide, in vivo, ex vivo, or in vitro. In some embodiments, a detectable signal comprises: a fluorescent signal, a chromatic signal, or a radioactive signal.

[0085] In some embodiments, the oligonucleotide is devoid of radioactive nucleobase(s); digoxigenin, streptavidin, biotin, a fluorophore, hapten label, CLICK label, amine label, or thiol label.

[0086] In certain embodiments, the consecutive nucleotide bases are linked by a backbone selected from the group consisting of a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, an alternating locked nucleic acid backbone, constrained ethyl backbone, and a phosphorothioate backbone. Each possibility represents a separate embodiment of the invention.

[0087] According to some embodiments, the oligonucleotide comprises a 2'-O-methyl-phosphorothioate backbone. According to other embodiments, the oligonucleotide comprises a 2'-Methoxy Ethyl (2'MOE) modification.

[0088] In some embodiments, the oligonucleotide comprises a 2'-O-methyl-phosphorothioate modification. In some embodiments, the oligonucleotide comprises a 2'MOE modification. In some embodiments, the modification is throughout the molecule. In some embodiments, the modification is at the 3' end of the molecule. In some embodiments, the modification is at the 5' end of the molecule. In some embodiments, the molecule comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 modifications. Each possibility represents a separate embodiment of the invention.

[0089] According to some embodiments, the oligonucleotide modification is capable of completely restoring CFTR function compared to non-mutated CFTR. According to certain embodiments, the oligonucleotide modification is capable of restoring at least 70%, 65%, 80%, 85%, 90%, or 95% of CFTR function compared to non-mutated CFTR. Each possibility represents a separate embodiment of the invention.

[0090] In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 1. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 2. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 3. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 4. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 5. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 6. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 7. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 8. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 9. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 10. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 11. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 12. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 13. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 14. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 15. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 16. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 17. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 18. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 19. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 20. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 21. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 22. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 23. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 24. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 25. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 40. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 41. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 42. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 43. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 44. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 45. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 46. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 47. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 48. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 49. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 50. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 51. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 52. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 53. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 54. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 55. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 56. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 57. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 58. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 59. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 60. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 61. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 62. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 63. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 64. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 65. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 66. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 67. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 68. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 69. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 70. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 71.

[0091] In certain embodiments, the oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID NO: 1 to SEQ ID NO: 5, and SEQ ID NO: 41. In certain embodiments, the oligonucleotide molecule consists of a nucleotide sequence set forth in SEQ ID NO: 1, in SEQ ID NO: 2, SEQ ID NO: 3, in SEQ ID NO: 4, in SEQ ID NO: 5, or in SEQ ID NO: 41. Each possibility represents a separate embodiment of the invention.

[0092] In some embodiments, the oligonucleotide is specific to a CFTR pre-mRNA. As used herein, the term "specific" refers to both base pair specificity and also gene specificity. In some embodiments, the oligonucleotide is specific to the CFTR gene. In some embodiments, the oligonucleotide is specific to an intronic sequence of CFTR. In some embodiments, the oligonucleotide is specific to a cryptic exon in CFTR. In some embodiments, the oligonucleotide is specific to a nucleic acid sequence of intron 22 of CFTR. In some embodiments, the nucleic acid sequence of intron 22 is intron 22 cryptic exon of CFTR.

[0093] In some embodiments, the oligonucleotide binds the CFTR pre-mRNA with perfect complementarity. In some embodiments, the oligonucleotide does not bind any gene other than CFTR with perfect complementarity. In some embodiments, the oligonucleotide does not bind any gene other than CFTR with a complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%. Each possibility represents a separate embodiment of the invention. In some embodiments, the oligonucleotide does not bind any gene other than CFTR with a complementarity of greater than 90%. In some embodiments, the oligonucleotide binds SEQ ID NO: 37 with perfect complementarity. In some embodiments, the oligonucleotide does not bind any sequence other than SEQ ID NO: 37 with perfect complementarity. In some embodiments, the oligonucleotide does not bind any sequence other than SEQ ID NO: 37 with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%. Each possibility represents a separate embodiment of the invention. In some embodiments, the oligonucleotide does not bind any sequence other than SEQ ID NO: 37 with a complementarity of greater than 90%. In some embodiments, the oligonucleotide does not bind with perfect complementarity to anywhere in the genome of a cell other than within CFTR. In some embodiments, the oligonucleotide does not bind with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100% to anywhere in the genome of a cell other than within CFTR. Each possibility represents a separate embodiment of the invention. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammal is a human.

[0094] In some embodiments, the oligonucleotide modulates expression of CFTR. In some embodiments, the oligonucleotide modulates splicing of CFTR. In some embodiments, the oligonucleotide modulates splicing, e.g., suppresses inclusion, of intron 22 cryptic exon of CFTR. In some embodiments, the oligonucleotide does not cause an off-target effect. In some embodiments, off-target is a target other than CFTR. In some embodiments, off-target is a target other than splicing, e.g., suppressing the inclusion, of intron 22 cryptic exon of CFTR. In some embodiments, the oligonucleotide does not substantially or significantly modulate expression of a gene other than CFTR. In some embodiments, the oligonucleotide does not substantially or significantly modulate splicing of a gene other than CFTR. In some embodiments, the oligonucleotide does not substantially or significantly modulate splicing of an exon other than intron 22 cryptic exon of CFTR. In some embodiments, substantial modulation of expression is a change in expression of at least 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50%. Each possibility represents a separate embodiment of the invention. In some embodiments, substantial modulation of expression is a change in expression of at least 20%.

[0095] In some embodiments, an oligonucleotide as disclosed herein targets, complements, suppresses, or any combination thereof, the inclusion of intron 22 cryptic exon to the mature CFTR mRNA transcribed from a mutated allele of the CFTR gene. In some embodiments, an oligonucleotide as disclosed herein does not target, complement, suppresses, or any combination thereof, splicing modulation of CFTR pre-mRNA transcribed from a wild type allele of the CFTR gene. In some an oligonucleotide as disclosed herein targets, complements, suppresses, or any combination thereof at least 2 fold more efficiently, at least 3 fold more efficiently, at least 5 fold more efficiently, at least 7 fold more efficiently, at least 10 fold more efficiently, at least 20 fold more efficiently, at least 50 fold more efficiently, or at least 100 fold more efficiently, the inclusion of intron 22 cryptic exon into the mature CFTR mRNA transcribed from a mutated allele of the CFTR gene compared to the wild type allele of the CFTR gene, or any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some an oligonucleotide as disclosed herein targets, complements, suppresses, or any combination thereof 2-10 fold more efficiently, 3-50 fold more efficiently, 5-100 fold more efficiently, 7-20 fold more efficiently, 2-40 fold more efficiently, 2-25 fold more efficiently, 50-150 fold more efficiently, or 2-100 fold more efficiently, the inclusion of intron 22 cryptic exon into the mature CFTR mRNA transcribed from a mutated allele of the CFTR gene compared to the wild type allele of the CFTR gene. Each possibility represents a separate embodiment of the invention.

[0096] In some embodiments, an oligonucleotide of the invention fully complements with a mutated allele of the CFTR gene. As used herein, the term "fully complements" refers to 100% hybridization, meaning the mutated CFTR allele and the oligonucleotide represent a reversed and complementary nucleic acid sequence versions of one another, as would be apparent to one of ordinary skill in the art of molecular biology. In some embodiments, an oligonucleotide of the invention partially complements with the wild type allele of the CFTR gene. As used herein, the term "partially" refers to any value or range lower than 100%. In some embodiments, the oligonucleotide of the invention and the wild type CFTR allele represent a reversed and complementary nucleic acid sequence version of one another which differ by at least one nucleotide, e.g., comprising at least one mismatched nucleotide.

[0097] In some embodiments, the oligonucleotide of the invention, and method of using same, provide the exclusion of a cryptic exon from the mature CFTR mRNA transcribed from a mutated allele of the CFTR gene. In some embodiments, the mature mRNA transcribed from the wild type allele is devoid of the cryptic exon.

[0098] In some embodiments, the cryptic exon is intron 22 cryptic exon. In some embodiments, the cryptic exon is 80-90 bases long.

[0099] In some embodiments, the oligonucleotide comprises an active fragment of any one of SEQ ID Nos.: 1-25, and 41-44.

[0100] In some embodiments, the oligonucleotide comprises an active fragment of any one of SEQ ID Nos.: 1-5, and 41.

[0101] As used herein, the term "active fragment" refers to a fragment that is 100% identical to a contiguous portion of the full nucleotide sequence of the oligonucleotide, providing that at least: 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the original oligonucleotide sequence is retained, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.

[0102] In some embodiments, the subject is heterozygous to the 3849 +10 Kb C-to-T mutation. In some embodiments, a subject treated according to the method of the invention, comprises or is characterized by having a mixture of a wild type full-length and fully functional CFTR protein encoded from the wild type allele and a full-length and fully functional CFTR protein encoded from the pre-mRNA from which the inclusion of intron 22 cryptic exon inclusion was suppressed using the oligonucleotide of the invention. In some embodiments, the oligonucleotide of the invention does not reduce the level of the wild type full-length and fully functional CFTR protein in a subject, e.g., heterozygous to the mutation disclosed hereinabove.

[0103] The present invention further provides, in another aspect, a pharmaceutical composition comprising a synthetic oligonucleotide molecule as described above, and a pharmaceutically acceptable carrier.

[0104] The term "pharmaceutically acceptable carrier" as used herein refers to any of the standard pharmaceutical carriers known in the field such as sterile solutions, tablets, coated tablets, and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acids, or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Examples of pharmaceutically acceptable carriers include, but are not limited to, the following: water, saline, buffers, inert, nontoxic solids (e.g., mannitol, talc). Compositions comprising such carriers are formulated by well-known conventional methods. Depending on the intended mode of administration and the intended use, the compositions may be in the form of solid, semi-solid, or liquid dosage forms, such, for example, as powders, granules, crystals, liquids, suspensions, liposomes, nano-particles, nano-emulsions, pastes, creams, salves, etc., and may be in unit-dosage forms suitable for administration of relatively precise dosages.

[0105] In certain embodiments, the pharmaceutical composition is formulated for oral, administration. In certain embodiments, the pharmaceutical composition is formulated for nasal administration. In certain embodiments, the pharmaceutical composition is formulated for administration by inhalation. In certain embodiments, the pharmaceutical composition is formulated for abdominal administration. In certain embodiments, the pharmaceutical composition is formulated subcutaneous administration. In certain embodiments, the pharmaceutical composition is formulated for intra-peritoneal administration. In certain embodiments, the pharmaceutical composition is formulated for intravenous administration.

[0106] In some embodiments, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject. In some embodiments, the subject is a human subject. It will be understood by a skilled artisan that a pharmaceutical composition intended to administration to a subject should not have off-target effects, i.e. effects other than the intended therapeutic ones. In some embodiments, the pharmaceutical composition is devoid of a substantial effect on a gene other than CFTR. In some embodiments, the pharmaceutical composition is devoid of any substantial effect other than suppressing the inclusion of intron 22 cryptic exon to the mature CFTR. In some embodiments, a substantial effect is one with a phenotypic result. In some embodiments, a substantial effect is a deleterious effect. In some embodiments, deleterious is with respect to the health and/or wellbeing of the subject.

[0107] In some embodiments, the composition administered by inhalation. In some embodiments, the composition is an inhalation composition. in some embodiments, the composition is a pharmaceutical composition.

[0108] Being a long-known and well-studied disease, certain drugs and agents are known in the art for the treatment of Cystic Fibrosis patients. Administrating a synthetic polynucleotide molecule according to the present invention with one or more of these drugs may be beneficial in achieving significant therapeutic results.

[0109] In certain embodiments, the pharmaceutical composition further comprises one or more CFTR modifiers.

[0110] In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of one or more CFTR modifiers.

[0111] In some embodiments, the CFTR modifier increases the duration of the CFTR gate being open, chloride flow through the CFTR gate, CFTR protein proper folding, the number of CFTR anchored to the cell membrane, or any combination thereof. Each possibility represents a separate embodiment of the invention.

[0112] In some embodiments, the modifier is selected from: potentiator, corrector, and amplifier.

[0113] As used herein, the term "potentiator" refers to any agent that increases the probability that a defective CFTR will be open and therefore allows chloride ions to pass through the channel pore.

[0114] As used herein, the term "corrector" refers to any agent that assists in proper CFTR channel folding so as to enable its trafficking to the cell membrane.

[0115] As used herein, the term "amplifier" refers to any agent that induces a cell to increase its CFTR protein production rates or yields, therefore resulting in an increased amount of the CFTR protein.

[0116] In certain embodiments, the CFTR modifier is selected from: a CFTR-splicing-modulating agent, Translational Read-Through agent, a CFTR amplifier, a CFTR potentiator and a CFTR corrector. In certain embodiments, the CFTR-splicing-modulating agent is a different synthetic oligonucleotide molecule capable of suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA; the Translational Read-Through agent is selected from the group consisting of 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (Ataluren) and ELX-02; the CFTR amplifier is PTI-428; the CFTR potentiator is selected from the group consisting of N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carbox- amide (Ivacaftor), QBW251, PTI-808 and VX-561 (deuterated ivacaftor); the CFTR potentiator is N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carbox- amide (Ivacaftor); or the CFTR corrector is selected from the group consisting of 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl)cyclopropanecarbonyl]amino}-3- -methylpyridin-2-yl}benzoic acid (Lumacaftor), 1-(2,2-difluoro-1,3-benzodioxol-5-yl)-.about.{N}-[1-[(2-{R})-2,3-dihydrox- ypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)indol-5-yl]cyclopropane- -1-carboxamide (Tezacaftor), VX-659, VX-445, VX-152 and VX-440, GLPG2222, FDL169 and PTI-801.

[0117] In certain embodiments, the pharmaceutical composition comprises at least about 1 nM of the synthetic oligonucleotide molecule. In certain embodiments, the pharmaceutical composition comprises at least about 2.5 nM of the synthetic oligonucleotide molecule. In certain embodiments, the pharmaceutical composition comprises at least about 10 nM of the synthetic oligonucleotide molecule. In certain embodiments, the pharmaceutical composition comprises 2.5 nM to 10 nM of the synthetic oligonucleotide molecule.

[0118] In certain embodiments, the pharmaceutical composition comprises 1 nM to 1 .mu.M of the synthetic oligonucleotide molecule. In certain embodiments, the pharmaceutical composition comprises 1 nM to 0.5 .mu.M of the synthetic oligonucleotide molecule. In certain embodiments, the pharmaceutical composition comprises 1 nM to 100 nM of the synthetic oligonucleotide molecule.

[0119] The present invention further provides, in another aspect, a synthetic oligonucleotide molecule as described above, or a pharmaceutical composition as described above, for use in the modulation of splicing of a CFTR pre-mRNA transcribed from a CFTR gene having a 3849 +10 Kb C-to-T mutation.

[0120] The phrase "modulation of splicing" as used herein refers to affecting a change in the level of any RNA or mRNA variant produced by the CFTR native pre-mRNA. For example, modulation may mean e.g. causing an increase or decrease in the level of abnormal CFTR mRNA, causing an increase or decrease in the level of normal, full-length CFTR mRNA, and/or causing an increase or decrease in the level of abnormal CFTR RNA or mRNA comprising a premature termination codon (non-sense codon). It is therefore evident that any change in ratio between certain CFTR splicing variants is also considered to be the result of splicing modulation. Each possibility represents a separate embodiment of the present invention. In certain embodiments, modulation means increasing the level of normal, full-length CFTR mRNA and/or decreasing the level of abnormal CFTR mRNA.

[0121] In certain embodiments, the use is for reducing the level of an mRNA molecule comprising the intron 22 cryptic exon. In certain embodiments, the use is for reducing the level of an mRNA molecule comprising the nucleotide sequence set forth in SEQ ID NO: 36. In certain embodiments, the use is for increasing the level of normal, full-length CFTR mRNA. In certain embodiments, the use is for increasing the level of an mRNA molecule comprising the nucleotide sequence set forth in SEQ ID NO: 34. In certain embodiments, the use is for correcting or improving chloride transport through the CFTR channel. In certain embodiments, the use is for increasing the production of functional CFTR protein. Each possibility represents a separate embodiment of the present invention.

[0122] The present invention further provides, in another aspect, a synthetic oligonucleotide molecule as described above, or a pharmaceutical composition as described above, for use in a method for improving at least one clinical parameter of Cystic Fibrosis.

[0123] The invention further provides, in another aspect, a method for improving at least one clinical parameter of Cystic Fibrosis in a patient in need thereof, comprising the step of administering a therapeutically effective amount of a synthetic polynucleotide molecule as described above to the patient.

[0124] The term "a therapeutically effective amount" as used herein refers to an amount necessary for improving at least one clinical parameter of Cystic Fibrosis or reducing the severity of at least one clinical parameter of Cystic Fibrosis in a patient. The therapeutically effective amounts may differ according to the patient's status, the synthetic polynucleotide molecule's administration route, excipient usage and co-usage of other active agents.

[0125] In certain embodiments, the clinical parameter is selected from the group consisting of lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, and the need for antibiotic therapy for sinopulmonary signs or symptoms. Each possibility represents a separate embodiment of the invention.

[0126] As used herein, the terms "treatment" or "treating" of a disease, disorder, or condition encompasses alleviation of at least one symptom thereof, a reduction in the severity thereof, or inhibition of the progression thereof. Treatment need not mean that the disease, disorder, or condition is totally cured. To be an effective treatment, a useful composition herein needs only to reduce the severity of a disease, disorder, or condition, reduce the severity of symptoms associated therewith, or provide improvement to a patient or subject's quality of life.

[0127] As used herein, the term "condition" includes anatomic and physiological deviations from the normal that constitute an impairment of the normal state of the living animal or one of its parts, that interrupts or modifies the performance of the bodily functions.

[0128] As used herein, the terms "subject" or "individual" or "animal" or "patient" or "mammal," refers to any subject, particularly a mammalian subject, for whom therapy is desired, for example, a human.

[0129] Being a genetic disease, Cystic Fibrosis currently cannot yet be cured, but its clinical manifestations and/or symptoms can be treated by the oligonucleotides of the present invention, for a marked increase and/or improvement in a patient's clinical status and quality of life.

[0130] The term "improving" as used herein refers to a favorable change, i.e. an increase or a decrease of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% in a clinical parameter of Cystic Fibrosis.

[0131] Different routes of AOs delivery have been examined in animal models and applied in clinical trials, chosen primarily according to the target tissue. For example, 2OMP was administrated to DMD patients (PRO-051) by local intramuscular injection (van Deutekom et al., 2007), and by abdominal subcutaneous injections (Goemans et al., 2011). 2OMP was also administrated to a SMA mouse model by intracerebroventricular injection (Williams et al., 2009; Hua et al., 2010). PMO was administrated to a DMD mouse model by intramuscular injection (Gebski, Mann, Fletcher, & Wilton, 2003), and repeated weakly intraperitoneal injections (Goyenvalle et al., 2010). PMO was also administrated to a SMA mouse model by intracerebroventricular injection (Porensky et al., 2012), and to DMD patients (AVI-4658) by local intramuscular injection (Kinali et al., 2009), or intravenously administration (Cirak et al., 2011; Mendell et al., 2013).

[0132] In certain embodiments, the method further comprises administering at least one additional anti-Cystic-Fibrosis agent to the patient. In certain such embodiments, the additional anti-Cystic-Fibrosis agent is selected from the group consisting of a CFTR-splicing-modulating agent, a CFTR potentiator and a CFTR corrector. Each possibility represents a separate embodiment of the present invention. In certain embodiments, the administration of the therapeutically effective amount of a synthetic polynucleotide molecule of the present invention and the administration of the at least one additional anti-Cystic-Fibrosis agent are independently oral, nasal, aerosol, inhalational, abdominal, subcutaneous, intra-peritoneal or intravenous administration. Each possibility represents a separate embodiment of the present invention. It should be understood that the selection of an administration route depends on the nature of the therapeutic agent and the site of its intended effect, and thus certain agents may be administrated via the same or different administration routes.

[0133] In certain embodiments, the administration of the synthetic oligonucleotide molecule or of the pharmaceutical composition is oral, nasal, inhalational, abdominal, subcutaneous, intra-peritoneal or intravenous administration.

[0134] In certain embodiments, the synthetic oligonucleotide molecule is administered in a concentration of at least about 1 nM. In certain embodiments, the synthetic oligonucleotide molecule is administered in a concentration of at least about 2.5 nM. In certain embodiments, the synthetic oligonucleotide molecule is administered in a concentration of at least about 10 nM. In certain embodiments, the synthetic oligonucleotide molecule is administered in a concentration of 2.5 nM to 10 nM.

[0135] The present invention further provides, in another aspect, the use of a synthetic oligonucleotide molecule as described above, or of a pharmaceutical composition as described above, in preparing a medicament.

[0136] In certain embodiments, the medicament is for treating or ameliorating a symptom of Cystic Fibrosis. In some embodiments, the medicament improves at least one clinical parameter of Cystic Fibrosis. According to some embodiments, the clinical parameter is selected from the group consisting of lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, and the need for antibiotic therapy for sinopulmonary signs or symptoms. Each possibility represents a separate embodiment of the invention.

[0137] The present invention further provides, in another aspect, a kit comprising a synthetic oligonucleotide molecule as described above.

[0138] In certain embodiments, the kit further comprises an additional anti-Cystic-Fibrosis agent.

[0139] In certain embodiments, the synthetic oligonucleotide and the additional anti-Cystic-Fibrosis agent are comprised in one pharmaceutical composition. In certain embodiments, the synthetic oligonucleotide and the additional anti-Cystic-Fibrosis agent are comprised in different pharmaceutical compositions. In certain embodiments, the synthetic oligonucleotide and the additional anti-Cystic-Fibrosis agent are independently formulated for oral, nasal, inhalation, abdominal, subcutaneous, or intra-peritoneal administration. Each possibility represents a different embodiment of the invention.

[0140] In certain embodiments, the synthetic oligonucleotide is in a concentration of at least about 1 nM. In certain embodiments, the synthetic oligonucleotide is in a concentration of at least about 2.5 nM. In certain embodiments, the synthetic oligonucleotide is in a concentration of at least about 10 nM. In certain embodiments, the synthetic oligonucleotide molecule is in a concentration of 2.5 nM to 10 nM.

[0141] The present invention further provides, in another aspect, a synthetic oligonucleotide molecule, consisting of 18-50 consecutive bases that are complementary to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation and at least partly suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, comprising a nucleotide sequence set forth in one of SEQ ID NO: 1 to SEQ ID NO: 25, and SEQ ID NO: 41 to SEQ ID NO: 44.

[0142] The present invention further provides, in another aspect, a synthetic oligonucleotide molecule, consisting of 17-50 consecutive bases that are complementary to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation and at least partly suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, comprising a nucleotide sequence set forth in one of SEQ ID NO: 1 to SEQ ID NO: 25 and SEQ ID NO: 40 to SEQ ID NO: 71.

[0143] In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in one of SEQ ID NO: 1 to SEQ ID NO: 10. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in one of SEQ ID NO: 1 to SEQ ID NO: 5, and SEQ ID NO: 41. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 1, in SEQ ID NO: 3, in SEQ ID NO: 4, in SEQ ID NO: 5, or SEQ ID NO: 41. In certain embodiments, the oligonucleotide molecule comprises or consists of a nucleotide sequence set forth in SEQ ID NO: 7.

[0144] In certain embodiments, the oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID NO: 40 to SEQ ID NO: 71. In certain embodiments, the oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID NO: 40 to SEQ ID NO: 48. In certain embodiments, the oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID NO: 49 to SEQ ID NO: 53. In certain embodiments, the oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID NO: 54 to SEQ ID NO: 58. In certain embodiments, the oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID NO: 59 to SEQ ID NO: 63. In certain embodiments, the oligonucleotide molecule comprises a nucleotide sequence set forth in one of SEQ ID NO: 54 to SEQ ID NO: 71.

[0145] The present invention further provides, in another aspect, a synthetic oligonucleotide sequence consisting of 18-20 consecutive bases comprising the sequence GAUGGAAGA (SEQ ID NO: 38), wherein the synthetic oligonucleotide sequence is complementary to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation.

[0146] The present invention further provides, in another aspect, a synthetic oligonucleotide sequence consisting of 17-20 consecutive bases comprising the sequence GAUGGAAGA (SEQ ID NO: 38), wherein the synthetic oligonucleotide sequence is complementary to a pre-mRNA transcript of a CFTR gene having a 3849 +10 Kb C-to-T mutation.

[0147] In certain embodiments, the oligonucleotide sequence is complementary to a nucleotide sequence within SEQ ID NO: 37. In certain embodiments, the oligonucleotide sequence is selected from the group consisting of: SEQ ID Nos: 1, 2, 4 and 7. In certain embodiments, the synthetic oligonucleotide sequence comprises the sequence CAACAGAUGGAAGA (SEQ ID NO: 39). In certain embodiments, the sequence is selected from the group consisting of: SEQ ID Nos: 1, 2 and 4.

[0148] In one embodiment, the present invention provides combined preparations. In one embodiment, "a combined preparation" defines especially a "kit of parts" in the sense that the combination partners as defined above can be dosed independently or by use of different fixed combinations with distinguished amounts of the combination partners i.e., simultaneously, concurrently, separately or sequentially. In some embodiments, the parts of the kit of parts can then, e.g., be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts. The ratio of the total amounts of the combination partners, in some embodiments, can be administered in the combined preparation.

[0149] In some embodiments, the kit of the invention comprises: at least one oligonucleotide; and at least one of: at least one CFTR modifier; or at least one CF drug, wherein the oligonucleotide is selected from SEQ ID Nos.: 1-25, and 41-44, and wherein the CFTR modifier is selected from: CFTR potentiator, CFTR corrector, and CFTR amplifier.

[0150] In some embodiments, the CF drug is an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof.

[0151] Types and doses of CF drugs, such as an antibiotic, a bronchodilator, and a corticosteroid, would be apparent to one of ordinary skill in the art. Non-limiting examples of CF drugs, such as antibiotics include, but are not limited to, cloxacillin, dicloxacillin, cephalosporin, trimethoprim, sulfamethoxazole, erythromycin, amoxicillin, clavulanate, ampicillin, tetracycline, linezolid, tobramycin or aztreonam lysine, fluoroquinolone, gentamicin, and monobactam with antipseudomonal activity.

[0152] In some embodiments, the components of the kit disclosed above are sterile. As used herein, the term "sterile" refers to a state of being free from biological contaminants. Any method of sterilization is applicable and would be apparent to one of ordinary skill in the art.

[0153] In some embodiments, the components of the kit are packaged within a container.

[0154] In some embodiments, the container is made of a material selected from the group consisting of thin-walled film or plastic (transparent or opaque), paperboard-based, foil, rigid plastic, metal (e.g., aluminum), glass, etc.

[0155] In some embodiments, the content of the kit is packaged, as described below, to allow for storage of the components until they are needed.

[0156] In some embodiments, some or all components of the kit may be packaged in suitable packaging to maintain sterility.

[0157] In some embodiments, the components of the kit are stored in separate containers within the main kit containment element e.g., box or analogous structure, may or may not be an airtight container, e.g., to further preserve the sterility of some or all of the components of the kit.

[0158] In some embodiments, the instructions may be recorded on a suitable recording medium or substrate. For example, the instructions may be printed on a substrate, such as paper or plastic, etc.

[0159] In some embodiments, the instructions may be present in the kit as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or sub-packaging) etc. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, etc. In other embodiments, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source, e.g. via the internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions is recorded on a suitable substrate.

[0160] According to some embodiments, there is provided a method for producing a compound suitable for treating CF.

[0161] In some embodiments, the method comprises obtaining a compound that binds to intro 22 of the CFTR pre-mRNA. In some embodiments, the method comprises obtaining a compound that binds to SEQ ID NO: 37. In some embodiments, the method comprises assaying the inclusion of intron 22 cryptic exon in the mature CFTR mRNA in the presence of the obtained compound, and selecting at least one compound that suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA, thereby producing a compound suitable for treating CF.

[0162] In some embodiments, the compound is an oligonucleotide. In some embodiments, the oligonucleotide is an oligonucleotide as disclosed and as described herein.

[0163] Methods of assaying cryptic exon inclusion are common. Non-limiting examples of such methods include, but are not limited to, PCR, qPCR, gene sequencing, northern-blot, dot-blot, in situ hybridization, or others all of which would be apparent to one of ordinary skill in the art.

[0164] In the discussion unless otherwise stated, adjectives such as "substantially" and "about" modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word "or" in the specification and claims is considered to be the inclusive "or" rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.

[0165] It should be understood that the terms "a" and "an" as used above and elsewhere herein refer to "one or more" of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms "a," "an" and "at least one" are used interchangeably in this application.

[0166] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0167] In the description and claims of the present application, each of the verbs, "comprise", "include" and "have" and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb.

[0168] Other terms as used herein are meant to be defined by their well-known meanings in the art.

[0169] Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive.

[0170] Throughout this specification and claims, the word "comprise", or variations such as "comprises" or "comprising", indicate the inclusion of any recited integer or group of integers but not the exclusion of any other integer or group of integers.

[0171] As used herein, the term "consists essentially of", or variations such as "consist essentially of" or "consisting essentially of", as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition.

[0172] As used herein, the terms "comprises", "comprising", "containing", "having" and the like can mean "includes", "including", and the like; "consisting essentially of" or "consists essentially" likewise has the meaning ascribed in U.S. patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. In one embodiment, the terms "comprises," "comprising, "having" are/is interchangeable with "consisting".

[0173] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

[0174] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments unless the embodiment is inoperative without those elements.

[0175] The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". This term encompasses the terms "consisting of" and "consisting essentially of". As used herein, the singular form "a", "an", "the" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0176] The following examples are meant to be construed as non-limiting to the scope of the invention and are to serve merely as illustrative embodiments.

[0177] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

EXAMPLES

[0178] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include chemical, molecular, biochemical, and cell biology techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); The Organic Chemistry of Biological Pathways by John McMurry and Tadhg Begley (Roberts and Company, 2005); Organic Chemistry of Enzyme-Catalyzed Reactions by Richard Silverman (Academic Press, 2002); Organic Chemistry (6th Edition) by Leroy "Skip" G Wade; Organic Chemistry by T. W. Graham Solomons and, Craig Fryhle.

TABLE-US-00001 TABLE 1 Anti-Sense Oligonucleotides (ASOs). SEQ Length ID Nucleotide (nucle- Name NO: sequence 5'.fwdarw.3' otides) SPL84-23 1 CUGCAACAGAUGGAAGACUC 20 SPL84-22 2 CAACAGAUGGAAGACUCUU 19 SPL84-17 3 CUCCAGAAAUCAAGAUGAC 19 SPL84-25 4 UACUGCAACAGAUGGAAGA 19 SPL84-2 5 AUCAAGAUGACAAGUCAACU 20 SPL84-16 6 GUGGUCUCCAGAAAUCAAG 19 SPL84-21 7 GAUGGAAGACUCUUGUAAU 19 SPL84-1 8 CAAGAUGACAAGUCAACUGAA 21 SPL84-7 9 GAAAUCAAGAUGACAAGUCAAC 22 SPL84-19 10 ACCUUGUGGUCUCCAGAAA 19 SPL84-18 11 CCAGAAAUCAAGAUGACAAG 20 SPL84-13 12 CACCAUUUUAAUACUGCAACA 21 SPL84-24 13 UGGAAGACUCUUGUAAUUAUU 21 SPL84-3 14 GAUGACAAGUCAACUGAAAUU 21 SPL84-15 15 CUUUCAGGGUGUCUUACUC 19 SPL84-14 16 UCAGGGUGUCUUACUCACC 19 SPL84-20 17 AUUACCUUGUGGUCUCCAGA 20 SPL84-5 18 GACAAGUCAACUGAAAUUUAG 21 SPL84-8 19 CAACUGAAAUUUAGAUCCACA 21 SPL84-6 20 AGUCAACUGAAAUUUAGAUCC 21 SPL84-9 21 GUGUCUUACUCACCAUUUUAA 21 SPL84-10 22 GUGUCUUACUCACCAUUU 18 SPL84-12 23 CUCACCAUUUUAAUACUGC 19 SPL84-4 24 GACAAGUCAACUGAAAUU 18 SPL84-11 25 CUUACUCACCAUUUUAAUAC 20 5' Kole 26 GUCUUACUCACCAUUUUA 18 3' Kole 27 CAAGUCAACUGAAAUUUAG 19 stop Kole 28 CUUGUAAUUAUUUUUACAU 19 ASO84-1 29 AAAUCAAGAUGACAAGUCAACUGAA 25 ASO84-2 30 CUUGUGGUCUCCAGAAAUCAAGAUG 25 ASO84-3 31 AACAGAUGGAAGACUCUUGUAAUUA 25 ASO84-3 32 UCAGGGUGUCUUACUCACCAUUUUA 25 Control 33 GACCACUUGCCACCCAUC 18 SPL84-23-1 40 CUGCAACAGAUGGAAGACU 19 SPL84-23-2 41 UGCAACAGAUGGAAGACUC 19 SPL84-23-3 42 CUGCAACAGAUGGAAGAC 18 SPL84-23-4 43 GCAACAGAUGGAAGACUC 18 SPL84-23-5 44 UGCAACAGAUGGAAGACU 18 SPL84-23-6 45 CUGCAACAGAUGGAAGA 17 SPL84-23-7 46 CAACAGAUGGAAGACUC 17 SPL84-23-8 47 UGCAACAGAUGGAAGAC 17 SPL84-23-9 48 GCAACAGAUGGAAGACU 17 49 CUCCAGAAAUCAAGAUGA 18 50 UCCAGAAAUCAAGAUGAC 18 51 CUCCAGAAAUCAAGAUG 17 52 CCAGAAAUCAAGAUGAC 17 53 UCCAGAAAUCAAGAUGA 17 54 CAACAGAUGGAAGACUCU 18 55 AACAGAUGGAAGACUCUU 18 56 ACAGAUGGAAGACUCUU 17 57 AACAGAUGGAAGACUCU 17 58 UACUGCAACAGAUGGAAG 18 59 ACUGCAACAGAUGGAAGA 18 60 UACUGCAACAGAUGGAA 17 61 ACUGCAACAGAUGGAAG 17 62 AUCAAGAUGACAAGUCAAC 19 63 UCAAGAUGACAAGUCAACU 19 64 AUCAAGAUGACAAGUCAA 18 65 CAAGAUGACAAGUCAACU 18 66 UCAAGAUGACAAGUCAAC 18 67 AUCAAGAUGACAAGUCA 17 68 AAGAUGACAAGUCAACU 17 69 UCAAGAUGACAAGUCAA 17 70 CAAGAUGACAAGUCAAC 17 SPL84-26 71 AAUUAUUUUUCAUUACCUUG 20

TABLE-US-00002 TABLE 2 CFTR-related sequences (all in sense orientation). SEQ ID Name NO: Chr. 7 position Mature CFTR mRNA 34 aauuggaagc aaaugacauc acagcagguc agagaaaaag gguugagcgg caggcacccagaguaguagg ucuuuggcau uaggagcuug agcccagacg gcccuagcag ggaccccagc gcccgagaga ccaugcagag gucgccucug gaaaaggcca gcguugucuc caaacuuuuu uucagcugga ccagaccaau uuugaggaaa ggauacagac agcgccugga auugucagac auauaccaaa ucccuucugu ugauucugcu gacaaucuau cugaaaaauu gaaagagaa ugggauagag agcuggcuuc aaagaaaaau ccuaaacuca uuaaugcccu ucggcgaugu uuuuucugga gauuuauguu cuauggaauc uuuuuauauu uaggggaagu caccaaagca guacagccuc ucuuacuggg aagaaucaua gcuuccuaug acccggauaa caaggaggaa cgcucuaucg cgauuuaucu aggcauaggc uuaugccuuc ucuuuauugu gaggacacug cuccuacacc cagccauuuu uggccuucau cacauuggaa ugcagaugag aauagcuaug uuuaguuuga uuuauaagaa gacuuuaaag cugucaagcc guguucuaga uaaaauaagu auuggacaac uuguuagucu ccuuuccaac aaccugaaca aauuugauga aggacuugca uuggcacauu ucguguggau cgcuccuuug caaguggcac uccucauggg gcuaaucugg gaguuguuac aggcgucugc cuucugugga cuugguuucc ugauaguccu ugcccuuuuu caggcugggc uagggagaau gaugaugaag uacagagauc agagagcugg gaagaucagu gaaagacuug ugauuaccuc agaaaugauu gaaaauaucc aaucuguuaa ggcauacugc ugggaagaag caauggaaaa aaugauugaa aacuuaagac aaacagaacu gaaacugacu cggaaggcag ccuaugugag auacuucaau agcucagccu ucuucuucuc aggguucuuu gugguguuuu uaucugugcu ucccuaugca cuaaucaaag gaaucauccu ccggaaaaua uucaccacca ucucauucug cauuguucug cgcauggcgg ucacucggca auuucccugg gcuguacaaa caugguauga cucucuugga gcaauaaaca aaauacagga uuucuuacaa aagcaagaau auaagacauu ggaauauaac uuaacgacua cagaaguagu gauggagaau guaacagccu ucugggagga gggauuuggg gaauuauuug agaaagcaaa acaaaacaau aacaauagaa aaacuucuaa uggugaugac agccucuucu ucaguaauuu cucacuucuu gguacuccug uccugaaaga uauuaauuuc aagauagaaa gaggacaguu guuggcgguu gcuggaucca cuggagcagg caagacuuca cuucuaaugg ugauuauggg agaacuggag ccuucagagg guaaaauuaa gcacagugga agaauuucau ucuguucuca guuuuccugg auuaugccug gcaccauuaa agaaaauauc aucuuuggug uuuccuauga ugaauauaga uacagaagcg ucaucaaagc augccaacua gaagaggaca ucuccaaguu ugcagagaaa gacaauauag uucuuggaga agguggaauc acacugagug gaggucaacg agcaagaauu ucuuuagcaa gagcaguaua caaagaugcu gauuuguauu uauuagacuc uccuuuugga uaccuagaug uuuuaacaga aaaagaaaua uuugaaagcu gugucuguaa acugauggcu aacaaaacua ggauuuuggu cacuucuaaa auggaacauu uaaagaaagc ugacaaaaua uuaauuuugc augaagguag cagcuauuuu uaugggacau uuucagaacu ccaaaaucua cagccagacu uuagcucaaa acucauggga ugugauucuu ucgaccaauu uagugcagaa agaagaaauu caauccuaac ugagaccuua caccguuucu cauuagaagg agaugcuccu gucuccugga cagaaacaaa aaaacaaucu uuuaaacaga cuggagaguu uggggaaaaa aggaagaauu cuauucucaa uccaaucaac ucuauacgaa aauuuuccau ugugcaaaag acucccuuac aaaugaaugg caucgaagag gauucugaug agccuuuaga gagaaggcug uccuuaguac cagauucuga gcagggagag gcgauacugc cucgcaucag cgugaucagc acuggcccca cgcuucaggc acgaaggagg cagucugucc ugaaccugau gacacacuca guuaaccaag gucagaacau ucaccgaaag acaacagcau ccacacgaaa agugucacug gccccucagg caaacuugac ugaacuggau auauauucaa gaagguuauc ucaagaaacu ggcuuggaaa uaagugaaga aauuaacgaa gaagacuuaa aggagugcuu uuuugaugau auggagagca uaccagcagu gacuacaugg aacacauacc uucgauauau uacuguccac aagagcuuaa uuuuugugcu aauuuggugc uuaguaauuu uucuggcaga gguggcugcu ucuuugguug ugcuguggcu ccuuggaaac acuccucuuc aagacaaagg gaauaguacu cauaguagaa auaacagcua ugcagugauu aucaccagca ccaguucgua uuauguguuu uacauuuacg ugggaguagc cgacacuuug cuugcuaugg gauucuucag aggucuacca cuggugcaua cucuaaucac agugucgaaa auuuuacacc acaaaauguu acauucuguu cuucaagcac cuaugucaac ccucaacacg uugaaagcag gugggauucu uaauagauuc uccaaagaua uagcaauuuu ggaugaccuu cugccucuua ccauauuuga cuucauccag uuguuauuaa uugugauugg agcuauagca guugucgcag uuuuacaacc cuacaucuuu guugcaacag ugccagugau aguggcuuuu auuauguuga gagcauauuu ccuccaaacc ucacagcaac ucaaacaacu ggaaucugaa ggcaggaguc caauuuucac ucaucuuguu acaagcuuaa aaggacuaug gacacuucgu gccuucggac ggcagccuua cuuugaaacu cuguuccaca aagcucugaa uuuacauacu gccaacuggu ucuuguaccu gucaacacug cgcugguucc aaaugagaau agaaaugauu uuugucaucu ucuucauugc uguuaccuuc auuuccauuu uaacaacagg agaaggagaa ggaagaguug guauuauccu gacuuuagcc augaauauca ugaguacauu gcagugggcu guaaacucca gcauagaugu ggauagcuug augcgaucug ugagccgagu cuuuaaguuc auugacaugc caacagaagg uaaaccuacc aagucaacca aaccauacaa gaauggccaa cucucgaaag uuaugauuau ugagaauuca cacgugaaga aagaugacau cuggcccuca gggggccaaa ugacugucaa agaucucaca gcaaaauaca cagaaggugg aaaugccaua uuagagaaca uuuccuucuc aauaaguccu ggccagaggg ugggccucuu gggaagaacu ggaucaggga agaguacuuu guuaucagcu uuuuugagac uacugaacac ugaaggagaa auccagaucg augguguguc uugggauuca auaacuuugc aacaguggag gaaagccuuu ggagugauac cacagaaagu auuuauuuuu ucuggaacau uuagaaaaaa cuuggauccc uaugaacagu ggagugauca agaaauaugg aaaguugcag augagguugg gcucagaucu gugauagaac aguuuccugg gaagcuugac uuuguccuug uggauggggg cuguguccua agccauggcc acaagcaguu gaugugcuug gcuagaucug uucucaguaa ggcgaagauc uugcugcuug augaacccag ugcucauuug gauccaguaa cauaccaaau aauuagaaga acucuaaaac aagcauuugc ugauugcaca guaauucucu gugaacacag gauagaagca augcuggaau gccaacaauu uuuggucaua gaagagaaca aagugcggca guacgauucc auccagaaac ugcugaacga gaggagccuc uuccggcaag ccaucagccc cuccgacagg gugaagcucu uuccccaccg gaacucaagc aagugcaagu cuaagcccca gauugcugcu cugaaagagg agacagaaga agaggugcaa gauacaaggc uuuagagagc agcauaaaug uugacauggg acauuugcuc auggaauugg agcucguggg acagucaccu cauggaauug gagcucgugg aacaguuacc ucugccucag aaaacaagga ugaauuaagu uuuuuuuuaa aaaagaaaca uuugguaagg gaauugagg acacugauau gggucuugau aaauggcuuc cuggcaauag ucaaauugug ugaaagguac uucaaauccu ugaagauuua ccacuugugu uuugcaagcc agauuuuccu gaaaacccuu gccaugugcu aguaauugga aaggcagcuc uaaaugucaa ucagccuagu ugaucagcuu auugucuagu gaaacucguu aauuuguagu guuggagaag aacugaaauc auacuucuua ggguuaugau uaaguaauga uaacuggaaa cuucagcggu uuauauaagc uuguauuccu uuuucucucc ucuccccaug auguuuagaa acacaacuau auuguuugcu aagcauucca acuaucucau uuccaagcaa guauuagaau accacaggaa ccacaagacu gcacaucaaa auaugcccca uucaacaucu agugagcagu caggaaagag aacuuccaga uccuggaaau caggguuagu auuguccagg ucuaccaaaa aucucaauau uucagauaau cacaauacau cccuuaccug ggaaagggcu guuauaaucu uucacagggg acaggauggu ucccuugaug aagaaguuga uaugccuuuu cccaacucca gaaagugaca agcucacaga ccuuugaacu agaguuuagc uggaaaagua uguuagugca aauugucaca ggacagcccu ucuuuccaca gaagcuccag guagagggug uguaaguaga uaggccaugg gcacuguggg uagacacaca ugaaguccaa gcauuuagau guauagguug auggugguau guuuucaggc uagauguaug uacuucaugc ugucuacacu aagagagaau gagagacaca cugaagaagc accaaucaug aauuaguuuu auaugcuucu guuuuauaau uuugugaagc aaaauuuuuu cucuaggaaa uauuuauuuu aauaauguuu caaacauaua uaacaaugcu guauuuuaaa agaaugauua ugaauuacau uuguauaaaa uaauuuuuau auuugaaaua uugacuuuuu auggcacuag uauuucuaug aaauauuaug uuaaaacugg gacaggggag aaccuagggu gauauuaacc aggggccaug aaucaccuuu uggucuggag ggaagccuug gggcugaugc aguuguugcc cacagcugua ugauucccag ccagcacagc cucuuagaug caguucugaa gaagauggua ccaccagucu gacuguuucc aucaagggua cacugccuuc ucaacuccaa acugacucuu aagaagacug cauuauauuu auuacuguaa gaaaauauca cuugucaaua aaauccauac auuuguguga aa Intron 22 cryptic exon * 35 TTGACTTGTCATCTTGATTTCTGGAGACCACAAGGTAATGA AAAATAATTACAAGAGTCTTCCATCTGTTGCAGTATTAAAA TG Exons 1-27 + cryptic 36 aauuggaagc aaaugacauc acagcagguc agagaaaaag gguugagcgg exon 22 caggcaccca gaguaguagg ucuuuggcau uaggagcuug agcccagacg gcccuagcag ggaccccagc gcccgagaga ccaugcagag gucgccucug gaaaaggcca gcguugucuc caaacuuuuu uucagcugga ccagaccaau uuugaggaaa ggauacagac agcgccugga auugucagac auauaccaaa ucccuucugu ugauucugcu gacaaucuau cugaaaaauu ggaaagagaa ugggauagag agcuggcuuc aaagaaaaau ccuaaacuca uuaaugcccu ucggcgaugu uuuuucugga gauuuauguu cuauggaauc uuuuuauauu uaggggaagu caccaaagca guacagccuc ucuuacuggg aagaaucaua gcuuccuaug acccggauaa caaggaggaa cgcucuaucg cgauuuaucu aggcauaggc uuaugccuuc ucuuuauugu gaggacacug cuccuacacc cagccauuuu uggccuucau cacauuggaa ugcagaugag aauagcuaug uuuaguuuga uuuauaagaa gacuuuaaag cugucaagcc guguucuaga uaaaauaagu auuggacaac uuguuagucu ccuuuccaac aaccugaaca aauuugauga aggacuugca uuggcacauu ucguguggau cgcuccuuug caaguggcac uccucauggg gcuaaucugg gaguuguuac aggcgucugc cuucugugga cuugguuucc ugauaguccu ugcccuuuuu caggcugggc uagggagaau gaugaugaag uacagagauc agagagcugg gaagaucagu gaaagacuug ugauuaccuc agaaaugauu gaaaauaucc aaucuguuaa ggcauacugc ugggaagaag caauggaaaa aaugauugaa aacuuaagac aaacagaacu gaaacugacu cggaaggcag ccuaugugag auacuucaau agcucagccu ucuucuucuc aggguucuuu gugguguuuu uaucugugcu ucccuaugca cuaaucaaag gaaucauccu ccggaaaaua uucaccacca ucucauucug cauuguucug cgcauggcgg ucacucggca auuucccugg gcuguacaaa caugguauga cucucuugga gcaauaaaca aaauacagga uuucuuacaa aagcaagaau auaagacauu ggaauauaac uuaacgacua cagaaguagu gauggagaau guaacagccu ucugggagga gggauuuggg gaauuauuug agaaagcaaa acaaaacaau aacaauagaa aaacuucuaa uggugaugac agccucuucu ucaguaauuu cucacuucuu gguacuccug uccugaaaga uauuaauuuc aagauagaaa gaggacaguu guuggcgguu gcuggaucca cuggagcagg caagacuuca cuucuaaugg ugauuauggg agaacuggag ccuucagagg guaaaauuaa gcacagugga agaauuucau ucuguucuca guuuuccugg auuaugccug gcaccauuaa agaaaauauc aucuuuggug uuuccuauga ugaauauaga uacagaagcg ucaucaaagc augccaacua gaagaggaca ucuccaaguu ugcagagaaa gacaauauag uucuuggaga agguggaauc acacugagug gaggucaacg agcaagaauu ucuuuagcaa gagcaguaua caaagaugcu gauuuguauu uauuagacuc uccuuuugga uaccuagaug uuuuaacaga aaaagaaaua uuugaaagcu gugucuguaa acugauggcu aacaaaacua ggauuuuggu cacuucuaaa auggaacauu uaaagaaagc ugacaaaaua uuaauuuugc augaagguag cagcuauuuu uaugggacau uuucagaacu ccaaaaucua cagccagacu uuagcucaaa acucauggga ugugauucuu ucgaccaauu uagugcagaa agaagaaauu caauccuaac ugagaccuua caccguuucu cauuagaagg agaugcuccu gucuccugga cagaaacaaa aaaacaaucu uuuaaacaga cuggagaguu uggggaaaaa aggaagaauu cuauucucaa uccaaucaac ucuauacgaa aauuuuccau ugugcaaaag acucccuuac aaaugaaugg caucgaagag gauucugaug agccuuuaga gagaaggcug uccuuaguac cagauucuga gcagggagag gcgauacugc cucgcaucag cgugaucagc acuggcccca cgcuucaggc acgaaggagg cagucugucc ugaaccugau gacacacuca guuaaccaag gucagaacau ucaccgaaag acaacagcau ccacacgaaa agugucacug gccccucagg caaacuugac ugaacuggau auauauucaa gaagguuauc ucaagaaacu ggcuuggaaa uaagugaaga aauuaacgaa gaagacuuaa aggagugcuu uuuugaugau auggagagca uaccagcagu gacuacaugg aacacauacc uucgauauau uacuguccac aagagcuuaa uuuuugugcu aauuuggugc uuaguaauuu uucuggcaga gguggcugcu ucuuugguug ugcuguggcu ccuuggaaac acuccucuuc aagacaaagg gaauaguacu cauaguagaa auaacagcua ugcagugauu aucaccagca ccaguucgua uuauguguuu uacauuuacg ugggaguagc cgacacuuug cuugcuaugg gauucuucag aggucuacca cuggugcaua cucuaaucac agugucgaaa auuuuacacc acaaaauguu acauucuguu cuucaagcac cuaugucaac ccucaacacg uugaaagcag gugggauucu uaauagauuc uccaaagaua uagcaauuuu ggaugaccuu cugccucuua ccauauuuga cuucauccag uuguuauuaa uugugauugg agcuauagca guugucgcag uuuuacaacc cuacaucuuu guugcaacag ugccagugau aguggcuuuu auuauguuga gagcauauuu ccuccaaacc ucacagcaac ucaaacaacu ggaaucugaa ggcaggaguc caauuuucac ucaucuuguu acaagcuuaa aaggacuaug gacacuucgu gccuucggac ggcagccuua cuuugaaacu cuguuccaca aagcucugaa uuuacauacu gccaacuggu ucuuguaccu gucaacacug cgcugguucc aaaugagaau agaaaugauu uuugucaucu ucuucauugc uguuaccuuc auuuccauuu uaacaacagg agaaggagaa ggaagaguug guauuauccu gacuuuagcc augaauauca ugaguacauu gcagugggcu guaaacucca gcauagaugu ggauagcuug augcgaucug ugagccgagu cuuuaaguuc auugacaugc caacagaagg uaaaccuacc aagucaacca aaccauacaa gaauggccaa cucucgaaag uuaugauuau ugagaauuca cacgugaaga aagaugacau cuggcccuca gggggccaaa ugacugucaa agaucucaca gcaaaauaca cagaaggugg aaaugccaua uuagagaaca uuuccuucuc aauaaguccu ggccagaggu ugacuuguca ucuugauuuc uggagaccac aagguaauga aaaauaauua caagagucuu ccaucuguug caguauuaaa auggugggcc ucuugggaag aacuggauca gggaagagua cuuuguuauc agcuuuuuug agacuacuga acacugaagg agaaauccag aucgauggug ugucuuggga uucaauaacu uugcaacagu ggaggaaagc cuuuggagug auaccacaga aaguauuuau uuuuucugga acauuuagaa aaaacuugga ucccuaugaa caguggagug aucaagaaau auggaaaguu gcagaugagg uugggcucag aucugugaua gaacaguuuc cugggaagcu ugacuuuguc cuuguggaug ggggcugugu ccuaagccau ggccacaagc aguugaugug cuuggcuaga ucuguucuca guaaggcgaa gaucuugcug cuugaugaac ccagugcuca uuuggaucca guaacauacc aaauaauuag aagaacucua aaacaagcau uugcugauug cacaguaauu cucugugaac acaggauaga agcaaugcug gaaugccaac aauuuuuggu cauagaagag aacaaagugc ggcaguacga uuccauccag aaacugcuga acgagaggag ccucuuccgg caagccauca gccccuccga cagggugaag cucuuucccc accggaacuc aagcaagugc aagucuaagc cccagauugc ugcucugaaa gaggagacag aagaagaggu gcaagauaca aggcuuuaga gagcagcaua aauguugaca ugggacauuu gcucauggaa uuggagcucg ugggacaguc accucaugga auuggagcuc guggaacagu uaccucugcc ucagaaaaca aggaugaauu aaguuuuuuu uuaaaaaaga aacauuuggu aaggggaauu gaggacacug auaugggucu ugauaaaugg cuuccuggca auagucaaau ugugugaaag guacuucaaa uccuugaaga uuuaccacuu guguuuugca agccagauuu uccugaaaac ccuugccaug ugcuaguaau uggaaaggca gcucuaaaug ucaaucagcc uaguugauca gcuuauuguc uagugaaacu cguuaauuug uaguguugga gaagaacuga aaucauacuu cuuaggguua ugauuaagua augauaacug gaaacuucag cgguuuauau aagcuuguau uccuuuuucu cuccucuccc caugauguuu agaaacacaa cuauauuguu ugcuaagcau uccaacuauc ucauuuccaa gcaaguauua gaauaccaca ggaaccacaa gacugcacau caaaauaugc cccauucaac aucuagugag cagucaggaa agagaacuuc cagauccugg aaaucagggu uaguauuguc caggucuacc aaaaaucuca auauuucaga uaaucacaau acaucccuua ccugggaaag ggcuguuaua aucuuucaca ggggacagga ugguucccuu gaugaagaag uugauaugcc uuuucccaac uccagaaagu gacaagcuca cagaccuuug aacuagaguu uagcuggaaa aguauguuag ugcaaauugu cacaggacag cccuucuuuc cacagaagcu ccagguagag gguguguaag uagauaggcc augggcacug uggguagaca cacaugaagu ccaagcauuu agauguauag guugauggug guauguuuuc aggcuagaug uauguacuuc augcugucua cacuaagaga gaaugagaga

cacacugaag aagcaccaau caugaauuag uuuuauaugc uucuguuuua uaauuuugug aagcaaaauu uuuucucuag gaaauauuua uuuuaauaau guuucaaaca uauauaacaa ugcuguauuu uaaaagaaug auuaugaauu acauuuguau aaaauaauuu uuauauuuga aauauugacu uuuuauggca cuaguauuuc uaugaaauau uauguuaaaa cugggacagg ggagaaccua gggugauauu aaccaggggc caugaaucac cuuuuggucu ggagggaagc cuuggggcug augcaguugu ugcccacagc uguaugauuc ccagccagca cagccucuua gaugcaguuc ugaagaagau gguaccacca gucugacugu uuccaucaag gguacacugc cuucucaacu ccaaacugac ucuuaagaag acugcauuau auuuauuacu guaagaaaau aucacuuguc aauaaaaucc auacauuugu gugaaa Target sequence for 37 AAGCAGCATATTCTCAATACTATGTTTCATTAATAATTAAT ASOs * (Bold-cryptic AGAGATATATGAACACATAAAAGATTCAATTATAATCACC exon) TTGTGGATCTAAATTTCAGTTGACTTGTCATCTTGATTTC TGGAGACCACAAGGTAATGAAAAATAATTACAAGAGTC TTCCATCTGTTGCAGTATTAAAATGGTGAGTAAGACACC CTGAAAGGAAATGTTCTATTCATGGTACAATGCAATTACAG CTAGCACCAAATTCAACACTGTTTAACTTTCAACATATTAT TTTG Sequence motif no. 1 38 GAUGGAAGA Sequence motif no. 2 39 CAACAGAUGGAAGA

Corresponding to positions 17279930-117280013 in the genome according to the Assemble version used as updated in 2013 (UCSC Genome Browser on Human December 2013 (GRCh38/hg38)).

Materials and Methods

Fisher Rat Thyroid (FRT) Cellular System

[0179] In order to screen for antisense oligonucleotides (ASOs) that modulate the splicing of the 3849 +10 kb C-to-T mutated CFTR a cellular screening system is required. As epithelial cells derived from patients (nasal or bronchial epithelial cells) are difficult to grow and have limited proliferation capacity the inventors have generated, fisher rat thyroid (FRT) cells stably expressing CFTR cDNA carrying the 3849 +10 kb C-to-T mutation (FRT 3849 mut). The cDNA is transfected into FRT cells using the Flp-In system (Invitrogen) that allows integration at a specific genomic location. It is important to note that FRT Flp-In cells are widely used for analysis of CFTR and can be used for RNA as well as functional analyses. In order to study the effect of ASOs on splicing, the cDNA is cloned to include a mini gene containing intronic sequences around the exon of interest. As a positive control FRT cells containing the cDNA with the mini gene carrying the wild type (WT) sequence (C in the mutation site) were also generated (FRT 3849 WT).

Transfection

[0180] Each ASO was transfected into FRT 3849 mutant cells using Lipofectamine 2000 transfection reagent (Invitrogen) according to the lipofectamine 2000 reagent protocol using the following lipofectamine amounts: 96 well-0.15 .mu.l, 6 well-3 .mu.l, 10 mm plate-15 .mu.l. In each experiment the effect of different ASOs was analyzed in comparison to cells treated with control ASOs.

RNA Extraction

[0181] Twenty-four (24) hours following transfection of FRT 3849 mutant cells, total RNA was extracted using RNeasy Mini Kit (QIAGEN). RNA concentration was determined using nanodrop. RNA-less and reverse transcriptase-less reactions were used as controls. Complementary DNA (cDNA) synthesis was performed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). The cDNA was analyzed by PCR and qPCR.

Quantitative Detection of Aberrantly Spliced CFTR Transcripts (qPCR)

[0182] Real-time PCR was performed in QuantStudio 12K Flex Real-Time PCR System using TaqMan.RTM. Fast Advanced Master Mix (Applied Biosystems) with TaqMan probes specific for the 84 bp cryptic exon. The expression level was normalized to the transcript levels of HPRT. Technical duplicates were analyzed for each sample. Analysis was perform using the double delta Ct analysis.

Determine the Ration Between these Two Transcripts (PCR)

[0183] PCR was performed using the Platinum.TM. SuperFi.TM. Green PCR Master Mix 12359-10 (Invitrogen) on cDNA diluted 1:2.5, 2 .mu.l of diluted cDNA for each reaction. PCR products were then run on an agarose gel for detection of the correctly and aberrantly spliced transcripts. The gels were exposed to UV light to visualize the PCR products and images were produced. The quantification of the fraction of correctly spliced transcripts was quantified using image J.

Half Maximal Effective Concentration (EC50) Analysis

[0184] FRT cells were transfected with each lead ASO in six concentrations (0.1, 1, 2.5, 10, 50 and 100 nM). For concentrations lower than 100 nM, control ASO was added for completion to total concentration of 100 nM. In each experiment the effect of 3 different ASOs was analyzed in comparison to cells treated with 100 nM control ASOs.

CFTR Protein Analysis by Western Blot

[0185] For protein analysis FRT 3849 mutant cells were transfected with 10 nM lead ASOs or control ASO every 24 hr for 3 days. Twenty-four (24) hr following the last transfection protein was extracted using RIPA buffer and analyzed by immunoblotting with a CFTR antibody. 6% polyacrylamide gels were used for protein separation. The gel was transferred to a nitrocellulose membrane, and antibody hybridization and chemiluminescence were performed according to the standard procedures. The primary antibodies used in this analysis were mouse anti CFTR M3A7 (Millipore) and rabbit anti Calnexin (Sigma). HRP-conjugated anti-rabbit and anti-mouse secondary antibodies were obtained from Jackson ImmunoResearch Laboratories.

Studies of CFTR Function Using a Membrane Potential Assay

[0186] FRT 3849 mutant cells are grown in 96-well (black, flat bottom; corning) plates. 24 h following transfection of the different ASOs, CFTR channel function was analyzed using the FLIPR membrane potential assay as previously described. Briefly, the cells were loaded with blue membrane potential dye (Molecular Devices), which can detect changes in transmembrane potential. The plate was then read in a fluorescence plate reader (BioTek Synergy H1) for baseline levels followed by CFTR stimulation using the cAMP agonist forskolin (10 .mu.M; Sigma), DMSO vehicle was used as a negative control. CFTR-mediated depolarization of the plasma membrane was detected as an increase in fluorescence and hyperpolarization (or repolarization) as a decrease. To terminate the functional assay, the CFTR inhibitor CFTRinh-172 (10 .mu.M; Cystic Fibrosis Foundation Therapeutics) was added to each well. Changes in transmembrane potential were normalized to the values prior to activation.

Primary Nasal Epithelial Cell Sampling and Culture

[0187] Human nasal endothelial cells (HNE) cells were sampled by nasal brushing of both nostrils. To increase the number of filters available to test the corrector efficacy, the inventors used conditionally reprogrammed and re-differentiated HNE cells. HNE cells were then seeded on porous filters (0.33 cm.sup.2, Transwell, Corning) and supplemented with culture medium. After 2 days, cells were cultured in an air-liquid interface for 2-4 weeks. ASOs dissolved in DDW, were added to the basal side of HNEs during the differentiation.

Ussing Chamber Studies

[0188] Following differentiation HNE cells were analyzed for CFTR channel using the Ussing chamber system as previously described (Pranke et al., 2017). In general, the short-circuit-current (Isc) was measured under voltage clamp conditions with an EVC4000 Precision V/I Clamp (World Precision Instruments). For all measurements, chloride concentration gradient across the epithelium was applied by differential composition of basal and apical Ringer solutions. Inhibitors and activators were added after stabilization of baseline Isc:sodium (Na+)-channel blocker Amiloride (100 .mu.M) to inhibit apical epithelial Na+ channel (ENaC); cAMP agonists Forskolin (10 .mu.M) to activate the transepithelial cAMP-dependent current (including Cl- transport through CFTR channels); VX-770 (10 .mu.M) to potentiate CFTR activity; CFTR inhibitor CFTRinh172 (5 .mu.M) to specifically inhibit CFTR; and ATP (100 .mu.M) to challenge the purinergic calcium-dependent Cl- secretion. The change after Forskolin served as an index of CFTR.

Example 1

Novel Antisense Oligonucleotides (ASOs)

[0189] Twenty-six (26) new antisense oligonucleotides (ASOs) were analyzed for their effect on the splicing of CFTR pre-mRNA including the mutation 3849 +10 Kb C-to-T. The ASOs were modified with 2'-O-Methyl phosphorothioate (2'OMP). Briefly, Fischer rat thyroid (FRT) cells were transfected with the ASOs, incubated for 24 hours, and then RNA was extracted and the levels of aberrantly spliced CFTR transcripts were measured by qRT-PCR (FIG. 3A). In addition, the percentage of correctly spliced CFTR transcripts after incubation with each ASO was also determined (FIG. 3B). The values shown are the average fold change (mean.+-.s.e.m.) relative to cells treated with a control ASO from 2-8 independent experiments. Values are normalized against transcripts of the HPRT gene.

[0190] As shown in FIG. 3, even at concentrations as low as 10 nM, all of the tested ASOs, except for one (SPL84-26) were surprisingly found to significantly decrease the levels of aberrantly spliced CFTR mRNA transcripts (to at least 0.6 of control ASO), and increase the prevalence of correctly spliced CFTR mRNA transcripts to at least 10 percent, compared to the negligible effect of the control ASO.

Example 2

Comparison of Novel ASOs and Previously Disclosed ASOs

[0191] The new ASOs provided herein were compared to several of the ASOs previously described (Friedman et al., J. Biol. Chem., 1999). The same methods were used as in Example 1 above, with the exception that in these experiments the FRT cells were transfected with lower concentrations of the ASOs (2.5 nM vs. 10 nM).

[0192] From the data presented in FIGS. 4A and 4B, it becomes evident that even at concentrations as low as 2.5 nM, all of the ASOs provided herein were surprisingly found to significantly decrease the levels of aberrantly spliced CFTR mRNA transcripts (to at least 80 percent of control ASO level), and increase the prevalence of correctly spliced CFTR mRNA transcripts to at least 15 percent, compared to the negligible effect of the control ASO. It is further important to note that these results are far superior to those achieved by previously described ASOs in a direct head-to-head comparison.

[0193] These results become even more surprising and promising when considering that the genetically-manipulated FRT cells used in the experiments contained a single copy of a CFTR gene having the 3849 +10 Kb C-to-T mutation, which is a condition more extreme than the most acute phenotype of CF in humans, where two CFTR gene alleles display little to none CFTR activity.

Example 3

Comparison of Novel ASOs and Previously Disclosed ASOs

[0194] The new ASOs provided herein were compared to several of the ASOs previously described in WO2014/045283. The same methods were used as in Example 1 above.

[0195] From the data presented in FIGS. 5A and 5B, it becomes evident that all of the ASOs provided herein were comparable in efficacy to the ASOs described in WO2014/045283, i.e. in decreasing the levels of aberrantly spliced CFTR mRNA transcripts, and/or increasing the prevalence of correctly spliced CFTR mRNA transcripts, compared to the negligible effect of the control ASO.

[0196] It is surprising to note that the new ASOs provided herein, despite being shorter than the ASOs previously described in WO2014/045283 (18-21 compared to 25 consecutive bases (16%-28%), present comparable efficacies in any one of the experiments. It is especially surprising and unpredictable since the ASOs previously described in Friedman et al., 1999, having 18-19 consecutive bases, displayed inferior efficacy in all the experiments.

[0197] From the data presented in Examples 1, 2 and 3 above, it is readily apparent that the ASOs provided by the present invention are highly capable of manipulating the splicing of CFTR pre-mRNA transcripts containing the 3849 +10 Kb C-to-T mutation such that the ratio between correctly spliced CFTR mRNA transcripts and aberrantly spliced CFTR mRNA transcripts becomes much more favorable.

[0198] These results become even more surprising and promising when considering that the genetically-manipulated FRT cells used in the experiments contained a single copy of a CFTR gene having the 3849 +10 Kb C-to-T mutation, which is a condition more extreme than the most acute phenotype of CF in humans, where two CFTR gene alleles display little to none CFTR activity.

Example 4

EC50 Analysis of Novel ASOs

[0199] The new ASOs SPL84-2, SPL84-17, SPL8422, SPL84-23 and SPL84-25 provided herein were tested in several concentrations to generate an EC50 curve indicating on the affinity and efficacy of each ASO. As illustrated in FIG. 6 and Table 3 (herein below), the ASOs were found to have a high efficiency and potency.

TABLE-US-00003 TABLE 3 SPL84- SPL84- SPL84- SPL84- SPL84- 1 17 22 23 25 Maximal effect (Fold 0.316 0.2784 0.2157 0.1868 0.1339 decrease from control ASO) EC50 (nM) 1.16 0.6246 0.3073 0.5133 0.9246

Example 5

Western Blot Analysis for CFTR Mature Protein Levels

[0200] The CFTR protein in a western blot can have two forms: immature--un-glycosylated protein (band B), and mature--full length glycosylated (band C). In homozygote WT cells most of the CFTR protein is found in band C--full length and mature. In FRT cells having the 3849 +10 Kb C-to-T mutation ("FRT mut") and treated with a control ASO all of the CFTR protein was visualized as truncated CFTR protein as in band B.

[0201] The transfection protocol was as follows: 10 nM of each ASO was transfected into FRT mut cells on three consecutive days. In each experiment the effect of several ASOs was analyzed in comparison to cells treated with 10 nM control ASOs. Each ASO was tested in 2 biological experiments. CFTR was stained by an antibody detecting only the full length CFTR protein (.alpha.CFTR--M3A7; FIG. 7). In the cells treated with control, no band C was detected, while following ASO transfection band C appeared, indicative of the formation of a full-length mature protein.

[0202] As illustrated in FIGS. 7A and 7B, the level of mature full-length protein was increased following transfection with 10 nM ASOs. These data provide direct evidence that the ASOs provided by the present invention have a pronounced and favorable effect not only on the pre-mRNA/mRNA level, but more importantly, on the protein level.

Example 6

Functional Analysis

[0203] FLIPR.TM. (Fluorescence Imaging Plate Reader) is a functional system for measuring changes in membrane potential by a fluorescent indicator. FLIPR can be used to test CFTR activation levels when the activation of CFTR is achieved by the addition of Forskolin (FSK) and the specificity for the CFTR channel is verified by the addition of CFTR specific inhibitor (inh-172). The experiments were performed 24 hours following transfection of 10 nM of each ASO to FRT mut cells.

[0204] FIG. 8A is a representative FLIPR trace demonstrating CFTR activation induced by ASO SPL84-17. FIG. 8B illustrates the average effect of several ASOs on CFTR function. (*, p value.ltoreq.0.05; **, p value.ltoreq.0.01; ***, p value.ltoreq.0.001; ****, p value.ltoreq.0.0001).

[0205] The data presented in FIGS. 8A and 8B clearly illustrates that the new ASOs provided by the present invention have a pronounced and favorable effect not only on the RNA and protein levels, but even more importantly, on the functional level.

Example 7

Efficacy in Primary Cells of a CF Patient

[0206] CFTR channel activity was analyzed in differentiated primary respiratory epithelial cells from CF patients. The Us sing chamber is employed to measure trans-epithelial currents indicative of the CFTR channel activity. This measurement is a strong predictor of patient response to the treatment (R.sup.2=0.95).

[0207] Human Nasal Epithelial (HNE) cells from CF patients carrying at least one CFTR allele with the 3849 +10 Kb C-to-T mutation were provided. In order to increase the number of filter assays, conditionally reprogrammed and re-differentiated HNE cells were used. In these experiments the HNE cells were exposed to the ASOs for 15-23 days, while differentiating on filters, with no addition of a transfection reagent.

[0208] Ussing chamber experiments were performed on HNE cells from 5 CF patients. Four of them are heterozygous for the 3849 10+Kb C-to-T mutation and a minimal function mutation: Paris patient #2 and Israel patient #4 (3849 +10 kb C-to-T/F508del), Israel patient #1 (3849 +10 kb C-to-T/W1282X) and Israel patient #2 (3849 +10 Kb C-to-T/405+1G-to-A). In patients heterozygous for the 3849 +10 Kb C-to-T mutation, the maximum expected activity is 50% of WT, which is sufficient to confer full health conditions. An additional tested patient is homozygous for the 3849 +10 kb C-to-T mutation (Paris patient #3).

[0209] First, 5 ASOs (SPL84-17, SPL84-22, SPL84-23, SPL84-2, and SPL84-25) were analyzed in cells from two patients (one heterozygote and one homozygote). In FIG. 9 the effects of the 5 ASOs in a compound heterozygote patient (Paris patient #2-3849 +10 kb C-to-T/F508del), are presented. In order to measure CFTR activity levels in the most accurate way, the change after the addition of a specific CFTR inhibitor (inh-172) was used as an index. As can be seen in the representative traces (FIG. 9A) and in the median of CFTR inh-172 (FIG. 9B) all tested ASOs led to a significant activation of CFTR compared to the control ASO. In this patient, SPL84-23 had the strongest effect reaching 55% of WT when cells were exposed to SPL84-23. This level indicates a full restoration of the 3849 allele. The other 4 ASOs also led to a significant induction of the activity ranging from 34%-42.5% of WT.

[0210] The effect of each of the 5 ASOs was also analysed in HNEs from a patient homozygous for the 3849 +10 kb C-to-T mutation (Paris #3). Consistent with the first tested heterozygote patient, ASO SPL84-23 showed full restoration of CFTR activity reaching activity levels of WT individuals. In this patient, three additional ASOs (SPL84-17, SPL84-22, and SPL84-2) also induced full restoration, indicating that these 3 ASOs also have a potential for high therapeutic efficacy. Nevertheless, the levels of CFTR activity between these ASOs varied, SPL84-17 and SPL84-22 showed higher levels of CFTR activity compared to SPL84-2 (231% and 186% compared to 151%, respectively). SPL84-25 also induced a high level of activation although lower than the effects of the other ASOs (93%) (FIG. 10).

[0211] Based on the results from the cells of these patients, the inventors chose to further analyse the effect of the 3 ASOs which showed the highest CFTR activity levels: SPL84-17, SPL8422 and SPL84-23 (FIGS. 9 and 10).

[0212] Next, these 3 ASOs were tested in two additional heterozygote patients carrying different minimal function mutation on the second allele (W1282X and 405+1G-to-A). It is worth noting that the use of HNE cells enables access to patients with various genotypes, but still carrying one 3849 +10 Kb C-to-T mutation. Consistent with the results from the first heterozygote patient (Paris #2), the 3 ASOs showed activation of CFTR in the additional tested patients, with a variable effect between patients.

[0213] The effect of ASO SPL84-23, which showed the highest effect in the tested heterozygotes, was tested in cells from an additional 3849 +10 kb C-to-T/F508del patient (Israel #4). In this patient the exposure to the ASO led also to a significant activation of the CFTR channel to 38% of WT levels.

[0214] Summarizing the functional results from all heterozygote patients tested, SPL84-23 has the strongest effect across cells from patients with different genotypes, reaching full restoration of the CFTR activity (average of 42.5% of WT ranging from 23% to 73.5%). The other two ASOs, SPL84-17 and SPL84-22, also show a significant restoration of the 3849 +10 Kb C-to-T allele, with a more modest effect (average of 30% and 31% of WT, respectively) (FIG. 11).

[0215] Various data indicate that avoiding CF disease symptoms (e.g., lung function) requires only partial restoration of protein/RNA levels. As an indication, splice site variants that allow CFTR transcript levels to reach 10-25% of normal levels have been found in individuals that do not have CF lung disease. Thus, the results provide a solid indication for the potential of the ASOs as drug candidates with a significant clinical benefit.

Example 8

ASOs Effect on Splicing

[0216] To test whether the significant activation of CFTR by ASO SPL84-23 treatment results from reduction in the level of aberrantly spliced CFTR transcripts, the effect of ASO SPL84-23 on the splicing pattern was further analyzed by extracting RNA from the same filters used for the Us sing chamber measurements. As can be seen in FIG. 12A, the level of the aberrantly spliced CFTR transcripts, carrying the 84 bp cryptic exon, was significantly reduced in the HNE cells of both the heterozygotes and homozygote patients (as measured by qRT-PCR and calculating the relative fold change in CFTR aberrant transcript levels between control ASO and SPL84-23). In the homozygote cells, since all transcripts originate from the 3849 +10 kb C-to-T mutated alleles, the absolute level of correctly and aberrantly spliced transcripts can be visualized on agarose gel using RT-PCR. The results demonstrate that SPL84-23 treatment resulted in a dramatic effect on the splicing pattern. In this patient, untreated cells or cells treated with the control ASO generated mainly aberrantly spliced CFTR with very low levels of correctly spliced transcripts. However, in SPL84-23 treated cells most of the RNA transcripts were correctly spliced (FIG. 12B).

Example 9

Chemical Modifications of AOs Effect CFTR Function in HNE Cells from a CF Patient

[0217] The effect of an ASO with the same sequence and different chemical modifications was evaluated. 2'OMP is considered a second-generation ASO chemistry and the effect of another second-generation modification, 2'-Methoxy Ethyl (2'MOE), was tested. Both modifications have similar characteristics of: (1) slowing down degradation by protecting the ASOs from nucleases; and (2) having higher affinity to the target.

[0218] The effect of SPL84-23 having 2'OMPs or 2'MOE modification in primary human nasal epithelial cells from patients carrying the 3849 +10 kb C to T mutation (free uptake) was compared using the Ussing chamber assay as described in Example 7.

[0219] CFTR function was measured in nasal epithelial cells from a patient homozygous for the 3849 mutation, following treatment of naked ASOs (free uptake, no transfection reagent) (FIG. 13). The ASOs were tested in 2 concentrations as indicated. SPL84-23 2'MOE showed a significant higher effect on the CFTR function compared to SPL84-23 2'OMP, in the two concentrations. Importantly, while SPL84-23 2'MOE completely rescued the CFTR function (to WT levels), in both 200 nM and 50 nM ASO concentrations, SPL84-23 2'OMP completely rescued the function only in the higher (200 nM) concentration.

Example 10

Optimization of ASO Improves Efficacy and Penetration

[0220] The inventors further optimized leading synthetic oligonucleotide candidates in order to improve their efficacy and penetration. The effects of chemistry and shortening of the ASO length were examined.

[0221] Changing the chemical modification from 2'OMe to IONIS 2.sup.nd generation 2'MOE and also ASO length from 17-20 bases were attempted.

[0222] Short versions of AS084-23 were screened for their effect on splicing by free uptake on primary patient HNE cells (SPL84-23-1--SPL84-23-9). On average in the three 3849 heterozygote patients analyzed, the effect of SPL84-23-1 (19 mer) was comparable to SPL84-23 (FIG. 14).

[0223] Optimization of ASO length was further examined in primary HNE cells and in primary HBE cells (human bronchial epithelial cells) from a heterozygous a patient (3849/F508del).

[0224] SPL84-23-1 (19 mer) was shown to have a similar effect on the CFTR function as the longer SPL84-23 ASO in primary HNE cells (FIGS. 15A-15B), as well as in primary HBE cells (FIGS. 16A-16B).

[0225] While the present invention has been particularly described, persons skilled in the art will appreciate that many variations and modifications can be made. Therefore, the invention is not to be construed as restricted to the particularly described embodiments, and the scope and concept of the invention will be more readily understood by reference to the claims, which follow.

Sequence CWU 1

1

71120RNAArtificial SequenceSynthetic 1cugcaacaga uggaagacuc 20219RNAArtificial SequenceSynthetic 2caacagaugg aagacucuu 19319RNAArtificial SequenceSynthetic 3cuccagaaau caagaugac 19419RNAArtificial SequenceSynthetic 4uacugcaaca gauggaaga 19520RNAArtificial SequenceSynthetic 5aucaagauga caagucaacu 20619RNAArtificial SequenceSynthetic 6guggucucca gaaaucaag 19719RNAArtificial SequenceSynthetic 7gauggaagac ucuuguaau 19821RNAArtificial SequenceSynthetic 8caagaugaca agucaacuga a 21922RNAArtificial SequenceSynthetic 9gaaaucaaga ugacaaguca ac 221019RNAArtificial SequenceSynthetic 10accuuguggu cuccagaaa 191120RNAArtificial SequenceSynthetic 11ccagaaauca agaugacaag 201221RNAArtificial SequenceSynthetic 12caccauuuua auacugcaac a 211321RNAArtificial SequenceSynthetic 13uggaagacuc uuguaauuau u 211421RNAArtificial SequenceSynthetic 14gaugacaagu caacugaaau u 211519RNAArtificial SequenceSynthetic 15cuuucagggu gucuuacuc 191619RNAArtificial SequenceSynthetic 16ucaggguguc uuacucacc 191720RNAArtificial SequenceSynthetic 17auuaccuugu ggucuccaga 201821RNAArtificial SequenceSynthetic 18gacaagucaa cugaaauuua g 211921RNAArtificial SequenceSynthetic 19caacugaaau uuagauccac a 212021RNAArtificial SequenceSynthetic 20agucaacuga aauuuagauc c 212121RNAArtificial SequenceSynthetic 21gugucuuacu caccauuuua a 212218RNAArtificial SequenceSynthetic 22gugucuuacu caccauuu 182319RNAArtificial SequenceSynthetic 23cucaccauuu uaauacugc 192418RNAArtificial SequenceSynthetic 24gacaagucaa cugaaauu 182520RNAArtificial SequenceSynthetic 25cuuacucacc auuuuaauac 202618RNAArtificial SequenceSynthetic 26gucuuacuca ccauuuua 182719RNAArtificial SequenceSynthetic 27caagucaacu gaaauuuag 192819RNAArtificial SequenceSynthetic 28cuuguaauua uuuuuacau 192925RNAArtificial SequenceSynthetic 29aaaucaagau gacaagucaa cugaa 253025RNAArtificial SequenceSynthetic 30cuuguggucu ccagaaauca agaug 253125RNAArtificial SequenceSynthetic 31aacagaugga agacucuugu aauua 253225RNAArtificial SequenceSynthetic 32ucaggguguc uuacucacca uuuua 253318RNAArtificial SequenceSynthetic 33gaccacuugc cacccauc 18346130RNAHomo sapiens 34aauuggaagc aaaugacauc acagcagguc agagaaaaag gguugagcgg caggcaccca 60gaguaguagg ucuuuggcau uaggagcuug agcccagacg gcccuagcag ggaccccagc 120gcccgagaga ccaugcagag gucgccucug gaaaaggcca gcguugucuc caaacuuuuu 180uucagcugga ccagaccaau uuugaggaaa ggauacagac agcgccugga auugucagac 240auauaccaaa ucccuucugu ugauucugcu gacaaucuau cugaaaaauu gaaagagaau 300gggauagaga gcuggcuuca aagaaaaauc cuaaacucau uaaugcccuu cggcgauguu 360uuuucuggag auuuauguuc uauggaaucu uuuuauauuu aggggaaguc accaaagcag 420uacagccucu cuuacuggga agaaucauag cuuccuauga cccggauaac aaggaggaac 480gcucuaucgc gauuuaucua ggcauaggcu uaugccuucu cuuuauugug aggacacugc 540uccuacaccc agccauuuuu ggccuucauc acauuggaau gcagaugaga auagcuaugu 600uuaguuugau uuauaagaag acuuuaaagc ugucaagccg uguucuagau aaaauaagua 660uuggacaacu uguuagucuc cuuuccaaca accugaacaa auuugaugaa ggacuugcau 720uggcacauuu cguguggauc gcuccuuugc aaguggcacu ccucaugggg cuaaucuggg 780aguuguuaca ggcgucugcc uucuguggac uugguuuccu gauaguccuu gcccuuuuuc 840aggcugggcu agggagaaug augaugaagu acagagauca gagagcuggg aagaucagug 900aaagacuugu gauuaccuca gaaaugauug aaaauaucca aucuguuaag gcauacugcu 960gggaagaagc aauggaaaaa augauugaaa acuuaagaca aacagaacug aaacugacuc 1020ggaaggcagc cuaugugaga uacuucaaua gcucagccuu cuucuucuca ggguucuuug 1080ugguguuuuu aucugugcuu cccuaugcac uaaucaaagg aaucauccuc cggaaaauau 1140ucaccaccau cucauucugc auuguucugc gcauggcggu cacucggcaa uuucccuggg 1200cuguacaaac augguaugac ucucuuggag caauaaacaa aauacaggau uucuuacaaa 1260agcaagaaua uaagacauug gaauauaacu uaacgacuac agaaguagug auggagaaug 1320uaacagccuu cugggaggag ggauuugggg aauuauuuga gaaagcaaaa caaaacaaua 1380acaauagaaa aacuucuaau ggugaugaca gccucuucuu caguaauuuc ucacuucuug 1440guacuccugu ccugaaagau auuaauuuca agauagaaag aggacaguug uuggcgguug 1500cuggauccac uggagcaggc aagacuucac uucuaauggu gauuauggga gaacuggagc 1560cuucagaggg uaaaauuaag cacaguggaa gaauuucauu cuguucucag uuuuccugga 1620uuaugccugg caccauuaaa gaaaauauca ucuuuggugu uuccuaugau gaauauagau 1680acagaagcgu caucaaagca ugccaacuag aagaggacau cuccaaguuu gcagagaaag 1740acaauauagu ucuuggagaa gguggaauca cacugagugg aggucaacga gcaagaauuu 1800cuuuagcaag agcaguauac aaagaugcug auuuguauuu auuagacucu ccuuuuggau 1860accuagaugu uuuaacagaa aaagaaauau uugaaagcug ugucuguaaa cugauggcua 1920acaaaacuag gauuuugguc acuucuaaaa uggaacauuu aaagaaagcu gacaaaauau 1980uaauuuugca ugaagguagc agcuauuuuu augggacauu uucagaacuc caaaaucuac 2040agccagacuu uagcucaaaa cucaugggau gugauucuuu cgaccaauuu agugcagaaa 2100gaagaaauuc aauccuaacu gagaccuuac accguuucuc auuagaagga gaugcuccug 2160ucuccuggac agaaacaaaa aaacaaucuu uuaaacagac uggagaguuu ggggaaaaaa 2220ggaagaauuc uauucucaau ccaaucaacu cuauacgaaa auuuuccauu gugcaaaaga 2280cucccuuaca aaugaauggc aucgaagagg auucugauga gccuuuagag agaaggcugu 2340ccuuaguacc agauucugag cagggagagg cgauacugcc ucgcaucagc gugaucagca 2400cuggccccac gcuucaggca cgaaggaggc agucuguccu gaaccugaug acacacucag 2460uuaaccaagg ucagaacauu caccgaaaga caacagcauc cacacgaaaa gugucacugg 2520ccccucaggc aaacuugacu gaacuggaua uauauucaag aagguuaucu caagaaacug 2580gcuuggaaau aagugaagaa auuaacgaag aagacuuaaa ggagugcuuu uuugaugaua 2640uggagagcau accagcagug acuacaugga acacauaccu ucgauauauu acuguccaca 2700agagcuuaau uuuugugcua auuuggugcu uaguaauuuu ucuggcagag guggcugcuu 2760cuuugguugu gcuguggcuc cuuggaaaca cuccucuuca agacaaaggg aauaguacuc 2820auaguagaaa uaacagcuau gcagugauua ucaccagcac caguucguau uauguguuuu 2880acauuuacgu gggaguagcc gacacuuugc uugcuauggg auucuucaga ggucuaccac 2940uggugcauac ucuaaucaca gugucgaaaa uuuuacacca caaaauguua cauucuguuc 3000uucaagcacc uaugucaacc cucaacacgu ugaaagcagg ugggauucuu aauagauucu 3060ccaaagauau agcaauuuug gaugaccuuc ugccucuuac cauauuugac uucauccagu 3120uguuauuaau ugugauugga gcuauagcag uugucgcagu uuuacaaccc uacaucuuug 3180uugcaacagu gccagugaua guggcuuuua uuauguugag agcauauuuc cuccaaaccu 3240cacagcaacu caaacaacug gaaucugaag gcaggagucc aauuuucacu caucuuguua 3300caagcuuaaa aggacuaugg acacuucgug ccuucggacg gcagccuuac uuugaaacuc 3360uguuccacaa agcucugaau uuacauacug ccaacugguu cuuguaccug ucaacacugc 3420gcugguucca aaugagaaua gaaaugauuu uugucaucuu cuucauugcu guuaccuuca 3480uuuccauuuu aacaacagga gaaggagaag gaagaguugg uauuauccug acuuuagcca 3540ugaauaucau gaguacauug cagugggcug uaaacuccag cauagaugug gauagcuuga 3600ugcgaucugu gagccgaguc uuuaaguuca uugacaugcc aacagaaggu aaaccuacca 3660agucaaccaa accauacaag aauggccaac ucucgaaagu uaugauuauu gagaauucac 3720acgugaagaa agaugacauc uggcccucag ggggccaaau gacugucaaa gaucucacag 3780caaaauacac agaaggugga aaugccauau uagagaacau uuccuucuca auaaguccug 3840gccagagggu gggccucuug ggaagaacug gaucagggaa gaguacuuug uuaucagcuu 3900uuuugagacu acugaacacu gaaggagaaa uccagaucga uggugugucu ugggauucaa 3960uaacuuugca acaguggagg aaagccuuug gagugauacc acagaaagua uuuauuuuuu 4020cuggaacauu uagaaaaaac uuggaucccu augaacagug gagugaucaa gaaauaugga 4080aaguugcaga ugagguuggg cucagaucug ugauagaaca guuuccuggg aagcuugacu 4140uuguccuugu ggaugggggc uguguccuaa gccauggcca caagcaguug augugcuugg 4200cuagaucugu ucucaguaag gcgaagaucu ugcugcuuga ugaacccagu gcucauuugg 4260auccaguaac auaccaaaua auuagaagaa cucuaaaaca agcauuugcu gauugcacag 4320uaauucucug ugaacacagg auagaagcaa ugcuggaaug ccaacaauuu uuggucauag 4380aagagaacaa agugcggcag uacgauucca uccagaaacu gcugaacgag aggagccucu 4440uccggcaagc caucagcccc uccgacaggg ugaagcucuu uccccaccgg aacucaagca 4500agugcaaguc uaagccccag auugcugcuc ugaaagagga gacagaagaa gaggugcaag 4560auacaaggcu uuagagagca gcauaaaugu ugacauggga cauuugcuca uggaauugga 4620gcucguggga cagucaccuc auggaauugg agcucgugga acaguuaccu cugccucaga 4680aaacaaggau gaauuaaguu uuuuuuuaaa aaagaaacau uugguaaggg aauugaggac 4740acugauaugg gucuugauaa auggcuuccu ggcaauaguc aaauugugug aaagguacuu 4800caaauccuug aagauuuacc acuuguguuu ugcaagccag auuuuccuga aaacccuugc 4860caugugcuag uaauuggaaa ggcagcucua aaugucaauc agccuaguug aucagcuuau 4920ugucuaguga aacucguuaa uuuguagugu uggagaagaa cugaaaucau acuucuuagg 4980guuaugauua aguaaugaua acuggaaacu ucagcgguuu auauaagcuu guauuccuuu 5040uucucuccuc uccccaugau guuuagaaac acaacuauau uguuugcuaa gcauuccaac 5100uaucucauuu ccaagcaagu auuagaauac cacaggaacc acaagacugc acaucaaaau 5160augccccauu caacaucuag ugagcaguca ggaaagagaa cuuccagauc cuggaaauca 5220ggguuaguau uguccagguc uaccaaaaau cucaauauuu cagauaauca caauacaucc 5280cuuaccuggg aaagggcugu uauaaucuuu cacaggggac aggaugguuc ccuugaugaa 5340gaaguugaua ugccuuuucc caacuccaga aagugacaag cucacagacc uuugaacuag 5400aguuuagcug gaaaaguaug uuagugcaaa uugucacagg acagcccuuc uuuccacaga 5460agcuccaggu agagggugug uaaguagaua ggccaugggc acugugggua gacacacaug 5520aaguccaagc auuuagaugu auagguugau ggugguaugu uuucaggcua gauguaugua 5580cuucaugcug ucuacacuaa gagagaauga gagacacacu gaagaagcac caaucaugaa 5640uuaguuuuau augcuucugu uuuauaauuu ugugaagcaa aauuuuuucu cuaggaaaua 5700uuuauuuuaa uaauguuuca aacauauaua acaaugcugu auuuuaaaag aaugauuaug 5760aauuacauuu guauaaaaua auuuuuauau uugaaauauu gacuuuuuau ggcacuagua 5820uuucuaugaa auauuauguu aaaacuggga caggggagaa ccuaggguga uauuaaccag 5880gggccaugaa ucaccuuuug gucuggaggg aagccuuggg gcugaugcag uuguugccca 5940cagcuguaug auucccagcc agcacagccu cuuagaugca guucugaaga agaugguacc 6000accagucuga cuguuuccau caaggguaca cugccuucuc aacuccaaac ugacucuuaa 6060gaagacugca uuauauuuau uacuguaaga aaauaucacu ugucaauaaa auccauacau 6120uugugugaaa 61303584DNAHomo sapiens 35ttgacttgtc atcttgattt ctggagacca caaggtaatg aaaaataatt acaagagtct 60tccatctgtt gcagtattaa aatg 84366216RNAHomo sapiens 36aauuggaagc aaaugacauc acagcagguc agagaaaaag gguugagcgg caggcaccca 60gaguaguagg ucuuuggcau uaggagcuug agcccagacg gcccuagcag ggaccccagc 120gcccgagaga ccaugcagag gucgccucug gaaaaggcca gcguugucuc caaacuuuuu 180uucagcugga ccagaccaau uuugaggaaa ggauacagac agcgccugga auugucagac 240auauaccaaa ucccuucugu ugauucugcu gacaaucuau cugaaaaauu ggaaagagaa 300ugggauagag agcuggcuuc aaagaaaaau ccuaaacuca uuaaugcccu ucggcgaugu 360uuuuucugga gauuuauguu cuauggaauc uuuuuauauu uaggggaagu caccaaagca 420guacagccuc ucuuacuggg aagaaucaua gcuuccuaug acccggauaa caaggaggaa 480cgcucuaucg cgauuuaucu aggcauaggc uuaugccuuc ucuuuauugu gaggacacug 540cuccuacacc cagccauuuu uggccuucau cacauuggaa ugcagaugag aauagcuaug 600uuuaguuuga uuuauaagaa gacuuuaaag cugucaagcc guguucuaga uaaaauaagu 660auuggacaac uuguuagucu ccuuuccaac aaccugaaca aauuugauga aggacuugca 720uuggcacauu ucguguggau cgcuccuuug caaguggcac uccucauggg gcuaaucugg 780gaguuguuac aggcgucugc cuucugugga cuugguuucc ugauaguccu ugcccuuuuu 840caggcugggc uagggagaau gaugaugaag uacagagauc agagagcugg gaagaucagu 900gaaagacuug ugauuaccuc agaaaugauu gaaaauaucc aaucuguuaa ggcauacugc 960ugggaagaag caauggaaaa aaugauugaa aacuuaagac aaacagaacu gaaacugacu 1020cggaaggcag ccuaugugag auacuucaau agcucagccu ucuucuucuc aggguucuuu 1080gugguguuuu uaucugugcu ucccuaugca cuaaucaaag gaaucauccu ccggaaaaua 1140uucaccacca ucucauucug cauuguucug cgcauggcgg ucacucggca auuucccugg 1200gcuguacaaa caugguauga cucucuugga gcaauaaaca aaauacagga uuucuuacaa 1260aagcaagaau auaagacauu ggaauauaac uuaacgacua cagaaguagu gauggagaau 1320guaacagccu ucugggagga gggauuuggg gaauuauuug agaaagcaaa acaaaacaau 1380aacaauagaa aaacuucuaa uggugaugac agccucuucu ucaguaauuu cucacuucuu 1440gguacuccug uccugaaaga uauuaauuuc aagauagaaa gaggacaguu guuggcgguu 1500gcuggaucca cuggagcagg caagacuuca cuucuaaugg ugauuauggg agaacuggag 1560ccuucagagg guaaaauuaa gcacagugga agaauuucau ucuguucuca guuuuccugg 1620auuaugccug gcaccauuaa agaaaauauc aucuuuggug uuuccuauga ugaauauaga 1680uacagaagcg ucaucaaagc augccaacua gaagaggaca ucuccaaguu ugcagagaaa 1740gacaauauag uucuuggaga agguggaauc acacugagug gaggucaacg agcaagaauu 1800ucuuuagcaa gagcaguaua caaagaugcu gauuuguauu uauuagacuc uccuuuugga 1860uaccuagaug uuuuaacaga aaaagaaaua uuugaaagcu gugucuguaa acugauggcu 1920aacaaaacua ggauuuuggu cacuucuaaa auggaacauu uaaagaaagc ugacaaaaua 1980uuaauuuugc augaagguag cagcuauuuu uaugggacau uuucagaacu ccaaaaucua 2040cagccagacu uuagcucaaa acucauggga ugugauucuu ucgaccaauu uagugcagaa 2100agaagaaauu caauccuaac ugagaccuua caccguuucu cauuagaagg agaugcuccu 2160gucuccugga cagaaacaaa aaaacaaucu uuuaaacaga cuggagaguu uggggaaaaa 2220aggaagaauu cuauucucaa uccaaucaac ucuauacgaa aauuuuccau ugugcaaaag 2280acucccuuac aaaugaaugg caucgaagag gauucugaug agccuuuaga gagaaggcug 2340uccuuaguac cagauucuga gcagggagag gcgauacugc cucgcaucag cgugaucagc 2400acuggcccca cgcuucaggc acgaaggagg cagucugucc ugaaccugau gacacacuca 2460guuaaccaag gucagaacau ucaccgaaag acaacagcau ccacacgaaa agugucacug 2520gccccucagg caaacuugac ugaacuggau auauauucaa gaagguuauc ucaagaaacu 2580ggcuuggaaa uaagugaaga aauuaacgaa gaagacuuaa aggagugcuu uuuugaugau 2640auggagagca uaccagcagu gacuacaugg aacacauacc uucgauauau uacuguccac 2700aagagcuuaa uuuuugugcu aauuuggugc uuaguaauuu uucuggcaga gguggcugcu 2760ucuuugguug ugcuguggcu ccuuggaaac acuccucuuc aagacaaagg gaauaguacu 2820cauaguagaa auaacagcua ugcagugauu aucaccagca ccaguucgua uuauguguuu 2880uacauuuacg ugggaguagc cgacacuuug cuugcuaugg gauucuucag aggucuacca 2940cuggugcaua cucuaaucac agugucgaaa auuuuacacc acaaaauguu acauucuguu 3000cuucaagcac cuaugucaac ccucaacacg uugaaagcag gugggauucu uaauagauuc 3060uccaaagaua uagcaauuuu ggaugaccuu cugccucuua ccauauuuga cuucauccag 3120uuguuauuaa uugugauugg agcuauagca guugucgcag uuuuacaacc cuacaucuuu 3180guugcaacag ugccagugau aguggcuuuu auuauguuga gagcauauuu ccuccaaacc 3240ucacagcaac ucaaacaacu ggaaucugaa ggcaggaguc caauuuucac ucaucuuguu 3300acaagcuuaa aaggacuaug gacacuucgu gccuucggac ggcagccuua cuuugaaacu 3360cuguuccaca aagcucugaa uuuacauacu gccaacuggu ucuuguaccu gucaacacug 3420cgcugguucc aaaugagaau agaaaugauu uuugucaucu ucuucauugc uguuaccuuc 3480auuuccauuu uaacaacagg agaaggagaa ggaagaguug guauuauccu gacuuuagcc 3540augaauauca ugaguacauu gcagugggcu guaaacucca gcauagaugu ggauagcuug 3600augcgaucug ugagccgagu cuuuaaguuc auugacaugc caacagaagg uaaaccuacc 3660aagucaacca aaccauacaa gaauggccaa cucucgaaag uuaugauuau ugagaauuca 3720cacgugaaga aagaugacau cuggcccuca gggggccaaa ugacugucaa agaucucaca 3780gcaaaauaca cagaaggugg aaaugccaua uuagagaaca uuuccuucuc aauaaguccu 3840ggccagaggu ugacuuguca ucuugauuuc uggagaccac aagguaauga aaaauaauua 3900caagagucuu ccaucuguug caguauuaaa auggugggcc ucuugggaag aacuggauca 3960gggaagagua cuuuguuauc agcuuuuuug agacuacuga acacugaagg agaaauccag 4020aucgauggug ugucuuggga uucaauaacu uugcaacagu ggaggaaagc cuuuggagug 4080auaccacaga aaguauuuau uuuuucugga acauuuagaa aaaacuugga ucccuaugaa 4140caguggagug aucaagaaau auggaaaguu gcagaugagg uugggcucag aucugugaua 4200gaacaguuuc cugggaagcu ugacuuuguc cuuguggaug ggggcugugu ccuaagccau 4260ggccacaagc aguugaugug cuuggcuaga ucuguucuca guaaggcgaa gaucuugcug 4320cuugaugaac ccagugcuca uuuggaucca guaacauacc aaauaauuag aagaacucua 4380aaacaagcau uugcugauug cacaguaauu cucugugaac acaggauaga agcaaugcug 4440gaaugccaac aauuuuuggu cauagaagag aacaaagugc ggcaguacga uuccauccag 4500aaacugcuga acgagaggag ccucuuccgg caagccauca gccccuccga cagggugaag 4560cucuuucccc accggaacuc aagcaagugc aagucuaagc cccagauugc ugcucugaaa 4620gaggagacag aagaagaggu gcaagauaca aggcuuuaga gagcagcaua aauguugaca 4680ugggacauuu gcucauggaa uuggagcucg ugggacaguc accucaugga auuggagcuc 4740guggaacagu uaccucugcc ucagaaaaca aggaugaauu aaguuuuuuu uuaaaaaaga 4800aacauuuggu aaggggaauu gaggacacug auaugggucu ugauaaaugg cuuccuggca 4860auagucaaau ugugugaaag guacuucaaa uccuugaaga uuuaccacuu guguuuugca 4920agccagauuu uccugaaaac ccuugccaug ugcuaguaau uggaaaggca gcucuaaaug 4980ucaaucagcc uaguugauca gcuuauuguc uagugaaacu cguuaauuug uaguguugga 5040gaagaacuga aaucauacuu cuuaggguua ugauuaagua augauaacug gaaacuucag 5100cgguuuauau aagcuuguau uccuuuuucu cuccucuccc caugauguuu agaaacacaa 5160cuauauuguu ugcuaagcau uccaacuauc ucauuuccaa gcaaguauua gaauaccaca 5220ggaaccacaa gacugcacau caaaauaugc cccauucaac aucuagugag cagucaggaa 5280agagaacuuc cagauccugg aaaucagggu uaguauuguc caggucuacc aaaaaucuca 5340auauuucaga uaaucacaau acaucccuua ccugggaaag ggcuguuaua aucuuucaca 5400ggggacagga ugguucccuu gaugaagaag uugauaugcc uuuucccaac uccagaaagu 5460gacaagcuca cagaccuuug aacuagaguu uagcuggaaa aguauguuag ugcaaauugu 5520cacaggacag cccuucuuuc cacagaagcu ccagguagag gguguguaag uagauaggcc 5580augggcacug uggguagaca cacaugaagu ccaagcauuu agauguauag guugauggug 5640guauguuuuc aggcuagaug uauguacuuc augcugucua cacuaagaga gaaugagaga 5700cacacugaag aagcaccaau caugaauuag

uuuuauaugc uucuguuuua uaauuuugug 5760aagcaaaauu uuuucucuag gaaauauuua uuuuaauaau guuucaaaca uauauaacaa 5820ugcuguauuu uaaaagaaug auuaugaauu acauuuguau aaaauaauuu uuauauuuga 5880aauauugacu uuuuauggca cuaguauuuc uaugaaauau uauguuaaaa cugggacagg 5940ggagaaccua gggugauauu aaccaggggc caugaaucac cuuuuggucu ggagggaagc 6000cuuggggcug augcaguugu ugcccacagc uguaugauuc ccagccagca cagccucuua 6060gaugcaguuc ugaagaagau gguaccacca gucugacugu uuccaucaag gguacacugc 6120cuucucaacu ccaaacugac ucuuaagaag acugcauuau auuuauuacu guaagaaaau 6180aucacuuguc aauaaaaucc auacauuugu gugaaa 621637284DNAHomo sapiens 37aagcagcata ttctcaatac tatgtttcat taataattaa tagagatata tgaacacata 60aaagattcaa ttataatcac cttgtggatc taaatttcag ttgacttgtc atcttgattt 120ctggagacca caaggtaatg aaaaataatt acaagagtct tccatctgtt gcagtattaa 180aatggtgagt aagacaccct gaaaggaaat gttctattca tggtacaatg caattacagc 240tagcaccaaa ttcaacactg tttaactttc aacatattat tttg 284389RNAArtificial SequenceSynthetic 38gauggaaga 93914RNAArtificial SequenceSynthetic 39caacagaugg aaga 144019RNAArtificial SequenceSynthetic 40cugcaacaga uggaagacu 194119RNAArtificial SequenceSynthetic 41ugcaacagau ggaagacuc 194218RNAArtificial SequenceSynthetic 42cugcaacaga uggaagac 184318RNAArtificial SequenceSynthetic 43gcaacagaug gaagacuc 184418RNAArtificial SequenceSynthetic 44ugcaacagau ggaagacu 184517RNAArtificial SequenceSynthetic 45cugcaacaga uggaaga 174617RNAArtificial SequenceSynthetic 46caacagaugg aagacuc 174717RNAArtificial SequenceSynthetic 47ugcaacagau ggaagac 174817RNAArtificial SequenceSynthetic 48gcaacagaug gaagacu 174918RNAArtificial SequenceSynthetic 49cuccagaaau caagauga 185018RNAArtificial SequenceSynthetic 50uccagaaauc aagaugac 185117RNAArtificial SequenceSynthetic 51cuccagaaau caagaug 175217RNAArtificial SequenceSynthetic 52ccagaaauca agaugac 175317RNAArtificial SequenceSynthetic 53uccagaaauc aagauga 175418RNAArtificial SequenceSynthetic 54caacagaugg aagacucu 185518RNAArtificial SequenceSynthetic 55aacagaugga agacucuu 185617RNAArtificial SequenceSynthetic 56acagauggaa gacucuu 175717RNAArtificial SequenceSynthetic 57aacagaugga agacucu 175818RNAArtificial SequenceSynthetic 58uacugcaaca gauggaag 185918RNAArtificial SequenceSynthetic 59acugcaacag auggaaga 186017RNAArtificial SequenceSynthetic 60uacugcaaca gauggaa 176117RNAArtificial SequenceSynthetic 61acugcaacag auggaag 176219RNAArtificial SequenceSynthetic 62aucaagauga caagucaac 196319RNAArtificial SequenceSynthetic 63ucaagaugac aagucaacu 196418RNAArtificial SequenceSynthetic 64aucaagauga caagucaa 186518RNAArtificial SequenceSynthetic 65caagaugaca agucaacu 186618RNAArtificial SequenceSynthetic 66ucaagaugac aagucaac 186717RNAArtificial SequenceSynthetic 67aucaagauga caaguca 176817RNAArtificial SequenceSynthetic 68aagaugacaa gucaacu 176917RNAArtificial SequenceSynthetic 69ucaagaugac aagucaa 177017RNAArtificial SequenceSynthetic 70caagaugaca agucaac 177120RNAArtificial SequenceSynthetic 71aauuauuuuu cauuaccuug 20

Claims

1-31. (canceled)

32. A synthetic oligonucleotide molecule characterized by at least partly suppressing the inclusion of intron 22 cryptic exon in the mature mRNA of a CFTR gene having a 3849 +10 Kb C-to-T mutation, a) wherein the sequence of said synthetic oligonucleotide molecule comprises the sequence as set forth in any one of SEQ ID NOs: 4, 6, 10, or 17 or an active fragment thereof; or b) wherein the nucleotide sequence of said synthetic oligonucleotide molecule comprises the sequence as set forth in any one of SEQ ID NOs: 1-3, 5, 8, 40-48, or an active fragment thereof and is characterized by increasing the percentage of correctly spliced mature CFTR mRNA by at least about 10%; and decreasing the level of aberrantly spliced mature CFTR mRNA by at least about 20%, and wherein said synthetic oligonucleotide molecule or active fragment thereof consists of 17-21 consecutive bases.

33. The synthetic oligonucleotide molecule of claim 32, wherein said active fragment comprises a nucleotide sequence as set forth in SEQ ID NO: 40.

34. The synthetic oligonucleotide molecule of claim 32, comprising the sequence GAUGGAAGA (SEQ ID NO: 38).

35. The synthetic oligonucleotide molecule of claim 32, consisting of 18 or 19 consecutive nucleotide bases.

36. The synthetic oligonucleotide molecule of claim 32, comprising a chemically modified backbone comprising: a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a 2'-O-methyl-phosphorothioate (2'OMP) backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, a 2'-Methoxy Ethyl (2'MOE) backbone, an alternating locked nucleic acid backbone, constrained ethyl backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-.beta.-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, or a combination thereof.

37. The synthetic oligonucleotide molecule of claim 32, having at least 80% complementarity to a nucleotide sequence within SEQ ID NO: 37.

38. The synthetic oligonucleotide molecule of claim 32, having 100% complementarity to a nucleotide sequence within SEQ ID NO: 37.

39. A pharmaceutical composition comprising the synthetic oligonucleotide molecule of claim 32 and a pharmaceutically acceptable carrier.

40. The pharmaceutical composition of claim 39, further comprising a CFTR modifier; a CF drug, or a combination thereof, wherein said CFTR modifier is selected from the group consisting of: CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier.

41. The pharmaceutical composition of claim 40, wherein said CFTR modifier is ivacaftor, lumacaftor, tezacaftor, elexacaftor, VX-659, VX-152, or VX-440, or any combination thereof.

42. The pharmaceutical composition of claim 40, wherein said CF drug is an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof.

43. The pharmaceutical composition of claim 39, formulated for oral, nasal, inhalation, abdominal, subcutaneous, intra-peritoneal or intravenous administration.

44. A method for treating Cystic Fibrosis (CF) in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of a synthetic oligonucleotide that at least partly suppresses the inclusion of intron 22 cryptic exon in the mature CFTR mRNA of a CFTR gene having a 3849 +10 Kb C-to-T mutation, a) wherein the sequence of said synthetic oligonucleotide molecule comprises the sequence as set forth in any one of SEQ ID NOs: 4, 6, 10, or 17 or an active fragment thereof; or b) wherein the nucleotide sequence of said synthetic oligonucleotide molecule comprises the sequence as set forth in any one of SEQ ID NOs: 1-3, 5, 8, 40-48, or an active fragment thereof and increases the percentage of correctly spliced mature CFTR mRNA by at least about 10%; and decreases the level of aberrantly spliced mature CFTR mRNA by at least about 20%, and wherein said synthetic oligonucleotide molecule or active fragment thereof consists of 17-21 consecutive bases, thereby treating CF in the subject.

45. The method of claim 44, wherein said active fragment comprises a nucleotide sequence as set forth in SEQ ID NO: 40.

46. The method of claim 44, wherein said synthetic oligonucleotide molecule comprises the sequence GAUGGAAGA (SEQ ID NO: 38).

47. The method of claim 44, wherein said synthetic oligonucleotide comprises a backbone selected from the group consisting of: a phosphate-ribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate-deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone (2'OMP), a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, a 2'-Methoxy Ethyl (2'MOE) backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-.beta.-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, and a combination thereof.

48. The method of claim 44, wherein said synthetic oligonucleotide molecule has at least 80% complementarity to a sequence within SEQ ID NO: 36 or to a sequence within SEQ ID NO: 37.

49. The method of claim 44, further comprising administering to said subject a therapeutically effective amount of one or more CFTR modifiers comprising a CFTR-splicing-modulating agent, a Translational Read-Through agent, a CFTR amplifier, a CFTR potentiator, or a CFTR corrector.

50. The method of claim 44, wherein said CFTR modifier is selected from the group consisting of: a different synthetic oligonucleotide molecule capable of suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA, Ataluren, ELX-02, ivacaftor, QBW251, PTI-808, VX-561, lumacaftor, tezacaftor, elexacaftor, VX-659, VX-445, VX-152 and VX-440, GLPG2222, FDL169, PTI-801, and any combination thereof.

51. The method of claim 44, wherein said subject is heterozygous for said 3849 +10 Kb C-to-T mutation.

52. The method of claim 44, wherein said treating comprises improving at least one clinical parameter of CF selected from the group consisting of: lung function, time to the first pulmonary exacerbation, change in weight, change in height, a change in Body Mass Index (BMI), change in the concentration of sweat chloride, number and/or duration of pulmonary exacerbations, total number of days of hospitalization for pulmonary exacerbations, and the need for antibiotic therapy for sinopulmonary signs or symptoms.