Compositions And Methods For Inhibiting Expression Of The Lect2 Gene

Bettencourt; Brian ;   et al.

Patent Application Summary

U.S. patent application number 17/392122 was filed with the patent office on 2022-07-07 for compositions and methods for inhibiting expression of the lect2 gene. The applicant listed for this patent is Alnylam Pharmaceuticals, Inc.. Invention is credited to Brian Bettencourt, Kevin Fitzgerald, Gregory Hinkle, Alfica Sehgal.

Application Number20220213473 17/392122
Document ID /
Family ID1000006211155
Filed Date2022-07-07

United States Patent Application 20220213473
Kind Code A1
Bettencourt; Brian ;   et al. July 7, 2022

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE LECT2 GENE

Abstract

The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the LECT2 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of LECT2.


Inventors: Bettencourt; Brian; (Groton, MA) ; Fitzgerald; Kevin; (Brookline, MA) ; Hinkle; Gregory; (Plymouth, MA) ; Sehgal; Alfica; (Medford, MA)
Applicant:
Name City State Country Type

Alnylam Pharmaceuticals, Inc.

Cambridge

MA

US
Family ID: 1000006211155
Appl. No.: 17/392122
Filed: August 2, 2021

Related U.S. Patent Documents

Application Number Filing Date Patent Number
16052719 Aug 2, 2018
17392122
15026897 Apr 1, 2016 10077444
PCT/US2014/058624 Oct 1, 2014
16052719
62035819 Aug 11, 2014
61885693 Oct 2, 2013

Current U.S. Class: 1/1
Current CPC Class: C12N 2310/315 20130101; C12N 2310/321 20130101; C12N 2310/322 20130101; C12N 15/1136 20130101; C12N 15/113 20130101; C12N 2310/14 20130101; C12N 2310/3533 20130101; C12N 2310/3515 20130101; C12N 2310/351 20130101
International Class: C12N 15/113 20060101 C12N015/113

Claims



1. (canceled)

2. A double-stranded ribonucleic acid (dsRNA) for inhibiting expression of LECT2, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a LECT2 RNA transcript, which antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from one of the antisense sequences listed in Tables 2-3, 5-6 and 9-10.

3. The dsRNA of claim 2, wherein said dsRNA comprises at least one modified nucleotide.

4.-9. (canceled)

10. The dsRNA of claim 2, wherein the duplex region is 15-30, 17-23, 19-21, or 21-23 nucleotide pairs in length.

11.-16. (canceled)

17. The dsRNA of claim 2, wherein at least one strand comprises a 3' overhang of at least 1 or 2 nucleotide.

18. (canceled)

19. The dsRNA of claim 3, wherein the at least one modified nucleotide is chosen from a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, or both.

20. The dsRNA of claim 19, wherein the dsRNA comprises one or more phosphorothioate linkages.

21.-22. (canceled)

23. The dsRNA of claim 2 wherein the sense strand is conjugated to at least one ligand.

24.-25. (canceled)

26. The dsRNA of claim 23, wherein the ligand is a GalNAc ligand.

27. The dsRNA of claim 23, wherein the ligand is ##STR00028##

28.-29. (canceled)

30. The dsRNA of claim 23, wherein the ligand is attached via a linker, and the ligand and linker are as shown in Formula XXIV: ##STR00029##

31.-33. (canceled)

34. A cell containing the dsRNA of claim 2.

35. A pharmaceutical composition for inhibiting expression of a LECT2 gene, the composition comprising the dsRNA of claim 2.

36.-40. (canceled)

41. The pharmaceutical composition of claim 35, wherein said composition comprises a lipid formulation.

42.-48. (canceled)

49. A method of inhibiting LECT2 expression in a cell, the method comprising: (a) introducing into the cell the dsRNA of claim 2, and (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of a LECT2 gene, thereby inhibiting expression of the LECT2 gene in the cell.

50.-53. (canceled)

54. The method of claim 49, wherein the cell is a liver cell or a hepatocyte.

55. (canceled)

56. The method of claim 49, wherein the expression of LECT2 is inhibited by at least 30%.

57. (canceled)

58. A method of treating a LECT2 amyloidosis comprising administering to a subject in need of such treatment a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand that is 15-30 base pairs in length and an antisense strand that is 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ ID NO: 1 or a nucleotide sequence having an A to G substitution at nucleotide position 373 of SEQ ID NO: 1.

59.-64. (canceled)

65. The method of claim 58, wherein the dsRNA is administered at a dose of 0.05-50, 0.01-5, 0.1-0.5, or 1-10 mg/kg body weight of the subject.

66.-67. (canceled)

68. The method of claim 65, wherein the dsRNA is conjugated to a GalNAc ligand.

69.-74. (canceled)

75. The method of claim 58, wherein the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from one of the antisense sequences listed in Tables 2-3, 5-6 and 9-10.
Description



CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional of U.S. application Ser. No. 16/052,719, filed Aug. 2, 2018, which is a divisional of U.S. application Ser. No. 15/026,897, filed Apr. 1, 2016, now U.S. Pat. No. 10,077,444, which is the U.S. National Phase application under 35 U.S.C. .sctn. 371 of International Application No. PCT/US2014/058624, filed Oct. 1, 2014, which claims the benefit of U.S. Provisional Application No. 61/885,693, filed Oct. 2, 2013 and U.S. Provisional Application No. 62/035,819, filed Aug. 11, 2014. The contents of the aforesaid applications are hereby incorporated by reference in their entirety.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 29, 2014, is named A2038-7200WO_SL.txt and is 294,414 bytes in size.

FIELD OF THE INVENTION

[0003] The invention relates to the specific inhibition of the expression of the LECT2 gene.

BACKGROUND OF THE INVENTION

[0004] Amyloidosis is a group of diseases characterized by deposition of insoluble fibrous protein aggregates, called amyloids, in organs or tissues. Amyloids can form from mutant or wild type proteins. One system of nomenclature for amyloid diseases uses an abbreviation for the protein that forms amyloid deposits, preceded by the letter "A." Thus, for example, ALECT2 is the abbreviation for an amyloidosis involving deposit of amyloids formed from leukocyte cell derived chemotactic factor-2 (ALECT2).

[0005] LECT2 amyloidosis (ALECT2) is one of the most recently discovered types of amyloidosis. LECT2 amyloidosis has been observed in individuals with renal or hepatic amyloidosis. This form of amyloidosis can present with nephrotic syndrome or with liver involvement (e.g., hepatitis, e.g., chronic hepatitis). It may be particularly prevalent in Mexican Americans and/or individuals who are homozygous for the G allele encoding valine at position 40 in the mature LECT2 protein (or at position 58 in the unprocessed protein). Treatments for LECT2 amyloidosis are limited, and new treatments are needed.

SUMMARY OF THE INVENTION

[0006] The present invention describes methods and iRNA compositions for modulating the expression of a LECT2 gene. In certain embodiments, expression of a LECT2 gene is reduced or inhibited using a LECT2-specific iRNA. Such inhibition can be useful in treating disorders related to LECT2 expression, such as amyloidosis, e.g. a LECT2 amyloidosis (ALECT2).

[0007] Accordingly, described herein are compositions and methods that effect the RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the LECT2 gene, such as in a cell or in a subject (e.g., in a mammal, such as a human subject). Also described are compositions and methods for treating a disorder related to expression of a LECT2 gene, such as a LECT2 amyloidosis.

[0008] In some embodiments, the LECT2 amyloidosis is a renal amyloidosis.

[0009] In some embodiments, the LECT2 amyloidosis involves amyloid deposition in the kidney.

[0010] In some embodiments, LECT2 amyloidosis is associated with renal disease (e.g., nephrotic syndrome). In some embodiments, the amyloidosis is associated with proteinuria. In some embodiments, proteinuria is absent.

[0011] In some embodiments, the LECT2 amyloidosis is a hepatic amyloidosis. In some embodiments, the LECT2 amyloidosis involves amyloid deposition in the liver.

[0012] In some embodiments, the LECT2 amyloidosis is associated with inflammation in the liver (e.g., hepatitis, e.g., chronic hepatitis).

[0013] In some embodiments, the subject is of Mexican descent (e.g., a Mexican American).

[0014] In embodiments, the subject carries the G allele of the LECT2 gene that encodes valine at position 40 in the mature protein (or amino acid 58 in the unprocessed protein). In embodiments, the subject is homozygous for the G allele (G/G genotype). In embodiments, a LECT2 protein expressed in the subject has valine at position 40 in the mature protein (or at amino acid 58 in the unprocessed protein).

[0015] In some embodiments, the methods described herein are effective to inhibit amyloid deposition (e.g., by preventing amyloid deposition or reducing amyloid deposition, e.g., by reducing size, number, or extent of amyloid deposits) or symptoms associated with amyloid deposition.

[0016] As used herein, the term "iRNA," "RNAi", "iRNA agent," "RNAi agent," or "iRNA molecule," refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA as described herein inhibits LECT2 expression in a cell or mammal.

[0017] The iRNAs (e.g., dsRNAs) included in the compositions featured herein include an RNA strand (the antisense strand) having a region, e.g., a region that is 30 nucleotides or less, generally 19-24 nucleotides in length, that is substantially complementary to at least part of an mRNA transcript of a LECT2 gene (e.g., a mouse or human LECT2 gene) (also referred to herein as a "LECT2-specific iRNA"). In embodiments, the LECT2 mRNA transcript is a human LECT2 mRNA transcript, e.g., SEQ ID NO: 1. In embodiments, the LECT2 mRNA transcript has an A to G substitution at nucleotide position 373 of SEQ ID NO: 1. In embodiments, the mRNA transcript encodes valine at position 40 in the mature LECT2 protein (or amino acid 58 in the unprocessed protein). In embodiments, the mRNA transcript encodes isoleucine at position 40 in the mature LECT2 protein (or amino acid 58 in the unprocessed protein).

[0018] In embodiments, the iRNA (e.g, dsRNA) described herein comprises an antisense strand having a region that is substantially complementary to a region of a human LECT2 mRNA. In embodiments, the human LECT2 mRNA has the sequence of NM_002302.2 (SEQ ID NO: 1). In embodiments, the human LECT2 mRNA has an A to G substitution at nucleotide position 373 of SEQ ID NO: 1.

[0019] In other embodiments, an iRNA encompasses a dsRNA having an RNA strand (the antisense strand) having a region that is substantially complementary to a portion of a LECT2 mRNA. In one embodiment, the iRNA encompasses a dsRNA having an RNA strand (the antisense strand) having a region that is substantially complementary to a portion of a LECT2 mRNA, e.g., a human LECT2 mRNA (e.g., a human LECT2 mRNA as provided in NM_002302.2 (SEQ ID NO: 1) or having an A to G substitution at nucleotide position 373 of SEQ ID NO: 1).

[0020] In one embodiment, an iRNA for inhibiting expression of a LECT2 gene includes at least two sequences that are complementary to each other. The iRNA includes a sense strand having a first sequence and an antisense strand having a second sequence. The antisense strand includes a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding a LECT2 transcript, and the region of complementarity is 30 nucleotides or less, and at least 15 nucleotides in length. Generally, the iRNA is 19 to 24 nucleotides in length.

[0021] In some embodiments, the iRNA is 19-21 nucleotides in length. In some embodiments, the iRNA is 19-21 nucleotides in length and is in a lipid formulation, e.g. a lipid nanoparticle (LNP) formulation (e.g., an LNP11 formulation). In one embodiment, the iRNA targeting LECT2 is formulated in a stable nucleic acid lipid particle (SNALP).

[0022] In some embodiments, the iRNA is 21-23 nucleotides in length. In some embodiments, the iRNA is 21-23 nucleotides in length and is in the form of a conjugate, e.g., conjugated to one or more GalNAc derivatives as described herein.

[0023] In some embodiments the iRNA is from about 15 to about 25 nucleotides in length, and in other embodiments the iRNA is from about 25 to about 30 nucleotides in length. An iRNA targeting LECT2, upon contact with a cell expressing LECT2, inhibits the expression of a LECT2 gene (e.g., by at least 10%, at least 20%, at least 25%, at least 30%, at least 35% or at least 40%, at least 50%, at least 60%, at least 70%, or at least 80%) when assayed by a method known in the art or as described herein.

[0024] In one embodiment, an iRNA (e.g., a dsRNA) featured herein comprises or consists of a first sequence of a dsRNA that is selected from the group consisting of the sense sequences of Tables 2-3, 5-6 and 9-10 and a second sequence that is selected from the group consisting of the corresponding antisense sequences of Tables 2-3, 5-6 and 9-10.

[0025] In embodiments, an iRNA (e.g., dsRNA) featured herein comprises or consists of a sense and/or antisense sequence selected from those provided in Table 2-3, 5-6 and 9-10.

[0026] The iRNA molecules featured herein can include naturally occurring nucleotides or can include at least one modified nucleotide, including, but not limited to a 2'-O-methyl modified nucleotide, a nucleotide having a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative. Alternatively, the modified nucleotide may be chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an acyclic nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. Such a modified sequence can be based, e.g., on a first sequence of said iRNA selected from the group consisting of the sense sequences of Tables 2-3, 5-6 and 9-10, and a second sequence selected from the group consisting of the corresponding antisense sequences of Tables 2-3, 5-6 and 9-10.

[0027] In one embodiment, an iRNA as described herein targets a wildtype LECT2 RNA transcript variant, and in another embodiment, the iRNA targets a mutant transcript (e.g., a LECT2 RNA carrying an allelic variant). For example, an iRNA featured in the invention can target a polymorphic variant, such as a single nucleotide polymorphism (SNP), of LECT2.

[0028] In some embodiments, the iRNA (e.g., dsRNA) targets (e.g., reduces) mRNA that encodes valine at position 40 in the mature LECT2 protein (or amino acid 58 in the unprocessed protein). In some embodiments, the iRNA (e.g., dsRNA) targets (e.g., reduces) mRNA that encodes isoleucine at position 40 in the mature LECT2 protein (or amino acid 58 in the unprocessed protein). In another embodiment, the iRNA (e.g., dsRNA) targets (e.g., reduces) both mRNA that encodes valine and mRNA that encodes isoleucine at position 40 in the mature LECT2 protein (or amino acid 58 in the unprocessed protein).

[0029] In another embodiment, the iRNA targets both a wildtype and a mutant LECT2 transcript. In yet another embodiment, the iRNA targets a particular transcript variant of LECT2. In yet another embodiment, the iRNA agent targets multiple transcript variants.

[0030] In one embodiment, an iRNA featured in the invention targets a non-coding region of a LECT2 RNA transcript, such as the 5' or 3' untranslated region of a transcript.

[0031] In some embodiments, an iRNA as described herein is in the form of a conjugate, e.g., a carbohydrate conjugate, which may serve as a targeting moiety and/or ligand, as described herein. In one embodiment, the conjugate is attached to the 3' end of the sense strand of the dsRNA. In some embodiments, the conjugate is attached via a linker, e.g., via a bivalent or trivalent branched linker.

[0032] In some embodiments, the conjugate comprises one or more N-acetylgalactosamine (GalNAc) derivatives. Such a conjugate is also referred to herein as a GalNAc conjugate. In some embodiments, the conjugate targets the RNAi agent (e.g., dsRNA) to a particular cell, e.g., a liver cell, e.g., a hepatocyte. The GalNAc derivatives can be attached via a linker, e.g., a bivalent or trivalent branched linker. In particular embodiments, the conjugate is

##STR00001##

[0033] In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker, e.g., a linker as shown in the following schematic, wherein X is O or S

##STR00002##

[0034] In some embodiments, X is O. In some embodiments, X is S.

[0035] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below

##STR00003##

[0036] In some embodiments, the RNAi agent is conjugated to a ligand that targets the RNAi (e.g., dsRNA) to a desired organ (e.g., the liver) or to a particular cell type (e.g., hepatocytes). In embodiments, the RNAi agent is conjugated to a ligand (e.g., a GalNAc ligand, e.g., L96) that targets the RNAi agent (e.g., dsRNA) to the liver.

[0037] In an aspect provided herein is a pharmaceutical composition for inhibiting the expression of a LECT2 gene in an organism, generally a human subject. The composition typically includes one or more of the iRNAs described herein and a pharmaceutically acceptable carrier or delivery vehicle. In one embodiment, the composition is used for treating a disorder related to LECT2 expression, e.g., amyloidosis, e.g., LECT2 amyloidosis.

[0038] In one aspect, an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of LECT2, wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of SEQ ID NO: 1.

[0039] In a further aspect, an iRNA provided herein is a double stranded RNAi (dsRNA) comprising a sense strand complementary to an antisense strand, wherein said antisense strand comprises a region of complementarity to a LECT2 RNA transcript, wherein each strand has about 14 to about 30 nucleotides, wherein said double stranded RNAi agent is represented by formula (III):

sense: 5'n.sub.p--N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub- .j--N.sub.a-n.sub.q3' antisense: 3'n.sub.p'--N.sub.a'--(X'X'X).sub.k--N.sub.b'--Y'Y'Y'-n.sub.b'--(Z'Z'Z').- sub.l--N.sub.a'-n.sub.q'5' (III) [0040] wherein: [0041] j, k, and 1 are each independently 0 or 1; [0042] p, p', q, and q' are each independently 0-6; [0043] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 nucleotides which are either modified or unmodified or combinations thereof, each sequence comprising at least two differently modified nucleotides; [0044] each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 nucleotides which are either modified or unmodified or combinations thereof; [0045] each n.sub.p, n.sub.p', n.sub.q, and n.sub.q' independently represents an overhang nucleotide; [0046] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides; [0047] modifications on N.sub.b differ from the modification on Y and modifications on N.sub.b' differ from the modification on Y'.

[0048] In embodiments, the sense strand is conjugated to at least one ligand.

[0049] In embodiments, i is 1; j is 1; or both i and j are 1.

[0050] In embodiments, k is 1; 1 is 1; or both k and 1 are 1.

[0051] In embodiments, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.

[0052] In embodiments, the Y'Y'Y' motif occurs at the 11, 12 and 13 positions of the antisense strand from the 5'-end.

[0053] In embodiments, the Y' is 2'-O-methyl.

[0054] In embodiments, the duplex region is 15-30 nucleotide pairs in length.

[0055] In embodiments, the duplex region is 17-23 nucleotide pairs in length.

[0056] In embodiments, the duplex region is 19-21 nucleotide pairs in length.

[0057] In embodiments, the duplex region is 21-23 nucleotide pairs in length.

[0058] In embodiments, the modifications on the nucleotides are selected from the group consisting of a locked nucleic acid (LNA), an acyclic nucleotide, a hexitol or hexose nucleic acid (HNA), a cyclohexene nucleic acid (CeNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-- allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and any combination thereof.

[0059] In embodiments, the modifications on the nucleotides are 2'-O-methyl, 2'-fluoro or both.

[0060] In embodiments, the ligand comprises a carbohydrate.

[0061] In embodiments, the ligand is attached via a linker.

[0062] In embodiments, the linker is a bivalent or trivalent branched linker.

[0063] In embodiments, the ligand is

##STR00004##

[0064] In embodiments, the ligand and linker are as shown in Formula XXIV:

##STR00005##

[0065] In embodiments, the ligand is attached to the 3' end of the sense strand.

[0066] In embodiments, the dsRNA has (e.g., comprises) a nucleotide sequence (e.g., a sense and/or antisense sequence) selected from the group of sequences provided in Tables 2-3, 5-6 and 9-10.

[0067] In a further aspect, an iRNA provided herein is a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of LECT2, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to a LECT2 RNA transcript, which antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from one of the antisense sequences listed in any one of Tables 2-3, 5-6 and 9-10.

[0068] In some embodiments, the dsRNA comprises at least one modified nucleotide.

[0069] In some embodiments, at least one of the modified nucleotides is chosen from the group consisting of: a 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.

[0070] In some embodiments, the modified nucleotide is chosen from the group consisting of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an acyclic nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.

[0071] In some embodiments, the region of complementarity is at least 17 nucleotides in length.

[0072] In some embodiments, the region of complementarity is between 19 and 21 nucleotides in length.

[0073] In some embodiments, the region of complementarity is 19 nucleotides in length.

[0074] In some embodiments, each strand is no more than 30 nucleotides in length.

[0075] In some embodiments, at least one strand comprises a 3' overhang of at least 1 nucleotide.

[0076] In some embodiments, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0077] In some embodiments, an iRNA (e.g., a dsRNA) described herein further comprises a ligand.

[0078] In some embodiments, the ligand is a GalNAc ligand.

[0079] In some embodiments, the ligand targets the iRNA (e.g., the dsRNA) to the liver (e.g., to hepatocytes).

[0080] In some embodiments, the ligand is conjugated to the 3' end of the sense strand of the dsRNA.

[0081] In some embodiments, the region of complementarity consists of an antisense sequence selected from the antisense sequences provided in Tables 2-3, 5-6 and 9-10.

[0082] In embodiments, the region of complementarity consists of an antisense sequence selected from a duplex disclosed herein, wherein the duplex suppresses LECT2 mRNA or protein expression by at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85% or 90%.

[0083] In some embodiments, the dsRNA comprises a sense strand comprising or consisting of a sense strand sequence selected from Table 2, 3, 5, 6, 9 or 10, and an antisense strand comprising or consisting of an antisense sequence selected from Table 2, 3, 5, 6, 9 or 10. In embodiments, the dsRNA comprises or consists of a pair of corresponding sense and antisense sequences selected from those of the duplexes disclosed in Tables 2-3 and 5-11. In certain embodiments, the dsRNA comprises or consists of a pair of corresponding sense and antisense sequences selected from those of the duplexes disclosed in Table 8.

[0084] In one aspect, the invention provides a cell containing at least one iRNA (e.g., dsRNAs) disclosed herein. The cell is typically a mammalian cell, such as a human cell. In embodiments, the cell is a liver cell (e.g., a hepatocyte).

[0085] In an aspect provided herein is a pharmaceutical composition for inhibiting expression of a LECT2 gene, the composition comprising an iRNA (e.g., a dsRNA) described herein.

[0086] In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is administered in an unbuffered solution. In embodiments, the unbuffered solution is saline or water.

[0087] In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA is administered with a buffer solution. In embodiments, the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof. In embodiments, the buffer solution is phosphate buffered saline (PBS).

[0088] In embodiments of the pharmaceutical compositions described herein, the iRNA (e.g., dsRNA) is targeted to the liver (e.g., to hepatocytes).

[0089] In embodiments of the pharmaceutical compositions described herein, the composition is administered intravenously.

[0090] In embodiments of the pharmaceutical compositions described herein, the composition is administered subcutaneously.

[0091] In embodiments, a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand) that targets the iRNA (e.g., dsRNA) to a liver cell, e.g., a hepatocyte.

[0092] In embodiments, a pharmaceutical composition comprises an iRNA (e.g., a dsRNA) described herein that comprises a ligand (e.g., a GalNAc ligand), and the pharmaceutical composition is administered subcutaneously. In embodiments, the ligand targets the iRNA (e.g., dsRNA) to a liver cell, e.g., a hepatocyte.

[0093] In certain embodiments, a pharmaceutical composition, e.g., a composition described herein, includes a lipid formulation. In some embodiments, the RNAi agent is in a LNP formulation, e.g., a MC3 formulation. In some embodiments, the LNP formulation targets the RNAi agent to a particular cell, e.g., a liver cell (e.g., a hepatocyte). In embodiments, the lipid formulation is a LNP11 formulation. In embodiments, the composition is administered intravenously.

[0094] In another embodiment, the pharmaceutical composition is formulated for administration according to a dosage regimen described herein, e.g., not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week. In another embodiment, the administration of the pharmaceutical composition can be maintained for a month or longer, e.g., one, two, three, or six months, or one year or longer.

[0095] In another embodiment, a composition containing an iRNA featured in the invention, e.g., a dsRNA targeting LECT2, is administered in conjunction with a second therapy for a disorder related to LECT2 expression (e.g., a LECT2 amyloidosis). An iRNA or composition comprising an iRNA provided herein can be administered before, after, or concurrent with a second therapy. In embodiments, the iRNA is administered before the second therapy. In embodiments, the iRNA is administered after the second therapy. In embodiments, the iRNA is administered concurrent with the second therapy.

[0096] In some embodiments, the second therapy is a non-iRNA therapeutic agent that is effective to treat the disorder or symptoms of the disorder.

[0097] In some embodiments, the disorder to be treated by the compositions or methods disclosed herein is a LECT2 amyloidosis that affects kidney function, e.g., through amyloid deposition in the kidney. In some such embodiments, the iRNA is administered in conjunction with a therapy that supports kidney function (e.g., dialysis). In embodiments, the iRNA is administered in conjunction with a diuretic, an ACE (angiotensin converting enzyme) inhibitor, an angiotensin receptor blocker, and/or dialysis, e.g., to support or manage kidney function.

[0098] In some embodiments, the disorder to be treated by the compositions or methods disclosed herein is a LECT2 amyloidosis involving amyloid deposits in the liver. In some such embodiments, the iRNA is administered in conjunction with a therapy that supports liver function.

[0099] In some embodiments, the disorder to be treated by the compositions or methods disclosed herein is a LECT2 amyloidosis, and the iRNA is administered in conjunction with removal of all or part of the organ(s) affected by the amyloidosis (e.g., resection of all or part of kidney or liver tissue affected by the amyloidosis). The removal is optionally conducted in conjunction with a replacement of all or part of the organ removed (e.g., in conjunction with a kidney or liver organ transplant).

[0100] In an aspect provided herein is a method of inhibiting LECT2 expression in a cell, the method comprising: (a) introducing into the cell an iRNA (e.g., a dsRNA) described herein and (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of a LECT2 gene, thereby inhibiting expression of the LECT2 gene in the cell.

[0101] In an aspect provided herein is a method for reducing or inhibiting the expression of a LECT2 gene in a cell (e.g., a liver cell, e.g., a hepatocyte). The method includes contacting the cell with a dsRNA as described herein, thereby inhibiting expression of a LECT2 gene. "Contacting," as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject (e.g., a liver cell) may be contacted when a composition comprising an RNAi is administered (e.g., intravenously or subcutaneously) to the subject.

[0102] In embodiments, the method includes [0103] (a) introducing into the cell a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA includes at least two sequences that are complementary to each other. The dsRNA has a sense strand having a first sequence and an antisense strand having a second sequence; the antisense strand has a region of complementarity that is substantially complementary to at least a part of an mRNA encoding LECT2, and where the region of complementarity is 30 nucleotides or less, e.g., 15-30 nucleotides in length, and generally 19-24 nucleotides in length, and where the dsRNA upon contact with a cell expressing LECT2, inhibits expression of a LECT2 gene by at least 10%, e.g., at least 20%, at least 30%, at least 40% or more; and [0104] (b) maintaining the cell of step (a) for a time sufficient to obtain degradation of the mRNA transcript of the LECT2 gene, thereby reducing or inhibiting expression of a LECT2 gene in the cell.

[0105] In embodiments of the foregoing methods of inhibiting LECT2 expression in a cell, the cell is treated ex vivo, in vitro, or in vivo. In embodiments, the cell is a hepatocyte.

[0106] In embodiments, the cell is present in a subject in need of treatment, prevention and/or management of a disorder related to LECT2 expression.

[0107] In embodiments, the disorder is a LECT2 amyloidosis, as described herein.

[0108] In embodiments, the expression of LECT2 is inhibited by at least 30%.

[0109] In embodiments, the iRNA (e.g., dsRNA) has an IC.sub.50 in the range of 0.0005-1 nM, e.g., between 0.001 and 0.2 nM, between 0.002 and 0.1 nM, between 0.005 and 0.075 nM, or between 0.01 and 0.05 nM. In embodiments, the iRNA (e.g., dsRNA) has an IC.sub.50 equal to or less than 0.02 nM, e.g., between 0.0005 and 0.02 nM, between 0.001 and 0.02 nM, between 0.005 and 0.02 nM, or between 0.01 and 0.02 nM. In embodiments, the iRNA (e.g., dsRNA) has an IC.sub.50 in the range of 0.01-1 nM.

[0110] In embodiments, the cell (e.g., the hepatocyte) is a mammalian cell (e.g., a human, non-human primate, or rodent cell).

[0111] In one embodiment, the subject is a mammal (e.g., a human) having a LECT2 amyloidosis.

[0112] In one embodiment, the dsRNA introduced reduces or inhibits expression of a LECT2 gene in the cell.

[0113] In one embodiment, the dsRNA inhibits expression of a LECT2 gene, or inhibits amyloid deposition (e.g., by preventing amyloid deposition or reducing amyloid deposition, e.g., by reducing size, number, or extent of amyloid deposits). The inhibition optionally involves an inhibition of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more compared to a reference, (e.g., a control that is untreated or treated with a non-targeting dsRNA (e.g., a dsRNA that does not target LECT2)).

[0114] In other aspects, the disclosure provides methods for treating pathological processes related to LECT2 expression (e.g., amyloid deposition). In one embodiment, the method includes administering to a subject, e.g., a patient in need of such treatment, an effective (e.g., a therapeutically or prophylactically effective) amount of a dsRNA provided herein.

[0115] In an aspect provided herein is a method of treating and/or preventing a disorder related to LECT2 expression (e.g., a LECT2 amyloidosis) comprising administering to a subject in need of such treatment a therapeutically effective amount of an iRNA (e.g., a dsRNA) described herein, or a composition comprising an iRNA (e.g., a dsRNA) described herein.

[0116] In an aspect provided herein is a method of treating a disorder related to LECT2 expression (e.g., LECT2 amyloidosis) comprising administering to a subject in need of such treatment a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of a LECT2 mRNA transcript, e.g., a human LECT2 mRNA transcript, e.g., SEQ ID NO: 1 or a nucleotide sequence having an A to G substitution at nucleotide position 373 of SEQ ID NO: 1. In one embodiment, the iRNA (e.g., dsRNA) targets mRNA that encodes valine at position 40 in the mature LECT2 protein (or amino acid 58 in the unprocessed protein).

[0117] In one embodiment provided herein is a method of treating a subject having a LECT2 amyloidosis, the method comprising administering to the subject a double-stranded ribonucleic acid (dsRNA), wherein said dsRNA comprises a sense strand and an antisense strand 15-30 base pairs in length and the antisense strand is complementary to at least 15 contiguous nucleotides of a LECT2 mRNA transcript, e.g., a human LECT2 mRNA transcript, e.g., SEQ ID NO: 1 or a nucleotide sequence having an A to G substitution at nucleotide position 373 of SEQ ID NO: 1. In one embodiment, the iRNA (e.g., dsRNA) targets mRNA that encodes valine at position 40 in the mature LECT2 protein (or amino acid 58 in the unprocessed protein).

[0118] In some embodiments, administration of the iRNA targeting LECT2 alleviates or relieves the severity of at least one symptom of a disorder related to LECT2 expression in the patient. In one embodiment, subject has a LECT2 amyloidosis. In another embodiment, the subject is at risk for developing a LECT2 amyloidosis.

[0119] In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation.

[0120] In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate.

[0121] In embodiments, the iRNA (e.g., dsRNA) is administered at a dose of 0.05-50 mg/kg.

[0122] In embodiments, the iRNA (e.g., dsRNA) is administered at a concentration of 0.01 mg/kg-5 mg/kg bodyweight of the subject.

[0123] In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation and is administered at a dose of 0.05-5 mg/kg. In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation and is administered at a dose of 0.1 to 0.5 mg/kg.

[0124] In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered at a dose of 0.5-50 mg/kg. In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered at a dose of 1 to 10 mg/kg.

[0125] In embodiments, the method inhibits expression of a LECT2 gene, or inhibits amyloid deposition (e.g., by preventing amyloid deposition or reducing amyloid deposition, e.g., by reducing size, number, or extent of amyloid deposits). The inhibition optionally involves an inhibition of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% compared to a reference (e.g., a control that is untreated or treated with a non-targeting dsRNA (e.g., a dsRNA that does not target LECT2)).

[0126] In embodiments, the iRNA (e.g., dsRNA) has an IC.sub.50 in the range of 0.0005-1 nM, e.g., between 0.001 and 0.2 nM, between 0.002 and 0.1 nM, between 0.005 and 0.075 nM, or between 0.01 and 0.05 nM. In embodiments, the iRNA (e.g., dsRNA) has an IC.sub.50 equal to or less than 0.02 nM, e.g., between 0.0005 and 0.02 nM, between 0.001 and 0.02 nM, between 0.005 and 0.02 nM, or between 0.01 and 0.02 nM. In embodiments, the iRNA (e.g., dsRNA) has an IC.sub.50 in the range of 0.01-1 nM.

[0127] In embodiments, a method described herein ameliorates a symptom associated with a LECT2 related disorder (e.g., a LECT2 amyloidosis).

[0128] In embodiments, a method described herein inhibits expression of a LECT2 gene in the subject.

[0129] In embodiments, a method described herein inhibits amyloid deposition (e.g., by preventing amyloid deposition or reducing amyloid deposition, e.g., by reducing size, number, or extent of amyloid deposits).

[0130] In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered according to a dosing regimen.

[0131] In embodiments, the subject is of Mexican descent (e.g., a Mexican American).

[0132] In embodiments, the subject carries the G allele of the LECT2 gene that encodes valine at position 40 in the mature protein (amino acid 58 in the unprocessed protein). In embodiments, the subject is homozygous for the G allele (G/G genotype).

[0133] In embodiments, a LECT2 protein expressed in the subject has valine at position 40 in the mature protein (or at amino acid 58 in the unprocessed protein).

[0134] In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered repeatedly, e.g., according to a dosing regimen.

[0135] In embodiments, the iRNA (e.g., dsRNA) or composition comprising the iRNA is administered subcutaneously. In embodiments, the iRNA is in the form of a GalNAc conjugate. In embodiments, the iRNA (e.g., the dsRNA) is administered at a dose of 0.5-50 mg/kg. In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered at a dose of 1 to 10 mg/kg.

[0136] In an aspect provided herein is a vector encoding at least one strand of an iRNA (e.g., a dsRNA) as described herein.

[0137] In an aspect provided herein is a vector encoding at least one strand of a dsRNA, wherein said dsRNA comprises a region of complementarity to at least a part of an mRNA encoding LECT2, wherein said dsRNA is 30 base pairs or less in length, and wherein said dsRNA targets said mRNA for cleavage.

[0138] In embodiments, the region of complementarity is at least 15 nucleotides in length.

[0139] In embodiments, the region of complementarity is 19 to 21 nucleotides in length.

[0140] In one aspect, a vector is provided for inhibiting the expression of a LECT2 gene in a cell. In one embodiment, the vector comprises an iRNA as described herein. In one embodiment, the vector includes at least one regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of an iRNA as described herein. In one embodiment the vector comprises at least one strand of a LECT2 iRNA.

[0141] In an aspect provided herein is a cell comprising a vector as described herein.

[0142] In an aspect provided herein is a cell containing a vector for inhibiting the expression of a LECT2 gene in a cell. The vector includes a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of an iRNA described herein.

[0143] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0144] The details of various embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be apparent from the description and the drawings, and from the claims.

DESCRIPTION OF THE DRAWINGS

[0145] FIG. 1 depicts a human LECT2 mRNA transcript sequence (Ref. Seq. NM_002302.2 GI:59806344, record dated Apr. 17, 2013; SEQ ID NO: 1).

DETAILED DESCRIPTION OF THE INVENTION

[0146] iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Described herein are iRNAs and methods of using them for modulating (e.g., inhibiting) the expression of a LECT2 gene. Also provided are compositions and methods for treatment of disorders related to LECT2 expression, such as amyloidosis (e.g., LECT2 amyloidosis).

[0147] The iRNAs of the compositions featured herein include an RNA strand (the antisense strand) having a region which is 30 nucleotides or less in length, i.e., 15-30 nucleotides in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an mRNA transcript of a LECT2 gene (also referred to herein as an "LECT2-specific iRNA"). The use of such an iRNA enables the targeted degradation of mRNAs of genes that are implicated in disorders related to LECT2 expression, as described herein. Very low dosages of LECT2-specific iRNAs can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of a LECT2 gene. iRNAs targeting LECT2 can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of a LECT2 gene, which can be assessed, e.g., in cell based assays.

[0148] The following description discloses how to make and use compositions containing iRNAs to modulate (e.g., inhibit) the expression of a LECT2 gene, as well as compositions and methods for treating disorders related to expression of a LECT2 gene.

[0149] Embodiments of the pharmaceutical compositions featured herein include an iRNA having an antisense strand comprising a region which is 30 nucleotides or less in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part of an RNA transcript of a LECT2 gene.

[0150] In some aspects, pharmaceutical compositions containing a LECT2 iRNA and a pharmaceutically acceptable carrier, methods of using the compositions to inhibit expression of a LECT2 gene, and methods of using the pharmaceutical compositions to treat disorders related to expression of a LECT2 gene (e.g., LECT2 amyloidosis) are featured herein.

I. Definitions

[0151] For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims, are provided below. If there is an apparent discrepancy between the usage of a term in other parts of this specification and its definition provided in this section, the definition in this section shall prevail.

[0152] As used herein, "LECT2" refers to leukocyte chemotactic factor 2 (also known as leukocyte cell-derived chemotaxin 2, chondromodulin-II, chm-II or chm2). See, e.g., Yamagoe S et al. Genomics, Mar. 15, 1998; 48(3):324-9. LECT2 was first identified as a novel neutrophil chemotactic protein and is identical with chondromodulin II, a growth stimulator for chondrocytes and osteoblasts. The human LECT2 gene was mapped to chromosome 5q31.1-q32. Ibid.

[0153] The sequence of a human LECT2 mRNA transcript can be found at NM_002302.2 (SEQ ID NO: 1). The sequence of a mouse LECT2 mRNA can be found at NM_010702.1 and at NM_010702.2, and the sequence of a rat LECT2 mRNA can be found at NM_001108405.1.

[0154] The human LECT2 protein is a secreted, 16 kDa protein. The LECT2 protein is secreted by the liver. It has high sequence similarity to the chondromodulin repeat regions of the chicken myb-induced myeloid 1 protein (world wide web address: genecards.org/cgi-bin/carddisp.pl?gene=LECT2; accessed Aug. 29, 2013). Polymorphism in the LECT2 gene has been associated with rheumatoid arthritis. Ibid.

[0155] LECT2 is expressed in various tissues, including the brain and stomach as well as the liver. Koshimizu, Y & Ohtomi, M. (2010) Brain Res. 1311:1-11. In a study using indirect immunoperoxidase staining to investigate the expression of LECT2 in normal and diseased human organs and tissues other than liver, it was found that LECT2 was generally expressed in vascular, endothelial and smooth muscle cells, adipocytes, cerebral nerve cells, apical squamous epithelia, parathyroid cells, sweat and sebaceous glandular epithelia, Hassall bodies and some mononuclear cells in immunohematopoeietic tissue. This protein was generally negative, although occasionally positively stained in osteoblasts, chondrocytes, cardiac and skeletal muscle cells, smooth muscle cells of the gastrointestinal tract, and the epithelial cells of some tissues. Nagai et al. (1998) Pathol Int. 48(11):882-6.

[0156] The human LECT2 gene codes for 151 amino acids including an 18 amino acid signal peptide. The secreted protein has 133 residues. A G/A polymorphism at nucleotide 172 in exon 3 of the gene (codon change GTC to ATC) has been identified and accounts for the presence of either valine or isoleucine at position 58 of the unprocessed protein (or position 40 of the mature protein). The G allele has an overall frequency of 0.477 and a frequency range of 0.6-0.7 in individuals of European descent. See Benson, M. D. et al. (2008) Kidney International, 74: 218-222; Murphy, C. L. et al. (2010) Am J Kidney Dis, 56(6):1100-1107. Patients with LECT2 amyloidosis typically are homozygous for the G allele. Without wishing to be bound by theory, it has been suggested that replacement of the buried isoleucine (A allele) side chain with valine (G allele) could destabilize the protein and possibly account for the amyloidogenic propensity of this LECT2 variant. Murphy, C. L. et al. (2010) Am J Kidney Dis, 56(6):1100-1107.

[0157] As used herein, a "LECT2 amyloidosis" or "ALECT2" includes an amyloidosis involving deposits of amyloid or amyloid fibrils that contain a LECT2 protein (e.g., any polymorphic variant of a LECT2 protein) or a portion of a LECT2 protein. The LECT2 protein can be a variant (e.g., a mutant) LECT2 protein. The amyloidosis can be systemic or local. In embodiments, the LECT2 amyloidosis involves amyloid deposits in the kidney and/or liver.

[0158] "G," "C," "A," "T" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.

[0159] As used herein, the term "iRNA," "RNAi", "iRNA agent," or "RNAi agent" refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript, e.g., via an RNA-induced silencing complex (RISC) pathway. In one embodiment, an iRNA as described herein effects inhibition of LECT2 expression. Inhibition of ALECT2 expression may be assessed based on a reduction in the level of ALECT2 mRNA or a reduction in the level of the ALECT2 protein. As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an ALECT2 gene, including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion. For example, the target sequence will generally be from 9-36 nucleotides in length, e.g., 15-30 nucleotides in length, including all sub-ranges therebetween. As non-limiting examples, the target sequence can be from 15-30 nucleotides, 15-26 nucleotides, 15-23 nucleotides, 15-22 nucleotides, 15-21 nucleotides, 15-20 nucleotides, 15-19 nucleotides, 15-18 nucleotides, 15-17 nucleotides, 18-30 nucleotides, 18-26 nucleotides, 18-23 nucleotides, 18-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, 19-30 nucleotides, 19-26 nucleotides, 19-23 nucleotides, 19-22 nucleotides, 19-21 nucleotides, 19-20 nucleotides, 20-30 nucleotides, 20-26 nucleotides, 20-25 nucleotides, 20-24 nucleotides, 20-23 nucleotides, 20-22 nucleotides, 20-21 nucleotides, 21-30 nucleotides, 21-26 nucleotides, 21-25 nucleotides, 21-24 nucleotides, 21-23 nucleotides, or 21-22 nucleotides.

[0160] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0161] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50.degree. C. or 70.degree. C. for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[0162] Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary" for the purposes described herein.

[0163] "Complementary" sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs includes, but are not limited to, G:U Wobble or Hoogstein base pairing.

[0164] The terms "complementary," "fully complementary" and "substantially complementary" herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.

[0165] As used herein, a polynucleotide that is "substantially complementary to at least part of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding an ALECT2 protein). For example, a polynucleotide is complementary to at least a part of a LECT2 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding LECT2. As another example, a polynucleotide is complementary to at least a part of a LECT2 mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding LECT2.

[0166] The term "double-stranded RNA" or "dsRNA," as used herein, refers to an iRNA that includes an RNA molecule or complex of molecules having a hybridized duplex region that comprises two anti-parallel and substantially complementary nucleic acid strands, which will be referred to as having "sense" and "antisense" orientations with respect to a target RNA. The duplex region can be of any length that permits specific degradation of a desired target RNA, e.g., through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g., 15-30 base pairs in length. Considering a duplex between 9 and 36 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 and any sub-range therein between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, or 21-22 base pairs. dsRNAs generated in the cell by processing with Dicer and similar enzymes are generally in the range of 19-22 base pairs in length. One strand of the duplex region of a dsDNA comprises a sequence that is substantially complementary to a region of a target RNA. The two strands forming the duplex structure can be from a single RNA molecule having at least one self-complementary region, or can be formed from two or more separate RNA molecules. Where the duplex region is formed from two strands of a single molecule, the molecule can have a duplex region separated by a single stranded chain of nucleotides (herein referred to as a "hairpin loop") between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure. The hairpin loop can comprise at least one unpaired nucleotide; in some embodiments the hairpin loop can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides. Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is referred to as a "linker." The term "siRNA" is also used herein to refer to a dsRNA as described above.

[0167] In another embodiment, the iRNA agent may be a "single-stranded siRNA" that is introduced into a cell or organism to inhibit a target mRNA. Single-stranded RNAi agents bind to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. The single-stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein (e.g., sequences provided in Tables 2-3, 5-6 and 9-10) may be used as a single-stranded siRNA as described herein or as chemically modified by the methods described in Lima et al., (2012) Cell 150; 883-894.

[0168] In another aspect, the RNA agent is a "single-stranded antisense RNA molecule." An single-stranded antisense RNA molecule is complementary to a sequence within the target mRNA. Single-stranded antisense RNA molecules can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. Alternatively, the single-stranded antisense molecules inhibit a target mRNA by hybridizing to the target and cleaving the target through an RNaseH cleavage event. The single-stranded antisense RNA molecule may be about 10 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence. In one embodiment, the single-stranded antisense RNA molecule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides complementary to any of the target sites described herein, e.g., sequences provided in any one of Tables 2-3, 5-6 and 9-10. In another embodiment, the single-stranded antisense RNA molecule may comprise a sequence that is at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense nucleotide sequences described herein, e.g., sequences provided in any one of Tables 2-3, 5-6 and 9-10.

[0169] The skilled artisan will recognize that the term "RNA molecule" or "ribonucleic acid molecule" encompasses not only RNA molecules as expressed or found in nature, but also analogs and derivatives of RNA comprising one or more ribonucleotide/ribonucleoside analogs or derivatives as described herein or as known in the art. Strictly speaking, a "ribonucleoside" includes a nucleoside base and a ribose sugar, and a "ribonucleotide" is a ribonucleoside with one, two or three phosphate moieties. However, the terms "ribonucleoside" and "ribonucleotide" can be considered to be equivalent as used herein. The RNA can be modified in the nucleobase structure, in the ribose structure, or in the ribose-phosphate backbone structure, e.g., as described herein below. However, the molecules comprising ribonucleoside analogs or derivatives must retain the ability to form a duplex. As non-limiting examples, an RNA molecule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group, a locked nucleoside, an abasic nucleoside, an acyclic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramidate or a non-natural base comprising nucleoside, or any combination thereof. Alternatively, an RNA molecule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 or more, up to the entire length of the dsRNA molecule. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molecule. In one embodiment, modified RNAs contemplated for use in methods and compositions described herein are peptide nucleic acids (PNAs) that have the ability to form the required duplex structure and that permit or mediate the specific degradation of a target RNA, e.g., via a RISC pathway.

[0170] In one aspect, a modified ribonucleoside includes a deoxyribonucleoside. In such an instance, an iRNA agent can comprise one or more deoxynucleosides, including, for example, a deoxynucleoside overhang(s), or one or more deoxynucleosides within the double stranded portion of a dsRNA. In certain embodiments, the RNA molecule comprises a percentage of deoxyribonucleoses of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95% or higher (but not 100%) deoxyribonucleosides, e.g., in one or both strands. In other embodiments, the term "iRNA" does not encompass a double stranded DNA molecule (e.g., a naturally-occurring double stranded DNA molecule or a 100% deoxynucleoside-containing DNA molecule).

[0171] In one aspect, an RNA interference agent includes a single stranded RNA that interacts with a target RNA sequence to direct the cleavage of the target RNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al., Genes Dev. 2001, 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleaves the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect the invention relates to a single stranded RNA that promotes the formation of a RISC complex to effect silencing of the target gene.

[0172] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) may be on the sense strand, the antisense strand or any combination thereof Furthermore, the nucleotide(s) of an overhang can be present on the 5' end, 3' end or both ends of either an antisense or sense strand of a dsRNA.

[0173] In one embodiment, the anti sense strand of a dsRNA has a 1-10 nucleotide overhang at the 3' end and/or the 5' end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide overhang at the 3' end and/or the 5' end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

[0174] The terms "blunt" or "blunt ended" as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide analogs at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a "blunt ended" dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule will be double-stranded over its entire length.

[0175] The term "antisense strand" or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence. As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches may be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5' and/or 3' terminus.

[0176] The term "sense strand," or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

[0177] As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle. A SNALP represents a vesicle of lipids coating a reduced aqueous interior comprising a nucleic acid such as an iRNA or a plasmid from which an iRNA is transcribed. SNALPs are described, e.g., in U.S. Patent Application Publication Nos. 2006/0240093, 2007/0135372, and in International Application No. WO 2009/082817. These applications are incorporated herein by reference in their entirety.

[0178] "Introducing into a cell," when referring to an iRNA, means facilitating or effecting uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of an iRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; an iRNA may also be "introduced into a cell," wherein the cell is part of a living organism. In such an instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, iRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be by a .beta.-glucan delivery system, such as those described in U.S. Pat. Nos. 5,032,401 and 5,607,677, and U.S. Publication No. 2005/0281781, which are hereby incorporated by reference in their entirety. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or known in the art.

[0179] As used herein, the term "modulate the expression of," refers to at an least partial "inhibition" or partial "activation" of a LECT2 gene expression in a cell treated with an iRNA composition as described herein compared to the expression of LECT2 in a control cell. A control cell includes an untreated cell, or a cell treated with a non-targeting control iRNA.

[0180] The terms "activate," "enhance," "up-regulate the expression of," "increase the expression of," and the like, in so far as they refer to a LECT2 gene, herein refer to the at least partial activation of the expression of a LECT2 gene, as manifested by an increase in the amount of LECT2 mRNA, which may be isolated from or detected in a first cell or group of cells in which a LECT2 gene is transcribed and which has or have been treated such that the expression of a LECT2 gene is increased, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells).

[0181] In one embodiment, expression of a LECT2 gene is activated by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA as described herein. In some embodiments, a LECT2 gene is activated by at least about 60%, 70%, or 80% by administration of an iRNA featured in the invention. In some embodiments, expression of a LECT2 gene is activated by at least about 85%, 90%, or 95% or more by administration of an iRNA as described herein. In some embodiments, the LECT2 gene expression is increased by at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000 fold or more in cells treated with an iRNA as described herein compared to the expression in an untreated cell. Activation of expression by small dsRNAs is described, for example, in Li et al., 2006 Proc. Natl. Acad. Sci. U.S.A. 103:17337-42, and in US2007/0111963 and US2005/226848, each of which is incorporated herein by reference.

[0182] The terms "silence," "inhibit expression of," "down-regulate expression of," "suppress expression of," and the like, in so far as they refer to a LECT2 gene, herein refer to the at least partial suppression of the expression of a LECT2 gene, as assessed, e.g., based on LECT2 mRNA expression, LECT2 protein expression, or another parameter functionally linked to LECT2 gene expression. For example, inhibition of LECT2 expression may be manifested by a reduction of the amount of LECT2 mRNA which may be isolated from or detected in a first cell or group of cells in which a LECT2 gene is transcribed and which has or have been treated such that the expression of a LECT2 gene is inhibited, as compared to a control. The control may be a second cell or group of cells substantially identical to the first cell or group of cells, except that the second cell or group of cells have not been so treated (control cells). The degree of inhibition is usually expressed as a percentage of a control level, e.g.,

( mRNA .times. .times. in .times. .times. control .times. .times. cells ) - ( mRNA .times. .times. in .times. .times. treated .times. .times. cells ) ( mRNA .times. .times. in .times. .times. control .times. .times. cells ) 100 .times. % ##EQU00001##

[0183] Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to LECT2 gene expression, e.g., the amount of protein encoded by a LECT2 gene. The reduction of a parameter functionally linked to LECT2 gene expression may similarly be expressed as a percentage of a control level. In principle, LECT2 gene silencing may be determined in any cell expressing LECT2, either constitutively or by genomic engineering, and by any appropriate assay.

[0184] For example, in certain instances, expression of a LECT2 gene is suppressed by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by administration of an iRNA disclosed herein. In some embodiments, a LECT2 gene is suppressed by at least about 60%, 65%, 70%, 75%, or 80% by administration of an iRNA disclosed herein. In some embodiments, a LECT2 gene is suppressed by at least about 85%, 90%, 95%, 98%, 99%, or more by administration of an iRNA as described herein.

[0185] In the context of the present disclosure, the terms "treat," "treatment," and the like mean to prevent, relieve or alleviate at least one symptom associated with a disorder related to LECT2 expression, or to slow or reverse the progression or anticipated progression of such a disorder. For example, the methods featured herein, when employed to treat a LECT2 amyloidosis, may serve to inhibit amyloid deposition, to reduce or prevent one or more symptoms of the amyloidosis, or to reduce the risk or severity of associated conditions (e.g., nephrotic syndrome or hepatitis). Thus, unless the context clearly indicates otherwise, the terms "treat," "treatment," and the like are intended to encompass prophylaxis, e.g., prevention of disorders and/or symptoms of disorders related to LECT2 expression.

[0186] By "lower" in the context of a disease marker or symptom is meant any decrease, e.g., a statistically or clinically significant decrease in such level. The decrease can be, for example, at least 10%, at least 20%, at least 30%, at least 40%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. The decrease can be down to a level accepted as within the range of normal for an individual without such disorder.

[0187] As used herein, the phrases "therapeutically effective amount" and "prophylactically effective amount" and the like refer to an amount that provides a therapeutic benefit in the treatment, prevention, or management of any disorder or pathological process related to LECT2 expression. The specific amount that is therapeutically effective may vary depending on factors known in the art, such as, for example, the type of disorder or pathological process, the patient's history and age, the stage of the disorder or pathological process, and the administration of other therapies.

[0188] As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an iRNA and a pharmaceutically acceptable carrier. As used herein, "pharmacologically effective amount," "therapeutically effective amount" or simply "effective amount" refers to that amount of an iRNA effective to produce the intended pharmacological, therapeutic or preventive result. For example, in a method of treating a disorder related to LECT2 expression (e.g., a LECT2 amyloidosis), an effective amount includes an amount effective to reduce one or more symptoms associated with the LECT2 amyloidosis, an amount effective to inhibit amyloid deposition (e.g., LECT2 amyloid deposition), or an amount effective to reduce the risk of developing conditions associated with LECT2 amyloidosis. For example, if a given clinical treatment is considered effective when there is at least a 10% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to obtain at least a 10% reduction in that parameter. For example, a therapeutically effective amount of an iRNA targeting LECT2 can reduce a level of LECT2 mRNA or a level of LECT2 protein by any measurable amount, e.g., by at least 10%, 20%, 30%, 40% or 50%.

[0189] The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract. Agents included in drug formulations are described further herein below.

[0190] The term "about" when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus the number or numerical range may vary from, for example, between 1% and 15% of the stated number or numerical range.

II. iRNA Agents

[0191] Described herein are iRNA agents that modulate (e.g., inhibit) the expression of a LECT2 gene.

[0192] In some embodiments, the iRNA agent activates the expression of a LECT2 gene in a cell or mammal.

[0193] In some embodiments, the iRNA agent includes double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a LECT2 gene in a cell or in a subject (e.g., in a mammal, e.g., in a human), where the dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a LECT2 gene, and where the region of complementarity is 30 nucleotides or less in length, generally 19-24 nucleotides in length, and where the dsRNA, upon contact with a cell expressing the LECT2 gene, inhibits the expression of the LECT2 gene, e.g., by at least 10%, 20%, 30%, 40%, or 50%.

[0194] The modulation (e.g., inhibition) of expression of the LECT2 gene can be assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by Western blot. Expression of a LECT2 gene in cell culture, such as in COS cells, HeLa cells, primary hepatocytes, HepG2 cells, primary cultured cells or in a biological sample from a subject can be assayed by measuring LECT2 mRNA levels, such as by bDNA or TaqMan assay, or by measuring protein levels, such as by immunofluorescence analysis, using, for example, Western Blotting or flow cytometric techniques.

[0195] A dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the anti sense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of a LECT2 gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. Generally, the duplex structure is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 base pairs in length, inclusive. Similarly, the region of complementarity to the target sequence is between 15 and 30 inclusive, more generally between 18 and 25 inclusive, yet more generally between 19 and 24 inclusive, and most generally between 19 and 21 nucleotides in length, inclusive.

[0196] In some embodiments, the dsRNA is between 15 and 20 nucleotides in length, inclusive, and in other embodiments, the dsRNA is between 25 and 30 nucleotides in length, inclusive. As the ordinarily skilled person will recognize, the targeted region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a "part" of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway). dsRNAs having duplexes as short as 9 base pairs can, under some circumstances, mediate RNAi-directed RNA cleavage. Most often a target will be at least 15 nucleotides in length, e.g., 15-30 nucleotides in length.

[0197] One of skill in the art will also recognize that the duplex region is a primary functional portion of a dsRNA, e.g., a duplex region of 9 to 36, e.g., 15-30 base pairs. Thus, in one embodiment, to the extent that it becomes processed to a functional duplex of e.g., 15-30 base pairs that targets a desired RNA for cleavage, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA. Thus, an ordinarily skilled artisan will recognize that in one embodiment, then, an miRNA is a dsRNA. In another embodiment, a dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful to target LECT2 expression is not generated in the target cell by cleavage of a larger dsRNA.

[0198] A dsRNA as described herein may further include one or more single-stranded nucleotide overhangs. The dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.

[0199] In one embodiment, a LECT2 gene is a human LECT2 gene. In another embodiment the LECT2 gene is a mouse or a rat LECT2 gene.

[0200] In specific embodiments, the dsRNA comprises a sense strand that comprises or consists of a sense sequence selected from the sense sequences provided in Tables 2-3, 5-6 and 9-10, and an antisense strand that comprises or consists of an antisense sequence selected from the antisense sequences provided in Tables 2-3, 5-6 and 9-10.

[0201] In one aspect, a dsRNA will include at least sense and antisense nucleotide sequences, whereby the sense strand is selected from the sequences provided in Tables 2-3, 5-6 and 9-10, and the corresponding antisense strand is selected from the sequences provided in Tables 2-3, 5-6 and 9-10.

[0202] In these aspects, one of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated by the expression of a LECT2 gene. As such, a dsRNA will include two oligonucleotides, where one oligonucleotide is described as the sense strand, and the second oligonucleotide is described as the corresponding antisense strand. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.

[0203] The skilled person is well aware that dsRNAs having a duplex structure of between 20 and 23, but specifically 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer RNA duplex structures can be effective as well.

[0204] In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided in Tables 2-3, 5-6 and 9-10, dsRNAs described herein can include at least one strand of a length of minimally 19 nucleotides. It can be reasonably expected that shorter duplexes having one of the sequences of Tables 2, 3, 5, 6, 9 or 10 minus only a few nucleotides on one or both ends will be similarly effective as compared to the dsRNAs described above.

[0205] In some embodiments, the dsRNA has a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one of the sequences of Tables 2, 3, 5, 6, 9 or 10.

[0206] In some embodiments, the dsRNA has an antisense sequence that comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides of an antisense sequence provided in Table 2 and a sense sequence that comprises at least 15, 16, 17, 18, or 19 contiguous nucleotides of a corresponding sense sequence provided in Table 2.

[0207] In some embodiments, the dsRNA comprises an antisense sequence that comprises at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of an antisense sequence provided in Table 3 and a sense sequence that comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a corresponding sense sequence provided in Table 3.

[0208] In some embodiments, the dsRNA comprises an antisense sequence that comprises at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of an antisense sequence provided in Table 5 and a sense sequence that comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a corresponding sense sequence provided in Table 5.

[0209] In some embodiments, the dsRNA comprises an antisense sequence that comprises at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of an antisense sequence provided in Table 6 and a sense sequence that comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a corresponding sense sequence provided in Table 6.

[0210] In some embodiments, the dsRNA comprises an antisense sequence that comprises at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of an antisense sequence provided in Table 5 and a sense sequence that comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a corresponding sense sequence provided in Table 9.

[0211] In some embodiments, the dsRNA comprises an antisense sequence that comprises at least 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleotides of an antisense sequence provided in Table 6 and a sense sequence that comprises at least 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides of a corresponding sense sequence provided in Table 10.

[0212] In some such embodiments, the dsRNA, although it comprises only a portion of the sequences provided in Table 2, 3, 5, 6, 9 or 10, is equally effective in inhibiting a level of LECT2 expression as is a dsRNA that comprises the full length sequences provided in Table 2, 3, 5, 6, 9 or 10. In some embodiments, the dsRNA differs in its inhibition of a level of expression of a LECT2 gene by not more than 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50% inhibition compared with a dsRNA comprising the full sequence disclosed herein.

[0213] The iRNAs provided in Tables 2-3, 5-6 and 9-10 identify a site in a LECT2 transcript that is susceptible to RISC-mediated cleavage. As such, the present invention further features iRNAs that target within one of such sequences. As used herein, an iRNA is said to target within a particular site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that particular site. Such an iRNA will generally include at least 15 contiguous nucleotides from one of the sequences provided in Tables 2-3, 5-6 and 9-10 coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in a LECT2 gene.

[0214] While a target sequence is generally 15-30 nucleotides in length, there is wide variation in the suitability of particular sequences in this range for directing cleavage of any given target RNA. Various software packages and the guidelines set out herein provide guidance for the identification of optimal target sequences for any given gene target, but an empirical approach can also be taken in which a "window" or "mask" of a given size (as a non-limiting example, 21 nucleotides) is literally or figuratively (including, e.g., in silico) placed on the target RNA sequence to identify sequences in the size range that may serve as target sequences. By moving the sequence "window" progressively one nucleotide upstream or downstream of an initial target sequence location, the next potential target sequence can be identified, until the complete set of possible sequences is identified for any given target size selected. This process, coupled with systematic synthesis and testing of the identified sequences (using assays described herein or known in the art) to identify those sequences that perform optimally can identify those RNA sequences that, when targeted with an iRNA agent, mediate the best inhibition of target gene expression. Thus, while the sequences identified, for example, in Tables 2-3, 5-6 and 9-10, represent effective target sequences, it is contemplated that further optimization of inhibition efficiency can be achieved by progressively "walking the window" one nucleotide upstream or downstream of the given sequences to identify sequences with equal or better inhibition characteristics.

[0215] Further, it is contemplated that for any sequence identified, e.g., in Tables 2-3, 5-6 and 9-10, further optimization can be achieved by systematically either adding or removing nucleotides to generate longer or shorter sequences and testing those and sequences generated by walking a window of the longer or shorter size up or down the target RNA from that point. Again, coupling this approach to generating new candidate targets with testing for effectiveness of iRNAs based on those target sequences in an inhibition assay as known in the art or as described herein can lead to further improvements in the efficiency of inhibition. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleotides as described herein or as known in the art, addition or changes in overhang, or other modifications as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, targeting to a particular location or cell type, increasing interaction with silencing pathway enzymes, increasing release from endosomes, etc.) as an expression inhibitor.

[0216] An iRNA as described herein can contain one or more mismatches to the target sequence. In one embodiment, an iRNA as described herein contains no more than 3 mismatches. If the antisense strand of the iRNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity. If the antisense strand of the iRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5' or 3' end of the region of complementarity. For example, for a 23 nucleotide iRNA agent RNA strand which is complementary to a region of a LECT2 gene, the RNA strand generally does not contain any mismatch within the central 13 nucleotides. The methods described herein or methods known in the art can be used to determine whether an iRNA containing a mismatch to a target sequence is effective in inhibiting the expression of a LECT2 gene. Consideration of the efficacy of iRNAs with mismatches in inhibiting expression of a LECT2 gene is important, especially if the particular region of complementarity in a LECT2 gene is known to have polymorphic sequence variation within the population.

[0217] In one embodiment, at least one end of a dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides. dsRNAs having at least one nucleotide overhang have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. In yet another embodiment, the RNA of an iRNA (e.g., a dsRNA) is chemically modified to enhance stability or other beneficial characteristics. The nucleic acids featured in the invention may be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Modifications include, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position, or having an acyclic sugar) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of RNA compounds useful in this invention include, but are not limited to RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In particular embodiments, the modified RNA will have a phosphorus atom in its internucleoside backbone.

[0218] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

[0219] Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Pat. RE39464, each of which is herein incorporated by reference.

[0220] Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH.sub.2 component parts.

[0221] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, each of which is herein incorporated by reference.

[0222] In other RNA mimetics suitable or contemplated for use in iRNAs, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0223] Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH.sub.2--NH--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--O--CH.sub.2--[known as a methylene (methylimino) or MMI backbone], --CH.sub.2--O--N(CH.sub.3)--CH.sub.2--, --CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and --N(CH.sub.3)--CH.sub.2--CH.sub.2--[wherein the native phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

[0224] Modified RNAs may also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3, O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3, O(CH.sub.2).sub.nONH.sub.2, and O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: C.sub.1 to C.sub.10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2, N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2.

[0225] In other embodiments, an iRNA agent comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides (or nucleosides). In certain embodiments, the sense strand or the antisense strand, or both sense strand and antisense strand, include less than five acyclic nucleotides per strand (e.g., four, three, two or one acyclic nucleotides per strand). The one or more acyclic nucleotides can be found, for example, in the double-stranded region, of the sense or antisense strand, or both strands; at the 5'-end, the 3'-end, both of the 5' and 3'-ends of the sense or antisense strand, or both strands, of the iRNA agent. In one embodiment, one or more acyclic nucleotides are present at positions 1 to 8 of the sense or antisense strand, or both. In one embodiment, one or more acyclic nucleotides are found in the antisense strand at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand. In another embodiment, the one or more acyclic nucleotides are found at one or both 3'-terminal overhangs of the iRNA agent.

[0226] The term "acyclic nucleotide" or "acyclic nucleoside" as used herein refers to any nucleotide or nucleoside having an acyclic sugar, e.g., an acyclic ribose. An exemplary acyclic nucleotide or nucleoside can include a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein). In certain embodiments, a bond between any of the ribose carbons (C1, C2, C3, C4, or C5), is independently or in combination absent from the nucleotide. In one embodiment, the bond between C2-C3 carbons of the ribose ring is absent, e.g., an acyclic 2'-3'-seco-nucleotide monomer. In other embodiments, the bond between C1-C2, C3-C4, or C4-C5 is absent (e.g., a 1'-2', 3'-4' or 4'-5'-seco nucleotide monomer). Exemplary acyclic nucleotides are disclosed in U.S. Pat. No. 8,314,227, incorporated herein by reference in its entirely. For example, an acyclic nucleotide can include any of monomers D-J in FIGS. 1-2 of U.S. Pat. No. 8,314,227. In one embodiment, the acyclic nucleotide includes the following monomer:

##STR00006##

[0227] wherein Base is a nucleobase, e.g., a naturally-occurring or a modified nucleobase (e.g., a nucleobase as described herein).

[0228] In certain embodiments, the acyclic nucleotide can be modified or derivatized, e.g., by coupling the acyclic nucleotide to another moiety, e.g., a ligand (e.g., a GalNAc, a cholesterol ligand), an alkyl, a polyamine, a sugar, a polypeptide, among others.

[0229] In other embodiments, the iRNA agent includes one or more acyclic nucleotides and one or more LNAs (e.g., an LNA as described herein). For example, one or more acyclic nucleotides and/or one or more LNAs can be present in the sense strand, the antisense strand, or both. The number of acyclic nucleotides in one strand can be the same or different from the number of LNAs in the opposing strand. In certain embodiments, the sense strand and/or the antisense strand comprises less than five LNAs (e.g., four, three, two or one LNAs) located in the double-stranded region or a 3'-overhang. In other embodiments, one or two LNAs are located in the double stranded region or the 3'-overhang of the sense strand. Alternatively, or in combination, the sense strand and/or antisense strand comprises less than five acyclic nucleotides (e.g., four, three, two or one acyclic nucleotides) in the double-stranded region or a 3'-overhang. In one embodiment, the sense strand of the iRNA agent comprises one or two LNAs in the 3'-overhang of the sense strand, and one or two acyclic nucleotides in the double-stranded region of the antisense strand (e.g., at positions 4 to 10 (e.g., positions 6-8) from the 5'-end of the antisense strand) of the iRNA agent.

[0230] In other embodiments, inclusion of one or more acyclic nucleotides (alone or in addition to one or more LNAs) in the iRNA agent results in one or more (or all) of: (i) a reduction in an off-target effect; (ii) a reduction in passenger strand participation in RNAi; (iii) an increase in specificity of the guide strand for its target mRNA; (iv) a reduction in a microRNA off-target effect; (v) an increase in stability; or (vi) an increase in resistance to degradation, of the iRNA molecule.

[0231] Other modifications include 2'-methoxy (2'-OCH.sub.3), 2'-aminopropoxy (2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. iRNAs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference.

[0232] An iRNA may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2.degree. C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0233] Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,681,941; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, also herein incorporated by reference.

[0234] The RNA of an iRNA can also be modified to include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acids (LNA) (also referred to herein as "locked nucleotides"). In one embodiment, a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting, e.g., the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, increase thermal stability, and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, O R. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).

[0235] Representative U.S. patents that teach the preparation of locked nucleic acids include, but are not limited to, the following: U.S. Pat. Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; 7,399,845, and 8,314,227, each of which is herein incorporated by reference in its entirety. Exemplary LNAs include but are not limited to, a 2', 4'-C methylene bicyclo nucleotide (see for example Wengel et al., International PCT Publication No. WO 00/66604 and WO 99/14226).

[0236] In other embodiments, the iRNA agents include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucleotides in the iRNA molecules can result in enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands.

[0237] Potentially stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3''-phosphate, inverted base dT (idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.

[0238] IRNA Motifs

[0239] In one embodiment, the sense strand sequence may be represented by formula (I):

5'n.sub.p--N.sub.a--(XXX).sub.i--N.sub.b--YYY--N.sub.b--(ZZZ).sub.j--N.s- ub.a-n.sub.q3' (I)

[0240] wherein:

[0241] i and j are each independently 0 or 1;

[0242] p and q are each independently 0-6;

[0243] each N.sub.a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0244] each N.sub.b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0245] each n.sub.p and n.sub.q independently represent an overhang nucleotide;

[0246] wherein Nb and Y do not have the same modification; and

[0247] XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. Preferably YYY is all 2'-F modified nucleotides.

[0248] In one embodiment, the N.sub.a and/or N.sub.b comprise modifications of alternating pattern.

[0249] In one embodiment, the YYY motif occurs at or near the cleavage site of the sense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the YYY motif can occur at or the vicinity of the cleavage site (e.g.: can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12 or 11, 12, 13) of the sense strand, the count starting from the 1.sup.st nucleotide, from the 5'-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end.

[0250] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. The sense strand can therefore be represented by the following formulas:

5'n.sub.p--N.sub.a--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3' (Ib);

5'n.sub.p--N.sub.a--XXX--N.sub.b--YYY--N.sub.a-n.sub.q3' (Ic); or

5'n.sub.p--N.sub.a--XXX--N.sub.b--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3' (Id).

[0251] When the sense strand is represented by formula (Ib), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0252] When the sense strand is represented as formula (Ic), N.sub.b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0253] When the sense strand is represented as formula (Id), each N.sub.b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6. Each N.sub.a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0254] Each of X, Y and Z may be the same or different from each other.

[0255] In other embodiments, i is 0 and j is 0, and the sense strand may be represented by the formula:

5'n.sub.p--N.sub.a--YYY--N.sub.a-n.sub.q3' (Ia).

[0256] When the sense strand is represented by formula (Ia), each N.sub.a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0257] In one embodiment, the antisense strand sequence of the RNAi may be represented by formula (II):

5'n.sub.q'--N.sub.a'--(Z'Z'Z').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'--(X'X'X- ').sub.l--N'.sub.a-n.sub.p'3' (II)

[0258] wherein:

[0259] k and 1 are each independently 0 or 1;

[0260] p' and q' are each independently 0-6;

[0261] each N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0262] each N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0263] each n.sub.p' and n.sub.q' independently represent an overhang nucleotide;

[0264] wherein N.sub.b' and Y' do not have the same modification;

[0265] and

[0266] X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0267] In one embodiment, the N.sub.a' and/or N.sub.b' comprise modifications of alternating pattern.

[0268] The Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand. For example, when the RNAi agent has a duplex region of 17-23 nucleotides in length, the Y'Y'Y' motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the 1.sup.st nucleotide, from the 5'-end; or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end. Preferably, the Y'Y'Y' motif occurs at positions 11, 12, 13.

[0269] In one embodiment, Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0270] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and 1 are 1.

[0271] The antisense strand can therefore be represented by the following formulas:

5'n.sub.q'--N.sub.a'--Z'Z'Z'--N.sub.b'--Y'Y'Y'--N.sub.a'-n.sub.p'3' (IIb);

5'n.sub.q'--N.sub.a'--Y'Y'Y'--N.sub.b'--X'X'X'-n.sub.p'3' (IIc); or

5'n.sub.q'--N.sub.a'-- Z'Z'Z'--N.sub.b'--Y'Y'Y'--N.sub.b'--X'X'X'--N.sub.a'-n.sub.p'3' (IId).

[0272] When the antisense strand is represented by formula (IIb), N.sub.b' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0273] When the antisense strand is represented as formula (IIc), N.sub.b' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0274] When the antisense strand is represented as formula (IId), each N.sub.b' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Preferably, N.sub.b is 0, 1, 2, 3, 4, 5 or 6.

[0275] In other embodiments, k is 0 and l is 0 and the antisense strand may be represented by the formula:

5'n.sub.p'--N.sub.a'--Y'Y'Y'--N.sub.a-n.sub.q'3' (Ia).

[0276] When the antisense strand is represented as formula (IIa), each N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0277] Each of X', Y' and Z' may be the same or different from each other.

[0278] Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y' and Z', in particular, may represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0279] In one embodiment, the sense strand of the RNAi agent may contain YYY motif occurring at 9, 10 and 11 positions of the strand when the duplex region is 21 nt, the count starting from the 1.sup.st nucleotide from the 5'-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end; and Y represents 2'-F modification. The sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2'-OMe modification or 2'-F modification.

[0280] In one embodiment the antisense strand may contain Y'Y'Y' motif occurring at positions 11, 12, 13 of the strand, the count starting from the 1.sup.st nucleotide from the 5'-end, or optionally, the count starting at the 1.sup.st paired nucleotide within the duplex region, from the 5'-end; and Y' represents 2'-O-methyl modification. The antisense strand may additionally contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex region; and X'X'X' and Z'Z'Z' each independently represents a 2'-OMe modification or 2'-F modification.

[0281] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (IIb), (IIc), and (IId), respectively.

[0282] Accordingly, the RNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):

sense: 5' n.sub.p--N.sub.a--(XXX).sub.i--N.sub.b--YYY--(ZZZ).sub.j--N.sub.a-n.sub.q- 3' antisense: 3' n.sub.p'--N.sub.a'--(X'X'X').sub.k--N.sub.b'--Y'Y'Y'--N.sub.b'--(Z'Z'Z').- sub.l--N.sub.a'-n.sub.q'5' (III)

wherein:

[0283] j, k, and 1 are each independently 0 or 1;

[0284] p, p', q, and q' are each independently 0-6;

[0285] each N.sub.a and N.sub.a' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides;

[0286] each N.sub.b and N.sub.b' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides;

[0287] wherein

[0288] each n.sub.p', n.sub.p, n.sub.q', and n.sub.q, each of which may or may not be present, independently represents an overhang nucleotide; and

[0289] XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0290] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is l and l is 0; k is 0 and l is 1; or both k and 1 are 0; or both k and 1 are 1.

[0291] Exemplary combinations of the sense strand and antisense strand forming a RNAi duplex include the formulas below:

5'n.sub.p--N.sub.a--YYY--N.sub.a-n.sub.q3'3'n.sub.p'--N.sub.a'--Y'Y'Y'--- N.sub.a'n.sub.q'5' (IIIa)

5'n.sub.p--N.sub.a--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3'3'n.sub.p'--N.su- b.a'--Y'Y'Y'--Z'Z'Z'--N.sub.a'n.sub.q'5' (IIIb)

5'n.sub.p--N.sub.a--XXX--N.sub.b--YYY--N.sub.a-n.sub.q3'3'n.sub.p'--N.su- b.a'--X'X'X'--N.sub.b'--Y'Y'Y'--N.sub.a'-n.sub.q'5' (IIIc)

5'n.sub.p--N.sub.a--XXX--N.sub.b--YYY--N.sub.b--ZZZ--N.sub.a-n.sub.q3'3'- n.sub.p'--N.sub.a'--X'X'X'--N.sub.b'--Y'Y'Y'--N.sub.b'--Z'Z'Z'--N.sub.a-n.- sub.q'5' (IIId)

[0292] When the RNAi agent is represented by formula (IIIa), each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0293] When the RNAi agent is represented by formula (IIIb), each N.sub.b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0294] When the RNAi agent is represented as formula (IIIc), each N.sub.b, N.sub.b' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.

[0295] When the RNAi agent is represented as formula (IIId), each N.sub.b, N.sub.b' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N.sub.a, N.sub.a' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides. Each of N.sub.a, N.sub.a', N.sub.b and N.sub.b, independently comprises modifications of alternating pattern.

[0296] Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same or different from each other.

[0297] When the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y' nucleotides.

[0298] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.

[0299] When the RNAi agent is represented as formula (IIIc) or (IIId), at least one of the X nucleotides may form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.

[0300] In one embodiment, the modification on the Y nucleotide is different than the modification on the Y' nucleotide, the modification on the Z nucleotide is different than the modification on the Z' nucleotide, and/or the modification on the X nucleotide is different than the modification on the X' nucleotide.

[0301] In one embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications and n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide a via phosphorothioate linkage. In yet another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications, n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In another embodiment, when the RNAi agent is represented by formula (IIId), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications, n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0302] In one embodiment, when the RNAi agent is represented by formula (IIIa), the N.sub.a modifications are 2'-O-methyl or 2'-fluoro modifications, n.sub.p'>0 and at least one n.sub.p' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

[0303] In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

[0304] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), wherein the duplexes are connected by a linker. The linker can be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.

[0305] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at the 5' end, and one or both of the 3' ends and are optionally conjugated to a ligand. Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.

iRNA Conjugates

[0306] The iRNA agents disclosed herein can be in the form of conjugates. The conjugate may be attached at any suitable location in the iRNA molecule, e.g., at the 3' end or the 5' end of the sense or the anti sense strand. The conjugates are optionally attached via a linker.

[0307] In some embodiments, an iRNA agent described herein is chemically linked to one or more ligands, moieties or conjugates, which may confer functionality, e.g., by affecting (e.g., enhancing) the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

[0308] In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g, molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Typical ligands will not take part in duplex pairing in a duplexed nucleic acid.

[0309] Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymers, or polyphosphazene. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an .alpha. helical peptide.

[0310] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic.

[0311] In some embodiments, the ligand is a GalNAc ligand that comprises one or more N-acetylgalactosamine (GalNAc) derivatives. In some embodiments, the GalNAc ligand is used to target the iRNA to the liver (e.g., to hepatocytes). Additional description of GalNAc ligands is provided in the section titled Carbohydrate Conjugates.

[0312] Other examples of ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g, cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG].sub.2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0313] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-.kappa.B.

[0314] The ligand can be a substance, e.g, a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, jasplakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0315] In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin etc. Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (e.g. serum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

[0316] Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

[0317] The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, Calif.). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

[0318] In the ligand-conjugated oligonucleotides and ligand-molecule bearing sequence-specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside-conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.

[0319] When using nucleotide-conjugate precursors that already bear a linking moiety, the synthesis of the sequence-specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0320] Lipid Conjugates

[0321] In one embodiment, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule can typically bind a serum protein, such as human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used. A lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a serum protein, e.g., HSA.

[0322] A lipid based ligand can be used to modulate, e.g., control (e.g., inhibit) the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

[0323] In one embodiment, the lipid based ligand binds HSA. For example, the ligand can bind HSA with a sufficient affinity such that distribution of the conjugate to a non-kidney tissue is enhanced. However, the affinity is typically not so strong that the HSA-ligand binding cannot be reversed.

[0324] In another embodiment, the lipid based ligand binds HSA weakly or not at all, such that distribution of the conjugate to the kidney is enhanced. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid based ligand.

[0325] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low density lipoprotein (LDL).

[0326] Cell Permeation Agents

[0327] In another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In one embodiment, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennapedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent is typically an .alpha.-helical agent, and can have a lipophilic and a lipophobic phase.

[0328] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0329] A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 685). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 686)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 687)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 688)) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Typically, the peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.

[0330] An RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD-containing peptides and peptidomimetics may include D-amino acids, as well as synthetic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM-1 or VEGF.

[0331] An RGD peptide moiety can be used to target a particular cell type, e.g., a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). An RGD peptide can facilitate targeting of an dsRNA agent to tumors of a variety of other tissues, including the lung, kidney, spleen, or liver (Aoki et al., Cancer Gene Therapy 8:783-787, 2001). Typically, the RGD peptide will facilitate targeting of an iRNA agent to the kidney. The RGD peptide can be linear or cyclic, and can be modified, e.g., glycosylated or methylated to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver a iRNA agent to a tumor cell expressing .alpha..sub..nu..beta..sub.3 (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001).

[0332] A "cell permeation peptide" is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an .alpha.-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., .alpha.-defensin, .beta.-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or indolicidin). A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0333] Carbohydrate Conjugates

[0334] In some embodiments of the compositions and methods of the invention, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, "carbohydrate" refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0335] In one embodiment, a carbohydrate conjugate comprises a monosaccharide. In one embodiment, the monosaccharide is an N-acetylgalactosamine (GalNAc). GalNAc conjugates, which comprise one or more N-acetylgalactosamine (GalNAc) derivatives, are described, for example, in U.S. Pat. No. 8,106,022, the entire content of which is hereby incorporated herein by reference. In some embodiments, the GalNAc conjugate serves as a ligand that targets the iRNA to particular cells. In some embodiments, the GalNAc conjugate targets the iRNA to liver cells, e.g., by serving as a ligand for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes).

[0336] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3' end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3' end of the sense strand) via a linker, e.g., a linker as described herein.

[0337] In some embodiments, the GalNAc conjugate is

##STR00007##

[0338] In some embodiments, the RNAi agent is attached to the carbohydrate conjugate via a linker as shown in the following schematic, wherein X is O or S

##STR00008##

[0339] In some embodiments, the RNAi agent is conjugated to L96 as defined in Table 1 and shown below

##STR00009##

[0340] In some embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

##STR00010## ##STR00011## ##STR00012## ##STR00013## ##STR00014##

[0341] Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

##STR00015##

when one of X or Y is an oligonucleotide, the other is a hydrogen.

[0342] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator and/or a cell permeation peptide.

[0343] In one embodiment, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

##STR00016## ##STR00017## ##STR00018##

when one of X or Y is an oligonucleotide, the other is a hydrogen.

[0344] Linkers

[0345] In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.

[0346] The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO.sub.2, SO.sub.2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkenyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO.sub.2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.

[0347] In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXI)-(XXXIV):

##STR00019##

wherein: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different; p.sup.2A, p.sup.2B, p.sup.3A, p.sup.3B, p.sup.4A, p.sup.4B, p.sup.5A, p.sup.5B, p.sup.5C, T.sup.2A, T.sup.2B, T.sup.3A, T.sup.3B, T.sup.4A, T.sup.4B, T.sup.4A, T.sup.5B, T.sup.5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH.sub.2, CH.sub.2NH or CH.sub.2O; Q.sup.2A, Q.sup.2B, Q.sup.3A, Q.sup.3B, Q.sup.4A, Q.sup.4B, Q.sup.5A, Q.sup.5B, Q.sup.5C are independently for each occurrence absent, alkylene, substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), SO.sub.2, N(R.sup.N), C(R').dbd.C(R''), C.ident.C or C(O); R.sup.2A, R.sup.2B, R.sup.3A, R.sup.3B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.5C are each independently for each occurrence absent, NH, O, S, CH.sub.2, C(O)O, C(O)NH, NHCH(R.sup.a)C(O), --C(O)--CH(R.sup.a)--NH--, CO, CH.dbd.N--O,

##STR00020##

or heterocyclyl;

[0348] L.sup.2A, L.sup.2B, L.sup.3A, L.sup.3B, L.sup.4A, L.sup.4B, L.sup.5A, L.sup.5B and L.sup.5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R.sup.a is H or amino acid side chain. Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XXXV):

##STR00021## [0349] wherein L.sup.5A, L.sup.5B and L.sup.5C represent a monosaccharide, such as GalNAc derivative.

[0350] Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.

[0351] A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In a preferred embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

[0352] Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0353] A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

[0354] A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

[0355] Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

[0356] In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0357] Redox Cleavable Linking Groups

[0358] In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (--S--S--). To determine if a candidate cleavable linking group is a suitable "reductively cleavable linking group," or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

[0359] Phosphate-Based Cleavable Linking Groups

[0360] In another embodiment, a cleavable linker comprises a phosphate-based cleavable linking group. A phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are --O--P(O)(ORk)-O--, --O--P(S)(ORk)-O--, --O--P(S)(SRk)-O--, --S--P(O)(ORk)-O--, --O--P(O)(ORk)-S--, --S--P(O)(ORk)-S--, --O--P(S)(ORk)-S--, --S--P(S)(ORk)-O--, --O--P(O)(Rk)-O--, --O--P(S)(Rk)-O--, --S--P(O)(Rk)-O--, --S--P(S)(Rk)-O--, --S--P(O)(Rk)-S--, --O--P(S)(Rk)-S--. Preferred embodiments are --O--P(O)(OH)--O--, --O--P(S)(OH)--O--, --O--P(S)(SH)--O--, --S--P(O)(OH)--O--, --O--P(O)(OH)--S--, --S--P(O)(OH)--S--, --O--P(S)(OH)--S--, --S--P(S)(OH)--O--, --O--P(O)(H)--O--, --O--P(S)(H)--O--, --S--P(O)(H)--O, --S--P(S)(H)--O--, --S--P(O)(H)--S--, --O--P(S)(H)--S--. A preferred embodiment is --O--P(O)(OH)--O--. These candidates can be evaluated using methods analogous to those described above.

[0361] Acid Cleavable Linking Groups

[0362] In another embodiment, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula --C.dbd.NN--, C(O)O, or --OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

[0363] Ester-Based Cleavable Linking Groups

[0364] In another embodiment, a cleavable linker comprises an ester-based cleavable linking group. An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula --C(O)O--, or --OC(O)--. These candidates can be evaluated using methods analogous to those described above.

[0365] Peptide-Based Cleavable Linking Groups

[0366] In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (--C(O)NH--). The amide group can be formed between any alkylene, alkenylene or alkynylene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula --NHCHRAC(O)NHCHRBC(O)--, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above. Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which is herein incorporated by reference.

[0367] It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

[0368] "Chimeric" iRNA compounds, or "chimeras," in the context of the present invention, are iRNA compounds, e.g., dsRNAs, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the iRNA may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0369] In certain instances, the RNA of an iRNA can be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. Comm., 2007, 365(1):54-61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

[0370] Delivery of iRNA

[0371] The delivery of an iRNA to a subject in need thereof can be achieved in a number of different ways. In vivo delivery can be performed directly by administering a composition comprising an iRNA, e.g. a dsRNA, to a subject. Alternatively, delivery can be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.

[0372] Direct Delivery

[0373] In general, any method of delivering a nucleic acid molecule can be adapted for use with an iRNA (see e.g., Akhtar S. and Julian R L. (1992) Trends Cell. Biol. 2(5):139-144 and WO94/02595, which are incorporated herein by reference in their entireties). However, there are three factors that are important to consider in order to successfully deliver an iRNA molecule in vivo: (a) biological stability of the delivered molecule, (2) preventing non-specific effects, and (3) accumulation of the delivered molecule in the target tissue. The non-specific effects of an iRNA can be minimized by local administration, for example by direct injection or implantation into a tissue (as a non-limiting example, a tumor) or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the agent, limits the exposure of the agent to systemic tissues that may otherwise be harmed by the agent or that may degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when an iRNA is administered locally. For example, intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, M J., et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, S J., et al (2003) Mol. Vis. 9:210-216) were both shown to prevent neovascularization in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J., et al (2005) Mol. Ther. 11:267-274) and can prolong survival of tumor-bearing mice (Kim, W J., et al (2006) Mol. Ther. 14:343-350; Li, S., et al (2007)Mol. Ther. 15:515-523). RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, P H., et al (2005) Gene Ther. 12:59-66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, G T., et al (2004) Neuroscience 129:521-528; Thakker, E R., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration (Howard, K A., et al (2006)Mol. Ther. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677-10684; Bitko, V., et al (2005) Nat. Med. 11:50-55). For administering an iRNA systemically for the treatment of a disease, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo.

[0374] Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects. iRNA molecules can be modified by chemical conjugation to other groups, e.g., a lipid or carbohydrate group as described herein. Such conjugates can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes. For example, GalNAc conjugates or lipid (e.g., LNP) formulations can be used to target iRNA to particular cells, e.g., liver cells, e.g., hepatocytes.

[0375] Lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432:173-178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, J O., et al (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim S H., et al (2008) Journal of Controlled Release 129(2):107-116) that encases an iRNA. The formation of vesicles or micelles further prevents degradation of the iRNA when administered systemically. Methods for making and administering cationic-iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, D R., et al (2003) J. Mol. Biol 327:761-766; Verma, U N., et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, A S et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety). Some non-limiting examples of drug delivery systems useful for systemic delivery of iRNAs include DOTAP (Sorensen, D R., et al (2003), supra; Verma, U N., et al (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, T S., et al (2006) Nature 441:111-114), cardiolipin (Chien, P Y., et al (2005) Cancer Gene Ther. 12:321-328; Pal, A., et al (2005) Int J. Oncol. 26:1087-1091), polyethyleneimine (Bonnet M E., et al (2008) Pharm. Res. August 16 Epub ahead of print; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472-487), and polyamidoamines (Tomalia, D A., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. Res. 16:1799-1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Pat. No. 7,427,605, which is herein incorporated by reference in its entirety.

[0376] Vector Encoded iRNAs

[0377] In another aspect, iRNA targeting the LECT2 gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0378] The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as an inverted repeat joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

[0379] An iRNA expression vector is typically a DNA plasmid or viral vector. An expression vector compatible with eukaryotic cells, e.g., with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources. Typically, such vectors contain convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

[0380] An iRNA expression plasmid can be transfected into a target cell as a complex with a cationic lipid carrier (e.g., Oligofectamine) or a non-cationic lipid-based carrier (e.g., Transit-TKO.TM.). Multiple lipid transfections for iRNA-mediated knockdowns targeting different regions of a target RNA over a period of a week or more are also contemplated by the invention. Successful introduction of vectors into host cells can be monitored using various known methods. For example, transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

[0381] Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (e) SV40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picornavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g. canary pox or fowl pox; and (j) a helper-dependent or gutless adenovirus. Replication-defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells' genome. The constructs can include viral sequences for transfection, if desired. Alternatively, the construct may be incorporated into vectors capable of episomal replication, e.g EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are further described below.

[0382] Vectors useful for the delivery of an iRNA will include regulatory elements (promoter, enhancer, etc.) sufficient for expression of the iRNA in the desired target cell or tissue. The regulatory elements can be chosen to provide either constitutive or regulated/inducible expression.

[0383] Expression of the iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems, suitable for the control of dsRNA expression in cells or in mammals include, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-.beta.-D1-thiogalactopyranoside (IPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the iRNA transgene.

[0384] In a specific embodiment, viral vectors that contain nucleic acid sequences encoding an iRNA can be used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding an iRNA are cloned into one or more vectors, which facilitates delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in U.S. Pat. Nos. 6,143,520; 5,665,557; and 5,981,276, which are herein incorporated by reference.

[0385] Adenoviruses are also contemplated for use in delivery of iRNAs. Adenoviruses are especially attractive vehicles, e.g., for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing an iRNA featured in the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

[0386] Use of Adeno-associated virus (AAV) vectors is also contemplated (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146). In one embodiment, the iRNA can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et. al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J. Virol., 70: 520-532; Samulski R et. al. (1989), J. Virol. 63: 3822-3826; U.S. Pat. Nos. 5,252,479; 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.

[0387] Another typical viral vector is a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.

[0388] The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors can be made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.

[0389] The pharmaceutical preparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

III. Pharmaceutical Compositions Containing iRNA

[0390] In one embodiment, the invention provides pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the iRNA is useful for treating a disease or disorder related to the expression or activity of a LECT2 gene (e.g., a LECT2 amyloidosis). Such pharmaceutical compositions are formulated based on the mode of delivery. For example, compositions can be formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV) delivery. In some embodiments, a composition provided herein (e.g., an LNP formulation) is formulated for intravenous delivery. In some embodiments, a composition provided herein (e.g., a composition comprising a GalNAc conjugate) is formulated for subcutaneous delivery.

[0391] The pharmaceutical compositions featured herein are administered in a dosage sufficient to inhibit expression of a LECT2 gene. In general, a suitable dose of iRNA will be in the range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight per day. For example, the dsRNA can be administered at 0.05 mg/kg, 0.5 mg/kg, 1 mg/kg, 1.5 mg/kg, 2 mg/kg, 3 mg/kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg, or 50 mg/kg per single dose. The pharmaceutical composition may be administered once daily, or the iRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as can be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0392] The effect of a single dose on LECT2 levels can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals.

[0393] The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using a suitable animal model.

[0394] A suitable animal model, e.g., a mouse containing a transgene expressing human LECT2, can be used to determine the therapeutically effective dose and/or an effective dosage regimen administration of LECT2 siRNA.

[0395] The present disclosure also includes pharmaceutical compositions and formulations that include the iRNA compounds featured herein. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.

[0396] The iRNA can be delivered in a manner to target a particular tissue, such as a tissue that produces erythrocytes. For example, the iRNA can be delivered to bone marrow, liver (e.g., hepatocytes of liver), lymph glands, spleen, lungs (e.g., pleura of lungs) or spine. In one embodiment, the iRNA is delivered to bone marrow.

[0397] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Suitable topical formulations include those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, iRNAs may be complexed to lipids, in particular to cationic lipids. Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C.sub.1-20 alkyl ester (e.g., isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. Pat. No. 6,747,014, which is incorporated herein by reference.

[0398] Liposomal Formulations

[0399] There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.

[0400] Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.

[0401] In order to traverse intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.

[0402] Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0403] Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.

[0404] Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.

[0405] Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis

[0406] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0407] Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0408] One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

[0409] Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g., as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

[0410] Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising Novasome.TM. I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome.TM. II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P. Pharma. Sci., 1994, 4, 6, 466).

[0411] Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GM1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0412] Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside GM1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside G.sub.M1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).

[0413] Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C.sub.1215G, that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.). Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.

[0414] A number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include a dsRNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising dsRNAs targeted to the raf gene.

[0415] Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0416] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0417] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0418] If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0419] If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0420] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

[0421] The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0422] Nucleic Acid Lipid Particles

[0423] In one embodiment, a LECT2 dsRNA featured in the invention is fully encapsulated in the lipid formulation, e.g., to form a SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle, including SPLP. As used herein, the term "SPLP" refers to a nucleic acid-lipid particle comprising plasmid DNA encapsulated within a lipid vesicle. SNALPs and SPLPs typically contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). SNALPs and SPLPs are extremely useful for systemic applications, as they exhibit extended circulation lifetimes following intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). SPLPs include "pSPLP," which include an encapsulated condensing agent-nucleic acid complex as set forth in PCT Publication No. WO 00/03683. The particles of the present invention typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid-lipid particles of the present invention are resistant in aqueous solution to degradation with a nuclease. Nucleic acid-lipid particles and their method of preparation are disclosed in, e.g., U.S. Pat. Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; and PCT Publication No. WO 96/40964.

[0424] In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1.

[0425] The cationic lipid may be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N--(I-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N--(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6a5)--N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydr- o-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1,1'-2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amin- o)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), or a mixture thereof. The cationic lipid may comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the particle.

[0426] In another embodiment, the compound 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-siRNA nanoparticles. Synthesis of 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in U.S. provisional patent application No. 61/107,998 filed on Oct. 23, 2008, which is herein incorporated by reference.

[0427] In one embodiment, the lipid-siRNA particle includes 40% 2, 2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C-DOMG (mole percent) with a particle size of 63.0.+-.20 nm and a 0.027 siRNA/Lipid Ratio.

[0428] The non-cationic lipid may be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non-cationic lipid may be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.

[0429] The conjugated lipid that inhibits aggregation of particles may be, for example, a polyethyleneglycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. The PEG-DAA conjugate may be, for example, a PEG-dilauryloxypropyl (Ci.sub.2), a PEG-dimyristyloxypropyl (Ci.sub.4), a PEG-dipalmityloxypropyl (Ci.sub.6), or a PEG-distearyloxypropyl (C].sub.8). The conjugated lipid that prevents aggregation of particles may be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[0430] In some embodiments, the nucleic acid-lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.

[0431] In some embodiments, the iRNA is formulated in a lipid nanoparticle (LNP).

[0432] LNP01

[0433] In one embodiment, the lipidoid ND984HCl (MW 1487) (see U.S. patent application Ser. No. 12/056,230, filed Mar. 26, 2008, which is herein incorporated by reference), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (e.g., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG-Ceramide C16, 100 mg/ml. The ND98, Cholesterol, and PEG-Ceramide C16 stock solutions can then be combined in a, e.g., 42:48:10 molar ratio. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35-45% and the final sodium acetate concentration is about 100-300 mM. Lipid-dsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture can be extruded through a polycarbonate membrane (e.g., 100 nm cut-off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol removal and simultaneous buffer exchange can be accomplished by, for example, dialysis or tangential flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.

##STR00022##

[0434] LNP01 formulations are described, e.g., in International Application Publication No. WO 2008/042973, which is hereby incorporated by reference.

[0435] Additional exemplary lipid-dsRNA formulations are provided in the following table.

TABLE-US-00001 TABLE 4 Exemplary lipid formulations cationic lipid/non-cationic lipid/cholesterol/ PEG-lipid conjugate Cationic Lipid Lipid:siRNA ratio SNALP 1,2-Dilinolenyloxy-N,N- DLinDMA/DPPC/ dimethylaminopropane Cholesterol/PEG-cDMA (DLinDMA) (57.1/7.1/34.4/1.4) lipid:siRNA ~7:1 S-XTC 2,2-Dilinoleyl-4- XTC/DPPC/ dimethylaminoethyl- Cholesterol/PEG-cDMA [1,3]-dioxolane (XTC) 57.1/7.1/34.4/1.4 lipid:siRNA ~7:1 LNP05 2,2-Dilinoleyl-4- XTC/DSPC/ dimethylaminoethyl- Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~6:1 LNP06 2,2-Dilinoleyl-4- XTC/DSPC/ dimethylaminoethyl- Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 57.5/7.5/31.5/3.5 lipid:siRNA ~11:1 LNP07 2,2-Dilinoleyl-4- XTC/DSPC/ dimethylaminoethyl- Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~6:1 LNP08 2,2-Dilinoleyl-4- XTC/DSPC/ dimethylaminoethyl- Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 60/7.5/31/1.5, lipid:siRNA ~11:1 LNP09 2,2-Dilinoleyl-4- XTC/DSPC/ dimethylaminoethyl- Cholesterol/PEG-DMG [1,3]-dioxolane (XTC) 50/10/38.5/1.5 Lipid:siRNA 10:1 LNP10 (3aR,5s,6aS)-N,N- ALN100/DSPC/ dimethyl-2,2- Cholesterol/PEG-DMG di((9Z,12Z)- 50/10/38.5/1.5 octadeca-9,12- Lipid:siRNA 10:1 dienyl)tetrahydro-3aH- cyclopenta[d][1,3]dioxol- 5-amine (ALN100) LNP11 (6Z,9Z,28Z,31Z)- MC-3/DSPC/ heptatriaconta- Cholesterol/PEG-DMG 6,9,28,31-tetraen-19-yl 4- 50/10/38.5/1.5 (dimethylamino)butanoate Lipid:siRNA 10:1 (MC3) LNP12 1,1'-(2-(4-(2-((2-(bis(2- C12-200/DSPC/ hydroxy- Cholesterol/PEG-DMG dodecyl)amino)ethyl)(2- 50/10/38.5/1.5 hydroxydode- Lipid:siRNA 10:1 cyl)amino)ethyl)piperazin-1- ypethylazanediypdidodecan- 2-ol (C12-200) LNP13 XTC XTC/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 33:1 LNP14 MC3 MC3/DSPC/Chol/PEG-DMG 40/15/40/5 Lipid:siRNA: 11:1 LNP15 MC3 MC3/DSPC/Chol/PEG- DSG/GalNAc-PEG-DSG 50/10/35/4.5/0.5 Lipid:siRNA: 11:1 LNP16 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP17 MC3 MC3/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP18 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/38.5/1.5 Lipid:siRNA: 12:1 LNP19 MC3 MC3/DSPC/Chol/PEG-DMG 50/10/35/5 Lipid:siRNA: 8:1 LNP20 MC3 MC3/DSPC/Chol/PEG-DPG 50/10/38.5/1.5 Lipid:siRNA: 10:1 LNP21 C12-200 C12-200/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 7:1 LNP22 XTC XTC/DSPC/Chol/PEG-DSG 50/10/38.5/1.5 Lipid:siRNA: 10:1

DSPC: distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG-DMG: PEG-didimyristoyl glycerol (C14-PEG, or PEG-C14) (PEG with avg mol wt of 2000) PEG-DSG: PEG-distyryl glycerol (C18-PEG, or PEG-C18) (PEG with avg mol wt of 2000) PEG-cDMA: PEG-carbamoyl-1,2-dimyristyloxypropylamine (PEG with avg mol wt of 2000)

[0436] SNALP (1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA)) comprising formulations are described in International Publication No. WO2009/127060, filed Apr. 15, 2009, which is hereby incorporated by reference.

[0437] XTC comprising formulations are described, e.g., in U.S. Provisional Ser. No. 61/148,366, filed Jan. 29, 2009; U.S. Provisional Ser. No. 61/156,851, filed Mar. 2, 2009; U.S. Provisional Ser. No. 61/185,712, filed Jun. 10, 2009; U.S. Provisional Ser. No. 61/228,373, filed Jul. 24, 2009; U.S. Provisional Ser. No. 61/239,686, filed Sep. 3, 2009, and International Application No. PCT/US2010/022614, filed Jan. 29, 2010, which are hereby incorporated by reference.

[0438] MC3 comprising formulations are described, e.g., in U.S. Provisional Ser. No. 61/244,834, filed Sep. 22, 2009, U.S. Provisional Ser. No. 61/185,800, filed Jun. 10, 2009, and International Application No. PCT/US10/28224, filed Jun. 10, 2010, which are hereby incorporated by reference.

[0439] ALNY-100 comprising formulations are described, e.g., International patent application number PCT/US09/63933, filed on Nov. 10, 2009, which is hereby incorporated by reference.

[0440] C12-200 comprising formulations are described in U.S. Provisional Ser. No. 61/175,770, filed May 5, 2009 and International Application No. PCT/US10/33777, filed May 5, 2010, which are hereby incorporated by reference.

Synthesis of Cationic Lipids

[0441] Any of the compounds, e.g., cationic lipids and the like, used in the nucleic acid-lipid particles featured in the invention may be prepared by known organic synthesis techniques. All substituents are as defined below unless indicated otherwise.

[0442] "Alkyl" means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Representative saturated straight chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl, and the like. Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.

[0443] "Alkenyl" means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative straight chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, and the like.

[0444] "Alkynyl" means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbons. Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1 butynyl, and the like.

[0445] "Acyl" means any alkyl, alkenyl, or alkynyl wherein the carbon at the point of attachment is substituted with an oxo group, as defined below. For example, --C(.dbd.O)alkyl, --C(.dbd.O)alkenyl, and --C(.dbd.O)alkynyl are acyl groups.

[0446] "Heterocycle" means a 5- to 7-membered monocyclic, or 7- to 10-membered bicyclic, heterocyclic ring which is either saturated, unsaturated, or aromatic, and which contains from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur heteroatoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle may be attached via any heteroatom or carbon atom. Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperizinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.

[0447] The terms "optionally substituted alkyl", "optionally substituted alkenyl", "optionally substituted alkynyl", "optionally substituted acyl", and "optionally substituted heterocycle" means that, when substituted, at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (.dbd.O) two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, --CN, --OR.sup.x, --NR.sup.xR.sup.y, --NR.sup.xC(.dbd.O)R.sup.y, --NR.sup.xSO.sub.2R.sup.y, --C(.dbd.O)R.sup.x, --C(.dbd.O)OR.sup.x, --C(.dbd.O)NR.sup.xR.sup.y, --SO.sub.nR.sup.x and --SO.sub.nNR.sup.xR.sup.y, wherein n is 0, 1 or 2, R.sup.x and R.sup.y are the same or different and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents may be further substituted with one or more of oxo, halogen, --OH, --CN, alkyl, --OR.sup.x, heterocycle, --NR.sup.xR.sup.y, --NR.sup.xC(.dbd.O)R.sup.y, --NR.sup.xSO.sub.2R.sup.y, --C(.dbd.O)R.sup.x, --C(.dbd.O)OR.sup.x, --C(.dbd.O)NR.sup.xR.sup.y, --SO.sub.nR.sup.x and --SO.sub.nNR.sup.xR.sup.y.

[0448] "Halogen" means fluoro, chloro, bromo and iodo.

[0449] In some embodiments, the methods featured in the invention may require the use of protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, PROTECTIVE GROUPS IN ORGANIC SYNTHESIS, Green, T. W. et al., Wiley-Interscience, New York City, 1999). Briefly, protecting groups within the context of this invention are any group that reduces or eliminates unwanted reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original functional group. In some embodiments an "alcohol protecting group" is used. An "alcohol protecting group" is any group which decreases or eliminates unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.

Synthesis of Formula A

[0450] In one embodiments, nucleic acid-lipid particles featured in the invention are formulated using a cationic lipid of formula A:

##STR00023##

where R1 and R2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R3 and R4 are independently lower alkyl or R3 and R4 can be taken together to form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is XTC (2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane). In general, the lipid of formula A above may be made by the following Reaction Schemes 1 or 2, wherein all substituents are as defined above unless indicated otherwise.

##STR00024##

[0451] Lipid A, where R.sub.1 and R.sub.2 are independently alkyl, alkenyl or alkynyl, each can be optionally substituted, and R.sub.3 and R.sub.4 are independently lower alkyl or R.sub.3 and R.sub.4 can be taken together to form an optionally substituted heterocyclic ring, can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 1 and 2 yields ketal 3. Treatment of ketal 3 with amine 4 yields lipids of formula A. The lipids of formula A can be converted to the corresponding ammonium salt with an organic salt of formula 5, where X is anion counter ion selected from halogen, hydroxide, phosphate, sulfate, or the like.

##STR00025##

[0452] Alternatively, the ketone 1 starting material can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to those of ordinary skill in the art. Reaction of 6 and 7 yields ketone 1. Conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.

Synthesis of MC3

[0453] Preparation of DLin-M-C3-DMA (i.e., (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate) was as follows. A solution of (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,N-dimethylaminopyridine (0.61 g) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 mL) was stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnesium sulphate, filtered and the solvent removed on a rotovap. The residue was passed down a silica gel column (20 g) using a 1-5% methanol/dichloromethane elution gradient. Fractions containing the purified product were combined and the solvent removed, yielding a colorless oil (0.54 g).

Synthesis of ALNY-100

[0454] Synthesis of ketal 519 [ALNY-100] was performed using the following scheme 3:

##STR00026##

Synthesis of 515

[0455] To a stirred suspension of LiAlH4 (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in a two neck RBF (1 L), was added a solution of 514 (10 g, 0.04926 mol) in 70 mL of THF slowly at 0.degree. C. under nitrogen atmosphere. After complete addition, reaction mixture was warmed to room temperature and then heated to reflux for 4 h. Progress of the reaction was monitored by TLC. After completion of reaction (by TLC) the mixture was cooled to 0.degree. C. and quenched with careful addition of saturated Na2SO4 solution. Reaction mixture was stirred for 4 h at room temperature and filtered off. Residue was washed well with THF. The filtrate and washings were mixed and diluted with 400 mL dioxane and 26 mL conc. HCl and stirred for 20 minutes at room temperature. The volatilities were stripped off under vacuum to furnish the hydrochloride salt of 515 as a white solid. Yield: 7.12 g 1H-NMR (DMSO, 400 MHz): .delta.=9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66-2.60 (m, 2H), 2.50-2.45 (m, 5H).

Synthesis of 516

[0456] To a stirred solution of compound 515 in 100 mL dry DCM in a 250 mL two neck RBF, was added NEt3 (37.2 mL, 0.2669 mol) and cooled to 0.degree. C. under nitrogen atmosphere. After a slow addition of N-(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) in 50 mL dry DCM, reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 h by TLC) mixture was washed successively with 1N HCl solution (1.times.100 mL) and saturated NaHCO.sub.3 solution (1.times.50 mL). The organic layer was then dried over anhyd. Na2SO4 and the solvent was evaporated to give crude material which was purified by silica gel column chromatography to get 516 as sticky mass. Yield: 11 g (89%). 1H-NMR (CDCl3, 400 MHz): .delta.=7.36-7.27 (m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2.60 (m, 2H), 2.30-2.25 (m, 2H). LC-MS [M+H]-232.3 (96.94%).

Synthesis of 517A and 517B

[0457] The cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 mL acetone and water (10:1) in a single neck 500 mL RBF and to it was added N-methyl morpholine-N-oxide (7.6 g, 0.06492 mol) followed by 4.2 mL of 7.6% solution of OsO4 (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (.about.3 h), the mixture was quenched with addition of solid Na2SO3 and resulting mixture was stirred for 1.5 h at room temperature. Reaction mixture was diluted with DCM (300 mL) and washed with water (2.times.100 mL) followed by saturated NaHCO3(1.times.50 mL) solution, water (1.times.30 mL) and finally with brine (1.times.50 mL). Organic phase was dried over an Na2SO4 and solvent was removed in vacuum. Silica gel column chromatographic purification of the crude material was afforded a mixture of diastereomers, which were separated by prep HPLC. Yield: -6 g crude

[0458] 517A--Peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 400 MHz): .delta.=7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4.48-4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS-[M+H]-266.3, [M+NH.sub.4+]-283.5 present, HPLC-97.86%. Stereochemistry confirmed by X-ray.

Synthesis of 518

[0459] Using a procedure analogous to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. 1H-NMR (CDCl3, 400 MHz): .delta.=7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (m, 2H), 2.78-2.74 (m, 7H), 2.06-2.00 (m, 8H), 1.96-1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37-1.25 (br m, 36H), 0.87 (m, 6H). HPLC-98.65%.

General Procedure for the Synthesis of Compound 519

[0460] A solution of compound 518 (1 eq) in hexane (15 mL) was added in a drop-wise fashion to an ice-cold solution of LAH in THF (1 M, 2 eq). After complete addition, the mixture was heated at 40.degree. C. over 0.5 h then cooled again on an ice bath. The mixture was carefully hydrolyzed with saturated aqueous Na2SO4 then filtered through celite and reduced to an oil. Column chromatography provided the pure 519 (1.3 g, 68%) which was obtained as a colorless oil. 13C NMR=130.2, 130.1 (.times.2), 127.9 (.times.3), 112.3, 79.3, 64.4, 44.7, 38.3, 35.4, 31.5, 29.9 (.times.2), 29.7, 29.6 (.times.2), 29.5 (.times.3), 29.3 (.times.2), 27.2 (.times.3), 25.6, 24.5, 23.3, 226, 14.1; Electrospray MS (+ve): Molecular weight for C44H80NO.sub.2 (M+H)+Calc. 654.6, Found 654.6.

[0461] Formulations prepared by either the standard or extrusion-free method can be characterized in similar manners. For example, formulations are typically characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. Particle size and particle size distribution of lipid-nanoparticles can be measured by light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, USA). Particles should be about 20-300 nm, such as 40-100 nm in size. The particle size distribution should be unimodal. The total dsRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye exclusion assay. A sample of the formulated dsRNA can be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes) in the presence or absence of a formulation disrupting surfactant, e.g., 0.5% Triton-X100. The total dsRNA in the formulation can be determined by the signal from the sample containing the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the "free" dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. Percent entrapped dsRNA is typically >85%. For SNALP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, and at least 120 nm. The suitable range is typically about at least 50 nm to about at least 110 nm, about at least 60 nm to about at least 100 nm, or about at least 80 nm to about at least 90 nm.

[0462] Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs featured in the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. Pat. No. 6,887,906, US Publn. No. 20030027780, and U.S. Pat. No. 6,747,014, each of which is incorporated herein by reference.

[0463] Compositions and formulations for parenteral, intraparenchymal (into the brain), intrathecal, intraventricular or intrahepatic administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0464] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.

[0465] The pharmaceutical formulations featured in the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0466] The compositions featured in the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0467] Additional Formulations

[0468] Emulsions

[0469] The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 .mu.m in diameter (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

[0470] Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0471] Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y. Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

[0472] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tri stearate.

[0473] A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0474] Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

[0475] Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0476] The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

[0477] In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0478] The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, L V., Popovich N G., and Ansel H C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, N.Y.; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

[0479] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.

[0480] Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Pat. Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.

[0481] Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories--surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

[0482] Penetration Enhancers

[0483] In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

[0484] Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

[0485] Surfactants: In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0486] Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C.sub.1-20 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0487] Bile salts: The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, N.Y., 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

[0488] Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of .beta.-diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, Mass., 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0489] Non-chelating non-surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0490] Agents that enhance uptake of iRNAs at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example Lipofectamine.TM. (Invitrogen; Carlsbad, Calif.), Lipofectamine 2000.TM. (Invitrogen; Carlsbad, Calif.), 293Fectin.TM. (Invitrogen; Carlsbad, Calif.), Cellfectin.TM. (Invitrogen; Carlsbad, Calif.), DMRIE-C.TM. (Invitrogen; Carlsbad, Calif.), FreeStyle.TM. MAX (Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. 2000 CD (Invitrogen; Carlsbad, Calif.), Lipofectamine.TM. (Invitrogen; Carlsbad, Calif.), RNAiMAX (Invitrogen; Carlsbad, Calif.), Oligofectamine.TM. (Invitrogen; Carlsbad, Calif.), Optifect.TM. (Invitrogen; Carlsbad, Calif.), X-tremeGENE Q2 Transfection Reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene (Grenzacherstrasse, Switzerland), Transfectam.RTM. Reagent (Promega; Madison, Wis.), TransFast.TM. Transfection Reagent (Promega; Madison, Wis.), Tfx.TM.-20 Reagent (Promega; Madison, Wis.), Tfx.TM.-50 Reagent (Promega; Madison, Wis.), DreamFect.TM. (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass.sup.a D1 Transfection Reagent (New England Biolabs; Ipswich, Mass., USA), LyoVec.TM./LipoGen.TM. (Invivogen; San Diego, Calif., USA), PerFectin Transfection Reagent (Genlantis; San Diego, Calif., USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), GenePORTER Transfection reagent (Genlantis; San Diego, Calif., USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, Calif., USA), Cytofectin Transfection Reagent (Genlantis; San Diego, Calif., USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, Calif., USA), TroganPORTER.TM. transfection Reagent (Genlantis; San Diego, Calif., USA), RiboFect (Bioline; Taunton, Mass., USA), PlasFect (Bioline; Taunton, Mass., USA), UniFECTOR (B-Bridge International; Mountain View, Calif., USA), SureFECTOR (B-Bridge International; Mountain View, Calif., USA), or HiFect.TM. (B-Bridge International, Mountain View, Calif., USA), among others.

[0491] Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

[0492] Carriers

[0493] Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0494] Excipients

[0495] In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

[0496] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0497] Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

[0498] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0499] Other Components

[0500] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0501] Aqueous suspensions may contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0502] In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA compounds and (b) one or more biologic agents which function by a non-RNAi mechanism. Examples of such biologic agents include agents that interfere with an interaction of LECT2 and at least one LECT2 binding partner.

[0503] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are typical.

[0504] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions featured in the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0505] In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of diseases or disorders related to LECT2 expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

[0506] Methods of Treating Disorders Related to Expression of a LECT2 Gene

[0507] The present disclosure relates to the use of an iRNA targeting LECT2 to inhibit LECT2 expression and/or to treat a disease, disorder, or pathological process that is related to LECT2 expression.

[0508] In one aspect, a method of treatment of a disorder related to expression of LECT2 is provided, the method comprising administering an iRNA (e.g., a dsRNA) disclosed herein to a subject in need thereof. In some embodiments, the iRNA inhibits (decreases) LECT2 expression. In some embodiments, the iRNA increases LECT2 expression.

[0509] As used herein, "a disorder related to LECT2 expression," a "disease related to LECT2 expression, a "pathological process related to LECT2 expression," or the like includes any condition, disorder, or disease in which LECT2 expression is altered (e.g., decreased or increased relative to a normal level). In some embodiments, LECT2 expression is decreased. In some embodiments, LECT2 expression is increased. In embodiments, the decrease or increase in LECT2 expression is detectable in the blood (e.g., in the plasma) of the subject. In embodiments, the decrease or increase in LECT2 expression is detectable in a tissue sample from the subject (e.g., in a kidney sample or a liver sample). The decrease or increase may be assessed relative the level observed in the same individual prior to the development of the disorder or relative to other individual(s) who do not have the disorder. The decrease or increase may be limited to a particular organ, tissue, or region of the body (e.g., the kidney or the liver).

[0510] As used herein, a "subject" to be treated according to the methods described herein, includes a human or non-human animal, e.g., a mammal. The mammal may be, for example, a rodent (e.g., a rat or mouse) or a primate (e.g., a monkey). In some embodiments, the subject is a human.

[0511] A "subject in need thereof" includes a subject having, suspected of having, or at risk of developing a disorder related to LECT2 expression. In some embodiments, the subject has, or is suspected of having, a disorder related to LECT2 expression. In some embodiments, the subject is at risk of developing a disorder related to LECT2 expression.

[0512] In some embodiments, the subject is an animal that serves as a model for a disorder related to LECT2 expression, e.g., a LECT2 amyloidosis.

[0513] LECT2 Amyloidosis

[0514] In embodiments, the disorder related to LECT2 expression is an amyloidosis, e.g., a LECT2 amyloidosis. LECT2 amyloidosis has been described in several clinical studies. See, e.g., Benson, M. D. et al (2008) Kidney International, 74: 218-222; Murphy, C. L. et al. (2010) Am J Kidney Dis, 56(6):1100-1107; Larsen, C. P. et al. (2010) Kidney Int., 77(9):816-819; Holanda, D. G. et al. (20011) Nephrol. Dial. Transplant., 26 (1): 373-376; and Sethi, S. et al. (2012) Kidney International 82, 226-234 (hereinafter Sethi et al.).

[0515] Clinical and pathological features of LECT2 amyloidosis mimic those of amyloid light chain (AL) amyloidosis. These symptoms include, e.g., symptoms of kidney disease and renal failure, e.g., fluid retention, swelling, and shortness of breath. Amyloidosis may affect the heart, peripheral nervous system, gastrointestinal tract, blood, lungs and skin. Heart complications include, e.g., heart failure and irregular heart beat. Other symptoms include, e.g., stroke, gastrointestinal disorders, enlarged liver, diminished spleen function, diminished function of the adrenal and other endocrine glands, skin color change or growths, lung problems, bleeding and bruising problems, fatigue and weight loss. In embodiments, the methods described herein are associated with improvement in one or more symptoms described herein.

[0516] Methods for diagnosis of amyloidosis, e.g., LECT2 amyloidosis, are described, e.g., in Leung, N. et al. (2010) Blood, published online Sep. 4, 2012; DOE 10.1182/blood-2012-03-413682; Shiller, S. M. et al. (2011). Laboratory Methods for the Diagnosis of Hereditary Amyloidoses, Amyloidosis-Mechanisms and Prospects for Therapy, Dr. Svetlana Sarantseva (Ed.), ISBN: 978-953-307-253-1; Sethi et al. (see above) and in U.S. Patent Application Publication No. 20100323381.

[0517] Based on the results provided by Sethi et al., LECT2 amyloidosis accounts for a significant percentage of cases of renal amyloidosis. See Table 1 of Sethi et al., which shows that 26 out of 127 cases of renal amyloidosis studied by laser microdissection and mass spectrometry of renal biopsy and/or nephrectomy specimens were determined to be of the LECT2 amyloid type. Sethi et al. further report that apolipoprotein E protein and serum amyloid P component (SAP) were also present in all cases of LECT2 amyloidosis.

[0518] In embodiments, the amyloidosis, e.g., the LECT2 amyloidosis, involves systemic amyloid deposition. In embodiments, the amyloidosis, e.g., the LECT2 amyloidosis, is localized entirely or predominately to a particular tissue or organ (e.g., to the kidney or liver).

[0519] In embodiments, the amyloidosis, e.g., the LECT2 amyloidosis, is hereditary.

[0520] In embodiments, a LECT2 amyloidosis is diagnosed using analysis of a sample from the subject (e.g., a biopsy sample). In embodiments, the biopsy sample is a renal biopsy. In embodiments, the sample is a nephrectomy sample. In embodiments, the sample is from a liver biopsy or from other resected liver tissue. In embodiments, the sample is analyzed using methods selected from one or more of immunohistochemistry, LECT2 immunoassay, electron microscopy, laser microdissection, and mass spectrometry. In embodiments, the LECT2 amyloidosis is diagnosed using laser microdissection and mass spectrometry.

[0521] In embodiments, the amyloidosis, e.g., the LECT2 amyloidosis, affects the kidney, e.g., involves amyloid deposition in the kidney. In embodiments, kidney function is compromised as a result of the amyloidosis. In embodiments, the subject suffers from one or more of fluid retention, swelling, and shortness of breath. In embodiments, the subject has nephrotic syndrome. In embodiments, the subject suffers from proteinuria. In embodiments, the subject has renal failure.

[0522] In embodiments, the amyloidosis, e.g., the LECT2 amyloidosis, affects the liver, e.g., involves amyloid deposition in the liver. In embodiments, liver function is compromised as a result of the amyloidosis. In embodiments, the subject has hepatitis, e.g., chronic hepatitis. In embodiments, the hepatitis is a viral hepatitis.

[0523] LECT2 amyloidosis has been found to be particularly prevalent in Mexican Americans and has also been associated with homozygosity for the G allele of the LECT2 gene that encodes valine at position 40 in the mature protein (amino acid 58 in the unprocessed protein). See, e.g., Benson, M. D. et al. (2008) Kidney International, 74: 218-222; Murphy, C. L. et al. (2010) Am J Kidney Dis, 56(6):1100-1107.

[0524] In some embodiments, the subject is of Mexican descent. In some embodiments, the subject is a Mexican American.

[0525] In embodiments, the subject carries the G allele of the LECT2 gene that encodes valine at position 40 in the mature protein (amino acid 58 in the unprocessed protein). In embodiments, the subject is homozygous for the G allele (G/G genotype). In embodiments, a LECT2 protein expressed in the subject has valine at position 40 in the mature protein (or at amino acid 58 in the unprocessed protein).

[0526] In some embodiments, the method decreases LECT2 expression. In embodiments, the decrease in LECT2 expression is assessed relative to the level in the same individual prior to the treatment. In some embodiments, the method is shown to decrease LECT2 expression by comparing the levels of LECT2 expression in a treated subject (or group of subjects) with the levels in a control subject (or group of subjects), e.g., an untreated subject (or group of subjects) or a subject (or group of subjects) treated with a control treatment (e.g., an iRNA (e.g., a dsRNA) that does not target LECT2).

[0527] In embodiments, the method reduces amyloid deposition, e.g., deposition of amyloid comprising a LECT2 protein or a portion thereof. In embodiments, the protein is a wild type protein. In embodiments, the protein is a human LECT2 protein, or a portion thereof, that includes valine at position 40 (position 40 of the mature, secreted protein, or at amino acid 58 in the unprocessed protein, as described herein). In embodiments, the method decreases the size, number, and/or extent of amyloid deposits.

[0528] In embodiments, the method decreases one or more symptoms associated with amyloid deposition.

[0529] In some embodiments, the dsRNA is administered in a form that targets the dsRNA to a particular organ or tissue to inhibit amyloid deposition in the organ or tissue. In some embodiments, the dsRNA is targeted to the liver. In some embodiments, the dsRNA is conjugated to a ligand, e.g., a GalNAc ligand (e.g., a GalNAc ligand as described herein) that targets the dsRNA to the liver (e.g., to hepatocytes).

[0530] Also provided herein is a method of reducing amyloid deposition, the method comprising administering a dsRNA as disclosed herein to a subject in need thereof (e.g., a subject having, suspected of having, or at risk for developing a LECT2 amyloidosis). In embodiments, the method decreases (e.g., prevents or diminishes) the size, number, and/or extent of amyloid deposits. The size, number, and/or extent of amyloid deposits may be assessed using any method known in the art (e.g., immunoassay, immunohistochemistry, mass spectrometry). The reduction of amyloid deposition may involve a decrease in amyloid deposition (e.g., size, number, and/or extent of amyloid deposits) of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more.

[0531] In the methods provided herein, the iRNA (e.g., dsRNA) and compositions thereof are administered in a therapeutically effective amount. Therapeutic effects of administration of a LECT2 siRNA can be established, for example, by comparison with an appropriate control. For example, inhibition of amyloid deposition may be established, for example, in a group of patients with amyloidosis (e.g., LECT2 amyloidosis) by comparison of any appropriate parameter (e.g., a parameter assessing the size, number, or extent of amyloid deposition) with the same parameter in an appropriate control group. A control group (e.g., a group of similar individuals or the same group of individuals in a crossover design) may include, for example, an untreated population, a population that has been treated with a conventional treatment; a population that has been treated with placebo or a non-targeting iRNA; and the like.

[0532] Rheumatoid Arthritis

[0533] Rheumatoid arthritis is also a disorder related to LECT2 expression. In particular, in a Japanese population, it was found that possession of one A allele of the LECT2 gene that encodes isoleucine at position 40 in the mature protein (or amino acid 58 in the unprocessed protein) was found to increase the overall risk of developing rheumatoid arthritis. Possessing two A alleles was strongly associated with disease severity. See Kameoka, Y. et al. (2000) Arth Rheum, 43(6):1419-20.

[0534] In one embodiment of the methods provided herein, the disorder related to LECT2 expression is rheumatoid arthritis. In one embodiment, the dsRNA inhibits LECT2 expression in a subject having rheumatoid arthritis. In some such embodiments, the dsRNA inhibits LECT2 expression in synovial tissue and/or in synovial fluid-derived cells (e.g., mononuclear cells and fibroblasts). In some embodiments, the dsRNA targets an mRNA that encodes isoleucine at position 40 in the mature protein (amino acid 58 in the unprocessed protein).

[0535] Liver Injury

[0536] LECT2 expression can increase during acute liver injury.

[0537] In one embodiment of the methods provided herein, the disorder related to LECT2 expression is acute liver injury. In embodiments, the iRNA (e.g., dsRNA) modulates (e.g., increases or decreases) LECT2 expression. In embodiments, the iRNA modulates LECT2 expression in the liver. In embodiments, the iRNA decreases LECT2 expression in the liver. In embodiments, the iRNA increases LECT2 expression in the liver.

[0538] Combination Therapies

[0539] In embodiments, an iRNA (e.g., a dsRNA) disclosed herein is administered in combination with a second therapy (e.g., one or more additional therapies) known to be effective in treating a disorder related to LECT2 expression (e.g., a LECT2 amyloidosis) or a symptom of such a disorder. The iRNA may be administered before, after, or concurrent with the second therapy. In embodiments, the iRNA is administered before the second therapy. In embodiments, the iRNA is administered after the second therapy. In embodiments, the iRNA is administered concurrent with the second therapy.

[0540] The second therapy may be an additional therapeutic agent. The iRNA and the additional therapeutic agent can be administered in combination in the same composition or the additional therapeutic agent can be administered as part of a separate composition.

[0541] In some embodiments, the second therapy is a non-iRNA therapeutic agent that is effective to treat the disorder or symptoms of the disorder.

[0542] In some embodiments, the disorder to be treated by the compositions or methods disclosed herein is a LECT2 amyloidosis that affects kidney function, e.g., through amyloid deposition in the kidney. In some such embodiments, the iRNA is administered in conjunction with a therapy that supports kidney function (e.g., dialysis, a diuretic, an angiotensin converting enzyme (ACE) inhibitor, an angiotensin receptor blocker (ARB), or dialysis).

[0543] In some embodiments, the disorder to be treated by the compositions or methods disclosed herein is a LECT2 amyloidosis involving amyloid deposits in the liver. In some such embodiments, the iRNA is administered in conjunction with a therapy that supports liver function.

[0544] In some embodiments, the disorder to be treated by the compositions or methods disclosed herein is a LECT2 amyloidosis, and the iRNA is administered in conjunction with removal of all or part of the organ(s) affected by the amyloidosis (e.g., resection of all or part of kidney or liver tissue affected by the amyloidosis). The removal is optionally conducted in conjunction with a replacement of all or part of the organ removed (e.g., in conjunction with a kidney or liver organ transplant).

[0545] Administration Dosages, Routes, and Timing

[0546] A subject (e.g., a human subject, e.g., a patient) can be administered a therapeutic amount of iRNA. The therapeutic amount can be, e.g., 0.05-50 mg/kg. For example, the therapeutic amount can be 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, or 2.5, 3.0, 3.5, 4.0, 4.5, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg/kg dsRNA.

[0547] In some embodiments, the iRNA is formulated for delivery to a target organ, e.g., to the liver.

[0548] In some embodiments, the iRNA is formulated as a lipid formulation, e.g., an LNP formulation as described herein. In some such embodiments, the therapeutic amount is 0.05-5 mg/kg, e.g., 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 mg/kg dsRNA. In some embodiments, the lipid formulation, e.g., LNP formulation, is administered intravenously. In embodiments, the iRNA (e.g., dsRNA) is formulated as an LNP formulation and is administered (e.g., intravenously administered) at a dose of 0.1 to 0.5 mg/kg.

[0549] In some embodiments, the iRNA is administered by intravenous infusion over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25 minute period.

In some embodiments, the iRNA is in the form of a GalNAc conjugate as described herein. In some such embodiments, the therapeutic amount is 0.5-50 mg, e.g., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 mg/kg dsRNA. In some embodiments, the GalNAc conjugate is administered subcutaneously. In embodiments, the iRNA (e.g., dsRNA) is in the form of a GalNAc conjugate and is administered (e.g., subcutaneously administered) at a dose of 1 to 10 mg/kg.

[0550] In some embodiments, the administration is repeated, for example, on a regular basis, such as, daily, biweekly (i.e., every two weeks) for one month, two months, three months, four months or longer. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration biweekly for three months, administration can be repeated once per month, for six months or a year or longer.

[0551] In some embodiments, the iRNA agent is administered in two or more doses. In some embodiments, the number or amount of subsequent doses is dependent on the achievement of a desired effect, e.g., inhibition of amyloid deposition, or the achievement of a therapeutic or prophylactic effect, e.g., reduction or prevention of one or more symptoms associated with the disorder.

[0552] In some embodiments, the iRNA agent is administered according to a schedule. For example, the iRNA agent may be administered once per week, twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule involves regularly spaced administrations, e.g., hourly, every four hours, every six hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In embodiments, the iRNA agent is administered at the frequency required to achieve a desired effect.

[0553] In embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. For example, the schedule may involve an initial set of doses that are administered in a relatively short period of time (e.g., about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer time period (e.g., about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the iRNA agent is not administered. In one embodiment, the iRNA agent is initially administered hourly and is later administered at a longer interval (e.g., daily, weekly, biweekly, or monthly). In another embodiment, the iRNA agent is initially administered daily and is later administered at a longer interval (e.g., weekly, biweekly, or monthly). In certain embodiments, the longer interval increases over time or is determined based on the achievement of a desired effect.

[0554] Before administration of a full dose of the iRNA, patients can be administered a smaller dose, such as a 5% infusion dose, and monitored for adverse effects, such as an allergic reaction, or for elevated lipid levels or blood pressure. In another example, the patient can be monitored for unwanted effects.

[0555] Methods for Modulating Expression of a LECT2 Gene

[0556] In yet another aspect, the invention provides a method for modulating (e.g., inhibiting or activating) the expression of LECT2 gene, e.g., in a cell or in a subject. In some embodiments, the cell is ex vivo, in vitro, or in vivo. In some embodiments, the cell is in the liver (e.g., a hepatocyte). In some embodiments, the cell is in a subject (e.g., a mammal, such as, for example, a human). In some embodiments, the subject (e.g., the human) is at risk, or is diagnosed with a disorder related to expression of LECT2 expression, as described herein.

[0557] In one embodiment, the method includes contacting the cell with an iRNA as described herein, in an amount effective to decrease the expression of a LECT2 gene in the cell. "Contacting," as used herein, includes directly contacting a cell, as well as indirectly contacting a cell. For example, a cell within a subject may be contacted when a composition comprising an iRNA is administered (e.g., intravenously or subcutaneously) to the subject.

[0558] The expression of a LECT2 gene may be assessed based on the level of expression of a LECT2 mRNA, a LECT2 protein, or the level of another parameter functionally linked to the level of expression of a LECT2 gene. In some embodiments, the expression of LECT2 is inhibited by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In some embodiments, the iRNA has an IC.sub.50 in the range of 0.001-0.01 nM, 0.001-0.10 nM, 0.001-1.0 nM, 0.001-10 nM, 0.01-0.05 nM, 0.01-0.50 nM, 0.02-0.60 nM, 0.01-1.0 nM, 0.01-1.5 nM, 0.01-10 nM. The IC.sub.50 value may be normalized relative to an appropriate control value, e.g., the IC.sub.50 of a non-targeting iRNA.

[0559] In some embodiments, the method includes introducing into the cell an iRNA as described herein and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of a LECT2 gene, thereby inhibiting the expression of the LECT2 gene in the cell.

[0560] In one embodiment, the method includes administering a composition described herein, e.g., a composition comprising an iRNA that targets LECT2, to the mammal such that expression of the target LECT2 gene is decreased, such as for an extended duration, e.g., at least two, three, four days or more, e.g., one week, two weeks, three weeks, or four weeks or longer. In some embodiments, the decrease in expression of LECT2 is detectable within 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, or 24 hours of the first administration.

[0561] In another embodiment, the method includes administering a composition as described herein to a mammal such that expression of the target LECT2 gene is increased by e.g., at least 10% compared to an untreated animal. In some embodiments, the activation of LECT2 occurs over an extended duration, e.g., at least two, three, four days or more, e.g., one week, two weeks, three weeks, four weeks, or more. Without wishing to be bound by theory, an iRNA can activate LECT2 expression by stabilizing the LECT2 mRNA transcript, interacting with a promoter in the genome, and/or inhibiting an inhibitor of LECT2 expression.

[0562] The iRNAs useful for the methods and compositions featured in the invention specifically target RNAs (primary or processed) of a LECT2 gene. Compositions and methods for inhibiting the expression of a LECT2 gene using iRNAs can be prepared and performed as described elsewhere herein.

[0563] In one embodiment, the method includes administering a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the LECT2 gene of the subject, e.g., the mammal, e.g., the human, to be treated. The composition may be administered by any appropriate means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.

[0564] In certain embodiments, the composition is administered by intravenous infusion or injection. In some such embodiments, the composition comprises a lipid formulated siRNA (e.g., an LNP formulation, such as an LNP11 formulation) for intravenous infusion.

[0565] In other embodiments, the composition is administered subcutaneously. In some such embodiments, the composition comprises an iRNA conjugated to a GalNAc ligand. In some such embodiments, the ligand targets the iRNA to the liver (e.g., to hepatocytes).

[0566] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

EXAMPLES

Example 1. LECT2 siRNA

[0567] Nucleic acid sequences provided herein are represented using standard nomenclature. See the abbreviations of Table 1.

TABLE-US-00002 TABLE 1 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds. Abbreviation Nucleotide(s) A Adenosine-3'-phosphate Ab beta-L-adenosine-3 phosphate Abs beta-L-adenosine-3 phosphorothioate Af 2'-fluoroadenosine-3'-phosphate Afs 2'-fluoroadenosine-3'-phosphorothioate As adenosine-3'-phosphorothioate C cytidine-3'-phosphate Cb beta-L-cytidine-3'-phosphate Cbs beta-L-cytidine-3'-phosphorothioate Cf 2'-fluorocytidine-3'-phosphate Cfs 2'-fluorocytidine-3'-phosphorothioate (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate (Chds) 2'-O-hexadecyl-cytidine-3'-phosphorothioate Cs cytidine-3'-phosphorothioate G guanosine-3'-phosphate Gb beta-L-guanosine-3 phosphate Gbs beta-L-guanosine-3 phosphorothioate Gf 2'-fluoroguanosine-3'-phosphate Gfs 2'-fluoroguanosine-3'-phosphorothioate Gs guanosine-3'-phosphorothioate T 5'-methyluridine-3'-phosphate Tb beta-L-thymidine-3'-phosphate Tbs beta-L-thymidine-3'-phosphorothioate Tf 2'-fluoro-5-methyluridine-3'-phosphate Tfs 2'-fluoro-5-methyluridine-3'-phosphorothioate Ts 5-methyluridine-3'-phosphorothioate U Uridine-3'-phosphate Ub beta-L-uridine-3 phosphate Ubs beta-L-uridine-3 phosphorothioate Uf 2'-fluorouridine-3'-phosphate Ufs 2'-fluorouridine-3'-phosphorothioate (Uhd) 2'-O-hexadecyl-uridine-3'-phosphate (Uhds) 2'-O-hexadecyl-uridine-3'-phosphorothioate Us uridine-3'-phosphorothioate N any nucleotide (G, A, C, T or U) a 2'-O-methyladenosine-3'-phosphate as 2'-O-methyladenosine-3'-phosphorothioate c 2'-O-methylcytidine-3'-phosphate cs 2'-O-methylcytidine-3'-phosphorothioate g 2'-O-methylguanosine-3'-phosphate gs 2'-O-methylguanosine-3'-phosphorothioate t 2'-O-methyl-5-methyluridine-3'-phosphate ts 2'-O-methyl-5-methyluridine-3'-phosphorothioate u 2'-O-methyluridine-3'-phosphate us 2'-O-methyluridine-3'-phosphorothioate dA 2 deoxyadenosine-3 phosphate dAs 2 deoxyadenosine-3 phosphorothioate dC 2 deoxycytidine-3 phosphate dCs 2 deoxycytidine-3 phosphorothioate dG 2 deoxyguanosine-3 phosphate dGs 2 deoxyguanosine-3 phosphorothioate dT 2'-deoxythymidine dTs 2 deoxythymidine-3 phosphorothioate dU 2 deoxyuridine s phosphorothioate linkage L961 N-[tris(GalNAc-alkyl)-amidodecanoyl)]- 4-hydroxyprolinol Hyp- (GalNAc-alkyl)3 (Aeo) 2'-O-methoxyethyladenosine-3'-phosphate (Aeos) 2'-O-methoxyethyladenosine-3'-phosphorothioate (Geo) 2'-O-methoxyethylguanosine-3'-phosphate (Geos) 2'-O-methoxyethylguanosine-3'-phosphorothioate (Teo) 2'-O-methoxyethyl-5-methyluridine-3'-phosphate (Teos) 2'-O-methoxyethyl-5-methyluridine-3'-phosphorothioate (m5Ceo) 2'-O-methoxyethyl-5-methylcytidine-3'-phosphate (m5Ceos) 2'-O-methoxyethyl-5-methylcytidine-3'-phosphorothioate

[0568] .sup.1The chemical structure of L96 is as follows:

##STR00027##

Experimental Methods

Bioinformatics

[0569] Transcripts

[0570] siRNA design was carried out to identify siRNAs targeting human, cynomolgus monkey (Macaca fascicularis; henceforth "cyno"), mouse, and rat LECT2 transcripts. Design used the following transcripts from the NCBI RefSeq collection, annotated in the NCBI Gene database (http://www.ncbi.nlm.nih.gov/gene/): Human, NM_002302.2; mouse, NM_010702.1; rat, NM_001108405.1. For cyno, design used a transcript sequenced from a liver-derived cDNA library. Due to high primate/rodent sequence divergence, siRNA duplexes were designed in several separate batches, including but not limited to batches containing duplexes matching human and cyno transcripts only; human, cyno, and mouse transcripts only; and human, cyno, mouse, and rat transcripts only. Most siRNA duplexes were designed that shared 100% identity in the designated region with the listed human transcript and other species transcripts considered in each design batch (above). In some instances, mismatches between duplex and mRNA target were allowed at the first antisense (last sense) position when the antisense strand:target mRNA complementary basepair was a GC or CG pair (see Table 3, oligos with label G21U, G21A, C21A). In these cases, duplexes were designed with UA or AU pairs at the first antisense:last sense pair. Thus the duplexes maintained complementarity but were mismatched with respect to target (U:C, U:G, A:C, or A:G).

[0571] siRNA Design, Specificity, and Efficacy Prediction

[0572] The predicted specificity of all possible 19mers was predicted from each sequence. Candidate 19mers were then selected that lacked repeats longer than 7 nucleotides. These 353 candidate human/cyno, 24 human/cyno/mouse, and 10 human/cyno/mouse/rat siRNAs were used in comprehensive searches against the appropriate transcriptomes (defined as the set of NM and XM_records within the human, cyno, mouse, or rat NCBI Refseq sets) using an exhaustive "brute-force" algorithm implemented in the python script `BruteForce.py`. The script next parsed the transcript-oligo alignments to generate a score based on the position and number of mismatches between the siRNA and any potential `off-target` transcript. The off-target score is weighted to emphasize differences in the `seed` region of siRNAs, in positions 2-9 from the 5' end of the molecule. Each oligo-transcript pair from the brute-force search was given a mismatch score by summing the individual mismatch scores; mismatches in the position 2-9 were counted as 2.8, mismatches in the cleavage site positions 10-11 were counted as 1.2, and mismatches in region 12-19 counted as 1.0. An additional off-target prediction was carried out by comparing the frequency of heptamers and octomers derived from 3 distinct, seed-derived hexamers of each oligo. The hexamers from positions 2-7 relative to the 5' start is used to create 2 heptamers and one octomer. A `heptamer1` was created by adding a 3' A to the hexamer; we create heptamer2 by adding a 5' A to the hexamer; we create the octomer by adding an A to both 5' and 3' ends of the hexamer. The frequency of octomers and heptamers in the human, cyno, mouse, or rat 3'UTRome (defined as the subsequence of the transcriptome from NCBI's Refseq database where the end of the coding region, the `CDS`, is clearly defined) was pre-calculated. The octomer frequency was normalized to the heptamer frequency using the median value from the range of octomer frequencies. A `mirSeedScore` was then calculated by calculating the sum of ((3.times. normalized octomer count)+(2.times. heptamer2 count)+(1.times. heptamer1 count)).

[0573] Both siRNA strands were assigned to a category of specificity according to the calculated scores: a score above 3 qualifies as highly specific, equal to 3 as specific and between 2.2 and 2.8 as moderately specific. The duplexes were sorted by the specificity of the antisense strand, and then moderately (or higher) specific duplexes whose antisense oligos possessed characteristics of duplexes with high predicted efficacy, including maximal UA content in the seed region and low overall GC content, were selected. 23 human/cyno/mouse sense:antisense oligo pairs, including 6 where the first antisense position was swapped to UA (above), were selected. Similarly, 24 human/cyno, and 5 human/cyno/mouse/rat, oligo pairs were selected. The selected antisense oligos were then extended to 23 nucleotides in length, and sense oligos to 21 nucleotides in length. The 48 oligo pairs that still fully matched at least human and cyno transcripts (excluding the first position for UA-swapped sequences) were then selected for synthesis and annealing into duplexes. (Table 3)

[0574] We also selected a set of 198 pairs of 19mer oligos that matched at least the human LECT2 transcript. These were selected to have at least one mismatch to all other annotated human transcripts, and possess good predicted efficacy as above. (Table 2)

TABLE-US-00003 TABLE 2 Human LECT2 siRNA Single Strands and Duplex Sequences SEQ ID SEQ ID NO: Start Position NO: (anti- on transcript (sense) sense) Oligo Name NM_002302.2 Sense Sequence (5'-3') Antisense Sequence (5'-3') 2 3 NM_002302.2_1- 1 AAAUCAAAUAGCUAUCCAU AUGGAUAGCUAUUUGAUUU 19_s 4 5 NM_002302.2_7- 7 AAUAGCUAUCCAUGGAAUA UAUUCCAUGGAUAGCUAUU 25_s 6 7 NM_002302.2_13- 13 UAUCCAUGGAAUAUUAGAA UUCUAAUAUUCCAUGGAUA 31_s 8 9 NM_002302.2_18- 18 AUGGAAUAUUAGAACUUGA UCAAGUUCUAAUAUUCCAU 36_s 10 11 NM_002302.2_21- 21 GAAUAUUAGAACUUGACUU AAGUCAAGUUCUAAUAUUC 39_s 12 13 NM_002302.2_28- 28 AGAACUUGACUUGCUCCAU AUGGAGCAAGUCAAGUUCU 46_s 14 15 NM_002302.2_29- 29 GAACUUGACUUGCUCCAUC GAUGGAGCAAGUCAAGUUC 47_s 16 17 NM_002302.2_34- 34 UGACUUGCUCCAUCCUCUU AAGAGGAUGGAGCAAGUCA 52_s 18 19 NM_002302.2_43- 43 CCAUCCUCUUAAACUUUUU AAAAAGUUUAAGAGGAUGG 61_s 20 21 NM_002302.2_47- 47 CCUCUUAAACUUUUUGUGU ACACAAAAAGUUUAAGAGG 65_s 22 23 NM_002302.2_49- 49 UCUUAAACUUUUUGUGUCU AGACACAAAAAGUUUAAGA 67_s 24 25 NM_002302.2_56- 56 CUUUUUGUGUCUCACACUA UAGUGUGAGACACAAAAAG 74_s 26 27 NM_002302.2_62- 62 GUGUCUCACACUAAAGAAA UUUCUUUAGUGUGAGACAC 80_s 28 29 NM_002302.2_67- 67 UCACACUAAAGAAAUGAGA UCUCAUUUCUUUAGUGUGA 85_s 30 31 NM_002302.2_69- 69 ACACUAAAGAAAUGAGAGA UCUCUCAUUUCUUUAGUGU 87_s 32 33 NM_002302.2_76- 76 AGAAAUGAGAGAUGCAGAA UUCUGCAUCUCUCAUUUCU 94_s 34 35 NM_002302.2_82- 82 GAGAGAUGCAGAAUUCUAA UUAGAAUUCUGCAUCUCUC 100_s 36 37 NM_002302.2_87- 87 AUGCAGAAUUCUAAGGCUA UAGCCUUAGAAUUCUGCAU 105_s 38 39 NM_002302.2_92- 92 GAAUUCUAAGGCUAAAUAG CUAUUUAGCCUUAGAAUUC 110_s 40 41 NM_002302.2_95- 95 UUCUAAGGCUAAAUAGCUA UAGCUAUUUAGCCUUAGAA 113_s 42 43 NM_002302.2_103- 103 CUAAAUAGCUAGGAAGUAU AUACUUCCUAGCUAUUUAG 121_s 44 45 NM_002302.2_107- 107 AUAGCUAGGAAGUAUUCAU AUGAAUACUUCCUAGCUAU 125_s 46 47 NM_002302.2_114- 114 GGAAGUAUUCAUUCAAACU AGUUUGAAUGAAUACUUCC 132_s 48 49 NM_002302.2_123- 123 CAUUCAAACUUGAAUAUUC GAAUAUUCAAGUUUGAAUG 141_s 50 51 NM_002302.2_131- 131 CUUGAAUAUUCUUCAAAGA UCUUUGAAGAAUAUUCAAG 149_s 52 53 NM_002302.2_141- 141 CUUCAAAGAGAGUGUGGGG CCCCACACUCUCUUUGAAG 159_s 54 55 NM_002302.2_144- 144 CAAAGAGAGUGUGGGGGCA UGCCCCCACACUCUCUUUG 162_s 56 57 NM_002302.2_152- 152 GUGUGGGGGCAACUCUAAU AUUAGAGUUGCCCCCACAC 170_s 58 59 NM_002302.2_156- 156 GGGGGCAACUCUAAUCAGA UCUGAUUAGAGUUGCCCCC 174_s 60 61 NM_002302.2_162- 162 AACUCUAAUCAGAGGAAGA UCUUCCUCUGAUUAGAGUU 180_s 62 63 NM_002302.2_168- 168 AAUCAGAGGAAGAAACUAA UUAGUUUCUUCCUCUGAUU 186_s 64 65 NM_002302.2_169- 169 AUCAGAGGAAGAAACUAAA UUUAGUUUCUUCCUCUGAU 187_s 66 67 NM_002302.2_178- 178 AGAAACUAAAGGAAGUAAA UUUACUUCCUUUAGUUUCU 196_s 68 69 NM_002302.2_179- 179 GAAACUAAAGGAAGUAAAA UUUUACUUCCUUUAGUUUC 197_s 70 71 NM_002302.2_184- 184 UAAAGGAAGUAAAACCAGA UCUGGUUUUACUUCCUUUA 202_s 72 73 NM_002302.2_190- 190 AAGUAAAACCAGAUGUUUU AAAACAUCUGGUUUUACUU 208_s 74 75 NM_002302.2_198- 198 CCAGAUGUUUUCCACCAAA UUUGGUGGAAAACAUCUGG 216_s 76 77 NM_002302.2_199- 199 CAGAUGUUUUCCACCAAAG CUUUGGUGGAAAACAUCUG 217_s 78 79 NM_002302.2_208- 208 UCCACCAAAGCCCUCCUUU AAAGGAGGGCUUUGGUGGA 226_s 80 81 NM_002302.2_209- 209 CCACCAAAGCCCUCCUUUU AAAAGGAGGGCUUUGGUGG 227_s 82 83 NM_002302.2_218- 218 CCCUCCUUUUGGCUGGUCU AGACCAGCCAAAAGGAGGG 236_s 84 85 NM_002302.2_228- 228 GGCUGGUCUGAUUUCUACC GGUAGAAAUCAGACCAGCC 246_s 86 87 NM_002302.2 232- 232 GGUCUGAUUUCUACCGCAC GUGCGGUAGAAAUCAGACC 250_s 88 89 NM_002302.2_237- 237 GAUUUCUACCGCACUGGCA UGCCAGUGCGGUAGAAAUC 255_s 90 91 NM_002302.2_243- 243 UACCGCACUGGCAGGGCCA UGGCCCUGCCAGUGCGGUA 261_s 92 93 NM_002302.2_245- 245 CCGCACUGGCAGGGCCAUG CAUGGCCCUGCCAGUGCGG 263_s 94 95 NM_002302.2_252- 252 GGCAGGGCCAUGGGCUAAU AUUAGCCCAUGGCCCUGCC 270_s 96 97 NM_002302.2_258- 258 GCCAUGGGCUAAUAUAUGU ACAUAUAUUAGCCCAUGGC 276_s 98 99 NM_002302.2_259- 259 CCAUGGGCUAAUAUAUGUG CACAUAUAUUAGCCCAUGG 277_s 100 101 NM_002302.2_266- 266 CUAAUAUAUGUGCUGGCAA UUGCCAGCACAUAUAUUAG 284_s 102 103 NM_002302.2_271- 271 AUAUGUGCUGGCAAGUCUU AAGACUUGCCAGCACAUAU 289_s 104 105 NM_002302.2_278- 278 CUGGCAAGUCUUCCAAUGA UCAUUGGAAGACUUGCCAG 296_s 106 107 NM_002302.2_281- 281 GCAAGUCUUCCAAUGAGAU AUCUCAUUGGAAGACUUGC 299_s 108 109 NM_002302.2_286- 286 UCUUCCAAUGAGAUCCGGA UCCGGAUCUCAUUGGAAGA 304_s 110 111 NM_002302.2_293- 293 AUGAGAUCCGGACGUGUGA UCACACGUCCGGAUCUCAU 311_s 112 113 NM_002302.2_297- 297 GAUCCGGACGUGUGACCGC GCGGUCACACGUCCGGAUC 315_s 114 115 NM_002302.2_301- 301 CGGACGUGUGACCGCCAUG CAUGGCGGUCACACGUCCG 319_s 116 117 NM_002302.2_304- 304 ACGUGUGACCGCCAUGGCU AGCCAUGGCGGUCACACGU 322_s 118 119 NM_002302.2_312- 312 CCGCCAUGGCUGUGGACAG CUGUCCACAGCCAUGGCGG 330_s 120 121 NM_002302.2_315- 315 CCAUGGCUGUGGACAGUAC GUACUGUCCACAGCCAUGG 333_s 122 123 NM_002302.2_319- 319 GGCUGUGGACAGUACUCUG CAGAGUACUGUCCACAGCC 337_s 124 125 NM_002302.2_330- 330 GUACUCUGCUCAAAGAAGU ACUUCUUUGAGCAGAGUAC 348_s 126 127 NM_002302.2_334- 334 UCUGCUCAAAGAAGUCAGA UCUGACUUCUUUGAGCAGA 352_s 128 129 NM_002302.2_340- 340 CAAAGAAGUCAGAGGCCUC GAGGCCUCUGACUUCUUUG 358_s 130 131 NM_002302.2_345- 345 AAGUCAGAGGCCUCACCAG CUGGUGAGGCCUCUGACUU 363_s 132 133 NM_002302.2_351- 351 GAGGCCUCACCAGGGUGUG CACACCCUGGUGAGGCCUC 369_s 134 135 NM_002302.2_354- 354 GCCUCACCAGGGUGUGGAC GUCCACACCCUGGUGAGGC 372_s 136 137 NM_002302.2_360- 360 CCAGGGUGUGGACAUCUUG CAAGAUGUCCACACCCUGG 378_s 138 139 NM_002302.2_364- 364 GGUGUGGACAUCUUGUGCU AGCACAAGAUGUCCACACC 382_s 140 141 NM_002302.2_371- 371 ACAUCUUGUGCUCUGCUGG CCAGCAGAGCACAAGAUGU 389_s 142 143 NM_002302.2_378- 378 GUGCUCUGCUGGAUCUACU AGUAGAUCCAGCAGAGCAC 396_s 144 145 NM_002302.2_383- 383 CUGCUGGAUCUACUGUGUA UACACAGUAGAUCCAGCAG 401_s 146 147 NM_002302.2_388- 388 GGAUCUACUGUGUACGCAC GUGCGUACACAGUAGAUCC 406_s 148 149 NM_002302.2_392- 392 CUACUGUGUACGCACCAUU AAUGGUGCGUACACAGUAG 410_s 150 151 NM_002302.2_395- 395 CUGUGUACGCACCAUUCAC GUGAAUGGUGCGUACACAG 413_s 152 153 NM_002302.2_403- 403 GCACCAUUCACUGGAAUGA UCAUUCCAGUGAAUGGUGC 421_s 154 155 NM_002302.2_406- 406 CCAUUCACUGGAAUGAUUG CAAUCAUUCCAGUGAAUGG 424_s 156 157 NM_002302.2_413- 413 CUGGAAUGAUUGUGGGCCA UGGCCCACAAUCAUUCCAG 431_s 158 159 NM_002302.2_416- 416 GAAUGAUUGUGGGCCAGGA UCCUGGCCCACAAUCAUUC 434_s 160 161 NM_002302.2_420- 420 GAUUGUGGGCCAGGAGAAA UUUCUCCUGGCCCACAAUC 438_s

162 163 NM_002302.2_426- 426 GGGCCAGGAGAAACCUUAU AUAAGGUUUCUCCUGGCCC 444_s 164 165 NM_002302.2_430- 430 CAGGAGAAACCUUAUCAAA UUUGAUAAGGUUUCUCCUG 448_s 166 167 NM_002302.2_436- 436 AAACCUUAUCAAAACAAGA UCUUGUUUUGAUAAGGUUU 454_s 168 169 NM_002302.2_442- 442 UAUCAAAACAAGAAUGCUA UAGCAUUCUUGUUUUGAUA 460_s 170 171 NM_002302.2_448- 448 AACAAGAAUGCUAUCAAUA UAUUGAUAGCAUUCUUGUU 466_s 172 173 NM_002302.2_450- 450 CAAGAAUGCUAUCAAUAAU AUUAUUGAUAGCAUUCUUG 468_s 174 175 NM_002302.2_462- 462 CAAUAAUGGUGUUCGAAUA UAUUCGAACACCAUUAUUG 480_s 176 177 NM_002302.2_465- 465 UAAUGGUGUUCGAAUAUCU AGAUAUUCGAACACCAUUA 483_s 178 179 NM_002302.2_471- 471 UGUUCGAAUAUCUGGAAGA UCUUCCAGAUAUUCGAACA 489_s 180 181 NM_002302.2_478- 478 AUAUCUGGAAGAGGUUUUU AAAAACCUCUUCCAGAUAU 496_s 182 183 NM_002302.2_480- 480 AUCUGGAAGAGGUUUUUGU ACAAAAACCUCUUCCAGAU 498_s 184 185 NM_002302.2_487- 487 AGAGGUUUUUGUGUCAAAA UUUUGACACAAAAACCUCU 505_s 186 187 NM_002302.2_490- 490 GGUUUUUGUGUCAAAAUGU ACAUUUUGACACAAAAACC 508_s 188 189 NM_002302.2_497- 497 GUGUCAAAAUGUUCUACAU AUGUAGAACAUUUUGACAC 515_s 190 191 NM_002302.2_500- 500 UCAAAAUGUUCUACAUUAA UUAAUGUAGAACAUUUUGA 518_s 192 193 NM_002302.2_506- 506 UGUUCUACAUUAAGCCAAU AUUGGCUUAAUGUAGAACA 524_s 194 195 NM_002302.2_528- 528 GUAUAAAGGUCCUAUUAAG CUUAAUAGGACCUUUAUAC 546_s 196 197 NM_002302.2_529- 529 UAUAAAGGUCCUAUUAAGA UCUUAAUAGGACCUUUAUA 547_s 198 199 NM_002302.2_538- 538 CCUAUUAAGAAGGGAGAAA UUUCUCCCUUCUUAAUAGG 556_s 200 201 NM_002302.2_539- 539 CUAUUAAGAAGGGAGAAAA UUUUCUCCCUUCUUAAUAG 557_s 202 203 NM_002302.2_544- 544 AAGAAGGGAGAAAAACUUG CAAGUUUUUCUCCCUUCUU 562_s 204 205 NM_002302.2_552- 552 AGAAAAACUUGGAACUCUA UAGAGUUCCAAGUUUUUCU 570_s 206 207 NM_002302.2_555- 555 AAAACUUGGAACUCUAUUG CAAUAGAGUUCCAAGUUUU 573_s 208 209 NM_002302.2_559- 559 CUUGGAACUCUAUUGCCCU AGGGCAAUAGAGUUCCAAG 577_s 210 211 NM_002302.2_566- 566 CUCUAUUGCCCUUGCAGAA UUCUGCAAGGGCAAUAGAG 584_s 212 213 NM_002302.2_573- 573 GCCCUUGCAGAAAGUUUAU AUAAACUUUCUGCAAGGGC 591_s 214 215 NM_002302.2_574- 574 CCCUUGCAGAAAGUUUAUC GAUAAACUUUCUGCAAGGG 592_s 216 217 NM_002302.2_581- 581 AGAAAGUUUAUCCUGGCAU AUGCCAGGAUAAACUUUCU 599_s 218 219 NM_002302.2_585- 585 AGUUUAUCCUGGCAUACAA UUGUAUGCCAGGAUAAACU 603_s 220 221 NM_002302.2_592- 592 CCUGGCAUACAAUCGCAUG CAUGCGAUUGUAUGCCAGG 610_s 222 223 NM_002302.2_598- 598 AUACAAUCGCAUGUGCACA UGUGCACAUGCGAUUGUAU 616_s 224 225 NM_002302.2_603- 603 AUCGCAUGUGCACAUUGAA UUCAAUGUGCACAUGCGAU 621_s 226 227 NM_002302.2_606- 606 GCAUGUGCACAUUGAAAAC GUUUUCAAUGUGCACAUGC 624_s 228 229 NM_002302.2_611- 611 UGCACAUUGAAAACUGUGA UCACAGUUUUCAAUGUGCA 629_s 230 231 NM_002302.2_616- 616 AUUGAAAACUGUGACUCGA UCGAGUCACAGUUUUCAAU 634_s 232 233 NM_002302.2_620- 620 AAAACUGUGACUCGAGUGA UCACUCGAGUCACAGUUUU 638_s 234 235 NM_002302.2_625- 625 UGUGACUCGAGUGACCCUA UAGGGUCACUCGAGUCACA 643_s 236 237 NM_002302.2_633- 633 GAGUGACCCUACUGCAUAC GUAUGCAGUAGGGUCACUC 651_s 238 239 NM_002302.2_637- 637 GACCCUACUGCAUACCUGU ACAGGUAUGCAGUAGGGUC 655_s 240 241 NM_002302.2_640- 640 CCUACUGCAUACCUGUAAA UUUACAGGUAUGCAGUAGG 658_s 242 243 NM_002302.2_644- 644 CUGCAUACCUGUAAAUCGA UCGAUUUACAGGUAUGCAG 662_s 244 245 NM_002302.2_651- 651 CCUGUAAAUCGAAGGCCAA UUGGCCUUCGAUUUACAGG 669_s 246 247 NM_002302.2_657- 657 AAUCGAAGGCCAAUGGUCA UGACCAUUGGCCUUCGAUU 675_s 248 249 NM_002302.2_663- 663 AGGCCAAUGGUCAGAUCUU AAGAUCUGACCAUUGGCCU 681_s 250 251 NM_002302.2_667- 667 CAAUGGUCAGAUCUUCAAA UUUGAAGAUCUGACCAUUG 685_s 252 253 NM_002302.2_674- 674 CAGAUCUUCAAAAUAAAAA UUUUUAUUUUGAAGAUCUG 692_s 254 255 NM_002302.2_686- 686 AUAAAAAGUCAUCUUAAAA UUUUAAGAUGACUUUUUAU 704_s 256 257 NM_002302.2_691- 691 AAGUCAUCUUAAAAACCUG CAGGUUUUUAAGAUGACUU 709_s 258 259 NM_002302.2_698- 698 CUUAAAAACCUGGAUGCAU AUGCAUCCAGGUUUUUAAG 716_s 260 261 NM_002302.2_699- 699 UUAAAAACCUGGAUGCAUA UAUGCAUCCAGGUUUUUAA 717_s 262 263 NM_002302.2_706- 706 CCUGGAUGCAUACCCUUCU AGAAGGGUAUGCAUCCAGG 724_s 264 265 NM_002302.2_709- 709 GGAUGCAUACCCUUCUCUU AAGAGAAGGGUAUGCAUCC 727_s 266 267 NM_002302.2_716- 716 UACCCUUCUCUUCAAGAAA UUUCUUGAAGAGAAGGGUA 734_s 268 269 NM_002302.2_719- 719 CCUUCUCUUCAAGAAAUUU AAAUUUCUUGAAGAGAAGG 737_s 270 271 NM_002302.2_728- 728 CAAGAAAUUUGUGUUCACA UGUGAACACAAAUUUCUUG 746_s 272 273 NM_002302.2_730- 730 AGAAAUUUGUGUUCACAAA UUUGUGAACACAAAUUUCU 748_s 274 275 NM_002302.2_736- 736 UUGUGUUCACAAAGGAAAA UUUUCCUUUGUGAACACAA 754_s 276 277 NM_002302.2_743- 743 CACAAAGGAAAAAUGCAUG CAUGCAUUUUUCCUUUGUG 761_s 278 279 NM_002302.2_745- 745 CAAAGGAAAAAUGCAUGAA UUCAUGCAUUUUUCCUUUG 763_s 280 281 NM_002302.2_750- 750 GAAAAAUGCAUGAAGGGAU AUCCCUUCAUGCAUUUUUC 768_s 282 283 NM_002302.2_755- 755 AUGCAUGAAGGGAUGGAUA UAUCCAUCCCUUCAUGCAU 773_s 284 285 NM_002302.2_763- 763 AGGGAUGGAUACCCCAUUU AAAUGGGGUAUCCAUCCCU 781_s 286 287 NM_002302.2_764- 764 GGGAUGGAUACCCCAUUUU AAAAUGGGGUAUCCAUCCC 782_s 288 289 NM_002302.2_773- 773 ACCCCAUUUUCCAUGACAU AUGUCAUGGAAAAUGGGGU 791_s 290 291 NM_002302.2_774- 774 CCCCAUUUUCCAUGACAUG CAUGUCAUGGAAAAUGGGG 792_s 292 293 NM_002302.2_783- 783 CCAUGACAUGAUUAUUACA UGUAAUAAUCAUGUCAUGG 801_s 294 295 NM_002302.2_786- 786 UGACAUGAUUAUUACACAU AUGUGUAAUAAUCAUGUCA 804_s 296 297 NM_002302.2_792- 792 GAUUAUUACACAUUGCAUG CAUGCAAUGUGUAAUAAUC 810_s 298 299 NM_002302.2_798- 798 UACACAUUGCAUGCCUGUA UACAGGCAUGCAAUGUGUA 816_s 300 301 NM_002302.2_803- 803 AUUGCAUGCCUGUAUCAAA UUUGAUACAGGCAUGCAAU 821_s 302 303 NM_002302.2_804- 804 UUGCAUGCCUGUAUCAAAA UUUUGAUACAGGCAUGCAA 822_s 304 305 NM_002302.2_815- 815 UAUCAAAACAUCUCACGUA UACGUGAGAUGUUUUGAUA 833_s 306 307 NM_002302.2_823- 823 CAUCUCACGUACCUCAUAA UUAUGAGGUACGUGAGAUG 841_s 308 309 NM_002302.2_828- 828 CACGUACCUCAUAAACAUA UAUGUUUAUGAGGUACGUG 846_s 310 311 NM_002302.2_830- 830 CGUACCUCAUAAACAUAUA UAUAUGUUUAUGAGGUACG 848_s 312 313 NM_002302.2_840- 840 AAACAUAUACACCUAUGUA UACAUAGGUGUAUAUGUUU 858_s 314 315 NM_002302.2_848- 848 ACACCUAUGUACCCACAAA UUUGUGGGUACAUAGGUGU 866_s 316 317 NM_002302.2_849- 849 CACCUAUGUACCCACAAAA UUUUGUGGGUACAUAGGUG 867_s 318 319 NM_002302.2_858- 858 ACCCACAAAAAUUUUUUAA UUAAAAAAUUUUUGUGGGU 876_s 320 321 NM_002302.2_863- 863 CAAAAAUUUUUUAAUUAAA UUUAAUUAAAAAAUUUUUG 881_s 322 323 NM_002302.2_872- 872 UUUAAUUAAAAAAAGGAAA UUUCCUUUUUUUAAUUAAA 890_s 324 325 NM_002302.2_877- 877 UUAAAAAAAGGAAAUUUGA UCAAAUUUCCUUUUUUUAA 895_s 326 327 NM_002302.2_883- 883 AAAGGAAAUUUGAGUUUAA UUAAACUCAAAUUUCCUUU 901_s 328 329 NM_002302.2_886- 886 GGAAAUUUGAGUUUAAAUA UAUUUAAACUCAAAUUUCC 904_s

330 331 NM_002302.2_889- 889 AAUUUGAGUUUAAAUAGAA UUCUAUUUAAACUCAAAUU 907_s 332 333 NM_002302.2_895- 895 AGUUUAAAUAGAAACAUGA UCAUGUUUCUAUUUAAACU 913_s 334 335 NM_002302.2_899- 899 UAAAUAGAAACAUGAUAAA UUUAUCAUGUUUCUAUUUA 917_s 336 337 NM_002302.2_905- 905 GAAACAUGAUAAAUGCAAG CUUGCAUUUAUCAUGUUUC 923_s 338 339 NM_002302.2_912- 912 GAUAAAUGCAAGAAAGAAA UUUCUUUCUUGCAUUUAUC 930_s 340 341 NM_002302.2_915- 915 AAAUGCAAGAAAGAAAACA UGUUUUCUUUCUUGCAUUU 933_s 342 343 NM_002302.2_920- 920 CAAGAAAGAAAACAUUUUG CAAAAUGUUUUCUUUCUUG 938_s 344 345 NM_002302.2_926- 926 AGAAAACAUUUUGAUUUUA UAAAAUCAAAAUGUUUUCU 944_s 346 347 NM_002302.2_932- 932 CAUUUUGAUUUUAACUCAU AUGAGUUAAAAUCAAAAUG 950_s 348 349 NM_002302.2_938- 938 GAUUUUAACUCAUUGUCAC GUGACAAUGAGUUAAAAUC 956_s 350 351 NM_002302.2_939- 939 AUUUUAACUCAUUGUCACU AGUGACAAUGAGUUAAAAU 957_s 352 353 NM_002302.2_948- 948 CAUUGUCACUCUGAUGUUC GAACAUCAGAGUGACAAUG 966_s 354 355 NM_002302.2_950- 950 UUGUCACUCUGAUGUUCAU AUGAACAUCAGAGUGACAA 968_s 356 357 NM_002302.2_956- 956 CUCUGAUGUUCAUGUGAAC GUUCACAUGAACAUCAGAG 974_s 358 359 NM_002302.2_960- 960 GAUGUUCAUGUGAACUGGU ACCAGUUCACAUGAACAUC 978_s 360 361 NM_002302.2_966- 966 CAUGUGAACUGGUUGCUUC GAAGCAACCAGUUCACAUG 984_s 362 363 NM_002302.2_973- 973 ACUGGUUGCUUCGGGCUCU AGAGCCCGAAGCAACCAGU 991_s 364 365 NM_002302.2_977- 977 GUUGCUUCGGGCUCUUUGA UCAAAGAGCCCGAAGCAAC 995_s 366 367 NM_002302.2_980- 980 GCUUCGGGCUCUUUGAUCU AGAUCAAAGAGCCCGAAGC 998_s 368 369 NM_002302.2_984- 984 CGGGCUCUUUGAUCUGUCA UGACAGAUCAAAGAGCCCG 1002_s 370 371 NM_002302.2_989- 989 UCUUUGAUCUGUCACCUAU AUAGGUGACAGAUCAAAGA 1007_s 372 373 NM_002302.2_994- 994 GAUCUGUCACCUAUGGAAU AUUCCAUAGGUGACAGAUC 1012_s 374 375 NM_002302.2_1001- 1001 CACCUAUGGAAUCUGAGUG CACUCAGAUUCCAUAGGUG 1019_s 376 377 NM_002302.2_1008- 1008 GGAAUCUGAGUGGUUUUAU AUAAAACCACUCAGAUUCC 1026_s 378 379 NM_002302.2_1013- 1013 CUGAGUGGUUUUAUUUUUU AAAAAAUAAAACCACUCAG 1031_s 380 381 NM_002302.2_1015- 1015 GAGUGGUUUUAUUUUUUAG CUAAAAAAUAAAACCACUC 1033_s 382 383 NM_002302.2_1019- 1019 GGUUUUAUUUUUUAGAUUU AAAUCUAAAAAAUAAAACC 1037_s 384 385 NM_002302.2_1025- 1025 AUUUUUUAGAUUUCUCAGU ACUGAGAAAUCUAAAAAAU 1043_s 386 387 NM_002302.2_1031- 1031 UAGAUUUCUCAGUCCCAAA UUUGGGACUGAGAAAUCUA 1049_s 388 389 NM_002302.2_1038- 1038 CUCAGUCCCAAAGAUCUAA UUAGAUCUUUGGGACUGAG 1056_s 390 391 NM_002302.2_1043- 1043 UCCCAAAGAUCUAAGAUAA UUAUCUUAGAUCUUUGGGA 1061_s 392 393 NM_002302.2_1046- 1046 CAAAGAUCUAAGAUAAAUA UAUUUAUCUUAGAUCUUUG 1064_s 394 395 NM_002302.2_1053- 1053 CUAAGAUAAAUAAACAAGA UCUUGUUUAUUUAUCUUAG 1071_s 396 397 NM_002302.2_1055- 1055 AAGAUAAAUAAACAAGAGA UCUCUUGUUUAUUUAUCUU 1073_s

TABLE-US-00004 TABLE 3 Human LECT2 siRNA Single Strands and Duplex Sequences Start SEQ Position ID on SEQ ID NO: transcript NO: (anti- NM_ Sense Sequence Antisense Sequence (sense) sense) Duplex Name 002302.2 (5'-3') (5'-3') Species.sup.1 398 399 NM_002302.2_512- 512 AUUAAGCCAAUUAAGUAUAAA UUUAUACUUAAUUGGCUUAAUGU HCMR 534_s 400 401 NM_002302.2_511- 511 CAUUAAGCCAAUUAAGUAUAA UUAUACUUAAUUGGCUUAAUGUA HCMR 533_s 402 403 NM_002302.2_508- 508 CUACAUUAAGCCAAUUAAGUA UACUUAAUUGGCUUAAUGUAGAA HCMR 530_s 404 405 NM_002302.2_509- 509 UACAUUAAGCCAAUUAAGUAU AUACUUAAUUGGCUUAAUGUAGA HCMR 531_s 406 407 NM_002302.2_510- 510 ACAUUAAGCCAAUUAAGUAUA UAUACUUAAUUGGCUUAAUGUAG HCMR 532_s 408 409 NM_002302.2_320- 320 UGUGGACAGUACUCUGCUCAA UUGAGCAGAGUACUGUCCACAGC HCM 342_s 410 411 NM_002302.2_515- 515 AAGCCAAUUAAGUAUAAAGGU ACCUUUAUACUUAAUUGGCUUAA HCM 537_s 412 413 NM_002302.2_513- 513 UUAAGCCAAUUAAGUAUAAAG CUUUAUACUUAAUUGGCUUAAUG HCM 535_s 414 415 NM_002302.2_317- 317 GGCUGUGGACAGUACUCUGCU AGCAGAGUACUGUCCACAGCCAU HCM 339_s 416 417 NM_002302.2_319- 319 CUGUGGACAGUACUCUGCUCA UGAGCAGAGUACUGUCCACAGCC HCM 341_s 418 419 NM_002302.2_321- 321 GUGGACAGUACUCUGCUCAAA UUUGAGCAGAGUACUGUCCACAG HCM 343_s 420 421 NM_002302.2_318- 318 GCUGUGGACAGUACUCUGCUC GAGCAGAGUACUGUCCACAGCCA HCM 340_s 422 423 NM_002302.2_514- 514 UAAGCCAAUUAAGUAUAAAGG CCUUUAUACUUAAUUGGCUUAAU HCM 536_s 424 425 NM_002302.2_324- 324 GACAGUACUCUGCUCAAAGAA UUCUUUGAGCAGAGUACUGUCCA HCM 346_s 426 427 NM_002302.2_323- 323 GGACAGUACUCUGCUCAAAGA UCUUUGAGCAGAGUACUGUCCAC HCM 345_s 428 429 NM_002302.2_322- 322 UGGACAGUACUCUGCUCAAAG CUUUGAGCAGAGUACUGUCCACA HCM 344_s 430 431 NM_002302.2_513- 513 UUAAGCCAAUUAAGUAUAAAU AUUUAUACUUAAUUGGCUUAAUG HCM 535_G21U_s 432 433 NM_002302.2_318- 318 GCUGUGGACAGUACUCUGCUA UAGCAGAGUACUGUCCACAGCCA HCM 340_C21A_s 434 435 NM_002302.2_514- 514 UAAGCCAAUUAAGUAUAAAGA UCUUUAUACUUAAUUGGCUUAAU HCM 536_G21A_s 436 437 NM_002302.2_322- 322 UGGACAGUACUCUGCUCAAAU AUUUGAGCAGAGUACUGUCCACA HCM 344_G21U_s 438 439 NM_002302.2_516- 516 AGCCAAUUAAGUAUAAAGGUA UACCUUUAUACUUAAUUGGCUUA HCM 538_C21A_s 440 441 NM_002302.2_516- 516 AGCCAAUUAAGUAUAAAGGUC GACCUUUAUACUUAAUUGGCUUA HCM 538_s 442 443 NM_002302.2_507- 507 UCUACAUUAAGCCAAUUAAGU ACUUAAUUGGCUUAAUGUAGAAC HC 529_s 444 445 NM_002302.2_506- 506 UUCUACAUUAAGCCAAUUAAG CUUAAUUGGCUUAAUGUAGAACA HC 528_s 446 447 NM_002302.2_505- 505 GUUCUACAUUAAGCCAAUUAA UUAAUUGGCUUAAUGUAGAACAU HC 527_s 448 449 NM_002302.2_504- 504 UGUUCUACAUUAAGCCAAUUA UAAUUGGCUUAAUGUAGAACAUU HC 526_s 450 451 NM_002302.2_314- 314 CAUGGCUGUGGACAGUACUCU AGAGUACUGUCCACAGCCAUGGC HC 336_s 452 453 NM_002302.2_316- 316 UGGCUGUGGACAGUACUCUGC GCAGAGUACUGUCCACAGCCAUG HC 338_s 454 455 NM_002302.2_506- 506 UUCUACAUUAAGCCAAUUAAA UUUAAUUGGCUUAAUGUAGAACA HC 528_G21A_s 456 457 NM_002302.2_316- 316 UGGCUGUGGACAGUACUCUGA UCAGAGUACUGUCCACAGCCAUG HC 338_C21A_s 458 459 NM_002302.2_263- 263 GCUAAUAUAUGUGCUGGCAAA UUUGCCAGCACAUAUAUUAGCCC HC 285_G21A_s 460 461 NM_002302.2_571- 571 GCCCUUGCAGAAAGUUUAUCA UGAUAAACUUUCUGCAAGGGCAA HC 593_C21A_s 462 463 NM_002302.2_130- 130 UUGAAUAUUCUUCAAAGAGAA UUCUCUUUGAAGAAUAUUCAAGU HC 152_G21A_s 464 465 NM_002302.2_263- 263 GCUAAUAUAUGUGCUGGCAAG CUUGCCAGCACAUAUAUUAGCCC HC 285_s 466 467 NM_002302.2_118- 118 AUUCAUUCAAACUUGAAUAUU AAUAUUCAAGUUUGAAUGAAUAC HC 140_s 468 469 NM_002302.2_107- 107 AGCUAGGAAGUAUUCAUUCAA UUGAAUGAAUACUUCCUAGCUAU HC 129_s 470 471 NM_002302.2_665- 665 CAAUGGUCAGAUCUUCAAAAU AUUUUGAAGAUCUGACCAUUGGC HC 687_s 472 473 NM_002302.2_668- 668 UGGUCAGAUCUUCAAAAUAAA UUUAUUUUGAAGAUCUGACCAUU HC 690_s 474 475 NM_002302.2_427- 427 CCAGGAGAAACCUUAUCAAAA UUUUGAUAAGGUUUCUCCUGGCC HC 449_s 476 477 NM_002302.2_572- 572 CCCUUGCAGAAAGUUUAUCCU AGGAUAAACUUUCUGCAAGGGCA HC 594_s 478 479 NM_002302.2_123- 123 UUCAAACUUGAAUAUUCUUCA UGAAGAAUAUUCAAGUUUGAAUG HC 145_s 480 481 NM_002302.2_106- 106 UAGCUAGGAAGUAUUCAUUCA UGAAUGAAUACUUCCUAGCUAUU HC 128_s 482 483 NM_002302.2_571- 571 GCCCUUGCAGAAAGUUUAUCC GGAUAAACUUUCUGCAAGGGCAA HC 593_s 484 485 NM_002302.2_130- 130 UUGAAUAUUCUUCAAAGAGAG CUCUCUUUGAAGAAUAUUCAAGU HC 152_s 486 487 NM_002302.2_664- 664 CCAAUGGUCAGAUCUUCAAAA UUUUGAAGAUCUGACCAUUGGCC HC 686_s 488 489 NM_002302.2_666- 666 AAUGGUCAGAUCUUCAAAAUA UAUUUUGAAGAUCUGACCAUUGG HC 688_s 490 491 NM_002302.2_421- 421 UGUGGGCCAGGAGAAACCUUA UAAGGUUUCUCCUGGCCCACAAU HC 443_s 492 493 NM_002302.2_368- 368 GACAUCUUGUGCUCUGCUGGA UCCAGCAGAGCACAAGAUGUCCA HC 390_s .sup.1H: human; C: cynomolgus monkey; M: mouse; R: rat

Example 2. In Vitro Screening of LECT2 siRNA

[0575] Experimental Methods

[0576] Cell Culture and Transfections:

[0577] Primary Cynomolgus monkey hepatocytes (PCH) (Celsis #MO03055, lot CBT) were transfected by adding 14.8 .mu.l of Opti-MEM plus 0.2 .mu.l of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 .mu.l of siRNA duplexes per well into a 96-well plate and incubated at room temperature for 15 minutes. 80 .mu.l of InVitroGRO CP Rat media (InVitro Technologies) containing .about.2.times.10.sup.4 PCH cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 10 nM and 0.1 nM final duplex concentration and dose response experiments were done over a range of doses from 10 nM to 36 fM final duplex concentration over 8, 6-fold dilutions.

[0578] RNA Isolation:

[0579] Total RNA was isolated using DYNABEADS mRNA Isolation Kit (Invitrogen, part #: 610-12). Cells were harvested and lysed in 150 .mu.l of Lysis/Binding Buffer then mixed for 5 minute at 850 rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 .mu.l Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After removing supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing supernatant, magnetic beads were washed 2 times with 150 .mu.l Wash Buffer A and mixed for 1 minute. Beads were capture again and supernatant removed. Beads were then washed with 150 .mu.l Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150 .mu.l Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50 .mu.l of Elution Buffer was added and mixed for 5 minutes at 70.degree. C. Beads were captured on magnet for 5 minutes. 40 .mu.l of supernatant was removed and added to another 96 well plate.

cDNA Synthesis

[0580] cDNA was synthesized using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, Calif., Cat #4368813). A master mix of 2 .mu.l 10.times. Buffer, 0.8 .mu.l 25.times.dNTPs, 2 .mu.l Random primers, 1 .mu.l Reverse Transcriptase, 1 .mu.l RNase inhibitor and 3.41 of H.sub.2O per reaction were added into 10 .mu.l total RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, Calif.) through the following steps: 25.degree. C. 10 min, 37.degree. C. 120 min, 85.degree. C. 5 sec, 4.degree. C. hold.

[0581] Real Time PCR:

[0582] 2 .mu.l of cDNA were added to a master mix containing 0.5 .mu.l of custom designed Cynomolgus monkey GAPDH TaqMan Probe (F-GCATCCTGGGCTACACTGA (SEQ ID NO: 494), R-TGGGTGTCGCTGTTGAAGTC (SEQ ID NO: 495), Probe-CCAGGTGGTCTCCTCC (SEQ ID NO: 496)), 0.5 .mu.l human Lect2 (Hs01040204_m1--which is cross reactive with Cynomolgus monkey Lect2) and 5 .mu.l Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was done in a LightCycler480 Real Time PCR system (Roche) using the .DELTA..DELTA.Ct(RQ) assay. Each duplex was tested in two independent transfections and each transfection was assayed in duplicate, unless otherwise noted in the summary tables.

[0583] To calculate relative fold change, real time data were analyzed using the .DELTA..DELTA.Ct method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells. IC.sub.50 s were calculated using a 4 parameter fit model using XLFit and normalized to cells transfected with AD-1955 or naive cells.

[0584] The modified and unmodified LECT2 siRNA sequences are shown in Tables 5 and 6, respectively. Nucleic acid sequences provided herein are represented using standard nomenclature (see the abbreviations of Table 1). In some instances, mismatches between duplex and mRNA target were allowed at the first antisense (last sense) position when the antisense strand:target mRNA complementary basepair was a GC or CG pair (see Tables 5 and 6, oligos with label G21U, G21A, C21A). In these cases, duplexes were designed with UA or AU pairs at the first antisense:last sense pair. Thus the duplexes maintained complementarity but were mismatched with respect to target (U:C, U:G, A:C, or A:G).

TABLE-US-00005 TABLE 5 Modified LECT2 siRNA Sequences Sense SEQ Duplex Oligo ID Antisense Name Name Sense Sequence NO Oligo Name AD-61249 A-122943 UfsasGfcUfaGfgAfAfGfuAfuUfcAfuUfcAfL96 497 A-122944 AD-61260 A-122931 AfsgsCfuAfgGfaAfGfUfaUfuCfaUfuCfaAfL96 499 A-122932 AD-61254 A-122929 AfsusUfcAfuUfcAfAfAfcUfuGfaAfuAfuUfL96 501 A-122930 AD-61243 A-122941 UfsusCfaAfaCfuUfGfAfaUfaUfuCfuUfcAfL96 503 A-122942 AD-61261 A-122947 UfsusGfaAfuAfuUfCfUfuCfaAfaGfaGfaGfL96 505 A-122948 AD-61242 A-122925 UfsusGfaAfuAfuUfCfUfuCfaAfaGfaGfaAfL96 507 A-122926 AD-61248 A-122927 GfscsUfaAfuAfuAfUfGfuGfcUfgGfcAfaGfL96 509 A-122928 AD-61277 A-122921 GfscsUfaAfuAfuAfUfGfuGfcUfgGfcAfaAfL96 511 A-122922 AD-61253 A-122913 CfsasUfgGfcUfgUfGfGfaCfaGfuAfcUfcUfL96 513 A-122914 AD-61259 A-122915 UfsgsGfcUfgUfgGfAfCfaGfuAfcUfcUfgCfL96 515 A-122916 AD-61271 A-122919 UfsgsGfcUfgUfgGfAfCfaGfuAfcUfcUfgAfL96 517 A-122920 AD-61239 A-122877 GfsgsCfuGfuGfgAfCfAfgUfaCfuCfuGfcUfL96 519 A-122878 AD-61257 A-122883 GfscsUfgUfgGfaCfAfGfuAfcUfcUfgCfuCfL96 521 A-122884 AD-61246 A-122895 GfscsUfgUfgGfaCfAfGfuAfcUfcUfgCfuAfL96 523 A-122896 AD-61245 A-122879 CfsusGfuGfgAfcAfGfUfaCfuCfuGfcUfcAfL96 525 A-122880 AD-61268 A-122871 UfsgsUfgGfaCfaGfUfAfcUfcUfgCfuCfaAfL96 527 A-122872 AD-61251 A-122881 GfsusGfgAfcAfgUfAfCfuCfuGfcUfcAfaAfL96 529 A-122882 AD-61281 A-122891 UfsgsGfaCfaGfuAfCfUfcUfgCfuCfaAfaGfL96 531 A-122892 AD-61258 A-122899 UfsgsGfaCfaGfuAfCfUfcUfgCfuCfaAfaUfL96 533 A-122900 AD-61275 A-122889 GfsgsAfcAfgUfaCfUfCfuGfcUfcAfaAfgAfL96 535 A-122890 AD-61269 A-122887 GfsasCfaGfuAfcUfCfUfgCfuCfaAfaGfaAfL96 537 A-122888 AD-61279 A-122955 UfsgsUfgGfgCfcAfGfGfaGfaAfaCfcUfuAfL96 539 A-122956 AD-61278 A-122937 CfscsAfgGfaGfaAfAfCfcUfuAfuCfaAfaAfL96 541 A-122938 AD-61247 A-122911 UfsgsUfuCfuAfcAfUfUfaAfgCfcAfaUfuAfL96 543 A-122912 AD-61241 A-122909 GfsusUfcUfaCfaUfUfAfaGfcCfaAfuUfaAfL96 545 A-122910 AD-61282 A-122907 UfsusCfuAfcAfuUfAfAfgCfcAfaUfuAfaGfL96 547 A-122908 AD-61265 A-122917 UfsusCfuAfcAfuUfAfAfgCfcAfaUfuAfaAfL96 549 A-122918 AD-61276 A-122905 UfscsUfaCfaUfuAfAfGfcCfaAfuUfaAfgUfL96 551 A-122906 AD-61250 A-122865 CfsusAfcAfuUfaAfGfCfcAfaUfuAfaGfuAfL96 553 A-122866 AD-61256 A-122867 UfsasCfaUfuAfaGfCfCfaAfuUfaAfgUfaUfL96 555 A-122868 AD-61262 A-122869 AfscsAfuUfaAfgCfCfAfaUfuAfaGfuAfuAfL96 557 A-122870 AD-61244 A-122863 CfsasUfuAfaGfcCfAfAfuUfaAfgUfaUfaAfL96 559 A-122864 AD-61238 A-122861 AfsusUfaAfgCfcAfAfUfuAfaGfuAfuAfaAfL96 561 A-122862 AD-61280 A-122875 UfsusAfaGfcCfaAfUfUfaAfgUfaUfaAfaGfL96 563 A-122876 AD-61240 A-122893 UfsusAfaGfcCfaAfUfUfaAfgUfaUfaAfaUfL96 565 A-122894 AD-61263 A-122885 UfsasAfgCfcAfaUfUfAfaGfuAfuAfaAfgGfL96 567 A-122886 AD-61252 A-122897 UfsasAfgCfcAfaUfUfAfaGfuAfuAfaAfgAfL96 569 A-122898 AD-61274 A-122873 AfsasGfcCfaAfuUfAfAfgUfaUfaAfaGfgUfL96 571 A-122874 AD-61270 A-122903 AfsgsCfcAfaUfuAfAfGfuAfuAfaAfgGfuCfL96 573 A-122904 AD-61264 A-122901 AfsgsCfcAfaUfuAfAfGfuAfuAfaAfgGfuAfL96 575 A-122902 AD-61255 A-122945 GfscsCfcUfuGfcAfGfAfaAfgUfuUfaUfcCfL96 577 A-122946 AD-61283 A-122923 GfscsCfcUfuGfcAfGfAfaAfgUfuUfaUfcAfL96 579 A-122924 AD-61284 A-122939 CfscsCfuUfgCfaGfAfAfaGfuUfuAfuCfcUfL96 581 A-122940 AD-61267 A-122950 CfscsAfaUfgGfuCfAfGfaUfcUfuCfaAfaAfL96 583 A-122952 AD-61266 A-122933 CfsasAfuGfgUfcAfGfAfuCfuUfcAfaAfaUfL96 585 A-122934 AD-61273 A-122953 AfsasUfgGfuCfaGfAfUfcUfuCfaAfaAfuAfL96 587 A-122954 AD-61272 A-122935 UfsgsGfuCfaGfaUfCfUfuCfaAfaAfuAfaAfL96 589 A-122936 SEQ Antisense Duplex ID position in Name Antisense Sequence NO NM_002302 AD-61249 usGfsaAfuGfaAfuAfcuuCfcUfaGfcUfasusu 498 106-128 AD-61260 usUfsgAfaUfgAfaUfacuUfcCfuAfgCfusasu 500 107-129 AD-61254 asAfsuAfuUfcAfaGfuuuGfaAfuGfaAfusasc 502 118-140 AD-61243 usGfsaAfgAfaUfaUfucaAfgUfuUfgAfasusg 504 123-145 AD-61261 csUfscUfcUfuUfgAfagaAfuAfuUfcAfasgsu 506 130-152 AD-61242 usUfscUfcUfuUfgAfagaAfuAfuUfcAfasgsu 508 130-152_G21A AD-61248 csUfsuGfcCfaGfcAfcauAfuAfuUfaGfcscsc 510 263-285 AD-61277 usUfsuGfcCfaGfcAfcauAfuAfuUfaGfcscsc 512 263-285_G21A AD-61253 asGfsaGfuAfcUfgUfccaCfaGfcCfaUfgsgsc 514 314-336 AD-61259 gsCfsaGfaGfuAfcUfgucCfaCfaGfcCfasusg 516 316-338 AD-61271 usCfsaGfaGfuAfcUfgucCfaCfaGfcCfasusg 518 316-338_C21A AD-61239 asGfscAfgAfgUfaCfuguCfcAfcAfgCfcsasu 520 317-339 AD-61257 gsAfsgCfaGfaGfuAfcugUfcCfaCfaGfcscsa 522 318-340 AD-61246 usAfsgCfaGfaGfuAfcugUfcCfaCfaGfcscsa 524 318-340_C21A AD-61245 usGfsaGfcAfgAfgUfacuGfuCfcAfcAfgscsc 526 319-341 AD-61268 usUfsgAfgCfaGfaGfuacUfgUfcCfaCfasgsc 528 320-342 AD-61251 usUfsuGfaGfcAfgAfguaCfuGfuCfcAfcsasg 530 321-343 AD-61281 csUfsuUfgAfgCfaGfaguAfcUfgUfcCfascsa 532 322-344 AD-61258 asUfsuUfgAfgCfaGfaguAfcUfgUfcCfascsa 534 322-344_G21U AD-61275 usCfsuUfuGfaGfcAfgagUfaCfuGfuCfcsasc 536 323-345 AD-61269 usUfscUfuUfgAfgCfagaGfuAfcUfgUfcscsa 538 324-346 AD-61279 usAfsaGfgUfuUfcUfccuGfgCfcCfaCfasasu 540 421-443 AD-61278 usUfsuUfgAfuAfaGfguuUfcUfcCfuGfgscsc 542 427-449 AD-61247 usAfsaUfuGfgCfuUfaauGfuAfgAfaCfasusu 544 504-526 AD-61241 usUfsaAfuUfgGfcUfuaaUfgUfaGfaAfcsasu 546 505-527 AD-61282 csUfsuAfaUfuGfgCfuuaAfuGfuAfgAfascsa 548 506-528 AD-61265 usUfsuAfaUfuGfgCfuuaAfuGfuAfgAfascsa 550 506-528_G21A AD-61276 asCfsuUfaAfuUfgGfcuuAfaUfgUfaGfasasc 552 507-529 AD-61250 usAfscUfuAfaUfuGfgcuUfaAfuGfuAfgsasa 554 508-530 AD-61256 asUfsaCfuUfaAfuUfggcUfuAfaUfgUfasgsa 556 509-531 AD-61262 usAfsuAfcUfuAfaUfuggCfuUfaAfuGfusasg 558 510-532 AD-61244 usUfsaUfaCfuUfaAfuugGfcUfuAfaUfgsusa 560 511-533 AD-61238 usUfsuAfuAfcUfuAfauuGfgCfuUfaAfusgsu 562 512-534 AD-61280 csUfsuUfaUfaCfuUfaauUfgGfcUfuAfasusg 564 513-535 AD-61240 asUfsuUfaUfaCfuUfaauUfgGfcUfuAfasusg 566 513-535_G21U AD-61263 csCfsuUfuAfuAfcUfuaaUfuGfgCfuUfasasu 568 514-536 AD-61252 usCfsuUfuAfuAfcUfuaaUfuGfgCfuUfasasu 570 514-536_G21A AD-61274 asCfscUfuUfaUfaCfuuaAfuUfgGfcUfusasa 572 515-537 AD-61270 gsAfscCfuUfuAfuAfcuuAfaUfuGfgCfususa 574 516-538 AD-61264 usAfscCfuUfuAfuAfcuuAfaUfuGfgCfususa 576 516-538_C21A AD-61255 gsGfsaUfaAfaCfuUfucuGfcAfaGfgGfcsasa 578 571-593 AD-61283 usGfsaUfaAfaCfuUfucuGfcAfaGfgGfcsasa 580 571-593_C21A AD-61284 asGfsgAfuAfaAfcUfuucUfgCfaAfgGfgscsa 582 572-594 AD-61267 usUfsuUfgAfaGfaUfcugAfcCfaUfuGfgscsc 584 664-686 AD-61266 asUfsuUfuGfaAfgAfucuGfaCfcAfuUfgsgsc 586 665-687 AD-61273 usAfsuUfuUfgAfaGfaucUfgAfcCfaUfusgsg 588 666-688 AD-61272 usUfsuAfuUfuUfgAfagaUfcUfgAfcCfasusu 590 668-690

TABLE-US-00006 TABLE 6 Unmodified LECT2 siRNA Sequences Sense Anti- Antisense Sense SEQ Position sense SEQ position Oligo ID in Oligo ID in Duplex Name Name Sense Sequence NO NM_002302 Name Antisense Sequence NO NM_002302 AD-61249UM A-122943 UAGCUAGGAAGUAUUCAUUCA 591 108-128 A-122944 UGAAUGAAUACUUCCUAGCUAUU 592 106-128 AD-61260 UM A-122931 AGCUAGGAAGUAUUCAUUCAA 593 109-129 A-122932 UUGAAUGAAUACUUCCUAGCUAU 594 107-129 AD-61254 UM A-122929 AUUCAUUCAAACUUGAAUAUU 595 120-140 A-122930 AAUAUUCAAGUUUGAAUGAAUAC 596 118-140 AD-61243 UM A-122941 UUCAAACUUGAAUAUUCUUCA 597 125-145 A-122942 UGAAGAAUAUUCAAGUUUGAAUG 598 123-145 AD-61261 UM A-122947 UUGAAUAUUCUUCAAAGAGAG 599 132-152 A-122948 CUCUCUUUGAAGAAUAUUCAAGU 600 130-152 AD-61242 UM A-122925 UUGAAUAUUCUUCAAAGAGAA 601 132-152_ A-122926 UUCUCUUUGAAGAAUAUUCAAGU 602 130-152_ G21A G21A AD-61248 UM A-122927 GCUAAUAUAUGUGCUGGCAAG 603 265-285 A-122928 CUUGCCAGCACAUAUAUUAGCCC 604 263-285 AD-61277 UM A-122921 GCUAAUAUAUGUGCUGGCAAA 605 265-285_ A-122922 UUUGCCAGCACAUAUAUUAGCCC 606 263-285_ G21A G21A AD-61253 UM A-122913 CAUGGCUGUGGACAGUACUCU 607 316-336 A-122914 AGAGUACUGUCCACAGCCAUGGC 608 314-336 AD-61259 UM A-122915 UGGCUGUGGACAGUACUCUGC 609 318-338 A-122916 GCAGAGUACUGUCCACAGCCAUG 610 316-338 AD-61271 UM A-122919 UGGCUGUGGACAGUACUCUGA 611 318-338_ A-122920 UCAGAGUACUGUCCACAGCCAUG 612 316-338_ C21A C21A AD-61239 UM A-122877 GGCUGUGGACAGUACUCUGCU 613 319-339 A-122878 AGCAGAGUACUGUCCACAGCCAU 614 317-339 AD-61257 UM A-122883 GCUGUGGACAGUACUCUGCUC 615 320-340 A-122884 GAGCAGAGUACUGUCCACAGCCA 616 318-340 AD-61246 UM A-122895 GCUGUGGACAGUACUCUGCUA 617 320-340_ A-122896 UAGCAGAGUACUGUCCACAGCCA 618 318-340_ C21A C21A AD-61245 UM A-122879 CUGUGGACAGUACUCUGCUCA 619 321-341 A-122880 UGAGCAGAGUACUGUCCACAGCC 620 319-341 AD-61268 UM A-122871 UGUGGACAGUACUCUGCUCAA 621 322-342 A-122872 UUGAGCAGAGUACUGUCCACAGC 622 320-342 AD-61251 UM A-122881 GUGGACAGUACUCUGCUCAAA 623 323-343 A-122882 UUUGAGCAGAGUACUGUCCACAG 624 321-343 AD-61281 UM A-122891 UGGACAGUACUCUGCUCAAAG 625 324-344 A-122892 CUUUGAGCAGAGUACUGUCCACA 626 322-344 AD-61258 UM A-122899 UGGACAGUACUCUGCUCAAAU 627 324-344_ A-122900 AUUUGAGCAGAGUACUGUCCACA 628 322-344_ G21U G21U AD-61275 UM A-122889 GGACAGUACUCUGCUCAAAGA 629 325-345 A-122890 UCUUUGAGCAGAGUACUGUCCAC 630 323-345 AD-61269 UM A-122887 GACAGUACUCUGCUCAAAGAA 631 326-346 A-122888 UUCUUUGAGCAGAGUACUGUCCA 632 324-346 AD-61279 UM A-122955 UGUGGGCCAGGAGAAACCUUA 633 423-443 A-122956 UAAGGUUUCUCCUGGCCCACAAU 634 421-443 AD-61278 UM A-122937 CCAGGAGAAACCUUAUCAAAA 635 429-449 A-122938 UUUUGAUAAGGUUUCUCCUGGCC 636 427-449 AD-61247 UM A-122911 UGUUCUACAUUAAGCCAAUUA 637 506-526 A-122912 UAAUUGGCUUAAUGUAGAACAUU 638 504-526 AD-61241 UM A-122909 GUUCUACAUUAAGCCAAUUAA 639 507-527 A-122910 UUAAUUGGCUUAAUGUAGAACAU 640 505-527 AD-61282 UM A-122907 UUCUACAUUAAGCCAAUUAAG 641 508-528 A-122908 CUUAAUUGGCUUAAUGUAGAACA 642 506-528 AD-61265 UM A-122917 UUCUACAUUAAGCCAAUUAAA 643 508-528_ A-122918 UUUAAUUGGCUUAAUGUAGAACA 644 506-528_ G21A G21A AD-61276 UM A-122905 UCUACAUUAAGCCAAUUAAGU 645 509-529 A-122906 ACUUAAUUGGCUUAAUGUAGAAC 646 507-529 AD-61250 UM A-122865 CUACAUUAAGCCAAUUAAGUA 647 510-530 A-122866 UACUUAAUUGGCUUAAUGUAGAA 648 508-530 AD-61256 UM A-122867 UACAUUAAGCCAAUUAAGUAU 649 511-531 A-122868 AUACUUAAUUGGCUUAAUGUAGA 650 509-531 AD-61262 UM A-122869 ACAUUAAGCCAAUUAAGUAUA 651 512-532 A-122870 UAUACUUAAUUGGCUUAAUGUAG 652 510-532 AD-61244 UM A-122863 CAUUAAGCCAAUUAAGUAUAA 653 513-533 A-122864 UUAUACUUAAUUGGCUUAAUGUA 654 511-533 AD-61238 UM A-122861 AUUAAGCCAAUUAAGUAUAAA 655 514-534 A-122862 UUUAUACUUAAUUGGCUUAAUGU 656 512-534 AD-61280 UM A-122875 UUAAGCCAAUUAAGUAUAAAG 657 515-535 A-122876 CUUUAUACUUAAUUGGCUUAAUG 658 513-535 AD-61240 UM A-122893 UUAAGCCAAUUAAGUAUAAAU 659 515-535_ A-122894 AUUUAUACUUAAUUGGCUUAAUG 660 513-535_ G21U G21U AD-61263 UM A-122885 UAAGCCAAUUAAGUAUAAAGG 661 516-536 A-122886 CCUUUAUACUUAAUUGGCUUAAU 662 514-536 AD-61252 UM A-122897 UAAGCCAAUUAAGUAUAAAGA 663 516-536_ A-122898 UCUUUAUACUUAAUUGGCUUAAU 664 514-536_ G21A G21A AD-61274 UM A-122873 AAGCCAAUUAAGUAUAAAGGU 665 517-537 A-122874 ACCUUUAUACUUAAUUGGCUUAA 666 515-537 AD-61270 UM A-122903 AGCCAAUUAAGUAUAAAGGUC 667 518-538 A-122904 GACCUUUAUACUUAAUUGGCUUA 668 516-538 AD-61264 UM A-122901 AGCCAAUUAAGUAUAAAGGUA 669 518-538_ A-122902 UACCUUUAUACUUAAUUGGCUUA 670 516-538_ C21A C21A AD-61255 UM A-122945 GCCCUUGCAGAAAGUUUAUCC 671 573-593 A-122946 GGAUAAACUUUCUGCAAGGGCAA 672 571-593 AD-61283 UM A-122923 GCCCUUGCAGAAAGUUUAUCA 673 573-593_ A-122924 UGAUAAACUUUCUGCAAGGGCAA 674 571-593_ C21A C21A AD-61284 UM A-122939 CCCUUGCAGAAAGUUUAUCCU 675 574-594 A-122940 AGGAUAAACUUUCUGCAAGGGCA 676 572-594 AD-61267 UM A-122950 CCAAUGGUCAGAUCUUCAAAA 677 666-686 A-122952 UUUUGAAGAUCUGACCAUUGGCC 678 664-686 AD-61266 UM A-122933 CAAUGGUCAGAUCUUCAAAAU 679 667-687 A-122934 AUUUUGAAGAUCUGACCAUUGGC 680 665-687 AD-61273 UM A-122953 AAUGGUCAGAUCUUCAAAAUA 681 668-688 A-122954 UAUUUUGAAGAUCUGACCAUUGG 682 666-688 AD-61272 UM A-122935 UGGUCAGAUCUUCAAAAUAAA 683 670-690 A-122936 UUUAUUUUGAAGAUCUGACCAUU 684 668-690

[0585] Results

[0586] The results of single dose screen in primary monkey hepatocytes are shown in Table 7. The single dose experiments were performed at 10 nM and 0.1 nM final duplex concentration and the data are expressed as percent message remaining relative to AD-1955 non-targeting control.

TABLE-US-00007 TABLE 7 LECT2 siRNA Single Dose Screen in Primary Monkey Hepatocytes 10 nM_ 0.1 nM_ 10 nM_ 0.1 nM_ DuplexID AVG AVG STDEV STDEV AD-61278 1.8 22.3 0.78 6.56 AD-61268 4.6 43.2 2.72 9.01 AD-61251 4.8 41.0 1.50 9.73 AD-61260 5.6 48.9 0.40 4.98 AD-61258 5.9 50.8 0.70 0.29 AD-61277 6.2 33.4 0.14 8.56 AD-61241 6.3 32.3 4.28 8.26 AD-61242 6.8 64.2 0.58 14.00 AD-61273 7.0 18.0 0.46 0.16 AD-61243 7.0 34.9 3.27 6.84 AD-61267 7.2 20.1 1.52 0.31 AD-61266 7.3 20.0 1.12 0.57 AD-61256 7.3 18.6 1.44 2.53 AD-61284 7.6 31.0 1.42 0.58 AD-61246 7.6 74.2 0.62 8.28 AD-61272 7.8 15.3 0.17 0.99 AD-61244 7.9 20.5 0.14 3.97 AD-61275 8.3 63.8 3.06 5.57 AD-61265 9.8 34.4 1.42 0.65 AD-61281 10.2 48.2 0.28 12.35 AD-61254 10.4 63.6 1.65 15.68 AD-61257 10.5 66.5 1.36 16.73 AD-61238 11.0 42.2 1.69 2.24 AD-61240 11.6 30.7 0.31 2.28 AD-61250 11.8 57.0 1.24 15.15 AD-61262 13.7 57.7 2.37 10.92 AD-61249 13.8 74.7 0.57 1.53 AD-61283 14.3 59.2 ND 13.47 AD-61282 14.7 44.6 0.11 1.13 AD-61261 15.6 58.0 0.65 25.10 AD-61264 16.2 66.7 0.75 2.89 AD-61239 16.6 78.5 6.08 4.68 AD-61274 17.9 66.9 3.54 13.94 AD-61253 18.8 90.1 0.23 4.49 AD-61280 18.8 56.8 4.16 9.66 AD-61276 21.0 71.0 0.87 3.88 AD-61269 21.1 85.8 2.52 10.42 AD-61279 21.5 67.6 0.58 1.60 AD-61255 22.1 87.0 4.14 1.78 AD-61248 25.7 85.8 2.95 9.58 AD-61270 27.4 77.8 3.94 12.22 AD-61252 28.1 82.3 0.89 0.07 AD-61245 41.9 90.1 6.65 3.46 AD-61271 46.5 82.5 4.44 26.55 AD-61263 53.2 82.4 4.04 11.61 AD-61247 56.7 93.6 1.25 4.20 AD-61259 78.1 90.2 0.96 7.14 AD-1955 100.6 11.1

[0587] A subset of LECT2 siRNA duplexes tested in the single dose screen were further tested in a dose response screen in primary monkey hepatocytes. The results are shown in Table 8. The dose response experiments were performed over a range of doses from 10 nM to 36 fM final duplex concentration. The data are expressed as IC50 values.

TABLE-US-00008 TABLE 8 LECT2 SiRNA Dose Response Screen in Primary Monkey Hepatocytes Duplex ID IC50 (nM) AD-61272 0.0024 AD-61273 0.0006 AD-61266 0.003 AD-61267 0.0026 AD-61278 0.0124 AD-61284 0.0522 AD-61240 0.0084 AD-61251 0.0621 AD-61268 0.117 AD-61256 0.0163 AD-61244 0.0165

Example 3. LECT2 siRNA Gene Walk

[0588] Experimental Methods

[0589] Bioinformatics:

[0590] A set of 93 overlapping siRNAs targeting the human LECT2 gene (NCBI refseqID NM_002302.2; NCBI Gene ID 3950 "leukocyte cell-derived chemotaxin 2") were designed using custom R and Python scripts. The LECT2 REF SEQ mRNA has a length of 1077 bases.

[0591] In Vitro Screening:

[0592] Cell Culture and Transfections:

[0593] Primary cynomolgus monkey hepatocytes (PCHs, Celsis #MO03055, lot CBT) were transfected by adding 14.8 .mu.l of Opti-MEM plus 0.2 .mu.l of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad Calif. cat #13778-150) to 5 .mu.l of siRNA duplexes per well into a 96-well plate and incubated at room temperature for 15 minutes. 80 ul of phenol red-free Williams Medium E (Life Technologies #A1217601) containing .about.2.times.10.sup.4 PCH cells were then added to the siRNA mixture. Cells were incubated for 24 hours prior to RNA purification. Single dose experiments were performed at 10 nM.

[0594] Total RNA was isolated using DYNABEADS mRNA Isolation Kit (Invitrogen, part #: 610-12). Cells were harvested and lysed in 150 .mu.l of Lysis/Binding Buffer then mixed for 5 minute at 850 rpm using an Eppendorf Thermomixer (the mixing speed was the same throughout the process). Ten microliters of magnetic beads and 80 .mu.l Lysis/Binding Buffer mixture were added to a round bottom plate and mixed for 1 minute. Magnetic beads were captured using magnetic stand and the supernatant was removed without disturbing the beads. After removing supernatant, the lysed cells were added to the remaining beads and mixed for 5 minutes. After removing supernatant, magnetic beads were washed 2 times with 150 .mu.l Wash Buffer A and mixed for 1 minute. Beads were capture again and supernatant removed. Beads were then washed with 150 .mu.l Wash Buffer B, captured and supernatant was removed. Beads were next washed with 150 .mu.l Elution Buffer, captured and supernatant removed. Beads were allowed to dry for 2 minutes. After drying, 50 .mu.l of Elution Buffer was added and mixed for 5 minutes at 70.degree. C. Beads were captured on magnet for 5 minutes. 40 .mu.l of supernatant was removed and added to another 96 well plate.

[0595] cDNA Synthesis:

[0596] cDNA was synthesized using ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, Calif., Cat #4368813). A master mix of 2 .mu.l 10.times. Buffer, 0.8 .mu.l 25.times.dNTPs, 2 .mu.l Random primers, 1 .mu.l Reverse Transcriptase, 1 .mu.l RNase inhibitor and 3.2 .mu.l of H.sub.2O per reaction were added into 10 .mu.l total RNA. cDNA was generated using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, Calif.) through the following steps: 25.degree. C. 10 min, 37.degree. C. 120 min, 85.degree. C. 5 sec, 4.degree. C. hold.

[0597] Real Time PCR:

[0598] 2 .mu.l of cDNA were added to a master mix containing 0.5 .mu.l of custom designed Cynomolgus monkey GAPDH TaqMan Probe (F-GCATCCTGGGCTACACTGA (SEQ ID NO: 494), R-TGGGTGTCGCTGTTGAAGTC (SEQ ID NO: 495), Probe-CCAGGTGGTCTCCTCC (SEQ ID NO: 496)), 0.5 .mu.l human Lect2 (Hs01040204_m1--which is cross reactive with Cynomolgus monkey Lect2) and 5 .mu.l Lightcycler 480 probe master mix (Roche Cat #04887301001) per well in a 384 well plates (Roche cat #04887301001). Real time PCR was done in a LightCycler480 Real Time PCR system (Roche) using the .DELTA..DELTA.Ct(RQ) assay. Each duplex was tested in two independent transfections and each transfection was assayed in duplicate, unless otherwise noted in the summary tables. To calculate relative fold change, real time data were analyzed using the .DELTA..DELTA.Ct method and normalized to assays performed with cells transfected with 10 nM AD-1955, or mock transfected cells.

[0599] The modified and unmodified LECT2 siRNA sequences are shown in Tables 9 and 10, respectively. Nucleic acid sequences provided herein are represented using standard nomenclature (see the abbreviations of Table 1).

TABLE-US-00009 TABLE 9 Modified LECT2 siRNA Sequences SEQ SEQ Sense Oligo ID Antisense ID Target Duplex Name Name Sense Oligo Sequence NO Oligo Name Antisense Oligo Sequence NO LECT2 AD-65819.1 A-131907.1 GAAUAUUAGAACUUGACUUdTdT 690 A-131908.1 AAGUCAAGUUCUAAUAUUCdTdT 691 LECT2 AD-65825.1 A-131909.1 AACUUGACUUGCUCCAUCCdTdT 692 A-131910.1 GGAUGGAGCAAGUCAAGUUdTdT 693 LECT2 AD-65831.1 A-131911.1 CCAUCCUCUUAAACUUUUUdTdT 694 A-131912.1 AAAAAGUUUAAGAGGAUGGdTdT 695 LECT2 AD-65837.1 A-131913.1 UAAACUUUUUGUGUCUCACdTdT 696 A-131914.1 GUGAGACACAAAAAGUUUAdTdT 697 LECT2 AD-65843.1 A-131915.1 GUCUCACACUAAAGAAAUGdTdT 698 A-131916.1 CAUUUCUUUAGUGUGAGACdTdT 699 LECT2 AD-65849.1 A-131917.1 AAAGAAAUGAGAGAUGCAGdTdT 700 A-131918.1 CUGCAUCUCUCAUUUCUUUdTdT 701 LECT2 AD-65855.1 A-131919.1 AUGCAGAAUUCUAAGGCUAdTdT 702 A-131920.1 UAGCCUUAGAAUUCUGCAUdTdT 703 LECT2 AD-65861.1 A-131921.1 UCUAAGGCUAAAUAGCUAGdTdT 704 A-131922.1 CUAGCUAUUUAGCCUUAGAdTdT 705 LECT2 AD-65820.1 A-131923.1 AUAGCUAGGAAGUAUUCAUdTdT 706 A-131924.1 AUGAAUACUUCCUAGCUAUdTdT 707 LECT2 AD-65826.1 A-131925.1 AUUCAUUCAAACUUGAAUAdTdT 708 A-131926.1 UAUUCAAGUUUGAAUGAAUdTdT 709 LECT2 AD-65832.1 A-131927.1 CUUGAAUAUUCUUCAAAGAdTdT 710 A-131928.1 UCUUUGAAGAAUAUUCAAGdTdT 711 LECT2 AD-65838.1 A-131929.1 CUUCAAAGAGAGUGUGGGGdTdT 712 A-131930.1 CCCCACACUCUCUUUGAAGdTdT 713 LECT2 AD-65844.1 A-131931.1 GUGUGGGGGCAACUCUAAUdTdT 714 A-131932.1 AUUAGAGUUGCCCCCACACdTdT 715 LECT2 AD-65850.1 A-131933.1 AACUCUAAUCAGAGGAAGAdTdT 716 A-131934.1 UCUUCCUCUGAUUAGAGUUdTdT 717 LECT2 AD-65856.1 A-131935.1 AGGAAGAAACUAAAGGAAGdTdT 718 A-131936.1 CUUCCUUUAGUUUCUUCCUdTdT 719 LECT2 AD-65862.1 A-131937.1 UAAAGGAAGUAAAACCAGAdTdT 720 A-131938.1 UCUGGUUUUACUUCCUUUAdTdT 721 LECT2 AD-65821.1 A-131939.1 AAACCAGAUGUUUUCCACCdTdT 722 A-131940.1 GGUGGAAAACAUCUGGUUUdTdT 723 LECT2 AD-65827.1 A-131941.1 UCCACCAAAGCCCUCCUUUdTdT 724 A-131942.1 AAAGGAGGGCUUUGGUGGAdTdT 725 LECT2 AD-65833.1 A-131943.1 CCUCCUUUUGGCUGGUCUGdTdT 726 A-131944.1 CAGACCAGCCAAAAGGAGGdTdT 727 LECT2 AD-65839.1 A-131945.1 GGCUGGUCUGAUUUCUACCdTdT 728 A-131946.1 GGUAGAAAUCAGACCAGCCdTdT 729 LECT2 AD-65845.1 A-131947.1 UUUCUACCGCACUGGCAGGdTdT 730 A-131948.1 CCUGCCAGUGCGGUAGAAAdTdT 731 LECT2 AD-65851.1 A-131949.1 GGCAGGGCCAUGGGCUAAUdTdT 732 A-131950.1 AUUAGCCCAUGGCCCUGCCdTdT 733 LECT2 AD-65857.1 A-131951.1 GGGCUAAUAUAUGUGCUGGdTdT 734 A-131952.1 CCAGCACAUAUAUUAGCCCdTdT 735 LECT2 AD-65863.1 A-131953.1 AUGUGCUGGCAAGUCUUCCdTdT 736 A-131954.1 GGAAGACUUGCCAGCACAUdTdT 737 LECT2 AD-65822.1 A-131955.1 AAGUCUUCCAAUGAGAUCCdTdT 738 A-131956.1 GGAUCUCAUUGGAAGACUUdTdT 739 LECT2 AD-65828.1 A-131957.1 AGAUCCGGACGUGUGACCGdTdT 740 A-131958.1 CGGUCACACGUCCGGAUCUdTdT 741 LECT2 AD-65834.1 A-131959.1 GUGUGACCGCCAUGGCUGUdTdT 742 A-131960.1 ACAGCCAUGGCGGUCACACdTdT 743 LECT2 AD-65840.1 A-131961.1 AUGGCUGUGGACAGUACUCdTdT 744 A-131962.1 GAGUACUGUCCACAGCCAUdTdT 745 LECT2 AD-65846.1 A-131963.1 AGUACUCUGCUCAAAGAAGdTdT 746 A-131964.1 CUUCUUUGAGCAGAGUACUdTdT 747 LECT2 AD-65852.1 A-131965.1 CAAAGAAGUCAGAGGCCUCdTdT 748 A-131966.1 GAGGCCUCUGACUUCUUUGdTdT 749 LECT2 AD-65858.1 A-131967.1 CAGAGGCCUCACCAGGGUGdTdT 750 A-131968.1 CACCCUGGUGAGGCCUCUGdTdT 751 LECT2 AD-65864.1 A-131969.1 CCAGGGUGUGGACAUCUUGdTdT 752 A-131970.1 CAAGAUGUCCACACCCUGGdTdT 753 LECT2 AD-65823.1 A-131971.1 ACAUCUUGUGCUCUGCUGGdTdT 754 A-131972.1 CCAGCAGAGCACAAGAUGUdTdT 755 LECT2 AD-65829.1 A-131973.1 CUGCUGGAUCUACUGUGUAdTdT 756 A-131974.1 UACACAGUAGAUCCAGCAGdTdT 757 LECT2 AD-65835.1 A-131975.1 CUGUGUACGCACCAUUCACdTdT 758 A-131976.1 GUGAAUGGUGCGUACACAGdTdT 759 LECT2 AD-65841.1 A-131977.1 CCAUUCACUGGAAUGAUUGdTdT 760 A-131978.1 CAAUCAUUCCAGUGAAUGGdTdT 761 LECT2 AD-65847.1 A-131979.1 AAUGAUUGUGGGCCAGGAGdTdT 762 A-131980.1 CUCCUGGCCCACAAUCAUUdTdT 763 LECT2 AD-65853.1 A-131981.1 GGGCCAGGAGAAACCUUAUdTdT 764 A-131982.1 AUAAGGUUUCUCCUGGCCCdTdT 765 LECT2 AD-65859.1 A-131983.1 CCUUAUCAAAACAAGAAUGdTdT 766 A-131984.1 CAUUCUUGUUUUGAUAAGGdTdT 767 LECT2 AD-65865.1 A-131985.1 CAAGAAUGCUAUCAAUAAUdTdT 768 A-131986.1 AUUAUUGAUAGCAUUCUUGdTdT 769 LECT2 AD-65824.1 A-131987.1 AUCAAUAAUGGUGUUCGAAdTdT 770 A-131988.1 UUCGAACACCAUUAUUGAUdTdT 771 LECT2 AD-65830.1 A-131989.1 GUUCGAAUAUCUGGAAGAGdTdT 772 A-131990.1 CUCUUCCAGAUAUUCGAACdTdT 773 LECT2 AD-65836.1 A-131991.1 UCUGGAAGAGGUUUUUGUGdTdT 774 A-131992.1 CACAAAAACCUCUUCCAGAdTdT 775 LECT2 AD-65842.1 A-131993.1 UUUUUGUGUCAAAAUGUUCdTdT 776 A-131994.1 GAACAUUUUGACACAAAAAdTdT 777 LECT2 AD-65848.1 A-131995.1 AUGUUCUACAUUAAGCCAAdTdT 778 A-131996.1 UUGGCUUAAUGUAGAACAUdTdT 779 LECT2 AD-65854.1 A-131997.1 UAAGCCAAUUAAGUAUAAAdTdT 780 A-131998.1 UUUAUACUUAAUUGGCUUAdTdT 781 LECT2 AD-65860.1 A-131999.1 AAGUAUAAAGGUCCUAUUAdTdT 782 A-132000.1 UAAUAGGACCUUUAUACUUdTdT 783 LECT2 AD-65866.1 A-132001.1 CCUAUUAAGAAGGGAGAAAdTdT 784 A-132002.1 UUUCUCCCUUCUUAAUAGGdTdT 785 LECT2 AD-65872.1 A-132003.1 AGGGAGAAAAACUUGGAACdTdT 786 A-132004.1 GUUCCAAGUUUUUCUCCCUdTdT 787 LECT2 AD-65878.1 A-132005.1 CUUGGAACUCUAUUGCCCUdTdT 788 A-132006.1 AGGGCAAUAGAGUUCCAAGdTdT 789 LECT2 AD-65884.1 A-132007.1 UUGCCCUUGCAGAAAGUUUdTdT 790 A-132008.1 AAACUUUCUGCAAGGGCAAdTdT 791 LECT2 AD-65890.1 A-132009.1 AGAAAGUUUAUCCUGGCAUdTdT 792 A-132010.1 AUGCCAGGAUAAACUUUCUdTdT 793 LECT2 AD-65896.1 A-132011.1 CCUGGCAUACAAUCGCAUGdTdT 794 A-132012.1 CAUGCGAUUGUAUGCCAGGdTdT 795 LECT2 AD-65902.1 A-132013.1 AUCGCAUGUGCACAUUGAAdTdT 796 A-132014.1 UUCAAUGUGCACAUGCGAUdTdT 797 LECT2 AD-65907.1 A-132015.1 CAUUGAAAACUGUGACUCGdTdT 798 A-132016.1 CGAGUCACAGUUUUCAAUGdTdT 799 LECT2 AD-65867.1 A-132017.1 GUGACUCGAGUGACCCUACdTdT 800 A-132018.1 GUAGGGUCACUCGAGUCACdTdT 801 LECT2 AD-65873.1 A-132019.1 UGACCCUACUGCAUACCUGdTdT 802 A-132020.1 CAGGUAUGCAGUAGGGUCAdTdT 803 LECT2 AD-65879.1 A-132021.1 CAUACCUGUAAAUCGAAGGdTdT 804 A-132022.1 CCUUCGAUUUACAGGUAUGdTdT 805 LECT2 AD-65891.1 A-132025.1 UGGUCAGAUCUUCAAAAUAdTdT 806 A-132026.1 UAUUUUGAAGAUCUGACCAdTdT 807 LECT2 AD-65897.1 A-132027.1 CUUCAAAAUAAAAAGUCAUdTdT 808 A-132028.1 AUGACUUUUUAUUUUGAAGdTdT 809 LECT2 AD-65903.1 A-132029.1 AAGUCAUCUUAAAAACCUGdTdT 810 A-132030.1 CAGGUUUUUAAGAUGACUUdTdT 811 LECT2 AD-65908.1 A-132031.1 AAAACCUGGAUGCAUACCCdTdT 812 A-132032.1 GGGUAUGCAUCCAGGUUUUdTdT 813 LECT2 AD-65868.1 A-132033.1 GCAUACCCUUCUCUUCAAGdTdT 814 A-132034.1 CUUGAAGAGAAGGGUAUGCdTdT 815 LECT2 AD-65874.1 A-132035.1 CUUCAAGAAAUUUGUGUUCdTdT 816 A-132036.1 GAACACAAAUUUCUUGAAGdTdT 817 LECT2 AD-65880.1 A-132037.1 UUGUGUUCACAAAGGAAAAdTdT 818 A-132038.1 UUUUCCUUUGUGAACACAAdTdT 819 LECT2 AD-65886.1 A-132039.1 AAGGAAAAAUGCAUGAAGGdTdT 820 A-132040.1 CCUUCAUGCAUUUUUCCUUdTdT 821 LECT2 AD-65892.1 A-132041.1 UGCAUGAAGGGAUGGAUACdTdT 822 A-132042.1 GUAUCCAUCCCUUCAUGCAdTdT 823 LECT2 AD-65898.1 A-132043.1 UGGAUACCCCAUUUUCCAUdTdT 824 A-132044.1 AUGGAAAAUGGGGUAUCCAdTdT 825 LECT2 AD-65904.1 A-132045.1 UUUCCAUGACAUGAUUAUUdTdT 826 A-132046.1 AAUAAUCAUGUCAUGGAAAdTdT 827 LECT2 AD-65909.1 A-132047.1 CAUGAUUAUUACACAUUGCdTdT 828 A-132048.1 GCAAUGUGUAAUAAUCAUGdTdT 829 LECT2 AD-65869.1 A-132049.1 CACAUUGCAUGCCUGUAUCdTdT 830 A-132050.1 GAUACAGGCAUGCAAUGUGdTdT 831 LECT2 AD-65875.1 A-132051.1 CCUGUAUCAAAACAUCUCAdTdT 832 A-132052.1 UGAGAUGUUUUGAUACAGGdTdT 833 LECT2 AD-65881.1 A-132053.1 CAUCUCACGUACCUCAUAAdTdT 834 A-132054.1 UUAUGAGGUACGUGAGAUGdTdT 835 LECT2 AD-65887.1 A-132055.1 CCUCAUAAACAUAUACACCdTdT 836 A-132056.1 GGUGUAUAUGUUUAUGAGGdTdT 837 LECT2 AD-65893.1 A-132057.1 AUACACCUAUGUACCCACAdTdT 838 A-132058.1 UGUGGGUACAUAGGUGUAUdTdT 839 LECT2 AD-65899.1 A-132059.1 GUACCCACAAAAAUUUUUUdTdT 840 A-132060.1 AAAAAAUUUUUGUGGGUACdTdT 841 LECT2 AD-65905.1 A-132061.1 UAAAAAAAGGAAAUUUGAGdTdT 842 A-132062.1 CUCAAAUUUCCUUUUUUUAdTdT 843 LECT2 AD-65910.1 A-132063.1 AAUUUGAGUUUAAAUAGAAdTdT 844 A-132064.1 UUCUAUUUAAACUCAAAUUdTdT 845 LECT2 AD-65870.1 A-132065.1 AUAGAAACAUGAUAAAUGCdTdT 846 A-132066.1 GCAUUUAUCAUGUUUCUAUdTdT 847 LECT2 AD-65876.1 A-132067.1 GAUAAAUGCAAGAAAGAAAdTdT 848 A-132068.1 UUUCUUUCUUGCAUUUAUCdTdT 849 LECT2 AD-65882.1 A-132069.1 GAAAGAAAACAUUUUGAUUdTdT 850 A-132070.1 AAUCAAAAUGUUUUCUUUCdTdT 851

LECT2 AD-65894.1 A-132073.1 ACUCAUUGUCACUCUGAUGdTdT 852 A-132074.1 CAUCAGAGUGACAAUGAGUdTdT 853 LECT2 AD-65900.1 A-132075.1 CUCUGAUGUUCAUGUGAACdTdT 854 A-132076.1 GUUCACAUGAACAUCAGAGdTdT 855 LECT2 AD-65906.1 A-132077.1 CAUGUGAACUGGUUGCUUCdTdT 856 A-132078.1 GAAGCAACCAGUUCACAUGdTdT 857 LECT2 AD-65911.1 A-132079.1 GUUGCUUCGGGCUCUUUGAdTdT 858 A-132080.1 UCAAAGAGCCCGAAGCAACdTdT 859 LECT2 AD-65871.1 A-132081.1 UCUUUGAUCUGUCACCUAUdTdT 860 A-132082.1 AUAGGUGACAGAUCAAAGAdTdT 861 LECT2 AD-65877.1 A-132083.1 CACCUAUGGAAUCUGAGUGdTdT 862 A-132084.1 CACUCAGAUUCCAUAGGUGdTdT 863 LECT2 AD-65883.1 A-132085.1 AAUCUGAGUGGUUUUAUUUdTdT 864 A-132086.1 AAAUAAAACCACUCAGAUUdTdT 865 LECT2 AD-65889.1 A-132087.1 UUUUUUAGAUUUCUCAGUCdTdT 866 A-132088.1 GACUGAGAAAUCUAAAAAAdTdT 867 LECT2 AD-65895.1 A-132089.1 CUCAGUCCCAAAGAUCUAAdTdT 868 A-132090.1 UUAGAUCUUUGGGACUGAGdTdT 869 LECT2 AD-65901.1 A-132091.1 GAUCUAAGAUAAAUAAACAdTdT 870 A-132092.1 UGUUUAUUUAUCUUAGAUCdTdT 871

TABLE-US-00010 TABLE 10 Unmodified LECT2 siRNA Sequences SEQ Duplex Sense Oligo ID Position in Target Name Name Sense Sequence NO NM_002302.2 LECT2 AD-65819.1 A-131907.1 GAAUAUUAGAACUUGACUU 872 011-29 LECT2 AD-65825.1 A-131909.1 AACUUGACUUGCUCCAUCC 874 020-38 LECT2 AD-65831.1 A-131911.1 CCAUCCUCUUAAACUUUUU 876 033-51 LECT2 AD-65837.1 A-131913.1 UAAACUUUUUGUGUCUCAC 878 042-60 LECT2 AD-65843.1 A-131915.1 GUCUCACACUAAAGAAAUG 880 054-72 LECT2 AD-65849.1 A-131917.1 AAAGAAAUGAGAGAUGCAG 882 064-82 LECT2 AD-65855.1 A-131919.1 AUGCAGAAUUCUAAGGCUA 884 077-95 LECT2 AD-65861.1 A-131921.1 UCUAAGGCUAAAUAGCUAG 886 086-104 LECT2 AD-65820.1 A-131923.1 AUAGCUAGGAAGUAUUCAU 888 097-115 LECT2 AD-65826.1 A-131925.1 AUUCAUUCAAACUUGAAUA 890 110-128 LECT2 AD-65832.1 A-131927.1 CUUGAAUAUUCUUCAAAGA 892 121-139 LECT2 AD-65838.1 A-131929.1 CUUCAAAGAGAGUGUGGGG 894 131-149 LECT2 AD-65844.1 A-131931.1 GUGUGGGGGCAACUCUAAU 896 142-160 LECT2 AD-65850.1 A-131933.1 AACUCUAAUCAGAGGAAGA 898 152-170 LECT2 AD-65856.1 A-131935.1 AGGAAGAAACUAAAGGAAG 900 164-182 LECT2 AD-65862.1 A-131937.1 UAAAGGAAGUAAAACCAGA 902 174-192 LECT2 AD-65821.1 A-131939.1 AAACCAGAUGUUUUCCACC 904 185-203 LECT2 AD-65827.1 A-131941.1 UCCACCAAAGCCCUCCUUU 906 198-216 LECT2 AD-65833.1 A-131943.1 CCUCCUUUUGGCUGGUCUG 908 209-227 LECT2 AD-65839.1 A-131945.1 GGCUGGUCUGAUUUCUACC 910 218-236 LECT2 AD-65845.1 A-131947.1 UUUCUACCGCACUGGCAGG 912 229-247 LECT2 AD-65851.1 A-131949.1 GGCAGGGCCAUGGGCUAAU 914 242-260 LECT2 AD-65857.1 A-131951.1 GGGCUAAUAUAUGUGCUGG 916 253-271 LECT2 AD-65863.1 A-131953.1 AUGUGCUGGCAAGUCUUCC 918 263-281 LECT2 AD-65822.1 A-131955.1 AAGUCUUCCAAUGAGAUCC 920 273-291 LECT2 AD-65828.1 A-131957.1 AGAUCCGGACGUGUGACCG 922 286-304 LECT2 AD-65834.1 A-131959.1 GUGUGACCGCCAUGGCUGU 924 296-314 LECT2 AD-65840.1 A-131961.1 AUGGCUGUGGACAGUACUC 926 307-325 LECT2 AD-65846.1 A-131963.1 AGUACUCUGCUCAAAGAAG 928 319-337 LECT2 AD-65852.1 A-131965.1 CAAAGAAGUCAGAGGCCUC 930 330-348 LECT2 AD-65858.1 A-131967.1 CAGAGGCCUCACCAGGGUG 932 339-357 LECT2 AD-65864.1 A-131969.1 CCAGGGUGUGGACAUCUUG 934 350-368 LECT2 AD-65823.1 A-131971.1 ACAUCUUGUGCUCUGCUGG 936 361-379 LECT2 AD-65829.1 A-131973.1 CUGCUGGAUCUACUGUGUA 938 373-391 LECT2 AD-65835.1 A-131975.1 CUGUGUACGCACCAUUCAC 940 385-403 LECT2 AD-65841.1 A-131977.1 CCAUUCACUGGAAUGAUUG 942 396-414 LECT2 AD-65847.1 A-131979.1 AAUGAUUGUGGGCCAGGAG 944 407-425 LECT2 AD-65853.1 A-131981.1 GGGCCAGGAGAAACCUUAU 946 416-434 LECT2 AD-65859.1 A-131983.1 CCUUAUCAAAACAAGAAUG 948 429-447 LECT2 AD-65865.1 A-131985.1 CAAGAAUGCUAUCAAUAAU 950 440-458 LECT2 AD-65824.1 A-131987.1 AUCAAUAAUGGUGUUCGAA 952 450-468 LECT2 AD-65830.1 A-131989.1 GUUCGAAUAUCUGGAAGAG 954 462-480 LECT2 AD-65836.1 A-131991.1 UCUGGAAGAGGUUUUUGUG 956 471-489 LECT2 AD-65842.1 A-131993.1 UUUUUGUGUCAAAAUGUUC 958 482-500 LECT2 AD-65848.1 A-131995.1 AUGUUCUACAUUAAGCCAA 960 495-513 LECT2 AD-65854.1 A-131997.1 UAAGCCAAUUAAGUAUAAA 962 506-524 LECT2 AD-65860.1 A-131999.1 AAGUAUAAAGGUCCUAUUA 964 516-534 LECT2 AD-65866.1 A-132001.1 CCUAUUAAGAAGGGAGAAA 966 528-546 LECT2 AD-65872.1 A-132003.1 AGGGAGAAAAACUUGGAAC 968 538-556 LECT2 AD-65878.1 A-132005.1 CUUGGAACUCUAUUGCCCU 970 549-567 LECT2 AD-65884.1 A-132007.1 UUGCCCUUGCAGAAAGUUU 972 561-579 LECT2 AD-65890.1 A-132009.1 AGAAAGUUUAUCCUGGCAU 974 571-589 LECT2 AD-65896.1 A-132011.1 CCUGGCAUACAAUCGCAUG 976 582-600 LECT2 AD-65902.1 A-132013.1 AUCGCAUGUGCACAUUGAA 978 593-611 LECT2 AD-65907.1 A-132015.1 CAUUGAAAACUGUGACUCG 980 605-623 LECT2 AD-65867.1 A-132017.1 GUGACUCGAGUGACCCUAC 982 616-634 LECT2 AD-65873.1 A-132019.1 UGACCCUACUGCAUACCUG 984 626-644 LECT2 AD-65879.1 A-132021.1 CAUACCUGUAAAUCGAAGG 986 637-655 LECT2 AD-65891.1 A-132025.1 UGGUCAGAUCUUCAAAAUA 988 660-678 LECT2 AD-65897.1 A-132027.1 CUUCAAAAUAAAAAGUCAU 990 669-687 LECT2 AD-65903.1 A-132029.1 AAGUCAUCUUAAAAACCUG 992 681-699 LECT2 AD-65908.1 A-132031.1 AAAACCUGGAUGCAUACCC 994 692-710 LECT2 AD-65868.1 A-132033.1 GCAUACCCUUCUCUUCAAG 996 703-721 LECT2 AD-65874.1 A-132035.1 CUUCAAGAAAUUUGUGUUC 998 715-733 LECT2 AD-65880.1 A-132037.1 UUGUGUUCACAAAGGAAAA 1000 726-744 LECT2 AD-65886.1 A-132039.1 AAGGAAAAAUGCAUGAAGG 1002 737-755 LECT2 AD-65892.1 A-132041.1 UGCAUGAAGGGAUGGAUAC 1004 746-764 LECT2 AD-65898.1 A-132043.1 UGGAUACCCCAUUUUCCAU 1006 758-776 LECT2 AD-65904.1 A-132045.1 UUUCCAUGACAUGAUUAUU 1008 770-788 LECT2 AD-65909.1 A-132047.1 CAUGAUUAUUACACAUUGC 1010 779-797 LECT2 AD-65869.1 A-132049.1 CACAUUGCAUGCCUGUAUC 1012 790-808 LECT2 AD-65875.1 A-132051.1 CCUGUAUCAAAACAUCUCA 1014 801-819 LECT2 AD-65881.1 A-132053.1 CAUCUCACGUACCUCAUAA 1016 813-831 LECT2 AD-65887.1 A-132055.1 CCUCAUAAACAUAUACACC 1018 824-842 LECT2 AD-65893.1 A-132057.1 AUACACCUAUGUACCCACA 1020 836-854 LECT2 AD-65899.1 A-132059.1 GUACCCACAAAAAUUUUUU 1022 846-864 LECT2 AD-65905.1 A-132061.1 UAAAAAAAGGAAAUUUGAG 1024 856-874 LECT2 AD-65910.1 A-132063.1 AAUUUGAGUUUAAAUAGAA 1026 867-885 LECT2 AD-65870.1 A-132065.1 AUAGAAACAUGAUAAAUGC 1028 880-898 LECT2 AD-65876.1 A-132067.1 GAUAAAUGCAAGAAAGAAA 1030 890-908 LECT2 AD-65882.1 A-132069.1 GAAAGAAAACAUUUUGAUU 1032 901-919 LECT2 AD-65894.1 A-132073.1 ACUCAUUGUCACUCUGAUG 1034 923-941 LECT2 AD-65900.1 A-132075.1 CUCUGAUGUUCAUGUGAAC 1036 934-952 LECT2 AD-65906.1 A-132077.1 CAUGUGAACUGGUUGCUUC 1038 944-962 LECT2 AD-65911.1 A-132079.1 GUUGCUUCGGGCUCUUUGA 1040 955_973 LECT2 AD-65871.1 A-132081.1 UCUUUGAUCUGUCACCUAU 1042 967-985 LECT2 AD-65877.1 A-132083.1 CACCUAUGGAAUCUGAGUG 1044 979-997 LECT2 AD-65883.1 A-132085.1 AAUCUGAGUGGUUUUAUUU 1046 988-1006 LECT2 AD-65889.1 A-132087.1 UUUUUUAGAUUUCUCAGUC 1048 999-1017 LECT2 AD-65895.1 A-132089.1 CUCAGUCCCAAAGAUCUAA 1050 1011-1029 LECT2 AD-65901.1 A-132091.1 GAUCUAAGAUAAAUAAACA 1052 1023-1041 SEQ Antisense ID Position in Target Oligo Name Antisense Sequence NO NM_002302.2 LECT2 A-131908.1 AAGUCAAGUUCUAAUAUUC 873 11-29 LECT2 A-131910.1 GGAUGGAGCAAGUCAAGUU 875 20-38 LECT2 A-131912.1 AAAAAGUUUAAGAGGAUGG 877 33-51 LECT2 A-131914.1 GUGAGACACAAAAAGUUUA 879 42-60 LECT2 A-131916.1 CAUUUCUUUAGUGUGAGAC 881 54-72 LECT2 A-131918.1 CUGCAUCUCUCAUUUCUUU 883 64-82 LECT2 A-131920.1 UAGCCUUAGAAUUCUGCAU 885 77-95 LECT2 A-131922.1 CUAGCUAUUUAGCCUUAGA 887 86-104 LECT2 A-131924.1 AUGAAUACUUCCUAGCUAU 889 97-115 LECT2 A-131926.1 UAUUCAAGUUUGAAUGAAU 891 110-128 LECT2 A-131928.1 UCUUUGAAGAAUAUUCAAG 893 121-139 LECT2 A-131930.1 CCCCACACUCUCUUUGAAG 895 131-149 LECT2 A-131932.1 AUUAGAGUUGCCCCCACAC 897 142-160 LECT2 A-131934.1 UCUUCCUCUGAUUAGAGUU 899 152-170 LECT2 A-131936.1 CUUCCUUUAGUUUCUUCCU 901 164-182 LECT2 A-131938.1 UCUGGUUUUACUUCCUUUA 903 174-192 LECT2 A-131940.1 GGUGGAAAACAUCUGGUUU 905 185-203 LECT2 A-131942.1 AAAGGAGGGCUUUGGUGGA 907 198-216 LECT2 A-131944.1 CAGACCAGCCAAAAGGAGG 909 209-227 LECT2 A-131946.1 GGUAGAAAUCAGACCAGCC 911 218-236 LECT2 A-131948.1 CCUGCCAGUGCGGUAGAAA 913 229-247 LECT2 A-131950.1 AUUAGCCCAUGGCCCUGCC 915 242-260 LECT2 A-131952.1 CCAGCACAUAUAUUAGCCC 917 253-271 LECT2 A-131954.1 GGAAGACUUGCCAGCACAU 919 263-281 LECT2 A-131956.1 GGAUCUCAUUGGAAGACUU 921 273-291 LECT2 A-131958.1 CGGUCACACGUCCGGAUCU 923 286-304 LECT2 A-131960.1 ACAGCCAUGGCGGUCACAC 925 296-314 LECT2 A-131962.1 GAGUACUGUCCACAGCCAU 927 307-325

LECT2 A-131964.1 CUUCUUUGAGCAGAGUACU 929 319-337 LECT2 A-131966.1 GAGGCCUCUGACUUCUUUG 931 330-348 LECT2 A-131968.1 CACCCUGGUGAGGCCUCUG 933 339-357 LECT2 A-131970.1 CAAGAUGUCCACACCCUGG 935 350-368 LECT2 A-131972.1 CCAGCAGAGCACAAGAUGU 937 361-379 LECT2 A-131974.1 UACACAGUAGAUCCAGCAG 939 373-391 LECT2 A-131976.1 GUGAAUGGUGCGUACACAG 941 385-403 LECT2 A-131978.1 CAAUCAUUCCAGUGAAUGG 943 396-414 LECT2 A-131980.1 CUCCUGGCCCACAAUCAUU 945 407-425 LECT2 A-131982.1 AUAAGGUUUCUCCUGGCCC 947 416-434 LECT2 A-131984.1 CAUUCUUGUUUUGAUAAGG 949 429-447 LECT2 A-131986.1 AUUAUUGAUAGCAUUCUUG 951 440-458 LECT2 A-131988.1 UUCGAACACCAUUAUUGAU 953 450-468 LECT2 A-131990.1 CUCUUCCAGAUAUUCGAAC 955 462-480 LECT2 A-131992.1 CACAAAAACCUCUUCCAGA 957 471-489 LECT2 A-131994.1 GAACAUUUUGACACAAAAA 959 482-500 LECT2 A-131996.1 UUGGCUUAAUGUAGAACAU 961 495-513 LECT2 A-131998.1 UUUAUACUUAAUUGGCUUA 963 506-524 LECT2 A-132000.1 UAAUAGGACCUUUAUACUU 965 516-534 LECT2 A-132002.1 UUUCUCCCUUCUUAAUAGG 967 528-546 LECT2 A-132004.1 GUUCCAAGUUUUUCUCCCU 969 538-556 LECT2 A-132006.1 AGGGCAAUAGAGUUCCAAG 971 549-567 LECT2 A-132008.1 AAACUUUCUGCAAGGGCAA 973 561-579 LECT2 A-132010.1 AUGCCAGGAUAAACUUUCU 975 571-589 LECT2 A-132012.1 CAUGCGAUUGUAUGCCAGG 977 582-600 LECT2 A-132014.1 UUCAAUGUGCACAUGCGAU 979 593-611 LECT2 A-132016.1 CGAGUCACAGUUUUCAAUG 981 605-623 LECT2 A-132018.1 GUAGGGUCACUCGAGUCAC 983 616-634 LECT2 A-132020.1 CAGGUAUGCAGUAGGGUCA 985 626-644 LECT2 A-132022.1 CCUUCGAUUUACAGGUAUG 987 637-655 LECT2 A-132026.1 UAUUUUGAAGAUCUGACCA 989 660-678 LECT2 A-132028.1 AUGACUUUUUAUUUUGAAG 991 669-687 LECT2 A-132030.1 CAGGUUUUUAAGAUGACUU 993 681-699 LECT2 A-132032.1 GGGUAUGCAUCCAGGUUUU 995 692-710 LECT2 A-132034.1 CUUGAAGAGAAGGGUAUGC 997 703-721 LECT2 A-132036.1 GAACACAAAUUUCUUGAAG 999 715-733 LECT2 A-132038.1 UUUUCCUUUGUGAACACAA 1001 726-744 LECT2 A-132040.1 CCUUCAUGCAUUUUUCCUU 1003 737-755 LECT2 A-132042.1 GUAUCCAUCCCUUCAUGCA 1005 746-764 LECT2 A-132044.1 AUGGAAAAUGGGGUAUCCA 1007 758-776 LECT2 A-132046.1 AAUAAUCAUGUCAUGGAAA 1009 770-788 LECT2 A-132048.1 GCAAUGUGUAAUAAUCAUG 1011 779-797 LECT2 A-132050.1 GAUACAGGCAUGCAAUGUG 1013 790-808 LECT2 A-132052.1 UGAGAUGUUUUGAUACAGG 1015 801-819 LECT2 A-132054.1 UUAUGAGGUACGUGAGAUG 1017 813-831 LECT2 A-132056.1 GGUGUAUAUGUUUAUGAGG 1019 824-842 LECT2 A-132058.1 UGUGGGUACAUAGGUGUAU 1021 836-854 LECT2 A-132060.1 AAAAAAUUUUUGUGGGUAC 1023 846-864 LECT2 A-132062.1 CUCAAAUUUCCUUUUUUUA 1025 856-874 LECT2 A-132064.1 UUCUAUUUAAACUCAAAUU 1027 867-885 LECT2 A-132066.1 GCAUUUAUCAUGUUUCUAU 1029 880-898 LECT2 A-132068.1 UUUCUUUCUUGCAUUUAUC 1031 890-908 LECT2 A-132070.1 AAUCAAAAUGUUUUCUUUC 1033 901-919 LECT2 A-132074.1 CAUCAGAGUGACAAUGAGU 1035 923-941 LECT2 A-132076.1 GUUCACAUGAACAUCAGAG 1037 934-952 LECT2 A-132078.1 GAAGCAACCAGUUCACAUG 1039 944-962 LECT2 A-132080.1 UCAAAGAGCCCGAAGCAAC 1041 955_973 LECT2 A-132082.1 AUAGGUGACAGAUCAAAGA 1043 967-985 LECT2 A-132084.1 CACUCAGAUUCCAUAGGUG 1045 979-997 LECT2 A-132086.1 AAAUAAAACCACUCAGAUU 1047 988-1006 LECT2 A-132088.1 GACUGAGAAAUCUAAAAAA 1049 999-1017 LECT2 A-132090.1 UUAGAUCUUUGGGACUGAG 1051 1011-1029 LECT2 A-132092.1 UGUUUAUUUAUCUUAGAUC 1053 1023-1041

[0600] Results

[0601] The results of single dose screen in primary monkey hepatocytes using modified LECT2 siRNA sequences are shown in Table 11. The single dose experiments were performed at 10 nM final duplex concentration and the data are expressed as percent message remaining relative to AD-1955 non-targeting control.

TABLE-US-00011 TABLE 11 Lect2 Single Dose Screen in Primary Monkey Hepatocytes Duplex Name 10 nM avg 10 nM stdev AD-65819.1 11.7 8.5 AD-65825.1 50.7 28.0 AD-65831.1 75.3 49.5 AD-65837.1 75.5 32.7 AD-65843.1 5.5 3.0 AD-65849.1 104.5 64.9 AD-65855.1 114.1 36.7 AD-65861.1 81.5 49.6 AD-65820.1 3.3 1.4 AD-65826.1 43.6 18.4 AD-65832.1 6.5 2.2 AD-65838.1 61.8 11.9 AD-65844.1 4.2 2.1 AD-65850.1 85.8 24.0 AD-65856.1 105.4 24.0 AD-65862.1 50.4 15.5 AD-65821.1 56.1 32.5 AD-65827.1 37.8 5.7 AD-65833.1 4.7 2.6 AD-65839.1 5.2 1.6 AD-65845.1 65.1 19.1 AD-65851.1 46.1 5.4 AD-65857.1 35.0 5.4 AD-65863.1 58.0 14.4 AD-65822.1 82.7 10.4 AD-65828.1 95.9 29.0 AD-65834.1 7.9 2.9 AD-65840.1 98.3 39.1 AD-65846.1 33.8 16.1 AD-65852.1 32.8 4.4 AD-65858.1 73.4 29.3 AD-65864.1 7.0 3.0 AD-65823.1 54.5 18.8 AD-65829.1 17.1 14.8 AD-65835.1 100.4 31.8 AD-65841.1 11.1 10.4 AD-65847.1 165.1 39.2 AD-65853.1 1.7 0.3 AD-65859.1 39.9 6.3 AD-65865.1 76.5 17.0 AD-65824.1 66.0 10.5 AD-65830.1 106.0 16.1 AD-65836.1 67.5 19.2 AD-65842.1 147.3 38.9 AD-65848.1 20.1 4.5 AD-65854.1 40.4 12.1 AD-65860.1 62.8 19.0 AD-65866.1 49.8 8.9 AD-65872.1 45.6 15.8 AD-65878.1 11.4 5.6 AD-65884.1 6.1 2.5 AD-65890.1 47.1 23.0 AD-65896.1 108.3 58.2 AD-65902.1 9.8 3.3 AD-65907.1 19.6 4.7 AD-65867.1 39.9 8.8 AD-65873.1 14.8 5.1 AD-65879.1 113.2 7.1 AD-65891.1 2.5 1.5 AD-65897.1 15.0 6.7 AD-65903.1 44.8 14.0 AD-65908.1 77.1 23.6 AD-65868.1 32.7 3.9 AD-65874.1 119.4 35.4 AD-65880.1 117.6 30.6 AD-65886.1 127.8 45.3 AD-65892.1 80.0 20.6 AD-65898.1 75.1 29.3 AD-65904.1 123.8 31.5 AD-65909.1 97.9 10.0 AD-65869.1 34.3 8.4 AD-65875.1 76.5 12.1 AD-65881.1 35.7 6.4 AD-65887.1 88.8 32.6 AD-65893.1 141.7 5.5 AD-65899.1 149.8 29.1 AD-65905.1 167.5 36.8 AD-65910.1 58.5 20.7 AD-65870.1 92.3 33.3 AD-65876.1 86.8 22.2 AD-65882.1 65.5 10.6 AD-65894.1 69.4 20.5 AD-65900.1 125.0 57.8 AD-65906.1 153.4 54.0 AD-65911.1 114.4 24.2 AD-65871.1 59.6 26.4 AD-65877.1 58.1 18.5 AD-65883.1 60.3 16.6 AD-65889.1 74.1 25.1 AD-65895.1 94.0 11.8 AD-65901.1 92.4 6.2 AD-1955 100.1 24.7

EQUIVALENTS

[0602] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 1053 <210> SEQ ID NO 1 <211> LENGTH: 1077 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 1 aaatcaaata gctatccatg gaatattaga acttgacttg ctccatcctc ttaaactttt 60 tgtgtctcac actaaagaaa tgagagatgc agaattctaa ggctaaatag ctaggaagta 120 ttcattcaaa cttgaatatt cttcaaagag agtgtggggg caactctaat cagaggaaga 180 aactaaagga agtaaaacca gatgttttcc accaaagccc tccttttggc tggtctgatt 240 tctaccgcac tggcagggcc atgggctaat atatgtgctg gcaagtcttc caatgagatc 300 cggacgtgtg accgccatgg ctgtggacag tactctgctc aaagaagtca gaggcctcac 360 cagggtgtgg acatcttgtg ctctgctgga tctactgtgt acgcaccatt cactggaatg 420 attgtgggcc aggagaaacc ttatcaaaac aagaatgcta tcaataatgg tgttcgaata 480 tctggaagag gtttttgtgt caaaatgttc tacattaagc caattaagta taaaggtcct 540 attaagaagg gagaaaaact tggaactcta ttgcccttgc agaaagttta tcctggcata 600 caatcgcatg tgcacattga aaactgtgac tcgagtgacc ctactgcata cctgtaaatc 660 gaaggccaat ggtcagatct tcaaaataaa aagtcatctt aaaaacctgg atgcataccc 720 ttctcttcaa gaaatttgtg ttcacaaagg aaaaatgcat gaagggatgg ataccccatt 780 ttccatgaca tgattattac acattgcatg cctgtatcaa aacatctcac gtacctcata 840 aacatataca cctatgtacc cacaaaaatt ttttaattaa aaaaaggaaa tttgagttta 900 aatagaaaca tgataaatgc aagaaagaaa acattttgat tttaactcat tgtcactctg 960 atgttcatgt gaactggttg cttcgggctc tttgatctgt cacctatgga atctgagtgg 1020 ttttattttt tagatttctc agtcccaaag atctaagata aataaacaag agaactt 1077 <210> SEQ ID NO 2 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 2 aaaucaaaua gcuauccau 19 <210> SEQ ID NO 3 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 3 auggauagcu auuugauuu 19 <210> SEQ ID NO 4 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 4 aauagcuauc cauggaaua 19 <210> SEQ ID NO 5 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 5 uauuccaugg auagcuauu 19 <210> SEQ ID NO 6 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 6 uauccaugga auauuagaa 19 <210> SEQ ID NO 7 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 7 uucuaauauu ccauggaua 19 <210> SEQ ID NO 8 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 8 auggaauauu agaacuuga 19 <210> SEQ ID NO 9 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 9 ucaaguucua auauuccau 19 <210> SEQ ID NO 10 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 10 gaauauuaga acuugacuu 19 <210> SEQ ID NO 11 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 11 aagucaaguu cuaauauuc 19 <210> SEQ ID NO 12 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 12 agaacuugac uugcuccau 19 <210> SEQ ID NO 13 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 13 auggagcaag ucaaguucu 19 <210> SEQ ID NO 14 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 14 gaacuugacu ugcuccauc 19 <210> SEQ ID NO 15 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 15 gauggagcaa gucaaguuc 19 <210> SEQ ID NO 16 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 16 ugacuugcuc cauccucuu 19 <210> SEQ ID NO 17 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 17 aagaggaugg agcaaguca 19 <210> SEQ ID NO 18 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 18 ccauccucuu aaacuuuuu 19 <210> SEQ ID NO 19 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 19 aaaaaguuua agaggaugg 19 <210> SEQ ID NO 20 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 20 ccucuuaaac uuuuugugu 19 <210> SEQ ID NO 21 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 21 acacaaaaag uuuaagagg 19 <210> SEQ ID NO 22 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 22 ucuuaaacuu uuugugucu 19 <210> SEQ ID NO 23 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 23 agacacaaaa aguuuaaga 19 <210> SEQ ID NO 24 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 24 cuuuuugugu cucacacua 19 <210> SEQ ID NO 25 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 25 uagugugaga cacaaaaag 19 <210> SEQ ID NO 26 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 26 gugucucaca cuaaagaaa 19 <210> SEQ ID NO 27 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 27 uuucuuuagu gugagacac 19 <210> SEQ ID NO 28 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 28 ucacacuaaa gaaaugaga 19 <210> SEQ ID NO 29 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 29 ucucauuucu uuaguguga 19 <210> SEQ ID NO 30 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 30 acacuaaaga aaugagaga 19 <210> SEQ ID NO 31 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 31 ucucucauuu cuuuagugu 19 <210> SEQ ID NO 32 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 32 agaaaugaga gaugcagaa 19 <210> SEQ ID NO 33 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 33 uucugcaucu cucauuucu 19 <210> SEQ ID NO 34 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 34 gagagaugca gaauucuaa 19 <210> SEQ ID NO 35 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 35 uuagaauucu gcaucucuc 19 <210> SEQ ID NO 36 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 36 augcagaauu cuaaggcua 19 <210> SEQ ID NO 37 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 37 uagccuuaga auucugcau 19 <210> SEQ ID NO 38 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 38 gaauucuaag gcuaaauag 19 <210> SEQ ID NO 39 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 39 cuauuuagcc uuagaauuc 19 <210> SEQ ID NO 40 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 40 uucuaaggcu aaauagcua 19 <210> SEQ ID NO 41 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 41 uagcuauuua gccuuagaa 19 <210> SEQ ID NO 42 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 42 cuaaauagcu aggaaguau 19 <210> SEQ ID NO 43 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 43 auacuuccua gcuauuuag 19 <210> SEQ ID NO 44 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 44 auagcuagga aguauucau 19 <210> SEQ ID NO 45 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 45 augaauacuu ccuagcuau 19 <210> SEQ ID NO 46 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 46 ggaaguauuc auucaaacu 19 <210> SEQ ID NO 47 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 47 aguuugaaug aauacuucc 19 <210> SEQ ID NO 48 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 48 cauucaaacu ugaauauuc 19 <210> SEQ ID NO 49 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 49 gaauauucaa guuugaaug 19 <210> SEQ ID NO 50 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 50 cuugaauauu cuucaaaga 19 <210> SEQ ID NO 51 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 51 ucuuugaaga auauucaag 19 <210> SEQ ID NO 52 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 52 cuucaaagag agugugggg 19 <210> SEQ ID NO 53 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 53 ccccacacuc ucuuugaag 19 <210> SEQ ID NO 54 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 54 caaagagagu gugggggca 19 <210> SEQ ID NO 55 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 55 ugcccccaca cucucuuug 19 <210> SEQ ID NO 56 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 56 gugugggggc aacucuaau 19 <210> SEQ ID NO 57 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 57 auuagaguug cccccacac 19 <210> SEQ ID NO 58 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 58 gggggcaacu cuaaucaga 19 <210> SEQ ID NO 59 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 59 ucugauuaga guugccccc 19 <210> SEQ ID NO 60 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 60 aacucuaauc agaggaaga 19 <210> SEQ ID NO 61 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 61 ucuuccucug auuagaguu 19 <210> SEQ ID NO 62 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 62 aaucagagga agaaacuaa 19 <210> SEQ ID NO 63 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 63 uuaguuucuu ccucugauu 19 <210> SEQ ID NO 64 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 64 aucagaggaa gaaacuaaa 19 <210> SEQ ID NO 65 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 65 uuuaguuucu uccucugau 19 <210> SEQ ID NO 66 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 66 agaaacuaaa ggaaguaaa 19 <210> SEQ ID NO 67 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 67 uuuacuuccu uuaguuucu 19 <210> SEQ ID NO 68 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 68 gaaacuaaag gaaguaaaa 19 <210> SEQ ID NO 69 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 69 uuuuacuucc uuuaguuuc 19 <210> SEQ ID NO 70 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 70 uaaaggaagu aaaaccaga 19 <210> SEQ ID NO 71 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 71 ucugguuuua cuuccuuua 19 <210> SEQ ID NO 72 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 72 aaguaaaacc agauguuuu 19 <210> SEQ ID NO 73 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 73 aaaacaucug guuuuacuu 19 <210> SEQ ID NO 74 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 74 ccagauguuu uccaccaaa 19 <210> SEQ ID NO 75 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 75 uuugguggaa aacaucugg 19 <210> SEQ ID NO 76 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 76 cagauguuuu ccaccaaag 19 <210> SEQ ID NO 77 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 77 cuuuggugga aaacaucug 19 <210> SEQ ID NO 78 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 78 uccaccaaag cccuccuuu 19 <210> SEQ ID NO 79 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 79 aaaggagggc uuuggugga 19 <210> SEQ ID NO 80 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 80 ccaccaaagc ccuccuuuu 19 <210> SEQ ID NO 81 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 81 aaaaggaggg cuuuggugg 19 <210> SEQ ID NO 82 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 82 cccuccuuuu ggcuggucu 19 <210> SEQ ID NO 83 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 83 agaccagcca aaaggaggg 19 <210> SEQ ID NO 84 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 84 ggcuggucug auuucuacc 19 <210> SEQ ID NO 85 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 85 gguagaaauc agaccagcc 19 <210> SEQ ID NO 86 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 86 ggucugauuu cuaccgcac 19 <210> SEQ ID NO 87 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 87 gugcgguaga aaucagacc 19 <210> SEQ ID NO 88 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 88 gauuucuacc gcacuggca 19 <210> SEQ ID NO 89 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 89 ugccagugcg guagaaauc 19 <210> SEQ ID NO 90 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 90 uaccgcacug gcagggcca 19 <210> SEQ ID NO 91 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 91 uggcccugcc agugcggua 19 <210> SEQ ID NO 92 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 92 ccgcacuggc agggccaug 19 <210> SEQ ID NO 93 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 93 cauggcccug ccagugcgg 19 <210> SEQ ID NO 94 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 94 ggcagggcca ugggcuaau 19 <210> SEQ ID NO 95 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 95 auuagcccau ggcccugcc 19 <210> SEQ ID NO 96 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 96 gccaugggcu aauauaugu 19 <210> SEQ ID NO 97 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 97 acauauauua gcccauggc 19 <210> SEQ ID NO 98 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 98 ccaugggcua auauaugug 19 <210> SEQ ID NO 99 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 99 cacauauauu agcccaugg 19 <210> SEQ ID NO 100 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 100 cuaauauaug ugcuggcaa 19 <210> SEQ ID NO 101 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 101 uugccagcac auauauuag 19 <210> SEQ ID NO 102 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 102 auaugugcug gcaagucuu 19 <210> SEQ ID NO 103 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 103 aagacuugcc agcacauau 19 <210> SEQ ID NO 104 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 104 cuggcaaguc uuccaauga 19 <210> SEQ ID NO 105 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 105 ucauuggaag acuugccag 19 <210> SEQ ID NO 106 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 106 gcaagucuuc caaugagau 19 <210> SEQ ID NO 107 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 107 aucucauugg aagacuugc 19 <210> SEQ ID NO 108 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 108 ucuuccaaug agauccgga 19 <210> SEQ ID NO 109 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 109 uccggaucuc auuggaaga 19 <210> SEQ ID NO 110 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 110 augagauccg gacguguga 19 <210> SEQ ID NO 111 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 111 ucacacgucc ggaucucau 19 <210> SEQ ID NO 112 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 112 gauccggacg ugugaccgc 19 <210> SEQ ID NO 113 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 113 gcggucacac guccggauc 19 <210> SEQ ID NO 114 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 114 cggacgugug accgccaug 19 <210> SEQ ID NO 115 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 115 cauggcgguc acacguccg 19 <210> SEQ ID NO 116 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 116 acgugugacc gccauggcu 19 <210> SEQ ID NO 117 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 117 agccauggcg gucacacgu 19 <210> SEQ ID NO 118 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 118 ccgccauggc uguggacag 19 <210> SEQ ID NO 119 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 119 cuguccacag ccauggcgg 19 <210> SEQ ID NO 120 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 120 ccauggcugu ggacaguac 19 <210> SEQ ID NO 121 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 121 guacugucca cagccaugg 19 <210> SEQ ID NO 122 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 122 ggcuguggac aguacucug 19 <210> SEQ ID NO 123 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 123 cagaguacug uccacagcc 19 <210> SEQ ID NO 124 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 124 guacucugcu caaagaagu 19 <210> SEQ ID NO 125 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 125 acuucuuuga gcagaguac 19 <210> SEQ ID NO 126 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 126 ucugcucaaa gaagucaga 19 <210> SEQ ID NO 127 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 127 ucugacuucu uugagcaga 19 <210> SEQ ID NO 128 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 128 caaagaaguc agaggccuc 19 <210> SEQ ID NO 129 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 129 gaggccucug acuucuuug 19 <210> SEQ ID NO 130 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 130 aagucagagg ccucaccag 19 <210> SEQ ID NO 131 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 131 cuggugaggc cucugacuu 19 <210> SEQ ID NO 132 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 132 gaggccucac cagggugug 19 <210> SEQ ID NO 133 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 133 cacacccugg ugaggccuc 19 <210> SEQ ID NO 134 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 134 gccucaccag gguguggac 19 <210> SEQ ID NO 135 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 135 guccacaccc uggugaggc 19 <210> SEQ ID NO 136 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 136 ccagggugug gacaucuug 19 <210> SEQ ID NO 137 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 137 caagaugucc acacccugg 19 <210> SEQ ID NO 138 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 138 gguguggaca ucuugugcu 19 <210> SEQ ID NO 139 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 139 agcacaagau guccacacc 19 <210> SEQ ID NO 140 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 140 acaucuugug cucugcugg 19 <210> SEQ ID NO 141 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 141 ccagcagagc acaagaugu 19 <210> SEQ ID NO 142 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 142 gugcucugcu ggaucuacu 19 <210> SEQ ID NO 143 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 143 aguagaucca gcagagcac 19 <210> SEQ ID NO 144 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 144 cugcuggauc uacugugua 19 <210> SEQ ID NO 145 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 145 uacacaguag auccagcag 19 <210> SEQ ID NO 146 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 146 ggaucuacug uguacgcac 19 <210> SEQ ID NO 147 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 147 gugcguacac aguagaucc 19 <210> SEQ ID NO 148 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 148 cuacugugua cgcaccauu 19 <210> SEQ ID NO 149 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 149 aauggugcgu acacaguag 19 <210> SEQ ID NO 150 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 150 cuguguacgc accauucac 19 <210> SEQ ID NO 151 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 151 gugaauggug cguacacag 19 <210> SEQ ID NO 152 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 152 gcaccauuca cuggaauga 19 <210> SEQ ID NO 153 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 153 ucauuccagu gaauggugc 19 <210> SEQ ID NO 154 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 154 ccauucacug gaaugauug 19 <210> SEQ ID NO 155 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 155 caaucauucc agugaaugg 19 <210> SEQ ID NO 156 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 156 cuggaaugau ugugggcca 19 <210> SEQ ID NO 157 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 157 uggcccacaa ucauuccag 19 <210> SEQ ID NO 158 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 158 gaaugauugu gggccagga 19 <210> SEQ ID NO 159 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 159 uccuggccca caaucauuc 19 <210> SEQ ID NO 160 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 160 gauugugggc caggagaaa 19 <210> SEQ ID NO 161 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 161 uuucuccugg cccacaauc 19 <210> SEQ ID NO 162 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 162 gggccaggag aaaccuuau 19 <210> SEQ ID NO 163 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 163 auaagguuuc uccuggccc 19 <210> SEQ ID NO 164 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 164 caggagaaac cuuaucaaa 19 <210> SEQ ID NO 165 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 165 uuugauaagg uuucuccug 19 <210> SEQ ID NO 166 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 166 aaaccuuauc aaaacaaga 19 <210> SEQ ID NO 167 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 167 ucuuguuuug auaagguuu 19 <210> SEQ ID NO 168 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 168 uaucaaaaca agaaugcua 19 <210> SEQ ID NO 169 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 169 uagcauucuu guuuugaua 19 <210> SEQ ID NO 170 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 170 aacaagaaug cuaucaaua 19 <210> SEQ ID NO 171 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 171 uauugauagc auucuuguu 19 <210> SEQ ID NO 172 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 172 caagaaugcu aucaauaau 19 <210> SEQ ID NO 173 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 173 auuauugaua gcauucuug 19 <210> SEQ ID NO 174 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 174 caauaauggu guucgaaua 19 <210> SEQ ID NO 175 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 175 uauucgaaca ccauuauug 19 <210> SEQ ID NO 176 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 176 uaaugguguu cgaauaucu 19 <210> SEQ ID NO 177 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 177 agauauucga acaccauua 19 <210> SEQ ID NO 178 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 178 uguucgaaua ucuggaaga 19 <210> SEQ ID NO 179 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 179 ucuuccagau auucgaaca 19 <210> SEQ ID NO 180 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 180 auaucuggaa gagguuuuu 19 <210> SEQ ID NO 181 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 181 aaaaaccucu uccagauau 19 <210> SEQ ID NO 182 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 182 aucuggaaga gguuuuugu 19 <210> SEQ ID NO 183 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 183 acaaaaaccu cuuccagau 19 <210> SEQ ID NO 184 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 184 agagguuuuu gugucaaaa 19 <210> SEQ ID NO 185 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 185 uuuugacaca aaaaccucu 19 <210> SEQ ID NO 186 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 186 gguuuuugug ucaaaaugu 19 <210> SEQ ID NO 187 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 187 acauuuugac acaaaaacc 19 <210> SEQ ID NO 188 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 188 gugucaaaau guucuacau 19 <210> SEQ ID NO 189 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 189 auguagaaca uuuugacac 19 <210> SEQ ID NO 190 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 190 ucaaaauguu cuacauuaa 19 <210> SEQ ID NO 191 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 191 uuaauguaga acauuuuga 19 <210> SEQ ID NO 192 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 192 uguucuacau uaagccaau 19 <210> SEQ ID NO 193 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 193 auuggcuuaa uguagaaca 19 <210> SEQ ID NO 194 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 194 guauaaaggu ccuauuaag 19 <210> SEQ ID NO 195 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 195 cuuaauagga ccuuuauac 19 <210> SEQ ID NO 196 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 196 uauaaagguc cuauuaaga 19 <210> SEQ ID NO 197 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 197 ucuuaauagg accuuuaua 19 <210> SEQ ID NO 198 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 198 ccuauuaaga agggagaaa 19 <210> SEQ ID NO 199 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 199 uuucucccuu cuuaauagg 19 <210> SEQ ID NO 200 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 200 cuauuaagaa gggagaaaa 19 <210> SEQ ID NO 201 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 201 uuuucucccu ucuuaauag 19 <210> SEQ ID NO 202 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 202 aagaagggag aaaaacuug 19 <210> SEQ ID NO 203 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 203 caaguuuuuc ucccuucuu 19 <210> SEQ ID NO 204 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 204 agaaaaacuu ggaacucua 19 <210> SEQ ID NO 205 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 205 uagaguucca aguuuuucu 19 <210> SEQ ID NO 206 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 206 aaaacuugga acucuauug 19 <210> SEQ ID NO 207 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 207 caauagaguu ccaaguuuu 19 <210> SEQ ID NO 208 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 208 cuuggaacuc uauugcccu 19 <210> SEQ ID NO 209 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 209 agggcaauag aguuccaag 19 <210> SEQ ID NO 210 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 210 cucuauugcc cuugcagaa 19 <210> SEQ ID NO 211 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 211 uucugcaagg gcaauagag 19 <210> SEQ ID NO 212 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 212 gcccuugcag aaaguuuau 19 <210> SEQ ID NO 213 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 213 auaaacuuuc ugcaagggc 19 <210> SEQ ID NO 214 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 214 cccuugcaga aaguuuauc 19 <210> SEQ ID NO 215 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 215 gauaaacuuu cugcaaggg 19 <210> SEQ ID NO 216 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 216 agaaaguuua uccuggcau 19 <210> SEQ ID NO 217 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 217 augccaggau aaacuuucu 19 <210> SEQ ID NO 218 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 218 aguuuauccu ggcauacaa 19 <210> SEQ ID NO 219 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 219 uuguaugcca ggauaaacu 19 <210> SEQ ID NO 220 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 220 ccuggcauac aaucgcaug 19 <210> SEQ ID NO 221 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 221 caugcgauug uaugccagg 19 <210> SEQ ID NO 222 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 222 auacaaucgc augugcaca 19 <210> SEQ ID NO 223 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 223 ugugcacaug cgauuguau 19 <210> SEQ ID NO 224 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 224 aucgcaugug cacauugaa 19 <210> SEQ ID NO 225 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 225 uucaaugugc acaugcgau 19 <210> SEQ ID NO 226 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 226 gcaugugcac auugaaaac 19 <210> SEQ ID NO 227 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 227 guuuucaaug ugcacaugc 19 <210> SEQ ID NO 228 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 228 ugcacauuga aaacuguga 19 <210> SEQ ID NO 229 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 229 ucacaguuuu caaugugca 19 <210> SEQ ID NO 230 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 230 auugaaaacu gugacucga 19 <210> SEQ ID NO 231 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 231 ucgagucaca guuuucaau 19 <210> SEQ ID NO 232 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 232 aaaacuguga cucgaguga 19 <210> SEQ ID NO 233 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 233 ucacucgagu cacaguuuu 19 <210> SEQ ID NO 234 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 234 ugugacucga gugacccua 19 <210> SEQ ID NO 235 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 235 uagggucacu cgagucaca 19 <210> SEQ ID NO 236 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 236 gagugacccu acugcauac 19 <210> SEQ ID NO 237 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 237 guaugcagua gggucacuc 19 <210> SEQ ID NO 238 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 238 gacccuacug cauaccugu 19 <210> SEQ ID NO 239 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 239 acagguaugc aguaggguc 19 <210> SEQ ID NO 240 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 240 ccuacugcau accuguaaa 19 <210> SEQ ID NO 241 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 241 uuuacaggua ugcaguagg 19 <210> SEQ ID NO 242 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 242 cugcauaccu guaaaucga 19 <210> SEQ ID NO 243 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 243 ucgauuuaca gguaugcag 19 <210> SEQ ID NO 244 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 244 ccuguaaauc gaaggccaa 19 <210> SEQ ID NO 245 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 245 uuggccuucg auuuacagg 19 <210> SEQ ID NO 246 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 246 aaucgaaggc caaugguca 19 <210> SEQ ID NO 247 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 247 ugaccauugg ccuucgauu 19 <210> SEQ ID NO 248 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 248 aggccaaugg ucagaucuu 19 <210> SEQ ID NO 249 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 249 aagaucugac cauuggccu 19 <210> SEQ ID NO 250 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 250 caauggucag aucuucaaa 19 <210> SEQ ID NO 251 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 251 uuugaagauc ugaccauug 19 <210> SEQ ID NO 252 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 252 cagaucuuca aaauaaaaa 19 <210> SEQ ID NO 253 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 253 uuuuuauuuu gaagaucug 19 <210> SEQ ID NO 254 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 254 auaaaaaguc aucuuaaaa 19 <210> SEQ ID NO 255 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 255 uuuuaagaug acuuuuuau 19 <210> SEQ ID NO 256 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 256 aagucaucuu aaaaaccug 19 <210> SEQ ID NO 257 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 257 cagguuuuua agaugacuu 19 <210> SEQ ID NO 258 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 258 cuuaaaaacc uggaugcau 19 <210> SEQ ID NO 259 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 259 augcauccag guuuuuaag 19 <210> SEQ ID NO 260 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 260 uuaaaaaccu ggaugcaua 19 <210> SEQ ID NO 261 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 261 uaugcaucca gguuuuuaa 19 <210> SEQ ID NO 262 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 262 ccuggaugca uacccuucu 19 <210> SEQ ID NO 263 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 263 agaaggguau gcauccagg 19 <210> SEQ ID NO 264 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 264 ggaugcauac ccuucucuu 19 <210> SEQ ID NO 265 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 265 aagagaaggg uaugcaucc 19 <210> SEQ ID NO 266 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 266 uacccuucuc uucaagaaa 19 <210> SEQ ID NO 267 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 267 uuucuugaag agaagggua 19 <210> SEQ ID NO 268 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 268 ccuucucuuc aagaaauuu 19 <210> SEQ ID NO 269 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 269 aaauuucuug aagagaagg 19 <210> SEQ ID NO 270 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 270 caagaaauuu guguucaca 19 <210> SEQ ID NO 271 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 271 ugugaacaca aauuucuug 19 <210> SEQ ID NO 272 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 272 agaaauuugu guucacaaa 19 <210> SEQ ID NO 273 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 273 uuugugaaca caaauuucu 19 <210> SEQ ID NO 274 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 274 uuguguucac aaaggaaaa 19 <210> SEQ ID NO 275 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 275 uuuuccuuug ugaacacaa 19 <210> SEQ ID NO 276 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 276 cacaaaggaa aaaugcaug 19 <210> SEQ ID NO 277 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 277 caugcauuuu uccuuugug 19 <210> SEQ ID NO 278 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 278 caaaggaaaa augcaugaa 19 <210> SEQ ID NO 279 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 279 uucaugcauu uuuccuuug 19 <210> SEQ ID NO 280 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 280 gaaaaaugca ugaagggau 19 <210> SEQ ID NO 281 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 281 aucccuucau gcauuuuuc 19 <210> SEQ ID NO 282 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 282 augcaugaag ggauggaua 19 <210> SEQ ID NO 283 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 283 uauccauccc uucaugcau 19 <210> SEQ ID NO 284 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 284 agggauggau accccauuu 19 <210> SEQ ID NO 285 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 285 aaauggggua uccaucccu 19 <210> SEQ ID NO 286 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 286 gggauggaua ccccauuuu 19 <210> SEQ ID NO 287 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 287 aaaauggggu auccauccc 19 <210> SEQ ID NO 288 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 288 accccauuuu ccaugacau 19 <210> SEQ ID NO 289 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 289 augucaugga aaauggggu 19 <210> SEQ ID NO 290 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 290 ccccauuuuc caugacaug 19 <210> SEQ ID NO 291 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 291 caugucaugg aaaaugggg 19 <210> SEQ ID NO 292 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 292 ccaugacaug auuauuaca 19 <210> SEQ ID NO 293 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 293 uguaauaauc augucaugg 19 <210> SEQ ID NO 294 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 294 ugacaugauu auuacacau 19 <210> SEQ ID NO 295 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 295 auguguaaua aucauguca 19 <210> SEQ ID NO 296 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 296 gauuauuaca cauugcaug 19 <210> SEQ ID NO 297 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 297 caugcaaugu guaauaauc 19 <210> SEQ ID NO 298 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 298 uacacauugc augccugua 19 <210> SEQ ID NO 299 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 299 uacaggcaug caaugugua 19 <210> SEQ ID NO 300 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 300 auugcaugcc uguaucaaa 19 <210> SEQ ID NO 301 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 301 uuugauacag gcaugcaau 19 <210> SEQ ID NO 302 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 302 uugcaugccu guaucaaaa 19 <210> SEQ ID NO 303 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 303 uuuugauaca ggcaugcaa 19 <210> SEQ ID NO 304 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 304 uaucaaaaca ucucacgua 19 <210> SEQ ID NO 305 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 305 uacgugagau guuuugaua 19 <210> SEQ ID NO 306 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 306 caucucacgu accucauaa 19 <210> SEQ ID NO 307 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 307 uuaugaggua cgugagaug 19 <210> SEQ ID NO 308 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 308 cacguaccuc auaaacaua 19 <210> SEQ ID NO 309 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 309 uauguuuaug agguacgug 19 <210> SEQ ID NO 310 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 310 cguaccucau aaacauaua 19 <210> SEQ ID NO 311 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 311 uauauguuua ugagguacg 19 <210> SEQ ID NO 312 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 312 aaacauauac accuaugua 19 <210> SEQ ID NO 313 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 313 uacauaggug uauauguuu 19 <210> SEQ ID NO 314 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 314 acaccuaugu acccacaaa 19 <210> SEQ ID NO 315 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 315 uuugugggua cauaggugu 19 <210> SEQ ID NO 316 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 316 caccuaugua cccacaaaa 19 <210> SEQ ID NO 317 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 317 uuuugugggu acauaggug 19 <210> SEQ ID NO 318 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 318 acccacaaaa auuuuuuaa 19 <210> SEQ ID NO 319 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 319 uuaaaaaauu uuugugggu 19 <210> SEQ ID NO 320 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 320 caaaaauuuu uuaauuaaa 19 <210> SEQ ID NO 321 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 321 uuuaauuaaa aaauuuuug 19 <210> SEQ ID NO 322 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 322 uuuaauuaaa aaaaggaaa 19 <210> SEQ ID NO 323 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 323 uuuccuuuuu uuaauuaaa 19 <210> SEQ ID NO 324 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 324 uuaaaaaaag gaaauuuga 19 <210> SEQ ID NO 325 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 325 ucaaauuucc uuuuuuuaa 19 <210> SEQ ID NO 326 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 326 aaaggaaauu ugaguuuaa 19 <210> SEQ ID NO 327 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 327 uuaaacucaa auuuccuuu 19 <210> SEQ ID NO 328 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 328 ggaaauuuga guuuaaaua 19 <210> SEQ ID NO 329 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 329 uauuuaaacu caaauuucc 19 <210> SEQ ID NO 330 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 330 aauuugaguu uaaauagaa 19 <210> SEQ ID NO 331 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 331 uucuauuuaa acucaaauu 19 <210> SEQ ID NO 332 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 332 aguuuaaaua gaaacauga 19 <210> SEQ ID NO 333 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 333 ucauguuucu auuuaaacu 19 <210> SEQ ID NO 334 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 334 uaaauagaaa caugauaaa 19 <210> SEQ ID NO 335 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 335 uuuaucaugu uucuauuua 19 <210> SEQ ID NO 336 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 336 gaaacaugau aaaugcaag 19 <210> SEQ ID NO 337 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 337 cuugcauuua ucauguuuc 19 <210> SEQ ID NO 338 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 338 gauaaaugca agaaagaaa 19 <210> SEQ ID NO 339 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 339 uuucuuucuu gcauuuauc 19 <210> SEQ ID NO 340 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 340 aaaugcaaga aagaaaaca 19 <210> SEQ ID NO 341 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 341 uguuuucuuu cuugcauuu 19 <210> SEQ ID NO 342 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 342 caagaaagaa aacauuuug 19 <210> SEQ ID NO 343 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 343 caaaauguuu ucuuucuug 19 <210> SEQ ID NO 344 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 344 agaaaacauu uugauuuua 19 <210> SEQ ID NO 345 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 345 uaaaaucaaa auguuuucu 19 <210> SEQ ID NO 346 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 346 cauuuugauu uuaacucau 19 <210> SEQ ID NO 347 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 347 augaguuaaa aucaaaaug 19 <210> SEQ ID NO 348 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 348 gauuuuaacu cauugucac 19 <210> SEQ ID NO 349 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 349 gugacaauga guuaaaauc 19 <210> SEQ ID NO 350 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 350 auuuuaacuc auugucacu 19 <210> SEQ ID NO 351 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 351 agugacaaug aguuaaaau 19 <210> SEQ ID NO 352 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 352 cauugucacu cugauguuc 19 <210> SEQ ID NO 353 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 353 gaacaucaga gugacaaug 19 <210> SEQ ID NO 354 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 354 uugucacucu gauguucau 19 <210> SEQ ID NO 355 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 355 augaacauca gagugacaa 19 <210> SEQ ID NO 356 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 356 cucugauguu caugugaac 19 <210> SEQ ID NO 357 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 357 guucacauga acaucagag 19 <210> SEQ ID NO 358 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 358 gauguucaug ugaacuggu 19 <210> SEQ ID NO 359 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 359 accaguucac augaacauc 19 <210> SEQ ID NO 360 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 360 caugugaacu gguugcuuc 19 <210> SEQ ID NO 361 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 361 gaagcaacca guucacaug 19 <210> SEQ ID NO 362 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 362 acugguugcu ucgggcucu 19 <210> SEQ ID NO 363 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 363 agagcccgaa gcaaccagu 19 <210> SEQ ID NO 364 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 364 guugcuucgg gcucuuuga 19 <210> SEQ ID NO 365 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 365 ucaaagagcc cgaagcaac 19 <210> SEQ ID NO 366 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 366 gcuucgggcu cuuugaucu 19 <210> SEQ ID NO 367 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 367 agaucaaaga gcccgaagc 19 <210> SEQ ID NO 368 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 368 cgggcucuuu gaucuguca 19 <210> SEQ ID NO 369 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 369 ugacagauca aagagcccg 19 <210> SEQ ID NO 370 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 370 ucuuugaucu gucaccuau 19 <210> SEQ ID NO 371 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 371 auaggugaca gaucaaaga 19 <210> SEQ ID NO 372 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 372 gaucugucac cuauggaau 19 <210> SEQ ID NO 373 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 373 auuccauagg ugacagauc 19 <210> SEQ ID NO 374 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 374 caccuaugga aucugagug 19 <210> SEQ ID NO 375 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 375 cacucagauu ccauaggug 19 <210> SEQ ID NO 376 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 376 ggaaucugag ugguuuuau 19 <210> SEQ ID NO 377 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 377 auaaaaccac ucagauucc 19 <210> SEQ ID NO 378 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 378 cugagugguu uuauuuuuu 19 <210> SEQ ID NO 379 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 379 aaaaaauaaa accacucag 19 <210> SEQ ID NO 380 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 380 gagugguuuu auuuuuuag 19 <210> SEQ ID NO 381 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 381 cuaaaaaaua aaaccacuc 19 <210> SEQ ID NO 382 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 382 gguuuuauuu uuuagauuu 19 <210> SEQ ID NO 383 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 383 aaaucuaaaa aauaaaacc 19 <210> SEQ ID NO 384 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 384 auuuuuuaga uuucucagu 19 <210> SEQ ID NO 385 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 385 acugagaaau cuaaaaaau 19 <210> SEQ ID NO 386 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 386 uagauuucuc agucccaaa 19 <210> SEQ ID NO 387 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 387 uuugggacug agaaaucua 19 <210> SEQ ID NO 388 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 388 cucaguccca aagaucuaa 19 <210> SEQ ID NO 389 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 389 uuagaucuuu gggacugag 19 <210> SEQ ID NO 390 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 390 ucccaaagau cuaagauaa 19 <210> SEQ ID NO 391 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 391 uuaucuuaga ucuuuggga 19 <210> SEQ ID NO 392 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 392 caaagaucua agauaaaua 19 <210> SEQ ID NO 393 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 393 uauuuaucuu agaucuuug 19 <210> SEQ ID NO 394 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 394 cuaagauaaa uaaacaaga 19 <210> SEQ ID NO 395 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 395 ucuuguuuau uuaucuuag 19 <210> SEQ ID NO 396 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 396 aagauaaaua aacaagaga 19 <210> SEQ ID NO 397 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 397 ucucuuguuu auuuaucuu 19 <210> SEQ ID NO 398 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 398 auuaagccaa uuaaguauaa a 21 <210> SEQ ID NO 399 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 399 uuuauacuua auuggcuuaa ugu 23 <210> SEQ ID NO 400 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 400 cauuaagcca auuaaguaua a 21 <210> SEQ ID NO 401 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 401 uuauacuuaa uuggcuuaau gua 23 <210> SEQ ID NO 402 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 402 cuacauuaag ccaauuaagu a 21 <210> SEQ ID NO 403 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 403 uacuuaauug gcuuaaugua gaa 23 <210> SEQ ID NO 404 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 404 uacauuaagc caauuaagua u 21 <210> SEQ ID NO 405 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 405 auacuuaauu ggcuuaaugu aga 23 <210> SEQ ID NO 406 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 406 acauuaagcc aauuaaguau a 21 <210> SEQ ID NO 407 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 407 uauacuuaau uggcuuaaug uag 23 <210> SEQ ID NO 408 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 408 uguggacagu acucugcuca a 21 <210> SEQ ID NO 409 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 409 uugagcagag uacuguccac agc 23 <210> SEQ ID NO 410 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 410 aagccaauua aguauaaagg u 21 <210> SEQ ID NO 411 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 411 accuuuauac uuaauuggcu uaa 23 <210> SEQ ID NO 412 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 412 uuaagccaau uaaguauaaa g 21 <210> SEQ ID NO 413 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 413 cuuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 414 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 414 ggcuguggac aguacucugc u 21 <210> SEQ ID NO 415 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 415 agcagaguac uguccacagc cau 23 <210> SEQ ID NO 416 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 416 cuguggacag uacucugcuc a 21 <210> SEQ ID NO 417 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 417 ugagcagagu acuguccaca gcc 23 <210> SEQ ID NO 418 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 418 guggacagua cucugcucaa a 21 <210> SEQ ID NO 419 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 419 uuugagcaga guacugucca cag 23 <210> SEQ ID NO 420 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 420 gcuguggaca guacucugcu c 21 <210> SEQ ID NO 421 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 421 gagcagagua cuguccacag cca 23 <210> SEQ ID NO 422 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 422 uaagccaauu aaguauaaag g 21 <210> SEQ ID NO 423 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 423 ccuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 424 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 424 gacaguacuc ugcucaaaga a 21 <210> SEQ ID NO 425 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 425 uucuuugagc agaguacugu cca 23 <210> SEQ ID NO 426 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 426 ggacaguacu cugcucaaag a 21 <210> SEQ ID NO 427 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 427 ucuuugagca gaguacuguc cac 23 <210> SEQ ID NO 428 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 428 uggacaguac ucugcucaaa g 21 <210> SEQ ID NO 429 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 429 cuuugagcag aguacugucc aca 23 <210> SEQ ID NO 430 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 430 uuaagccaau uaaguauaaa u 21 <210> SEQ ID NO 431 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 431 auuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 432 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 432 gcuguggaca guacucugcu a 21 <210> SEQ ID NO 433 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 433 uagcagagua cuguccacag cca 23 <210> SEQ ID NO 434 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 434 uaagccaauu aaguauaaag a 21 <210> SEQ ID NO 435 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 435 ucuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 436 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 436 uggacaguac ucugcucaaa u 21 <210> SEQ ID NO 437 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 437 auuugagcag aguacugucc aca 23 <210> SEQ ID NO 438 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 438 agccaauuaa guauaaaggu a 21 <210> SEQ ID NO 439 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 439 uaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 440 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 440 agccaauuaa guauaaaggu c 21 <210> SEQ ID NO 441 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 441 gaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 442 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 442 ucuacauuaa gccaauuaag u 21 <210> SEQ ID NO 443 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 443 acuuaauugg cuuaauguag aac 23 <210> SEQ ID NO 444 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 444 uucuacauua agccaauuaa g 21 <210> SEQ ID NO 445 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 445 cuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 446 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 446 guucuacauu aagccaauua a 21 <210> SEQ ID NO 447 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 447 uuaauuggcu uaauguagaa cau 23 <210> SEQ ID NO 448 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 448 uguucuacau uaagccaauu a 21 <210> SEQ ID NO 449 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 449 uaauuggcuu aauguagaac auu 23 <210> SEQ ID NO 450 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 450 cauggcugug gacaguacuc u 21 <210> SEQ ID NO 451 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 451 agaguacugu ccacagccau ggc 23 <210> SEQ ID NO 452 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 452 uggcugugga caguacucug c 21 <210> SEQ ID NO 453 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 453 gcagaguacu guccacagcc aug 23 <210> SEQ ID NO 454 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 454 uucuacauua agccaauuaa a 21 <210> SEQ ID NO 455 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 455 uuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 456 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 456 uggcugugga caguacucug a 21 <210> SEQ ID NO 457 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 457 ucagaguacu guccacagcc aug 23 <210> SEQ ID NO 458 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 458 gcuaauauau gugcuggcaa a 21 <210> SEQ ID NO 459 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 459 uuugccagca cauauauuag ccc 23 <210> SEQ ID NO 460 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 460 gcccuugcag aaaguuuauc a 21 <210> SEQ ID NO 461 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 461 ugauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 462 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 462 uugaauauuc uucaaagaga a 21 <210> SEQ ID NO 463 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 463 uucucuuuga agaauauuca agu 23 <210> SEQ ID NO 464 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 464 gcuaauauau gugcuggcaa g 21 <210> SEQ ID NO 465 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 465 cuugccagca cauauauuag ccc 23 <210> SEQ ID NO 466 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 466 auucauucaa acuugaauau u 21 <210> SEQ ID NO 467 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 467 aauauucaag uuugaaugaa uac 23 <210> SEQ ID NO 468 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 468 agcuaggaag uauucauuca a 21 <210> SEQ ID NO 469 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 469 uugaaugaau acuuccuagc uau 23 <210> SEQ ID NO 470 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 470 caauggucag aucuucaaaa u 21 <210> SEQ ID NO 471 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 471 auuuugaaga ucugaccauu ggc 23 <210> SEQ ID NO 472 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 472 uggucagauc uucaaaauaa a 21 <210> SEQ ID NO 473 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 473 uuuauuuuga agaucugacc auu 23 <210> SEQ ID NO 474 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 474 ccaggagaaa ccuuaucaaa a 21 <210> SEQ ID NO 475 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 475 uuuugauaag guuucuccug gcc 23 <210> SEQ ID NO 476 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 476 cccuugcaga aaguuuaucc u 21 <210> SEQ ID NO 477 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 477 aggauaaacu uucugcaagg gca 23 <210> SEQ ID NO 478 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 478 uucaaacuug aauauucuuc a 21 <210> SEQ ID NO 479 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 479 ugaagaauau ucaaguuuga aug 23 <210> SEQ ID NO 480 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 480 uagcuaggaa guauucauuc a 21 <210> SEQ ID NO 481 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 481 ugaaugaaua cuuccuagcu auu 23 <210> SEQ ID NO 482 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 482 gcccuugcag aaaguuuauc c 21 <210> SEQ ID NO 483 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 483 ggauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 484 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 484 uugaauauuc uucaaagaga g 21 <210> SEQ ID NO 485 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 485 cucucuuuga agaauauuca agu 23 <210> SEQ ID NO 486 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 486 ccaaugguca gaucuucaaa a 21 <210> SEQ ID NO 487 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 487 uuuugaagau cugaccauug gcc 23 <210> SEQ ID NO 488 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 488 aauggucaga ucuucaaaau a 21 <210> SEQ ID NO 489 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 489 uauuuugaag aucugaccau ugg 23 <210> SEQ ID NO 490 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 490 ugugggccag gagaaaccuu a 21 <210> SEQ ID NO 491 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 491 uaagguuucu ccuggcccac aau 23 <210> SEQ ID NO 492 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 492 gacaucuugu gcucugcugg a 21 <210> SEQ ID NO 493 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 493 uccagcagag cacaagaugu cca 23 <210> SEQ ID NO 494 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic probe" <400> SEQUENCE: 494 gcatcctggg ctacactga 19 <210> SEQ ID NO 495 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic probe" <400> SEQUENCE: 495 tgggtgtcgc tgttgaagtc 20 <210> SEQ ID NO 496 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic probe" <400> SEQUENCE: 496 ccaggtggtc tcctcc 16 <210> SEQ ID NO 497 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 497 uagcuaggaa guauucauuc a 21 <210> SEQ ID NO 498 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 498 ugaaugaaua cuuccuagcu auu 23 <210> SEQ ID NO 499 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 499 agcuaggaag uauucauuca a 21 <210> SEQ ID NO 500 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 500 uugaaugaau acuuccuagc uau 23 <210> SEQ ID NO 501 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 501 auucauucaa acuugaauau u 21 <210> SEQ ID NO 502 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 502 aauauucaag uuugaaugaa uac 23 <210> SEQ ID NO 503 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 503 uucaaacuug aauauucuuc a 21 <210> SEQ ID NO 504 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 504 ugaagaauau ucaaguuuga aug 23 <210> SEQ ID NO 505 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 505 uugaauauuc uucaaagaga g 21 <210> SEQ ID NO 506 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 506 cucucuuuga agaauauuca agu 23 <210> SEQ ID NO 507 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 507 uugaauauuc uucaaagaga a 21 <210> SEQ ID NO 508 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 508 uucucuuuga agaauauuca agu 23 <210> SEQ ID NO 509 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 509 gcuaauauau gugcuggcaa g 21 <210> SEQ ID NO 510 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 510 cuugccagca cauauauuag ccc 23 <210> SEQ ID NO 511 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 511 gcuaauauau gugcuggcaa a 21 <210> SEQ ID NO 512 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 512 uuugccagca cauauauuag ccc 23 <210> SEQ ID NO 513 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 513 cauggcugug gacaguacuc u 21 <210> SEQ ID NO 514 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 514 agaguacugu ccacagccau ggc 23 <210> SEQ ID NO 515 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 515 uggcugugga caguacucug c 21 <210> SEQ ID NO 516 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 516 gcagaguacu guccacagcc aug 23 <210> SEQ ID NO 517 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 517 uggcugugga caguacucug a 21 <210> SEQ ID NO 518 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 518 ucagaguacu guccacagcc aug 23 <210> SEQ ID NO 519 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 519 ggcuguggac aguacucugc u 21 <210> SEQ ID NO 520 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 520 agcagaguac uguccacagc cau 23 <210> SEQ ID NO 521 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 521 gcuguggaca guacucugcu c 21 <210> SEQ ID NO 522 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 522 gagcagagua cuguccacag cca 23 <210> SEQ ID NO 523 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 523 gcuguggaca guacucugcu a 21 <210> SEQ ID NO 524 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 524 uagcagagua cuguccacag cca 23 <210> SEQ ID NO 525 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 525 cuguggacag uacucugcuc a 21 <210> SEQ ID NO 526 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 526 ugagcagagu acuguccaca gcc 23 <210> SEQ ID NO 527 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 527 uguggacagu acucugcuca a 21 <210> SEQ ID NO 528 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 528 uugagcagag uacuguccac agc 23 <210> SEQ ID NO 529 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 529 guggacagua cucugcucaa a 21 <210> SEQ ID NO 530 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 530 uuugagcaga guacugucca cag 23 <210> SEQ ID NO 531 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 531 uggacaguac ucugcucaaa g 21 <210> SEQ ID NO 532 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 532 cuuugagcag aguacugucc aca 23 <210> SEQ ID NO 533 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 533 uggacaguac ucugcucaaa u 21 <210> SEQ ID NO 534 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 534 auuugagcag aguacugucc aca 23 <210> SEQ ID NO 535 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 535 ggacaguacu cugcucaaag a 21 <210> SEQ ID NO 536 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 536 ucuuugagca gaguacuguc cac 23 <210> SEQ ID NO 537 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 537 gacaguacuc ugcucaaaga a 21 <210> SEQ ID NO 538 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 538 uucuuugagc agaguacugu cca 23 <210> SEQ ID NO 539 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 539 ugugggccag gagaaaccuu a 21 <210> SEQ ID NO 540 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 540 uaagguuucu ccuggcccac aau 23 <210> SEQ ID NO 541 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 541 ccaggagaaa ccuuaucaaa a 21 <210> SEQ ID NO 542 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 542 uuuugauaag guuucuccug gcc 23 <210> SEQ ID NO 543 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 543 uguucuacau uaagccaauu a 21 <210> SEQ ID NO 544 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 544 uaauuggcuu aauguagaac auu 23 <210> SEQ ID NO 545 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 545 guucuacauu aagccaauua a 21 <210> SEQ ID NO 546 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 546 uuaauuggcu uaauguagaa cau 23 <210> SEQ ID NO 547 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 547 uucuacauua agccaauuaa g 21 <210> SEQ ID NO 548 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 548 cuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 549 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 549 uucuacauua agccaauuaa a 21 <210> SEQ ID NO 550 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 550 uuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 551 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 551 ucuacauuaa gccaauuaag u 21 <210> SEQ ID NO 552 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 552 acuuaauugg cuuaauguag aac 23 <210> SEQ ID NO 553 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 553 cuacauuaag ccaauuaagu a 21 <210> SEQ ID NO 554 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 554 uacuuaauug gcuuaaugua gaa 23 <210> SEQ ID NO 555 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 555 uacauuaagc caauuaagua u 21 <210> SEQ ID NO 556 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 556 auacuuaauu ggcuuaaugu aga 23 <210> SEQ ID NO 557 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 557 acauuaagcc aauuaaguau a 21 <210> SEQ ID NO 558 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 558 uauacuuaau uggcuuaaug uag 23 <210> SEQ ID NO 559 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 559 cauuaagcca auuaaguaua a 21 <210> SEQ ID NO 560 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 560 uuauacuuaa uuggcuuaau gua 23 <210> SEQ ID NO 561 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 561 auuaagccaa uuaaguauaa a 21 <210> SEQ ID NO 562 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 562 uuuauacuua auuggcuuaa ugu 23 <210> SEQ ID NO 563 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 563 uuaagccaau uaaguauaaa g 21 <210> SEQ ID NO 564 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 564 cuuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 565 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 565 uuaagccaau uaaguauaaa u 21 <210> SEQ ID NO 566 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 566 auuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 567 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 567 uaagccaauu aaguauaaag g 21 <210> SEQ ID NO 568 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 568 ccuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 569 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 569 uaagccaauu aaguauaaag a 21 <210> SEQ ID NO 570 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 570 ucuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 571 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 571 aagccaauua aguauaaagg u 21 <210> SEQ ID NO 572 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 572 accuuuauac uuaauuggcu uaa 23 <210> SEQ ID NO 573 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 573 agccaauuaa guauaaaggu c 21 <210> SEQ ID NO 574 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 574 gaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 575 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 575 agccaauuaa guauaaaggu a 21 <210> SEQ ID NO 576 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 576 uaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 577 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 577 gcccuugcag aaaguuuauc c 21 <210> SEQ ID NO 578 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 578 ggauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 579 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 579 gcccuugcag aaaguuuauc a 21 <210> SEQ ID NO 580 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 580 ugauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 581 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 581 cccuugcaga aaguuuaucc u 21 <210> SEQ ID NO 582 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 582 aggauaaacu uucugcaagg gca 23 <210> SEQ ID NO 583 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 583 ccaaugguca gaucuucaaa a 21 <210> SEQ ID NO 584 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 584 uuuugaagau cugaccauug gcc 23 <210> SEQ ID NO 585 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 585 caauggucag aucuucaaaa u 21 <210> SEQ ID NO 586 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 586 auuuugaaga ucugaccauu ggc 23 <210> SEQ ID NO 587 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 587 aauggucaga ucuucaaaau a 21 <210> SEQ ID NO 588 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 588 uauuuugaag aucugaccau ugg 23 <210> SEQ ID NO 589 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 589 uggucagauc uucaaaauaa a 21 <210> SEQ ID NO 590 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 590 uuuauuuuga agaucugacc auu 23 <210> SEQ ID NO 591 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 591 uagcuaggaa guauucauuc a 21 <210> SEQ ID NO 592 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 592 ugaaugaaua cuuccuagcu auu 23 <210> SEQ ID NO 593 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 593 agcuaggaag uauucauuca a 21 <210> SEQ ID NO 594 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 594 uugaaugaau acuuccuagc uau 23 <210> SEQ ID NO 595 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 595 auucauucaa acuugaauau u 21 <210> SEQ ID NO 596 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 596 aauauucaag uuugaaugaa uac 23 <210> SEQ ID NO 597 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 597 uucaaacuug aauauucuuc a 21 <210> SEQ ID NO 598 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 598 ugaagaauau ucaaguuuga aug 23 <210> SEQ ID NO 599 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 599 uugaauauuc uucaaagaga g 21 <210> SEQ ID NO 600 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 600 cucucuuuga agaauauuca agu 23 <210> SEQ ID NO 601 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 601 uugaauauuc uucaaagaga a 21 <210> SEQ ID NO 602 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 602 uucucuuuga agaauauuca agu 23 <210> SEQ ID NO 603 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 603 gcuaauauau gugcuggcaa g 21 <210> SEQ ID NO 604 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 604 cuugccagca cauauauuag ccc 23 <210> SEQ ID NO 605 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 605 gcuaauauau gugcuggcaa a 21 <210> SEQ ID NO 606 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 606 uuugccagca cauauauuag ccc 23 <210> SEQ ID NO 607 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 607 cauggcugug gacaguacuc u 21 <210> SEQ ID NO 608 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 608 agaguacugu ccacagccau ggc 23 <210> SEQ ID NO 609 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 609 uggcugugga caguacucug c 21 <210> SEQ ID NO 610 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 610 gcagaguacu guccacagcc aug 23 <210> SEQ ID NO 611 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 611 uggcugugga caguacucug a 21 <210> SEQ ID NO 612 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 612 ucagaguacu guccacagcc aug 23 <210> SEQ ID NO 613 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 613 ggcuguggac aguacucugc u 21 <210> SEQ ID NO 614 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 614 agcagaguac uguccacagc cau 23 <210> SEQ ID NO 615 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 615 gcuguggaca guacucugcu c 21 <210> SEQ ID NO 616 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 616 gagcagagua cuguccacag cca 23 <210> SEQ ID NO 617 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 617 gcuguggaca guacucugcu a 21 <210> SEQ ID NO 618 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 618 uagcagagua cuguccacag cca 23 <210> SEQ ID NO 619 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 619 cuguggacag uacucugcuc a 21 <210> SEQ ID NO 620 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 620 ugagcagagu acuguccaca gcc 23 <210> SEQ ID NO 621 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 621 uguggacagu acucugcuca a 21 <210> SEQ ID NO 622 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 622 uugagcagag uacuguccac agc 23 <210> SEQ ID NO 623 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 623 guggacagua cucugcucaa a 21 <210> SEQ ID NO 624 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 624 uuugagcaga guacugucca cag 23 <210> SEQ ID NO 625 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 625 uggacaguac ucugcucaaa g 21 <210> SEQ ID NO 626 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 626 cuuugagcag aguacugucc aca 23 <210> SEQ ID NO 627 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 627 uggacaguac ucugcucaaa u 21 <210> SEQ ID NO 628 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 628 auuugagcag aguacugucc aca 23 <210> SEQ ID NO 629 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 629 ggacaguacu cugcucaaag a 21 <210> SEQ ID NO 630 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 630 ucuuugagca gaguacuguc cac 23 <210> SEQ ID NO 631 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 631 gacaguacuc ugcucaaaga a 21 <210> SEQ ID NO 632 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 632 uucuuugagc agaguacugu cca 23 <210> SEQ ID NO 633 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 633 ugugggccag gagaaaccuu a 21 <210> SEQ ID NO 634 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 634 uaagguuucu ccuggcccac aau 23 <210> SEQ ID NO 635 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 635 ccaggagaaa ccuuaucaaa a 21 <210> SEQ ID NO 636 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 636 uuuugauaag guuucuccug gcc 23 <210> SEQ ID NO 637 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 637 uguucuacau uaagccaauu a 21 <210> SEQ ID NO 638 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 638 uaauuggcuu aauguagaac auu 23 <210> SEQ ID NO 639 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 639 guucuacauu aagccaauua a 21 <210> SEQ ID NO 640 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 640 uuaauuggcu uaauguagaa cau 23 <210> SEQ ID NO 641 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 641 uucuacauua agccaauuaa g 21 <210> SEQ ID NO 642 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 642 cuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 643 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 643 uucuacauua agccaauuaa a 21 <210> SEQ ID NO 644 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 644 uuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 645 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 645 ucuacauuaa gccaauuaag u 21 <210> SEQ ID NO 646 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 646 acuuaauugg cuuaauguag aac 23 <210> SEQ ID NO 647 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 647 cuacauuaag ccaauuaagu a 21 <210> SEQ ID NO 648 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 648 uacuuaauug gcuuaaugua gaa 23 <210> SEQ ID NO 649 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 649 uacauuaagc caauuaagua u 21 <210> SEQ ID NO 650 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 650 auacuuaauu ggcuuaaugu aga 23 <210> SEQ ID NO 651 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 651 acauuaagcc aauuaaguau a 21 <210> SEQ ID NO 652 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 652 uauacuuaau uggcuuaaug uag 23 <210> SEQ ID NO 653 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 653 cauuaagcca auuaaguaua a 21 <210> SEQ ID NO 654 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 654 uuauacuuaa uuggcuuaau gua 23 <210> SEQ ID NO 655 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 655 auuaagccaa uuaaguauaa a 21 <210> SEQ ID NO 656 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 656 uuuauacuua auuggcuuaa ugu 23 <210> SEQ ID NO 657 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 657 uuaagccaau uaaguauaaa g 21 <210> SEQ ID NO 658 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 658 cuuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 659 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 659 uuaagccaau uaaguauaaa u 21 <210> SEQ ID NO 660 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 660 auuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 661 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 661 uaagccaauu aaguauaaag g 21 <210> SEQ ID NO 662 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 662 ccuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 663 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 663 uaagccaauu aaguauaaag a 21 <210> SEQ ID NO 664 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 664 ucuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 665 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 665 aagccaauua aguauaaagg u 21 <210> SEQ ID NO 666 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 666 accuuuauac uuaauuggcu uaa 23 <210> SEQ ID NO 667 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 667 agccaauuaa guauaaaggu c 21 <210> SEQ ID NO 668 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 668 gaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 669 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 669 agccaauuaa guauaaaggu a 21 <210> SEQ ID NO 670 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 670 uaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 671 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 671 gcccuugcag aaaguuuauc c 21 <210> SEQ ID NO 672 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 672 ggauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 673 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 673 gcccuugcag aaaguuuauc a 21 <210> SEQ ID NO 674 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 674 ugauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 675 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 675 cccuugcaga aaguuuaucc u 21 <210> SEQ ID NO 676 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 676 aggauaaacu uucugcaagg gca 23 <210> SEQ ID NO 677 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 677 ccaaugguca gaucuucaaa a 21 <210> SEQ ID NO 678 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 678 uuuugaagau cugaccauug gcc 23 <210> SEQ ID NO 679 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 679 caauggucag aucuucaaaa u 21 <210> SEQ ID NO 680 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 680 auuuugaaga ucugaccauu ggc 23 <210> SEQ ID NO 681 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 681 aauggucaga ucuucaaaau a 21 <210> SEQ ID NO 682 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 682 uauuuugaag aucugaccau ugg 23 <210> SEQ ID NO 683 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 683 uggucagauc uucaaaauaa a 21 <210> SEQ ID NO 684 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 684 uuuauuuuga agaucugacc auu 23 <210> SEQ ID NO 685 <211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic peptide" <400> SEQUENCE: 685 Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro 1 5 10 15 <210> SEQ ID NO 686 <211> LENGTH: 11 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic peptide" <400> SEQUENCE: 686 Ala Ala Leu Leu Pro Val Leu Leu Ala Ala Pro 1 5 10 <210> SEQ ID NO 687 <211> LENGTH: 13 <212> TYPE: PRT <213> ORGANISM: Human immunodeficiency virus <400> SEQUENCE: 687 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln 1 5 10 <210> SEQ ID NO 688 <211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Drosophila sp. <400> SEQUENCE: 688 Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys 1 5 10 15 <210> SEQ ID NO 689 <400> SEQUENCE: 689 000 <210> SEQ ID NO 690 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 690 gaauauuaga acuugacuut t 21 <210> SEQ ID NO 691 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 691 aagucaaguu cuaauauuct t 21 <210> SEQ ID NO 692 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 692 aacuugacuu gcuccaucct t 21 <210> SEQ ID NO 693 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 693 ggauggagca agucaaguut t 21 <210> SEQ ID NO 694 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 694 ccauccucuu aaacuuuuut t 21 <210> SEQ ID NO 695 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 695 aaaaaguuua agaggauggt t 21 <210> SEQ ID NO 696 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 696 uaaacuuuuu gugucucact t 21 <210> SEQ ID NO 697 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 697 gugagacaca aaaaguuuat t 21 <210> SEQ ID NO 698 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 698 gucucacacu aaagaaaugt t 21 <210> SEQ ID NO 699 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 699 cauuucuuua gugugagact t 21 <210> SEQ ID NO 700 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 700 aaagaaauga gagaugcagt t 21 <210> SEQ ID NO 701 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 701 cugcaucucu cauuucuuut t 21 <210> SEQ ID NO 702 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 702 augcagaauu cuaaggcuat t 21 <210> SEQ ID NO 703 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 703 uagccuuaga auucugcaut t 21 <210> SEQ ID NO 704 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 704 ucuaaggcua aauagcuagt t 21 <210> SEQ ID NO 705 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 705 cuagcuauuu agccuuagat t 21 <210> SEQ ID NO 706 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 706 auagcuagga aguauucaut t 21 <210> SEQ ID NO 707 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 707 augaauacuu ccuagcuaut t 21 <210> SEQ ID NO 708 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 708 auucauucaa acuugaauat t 21 <210> SEQ ID NO 709 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 709 uauucaaguu ugaaugaaut t 21 <210> SEQ ID NO 710 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 710 cuugaauauu cuucaaagat t 21 <210> SEQ ID NO 711 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 711 ucuuugaaga auauucaagt t 21 <210> SEQ ID NO 712 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 712 cuucaaagag aguguggggt t 21 <210> SEQ ID NO 713 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 713 ccccacacuc ucuuugaagt t 21 <210> SEQ ID NO 714 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 714 gugugggggc aacucuaaut t 21 <210> SEQ ID NO 715 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 715 auuagaguug cccccacact t 21 <210> SEQ ID NO 716 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 716 aacucuaauc agaggaagat t 21 <210> SEQ ID NO 717 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 717 ucuuccucug auuagaguut t 21 <210> SEQ ID NO 718 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 718 aggaagaaac uaaaggaagt t 21 <210> SEQ ID NO 719 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 719 cuuccuuuag uuucuuccut t 21 <210> SEQ ID NO 720 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 720 uaaaggaagu aaaaccagat t 21 <210> SEQ ID NO 721 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 721 ucugguuuua cuuccuuuat t 21 <210> SEQ ID NO 722 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 722 aaaccagaug uuuuccacct t 21 <210> SEQ ID NO 723 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 723 gguggaaaac aucugguuut t 21 <210> SEQ ID NO 724 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 724 uccaccaaag cccuccuuut t 21 <210> SEQ ID NO 725 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 725 aaaggagggc uuugguggat t 21 <210> SEQ ID NO 726 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 726 ccuccuuuug gcuggucugt t 21 <210> SEQ ID NO 727 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 727 cagaccagcc aaaaggaggt t 21 <210> SEQ ID NO 728 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 728 ggcuggucug auuucuacct t 21 <210> SEQ ID NO 729 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 729 gguagaaauc agaccagcct t 21 <210> SEQ ID NO 730 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 730 uuucuaccgc acuggcaggt t 21 <210> SEQ ID NO 731 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 731 ccugccagug cgguagaaat t 21 <210> SEQ ID NO 732 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 732 ggcagggcca ugggcuaaut t 21 <210> SEQ ID NO 733 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 733 auuagcccau ggcccugcct t 21 <210> SEQ ID NO 734 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 734 gggcuaauau augugcuggt t 21 <210> SEQ ID NO 735 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 735 ccagcacaua uauuagccct t 21 <210> SEQ ID NO 736 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 736 augugcuggc aagucuucct t 21 <210> SEQ ID NO 737 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 737 ggaagacuug ccagcacaut t 21 <210> SEQ ID NO 738 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 738 aagucuucca augagaucct t 21 <210> SEQ ID NO 739 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 739 ggaucucauu ggaagacuut t 21 <210> SEQ ID NO 740 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 740 agauccggac gugugaccgt t 21 <210> SEQ ID NO 741 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 741 cggucacacg uccggaucut t 21 <210> SEQ ID NO 742 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 742 gugugaccgc cauggcugut t 21 <210> SEQ ID NO 743 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 743 acagccaugg cggucacact t 21 <210> SEQ ID NO 744 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 744 auggcugugg acaguacuct t 21 <210> SEQ ID NO 745 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 745 gaguacuguc cacagccaut t 21 <210> SEQ ID NO 746 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 746 aguacucugc ucaaagaagt t 21 <210> SEQ ID NO 747 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 747 cuucuuugag cagaguacut t 21 <210> SEQ ID NO 748 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 748 caaagaaguc agaggccuct t 21 <210> SEQ ID NO 749 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 749 gaggccucug acuucuuugt t 21 <210> SEQ ID NO 750 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 750 cagaggccuc accagggugt t 21 <210> SEQ ID NO 751 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 751 cacccuggug aggccucugt t 21 <210> SEQ ID NO 752 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 752 ccagggugug gacaucuugt t 21 <210> SEQ ID NO 753 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 753 caagaugucc acacccuggt t 21 <210> SEQ ID NO 754 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 754 acaucuugug cucugcuggt t 21 <210> SEQ ID NO 755 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 755 ccagcagagc acaagaugut t 21 <210> SEQ ID NO 756 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 756 cugcuggauc uacuguguat t 21 <210> SEQ ID NO 757 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 757 uacacaguag auccagcagt t 21 <210> SEQ ID NO 758 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 758 cuguguacgc accauucact t 21 <210> SEQ ID NO 759 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 759 gugaauggug cguacacagt t 21 <210> SEQ ID NO 760 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 760 ccauucacug gaaugauugt t 21 <210> SEQ ID NO 761 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 761 caaucauucc agugaauggt t 21 <210> SEQ ID NO 762 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 762 aaugauugug ggccaggagt t 21 <210> SEQ ID NO 763 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 763 cuccuggccc acaaucauut t 21 <210> SEQ ID NO 764 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 764 gggccaggag aaaccuuaut t 21 <210> SEQ ID NO 765 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 765 auaagguuuc uccuggccct t 21 <210> SEQ ID NO 766 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 766 ccuuaucaaa acaagaaugt t 21 <210> SEQ ID NO 767 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 767 cauucuuguu uugauaaggt t 21 <210> SEQ ID NO 768 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 768 caagaaugcu aucaauaaut t 21 <210> SEQ ID NO 769 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 769 auuauugaua gcauucuugt t 21 <210> SEQ ID NO 770 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 770 aucaauaaug guguucgaat t 21 <210> SEQ ID NO 771 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 771 uucgaacacc auuauugaut t 21 <210> SEQ ID NO 772 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 772 guucgaauau cuggaagagt t 21 <210> SEQ ID NO 773 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 773 cucuuccaga uauucgaact t 21 <210> SEQ ID NO 774 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 774 ucuggaagag guuuuugugt t 21 <210> SEQ ID NO 775 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 775 cacaaaaacc ucuuccagat t 21 <210> SEQ ID NO 776 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 776 uuuuuguguc aaaauguuct t 21 <210> SEQ ID NO 777 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 777 gaacauuuug acacaaaaat t 21 <210> SEQ ID NO 778 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 778 auguucuaca uuaagccaat t 21 <210> SEQ ID NO 779 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 779 uuggcuuaau guagaacaut t 21 <210> SEQ ID NO 780 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 780 uaagccaauu aaguauaaat t 21 <210> SEQ ID NO 781 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 781 uuuauacuua auuggcuuat t 21 <210> SEQ ID NO 782 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 782 aaguauaaag guccuauuat t 21 <210> SEQ ID NO 783 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 783 uaauaggacc uuuauacuut t 21 <210> SEQ ID NO 784 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 784 ccuauuaaga agggagaaat t 21 <210> SEQ ID NO 785 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 785 uuucucccuu cuuaauaggt t 21 <210> SEQ ID NO 786 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 786 agggagaaaa acuuggaact t 21 <210> SEQ ID NO 787 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 787 guuccaaguu uuucucccut t 21 <210> SEQ ID NO 788 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 788 cuuggaacuc uauugcccut t 21 <210> SEQ ID NO 789 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 789 agggcaauag aguuccaagt t 21 <210> SEQ ID NO 790 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 790 uugcccuugc agaaaguuut t 21 <210> SEQ ID NO 791 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 791 aaacuuucug caagggcaat t 21 <210> SEQ ID NO 792 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 792 agaaaguuua uccuggcaut t 21 <210> SEQ ID NO 793 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 793 augccaggau aaacuuucut t 21 <210> SEQ ID NO 794 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 794 ccuggcauac aaucgcaugt t 21 <210> SEQ ID NO 795 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 795 caugcgauug uaugccaggt t 21 <210> SEQ ID NO 796 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 796 aucgcaugug cacauugaat t 21 <210> SEQ ID NO 797 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 797 uucaaugugc acaugcgaut t 21 <210> SEQ ID NO 798 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 798 cauugaaaac ugugacucgt t 21 <210> SEQ ID NO 799 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 799 cgagucacag uuuucaaugt t 21 <210> SEQ ID NO 800 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 800 gugacucgag ugacccuact t 21 <210> SEQ ID NO 801 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 801 guagggucac ucgagucact t 21 <210> SEQ ID NO 802 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 802 ugacccuacu gcauaccugt t 21 <210> SEQ ID NO 803 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 803 cagguaugca guagggucat t 21 <210> SEQ ID NO 804 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 804 cauaccugua aaucgaaggt t 21 <210> SEQ ID NO 805 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 805 ccuucgauuu acagguaugt t 21 <210> SEQ ID NO 806 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 806 uggucagauc uucaaaauat t 21 <210> SEQ ID NO 807 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 807 uauuuugaag aucugaccat t 21 <210> SEQ ID NO 808 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 808 cuucaaaaua aaaagucaut t 21 <210> SEQ ID NO 809 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 809 augacuuuuu auuuugaagt t 21 <210> SEQ ID NO 810 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 810 aagucaucuu aaaaaccugt t 21 <210> SEQ ID NO 811 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 811 cagguuuuua agaugacuut t 21 <210> SEQ ID NO 812 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 812 aaaaccugga ugcauaccct t 21 <210> SEQ ID NO 813 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 813 ggguaugcau ccagguuuut t 21 <210> SEQ ID NO 814 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 814 gcauacccuu cucuucaagt t 21 <210> SEQ ID NO 815 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 815 cuugaagaga aggguaugct t 21 <210> SEQ ID NO 816 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 816 cuucaagaaa uuuguguuct t 21 <210> SEQ ID NO 817 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 817 gaacacaaau uucuugaagt t 21 <210> SEQ ID NO 818 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 818 uuguguucac aaaggaaaat t 21 <210> SEQ ID NO 819 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 819 uuuuccuuug ugaacacaat t 21 <210> SEQ ID NO 820 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 820 aaggaaaaau gcaugaaggt t 21 <210> SEQ ID NO 821 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 821 ccuucaugca uuuuuccuut t 21 <210> SEQ ID NO 822 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 822 ugcaugaagg gauggauact t 21 <210> SEQ ID NO 823 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 823 guauccaucc cuucaugcat t 21 <210> SEQ ID NO 824 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 824 uggauacccc auuuuccaut t 21 <210> SEQ ID NO 825 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 825 auggaaaaug ggguauccat t 21 <210> SEQ ID NO 826 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 826 uuuccaugac augauuauut t 21 <210> SEQ ID NO 827 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 827 aauaaucaug ucauggaaat t 21 <210> SEQ ID NO 828 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 828 caugauuauu acacauugct t 21 <210> SEQ ID NO 829 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 829 gcaaugugua auaaucaugt t 21 <210> SEQ ID NO 830 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 830 cacauugcau gccuguauct t 21 <210> SEQ ID NO 831 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 831 gauacaggca ugcaaugugt t 21 <210> SEQ ID NO 832 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 832 ccuguaucaa aacaucucat t 21 <210> SEQ ID NO 833 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 833 ugagauguuu ugauacaggt t 21 <210> SEQ ID NO 834 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 834 caucucacgu accucauaat t 21 <210> SEQ ID NO 835 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 835 uuaugaggua cgugagaugt t 21 <210> SEQ ID NO 836 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 836 ccucauaaac auauacacct t 21 <210> SEQ ID NO 837 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 837 gguguauaug uuuaugaggt t 21 <210> SEQ ID NO 838 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 838 auacaccuau guacccacat t 21 <210> SEQ ID NO 839 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 839 uguggguaca uagguguaut t 21 <210> SEQ ID NO 840 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 840 guacccacaa aaauuuuuut t 21 <210> SEQ ID NO 841 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 841 aaaaaauuuu uguggguact t 21 <210> SEQ ID NO 842 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 842 uaaaaaaagg aaauuugagt t 21 <210> SEQ ID NO 843 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 843 cucaaauuuc cuuuuuuuat t 21 <210> SEQ ID NO 844 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 844 aauuugaguu uaaauagaat t 21 <210> SEQ ID NO 845 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 845 uucuauuuaa acucaaauut t 21 <210> SEQ ID NO 846 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 846 auagaaacau gauaaaugct t 21 <210> SEQ ID NO 847 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 847 gcauuuauca uguuucuaut t 21 <210> SEQ ID NO 848 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 848 gauaaaugca agaaagaaat t 21 <210> SEQ ID NO 849 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 849 uuucuuucuu gcauuuauct t 21 <210> SEQ ID NO 850 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 850 gaaagaaaac auuuugauut t 21 <210> SEQ ID NO 851 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 851 aaucaaaaug uuuucuuuct t 21 <210> SEQ ID NO 852 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 852 acucauuguc acucugaugt t 21 <210> SEQ ID NO 853 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 853 caucagagug acaaugagut t 21 <210> SEQ ID NO 854 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 854 cucugauguu caugugaact t 21 <210> SEQ ID NO 855 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 855 guucacauga acaucagagt t 21 <210> SEQ ID NO 856 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 856 caugugaacu gguugcuuct t 21 <210> SEQ ID NO 857 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 857 gaagcaacca guucacaugt t 21 <210> SEQ ID NO 858 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 858 guugcuucgg gcucuuugat t 21 <210> SEQ ID NO 859 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 859 ucaaagagcc cgaagcaact t 21 <210> SEQ ID NO 860 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 860 ucuuugaucu gucaccuaut t 21 <210> SEQ ID NO 861 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 861 auaggugaca gaucaaagat t 21 <210> SEQ ID NO 862 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 862 caccuaugga aucugagugt t 21 <210> SEQ ID NO 863 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 863 cacucagauu ccauaggugt t 21 <210> SEQ ID NO 864 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 864 aaucugagug guuuuauuut t 21 <210> SEQ ID NO 865 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 865 aaauaaaacc acucagauut t 21 <210> SEQ ID NO 866 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 866 uuuuuuagau uucucaguct t 21 <210> SEQ ID NO 867 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 867 gacugagaaa ucuaaaaaat t 21 <210> SEQ ID NO 868 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 868 cucaguccca aagaucuaat t 21 <210> SEQ ID NO 869 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 869 uuagaucuuu gggacugagt t 21 <210> SEQ ID NO 870 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 870 gaucuaagau aaauaaacat t 21 <210> SEQ ID NO 871 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 871 uguuuauuua ucuuagauct t 21 <210> SEQ ID NO 872 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 872 gaauauuaga acuugacuu 19 <210> SEQ ID NO 873 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 873 aagucaaguu cuaauauuc 19 <210> SEQ ID NO 874 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 874 aacuugacuu gcuccaucc 19 <210> SEQ ID NO 875 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 875 ggauggagca agucaaguu 19 <210> SEQ ID NO 876 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 876 ccauccucuu aaacuuuuu 19 <210> SEQ ID NO 877 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 877 aaaaaguuua agaggaugg 19 <210> SEQ ID NO 878 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 878 uaaacuuuuu gugucucac 19 <210> SEQ ID NO 879 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 879 gugagacaca aaaaguuua 19 <210> SEQ ID NO 880 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 880 gucucacacu aaagaaaug 19 <210> SEQ ID NO 881 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 881 cauuucuuua gugugagac 19 <210> SEQ ID NO 882 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 882 aaagaaauga gagaugcag 19 <210> SEQ ID NO 883 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 883 cugcaucucu cauuucuuu 19 <210> SEQ ID NO 884 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 884 augcagaauu cuaaggcua 19 <210> SEQ ID NO 885 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 885 uagccuuaga auucugcau 19 <210> SEQ ID NO 886 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 886 ucuaaggcua aauagcuag 19 <210> SEQ ID NO 887 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 887 cuagcuauuu agccuuaga 19 <210> SEQ ID NO 888 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 888 auagcuagga aguauucau 19 <210> SEQ ID NO 889 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 889 augaauacuu ccuagcuau 19 <210> SEQ ID NO 890 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 890 auucauucaa acuugaaua 19 <210> SEQ ID NO 891 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 891 uauucaaguu ugaaugaau 19 <210> SEQ ID NO 892 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 892 cuugaauauu cuucaaaga 19 <210> SEQ ID NO 893 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 893 ucuuugaaga auauucaag 19 <210> SEQ ID NO 894 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 894 cuucaaagag agugugggg 19 <210> SEQ ID NO 895 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 895 ccccacacuc ucuuugaag 19 <210> SEQ ID NO 896 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 896 gugugggggc aacucuaau 19 <210> SEQ ID NO 897 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 897 auuagaguug cccccacac 19 <210> SEQ ID NO 898 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 898 aacucuaauc agaggaaga 19 <210> SEQ ID NO 899 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 899 ucuuccucug auuagaguu 19 <210> SEQ ID NO 900 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 900 aggaagaaac uaaaggaag 19 <210> SEQ ID NO 901 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 901 cuuccuuuag uuucuuccu 19 <210> SEQ ID NO 902 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 902 uaaaggaagu aaaaccaga 19 <210> SEQ ID NO 903 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 903 ucugguuuua cuuccuuua 19 <210> SEQ ID NO 904 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 904 aaaccagaug uuuuccacc 19 <210> SEQ ID NO 905 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 905 gguggaaaac aucugguuu 19 <210> SEQ ID NO 906 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 906 uccaccaaag cccuccuuu 19 <210> SEQ ID NO 907 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 907 aaaggagggc uuuggugga 19 <210> SEQ ID NO 908 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 908 ccuccuuuug gcuggucug 19 <210> SEQ ID NO 909 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 909 cagaccagcc aaaaggagg 19 <210> SEQ ID NO 910 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 910 ggcuggucug auuucuacc 19 <210> SEQ ID NO 911 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 911 gguagaaauc agaccagcc 19 <210> SEQ ID NO 912 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 912 uuucuaccgc acuggcagg 19 <210> SEQ ID NO 913 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 913 ccugccagug cgguagaaa 19 <210> SEQ ID NO 914 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 914 ggcagggcca ugggcuaau 19 <210> SEQ ID NO 915 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 915 auuagcccau ggcccugcc 19 <210> SEQ ID NO 916 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 916 gggcuaauau augugcugg 19 <210> SEQ ID NO 917 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 917 ccagcacaua uauuagccc 19 <210> SEQ ID NO 918 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 918 augugcuggc aagucuucc 19 <210> SEQ ID NO 919 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 919 ggaagacuug ccagcacau 19 <210> SEQ ID NO 920 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 920 aagucuucca augagaucc 19 <210> SEQ ID NO 921 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 921 ggaucucauu ggaagacuu 19 <210> SEQ ID NO 922 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 922 agauccggac gugugaccg 19 <210> SEQ ID NO 923 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 923 cggucacacg uccggaucu 19 <210> SEQ ID NO 924 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 924 gugugaccgc cauggcugu 19 <210> SEQ ID NO 925 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 925 acagccaugg cggucacac 19 <210> SEQ ID NO 926 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 926 auggcugugg acaguacuc 19 <210> SEQ ID NO 927 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 927 gaguacuguc cacagccau 19 <210> SEQ ID NO 928 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 928 aguacucugc ucaaagaag 19 <210> SEQ ID NO 929 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 929 cuucuuugag cagaguacu 19 <210> SEQ ID NO 930 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 930 caaagaaguc agaggccuc 19 <210> SEQ ID NO 931 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 931 gaggccucug acuucuuug 19 <210> SEQ ID NO 932 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 932 cagaggccuc accagggug 19 <210> SEQ ID NO 933 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 933 cacccuggug aggccucug 19 <210> SEQ ID NO 934 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 934 ccagggugug gacaucuug 19 <210> SEQ ID NO 935 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 935 caagaugucc acacccugg 19 <210> SEQ ID NO 936 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 936 acaucuugug cucugcugg 19 <210> SEQ ID NO 937 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 937 ccagcagagc acaagaugu 19 <210> SEQ ID NO 938 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 938 cugcuggauc uacugugua 19 <210> SEQ ID NO 939 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 939 uacacaguag auccagcag 19 <210> SEQ ID NO 940 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 940 cuguguacgc accauucac 19 <210> SEQ ID NO 941 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 941 gugaauggug cguacacag 19 <210> SEQ ID NO 942 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 942 ccauucacug gaaugauug 19 <210> SEQ ID NO 943 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 943 caaucauucc agugaaugg 19 <210> SEQ ID NO 944 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 944 aaugauugug ggccaggag 19 <210> SEQ ID NO 945 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 945 cuccuggccc acaaucauu 19 <210> SEQ ID NO 946 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 946 gggccaggag aaaccuuau 19 <210> SEQ ID NO 947 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 947 auaagguuuc uccuggccc 19 <210> SEQ ID NO 948 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 948 ccuuaucaaa acaagaaug 19 <210> SEQ ID NO 949 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 949 cauucuuguu uugauaagg 19 <210> SEQ ID NO 950 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 950 caagaaugcu aucaauaau 19 <210> SEQ ID NO 951 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 951 auuauugaua gcauucuug 19 <210> SEQ ID NO 952 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 952 aucaauaaug guguucgaa 19 <210> SEQ ID NO 953 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 953 uucgaacacc auuauugau 19 <210> SEQ ID NO 954 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 954 guucgaauau cuggaagag 19 <210> SEQ ID NO 955 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 955 cucuuccaga uauucgaac 19 <210> SEQ ID NO 956 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 956 ucuggaagag guuuuugug 19 <210> SEQ ID NO 957 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 957 cacaaaaacc ucuuccaga 19 <210> SEQ ID NO 958 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 958 uuuuuguguc aaaauguuc 19 <210> SEQ ID NO 959 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 959 gaacauuuug acacaaaaa 19 <210> SEQ ID NO 960 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 960 auguucuaca uuaagccaa 19 <210> SEQ ID NO 961 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 961 uuggcuuaau guagaacau 19 <210> SEQ ID NO 962 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 962 uaagccaauu aaguauaaa 19 <210> SEQ ID NO 963 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 963 uuuauacuua auuggcuua 19 <210> SEQ ID NO 964 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 964 aaguauaaag guccuauua 19 <210> SEQ ID NO 965 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 965 uaauaggacc uuuauacuu 19 <210> SEQ ID NO 966 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 966 ccuauuaaga agggagaaa 19 <210> SEQ ID NO 967 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 967 uuucucccuu cuuaauagg 19 <210> SEQ ID NO 968 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 968 agggagaaaa acuuggaac 19 <210> SEQ ID NO 969 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 969 guuccaaguu uuucucccu 19 <210> SEQ ID NO 970 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 970 cuuggaacuc uauugcccu 19 <210> SEQ ID NO 971 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 971 agggcaauag aguuccaag 19 <210> SEQ ID NO 972 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 972 uugcccuugc agaaaguuu 19 <210> SEQ ID NO 973 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 973 aaacuuucug caagggcaa 19 <210> SEQ ID NO 974 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 974 agaaaguuua uccuggcau 19 <210> SEQ ID NO 975 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 975 augccaggau aaacuuucu 19 <210> SEQ ID NO 976 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 976 ccuggcauac aaucgcaug 19 <210> SEQ ID NO 977 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 977 caugcgauug uaugccagg 19 <210> SEQ ID NO 978 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 978 aucgcaugug cacauugaa 19 <210> SEQ ID NO 979 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 979 uucaaugugc acaugcgau 19 <210> SEQ ID NO 980 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 980 cauugaaaac ugugacucg 19 <210> SEQ ID NO 981 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 981 cgagucacag uuuucaaug 19 <210> SEQ ID NO 982 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 982 gugacucgag ugacccuac 19 <210> SEQ ID NO 983 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 983 guagggucac ucgagucac 19 <210> SEQ ID NO 984 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 984 ugacccuacu gcauaccug 19 <210> SEQ ID NO 985 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 985 cagguaugca guaggguca 19 <210> SEQ ID NO 986 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 986 cauaccugua aaucgaagg 19 <210> SEQ ID NO 987 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 987 ccuucgauuu acagguaug 19 <210> SEQ ID NO 988 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 988 uggucagauc uucaaaaua 19 <210> SEQ ID NO 989 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 989 uauuuugaag aucugacca 19 <210> SEQ ID NO 990 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 990 cuucaaaaua aaaagucau 19 <210> SEQ ID NO 991 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 991 augacuuuuu auuuugaag 19 <210> SEQ ID NO 992 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 992 aagucaucuu aaaaaccug 19 <210> SEQ ID NO 993 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 993 cagguuuuua agaugacuu 19 <210> SEQ ID NO 994 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 994 aaaaccugga ugcauaccc 19 <210> SEQ ID NO 995 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 995 ggguaugcau ccagguuuu 19 <210> SEQ ID NO 996 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 996 gcauacccuu cucuucaag 19 <210> SEQ ID NO 997 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 997 cuugaagaga aggguaugc 19 <210> SEQ ID NO 998 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 998 cuucaagaaa uuuguguuc 19 <210> SEQ ID NO 999 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 999 gaacacaaau uucuugaag 19 <210> SEQ ID NO 1000 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1000 uuguguucac aaaggaaaa 19 <210> SEQ ID NO 1001 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1001 uuuuccuuug ugaacacaa 19 <210> SEQ ID NO 1002 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1002 aaggaaaaau gcaugaagg 19 <210> SEQ ID NO 1003 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1003 ccuucaugca uuuuuccuu 19 <210> SEQ ID NO 1004 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1004 ugcaugaagg gauggauac 19 <210> SEQ ID NO 1005 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1005 guauccaucc cuucaugca 19 <210> SEQ ID NO 1006 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1006 uggauacccc auuuuccau 19 <210> SEQ ID NO 1007 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1007 auggaaaaug ggguaucca 19 <210> SEQ ID NO 1008 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1008 uuuccaugac augauuauu 19 <210> SEQ ID NO 1009 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1009 aauaaucaug ucauggaaa 19 <210> SEQ ID NO 1010 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1010 caugauuauu acacauugc 19 <210> SEQ ID NO 1011 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1011 gcaaugugua auaaucaug 19 <210> SEQ ID NO 1012 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1012 cacauugcau gccuguauc 19 <210> SEQ ID NO 1013 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1013 gauacaggca ugcaaugug 19 <210> SEQ ID NO 1014 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1014 ccuguaucaa aacaucuca 19 <210> SEQ ID NO 1015 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1015 ugagauguuu ugauacagg 19 <210> SEQ ID NO 1016 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1016 caucucacgu accucauaa 19 <210> SEQ ID NO 1017 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1017 uuaugaggua cgugagaug 19 <210> SEQ ID NO 1018 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1018 ccucauaaac auauacacc 19 <210> SEQ ID NO 1019 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1019 gguguauaug uuuaugagg 19 <210> SEQ ID NO 1020 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1020 auacaccuau guacccaca 19 <210> SEQ ID NO 1021 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1021 uguggguaca uagguguau 19 <210> SEQ ID NO 1022 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1022 guacccacaa aaauuuuuu 19 <210> SEQ ID NO 1023 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1023 aaaaaauuuu uguggguac 19 <210> SEQ ID NO 1024 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1024 uaaaaaaagg aaauuugag 19 <210> SEQ ID NO 1025 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1025 cucaaauuuc cuuuuuuua 19 <210> SEQ ID NO 1026 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1026 aauuugaguu uaaauagaa 19 <210> SEQ ID NO 1027 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1027 uucuauuuaa acucaaauu 19 <210> SEQ ID NO 1028 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1028 auagaaacau gauaaaugc 19 <210> SEQ ID NO 1029 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1029 gcauuuauca uguuucuau 19 <210> SEQ ID NO 1030 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1030 gauaaaugca agaaagaaa 19 <210> SEQ ID NO 1031 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1031 uuucuuucuu gcauuuauc 19 <210> SEQ ID NO 1032 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1032 gaaagaaaac auuuugauu 19 <210> SEQ ID NO 1033 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1033 aaucaaaaug uuuucuuuc 19 <210> SEQ ID NO 1034 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1034 acucauuguc acucugaug 19 <210> SEQ ID NO 1035 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1035 caucagagug acaaugagu 19 <210> SEQ ID NO 1036 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1036 cucugauguu caugugaac 19 <210> SEQ ID NO 1037 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1037 guucacauga acaucagag 19 <210> SEQ ID NO 1038 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1038 caugugaacu gguugcuuc 19 <210> SEQ ID NO 1039 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1039 gaagcaacca guucacaug 19 <210> SEQ ID NO 1040 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1040 guugcuucgg gcucuuuga 19 <210> SEQ ID NO 1041 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1041 ucaaagagcc cgaagcaac 19 <210> SEQ ID NO 1042 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1042 ucuuugaucu gucaccuau 19 <210> SEQ ID NO 1043 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1043 auaggugaca gaucaaaga 19 <210> SEQ ID NO 1044 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1044 caccuaugga aucugagug 19 <210> SEQ ID NO 1045 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1045 cacucagauu ccauaggug 19 <210> SEQ ID NO 1046 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1046 aaucugagug guuuuauuu 19 <210> SEQ ID NO 1047 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1047 aaauaaaacc acucagauu 19 <210> SEQ ID NO 1048 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1048 uuuuuuagau uucucaguc 19 <210> SEQ ID NO 1049 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1049 gacugagaaa ucuaaaaaa 19 <210> SEQ ID NO 1050 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1050 cucaguccca aagaucuaa 19 <210> SEQ ID NO 1051 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1051 uuagaucuuu gggacugag 19 <210> SEQ ID NO 1052 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1052 gaucuaagau aaauaaaca 19 <210> SEQ ID NO 1053 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1053 uguuuauuua ucuuagauc 19

1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 1053 <210> SEQ ID NO 1 <211> LENGTH: 1077 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 1 aaatcaaata gctatccatg gaatattaga acttgacttg ctccatcctc ttaaactttt 60 tgtgtctcac actaaagaaa tgagagatgc agaattctaa ggctaaatag ctaggaagta 120 ttcattcaaa cttgaatatt cttcaaagag agtgtggggg caactctaat cagaggaaga 180 aactaaagga agtaaaacca gatgttttcc accaaagccc tccttttggc tggtctgatt 240 tctaccgcac tggcagggcc atgggctaat atatgtgctg gcaagtcttc caatgagatc 300 cggacgtgtg accgccatgg ctgtggacag tactctgctc aaagaagtca gaggcctcac 360 cagggtgtgg acatcttgtg ctctgctgga tctactgtgt acgcaccatt cactggaatg 420 attgtgggcc aggagaaacc ttatcaaaac aagaatgcta tcaataatgg tgttcgaata 480 tctggaagag gtttttgtgt caaaatgttc tacattaagc caattaagta taaaggtcct 540 attaagaagg gagaaaaact tggaactcta ttgcccttgc agaaagttta tcctggcata 600 caatcgcatg tgcacattga aaactgtgac tcgagtgacc ctactgcata cctgtaaatc 660 gaaggccaat ggtcagatct tcaaaataaa aagtcatctt aaaaacctgg atgcataccc 720 ttctcttcaa gaaatttgtg ttcacaaagg aaaaatgcat gaagggatgg ataccccatt 780 ttccatgaca tgattattac acattgcatg cctgtatcaa aacatctcac gtacctcata 840 aacatataca cctatgtacc cacaaaaatt ttttaattaa aaaaaggaaa tttgagttta 900 aatagaaaca tgataaatgc aagaaagaaa acattttgat tttaactcat tgtcactctg 960 atgttcatgt gaactggttg cttcgggctc tttgatctgt cacctatgga atctgagtgg 1020 ttttattttt tagatttctc agtcccaaag atctaagata aataaacaag agaactt 1077 <210> SEQ ID NO 2 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 2 aaaucaaaua gcuauccau 19 <210> SEQ ID NO 3 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 3 auggauagcu auuugauuu 19 <210> SEQ ID NO 4 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 4 aauagcuauc cauggaaua 19 <210> SEQ ID NO 5 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 5 uauuccaugg auagcuauu 19 <210> SEQ ID NO 6 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 6 uauccaugga auauuagaa 19 <210> SEQ ID NO 7 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 7 uucuaauauu ccauggaua 19 <210> SEQ ID NO 8 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 8 auggaauauu agaacuuga 19 <210> SEQ ID NO 9 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 9 ucaaguucua auauuccau 19 <210> SEQ ID NO 10 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 10 gaauauuaga acuugacuu 19 <210> SEQ ID NO 11 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 11 aagucaaguu cuaauauuc 19 <210> SEQ ID NO 12 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 12 agaacuugac uugcuccau 19 <210> SEQ ID NO 13 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 13 auggagcaag ucaaguucu 19 <210> SEQ ID NO 14 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 14 gaacuugacu ugcuccauc 19 <210> SEQ ID NO 15 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 15 gauggagcaa gucaaguuc 19 <210> SEQ ID NO 16 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 16 ugacuugcuc cauccucuu 19 <210> SEQ ID NO 17 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 17 aagaggaugg agcaaguca 19 <210> SEQ ID NO 18 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 18 ccauccucuu aaacuuuuu 19 <210> SEQ ID NO 19 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 19 aaaaaguuua agaggaugg 19 <210> SEQ ID NO 20 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 20 ccucuuaaac uuuuugugu 19 <210> SEQ ID NO 21 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 21 acacaaaaag uuuaagagg 19 <210> SEQ ID NO 22 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 22 ucuuaaacuu uuugugucu 19 <210> SEQ ID NO 23 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 23 agacacaaaa aguuuaaga 19 <210> SEQ ID NO 24 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 24 cuuuuugugu cucacacua 19 <210> SEQ ID NO 25 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 25 uagugugaga cacaaaaag 19 <210> SEQ ID NO 26 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 26 gugucucaca cuaaagaaa 19 <210> SEQ ID NO 27 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 27 uuucuuuagu gugagacac 19 <210> SEQ ID NO 28 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 28 ucacacuaaa gaaaugaga 19 <210> SEQ ID NO 29 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 29 ucucauuucu uuaguguga 19 <210> SEQ ID NO 30 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 30 acacuaaaga aaugagaga 19 <210> SEQ ID NO 31 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 31 ucucucauuu cuuuagugu 19 <210> SEQ ID NO 32 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 32 agaaaugaga gaugcagaa 19 <210> SEQ ID NO 33 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 33 uucugcaucu cucauuucu 19 <210> SEQ ID NO 34 <211> LENGTH: 19 <212> TYPE: RNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 34 gagagaugca gaauucuaa 19 <210> SEQ ID NO 35 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 35 uuagaauucu gcaucucuc 19 <210> SEQ ID NO 36 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 36 augcagaauu cuaaggcua 19 <210> SEQ ID NO 37 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 37 uagccuuaga auucugcau 19 <210> SEQ ID NO 38 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 38 gaauucuaag gcuaaauag 19 <210> SEQ ID NO 39 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 39 cuauuuagcc uuagaauuc 19 <210> SEQ ID NO 40 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 40 uucuaaggcu aaauagcua 19 <210> SEQ ID NO 41 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 41 uagcuauuua gccuuagaa 19 <210> SEQ ID NO 42 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 42 cuaaauagcu aggaaguau 19 <210> SEQ ID NO 43 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 43 auacuuccua gcuauuuag 19 <210> SEQ ID NO 44 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 44 auagcuagga aguauucau 19 <210> SEQ ID NO 45 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 45 augaauacuu ccuagcuau 19 <210> SEQ ID NO 46 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 46 ggaaguauuc auucaaacu 19 <210> SEQ ID NO 47 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 47 aguuugaaug aauacuucc 19 <210> SEQ ID NO 48 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 48 cauucaaacu ugaauauuc 19 <210> SEQ ID NO 49 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 49 gaauauucaa guuugaaug 19 <210> SEQ ID NO 50 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 50 cuugaauauu cuucaaaga 19 <210> SEQ ID NO 51 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 51 ucuuugaaga auauucaag 19 <210> SEQ ID NO 52 <211> LENGTH: 19

<212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 52 cuucaaagag agugugggg 19 <210> SEQ ID NO 53 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 53 ccccacacuc ucuuugaag 19 <210> SEQ ID NO 54 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 54 caaagagagu gugggggca 19 <210> SEQ ID NO 55 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 55 ugcccccaca cucucuuug 19 <210> SEQ ID NO 56 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 56 gugugggggc aacucuaau 19 <210> SEQ ID NO 57 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 57 auuagaguug cccccacac 19 <210> SEQ ID NO 58 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 58 gggggcaacu cuaaucaga 19 <210> SEQ ID NO 59 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 59 ucugauuaga guugccccc 19 <210> SEQ ID NO 60 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 60 aacucuaauc agaggaaga 19 <210> SEQ ID NO 61 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 61 ucuuccucug auuagaguu 19 <210> SEQ ID NO 62 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 62 aaucagagga agaaacuaa 19 <210> SEQ ID NO 63 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 63 uuaguuucuu ccucugauu 19 <210> SEQ ID NO 64 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 64 aucagaggaa gaaacuaaa 19 <210> SEQ ID NO 65 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 65 uuuaguuucu uccucugau 19 <210> SEQ ID NO 66 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 66 agaaacuaaa ggaaguaaa 19 <210> SEQ ID NO 67 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 67 uuuacuuccu uuaguuucu 19 <210> SEQ ID NO 68 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 68 gaaacuaaag gaaguaaaa 19 <210> SEQ ID NO 69 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 69 uuuuacuucc uuuaguuuc 19 <210> SEQ ID NO 70

<211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 70 uaaaggaagu aaaaccaga 19 <210> SEQ ID NO 71 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 71 ucugguuuua cuuccuuua 19 <210> SEQ ID NO 72 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 72 aaguaaaacc agauguuuu 19 <210> SEQ ID NO 73 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 73 aaaacaucug guuuuacuu 19 <210> SEQ ID NO 74 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 74 ccagauguuu uccaccaaa 19 <210> SEQ ID NO 75 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 75 uuugguggaa aacaucugg 19 <210> SEQ ID NO 76 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 76 cagauguuuu ccaccaaag 19 <210> SEQ ID NO 77 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 77 cuuuggugga aaacaucug 19 <210> SEQ ID NO 78 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 78 uccaccaaag cccuccuuu 19 <210> SEQ ID NO 79 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 79 aaaggagggc uuuggugga 19 <210> SEQ ID NO 80 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 80 ccaccaaagc ccuccuuuu 19 <210> SEQ ID NO 81 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 81 aaaaggaggg cuuuggugg 19 <210> SEQ ID NO 82 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 82 cccuccuuuu ggcuggucu 19 <210> SEQ ID NO 83 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 83 agaccagcca aaaggaggg 19 <210> SEQ ID NO 84 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 84 ggcuggucug auuucuacc 19 <210> SEQ ID NO 85 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 85 gguagaaauc agaccagcc 19 <210> SEQ ID NO 86 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 86 ggucugauuu cuaccgcac 19 <210> SEQ ID NO 87 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 87 gugcgguaga aaucagacc 19

<210> SEQ ID NO 88 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 88 gauuucuacc gcacuggca 19 <210> SEQ ID NO 89 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 89 ugccagugcg guagaaauc 19 <210> SEQ ID NO 90 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 90 uaccgcacug gcagggcca 19 <210> SEQ ID NO 91 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 91 uggcccugcc agugcggua 19 <210> SEQ ID NO 92 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 92 ccgcacuggc agggccaug 19 <210> SEQ ID NO 93 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 93 cauggcccug ccagugcgg 19 <210> SEQ ID NO 94 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 94 ggcagggcca ugggcuaau 19 <210> SEQ ID NO 95 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 95 auuagcccau ggcccugcc 19 <210> SEQ ID NO 96 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 96 gccaugggcu aauauaugu 19 <210> SEQ ID NO 97 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 97 acauauauua gcccauggc 19 <210> SEQ ID NO 98 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 98 ccaugggcua auauaugug 19 <210> SEQ ID NO 99 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 99 cacauauauu agcccaugg 19 <210> SEQ ID NO 100 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 100 cuaauauaug ugcuggcaa 19 <210> SEQ ID NO 101 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 101 uugccagcac auauauuag 19 <210> SEQ ID NO 102 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 102 auaugugcug gcaagucuu 19 <210> SEQ ID NO 103 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 103 aagacuugcc agcacauau 19 <210> SEQ ID NO 104 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 104 cuggcaaguc uuccaauga 19 <210> SEQ ID NO 105 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 105 ucauuggaag acuugccag 19

<210> SEQ ID NO 106 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 106 gcaagucuuc caaugagau 19 <210> SEQ ID NO 107 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 107 aucucauugg aagacuugc 19 <210> SEQ ID NO 108 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 108 ucuuccaaug agauccgga 19 <210> SEQ ID NO 109 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 109 uccggaucuc auuggaaga 19 <210> SEQ ID NO 110 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 110 augagauccg gacguguga 19 <210> SEQ ID NO 111 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 111 ucacacgucc ggaucucau 19 <210> SEQ ID NO 112 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 112 gauccggacg ugugaccgc 19 <210> SEQ ID NO 113 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 113 gcggucacac guccggauc 19 <210> SEQ ID NO 114 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 114 cggacgugug accgccaug 19 <210> SEQ ID NO 115 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 115 cauggcgguc acacguccg 19 <210> SEQ ID NO 116 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 116 acgugugacc gccauggcu 19 <210> SEQ ID NO 117 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 117 agccauggcg gucacacgu 19 <210> SEQ ID NO 118 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 118 ccgccauggc uguggacag 19 <210> SEQ ID NO 119 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 119 cuguccacag ccauggcgg 19 <210> SEQ ID NO 120 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 120 ccauggcugu ggacaguac 19 <210> SEQ ID NO 121 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 121 guacugucca cagccaugg 19 <210> SEQ ID NO 122 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 122 ggcuguggac aguacucug 19 <210> SEQ ID NO 123 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 123 cagaguacug uccacagcc 19

<210> SEQ ID NO 124 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 124 guacucugcu caaagaagu 19 <210> SEQ ID NO 125 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 125 acuucuuuga gcagaguac 19 <210> SEQ ID NO 126 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 126 ucugcucaaa gaagucaga 19 <210> SEQ ID NO 127 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 127 ucugacuucu uugagcaga 19 <210> SEQ ID NO 128 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 128 caaagaaguc agaggccuc 19 <210> SEQ ID NO 129 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 129 gaggccucug acuucuuug 19 <210> SEQ ID NO 130 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 130 aagucagagg ccucaccag 19 <210> SEQ ID NO 131 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 131 cuggugaggc cucugacuu 19 <210> SEQ ID NO 132 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 132 gaggccucac cagggugug 19 <210> SEQ ID NO 133 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 133 cacacccugg ugaggccuc 19 <210> SEQ ID NO 134 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 134 gccucaccag gguguggac 19 <210> SEQ ID NO 135 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 135 guccacaccc uggugaggc 19 <210> SEQ ID NO 136 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 136 ccagggugug gacaucuug 19 <210> SEQ ID NO 137 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 137 caagaugucc acacccugg 19 <210> SEQ ID NO 138 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 138 gguguggaca ucuugugcu 19 <210> SEQ ID NO 139 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 139 agcacaagau guccacacc 19 <210> SEQ ID NO 140 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 140 acaucuugug cucugcugg 19 <210> SEQ ID NO 141 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 141

ccagcagagc acaagaugu 19 <210> SEQ ID NO 142 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 142 gugcucugcu ggaucuacu 19 <210> SEQ ID NO 143 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 143 aguagaucca gcagagcac 19 <210> SEQ ID NO 144 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 144 cugcuggauc uacugugua 19 <210> SEQ ID NO 145 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 145 uacacaguag auccagcag 19 <210> SEQ ID NO 146 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 146 ggaucuacug uguacgcac 19 <210> SEQ ID NO 147 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 147 gugcguacac aguagaucc 19 <210> SEQ ID NO 148 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 148 cuacugugua cgcaccauu 19 <210> SEQ ID NO 149 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 149 aauggugcgu acacaguag 19 <210> SEQ ID NO 150 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 150 cuguguacgc accauucac 19 <210> SEQ ID NO 151 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 151 gugaauggug cguacacag 19 <210> SEQ ID NO 152 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 152 gcaccauuca cuggaauga 19 <210> SEQ ID NO 153 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 153 ucauuccagu gaauggugc 19 <210> SEQ ID NO 154 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 154 ccauucacug gaaugauug 19 <210> SEQ ID NO 155 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 155 caaucauucc agugaaugg 19 <210> SEQ ID NO 156 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 156 cuggaaugau ugugggcca 19 <210> SEQ ID NO 157 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 157 uggcccacaa ucauuccag 19 <210> SEQ ID NO 158 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 158 gaaugauugu gggccagga 19 <210> SEQ ID NO 159 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 159

uccuggccca caaucauuc 19 <210> SEQ ID NO 160 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 160 gauugugggc caggagaaa 19 <210> SEQ ID NO 161 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 161 uuucuccugg cccacaauc 19 <210> SEQ ID NO 162 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 162 gggccaggag aaaccuuau 19 <210> SEQ ID NO 163 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 163 auaagguuuc uccuggccc 19 <210> SEQ ID NO 164 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 164 caggagaaac cuuaucaaa 19 <210> SEQ ID NO 165 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 165 uuugauaagg uuucuccug 19 <210> SEQ ID NO 166 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 166 aaaccuuauc aaaacaaga 19 <210> SEQ ID NO 167 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 167 ucuuguuuug auaagguuu 19 <210> SEQ ID NO 168 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 168 uaucaaaaca agaaugcua 19 <210> SEQ ID NO 169 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 169 uagcauucuu guuuugaua 19 <210> SEQ ID NO 170 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 170 aacaagaaug cuaucaaua 19 <210> SEQ ID NO 171 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 171 uauugauagc auucuuguu 19 <210> SEQ ID NO 172 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 172 caagaaugcu aucaauaau 19 <210> SEQ ID NO 173 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 173 auuauugaua gcauucuug 19 <210> SEQ ID NO 174 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 174 caauaauggu guucgaaua 19 <210> SEQ ID NO 175 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 175 uauucgaaca ccauuauug 19 <210> SEQ ID NO 176 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 176 uaaugguguu cgaauaucu 19 <210> SEQ ID NO 177 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide"

<400> SEQUENCE: 177 agauauucga acaccauua 19 <210> SEQ ID NO 178 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 178 uguucgaaua ucuggaaga 19 <210> SEQ ID NO 179 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 179 ucuuccagau auucgaaca 19 <210> SEQ ID NO 180 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 180 auaucuggaa gagguuuuu 19 <210> SEQ ID NO 181 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 181 aaaaaccucu uccagauau 19 <210> SEQ ID NO 182 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 182 aucuggaaga gguuuuugu 19 <210> SEQ ID NO 183 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 183 acaaaaaccu cuuccagau 19 <210> SEQ ID NO 184 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 184 agagguuuuu gugucaaaa 19 <210> SEQ ID NO 185 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 185 uuuugacaca aaaaccucu 19 <210> SEQ ID NO 186 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 186 gguuuuugug ucaaaaugu 19 <210> SEQ ID NO 187 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 187 acauuuugac acaaaaacc 19 <210> SEQ ID NO 188 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 188 gugucaaaau guucuacau 19 <210> SEQ ID NO 189 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 189 auguagaaca uuuugacac 19 <210> SEQ ID NO 190 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 190 ucaaaauguu cuacauuaa 19 <210> SEQ ID NO 191 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 191 uuaauguaga acauuuuga 19 <210> SEQ ID NO 192 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 192 uguucuacau uaagccaau 19 <210> SEQ ID NO 193 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 193 auuggcuuaa uguagaaca 19 <210> SEQ ID NO 194 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 194 guauaaaggu ccuauuaag 19 <210> SEQ ID NO 195 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide"

<400> SEQUENCE: 195 cuuaauagga ccuuuauac 19 <210> SEQ ID NO 196 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 196 uauaaagguc cuauuaaga 19 <210> SEQ ID NO 197 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 197 ucuuaauagg accuuuaua 19 <210> SEQ ID NO 198 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 198 ccuauuaaga agggagaaa 19 <210> SEQ ID NO 199 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 199 uuucucccuu cuuaauagg 19 <210> SEQ ID NO 200 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 200 cuauuaagaa gggagaaaa 19 <210> SEQ ID NO 201 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 201 uuuucucccu ucuuaauag 19 <210> SEQ ID NO 202 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 202 aagaagggag aaaaacuug 19 <210> SEQ ID NO 203 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 203 caaguuuuuc ucccuucuu 19 <210> SEQ ID NO 204 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 204 agaaaaacuu ggaacucua 19 <210> SEQ ID NO 205 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 205 uagaguucca aguuuuucu 19 <210> SEQ ID NO 206 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 206 aaaacuugga acucuauug 19 <210> SEQ ID NO 207 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 207 caauagaguu ccaaguuuu 19 <210> SEQ ID NO 208 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 208 cuuggaacuc uauugcccu 19 <210> SEQ ID NO 209 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 209 agggcaauag aguuccaag 19 <210> SEQ ID NO 210 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 210 cucuauugcc cuugcagaa 19 <210> SEQ ID NO 211 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 211 uucugcaagg gcaauagag 19 <210> SEQ ID NO 212 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 212 gcccuugcag aaaguuuau 19 <210> SEQ ID NO 213 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence:

Synthetic oligonucleotide" <400> SEQUENCE: 213 auaaacuuuc ugcaagggc 19 <210> SEQ ID NO 214 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 214 cccuugcaga aaguuuauc 19 <210> SEQ ID NO 215 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 215 gauaaacuuu cugcaaggg 19 <210> SEQ ID NO 216 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 216 agaaaguuua uccuggcau 19 <210> SEQ ID NO 217 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 217 augccaggau aaacuuucu 19 <210> SEQ ID NO 218 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 218 aguuuauccu ggcauacaa 19 <210> SEQ ID NO 219 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 219 uuguaugcca ggauaaacu 19 <210> SEQ ID NO 220 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 220 ccuggcauac aaucgcaug 19 <210> SEQ ID NO 221 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 221 caugcgauug uaugccagg 19 <210> SEQ ID NO 222 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 222 auacaaucgc augugcaca 19 <210> SEQ ID NO 223 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 223 ugugcacaug cgauuguau 19 <210> SEQ ID NO 224 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 224 aucgcaugug cacauugaa 19 <210> SEQ ID NO 225 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 225 uucaaugugc acaugcgau 19 <210> SEQ ID NO 226 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 226 gcaugugcac auugaaaac 19 <210> SEQ ID NO 227 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 227 guuuucaaug ugcacaugc 19 <210> SEQ ID NO 228 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 228 ugcacauuga aaacuguga 19 <210> SEQ ID NO 229 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 229 ucacaguuuu caaugugca 19 <210> SEQ ID NO 230 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 230 auugaaaacu gugacucga 19 <210> SEQ ID NO 231 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source

<223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 231 ucgagucaca guuuucaau 19 <210> SEQ ID NO 232 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 232 aaaacuguga cucgaguga 19 <210> SEQ ID NO 233 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 233 ucacucgagu cacaguuuu 19 <210> SEQ ID NO 234 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 234 ugugacucga gugacccua 19 <210> SEQ ID NO 235 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 235 uagggucacu cgagucaca 19 <210> SEQ ID NO 236 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 236 gagugacccu acugcauac 19 <210> SEQ ID NO 237 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 237 guaugcagua gggucacuc 19 <210> SEQ ID NO 238 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 238 gacccuacug cauaccugu 19 <210> SEQ ID NO 239 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 239 acagguaugc aguaggguc 19 <210> SEQ ID NO 240 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 240 ccuacugcau accuguaaa 19 <210> SEQ ID NO 241 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 241 uuuacaggua ugcaguagg 19 <210> SEQ ID NO 242 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 242 cugcauaccu guaaaucga 19 <210> SEQ ID NO 243 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 243 ucgauuuaca gguaugcag 19 <210> SEQ ID NO 244 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 244 ccuguaaauc gaaggccaa 19 <210> SEQ ID NO 245 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 245 uuggccuucg auuuacagg 19 <210> SEQ ID NO 246 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 246 aaucgaaggc caaugguca 19 <210> SEQ ID NO 247 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 247 ugaccauugg ccuucgauu 19 <210> SEQ ID NO 248 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 248 aggccaaugg ucagaucuu 19 <210> SEQ ID NO 249 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:

<221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 249 aagaucugac cauuggccu 19 <210> SEQ ID NO 250 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 250 caauggucag aucuucaaa 19 <210> SEQ ID NO 251 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 251 uuugaagauc ugaccauug 19 <210> SEQ ID NO 252 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 252 cagaucuuca aaauaaaaa 19 <210> SEQ ID NO 253 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 253 uuuuuauuuu gaagaucug 19 <210> SEQ ID NO 254 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 254 auaaaaaguc aucuuaaaa 19 <210> SEQ ID NO 255 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 255 uuuuaagaug acuuuuuau 19 <210> SEQ ID NO 256 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 256 aagucaucuu aaaaaccug 19 <210> SEQ ID NO 257 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 257 cagguuuuua agaugacuu 19 <210> SEQ ID NO 258 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 258 cuuaaaaacc uggaugcau 19 <210> SEQ ID NO 259 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 259 augcauccag guuuuuaag 19 <210> SEQ ID NO 260 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 260 uuaaaaaccu ggaugcaua 19 <210> SEQ ID NO 261 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 261 uaugcaucca gguuuuuaa 19 <210> SEQ ID NO 262 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 262 ccuggaugca uacccuucu 19 <210> SEQ ID NO 263 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 263 agaaggguau gcauccagg 19 <210> SEQ ID NO 264 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 264 ggaugcauac ccuucucuu 19 <210> SEQ ID NO 265 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 265 aagagaaggg uaugcaucc 19 <210> SEQ ID NO 266 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 266 uacccuucuc uucaagaaa 19 <210> SEQ ID NO 267 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 267 uuucuugaag agaagggua 19 <210> SEQ ID NO 268 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 268 ccuucucuuc aagaaauuu 19 <210> SEQ ID NO 269 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 269 aaauuucuug aagagaagg 19 <210> SEQ ID NO 270 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 270 caagaaauuu guguucaca 19 <210> SEQ ID NO 271 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 271 ugugaacaca aauuucuug 19 <210> SEQ ID NO 272 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 272 agaaauuugu guucacaaa 19 <210> SEQ ID NO 273 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 273 uuugugaaca caaauuucu 19 <210> SEQ ID NO 274 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 274 uuguguucac aaaggaaaa 19 <210> SEQ ID NO 275 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 275 uuuuccuuug ugaacacaa 19 <210> SEQ ID NO 276 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 276 cacaaaggaa aaaugcaug 19 <210> SEQ ID NO 277 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 277 caugcauuuu uccuuugug 19 <210> SEQ ID NO 278 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 278 caaaggaaaa augcaugaa 19 <210> SEQ ID NO 279 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 279 uucaugcauu uuuccuuug 19 <210> SEQ ID NO 280 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 280 gaaaaaugca ugaagggau 19 <210> SEQ ID NO 281 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 281 aucccuucau gcauuuuuc 19 <210> SEQ ID NO 282 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 282 augcaugaag ggauggaua 19 <210> SEQ ID NO 283 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 283 uauccauccc uucaugcau 19 <210> SEQ ID NO 284 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 284 agggauggau accccauuu 19 <210> SEQ ID NO 285 <211> LENGTH: 19 <212> TYPE: RNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 285 aaauggggua uccaucccu 19 <210> SEQ ID NO 286 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 286 gggauggaua ccccauuuu 19 <210> SEQ ID NO 287 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 287 aaaauggggu auccauccc 19 <210> SEQ ID NO 288 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 288 accccauuuu ccaugacau 19 <210> SEQ ID NO 289 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 289 augucaugga aaauggggu 19 <210> SEQ ID NO 290 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 290 ccccauuuuc caugacaug 19 <210> SEQ ID NO 291 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 291 caugucaugg aaaaugggg 19 <210> SEQ ID NO 292 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 292 ccaugacaug auuauuaca 19 <210> SEQ ID NO 293 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 293 uguaauaauc augucaugg 19 <210> SEQ ID NO 294 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 294 ugacaugauu auuacacau 19 <210> SEQ ID NO 295 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 295 auguguaaua aucauguca 19 <210> SEQ ID NO 296 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 296 gauuauuaca cauugcaug 19 <210> SEQ ID NO 297 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 297 caugcaaugu guaauaauc 19 <210> SEQ ID NO 298 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 298 uacacauugc augccugua 19 <210> SEQ ID NO 299 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 299 uacaggcaug caaugugua 19 <210> SEQ ID NO 300 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 300 auugcaugcc uguaucaaa 19 <210> SEQ ID NO 301 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 301 uuugauacag gcaugcaau 19 <210> SEQ ID NO 302 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 302 uugcaugccu guaucaaaa 19 <210> SEQ ID NO 303 <211> LENGTH: 19

<212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 303 uuuugauaca ggcaugcaa 19 <210> SEQ ID NO 304 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 304 uaucaaaaca ucucacgua 19 <210> SEQ ID NO 305 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 305 uacgugagau guuuugaua 19 <210> SEQ ID NO 306 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 306 caucucacgu accucauaa 19 <210> SEQ ID NO 307 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 307 uuaugaggua cgugagaug 19 <210> SEQ ID NO 308 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 308 cacguaccuc auaaacaua 19 <210> SEQ ID NO 309 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 309 uauguuuaug agguacgug 19 <210> SEQ ID NO 310 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 310 cguaccucau aaacauaua 19 <210> SEQ ID NO 311 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 311 uauauguuua ugagguacg 19 <210> SEQ ID NO 312 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 312 aaacauauac accuaugua 19 <210> SEQ ID NO 313 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 313 uacauaggug uauauguuu 19 <210> SEQ ID NO 314 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 314 acaccuaugu acccacaaa 19 <210> SEQ ID NO 315 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 315 uuugugggua cauaggugu 19 <210> SEQ ID NO 316 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 316 caccuaugua cccacaaaa 19 <210> SEQ ID NO 317 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 317 uuuugugggu acauaggug 19 <210> SEQ ID NO 318 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 318 acccacaaaa auuuuuuaa 19 <210> SEQ ID NO 319 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 319 uuaaaaaauu uuugugggu 19 <210> SEQ ID NO 320 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 320 caaaaauuuu uuaauuaaa 19 <210> SEQ ID NO 321

<211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 321 uuuaauuaaa aaauuuuug 19 <210> SEQ ID NO 322 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 322 uuuaauuaaa aaaaggaaa 19 <210> SEQ ID NO 323 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 323 uuuccuuuuu uuaauuaaa 19 <210> SEQ ID NO 324 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 324 uuaaaaaaag gaaauuuga 19 <210> SEQ ID NO 325 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 325 ucaaauuucc uuuuuuuaa 19 <210> SEQ ID NO 326 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 326 aaaggaaauu ugaguuuaa 19 <210> SEQ ID NO 327 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 327 uuaaacucaa auuuccuuu 19 <210> SEQ ID NO 328 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 328 ggaaauuuga guuuaaaua 19 <210> SEQ ID NO 329 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 329 uauuuaaacu caaauuucc 19 <210> SEQ ID NO 330 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 330 aauuugaguu uaaauagaa 19 <210> SEQ ID NO 331 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 331 uucuauuuaa acucaaauu 19 <210> SEQ ID NO 332 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 332 aguuuaaaua gaaacauga 19 <210> SEQ ID NO 333 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 333 ucauguuucu auuuaaacu 19 <210> SEQ ID NO 334 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 334 uaaauagaaa caugauaaa 19 <210> SEQ ID NO 335 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 335 uuuaucaugu uucuauuua 19 <210> SEQ ID NO 336 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 336 gaaacaugau aaaugcaag 19 <210> SEQ ID NO 337 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 337 cuugcauuua ucauguuuc 19 <210> SEQ ID NO 338 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 338 gauaaaugca agaaagaaa 19

<210> SEQ ID NO 339 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 339 uuucuuucuu gcauuuauc 19 <210> SEQ ID NO 340 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 340 aaaugcaaga aagaaaaca 19 <210> SEQ ID NO 341 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 341 uguuuucuuu cuugcauuu 19 <210> SEQ ID NO 342 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 342 caagaaagaa aacauuuug 19 <210> SEQ ID NO 343 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 343 caaaauguuu ucuuucuug 19 <210> SEQ ID NO 344 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 344 agaaaacauu uugauuuua 19 <210> SEQ ID NO 345 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 345 uaaaaucaaa auguuuucu 19 <210> SEQ ID NO 346 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 346 cauuuugauu uuaacucau 19 <210> SEQ ID NO 347 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 347 augaguuaaa aucaaaaug 19 <210> SEQ ID NO 348 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 348 gauuuuaacu cauugucac 19 <210> SEQ ID NO 349 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 349 gugacaauga guuaaaauc 19 <210> SEQ ID NO 350 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 350 auuuuaacuc auugucacu 19 <210> SEQ ID NO 351 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 351 agugacaaug aguuaaaau 19 <210> SEQ ID NO 352 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 352 cauugucacu cugauguuc 19 <210> SEQ ID NO 353 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 353 gaacaucaga gugacaaug 19 <210> SEQ ID NO 354 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 354 uugucacucu gauguucau 19 <210> SEQ ID NO 355 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 355 augaacauca gagugacaa 19 <210> SEQ ID NO 356 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 356 cucugauguu caugugaac 19

<210> SEQ ID NO 357 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 357 guucacauga acaucagag 19 <210> SEQ ID NO 358 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 358 gauguucaug ugaacuggu 19 <210> SEQ ID NO 359 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 359 accaguucac augaacauc 19 <210> SEQ ID NO 360 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 360 caugugaacu gguugcuuc 19 <210> SEQ ID NO 361 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 361 gaagcaacca guucacaug 19 <210> SEQ ID NO 362 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 362 acugguugcu ucgggcucu 19 <210> SEQ ID NO 363 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 363 agagcccgaa gcaaccagu 19 <210> SEQ ID NO 364 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 364 guugcuucgg gcucuuuga 19 <210> SEQ ID NO 365 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 365 ucaaagagcc cgaagcaac 19 <210> SEQ ID NO 366 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 366 gcuucgggcu cuuugaucu 19 <210> SEQ ID NO 367 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 367 agaucaaaga gcccgaagc 19 <210> SEQ ID NO 368 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 368 cgggcucuuu gaucuguca 19 <210> SEQ ID NO 369 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 369 ugacagauca aagagcccg 19 <210> SEQ ID NO 370 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 370 ucuuugaucu gucaccuau 19 <210> SEQ ID NO 371 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 371 auaggugaca gaucaaaga 19 <210> SEQ ID NO 372 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 372 gaucugucac cuauggaau 19 <210> SEQ ID NO 373 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 373 auuccauagg ugacagauc 19 <210> SEQ ID NO 374 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 374 caccuaugga aucugagug 19

<210> SEQ ID NO 375 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 375 cacucagauu ccauaggug 19 <210> SEQ ID NO 376 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 376 ggaaucugag ugguuuuau 19 <210> SEQ ID NO 377 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 377 auaaaaccac ucagauucc 19 <210> SEQ ID NO 378 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 378 cugagugguu uuauuuuuu 19 <210> SEQ ID NO 379 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 379 aaaaaauaaa accacucag 19 <210> SEQ ID NO 380 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 380 gagugguuuu auuuuuuag 19 <210> SEQ ID NO 381 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 381 cuaaaaaaua aaaccacuc 19 <210> SEQ ID NO 382 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 382 gguuuuauuu uuuagauuu 19 <210> SEQ ID NO 383 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 383 aaaucuaaaa aauaaaacc 19 <210> SEQ ID NO 384 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 384 auuuuuuaga uuucucagu 19 <210> SEQ ID NO 385 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 385 acugagaaau cuaaaaaau 19 <210> SEQ ID NO 386 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 386 uagauuucuc agucccaaa 19 <210> SEQ ID NO 387 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 387 uuugggacug agaaaucua 19 <210> SEQ ID NO 388 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 388 cucaguccca aagaucuaa 19 <210> SEQ ID NO 389 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 389 uuagaucuuu gggacugag 19 <210> SEQ ID NO 390 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 390 ucccaaagau cuaagauaa 19 <210> SEQ ID NO 391 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 391 uuaucuuaga ucuuuggga 19 <210> SEQ ID NO 392 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 392

caaagaucua agauaaaua 19 <210> SEQ ID NO 393 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 393 uauuuaucuu agaucuuug 19 <210> SEQ ID NO 394 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 394 cuaagauaaa uaaacaaga 19 <210> SEQ ID NO 395 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 395 ucuuguuuau uuaucuuag 19 <210> SEQ ID NO 396 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 396 aagauaaaua aacaagaga 19 <210> SEQ ID NO 397 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 397 ucucuuguuu auuuaucuu 19 <210> SEQ ID NO 398 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 398 auuaagccaa uuaaguauaa a 21 <210> SEQ ID NO 399 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 399 uuuauacuua auuggcuuaa ugu 23 <210> SEQ ID NO 400 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 400 cauuaagcca auuaaguaua a 21 <210> SEQ ID NO 401 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 401 uuauacuuaa uuggcuuaau gua 23 <210> SEQ ID NO 402 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 402 cuacauuaag ccaauuaagu a 21 <210> SEQ ID NO 403 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 403 uacuuaauug gcuuaaugua gaa 23 <210> SEQ ID NO 404 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 404 uacauuaagc caauuaagua u 21 <210> SEQ ID NO 405 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 405 auacuuaauu ggcuuaaugu aga 23 <210> SEQ ID NO 406 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 406 acauuaagcc aauuaaguau a 21 <210> SEQ ID NO 407 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 407 uauacuuaau uggcuuaaug uag 23 <210> SEQ ID NO 408 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 408 uguggacagu acucugcuca a 21 <210> SEQ ID NO 409 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 409 uugagcagag uacuguccac agc 23 <210> SEQ ID NO 410 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 410

aagccaauua aguauaaagg u 21 <210> SEQ ID NO 411 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 411 accuuuauac uuaauuggcu uaa 23 <210> SEQ ID NO 412 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 412 uuaagccaau uaaguauaaa g 21 <210> SEQ ID NO 413 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 413 cuuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 414 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 414 ggcuguggac aguacucugc u 21 <210> SEQ ID NO 415 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 415 agcagaguac uguccacagc cau 23 <210> SEQ ID NO 416 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 416 cuguggacag uacucugcuc a 21 <210> SEQ ID NO 417 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 417 ugagcagagu acuguccaca gcc 23 <210> SEQ ID NO 418 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 418 guggacagua cucugcucaa a 21 <210> SEQ ID NO 419 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 419 uuugagcaga guacugucca cag 23 <210> SEQ ID NO 420 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 420 gcuguggaca guacucugcu c 21 <210> SEQ ID NO 421 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 421 gagcagagua cuguccacag cca 23 <210> SEQ ID NO 422 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 422 uaagccaauu aaguauaaag g 21 <210> SEQ ID NO 423 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 423 ccuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 424 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 424 gacaguacuc ugcucaaaga a 21 <210> SEQ ID NO 425 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 425 uucuuugagc agaguacugu cca 23 <210> SEQ ID NO 426 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 426 ggacaguacu cugcucaaag a 21 <210> SEQ ID NO 427 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 427 ucuuugagca gaguacuguc cac 23 <210> SEQ ID NO 428 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide"

<400> SEQUENCE: 428 uggacaguac ucugcucaaa g 21 <210> SEQ ID NO 429 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 429 cuuugagcag aguacugucc aca 23 <210> SEQ ID NO 430 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 430 uuaagccaau uaaguauaaa u 21 <210> SEQ ID NO 431 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 431 auuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 432 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 432 gcuguggaca guacucugcu a 21 <210> SEQ ID NO 433 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 433 uagcagagua cuguccacag cca 23 <210> SEQ ID NO 434 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 434 uaagccaauu aaguauaaag a 21 <210> SEQ ID NO 435 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 435 ucuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 436 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 436 uggacaguac ucugcucaaa u 21 <210> SEQ ID NO 437 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 437 auuugagcag aguacugucc aca 23 <210> SEQ ID NO 438 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 438 agccaauuaa guauaaaggu a 21 <210> SEQ ID NO 439 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 439 uaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 440 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 440 agccaauuaa guauaaaggu c 21 <210> SEQ ID NO 441 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 441 gaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 442 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 442 ucuacauuaa gccaauuaag u 21 <210> SEQ ID NO 443 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 443 acuuaauugg cuuaauguag aac 23 <210> SEQ ID NO 444 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 444 uucuacauua agccaauuaa g 21 <210> SEQ ID NO 445 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 445 cuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 446 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide"

<400> SEQUENCE: 446 guucuacauu aagccaauua a 21 <210> SEQ ID NO 447 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 447 uuaauuggcu uaauguagaa cau 23 <210> SEQ ID NO 448 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 448 uguucuacau uaagccaauu a 21 <210> SEQ ID NO 449 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 449 uaauuggcuu aauguagaac auu 23 <210> SEQ ID NO 450 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 450 cauggcugug gacaguacuc u 21 <210> SEQ ID NO 451 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 451 agaguacugu ccacagccau ggc 23 <210> SEQ ID NO 452 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 452 uggcugugga caguacucug c 21 <210> SEQ ID NO 453 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 453 gcagaguacu guccacagcc aug 23 <210> SEQ ID NO 454 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 454 uucuacauua agccaauuaa a 21 <210> SEQ ID NO 455 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 455 uuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 456 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 456 uggcugugga caguacucug a 21 <210> SEQ ID NO 457 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 457 ucagaguacu guccacagcc aug 23 <210> SEQ ID NO 458 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 458 gcuaauauau gugcuggcaa a 21 <210> SEQ ID NO 459 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 459 uuugccagca cauauauuag ccc 23 <210> SEQ ID NO 460 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 460 gcccuugcag aaaguuuauc a 21 <210> SEQ ID NO 461 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 461 ugauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 462 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 462 uugaauauuc uucaaagaga a 21 <210> SEQ ID NO 463 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 463 uucucuuuga agaauauuca agu 23 <210> SEQ ID NO 464 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence:

Synthetic oligonucleotide" <400> SEQUENCE: 464 gcuaauauau gugcuggcaa g 21 <210> SEQ ID NO 465 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 465 cuugccagca cauauauuag ccc 23 <210> SEQ ID NO 466 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 466 auucauucaa acuugaauau u 21 <210> SEQ ID NO 467 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 467 aauauucaag uuugaaugaa uac 23 <210> SEQ ID NO 468 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 468 agcuaggaag uauucauuca a 21 <210> SEQ ID NO 469 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 469 uugaaugaau acuuccuagc uau 23 <210> SEQ ID NO 470 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 470 caauggucag aucuucaaaa u 21 <210> SEQ ID NO 471 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 471 auuuugaaga ucugaccauu ggc 23 <210> SEQ ID NO 472 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 472 uggucagauc uucaaaauaa a 21 <210> SEQ ID NO 473 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 473 uuuauuuuga agaucugacc auu 23 <210> SEQ ID NO 474 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 474 ccaggagaaa ccuuaucaaa a 21 <210> SEQ ID NO 475 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 475 uuuugauaag guuucuccug gcc 23 <210> SEQ ID NO 476 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 476 cccuugcaga aaguuuaucc u 21 <210> SEQ ID NO 477 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 477 aggauaaacu uucugcaagg gca 23 <210> SEQ ID NO 478 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 478 uucaaacuug aauauucuuc a 21 <210> SEQ ID NO 479 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 479 ugaagaauau ucaaguuuga aug 23 <210> SEQ ID NO 480 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 480 uagcuaggaa guauucauuc a 21 <210> SEQ ID NO 481 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 481 ugaaugaaua cuuccuagcu auu 23 <210> SEQ ID NO 482 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source

<223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 482 gcccuugcag aaaguuuauc c 21 <210> SEQ ID NO 483 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 483 ggauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 484 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 484 uugaauauuc uucaaagaga g 21 <210> SEQ ID NO 485 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 485 cucucuuuga agaauauuca agu 23 <210> SEQ ID NO 486 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 486 ccaaugguca gaucuucaaa a 21 <210> SEQ ID NO 487 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 487 uuuugaagau cugaccauug gcc 23 <210> SEQ ID NO 488 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 488 aauggucaga ucuucaaaau a 21 <210> SEQ ID NO 489 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 489 uauuuugaag aucugaccau ugg 23 <210> SEQ ID NO 490 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 490 ugugggccag gagaaaccuu a 21 <210> SEQ ID NO 491 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 491 uaagguuucu ccuggcccac aau 23 <210> SEQ ID NO 492 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 492 gacaucuugu gcucugcugg a 21 <210> SEQ ID NO 493 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 493 uccagcagag cacaagaugu cca 23 <210> SEQ ID NO 494 <211> LENGTH: 19 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic probe" <400> SEQUENCE: 494 gcatcctggg ctacactga 19 <210> SEQ ID NO 495 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic probe" <400> SEQUENCE: 495 tgggtgtcgc tgttgaagtc 20 <210> SEQ ID NO 496 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic probe" <400> SEQUENCE: 496 ccaggtggtc tcctcc 16 <210> SEQ ID NO 497 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 497 uagcuaggaa guauucauuc a 21 <210> SEQ ID NO 498 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 498 ugaaugaaua cuuccuagcu auu 23 <210> SEQ ID NO 499 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 499 agcuaggaag uauucauuca a 21 <210> SEQ ID NO 500 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:

<221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 500 uugaaugaau acuuccuagc uau 23 <210> SEQ ID NO 501 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 501 auucauucaa acuugaauau u 21 <210> SEQ ID NO 502 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 502 aauauucaag uuugaaugaa uac 23 <210> SEQ ID NO 503 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 503 uucaaacuug aauauucuuc a 21 <210> SEQ ID NO 504 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 504 ugaagaauau ucaaguuuga aug 23 <210> SEQ ID NO 505 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 505 uugaauauuc uucaaagaga g 21 <210> SEQ ID NO 506 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 506 cucucuuuga agaauauuca agu 23 <210> SEQ ID NO 507 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 507 uugaauauuc uucaaagaga a 21 <210> SEQ ID NO 508 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 508 uucucuuuga agaauauuca agu 23 <210> SEQ ID NO 509 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 509 gcuaauauau gugcuggcaa g 21 <210> SEQ ID NO 510 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 510 cuugccagca cauauauuag ccc 23 <210> SEQ ID NO 511 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 511 gcuaauauau gugcuggcaa a 21 <210> SEQ ID NO 512 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 512 uuugccagca cauauauuag ccc 23 <210> SEQ ID NO 513 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 513 cauggcugug gacaguacuc u 21 <210> SEQ ID NO 514 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 514 agaguacugu ccacagccau ggc 23 <210> SEQ ID NO 515 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 515 uggcugugga caguacucug c 21 <210> SEQ ID NO 516 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 516 gcagaguacu guccacagcc aug 23 <210> SEQ ID NO 517 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 517 uggcugugga caguacucug a 21 <210> SEQ ID NO 518 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 518 ucagaguacu guccacagcc aug 23 <210> SEQ ID NO 519 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 519 ggcuguggac aguacucugc u 21 <210> SEQ ID NO 520 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 520 agcagaguac uguccacagc cau 23 <210> SEQ ID NO 521 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 521 gcuguggaca guacucugcu c 21 <210> SEQ ID NO 522 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 522 gagcagagua cuguccacag cca 23 <210> SEQ ID NO 523 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 523 gcuguggaca guacucugcu a 21 <210> SEQ ID NO 524 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 524 uagcagagua cuguccacag cca 23 <210> SEQ ID NO 525 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 525 cuguggacag uacucugcuc a 21 <210> SEQ ID NO 526 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 526 ugagcagagu acuguccaca gcc 23 <210> SEQ ID NO 527 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 527 uguggacagu acucugcuca a 21 <210> SEQ ID NO 528 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 528 uugagcagag uacuguccac agc 23 <210> SEQ ID NO 529 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 529 guggacagua cucugcucaa a 21 <210> SEQ ID NO 530 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 530 uuugagcaga guacugucca cag 23 <210> SEQ ID NO 531 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 531 uggacaguac ucugcucaaa g 21 <210> SEQ ID NO 532 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 532 cuuugagcag aguacugucc aca 23 <210> SEQ ID NO 533 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 533 uggacaguac ucugcucaaa u 21 <210> SEQ ID NO 534 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 534 auuugagcag aguacugucc aca 23 <210> SEQ ID NO 535 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 535 ggacaguacu cugcucaaag a 21 <210> SEQ ID NO 536 <211> LENGTH: 23 <212> TYPE: RNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 536 ucuuugagca gaguacuguc cac 23 <210> SEQ ID NO 537 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 537 gacaguacuc ugcucaaaga a 21 <210> SEQ ID NO 538 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 538 uucuuugagc agaguacugu cca 23 <210> SEQ ID NO 539 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 539 ugugggccag gagaaaccuu a 21 <210> SEQ ID NO 540 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 540 uaagguuucu ccuggcccac aau 23 <210> SEQ ID NO 541 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 541 ccaggagaaa ccuuaucaaa a 21 <210> SEQ ID NO 542 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 542 uuuugauaag guuucuccug gcc 23 <210> SEQ ID NO 543 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 543 uguucuacau uaagccaauu a 21 <210> SEQ ID NO 544 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 544 uaauuggcuu aauguagaac auu 23 <210> SEQ ID NO 545 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 545 guucuacauu aagccaauua a 21 <210> SEQ ID NO 546 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 546 uuaauuggcu uaauguagaa cau 23 <210> SEQ ID NO 547 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 547 uucuacauua agccaauuaa g 21 <210> SEQ ID NO 548 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 548 cuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 549 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 549 uucuacauua agccaauuaa a 21 <210> SEQ ID NO 550 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 550 uuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 551 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 551 ucuacauuaa gccaauuaag u 21 <210> SEQ ID NO 552 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 552 acuuaauugg cuuaauguag aac 23 <210> SEQ ID NO 553 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 553 cuacauuaag ccaauuaagu a 21 <210> SEQ ID NO 554 <211> LENGTH: 23

<212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 554 uacuuaauug gcuuaaugua gaa 23 <210> SEQ ID NO 555 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 555 uacauuaagc caauuaagua u 21 <210> SEQ ID NO 556 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 556 auacuuaauu ggcuuaaugu aga 23 <210> SEQ ID NO 557 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 557 acauuaagcc aauuaaguau a 21 <210> SEQ ID NO 558 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 558 uauacuuaau uggcuuaaug uag 23 <210> SEQ ID NO 559 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 559 cauuaagcca auuaaguaua a 21 <210> SEQ ID NO 560 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 560 uuauacuuaa uuggcuuaau gua 23 <210> SEQ ID NO 561 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 561 auuaagccaa uuaaguauaa a 21 <210> SEQ ID NO 562 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 562 uuuauacuua auuggcuuaa ugu 23 <210> SEQ ID NO 563 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 563 uuaagccaau uaaguauaaa g 21 <210> SEQ ID NO 564 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 564 cuuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 565 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 565 uuaagccaau uaaguauaaa u 21 <210> SEQ ID NO 566 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 566 auuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 567 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 567 uaagccaauu aaguauaaag g 21 <210> SEQ ID NO 568 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 568 ccuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 569 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 569 uaagccaauu aaguauaaag a 21 <210> SEQ ID NO 570 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 570 ucuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 571 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 571 aagccaauua aguauaaagg u 21 <210> SEQ ID NO 572

<211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 572 accuuuauac uuaauuggcu uaa 23 <210> SEQ ID NO 573 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 573 agccaauuaa guauaaaggu c 21 <210> SEQ ID NO 574 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 574 gaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 575 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 575 agccaauuaa guauaaaggu a 21 <210> SEQ ID NO 576 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 576 uaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 577 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 577 gcccuugcag aaaguuuauc c 21 <210> SEQ ID NO 578 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 578 ggauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 579 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 579 gcccuugcag aaaguuuauc a 21 <210> SEQ ID NO 580 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 580 ugauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 581 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 581 cccuugcaga aaguuuaucc u 21 <210> SEQ ID NO 582 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 582 aggauaaacu uucugcaagg gca 23 <210> SEQ ID NO 583 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 583 ccaaugguca gaucuucaaa a 21 <210> SEQ ID NO 584 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 584 uuuugaagau cugaccauug gcc 23 <210> SEQ ID NO 585 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 585 caauggucag aucuucaaaa u 21 <210> SEQ ID NO 586 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 586 auuuugaaga ucugaccauu ggc 23 <210> SEQ ID NO 587 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 587 aauggucaga ucuucaaaau a 21 <210> SEQ ID NO 588 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 588 uauuuugaag aucugaccau ugg 23 <210> SEQ ID NO 589 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 589 uggucagauc uucaaaauaa a 21

<210> SEQ ID NO 590 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 590 uuuauuuuga agaucugacc auu 23 <210> SEQ ID NO 591 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 591 uagcuaggaa guauucauuc a 21 <210> SEQ ID NO 592 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 592 ugaaugaaua cuuccuagcu auu 23 <210> SEQ ID NO 593 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 593 agcuaggaag uauucauuca a 21 <210> SEQ ID NO 594 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 594 uugaaugaau acuuccuagc uau 23 <210> SEQ ID NO 595 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 595 auucauucaa acuugaauau u 21 <210> SEQ ID NO 596 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 596 aauauucaag uuugaaugaa uac 23 <210> SEQ ID NO 597 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 597 uucaaacuug aauauucuuc a 21 <210> SEQ ID NO 598 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 598 ugaagaauau ucaaguuuga aug 23 <210> SEQ ID NO 599 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 599 uugaauauuc uucaaagaga g 21 <210> SEQ ID NO 600 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 600 cucucuuuga agaauauuca agu 23 <210> SEQ ID NO 601 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 601 uugaauauuc uucaaagaga a 21 <210> SEQ ID NO 602 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 602 uucucuuuga agaauauuca agu 23 <210> SEQ ID NO 603 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 603 gcuaauauau gugcuggcaa g 21 <210> SEQ ID NO 604 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 604 cuugccagca cauauauuag ccc 23 <210> SEQ ID NO 605 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 605 gcuaauauau gugcuggcaa a 21 <210> SEQ ID NO 606 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 606 uuugccagca cauauauuag ccc 23 <210> SEQ ID NO 607 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 607 cauggcugug gacaguacuc u 21

<210> SEQ ID NO 608 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 608 agaguacugu ccacagccau ggc 23 <210> SEQ ID NO 609 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 609 uggcugugga caguacucug c 21 <210> SEQ ID NO 610 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 610 gcagaguacu guccacagcc aug 23 <210> SEQ ID NO 611 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 611 uggcugugga caguacucug a 21 <210> SEQ ID NO 612 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 612 ucagaguacu guccacagcc aug 23 <210> SEQ ID NO 613 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 613 ggcuguggac aguacucugc u 21 <210> SEQ ID NO 614 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 614 agcagaguac uguccacagc cau 23 <210> SEQ ID NO 615 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 615 gcuguggaca guacucugcu c 21 <210> SEQ ID NO 616 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 616 gagcagagua cuguccacag cca 23 <210> SEQ ID NO 617 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 617 gcuguggaca guacucugcu a 21 <210> SEQ ID NO 618 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 618 uagcagagua cuguccacag cca 23 <210> SEQ ID NO 619 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 619 cuguggacag uacucugcuc a 21 <210> SEQ ID NO 620 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 620 ugagcagagu acuguccaca gcc 23 <210> SEQ ID NO 621 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 621 uguggacagu acucugcuca a 21 <210> SEQ ID NO 622 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 622 uugagcagag uacuguccac agc 23 <210> SEQ ID NO 623 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 623 guggacagua cucugcucaa a 21 <210> SEQ ID NO 624 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 624 uuugagcaga guacugucca cag 23 <210> SEQ ID NO 625 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 625 uggacaguac ucugcucaaa g 21

<210> SEQ ID NO 626 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 626 cuuugagcag aguacugucc aca 23 <210> SEQ ID NO 627 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 627 uggacaguac ucugcucaaa u 21 <210> SEQ ID NO 628 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 628 auuugagcag aguacugucc aca 23 <210> SEQ ID NO 629 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 629 ggacaguacu cugcucaaag a 21 <210> SEQ ID NO 630 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 630 ucuuugagca gaguacuguc cac 23 <210> SEQ ID NO 631 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 631 gacaguacuc ugcucaaaga a 21 <210> SEQ ID NO 632 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 632 uucuuugagc agaguacugu cca 23 <210> SEQ ID NO 633 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 633 ugugggccag gagaaaccuu a 21 <210> SEQ ID NO 634 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 634 uaagguuucu ccuggcccac aau 23 <210> SEQ ID NO 635 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 635 ccaggagaaa ccuuaucaaa a 21 <210> SEQ ID NO 636 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 636 uuuugauaag guuucuccug gcc 23 <210> SEQ ID NO 637 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 637 uguucuacau uaagccaauu a 21 <210> SEQ ID NO 638 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 638 uaauuggcuu aauguagaac auu 23 <210> SEQ ID NO 639 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 639 guucuacauu aagccaauua a 21 <210> SEQ ID NO 640 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 640 uuaauuggcu uaauguagaa cau 23 <210> SEQ ID NO 641 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 641 uucuacauua agccaauuaa g 21 <210> SEQ ID NO 642 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 642 cuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 643 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 643

uucuacauua agccaauuaa a 21 <210> SEQ ID NO 644 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 644 uuuaauuggc uuaauguaga aca 23 <210> SEQ ID NO 645 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 645 ucuacauuaa gccaauuaag u 21 <210> SEQ ID NO 646 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 646 acuuaauugg cuuaauguag aac 23 <210> SEQ ID NO 647 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 647 cuacauuaag ccaauuaagu a 21 <210> SEQ ID NO 648 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 648 uacuuaauug gcuuaaugua gaa 23 <210> SEQ ID NO 649 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 649 uacauuaagc caauuaagua u 21 <210> SEQ ID NO 650 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 650 auacuuaauu ggcuuaaugu aga 23 <210> SEQ ID NO 651 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 651 acauuaagcc aauuaaguau a 21 <210> SEQ ID NO 652 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 652 uauacuuaau uggcuuaaug uag 23 <210> SEQ ID NO 653 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 653 cauuaagcca auuaaguaua a 21 <210> SEQ ID NO 654 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 654 uuauacuuaa uuggcuuaau gua 23 <210> SEQ ID NO 655 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 655 auuaagccaa uuaaguauaa a 21 <210> SEQ ID NO 656 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 656 uuuauacuua auuggcuuaa ugu 23 <210> SEQ ID NO 657 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 657 uuaagccaau uaaguauaaa g 21 <210> SEQ ID NO 658 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 658 cuuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 659 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 659 uuaagccaau uaaguauaaa u 21 <210> SEQ ID NO 660 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 660 auuuauacuu aauuggcuua aug 23 <210> SEQ ID NO 661 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 661

uaagccaauu aaguauaaag g 21 <210> SEQ ID NO 662 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 662 ccuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 663 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 663 uaagccaauu aaguauaaag a 21 <210> SEQ ID NO 664 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 664 ucuuuauacu uaauuggcuu aau 23 <210> SEQ ID NO 665 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 665 aagccaauua aguauaaagg u 21 <210> SEQ ID NO 666 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 666 accuuuauac uuaauuggcu uaa 23 <210> SEQ ID NO 667 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 667 agccaauuaa guauaaaggu c 21 <210> SEQ ID NO 668 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 668 gaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 669 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 669 agccaauuaa guauaaaggu a 21 <210> SEQ ID NO 670 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 670 uaccuuuaua cuuaauuggc uua 23 <210> SEQ ID NO 671 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 671 gcccuugcag aaaguuuauc c 21 <210> SEQ ID NO 672 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 672 ggauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 673 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 673 gcccuugcag aaaguuuauc a 21 <210> SEQ ID NO 674 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 674 ugauaaacuu ucugcaaggg caa 23 <210> SEQ ID NO 675 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 675 cccuugcaga aaguuuaucc u 21 <210> SEQ ID NO 676 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 676 aggauaaacu uucugcaagg gca 23 <210> SEQ ID NO 677 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 677 ccaaugguca gaucuucaaa a 21 <210> SEQ ID NO 678 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 678 uuuugaagau cugaccauug gcc 23 <210> SEQ ID NO 679 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide"

<400> SEQUENCE: 679 caauggucag aucuucaaaa u 21 <210> SEQ ID NO 680 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 680 auuuugaaga ucugaccauu ggc 23 <210> SEQ ID NO 681 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 681 aauggucaga ucuucaaaau a 21 <210> SEQ ID NO 682 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 682 uauuuugaag aucugaccau ugg 23 <210> SEQ ID NO 683 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 683 uggucagauc uucaaaauaa a 21 <210> SEQ ID NO 684 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 684 uuuauuuuga agaucugacc auu 23 <210> SEQ ID NO 685 <211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic peptide" <400> SEQUENCE: 685 Ala Ala Val Ala Leu Leu Pro Ala Val Leu Leu Ala Leu Leu Ala Pro 1 5 10 15 <210> SEQ ID NO 686 <211> LENGTH: 11 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic peptide" <400> SEQUENCE: 686 Ala Ala Leu Leu Pro Val Leu Leu Ala Ala Pro 1 5 10 <210> SEQ ID NO 687 <211> LENGTH: 13 <212> TYPE: PRT <213> ORGANISM: Human immunodeficiency virus <400> SEQUENCE: 687 Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Pro Gln 1 5 10 <210> SEQ ID NO 688 <211> LENGTH: 16 <212> TYPE: PRT <213> ORGANISM: Drosophila sp. <400> SEQUENCE: 688 Arg Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys Lys 1 5 10 15 <210> SEQ ID NO 689 <400> SEQUENCE: 689 000 <210> SEQ ID NO 690 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 690 gaauauuaga acuugacuut t 21 <210> SEQ ID NO 691 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 691 aagucaaguu cuaauauuct t 21 <210> SEQ ID NO 692 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 692 aacuugacuu gcuccaucct t 21 <210> SEQ ID NO 693 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 693 ggauggagca agucaaguut t 21 <210> SEQ ID NO 694 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 694 ccauccucuu aaacuuuuut t 21 <210> SEQ ID NO 695 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 695 aaaaaguuua agaggauggt t 21 <210> SEQ ID NO 696 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE:

<221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 696 uaaacuuuuu gugucucact t 21 <210> SEQ ID NO 697 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 697 gugagacaca aaaaguuuat t 21 <210> SEQ ID NO 698 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 698 gucucacacu aaagaaaugt t 21 <210> SEQ ID NO 699 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 699 cauuucuuua gugugagact t 21 <210> SEQ ID NO 700 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 700 aaagaaauga gagaugcagt t 21 <210> SEQ ID NO 701 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 701 cugcaucucu cauuucuuut t 21 <210> SEQ ID NO 702 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 702 augcagaauu cuaaggcuat t 21 <210> SEQ ID NO 703 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 703 uagccuuaga auucugcaut t 21 <210> SEQ ID NO 704 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 704 ucuaaggcua aauagcuagt t 21 <210> SEQ ID NO 705 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 705 cuagcuauuu agccuuagat t 21 <210> SEQ ID NO 706 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 706 auagcuagga aguauucaut t 21 <210> SEQ ID NO 707 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 707 augaauacuu ccuagcuaut t 21 <210> SEQ ID NO 708 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 708 auucauucaa acuugaauat t 21 <210> SEQ ID NO 709 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 709 uauucaaguu ugaaugaaut t 21 <210> SEQ ID NO 710 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide"

<220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 710 cuugaauauu cuucaaagat t 21 <210> SEQ ID NO 711 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 711 ucuuugaaga auauucaagt t 21 <210> SEQ ID NO 712 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 712 cuucaaagag aguguggggt t 21 <210> SEQ ID NO 713 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 713 ccccacacuc ucuuugaagt t 21 <210> SEQ ID NO 714 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 714 gugugggggc aacucuaaut t 21 <210> SEQ ID NO 715 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 715 auuagaguug cccccacact t 21 <210> SEQ ID NO 716 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 716 aacucuaauc agaggaagat t 21 <210> SEQ ID NO 717 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 717 ucuuccucug auuagaguut t 21 <210> SEQ ID NO 718 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 718 aggaagaaac uaaaggaagt t 21 <210> SEQ ID NO 719 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 719 cuuccuuuag uuucuuccut t 21 <210> SEQ ID NO 720 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 720 uaaaggaagu aaaaccagat t 21 <210> SEQ ID NO 721 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 721 ucugguuuua cuuccuuuat t 21 <210> SEQ ID NO 722 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 722 aaaccagaug uuuuccacct t 21 <210> SEQ ID NO 723 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 723 gguggaaaac aucugguuut t 21 <210> SEQ ID NO 724 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence:

Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 724 uccaccaaag cccuccuuut t 21 <210> SEQ ID NO 725 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 725 aaaggagggc uuugguggat t 21 <210> SEQ ID NO 726 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 726 ccuccuuuug gcuggucugt t 21 <210> SEQ ID NO 727 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 727 cagaccagcc aaaaggaggt t 21 <210> SEQ ID NO 728 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 728 ggcuggucug auuucuacct t 21 <210> SEQ ID NO 729 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 729 gguagaaauc agaccagcct t 21 <210> SEQ ID NO 730 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 730 uuucuaccgc acuggcaggt t 21 <210> SEQ ID NO 731 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 731 ccugccagug cgguagaaat t 21 <210> SEQ ID NO 732 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 732 ggcagggcca ugggcuaaut t 21 <210> SEQ ID NO 733 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 733 auuagcccau ggcccugcct t 21 <210> SEQ ID NO 734 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 734 gggcuaauau augugcuggt t 21 <210> SEQ ID NO 735 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 735 ccagcacaua uauuagccct t 21 <210> SEQ ID NO 736 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 736 augugcuggc aagucuucct t 21 <210> SEQ ID NO 737 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 737 ggaagacuug ccagcacaut t 21 <210> SEQ ID NO 738 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source

<223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 738 aagucuucca augagaucct t 21 <210> SEQ ID NO 739 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 739 ggaucucauu ggaagacuut t 21 <210> SEQ ID NO 740 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 740 agauccggac gugugaccgt t 21 <210> SEQ ID NO 741 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 741 cggucacacg uccggaucut t 21 <210> SEQ ID NO 742 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 742 gugugaccgc cauggcugut t 21 <210> SEQ ID NO 743 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 743 acagccaugg cggucacact t 21 <210> SEQ ID NO 744 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 744 auggcugugg acaguacuct t 21 <210> SEQ ID NO 745 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 745 gaguacuguc cacagccaut t 21 <210> SEQ ID NO 746 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 746 aguacucugc ucaaagaagt t 21 <210> SEQ ID NO 747 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 747 cuucuuugag cagaguacut t 21 <210> SEQ ID NO 748 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 748 caaagaaguc agaggccuct t 21 <210> SEQ ID NO 749 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 749 gaggccucug acuucuuugt t 21 <210> SEQ ID NO 750 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 750 cagaggccuc accagggugt t 21 <210> SEQ ID NO 751 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 751 cacccuggug aggccucugt t 21 <210> SEQ ID NO 752 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE:

<221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 752 ccagggugug gacaucuugt t 21 <210> SEQ ID NO 753 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 753 caagaugucc acacccuggt t 21 <210> SEQ ID NO 754 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 754 acaucuugug cucugcuggt t 21 <210> SEQ ID NO 755 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 755 ccagcagagc acaagaugut t 21 <210> SEQ ID NO 756 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 756 cugcuggauc uacuguguat t 21 <210> SEQ ID NO 757 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 757 uacacaguag auccagcagt t 21 <210> SEQ ID NO 758 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 758 cuguguacgc accauucact t 21 <210> SEQ ID NO 759 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 759 gugaauggug cguacacagt t 21 <210> SEQ ID NO 760 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 760 ccauucacug gaaugauugt t 21 <210> SEQ ID NO 761 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 761 caaucauucc agugaauggt t 21 <210> SEQ ID NO 762 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 762 aaugauugug ggccaggagt t 21 <210> SEQ ID NO 763 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 763 cuccuggccc acaaucauut t 21 <210> SEQ ID NO 764 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 764 gggccaggag aaaccuuaut t 21 <210> SEQ ID NO 765 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 765 auaagguuuc uccuggccct t 21 <210> SEQ ID NO 766 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 766 ccuuaucaaa acaagaaugt t 21 <210> SEQ ID NO 767 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 767 cauucuuguu uugauaaggt t 21 <210> SEQ ID NO 768 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 768 caagaaugcu aucaauaaut t 21 <210> SEQ ID NO 769 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 769 auuauugaua gcauucuugt t 21 <210> SEQ ID NO 770 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 770 aucaauaaug guguucgaat t 21 <210> SEQ ID NO 771 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 771 uucgaacacc auuauugaut t 21 <210> SEQ ID NO 772 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 772 guucgaauau cuggaagagt t 21 <210> SEQ ID NO 773 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 773 cucuuccaga uauucgaact t 21 <210> SEQ ID NO 774 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 774 ucuggaagag guuuuugugt t 21 <210> SEQ ID NO 775 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 775 cacaaaaacc ucuuccagat t 21 <210> SEQ ID NO 776 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 776 uuuuuguguc aaaauguuct t 21 <210> SEQ ID NO 777 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 777 gaacauuuug acacaaaaat t 21 <210> SEQ ID NO 778 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 778 auguucuaca uuaagccaat t 21 <210> SEQ ID NO 779 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 779 uuggcuuaau guagaacaut t 21 <210> SEQ ID NO 780 <211> LENGTH: 21 <212> TYPE: DNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 780 uaagccaauu aaguauaaat t 21 <210> SEQ ID NO 781 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 781 uuuauacuua auuggcuuat t 21 <210> SEQ ID NO 782 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 782 aaguauaaag guccuauuat t 21 <210> SEQ ID NO 783 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 783 uaauaggacc uuuauacuut t 21 <210> SEQ ID NO 784 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 784 ccuauuaaga agggagaaat t 21 <210> SEQ ID NO 785 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 785 uuucucccuu cuuaauaggt t 21 <210> SEQ ID NO 786 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 786 agggagaaaa acuuggaact t 21 <210> SEQ ID NO 787 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 787 guuccaaguu uuucucccut t 21 <210> SEQ ID NO 788 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 788 cuuggaacuc uauugcccut t 21 <210> SEQ ID NO 789 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 789 agggcaauag aguuccaagt t 21 <210> SEQ ID NO 790 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 790 uugcccuugc agaaaguuut t 21 <210> SEQ ID NO 791 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 791 aaacuuucug caagggcaat t 21 <210> SEQ ID NO 792 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 792 agaaaguuua uccuggcaut t 21 <210> SEQ ID NO 793 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 793 augccaggau aaacuuucut t 21 <210> SEQ ID NO 794 <211> LENGTH: 21

<212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 794 ccuggcauac aaucgcaugt t 21 <210> SEQ ID NO 795 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 795 caugcgauug uaugccaggt t 21 <210> SEQ ID NO 796 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 796 aucgcaugug cacauugaat t 21 <210> SEQ ID NO 797 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 797 uucaaugugc acaugcgaut t 21 <210> SEQ ID NO 798 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 798 cauugaaaac ugugacucgt t 21 <210> SEQ ID NO 799 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 799 cgagucacag uuuucaaugt t 21 <210> SEQ ID NO 800 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 800 gugacucgag ugacccuact t 21 <210> SEQ ID NO 801 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 801 guagggucac ucgagucact t 21 <210> SEQ ID NO 802 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 802 ugacccuacu gcauaccugt t 21 <210> SEQ ID NO 803 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 803 cagguaugca guagggucat t 21 <210> SEQ ID NO 804 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 804 cauaccugua aaucgaaggt t 21 <210> SEQ ID NO 805 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 805 ccuucgauuu acagguaugt t 21 <210> SEQ ID NO 806 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 806 uggucagauc uucaaaauat t 21 <210> SEQ ID NO 807 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 807 uauuuugaag aucugaccat t 21 <210> SEQ ID NO 808

<211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 808 cuucaaaaua aaaagucaut t 21 <210> SEQ ID NO 809 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 809 augacuuuuu auuuugaagt t 21 <210> SEQ ID NO 810 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 810 aagucaucuu aaaaaccugt t 21 <210> SEQ ID NO 811 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 811 cagguuuuua agaugacuut t 21 <210> SEQ ID NO 812 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 812 aaaaccugga ugcauaccct t 21 <210> SEQ ID NO 813 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 813 ggguaugcau ccagguuuut t 21 <210> SEQ ID NO 814 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 814 gcauacccuu cucuucaagt t 21 <210> SEQ ID NO 815 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 815 cuugaagaga aggguaugct t 21 <210> SEQ ID NO 816 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 816 cuucaagaaa uuuguguuct t 21 <210> SEQ ID NO 817 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 817 gaacacaaau uucuugaagt t 21 <210> SEQ ID NO 818 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 818 uuguguucac aaaggaaaat t 21 <210> SEQ ID NO 819 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 819 uuuuccuuug ugaacacaat t 21 <210> SEQ ID NO 820 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 820 aaggaaaaau gcaugaaggt t 21 <210> SEQ ID NO 821 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 821 ccuucaugca uuuuuccuut t 21

<210> SEQ ID NO 822 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 822 ugcaugaagg gauggauact t 21 <210> SEQ ID NO 823 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 823 guauccaucc cuucaugcat t 21 <210> SEQ ID NO 824 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 824 uggauacccc auuuuccaut t 21 <210> SEQ ID NO 825 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 825 auggaaaaug ggguauccat t 21 <210> SEQ ID NO 826 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 826 uuuccaugac augauuauut t 21 <210> SEQ ID NO 827 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 827 aauaaucaug ucauggaaat t 21 <210> SEQ ID NO 828 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 828 caugauuauu acacauugct t 21 <210> SEQ ID NO 829 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 829 gcaaugugua auaaucaugt t 21 <210> SEQ ID NO 830 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 830 cacauugcau gccuguauct t 21 <210> SEQ ID NO 831 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 831 gauacaggca ugcaaugugt t 21 <210> SEQ ID NO 832 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 832 ccuguaucaa aacaucucat t 21 <210> SEQ ID NO 833 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 833 ugagauguuu ugauacaggt t 21 <210> SEQ ID NO 834 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 834 caucucacgu accucauaat t 21 <210> SEQ ID NO 835 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 835 uuaugaggua cgugagaugt t 21

<210> SEQ ID NO 836 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 836 ccucauaaac auauacacct t 21 <210> SEQ ID NO 837 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 837 gguguauaug uuuaugaggt t 21 <210> SEQ ID NO 838 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 838 auacaccuau guacccacat t 21 <210> SEQ ID NO 839 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 839 uguggguaca uagguguaut t 21 <210> SEQ ID NO 840 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 840 guacccacaa aaauuuuuut t 21 <210> SEQ ID NO 841 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 841 aaaaaauuuu uguggguact t 21 <210> SEQ ID NO 842 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 842 uaaaaaaagg aaauuugagt t 21 <210> SEQ ID NO 843 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 843 cucaaauuuc cuuuuuuuat t 21 <210> SEQ ID NO 844 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 844 aauuugaguu uaaauagaat t 21 <210> SEQ ID NO 845 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 845 uucuauuuaa acucaaauut t 21 <210> SEQ ID NO 846 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 846 auagaaacau gauaaaugct t 21 <210> SEQ ID NO 847 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 847 gcauuuauca uguuucuaut t 21 <210> SEQ ID NO 848 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 848 gauaaaugca agaaagaaat t 21 <210> SEQ ID NO 849 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 849 uuucuuucuu gcauuuauct t 21

<210> SEQ ID NO 850 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 850 gaaagaaaac auuuugauut t 21 <210> SEQ ID NO 851 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 851 aaucaaaaug uuuucuuuct t 21 <210> SEQ ID NO 852 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 852 acucauuguc acucugaugt t 21 <210> SEQ ID NO 853 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 853 caucagagug acaaugagut t 21 <210> SEQ ID NO 854 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 854 cucugauguu caugugaact t 21 <210> SEQ ID NO 855 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 855 guucacauga acaucagagt t 21 <210> SEQ ID NO 856 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 856 caugugaacu gguugcuuct t 21 <210> SEQ ID NO 857 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 857 gaagcaacca guucacaugt t 21 <210> SEQ ID NO 858 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 858 guugcuucgg gcucuuugat t 21 <210> SEQ ID NO 859 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 859 ucaaagagcc cgaagcaact t 21 <210> SEQ ID NO 860 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 860 ucuuugaucu gucaccuaut t 21 <210> SEQ ID NO 861 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 861 auaggugaca gaucaaagat t 21 <210> SEQ ID NO 862 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 862 caccuaugga aucugagugt t 21 <210> SEQ ID NO 863 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 863

cacucagauu ccauaggugt t 21 <210> SEQ ID NO 864 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 864 aaucugagug guuuuauuut t 21 <210> SEQ ID NO 865 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 865 aaauaaaacc acucagauut t 21 <210> SEQ ID NO 866 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 866 uuuuuuagau uucucaguct t 21 <210> SEQ ID NO 867 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 867 gacugagaaa ucuaaaaaat t 21 <210> SEQ ID NO 868 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 868 cucaguccca aagaucuaat t 21 <210> SEQ ID NO 869 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 869 uuagaucuuu gggacugagt t 21 <210> SEQ ID NO 870 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 870 gaucuaagau aaauaaacat t 21 <210> SEQ ID NO 871 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Combined DNA/RNA Molecule: Synthetic oligonucleotide" <400> SEQUENCE: 871 uguuuauuua ucuuagauct t 21 <210> SEQ ID NO 872 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 872 gaauauuaga acuugacuu 19 <210> SEQ ID NO 873 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 873 aagucaaguu cuaauauuc 19 <210> SEQ ID NO 874 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 874 aacuugacuu gcuccaucc 19 <210> SEQ ID NO 875 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 875 ggauggagca agucaaguu 19 <210> SEQ ID NO 876 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 876 ccauccucuu aaacuuuuu 19 <210> SEQ ID NO 877 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 877 aaaaaguuua agaggaugg 19 <210> SEQ ID NO 878 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 878 uaaacuuuuu gugucucac 19 <210> SEQ ID NO 879 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source

<223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 879 gugagacaca aaaaguuua 19 <210> SEQ ID NO 880 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 880 gucucacacu aaagaaaug 19 <210> SEQ ID NO 881 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 881 cauuucuuua gugugagac 19 <210> SEQ ID NO 882 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 882 aaagaaauga gagaugcag 19 <210> SEQ ID NO 883 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 883 cugcaucucu cauuucuuu 19 <210> SEQ ID NO 884 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 884 augcagaauu cuaaggcua 19 <210> SEQ ID NO 885 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 885 uagccuuaga auucugcau 19 <210> SEQ ID NO 886 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 886 ucuaaggcua aauagcuag 19 <210> SEQ ID NO 887 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 887 cuagcuauuu agccuuaga 19 <210> SEQ ID NO 888 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 888 auagcuagga aguauucau 19 <210> SEQ ID NO 889 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 889 augaauacuu ccuagcuau 19 <210> SEQ ID NO 890 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 890 auucauucaa acuugaaua 19 <210> SEQ ID NO 891 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 891 uauucaaguu ugaaugaau 19 <210> SEQ ID NO 892 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 892 cuugaauauu cuucaaaga 19 <210> SEQ ID NO 893 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 893 ucuuugaaga auauucaag 19 <210> SEQ ID NO 894 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 894 cuucaaagag agugugggg 19 <210> SEQ ID NO 895 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 895 ccccacacuc ucuuugaag 19 <210> SEQ ID NO 896 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 896 gugugggggc aacucuaau 19 <210> SEQ ID NO 897 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE:

<221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 897 auuagaguug cccccacac 19 <210> SEQ ID NO 898 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 898 aacucuaauc agaggaaga 19 <210> SEQ ID NO 899 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 899 ucuuccucug auuagaguu 19 <210> SEQ ID NO 900 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 900 aggaagaaac uaaaggaag 19 <210> SEQ ID NO 901 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 901 cuuccuuuag uuucuuccu 19 <210> SEQ ID NO 902 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 902 uaaaggaagu aaaaccaga 19 <210> SEQ ID NO 903 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 903 ucugguuuua cuuccuuua 19 <210> SEQ ID NO 904 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 904 aaaccagaug uuuuccacc 19 <210> SEQ ID NO 905 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 905 gguggaaaac aucugguuu 19 <210> SEQ ID NO 906 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 906 uccaccaaag cccuccuuu 19 <210> SEQ ID NO 907 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 907 aaaggagggc uuuggugga 19 <210> SEQ ID NO 908 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 908 ccuccuuuug gcuggucug 19 <210> SEQ ID NO 909 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 909 cagaccagcc aaaaggagg 19 <210> SEQ ID NO 910 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 910 ggcuggucug auuucuacc 19 <210> SEQ ID NO 911 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 911 gguagaaauc agaccagcc 19 <210> SEQ ID NO 912 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 912 uuucuaccgc acuggcagg 19 <210> SEQ ID NO 913 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 913 ccugccagug cgguagaaa 19 <210> SEQ ID NO 914 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 914 ggcagggcca ugggcuaau 19 <210> SEQ ID NO 915 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence

<220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 915 auuagcccau ggcccugcc 19 <210> SEQ ID NO 916 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 916 gggcuaauau augugcugg 19 <210> SEQ ID NO 917 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 917 ccagcacaua uauuagccc 19 <210> SEQ ID NO 918 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 918 augugcuggc aagucuucc 19 <210> SEQ ID NO 919 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 919 ggaagacuug ccagcacau 19 <210> SEQ ID NO 920 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 920 aagucuucca augagaucc 19 <210> SEQ ID NO 921 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 921 ggaucucauu ggaagacuu 19 <210> SEQ ID NO 922 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 922 agauccggac gugugaccg 19 <210> SEQ ID NO 923 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 923 cggucacacg uccggaucu 19 <210> SEQ ID NO 924 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 924 gugugaccgc cauggcugu 19 <210> SEQ ID NO 925 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 925 acagccaugg cggucacac 19 <210> SEQ ID NO 926 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 926 auggcugugg acaguacuc 19 <210> SEQ ID NO 927 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 927 gaguacuguc cacagccau 19 <210> SEQ ID NO 928 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 928 aguacucugc ucaaagaag 19 <210> SEQ ID NO 929 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 929 cuucuuugag cagaguacu 19 <210> SEQ ID NO 930 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 930 caaagaaguc agaggccuc 19 <210> SEQ ID NO 931 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 931 gaggccucug acuucuuug 19 <210> SEQ ID NO 932 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 932 cagaggccuc accagggug 19 <210> SEQ ID NO 933 <211> LENGTH: 19 <212> TYPE: RNA

<213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 933 cacccuggug aggccucug 19 <210> SEQ ID NO 934 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 934 ccagggugug gacaucuug 19 <210> SEQ ID NO 935 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 935 caagaugucc acacccugg 19 <210> SEQ ID NO 936 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 936 acaucuugug cucugcugg 19 <210> SEQ ID NO 937 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 937 ccagcagagc acaagaugu 19 <210> SEQ ID NO 938 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 938 cugcuggauc uacugugua 19 <210> SEQ ID NO 939 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 939 uacacaguag auccagcag 19 <210> SEQ ID NO 940 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 940 cuguguacgc accauucac 19 <210> SEQ ID NO 941 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 941 gugaauggug cguacacag 19 <210> SEQ ID NO 942 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 942 ccauucacug gaaugauug 19 <210> SEQ ID NO 943 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 943 caaucauucc agugaaugg 19 <210> SEQ ID NO 944 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 944 aaugauugug ggccaggag 19 <210> SEQ ID NO 945 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 945 cuccuggccc acaaucauu 19 <210> SEQ ID NO 946 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 946 gggccaggag aaaccuuau 19 <210> SEQ ID NO 947 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 947 auaagguuuc uccuggccc 19 <210> SEQ ID NO 948 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 948 ccuuaucaaa acaagaaug 19 <210> SEQ ID NO 949 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 949 cauucuuguu uugauaagg 19 <210> SEQ ID NO 950 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 950 caagaaugcu aucaauaau 19 <210> SEQ ID NO 951 <211> LENGTH: 19

<212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 951 auuauugaua gcauucuug 19 <210> SEQ ID NO 952 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 952 aucaauaaug guguucgaa 19 <210> SEQ ID NO 953 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 953 uucgaacacc auuauugau 19 <210> SEQ ID NO 954 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 954 guucgaauau cuggaagag 19 <210> SEQ ID NO 955 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 955 cucuuccaga uauucgaac 19 <210> SEQ ID NO 956 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 956 ucuggaagag guuuuugug 19 <210> SEQ ID NO 957 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 957 cacaaaaacc ucuuccaga 19 <210> SEQ ID NO 958 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 958 uuuuuguguc aaaauguuc 19 <210> SEQ ID NO 959 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 959 gaacauuuug acacaaaaa 19 <210> SEQ ID NO 960 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 960 auguucuaca uuaagccaa 19 <210> SEQ ID NO 961 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 961 uuggcuuaau guagaacau 19 <210> SEQ ID NO 962 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 962 uaagccaauu aaguauaaa 19 <210> SEQ ID NO 963 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 963 uuuauacuua auuggcuua 19 <210> SEQ ID NO 964 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 964 aaguauaaag guccuauua 19 <210> SEQ ID NO 965 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 965 uaauaggacc uuuauacuu 19 <210> SEQ ID NO 966 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 966 ccuauuaaga agggagaaa 19 <210> SEQ ID NO 967 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 967 uuucucccuu cuuaauagg 19 <210> SEQ ID NO 968 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 968 agggagaaaa acuuggaac 19 <210> SEQ ID NO 969

<211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 969 guuccaaguu uuucucccu 19 <210> SEQ ID NO 970 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 970 cuuggaacuc uauugcccu 19 <210> SEQ ID NO 971 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 971 agggcaauag aguuccaag 19 <210> SEQ ID NO 972 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 972 uugcccuugc agaaaguuu 19 <210> SEQ ID NO 973 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 973 aaacuuucug caagggcaa 19 <210> SEQ ID NO 974 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 974 agaaaguuua uccuggcau 19 <210> SEQ ID NO 975 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 975 augccaggau aaacuuucu 19 <210> SEQ ID NO 976 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 976 ccuggcauac aaucgcaug 19 <210> SEQ ID NO 977 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 977 caugcgauug uaugccagg 19 <210> SEQ ID NO 978 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 978 aucgcaugug cacauugaa 19 <210> SEQ ID NO 979 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 979 uucaaugugc acaugcgau 19 <210> SEQ ID NO 980 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 980 cauugaaaac ugugacucg 19 <210> SEQ ID NO 981 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 981 cgagucacag uuuucaaug 19 <210> SEQ ID NO 982 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 982 gugacucgag ugacccuac 19 <210> SEQ ID NO 983 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 983 guagggucac ucgagucac 19 <210> SEQ ID NO 984 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 984 ugacccuacu gcauaccug 19 <210> SEQ ID NO 985 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 985 cagguaugca guaggguca 19 <210> SEQ ID NO 986 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 986 cauaccugua aaucgaagg 19

<210> SEQ ID NO 987 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 987 ccuucgauuu acagguaug 19 <210> SEQ ID NO 988 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 988 uggucagauc uucaaaaua 19 <210> SEQ ID NO 989 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 989 uauuuugaag aucugacca 19 <210> SEQ ID NO 990 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 990 cuucaaaaua aaaagucau 19 <210> SEQ ID NO 991 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 991 augacuuuuu auuuugaag 19 <210> SEQ ID NO 992 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 992 aagucaucuu aaaaaccug 19 <210> SEQ ID NO 993 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 993 cagguuuuua agaugacuu 19 <210> SEQ ID NO 994 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 994 aaaaccugga ugcauaccc 19 <210> SEQ ID NO 995 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 995 ggguaugcau ccagguuuu 19 <210> SEQ ID NO 996 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 996 gcauacccuu cucuucaag 19 <210> SEQ ID NO 997 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 997 cuugaagaga aggguaugc 19 <210> SEQ ID NO 998 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 998 cuucaagaaa uuuguguuc 19 <210> SEQ ID NO 999 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 999 gaacacaaau uucuugaag 19 <210> SEQ ID NO 1000 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1000 uuguguucac aaaggaaaa 19 <210> SEQ ID NO 1001 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1001 uuuuccuuug ugaacacaa 19 <210> SEQ ID NO 1002 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1002 aaggaaaaau gcaugaagg 19 <210> SEQ ID NO 1003 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1003 ccuucaugca uuuuuccuu 19 <210> SEQ ID NO 1004 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1004 ugcaugaagg gauggauac 19

<210> SEQ ID NO 1005 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1005 guauccaucc cuucaugca 19 <210> SEQ ID NO 1006 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1006 uggauacccc auuuuccau 19 <210> SEQ ID NO 1007 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1007 auggaaaaug ggguaucca 19 <210> SEQ ID NO 1008 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1008 uuuccaugac augauuauu 19 <210> SEQ ID NO 1009 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1009 aauaaucaug ucauggaaa 19 <210> SEQ ID NO 1010 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1010 caugauuauu acacauugc 19 <210> SEQ ID NO 1011 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1011 gcaaugugua auaaucaug 19 <210> SEQ ID NO 1012 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1012 cacauugcau gccuguauc 19 <210> SEQ ID NO 1013 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1013 gauacaggca ugcaaugug 19 <210> SEQ ID NO 1014 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1014 ccuguaucaa aacaucuca 19 <210> SEQ ID NO 1015 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1015 ugagauguuu ugauacagg 19 <210> SEQ ID NO 1016 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1016 caucucacgu accucauaa 19 <210> SEQ ID NO 1017 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1017 uuaugaggua cgugagaug 19 <210> SEQ ID NO 1018 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1018 ccucauaaac auauacacc 19 <210> SEQ ID NO 1019 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1019 gguguauaug uuuaugagg 19 <210> SEQ ID NO 1020 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1020 auacaccuau guacccaca 19 <210> SEQ ID NO 1021 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1021 uguggguaca uagguguau 19 <210> SEQ ID NO 1022 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1022 guacccacaa aaauuuuuu 19

<210> SEQ ID NO 1023 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1023 aaaaaauuuu uguggguac 19 <210> SEQ ID NO 1024 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1024 uaaaaaaagg aaauuugag 19 <210> SEQ ID NO 1025 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1025 cucaaauuuc cuuuuuuua 19 <210> SEQ ID NO 1026 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1026 aauuugaguu uaaauagaa 19 <210> SEQ ID NO 1027 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1027 uucuauuuaa acucaaauu 19 <210> SEQ ID NO 1028 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1028 auagaaacau gauaaaugc 19 <210> SEQ ID NO 1029 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1029 gcauuuauca uguuucuau 19 <210> SEQ ID NO 1030 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1030 gauaaaugca agaaagaaa 19 <210> SEQ ID NO 1031 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1031 uuucuuucuu gcauuuauc 19 <210> SEQ ID NO 1032 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1032 gaaagaaaac auuuugauu 19 <210> SEQ ID NO 1033 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1033 aaucaaaaug uuuucuuuc 19 <210> SEQ ID NO 1034 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1034 acucauuguc acucugaug 19 <210> SEQ ID NO 1035 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1035 caucagagug acaaugagu 19 <210> SEQ ID NO 1036 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1036 cucugauguu caugugaac 19 <210> SEQ ID NO 1037 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1037 guucacauga acaucagag 19 <210> SEQ ID NO 1038 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1038 caugugaacu gguugcuuc 19 <210> SEQ ID NO 1039 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1039 gaagcaacca guucacaug 19 <210> SEQ ID NO 1040 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1040

guugcuucgg gcucuuuga 19 <210> SEQ ID NO 1041 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1041 ucaaagagcc cgaagcaac 19 <210> SEQ ID NO 1042 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1042 ucuuugaucu gucaccuau 19 <210> SEQ ID NO 1043 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1043 auaggugaca gaucaaaga 19 <210> SEQ ID NO 1044 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1044 caccuaugga aucugagug 19 <210> SEQ ID NO 1045 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1045 cacucagauu ccauaggug 19 <210> SEQ ID NO 1046 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1046 aaucugagug guuuuauuu 19 <210> SEQ ID NO 1047 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1047 aaauaaaacc acucagauu 19 <210> SEQ ID NO 1048 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1048 uuuuuuagau uucucaguc 19 <210> SEQ ID NO 1049 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1049 gacugagaaa ucuaaaaaa 19 <210> SEQ ID NO 1050 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1050 cucaguccca aagaucuaa 19 <210> SEQ ID NO 1051 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1051 uuagaucuuu gggacugag 19 <210> SEQ ID NO 1052 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1052 gaucuaagau aaauaaaca 19 <210> SEQ ID NO 1053 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <221> NAME/KEY: source <223> OTHER INFORMATION: /note="Description of Artificial Sequence: Synthetic oligonucleotide" <400> SEQUENCE: 1053 uguuuauuua ucuuagauc 19

* * * * *

References


uspto.report is an independent third-party trademark research tool that is not affiliated, endorsed, or sponsored by the United States Patent and Trademark Office (USPTO) or any other governmental organization. The information provided by uspto.report is based on publicly available data at the time of writing and is intended for informational purposes only.

While we strive to provide accurate and up-to-date information, we do not guarantee the accuracy, completeness, reliability, or suitability of the information displayed on this site. The use of this site is at your own risk. Any reliance you place on such information is therefore strictly at your own risk.

All official trademark data, including owner information, should be verified by visiting the official USPTO website at www.uspto.gov. This site is not intended to replace professional legal advice and should not be used as a substitute for consulting with a legal professional who is knowledgeable about trademark law.

© 2024 USPTO.report | Privacy Policy | Resources | RSS Feed of Trademarks | Trademark Filings Twitter Feed