U.S. patent application number 17/467998 was filed with the patent office on 2022-06-30 for transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same.
The applicant listed for this patent is NMC, INC.. Invention is credited to Richard Thomas Sayre.
Application Number | 20220204982 17/467998 |
Document ID | / |
Family ID | 1000006211326 |
Filed Date | 2022-06-30 |
United States Patent
Application |
20220204982 |
Kind Code |
A1 |
Sayre; Richard Thomas |
June 30, 2022 |
TRANSGENIC PLANTS WITH ENGINEERED REDOX SENSITIVE MODULATION OF
PHOTOSYNTHETIC ANTENNA COMPLEX PIGMENTS AND METHODS FOR MAKING THE
SAME
Abstract
Embodiments of the present invention provide for a transgenic
plan, methods of making and DNA contructs for use in the transgenic
plant which transgenic plant is capable of modulating its
photosynthetic antenna complex composition in response to increases
or decreases in light intensity by modulation of the ratio of
chlorophyll a to chlorophyll b such that there is an increase in
the Chl a/b ratio at high light intensity and a decrease in the Chl
a/b ratio at low light intensity versus wild-type plants grown in
the same conditions.
Inventors: |
Sayre; Richard Thomas; (Los
Alamos, NM) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NMC, INC. |
Los Alamos |
NM |
US |
|
|
Family ID: |
1000006211326 |
Appl. No.: |
17/467998 |
Filed: |
September 7, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16995499 |
Aug 17, 2020 |
11111497 |
|
|
17467998 |
|
|
|
|
15594274 |
May 12, 2017 |
10745708 |
|
|
16995499 |
|
|
|
|
PCT/US2015/060448 |
Nov 12, 2015 |
|
|
|
15594274 |
|
|
|
|
62078936 |
Nov 12, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
Y02A 40/146 20180101;
C12N 15/8269 20130101; C12Y 114/13122 20130101; C12N 15/8222
20130101; C12N 15/825 20130101; C12N 15/8261 20130101; C12N 15/8237
20130101; C12N 9/0073 20130101; C12N 15/8245 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12N 9/02 20060101 C12N009/02 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under
Contract/Grant Nos. EF-1219603 awarded by the National Science
Foundationand; Prime No: DE-SC0001295, Sub No: 21017-NM awarded by
the Department of Energy (DOE-CABS); DE-SC0001035 awarded under
DOE-PARC; DE-EE0006316 awarded under DOE-REAP; DE-EE007089 and DOE
DE-EE0003046 awarded by DOE-PACE. The government has certain rights
in the invention.
Claims
1-34. (canceled)
35. A genetically modified plant wherein a native chlorophyll a
oxidase gene (Cao) has suppressed Cao expression in the genetically
modified plant, the genetically modified plant comprising: a DNA
construct comprising a heterologous expression control sequence
operatively linked to a polynucleotide sequence encoding a
chlorophyll a oxidase wherein the expression control sequence
interacts with a redox-sensitive modulator responsive to changes in
ambient light intensity, wherein the redox-sensitive modulator is
chosen from NAB1, GCD2, and GLD-1.
36. The genetically modified plant of claim 35, wherein the native
chlorophyll a oxidase gene is disrupted using a procedure chosen
from CRISPR/Cas 9 mediated genome editing, TALEN-mediated gene
disruption, chemical mutagenesis coupled with TILING, insertional
mutagenesis coupled with PCR screening for insertion events in the
native chlorophyll a oxidase gene, or gene disruption by RNA
interference (RNAi).
37. The genetically modified plant of claim 35, wherein the
heterologous expression control sequences comprise a cold-shock
domain sequence motif.
38. The genetically modified plant of claim 37, wherein the cold
shock domain sequence motif is operatively linked to a
promoter.
39. The genetically modified plant of claim 38, wherein the
promoter is chosen from the psaD, actin, ubiquitin, .beta.-tublin,
PR-1a, and 35S.
40. The genetically modified plant of claim 35, wherein the DNA
construct includes a reverse compliment of the polynucleotide
sequence encoding a chlorophyll a oxidase fragment and the
expression controlled sequence is a tissue-specific promoter that
is responsive to changes in ambient light intensity
41. The genetically modified plant of claim 40, wherein the
tissue-specific promoter is CAB1 or RbcS.
42. The genetically modified plant of claim 35 wherein the
genetically modified plant may be selected from the group
consisting of millet, corn (maize), sorghum, barley, oats, rice,
rye, teff, triticale, wheat, rice, wild rice, amaranth, beans,
lentils, fava, lupin, peanuts, chickpeas, pigeon peas, soybeans,
mustards, rape seed, safflower, sunflower, flax, jatropha, hemp,
Arabidopsis, Camelina, poppy, trees selected from poplar, willow,
eucalyptus, southern beech, sycamore, and ash, Miscanthus, hemp,
switchgrass, reed, canary grass, rye, giant reed, beets, sweet
sorghum, sugar cane, potatoes, sweet potatoes, cassava, olives,
soybean, rapeseed, and corn.
43. The DNA construct of claim 42, wherein the genetically modified
plant is Camelina.
44. A method to produce a genetically modified plant, the method
comprising the steps of: a) transforming a plant with a
heterologous polynucleotide sequence comprising an expression
control sequence operatively linked to a polynucleotide sequence
encoding a chlorophyll a oxidase wherein the expression control
sequence interacts with a redox-sensitive modulator responsive to
changes in ambient light intensity, wherein the redox-sensitive
modulator is chosen from NAB1, GCD2, and GLD-1 wherein the native
Cao has suppressed Cao expression in the genetically modified
plant; and b) selecting the genetically modified plant that is
capable of modulating the antenna size in response to changes in
light intensity such that there is an increase in the Chl a/b ratio
of the antenna complex composition in the upper canopy (high light
intensity) versus a Chl a/b ratio in an antenna complex composition
in an upper canopy of wild-type plants grown in the same conditions
and a decrease in the Chl a/b ratio in a lower canopy (low light
intensity) of the genetically modified plant as compared to the Chl
a/b ratio in the upper canopy of the genetically modified
plant.
45. A method to produce a genetically modified plant, the method
comprising the steps of: a) producing a genetically modified plant
wherein an endogenous chlorophyll a oxidase gene (Cao) has
suppressed Cao expression; b) transforming the genetically modified
plant with a heterologous polynucleotide sequence encoding for a
modified chlorophyll a oxidase wherein expression of the modified
chlorophyll a oxidase is controlled by changes in ambient light
intensity wherein the expression control sequence interacts with a
redox-sensitive modulator responsive to changes in ambient light
intensity, wherein the redox-sensitive modulator is chosen from
NAB1, GCD2, and GLD-1; and c) selecting a genetically modified
plant that is capable of modulating the antenna size in response to
changes in light intensity such that there is an increase in the
Chl a/b ratio of the antenna complex composition in the upper
canopy (high light intensity) versus a Chl a/b ratio in an antenna
complex composition in an upper canopy of wild-type plants grown in
the same conditions and a decrease in the Chl a/b ratio in a lower
canopy (low light intensity) of the genetically modified plant as
compared to the Chl a/b ratio in the upper canopy of the
genetically modified plant.
46. The method of claim 45, wherein the heterologous polynucleotide
sequence comprises a promoter operatively linked to a cold-shock
domain consensus sequence.
47. The method of claim 46, wherein the cold-shock domain sequence
is chosen from: SEQ. ID. NO. 18-26.
48. The method of claim 46, wherein the heterologous polynucleotide
comprises a promoter operatively linked to the modified chlorophyll
a oxidase chosen from psaD, actin, ubiquitin, .beta.-tublin, 35S,
and PR1-a.
49. The method of claim 44, wherein the heterologous polynucleotide
sequence comprises a tissue targeting sequence.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/995,499, titled "Transgenic Plants with
Engineered Redox Sensitive Modulation of Photosynthetic Antenna
Complex Pigments and Methods for Making the Same", filed on Aug.
17, 2020, which is a continuation of U.S. patent application Ser.
No. 15/594,274, entitled "Transgenic Plants with Engineered Redox
Sensitive Modulation of Photosynthetic Antenna Complex Pigments and
Methods for Making the Same", filed on May 12, 2017, and issued as
U.S. Pat. No. 10,745,708 on Aug. 18, 2020, which is a continuation
of International Patent Application No. PCT/US2015/060448, entitled
"Transgenic Plants with Engineered Redox Sensitive Modulation of
Photosynthetic Antenna Complex Pigments and Methods for Making the
Same", filed on Nov. 12, 2015, which claims priority to and the
benefit of U.S. Provisional Patent Application No. 62/078,936,
entitled "Engineered plants with intermediate size light-harvesting
complex antenna complexes and method for same", filed on Nov. 12,
2014, and the specification and claims thereof are incorporated
herein by reference.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Aug. 17, 2020, is named Sequence Listing 081720 ST25.txt and is
48 KB in size.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ON A COMPACT
DISC
[0004] NA.
COPYRIGHTED MATERIAL
[0005] NA.
BACKGROUND
[0006] Note that the following discussion refers to a number of
publications by author(s) and year of publication, and that due to
recent publication dates certain publications are not to be
considered as prior art vis-a-vis the present invention. Discussion
of such publications herein is given for more complete background
and is not to be construed as an admission that such publications
are prior art for patentability determination purposes.
[0007] Photosynthetic plants utilize sunlight to power all cellular
processes (directly or indirectly) and ultimately derive most or
all of their biomass through chemical reactions driven by light.
All commercially important photosynthetic plants belong to the
kingdom Plantae. They include familiar organisms such as trees,
herbs, bushes, grasses, vines, ferns, mosses, and the Chlorophytic
green algae.
[0008] Plants obtain energy from sunlight via a process called
photosynthesis. Photosynthesis is a process that converts carbon
dioxide into organic compounds, especially sugars, using the energy
from sunlight (Blankenship, 2010). Plants absorb sunlight via their
photosynthetic antenna complexes, also called light harvesting
complexes (LHC) and sometimes referred to herein as light
harvesting antenna complexes, whose function it is to transfer
excitation energy to the reaction center complexes of Photosystem
II (PSII) and Photosystem I (PSI). The reaction centers then drive
electron transfer, photophosphorylation and oxygenic reactions that
lead to energy production and carbon capture in the form of complex
biomolecules (e.g., sugar, starch, lipids, and the like).
[0009] Light harvesting antenna complexes for PSI (termed LHC I)
and PSII (termed LHC II) are composed of pigment-protein complexes.
Light harvesting antenna pigments including chlorophyll a (Chl a)
and chlorophyll b (Chl b) and a variety of accessory pigments
(e.g., carotenoids and xanthophylls) which participate in the
complicated energy transfer route of photosynthesis. The PSII light
harvesting complex includes the proximal (near) antenna Chl a
binding proteins associated with the PSII reaction center; and the
peripheral (distal) antenna Chl a, Chl b, and carotenoid binding
proteins. The peripheral antenna complex of PSII (LHC II) further
comprises the major (outer) more abundant trimeric antenna proteins
that are encoded by nine genes (LHCBM 1-LHCBM9) and a core (inner)
antenna protein complex that is encoded by three genes (LHCB4,
LHCB5 and LHCB7) (Minagawa and Takahashi, 2004). LHC II proteins
contain up to 80% of the total chlorophyll in plant and algal
thylakoid membranes.
[0010] The process of photosynthesis has been optimized through
evolution to produce plants adapted to be more fit in natural
environments; it was not, however, necessarily optimized to give
the highest harvest index in monoculture conditions relevant to
agriculture. Here "harvest index" refers to the yield of the
desired product compared to the total mass of the plant. Strategies
involving reducing the optical cross-section of photosynthetic
light-harvesting antenna size have been developed and successfully
implemented in algal cultures, resulting in improved productivity.
The instant invention describes a similar approach that can be also
utilized in plants for improved productivity. Engineered plants
with a range of chlorophyll a/b ratios, and, as a result, light
harvesting antenna sizes can be produced. An optimal range of
antenna sizes results in improved photosynthetic performance and
the invention describes a sharp transition point where further
reductions in antenna size becomes detrimental to photosynthetic
efficiency. We hypothesize that this transition point is related to
a phase transition in the arrangement of photosystem II in
thylakoid membranes, regulated by the abundance of light harvesting
complexes II. Plants with optimized antenna perform well not only
in controlled greenhouse conditions, but also in the field.
Embodiment of the present invention provides transgenic plants
having improved yield of productivity, constructs and methods of
use to produce said tranasgenic plants.
[0011] In nature, photosynthetic cells may adjust to altered light
environments in order to optimize energy capture and conversion
efficiency or, alternatively, to protect the cells from too much
light. Cells adjusted to low light levels typically possess larger
light harvesting antenna complexes than those acclimated to high
light intensities so as to maximize light capture at limiting light
conditions. Such low light acclimated plants have lower Chl a/b
ratios as the photosystems contain relatively high amounts of Chl b
and have a large light-harvesting complex (LHC) antenna (composed
mostly of chlorophylls a and b). It has been reported plants that
can adapt to high light intensity but the linkage to defined chl
a/b ratios and improved yields has not been proven. Adapted plants
that are grown under high light (HL) intensity, were shown to have
relatively low amounts of Chl b in their LHC, smaller LHC antenna,
and a higher Chl a/b ratio (Bjorkman et al., 1972; Leong and
Anderson, 1984; Larsson et al., 1987). However, other studies have
shown that photosynthetic cells acclimated to high light
intensities have 50% lower cellular Chl contents but show only
slight (if any) increases in the Chl a/b ratio (Neale and Melis,
1986).
[0012] A negative consequence of having efficient light harvesting
complexes is that photosynthetic electron transfer in nearly all
photosynthetic cells becomes light saturated at only 25% of full
sunlight intensity (here full sun is assumed to be 2000 .mu.mol
photons m-2s-1 at 400-700 nm) (Polle et al., 2001). At high
photosynthetic photon flux densities (photosynthetic photon flux
density is a measure of the number of photons in the 400-700 nm
range of the visible light spectrum that fall on a square meter of
target area per second), the rate of photon absorption exceeds the
rate at which photosynthesis can convert the energized antenna
complexes into productive charge transfer processes (that are used
to produce reducing equivalents and energy). Over excitation of the
light harvesting antenna complex under high light intensities
increases the potential for long-lived excited states and
photo-oxidative damage in plants, this is due to the generation and
accumulation of reactive oxygen species (ROS) such as chlorophyll
in its triplet state (3Chl) and reactive oxygen species
(Krieger-Liszkay et al., 2008, Vass and Cser, 2009).
[0013] Plants have short- and long-term responses to protect the
photosynthetic apparatus from the harmful effects of excess light.
Short-term responses include the thermal dissipation of excess
absorbed photons (qE) and state transitions (qT), both of which are
components of non-photochemical quenching (NPQ). The qE
(energy-dependent quenching) processes involve the de-excitation of
Chl in its singlet excited state (Chl*) formed in the PSII antenna
upon light absorption to minimize the formation of triplet state
chlorophyll (3Chl) and ROS in the photosynthetic apparatus (Muller
et al., 2001). Processes associated with qT are involved in
regulating the relative excitation of PSII and PSI and thereby
regulate linear and cyclic electron flow during photosynthesis
(Eberhard et al., 2008). Longer term responses occur over hours and
days after high light exposure and include transcriptional and
translation level changes in LHC mRNAs and high light induced
mRNAs, PSII core protein (D 1) turnover and PSII repair, and
increases in the xanthophyll cycle carotenoids. Hence, under high
light intensities, up to 80% of absorbed photons can be dissipated
as heat or fluorescence due to fluorescence and the activation of
the short-term photoprotective responses (NPQ) causing large
decreases in light utilization efficiency and photosynthetic
productivities (Polle et al., 2002).
[0014] Chl b is synthesized from proto-Chl a by chlorophyll a
oxygenase (CAO) which is sometimes referred to in the literature as
chlorophyll b synthase. Either nomenclature applies to the instant
invention. The overexpression of the Cao gene leads to the
enhancement of Chl b biosynthesis in Arabidopsis and consequently
to an enlargement of the PSII-associated peripheral antenna (Tanaka
et al., 2001). Significantly, Chl b-less mutants (cbs-3) of a green
alga, Chlamydomonas, have substantially elevated light-saturated
photosynthetic oxygen evolution rates (up to 1.25 fold increase
when expressed on a Chl basis) compared to the wild-type and do not
light saturate at full sunlight intensities (Polle et al., 2000).
Moreover, studies where the size of the LHC II has been
preferentially attenuated have shown that reducing PSII antenna
size (and not PSI) results in higher rates of oxygen evolution at
high light intensities than wild-type cells (Polle et al., 2002;
Polle et al., 2001).
[0015] Embodiments of transgenic plants of the present invention
are engineered to artificially modulate the light harvesting
complexes. For example, the modulation of the LHC can occur in a
tissue-specific manner that is, the expression of one or more genes
is linked either to a light-activated promoter or is driven by a
tissue-specific promoter that is only active in photosynthetic
tissues of the plant. Unexpectedly, a transgenic plant as described
according to one embodiment of the present invention provides for
improved partition of a significant amount of the improved carbon
fixation into storage tissues such as the seed or starch rather
than a generalized increase in biomass of all tissues.
Additionally, these transgenic plants have improved rates of
growth, starch accumulation in plastids, and non-photochemical
quenching (high light photoprotection) in comparison to wild-type
plants grown under the same condition.
[0016] This and other unmet needs of the prior art are met by
exemplary compositions and methods as described in more detail
below.
BRIEF SUMMARY OF THE INVENTION
[0017] One embodiment of the present invention provides for a
transgenic plant capable of modulating its photosynthetic antenna
complex composition in response to increases or decreases in light
intensity by modulation of the ratio of chlorophyll a to
chlorophyll b such that there is an increase in the Chl a/b ratio
at high light intensity and a decrease in the Chl a/b ratio at low
light intensity versus wild-type plants grown in the same
conditions. The transgenic plant's native chlorophyll a oxidase
gene may be excised, disrupted or suppressed. For example, the
native chlorophyll a oxidase gene is disrupted using a procedure
chosen from CRISPR/Cas 9 mediated genome editing, TALEN-mediated
gene disruption, chemical mutagenesis coupled with TILING,
insertional mutagenesis coupled with PCR screening for insertion
events in the native chlorophyll a oxidase gene, gene disruption by
RNA interference (RNAi). In a preferred embodiment, the transgenic
plant comprises a DNA construct comprising a heterologous
expression control sequence operatively linked to a polynucleotide
sequence encoding a chlorophyll a oxidase or fragment thereof. The
expression control sequence may interact with a redox-sensitive
modulator responsive to changes in ambient light intensity and the
redox-sensitive modulator may be chosen from NAB1, GCD2, and GLD-1.
The expression control sequences may comprise a cold-shock domain
sequence motif and in a preferred embodiment, the cold shock domain
sequence motif is chosen from CSDDCS and may be operatively linked
to a promoter. The promoter may be chosen from the group consisting
of psaD, actin, ubiquitin, .beta.-tublin, PR-1a, and 35S or the
promoter is a tissue-specific promoter such as CAB1 or RbcS. In a
preferred embodiment, the polynucleotide sequence of the construct
is a heterologous DNAsequence. The DNA construct may include a
reverse compliment of the polynucleotide sequence encoding a
fragment of chlorophyll a oxidase and the expression controlled
sequence may be a tissue-specific promoter that is responsive to
changes in ambient light intensity.
[0018] Another embodiment provides for a method to produce a
transgenic plant with the ability to modulate its Chl a/b ratio of
an antenna complex in response to ambient sunlight comprising the
steps of stably transforming a plant with a heterologous
polynucleotide sequence containing targeting sequences to a portion
of an endogenous chlorophyll a oxidase gene wherein the
heterologous polynucleotide sequence excises, disrupts or
suppresses expression of the endogenous chlorophyll a oxidase gene
in response to changes in ambient light intensity. A transformant
is selected that is capable of modulating the antenna size in
response to changes in light intensity.
[0019] In another method, a transgenic plant is produced with the
ability to modulate its Chl a/b ratio of an antenna complex in
response to ambient sunlight comprising the steps of producing a
transgenic plant wherein an endogenous chlorophyll a oxidase gene
has been disrupted. The transgenic plant is stably transformed with
a heterologous polynucleotide sequence encoding for a modified
chlorophyll a oxidase wherein expression of the modified
chlorophyll a oxidase is controlled by changes in ambient light
intensity. A transformant is selected that is capable of modulating
the antenna size in response to changes in light intensity. In a
preferred embodiment, the heterologous polynucleotide sequence
comprises a promoter operatively linked to a cold-shock domain
consensus sequence, for example the cold-shock domain sequence is
chosen from the group consisting of: SEQ. ID. NO. 18-26.
Additionally, the heterologous polynucleotide may comprise a
promoter operatively linked to the modified chlorophyll a oxidase
chosen from psaD, actin, ubiquitin, .beta.-tublin, 35S, and PR1-a.
In a preferred embodiment, the heterologous polynucleotide sequence
comprises a tissue targeting sequence.
[0020] Another embodiment of the present invention provides for a
DNA construct for producing a transgenic plant comprising a
heterologous expression control sequence operatively linked to a
polynucleotide sequence encoding a chlorophyll a oxidase or
fragment thereof wherein expression of the polynucleotide sequence
is controlled by changes in ambient light intensity. In a preferred
embodiment, the heterologous expression control sequence is under
the control of a redox-sensitive modulator which is responsive to
changes in ambient light intensity. For example, the heterologous
expression control sequence comprises a promoter that is
operatively linked to a cold-shock domain consensus sequence and
preferably the cold-shock domain sequence is chosen from the group
consisting of: SEQ. ID NO. 18-26. In a preferred embodiment the
promoter is chosen from psaD, actin, ubiquitin, .beta.-tublin, 35S,
and PR1-a and/or the redox-sensitive modulator is chosen from NAB1,
GCD2, and GLD-1. In a preferred embodiment, the heterologous
expression control sequence is a promoter responsive to changes in
ambient light intensity and the polynucleotide sequence encodes for
a portion of a chlorophyll a oxidase and a reverse compliment
thereof. For example, the chlorophyll a oxidase or a fragment
thereof for which the polynucleotide sequence encodes is selected
from the group consisting of SEQ ID NO 1-5. Alternatively, the
polynucleotide encodes a polypeptide having chlorophyll a oxidase
activity or a polypeptide that is shorter than the polypeptide
having chlorophyll a oxidase activity but has substantial sequence
homology to the native gene for that portion of the polynucleotide
expressed.
[0021] The transgenic plant may be selected from the group
consisting of millet, corn (maize), sorghum, barley, oats, rice,
rye, teff, triticale, wheat, rice, wild rice, amaranth, beans,
lentils, fava, lupin, peanuts, chickpeas, pigeon peas, soybeans,
mustards, rape seed (canola), safflower, sunflower, flax, jatropha,
hemp, Arabidopsis, Camelina, poppy, trees (poplar, willow,
eucalyptus, southern beech, sycamore, ash), Miscanthus, hemp,
switchgrass, reed, canary grass, rye, giant reed, beets, sweet
sorghum, sugar cane, potatoes, sweet potatoes, cassava, olives,
soybean, rapeseed, and corn and preferably is Camelina. In a
preferred embodiment, the Chl a/b ratio at high light levels in the
transgenic plants is around 10% greater than that seen in wild-type
plants. For example, the Chl a/b ratio is between 4 and 8 under
high light intensity and preferably the Chl a/b ratio is between 5
and 8 under high light intensity. Preferably there is greater than
around 10% increase in accumulation of the transgenic plant carbon
sink storage compounds over the wild-type plant, for example, the
transgenic plant storage compounds are chosen from lipid, starch,
sugar, waxes, pigments and oils. In a preferred embodiment, the
transgenic plant grows at around 10% faster than the wild-type
plant of the same strain.
[0022] One aspect of the present invention provides methods and
compositions for producing transgenic plants capable of
self-modulating the size of photosystem II (PSII) peripheral
antenna complex by regulating the expression of the chlorophyll a
oxygenase gene (Cao) in response to different light intensities and
in a tissue-specific manner as compared to wildtype plants. Also
provided are transgenic plants that also exhibit enhanced
photosynthetic productivity, higher yields of plant storage
compounds, higher rates of growth, and/or other enhanced traits,
(as compared to wild-type plants of the same strain) and methods
for their use.
[0023] One aspect of such an enhanced transgenic photosynthetic
plant provides for improved production systems with higher
flexibility in growth conditions and improved yields.
[0024] An embodiment of the present invention describes methods for
generating transgenic plants capable of modulating their PSII
peripheral antenna size as a function of light intensity, and
exhibit enhanced photosynthetic productivity. Although wild-type
algae have pre-existing mechanisms to modulate the expression and
size of their LHC II antenna at the transcriptional and
post-transcriptional level under varying light levels (Durnford et
al., 2003) the range of PSII antenna adjustment in wild-type plants
is limited and cannot be similarly controlled to provide the
advantages provided by the current invention.
[0025] One embodiment of the present invention takes advantage of a
recently described light regulated and redox-sensitive,
trans-acting protein factor called nucleic acid binding protein 1
("NAB 1") that binds to LHC II mRNAs, negatively regulating their
translation leading to a reduction of LHC II content under high
light growth conditions in Chlamydomonas reinhardtii (Mussgnug et
al., 2005). NAB1 binds to a cold-shock domain consensus sequence
(CSDCS) motif found in several LHC II mRNAs (for example LHCM B6),
sequestrating them into translationally silent messenger
ribonucleoprotein complexes. By inserting the CSDCS element of the
LHCM B6 mRNA into the promoter region used to control the
expression of the Cao gene, transgenic organisms of the instant
invention modulate the expression of the Cao gene in a light
dependent manner. At high light intensity the NAB 1 protein binds
to its respective mRNA binding site on the engineered Cao
transcript, repressing its translation and the synthesis of Chl b,
resulting in a reduced PSII peripheral antenna size. Conversely,
under lower light intensities translational repression by NAB 1 is
reduced due to lower NAB 1 expresssion levels allowing for
increased levels of Cao gene translation and Chl b synthesis
leading to the assembly of wild-type levels of the peripheral PSII
antenna and in increased light capture at lower light
intensities.
[0026] Embodiments of transgenic plants of the present invention
are engineered to modulate LHC abundance in a tissue-specific
manner that is, the expression of genes is linked either to a
light-activated promoter or is driven by a tissue-specific promoter
that is only active in photosynthetic tissues of the plant.
[0027] These transgenic plants are capable of modulating their PSII
peripheral antenna size as a function of light intensity, and
exhibit enhanced photosynthetic productivity compared to wild-type
plants. Such enhanced photosynthetic plants provide for improved
production systems with higher flexibility in growth conditions and
improved yields. Unexpectedly, these plants partition much of the
improved carbon fixation into storage tissues such as the seed or
starch rather than a generalized increase in biomass of all
tissues. Additionally, these plants have improved rates of growth,
starch accumulation in plastids, and non-photochemical quenching
(high light photoprotection) in comparison to wild-type plants
grown under the same condition.
[0028] This and other unmet needs of the prior art are met by
exemplary compositions and methods as described in more detail
below. Exemplary embodiments of the compositions, systems, and
methods disclosed herein provide enhanced yields of plants and or
carbon sink within the plant(s). In a further embodiment the
enhanced yields of the modified plants are not reflected in a
generalized increase in all tissues but rather an increase in
storage tissues for such generalized storage compounds such as but
not limited to polysaccharides, proteins and lipids. In general
compounds that store carbon for later use in metabolic processes
are considered carbon sinks and will be referred to as such in this
application.
[0029] In yet a further embodiment the enhanced yields are
accompanied by an increased overall growth rate of the engineered
plants relative to wild-type plants grown under identical
conditions.
[0030] In one aspect, embodiments of the present invention provide
novel elements for engineering plants to contain intermediate size
(Chl a/b ratios between 3 and 6) self-adjusting light-harvesting
antenna complexes in a tissue-specific manner.
[0031] Another embodiment of the present invention provides a novel
step to generate chlorophyll a oxygenase gene (Cao) knockouts in
plants using one of several strategies including but not limited
to: clustered regularly interspaced short palindromic repeats
coupled with the Cas 9 nuclease (CRISPR/Cas9) mediated gene
disruption (Cong et al., 2013, Zhang, 2014), transcription
activator-like effector nuclease (TALEN)-mediated gene disruption
(Gaj et al., 2013), chemical mutagenesis coupled with targeting
induced local lesions in genomes (TILING) (Coman et al., 2013,
Leviatan et al., 2013), and insertional mutagenesis coupled with
PCR screening for insertion event in the Cao gene.
[0032] In a further embodiment Cao gene knockout plants (where the
endogenous Cao gene has been deleted or rendered non-functional)
are modified with the introduction of 5' modified Cao gene into Cao
knockout plant background using Ti Plasmid-mediated transformation.
The introduced Cao gene has been modified to include either 3' or
5' nucleotide translation inhibitor binding domains that interact
with specific trans-acting, translational repressor proteins from
various sources such as: NAB1 (algae), the GCD2 (yeast;
Saccharomyces cerevisiae) (Foiani et al., 1991), GLD-1 from mouse
S4 in Escherichia coli (Jinks-Robertson and Nomura, 1982), STAR
proteins (Saccomanno et al., 1999) and bacteriophage RB69 RegA
(Jozwik and Miller, 1995) and other trans-acting repressors.
[0033] In yet a further embodiment, the expression of the
translational repressor/inhibitor protein is controlled by a
leaf-specific and light-induced gene promoter such as CAB1, rbcS,
Dof 1, PPDK, and the like (Yanagisawa and Sheen, 1998, Matsuoka et
al., 1993, Chattopadhyay et al., 1998). So that CAO protein is
suppressed in high light but active in low light. The net result is
higher Chl a/b ratios in high light intensity (upper canopy) and
lower Chl a/b ratios in low light intensity (lower canopy) as
compared to wild type.
[0034] In another embodiment, the plant's endogenous Cao is either
modified, disrupted or repressed.
[0035] In another embodiment, siRNA technology is used to regulate
expression of the Cao gene to modulate the Chl a/b ratios and
antenna size in plants. The siRNA construct(s) targeting the Cao
gene (CAOi) is introduced into plants using Agrobacterium
Ti-plasmid. Expression of Cao siRNA constructs is controlled by a
leaf-specific and light induced gene promoter which can be but is
not limited to CAB1, rbcS, Dof 1, PPDK, and the like (Yanagisawa
and Sheen, 1998, Matsuoka et al., 1993, Chattopadhyay et al.,
1998).
[0036] In another embodiment, plants of the instant experiment have
a Chl a/b ratio of about 5 and exhibit higher areal rates of
photosynthesis than plants having any other Chl a/b ratio.
[0037] In yet another embodiment, plants with Chl a/b ratios of
about 5 also have the higher levels of non-photochemical quenching
(NPQ) than wild-type plants.
[0038] In yet another embodiment, plants with Chl a/b ratios of
about 5 have higher starch or storage compound accumulation than
wild-type.
[0039] In yet another embodiment, plants with intermediate antenna
sizes (Chl a/b in the range of about 4 to 6) had reduced lower leaf
drop and lower leaves persisted longer than those in mature
wild-type plants.
[0040] In another embodiment, siRNA constructs targeting the Cao
gene (CAOi) have Chl a/b ratios about 5 and grow faster than
wild-type plants under the same conditions.
[0041] In a further embodiment, plants having siRNA elements
targeting the Cao gene have higher seed count than wild-type plants
and enhanced per plant seed mass to at least about 15% higher to,
preferably, about double that of the wild-type plant.
[0042] In another aspect, the transgenic plant comprises a DNA
construct comprising heterologous expression control sequence that
is capable of binding to a redox-sensitive modulator that is
responsive to ambient light intensity. In one aspect, a
redox-sensitive repressor is more active at low light intensity,
than at high light intensity.
[0043] In another aspect, the redox-sensitive modulator is NAB 1.
In another aspect, the expression control sequences comprise a
cold-shock domain consensus sequence (CSDDCS) motif. In yet another
aspect, the expression control sequences further comprise a
promoter operatively linked to the cold-shock domain consensus
sequence. In one aspect, the promoter is selected from the group
consisting of psaD, actin, ubiquitin, and .beta.-tubulin.
[0044] In one aspect, the expression control sequences are
operatively coupled to a polynucleotide sequence encoding the CAO
protein. In one aspect, the polynucleotide sequence encoding the
CAO protein is a heterologous nucleic acid sequence.
[0045] In another aspect, the transgenic plant comprises a
heterologous redox-sensitive modulator. In one aspect, the
heterologous redox-sensitive modulator is NAB 1. In another aspect,
the transgenic plant exhibits an increase in biomass production
compared to wild-type plants grown under identical conditions.
[0046] In another embodiment, a method of producing an improved
plant, comprising the steps of stably transforming a plant with a
heterologous polynucleotide sequence comprising expression control
sequences comprising a cold-shock domain consensus sequence
(CSDDCS) motif, that is capable of binding to a redox-sensitive
modulator that is responsive to ambient light intensity; selecting
a transformant that is capable of modulating PSII antenna size in
response to ambient light intensity is provided.
[0047] In one aspect, the heterologous polynucleotide sequences
comprise targeting sequences specific for the plant's endogenous
Cao gene.
[0048] In one aspect, the plant's endogenous chlorophyll a oxidase
gene (Cao) has been modified, disrupted or suppressed.
[0049] In one aspect, the expression control sequences further
comprise a promoter operatively linked to the cold-shock domain
consensus sequence. In one aspect, the promoter is selected from
the group consisting of psaD, actin, ubiquitin, and
.beta.-tubulin.
[0050] In one aspect, the expression control sequences are
operatively coupled to a polynucleotide sequence encoding the CAO
protein.
[0051] In one aspect, the selection is based on screening
transgenic organisms that exhibit an increase in Chl a/b ratios
when grown under high light intensity conditions, and a decrease in
Chl a/b ratios when grown under low light intensity conditions.
[0052] In one aspect, the selection is based on screening the
transgenic plants that exhibit an increase in biomass production
compared to wild-type organisms grown under identical
conditions.
[0053] In one aspect, the plant comprises a heterologous
redox-sensitive modulator.
[0054] In one aspect, the heterologous redox-sensitive modulator is
NAB 1.
[0055] In another embodiment, the invention includes a method of
enhancing yields of photosynthetic productivity under conditions of
high light intensity, and or high density growth, the method
comprising providing a plant comprising a heterologous
polynucleotide sequence comprising expression control sequences
comprising a cold-shock domain consensus sequence (CSDDCS) motif
operatively coupled to a polynucleotide sequence encoding the CAO
protein; wherein expression of the Cao is increased at low light
intensity, compared to the expression of the Cao at high light
intensity; cultivating the transgenic plant at high light intensity
and I or high density.
[0056] In another embodiment, the invention includes a method of
enhancing bio-oil, or bio-diesel production from a plant the method
comprising providing plant comprising a heterologous polynucleotide
sequence comprising expression control sequences comprising a
cold-shock domain consensus sequence (CSDDCS) motif operatively
coupled to a polynucleotide sequence encoding the CAO protein,
wherein expression of the Cao gene is increased at low light
intensity, compared to the expression of the Cao gene at high light
intensity; and cultivating the plant at high light intensity and I
or high density.
[0057] In another embodiment, the invention includes a method of
enhancing .beta.-carotene, lutein, or zeaxanthin production from a
plant, the method comprising; providing plant comprising a
heterologous polynucleotide sequence comprising expression control
sequences comprising a cold-shock domain consensus sequence
(CSDDCS) motif operatively coupled to a polynucleotide sequence
encoding the CAO protein, wherein expression of the Cao is
increased at low light intensity, compared to the expression of the
Cao at high light intensity; and cultivating the plant at high
light intensity and I or high density.
[0058] In one aspect of any of these methods, the transgenic
plant's endogenous chlorophyll a oxidase gene (Cao) has been
modified, disrupted or suppressed.
[0059] In another aspect of any of these methods, the expression
control sequences further comprise a promoter operatively linked to
the cold-shock domain consensus sequence. In one aspect of this
embodiment, the promoter is selected from the group consisting of
psaD, actin, ubiquitin, and .beta.-tubulin.
[0060] In another aspect of any of these methods, the
polynucleotide sequence encoding the CAO protein is a heterologous
nucleic acid sequence.
[0061] In another aspect of any of these methods, the plant
comprises a heterologous redox-sensitive translational repressor.
In one aspect of this embodiment, the heterologous redox-sensitive
repressor is NAB 1.
[0062] In another embodiment, the current invention includes an
expression vector comprising expression control sequences
comprising a cold-shock domain consensus sequence (CSDDCS) motif
operatively coupled to a polynucleotide sequence encoding the CAO
protein.
[0063] In one aspect, the expression vector further comprises a
promoter operatively linked to the cold-shock domain consensus
sequence. In one aspect, the promoter is selected from the group
consisting of psaD, actin, ubiquitin, and .beta.-tubulin. In one
aspect the expression vector comprises a CSDDCS motif is selected
from the group consisting of SEQ ID. No. 18, SEQ ID. No. 19, SEQ
ID. No. 20, SEQ ID. No. 21, SEQ ID. No. 22, SEQ ID. No. 23, SEQ ID.
No. 24, SEQ ID. No. 25, and SEQ ID. No. 26.
[0064] In one aspect the expression vector comprises a Cao gene
selected from the group consisting of SEQ ID. No. 1, SEQ ID. No. 2,
SEQ ID. No. 3, SEQ ID. No. 4, and SEQ ID. No. 5.
[0065] Further scope of applicability of the present invention will
be set forth in part in the detailed description to follow, taken
in conjunction with the accompanying drawing, and in part will
become apparent to those skilled in the art upon examination of the
following, or may be learned by practice of the invention. The
objects and advantages of the invention may be realized and
attained by means of the instrumentalities and combinations
particularly pointed out in the appended claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0066] The accompanying drawings, which are incorporated into and
form a part of the specification, illustrate one or more
embodiments of the present invention and, together with the
description, serve to explain the principles of the invention. The
drawings are only for the purpose of illustrating one or more
preferred embodiments of the invention and are not to be construed
as limiting the invention. A better understanding of the features
and advantages of the present invention exemplary embodiments of
the invention will be had when reference is made to the
accompanying drawings.
[0067] FIG. 1--Schematic of fixation of carbon during
photosynthesis.
[0068] FIG. 2--Illustration explaining the underlying basis and
utility of the invention on light capture and use.
[0069] FIG. 3--Conversion of chlorophyll a (Chl a) to chlorophyll b
(Chl b) is accomplished by the Chl a oxygenase enzyme (CAO). One
embodiment of the current invention reduces or eliminates
expression of this gene.
[0070] FIG. 4A-B--Two constructs useful for the Agrobacterium Ti
plasmid-mediated transformation of Camelina sativa (C. sativa)
according to one or more embodiments of the present invention.
[0071] FIG. 5--Photosynthetic rates are compared under different
light intensities in transgenic Camelina plants where siRNA
technology was used to control expression the Cao gene at different
rates. The abbreviation CAOi indicates that the chlorophyll a
oxidase gene is under the control of an engineered siRNA
effector.
[0072] FIG. 6A-B--Comparison of the Chl a/b ratio at different
positions on the plant as well as the relative chlorophyll content
per unit leaf area at different positions on the plant. The x axis
of the bar chart on FIG. 6A shows three different CAOi mutants
(CAOi 4, 6 & 7) and the wild-type plant. FIG. 6B illustrates
the Ch./Leaf Area of different leaf positions compared to Wild Type
(WT).
[0073] FIG. 7--Light transmittance through leaves of wild-type and
chlorophyll a oxidase expression mutants generated using RNAi
techniques (CAOi mutants). These provided chlorophyll a/b ratios of
6 while the wild-type plants tested had chlorophyll a/b ratios of
3.
[0074] FIG. 8A-D--Comparison of the chlorophyll fluorescence of
wild-type Camelina and a CAOi mutant. The original pictures were
false color with blue, green, yellow and red used to indicate
different levels of fluorescence. Blue represented no or low
chlorophyll fluorescence, green low fluorescence, yellow increasing
fluorescence and red high fluorescence. The CAOi mutant leaf in all
the figures had an area of low fluorescence in the upper right
portion of the leaf that appears as dark grey (blue in original
picture). After 1 sec of light the CAOi mutant had low fluorescence
(light grey/green) while the WT quickly showed increased
fluorescence (light grey/yellow). After 10 seconds of light
exposure, the CAOi mutant began to demonstrate increased
fluorescence around its tip (light grey/yellow) while the WT was
highly fluorescent (dark grey/red). On prolonged exposure to light
(1 min and 5 min) the CAOi and WT reverted to a steady state where
the CAOi mutant had low fluorescence (grey/green) and WT had
increased fluorescence (light grey/yellow).
[0075] FIG. 9--Non-photochemical quenching (NPQ) over time for
several different mutant CAOi lines compared to wild-type. The
upper bar represents when the light was on (clear) or off
(dark).
[0076] FIG. 10--Comparison of the proteins associated with the
photosynthetic complexes of wild-type and CAOi mutant lines of
Camelina.
[0077] FIG. 11A-D--Impact of CAOi inhibition of the antenna complex
on accumulation of starch in Camelina and the number of granules
per cross-sectional view of the thylakoid under electron
microscopic examination.
[0078] FIG. 12A-B--Camelina CAOi mutant plants (CAOi) compared to
wild-type plants (WT) have more leaves and extended lifetimes.
[0079] FIG. 13--Camelina CAOi mutant line (CAOi 8-1; Chl a/b ratio
6) at three weeks in a greenhouse trial grows more rapidly than
wild-type line (Chl a/b ratio=3).
[0080] FIG. 14A-B--Comparison of CAOi line (CAOi 8-1) to wild-type
lines for plant weight, pod weight and number of pods.
[0081] FIG. 15--Construct for transformation of Arabidopsis to
generate a line as described in Example 4. Physical map of
pb110-CAO-NAB-cab-nos Agrobacterium Ti-plasmid. Pb110 backbone was
used to harbor an Arabidopsis CAO gene with a Chlamydomonas LRE
(Light Responsive Element) fused to the 5' end of an Arabidopsis
Cao gene driven by the Arabidopsis CAO-promoter (CAO-pro) and
CAO-terminator (CAO-term); as well as NAB1 gene (from
Chlamydomonas) driven by light-sensitive cab-promoter and
nos-terminator). LB/RB T-DNA--left/right border. The downstream
(for promoter) or upstream (for terminator) DNA sequences of CAO
gene from Arabidopsis so that translation of the gene is regulated
by same promoter and terminator as in growing plant.
[0082] FIG. 16A is a schematic representation of the gene construct
used to induce siRNA silencing of the CAO genes in C. sativa. FIG.
16B is a comparison of growth phenotypes of 3-week old wild type
and transgenic plants. FIG. 16C is a comparison of fully developed
pod size in WT, CR L-I, CR H-I and CR V-H lines. The pod
development in CR H-I and CR V-H lines is not compromised, while CR
V-H pods are much smaller at maturity. Scale bar, 1 cm.
[0083] FIG. 17A is Photosynthesis light saturation response curves
of WT, CR L-I, CR H-I and CR V-H. FIG. 17B is Non-photochemical
quenching (NPQ) in in WT, CR L-I, CR H-I and CR V-H. Leaves were
exposed to 150 s of actinic light (800 .mu.mol photons m-2 s-1;
white bar) followed by 150 s of dark relaxation (black bar).
[0084] FIG. 18A-M provides a comparison of thylakoid structure and
PSII complex composition of WT and CR transgenics. Panels a through
h represent--Electron micrographs of thylakoid membranes from the
wild type and CR lines obtained by transmission electron
microscopy. Leaves from 3-week-old wild-type and CR L-I, CR H-I,
and CR V-H plants were directly fixed 3 h after the start of the
light phase of the growth photoperiod and prepared for transmission
electron microscopy. Chloroplast sections are shown for the wild
type (a & e), CR L-I (b & f), CR H-I (c & g), and CR
V-H (d & h) plants. Bars in the top and bottom panels are 50
and 100 nm in length, respectively.
[0085] Physical parameters of the thylakoids in WT and mutant
lines. (i) The thickness of thylakoid double membranes in WT and CR
L-I, CR H-I, and CR V-H mutants, (j) The thickness of lumen in WT
and CR mutants (k) Amount of thylakoids per granum in wild type and
mutants. Average and maximum number of thylakoids per stack are
shown (1) Amount of starch granules per section in chloroplasts of
WT and CR L-I, CR H-I, and CR V-H mutants.
[0086] In Panel m is the blue native polyacrylamide electrophoresis
(BN-PAGE) gel of PSII supercomplex formation as a function of Chl b
abundance. Thylakoid membranes (8 .mu.g of chlorophyll) isolated
from wild type and CR L-I, CR H-I, and CR V-H lines were
solubilized with final concentration of 1% (w/v) .alpha.-DM and
subjected to BN-PAGE. Identities of the photosystem complexes are
given on the left of the panel. The PSII supercomplexes are
assigned as follows: SC1 (C2S or C2M), SC2 (C2S2 and C2SM), SC3
(C2S2M) and SC4 (C2S2M2).
[0087] FIG. 19--Photograph of Arabidopsis NAB1-CAO transgenic lines
(labeled as NAB.CAO-1 & NAB.CAO-3) and the chlorophyll b minus
(no chl b) Chlorina mutant lines (labeled Chl-5 & CHL-7).
Transgenic NAB1-CAO lines are Left of the ruler and Chlorina lines
are Right of the ruler.
[0088] FIG. 20--Non-photochemical Quenching (NPQ) of Arabidopsis
NAB1-CAO transgenics and Chlorina plants (4 week old) grown in
moderate light intensity 150-180 .mu.moles, and high light (400
.mu.moles) treatment for 5 hours.
DETAILED DESCRIPTION OF THE INVENTION
[0089] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used in the practice of the exemplary
embodiments, suitable methods and materials are described below.
All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. In case of conflict, the present specification, including
definitions, will control. In addition, the materials, methods, and
examples are for illustrative purposes only and not intended to be
limiting.
[0090] As used herein, the singular forms "a," "an," and "the,"
include plural referents unless the context clearly indicates
otherwise. Thus, for example, reference to "a molecule" includes
one or more of such molecules, "a reagent" includes one or more of
such different reagents, reference to "an antibody" includes one or
more of such different antibodies, and reference to "the method"
includes reference to equivalent steps and methods known to those
of ordinary skill in the art that could be modified or substituted
for the methods described herein.
[0091] Where a range of values is provided, it is understood that
each intervening value, to the tenth of the unit of the lower limit
unless the context clearly dictates otherwise, between the upper
and lower limits of that range is also specifically disclosed. Each
smaller range between any stated value or intervening value in a
stated range and any other stated or intervening value in that
stated range is encompassed within the invention. The upper and
lower limits of these smaller ranges can independently be included
or excluded in the range, and each range where either, neither or
both limits are included in the smaller ranges is also encompassed
within the invention, subject to any specifically excluded limit in
the stated range. Where the stated range includes one or both of
the limits, ranges excluding either or both of those included
limits are also included in the invention.
[0092] The terms "about" or "approximately" means within an
acceptable error range for the particular value as determined by
one of ordinary skill in the art, which will depend in part on how
the value is measured or determined, i.e., the limitations of the
measurement system. For example, "about" can mean within 1 or 2
standard deviations, from the mean value. Alternatively, "about"
can mean plus or minus a range of up to 20%, preferably up to 10%,
more preferably up to 5%.
[0093] As used herein, the terms "cell," "cells," "host cell," and
"host cells," are used interchangeably and, encompass any cells and
preferably includes plant, and algal cells. All such designations
include cell populations and progeny. Thus, the terms
"transformants" and "transfectants" include the primary subject
cell and cell lines derived therefrom without regard for the number
of transfers.
[0094] As used herein a "control plant" means a plant that does not
contain the recombinant DNA that expressed a protein or element
that imparts an enhanced trait. A control plant is to identify and
select a transgenic plant that has an enhanced trait. A suitable
control plant can be a non-transgenic plant of the parental line
used to generate a transgenic organism, i.e. devoid of recombinant
DNA. A suitable control organism may in some cases be a progeny of
a hemizygous transgenic plant that does not contain the recombinant
DNA, known as a negative segregant.
[0095] The phrase "conservative amino acid substitution" or
"conservative mutation" refers to the replacement of one amino acid
by another amino acid with a common property to the replaced amino
acid. A functional way to define common properties between
individual amino acids is to analyze the normalized frequencies of
amino acid changes between corresponding proteins of homologous
organisms (Schulz and Schirmer, 1979). According to such analyses,
groups of amino acids can be defined where amino acids within a
group exchange preferentially with each other and therefore
resemble each other most in their impact on the overall protein
structure (Schulz and Schirmer, 1979).
[0096] Examples of amino acid groups defined in this manner
include: a "charged polar group," consisting of glutamic acid
(Glu), aspartic acid (Asp), asparagine (Asn), glutamine (Gln),
lysine (Lys), arginine (Arg) and histidine (His); an "aromatic, or
cyclic group," consisting of proline (Pro), phenylalanine (Phe),
tyrosine (Tyr) and tryptophan (Trp); and an "aliphatic group"
consisting of glycine (Gly), alanine (Ala), valine (Val), leucine
(Leu), isoleucine (Ile), methionine (Met), serine (Ser), threonine
(Thr) and cysteine (Cys).
[0097] Within each group, subgroups can also be identified, for
example, the group of charged polar amino acids can be sub-divided
into the sub-groups consisting of the "positively-charged
sub-group," consisting of Lys, Arg and His; the negatively-charged
sub-group," consisting of Glu and Asp, and the "polar sub-group"
consisting of Asn and Gin. The aromatic or cyclic group can be
sub-divided into the sub-groups consisting of the "nitrogen ring
sub-group," consisting of Pro, His and Trp; and the "phenyl
sub-group" consisting of Phe and Tyr. The aliphatic group can be
sub-divided into the sub-groups consisting of the "large aliphatic
non-polar sub-group," consisting of Val, Leu and Ile; the
"aliphatic slightly-polar sub-group," consisting of Met, Ser, Thr
and Cys; and the "small-residue sub-group," consisting of Gly and
Ala.
[0098] Examples of conservative mutations include substitutions of
amino acids within the sub-groups above, for example, Lys for Arg
and vice versa such that a positive charge can be maintained; Glu
for Asp and vice versa such that a negative charge can be
maintained; Ser for Thr such that a free --OH can be maintained;
and Gin for Asn such that a free --NH2 can be maintained.
[0099] The term "cold-shock domain consensus sequence (CSDDCS)
motif" or "CSDDCS motif" refers to a nucleic acid sequence that is
substantially identical to any of SEQ. ID. NOs. 6 to 14. The CSDDCS
refers to a group of nucleic acid sequences that serve as binding
sites for proteins which display RNA-binding domains that can serve
as transcription factors. These cold-shock domain sequences are
found in a variety of seemingly unrelated proteins and all
functionally control protein expression.
[0100] "Enhanced trait" or "enhanced phenotype" as used herein
refers to a measurable improvement in a trait of plant including,
but not limited to, yield increase, including increased yield under
non-stress conditions and increased yield under environmental
stress conditions. Many enhanced traits can affect "yield",
including without limitation, number of cells in a liquid culture
of a unicellular or multicellular plant, increased efficiencies of
light utilization by a plant, amount of biomass production by a
plant, amount of biofuel production by a plant, amount of select
storage materials accumulated in a plant and amounts of compounds
including but not limited to agar, alginate, carrageenan, starch,
omega fatty acids, lipid, Coenzyme Q10, astaxanthin, and
.beta.-carotene. Nutraceutical, a term combining the words
"nutrition" and "pharmaceutical", is a food or food product that
provides health and medical benefits, including the prevention and
treatment of disease. Such products may range from isolated
nutrients, dietary supplements and specific diets to genetically
engineered foods, herbal products, and processed foods such as
cereals, soups, and beverages. Other enhanced traits include plant
height, pod number, pod position on the plant, number of
internodes, incidence of pod shatter, grain size, efficiency of
nodulation and nitrogen fixation, efficiency of nutrient
assimilation, resistance to biotic and abiotic stress, carbon
assimilation, plant architecture, resistance to lodging, percent
seed germination, seedling vigor, and juvenile traits. Other traits
that can affect yield include, efficiency of germination (including
germination in stressed conditions), growth rate (including growth
rate in stressed conditions), ear number, seed number per year,
seed size, composition of seed (starch, oil, protein) and
characteristics of seed fill.
[0101] The term "expression" as used herein refers to transcription
and/or translation of a nucleotide sequence within a cell. The
level of expression of a desired product in a cell may be
determined on the basis of either the amount of corresponding mRNA
that is present in the cell, or the amount of the desired
polypeptide encoded by the selected sequence. For example, mRNA
transcribed from a selected sequence can be quantified by Northern
blot hybridization, ribonuclease RNA protection, in situ
hybridization to cellular RNA or by PCR. Proteins encoded by a
selected sequence can be quantified by various methods including,
but not limited to, e.g., ELISA, Western blotting,
radioimmunoassay, immunoprecipitation, assaying for the biological
activity of the protein, or by immunostaining of the protein
followed by FACS analysis.
[0102] "Expression control sequences" are regulatory sequences of
nucleic acids, and may comprise one or more of the following:
promoters, leaders, enhancers, introns, recognition motifs for RNA,
or DNA binding proteins, polyadenylation signals, terminators,
internal ribosome entry sites (IRES) and the like, that have the
ability to affect the transcription or translation of a coding
sequence in a cell. Exemplary expression control sequences are
described in Goeddel; Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990).
[0103] A "gene" is a sequence of nucleotides which code for a
functional "gene product". Generally, a gene product is a
functional protein. However, a gene product can also be another
type of molecule in a cell, such as RNA (e.g., a tRNA or an rRNA).
A gene may also comprise regulatory (i.e., non-coding) sequences as
well as coding sequences and introns. Exemplary regulatory
sequences include promoters, enhancers and terminators. The
transcribed region of the gene may also include untranslated
regions including introns, a 5'-untranslated region (5'-UTR) and a
3'-untranslated region (3'-UTR).
[0104] The term "heterologous DNA" refers to DNA which has been
introduced into a cell, or a nucleic acid molecule, that is derived
from another source, or which is from the same source but is
located in a different context such as multiple copies of a native
gene being introduced in tandem or a promoter used to drive one
gene in the wild-type driving a different or introduced gene.
[0105] The term "high light intensity" refers to a photon flux of
about 500 .mu.E m-2s-1 or more; conversely the term "low light
intensity" refers to a photon flux of about 50 .mu.E m-2s-1 or
less.
[0106] The term "homology" describes a mathematically based
comparison of sequence similarities which is used to identify genes
or proteins having similar functions or motifs. The nucleic acid
and protein sequences of the present invention can be used as a
"query sequence" to perform a search against public databases to,
for example, identify other family members, related sequences or
homologs. Such searches can be performed using the NBLAST and
XBLAST programs (version 2.0) of Altschul (Altschul et al., 1990).
BLAST nucleotide searches can be performed with the NBLAST program,
score=100, word length=12 to obtain nucleotide sequences homologous
to nucleic acid molecules of the invention. BLAST protein searches
can be performed with the XBLAST program, score=50, word length=3
to obtain amino acid sequences homologous to protein molecules of
the invention. To obtain gapped alignments for comparison purposes,
Gapped BLAST can be utilized as described in Altschul (Altschul et
al., 1997). When utilizing BLAST and Gapped BLAST programs, the
default parameters of the respective programs (e.g., XBLAST and
BLAST) can be used.
[0107] The term "homologous" refers to the relationship between two
proteins that possess a "common evolutionary origin", including
proteins from superfamilies (e.g., the immunoglobulin superfamily)
in the same species of animal, as well as homologous proteins from
different species of animal (for example, myosin light chain
polypeptide, and etc. (Reeck et al., 1987). Such proteins (and
their encoding nucleic acids) have sequence homology, as reflected
by their sequence similarity, whether in terms of percent identity
or by the presence of specific residues or motifs and conserved
positions.
[0108] As used herein, the term "increase" or the related terms
"increased", "enhance" or "enhanced" refers to a statistically
significant increase. For the avoidance of doubt, the terms
generally refer to at least a 10% increase in a given parameter,
and can encompass at least a 20% increase, 30% increase, 40%
increase, 50% increase, 60% increase, 70% increase, 80% increase,
90% increase, 95% increase, 97% increase, 99% or even a greater
than 100% increase over the control value.
[0109] The term "isolated," when used to describe a protein or
nucleic acid, means that the material has been identified and
separated and/or recovered from a component of its natural
environment. Contaminant components of its natural environment are
materials that would typically interfere with research, diagnostic
or therapeutic uses for the protein or nucleic acid, and may
include enzymes, hormones, and other proteinaceous or
non-proteinaceous solutes. In some embodiments, the protein or
nucleic acid will be purified to at least 95% homogeneity as
assessed by SDS-PAGE under non-reducing or reducing conditions
using Coomassie blue or, preferably, silver stain. Isolated protein
includes protein in situ within recombinant cells, since at least
one component of the protein of interest's natural environment will
not be present. Ordinarily, however, isolated proteins and nucleic
acids will be prepared by at least one purification step.
[0110] As used herein, "identity" means the percentage of identical
nucleotide or amino acid residues at corresponding positions in two
or more sequences when the sequences are aligned to maximize
sequence matching, i.e., taking into account gaps and insertions.
Identity can be readily calculated by known methods, including but
not limited to those described in (Computational Molecular Biology,
Lesk, A. M., ed., Oxford University Press, New York, 1988;
Biocomputing: Informatics and Genome Projects, Smith, D. W., ed.,
Academic Press, New York, 1993; Computer Analysis of Sequence Data,
Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New
Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje,
G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov,
M. and Devereux, J., eds., M Stockton Press, New York, 1991; and
Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073
(1988). Methods to determine identity are designed to give the
largest match between the sequences tested. Moreover, methods to
determine identity are codified in publicly available computer
programs.
[0111] Optimal alignment of sequences for comparison can be
conducted, for example, by the local homology algorithm described
in Smith & Waterman 1981, by the homology alignment algorithm
described in Needleman & Wunsch 1970, by the search for
similarity method described in Pearson & Lipman 1988, by
computerized implementations of these algorithms (GAP, BESTFIT,
PASTA, and TFASTA in the GCG Wisconsin Package, available from
Accelrys, Inc., San Diego, Calif., United States of America), or by
visual inspection. See generally references such as Altschul, S. F.
et al., J. Molec. Biol. 215: 403-410 (1990) and Altschul et al.
Nuc. Acids Res. 25: 3389-3402 (1997).
[0112] One example of an algorithm that is suitable for determining
percent sequence identity and sequence similarity is the BLAST
algorithm, which is described in (Altschul, S., et al., NCBI NLM
NIH Bethesda, Md. 20894; & Altschul, S., et al., J. Mol. Biol.
215: 403-410 (1990). Software for performing BLAST analyses is
publicly available through the National Center for Biotechnology
Information. This algorithm involves first identifying high scoring
sequence pairs (HSPs) by identifying short words of length W in the
query sequence, which either match or satisfy some positive-valued
threshold score T when aligned with a word of the same length in a
database sequence. T is referred to as the neighborhood word score
threshold.
[0113] These initial neighborhood word hits act as seeds for
initiating searches to find longer HSPs containing them. The word
hits are then extended in both directions along each sequence for
as far as the cumulative alignment score can be increased.
Cumulative scores are calculated using, for nucleotide sequences,
the parameters M (reward score for a pair of matching residues;
always; 0) and N (penalty score for mismatching residues; always;
0). For amino acid sequences, a scoring matrix is used to calculate
the cumulative score. Extension of the word hits in each direction
are halted when the -27 cumulative alignment score falls off by the
quantity X from its maximum achieved value, the cumulative score
goes to zero or below due to the accumulation of one or more
negative-scoring residue alignments, or the end of either sequence
is reached. The BLAST algorithm parameters W, T, and X determine
the sensitivity and speed of the alignment. The BLASTN program (for
nucleotide sequences) uses as defaults a word length (W) of 11, an
expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison
of both strands. For amino acid sequences, the BLASTP program uses
as defaults a word length (W) of 3, an expectation (E) of 10, and
the BLOSUM62 scoring matrix.
[0114] In addition to calculating percent sequence identity, the
BLAST algorithm also performs a statistical analysis of the
similarity between two sequences. One measure of similarity
provided by the BLAST algorithm is the smallest sum probability
(P(N)), which provides an indication of the probability by which a
match between two nucleotide or amino acid sequences would occur by
chance. For example, a test nucleic acid sequence is considered
similar to a reference sequence if the smallest sum probability in
a comparison of the test nucleic acid sequence to the reference
nucleic acid sequence is in one embodiment less than about 0.1, in
another embodiment less than about 0.01, and in still another
embodiment less than about 0.001.
[0115] The term "Oil" as used herein refers to any combination of
lipid fractions of a biomass. "Lipid," "lipid fraction," or "lipid
component" as used herein can include any hydrocarbon soluble in
non-polar solvents and insoluble, or relatively insoluble, in
water. The lipid fractions can include, but are not limited to,
free fatty acids, waxes, sterols and sterol esters,
triacylglycerides, diacylglycerides, monoacylglycerides,
tocopherols, eicosanoids, glycoglycerolipids, glycosphingolipds,
sphingolipids, and phospholipids. The lipid fractions can also
comprise other lipid soluble materials such as chlorophyll and
other algal pigments, including, for example, antioxidants such as
but not limited to astaxanthin, zeaxanthin, and canthaxanthin.
[0116] The terms "operably linked" and "operatively linked," as
used interchangeably herein, refer to the positioning of two or
more nucleotide sequences or sequence elements in a manner that
permits them to function in their intended manner. In some
embodiments, a nucleic acid molecule according to the invention
includes one or more DNA elements capable of opening chromatin
and/or maintaining chromatin in an open state operably linked to a
nucleotide sequence encoding a recombinant protein. In other
embodiments, a nucleic acid molecule may additionally include one
or more DNA or RNA nucleotide sequences chosen from: (a) a
nucleotide sequence capable of increasing translation; (b) a
nucleotide sequence capable of increasing secretion of the
recombinant protein outside a cell; (c) a nucleotide sequence
capable of increasing the mRNA stability, and (d) a nucleotide
sequence capable of binding a trans-acting factor to modulate
transcription or translation, where such nucleotide sequences are
operatively linked to a nucleotide sequence encoding a recombinant
protein. Generally, but not necessarily, the nucleotide sequences
that are operably linked are contiguous and, where necessary, in
reading frame. However, although an operably linked DNA element
capable of opening chromatin and/or maintaining chromatin in an
open state is generally located upstream of a nucleotide sequence
encoding a recombinant protein; it is not necessarily contiguous
with it. Operable linking of various nucleotide sequences is
accomplished by recombinant methods well known in the art, e.g.
using PCR methodology, by ligation at suitable restrictions sites
or by annealing. Synthetic oligonucleotide linkers or adaptors can
be used in accord with conventional practice if suitable
restriction sites are not present.
[0117] The terms "polynucleotide," "nucleotide sequence" and
"nucleic acid" are used interchangeably herein, refer to a
polymeric form of nucleotides of any length, either ribonucleotides
or deoxyribonucleotides. These terms include a single-, double- or
triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA hybrid, or a
polymer comprising purine and pyrimidine bases, or other natural,
chemically, biochemically modified, non-natural or derivatized
nucleotide bases. The backbone of the polynucleotide can comprise
sugars and phosphate groups (as may typically be found in RNA or
DNA), or modified or substituted sugar or phosphate groups. In
addition, a double-stranded polynucleotide can be obtained from the
single stranded polynucleotide product of chemical synthesis either
by synthesizing the complementary strand and annealing the strands
under appropriate conditions, or by synthesizing the complementary
strand de novo using a DNA polymerase with an appropriate primer. A
nucleic acid molecule can take many different forms, e.g., a gene
or gene fragment, one or more exons, one or more intrans, mRNA,
tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched
polynucleotides, plasmids, vectors, isolated DNA of any sequence,
isolated RNA of any sequence, nucleic acid probes, and primers. A
polynucleotide may comprise modified nucleotides, such as
methylated nucleotides and nucleotide analogs, uracil, other sugars
and linking groups such as fluororibose and thioate, and nucleotide
branches. As used herein, a polynucleotide includes not only
naturally occurring bases such as A, T, U, C, and G, but also
includes any of their analogs or modified forms of these bases,
such as methylated nucleotides, inter-nucleotide modifications such
as uncharged linkages and thioates, use of sugar analogs, and
modified and/or alternative backbone structures, such as
polyamides. A "promoter" is a DNA regulatory region capable of
binding RNA polymerase in a cell and initiating transcription of a
downstream (3' direction) coding sequence. As used herein, the
promoter sequence is bounded at its 3' terminus by the
transcription initiation site and extends upstream (5' direction)
to include the minimum number of bases or elements necessary to
initiate transcription at levels detectable above background. A
transcription initiation site (conveniently defined by mapping with
nuclease S1) can be found within a promoter sequence, as well as
protein binding domains (consensus sequences) responsible for the
binding of RNA polymerase. Prokaryotic promoters contain
Shine-Dalgarno sequences in addition to the -10 and -35 consensus
sequences.
[0118] A large number of promoters, including constitutive,
inducible and repressible promoters, from a variety of different
sources are well known in the art. Representative sources include
for example, algal, viral, mammalian, insect, plant, yeast, and
bacterial cell types, and suitable promoters from these sources are
readily available, or can be made synthetically, based on sequences
publicly available on line or, for example, from depositories such
as the ATCC as well as other commercial or individual sources.
Promoters can be unidirectional (i.e., initiate transcription in
one direction) or bi-directional (i.e., initiate transcription in
either a 3' or 5' direction). Non-limiting examples of promoters
active in plants include, for example nopaline synthase (nos)
promoter and octopine synthase (ocs) promoters carried on
tumor-inducing plasmids of Agrobacterium tumefaciens and the method
wherein the tissue targeting sequence is chosen from sequences
promoters such as the Cauliflower Mosaic Virus (CaMV) 19S or 35S
promoter (U.S. Pat. No. 5,352,605), CaMV 35S promoter with a
duplicated enhancer (U.S. Pat. Nos. 5,164,316; 5,196,525;
5,322,938; 5,359,142; and 5,424,200), and the Figwort Mosaic Virus
(FMV) 35S promoter (U.S. Pat. No. 5,378,619). These promoters and
numerous others have been used in the creation of constructs for
transgene expression in plants or plant cells. Other useful
promoters are described, for example, in U.S. Pat. Nos. 5,391,725;
5,428,147; 5,447,858; 5,608,144; 5,614,399; 5,633,441; 6,232,526;
and 5,633,435, all of which are incorporated herein by reference.
Additional useful light inducible promoters include but not limited
to are: (1) PPCZm1 (phosphoenolpyruvate carboxylase from corn)
Kausch et al. (2001) Plant Molecular Biology 45, 1-15; (2) RbcS
(ribulose-bisphosphate carboxylase from rice) Nomura et al. (2000)
The Plant Journal 22(3), 211-221 (3) Rca (Rubisco Activase from
rice) Yang et al. (2012) Biochemical and Biophysical Research
Communications 418, 565-570 (4) LHCP2 (light harvesting chlorophyll
a/b binding-protein from rice) Tada et al. (1991), EMBO J. 10(7),
1803-1808 (5) cyFBPase (cytosolic fructose 1,6 biphosphatase from
rice) Si et al., 2002, Acta Botanica Sinica. 44(11), 1339-1345. In
a preferred embodiment the promoter will be a light-inducible
promoter such as the promoter for rbcS, CAB1, Dof1, psbD, PPDK,
PPCZm1, Rca, LHCP2, cyFBPase and the like.
[0119] The term "purified" as used herein refers to material that
has been isolated under conditions that reduce or eliminate the
presence of unrelated materials, i.e., contaminants, including
native materials from which the material is obtained. For example,
a purified protein is preferably substantially free of other
proteins or nucleic acids with which it is associated in a cell.
Methods for purification are well-known in the art. As used herein,
the term "substantially free" is used operationally, in the context
of analytical testing of the material. Preferably, purified
material substantially free of contaminants is at least 50% pure;
more preferably, at least 75% pure, and more preferably still at
least 95% pure. Purity can be evaluated by chromatography, gel
electrophoresis, immunoassay, composition analysis, biological
assay, and other methods known in the art. The term "substantially
pure" indicates the highest degree of purity, which can be achieved
using conventional purification techniques known in the art.
[0120] The term "sequence similarity" refers to the degree of
identity or correspondence between nucleic acid or amino acid
sequences that may or may not share a common evolutionary origin
(see Reeck et al., supra). However, in common usage and in the
instant application, the term "homologous", when modified with an
adverb such as "highly", may refer to sequence similarity and may
or may not relate to a common evolutionary origin.
[0121] In specific embodiments, two nucleic acid sequences are
"substantially homologous" or "substantially similar" when at least
about 85%, and more preferably at least about 90% or at least about
95% of the nucleotides match over a defined length of the nucleic
acid sequences, as determined by a sequence comparison algorithm
known such as BLAST, FASTA, DNA Strider, CLUSTAL, etc. An example
of such a sequence is an allelic or species variant of the specific
genes of the present invention. Sequences that are substantially
homologous may also be identified by hybridization, e.g., in a
Southern hybridization experiment under, e.g., stringent conditions
as defined for that particular system.
[0122] The term "specific" is applicable to a situation in which
one member of a specific binding pair will not show any significant
binding to molecules other than its specific binding partner(s).
The term is applicable to the situation where two complementary
polynucleotide strands can anneal together, yet each single
stranded polynucleotide exhibits little or no binding to other
polynucleotide sequences under stringent hybridization
conditions.
[0123] Similarly, in particular embodiments of the invention, two
amino acid sequences are "substantially homologous" or
"substantially similar" when greater than 90% of the amino acid
residues are identical. Two sequences are functionally identical
when greater than about 95% of the amino acid residues are similar.
Preferably the similar or homologous polypeptide sequences are
identified by alignment using, for example, the GCG (Genetics
Computer Group, Version 7, Madison, Wis.) pileup program, or using
any of the programs and algorithms described above. The program may
use the local homology algorithm of Smith and Waterman with the
default values: Gap creation penalty=-(1+Ilk), k being the gap
extension number, Average match=1, Average mismatch=-0.333.
[0124] The term "suppressed" in the context of "suppressed Cao
expression" encompasses the absence of endogenous chlorophyll a
oxygenase protein (CAO) in a plant cell, e.g., Arabidopsis, as well
as protein expression that is present but reduced as compared to
the level of CAO protein production in a wild-type plant. The term
"suppressed" also encompasses an amount of CAO protein that is
equivalent to wild-type levels, but where the protein has a reduced
level of activity in comparison to wild-type plants. Generally, at
least a 50% decrease in endogenous CAO activity, or expression, or
the like is preferred, in other aspect, at least about 75%, or at
least about 95%, or 100% (i.e. no endogenous activity) being
particularly preferred. By convention and for clarity the
abbreviation CAO (all caps) will refer to the protein and Cao
(lower script, italics) will refer to the gene sequence unless
otherwise indicated by the context of the sentence.
[0125] The term "knockout" or "knockout plant" refers to a plant
where a specific gene has been directly rendered inoperable by
genetically modifying the gene itself. This could be by a number of
different methods such as insertion of nonsense sequence, insertion
of stop codons, deletion of sequence within the gene to change the
reading frame of the gene rending it inoperable. This differs in
control of the gene by trans-acting engineering where one would
control the gene's expression but not alter the gene directly to
prevent its expression. Often genes that are controlled by
trans-acting elements are called "knockdown plants" which is
distinguished herein using the above definition as distinct from
knockout plants.
[0126] As used herein, a "transgenic plant" is one whose genome has
been altered by the incorporation of exogenous genetic material,
e.g. by transformation as described herein. The term "transgenic
plant" is used to refer to the plant produced from an original
transformation event, or progeny from later generations or crosses
of a transgenic plant so long as the progeny contains the exogenous
genetic material in its genome. By "exogenous" is meant that a
nucleic acid molecule, for example, a recombinant DNA, originates
from outside the plant into which it is introduced. An exogenous
nucleic acid molecule may comprise naturally or non-naturally
occurring DNA, and may be derived from the same or a different
plant species than that into which it is introduced.
[0127] The term "transformation" or "transfection" refers to the
transfer of one or more nucleic acid molecules into a cell or
organism. Methods of introducing nucleic acid molecules into cells
include, for instance, calcium phosphate transfection, DEAE-dextran
mediated transfection, microinjection, cationic lipid-mediated
transfection, electroporation, scrape loading, ballistic
introduction or infection with viruses or other infectious
agents.
[0128] "Transformed", "transduced", or "transgenic", in the context
of a cell or organism, refers to a cell or organism into which a
recombinant or heterologous nucleic acid molecule (e.g., one or
more DNA constructs or RNA, or siRNA counterparts) has been
introduced. The nucleic acid molecule can be stably expressed (i.e.
maintained in a functional form in the cell for longer than about
three months) or non-stably maintained in a functional form in the
cell for less than three months i.e. is transiently expressed. For
example, "transformed," "transformant," and "transgenic" cells or
organisms have been through the transformation process and contain
foreign nucleic acid. The term "untransformed" refers to cells or
organisms that have not been through the transformation
process.
[0129] The practice of the present invention will employ, unless
otherwise indicated, conventional techniques of chemistry,
molecular biology, microbiology, recombinant DNA and immunology,
which are within the capabilities of a person of ordinary skill in
the art. Such techniques are explained in the literature. See, for
example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989,
Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3,
Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995
and periodic supplements; Current Protocols in Molecular Biology,
chapters 9, 13, and 16, John Wiley & Sons, New York, N.Y.); B.
Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing:
Essential Techniques, John Wiley & Sons; J. M. Polak and James
O'D. McGee, 1990, In Situ Hybridization: Principles and Practice;
Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide
Synthesis: A Practical Approach, Irl Press; D. M. J. Lilley and J.
E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A:
Synthesis and Physical Analysis of DNA Methods in Enzymology,
Academic Press; A Handbook of Recipes, Reagents, and Other
Reference Tools for Use at the Bench, Edited Jane Roskams and Linda
Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969-630-3.
Each of these general texts is herein incorporated by
reference.
[0130] The terms "chlorophyll a oxygenase sequence" "chlorophyll a
oxygenase gene" or "Cao" refer to the gene sequence for enzymes
capable of the synthesis of chlorophyll b via the oxidation of the
methyl group on ring II of chlorophyll a. In the literature the
chlorophyll a oxygenase has also been referred to as the
chlorophyll b synthase and, as used in the current invention, any
reference to chlorophyll b synthase is taken to equally refer to
the chlorophyll a oxygenase. Representative species for various
species of chlorophyll a oxygenase are provided in the sequence
listing, and genes from other species may be readily identified by
standard homology searching of publicly available or proprietary
databases.
[0131] The terms "chlorophyll a oxygenase" or "CAO" refer to all
naturally-occurring and synthetic forms of chlorophyll a oxygenase
protein. In one aspect the chlorophyll a oxygenase is from a plant.
In another aspect the chlorophyll a oxygenase is from algae.
[0132] Chlorophyll is a green pigment found in the chloroplasts of
algae and plants as well as in the photosynthetic membranes of
cyanobacteria and photosynthetic bacteria. It plays a critical role
in the photosynthetic process by absorbing light and transferring
light energy by resonance energy transfer to the reaction centers
of the photosystems. Chlorophyll a (Chl a) is a form of chlorophyll
that absorbs light energy from the violet-blue and orange-red
portions of the electromagnetic spectrum with it red peak maximum
at 659 nm. Chlorophyll b (Chl b) is another form of chlorophyll
that also absorbs light energy from the violet-blue and orange-red
portions of the electromagnetic spectrum with it red peak maximum
at 642 nm. The slight shift in the absorbance maximum between Chl a
and Chl b allows Chl b to easily pass energy to Chl a down the
energy gradient (higher energy to lower energy) with high
efficiency with the final destination of that energy being the
reaction centers.
[0133] Accordingly the term "redox-sensitive modulators" refers to
the group of proteins capable of mediating the reversible redox
dependent regulation of gene transcription or translation. In one
aspect such redox-sensitive modulators include proteins that
include the conserved cold shock domain (Prosite motif PS00352;
Bucher and Bairoch, (In) ISMB-94; Proceedings 2nd International
Conference on Intelligent Systems for Molecular Biology, Altman R.,
Brutlag D., Karp P., Lathrop R., Searls D., ds., pp 53-61,
AAAIPress, Menlo Park, 1994; Hofmann et al., Nucleic Acids Res.
27:215, 1999).
[0134] The term "NAB 1" as used herein includes all
naturally-occurring and synthetic forms of NAB 1 that retain
redox-sensitive modulator activity. Such NAB 1 proteins include the
protein from Chlamydomonas, as well as peptides derived from other
plant species and genera. In one aspect, "NAB 1" refers to the
Chlamydomonas NAB 1 having the amino acid sequence SEQ. ID. NO.
6.
[0135] As used herein "wild-type plants" are of the same strain as
the transgenic plants to which a comparison is made.
[0136] As used herein light responsive element (LRE) means the 13
bp long, sequence GCCAGACCCCCGC SEQ ID NO. 27 that is a binding
site for NAB 1 for regulation/inhibition of translation of the
downstream protein.
[0137] The publications discussed above are provided solely for
their disclosure before the filing date of the present application.
Nothing herein is to be construed as an admission that the
invention is not entitled to antedate such disclosures by virtue of
prior invention.
[0138] Referring now to FIG. 1, carbon as bicarbonate (HCO3) is
transported through the cell membrane by a bicarbonate transporter
(HLA3), through the chloroplast membrane as bicarbonate by another
bicarbonate transporter (LCIA), it interacts with the electron
transport apparatus of photosynthesis powered by the antenna
complexes in the thylakoid stacks or grana (shown as stacks of
plates in FIG. 1). The electron transport system produces energy
and reducing equivalents that are used by the ribulose bisphosphate
carboxylase/oxgenase (RuBisCo) to fix carbon as a useful substrate
molecule. This is then fed to the rest of the cell to produce
energy that runs plant metabolic processes.
[0139] Referring now to FIG. 2, wild-type plants have a full
complement of the Chl a/b antenna complex that is capable of
capturing more light energy than can be handled by the electron
transfer system. This excess energy is dissipated as heat and
reactive oxygen species (ROS; which have detrimental impacts on the
plant through other processes such as photoinhibition). The full
complement of the antenna complex is optimized to keep the plant
functioning when shaded by competitors and is inefficient in
handling full sunlight. Embodiments of the present invention
provide a system where, during high sunlight or high light
intensity, the antenna complex can be adjusted for optimal energy
capture and linkage to the available electron transport system. As
light is decreased more antenna complex is produced and the
transgenic plant can continue to function optimally at this lower
light and/or perform better than wild-type plants under the same
growing conditions.
[0140] Referring now to FIG. 3, conversion of Chl a to Chl b is
accomplished by the CAO enzyme which is encoded by the Cao gene.
Control of the expression of the cao gene to allow high expression
of the Cao gene under low light levels and reduced expression under
high light levels allows self-adjustment of the size of the
available antenna complex.
[0141] Referring now to FIG. 4A-B, constructs according to one
embodiment of the present invention were based on the pCambia1301
vector and contained either a short (272 bp) or long (750 bp)
section of the Arabidopsis Cao gene plus the reverse complement of
these portions of the Camelina genome under the control of
leaf-specific CAB1 promoter. In addition, the vectors contained
bacterial kanamycin and plant hygromycin resistance genes and two
Arabidopsis introns. Detailed description of these plasmids is
provided in Example 3.
[0142] Referring now to FIG. 5, the photosynthetic rate was
compared under different light intensities in transgenic Camelina
sativa plants where siRNA technology was used to control expression
of the Cao gene at different rates. These mutants were produced
using the Suneson line using the pCambrai1301CAOiLong (FIG. 4A-B)
using the floral dip method as described in Examples 4 and 5. This
resulted in Cao gene knock down transgenic plants.
[0143] Through the methods described in the instant invention, the
expression of Chl b was inhibited and the amount of antenna complex
altered. This alteration was reflected in the ratio of Chl a to Chl
b (Chl a/b ratio). The wild-type plants had a Chl a/b ratio of 1.9.
Transgenic plants were made where this ratio varied from 3.3 to 12.
It is obvious from these data that high Chl a/b ratios (e.g., 12)
were not optimal for improved photosynthetic rate (e.g., CAOi 9-5).
However, when the Chl a/b ratio was between 3.3 and 4.3, a
significant improvement in the photosynthetic rate was observed
compared to wild-type.
[0144] Referring now to FIG. 6A-B, comparison of the Chl a/b ratio
at different positions on the plant as well as the relative
chlorophyll content per unit leaf area at different positions on
the plant is illustrated. Wild-type plants had lower Chl a/b ratios
than three different CAOi mutants (referred to on the x-axis as 4,
6 and 7). All three of the CAOi transgenic plants where the Cao
gene is regulated by light intensity all had significantly higher
Chl a/b ratios than wild-type at the two locations within the plant
measured (bottom and top). The regulation was most pronounced in
CAOi 7 mutant where the shaded leaves (bottom) had a Chl a/b ration
of about 3.4 while the full sun leaves had a Chl a/b ratio closer
to 5.2. The bottom panel shows data from wild-type and CAOi 7
plants, the chlorophyll per unit leaf area was normalized to the WT
plants. The chlorophyll per unit area of CAOi 7 leaves in the high
light (top) was 40% of that found in the wild-type. However, the
chlorophyll per unit area of the CAOi 7 and WT plants in the bottom
leaves was virtually identical.
[0145] Referring now to FIG. 7, three wild-type Camelina plants
that had chl a/b ratios of 3 had reduced transmittance of light
through the leaf in comparison to three CAO siRNA (CAOi) mutants
that had Chl a/b ratios of 6. Since the leaf thicknesses were very
similar this increase in transmitted light by the CAOi mutants
reflects the reduced antenna complexes relative to reaction centers
in these CAOi mutants.
[0146] Referring now to FIG. 8A-D, comparison of the chlorophyll
fluorescence of wild-type Camelina and a CAOi mutant. This picture
is a black and white rendering of a colored photograph. Dark blue
in the original is no fluorescence and was only observed in the top
right corner of each CAOi mutant. Green is shown here as a medium
gray and reflects mild fluorescence. Yellow is increased
fluorescence and is a lighter grey. And red is shown as dark grey
and represents highly fluorescent portions of the leaf. The darker
portion of the CAOi mutant leaf is an artifact and not chlorophyll
fluorescence. After 1 second exposure the WT leaf begins to show
increased fluorescence (observed here as a lightening in the center
and top half of the leaf). After 10 seconds, the CAOi mutant began
to exhibit increase fluorescence at its tip (lightening in color)
while the WT was highly fluorescent. On prolonged light exposure
the CAOi mutants seemed to reach a steady low level of fluorescence
while the WT settled to a moderate level of chlorophyll
fluorescence. The CAOi mutant leaves demonstrated reduced
chlorophyll fluorescence after prolonged exposure to light.
[0147] Referring now to FIG. 9, non-photochemical quenching (NPQ)
over time for several different mutant CAOi lines compared to
wild-type. Light was on from 0-5 min then plants were in the dark.
Plants with Chl a/b ratios >7 showed reduced NPQ and reduced
photoprotection. This reduction of NPQ at high Chl a/b ratios could
explain why the photosynthetic rates decreased for the mutants with
a Chl a/b ratio of 12 (FIG. 5).
[0148] Referring now to FIG. 10, comparison of the proteins
associated with the photosynthetic complexes of wild-type and CAOi
mutant lines of Camelina. Electrophoresis using blue native green
gels show the photosynthetic complex of wild-type compared to CAOi
mutant expressing Chl a/b ratio of 6.2 shows an altered makeup of
the proteins related to light capture such as the PSII/LHC II
supercomplexes and the LHC II trimer.
[0149] Referring now to FIG. 11A-D, the impact of CAOi inhibition
of the antenna complex on accumulation of starch in Camelina is
demonstrated. The CAO-7 mutant with a Chl a/b ratio of 5 had
similar starch deposition to that of wild-type. However, high
expression of the CAOi system in CAO-9 led to a strong decrease in
the amount of starch granules seen per section.
[0150] Referring now to FIG. 12, Camelina CAOi mutant plants
compared to wild-type plants had more lower leaves with extended
lifetimes.
[0151] Referring now to FIG. 13, Camelina CAOi mutant line (CAOi
8-1; Chl a/b ratio 6) at three weeks in a greenhouse trial grows
more rapidly than wild-type line (Chl a/b ratio=3).
[0152] Referring now to FIG. 14A-B, comparison of a CAOi line (CAOi
8-1) to wild-type lines for plant weight, pod weight and number of
pods. The overall biomass of the CAOi mutant line was significantly
higher than wild-type. The overall weight of the pod fraction was
significantly higher in the mutant than the wild-type. However,
this reflected the number of pods produced rather than an increase
in weight per pods.
[0153] Referring now to FIG. 15, a map of the construct
pB110-CAO0NAB1-cab-nos is provided. Physical map of
pb110-CAO-NAB-cab-nos Agrobacterium Ti-plasmid. Pb110 backbone was
used to harbor an Arabidopsis Cao gene with a Chlamydomonas LRE
(Light Responsive Element) fused to the 5' end of an Arabidopsis
Cao gene driven by the native Arabidopsis CAO-promoter (CAO-pro)
and CAO-terminator (CAO-term); as well as NAB1 gene (from
Chlamydomonas) driven by light-sensitive cab-promoter and
nos-terminator). LB/RB T-DNA left/right border.
[0154] Embodiments of the present invention provides methods, and
compositions for modulating the PSII peripheral antenna size of
plants, specifically plants such as wheat, barley, Arabidopsis,
Camelina, and any agriculturally or bioenergy important plant by
negatively regulating the expression of the chlorophyll a oxygenase
gene (Cao) to high light intensity in a tissue-specific manner.
[0155] Accordingly in one aspect, the current invention includes a
method of producing an improved plant, comprising the steps of
stably transforming a plant with a heterologous polynucleotide
sequence comprising expression control sequences comprising a
cold-shock domain consensus sequence (CSDDCS) motif, that is
capable of binding to a redox-sensitive modulator that is
responsive to ambient light intensity said control sequences are
operably linked to a native or heterologous Cao gene selecting a
transformant that is capable of modulating PSII antenna size in
response to ambient light intensity.
[0156] In another embodiment, the current invention includes a
method of enhancing yields of photosynthetic productivity under
conditions of high light intensity, and or high density growth, the
method comprising providing a plant comprising a heterologous
polynucleotide sequence comprising expression control sequences
comprising a cold-shock domain consensus sequence (CSDDCS) motif
operatively coupled to a polynucleotide sequence encoding CAO;
wherein expression of the Cao gene is increased at low light
intensity, compared to the expression of the Cao gene at high light
intensity and cultivating the plant at high light intensity and or
high density.
[0157] In another embodiment, the current invention includes a
method of enhancing production of carbon sink storage compounds,
such as oil, starch and sugar, from a plant the method comprising
providing the plant comprising a heterologous polynucleotide
sequence comprising expression control sequences comprising a
cold-shock domain consensus sequence (CSDDCS) motif operatively
coupled to a polynucleotide sequence encoding the CAO protein,
wherein expression of the cao is increased at low light intensity,
compared to the expression of the Cao at high light intensity
cultivating the plant at high light intensity and or high density.
In another embodiment, the current invention includes a method of
enhancing lipid and/or oil (suitable for biodiesel feedstocks)
production from a plant the method comprising providing the plant
comprising a heterologous polynucleotide sequence comprising
expression control sequences comprising a cold-shock domain
consensus sequence (CSDDCS) motif operatively coupled to a
polynucleotide sequence encoding CAO, wherein expression of the cao
is increased at low light intensity, compared to the expression of
the Cao at high light intensity cultivating the plant at high light
intensity and or high density.
[0158] In another embodiment the present invention includes a
method of enhancing (3-carotene, lutein, or zeaxanthin levels from
a plant, the method comprising providing plant comprising a
heterologous polynucleotide sequence comprising expression control
sequences comprising a cold-shock domain consensus sequence
(CSDDCS) motif operatively coupled to a polynucleotide sequence
encoding CAO, wherein expression of the Cao gene is increased at
low light intensity, compared to the expression of the Cao gene at
high light intensity cultivating the plant at high light intensity
and or high density.
[0159] In yet another embodiment, the current invention includes
transgenic plants produced by any of the methods described
above.
Chlorophyll A Oxygenase (Cao)
[0160] The chlorophyll a oxygenase (CAO) may be in its native form
(as found naturally in the plant), i.e., as different apoprotein
forms or allelic variants as they appear in nature, which may
differ in their amino acid sequence, for example, by truncation
(e.g., from the N- or C-terminus or both) or other amino acid
deletions, additions, insertions, substitutions, or
post-translational modifications. Naturally occurring chemical
modifications including post-translational modifications and
degradation products of CAO, are also specifically included in any
of the methods of the invention including for example,
pyroglutamyl, iso-aspartyl, proteolytic, phosphorylated,
glycosylated, reduced, oxidized, isomerized, and deaminated
variants of CAO.
[0161] The CAO, which may be used in the invention including any of
the methods of the invention, may have amino acid sequences which
are substantially homologous, or substantially similar to the
native CAO amino acid sequences, for example, to any of the native
Cao sequences provided in the sequence listing. Alternatively, the
CAO may have an amino acid sequence having at least 30% preferably
at least 40, 50, 60, 70, 75, 80, 85, 90, 95, 98, or 99% identity
with Cao genes encoding the proteins in SEQ ID Nos 1-5. In a
preferred embodiment, the chlorophyll a oxygenase gene for use in
any of the methods of the present invention is at least 80%
identical to the mature CAO from Chlamydomonas.
Suppression of Chlorophyll a Oxygenase Gene (cao) Expression
[0162] The invention provides methods, compositions, and transgenic
plants having a reduced chlorophyll antenna size by suppressing the
endogenous expression of Cao, and operatively coupling the
expression of a heterologous Cao gene to expression control
sequences that are regulated by the activity of a redox-sensitive
modulator. Accordingly in one aspect, the present invention
includes transgenic plants in which the endogenous Cao gene has
been knocked out or the expression of the gene suppressed.
[0163] Exemplary chlorophyll a oxygenase nucleic acid sequences can
be used to prepare expression cassettes useful for inhibiting or
suppressing chlorophyll a oxygenase expression, and for providing
for heterologous recombinant Cao genes, are identified in the
sequence listing. A number of methods can be used to inhibit gene
expression in plants. For instance, siRNA, antisense, or ribozyme
technology can be conveniently used for designing new crop plants
with improved yields and/or disease resistance (Ali et al.,
2010).
[0164] For antisense expression, a nucleic acid segment from the
desired chlorophyll a oxygenase gene is cloned and operably linked
to a promoter such that the antisense strand of chlorophyll a RNA
will be transcribed. The expression cassette is then transformed
into plants, e.g., Camelina, and the antisense strand of RNA is
produced. The antisense nucleic acid sequence transformed into
plants will be substantially identical to at least a portion of the
endogenous gene or genes to be repressed. The sequence, however,
does not have to be perfectly identical to inhibit expression.
Thus, an antisense or sense nucleic acid molecule encoding a
portion of the entire chlorophyll a oxygenase gene can be useful
for producing a plant in which chlorophyll a oxygenase expression
is suppressed. This is often referred to as a knockdown mutant in
contrast to a knockout mutant with the gene target itself is
modified. The vectors of the present invention can be designed such
that the inhibitory effect applies to other proteins within a
family of genes exhibiting homology or substantial homology to the
target gene.
[0165] For antisense suppression, the introduced sequence also need
not be full length relative to either the primary transcription
product or fully processed mRNA. Generally, higher homology can be
used to compensate for the use of a shorter sequence. Furthermore,
the introduced sequence need not have the same intron or exon
pattern, and homology of non-coding segments may be equally
effective. Normally, a sequence of between about 30 or 40
nucleotides and about full length nucleotides should be used,
though a sequence of at least about 100 nucleotides is preferred, a
sequence of at least about 200 nucleotides is more preferred, and a
sequence of at least about 500 nucleotides is especially preferred.
Sequences can also be longer, e.g., 1000 or 2000 nucleotides or
greater in length.
[0166] Catalytic RNA molecules or ribozymes can also be used to
inhibit expression of chlorophyll a oxygenase genes. It is possible
to design ribozymes that specifically pair with virtually any
target RNA and cleave the phosphodiester backbone at a specific
location, thereby functionally inactivating the target RNA. In
carrying out this cleavage, the ribozyme is not itself altered, and
is thus capable of recycling and cleaving other molecules, making
it a true enzyme. The inclusion of ribozyme sequences within
antisense RNAs confers RNA cleaving activity upon them, thereby
increasing the activity of the constructs.
[0167] A number of classes of ribozymes have been identified. One
class of ribozymes is derived from a number of small circular RNAs
that are capable of self-cleavage and replication in plants.
Ribozymes, e.g., Group I introns, have also been identified in the
chloroplast of green algae (see, e.g., Cech et al., (1990) Annu Rev
Biochem 59:543-568; Bhattacharya et al., (1996) Molec Biol and Evol
13:978-989; Erin, et al., (2003) Amer J Botany 90:628-633, Turmel,
et al., (1993) Nucl Acids Res. 21:5242-5250; and Van Oppen et al.,
(1993) Molec Biol and Evol 10:1317-1326). The design and use of
target RNA-specific ribozymes is described, e.g., in Haseloff et
al. (1988) Nature, 334:585-591.
[0168] Another method of suppression is sense suppression (also
known as co-suppression). Introduction of expression cassettes in
which a nucleic acid is configured in the sense orientation with
respect to the promoter has been shown to be an effective means by
which to block the transcription of target genes. For an example of
the use of this method to modulate expression of endogenous genes
see, Napoli et al., (1990) The Plant Cell 2:279-289; Flavell,
(1994) Proc. Natl. Acad. Sci., USA 91:3490-3496; Kooter and Mol,
(1993) Current Opin. Biol. 4: 166-171; and U.S. Pat. Nos.
5,034,323, 5,231,020, and 5,283,184.
[0169] Generally, where inhibition of expression is desired, some
transcription of the introduced sequence occurs. The effect may
occur where the introduced sequence contains no coding sequence per
se, but only intron or untranslated sequences homologous to
sequences present in the primary transcript of the endogenous
sequence. The introduced sequence generally will be substantially
identical to the endogenous sequence intended to be repressed. This
minimal identity will typically be greater than about 65%, but a
higher identity might exert a more effective repression of
expression of the endogenous sequences. Substantially greater
identity of more than about 80% is preferred, though about 90% or
95% to absolute identity would be most preferred. As with antisense
regulation, the effect should apply to any other proteins within a
similar family of genes exhibiting homology or substantial
homology.
[0170] For sense suppression, the introduced sequence in the
expression cassette, needing less than absolute identity, also need
not be full length, relative to either the primary transcription
product or fully processed mRNA. This may be preferred to avoid
concurrent production of some plants that are over-expressers. A
higher identity in a shorter than full length sequence compensates
for a longer, less identical sequence. Furthermore, the introduced
sequence need not have the same intron or exon pattern, and
identity of non-coding segments will be equally effective.
Normally, a sequence of the size ranges noted above for antisense
regulation is used.
[0171] Endogenous gene expression may also be suppressed by means
of RNA interference (RNAi), which uses a double-stranded RNA having
a sequence identical or similar to the sequence of the target
chlorophyll a oxygenase gene. See generally, PCT International
Publication Nos. WO 99/32619 WO 99/07409, WO 00/44914, WO 00/44895,
WO 00/63364 WO 00/01846, WO 01/36646, WO 01175164, WO01/29058, WO
02/055692, WO 02/44321, WO2005/054439, and WO2005/110068.
[0172] RNAi is the phenomenon in which when a double-stranded RNA
having a sequence identical or similar to that of the target gene
is introduced into a cell, the expressions of both the inserted
exogenous gene and target endogenous gene are suppressed. The
double-stranded RNA may be formed from two separate complementary
RNAs or may be a single RNA with internally complementary sequences
that form a double-stranded RNA. The introduced double-stranded RNA
is initially cleaved into small fragments, which then serve as
indexes of the target gene in some manner, thereby degrading the
target gene. RNAi is known to be also effective in plants (see,
e.g., Chuang, C. F. & Meyerowitz, E. M., (2000); Proc. Natl.
Acad. Sci. USA 97:4985 Waterhouse et al., (1998) Proc. Natl. Acad.
Sci. USA 95:13959-13964; Tabara et al. (1998) Science 282:430-431).
For example, to achieve suppression of the expression of a DNA
encoding a protein using siRNA, a double-stranded RNA having the
sequence of a DNA encoding the protein, or a substantially similar
sequence thereof (including those engineered not to translate the
protein) or fragment thereof, is introduced into a plant of
interest, e.g., wheat. The resulting plants may then be screened
for a phenotype associated with the target protein and/or by
monitoring steady-state RNA levels for transcripts encoding the
protein. Although the nucleic acids forming the basis for RNAi need
not be completely identical to the targeted gene, they may be at
least 70%, 80%, 90%, 95% or more identical to the CAO targeted gene
sequence; such as, for example, a gene from SEQ ID NO 1-5 and
fragments thereof. See, e.g., U.S. Patent Publication No.
2004/0029283. The constructs encoding an RNA molecule with a
stem-loop structure that is unrelated to the target gene and that
is positioned distally to a sequence specific for the gene of
interest may also be used to inhibit target gene expression. See,
e.g., U.S. Patent Publication No. 2003/0221211, and the current
examples.
[0173] The siRNA polynucleotides may encompass the full-length
target RNA or may correspond to a fragment of the target RNA. In
some cases, the fragment will have fewer than 100, 200, 300, 400,
500 600, 700, 800, 900 or 1,000 nucleotides corresponding to the
target sequence. In addition, in some embodiments, these fragments
are at least, e.g., 15, 20, 25, 30, 50, 100, 150, 200, or more
nucleotides in length. In some cases, fragments for use in RNAi
will be at least substantially similar to regions of a target
protein that do not occur in other proteins in the organism or may
be selected to have as little similarity to other organism
transcripts as possible, e.g., selected by comparison to sequences
in analyzing publicly-available sequence databases. Thus, siRNA
fragments may be selected for similarity or identity with the N
terminal region of the chlorophyll a oxygenase sequences of the
invention (i.e., those sequences lacking significant homology to
sequences in the databases) or may be selected for identity or
similarity to conserved regions of chlorophyll a oxygenase
proteins.
[0174] Expression vectors that continually express siRNA in
transiently- and stably-transfected cells have been engineered to
express small hairpin RNAs, which get processed in vivo into siRNAs
molecules capable of carrying out gene-specific silencing
(Brummelkamp et al., (2002) Science 296:550-553, and Paddison, et
al., (2002) Genes & Dev. 16:948-958). Post-transcriptional gene
silencing by double-stranded RNA is discussed in further detail by
Hammond et al. Nature Rev Gen 2:110-119 (2001), Fire et al. (1998)
Nature 391:806-811 and Timmons and Fire (1998) Nature 395:854.
[0175] One of skill in the art will recognize that using technology
based on specific nucleotide sequences (e.g., antisense or sense
suppression technology), families of homologous genes can be
suppressed with a single sense or antisense transcript. For
instance, if a sense or antisense transcript is designed to have a
sequence that is conserved among a family of genes, then multiple
members of a gene family can be suppressed. Conversely, if the goal
is to only suppress one member of a homologous gene family, then
the sense or antisense transcript should be targeted to sequences
with the most variation between family members.
Light Regulated Translational Modulators
[0176] The present invention exploits the ability of certain
proteins (redox-sensitive modulators) to act as reversible
thiol-based redox switches to regulate gene expression in plants to
enable the light dependent regulation of PSII antenna size. Such
proteins represent a growing family of proteins that is widely
dispersed within the plant and animal kingdoms. See generally
Antelmann H, & Heimann J D. (2010), Brandes et al., (2009)
Thiol-based redox switches in eukaryotic proteins. Antioxid Redox
Signal. 11(5):997-1014, Paget M S, & Buttner M J. (2003)
Thiol-based regulatory switches. Annu Rev Genet. 37:91-121.
[0177] The cold shock domain (CSD) is among the most ancient and
well conserved nucleic acid binding domains from bacteria to higher
animals and plants (Chsikam et al., BMB Reports (2010) 43(1) 1-8;
Nakaminami et al., (2006) 103(26) 10123-10127).
[0178] Proteins containing a CSD motif are also referred to as Y
box proteins and eukaryotic members of this large family generally
contain a secondary auxiliary RNA domain which modulates the RNA
affinity of the protein, but can be dispensable for selective RNA
recognition.
[0179] An exemplary redox-sensitive modulator includes the
cytosolic RNA binding protein NAB 1 (SEQ. ID. NO. 6) from
Chlamydomonas. NAB 1 harbors 2 RNA binding motifs and one of these
motifs, located at the N-terminus, is a cold shock domain. NAB 1
represses the translation of LHC II (light harvesting complex of
photosystem II) by sequestering the encoding mRNAs into
translationally silent mRNA complexes. (Mussgnug et al., The Plant
Cell (2005) 17 3409-3421).
[0180] NAB 1 contains 2 cysteine residues, Cys-81 and Cys-226,
within its C-terminal RNA recognition motif. Modification of these
cysteines either by oxidation or by alkylation in vitro is
accompanied by a decrease in RNA binding affinity for the target
mRNA sequence. Recent studies have confirmed that NAB 1 is fully
active in its dithiol reduced state, and is reversibly deactivated
by modification of its cysteines. (Wobbe et al., (2009) Pro. Nat.
Acad. Sci. 106(32) 13290-13295).
[0181] NAB 1 and NAB 1-like redox-sensitive modulators from a
number of different species have been sequenced, and are known in
the art to be at least partially functionally interchangeable. It
would thus be a routine matter to identify and select a variant
being a NAB 1 or NAB 1-like protein from a species or genus other
than Chlamydomonas. Several such variants of NAB 1 or NAB 1-like
redox-sensitive modulators from a number of species are identified
by their amino acid sequence in SEQ. ID. Nos. 6-17.
[0182] Thus all such homologues, orthologs, and naturally occurring
isoforms of NAB 1 from Chlamydomonas as well as other species (SEQ.
ID. NOs. 6-17) are included in any of the methods and kits of the
invention, as long as they retain detectable activity. It will be
understood that for the recombinant production of NAB 1 in
different species it will typically be necessary to codon optimize
the nucleic acid sequence of the gene for the organism in question.
Such codon optimization can be completed by standard analysis of
the preferred codon usage for the organism in question, and the
synthesis of an optimized nucleic acid via standard DNA synthesis.
A number of companies provide such services on a fee for services
basis and include for example, DNA2.0, (CA, USA) and Operon
Technologies. (CA, USA).
[0183] It is known in the art to synthetically modify the sequences
of proteins or peptides, while retaining their useful activity, and
this may be achieved using techniques which are standard in the art
and widely described in the literature, e.g., random or
site-directed mutagenesis, cleavage, and ligation of nucleic acids,
or via the chemical synthesis or modification of amino acids or
polypeptide chains. For instance, conservative amino acid mutation
changes can be introduced into NAB 1 protein and are considered
within the scope of the present invention.
[0184] The NAB 1 and NAB 1-like redox-sensitive modulators may thus
include one or more amino acid deletions, additions, insertions,
and/or substitutions based on any of the naturally-occurring
isoforms of NAB 1. These may be contiguous or non-contiguous.
Representative variants may include those having 1 to 8, or more
preferably 1 to 4, 1 to 3, or 1 or 2 amino acid substitutions,
insertions, and/or deletions as compared to any of sequences of
SEQ. ID. NOs 6-17.
[0185] NAB1 and NAB 1-like redox-sensitive modulator polypeptides
which may be used in any of the methods of the invention may have
amino acid sequences which are substantially homologous, or
substantially similar to any of the NAB 1 sequences of SEQ. ID. NOs
6-17. Alternatively, the NAB 1 and NAB 1-like redox-sensitive
modulators may have an amino acid sequences having at least 30%
preferably at least 40, 50, 60, 70, 75, 80, 85, 90, 95, 98, or 99%
identity with a NAB 1 or NAB 1-like redox-sensitive modulators
listed in SEQ. ID. NOs 6-17. In one aspect, the NAB 1 or and NAB
1-like redox-sensitive modulator is substantially homologous, or
substantially similar to SEQ. ID. NO. 6.
[0186] Fragments of endogenous or synthetic NAB 1 or and NAB 1-like
redox-sensitive modulator sequences may also have the desirable
functional properties of the peptide from which they were derived
and may be used in any of the methods of the invention. The term
"fragment" as used herein thus includes fragments of NAB 1 provided
that the fragment retains the biological activity of the whole
molecule. The fragment may also include an N-terminal or C-terminal
fragment of NAB I. Preferred fragments comprise residues 1-80 of
the endogenous NAB 1 or and NAB 1-like redox-sensitive modulator,
comprising the cold shock domain, or residues 160 to 247 comprising
the RNA recognition motif. Also included are fragment s having N-
and I or C-terminal extensions or flanking sequences. The length of
such extended peptides may vary, but typically are not more than
50, 30, 25, or 20 amino acids in length.
[0187] Fusion proteins of NAB 1, and fragments of NAB I to other
proteins are also included, and these fusion proteins may enhance
the biological activity of NAB 1, targeting, binding or redox
sensitivity. It will be appreciated that a flexible molecular
linker (or spacer) optionally may be interposed between, and
covalently join, the NAB 1 and any of the fusion proteins disclosed
herein. Any such fusion protein many be used in any of the methods
of the present invention.
[0188] Variants may include, e.g., different allelic variants as
they appear in nature, e.g., in other species or due to
geographical variation. All such variants, derivatives, fusion
proteins, or fragments of NAB 1 are included, may be used in any of
the methods claims disclosed herein, and are subsumed under the
term "NAB 1".
[0189] The variants, derivatives, and fragments are functionally
equivalent in that they have detectable redox dependent RNA binding
activity. More particularly, they exhibit at least 40%, preferably
at least 60%, more preferably at least 80% of the activity of
wild-type NAB 1, particularly Chlamydomonas NAB 1. Thus they are
capable of functioning as NAB 1, i.e., can substitute for NAB 1
itself.
[0190] Such activity means any activity exhibited by an endogenous
NAB 1 or and NAB 1-like redox-sensitive modulator, whether a
physiological response inhibited in an in vivo or in vitro test
system, or any biological activity or reaction mediated by an
endogenous NAB 1 or and NAB 1-like redox-sensitive modulator (e.g.,
in an enzyme assay or in binding to test tissues, nucleic acids, or
metal ions).
[0191] Thus, it is known that NAB 1 binds to cold shock domain
consensus sequence motifs, for example as provided in SEQ ID Nos
18-26. An assay for NAB 1 activity can thus be made by assaying for
redox dependent binding to a nucleic acid comprising a cold shock
domain consensus sequence motif. Such an assay is described in
Wobbe et al., (2009) Proc. Natl. Acad. Sci. USA 106 (32)
13290-13295.
[0192] In one aspect of any of these methods and transgenic
organisms, the NAB 1 or and NAB 1-like redox-sensitive modulator is
endogenous to the organism. In another aspect of any of these
methods and transgenic organisms, the NAB 1 is heterologous to the
transgenic organism.
Plants
[0193] The present invention can be practiced with any plant with
light harvesting antenna. Previous application of this technology
in algae (Sayre WO2013/016267) has demonstrated that single-celled
photosynthetic eukaryotes are capable of modulation of antenna size
under different light intensities. This previous invention did not
contemplate tissue-specific expression in plants nor the improved
production of storage tissues such as starch and oils observed in
the present invention. The present invention demonstrates that this
is also possible with the more complex, tissue-specific complexes
in higher plants and that unexpected results occurred in the
deposition of starch and other storage compounds. The plants used
with the invention can include any naturally occurring plant
species or any genetically engineered plant. The plant used with
the invention includes any commercially available strain, any
strain native to a particular region, or any proprietary strain.
Additionally, the plant can be of any Division, Class, Order,
Family, Genus, or Species, or any subsection thereof. Another
contrast with the WO2013/016267 invention is the improved growth
rate of the transformed plants versus wild-type.
[0194] In certain embodiments, the plants used with the methods of
the invention can be members of any division in the plant kingdom
(Plantae) whether vascular or non-vascular, monocot or dicot, land
or water plant. In one aspect of the invention the plants are
chosen from land plants. In a further aspect the plants are chosen
from those important to agriculture or biofuel production. In a
further aspect, the plants are chosen from seed bearing plants.
[0195] Plants that could be of particular importance in the
application of this invention are seed crops such as but not
limited to millet, corn (maize), sorghum, barley, oats, rice, rye,
teff, triticale, wheat, rice, wild rice, amaranth, beans, lentils,
fava, lupin, peanuts, chickpeas, pigeon peas, soybeans, mustards,
rape seed (canola), safflower, sunflower, flax, jatropa, hemp, and
Poppy.
[0196] Plants that could be of particular importance in the
application of this invention are biomass crops such as but not
limited to trees (poplar, willow, eucalyptus, southern beech,
sycamore, ash), miscanthus, hemp, switchgrass, reed canary grass,
rye, and giant reed.
[0197] Plants that could be of particular importance in the
application of this invention are sugar, starch and oil crops such
as but not limited to beets, sweet sorghum, sugar cane, potatoes,
sweet potatoes, cassava, olives, soybean, rapeseed, corn, and
linseed.
[0198] In one aspect of any of the claimed methods, plants of the
following species are preferred, Camelina and Arabidopsis.
Expression Vectors
[0199] In any of these embodiments, an expression vector can be
used to deliver a nucleic acid molecule comprising expression
control sequences comprising a cold-shock domain consensus sequence
(CSDDCS) motif operatively coupled to a polynucleotide sequence
encoding CAO. In one aspect the expression vector will further
comprise a promoter operatively coupled to the CSDDCS motif and
drives expression of the CAO coding region. Typically the CSDDCS
motif is inserted between the promoter and the start of the Cao
start codon.
[0200] In one aspect, the expression vector comprises a CSDDCS
motif is substantially identical to a sequence selected from the
group consisting of SEQ ID. No. 18, SEQ ID. No. 19, SEQ ID. No. 20,
SEQ ID. No. 21, SEQ ID. No. 22, SEQ ID. No. 23, SEQ ID. No. 24, SEQ
ID. No. 25, and SEQ ID. No. 26.
[0201] In different embodiments the Cao gene may be an endogenous
gene from the plant to be used with the expression vector.
Accordingly in different aspects the Cao gene may be any plant Cao
gene. In one aspect, the Cao gene is substantially identical to a
sequence selected from the group consisting of SEQ ID. No. 1, SEQ
ID. No. 2, SEQ ID. No. 3, SEQ ID. No. 4, and SEQ ID. No. 5.
[0202] In any of these embodiments, a vector can also be used to
deliver a nucleic acid molecule encoding a silencing RNA into a
plant cell to enable the suppression of the expression of the
endogenous CAO in the cell.
[0203] The expression vectors can be, for example, DNA plasmids or
viral vectors. Various expression vectors are known in the art. The
selection of the appropriate expression vector can be made on the
basis of several factors including, but not limited to the cell
type wherein expression is desired. For example,
Agrobacterium-based expression vectors can be used to express the
nucleic acids of the presently disclosed subject matter when stable
expression of the vector insert is sought in a plant cell.
[0204] In other embodiments of the invention, it is contemplated
that one may wish to employ replication-competent viral vectors for
plant transformation. Such vectors include, for example, wheat
dwarf virus (WDV) "shuttle" vectors, such as pW 1-11 and pW 1-GUS
(Ugaki et al., 1991). These vectors are capable of autonomous
replication in maize cells as well as E. coli, and as such may
provide increased sensitivity for detecting DNA delivered to
transgenic cells. A replicating vector also may be useful for
delivery of genes flanked by DNA sequences from transposable
elements such as Ac/Ds, or Mu. It has been proposed that
transposition of these elements within the maize genome requires
DNA replication (Laufs et al, 1990). It also is contemplated that
transposable elements would be useful for producing transgenic
plants lacking elements necessary for selection and maintenance of
the plasmid vector in bacteria, e.g., antibiotic resistance genes,
or other selectable markers, and origins of DNA replication. It
also is proposed that use of a transposable element such as Ac, Ds,
or Mu would actively promote integration of the desired DNA and
hence increase the frequency of stably transformed cells.
Promoters
[0205] The expression of the nucleotide sequence of the expression
cassette can be under the control of a constitutive promoter or an
inducible promoter that initiates transcription only when the
transformed cell is exposed to some particular external stimulus.
Basal promoters in plants typically comprise canonical regions
associated with the initiation of transcription, such as CAAT and
TATA boxes. The TATA box element is usually located approximately
20 to 35 nucleotides upstream of the initiation site of
transcription. The CAAT box element is usually located
approximately 40 to 200 nucleotides upstream of the start site of
transcription. The location of these basal promoter elements result
in the synthesis of a RNA transcript comprising nucleotides
upstream of the translational ATG start site. The region of RNA
upstream of the ATG is commonly referred to as a 5' untranslated
region or 5' UTR. It is possible to use standard molecular biology
techniques to make combinations of basal promoters, that is,
regions comprising sequences from the CAAT box to the translational
start site, with other upstream promoter elements to enhance or
otherwise alter promoter activity or specificity.
[0206] The promoters may be altered to contain "enhancer DNA" to
assist in elevating gene expression. As is known in the art certain
DNA elements can be used to enhance the transcription of DNA. These
enhancers often are found 5' to the start of transcription in a
promoter that functions in eukaryotic cells, but can often be
inserted upstream (5') or downstream (3') to the coding sequence.
In some instances, these 5' enhancer DNA elements are introns.
Among the introns that are particularly useful as enhancer DNA are
the 5' introns from the rice actin 1 gene (see U.S. Pat. No.
5,641,876), the rice actin 2 gene, the maize alcohol dehydrogenase
gene, the maize heat shock protein 70 gene (U.S. Pat. No.
5,593,874), the maize shrunken 1 gene, the light sensitive I gene
of Solanum tuberosum, and the heat shock protein 70 gene of Petunia
hybrida (U.S. Pat. No. 5,659,122).
[0207] For in vivo expression in plants, exemplary constitutive
promoters include those derived from the CaMV 35S, rice actin, and
maize ubiquitin genes, each described herein below.
[0208] Exemplary inducible promoters for this purpose include the
chemically inducible PR-promoter and a wound-inducible promoter,
also described herein below. Selected promoters can direct
expression in specific cell types (such as leaf epidermal cells,
mesophyll cells, root cortex cells) or in specific tissues or
organs (roots, leaves or flowers, for example). Exemplary
tissue-specific promoters include the well-characterized
leaf-specific promoters, each described herein below.
[0209] Depending upon the cell system utilized, any one of a number
of suitable promoters can be used. Promoter selection can be based
on expression profile and expression level. The following are
representative non-limiting examples of promoters that can be used
in the expression cassettes.
[0210] 35S Promoter. The CaMV 35S promoter can be used to drive
constitutive gene expression. Construction of the plasmid pCGNl 761
is described in the published European Patent Application EP 0 392
225, which a CaMV 35S promoter and the tml transcriptional
terminator with a unique EcoRI site between the promoter and the
terminator and has a pUC-type backbone.
[0211] Actin Promoter. Several isoforms of actin are known to be
expressed in most cell types and consequently the actin promoter is
a good choice for a constitutive promoter. In particular, the
promoter from the rice Act 1 gene has been cloned and characterized
(McElroy et al., 1990). A 1.3 kb fragment of the promoter was found
to contain inter alia the regulatory elements required for
expression in rice protoplasts. Furthermore, numerous expression
vectors based on the Act 1 promoter have been constructed
specifically for use in monocotyledons (McElroy et al., 1991).
These incorporate the Act 1-intron 1, Adbl 5' flanking sequence and
Adbl-intron 1 (from the maize alcohol dehydrogenase gene) and
sequence from the CaMV 35S promoter. Vectors showing highest
expression were fusions of 35S and Act 1 intron or the Act 1 5'
flanking sequence and the Act 1-intron. Optimization of sequences
around the initiating ATG (of the GUS reporter gene) also enhanced
expression.
[0212] Ubiquitin Promoter. Ubiquitin is another gene product known
to accumulate in many cell types and its promoter has been cloned
from several species for use in transgenic plants (e.g.
sunflower--Binet et al., 1991 and maize--Christensen et al, 1989).
The maize ubiquitin promoter has been developed in transgenic
monocot systems and its sequence and vectors constructed for
monocot transformation are disclosed in the European Patent
Publication EP 0 342 926 which is herein incorporated by reference.
Taylor et al., 1993 describe a vector (pAHC25) that comprises the
maize ubiquitin promoter and first intron and its high activity in
cell suspensions of numerous monocotyledons when introduced via
microparticle bombardment. The ubiquitin promoter is suitable for
gene expression in transgenic plants, especially monocotyledons.
Suitable vectors are derivatives of pAHC25 or any of the
transformation vectors described in this application, modified by
the introduction of the appropriate ubiquitin promoter and/or
intron sequences.
[0213] Inducible Expression Chemically Inducible PR-1a Promoter.
The double 35S promoter in pCGN 1 761ENX can be replaced with any
other promoter of choice that will result in suitably high
expression levels. By way of example, one of the chemically
inducible promoters described in U.S. Pat. No. 5,614,395 can
replace the double 35S promoter.
[0214] The promoter of choice is preferably excised from its source
by restriction enzymes, but alternatively can be PCR-amplified
using primers that carry appropriate terminal restriction
sites.
[0215] The selected target gene coding sequence can be inserted
into this vector, and the fusion products (i.e.,
promoter-gene-terminator) can subsequently be transferred to any
selected transformation vector, including those described below.
Various chemical regulators can be employed to induce expression of
the selected coding sequence in the plants transformed according to
the presently disclosed subject matter, including the
benzothiadiazole, isonicotinic acid, and salicylic acid compounds
disclosed in U.S. Pat. Nos. 5,523,311 and 5,614,395, herein
incorporated by reference.
[0216] Transcriptional Terminators. A variety of transcriptional
terminators are available for use in expression cassettes. These
are responsible for the termination of transcription beyond the
transgene and its correct polyadenylation.
[0217] Appropriate transcriptional terminators are those that are
known to function in the relevant plant system. Representative
plant transcriptional terminators include the CaMV 35S terminator,
the tml terminator, the nopaline synthase terminator, and the pea
rbcS E9 terminator. With regard to RNA polymerase III terminators,
these terminators typically comprise--52 run of 5 or more
consecutive thymidine residues. In one embodiment, an RNA
polymerase III terminator comprises the sequence TTTTTTT. These can
be used in both monocots and dicots.
[0218] Sequences for the Enhancement or Regulation of
Expression--Numerous sequences have been found to enhance the
expression of an operatively lined nucleic acid sequence, and these
sequences can be used in conjunction with the nucleic acids of the
presently disclosed subject matter to increase their expression in
transgenic plants.
[0219] Various intron sequences have been shown to enhance
expression, particularly in monocotyledonous cells. For example,
the introns of the maize Adbl gene have been found to significantly
enhance the expression of the wild-type gene under its cognate
promoter when introduced into maize cells. Intron 1 was found to be
particularly effective and enhanced expression in fusion constructs
with the chloramphenicol acetyltransferase gene (Callis et al.,
1987). In the same experimental system, the intron from the maize
bronze gene had a similar effect in enhancing expression. Intron
sequences have been routinely incorporated into plant
transformation vectors, typically within the non-translated
leader.
[0220] A number of non-translated leader sequences derived from
viruses are also known to enhance expression, and these are
particularly effective in dicotyledonous cells. Specifically,
leader sequences from Tobacco Mosaic Virus (TMV, the "W-sequence"),
Maize Chlorotic Mottle Virus (MCMV), and Alfalfa Mosaic Virus (AMY)
have been shown to be effective in enhancing expression (e.g.
Gallie et al., 1987; Skuzeski et al., 1990).
[0221] Agrobacterium Transformation Vectors. Many vectors are
available for transformation using Agrobacterium tumefaciens and
may be used for plant transformation. These typically carry at
least one T-DNA border sequence and include vectors such as pBIN 1
9 (Bevan, 1984) and related vectors.
[0222] Other Plant Transformation Vectors: Transformation without
the use of Agrobacterium tumefaciens circumvents the requirement
for T-DNA sequences in the chosen transformation vector and
consequently vectors lacking these sequences can be utilized in
addition to vectors such as the ones described above which contain
T-DNA sequences. Transformation techniques that do not rely on
Agrobacterium include transformation via particle bombardment,
protoplast uptake (e.g. PEG and electroporation), vortexing with
glass beads, and microinjection. The choice of vector can depend on
the technique chosen for the species being transformed.
[0223] Selectable Markers: For certain target species, different
antibiotic or herbicide selection markers can be preferred.
Selection markers used routinely in transformation include the
nptll gene, which confers resistance to kanamycin and related
antibiotics (Messing & Vierra, 1982; Bevan et al., 1983), the
bar gene, which confers resistance to the herbicide
phosphinothricin (White et al., 1990; Spencer et al., 1990), the
hph gene, which confers resistance to the antibiotic hygromycin
(Blochlinger & Diggelmann, 1984), the dhfr gene, which confers
resistance to methotrexate (Bourouis & Jarry, 1983), and the
EPSP synthase gene, which confers resistance to glyphosate (U.S.
Pat. Nos. 4,940,935 and 5, 188,642).
[0224] Screenable Markers. An example of screenable markers that
may be employed include a .beta.-glucuronidase or uidA gene
(Jefferson et al., 1986; the protein product is commonly referred
to as GUS), isolated from E. coli, which encodes an enzyme for
which various chromogenic substrates are known; an R-locus gene,
which encodes a product that regulates the production of
anthocyanin pigments (red color) in plant tissues (Dellaporta et
al., 1988); a P-lactamase gene (Sutcliffe, 1978), which encodes an
enzyme for which various chromogenic substrates are known (e.g.,
PADAC, a chromogenic cephalosporin); a xylE gene (Zukowsky et al.,
1983) which encodes a catechol dioxygenase that can convert
chromogenic catechols; an alpha-amylase gene (Ikuta et al., 1990);
a tyrosinase gene (Katz et al., 1983) which encodes an enzyme
capable of oxidizing tyrosine to DOPA and dopaquinone which in time
condenses to form the easily-detectable compound melanin; a
.beta.-galactosidase gene, which encodes an enzyme for which there
are chromogenic substrates; a luciferase (Lux) gene (Ow et al.,
1986), which allows for bioluminescence detection; an aequorin gene
(Prasher et al., 1985) which may be employed in calcium-sensitive
bioluminescence detection; or a gene encoding for green fluorescent
protein (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al.,
1996; Tian et al., 1997; PCT Publication WO 97/41228).
[0225] The R gene complex in maize encodes a protein that acts to
regulate the production of anthocyanin pigments in most seed and
plant tissue. Maize strains can have one, or as many as four, R
alleles which combine to regulate pigmentation in a developmental
and tissue-specific manner. Thus, an R gene introduced into such
cells will cause the expression of a red pigment and, if stably
incorporated, can be visually scored as a red sector. If a maize
line carries dominant alleles for genes encoding for the enzymatic
intermediates in the anthocyanin biosynthetic pathway (C2, A1, A2,
Bz 1 and Bz2), but carries a recessive allele at the R locus,
transformation of any cell from that line with R will result in red
pigment formation. Exemplary lines include Wisconsin 22 which
contains the rg-Stadler allele and TR I 12, a K55 derivative which
has the genotype r-g, b, Pl. Alternatively, any genotype of maize
can be utilized if the CI and R alleles are introduced
together.
[0226] It further is proposed that R gene regulatory regions may be
employed in chimeric constructs in order to provide mechanisms for
controlling the expression of chimeric genes. More diversity of
phenotypic expression is known at the R locus than at any other
locus (Coe et al., 1988). It is contemplated that regulatory
regions obtained from regions 5' to the structural R gene would be
valuable in directing the expression of genes for, e.g., insect
resistance, herbicide tolerance or other protein coding regions.
For the purposes of the present invention, it is believed that any
of the various R gene family members may be successfully employed
(e.g., P, S, Le, etc.). However, the most preferred will generally
be Sn (particularly Sn:bol3). Sn is a dominant member of the R gene
complex and is functionally similar to the R and B loci in that Sn
controls the tissue-specific deposition of anthocyanin pigments in
certain seedling and plant cells, therefore, its phenotype is
similar to R.
[0227] Other markers provide for visible light emission as an
easily screened phenotype. A selectable marker contemplated for use
in the present invention is firefly luciferase, encoded by the Lux
gene. The presence of the tux gene in transformed cells may be
detected using, for example, X-ray film, scintillation counting,
fluorescent spectrophotometry, low-light video cameras, photon
counting cameras or multiwell luminometry. It also is envisioned
that this system may be developed for population screening for
bioluminescence, such as on tissue culture plates, or even for
whole plant screening. The gene which encodes green fluorescent
protein (GFP) is contemplated as a particularly useful reporter
gene (Sheen et al., 1995; Haseloff et al., 1997; Reichel et al.,
1996; Tian et al., 1997; PCT Publication WO 97/41228). Expression
of green fluorescent protein may be visualized in a cell or plant
as fluorescence following illumination by particular wavelengths of
light. Where use of a selectable marker gene such as Lux or GFP is
desired, the inventors contemplated that benefit may be realized by
creating a gene fusion between the selectable marker gene and a
selectable marker gene, for example, a GFP-NPTII gene fusion (PCT
Publication WO 99/60129). This could allow, for example, selection
of transformed cells followed by screening of transgenic plants or
seeds. In a similar manner, it is possible to utilize other readily
available fluorescent proteins such as red fluorescent protein
(CLONTECH, Palo Alto, Calif.).
Methods of Transformation
[0228] Suitable methods for plant transformation for use with the
current invention are believed to include virtually any method by
which DNA can be introduced into a cell, such as by direct delivery
of DNA such as by PEG-mediated transformation of protoplasts
(Omirulleh et al., 1993), by desiccation/inhibition-mediated DNA
uptake (Potrykus et al., 1985), by electroporation (U.S. Pat. No.
5,384,253, specifically incorporated herein by reference in its
entirety), by agitation with silicon carbide fibers (Kaeppler et
al., 1990; U.S. Pat. Nos. 5,302,523, and 5,464,765, each
specifically incorporated herein by reference in their entirety),
by Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,591,616
and 5,563,055; each specifically incorporated herein by reference)
and by acceleration of DNA coated particles (U.S. Pat. Nos.
5,550,318; 5,538,877; and 5,538,880; each specifically incorporated
herein by reference in their entirety), and etc. Through the
application of techniques such as these, maize cells as well as
those of virtually any other plant species may be stably
transformed and these the transformed cells developed into
transgenic plants. In certain embodiments, acceleration methods are
preferred and include, for example, microparticle bombardment and
the like.
Electroporation
[0229] Where one wishes to introduce DNA by means of
electroporation, it is contemplated that the method of Krzyzek et
al. (U.S. Pat. No. 5,384,253, incorporated herein by reference in
its entirety) will be particularly advantageous. In this method,
certain cell wall-degrading enzymes, such as pectin-degrading
enzymes, are employed to render the target recipient cells more
susceptible to transformation by electroporation than untreated
cells. Alternatively, recipient cells are made more susceptible to
transformation by mechanical wounding.
[0230] To effect transformation by electroporation, one may employ
either friable tissues, such as a suspension culture of cells or
embryogenic callus or alternatively one may transform immature
embryos or other organized tissue directly. In this technique, one
would partially degrade the cell walls of the chosen cells by
exposing them to pectin-degrading enzymes (pectolyases) or
mechanically wounding in a controlled manner. Examples of some
species that have been transformed by electroporation of intact
cells include maize (U.S. Pat. No. 5,384,253; D'Halluin et al.,
1992), wheat (Zhou et al., 1993), and soybean (Christou et al.,
1987).
[0231] One also may employ protoplasts for electroporation
transformation of plants (Bates, 1994; Lazzeri, 1995). For example,
the generation of transgenic soybean plants by electroporation of
cotyledon-derived protoplasts is described by Dhir and Widholm in
PCT Publication WO 92117598 (specifically incorporated herein by
reference). Other examples of species for which protoplast
transformation has been described include barley (Lazerri, 1995),
sorghum (Battraw and Hall, 1991), maize (Bhattacharjee et al.,
1997), wheat (He et al., 1994) and tomato (Tsukada, 1989).
Microparticle Bombardment
[0232] One method for delivering transforming DNA segments to plant
cells in accordance with the invention is microparticle bombardment
(U.S. Pat. Nos. 5,550,318; 5,538,880; 5,610,042; and PCT
Publication WO 95/06128; each of which is specifically incorporated
herein by reference in its entirety). In this method, particles may
be coated with nucleic acids and delivered into cells by a
propelling force. Exemplary particles include those comprised of
tungsten, platinum, and preferably, gold. It is contemplated that
in some instances DNA precipitation onto metal particles would not
be necessary for DNA delivery to a recipient cell using
microparticle bombardment. However, it is contemplated that
particles may contain DNA rather than be coated with DNA. Hence, it
is proposed that DNA-coated particles may increase the level of DNA
delivery via particle bombardment but are not, in and of
themselves, necessary. For the bombardment, cells in suspension are
concentrated on filters or solid culture medium. Alternatively,
immature embryos or other target cells may be arranged on solid
culture medium. The cells to be bombarded are positioned at an
appropriate distance below the microparticle stopping plate.
[0233] An illustrative embodiment of a method for delivering DNA
into plant cells by acceleration is the Biolistics Particle
Delivery System (BioRad, Hercules, Calif.), which can be used to
propel particles coated with DNA or cells through a screen, such as
a stainless steel or Nytex screen, onto a filter surface covered
with monocot plant cells cultured in suspension. The screen
disperses the particles so that they are not delivered to the
recipient cells in large aggregates. It is believed that a screen
intervening between the projectile apparatus and the cells to be
bombarded reduces the size of projectiles aggregate and may
contribute to a higher frequency of transformation by reducing the
damage inflicted on the recipient cells by projectiles that are too
large.
[0234] Microparticle bombardment techniques are widely applicable,
and may be used to transform virtually any plant species. Examples
of species for which have been transformed by microparticle
bombardment include monocot species such as maize (PCT Publication
WO 95/06128), barley (Ritala et al., 1994; Hensgens et al., 1993),
wheat (U.S. Pat. No. 5,563,055, specifically incorporated herein by
reference in its entirety), rice (Hensgens et al., 1993), oat
(Tarbet et al., 1995; Tarbet et al., 1998), rye (Hensgens et al.,
1993), sugarcane (Bower et al., 1992), and sorghum (Casa et al.,
1993; Hagio et al., 1991); as well as a number of dicots including
tobacco (Tomes et al., 1990; Buising and Benbow, 1994), soybean
(U.S. Pat. No. 5,322,783, specifically incorporated herein by
reference in its entirety), sunflower (Knittel et al. 1994), peanut
(Singsit et al., 1997), cotton (McCabe and Martinell, 1993), tomato
(Van Eck et al. 1995), and legumes in general (U.S. Pat. No.
5,563,055, specifically incorporated herein by reference in its
entirety).
Agrobacterium-Mediated Transformation
[0235] Agrobacterium-mediated transfer is a preferred system that
is widely applicable for introducing genes into plant. The use of
Agrobacterium-mediated plant integrating vectors to introduce DNA
into plant cells is well known in the art. See, for example, the
methods described by Fraley et al. (1985), Rogers et al. (1987) and
U.S. Pat. No. 5,563,055, specifically incorporated herein by
reference in its entirety.
[0236] Agrobacterium-mediated transformation is most efficient in
dicotyledonous plants and is the preferable method for
transformation of dicots, including Arabidopsis, tobacco, tomato,
and potato. Indeed, while Agrobacterium-mediated transformation has
been routinely used with dicotyledonous plants for a number of
years, it has only recently become applicable to monocotyledonous
plants. Advances in Agrobacterium-mediated transformation
techniques have now made the technique applicable to nearly all
monocotyledonous plants. For example, Agrobacterium-mediated
transformation techniques have now been applied to rice (Hiei et
al., 1997; Zhang et al., 1997; U.S. Pat. No. 5,591,616,
specifically incorporated herein by reference in its entirety),
wheat (McCormac et al., 1998), barley (Tingay et al., 1997;
McCormac et al., 1998), and maize (Ishida et al., 1996; U.S. Pat.
No. 5,981,840).
[0237] Modern Agrobacterium transformation vectors are capable of
replication in E. coli as well as Agrobacterium, allowing for
convenient manipulations as described (Klee et al., 1985).
Moreover, recent technological advances in vectors for
Agrobacterium-mediated gene transfer have improved the arrangement
of genes and restriction sites in the vectors to facilitate the
construction of vectors capable of expressing various polypeptide
encoding genes.
[0238] The vectors described (Rogers et al., 1987) have convenient
multi-linker regions flanked by a promoter and a polyadenylation
site for direct expression of inserted polypeptide encoding genes
and are suitable for present purposes. In addition, Agrobacterium
containing both armed and disarmed Ti genes can be used for the
transformations. In those plant strains where
Agrobacterium-mediated transformation is efficient, it is the
method of choice because of the facile and defined nature of the
gene transfer.
[0239] A number of wild-type and disarmed strains of Agrobacterium
tumefaciens and Agrobacterium rhizogenes harboring Ti or Ri
plasmids can be used for gene transfer into plants. Preferably, the
Agrobacterium contains disarmed Ti and Ri plasmids that do not
contain the oncogenes which cause tumorigenes is or rhizogenesis,
respectively, which are used as the vectors and contain the genes
of interest that are subsequently introduced into plants. Preferred
strains would include but are not limited to Agrobacterium
tumefaciens strain C58, a nopaline-type strain that is used to
mediate the transfer of DNA into a plant cell, octopine-type
strains such as LBA4404 or succinamopine-type strains e.g., EHA 101
or EHA105. The use of these strains for plant transformation has
been reported and the methods are familiar to those of skill in the
art.
[0240] Those of skill in the art are aware of the typical steps in
the plant transformation process. The Agrobacterium can be prepared
either by inoculating a liquid such as Luria Burtani (LB) media
directly from a glycerol stock or streaking the Agrobacterium onto
a solidified media from a glycerol stock, allowing the bacteria to
grow under the appropriate selective conditions, generally from
about 26-30.degree. C., more preferably about 28.degree. C., and
taking a single colony from the plate and inoculating a liquid
culture medium containing the selective agents. Alternatively a
transfer loop or slurry of Agrobacterium can be taken from the
plate and resuspended in liquid and used for inoculation. Those of
skill in the art are familiar with procedures for growth and
suitable culture conditions for Agrobacterium as well as subsequent
inoculation procedures. The density of the Agrobacterium culture
used for inoculation and the ratio of Agrobacterium cells to
explant can vary from one system to the next, and therefore
optimization of these parameters for any transformation method is
expected.
[0241] Typically, an Agrobacterium culture is inoculated from a
streaked plate or glycerol stock and is grown overnight, and the
bacterial cells are washed and resuspended in a culture medium
suitable for inoculation of the explant. Suitable inoculation media
for the present invention include, but are not limited 1/2 strength
MSPL (2.2 g/L GIBCO (Carlsbad, Calif.) MS salts, 2 mg/L glycine,
0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 115
g/L L-proline, 26 g/L D-glucose, 68.5 g/L sucrose, pH 5.4) or 1/2
strength MS VI (2.2 g/L GIBCO (Carlsbad, Calif.) MS salts, 2 mg/L
glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L
thiamine, 115 g/L L-proline, 10 g/L D-glucose, and 10 g/L sucrose,
pH 5.4). The inoculation media may be supplemented with a growth
inhibiting agent (PCT Publication WO 01109302). The range and
concentration of the growth inhibition agent can vary and depends
of the agent and plant system. Growth inhibiting agents including,
but not limited to, silver nitrate, silver thiosulfate, or
carbenicillin are the preferred growth inhibition agents. The
growth inhibiting agent is added in the amount necessary to achieve
the desired effect. Silver nitrate is preferably used in the
inoculation media at a concentration of about 1 .mu.M (micromolar)
to 1 mM (millimolar), more preferably 5 .mu.M-100 .mu.M. The
concentration of carbenicillin used in the inoculation media is
about 5 mg/L to 100 mg/L more preferably about 50 mg/L. A compound
which induces Agrobacterium virulence genes such as acetosyringone
can also be added to the inoculation medium.
[0242] In a preferred embodiment, the Agrobacterium used for
inoculation are pre-induced in a medium such as a buffered media
with appropriate salts containing acetosyringone, a carbohydrate,
and selective antibiotics. In a preferred embodiment, the
Agrobacterium cultures used for transformation are pre-induced by
culturing at about 28.degree. C. in AB-glucose minimal medium
(Chilton et al., 1974; Lichtenstein and Draper, 1986) supplemented
with acetosyringone at about 200 .mu.M and glucose at about 2%. The
concentration of selective antibiotics for Agrobacterium in the
pre-induction medium is about half the concentration normally used
in selection. The density of the Agrobacterium cells used is about
107-1010 cfu/mL of Agrobacterium. More preferably, the density of
Agrobacterium cells used is about 5.times.108-4.times.109 cfu/mL.
Prior to inoculation the Agrobacterium can be washed in a suitable
media such as 1/2 strength MS.
[0243] In a preferred embodiment, the floral dip method of
transformation with Agrobacterium and the Ti plasmid was used as
described in Example 4.
[0244] The next stage of the transformation process is the
inoculation. In this stage the explants and Agrobacterium cell
suspensions are mixed together. The mixture of Agrobacterium and
explant(s) can also occur prior to or after a wounding step. By
wounding as used herein is meant any method to disrupt the plant
cells thereby allowing the Agrobacterium to interact with the plant
cells. Those of skill in the art are aware of the numerous methods
for wounding. These methods would include, but are not limited to,
particle bombardment of plant tissues, sonicating, vacuum
infiltrating, shearing, piercing, poking, cutting, or tearing plant
tissues with a scalpel, needle or other device. The duration and
condition of the inoculation and Agrobacterium cell density will
vary depending on the plant transformation system. The inoculation
is generally performed at a temperature of about 15.degree.
C.-30.degree. C., preferably 23.degree. C.-28.degree. C. from less
than one minute to about 3 hours. The inoculation can also be done
using a vacuum infiltration system.
[0245] After inoculation, any excess Agrobacterium suspension can
be removed and the Agrobacterium and target plant material are
co-cultured. The co-culture refers to the time post-inoculation and
prior to transfer to a delay or selection medium. Any number of
plant tissue culture media can be used for the co-culture step. For
the present invention, a reduced salt media such as half-strength
MS-based co-culture media is used and the media lacks complex media
additives including but not limited to undefined additives such as
casein hydolysate, and B5 vitamins and organic additives. Plant
tissues after inoculation with Agrobacterium can be cultured in a
liquid media. More preferably, plant tissues after inoculation with
Agrobacterium are cultured on a semi-solid culture medium
solidified with a gelling agent such as agarose, more preferably a
low EEO agarose. The co-culture duration is from about one hour to
72 hours, preferably less than 36 hours, more preferably about 6
hours to 35 hours. The co-culture media can contain one or more
Agrobacterium growth inhibiting agent(s) or combination of growth
inhibiting agents such as silver nitrate, silver thiosulfate, or
carbenicillin. The concentration of silver nitrate or silver
thiosulfate is preferably about 1 .mu.M to 1 mM, more preferably
about 5 .mu.M to 100 .mu.M, even more preferably about 10 .mu.M to
50 .mu.M, most preferably about 20 .mu.M. The concentration of
carbenicillin in the co-culture medium is preferably about 5 mg/L
to 100 mg/L more preferably 10 mg/L to 50 mg/L, even more
preferably about 50 mg/L. The co-culture is typically performed for
about one to three days more preferably for less than 24 hours at a
temperature of about 18.degree. C.-30.degree. C., more preferably
about 23.degree. C.-25.degree. C. The co-culture can be performed
in the light or in light-limiting conditions. Preferably, the
co-culture is performed in light-limiting conditions. By
light-limiting conditions as used herein is meant any conditions
which limit light during the co-culture period including but not
limited to covering a culture dish containing the
plant/Agrobacterium mixture with a cloth, foil, or placing the
culture dishes in a black bag, or placing the cultured cells in a
dark room. Lighting conditions can be optimized for each plant
system as is known to those of skill in the art.
[0246] After co-culture with Agrobacterium, the explants can be
placed directly onto selective media. The explants can be
sub-cultured onto selective media in successive steps or stages.
For example, the first selective media can contain a low amount of
selective agent, and the next sub-culture can contain a higher
concentration of selective agent or vice versa. The explants can
also be placed directly on a fixed concentration of selective
agent. Alternatively, after co-culture with Agrobacterium, the
explants can be placed on media without the selective agent. Those
of skill in the art are aware of the numerous modifications in
selective regimes, media, and growth conditions that can be varied
depending on the plant system and the selective agent. In the
preferred embodiment, after incubation on non-selective media
containing the antibiotics to inhibit Agrobacterium growth without
selective agents, the explants are cultured on selective growth
media. Typical selective agents include but are not limited to
antibiotics such as geneticin (G418), kanamycin, paromomycin,
herbicides such as glyphosate or phosephinothericine, or other
growth inhibitory compounds such as amino acid analogues, e.g.,
5-methyltryptophan. Additional appropriate media components can be
added to the selection or delay medium to inhibit Agrobacterium
growth. Such media components can include, but are not limited to
antibiotics such as carbenicillin or cefotaxime.
[0247] After the co-culture step, and preferably before the
explants are placed on selective or delay media, cells can be
analyzed for efficiency of DNA delivery by a transient assay that
can be used to detect the presence of one or more gene(s) contained
on the transformation vector, including, but not limited to a
selectable marker gene such as the gene that encodes for
(3-glucuronidase (GUS). The total number of blue spots (indicating
GUS expression) for a selected number of explants is used as a
positive correlation of DNA transfer efficiency. The efficiency of
T-DNA delivery and the effect of various culture condition
manipulations on T-DNA delivery can be tested in transient analyses
as described. A reduction in the T-DNA transfer process can result
in a decrease in copy number and complexity of integration as
complex integration patterns can originate from co-integration of
separate T-DNAs (DeNeve et al., 1997). The effect of culture
conditions of the target tissue can be tested by transient analyses
and more preferably, in stably transformed plants. Any number of
methods are suitable for plant analyses, including but not limited
to, histochemical assays, biological assays, and molecular
analyses.
[0248] After effecting delivery of exogenous DNA to recipient
cells, the next steps generally concern identifying the transformed
cells for further culturing and plant regeneration. As mentioned
herein, in order to improve the ability to identify transformants,
one may desire to employ a selectable marker gene as, or in
addition to, the expressible gene of interest. In this case, one
would then generally assay the potentially transformed cell
population by exposing the cells to a selective agent or agents, or
one would screen the cells for the desired marker gene trait.
Other Transformation Methods
[0249] Transformation of plant protoplasts can be achieved using
methods based on calcium phosphate precipitation, polyethylene
glycol treatment, electroporation, and combinations of these
treatments (see, e.g., Potrykus et al., 1985; Lorz et al., 1985;
Omirulleh et al., 1993; Fromm et al., 1986; Uchirniya et al., 1986;
Callis et al., 1987; Marcotte et al., 1988).
[0250] Application of these systems to different plant strains
depends upon the ability to regenerate that particular plant strain
from protoplasts. Illustrative methods for the regeneration of
cereals from protoplasts have been described (Toriyama et al.,
1986; Yamada et al., 1986; Abdullah et al., 1986; Omirulleh et al.,
1993 and U.S. Pat. No. 5,508,184; each specifically incorporated
herein by reference in its entirety). Examples of the use of direct
uptake transformation of cereal protoplasts include transformation
of rice (Ghosh-Biswas et al., 1994), sorghum (Battraw and Hall,
1991), barley (Lazerri, 1995), oat (Zheng and Edwards, 1990) and
maize (Ornirulleh et al., 1993).
[0251] To transform plant strains that cannot be successfully
regenerated from protoplasts, other ways to introduce DNA into
intact cells or tissues can be utilized. For example, regeneration
of cereals from immature embryos or explants can be effected as
described (Vasil, 1989). Also, silicon carbide fiber-mediated
transformation may be used with or without first producing
protoplasts (Kaeppler, 1990; Kaeppler et al., 1992; U.S. Pat. No.
5,563,055, specifically incorporated herein by reference in its
entirety). Transformation with this technique is accomplished by
agitating silicon carbide fibers together with cells in a DNA
solution. DNA passively enters as the cells are punctured. This
technique has been used successfully with, for example, the monocot
cereals maize (PCT Publication WO 95/06128, specifically
incorporated herein by reference in its entirety).
Selection
[0252] It is believed that DNA is introduced into only a small
percentage of target cells in any one experiment. In order to
provide an efficient system for identification of those cells
receiving DNA and integrating it into their genomes one may employ
a means for selecting those cells that are stably transformed. One
exemplary embodiment of such a method is to introduce into a cell,
a marker gene which confers resistance to some normally inhibitory
agent, such as an antibiotic or herbicide. Examples of antibiotics
which may be used include the aminoglycoside antibiotics neomycin,
kanamycin, G418 and paromomycin, or the antibiotic hygromycin.
Resistance to the aminoglycoside antibiotics is conferred by
aminoglycoside phosphotransferase enzymes such as neomycin
phosphotransferase II (NPT II) or NPT I, whereas resistance to
hygromycin is conferred by hygromycin phosphotransferase.
[0253] Potentially transformed cells then are exposed to the
selective agent. In the population of surviving cells will be those
cells where, generally, the resistance-conferring gene has been
integrated and expressed at sufficient levels to permit cell
survival. Cells may be tested further to confirm stable integration
of the exogenous DNA. Using the techniques disclosed herein,
greater than 40% of bombarded embryos may yield transformants.
[0254] One example of an herbicide which is useful for selection of
transformed cell lines in the practice of the invention is the
broad spectrum herbicide glyphosate. Glyphosate inhibits the action
of the enzyme EPSPS, which is active in the aromatic amino acid
biosynthetic pathway. Inhibition of this enzyme leads to starvation
for the amino acids phenylalanine, tyrosine, and tryptophan and
secondary metabolites derived thereof. U.S. Pat. No. 4,535,060
describes the isolation of EPSPS mutations which confer glyphosate
resistance on the Salmonella typhimurium gene for EPSPS, aroA. The
EPSPS gene was cloned from Zea mays and mutations similar to those
found in a glyphosate resistant aroA gene were introduced in vitro.
Mutant genes encoding glyphosate resistant EPSPS enzymes are
described in, for example, PCT Publication WO 97/04103. The best
characterized mutant EPSPS gene conferring glyphosate resistance
comprises amino acid changes at residues 102 and 106, although it
is anticipated that other mutations will also be useful (PCT
Publication WO 97/04103). Furthermore, a naturally occurring
glyphosate resistant EPSPS may be used, e.g., the CP4 gene isolated
from Agrobacterium encodes a glyphosate resistant EPSPS (U.S. Pat.
No. 5,627,061).
[0255] To use the bar-bialaphos or the EPSPS-glyphosate selective
systems, tissue is cultured for 0-28 days on nonselective medium
and subsequently transferred to medium containing from 1-3 mg/L
bialaphos or 1-3 mM glyphosate as appropriate. While ranges of 1-3
mg/L bialaphos or 1-3 mM glyphosate will typically be preferred, it
is believed that ranges of 0.1-50 mg/L bialaphos or 0.1-50 mM
glyphosate will find utility in the practice of the invention.
Bialaphos and glyphosate are provided as examples of agents
suitable for selection of transformants, but the technique of this
invention is not limited to them.
[0256] Another herbicide which constitutes a desirable selection
agent is the broad spectrum herbicide bialaphos. Bialaphos is a
tripeptide antibiotic produced by Streptomyces hygroscopicus and is
composed of phosphinothricin (PPT), an analogue of L-glutamic acid,
and two L-alanine residues. Upon removal of the L-alanine residues
by intracellular peptidases, the PPT is released and is a potent
inhibitor of glutamine synthetase (GS), a pivotal enzyme involved
in ammonia assimilation and nitrogen metabolism (Ogawa et al.,
1973). Synthetic PPT, the active ingredient in the herbicide
Liberty.TM. also is effective as a selection agent. Inhibition of
GS in plants by PPT causes the rapid accumulation of ammonia and
death of the plant cells.
[0257] The organism producing bialaphos and other species of the
genus Streptomyces also synthesizes an enzyme phosphinothricin
acetyl transferase (PAT) which is encoded by the bar gene in
Streptomyces hygroscopicus and the pat gene in Streptomyces
viridochromogenes. The use of the herbicide resistance gene
encoding phosphinothricin acetyl transferase (PAT) is referred to
in DE 3642 829 A, wherein the gene is isolated from Streptomyces
viridochromogenes. In the bacterial source organism, this enzyme
acetylates the free amino group of PPT preventing auto-toxicity
(Thompson et al., 1987). The bar gene has been cloned (Murakami et
al., 1986; Thompson et al., 1987) and expressed in transgenic
tobacco, tomato, potato (De Block et al., 1987) Brassica (De Block
et al., 1989) and maize (U.S. Pat. No. 5,550,318). In previous
reports, some transgenic plants which expressed the resistance gene
were completely resistant to commercial formulations of PPT and
bialaphos in greenhouses.
[0258] It further is contemplated that the herbicide dalapon,
2,2-dichloropropionic acid, may be useful for identification of
transformed cells. The enzyme 2,2-dichloropropionic acid
dehalogenase (deh) inactivates the herbicidal activity of
2,2-dichloropropionic acid and therefore confers herbicidal
resistance on cells or plants expressing a gene encoding the
dehalogenase enzyme (Buchanan-Wollaston et al., 1992; U.S. Pat. No.
5,780,708).
[0259] Alternatively, a gene encoding anthranilate synthase, which
confers resistance to certain amino acid analogs, e.g.,
5-methyltryptophan or 6-methyl anthranilate, may be useful as a
selectable marker gene. The use of an anthranilate synthase gene as
a selectable marker was described in U.S. Pat. Nos. 5,508,468 and
6,118,047. An example of a selectable marker trait is the red
pigment produced under the control of the R-locus in maize. This
pigment may be detected by culturing cells on a solid support
containing nutrient media capable of supporting growth at this
stage and selecting cells from colonies (visible aggregates of
cells) that are pigmented. These cells may be cultured further,
either in suspension or on solid media. In a similar fashion, the
introduction of the C1 and B genes will result in pigmented cells
and/or tissues.
[0260] The enzyme luciferase may be used as a selectable marker in
the context of the present invention. In the presence of the
substrate luciferin, cells expressing luciferase emit light which
can be detected on photographic or x-ray film, in a luminometer (or
liquid scintillation counter), by devices that enhance night
vision, or by a highly light sensitive video camera, such as a
photon counting camera. All of these assays are nondestructive and
transformed cells may be cultured further following identification.
The photon counting camera is especially valuable as it allows one
to identify specific cells or groups of cells that are expressing
luciferase and manipulate cells expressing in real time. Another
selectable marker which may be used in a similar fashion is the
gene coding for green fluorescent protein (GFP) or a gene coding
for other fluorescing proteins such as DsRed.RTM. (Clontech, Palo
Alto, Calif.).
[0261] It further is contemplated that combinations of selectable
and selectable markers will be useful for identification of
transformed cells. In some cell or tissue types a selection agent,
such as bialaphos or glyphosate, may either not provide enough
killing activity to clearly recognize transformed cells or may
cause substantial nonselective inhibition of transformants and
nontransformants alike, thus causing the selection technique to not
be effective. It is proposed that selection with a growth
inhibiting compound, such as bialaphos or glyphosate at
concentrations below those that cause 100% inhibition followed by
screening of growing tissue for expression of a selectable marker
gene such as luciferase or GFP would allow one to recover
transformants from cell or tissue types that are not amenable to
selection alone. It is proposed that combinations of selection and
screening may enable one to identify transformants in a wider
variety of cell and tissue types. This may be efficiently achieved
using a gene fusion between a selectable marker gene and a
selectable marker gene, for example, between an NPTII gene and a
GFP gene (WO 99/60129).
Regeneration and Seed Production
[0262] Cells that survive the exposure to the selective agent, or
cells that have been scored positive in a screening assay, may be
cultured in media that supports regeneration of plants. In an
exemplary embodiment, MS and N6 (Chu et al., 1975) media may be
modified by including further substances such as growth regulators.
Preferred growth regulators for plant regeneration include
cytokinins such as 6-benzylamino purine, zeatin, kinetin,
thidiazuron, diphenylurea or the like, and abscisic acid. Media
improvement in these and like ways has been found to facilitate the
growth of cells at specific developmental stages. Tissue may be
maintained on a basic media with auxin type growth regulators until
sufficient tissue is available to begin plant regeneration efforts,
or following repeated rounds of manual selection, until the
morphology of the tissue is suitable for regeneration, then
transferred to media conducive to maturation of embryos. Cultures
are transferred every 1-4 weeks, preferably every 2-3 weeks on this
medium. Shoot development will signal the time to transfer to
medium lacking growth regulators.
[0263] The transformed cells, identified by selection or screening
and cultured in an appropriate medium that supports regeneration,
will then be allowed to mature into plants. Developing plantlets
were transferred to soil-free plant growth mix, and hardened off,
e.g., in an environmentally controlled chamber at about 85%
relative humidity, 600 ppm CO2, and 25-250 micromole photons m-2s-1
of light, prior to transfer to a greenhouse or growth chamber for
maturation. Plants are preferably matured either in a growth
chamber or greenhouse. Plants are regenerated from about 6 weeks to
10 months after a transformant is identified, depending on the
initial tissue. During regeneration, cells are grown on solid media
in tissue culture vessels. Illustrative embodiments of such vessels
are petri dishes and plant tissue culture flasks. Regenerating
plants are preferably grown at about 19 to 28.degree. C. After the
regenerating plants have reached the stage of shoot and root
development, they may be transferred to a greenhouse for further
growth and testing. Plants may be pollinated using conventional
plant breeding methods known to those of skill in the art and seed
produced.
[0264] Progeny may be recovered from transformed plants and tested
for expression of the exogenous expressible gene. Note however,
that seeds on transformed plants may occasionally require embryo
rescue due to cessation of seed development and premature
senescence of plants. To rescue developing embryos, they are
excised from surface-disinfected seeds 10-20 days post-pollination
and cultured. An embodiment of media used for culture at this stage
comprises MS salts, 2% sucrose, and 5.5 g/l agarose. In embryo
rescue, large embryos (defined as greater than 3 mm in length) are
germinated directly on an appropriate media. Embryos smaller than
that may be cultured for 1 wk on media containing the above
ingredients along with 10-5 M abscisic acid and then transferred to
growth regulator-free medium for germination.
Characterization
[0265] To confirm the presence of the exogenous DNA or
"transgene(s)" in the regenerating plants, a variety of assays,
known in the art may be performed. Such assays include, for
example, "molecular biological" assays, such as Southern and
Northern blotting and PCR; "biochemical" assays, such as detecting
the presence of a protein product, e.g., by immunological means
(ELISAs and Western blots) or by enzymatic function; plant part
assays, such as leaf or root assays; and also, by analyzing the
phenotype of the whole regenerated plant.
DNA Integration, RNA Expression and Inheritance
[0266] Genomic DNA may be isolated from callus cell lines or any
plant parts to determine the presence of the exogenous gene through
the use of techniques well known to those skilled in the art. Note,
that intact sequences will not always be present, presumably due to
rearrangement or deletion of sequences in the cell.
[0267] The presence of DNA elements introduced through the methods
of this invention may be determined by polymerase chain reaction
(PCR). Using this technique discreet fragments of DNA are amplified
and detected by gel electrophoresis. This type of analysis permits
one to determine whether a gene is present in a stable
transformant, but does not necessarily prove integration of the
introduced gene into the cell's genome. Typically, DNA has been
integrated into the genome of all transformants that demonstrate
the presence of the gene through PCR analysis. In addition, it is
not possible using PCR techniques to determine whether
transformants have exogenous genes introduced into different sites
in the genome, i.e., whether transformants are of independent
origin. Using PCR techniques it is possible to clone fragments of
the host's genomic DNA adjacent to an introduced gene.
[0268] Positive proof of DNA integration into the host genome and
the independent identities of transformants may be determined using
the technique of Southern hybridization. Using this technique
specific DNA sequences that were introduced into the host genome
and flanking host DNA sequences can be identified. Hence the
Southern hybridization pattern of a given transformant serves as an
identifying characteristic of that transformant. In addition, it is
possible through Southern hybridization to demonstrate the presence
of introduced genes in high molecular weight DNA, i.e., confirm
that the introduced gene has been integrated into the transformed
cell's genome. The technique of Southern hybridization provides
information that is obtained using PCR, e.g., the presence of a
gene, but also demonstrates integration into the genome and
characterizes each individual transformant.
[0269] It is contemplated that using the techniques of dot or slot
blot hybridization, which are modifications of Southern
hybridization techniques, one could obtain the same information
that is derived from PCR, e.g., the presence of a gene.
[0270] Both PCR and Southern hybridization techniques can be used
to demonstrate transmission of a transgene to progeny. In most
instances the characteristic Southern hybridization pattern for a
given transformant will segregate in progeny as one or more
Mendelian genes (Spencer et al., 1992) indicating stable
inheritance of the transgene.
[0271] Whereas DNA analysis techniques may be conducted using DNA
isolated from any part of a plant, RNA will only be expressed in
particular cells or tissue types and hence it will be necessary to
prepare RNA for analysis from these tissues. PCR techniques,
referred to as RT-PCR, also may be used for detection and
quantitation of RNA produced from introduced genes. In this
application of PCR it is first necessary to reverse transcribe RNA
into DNA, using enzymes such as reverse transcriptase, and then
through the use of conventional PCR techniques amplify the DNA. In
most instances PC techniques, while useful, will not demonstrate
integrity of the RNA product. Further information about the nature
of the RNA product may be obtained by Northern blotting. This
technique will demonstrate the presence of an RNA species and give
information about the integrity of that RNA. The presence or
absence of an RNA species also can be determined using dot or slot
blot Northern hybridizations. These techniques are modifications of
Northern blotting and will only demonstrate the presence or absence
of an RNA species.
[0272] It is further contemplated that TAQMAN.RTM. technology
(Applied Biosystems, Foster City, Calif.) may be used to quantitate
both DNA and RNA in a transgenic cell.
Gene Expression
[0273] While Southern blotting and PCR may be used to detect the
gene(s) in question, they do not provide information as to whether
the gene is being expressed. Expression may be evaluated by
specifically identifying the protein products of the introduced
genes or evaluating the phenotypic changes brought about by their
expression. Among the more common methods of determination of the
expression of proteins is reverse transcriptase polymerase chain
reaction (RT-PCR) and real-time RT-PCR. Both of these techniques
enable one to determine message expression with well developed
methods.
[0274] Assays for the production and identification of specific
proteins may make use of physical-chemical, structural, functional,
or other properties of the proteins. Unique physical-chemical or
structural properties allow the proteins to be separated and
identified by electrophoretic procedures, such as native or
denaturing gel electrophoresis or isoelectric focusing, or by
chromatographic techniques such as ion exchange or gel exclusion
chromatography. The unique structures of individual proteins offer
opportunities for use of specific antibodies to detect their
presence in formats such as an ELISA assay. Combinations of
approaches may be employed with even greater specificity such as
Western blotting in which antibodies are used to locate individual
gene products that have been separated by electrophoretic
techniques. Additional techniques may be employed to absolutely
confirm the identity of the product of interest such as evaluation
by amino acid sequencing following purification. Although these are
among the most commonly employed, other procedures may be
additionally used.
[0275] Assay procedures also may be used to identify the expression
of proteins by their functionality, especially the ability of
enzymes to catalyze specific chemical reactions involving specific
substrates and products. These reactions may be followed by
providing and quantifying the loss of substrates or the generation
of products of the reactions by physical or chemical procedures.
Examples are as varied as the enzyme to be analyzed and may include
assays for PAT enzymatic activity by following production of
radiolabeled acetylated phosphinothricin from phosphinothricin and
14C-acetyl CoA or for anthranilate synthase activity by following
an increase in fluorescence as anthranilate is produced, to name
two.
[0276] Very frequently the expression of a gene product is
determined by evaluating the phenotypic results of its expression.
These assays also may take many forms, including but not limited
to, analyzing changes in the chemical composition, morphology, or
physiological properties of the plant. Chemical composition may be
altered by expression of genes encoding enzymes or storage proteins
which change amino acid composition and may be detected by amino
acid analysis, or by enzymes which change starch quantity which may
be analyzed by near infrared reflectance spectrometry.
Morphological changes may include greater stature or thicker
stalks. Most often changes in response of plants or plant parts to
imposed treatments are evaluated under carefully controlled
conditions termed bioassays.
Event Specific Transgene Assay
[0277] Southern blotting, PCR and RT-PCR techniques can be used to
identify the presence or absence and expression of a given
transgene but, depending upon experimental design, may not
specifically and uniquely identify identical or related transgene
constructs located at different insertion points within the
recipient genome. To more precisely characterize the presence of
transgenic material in a transformed plant, one skilled in the art
could identify the point of insertion of the transgene and, using
the sequence of the recipient genome flanking the transgene,
develop an assay that specifically and uniquely identifies a
particular insertion event. Many methods can be used to determine
the point of insertion such as, but not limited to, Genome
Walker.TM. technology (CLONTECH, Palo Alto, Calif.), Vectorette.TM.
technology (Sigma, St. Louis, Mo.), restriction site
oligonucleotide PCR (Sarkar et al., 1993; Weber et al., 1998),
uneven PCR (Chen and Wu, 1997) and generation of genomic DNA clones
containing the transgene of interest in a vector such as, but not
limited to, lambda phage.
[0278] Once the sequence of the genomic DNA directly adjacent to
the transgenic insert on either or both sides has been determined,
one skilled in the art can develop an assay to specifically and
uniquely identify the insertion event. For example, two
oligonucleotide primers can be designed, one wholly contained
within the transgene and one wholly contained within the flanking
sequence, which can be used together with the PCR technique to
generate a PCR product unique to the inserted transgene.
[0279] In one embodiment, the two oligonucleotide primers for use
in PCR could be designed such that one primer is complementary to
sequences in both the transgene and adjacent flanking sequence such
that the primer spans the junction of the insertion site while the
second primer could be homologous to sequences contained wholly
within the transgene. In another embodiment, the two
oligonucleotide primers for use in PCR could be designed such that
one primer is complementary to sequences in both the transgene and
adjacent flanking sequence such that the primer spans the junction
of the insertion site while the second primer could be homologous
to sequences contained wholly within the genomic sequence adjacent
to the insertion site. Confirmation of the PCR reaction may be
monitored by, but not limited to, size analysis on gel
electrophoresis, sequence analysis, hybridization of the PCR
product to a specific radiolabeled DNA or RNA probe or to a
molecular beacon (Tyagi and Kramer, 1996), or use of the primers in
conjugation with a TAQMAN.TM. probe and technology (Applied
Biosystems, Foster City, Calif.).
Site Specific Integration or Excision of Transgenes
[0280] It is specifically contemplated by the inventors that one
could employ techniques for the site-specific integration or
excision of transformation constructs prepared in accordance with
the instant invention. An advantage of site-specific integration or
excision is that it can be used to overcome problems associated
with conventional transformation techniques, in which
transformation constructs typically randomly integrate into a host
genome and multiple copies of a construct may integrate. This
random insertion of introduced DNA into the genome of the targeted
cells can be detrimental to the cell if the foreign DNA inserts
into an essential gene. In addition, the expression of a transgene
may be influenced by "position effects" caused by the surrounding
genomic DNA. Further, because of difficulties associated with
plants possessing multiple transgene copies, including gene
silencing, recombination and unpredictable inheritance, it is
typically desirable to control the copy number of the inserted DNA,
often only desiring the insertion of a single copy of the DNA
sequence.
[0281] Site-specific integration can be achieved in plants by means
of homologous recombination (see, for example, U.S. Pat. No.
5,527,695, specifically incorporated herein by reference in its
entirety). Homologous recombination is a reaction between any pair
of DNA sequences having a similar sequence of nucleotides, where
the two sequences interact (recombine) to form a new recombinant
DNA species. The frequency of homologous recombination increases as
the length of the shared nucleotide DNA sequences increases, and is
higher with linearized plasmid molecules than with circularized
plasmid molecules. Homologous recombination can occur between two
DNA sequences that are less than identical, but the recombination
frequency declines as the divergence between the two sequences
increases.
[0282] Introduced DNA sequences can be targeted via homologous
recombination by linking a DNA molecule of interest to sequences
sharing homology with endogenous sequences of the targeted cell.
Once the DNA enters the cell, the two homologous sequences can
interact to insert the introduced DNA at the site where the
homologous genomic DNA sequences were located. Therefore, the
choice of homologous sequences contained on the introduced DNA will
determine the site where the introduced DNA is integrated via
homologous recombination. For example, if the DNA sequence of
interest is linked to DNA sequences sharing homology to a single
copy gene of a host plant cell, the DNA sequence of interest will
be inserted via homologous recombination at only that single
specific site. However, if the DNA sequence of interest is linked
to DNA sequences sharing homology to a multicopy gene of the host
eukaryotic cell, then the DNA sequence of interest can be inserted
via homologous recombination at each of the specific sites where a
copy of the gene is located.
[0283] DNA can be inserted into the host genome by a homologous
recombination reaction involving either a single reciprocal
recombination (resulting in the insertion of the entire length of
the introduced DNA) or through a double reciprocal recombination
(resulting in the insertion of only the DNA located between the two
recombination events). For example, if one wishes to insert a
foreign gene into the genomic site where a selected gene is
located, the introduced DNA should contain sequences homologous to
the selected gene. A single homologous recombination event would
then result in the entire introduced DNA sequence being inserted
into the selected gene. Alternatively, a double recombination event
can be achieved by flanking each end of the DNA sequence of
interest (the sequence intended to be inserted into the genome)
with DNA sequences homologous to the selected gene. A homologous
recombination event involving each of the homologous flanking
regions will result in the insertion of the foreign DNA. Thus only
those DNA sequences located between the two regions sharing genomic
homology become integrated into the genome.
[0284] Although introduced sequences can be targeted for insertion
into a specific genomic site via homologous recombination, in
higher eukaryotes homologous recombination is a relatively rare
event compared to random insertion events. Thus random integration
of transgenes is more common in plants. To maintain control over
the copy number and the location of the inserted DNA, randomly
inserted DNA sequences can be removed. One manner of removing these
random insertions is to utilize a site-specific recombinase system
(U.S. Pat. No. 5,527,695).
[0285] A number of different site specific recombinase systems
could be employed in accordance with the instant invention,
including, but not limited to, the Cre/lox system of bacteriophage
Pl (U.S. Pat. No. 5,658,772, specifically incorporated herein by
reference in its entirety), the FLP/FRT system of yeast (Golie and
Lindquist, 1989), the Gin recombinase of phage Mu (Maeser et al.,
1991), the Pin recombinase of E. coli (Enomoto et al., 19831, and
the R/RS system of the pSR1 plasmid (Araki et al., 1992). The
bacteriophage Pl Cre/lox and the yeast FLP/FRT systems constitute
two particularly useful systems for site specific integration or
excision of transgenes. In these systems, a recombinase (Cre or
FLP) will interact specifically with its respective site-specific
recombination sequence (lox or FRT, respectively) to invert or
excise the intervening sequences. The sequence for each of these
two systems is relatively short (34 bp for lox and 47 bp for FRT)
and therefore, convenient for use with transformation vectors.
[0286] The FLP/FRT recombinase system has been demonstrated to
function efficiently in plant cells. Experiments on the performance
of the FLP/FRT system in both maize and rice protoplasts indicate
that FRT site structure, and amount of the FLP protein present,
affects excision activity. In general, short incomplete FRT sites
leads to higher accumulation of excision products than the complete
full-length FRT sites. The systems can catalyze both intra- and
intermolecular reactions in maize protoplasts, indicating its
utility for DNA excision as well as integration reactions. The
recombination reaction is reversible and this reversibility can
compromise the efficiency of the reaction in each direction.
Altering the structure of the site-specific recombination sequences
is one approach to remedying this situation. The site-specific
recombination sequence can be mutated in a manner that the product
of the recombination reaction is no longer recognized as a
substrate for the reverse reaction, thereby stabilizing the
integration or excision event.
[0287] In the Cre-lox system, discovered in bacteriophage Pl,
recombination between lox sites occurs in the presence of the Cre
recombinase (see, e.g., U.S. Pat. No. 5,658,772, specifically
incorporated herein by reference in its entirety). This system has
been utilized to excise a gene located between two lox sites which
had been introduced into a yeast genome (Sauer, 1987). Cre was
expressed from an inducible yeast GAL1 promoter and this Cre gene
was located on an autonomously replicating yeast vector.
[0288] Since the lox site is an asymmetrical nucleotide sequence,
lox sites on the same DNA molecule can have the same or opposite
orientation with respect to each other. Recombination between lox
sites in the same orientation results in a deletion of the DNA
segment located between the two lox sites and a connection between
the resulting ends of the original DNA molecule. The deleted DNA
segment forms a circular molecule of DNA. The original DNA molecule
and the resulting circular molecule each contain a single lox site.
Recombination between lox sites in opposite orientations on the
same DNA molecule result in an inversion of the nucleotide sequence
of the DNA segment located between the two lox sites. In addition,
reciprocal exchange of DNA segments proximate to lox sites located
on two different DNA molecules can occur. All of these
recombination events are catalyzed by the product of the Cre coding
region.
Deletion of Sequences Located within the Transgenic Insert
[0289] During the transformation process it is often necessary to
include ancillary sequences, such as selectable marker or reporter
genes, for tracking the presence or absence of a desired trait gene
transformed into the plant on the DNA construct. Such ancillary
sequences often do not contribute to the desired trait or
characteristic conferred by the phenotypic trait gene. Homologous
recombination is a method by which introduced sequences may be
selectively deleted in transgenic plants.
[0290] It is known that homologous recombination results in genetic
rearrangements of transgenes in plants. Repeated DNA sequences have
been shown to lead to deletion of a flanked sequence in various
dicot species, e.g. Arabidopsis thaliana (Swoboda et al., 1994;
Jelesko et al., 1999), Brassica napus (Gal et al., 1991; Swoboda et
al, 1993) and Nicotiana tabacum (Peterhans et al., 1990; Zubko et
al., 2000). One of the most widely held models for homologous
recombination is the double-strand break repair (DSBR) model
(Szostak et al., 1983).
[0291] Deletion of sequences by homologous recombination relies
upon directly repeated DNA sequences positioned about the region to
be excised in which the repeated DNA sequences direct excision
utilizing native cellular recombination mechanisms. The first
fertile transgenic plants are crossed to produce either hybrid or
inbred progeny plants, and from those progeny plants, one or more
second fertile transgenic plants are selected which contain a
second DNA sequence that has been altered by recombination,
preferably resulting in the deletion of the ancillary sequence. The
first fertile plant can be either hemizygous or homozygous for the
DNA sequence containing the directly repeated DNA that will drive
the recombination event. The directly repeated sequences are
located 5' and 3' to the target sequence in the transgene. As a
result of the recombination event, the transgene target sequence
may be deleted, amplified or otherwise modified within the plant
genome. In the preferred embodiment, a deletion of the target
sequence flanked by the directly repeated sequence will result.
[0292] Alternatively, directly repeated DNA sequence mediated
alterations of transgene insertions may be produced in somatic
cells. Preferably, recombination occurs in a cultured cell, e.g.,
callus, and may be selected based on deletion of a negative
selectable marker gene, e.g., the periA gene isolated from
Burkholderia caryolphilli that encodes a phosphonate ester
hydrolase enzyme that catalyzes the hydrolysis of glyceryl
glyphosate to the toxic compound glyphosate (U.S. Pat. No.
5,254,801).
Breeding Plants of the Invention
[0293] In addition to direct transformation of a particular plant
genotype with a construct prepared according to the current
invention, transgenic plants may be made by crossing a plant having
a construct of the invention to a second plant lacking the
construct. For example, a selected coding region operably linked to
a promoter can be introduced into a particular plant variety by
crossing, without the need for ever directly transforming a plant
of that given variety. Therefore, the current invention not only
encompasses a plant directly regenerated from cells which have been
transformed in accordance with the current invention, but also the
progeny of such plants. As used herein the term "progeny" denotes
the offspring of any generation of a parent plant prepared in
accordance with the instant invention, wherein the progeny
comprises a construct prepared in accordance with the invention.
"Crossing" a plant to provide a plant line having one or more added
transgenes relative to a starting plant line, as disclosed herein,
is defined as the techniques that result in a transgene of the
invention being introduced into a plant line by crossing a starting
line with a donor plant line that comprises a transgene of the
invention.
[0294] To achieve this one could, for example, perform the
following steps: plant seeds of the first (starting line) and
second (donor plant line that comprises a transgene of the
invention) parent plants; grow the seeds of the first and second
parent plants into plants that bear flowers; pollinate a flower
from the first parent plant with pollen from the second parent
plant; and harvest seeds produced on the parent plant bearing the
fertilized flower.
[0295] Backcrossing is herein defined as the process including the
steps of crossing a plant of a first genotype containing a desired
gene, DNA sequence or element to a plant of a second genotype
lacking the desired gene, DNA sequence or element; selecting one or
more progeny plant containing the desired gene, DNA sequence or
element; crossing the progeny plant to a plant of the second
genotype; repeating steps (b) and (c) for the purpose of
transferring the desired gene, DNA sequence or element from a plant
of a first genotype to a plant of a second genotype.
[0296] Introgression of a DNA element into a plant genotype is
defined as the result of the process of backcross conversion. A
plant genotype into which a DNA sequence has been introgressed may
be referred to as a backcross converted genotype, line, inbred, or
hybrid. Similarly a plant genotype lacking the desired DNA sequence
may be referred to as an unconverted genotype, line, inbred, or
hybrid.
[0297] Using a variety of methods exemplary embodiments of the
invention are directed at improving the non-destructive extraction
of hydrophobic materials from cells. This is particularly
applicable to improved performance in higher plants, with special
focus on crop plants and with additional focus on plants with large
storage sinks such as seeds and other carbon storage tissues (e.g.,
potato, cassava, and sweet potato).
EXAMPLES
[0298] Certain embodiments of the invention will not be described
in more detail through the following examples. The examples are
intended solely to aid in more fully describing selected
embodiments of the invention, and should not be considered to limit
the scope of the invention in any way.
Example 1--Transformation of Arabidopsis
[0299] The constructs produced for modulation of the antenna
complex of Arabidopsis were transformed into the plants using
protocols developed by Bechtold and colleagues (Bechtold et al.,
1993) and Clough and Bent (Clough and Bent, 1998). Briefly we grew
Arabidopsis plants until they are flowering. An Agrobacterium
tumefaciens strain (for example, LBA4004) carrying gene of interest
on a binary vector were prepared. A large overnight liquid culture
was grown @ 28-30.degree. C. in LB with selection antibiotic to
select for the binary plasmid. The Agrobacterium, was spun down and
resuspend to A600=1 in a 5% Sucrose solution (if made fresh, no
need to autoclave) in half-strength Murashige & Skoog (MS)
medium. Before dipping, Silwet L-77 was added to a concentration of
0.05% (500 .mu.L/L) and mixed well. The above-ground parts of plant
were dipped in Agrobacterium solution for 5 minutes. The dipped
plants were placed under a dark dome or cover overnight to maintain
high humidity (plants were laid on their side if necessary).
Continued to grow plants normally. The dry seed was harvested and
selected for transformants using PCR.
Example 2--Camelina Transformation Procedure
[0300] The constructs produced for modulation of the antenna
complex of Arabidopsis were transformed into the plants using
protocols developed by Lu and Kang (Lu and Kang, 2008). Grew
Camelina plants until they are flowering. Agrobacterium tumefaciens
strain LBA4004 carrying gene of interest on a binary vector were
prepared. A large overnight liquid culture was grown @
28-30.degree. C. in LB with selection antibiotic to select for the
binary plasmid. Agrobacterium was spun down, resuspended to A600=1
in 5% Sucrose solution (if made fresh, no need to autoclave) in
half-strength MS. Silwet L-77 was added before dipping, to a
concentration of 0.05% (500 .mu.L/L) and mixed well. A beaker with
resuspended Agrobacteria culture was placed in a 310 mm high vacuum
desiccator. One to two Camelina plants were put into the
desiccator. The plants were bent carefully so they fit in a
desiccator and placed flowering part into the liquid culture. A
vacuum was applied to reduce the atmospheric pressure by about 95%.
After 5 minutes, treated plants were placed under a dark dome or
cover overnight to maintain high humidity (plants can be laid on
their side if necessary) and continued to grow plants normally.
Harvested dry seed and select for transformants.
Example 3--Production of Constructs for Transformation of
Camelina
[0301] A fragment of the Camelina satina Cao gene was cloned using
RT-PCR with total RNA isolated from Camelina leaves as a template.
Primers were based on the Arabidopsis Cao gene's sequence.
[0302] Based on the obtained sequence, 2 different vectors were
constructed and inserted into modified pCambia1301 plasmid carrying
bacterial kanamycin resistance (kan) and plant hygromycin (hptII)
resistance genes. The schematic representation of the vectors is in
FIG. 4A-B. The pCambia1301CAOiShort vector (pCambria1301NFCAORNAiS)
contains 272 bp of Camelina Cao sequence, followed by an intron
from Arabidopsis Cao and a reverse complement of the Camelina
sequence. The pCAmbia1301CAOiLong (pCambia1301NFCAORNAiL) contained
750 bp of Camelina Cao sequence, 2 Arabidopsis introns and the
reverse complement of the Camelina sequence. In this vector the Cao
gene was under the control of leaf-specific CAB1 promoter. The
construct was made such that a genomic sense/antisense region
spanned the first 2 exons of CAO genes with introns from A.
thaliana under the control of leaf-specific CAB1 promoter was used
to generate a CAO RNAi plasmid on basis of pCambia1301 plasmid
carrying bacterial kanamycin resistance (kan) and plant hygromycin
(hptII) resistance genes. The pCambia1301CAOiShort vector
(pCambria1301NFCAORNAiS) contained 272 bp of the Camelina Cao
sequence, followed by an intron from the Arabidopsis Cao gene and a
reverse complement of the Camelina sequence. The
pCambia1301CAOiLong (pCambia1301NFCAORNAiL; FIG. 4A top) contained
750 bp of Camelina Cao sequence, 2 Arabidopsis introns and the
reverse complement of the Camelina sequence. Transformation of the
Suneson line of Camelina sativa with the pCambia1301CAOiShort or
pCambia1301CAOiLong vector resulted in Cao gene knock down
transgenic plants.
[0303] The mutants were initially screened based on resistance to
hygromycin. The putative transformants were then confirmed by PCR
analysis to contain the correct sequences.
[0304] The reduced antenna sizes were confirmed by the following
methods: Reduced fluorescence of the transgenic plants (FIG. 8A-D)
and blue native green gel analysis (FIG. 10) demonstrated the
reduction in Photosystem II supercomplexes (the antenna size).
Example 4. Transformation of the Arabidopsis chlorina Line Using
the Floral Dip Method
[0305] For transformation the Arabidopsis chlorina line Chl-3 was
utilized. This Chl-3 line was generated by X-ray induced
mutagenesis in CAO (Chlorophyll A Oxygenase) and was obtained from
the Arabidopsis Biological Resource Center at Ohio State
University.
[0306] A simplified Arabidopsis transformation protocol developed
by Steve Clough and Andrew Bent (1998) from the University of
Illinois, Urbana-Champaign was used for this procedure. This is
described below as performed for this transformation. [0307] 1.
Grew healthy Arabidopsis plants until they are flowering. Clipped
bolts to encourage proliferation of many secondary bolts. [0308] 2.
Prepared Agrobacterium tumefaciens strain carrying gene of interest
on a binary vector. Grow a large liquid culture at 28 C in
Luria-Bertani (LB) broth with antibiotics to select for the binary
plasmid. [0309] 3. Spun down Agrobacterium, resuspend to
A.sub.600=0.8-1.0 in Murashige and Skoog (MS) with 5% Sucrose.
[0310] 4. Added Silwet L-77 (siloxane polyalkyleneoxide copolymer;
a surfactant) to a concentration of 0.05% and mixed well. [0311] 5.
Dipped inflorescences from the plant in Agrobacterium solution and
leave for 5 minutes. [0312] 6. Place dipped plants in dark, and
covered with a dome to maintain high humidity for 16-24 hours.
[0313] 7. Returned transformed plants to normal growth conditions.
Grew plants for 2-3 weeks, until the siliques are ripe and ready
for harvesting. [0314] 8. Selected for transformants using
fluorescence or antibiotic marker.
[0315] Vector construction--The plasmid for siRNA-mediated
silencing of the chlorophillide a oxygenase (Cao) gene
(pB110-CAO-NAB1-cab-nos) was constructed using a genomic sense/cDNA
anti-sense strategy. Referring now to FIG. 15, a construct for
transformation of Arabidopsis to generate a line as described in
Example 4 is illustrated. Physical map of pb110-CAO-NAB-cab-nos
Agrobacterium Ti-plasmid is identified. Pb110 backbone was used to
harbor an Arabidopsis CAO gene with a Chlamydomonas LRE (Light
Responsive Element) fused to the 5' end of an Arabidopsis Cao gene
driven by the native CAO-promoter (CAO-pro) and CAO-terminator
(CAO-term); as well as NAB1 gene (from Chlamydomonas) driven by
light-sensitive cab-promoter and nos-terminator). The notation
LB/RB T-DNA indications left/right border. The LRE
(5'-GCCAGACCCCCGC-3') (SEQ. ID. 27) serves as binding site for NAB
1 to allow light inducible control of expression
Example 5. Engineering Camelina Plants Using siRNA to Reduce the
Chl b Level Through Modulation of the Cao Gene
[0316] The background plant line used was Camelina line Suneson
having knockout Cao genes. Since the sequence of the C. sativa Cao
gene was unknown, primers homologous to A. thaliana cao sequence
were used to amplify the C. sativa Cao gene, C. sativa cDNA made
from total RNA with qScript and the following forward
(ATGAACGCCGCCGTGTTTAGT) (SEQ ID NO 28) and reverse
(CGGTTCAGCGCAATGTCTCCA) (SEQ ID NO 29) were used for this PCR. The
resulting PCR product was cloned by the TA blunt cloning kit and
six variants of the Cao gene were sequenced. The resulting
sequences were used to design and synthesize the siRNA cassette
under control of CAB1 leaf-specific promoter, which was placed in a
modified pCambia1301 vector using EcoRI and HindIII restriction
sites. FIG. 4A-B provides the details for the constructs used to
transform the C. sativa line.
[0317] Generation and screening of CAO siRNA transgenic lines--For
the generation of CAO siRNA lines, C. sativa (line Suneson) was
transformed using the vacuum infiltration floral dip method. The
transformed plants were grown to maturity and the resulting seeds
were screened on MS media. Agar plates supplemented with 25
.mu.g/ml hygromycin as selection agent. The hygromycin resistant
seedlings were transferred to soil. To determine the presence of
the siRNA sequence, the total plant DNA was extracted using a
Qiagen kit and used as a PCR template. The presence of the
transgene was confirmed by PCR using forward (5') and reverse (3'')
primers which hybridizes to the Cab 1 promoter and Nos terminator
sequences, respectively. The T3 or above generation plants grown in
controlled greenhouse conditions were used for subsequent
experiments.
[0318] Chlorophyll determination--For chlorophyll a and b
concentration determination, approximately 5 mm2 leaf disks were
excised and homogenized in 1 ml of 80% acetone using a beat beater.
The samples were spun down in a microfuge at maximum speed for 3
mins and the supernatants were used to determine chlorophyll
concentrations according to Arnon equations (Amon, 1949).
[0319] Chlorophyll fluorescence measurements--Chlorophyll a
fluorescence was measured on detached leaves placed on wet filter
paper using Handy FluorCam FC 1000-H (Photon Systems, Drasov, Chech
Republic). Leaves were dark-adapted for 20 min and the minimal
fluorescence (Fo) determined with low intensity measuring light
pulses (620 nm). Then a 0.8 second (s) saturating pulse of white
light (4000 mmol photons m-2 s-1) was applied to determine the
maximum fluorescence in a dark-adapted state (Fm). The leaves were
then exposed to 300 s of 500 umol m-2 s-1 actinic white light,
followed by 300 s of dark relaxation. The maximum fluorescence in
light-adapted state (Fm'), was determined using a series of 0.8 s
pulses of saturating white light. NPQ values were calculated as
(Fm-Fm')/Fm'.
[0320] Isolation of Thylakoid Membranes--Isolation of thylakoid
membranes was carried out according to (Jarvi, S., Suorsa, M.,
Paakkarinen, V. & Aro, E. M. Optimized native gel systems for
separation of thylakoid protein complexes: novel super- and
mega-complexes. The Biochemical Journal 439, 207-214 (2011)), with
slight modifications. All steps were carried out in the dark at
4.degree. C. Fresh Camelina leaves were ground in a blender with
ice cold grinding buffer (50 mM Hepes/KOH (pH 7.5), 330 mM
sorbitol, 2 mM EDTA, 1 mM MgCl2, 5 mM ascorbate and 0.05% BSA) and
filtered through 2 layers of Miracloth. The suspension was briefly
centrifuged at 500 g at 4.degree. C. for 30 sec. The supernatant
was centrifuged for at 10000 g for 10 min. The pellet was
resuspended in a Shock Buffer (50 mM Hepes/KOH (pH 7.5), 5 mM
sorbitol and 5 mM MgCl2) followed by centrifugation at 10000 g at
4.degree. C. for 10 min. Remnants of the Shock Buffer were removed
by suspending the pellet into Storage Buffer (50 mM Hepes/KOH (pH
7.5), 100 mM sorbitol and 10 mM MgCl2) followed by centrifugation
at 10000 g for 10 min. Finally, the thylakoid pellet was suspended
into a small aliquot of storage buffer. The chlorophyll
concentration was determined in aqueous 80% acetone according to
Arnon, D. I. Copper Enzymes in Isolated Chloroplasts.
Polyphenoloxidase in Beta Vulgaris. Plant physiology 24, 1-15
(1949).
[0321] Photosynthesis rate determination--Gas-exchange measurements
were performed with a LI-6400 open-flow gas exchange system
(Li-Cor). Photosynthetic light response curves were produced by
increasing light intensity from 0 to 2000 .mu.mol photons m-2 s-1.
The reference CO2 concentration was set at 400 .mu.mol CO2 mol-1
air. The leaf temperature was kept the 25.degree. C. and relative
humidity at 50%. The measurements were done on fully opened leaves
(leaves 8-10 from the bottom) of plants that were 3.5 weeks
old.
[0322] Blue-native gel electrophoresis--Thylakoids containing 8
.mu.g of chlorophyll were solubilized for 5 min by addition of
equal volume of buffer containing .alpha.-dodecyl-maltoside at a 2%
w/v concentration. A 1/10th volume of sample buffer containing
Serva-Blue G was added and the sample was centrifuged in a
microfuge for 10 min at maximum speed. Thylakoid complexes were
resolved for 6 hours at 4.degree. C. on 4-12% Tris Tricine gel
using the Novex minigel system with a constant current of 6 mA.
[0323] Electron Microscopy--Camelina sativa leaves were collected
at age 3 weeks and fixed in cacodylate buffer containing 2.5%
glutaraldehyde. Post-fixation, embedding and sectioning were done
as previously described (Rieder and Cassels, 1999). The 100 nm
think sections were imaged at Phillips/FEI T-12 microscope at 80 kV
(sectioning and imaging were performed by Electron Microscopy Core
of Vanderbilt University, Nashville, Tenn.). ImageJ was used to
measure thickness of thylakoid membranes and lumen. Five
chloroplast sections were used for analysis for each sample for
thylakoid membrane measurements, and fifteen chloroplast sections
per sample were used for starch granules count.
[0324] Light transmittance through leaves--Light transmission
through the leaves between wavelengths 400 nm and 700 nm was
determined with BLACK-Comet CXR-SR-50 spectrometer (StellarNet
Inc.). Full sunlight at midday was used as a light source. The
experiment was repeated in triplicate.
[0325] In FIG. 16A-C it can be seen that the degree of Chl b
reduction determines plant phenotype. FIG. 16A represents a
schematic representation of the gene construct used to induce siRNA
silencing of the CAO genes in C. sativa. Exons are represented by
boxes and introns by "V"s. FIG. 16B provides a comparison of growth
phenotypes of 3-week old wild type and transgenic plants. Plants
with low-intermediate antenna size (CR L-I) corresponding to Chl
a/b ratios of 4-5 have more vigorous growth compared to both wild
type (WT) and plants with high-intermediate (CR H-I, Chl a/b ratios
6-9) and very high (CR V-H, Chl a/b ratios above 10). Scale bar, 10
cm. FIG. 16C provides a comparison of fully developed pod size in
WT, CR L-I, CR H-I and CR V-H lines. The pod development in CR H-I
and CR V-H lines is not compromised, while CR V-H pods are much
smaller at maturity. Scale bar, 1 cm.
[0326] Transgenic Plants Demonstrate a Range of Phenotypes Based on
the Degree of chl b Reduction
[0327] Since C. sativa is an allohexaploid plant, all the variants
of the Cao gene were cloned and sequenced to ascertain that their
sequences were similar enough to be targeted with a single siRNA
construct. A genomic sense/antisense construct spanning the first 2
exons of Cao genes with introns from A. thaliana under the control
of leaf-specific CAB1 promoter was used to generate a CAO siRNA
plasmid. C. sativa plants were transformed by the floral dip method
using vacuum infiltration and screened for resistance to
hygromycin. Hygromycin-resistant T1 plants were planted and
screened for reduced Chl a/b ratios. The Chl a/b ratios varied from
4 to 19. For subsequent experiments, CAO-siRNA lines (>T3
generation) were chosen covering a wide range of Chl a/b ratios and
antenna sizes in order to demonstrate the dependence of plant
performance on the degree of antenna reduction.
[0328] The transgenic plants were assigned to three different
groups, according to their Chl a/b ratios and growth phenotypes:
Chl a/b ratios low-intermediate "CR L-I" (chl a/b=4-5), Chl a/b
ratio high-intermediate "CR H-I" (chl a/b=6-8), and Chl a/b ratio
very high "CR V-H" chl a/b=9 and above. Representative phenotypes
for each group are shown in FIG. 16.
CR L-I Plants with Moderate Reduction in Antenna Size have
Increased Photosynthetic Rates
[0329] The phenotypical characteristics of the transgenic lines
were correlated with their photosynthesis rates. Specifically, the
dependence of the CO2 fixation rate on light intensity in C. sativa
plants grown under controlled greenhouse conditions were measured.
Compared to WT, in CR H-I transgenics the photosynthesis rate was
reduced by 10-15% at all light intensity ranges. In the CR V-H
transgenics, the photosynthetic rate was severely impaired
consistent with their stunted growth pattern. Not surprisingly,
there was also a slight reduction of the photosynthetic rate in the
best performing CR L-I line at low light intensity. This is an
expected result in truncated antenna plants under light-limiting
conditions, where the photochemistry is not saturated. Importantly,
however, under high light conditions, the real photosynthesis rate
in this line was 17% greater than in WT.
CR-LI Plants have Robust NPQ, Further Reduction in Antenna Size
Impairs NPQ
[0330] CR transgenic plants with reduced antenna sizes were still
able to perform efficient non-photochemical quenching (NPQ). NPQ
collectively refers to a number of mechanisms of energy
dissipation, which reduce the formation of damaging reactive oxygen
species generated under condition of excess light when
photochemistry is saturated. Mutants lacking Chl b, LHCII proteins,
or exhibiting alterations in the topological organization of PSII
antenna are known to undergo a strong reduction in NPQ,
demonstrating the intricate involvement of antenna proteins in its
activation Kovacs, L. et al. Lack of the light-harvesting complex
CP24 affects the structure and function of the grana membranes of
higher plant chloroplasts. The Plant cell 18, 3106-3120 (2006); de
Bianchi, S., Dall'Osto, L., Tognon, G., Morosinotto, T. &
Bassi, R. Minor antenna proteins CP24 and CP26 affect the
interactions between photosystem II subunits and the electron
transport rate in grana membranes of Arabidopsis. The Plant cell
20, 1012-1028 (2008).
[0331] There are several known components of NPQ. The fastest
component, qE, typically develops within seconds to minutes of high
light exposure. There is evidence that there are at least two
different quenching mechanisms contributing to qE, both dependent
on the buildup of the trans-membrane proton gradient: 1) the
zeathanthin (Zea) dependent NPQ associated with deopoxidation of
violaxanthin via xanthophyll cycle and 2) PsbS-dependent mechanism
that acts on LHCII antenna complexes resulting in functionally
detached antennas and a rapid and reversible change in the
organization of grana membranes Betterle, N. et al. Light-induced
dissociation of an antenna hetero-oligomer is needed for
non-photochemical quenching induction. The Journal of Biological
Chemistry 284, 15255-15266 (2009).
[0332] NPQ in dark-adapted WT and CR mutant plants was compared.
The actinic light intensity of 800 mol m-2 s-1 was used to maximize
the qE, while minimizing the photoinhibition. Measurements showed
that the NPQ formation in the transgenics tracked the level of Chl
b reduction. Compared to WT, NPQ was 15% higher in the CR L-I line
and correspondingly reduced in CR H-I and CRV-H (FIG. 17B).
Referring now to FIG. 17A is Photosynthesis light saturation
response curves of WT, CR L-I, CR H-I and CR V-H. All experiments
were performed on 3.5 week-old plants. Results are the average and
.+-.SE of at least 5 independent experiments. FIG. 17B is
non-photochemical quenching (NPQ) in in WT, CR L-I, CR H-I and CR
V-H. Leaves were exposed to 150 s of actinic light (800 .mu.mol
photons m-2 s-1; white bar) followed by 150 s of dark relaxation
(black bar). Results are the average and .+-.SE of 10 independent
measurements.
[0333] FIG. 18A-M--Comparison of thylakoid structure and PSII
complex composition of WT and CR transgenics. FIG. 18A through FIG.
18H represent--Electron micrographs of thylakoid membranes from the
wild type and CR lines obtained by transmission electron
microscopy. Leaves from 3-week-old wild-type and CR L-I, CR H-I,
and CR V-H plants were directly fixed 3 h after the start of the
light phase of the growth photoperiod and prepared for transmission
electron microscopy. Chloroplast sections are shown for the wild
type FIG. 18A-FIG. 18E, CR L-I (FIG. 18B-FIG. 18F), CR H-I (FIG.
18C-FIG. 18G), and CR V-H (FIG. 18D-FIG. 1811) plants. Bars in the
top and bottom panels are 50 and 100 nm in length,
respectively.
The Transition Point in Photosynthetic Efficiency is Related to
PSII Supercomplex Composition
[0334] To determine if the sharp drop in plant performance is
correlated with dramatic changes in light harvesting supercomplex
organization, the composition of light harvesting supercomplexes
from thylakoid membranes was analyzed using blue native-PAGE
(BN-PAGE), a technique commonly used to characterize intact
membrane protein complexes. To monitor potential variations in PSII
supercomplexes, we isolated thylakoid membranes from wild type and
all CR lines and solubilized them by mild detergent treatment using
.alpha.-dodecyl-maltoside. After separation under non-denaturing
BN-PAGE conditions, 7 major chlorophyll-containing bands were
observed (see FIG. 18M). The four upper bands on the gel
represented various forms of PSII supercomplexes. For higher
plants, the largest observed supercomplex, SC1, consists of a
dimeric core (C2), two LHCII trimers (S) strongly bound to the
complex, and two more trimers, moderately bound (trimer M) trimers
(Caffarri, S., Kouril, R., Kereiche, S., Boekema, E. J. &
Croce, R. Functional architecture of higher plant photosystem II
supercomplexes. The EMBO Journal 28, 3052-3063 (2009); Boekema, E.
J., Van Roon, H., Van Breemen, J. F. & Dekker, J. P.
Supramolecular organization of photosystem II and its
light-harvesting antenna in partially solubilized photosystem II
membranes. European Journal of Biochemistry/FEBS 266, 444-452
(1999); Dekker and Boekema, 2005)). The smaller complexes are
assigned as C2S2M (SC2), C2S2 (SC3), and C2S or S2M, based on the
previous study.
[0335] The abundance of supercomlexes containing M-trimers, as well
as of unattached L-trimers, decreases with increasing chl a/ratio.
The transition from CR L-I to CR H-I lines corresponded to almost
complete elimination of those higher order supercomplexes, as well
as of L-trimers. Thus, in order to compensate for reduction of Chl
b content, Camelina plants preferentially decreased the number of
LHC subunits that tend to form loser association, which could serve
to preserve the photosynthesis efficiency by retaining the strongly
coupled antenna complexes.
Thylakoid Membrane Stacking is Altered with Antenna
Modification
[0336] The chloroplast organization in C. sativa WT as well as in
transgenic lines with different levels of Chl a/b was examined by
transmission electron microscopy (TEM) to determine how thylakoid
stacking was affected by LHCII content and supercomplex
composition.
[0337] It was previously described that Chl b deficient mutants
show compromised grana formation in variety of plants as soybean
(H., N. et al. Characterization of the Arabidopsis thaliana mutant
pcb2 which accumulates divinyl chlorophylls. Plant & Cell
Physiology 46, 467-473 (2005)) or Arabidopsis (R. W. Keck et al,
1970). In agreement with previous observations, amount of
thylakoids per granum in CR lines was progressively decreased in
parallel with decreasing of Chl b levels. Interestingly, changes of
thylakoid membrane structure in the grana were not linear for
transgenic plants having a range of Chl a/b ratios. Plants with
slightly decreased Chl b level (CR L-I) had slightly thicker double
membranes and increased lumenal space compared to both wild type
and CR H-I mutants. The less tightly appressed membranes structure
could be an explanation for improved photosynthesis rate since it
would facilitate diffusion of lumenal soluble electron transfer
components such as plastocyanin and rearrangement of components of
photosynthetic apparatus. CR H-I plants with Chl a/b ratios of 6-7
in contrary had thinner and more compact double thylakoid membrane
compare to wild type and CR LI-mutant, which could impair diffusion
of soluble electron transfer carriers.
CR-LI Lines Demonstrate Increased Yield in Field
[0338] To analyze the biomass and seed yield in CR lines under
real-life conditions, we conducted a small-scale test field
experiment in Nebraska. The plants with the highest Chl a/b ratio
were not included in the study since our preliminary data
demonstrated that they do not produce well-developed seed pods. We
collected leaf samples from 4-week-old plants, to characterize Chl
a/b ratios at different canopy levels. The results are shown in
Table 1. Both WT and CR lines exhibited change in Chl a/b values
between top, middle, and bottom leaves. Notably, however, in all CR
transgenics the Chl a/b ratios were higher at all canopy levels
compared to the corresponding values for wild type. At the top of
the canopy, the WT plants had Chl a/b ratios of 3.2.+-.0.1, CR-LI
had ratios of 5.0.+-.0.3, CR-HI of 5.6.+-.0.1, and CR V-H of
7.0.+-.0.4.
TABLE-US-00001 TABLE 1 Chl a/b ratios at different canopy levels of
WT and CR L-I and two CR H-I lines grown in field studies Leaf
position Chl a/b Ratios in canopy WT CR L-I CR H-I (1) CR H-I (2)
Top 3.2 .+-. 0.1 5.0 .+-. 0.3 5.6 .+-. 0.1 7.0 .+-. 0.4 Middle 3.0
.+-. 0.1 4.3 .+-. 0.2 4.9 .+-. 0.2 5.9 .+-. 0.4 Bottom 2.6 .+-. 0.2
3.9 .+-. 0.2 4.3 .+-. 0.3 4.6 .+-. 0.3
[0339] In plants grown as dense canopies, light availability is a
major limiting factor for a net photosynthesis gain. As shown in
FIG. 7, the light transmission though individual leaf significantly
increases with antenna size reduction. Overall, between 400 and 700
nm, wild type leaves transmitted 36% less light compared to leaves
with Chl a/b ratio of 4.3 (CR-LI line). Thus, this increased light
penetration may result in improved biomass accumulation.
[0340] The seed and biomass yields are summarized in Table 2.
Consistent with our previous observations, there was a transition
point at which the Chl a/b increase stopped being beneficial for
the productivity. Overall, the CR-LI transgenics that maintained
their Chl a/b ratios at the top of the canopy near 5, had greater
seed yield (+25%) and increase in total dry weight biomass
(>40%) compared to wild type. Seed yield increase resulted
increased pod numbers, while the number of seeds per pod and weight
of individual seeds stayed the same indicating that the plant
response to increased photosynthate by increased flowering and
subsequent seed and pod formation (Table 2).
[0341] Consistent with our previous observations, even a slight
further increase in Chl a/b ratio was detrimental, with an abrupt
drop in productivity. Already in the CR line with Chl a/b value of
5.6, a 33% decline in seed yield and 18% decline in biomass were
observed compared to WT. In CR lines with Chl a/b levels of 7 at
the top of the canopy, the seed yield dropped to just 40%, and the
total dry weight biomass to 60%, of WT (see Table 2).
TABLE-US-00002 TABLE 2 Yield of WT and CR L-I and two CR H-I lines
grown in field studies. (Values are the mean plus the standard
error of 30 plants) Traits WT CR L-I CR H-I (1) CR H-I (2) Seed
weight (g) 3.6 .+-. 0.4 4.5 .+-. 0.4 2.4 .+-. 0.2 1.4 .+-. 0.1 Seed
weight (g) n/a +25% -33% -61% increase/decrease over WT (%) Plant
weight (g) 11.8 .+-. 1.3 17.0 .+-. 1.3 9.6 .+-. 0.6 7.0 .+-. 0.5
Plant weight (g) n/a +44% -18% -40% increase/decrease over WT (%)
No. of pods per 481 .+-. 57 607 .+-. 53 375 .+-. 24 292 .+-. 23
plant Seed weight/pod 11.3 .+-. 0.6 10.0 .+-. 0.4 12.7 .+-. 0.6
11.3 .+-. 0.6 (mg)
[0342] In this example, Camelina sativa plants were engineered with
a range of Chl a/b ratios, resulting in a range of photosynthetic
antenna sizes. The plants with slightly reduced antenna compared to
wild type had improved photosynthetic performance at high light
intensities when assayed as 4 week old plants. Furthermore,
increased light penetration through plants' leaves throughout the
day with slightly reduced antenna sizes allows for increased total
plant photosynthesis throughout the canopy.
Example 6. Characterisitics of Arabidopsis NAB1-CAO Transgenic
Lines
[0343] Transgenic lines were made as described in Example 4. Plants
were grown for 4 weeks and then compared visually, for non
photochemical quenching (NPQ) and chlorophyll content. As seen in
FIG. 19 the transgenic plants grew much better than the Chlorina
chlorophyll b minus mutant parent line. Both of the transgenic
lines grew better than the parental line. The higher Chl a/b ratio
line 3 (chl a/b=10) seemed to grow better than the lower Chl a/b
line 1 (chl a/b=5) under the conditions utilized.
[0344] Chlorophyll determinations were done on the Arabidopsis
NAB1-CAO transgenics and Chlorina mutants grown in moderate light,
by spectrometry. Chl-5 and Chl-7 correspond to two Chlorina
(Chlb-less) mutant lines. It is apparent that the transgenic lines
had higher chlorophyll content per unit leaf area than that of the
parental lines.
TABLE-US-00003 TABLE 3 Chlorophyll determination from leaf tissues
of Arabidopsis transgenic NAB1-CAO lines compared to parental
chlorophyll b minus Chlorina lines. Line chlorophyll/cm.sup.2
(leaf) Chl a/Chl b NAB1-CAO-1 34.07 6.30 NAB1-CAO-3 31.84 10.86
Chl-5 11.58 n/d Chl-7 9.41 n/d
[0345] Non photochemical quenching of a transgenic NAB1-CAO line
was compared to that in a Chlorina line under high and moderately
high light intensities (FIG. 20). Both of the transgenic NAB1-CAO
lines were significantly better at NPQ than the chlorophyll b minus
chlorina line.
[0346] Although the invention has been described in detail with
particular reference to these preferred embodiments, other
embodiments can achieve the same results. For example, nucleic
acids encoding a protein may correspond to a specific SEQ. ID. NO.
but may also cover alterations allowed by the degeneracy of the
genetic code. Variations and modifications of the present invention
will be obvious to those skilled in the art and it is intended to
cover in the appended claims all such modifications and
equivalents. The entire disclosures of all references,
applications, patents, and publications cited above are hereby
incorporated by reference.
REFERENCES CITED
[0347] The following references and others cited herein but not
listed here, to the extent that they provide exemplary procedural
and other details supplementary to those set forth herein, are
specifically incorporated herein by reference.
TABLE-US-00004 US PATENT DOCUMENTS 4,535,060 5,391,725 5,610,042
4,940,935 5,424,200 5,614,395 5,034,323 5,428,147 5,614,399
5,164,316 5,447,858 5,633,435 5,188,642 5,464,765 5,633,441
5,196,525 5,508,184 5,593,874 5,231,020 5,508,468 5,614,395
5,254,801 5,523,311 5,627,061 5,283,184 5,527,695 5,659,122
5,302,523 5,538,880 5,780,708 5,322,783 5,538,877 5,981,840
5,322,938 5,550,318 6,118,047 5,352,605 5,563,055 6,232,526
5,359,142 5,658,772 2003/0221211 5,378,619 5,591,616 2004/0029283
5,384,253 5,608,144 OTHER PATENT DOCUMENTS EP 0 342 926 WO 99/32619
WO 01/29058, WO 92/117598 WO 00/44914. WO 02/055692, WO 95/06128 WO
00/44895, WO 02/44321, WO 97/04103 WO 00/63364 W02005/054439, WO
97/41228 WO 00/01846, W02005/110068 WO 99/07409 WO 01/36646,
WO2013/016267 WO 99/60129 WO 01175164,
OTHER PUBLICATIONS
[0348] ALI, N., DATTA, S. K. & DATTA, K. 2010. RNA interference
in designing transgenic crops. GMcrops, 1, 207-13. [0349] ALTSCHUL,
S. F., GISH, W., MILLER, W., MYERS, E. W. & LIPMAN, D. J. 1990.
Basic local alignment search tool. J Mol Biol, 215, 403-10. [0350]
ALTSCHUL, S. F., MADDEN, T. L., SCHAFFER, A. A., ZHANG, J., ZHANG,
Z., MILLER, W. & LIPMAN, D. J. 1997. Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res, 25, 3389-402. [0351] BECHTOLD, N., ELLIS, J.
& PELLETIER, G. 1993. In planta Agrobacterium-mediated gene
transfer by in filtration of adult Arabidopsis thaliana plants. C R
Acad Sci Paris, Life Sciences, 316, 1194-1199. [0352] BLANKENSHIP,
R. E. 2010. Early evolution of photosynthesis. Plant Physiol, 154,
434-8. [0353] CHATTOPADHYAY, S., ANG, L. H., PUENTE, P., DENG, X.
W. & WEI, N. 1998. Arabidopsis bZIP protein HY5 directly
interacts with light-responsive promoters in mediating light
control of gene expression. Plant Cell, 10, 673-83. [0354] CLOUGH,
S. J. & BENT, A. F. 1998. Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J, 16, 735-43. [0355] COMAN, D., GRUISSEM, W. & HENNIG,
L. 2013. Transcript profiling in Arabidopsis with genome tiling
microarrays. Methods Mol Biol, 1067, 35-49. [0356] CONG, L., RAN,
F. A., COX, D., LIN, S., BARRETTO, R., HABIB, N., HSU, P. D., WU,
X., JIANG, W., MARRAFFINI, L. A. & ZHANG, F. 2013. Multiplex
genome engineering using CRISPR/Cas systems. Science, 339, 819-23.
[0357] DURNFORD, D. G., PRICE, J. A., MCKIM, S. M. &
SARCHFIELD, M. L. 2003. Light-harvesting complex gene expression is
controlled by both transcriptional and post-transcriptional
mechanisms during photoacclimation in Chlamydomonas reinhardtii.
Physiologia Plantarum, 118, 193-205. [0358] EBERHARD, S., FINAZZI,
G. & WOLLMAN, F. A. 2008. The dynamics of photosynthesis. Annu
Rev Genet, 42, 463-515. [0359] FOIANI, M., CIGAN, A. M., PADDON, C.
J., HARASHIMA, S. & HINNEBUSCH, A. G. 1991. GCD2, a
translational repressor of the GCN4 gene, has a general function in
the initiation of protein synthesis in Saccharomyces cerevisiae.
Mol Cell Biol, 11, 3203-16. [0360] GAJ, T., GERSBACH, C. A. &
BARBAS, C. F., 3RD 2013. ZFN, TALEN, and CRISPR/Cas-based methods
for genome engineering. Trends Biotechnol, 31, 397-405. [0361]
JINKS-ROBERTSON, S. & NOMURA, M. 1982. Ribosomal protein S4
acts in trans as a translational repressor to regulate expression
of the alpha operon in Escherichia coli. J Bacteriol, 151, 193-202.
[0362] JOZWIK, C. E. & MILLER, E. S. 1995. RNA-protein
interactions of the bacteriophage RB69 RegAtranslational repressor
protein. Nucleic Acids Symp Ser, 256-7. [0363] KRIEGER-LISZKAY, A.,
FUFEZAN, C. & TREBST, A. 2008. Singlet oxygen production in
photosystem II and related protection mechanism. Photosynth Res,
98, 551-64. [0364] LEVIATAN, N., ALKAN, N., LESIAKOWITZ, D. &
FLUHR, R. 2013. Genome-wide survey of coldstress regulated
alternative splicing in Arabidopsis thaliana with tiling
microarray. PLoS One, 8, e66511. [0365] LU, C. & KANG, J. 2008.
Generation of transgenic plants of a potential oilseed crop
Camelina sativa by Agrobacterium-mediated transformation. Plant
Cell Rep, 27, 273-8. [0366] MATSUOKA, M., TADA, Y., FUJIMURA, T.
& KANO-MURAKAMI, Y. 1993. Tissue-specific light-regulated
expression directed by the promoter of a C4 gene, maize pyruvate,
orthophosphate dikinase, in a C3 plant, rice. Proc Natl Acad Sci
USA, 90, 9586-90. [0367] MINAGAWA, J. & TAKAHASHI, Y. 2004.
Structure, function and assembly of Photosystem II and its
light-harvesting proteins. Photosynth Res, 82, 241-63. [0368]
MULLER, P., LI, X. P. & NIYOGI, K. K. 2001. Non-photochemical
quenching. A response to excess light energy. Plant Physiol, 125,
1558-66. [0369] MUSSGNUG, J. H., WOBBE, L., ELLES, I., CLAUS, C.,
HAMILTON, M., FINK, A., KAHMANN, U., KAPAZOGLOU, A., MULLINEAUX, C.
W., HIPPLER, M., NICKELSEN, J., NIXON, P. J. & KRUSE, O. 2005.
NAB1 is an RNA binding protein involved in the light-regulated
differential expression of the light-harvesting antenna of
Chlamydomonas reinhardtii. Plant Cell, 17, 3409-21. [0370] NEALE,
P. J. & MELIS, A. 1986. Algal photosynthetic membrane complexes
and the photosynthesis-irradiance curve. A comparison of
light-adaptation responses in Chlamydomonas reinhardtii
(Chlorophyta). J Phycology, 22, 531-538. [0371] POLLE, J.,
KANAKAGIRI, S., JIN, E.-S., MASUDA, T. & MELIS, A. 2002.
Truncated chlorophyll antenna size of the photosystems--A practical
method to improve microalgal producctivity and hydrogen production
in mass culture. Intl J Hydrogen Energy, 27, 1257-1264. [0372]
POLLE, J. E., BENEMANN, J. R., TANAKA, A. & MELIS, A. 2000.
Photosynthetic apparatus organization and function in the wild type
and a chlorophyll b-less mutant of Chlamydomonas reinhardtii.
Dependence on carbon source. Planta, 211, 335-44. [0373] POLLE, J.
E. W., NIYOGI, K. K. & MELIS, A. 2001. Absence of Lutein,
Violaxanthin and Neoxanthin Affects the Functional Chlorophyll
Antenna Size of Photosystem-II but not that of Photosystem-I in the
Green Alga Chlamydomonas reinhardtii. Plant Cell Physiology, 42,
482-491. [0374] REECK, G. R., DE HAEN, C., TELLER, D. C.,
DOOLITTLE, R. F., FITCH, W. M., DICKERSON, R. E., CHAMBON, P.,
MCLACHLAN, A. D., MARGOLIASH, E., JUKES, T. H. & ET AL. 1987.
"Homology" in proteins and nucleic acids: a terminology muddle and
a way out of it. Cell, 50, 667. [0375] SACCOMANNO, L., LOUSHIN, C.,
JAN, E., PUNKAY, E., ARTZT, K. & GOODWIN, E. B. 1999. The STAR
protein QKI-6 is a translational repressor. Proc Natl Acad Sci USA,
96, 12605-10. [0376] SCHULZ, G. & SCHIRMER, R. 1979. Principles
of Protein Structure, New York, Springer. TANAKA, R., KOSHINO, Y.,
SAWA, S., ISHIGURO, S., OKADA, K. & TANAKA, A. 2001.
Overexpression of chlorophyllide a oxygenase (CAO) enlarges the
antenna size of photosystem II in Arabidopsis thaliana. Plant J,
26, 365-73. [0377] VASS, I. & CSER, K. 2009. Janus-faced charge
recombinations in photosystem II photoinhibition. Trends Plant Sci,
14, 200-5. [0378] YANAGISAWA, S. & SHEEN, J. 1998. Involvement
of maize Dof zinc finger proteins in tissue-specific and
light-regulated gene expression. Plant Cell, 10, 75-89. [0379]
ZHANG, F. 2014. CRISPR-Cas systems and methods for altering
expression of gene products. U.S. patent application Ser. No.
14/054,414. Apr. 15, 2014.
Sequence CWU 1
1
291645PRTChlamydomonas reinhardtiiMISC_FEATUREChlorophyll a
oxygenase (CAO) 1Met Leu Pro Ala Ser Leu Gln Arg Lys Ala Ala Ala
Val Gly Gly Arg1 5 10 15Gly Pro Thr Asn Gln Ser Arg Val Ala Val Arg
Val Ser Ala Gln Pro 20 25 30Lys Glu Ala Pro Pro Ala Ser Thr Pro Ile
Val Glu Asp Pro Glu Ser 35 40 45Lys Phe Arg Arg Tyr Gly Lys His Phe
Gly Gly Ile His Lys Leu Ser 50 55 60Met Asp Trp Leu Asp Ser Val Pro
Arg Val Arg Val Arg Thr Lys Asp65 70 75 80Ser Arg Gln Leu Asp Asp
Met Leu Glu Leu Ala Val Leu Asn Glu Arg 85 90 95Leu Ala Gly Arg Leu
Glu Pro Trp Gln Ala Arg Gln Lys Leu Glu Tyr 100 105 110Leu Arg Lys
Arg Arg Lys Asn Trp Glu Arg Ile Phe Glu Tyr Val Thr 115 120 125Arg
Gln Asp Ala Ala Ala Thr Leu Ala Met Ile Glu Glu Ala Asn Arg 130 135
140Lys Val Glu Glu Ser Leu Ser Glu Glu Ala Arg Glu Lys Thr Ala
Val145 150 155 160Gly Asp Leu Arg Asp Gln Leu Glu Ser Leu Arg Ala
Gln Val Ala Gln 165 170 175Ala Gln Glu Arg Leu Ala Met Thr Gln Ser
Arg Val Glu Gln Asn Leu 180 185 190Gln Arg Val Asn Glu Leu Lys Ala
Glu Ala Thr Thr Leu Glu Arg Met 195 200 205Arg Lys Ala Ser Asp Leu
Asp Ile Lys Glu Arg Glu Arg Ile Ala Ile 210 215 220Ser Thr Val Ala
Ala Lys Gly Pro Ala Ser Ser Ser Ser Ser Ala Ala225 230 235 240Ala
Val Ser Ala Pro Ala Thr Ser Ala Thr Leu Thr Val Glu Arg Pro 245 250
255Ala Ala Thr Thr Val Thr Gln Glu Val Pro Ser Thr Ser Tyr Gly Thr
260 265 270Pro Val Asp Arg Ala Pro Arg Arg Ser Lys Ala Ala Ile Arg
Arg Ser 275 280 285Arg Gly Leu Glu Ser Ser Met Glu Ile Glu Glu Gly
Leu Arg Asn Phe 290 295 300Trp Tyr Pro Ala Glu Phe Ser Ala Arg Leu
Pro Lys Asp Thr Leu Val305 310 315 320Pro Phe Glu Leu Phe Gly Glu
Pro Trp Val Met Phe Arg Asp Glu Lys 325 330 335Gly Gln Pro Ser Cys
Ile Arg Asp Glu Cys Ala His Arg Gly Cys Pro 340 345 350Leu Ser Leu
Gly Lys Val Val Glu Gly Gln Val Met Cys Pro Tyr His 355 360 365Gly
Trp Glu Phe Asn Gly Asp Gly Ala Cys Thr Lys Met Pro Ser Thr 370 375
380Pro Phe Cys Arg Asn Val Gly Val Ala Ala Leu Pro Cys Ala Glu
Lys385 390 395 400Asp Gly Phe Ile Trp Val Trp Pro Gly Asp Gly Leu
Pro Ala Glu Thr 405 410 415Leu Pro Asp Phe Ala Gln Pro Pro Glu Gly
Phe Leu Ile His Ala Glu 420 425 430Ile Met Val Asp Val Pro Val Glu
His Gly Leu Leu Ile Glu Asn Leu 435 440 445Leu Asp Leu Ala His Ala
Pro Phe Thr His Thr Ser Thr Phe Ala Arg 450 455 460Gly Trp Pro Val
Pro Asp Phe Val Lys Phe His Ala Asn Lys Ala Leu465 470 475 480Ser
Gly Phe Trp Asp Pro Tyr Pro Ile Asp Met Ala Phe Gln Pro Pro 485 490
495Cys Met Thr Leu Ser Thr Ile Gly Leu Ala Gln Pro Gly Lys Ile Met
500 505 510Arg Gly Val Thr Ala Ser Gln Cys Lys Asn His Leu His Gln
Leu His 515 520 525Val Cys Met Pro Ser Lys Lys Gly His Thr Arg Leu
Leu Tyr Arg Met 530 535 540Ser Leu Asp Phe Leu Pro Trp Met Arg His
Val Pro Phe Ile Asp Arg545 550 555 560Ile Trp Lys Gln Val Ala Ala
Gln Val Leu Gly Glu Asp Leu Val Leu 565 570 575Val Leu Gly Gln Gln
Asp Arg Met Leu Arg Gly Gly Ser Asn Trp Ser 580 585 590Asn Pro Ala
Pro Tyr Asp Lys Leu Ala Val Arg Tyr Arg Arg Trp Arg 595 600 605Asn
Gly Val Asn Ala Glu Val Ala Arg Val Arg Ala Gly Glu Pro Pro 610 615
620Ser Asn Pro Val Ala Met Ser Ala Gly Glu Met Phe Ser Val Asp
Glu625 630 635 640Asp Asp Met Asp Asn 6452657PRTVolvox carteri f.
nagariensisMISC_FEATUREchlorophyll a oxygenase 2Met Leu Pro Ala Gln
Arg Gln Cys Arg Thr Ser Ala Cys Gln Gly Arg1 5 10 15Gly Ile Ile Ser
Lys Arg Thr Ile Arg Ala Asp Phe Lys Val His Ala 20 25 30Ser Val Ser
Gln Gln Pro Ser Ser Asp Lys Pro Glu Gln Gln Ala Val 35 40 45Pro Ser
Ile Val Glu Asp Pro Glu Ala Lys Phe Arg Arg Tyr Gly Lys 50 55 60His
Phe Gly Gly Ile His Lys Leu Asn Leu Asp Trp Leu Glu Ala Val65 70 75
80Pro Arg Val Arg Val Arg Thr Lys Asp Ser Arg Gln Leu Asp Glu Leu
85 90 95Leu Glu Leu Ala Val Leu Asn Glu Arg Leu Ala Gly Arg Leu Glu
Pro 100 105 110Trp Gln Ala Arg Gln Lys Leu Glu Tyr Leu Arg Lys Arg
Arg Lys Asn 115 120 125Trp Glu Arg Ile Phe Glu Tyr Val Thr Lys Gln
Asp Ala Ala Ala Thr 130 135 140Leu Ala Met Ile Glu Glu Ala Asn Arg
Lys Val Glu Glu Ala Leu Ser145 150 155 160Glu Glu Ala Arg Glu Arg
Thr Ala Val Gly Asp Leu Arg Glu Gln Leu 165 170 175Gln Val Leu Gln
Arg Gln Val Gln Glu Ala Gln Glu Arg Leu Gln Leu 180 185 190Thr Gln
Ala Arg Val Glu Gln Asn Leu Asn Arg Val Asn Glu Leu Lys 195 200
205Ala Glu Ala Val Gly Leu Glu Arg Met Arg Asn Gly Arg Met Gly Gly
210 215 220Asp Arg Lys Lys Glu Leu Gln Val Ala Ala Pro Val Ala Val
Thr Ala225 230 235 240Ala Ala Ser Ala Ala Arg Pro Ala Val Ser Ala
Thr Ala Val Ala Glu 245 250 255Ser Val Pro Ala Ala Ile Val Thr Val
Glu Pro Pro Thr Arg Ser Tyr 260 265 270Thr Pro Asn Gly Ser Ser Asp
Gly Thr Ser Val Val Ala Pro Pro Gly 275 280 285Arg Arg Ser Lys Val
Ala Ile Arg Arg Gly Arg Gly Leu Glu Ser Ser 290 295 300Leu Asp Phe
Glu Pro Gly Leu Arg Asn Phe Trp Tyr Pro Ala Glu Phe305 310 315
320Ser Ala Lys Leu Gly Gln Asp Thr Leu Val Pro Phe Glu Leu Phe Gly
325 330 335Glu Pro Trp Val Leu Phe Arg Asp Glu Lys Gly Gln Pro Ala
Cys Ile 340 345 350Lys Asp Glu Cys Ala His Arg Ala Cys Pro Leu Ser
Leu Gly Lys Val 355 360 365Val Glu Gly Gln Val Val Cys Ala Tyr His
Gly Trp Glu Phe Asn Gly 370 375 380Asp Gly His Cys Thr Lys Met Pro
Ser Thr Pro His Cys Arg Asn Val385 390 395 400Gly Val Ser Ala Leu
Pro Cys Ala Glu Lys Asp Gly Phe Ile Trp Val 405 410 415Trp Pro Gly
Asp Gly Leu Pro Ala Gln Thr Leu Pro Asp Phe Ala Arg 420 425 430Pro
Pro Glu Gly Phe Gln Val His Ala Glu Ile Met Val Asp Val Pro 435 440
445Val Glu His Gly Leu Leu Met Glu Asn Leu Leu Asp Leu Ala His Ala
450 455 460Pro Phe Thr His Thr Thr Thr Phe Ala Arg Gly Trp Pro Val
Pro Asp465 470 475 480Phe Val Lys Phe His Thr Asn Lys Leu Leu Ser
Gly Tyr Trp Asp Pro 485 490 495Tyr Pro Ile Asp Met Ala Phe Gln Pro
Pro Cys Met Val Leu Ser Thr 500 505 510Ile Gly Leu Ala Gln Pro Gly
Lys Ile Met Arg Gly Val Thr Ala Ser 515 520 525Gln Cys Lys Asn His
Leu His Gln Leu His Val Cys Met Pro Ser Lys 530 535 540Lys Gly His
Thr Arg Leu Leu Tyr Arg Met Ser Leu Asp Phe Leu Pro545 550 555
560Trp Met Arg Tyr Val Pro Phe Ile Asp Lys Val Trp Lys Asn Val Ala
565 570 575Gly Gln Val Leu Gly Glu Asp Leu Val Leu Val Leu Gly Gln
Gln Asp 580 585 590Arg Leu Leu Arg Gly Gly Asn Thr Trp Ser Asn Pro
Ala Pro Tyr Asp 595 600 605Lys Leu Ala Val Arg Tyr Arg Arg Trp Arg
Asn Ser Val Ser Pro Asp 610 615 620Gly Ala Gly Leu Asp Gly Pro Ala
Pro Leu Asn Pro Val Ala Met Ser625 630 635 640Ala Gly Glu Met Phe
Ser Ile Asp Glu Asp Glu Gln Asp Pro Arg Met 645 650
655Gln3463PRTDunaliella salinaMISC_FEATURECAO mRNA for chlorophyll
b synthase 3Met Gln Ser Lys Leu Leu Gly Leu Gln Asp Glu Ile Ser Glu
Ala Arg1 5 10 15Asp Lys Leu Arg Thr Ser Glu Ala Arg Val Ala Gln Asn
Leu Lys Arg 20 25 30Val Asp Glu Leu Lys Ala Glu Ala Ala Ser Leu Glu
Arg Met Arg Leu 35 40 45Ala Ser Ser Ser Ser Thr Asp Ser Thr Val Ser
Ile Ala Ser Arg Gly 50 55 60Gly Ala Ala Val Ala Ala Thr Thr Ser Val
Pro Asp His Val Glu Arg65 70 75 80Glu Gly Ile Gln Ser Arg Val Arg
Gly Ser Gly Met Ala Ser Thr Ser 85 90 95Tyr Pro Ser His Val Pro Gln
Pro Ser Gln Ala Val Arg Arg Gly Pro 100 105 110Lys Pro Lys Asp Ser
Arg Arg Leu Arg Ser Ser Leu Glu Leu Glu Asp 115 120 125Gly Leu Arg
Asn Phe Trp Tyr Pro Thr Glu Phe Ala Lys Lys Leu Glu 130 135 140Pro
Gly Met Met Val Pro Phe Asp Leu Phe Gly Val Pro Trp Val Leu145 150
155 160Phe Arg Asp Glu His Ser Ala Pro Thr Cys Ile Lys Asp Ser Cys
Ala 165 170 175His Arg Ala Cys Pro Leu Ser Leu Gly Lys Val Ile Asn
Gly His Val 180 185 190Gln Cys Pro Tyr His Gly Trp Glu Phe Asp Gly
Ser Gly Ala Cys Thr 195 200 205Lys Met Pro Ser Thr Arg Met Cys His
Gly Val Gly Val Ala Ala Leu 210 215 220Pro Cys Val Glu Lys Asp Gly
Phe Val Trp Val Trp Pro Gly Asp Gly225 230 235 240Pro Pro Pro Asp
Leu Pro Pro Asp Phe Thr Ala Pro Pro Ala Gly Tyr 245 250 255Asp Val
His Ala Glu Ile Met Val Asp Val Pro Val Glu His Gly Leu 260 265
270Leu Met Glu Asn Leu Leu Asp Leu Ala His Ala Pro Phe Thr His Thr
275 280 285Thr Thr Phe Ala Arg Gly Trp Pro Ile Pro Glu Ala Val Arg
Phe His 290 295 300Ala Thr Lys Met Leu Ala Gly Asp Trp Asp Pro Tyr
Pro Ile Ser Met305 310 315 320Ser Phe Asn Pro Pro Cys Ile Ala Leu
Ser Thr Ile Gly Leu Ser Gln 325 330 335Pro Gly Lys Ile Met Arg Gly
Tyr Lys Ala Glu Glu Cys Lys Arg His 340 345 350Leu His Gln Leu His
Val Cys Met Pro Ser Lys Glu Gly His Thr Arg 355 360 365Leu Leu Tyr
Arg Met Ser Leu Asp Phe Trp Gly Trp Ala Lys His Val 370 375 380Pro
Phe Val Asp Val Leu Trp Lys Lys Ile Ala Gly Gln Val Leu Gly385 390
395 400Glu Asp Leu Val Leu Val Leu Gly Gln Gln Ala Arg Met Ile Gly
Gly 405 410 415Asp Asp Thr Trp Cys Thr Pro Met Pro Tyr Asp Lys Leu
Ala Val Arg 420 425 430Tyr Arg Arg Trp Arg Asn Met Val Ala Asp Gly
Glu Tyr Glu Glu Gly 435 440 445Ser Arg Asn Arg Cys Thr Ser Gln Tyr
Asp Ser Trp Pro Asp Val 450 455 4604297PRTNephroselmis
pyriformisMISC_FEATURECAOa for chlorophyllide a oxygenase 4Ala Val
Glu Phe Thr Ser Arg Leu Gly Lys Asp Ile Met Val Pro Phe1 5 10 15Glu
Cys Phe Glu Glu Ser Trp Val Leu Phe Arg Asp Glu Asp Gly Lys 20 25
30Ala Gly Cys Ile Lys Asp Glu Cys Ala His Arg Ala Cys Pro Leu Ser
35 40 45Leu Gly Thr Val Glu Asn Gly Gln Ala Thr Cys Ala Tyr His Gly
Trp 50 55 60Gln Phe Ser Thr Gly Gly Glu Cys Thr Lys Ile Pro Ser Val
Gly Ala65 70 75 80Arg Gly Cys Ser Gly Val Gly Val Arg Ala Met Pro
Thr Val Glu Gln 85 90 95Asp Gly Met Ile Trp Ile Trp Pro Gly Asp Glu
Lys Pro Ala Glu His 100 105 110Ile Pro Ser Lys Glu Val Leu Pro Pro
Ala Gly His Thr Leu His Ala 115 120 125Glu Ile Val Leu Asp Val Pro
Val Glu His Gly Leu Leu Leu Glu Asn 130 135 140Leu Leu Asp Leu Ala
His Ala Pro Phe Thr His Thr Ser Thr Phe Ala145 150 155 160Lys Gly
Trp Ala Val Pro Glu Leu Val Lys Phe Ser Thr Asp Lys Val 165 170
175Arg Ala Leu Gly Gly Ala Trp Glu Pro Tyr Pro Ile Asp Met Ser Phe
180 185 190Glu Pro Pro Cys Met Val Leu Ser Thr Ile Gly Leu Ala Gln
Pro Gly 195 200 205Lys Val Asp Ala Gly Val Arg Ala Ser Glu Cys Glu
Lys His Leu His 210 215 220Gln Leu His Val Cys Met Pro Ser Gly Ala
Gly Lys Thr Arg Leu Leu225 230 235 240Tyr Arg Met His Leu Asp Phe
Met Pro Phe Leu Lys Tyr Val Pro Gly 245 250 255Met His Leu Val Trp
Glu Ala Met Ala Asn Gln Val Leu Gly Glu Asp 260 265 270Leu Arg Leu
Val Leu Gly Gln Gln Asp Arg Leu Gln Arg Gly Gly Asp 275 280 285Val
Trp Ser Asn Pro Met Glu Tyr Asp 290 2955299PRTMesostigma
virideMISC_FEATURECAO for chlorophyllide a oxygenase 5Asp Glu Asp
Gly Arg Val Ala Cys Leu Arg Asp Glu Cys Ala His Arg1 5 10 15Ala Cys
Pro Leu Ser Leu Gly Thr Val Glu Asn Gly His Ala Thr Cys 20 25 30Pro
Tyr His Gly Trp Gln Tyr Asp Thr Asp Gly Lys Cys Thr Lys Met 35 40
45Pro Gln Thr Arg Leu Arg Ala Gln Val Arg Val Ser Thr Leu Pro Val
50 55 60Arg Glu His Asp Gly Met Ile Trp Val Tyr Pro Gly Ser Asn Glu
Pro65 70 75 80Pro Glu His Leu Pro Ser Phe Leu Pro Pro Ser Asn Phe
Thr Val His 85 90 95Ala Glu Leu Val Leu Glu Val Pro Ile Glu His Gly
Leu Met Ile Glu 100 105 110Asn Leu Leu Asp Leu Ala His Ala Pro Phe
Thr His Thr Glu Thr Phe 115 120 125Ala Lys Gly Trp Ser Val Pro Asp
Ser Val Asn Phe Lys Val Ala Ala 130 135 140Gln Ser Leu Ala Gly His
Trp Glu Pro Tyr Pro Ile Ser Met Lys Phe145 150 155 160Glu Pro Pro
Cys Met Thr Ile Ser Glu Ile Gly Leu Ala Lys Pro Gly 165 170 175Gln
Leu Glu Ala Gly Lys Phe Ser Gly Glu Cys Lys Gln His Leu His 180 185
190Gln Leu His Val Cys Met Pro Ala Gly Glu Gly Arg Thr Arg Ile Leu
195 200 205Tyr Arg Met Cys Leu Asp Phe Ala His Trp Val Lys Tyr Ile
Pro Gly 210 215 220Ile Gln Asn Val Trp Ser Gly Met Ala Thr Gln Val
Leu Gly Glu Asp225 230 235 240Leu Arg Leu Val Glu Gly Gln Gln Asp
Arg Met Leu Arg Gly Ala Asp 245 250 255Ile Trp Tyr Asn Pro Val Ala
Tyr Asp Lys Leu Gly Val Arg Tyr Arg 260 265 270Ser Trp Arg Arg Ala
Val Glu Arg Asn Thr Arg Ser Arg Phe Ile Gly 275 280 285Gly Gln Glu
Lys Leu Ala Pro Glu Gly Arg Asp 290 2956247PRTChlamydomonas
reinhardtiiMISC_FEATUREnucleic acid binding protein 6Met Gly Glu
Gln Leu Arg Gln Gln Gly Thr Val Lys Trp Phe Asn Ala1 5 10 15Thr Lys
Gly Phe Gly Phe Ile Thr Pro Gly Gly Gly Gly Glu Asp Leu 20 25 30Phe
Val His Gln Thr Asn Ile Asn Ser Glu Gly Phe Arg Ser Leu Arg 35 40
45Glu Gly Glu Val Val Glu Phe Glu
Val Glu Ala Gly Pro Asp Gly Arg 50 55 60Ser Lys Ala Val Asn Val Thr
Gly Pro Gly Gly Ala Ala Pro Glu Gly65 70 75 80Ala Pro Arg Asn Phe
Arg Gly Gly Gly Arg Gly Arg Gly Arg Ala Arg 85 90 95Gly Ala Arg Gly
Gly Tyr Ala Ala Ala Tyr Gly Tyr Pro Gln Met Ala 100 105 110Pro Val
Tyr Pro Gly Tyr Tyr Phe Phe Pro Ala Asp Pro Thr Gly Arg 115 120
125Gly Arg Gly Arg Gly Gly Arg Gly Gly Ala Met Pro Ala Met Gln Gly
130 135 140Val Met Pro Gly Val Ala Tyr Pro Gly Met Pro Met Gly Gly
Val Gly145 150 155 160Met Glu Pro Thr Gly Glu Pro Ser Gly Leu Gln
Val Val Val His Asn 165 170 175Leu Pro Trp Ser Cys Gln Trp Gln Gln
Leu Lys Asp His Phe Lys Glu 180 185 190Trp Arg Val Glu Arg Ala Asp
Val Val Tyr Asp Ala Trp Gly Arg Ser 195 200 205Arg Gly Phe Gly Thr
Val Arg Phe Thr Thr Lys Glu Asp Ala Ala Thr 210 215 220Ala Cys Asp
Lys Leu Asn Asn Ser Gln Ile Asp Gly Arg Thr Ile Ser225 230 235
240Val Arg Leu Asp Arg Phe Ala 2457226PRTChlamydomonas
incertaMISC_FEATUREputative nucleic acid-binding protein, partial
7Met Gly Glu Gln Leu Arg Gln Gln Gly Thr Val Lys Trp Phe Asn Ala1 5
10 15Thr Lys Gly Phe Gly Phe Ile Thr Pro Gly Gly Gly Gly Glu Asp
Leu 20 25 30Phe Val His Gln Thr Asn Ile Asn Ser Glu Gly Phe Arg Ser
Leu Arg 35 40 45Glu Gly Glu Ala Val Glu Phe Glu Val Glu Ala Gly Pro
Asp Gly Arg 50 55 60Ser Lys Ala Val Asn Val Thr Gly Pro Ala Gly Ala
Ala Pro Glu Gly65 70 75 80Ala Pro Arg Asn Phe Arg Gly Gly Gly Arg
Gly Arg Gly Arg Ala Arg 85 90 95Gly Ala Arg Gly Gly Tyr Ala Ala Ala
Tyr Gly Tyr Pro Gln Met Ala 100 105 110Pro Val Tyr Pro Gly Tyr Tyr
Phe Phe Pro Ala Asp Pro Thr Gly Arg 115 120 125Gly Arg Gly Arg Gly
Gly Arg Gly Gly Ala Met Pro Gly Met Gln Gly 130 135 140Val Met Pro
Gly Val Ala Tyr Pro Gly Met Pro Met Gly Gly Val Gly145 150 155
160Met Glu Ala Thr Gly Asp Pro Ser Gly Leu Gln Val Val Val His Asn
165 170 175Leu Pro Trp Ser Cys Gln Trp Gln Gln Leu Lys Asp His Phe
Lys Glu 180 185 190Trp Arg Val Glu Arg Ala Asp Val Val Tyr Asp Ala
Trp Gly Arg Ser 195 200 205Arg Gly Phe Gly Thr Val Arg Phe Thr Thr
Lys Glu Asp Ala Ala Met 210 215 220Ala Cys2258242PRTVolvox carteri
f. nagariensisMISC_FEATUREnucleic acid binding protein 8Met Gly Glu
Gln Leu Arg Gln Arg Gly Thr Val Lys Trp Phe Asn Ala1 5 10 15Thr Lys
Gly Phe Gly Phe Ile Thr Pro Glu Gly Gly Gly Glu Asp Phe 20 25 30Phe
Val His Gln Thr Asn Ile Asn Ser Asp Gly Phe Arg Ser Leu Arg 35 40
45Glu Gly Glu Ala Val Glu Phe Glu Val Glu Ala Gly Pro Asp Gly Arg
50 55 60Ser Lys Ala Val Ser Val Ser Gly Pro Gly Gly Ser Ala Pro Glu
Gly65 70 75 80Ala Pro Arg Asn Phe Arg Gly Gly Gly Arg Gly Arg Gly
Arg Ala Arg 85 90 95Gly Ala Arg Gly Ala Tyr Ala Ala Tyr Gly Tyr Pro
Gln Met Pro Pro 100 105 110Met Tyr Pro Gly Tyr Tyr Phe Phe Pro Ala
Asp Pro Thr Gly Arg Gly 115 120 125Arg Gly Arg Gly Arg Gly Gly Met
Pro Ile Gln Gly Met Ile Gln Gly 130 135 140Met Pro Tyr Pro Gly Ile
Pro Ile Pro Gly Gly Leu Glu Pro Thr Gly145 150 155 160Glu Pro Ser
Gly Leu Gln Val Val Val His Asn Leu Pro Trp Ser Cys 165 170 175Gln
Trp Gln Gln Leu Lys Asp His Phe Lys Glu Trp Arg Val Glu Arg 180 185
190Ala Asp Val Val Tyr Asp Ala Trp Gly Arg Ser Arg Gly Phe Gly Thr
195 200 205Val Arg Phe Ala Thr Lys Glu Asp Ala Ala Gln Ala Cys Glu
Lys Met 210 215 220Asn Asn Ser Gln Ile Asp Gly Arg Thr Ile Ser Val
Arg Leu Asp Arg225 230 235 240Phe Glu9178PRTPhyscomitrella
patens,MISC_FEATUREpredicted protein, partial 9Ala Lys Glu Thr Gly
Lys Val Lys Trp Phe Asn Ser Ser Lys Gly Phe1 5 10 15Gly Phe Ile Thr
Pro Asp Lys Gly Gly Glu Asp Leu Phe Val His Gln 20 25 30Thr Ser Ile
His Ala Glu Gly Phe Arg Ser Leu Arg Glu Gly Glu Val 35 40 45Val Glu
Phe Gln Val Glu Ser Ser Glu Asp Gly Arg Thr Lys Ala Leu 50 55 60Ala
Val Thr Gly Pro Gly Gly Ala Phe Val Gln Gly Ala Ser Tyr Arg65 70 75
80Arg Asp Gly Tyr Gly Gly Pro Gly Arg Gly Ala Gly Glu Gly Gly Gly
85 90 95Arg Gly Thr Val Gly Gly Ala Gly Arg Gly Arg Gly Arg Gly Gly
Arg 100 105 110Gly Val Gly Gly Phe Val Gly Glu Arg Ser Gly Ala Ala
Gly Gly Glu 115 120 125Arg Thr Cys Tyr Asn Cys Gly Glu Gly Gly His
Ile Ala Arg Glu Cys 130 135 140Gln Asn Glu Ser Thr Gly Asn Ala Arg
Gln Gly Gly Gly Gly Gly Gly145 150 155 160Gly Asn Arg Ser Cys Tyr
Thr Cys Gly Glu Ala Gly His Leu Ala Arg 165 170 175Asp
Cys10444PRTZea maysMISC_FEATUREunknown 10Met Ala Ala Ala Ala Arg
Gln Arg Gly Thr Val Lys Trp Phe Asn Asp1 5 10 15Thr Lys Gly Phe Gly
Phe Ile Ser Pro Glu Asp Gly Ser Glu Asp Leu 20 25 30Phe Val His Gln
Ser Ser Ile Lys Ser Glu Gly Phe Arg Ser Leu Ala 35 40 45Glu Gly Glu
Glu Val Glu Phe Ser Val Ser Glu Gly Asp Asp Gly Arg 50 55 60Thr Lys
Ala Val Asp Val Thr Gly Pro Asp Gly Ser Ser Ala Ser Gly65 70 75
80Ser Arg Leu Leu His Asp Gly Ala Trp Arg Pro Phe Cys Ile Phe Thr
85 90 95Ser Thr Arg Gln Pro Glu Gln His Arg Gly Ser Gly Ser Asp Arg
His 100 105 110Asp Gly Gly Asp Tyr Asn His Pro Lys Pro Gln Ala Ile
Ala Ala Gly 115 120 125Ala His Ser Leu Leu Leu Thr Arg Ala Cys Leu
Ser Ser Lys Ser Pro 130 135 140Pro Pro Ser Leu Ala Val Gly Leu Leu
Ser Val Leu Ala Gln Arg Thr145 150 155 160Gly Pro Thr Pro Gly Thr
Thr Gly Ser Ala Ala Ser Leu Ser Gly Ser 165 170 175Ser Pro Ile Ser
Leu Gly Phe Asn Pro Thr Ser Phe Leu Pro Phe Leu 180 185 190Gln Thr
Ala Arg Trp Leu Pro Cys Ser Asp Leu Ala Thr Ser Ser Ser 195 200
205Ser Ala Pro Ser Ser Pro Pro Arg Ser Leu Ala Pro Ser Ala Pro Pro
210 215 220Lys Lys Ala Leu Ile Gly Ala Ser Thr Gly Ser Thr Gly Ile
Ala Thr225 230 235 240Ser Ser Gly Ala Gly Ala Ala Met Ser Arg Ser
Asn Trp Leu Ser Arg 245 250 255Trp Val Ser Ser Cys Ser Asp Asp Ala
Lys Thr Ala Phe Ala Ala Val 260 265 270Thr Val Pro Leu Leu Tyr Gly
Ser Ser Leu Ala Glu Pro Lys Ser Ile 275 280 285Pro Ser Lys Ser Met
Tyr Pro Thr Phe Asp Val Gly Asp Arg Ile Leu 290 295 300Ala Glu Lys
Val Ser Tyr Ile Phe Arg Asp Pro Glu Ile Ser Asp Ile305 310 315
320Val Ile Phe Arg Ala Pro Pro Gly Leu Gln Val Tyr Gly Tyr Ser Ser
325 330 335Gly Asp Val Phe Ile Lys Arg Val Val Ala Lys Gly Gly Asp
Tyr Val 340 345 350Glu Val Arg Asp Gly Lys Leu Phe Val Asn Gly Val
Val Gln Asp Glu 355 360 365Asp Phe Val Leu Glu Pro His Asn Tyr Glu
Met Glu Pro Val Leu Val 370 375 380Pro Glu Gly Tyr Val Phe Val Leu
Gly Asp Asn Arg Asn Asn Ser Phe385 390 395 400Asp Ser His Asn Trp
Gly Pro Leu Pro Val Arg Asn Ile Val Gly Arg 405 410 415Ser Ile Leu
Arg Tyr Trp Pro Pro Ser Lys Ile Asn Asp Thr Ile Tyr 420 425 430Glu
Pro Asp Val Ser Arg Leu Thr Val Pro Ser Ser 435 44011197PRTOryza
sativaMISC_FEATUREJaponica Group 11Met Ala Ser Glu Arg Val Lys Gly
Thr Val Lys Trp Phe Asp Ala Thr1 5 10 15Lys Gly Phe Gly Phe Ile Thr
Pro Asp Asp Gly Gly Glu Asp Leu Phe 20 25 30Val His Gln Ser Ser Leu
Lys Ser Asp Gly Tyr Arg Ser Leu Asn Asp 35 40 45Gly Asp Val Val Glu
Phe Ser Val Gly Ser Gly Asn Asp Gly Arg Thr 50 55 60Lys Ala Val Asp
Val Thr Ala Pro Gly Gly Gly Ala Leu Thr Gly Gly65 70 75 80Ser Arg
Pro Ser Gly Gly Gly Asp Arg Gly Tyr Gly Gly Gly Gly Gly 85 90 95Gly
Gly Arg Tyr Gly Gly Asp Arg Gly Tyr Gly Gly Gly Gly Gly Gly 100 105
110Tyr Gly Gly Gly Asp Arg Gly Tyr Gly Gly Gly Gly Gly Tyr Gly Gly
115 120 125Gly Gly Gly Gly Gly Ser Arg Ala Cys Tyr Lys Cys Gly Glu
Glu Gly 130 135 140His Met Ala Arg Asp Cys Ser Gln Gly Gly Gly Gly
Gly Gly Gly Tyr145 150 155 160Gly Gly Gly Gly Gly Gly Tyr Arg Gly
Gly Gly Gly Gly Gly Gly Gly 165 170 175Gly Gly Cys Tyr Asn Cys Gly
Glu Thr Gly His Ile Ala Arg Glu Cys 180 185 190Pro Ser Lys Thr Tyr
19512139PRTChlorella variabilis 12Met Ala Ala Ala Lys Ala Thr Gly
Thr Val Lys Trp Gly Tyr Gly Phe1 5 10 15Ile Thr Pro Asp Ser Gly Gly
Glu Asp Leu Phe Val His Gln Thr Ala 20 25 30Ile Val Ser Glu Gly Phe
Arg Ser Leu Arg Glu Gly Glu Pro Val Glu 35 40 45Phe Phe Val Glu Thr
Ser Asp Asp Gly Arg Gln Lys Ala Val Asn Val 50 55 60Thr Gly Pro Asn
Gly Ala Ala Pro Glu Gly Ala Pro Arg Arg Gln Phe65 70 75 80Asp Asp
Gly Tyr Gly Ala Gly Gly Gly Gly Gly Ser Tyr Gly Gly Gly 85 90 95Phe
Gly Gly Gly Gly Gly Gly Gly Arg Arg Gly Gly Gly Arg Gly Gly 100 105
110Gly Gly Tyr Gly Gly Gly Gly Tyr Gly Gly Gly Tyr Asp Gln Gly Gly
115 120 125Tyr Gly Gly Gln Pro Pro Ile Ala Cys Asn Met 130
13513182PRTSelaginella moellendorffiiMISC_FEATUREhypothetical
protein 13Met Ala Ser Pro Ala Asp Ala Lys Arg Thr Gly Lys Val Lys
Trp Phe1 5 10 15Asn Val Thr Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp
Gly Ser Glu 20 25 30Glu Leu Phe Val His Gln Ser Ala Ile Phe Ala Glu
Gly Phe Arg Ser 35 40 45Leu Arg Glu Gly Glu Ile Val Glu Phe Ser Val
Glu Gln Gly Glu Asp 50 55 60Gln Arg Met Arg Ala Ala Asp Val Thr Gly
Pro Asp Gly Ser His Val65 70 75 80Gln Gly Ala Pro Ser Ser Phe Gly
Ser Arg Gly Gly Gly Gly Gly Gly 85 90 95Gly Arg Gly Gly Arg Gly Arg
Ala Gly Gly Gly Asp Asn Pro Ile Val 100 105 110Cys Tyr Asn Cys Asn
Glu Ala Gly His Val Ser Arg Asp Cys Lys Tyr 115 120 125Gln Gln Glu
Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Arg Gly 130 135 140Pro
Pro Ser Gly Arg Arg Gly Gly Gly Ala Gly Gly Gly Ser Gly Gly145 150
155 160Gly Gly Arg Gly Cys Phe Thr Cys Gly Ala Gln Gly His Ile Ser
Arg 165 170 175Asp Cys Pro Ser Asn Tyr 18014208PRTvitis
viniferaMISC_FEATUREcold shock domain protein 3 14Met Ala Gln Glu
Arg Ser Thr Gly Val Val Arg Trp Phe Ser Asp Gln1 5 10 15Lys Gly Phe
Gly Phe Ile Thr Pro Asn Glu Gly Gly Glu Asp Leu Phe 20 25 30Val His
Gln Ser Ser Ile Lys Ser Asp Gly Phe Arg Ser Leu Gly Glu 35 40 45Gly
Glu Thr Val Glu Phe Gln Ile Val Leu Gly Glu Asp Gly Arg Thr 50 55
60Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ser Ser Val Gln Gly Ser65
70 75 80Lys Arg Asp Asn Tyr Gly Gly Gly Gly Gly Gly Gly Ile Ala Ser
Glu 85 90 95Glu Ile Met Ala Ala Ala Ala Ala Val Val Val Glu Glu Ala
Glu Ala 100 105 110Glu Val Val Ile Pro Ala Val Ala Val Ala Val Val
Ile Thr Val Val 115 120 125Ile Met Gly Thr Trp Leu Gly Ile Ala Leu
Trp Lys Ala Ala Ala Leu 130 135 140Val Gly Ser Val Val Ala Glu Val
Glu Ala Val Glu Gly Leu Val Ala145 150 155 160Val Ala Val Asp Ala
Thr Thr Val Asp Arg Lys Gly Ile Leu Leu Glu 165 170 175Asn Ala Leu
Thr Leu Thr His Arg Asp Glu Gly Lys Arg Gly Val Ile 180 185 190Val
Tyr Ile Leu Phe Phe Pro Ala Ser Ser Lys Ile Phe Phe Pro Val 195 200
20515231PRTTriticum aestivumMISC_FEATUREcold shock domain protein 3
15Met Gly Glu Arg Val Lys Gly Thr Val Lys Trp Phe Asn Val Thr Lys1
5 10 15Gly Phe Gly Phe Ile Ser Pro Asp Asp Gly Gly Glu Asp Leu Phe
Val 20 25 30His Gln Ser Ala Ile Lys Ser Asp Gly Tyr Arg Ser Leu Asn
Glu Asn 35 40 45Asp Ala Val Glu Phe Glu Ile Ile Thr Gly Asp Asp Gly
Arg Thr Lys 50 55 60Ala Ser Asp Val Thr Ala Pro Gly Gly Gly Ala Leu
Ser Gly Gly Ser65 70 75 80Arg Pro Gly Glu Gly Gly Gly Asp Arg Gly
Gly Arg Gly Gly Tyr Gly 85 90 95Gly Gly Gly Gly Gly Tyr Gly Gly Gly
Gly Gly Gly Tyr Gly Gly Gly 100 105 110Gly Gly Gly Tyr Gly Gly Gly
Gly Gly Gly Tyr Gly Gly Gly Gly Tyr 115 120 125Gly Gly Gly Gly Gly
Gly Gly Arg Gly Cys Tyr Lys Cys Gly Glu Asp 130 135 140Gly His Ile
Ser Arg Asp Cys Pro Gln Gly Gly Gly Gly Gly Gly Gly145 150 155
160Tyr Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Gly Arg Glu Cys
165 170 175Tyr Lys Cys Gly Glu Glu Gly His Ile Ser Arg Asp Cys Pro
Gln Gly 180 185 190Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Arg
Gly Gly Gly Gly 195 200 205Gly Gly Gly Gly Cys Phe Ser Cys Gly Glu
Ser Gly His Phe Ser Arg 210 215 220Glu Cys Pro Asn Lys Ala His225
23016135PRTCryptosporidium parvum Iowa IIMISC_FEATUREcold shock RNA
binding domain of the OB fold, partial 16Glu Lys Pro Ile Lys Leu
Val Lys Met Pro Leu Ser Gly Val Cys Lys1 5 10 15Trp Phe Asp Ser Thr
Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly 20 25 30Ser Glu Asp Ile
Phe Val His Gln Gln Asn Ile Lys Val Glu Gly Phe 35 40 45Arg Ser Leu
Ala Gln Asp Glu Arg Val Glu Tyr Glu Ile Glu Thr Asp 50 55 60Asp Lys
Gly Arg Arg Lys Ala Val Asn Val Ser Gly Pro Asn Gly Ala65 70 75
80Pro Val Lys Gly Asp Arg Arg Arg Gly Arg Gly Arg Gly Arg Gly Arg
85 90 95Gly Met Arg Gly Arg Gly Arg Gly Gly Arg Gly Arg Gly Phe Tyr
Gln 100 105 110Asn Gln Asn Gln Ser Gln Pro Gln Ser Gln Gln Gln Pro
Val Ser Thr 115 120 125Gln Ser Gln Pro Val Ala His 130
13517301PRTArabidopsis thalianaMISC_FEATUREcold shock domain
protein 3 17Met Ala Met Glu Asp Gln Ser Ala Ala Arg Ser Ile Gly Lys
Val
Ser1 5 10 15Trp Phe Ser Asp Gly Lys Gly Tyr Gly Phe Ile Thr Pro Asp
Asp Gly 20 25 30Gly Glu Glu Leu Phe Val His Gln Ser Ser Ile Val Ser
Asp Gly Phe 35 40 45Arg Ser Leu Thr Leu Gly Glu Ser Val Glu Tyr Glu
Ile Ala Leu Gly 50 55 60Ser Asp Gly Lys Thr Lys Ala Ile Glu Val Thr
Ala Pro Gly Gly Gly65 70 75 80Ser Leu Asn Lys Lys Glu Asn Ser Ser
Arg Gly Ser Gly Gly Asn Cys 85 90 95Phe Asn Cys Gly Glu Val Gly His
Met Ala Lys Asp Cys Asp Gly Gly 100 105 110Ser Gly Gly Lys Ser Phe
Gly Gly Gly Gly Gly Arg Arg Ser Gly Gly 115 120 125Glu Gly Glu Cys
Tyr Met Cys Gly Asp Val Gly His Phe Ala Arg Asp 130 135 140Cys Arg
Gln Ser Gly Gly Gly Asn Ser Gly Gly Gly Gly Gly Gly Gly145 150 155
160Arg Pro Cys Tyr Ser Cys Gly Glu Val Gly His Leu Ala Lys Asp Cys
165 170 175Arg Gly Gly Ser Gly Gly Asn Arg Tyr Gly Gly Gly Gly Gly
Arg Gly 180 185 190Ser Gly Gly Asp Gly Cys Tyr Met Cys Gly Gly Val
Gly His Phe Ala 195 200 205Arg Asp Cys Arg Gln Asn Gly Gly Gly Asn
Val Gly Gly Gly Gly Ser 210 215 220Thr Cys Tyr Thr Cys Gly Gly Val
Gly His Ile Ala Lys Val Cys Thr225 230 235 240Ser Lys Ile Pro Ser
Gly Gly Gly Gly Gly Gly Arg Ala Cys Tyr Glu 245 250 255Cys Gly Gly
Thr Gly His Leu Ala Arg Asp Cys Asp Arg Arg Gly Ser 260 265 270Gly
Ser Ser Gly Gly Gly Gly Gly Ser Asn Lys Cys Phe Ile Cys Gly 275 280
285Lys Glu Gly His Phe Ala Arg Glu Cys Thr Ser Val Ala 290 295
3001813DNAchlamydomonas reinhardtiimisc_featureconsensus sequence
LHCBM1 18gctgggacac cgc 131913DNAchlamydomonas
reinhardtiimisc_featureConsensus sequence LHCBM2 19gcgacacccc cgc
132013DNAchlamydomonas reinhardtiimisc_featureConsensus sequence
LHCBM2misc_featureConsensus sequence LHCBM3 20gctggaccac cgt
132113DNAchlamydomonas reinhardtiimisc_featureConsensus sequence
LHCBM3misc_featureConsensus sequence LHCBM4 21gcctgacccc cga
132213DNAchlamydomonas reinhardtiimisc_featureConsensus sequence
LHCBM5 22gcatcacccc cga 132313DNAchlamydomonas
reinhardtiimisc_featureConsensus sequence LHCBM6 23gccagacccc cga
132413DNAchlamydomonas reinhardtiimisc_featureConsensus sequence
LHCBM8 24gcgacacccc cgc 132513DNAchlamydomonas
reinhardtiimisc_featureConsensus sequence LHCBM9 25tccataccac cgt
132613DNAchlamydomonas
reinhardtiimisc_featureCSDCSmisc_feature(5)..(5)n is a, c, g,or t
26gccanaccac cgc 132713DNAChlamydomonas reinhardtiimisc_featureLRE
(Light responsive element) 27gccagacccc cgc
132821DNAartificialforward primers homologous to A. thaliana cao
28atgaacgccg ccgtgtttag t 212921DNAartificialreverse primer
homologous to A. thalianan cao sequence 29cggttcagcg caatgtctcc a
21
* * * * *