U.S. patent application number 17/335499 was filed with the patent office on 2022-06-23 for closed-ended linear duplex dna for non-viral gene transfer.
This patent application is currently assigned to University of Massachusetts. The applicant listed for this patent is University of Massachusetts, Voyager Therapeutics, Inc.. Invention is credited to Sylvain Cecchini, Robert M. Kotin.
Application Number | 20220195456 17/335499 |
Document ID | / |
Family ID | |
Filed Date | 2022-06-23 |
United States Patent
Application |
20220195456 |
Kind Code |
A9 |
Kotin; Robert M. ; et
al. |
June 23, 2022 |
CLOSED-ENDED LINEAR DUPLEX DNA FOR NON-VIRAL GENE TRANSFER
Abstract
Aspects of the disclosure relate to a nucleic acid comprising a
heterologous nucleic acid insert flanked by interrupted
self-complementary sequences, wherein one self-complementary
sequence is interrupted by a cross-arm sequence forming two
opposing, lengthwise-symmetric stem-loops, and wherein the other of
the self-complementary sequences is interrupted by a truncated
cross-arm sequence. Methods of delivering the nucleic acid to a
cell are also provided.
Inventors: |
Kotin; Robert M.; (Bethesda,
MD) ; Cecchini; Sylvain; (Westborough, MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Massachusetts
Voyager Therapeutics, Inc. |
Boston
Cambridge |
MA
MA |
US
US |
|
|
Assignee: |
University of Massachusetts
Boston
MA
Voyager Therapeutics, Inc.
Cambridge
MA
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20210355507 A1 |
November 18, 2021 |
|
|
Appl. No.: |
17/335499 |
Filed: |
June 1, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16081337 |
Aug 30, 2018 |
11066679 |
|
|
PCT/US17/20828 |
Mar 3, 2017 |
|
|
|
17335499 |
|
|
|
|
62406913 |
Oct 11, 2016 |
|
|
|
62394720 |
Sep 14, 2016 |
|
|
|
62303047 |
Mar 3, 2016 |
|
|
|
International
Class: |
C12N 15/86 20060101
C12N015/86; C12N 15/09 20060101 C12N015/09; C12N 15/63 20060101
C12N015/63; C12N 15/66 20060101 C12N015/66; C07K 14/005 20060101
C07K014/005; C12N 15/64 20060101 C12N015/64; A61P 11/12 20060101
A61P011/12; A61P 27/02 20060101 A61P027/02; A61P 3/08 20060101
A61P003/08; A61P 7/04 20060101 A61P007/04; A61P 1/16 20060101
A61P001/16; A61P 3/00 20060101 A61P003/00; A61K 48/00 20060101
A61K048/00 |
Claims
1.-69. (canceled)
70. A method of preventing or treating one or more genetic
deficiencies or dysfunctions in a mammalian subject, comprising
administering a closed-ended linear duplex DNA (ceDNA) to the
subject, wherein the ceDNA comprises a nucleic acid insert
comprising a transgene encoding a protein or functional RNA for
preventing or treating the one or more genetic deficiencies or
dysfunctions; wherein the insert is flanked by at least two
adeno-associated virus (AAV) inverted terminal repeat (ITR)
sequences; wherein the at least two ITR sequences are asymmetric
and covalently linked with respect to one another, each sequence
having an operative terminal resolution site and a rolling circle
replication protein binding element (RBE); wherein a first ITR
sequence is interrupted by a cross-arm sequence forming two
opposing, lengthwise-symmetric stem-loops formed by interrupted
palindromic sequences B-B' and C-C', each of the opposing
lengthwise-symmetric stem-loops having a stem portion in the range
of 5 to 15 base pairs in length and a loop portion having 2 to 5
unpaired deoxyribonucleotides; wherein a second ITR sequence is
interrupted by a truncated cross-arm sequence having one or more
deletions of between 11 and 20 nucleotides in a palindromic
sequence loop region B-B' and/or a palindromic sequence loop region
C-C'; and wherein the ceDNA is administered to the subject in an
amount sufficient to treat or prevent the one or more genetic
deficiencies or dysfunctions in the subject.
71. The method of claim 70, wherein the transgene encodes a protein
or functional RNA selected from the group consisting of:
glucose-6-phosphatase, phosphoenolpyruvate-carboxykinase,
galactose-1 phosphate uridyl transferase, phenylalanine
hydroxylase, branched chain alpha-ketoacid dehydrogenase,
fumarylacetoacetate hydrolase, methylmalonyl-CoA mutase, medium
chain acyl Co A dehydrogenase, ornithine transcarbamylase,
argininosuccinic acid synthetase, low density lipoprotein receptor
protein, UDP-glucouronosyltransferase, adenosine deaminase,
hypoxanthine guanine phosphoribosyl transferase, biotinidase,
beta-glucocerebrosidase, beta-glucuronidase, peroxisome membrane
protein 70 kDa, porphobilinogen deaminase, alpha-1 antitrypsin,
erythropoietin, vascular endothelial growth factor, angiopoietin-1,
fibroblast growth factor, thrombomodulin, tissue factor pathway
inhibitor, aromatic amino acid decarboxylase (AADC), tyrosine
hydroxylase (TH), beta-adrenergic receptor, phospholamban,
sarco(endo)plasmic reticulum adenosine triphosphatase-2 (SERCA2),
cardiac adenylyl cyclase, a tumor suppressor gene, p53, a cytokine,
an interleukin, dystrophin, minidystrophin, utrophin, miniutrophin,
and insulin.
72. The method of claim 70, wherein: (a) the transgene encodes
glucose-6-phosphatase and the one or more genetic deficiencies or
dysfunctions comprise glycogen storage deficiency type 1A; (b) the
transgene encodes phosphoenolpyruvate-carboxykinase and the one or
more genetic deficiencies or dysfunctions comprise Pepck
deficiency; (c) the transgene encodes galactose-1 phosphate uridyl
transferase and the one or more genetic deficiencies or
dysfunctions comprise galactosemia; (d) the transgene encodes
phenylalanine hydroxylase and the one or more genetic deficiencies
or dysfunctions comprise phenylketonuria; (e) the transgene encodes
branched chain alpha-ketoacid dehydrogenase and the one or more
genetic deficiencies or dysfunctions comprise Maple syrup urine
disease; (f) the transgene encodes fumarylacetoacetate hydrolase
and the one or more genetic deficiencies or dysfunctions comprise
tyrosinemia type 1; (g) the transgene encodes methylmalonyl-CoA
mutase and the one or more genetic deficiencies or dysfunctions
comprise methylmalonic acidemia; (h) the transgene encodes medium
chain acyl Co A dehydrogenase and the one or more genetic
deficiencies or dysfunctions comprise medium chain acetyl Co A
deficiency; (i) the transgene encodes ornithine transcarbamylase
and the one or more genetic deficiencies or dysfunctions comprise
ornithine transcarbamylase deficiency; (j) the transgene encodes
argininosuccinic acid synthetase and the one or more genetic
deficiencies or dysfunctions comprise citrullinemia; (k) the
transgene encodes low density lipoprotein receptor protein and the
one or more genetic deficiencies or dysfunctions comprise familial
hypercholesterolemia; (l) the transgene encodes
UDP-glucouronosyltransferase and the one or more genetic
deficiencies or dysfunctions comprise Crigler-Najjar disease; (m)
the transgene encodes adenosine deaminase and the one or more
genetic deficiencies or dysfunctions comprise severe combined
immunodeficiency disease; (n) the transgene encodes hypoxanthine
guanine phosphoribosyl transferase and the one or more genetic
deficiencies or dysfunctions comprise Gout and Lesch-Nyan syndrome;
(o) the transgene encodes biotinidase and the one or more genetic
deficiencies or dysfunctions comprise biotinidase deficiency; (p)
the transgene encodes beta-glucocerebrosidase and the one or more
genetic deficiencies or dysfunctions comprise Gaucher disease; (q)
the transgene encodes beta-glucuronidase and the one or more
genetic deficiencies or dysfunctions comprise Sly syndrome; (r) the
transgene encodes peroxisome membrane protein 70 kDa and the one or
more genetic deficiencies or dysfunctions comprise Zellweger
syndrome; (s) the transgene encodes porphobilinogen deaminase and
the one or more genetic deficiencies or dysfunctions comprise acute
intermittent porphyria; (t) the transgene encodes alpha-1
antitrypsin and the one or more genetic deficiencies or
dysfunctions comprise for treatment of alpha-1 antitrypsin
deficiency (emphysema); (u) the transgene encodes erythropoietin
and the one or more genetic deficiencies or dysfunctions comprise
anemia due to thalassemia or to renal failure; (v) the transgene
encodes vascular endothelial growth factor, angiopoietin-1, or
fibroblast growth factor and the one or more genetic deficiencies
or dysfunctions comprise ischemic diseases; (w) the transgene
encodes thrombomodulin or tissue factor pathway inhibitor and the
one or more genetic deficiencies or dysfunctions comprise occluded
blood vessels; (x) the transgene encodes aromatic amino acid
decarboxylase (AADC) or tyrosine hydroxylase (TH) and the one or
more genetic deficiencies or dysfunctions comprise Parkinson's
disease; (y) the transgene encodes beta adrenergic receptor,
phospholamban, sarco(endo)plasmic reticulum adenosine
triphosphatase-2 (SERCA2), or cardiac adenylyl cyclase and the one
or more genetic deficiencies or dysfunctions comprise congestive
heart failure; (z) the transgene encodes a tumor suppressor gene
and the one or more genetic deficiencies or dysfunctions comprise
cancer; (aa) the transgene encodes p53 and the one or more genetic
deficiencies or dysfunctions comprise cancer; (bb) the transgene
encodes a cytokine for prevention or treatment inflammatory and
immune disorders or cancer; (cc) the transgene encodes dystrophin
or minidystrophin or utrophin or miniutrophin and the one or more
genetic deficiencies or dysfunctions comprise muscular dystrophies;
or (dd) the transgene encodes insulin and the one or more genetic
deficiencies or dysfunctions comprise diabetes.
73. The method of claim 70, wherein the transgene encoding a
protein or functional RNA is useful for the treatment of a
condition, disease or disorder associated with the central nervous
system (CNS); a condition, disease or disorder associated with the
cardiovascular system; a condition, disease or disorder associated
with the pulmonary system; a condition, disease or disorder
associated with the liver; a condition, disease or disorder
associated with the kidney; a condition, disease or disorder
associated with the eye; or a condition, disease or disorder
associated with the blood; or a cancer.
74. The method of claim 73, wherein: (a) the transgene for a
condition, disease or disorder associated with the CNS is selected
from the group consisting of DRD2, GRIA1, GRIA2, GRIN1, SLC1A1,
SYP, SYT1, CHRNA7, 3Rtau/4rTUS, APP, BAX, BCL-2, GRIK1, GFAP, IL-1,
AGER, UCH-L1, SKP1, EGLN1, Nurr-1, BDNF, TrkB, gstm1, S106.beta.,
IT15, PRNP, JPH3, TBP, ATXN1, ATXN2, ATXN3, Atrophin 1, FTL,
TITF-1, FXN, ASPA, DMD, SMN1, UBE1, and DYNC1H1; (b) the transgene
for a condition, disease or disorder associated with the
cardiovascular system is selected from the group consisting of
VEGF, FGF, SDF-1, connexin 40, connexin 43, SCN4a, HIF1.alpha.,
SERCa2a, ADCY1, and ADCY6. (c) the transgene for a condition,
disease or disorder associated with the pulmonary system is
selected from the group consisting of CFTR, AAT, TNF.alpha.,
TGF.beta.1, SFTPA1, SFTPA2, SFTPB, SFTPC, HPS1, HPS3, HPS4, ADTB3A,
IL1A, IL1B, LTA, IL6, CXCR1, and CXCR2; (d) the transgene for a
condition, disease or disorder associated with the liver is
selected from the group consisting of .alpha.1-AT, HFE, ATP7B,
fumarylacetoacetate hydrolase (FAH), glucose-6-phosphatase, NCAN,
GCKR, LYPLAL1, PNPLA3, lecithin cholesterol acetyltransferase,
phenylalanine hydroxylase, and G6PC; (e) the transgene for a
condition, disease or disorder associated with the kidney is
selected from the group consisting of PKD1, PKD2, PKHD1, NPHS1,
NPHS2, PLCE1, CD2AP, LAMB2, TRPC6, WT1, LMX1B, SMARCAL1, COQ2,
PDSS2, SCARB3, FN1, COL4A5, COL4A6, COL4A3, COL4A4, FOX1C, RET,
UPK3A, BMP4, SIX2, CDC5L, USF2, ROBO2, SLIT2, EYA1, MYOG, SIX1,
SIX5, FRAS1, FREM2, GATA3, KAL1, PAX2, TCF2, and SALL1; (f) the
transgene for a condition, disease or disorder associated with the
eye is selected from the group consisting of ABCA4, VEGF, CEP290,
CFH, C3, MT-ND2, ARMS2, TIMP3, CAMK4, FMN1, RHO, USH2A, RPGR, RP2,
TMCO, SIX1, SIX6, LRP12, ZFPM2, TBK1, GALC, myocilin, CYP1B1, CAV1,
CAV2, optineurin and CDKN2B; (g) the transgene for a condition,
disease or disorder associated with the blood is selected from the
group consisting of Factor VIII (FVIII), Factor IX (FIX), von
Willebrand factor (VWF); or (h) the transgene associated with a
cancer is selected from the group consisting of AARS, ABCB1, ABCC4,
ABI2, ABL1, ABL2, ACK1, ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB,
ANPEP, ANXA5, ANXA7, AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS,
ATF4, ATM, ATP5B, ATP5O, AXL, BARD1, BAX, BCL2, BHLHB2, BLMH, BRAF,
BRCA1, BRCA2, BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB,
CCL2, CCND1, CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59,
CDC20, CDC25, CDC25A, CDC25B, CDC2L5, CDK10, CDK4, CDK5, CDK9,
CDKL1, CDKNIA, CDKNIB, CDKNIC, CDKN2A, CDKN2B, CDKN2D, CEBPG,
CENPC1, CGRRF1, CHAF1A, CIB1, CKMT1, CLK1, CLK2, CLK3, CLNS1A,
CLTC, COL1A1, COL6A3, COX6C, COX7A2, CRAT, CRHRl, CSFIR, CSK,
CSNK1G2, CTNNAl, CTNNBl, CTPS, CTSC, CTSD, CUL1, CYR61, DCC, DCN,
DDX10, DEK, DHCR7, DHRS2, DHX8, DLG3, DVL1, DVL3, E2F1, E2F3, E2F5,
EGFR, EGR1, EIF5, EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETV3,
ETV6, F2R, FASTK, FBN1, FBN2, FES, FGFR1, FGR, FKBP8, FN1, FOS,
FOSL1, FOSL2, FOXG1A, FOXOIA, FRAP1, FRZB, FTL, FZD2, FZD5, FZD9,
G22P1, GAS 6, GCN5L2, GDF15, GNA13, GNAS, GNB2, GNB2L1, GPR39,
GRB2, GSK3A, GSPT1, GTF2I, HDAC1, HDGF, HMMR, HPRT1, HRB, HSPA4,
HSPA5, HSPA8, HSPB1, HSPH1, HYAL1, HYOU1, ICAM1, ID1, ID2, IDUA,
IER3, IFITM1, IGF1R, IGF2R, IGFBP3, IGFBP4, IGFBP5, IL1B, ILK,
ING1, IRF3, ITGA3, ITGA6, ITGB4, JAK1, JARIDIA, JUN, JUNB, JUND,
K-ALPHA-1, KIT, KITLG, KLK10, KPNA2, KRAS2, KRT18, KRT2A, KRT9,
LAMB1, LAMP2, LCK, LCN2, LEP, LITAF, LRPAP1, LTF, LYN, LZTR1,
MADH1, MAP2K2, MAP3K8, MAPK12, MAPK13, MAPKAPK3, MAPRE1, MARS,
MAS1, MCC, MCM2, MCM4, MDM2, MDM4, MET, MGST1, MICB, MLLT3, MME,
MMP1, MMP14, MMP17, MMP2, MNDA, MSH2, MSH6, MT3, MYB, MYBL1, MYBL2,
MYC, MYCL1, MYCN, MYD88, MYL9, MYLK, NEO1, NF1, NF2, NFKB1, NFKB2,
NFSF7, NID, NINJ1, NMBR, NME1, NME2, NME3, NOTCH1, NOTCH2, NOTCH4,
NPM1, NQO1, NR1D1, NR2F1, NR2F6, NRAS, NRG1, NSEP1, OSM, PA2G4,
PABPC1, PCNA, PCTK1, PCTK2, PCTK3, PDGFA, PDGFB, PDGFRA, PDPK1,
PEA15, PFDN4, PFDN5, PGAM1, PHB, PIK3CA, PIK3CB, PIK3CG, PIM1,
PKM2, PKMYT1, PLK2, PPARD, PPARG, PPIH, PPP1CA, PPP2R5A, PRDX2,
PRDX4, PRKAR1A, PRKCBP1, PRNP, PRSS15, PSMA1, PTCH, PTEN, PTGS1,
PTMA, PTN, PTPRN, RAB5A, RAC1, RAD50, RAF1, RALBP1, RAP1A, RARA,
RARB, RASGRF1, RB1, RBBP4, RBL2, REA, REL, RELA, RELB, RET, RFC2,
RGS 19, RHOA, RHOB, RHOC, RHOD, RIPK1, RPN2, RPS6KB1, RRM1, SARS,
SELENBP1, SEMA3C, SEMA4D, SEPP1, SERPINH1, SFN, SFPQ, SFRS7, SHB,
SHH, SIAH2, SIVA, SIVA TP53, SKI, SKIL, SLC16A1, SLC1A4, SLC20A1,
SMO, SMPD1, SNAI2, SND1, SNRPB2, SOCS 1, SOCS3, SOD1, SORT1,
SPINT2, SPRY2, SRC, SRPX, STAT1, STAT2, STAT3, STAT5B, STC1, TAF1,
TBL3, TBRG4, TCF1, TCF7L2, TFAP2C, TFDP1, TFDP2, TGFA, TGFB 1,
TGFBI, TGFBR2, TGFBR3, THBS1, TIE, TIMP1, TIMP3, TJP1, TK1, TLE1,
TNF.alpha., TNFRSF10A, TNFRSF10B, TNFRSF1A, TNFRSF1B, TNFRSF6,
TNFSF7, TNK1, TOB1, TP53, TP53BP2, TP53I3, TP73, TPBG, TPT1, TRADD,
TRAM1, TRRAP, TSG101, TUFM, TXNRD1, TYRO3, UBC, UBE2L6, UCHL1,
USP7, VDAC1, VEGF, VHL, VIL2, WEE1, WNT1, WNT2, WNT2B, WNT3, WNT5A,
WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70, and ZNF9.
75. The method of claim 70, wherein the transgene encodes
phenylalanine hydrolase and the one or more genetic deficiencies or
dysfunctions comprise phenylketonuria.
76. The method of claim 70, wherein the transgene encodes
beta-glucocerebrosidase and the one or more genetic deficiencies or
dysfunctions comprise Gaucher disease.
77. The method of claim 70, wherein the transgene encodes ATP7B and
the one or more genetic deficiencies or dysfunctions comprise a
condition, disease or disorder associated with the liver.
78. The method of claim 70, wherein the transgene encodes Factor
VIII (FVIII) and the one or more genetic deficiencies or
dysfunctions comprise a condition, disease or disorder associated
with the blood.
79. The method of claim 70, wherein the transgene encodes Factor IX
(FIX) and the one or more genetic deficiencies or dysfunctions
comprise a condition, disease or disorder associated with the
blood.
80. The method of claim 70, wherein the transgene encodes ABCA4 and
the one or more genetic deficiencies or dysfunctions comprise a
condition, disease or disorder associated with the eye.
81. The method of claim 70, wherein the transgene encodes CEP290
and the one or more genetic deficiencies or dysfunctions comprise a
condition, disease or disorder associated with the eye.
82. The method of claim 70, wherein (i) the ITRs are in the range
of 40 to 1000 nucleotides in length; (ii) the cross-arm sequence
has a Gibbs free energy (.DELTA.G) of unfolding under physiological
conditions in the range of -12 kcal/mol to -30 kcal/mol; (iii) the
RBE comprises the sequence 5'-GCTCGCTCGCTC-3'; (iv) the operative
terminal resolution site comprises a sequence 5'-TT-3' and/or the
3' end of the operative terminal resolution site is 15 to 25
nucleotides from the 5' end of the rolling circle replication
protein binding element; (v) the truncated cross-arm sequence forms
two opposing, lengthwise-asymmetric stem-loops; and/or (vi) the
nucleic acid insert is a promoterless construct as a substrate for
gene editing selected from a substrate for TALENS, a substrate for
zinc finger nucleases (ZFNs), a substrate for meganucleases, a
substrate for Cas9, and a substrate for another gene editing
protein.
83. The method of claim 82, wherein one of the opposing,
lengthwise-asymmetric stem-loops has a stem portion in the range of
8 to 10 base pairs in length and a loop portion having 2 to 5
unpaired deoxyribonucleotides or the one lengthwise-asymmetric
stem-loop has a stem portion less than 8 base pairs in length and a
loop portion having 2 to 5 deoxyribonucleotides.
84. The method of claim 82, wherein the ITRs are in the range of
100 to 160 nucleotides in length.
85. The method of claim 70, wherein the ceDNA is prepared with a
pharmaceutically acceptable excipient or carrier.
86. The method of claim 70, wherein the ceDNA is administered by a
lipid nanoparticle.
87. The method of claim 70, wherein the ceDNA is administered to
the subject in a therapeutically effective amount to transfect a
desired tissue and to provide sufficient levels of gene transfer
and expression.
88. The method of claim 70, wherein the ceDNA is administered
intravenously, intramuscularly, subcutaneously, intradermally,
intratumorally, intrathecally, intraocularly, intranasally, orally,
or intravitreally.
89. The method of claim 70, wherein the ceDNA is administered by a
portal vein injection.
90. A method of preventing or treating one or more genetic
deficiencies or dysfunctions in a mammalian subject, comprising
administering a host cell comprising a closed-ended linear duplex
DNA (ceDNA) to the subject, wherein the ceDNA comprises a nucleic
acid insert comprising a transgene encoding a protein or functional
RNA for preventing or treating the one or more genetic deficiencies
or dysfunctions; wherein the insert is flanked by at least two
adeno-associated virus (AAV) inverted terminal repeat (ITR)
sequences; wherein the at least two ITR sequences are asymmetric
and covalently linked with respect to one another, each sequence
having an operative terminal resolution site and a rolling circle
replication protein binding element (RBE); wherein a first ITR
sequence is interrupted by a cross-arm sequence forming two
opposing, lengthwise-symmetric stem-loops formed by interrupted
palindromic sequences B-B' and C-C', each of the opposing
lengthwise-symmetric stem-loops having a stem portion in the range
of 5 to 15 base pairs in length and a loop portion having 2 to 5
unpaired deoxyribonucleotides; wherein a second ITR sequence is
interrupted by a truncated cross-arm sequence having one or more
deletions of between 11 and 20 nucleotides in a palindromic
sequence loop region B-B' and/or a palindromic sequence loop region
C-C'; and wherein the host cell is administered to the subject in
an amount sufficient to treat or prevent the one or more genetic
deficiencies or dysfunctions in the subject.
Description
RELATED APPLICATIONS
[0001] This application is a continuation under 35 U.S.C. .sctn.
120 of U.S. application Ser. No. 16/081,337, filed Aug. 30, 2018,
which is a National Stage Application of PCT/US2017/020828, filed
Mar. 3, 2017, entitled "CLOSED-ENDED LINEAR DUPLEX DNA FOR
NON-VIRAL GENE TRANSFER", which claims the benefit under 35 U.S.C.
119(e) of the filing date of U.S. Provisional Application
62/303,047, filed on Mar. 3, 2016, entitled "CLOSED-ENDED LINEAR
DUPLEX DNA FOR NON-VIRAL GENE TRANSFER", U.S. Provisional
Application 62/394,720, filed Sep. 14, 2016, entitled "CLOSED-ENDED
LINEAR DUPLEX DNA FOR NON-VIRAL GENE TRANSFER", and U.S.
Provisional Application 62/406,913, filed Oct. 11, 2016, entitled
"CLOSED-ENDED LINEAR DUPLEX DNA FOR NON-VIRAL GENE TRANSFER", the
entire contents of each are incorporated herein by reference.
BACKGROUND
[0002] Current gene delivery vectors have several drawbacks. Both
viral and bacterial-derived gene delivery vectors can induce the
innate and adaptive immune responses of a patient. For example,
plasmid DNA (pDNA) and mini-circle DNA (mcDNA) vectors, typically
have prokaryotic patterns of DNA methylation that are not present
in eukaryotic DNA. Additionally, lipopolysaccharides (LPS) and
other bacterial-derived molecules are recognized in vertebrate
cells by the innate immune response pattern recognition receptor
(PRR) as pathogen-associated molecular patterns (PAMPs), leading to
activation of cellular genes in response to the invasive microbial
pathogen. Plasmid DNA conformationally is uniquely bacterial; the
closest mammalian structure is the mitochondrial genome, or duplex
circular DNA, which compartmentalized in the organelle, is not
exposed to the cytosolic PRRs. In another example, recombinant
adeno-associated viruses (rAAVs) can induce a T-cell response to
processed capsid antigens or be neutralized by circulating
immunoglobulins and non-Ig glycoproteins. Viral vectors also have
limited transgene carrying capacity and are labor intensive,
expensive, and time consuming to produce. Accordingly, improved
compositions and methods for gene delivery are needed.
SUMMARY
[0003] The disclosure relates, in some aspects, to the discovery
that replication of nucleic acids encoding a heterologous nucleic
acid insert flanked by certain types of asymmetric termini (e.g.,
asymmetric interrupted self-complementary sequences) results in
covalent linkage of the asymmetric termini (e.g., asymmetric
interrupted self-complementary sequences) and leads to the
production of a novel conformation of closed-ended linear duplex
DNA (ceDNA). In some embodiments, nucleic acids having asymmetric
interrupted self-complementary sequences can be readily produced
(e.g., in large quantities) while avoiding scale up issues
associated with other gene therapy vectors (e.g., viral based
vectors). This result is surprising in view of reports that
symmetry is required in the internal palindromic region for
purposes of propagation of similar nucleic acids.
[0004] In some embodiments, nucleic acids having asymmetric
interrupted self-complementary sequences, as disclosed herein, may
have improved genetic stability compared with other gene therapy
vectors (e.g., nucleic acids having symmetric interrupted
self-complementary sequences). In some embodiments, nucleic acids
having asymmetric interrupted self-complementary sequences, as
disclosed herein, may have improved safety profiles compared with
other vectors (e.g., nucleic acids having symmetric interrupted
self-complementary sequences). For example, in some embodiments,
administration of nucleic acids having asymmetric interrupted
self-complementary sequences may be less likely to result in
insertional mutagenesis compared with other vectors (e.g., nucleic
acids having symmetric interrupted self-complementary sequences)
due to the asymmetric nature of the construct.
[0005] In certain embodiments, nucleic acids having asymmetric
interrupted self-complementary sequences that are engineered to
express a transcript (e.g., a transcript encoding a protein or
functional nucleic acid) may have improved expression compared with
other vectors (e.g., nucleic acids having symmetric interrupted
self-complementary sequences) because the asymmetric nature of the
constructs makes them less likely to interact in cells with certain
enzymes (e.g., helicases, such as, RecQ helicases) that can reduce
the transcriptional capacity of such vectors.
[0006] In some embodiments, administration of a nucleic acid having
asymmetric interrupted self-complementary sequences, as described
herein, is less likely to induce an immune response in a subject
compared with administration of other gene therapy vectors (e.g.,
plasmid DNA vectors and viral vectors). Therefore, in some
embodiments, a nucleic acid described herein can be administered to
a subject on multiple occasions (e.g., in the context of long-term
gene therapy) without inducing a substantial immune response that
would prevent or inhibit expression and/or activity of a gene
product encoded by the nucleic acid.
[0007] In some aspects, the disclosure provides a nucleic acid
comprising a heterologous nucleic acid insert flanked by at least
one interrupted self-complementary sequence, each
self-complementary sequence having an operative terminal resolution
site and a rolling circle replication protein binding element,
wherein the self-complementary sequence is interrupted by a
cross-arm sequence forming two opposing, lengthwise-symmetric
stem-loops, each of the opposing lengthwise-symmetric stem-loops
having a stem portion in the range of 5 to 15 base pairs in length
and a loop portion having 2 to 5 unpaired deoxyribonucleotides.
[0008] In some embodiments, interrupted self-complementary
sequences are derived from a one or more organisms or viral
serotypes, including from parvoviruses, dependovirus, etc. For
example, in some embodiments, a nucleic acid comprises a first
interrupted self-complementary sequence derived from an AAV2
serotype and a second interrupted self-complementary sequence
derived from an AAV9 serotype. In another non-limiting example, a
nucleic acid as described by the disclosure may comprise a first
interrupted self-complementary sequence from an AAV2 serotype and a
second interrupted self-complementary sequence from a parvovirus
(e.g., parvovirus B19). In some embodiments, interrupted
self-complementary sequences are derived from the same organism or
viral serotype but have different lengths, or combinations of the
foregoing. In some embodiments, the nucleic acid comprises a second
interrupted self-complementary sequence that is interrupted by a
truncated cross-arm sequence. For example, in some embodiments, a
nucleic acid comprises a first self-interrupted self-complementary
sequence derived from an AAV2 serotype that is 145 base pairs in
length, and a second interrupted self-complementary sequence
derived from an AAV2 serotype that is shorter than 145 base pairs
in length (e.g., a truncated cross-arm sequence).
[0009] In some aspects, the disclosure provides a nucleic acid
comprising a heterologous nucleic acid insert flanked by
interrupted self-complementary sequences, each self-complementary
sequence having an operative terminal resolution site and a rolling
circle replication protein binding element, wherein one
self-complementary sequence is interrupted by a cross-arm sequence
forming two opposing, lengthwise-symmetric stem-loops, each of the
opposing lengthwise-symmetric stem-loops having a stem portion in
the range of 5 to 15 base pairs in length and a loop portion having
2 to 5 unpaired deoxyribonucleotides, wherein the other of the
self-complementary sequences is interrupted by a truncated
cross-arm sequence.
[0010] In some embodiments, the interrupted self-complementary
sequence(s) are in the range of 40 to 1000 nucleotides in length.
In some embodiments, the interrupted self-complementary sequence(s)
are in the range of 100 to 160 nucleotides in length.
[0011] In some embodiments, the cross-arm sequence has a Gibbs free
energy (.DELTA.G) of unfolding under physiological conditions in
the range of -12 kcal/mol to -30 kcal/mol. In some embodiments, the
cross-arm sequence has a Gibbs free energy (.DELTA.G) of unfolding
under physiological conditions in the range of -20 kcal/mol to -25
kcal/mol.
[0012] In some embodiments, each of the opposing
lengthwise-symmetric stem-loops have a stem portion in the range of
3 to 15 base pairs in length. In some embodiments, each of the
opposing lengthwise-symmetric stem-loops have a stem portion in the
range of 8 to 10 base pairs in length.
[0013] In some embodiments, each loop portion has 2 to 5 unpaired
deoxyribonucleotides. In some embodiments, each loop portion has
three deoxyribonucleotides.
[0014] In some embodiments, one loop portion has three
deoxythymidines and the other loop portion has three
deoxyadenosines.
[0015] In some embodiments, the rolling circle replication protein
binding element is a Rep binding element (RBE). In some
embodiments, the RBE comprises the sequence 5'-GCTCGCTCGCTC-3' (SEQ
ID NO: 1).
[0016] In some embodiments, the operative terminal resolution site
comprises a sequence 5'-TT-3'. In some embodiments, the 3' end of
the operative terminal resolution site is 15 to 25 nucleotides from
the 5' end of the rolling circle replication protein binding
element.
[0017] In some embodiments, the truncated cross-arm sequence forms
two opposing, lengthwise-asymmetric stem-loops. In some
embodiments, one of the opposing, lengthwise-asymmetric stem-loops
has a stem portion in the range of 8 to 10 base pairs in length and
a loop portion having 2 to 5 unpaired deoxyribonucleotides. In some
embodiments, the one lengthwise-asymmetric stem-loop has a stem
portion less than 8 base pairs in length and a loop portion having
2 to 5 deoxyribonucleotides. In some embodiments, the one
lengthwise-asymmetric stem-loop has a stem portion less than 3 base
pairs in length. In some embodiments, the one lengthwise-asymmetric
stem-loops has a loop portion having 3 or fewer
deoxyribonucleotides. In some embodiments, the truncated cross-arm
sequence has a Gibbs free energy (.DELTA.G) of unfolding under
physiological conditions in the range of 0 kcal/mol to -22
kcal/mol.
[0018] In some embodiments, the heterologous nucleic acid insert is
engineered to express a protein or functional RNA. In some
embodiments, the heterologous nucleic acid insert is a promoterless
construct as a substrate for gene editing. In some embodiments, the
promoterless construct provides a substrate for TALENS, zinc finger
nucleases (ZFNs), meganucleases, Cas9, and other gene editing
proteins. In some embodiments, the promoterless construct is
flanked by nucleic acid with homology to cell DNA to promote
homologous recombination into the cell genome. In some embodiments,
the construct is flanked by nucleic acid with homology to cell DNA
to promote homologous recombination into the cell genome.
[0019] In some embodiments, the nucleic acid is in the range of 500
to 50,000 nucleotides in length. In some embodiments, the nucleic
acid is in the range of 500 to 10,000 nucleotides in length. In
some embodiments, the nucleic acid is in the range of 1000 to
10,000 nucleotides in length. In some embodiments, the nucleic acid
is in the range of 500 to 5,000 nucleotides in length.
[0020] In some aspects, the disclosure provides a composition
comprising a plurality of nucleic acids as described by the
disclosure. In some embodiments, the plurality of nucleic acids is
linked end-to-end. In some aspects, the disclosure provides a
composition comprising a nucleic acid as described by the
disclosure and a pharmaceutically acceptable carrier.
[0021] In some aspects, the disclosure provides a composition
comprising: a monomeric nucleic acid comprising a single subunit;
and, at least one multimeric nucleic acid comprising two or more
subunits, wherein each subunit of the monomeric nucleic acid and of
the at least one multimeric nucleic acid comprises a heterologous
nucleic acid insert flanked by interrupted self-complementary
sequences, each self-complementary sequence having an operative
terminal resolution site and a rolling circle replication protein
binding element, wherein one self-complementary sequence is
interrupted by a cross-arm sequence forming two opposing,
lengthwise-symmetric stem-loops and the other of the
self-complementary sequences is interrupted by a truncated
cross-arm sequence. In some embodiments, each multimer has at least
one, and in some cases only one, self-complementary terminal
palindrome.
[0022] In some embodiments, the at least one multimeric nucleic
acid is a comprises two subunits. In some embodiments, multimeric
nucleic acid has no more than two subunits. In some embodiments,
the two subunits are linked in a tail-to-tail configuration, or
head-to-head configuration, or a head-to-tail configuration.
[0023] In some aspects, the disclosure provides host cell
comprising the nucleic acid as described by the disclosure. In some
embodiments, the host cell further comprises a rolling circle
replication protein that selectively binds to the rolling circle
replication protein binding element of the nucleic acid.
[0024] In some embodiments, the disclosure provides a method of
delivering a heterologous nucleic acid to a cell, the method
comprising delivering to the cell a nucleic acid as described by
the disclosure.
[0025] In some aspects, the disclosure provides a method of
delivering a heterologous nucleic acid to a subject, the method
comprising delivering to the subject a nucleic acid as described by
the disclosure, wherein the delivery of the nucleic acid does not
result in eliciting an acquired immune response against the nucleic
acid in the subject. In some embodiments, the immune response is a
humoral response. In some embodiments, the immune response is a
cellular response.
[0026] In some embodiments, the heterologous nucleic acid is
delivered on multiple occasions to the subject. In some
embodiments, the number of occasions in which heterologous nucleic
acid is delivered (e.g., administered) to the subject is in a range
of 2 to 10 times. In some embodiments, the number of occasions in
which heterologous nucleic acid is delivered to the subject is
hourly, daily weekly, biweekly, monthly, quarterly, semi-annually,
or annually. In some embodiments, the number of occasions in which
heterologous nucleic acid is delivered to the subject is the number
of occasions as required to maintain a clinical (e.g., therapeutic)
benefit.
[0027] In some aspects the disclosure provides a method of
delivering a heterologous nucleic acid to a subject, the method
comprising delivering a host cell as described by the disclosure to
the subject. In some embodiments, the host cell is a blood cell. In
some embodiments, the host cell is a progenitor (e.g.,
hematopoietic stem cell, HSC), myeloid, or lymphoid cell. In some
embodiments, the host cell is delivered on multiple occasions. In
some embodiments, the frequency at which the host cell is delivered
on multiple occasions is determined by the half-life of the host
cell. In some embodiments, the host cell is delivered on multiple
occasions to achieve (e.g., achieve and maintain) therapeutic
benefit.
[0028] In some aspects, the disclosure provides a method of
preparing nucleic acids, the method comprising: (i) introducing
into a permissive cell a nucleic acid encoding a heterologous
nucleic acid insert flanked by at least one interrupted
self-complementary sequence, each self-complementary sequence
having an operative terminal resolution site and a rolling circle
replication protein binding element, wherein the self-complementary
sequence is interrupted by a cross-arm sequence forming two
opposing, lengthwise-symmetric stem-loops, each of the opposing
lengthwise-symmetric stem-loops having a stem portion in the range
of 5 to 15 base pairs in length and a loop portion having 2 to 5
unpaired deoxyribonucleotides; and, (ii) maintaining the permissive
cell under conditions in which a rolling circle replication protein
in the permissive cell initiates production of multiple copies of
the nucleic acid.
[0029] In some embodiments, the method further comprises the step
of purifying the multiple copies of the nucleic acid. In some
embodiments, the purification comprises contacting the nucleic acid
with a silica gel resin.
[0030] In some embodiments, the rolling circle replication protein
is selected from the group consisting of wild-type AAV Rep 78, AAV
Rep 52, AAV Rep68, and AAV Rep 40. In some embodiments, the set of
rolling circle replication proteins include at least one from AAV
Rep 78 and AAV Rep 68, and one from AAV Rep 52 and AAV Rep 40. In
some embodiments, rolling circle replication proteins are
functionally equivalent derivatives of wild-type AAV Rep proteins
including truncated proteins or fusion proteins.
[0031] In some embodiments, the permissive cell is not a mammalian
cell. In some embodiments, the permissive cell is an insect or
other invertebrate-species cell line, yeast cell line, or bacterial
cell line. In some embodiments, the permissive cell is used for
production, e.g., Spodoptera frupperda larva. In some embodiments,
occluded recombinant Autograph californica multiple
nucleopolyhedrosis virus (AcMNPV) have been used to infect S.
frugiperda larvae for recombinant protein production, for example
via a current good manufacturing practice (cGMP) process for
protein production in larvae.
[0032] In some embodiments, the rolling circle replication protein
is encoded by a helper virus vector, optionally wherein the helper
virus vector is Autograph californica multiple nucleopolyhedrosis
virus (AcMNPV) vector or a baculovirus expression vectors
(BEV).
[0033] In some aspects, the disclosure provides a method of
preparing nucleic acids, the method comprising: introducing into a
permissive cell a nucleic acid comprising a heterologous nucleic
acid insert flanked by interrupted self-complementary sequences,
each self-complementary sequence having an operative terminal
resolution site and a rolling circle replication protein binding
element, wherein one self-complementary sequence is interrupted by
a cross-arm sequence that forms two opposing, lengthwise-symmetric
stem-loops, wherein the other of the self-complementary sequences
is interrupted by a truncated cross-arm sequence, wherein the
permissive cell expresses a rolling circle replication protein, but
does not express viral capsid proteins capable of packaging
replicative copies of the nucleic acid into a viral particle; and
maintaining the permissive cell under conditions in which the
rolling circle replication protein in the permissive cell
replicates the nucleic acid.
[0034] In some aspects, the disclosure provides a method of
preparing nucleic acids, the method comprising: introducing into a
permissive cell a nucleic acid comprising a heterologous nucleic
acid insert flanked by interrupted self-complementary sequences,
each self-complementary sequence having an operative terminal
resolution site and a rolling circle replication protein binding
element, wherein one self-complementary sequence has been
determined to be interrupted by a cross-arm sequence that forms two
opposing, lengthwise-symmetric stem-loops, wherein the other of the
self-complementary sequences has been determined to be interrupted
by a truncated cross-arm sequence, wherein the permissive cell
expresses a rolling circle replication protein, but does not
express viral capsid proteins capable of packaging replicative
copies of the nucleic acid into a viral particle; and maintaining
the permissive cell under conditions in which the rolling circle
replication protein in the permissive cell replicates the nucleic
acid.
[0035] In some embodiments, the method further comprises isolating
the replicated nucleic acid from the permissive cell.
[0036] In some aspects, the disclosure provides a method of
analyzing a nucleic acid, the method comprising: obtaining a
nucleic acid preparation comprising nucleic acid replication
products isolated from a permissive cell, wherein the permissive
cell comprises a nucleic acid comprising a heterologous nucleic
acid insert flanked by interrupted self-complementary sequences,
each self-complementary sequence having an operative terminal
resolution site and a rolling circle replication protein binding
element, wherein one self-complementary sequence is interrupted by
a cross-arm sequence that forms two opposing, lengthwise-symmetric
stem-loops, wherein the other of the self-complementary sequences
is interrupted by a truncated cross-arm sequence, wherein the
permissive cell expresses a rolling circle replication protein, but
does not express viral capsid proteins capable of packaging
replicative copies of the nucleic acid into a viral particle, and
wherein the rolling circle replication protein binds to the rolling
circle replication protein binding element of the nucleic acid and
replicates the nucleic acid to produce nucleic acid replication
products; and determining a physiochemical property of one or more
replication products.
[0037] In some embodiments, the physiochemical property is the
nucleotide sequence of one or each self-complementary sequence.
[0038] In some embodiments, the physiochemical property is the
extent of multimerization of one or more replication products. In
some embodiments, the physiochemical property is the stoichiometry
of monomeric and/or multimeric forms of the replication product in
the nucleic acid preparation.
[0039] In some embodiments, the physiochemical property is the
susceptibility of one or more replication products to digestion
with a restriction endonuclease.
[0040] In some embodiments, the physiochemical property is the
polarity of monomers in a dimeric form of the replication product,
wherein the polarity is head-to-head, head-to-tail or
tail-to-tail.
[0041] In some embodiments, the physiochemical property is the
molecular weight of one or more replication products or of a
fragment of a replication product. In some embodiments, the
molecular weight is of a fragment of the one or more replication
products that comprises one or each self-complementary sequence. In
some embodiments, the molecular weight is determined based on
electrophoretic mobility. In some embodiments, the molecular weight
is determined based on mass spectroscopy.
[0042] In some embodiments, the molecular weight is of a fragment
of the one or more replication products, and wherein prior to
determining the molecular weight the fragment is amplified by a
reaction comprising primer extension by a polymerase. In some
embodiments, the reaction comprising primer extension is a
polymerase chain reaction.
BRIEF DESCRIPTION OF DRAWINGS
[0043] FIG. 1A shows the theoretical secondary structure of AAV2
ITR based on maximizing the stability and decreasing the Gibb's
free energy (.DELTA.G, negative values indicate spontaneous
formation). FIG. 1B shows several non-limiting examples of
truncations in the stem-region of the AAV2 ITR that result in a
nucleic acid molecule having asymmetric termini.
[0044] FIGS. 2A-2B show representations of symmetric and asymmetric
open and closed-ended duplex DNA (ceDNA) molecules. FIG. 2A shows
several non-limiting examples of nucleic acids having symmetric
termini (left box) and several non-limiting examples of nucleic
acids having asymmetric termini (e.g., ceDNA) (right box). FIG. 2B
shows asymmetric terminal regions induce alteration of nucleic acid
nicking and strand separation induced during viral replication,
resulting in formation of closed-ended duplex DNA molecules
(right).
[0045] FIG. 3 shows a graphic depiction of a pair of asymmetric
ITRs. A full length AAV2 ITR is shown on top, and an AAV2 ITR
having a truncation in the C-stem is depicted on the bottom. Both
the full-length and the truncated ITR comprise an operative
Rep-binding element (RBE) and an operative terminal resolution site
(trs).
[0046] FIG. 4 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with ocular
disease.
[0047] FIG. 5 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with blood
disease.
[0048] FIG. 6 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with liver
disease.
[0049] FIG. 7 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with lung
disease.
[0050] FIGS. 8A-8D show delivery of ceDNA to the eye. Adult mice
were anesthetized by Ketamine/Xylazine (100/10 mg/kg) and the
transfection agent was delivered intravitreally by a trans scleral
injection of a volume of 1-2 .mu.l. Antibiotic ointment was applied
on cornea to prevent eye from drying while the mouse was
recovering. Mouse was allowed to recover at 37 degree and then
placed back into the mouse room for 2 weeks and the euthanized by
CO.sub.2 asphyxiation. Retina was dissected and processed for flat
mount or section. No GFP antibody staining was necessary to detect
transfected cells. FIG. 8A shows a flat mount of GFP fluorescence
on a mouse retina. FIG. 8B shows GFP fluorescence in a cross
section of the retina. FIG. 8C shows GFP fluorescence and glial
cell staining in a cross section of the retina. FIG. 8D shows GFP
fluorescence in mouse retina after delivery of ceDNA (e.g., ceDNA
having asymmetric interrupted self-complementary sequences) by
sub-retinal electroporation (top) and intravitreal injection
(bottom).
[0051] FIGS. 9A-9C show intracranial injection of ceDNA-GFP (e.g.,
ceDNA having asymmetric interrupted self-complementary sequences
and encoding GFP) formulated with in vivo j etPEI, into rat
striatum. FIG. 9A shows staining for GFP expression at 3 wks and 20
wks post-injection; similar GFP expression was seen at 3 wks and 20
wks. FIGS. 9B and 9C show immunohistochemistry (IHC) with
antibodies (Abs) against Iba1 (FIG. 9B) and MHCII (FIG. 9C); at 3
wks, no MHCII or Iba1 antigen was detected in the brain
sections.
[0052] FIGS. 10A-10E show results of a sequence analysis of the
plasmid DNA interrupted self-complementary sequences. FIG. 10F
shows agarose gel electrophoretic separation of ceDNA-GFP. The left
side of the figure shows native gel electrophoresis of uncut
ceDNA-GFP and ceDNA-GFP digested with XhoI. Monomeric (.about.2.1
kb) and dimeric (.about.4.1 kb) conformer products are observed in
the native gel; the 0.4 terminal fragment is obscured by
fluorescence of impurities at the bottom of the gel. The right side
of the figure shows denaturing gel electrophoresis of uncut
ceDNA-GFP and ceDNA-GFP digested with XhoI. The dimeric (.about.4.1
kb) conformer product is observed in the denaturing gel; denatured
terminal 0.4 kb products that run as a single stranded DNA at 0.8
kb are also observed.
DETAILED DESCRIPTION
[0053] The disclosure relates in some aspects to compositions and
methods for delivery of a transgene to a subject (e.g., a cell of a
subject, or a tissue of a subject). The disclosure relates, in
part, to the discovery that replication of nucleic acids encoding a
heterologous nucleic acid insert flanked by certain types of
asymmetric terminal sequences (e.g., asymmetric interrupted
self-complementary sequences) results in covalent linkage of the
asymmetric terminal sequences and leads to the production of a
novel conformation of closed-ended linear duplex DNA (ceDNA). In
some embodiments, nucleic acids having asymmetric interrupted
self-complementary sequences may have improved expression,
replication (e.g., production yield) in a subject compared to
currently used gene therapy vectors. In some embodiments, improved
expression of nucleic acids comprising asymmetric interrupted
self-complementary sequences is related to a preference of RecQ
helicases (e.g., RecQ1) to interact with nucleic acids comprising
symmetric interrupted self-complementary sequences compared to
nucleic acids having asymmetric interrupted self-complementary
sequences.
[0054] In some embodiments, nucleic acids having asymmetric
interrupted self-complementary sequences (e.g., are derived from a
different organism or viral serotype, or are derived from the same
organism or viral serotype but have different lengths, or a
combination of the foregoing) may have reduced likelihood of
insertional mutagenesis in a subject compared to currently used
gene therapy vectors. In some embodiments, administration of
nucleic acids having asymmetric interrupted self-complementary
sequences induce a reduced immune response, or do not induce a
detectable immune response, in a subject relative to plasmid DNA
vectors.
[0055] A "nucleic acid" sequence refers to a DNA or RNA sequence.
In some embodiments, proteins and nucleic acids of the disclosure
are isolated. As used herein, the term "isolated" means
artificially produced. In some embodiments, with respect to nucleic
acids, the term "isolated" refers to a nucleic acid that is: (i)
amplified in vitro by, for example, polymerase chain reaction
(PCR); (ii) recombinantly produced by molecular cloning; (iii)
purified, as by restriction endonuclease cleavage and gel
electrophoretic fractionation, or column chromatography; or (iv)
synthesized by, for example, chemical synthesis. An isolated
nucleic acid is one which is readily manipulable by recombinant DNA
techniques well known in the art. Thus, a nucleotide sequence
contained in a vector in which 5' and 3' restriction sites are
known or for which polymerase chain reaction (PCR) primer sequences
have been disclosed is considered isolated but a nucleic acid
sequence existing in its native state in its natural host is not.
An isolated nucleic acid may be substantially purified, but need
not be. For example, a nucleic acid that is isolated within a
cloning or expression vector is not pure in that it may comprise
only a tiny percentage of the material in the cell in which it
resides. Such a nucleic acid is isolated, however, as the term is
used herein because it is readily manipulable by standard
techniques known to those of ordinary skill in the art. As used
herein with respect to proteins or peptides, the term "isolated"
refers to a protein or peptide that has been isolated from its
natural environment or artificially produced (e.g., by chemical
synthesis, by recombinant DNA technology, etc.).
[0056] The skilled artisan will also realize that conservative
amino acid substitutions may be made to provide functionally
equivalent variants, or homologs of the capsid proteins. In some
aspects the disclosure embraces sequence alterations that result in
conservative amino acid substitutions. As used herein, a
conservative amino acid substitution refers to an amino acid
substitution that does not alter the relative charge or size
characteristics of the protein in which the amino acid substitution
is made. Variants can be prepared according to methods for altering
polypeptide sequence known to one of ordinary skill in the art such
as are found in references that compile such methods, e.g.,
Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds.,
Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York, 1989, or Current Protocols in Molecular Biology,
F. M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York.
For example, in some embodiments, conservative substitutions of
amino acids include substitutions made among amino acids within the
following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A,
G; (e) S, T; (f) Q, N; and (g) E, D. Therefore, one can make
conservative amino acid substitutions to the amino acid sequence of
proteins and polypeptides disclosed herein.
Interrupted Self-Complementary Sequences
[0057] The disclosure is based, in part, on the discovery that
nucleic acids having asymmetric terminal sequences (e.g.,
asymmetric interrupted self-complementary sequences) form
closed-ended linear duplex DNA structures (e.g., ceDNA) that, in
some embodiments, exhibit reduced immunogenicity compared to
currently available gene delivery vectors. In some embodiments,
ceDNA behaves as linear duplex DNA under native conditions and
transforms into single-stranded circular DNA under denaturing
conditions. Without wishing to be bound by any particular theory,
nucleic acids described by the disclosure (e.g., ceDNA) are useful,
in some embodiments, for the delivery of heterologous nucleic acid
inserts (e.g., transgenes) to a subject.
[0058] In some aspects, the disclosure provides a nucleic acid
comprising a heterologous nucleic acid insert flanked by
interrupted self-complementary sequences, each self-complementary
sequence having an operative terminal resolution site and a rolling
circle replication protein binding element, wherein one
self-complementary sequence is interrupted by a cross-arm sequence
forming two opposing, lengthwise-symmetric stem-loops, each of the
opposing lengthwise-symmetric stem-loops having a stem portion and
a loop portion, wherein the other of the self-complementary
sequences is interrupted by a truncated cross-arm sequence.
[0059] As used herein, the term "flanked" refers to the positioning
of a first interrupted self-complementary sequence upstream (e.g.,
5') relative to a heterologous nucleic acid insert and a second
interrupted self-complementary sequence downstream (e.g., 3')
relative to the heterologous nucleic acid insert. For example, an
adeno-associated virus genome comprises open reading frames of the
rep and cap genes "flanked" by inverted terminal repeats
(ITRs).
[0060] As used herein, the term "interrupted self-complementary
sequence" refers to a polynucleotide sequence encoding a nucleic
acid having palindromic (e.g., a contiguous stretch of
polynucleotides that is identical to its complementary strand, if
both are "read" in the same 5' to 3' direction) terminal sequences
that are interrupted by one or more stretches of non-palindromic
polynucleotides. Generally, a polynucleotide encoding one or more
interrupted palindromic sequences will fold back upon itself,
forming a stem-loop structure (e.g., a hairpin loop, a "T"-shaped
loop, or a "Y"-shaped loop), for example as shown in the AAV2 ITR
structure depicted in FIG. 1A and the exemplary structures depicted
in FIG. 2A.
[0061] In some embodiments, an interrupted self-complementary
sequence forms a "T"-shaped structure having a stem sequence and a
cross-arm sequence. In some embodiments, the "cross-arm sequence"
forms two opposing (e.g., relative to the stem sequence),
lengthwise-symmetric stem-loops, each of the opposing
lengthwise-symmetric stem-loops having a stem portion and a loop
portion. For example, in some embodiments, the stem sequence is
formed by hybridization of the complementary (e.g., palindromic)
5'- and 3'-ends of a polynucleotide sequence (referred to as
"A-A'"), where the A-A' palindrome is interrupted by the cross-arm
polynucleotide sequence formed by a pair of loop-forming
interrupted palindromic sequences denoted "B-B'" and "C-C'",
respectively, as shown in FIG. 1A. In some embodiments, the loop
portion of each cross arm (e.g., loops formed by interrupted
palindromic sequences B-B' and C-C') is formed from unpaired
nucleotides (e.g., unpaired deoxyribonucleotides). It should be
appreciated that an interrupted self-complementary sequence
described by the disclosure may comprise more than two (e.g., 3, 4,
or more) cross-arm sequences.
[0062] An interrupted self-complementary sequence can be of any
size, provided that the sequence forms a hairpin loop and functions
as a primer for nucleic acid replication (e.g., DNA replication).
For example, an interrupted self-complementary sequence can range
from about 20 to about 2000 nucleotides in length. In some
embodiments, an interrupted self-complementary sequence ranges from
about 40 to 1000 nucleotides in length. In some embodiments, an
interrupted self-complementary sequence is at least 40, at least
50, at least 60, at least 70, at least 80, at least 90, at least
100, at least 200, at least 300, at least 400, at least 500, at
least 600, at least 700, at least 800, at least 900, or up to 1000
nucleotides in length. In some embodiments, an interrupted
self-complementary sequence is more than 1000 nucleotides in
length. In some embodiments, an interrupted self-complementary
sequence ranges from about 100 to 160 nucleotides in length. In
some embodiments, an interrupted self-complementary nucleotide
ranges from about 115 to about 150 nucleotides in length.
[0063] In some aspects, the disclosure relates to nucleic acid
having an interrupted self-complementary sequence that forms
opposing lengthwise-symmetric stem-loops. In some embodiments, each
of the opposing lengthwise-symmetric stem-loops have a stem portion
in the range of 3 to 15 base pairs in length. In some embodiments,
each of the opposing lengthwise-symmetric stem-loops have a stem
portion in the range of 8 to 10 base pairs in length. In some
embodiments, each of the opposing lengthwise-symmetric stem-loops
have a stem portion that is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, or 15 nucleotides in length.
[0064] Generally, a loop portion of a stem-loop structure comprises
at least 2 unpaired nucleotides. In some embodiments, each loop
portion has 2 to 5 unpaired deoxyribonucleotides (e.g., 2, 3, 4, or
5 unpaired deoxyribonucleotides). In some embodiments, each loop
portion of a cross-arm sequence described by the disclosure has
three deoxyribonucleotides. In some embodiments, one loop portion
of a cross-arm sequence described by the disclosure has three
deoxythymidines and the other loop portion has three
deoxyadenosines.
[0065] In some aspects, the disclosure relates to interrupted
self-complementary sequences flanking a nucleic acid insert, where
the interrupted self-complementary sequences are asymmetric with
respect to one another (e.g., are derived from a different organism
or viral serotype, or are derived from the same organism or viral
serotype but have different lengths, or a combination of the
foregoing). In some embodiments, one of a pair of asymmetric
self-complementary sequences comprises a truncated cross-arm
sequence. As used herein, "truncated cross-arm sequence" refers to
a cross-arm sequence that has a shorter length relative to the
corresponding self-complementary sequence flanking a heterologous
nucleic acid sequence. A truncated cross-arm sequence can have
between 1 and 50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, or 50) nucleotide deletions relative to a full-length
cross-arm sequence. In some embodiments, a truncated cross-arm
sequence has between 1 and 30 nucleotide deletions relative to a
full-length cross-arm sequence. In some embodiments, a truncated
cross-arm sequence contains between 2 and 20 nucleotide deletions
relative to a full-length cross-arm sequence.
[0066] In some embodiments, a truncated cross-arm sequence forms
two opposing, lengthwise-asymmetric stem-loops. In some
embodiments, one of the opposing, lengthwise-asymmetric stem-loops
of the truncated cross-arm sequence has a stem portion in the range
of 8 to 10 base pairs in length and a loop portion having 2 to 5
unpaired deoxyribonucleotides. In some embodiments, a one
lengthwise-asymmetric stem-loop of a truncated cross-arm sequence
has a stem portion less than 8 base pairs in length and a loop
portion having 2 to 5 deoxyribonucleotides. In some embodiments,
the one lengthwise-asymmetric stem-loop has a stem portion less
than 3 base pairs in length. In some embodiments, the one
lengthwise-asymmetric stem-loops has a loop portion having 3 or
fewer deoxyribonucleotides.
[0067] Generally, a truncated cross-arm sequence does not contain
any nucleotide deletions (e.g., relative to a non-truncated
cross-arm sequence) in the A or A' regions, so as not to interfere
with DNA replication (e.g., binding to a RBE by Rep protein, or
nicking at a terminal resolution site). In some embodiments, a
truncated cross-arm sequence has one or more deletions in the B,
B', C, and/or C' region. Several non-limiting examples of truncated
cross-arm sequences are shown below:
[0068] AAV2 ITR .DELTA. C-region indicated by parenthesis; all or
partial deletions within the square brackets can be used to create
asymmetric interrupted self-complementary sequences; below, "RBE"
refers to "Rep-binding element".
TABLE-US-00001 C-Region B-Region .DELTA. RBE'
5'cggg(cgaccaaaggtc)gcccg-a-cgcccgggctttgcccgggc (SEQ ID NO: 2)
5'cggg(cgaccaaaggtcg)cccg-a-cgcccgggctttgcccgggc (SEQ ID NO: 2)
5'gccc(gggcaaagccc)gggcg-t-cgggcgacctttggtcgcccg (SEQ ID NO: 3)
5'gccc(gggcaaagccc)gggcg-t-cgggcgacctttggtcgcccg (SEQ ID NO: 3)
5'[cgggcgaccaaaggtcgcccg]-a-cgcccgggctttgcccgggc (SEQ ID NO: 2)
5'[cgggcgaccaaaggtcgcccg]-a-cgcccgggctttgcccgggc (SEQ ID NO: 2)
5'[gcccgggcaaagcccgggcg]-t-cgggcgacctttggtcgcccg (SEQ ID NO: 3)
5'[gcccgggcaaagcccgggcg]-t-cgggcgacctttggtcgcccg (SEQ ID NO: 3)
Generally, the thermodynamic properties of a nucleic acid (e.g.,
Gibbs free energy (.DELTA.G), G+C composition, A+T composition,
melting temperature, base composition of each strand, length of
complementary sequence, unpaired bases within the duplex region,
and unpaired bases constituting the loop) required for hairpin
formation are known in the art, for example as disclosed in Bosco
et al., Nucl. Acids Res. (2013) doi: 10.1093/nar/gkt1089; First
published online: Nov. 12, 2013.
[0069] In some embodiments, the cross-arm sequence has a Gibbs free
energy (.DELTA.G) of unfolding under physiological conditions in
the range of -12 kcal/mol to -30 kcal/mol. In some embodiments, the
cross-arm sequence has a Gibbs free energy (.DELTA.G) of unfolding
under physiological conditions in the range of -20 kcal/mol to -25
kcal/mol. In some embodiments, the thermodynamic properties of a
truncated cross-arm sequence can be the same (e.g., identical)
relative to a full-length cross-arm sequence even though they may
have sequence differences that render them asymmetric. In some
embodiments, the thermodynamic properties of a truncated cross-arm
sequence can be the different than those of a full-length cross-arm
sequence. For example, in some embodiments, a truncated cross-arm
sequence has a Gibbs free energy (.DELTA.G) of unfolding under
physiological conditions in the range of 0 kcal/mol to greater than
-22 kcal/mol.
[0070] As used herein, the term "operative" refers to the ability
of a nucleic acid sequence to perform its intended function. For
example, an "operative binding region" is a nucleic acid sequence
that retains binding function for its intended target (e.g., a
protein or nucleic acid). In another example, an "operative
cleavage site" is a nucleic acid sequence that retains its ability
to be specifically cleaved by a particular enzyme or enzymes.
[0071] Aspects of the disclosure relate to the discovery that
self-complementary nucleic acid sequences comprising an operative
rolling circle replication protein binding element is required for
the formation of closed-ended linear duplex DNA (ceDNA). As used
here, "rolling circle replication protein binding element" refers
to a conserved nucleic acid sequence (e.g., motif) that is
recognized and bound by a rolling circle replication protein, which
is a viral nonstructural protein (NS protein) that initiates
rolling circle (e.g., rolling hairpin) replication. Rolling circle
(e.g., rolling hairpin) replication is described by Tattersall et
al. Nature 2009, 263, pp. 106-109. Examples of NS proteins include,
but are not limited to AAV Rep proteins (e.g., Rep78, Rep68, Rep52,
Rep40), parvovirus nonstructural proteins (e.g., NS2), rotavirus
nonstructural proteins (e.g., NSP1), and densovirus nonstructural
proteins (e.g., PfDNV NS1). In some embodiments, the rolling circle
replication protein binding element is a Rep binding element (RBE).
In some embodiments, the RBE comprises the sequence
5'-GCTCGCTCGCTC-3'.
[0072] In some embodiments, rolling circle replication proteins are
from the dependoparvovirus genus of the Parvoviridae family of
viruses with linear single-stranded DNA genomes. In some
embodiments, the rolling circle replication proteins are from the
genera of the autonomous Parvovirinae including mice minute virus,
Aleutian mink disease virus, bovine parvovirus, canine parvovirus,
chicken parvovirus, feline panleukopenia virus, feline parvovirus,
goose parvovirus, HB parvovirus, H-1 parvovirus, Kilham rat virus,
lapine parvovivirus, LUIII virus, mink enteritis virus, mouse
parvovirus, porcine parvovirus, raccoon parvovivurs, RT parvovirus,
Tumor virus X, rat parvovirus 1a, barbarie duck parvovirus, equine
parvovirus, hamster parvovirus, and rheumatorid arthritis virus 1.
In some embodiments, the genus is parvovirus. In some embodiments,
the rolling circle replication proteins are from the genera of
Densovirinae including brevidensovirus, densovirus, and
iteravirus.
[0073] In some embodiments, a rolling circle replication protein is
from the genera of the subfamily Parvovirinae. Examples of
Parvovirinae genera include but are not limited to Amdoparvovirus,
Aveparvovirus, Bocaparvovirus, Copiparvovirus, Dependoparvovirus,
Erythroparvovirus, Protoparvovirus, Tetraparvovirus. In some
embodiments, the rolling circle replication proteins are from the
genera of the subfamily, Densovirinae. Examples of Densovirinae
genera include but are not limited to Amdoparvovirus,
Aveparvovirus, Bocaparvovirus, Copiparvovirus, Dependoparvovirus,
Erythroparvovirus, Protoparvovirus, and Tetraparvovirus. In some
embodiments, the rolling circle replication protein(s) is from a
Dependovirus, such as Adeno-associated virus 2 (AAV2),
Adeno-associated virus 3 (AAV3), Adeno-associated virus 4 (AAV4),
or Adeno-associated virus 5 (AAV5), or any combination thereof.
[0074] In some embodiments, the rolling circle replication proteins
are derived from the single-stranded DNA bacteriophage families. In
some embodiments, the virus families are the Microviridae and the
Inoviridae.
[0075] In some embodiments, the rolling circle replication proteins
are derived from Gram positive bacteria.
[0076] Aspects of the disclosure relate to the discovery that
interrupted self-complementary nucleic acid sequences comprising an
operative terminal resolution site (trs) are required for the
formation of closed-ended linear duplex DNA (ceDNA). Typically,
replication of nucleic acids comprising interrupted
self-complementary nucleic acid sequences (e.g., AAV ITRs) is
initiated from the 3' end of the cross-arm (e.g., hairpin
structure) and generates a duplex molecule in which one of the ends
is covalently closed; the covalently closed ends of the duplex
molecule are then cleaved by a process called terminal resolution
to form a two separate single-stranded nucleic acid molecules.
Without wishing to be bound by any particular theory, the process
of terminal resolution is mediated by a site- and strand-specific
endonuclease cleavage at a terminal resolution site (trs) (e.g., a
rolling circle replication protein, such as AAV Rep protein).
Examples of trs sequences include 3'-CCGGTTG-5 and 5'-AGTTGG-3'
(recognized by AAV2 p5 protein). It has been hypothesized that
Rep-mediated strand nicking takes place between the central
di-thymidine ("TT") portion of the trs sequence. Therefore, in some
embodiments, the operative terminal resolution site comprises a
sequence 5'-TT-3'.
[0077] Aspects of the disclosure relate to the positioning of a
terminal resolution site (trs) relative to a rolling circle
replication protein binding element. Generally, a trs is positioned
upstream (e.g., 5') relative to a rolling circle replication
protein binding element. However, in some embodiments, a trs is
positioned downstream (e.g., 3') relative to a rolling circle
replication protein binding element. In some embodiments, the 3'
end of the operative terminal resolution site is 15 to 25
nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25
nucleotides) from the 5' end of the rolling circle replication
protein binding element.
[0078] In some embodiments, an interrupted self-complementary
sequence is an AAV inverted terminal repeat sequence. The AAV ITR
sequence can be of any AAV serotype, including but not limited to,
AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, non-human
primate AAV serotypes (e.g., AAVrh.10), and variants thereof. In
some embodiments, an interrupted self-complementary sequence is an
AAV2 ITR or a variant thereof (e.g., AAV2 ITR, or a truncated AAV2
ITR having a deletion in the "B arm" or "C arm"). In some
embodiments, an interrupted self-complementary sequence is an AAV5
ITR or a variant thereof (e.g., AAV5 ITR, or a truncated AAV5 ITR
having a deletion in the "B arm" or "C arm"). As used herein, a
"variant" of an AAV ITR is a polynucleotide having between about
70% and about 99.9% similarity to a wild-type AAV ITR sequence. In
some embodiments, an AAV ITR variant is about 70%, about 75%, about
80%, about 85%, about 90%, about 95%, or about 99% identical to a
wild-type AAV ITR.
[0079] An AAV ITR can exist in two conformations: "flip" and
"flop", which are a result of the rolling hairpin mechanism of AAV
replication. A non-limiting example of an interrupted
self-complementary sequence (e.g., AAV2 ITR) in both "flip" and
"flop" conformations is shown below:
TABLE-US-00002 GenBank (>gi|110645916|ref|NC_001401.21|
Adeno-associated virus - 2, complete genome) Flop conformation (SEQ
ID NO: 4) ttggccactccctctctgcgcgctcgctcgctcactgaggc
cgggcgaccaaaggtcgcccgacgcccgggctttg
|||||||||||||||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||
aaccggtgagggagagacgcgcgagcgagcgagtgactccg
gcccgctggtttccagcgggctgcgggcccgaaac (SEQ ID NO: 5)
cccgggc_ggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct
|||||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
gggcccg_ccggagtcactcgctcgctcgcgcgtctctccctcaccggttgaggtagtgatccccaagga
Flip conformation (SEQ ID NO: 6)
aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggcc_gggcgaccaaa-
ggt ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
||||||||||||||
tccttggggatcactacctcaaccggtgagggagagacgcgcgagcgagcgagtgactccgg_cccgctggttt-
cca (SEQ ID NO: 7)
cgcccgacgcccgggctttgcccgggcg_gcctcagtgagcgagcgagcgcgcagagagggagtggccaa
||||||||||||||||||||||||||||
|||||||||||||||||||||||||||||||||||||||||
gcgggctgcgggcccgaaacgggcccgc_cggagtcactcgctcgctcgcgcgtctctccctcaccggtt
In some embodiments, a nucleic acid described by the disclosure
(e.g., ceDNA) comprises an interrupted self-complementary sequence
in the flip conformation. In some embodiments, a nucleic acid
described by the disclosure (e.g., ceDNA) comprises an interrupted
self-complementary sequence in the flop conformation.
[0080] Aspects of the disclosure relate to compositions comprising
a population of nucleic acids described by the disclosure.
Generally, the populations may be homogenous (e.g., comprising
multiple copies of the same nucleic acid) or heterogeneous (e.g.,
comprising multiple different nucleic acids). For example, in some
embodiments, a composition comprises a monomeric nucleic acid
(e.g., a population of a single species of monomeric nucleic acid)
comprising a single subunit. In some embodiments, the subunit
comprises a heterologous nucleic acid insert flanked by interrupted
self-complementary sequences, each self-complementary sequence
having an operative terminal resolution site and a rolling circle
replication protein binding element, wherein one self-complementary
sequence is interrupted by a cross-arm sequence forming two
opposing, lengthwise-symmetric stem-loops and the other of the
self-complementary sequences is interrupted by a truncated
cross-arm sequence.
[0081] In some embodiments, a composition comprises a multimeric
nucleic acid comprising two or more subunits (e.g., 2, 3, 4, 5, 6,
7, 8, 9, 10, or more subunits). In some embodiments, each subunit
of the multimeric nucleic acid comprises a heterologous nucleic
acid insert flanked by interrupted self-complementary sequences,
each self-complementary sequence having an operative terminal
resolution site and a rolling circle replication protein binding
element, wherein one self-complementary sequence is interrupted by
a cross-arm sequence forming two opposing, lengthwise-symmetric
stem-loops and the other of the self-complementary sequences is
interrupted by a truncated cross-arm sequence. In some embodiments,
the multimeric nucleic acid comprises two subunits (e.g., is a
dimer). In some embodiments, each multimer has at least one, and in
some cases only one, self-complementary terminal palindrome.
[0082] In some embodiments, the subunits of a multimeric nucleic
acid form concatamers, As used herein, "concatamer" refers to a
nucleic acid molecule comprising multiple copies of the same or
substantially the same nucleic acid sequences (e.g., subunits) that
are typically linked in a series. In some embodiments, concatamers
described by the disclosure can be orientated in either a
head-to-head polarity, or a tail-to-tail polarity. In embodiments
in which subunits contain a heterologous nucleic acid sequence
configured to express an RNA transcript, "head-to-head" polarity
refers to a concatamer in which the interrupted self-complementary
sequences closest to the promoter sequence of each subunit are
covalently linked (e.g., the subunits are linked 5'-end to 5'-end).
In such embodiments, "tail-to-tail" polarity refers to a concatamer
in which the interrupted self-complementary sequences distal to the
promoter sequence of each subunit are covalently linked (e.g., the
subunits are linked 5'-end to 5'-end). In some embodiments, the two
subunits are linked in a tail-to-tail configuration (e.g.,
polarity).
[0083] In some embodiments, a composition comprises both monomeric
and multimeric nucleic acids (e.g., comprises a heterogeneous
population of nucleic acids).
Heterologous Nucleic Acid Inserts
[0084] The composition of the transgene sequence (e.g.,
heterologous nucleic acid insert) of the nucleic acid will depend
upon the use to which the resulting nucleic acid will be put. For
example, one type of transgene sequence includes a reporter
sequence, which upon expression produces a detectable signal. In
another example, the transgene encodes a therapeutic protein or
therapeutic functional RNA. In another example, the transgene
encodes a protein or functional RNA that is intended to be used for
research purposes, e.g., to create a somatic transgenic animal
model harboring the transgene, e.g., to study the function of the
transgene product. In another example, the transgene encodes a
protein or functional RNA that is intended to be used to create an
animal model of disease. Appropriate transgene coding sequences
will be apparent to the skilled artisan.
[0085] The disclosure is based, in part, on the discovery that
unlike AAV vectors, nucleic acids described herein (e.g., ceDNA)
are not limited with respect to the size of a heterologous nucleic
acid insert (e.g., transgene sequence). In some embodiments, a
transgene (e.g., heterologous nucleic acid insert) flanked by
interrupted self-complementary sequences ranges from about 10 to
about 5,000 base pairs, about 10 to about 10,000 base pairs, about
10 to about 50,000 base pairs in length. In some embodiments, a
transgene (e.g., heterologous nucleic acid insert) flanked by
interrupted self-complementary sequences ranges from about 10 to
about 50 base pairs in length. In some embodiments, a transgene
(e.g., heterologous nucleic acid insert) flanked by interrupted
self-complementary sequences ranges from about 20 to about 100 base
pairs in length. In some embodiments, a transgene (e.g.,
heterologous nucleic acid insert) flanked by interrupted
self-complementary sequences ranges from about 500 to about 1500
base pairs in length. In some embodiments, a transgene (e.g.,
heterologous nucleic acid insert) flanked by interrupted
self-complementary sequences ranges from about 1000 to about 5000
base pairs in length. In some embodiments, the size of a transgene
(e.g., heterologous nucleic acid insert) exceeds the capacity of a
traditional AAV vector (e.g., exceeds about 4.8 kb).
[0086] Reporter sequences that may be provided in a transgene
include, without limitation, DNA sequences encoding
.beta.-lactamase, .beta.-galactosidase (LacZ), alkaline
phosphatase, thymidine kinase, green fluorescent protein (GFP),
chloramphenicol acetyltransferase (CAT), luciferase, and others
well known in the art. When associated with regulatory elements
which drive their expression, the reporter sequences, provide
signals detectable by conventional means, including enzymatic,
radiographic, colorimetric, fluorescence or other spectrographic
assays, fluorescent activating cell sorting assays and
immunological assays, including enzyme linked immunosorbent assay
(ELISA), radioimmunoassay (RIA) and immunohistochemistry. For
example, where the marker sequence is the LacZ gene, the presence
of the vector carrying the signal is detected by assays for
.beta.-galactosidase activity. Where the transgene is green
fluorescent protein or luciferase, the vector carrying the signal
may be measured visually by color or light production in a
luminometer. Such reporters can, for example, be useful in
verifying the tissue-specific targeting capabilities and tissue
specific promoter regulatory activity of a nucleic acid.
[0087] In some aspects, the disclosure provides nucleic acids for
use in methods of preventing or treating one or more genetic
deficiencies or dysfunctions in a mammal, such as for example, a
polypeptide deficiency or polypeptide excess in a mammal, and
particularly for treating or reducing the severity or extent of
deficiency in a human manifesting one or more of the disorders
linked to a deficiency in such polypeptides in cells and tissues.
The method involves administration of nucleic acid (e.g., a nucleic
acid as described by the disclosure) that encodes one or more
therapeutic peptides, polypeptides, siRNAs, microRNAs, antisense
nucleotides, etc. in a pharmaceutically-acceptable carrier to the
subject in an amount and for a period of time sufficient to treat
the deficiency or disorder in the subject suffering from such a
disorder.
[0088] Thus, the disclosure embraces the delivery of nucleic acids
(e.g., nucleic acids as described by the disclosure) encoding one
or more peptides, polypeptides, or proteins, which are useful for
the treatment or prevention of disease states in a mammalian
subject. Exemplary therapeutic proteins include one or more
polypeptides selected from the group consisting of growth factors,
interleukins, interferons, anti-apoptosis factors, cytokines,
anti-diabetic factors, anti-apoptosis agents, coagulation factors,
anti-tumor factors. Other non-limiting examples of therapeutic
proteins include BDNF, CNTF, CSF, EGF, FGF, G-SCF, GM-CSF,
gonadotropin, IFN, IFG-1, M-CSF, NGF, PDGF, PEDF, TGF, VEGF,
TGF-B2, TNF, prolactin, somatotropin, XIAP1, IL-1, IL-2, IL-3,
IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-10(187A), viral
IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16 IL-17, and
IL-18.
[0089] The nucleic acids (e.g., nucleic acids as described by the
disclosure) may comprise a gene to be transferred (e.g., expressed
in) to a subject to treat a disease associated with reduced
expression, lack of expression or dysfunction of the gene.
Exemplary genes and associated disease states include, but are not
limited to: glucose-6-phosphatase, associated with glycogen storage
deficiency type 1A; phosphoenolpyruvate-carboxykinase, associated
with Pepck deficiency; galactose-1 phosphate uridyl transferase,
associated with galactosemia; phenylalanine hydroxylase, associated
with phenylketonuria; branched chain alpha-ketoacid dehydrogenase,
associated with Maple syrup urine disease; fumarylacetoacetate
hydrolase, associated with tyrosinemia type 1; methylmalonyl-CoA
mutase, associated with methylmalonic acidemia; medium chain acyl
CoA dehydrogenase, associated with medium chain acetyl CoA
deficiency; omithine transcarbamylase, associated with omithine
transcarbamylase deficiency; argininosuccinic acid synthetase,
associated with citrullinemia; low density lipoprotein receptor
protein, associated with familial hypercholesterolemia;
UDP-glucouronosyltransferase, associated with Crigler-Najjar
disease; adenosine deaminase, associated with severe combined
immunodeficiency disease; hypoxanthine guanine phosphoribosyl
transferase, associated with Gout and Lesch-Nyan syndrome;
biotinidase, associated with biotinidase deficiency;
beta-glucocerebrosidase, associated with Gaucher disease;
beta-glucuronidase, associated with Sly syndrome; peroxi some
membrane protein 70 kDa, associated with Zellweger syndrome;
porphobilinogen deaminase, associated with acute intermittent
porphyria; alpha-1 antitrypsin for treatment of alpha-1 antitrypsin
deficiency (emphysema); erythropoietin for treatment of anemia due
to thalassemia or to renal failure; vascular endothelial growth
factor, angiopoietin-1, and fibroblast growth factor for the
treatment of ischemic diseases; thrombomodulin and tissue factor
pathway inhibitor for the treatment of occluded blood vessels as
seen in, for example, atherosclerosis, thrombosis, or embolisms;
aromatic amino acid decarboxylase (AADC), and tyrosine hydroxylase
(TH) for the treatment of Parkinson's disease; the beta adrenergic
receptor, anti-sense to, or a mutant form of, phospholamban, the
sarco(endo)plasmic reticulum adenosine triphosphatase-2 (SERCA2),
and the cardiac adenylyl cyclase for the treatment of congestive
heart failure; a tumor suppessor gene such as p53 for the treatment
of various cancers; a cytokine such as one of the various
interleukins for the treatment of inflammatory and immune disorders
and cancers; dystrophin or minidystrophin and utrophin or
miniutrophin for the treatment of muscular dystrophies; and,
insulin for the treatment of diabetes.
[0090] In some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the central nervous system (CNS). The following is
a non-limiting list of genes associated with CNS disease: DRD2,
GRIA1, GRIA2,GRIN1, SLC1A1, SYP, SYT1, CHRNA7, 3Rtau/4rTUS, APP,
BAX, BCL-2, GRIK1, GFAP, IL-1, AGER, associated with Alzheimer's
Disease; UCH-L1, SKP1, EGLN1, Nurr-1, BDNF, TrkB, gstm1,
S106.beta., associated with Parkinson's Disease; IT15, PRNP, JPH3,
TBP, ATXN1, ATXN2, ATXN3, Atrophin 1, FTL, TITF-1, associated with
Huntington's Disease; FXN, associated with Freidrich's ataxia;
ASPA, associated with Canavan's Disease; DMD, associated with
muscular dystrophy; and SMN1, UBE1, DYNC1H1 associated with spinal
muscular atrophy. In some embodiments, the disclosure relates to a
heterologous nucleic acid insert that expresses one or more of the
foregoing genes or fragments thereof. In some embodiments, the
disclosure relates to a heterologous nucleic acid insert that
expresses one or more functional RNAs that inhibit expression of
one or more of the foregoing genes.
[0091] In some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the cardiovascular system. The following is a
non-limiting list of genes associated with cardiovascular disease:
VEGF, FGF, SDF-1, connexin 40, connexin 43, SCN4a, HIF1.alpha.,
SERCa2a, ADCY1, and ADCY6. In some embodiments, the disclosure
relates to a heterologous nucleic acid insert that expresses one or
more of the foregoing genes or fragments thereof. In some
embodiments, the disclosure relates to a heterologous nucleic acid
insert that expresses one or more functional RNAs that inhibit
expression of one or more of the foregoing genes.
[0092] In some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the pulmonary system. The following is a
non-limiting list of genes associated with pulmonary disease: CFTR,
AAT, TNF.alpha., TGF.beta.1, SFTPA1, SFTPA2, SFTPB, SFTPC, HPS1,
HPS3, HPS4, ADTB3A, IL1A, IL1B, LTA, IL6, CXCR1, and CXCR2. In some
embodiments, the disclosure relates to a heterologous nucleic acid
insert that expresses one or more of the foregoing genes or
fragments thereof. In some embodiments, the disclosure relates to a
heterologous nucleic acid insert that expresses one or more
functional RNAs that inhibit expression of one or more of the
foregoing genes. Non-limiting examples of heterologous nucleic acid
inserts encoding a protein or functional RNA useful for the
treatment of a condition, disease or disorder associated with the
pulmonary system are depicted in FIGS. 10A-10F.
[0093] In some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the liver. The following is a non-limiting list of
genes associated with liver disease: .alpha.1-AT, HFE, ATP7B,
fumarylacetoacetate hydrolase (FAH), glucose-6-phosphatase, NCAN,
GCKR, LYPLAL1, PNPLA3, lecithin cholesterol acetyltransferase,
phenylalanine hydroxylase, and G6PC. In some embodiments, the
disclosure relates to a heterologous nucleic acid insert that
expresses one or more of the foregoing genes or fragments thereof.
In some embodiments, the disclosure relates to a heterologous
nucleic acid insert that expresses one or more functional RNAs that
inhibit expression of one or more of the foregoing genes.
Non-limiting examples of heterologous nucleic acid inserts encoding
a protein or functional RNA useful for the treatment of a
condition, disease or disorder associated with the liver are
depicted in FIG. 9.
[0094] In some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the kidney. The following is a non-limiting list of
genes associated with kidney disease: PKD1, PKD2, PKHD1, NPHS1,
NPHS2, PLCE1, CD2AP, LAMB2, TRPC6, WT1, LMX1B, SMARCAL1, COQ2,
PDSS2, SCARB3, FN1, COL4A5, COL4A6, COL4A3, COL4A4, FOX1C, RET,
UPK3A, BMP4, SIX2, CDC5L, USF2, ROBO2, SLIT2, EYA1, MYOG, SIX1,
SIX5, FRAS1, FREM2, GATA3, KAL1, PAX2, TCF2, and SALL1. In some
embodiments, the disclosure relates to a heterologous nucleic acid
insert that expresses one or more of the foregoing genes or
fragments thereof. In some embodiments, the disclosure relates to a
heterologous nucleic acid insert that expresses one or more
functional RNAs that inhibit expression of one or more of the
foregoing genes.
[0095] In some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the eye. The following is a non-limiting list of
genes associated with ocular disease: ABCA4, VEGF, CEP290, CFH, C3,
MT-ND2, ARMS2, TIMP3, CAMK4, FMN1, RHO, USH2A, RPGR, RP2, TMCO,
SIX1, SIX6, LRP12, ZFPM2, TBK1, GALC, myocilin, CYP1B1, CAV1, CAV2,
optineurin and CDKN2B. In some embodiments, the disclosure relates
to a heterologous nucleic acid insert that expresses one or more of
the foregoing genes or fragments thereof. In some embodiments, the
disclosure relates to a heterologous nucleic acid insert that
expresses one or more functional RNAs that inhibit expression of
one or more of the foregoing genes. Non-limiting examples of
heterologous nucleic acid inserts encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the eye are depicted in FIG. 7.
[0096] In some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the blood (e.g., red blood cells). The following is
a non-limiting list of genes associated with diseases and disorders
of the blood: Factor VIII (FVIII), Factor IX (FIX), von Willebrand
factor (VWF). In some embodiments, the disclosure relates to a
heterologous nucleic acid insert that expresses one or more of the
foregoing genes or fragments thereof. In some embodiments, the
disclosure relates to a heterologous nucleic acid insert that
expresses one or more functional RNAs that inhibit expression of
one or more of the foregoing genes. Non-limiting examples of
heterologous nucleic acid inserts encoding a protein or functional
RNA useful for the treatment of a condition, disease or disorder
associated with the blood are depicted in FIG. 8.
[0097] The nucleic acids of the disclosure (e.g., nucleic acid
having a heterologous nucleic acid insert) can be used to restore
the expression of genes that are reduced in expression, silenced,
or otherwise dysfunctional in a subject (e.g., a tumor suppressor
that has been silenced in a subject having cancer). The nucleic
acids of the disclosure can also be used to knockdown the
expression of genes that are aberrantly expressed in a subject
(e.g., an oncogene that is expressed in a subject having cancer).
In some embodiments, a heterologous nucleic acid insert encoding a
gene product associated with cancer (e.g., tumor suppressors) may
be used to treat the cancer, by administering nucleic acid
comprising the heterologous nucleic acid insert to a subject having
the cancer. In some embodiments, a nucleic acid comprising a
heterologous nucleic acid insert encoding a small interfering
nucleic acid (e.g., shRNAs, miRNAs) that inhibits the expression of
a gene product associated with cancer (e.g., oncogenes) may be used
to treat the cancer, by administering nucleic acid comprising the
heterologous nucleic acid insert to a subject having the cancer. In
some embodiments, nucleic comprising a heterologous nucleic acid
insert encoding a gene product associated with cancer (or a
functional RNA that inhibits the expression of a gene associated
with cancer) may be used for research purposes, e.g., to study the
cancer or to identify therapeutics that treat the cancer. The
following is a non-limiting list of exemplary genes known to be
associated with the development of cancer (e.g., oncogenes and
tumor suppressors): AARS, ABCB1, ABCC4, ABI2, ABL1, ABL2, ACK1,
ACP2, ACY1, ADSL, AK1, AKR1C2, AKT1, ALB, ANPEP, ANXA5, ANXA7,
AP2M1, APC, ARHGAP5, ARHGEF5, ARID4A, ASNS, ATF4, ATM, ATP5B,
ATP5O, AXL, BARD1, BAX, BCL2, BHLHB2, BLMH, BRAF, BRCA1, BRCA2,
BTK, CANX, CAP1, CAPN1, CAPNS1, CAV1, CBFB, CBLB, CCL2, CCND1,
CCND2, CCND3, CCNE1, CCT5, CCYR61, CD24, CD44, CD59, CDC20, CDC25,
CDC25A, CDC25B, CDC2L5, CDK10, CDK4, CDK5, CDK9, CDKL1, CDKN1A,
CDKN1B, CDKN1C, CDKN2A, CDKN2B, CDKN2D, CEBPG, CENPC1, CGRRF1,
CHAF1A, CIB1, CKMT1, CLK1, CLK2, CLK3, CLNS1A, CLTC, COL1A1,
COL6A3, COX6C, COX7A2, CRAT, CRHR1, CSF1R, CSK, CSNK1G2, CTNNA1,
CTNNB1, CTPS, CTSC, CTSD, CUL1, CYR61, DCC, DCN, DDX10, DEK, DHCR7,
DHRS2, DHX8, DLG3, DVL1, DVL3, E2F1, E2F3, E2F5, EGFR, EGR1, EIF5,
EPHA2, ERBB2, ERBB3, ERBB4, ERCC3, ETV1, ETV3, ETV6, F2R, FASTK,
FBN1, FBN2, FES, FGFR1, FGR, FKBP8, FN1, FOS, FOSL1, FOSL2, FOXG1A,
FOXO1A, FRAP1, FRZB, FTL, FZD2, FZD5, FZD9, G22P1, GAS6, GCN5L2,
GDF15, GNA13, GNAS, GNB2, GNB2L1, GPR39, GRB2, GSK3A, GSPT1, GTF2I,
HDAC1, HDGF, HMMR, HPRT1, HRB, HSPA4, HSPA5, HSPA8, HSPB1, HSPH1,
HYAL1, HYOU1, ICAM1, ID1, ID2, IDUA, IER3, IFITM1, IGF1R, IGF2R,
IGFBP3, IGFBP4, IGFBP5, IL1B, ILK, ING1, IRF3, ITGA3, ITGA6, ITGB4,
JAK1, JARID1A, JUN, JUNB, JUND, K-ALPHA-1, KIT, KITLG, KLK10,
KPNA2, KRAS2, KRT18, KRT2A, KRT9, LAMB1, LAMP2, LCK, LCN2, LEP,
LITAF, LRPAP1, LTF, LYN, LZTR1, MADH1, MAP2K2, MAP3K8, MAPK12,
MAPK13, MAPKAPK3, MAPRE1, MARS, MAS1, MCC, MCM2, MCM4, MDM2, MDM4,
MET, MGST1, MICB, MLLT3, MME, MMP1, MMP14, MMP17, MMP2, MNDA, MSH2,
MSH6, MT3, MYB, MYBL1, MYBL2, MYC, MYCL1, MYCN, MYD88, MYL9, MYLK,
NEO1, NF1, NF2, NFKB1, NFKB2, NFSF7, NID, NINJ1, NMBR, NME1, NME2,
NME3, NOTCH1, NOTCH2, NOTCH4, NPM1, NQO1, NR1D1, NR2F1, NR2F6,
NRAS, NRG1, NSEP1, OSM, PA2G4, PABPC1, PCNA, PCTK1, PCTK2, PCTK3,
PDGFA, PDGFB, PDGFRA, PDPK1, PEA15, PFDN4, PFDN5, PGAM1, PHB,
PIK3CA, PIK3CB, PIK3CG, PIM1, PKM2, PKMYT1, PLK2, PPARD, PPARG,
PPIH, PPP1CA, PPP2R5A, PRDX2, PRDX4, PRKAR1A, PRKCBP1, PRNP,
PRSS15, PSMA1, PTCH, PTEN, PTGS1, PTMA, PTN, PTPRN, RAB5A, RAC1,
RAD50, RAF1, RALBP1, RAP1A, RARA, RARB, RASGRF1, RB1, RBBP4, RBL2,
REA, REL, RELA, RELB, RET, RFC2, RGS19, RHOA, RHOB, RHOC, RHOD,
RIPK1, RPN2, RPS6KB1, RRM1, SARS, SELENBP1, SEMA3C, SEMA4D, SEPP1,
SERPINH1, SFN, SFPQ, SFRS7, SHB, SHH, SIAH2, SIVA, SIVA TP53, SKI,
SKIL, SLC16A1, SLC1A4, SLC20A1, SMO, SMPD1, SNAI2, SND1, SNRPB2,
SOCS1, SOCS3, SOD1, SORT1, SPINT2, SPRY2, SRC, SRPX, STAT1, STAT2,
STAT3, STAT5B, STC1, TAF1, TBL3, TBRG4, TCF1, TCF7L2, TFAP2C,
TFDP1, TFDP2, TGFA, TGFB1, TGFBI, TGFBR2, TGFBR3, THBS1, TIE,
TIMP1, TIMP3, TJP1, TK1, TLE1, TNF, TNFRSF10A, TNFRSF10B, TNFRSF1A,
TNFRSF1B, TNFRSF6, TNFSF7, TNK1, TOB1, TP53, TP53BP2, TP53I3, TP73,
TPBG, TPT1, TRADD, TRAM1, TRRAP, TSG101, TUFM, TXNRD1, TYRO3, UBC,
UBE2L6, UCHL1, USP7, VDAC1, VEGF, VHL, VIL2, WEE1, WNT1, WNT2,
WNT2B, WNT3, WNT5A, WT1, XRCC1, YES1, YWHAB, YWHAZ, ZAP70, and
ZNF9.
[0098] In some embodiments, the instant disclosure relates to a
heterologous nucleic acid insert encoding a gene product associated
with a CNS-related disorder. The following is a non-limiting list
of genes associated with a CNS-related disorder: DRD2, GRIA1,
GRIA2,GRIN1, SLC1A1, SYP, SYT1, CHRNA7, 3Rtau/4rTUS, APP, BAX,
BCL-2, GRIK1, GFAP, IL-1, AGER, associated with Alzheimer's
Disease; UCH-L1, SKP1, EGLN1, Nurr-1, BDNF, TrkB, gstm1,
S106.beta., associated with Parkinson's Disease; IT15, PRNP, JPH3,
TBP, ATXN1, ATXN2, ATXN3, Atrophin 1, FTL, TITF-1, associated with
Huntington's Disease; FXN, associated with Freidrich's ataxia;
ASPA, associated with Canavan's Disease; DMD, associated with
muscular dystrophy; and SMN1, UBE1, DYNC1H1 associated with spinal
muscular atrophy.
[0099] A heterologous nucleic acid insert may comprise as a
transgene, a nucleic acid encoding a protein or functional RNA that
modulates apoptosis. The following is a non-limiting list of genes
associated with apoptosis and nucleic acids encoding the products
of these genes and their homologues and encoding small interfering
nucleic acids (e.g., shRNAs, miRNAs) that inhibit the expression of
these genes and their homologues are useful as transgenes in
certain embodiments of the disclosure: RPS27A, ABL1, AKT1, APAF1,
BAD, BAG1, BAG3, BAG4, BAK1, BAX, BCL10, BCL2, BCL2A1, BCL2L1,
BCL2L10, BCL2L11, BCL2L12, BCL2L13, BCL2L2, BCLAF1, BFAR, BID, BIK,
NAIP, BIRC2, BIRC3, XIAP, BIRC5, BIRC6, BIRC7, BIRC8, BNIP1, BNIP2,
BNIP3, BNIP3L, BOK, BRAF, CARD10, CARD11, NLRC4, CARD14, NOD2,
NOD1, CARD6, CARD8, CARD9, CASP1, CASP10, CASP14, CASP2, CASP3,
CASP4, CASP5, CASP6, CASP7, CASP8, CASP9, CFLAR, CIDEA, CIDEB,
CRADD, DAPK1, DAPK2, DFFA, DFFB, FADD, GADD45A, GDNF, HRK, IGF1R,
LTA, LTBR, MCL1, NOL3, PYCARD, RIPK1, RIPK2, TNF, TNFRSF10A,
TNFRSF10B, TNFRSF10C, TNFRSF10D, TNFRSF11B, TNFRSF12A, TNFRSF14,
TNFRSF19, TNFRSF1A, TNFRSF1B, TNFRSF21, TNFRSF25, CD40, FAS,
TNFRSF6B, CD27, TNFRSF9, TNFSF10, TNFSF14, TNFSF18, CD40LG, FASLG,
CD70, TNFSF8, TNFSF9, TP53, TP53BP2, TP73, TP63, TRADD, TRAF1,
TRAF2, TRAF3, TRAF4, TRAF5 DRD2, GRIA1, GRIA2,GRIN1, SLC1A1, SYP,
SYT1, CHRNA7, 3Rtau/4rTUS, APP, BAX, BCL-2, GRIK1, GFAP, IL-1,
AGER, UCH-L1, SKP1, EGLN1, Nurr-1, BDNF, TrkB, gstm1, S106.beta.,
IT15, PRNP, JPH3, TBP, ATXN1, ATXN2, ATXN3, Atrophin 1, FTL,
TITF-1, FXN, ASPA, DMD, and SMN1, UBE1, DYNC1H1.
[0100] The skilled artisan will also realize that in the case of
transgenes encoding proteins or polypeptides, that mutations that
results in conservative amino acid substitutions may be made in a
transgene to provide functionally equivalent variants, or homologs
of a protein or polypeptide. In some aspects the disclosure
embraces sequence alterations that result in conservative amino
acid substitution of a transgene. In some embodiments, the
transgene comprises a gene having a dominant negative mutation. For
example, a transgene may express a mutant protein that interacts
with the same elements as a wild-type protein, and thereby blocks
some aspect of the function of the wild-type protein.
[0101] Useful transgene products also include miRNAs. miRNAs and
other small interfering nucleic acids regulate gene expression via
target RNA transcript cleavage/degradation or translational
repression of the target messenger RNA (mRNA). miRNAs are natively
expressed, typically as final 19-25 non-translated RNA products.
miRNAs exhibit their activity through sequence-specific
interactions with the 3' untranslated regions (UTR) of target
mRNAs. These endogenously expressed miRNAs form hairpin precursors
which are subsequently processed into a miRNA duplex, and further
into a "mature" single stranded miRNA molecule. This mature miRNA
guides a multiprotein complex, miRISC, which identifies target
site, e.g., in the 3' UTR regions, of target mRNAs based upon their
complementarity to the mature miRNA.
[0102] The following non-limiting list of miRNA genes, and their
homologues, are useful as transgenes or as targets for small
interfering nucleic acids encoded by transgenes (e.g., miRNA
sponges, antisense oligonucleotides, TuD RNAs) in certain
embodiments of the methods: hsa-let-7a, hsa-let-7a*, hsa-let-7b,
hsa-let-7b*, hsa-let-7c, hsa-let-7c*, hsa-let-7d, hsa-let-7d*,
hsa-let-7e, hsa-let-7e*, hsa-let-7f, hsa-let-7f-1*, hsa-let-7f-2*,
hsa-let-7g, hsa-let-7g*, hsa-let-7i, hsa-let-7i*, hsa-miR-1,
hsa-miR-100, hsa-miR-100*, hsa-miR-101, hsa-miR-101*, hsa-miR-103,
hsa-miR-105, hsa-miR-105*, hsa-miR-106a, hsa-miR-106a*,
hsa-miR-106b, hsa-miR-106b*, hsa-miR-107, hsa-miR-10a,
hsa-miR-10a*, hsa-miR-10b, hsa-miR-10b*, hsa-miR-1178,
hsa-miR-1179, hsa-miR-1180, hsa-miR-1181, hsa-miR-1182,
hsa-miR-1183, hsa-miR-1184, hsa-miR-1185, hsa-miR-1197,
hsa-miR-1200, hsa-miR-1201, hsa-miR-1202, hsa-miR-1203,
hsa-miR-1204, hsa-miR-1205, hsa-miR-1206, hsa-miR-1207-3p,
hsa-miR-1207-5p, hsa-miR-1208, hsa-miR-122, hsa-miR-122*,
hsa-miR-1224-3p, hsa-miR-1224-5p, hsa-miR-1225-3p, hsa-miR-1225-5p,
hsa-miR-1226, hsa-miR-1226*, hsa-miR-1227, hsa-miR-1228,
hsa-miR-1228*, hsa-miR-1229, hsa-miR-1231, hsa-miR-1233,
hsa-miR-1234, hsa-miR-1236, hsa-miR-1237, hsa-miR-1238,
hsa-miR-124, hsa-miR-124*, hsa-miR-1243, hsa-miR-1244,
hsa-miR-1245, hsa-miR-1246, hsa-miR-1247, hsa-miR-1248,
hsa-miR-1249, hsa-miR-1250, hsa-miR-1251, hsa-miR-1252,
hsa-miR-1253, hsa-miR-1254, hsa-miR-1255a, hsa-miR-1255b,
hsa-miR-1256, hsa-miR-1257, hsa-miR-1258, hsa-miR-1259,
hsa-miR-125a-3p, hsa-miR-125a-5p, hsa-miR-125b, hsa-miR-125b-1*,
hsa-miR-125b-2*, hsa-miR-126, hsa-miR-126*, hsa-miR-1260,
hsa-miR-1261, hsa-miR-1262, hsa-miR-1263, hsa-miR-1264,
hsa-miR-1265, hsa-miR-1266, hsa-miR-1267, hsa-miR-1268,
hsa-miR-1269, hsa-miR-1270, hsa-miR-1271, hsa-miR-1272,
hsa-miR-1273, hsa-miR-127-3p, hsa-miR-1274a, hsa-miR-1274b,
hsa-miR-1275, hsa-miR-127-5p, hsa-miR-1276, hsa-miR-1277,
hsa-miR-1278, hsa-miR-1279, hsa-miR-128, hsa-miR-1280,
hsa-miR-1281, hsa-miR-1282, hsa-miR-1283, hsa-miR-1284,
hsa-miR-1285, hsa-miR-1286, hsa-miR-1287, hsa-miR-1288,
hsa-miR-1289, hsa-miR-129*, hsa-miR-1290, hsa-miR-1291,
hsa-miR-1292, hsa-miR-1293, hsa-miR-129-3p, hsa-miR-1294,
hsa-miR-1295, hsa-miR-129-5p, hsa-miR-1296, hsa-miR-1297,
hsa-miR-1298, hsa-miR-1299, hsa-miR-1300, hsa-miR-1301,
hsa-miR-1302, hsa-miR-1303, hsa-miR-1304, hsa-miR-1305,
hsa-miR-1306, hsa-miR-1307, hsa-miR-1308, hsa-miR-130a,
hsa-miR-130a*, hsa-miR-130b, hsa-miR-130b*, hsa-miR-132,
hsa-miR-132*, hsa-miR-1321, hsa-miR-1322, hsa-miR-1323,
hsa-miR-1324, hsa-miR-133a, hsa-miR-133b, hsa-miR-134,
hsa-miR-135a, hsa-miR-135a*, hsa-miR-135b, hsa-miR-135b*,
hsa-miR-136, hsa-miR-136*, hsa-miR-137, hsa-miR-138,
hsa-miR-138-1*, hsa-miR-138-2*, hsa-miR-139-3p, hsa-miR-139-5p,
hsa-miR-140-3p, hsa-miR-140-5p, hsa-miR-141, hsa-miR-141*,
hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-143, hsa-miR-143*,
hsa-miR-144, hsa-miR-144*, hsa-miR-145, hsa-miR-145*, hsa-miR-146a,
hsa-miR-146a*, hsa-miR-146b-3p, hsa-miR-146b-5p, hsa-miR-147,
hsa-miR-147b, hsa-miR-148a, hsa-miR-148a*, hsa-miR-148b,
hsa-miR-148b*, hsa-miR-149, hsa-miR-149*, hsa-miR-150,
hsa-miR-150*, hsa-miR-151-3p, hsa-miR-151-5p, hsa-miR-152,
hsa-miR-153, hsa-miR-154, hsa-miR-154*, hsa-miR-155, hsa-miR-155*,
hsa-miR-15a, hsa-miR-15a*, hsa-miR-15b, hsa-miR-15b*, hsa-miR-16,
hsa-miR-16-1*, hsa-miR-16-2*, hsa-miR-17, hsa-miR-17*,
hsa-miR-181a, hsa-miR-181a*, hsa-miR-181a-2*, hsa-miR-181b,
hsa-miR-181c, hsa-miR-181c*, hsa-miR-181d, hsa-miR-182,
hsa-miR-182*, hsa-miR-1825, hsa-miR-1826, hsa-miR-1827,
hsa-miR-183, hsa-miR-183*, hsa-miR-184, hsa-miR-185, hsa-miR-185*,
hsa-miR-186, hsa-miR-186*, hsa-miR-187, hsa-miR-187*,
hsa-miR-188-3p, hsa-miR-188-5p, hsa-miR-18a, hsa-miR-18a*,
hsa-miR-18b, hsa-miR-18b*, hsa-miR-190, hsa-miR-190b, hsa-miR-191,
hsa-miR-191*, hsa-miR-192, hsa-miR-192*, hsa-miR-193a-3p,
hsa-miR-193a-5p, hsa-miR-193b, hsa-miR-193b*, hsa-miR-194,
hsa-miR-194*, hsa-miR-195, hsa-miR-195*, hsa-miR-196a,
hsa-miR-196a*, hsa-miR-196b, hsa-miR-197, hsa-miR-198,
hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a,
hsa-miR-19a*, hsa-miR-19b, hsa-miR-19b-1*, hsa-miR-19b-2*,
hsa-miR-200a, hsa-miR-200a*, hsa-miR-200b, hsa-miR-200b*,
hsa-miR-200c, hsa-miR-200c*, hsa-miR-202, hsa-miR-202*,
hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-206, hsa-miR-208a,
hsa-miR-208b, hsa-miR-20a, hsa-miR-20a*, hsa-miR-20b, hsa-miR-20b*,
hsa-miR-21, hsa-miR-21*, hsa-miR-210, hsa-miR-211, hsa-miR-212,
hsa-miR-214, hsa-miR-214*, hsa-miR-215, hsa-miR-216a, hsa-miR-216b,
hsa-miR-217, hsa-miR-218, hsa-miR-218-1*, hsa-miR-218-2*,
hsa-miR-219-1-3p, hsa-miR-219-2-3p, hsa-miR-219-5p, hsa-miR-22,
hsa-miR-22*, hsa-miR-220a, hsa-miR-220b, hsa-miR-220c, hsa-miR-221,
hsa-miR-221*, hsa-miR-222, hsa-miR-222*, hsa-miR-223, hsa-miR-223*,
hsa-miR-224, hsa-miR-23a, hsa-miR-23a*, hsa-miR-23b, hsa-miR-23b*,
hsa-miR-24, hsa-miR-24-1*, hsa-miR-24-2*, hsa-miR-25, hsa-miR-25*,
hsa-miR-26a, hsa-miR-26a-1*, hsa-miR-26a-2*, hsa-miR-26b,
hsa-miR-26b*, hsa-miR-27a, hsa-miR-27a*, hsa-miR-27b, hsa-miR-27b*,
hsa-miR-28-3p, hsa-miR-28-5p, hsa-miR-296-3p, hsa-miR-296-5p,
hsa-miR-297, hsa-miR-298, hsa-miR-299-3p, hsa-miR-299-5p,
hsa-miR-29a, hsa-miR-29a*, hsa-miR-29b, hsa-miR-29b-1*,
hsa-miR-29b-2*, hsa-miR-29c, hsa-miR-29c*, hsa-miR-300,
hsa-miR-301a, hsa-miR-301b, hsa-miR-302a, hsa-miR-302a*,
hsa-miR-302b, hsa-miR-302b*, hsa-miR-302c, hsa-miR-302c*,
hsa-miR-302d, hsa-miR-302d*, hsa-miR-302e, hsa-miR-302f,
hsa-miR-30a, hsa-miR-30a*, hsa-miR-30b, hsa-miR-30b*, hsa-miR-30c,
hsa-miR-30c-1*, hsa-miR-30c-2*, hsa-miR-30d, hsa-miR-30d*,
hsa-miR-30e, hsa-miR-30e*, hsa-miR-31, hsa-miR-31*, hsa-miR-32,
hsa-miR-32*, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c,
hsa-miR-320d, hsa-miR-323-3p, hsa-miR-323-5p, hsa-miR-324-3p,
hsa-miR-324-5p, hsa-miR-325, hsa-miR-326, hsa-miR-328, hsa-miR-329,
hsa-miR-330-3p, hsa-miR-330-5p, hsa-miR-331-3p, hsa-miR-331-5p,
hsa-miR-335, hsa-miR-335*, hsa-miR-337-3p, hsa-miR-337-5p,
hsa-miR-338-3p, hsa-miR-338-5p, hsa-miR-339-3p, hsa-miR-339-5p,
hsa-miR-33a, hsa-miR-33a*, hsa-miR-33b, hsa-miR-33b*, hsa-miR-340,
hsa-miR-340*, hsa-miR-342-3p, hsa-miR-342-5p, hsa-miR-345,
hsa-miR-346, hsa-miR-34a, hsa-miR-34a*, hsa-miR-34b, hsa-miR-34b*,
hsa-miR-34c-3p, hsa-miR-34c-5p, hsa-miR-361-3p, hsa-miR-361-5p,
hsa-miR-362-3p, hsa-miR-362-5p, hsa-miR-363, hsa-miR-363*,
hsa-miR-365, hsa-miR-367, hsa-miR-367*, hsa-miR-369-3p,
hsa-miR-369-5p, hsa-miR-370, hsa-miR-371-3p, hsa-miR-371-5p,
hsa-miR-372, hsa-miR-373, hsa-miR-373*, hsa-miR-374a,
hsa-miR-374a*, hsa-miR-374b, hsa-miR-374b*, hsa-miR-375,
hsa-miR-376a, hsa-miR-376a*, hsa-miR-376b, hsa-miR-376c,
hsa-miR-377, hsa-miR-377*, hsa-miR-378, hsa-miR-378*, hsa-miR-379,
hsa-miR-379*, hsa-miR-380, hsa-miR-380*, hsa-miR-381, hsa-miR-382,
hsa-miR-383, hsa-miR-384, hsa-miR-409-3p, hsa-miR-409-5p,
hsa-miR-410, hsa-miR-411, hsa-miR-411*, hsa-miR-412, hsa-miR-421,
hsa-miR-422a, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424,
hsa-miR-424*, hsa-miR-425, hsa-miR-425*, hsa-miR-429, hsa-miR-431,
hsa-miR-431*, hsa-miR-432, hsa-miR-432*, hsa-miR-433, hsa-miR-448,
hsa-miR-449a, hsa-miR-449b, hsa-miR-450a, hsa-miR-450b-3p,
hsa-miR-450b-5p, hsa-miR-451, hsa-miR-452, hsa-miR-452*,
hsa-miR-453, hsa-miR-454, hsa-miR-454*, hsa-miR-455-3p,
hsa-miR-455-5p, hsa-miR-483-3p, hsa-miR-483-5p, hsa-miR-484,
hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-486-3p, hsa-miR-486-5p,
hsa-miR-487a, hsa-miR-487b, hsa-miR-488, hsa-miR-488*, hsa-miR-489,
hsa-miR-490-3p, hsa-miR-490-5p, hsa-miR-491-3p, hsa-miR-491-5p,
hsa-miR-492, hsa-miR-493, hsa-miR-493*, hsa-miR-494, hsa-miR-495,
hsa-miR-496, hsa-miR-497, hsa-miR-497*, hsa-miR-498,
hsa-miR-499-3p, hsa-miR-499-5p, hsa-miR-500, hsa-miR-500*,
hsa-miR-501-3p, hsa-miR-501-5p, hsa-miR-502-3p, hsa-miR-502-5p,
hsa-miR-503, hsa-miR-504, hsa-miR-505, hsa-miR-505*, hsa-miR-506,
hsa-miR-507, hsa-miR-508-3p, hsa-miR-508-5p, hsa-miR-509-3-5p,
hsa-miR-509-3p, hsa-miR-509-5p, hsa-miR-510, hsa-miR-511,
hsa-miR-512-3p, hsa-miR-512-5p, hsa-miR-513a-3p, hsa-miR-513a-5p,
hsa-miR-513b, hsa-miR-513c, hsa-miR-514, hsa-miR-515-3p,
hsa-miR-515-5p, hsa-miR-516a-3p, hsa-miR-516a-5p, hsa-miR-516b,
hsa-miR-517*, hsa-miR-517a, hsa-miR-517b, hsa-miR-517c,
hsa-miR-518a-3p, hsa-miR-518a-5p, hsa-miR-518b, hsa-miR-518c,
hsa-miR-518c*, hsa-miR-518d-3p, hsa-miR-518d-5p, hsa-miR-518e,
hsa-miR-518e*, hsa-miR-518f, hsa-miR-518f*, hsa-miR-519a,
hsa-miR-519b-3p, hsa-miR-519c-3p, hsa-miR-519d, hsa-miR-519e,
hsa-miR-519e*, hsa-miR-520a-3p, hsa-miR-520a-5p, hsa-miR-520b,
hsa-miR-520c-3p, hsa-miR-520d-3p, hsa-miR-520d-5p, hsa-miR-520e,
hsa-miR-520f, hsa-miR-520g, hsa-miR-520h, hsa-miR-521, hsa-miR-522,
hsa-miR-523, hsa-miR-524-3p, hsa-miR-524-5p, hsa-miR-525-3p,
hsa-miR-525-5p, hsa-miR-526b, hsa-miR-526b*, hsa-miR-532-3p,
hsa-miR-532-5p, hsa-miR-539, hsa-miR-541, hsa-miR-541*,
hsa-miR-542-3p, hsa-miR-542-5p, hsa-miR-543, hsa-miR-544,
hsa-miR-545, hsa-miR-545*, hsa-miR-548a-3p, hsa-miR-548a-5p,
hsa-miR-548b-3p, hsa-miR-548b-5p, hsa-miR-548c-3p, hsa-miR-548c-5p,
hsa-miR-548d-3p, hsa-miR-548d-5p, hsa-miR-548e, hsa-miR-548f,
hsa-miR-548g, hsa-miR-548h, hsa-miR-548i, hsa-miR-548j,
hsa-miR-548k, hsa-miR-548l, hsa-miR-548m, hsa-miR-548n,
hsa-miR-548o, hsa-miR-548p, hsa-miR-549, hsa-miR-550, hsa-miR-550*,
hsa-miR-551a, hsa-miR-551b, hsa-miR-551b*, hsa-miR-552,
hsa-miR-553, hsa-miR-554, hsa-miR-555, hsa-miR-556-3p,
hsa-miR-556-5p, hsa-miR-557, hsa-miR-558, hsa-miR-559, hsa-miR-561,
hsa-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-566, hsa-miR-567,
hsa-miR-568, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572,
hsa-miR-573, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-575,
hsa-miR-576-3p, hsa-miR-576-5p, hsa-miR-577, hsa-miR-578,
hsa-miR-579, hsa-miR-580, hsa-miR-581, hsa-miR-582-3p,
hsa-miR-582-5p, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-586,
hsa-miR-587, hsa-miR-588, hsa-miR-589, hsa-miR-589*,
hsa-miR-590-3p, hsa-miR-590-5p, hsa-miR-591, hsa-miR-592,
hsa-miR-593, hsa-miR-593 *, hsa-miR-595, hsa-miR-596, hsa-miR-597,
hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602,
hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hsa-miR-607,
hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR-612,
hsa-miR-613, hsa-miR-614, hsa-miR-615-3p, hsa-miR-615-5p,
hsa-miR-616, hsa-miR-616*, hsa-miR-617, hsa-miR-618, hsa-miR-619,
hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624,
hsa-miR-624*, hsa-miR-625, hsa-miR-625*, hsa-miR-626, hsa-miR-627,
hsa-miR-628-3p, hsa-miR-628-5p, hsa-miR-629, hsa-miR-629*,
hsa-miR-630, hsa-miR-631, hsa-miR-632, hsa-miR-633, hsa-miR-634,
hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639,
hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644,
hsa-miR-645, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR-649,
hsa-miR-650, hsa-miR-651, hsa-miR-652, hsa-miR-653, hsa-miR-654-3p,
hsa-miR-654-5p, hsa-miR-655, hsa-miR-656, hsa-miR-657, hsa-miR-658,
hsa-miR-659, hsa-miR-660, hsa-miR-661, hsa-miR-662, hsa-miR-663,
hsa-miR-663b, hsa-miR-664, hsa-miR-664*, hsa-miR-665, hsa-miR-668,
hsa-miR-671-3p, hsa-miR-671-5p, hsa-miR-675, hsa-miR-7,
hsa-miR-708, hsa-miR-708*, hsa-miR-7-1*, hsa-miR-7-2*, hsa-miR-720,
hsa-miR-744, hsa-miR-744*, hsa-miR-758, hsa-miR-760, hsa-miR-765,
hsa-miR-766, hsa-miR-767-3p, hsa-miR-767-5p, hsa-miR-768-3p,
hsa-miR-768-5p, hsa-miR-769-3p, hsa-miR-769-5p, hsa-miR-770-5p,
hsa-miR-802, hsa-miR-873, hsa-miR-874, hsa-miR-875-3p,
hsa-miR-875-5p, hsa-miR-876-3p, hsa-miR-876-5p, hsa-miR-877,
hsa-miR-877*, hsa-miR-885-3p, hsa-miR-885-5p, hsa-miR-886-3p,
hsa-miR-886-5p, hsa-miR-887, hsa-miR-888, hsa-miR-888*,
hsa-miR-889, hsa-miR-890, hsa-miR-891a, hsa-miR-891b, hsa-miR-892a,
hsa-miR-892b, hsa-miR-9, hsa-miR-9*, hsa-miR-920, hsa-miR-921,
hsa-miR-922, hsa-miR-923, hsa-miR-924, hsa-miR-92a, hsa-miR-92a-1*,
hsa-miR-92a-2*, hsa-miR-92b, hsa-miR-92b*, hsa-miR-93, hsa-miR-93*,
hsa-miR-933, hsa-miR-934, hsa-miR-935, hsa-miR-936, hsa-miR-937,
hsa-miR-938, hsa-miR-939, hsa-miR-940, hsa-miR-941, hsa-miR-942,
hsa-miR-943, hsa-miR-944, hsa-miR-95, hsa-miR-96, hsa-miR-96*,
hsa-miR-98, hsa-miR-99a, hsa-miR-99a*, hsa-miR-99b, and
hsa-miR-99b*.
[0103] A miRNA inhibits the function of the mRNAs it targets and,
as a result, inhibits expression of the polypeptides encoded by the
mRNAs. Thus, blocking (partially or totally) the activity of the
miRNA (e.g., silencing the miRNA) can effectively induce, or
restore, expression of a polypeptide whose expression is inhibited
(derepress the polypeptide). In one embodiment, derepression of
polypeptides encoded by mRNA targets of a miRNA is accomplished by
inhibiting the miRNA activity in cells through any one of a variety
of methods. For example, blocking the activity of a miRNA can be
accomplished by hybridization with a small interfering nucleic acid
(e.g., antisense oligonucleotide, miRNA sponge, TuD RNA) that is
complementary, or substantially complementary to, the miRNA,
thereby blocking interaction of the miRNA with its target mRNA. As
used herein, an small interfering nucleic acid that is
substantially complementary to a miRNA is one that is capable of
hybridizing with a miRNA, and blocking the miRNA's activity. In
some embodiments, an small interfering nucleic acid that is
substantially complementary to a miRNA is an small interfering
nucleic acid that is complementary with the miRNA at all but 1, 2,
3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 bases.
In some embodiments, an small interfering nucleic acid sequence
that is substantially complementary to a miRNA, is an small
interfering nucleic acid sequence that is complementary with the
miRNA at, at least, one base.
[0104] A "miRNA Inhibitor" is an agent that blocks miRNA function,
expression and/or processing. For instance, these molecules include
but are not limited to microRNA specific antisense, microRNA
sponges, tough decoy RNAs (TuD RNAs) and microRNA oligonucleotides
(double-stranded, hairpin, short oligonucleotides) that inhibit
miRNA interaction with a Drosha complex. MicroRNA inhibitors can be
expressed in cells from a transgenes of a nucleic acid, as
discussed above. MicroRNA sponges specifically inhibit miRNAs
through a complementary heptameric seed sequence (Ebert, M. S.
Nature Methods, Epub Aug. 12, 2007;). In some embodiments, an
entire family of miRNAs can be silenced using a single sponge
sequence. TuD RNAs achieve efficient and long-term-suppression of
specific miRNAs in mammalian cells (See, e.g., Takeshi Haraguchi,
et al., Nucleic Acids Research, 2009, Vol. 37, No. 6 e43, the
contents of which relating to TuD RNAs are incorporated herein by
reference). Other methods for silencing miRNA function
(derepression of miRNA targets) in cells will be apparent to one of
ordinary skill in the art.
[0105] In some aspects, nucleic acids described herein (e.g.,
ceDNA) may be useful for the treatment of CNS-related disorders. As
used herein, a "CNS-related disorder" is a disease or condition of
the central nervous system. A CNS-related disorder may affect the
spinal cord (e.g., a myelopathy), brain (e.g., a encephalopathy) or
tissues surrounding the brain and spinal cord. A CNS-related
disorder may be of a genetic origin, either inherited or acquired
through a somatic mutation. A CNS-related disorder may be a
psychological condition or disorder, e.g., Attention Deficient
Hyperactivity Disorder, Autism Spectrum Disorder, Mood Disorder,
Schizophrenia, Depression, Rhett Syndrome, etc. A CNS-related
disorder may be an autoimmune disorder. A CNS-related disorder may
also be a cancer of the CNS, e.g., brain cancer. A CNS-related
disorder that is a cancer may be a primary cancer of the CNS, e.g.,
an astrocytoma, glioblastomas, etc., or may be a cancer that has
metastasized to CNS tissue, e.g., a lung cancer that has
metastasized to the brain. Further non-limiting examples of
CNS-related disorders, include Parkinson's Disease, Lysosomal
Storage Disease, Ischemia, Neuropathic Pain, Amyotrophic lateral
sclerosis (ALS), Multiple Sclerosis (MS), and Canavan disease
(CD).
[0106] In some embodiments, nucleic acids (e.g., ceDNA) described
herein may be useful for delivering gene therapy to cardiac cells
(e.g., heart tissue). Accordingly, in some embodiments, nucleic
acids (e.g., ceDNA) described herein may be useful for the
treatment of cardiovascular disorders. As used herein, a
"cardiovascular disorder" is a disease or condition of the
cardiovascular system. A cardiovascular disease may affect the
heart, circulatory system, arteries, veins, blood vessels and/or
capillaries. A cardiovascular disorder may be of a genetic origin,
either inherited or acquired through a somatic mutation.
Non-limiting examples of cardiovascular disorders include rheumatic
heart disease, valvular heart disease, hypertensive heart disease,
aneurysm, atherosclerosis, hypertension (e.g., high blood
pressure), peripheral arterial disease (PAD), ischemic heart
disease, angina, coronary heart disease, coronary artery disease,
myocardial infarction, cerebral vascular disease, transient
ischemic attack, inflammatory heart disease, cardiomyopathy,
pericardial disease, congenital heart disease, heart failure,
stroke, and myocarditis due to Chagas disease.
[0107] In some embodiments, nucleic acids described herein (e.g.,
ceDNA) may target the lung and/or tissue of the pulmonary system.
Accordingly, in some embodiments, nucleic acids (e.g., ceDNA)
described herein may be useful for treatment of pulmonary disease.
As used herein a "pulmonary disease" is a disease or condition of
the pulmonary system. A pulmonary disease may affect the lungs or
muscles involved in breathing. A pulmonary disease may be of a
genetic origin, either inherited or acquired through a somatic
mutation. A pulmonary disease may be a cancer of the lung,
including but not limited to, non-small cell lung cancer, small
cell lung cancer, and lung carcinoid tumor. Further non-limiting
examples of pulmonary diseases include acute bronchitis, acute
respiratory distress syndrome (ARDS), asbestosis, asthma,
bronchiectasis, bronchiolitis, bronchiolitis obliterans organizing
pneumonia (BOOP), bronchopulmonary dysplasia, byssinosis, chronic
bronchitis, coccidioidomycosis (Cocci), chronic obstructive
pulmonary disorder (COPD), to cryptogenic organizing pneumonia
(COP), cystic fibrosis, emphysema, Hantavirus Pulmonary Syndrome,
histoplasmosis, Human Metapneumovirus, hypersensitivity
pneumonitis, influenza, lymphangiomatosis, mesothelioma, Middle
Eastern Respiratory Syndrome, non-tuberculosis Mycobacterium,
Pertussis, Pneumoconiosis (Black Lung Disease), pneumonia, primary
ciliary dyskinesia, primary pulmonary hypertension, pulmonary
arterial hypertension, pulmonary fibrosis, pulmonary vascular
disease, Respiratory Syncytial Virus (RSV), sarcoidosis, Severe
Acute Respiratory Syndrome (SARS), silicosis, sleep apnea, Sudden
Infant Death Syndrome (SIDS), and tuberculosis.
[0108] In some embodiments, nucleic acids described herein (e.g.,
ceDNA) may target liver tissue. Accordingly, in some embodiments,
nucleic acids described herein (e.g., ceDNA) may be useful for
treatment of hepatic disease. As used herein a "hepatic disease" is
a disease or condition of the liver. A hepatic disease may be of a
genetic origin, either inherited or acquired through a somatic
mutation. A hepatic disease may be a cancer of the liver, including
but not limited to hepatocellular carcinoma (HCC), fibrolamellar
carcinoma, cholangiocarcinoma, angiosarcoma and hepatoblastoma.
Further non-limiting examples of pulmonary diseases include
Alagille Syndrome, Alpha 1 Anti-Trypsin Deficiency, autoimmune
hepatitis, biliary atresia, cirrhosis, cystic disease of the liver,
fatty liver disease, galactosemia, gallstones, Gilbert's Syndrome,
hemochromatosis, liver disease in pregnancy, neonatal hepatitis,
primary biliary cirrhosis, primary sclerosing cholangitis,
porphyria, Reye's Syndrome, sarcoidosis, toxic hepatitis, Type 1
Glycogen Storage Disease, tyrosinemia, viral hepatitis A, B, C,
Wilson Disease, and schistosomiasis.
[0109] In some embodiments, nucleic acids described herein (e.g.,
ceDNA) may target kidney tissue. Accordingly, in some embodiments,
nucleic acids described herein (e.g., ceDNA) may be useful for
treatment of kidney disease. As used herein a "kidney disease" is a
disease or condition of the liver. A hepatic disease may be of a
genetic origin, either inherited or acquired through a somatic
mutation. A hepatic disease may be a cancer of the kidney,
including but not limited to renal cell cancer, clear cell cancer,
papillary cancer type 1, papillary cancer type 2, chromophobe
cancer, oncocytic cell cancer, collecting duct cancer, transitional
cell cancer of the renal pelvis and Wilm's tumor. Further
non-limiting examples of kidney disease include
Abderhalden-Kaufmann-Lignac syndrome (Nephropathic Cystinosis),
Acute Kidney Failure/Acute Kidney Injury, Acute Lobar Nephronia,
Acute Phosphate Nephropathy, Acute Tubular Necrosis, Adenine
Phosphoribosyltransferase Deficiency, Adenovirus Nephritis, Alport
Syndrome, Amyloidosis, Angiomyolipoma, Analgesic Nephropathy,
Angiotensin Antibodies and Focal Segmental Glomerulosclerosis,
Antiphospholipid Syndrome, Anti-TNF-.alpha. Therapy-related
Glomerulonephritis, APOL1 Mutations, Apparent Mneralocorticoid
Excess Syndrome, Aristolochic Acid Nephropathy, Balkan Endemic
Nephropathy, Bartter Syndrome, Beeturia, .beta.-Thalassemia Renal
Disease, Bile Cast Nephropathy, BK Polyoma, C1q Nephropathy,
Cardiorenal syndrome, CFHR5 nephropathy, Cholesterol Emboli,
Churg-Strauss syndrome, Chyluria, Collapsing Glomerulopathy,
Collapsing Glomerulopathy Related to CMV, Congenital Nephrotic
Syndrome, Conorenal syndrome (Mainzer-Saldino Syndrome or
Saldino-Mainzer Disease), Contrast Nephropathy, Copper Sulfate
Intoxication, Cortical Necrosis, Cryoglobuinemia, Crystal-Induced
Acute Kidney injury, Cystic Kidney Disease, Acquired, Cystinuria,
Dense Deposit Disease (MPGN Type 2), Dent Disease (X-linked
Recessive Nephrolithiasis), Dialysis Disequilibrium Syndrome,
Diabetic Kidney Disease, Diabetes Insipidus, EAST syndrome, Ectopic
Ureter, Edema, Erdheim-Chester Disease, Fabry's Disease, Familial
Hypocalciuric Hypercalcemia, Fanconi Syndrome, Fraser syndrome,
Fibronectin Glomerulopathy, Fibrillary Glomerulonephritis and
Immunotactoid Glomerulopathy, Fraley syndrome, Focal Segmental
Glomerulosclerosis, Focal Sclerosis, Focal Glomerulosclerosis,
Galloway Mowat syndrome, Gitelman Syndrome, Glomerular Diseases,
Glomerular Tubular Reflux, Glycosuria, Goodpasture Syndrome,
Hemolytic Uremic Syndrome (HUS), Atypical Hemolytic Uremic Syndrome
(aHUS), Hemophagocytic Syndrome, Hemorrhagic Cystitis,
Hemosiderosis related to Paroxysmal Nocturnal Hemoglobinuria and
Hemolytic Anemia, Hepatic Veno-Occlusive Disease, Sinusoidal
Obstruction Syndrome, Hepatitis C-Associated Renal Disease,
Hepatorenal Syndrome, HIV-Associated Nephropathy (HIVAN), Horseshoe
Kidney (Renal Fusion), Hunner's Ulcer, Hyperaldosteronism,
Hypercalcemia, Hyperkalemia, Hypermagnesemia, Hypernatremia,
Hyperoxaluria, Hyperphosphatemia, Hypocalcemia, Hypokalemia,
Hypokalemia-induced renal dysfunction, Hypomagnesemia,
Hyponatremia, Hypophosphatemia, IgA Nephropathy, IgG4 Nephropathy,
Interstitial Cystitis, Painful Bladder Syndrome, Interstitial
Nephritis, Ivemark's syndrome, Kidney Stones, Nephrolithiasis,
Leptospirosis Renal Disease, Light Chain Deposition Disease,
Monoclonal Immunoglobulin Deposition Disease, Liddle Syndrome,
Lightwood-Albright Syndrome, Lipoprotein Glomerulopathy, Lithium
Nephrotoxicity, LMX1B Mutations Cause Hereditary FSGS, Loin Pain
Hematuria, Lupus, Systemic Lupus Erythematosis, Lupus Kidney
Disease, Lupus Nephritis, Lyme Disease-Associated
Glomerulonephritis, Malarial Nephropathy, Malignant Hypertension,
Malakoplakia, Meatal Stenosis, Medullary Cystic Kidney Disease,
Medullary Sponge Kidney, Megaureter, Melamine Toxicity and the
Kidney, Membranoproliferative Glomerulonephritis, Membranous
Nephropathy, MesoAmerican Nephropathy, Metabolic Acidosis,
Metabolic Alkalosis, Microscopic Polyangiitis, Milk-alkalai
syndrome, Minimal Change Disease, Multicystic dysplastic kidney,
Multiple Myeloma, Myeloproliferative Neoplasms and Glomerulopathy,
Nail-patella Syndrome, Nephrocalcinosis, Nephrogenic Systemic
Fibrosis, Nephroptosis (Floating Kidney, Renal Ptosis), Nephrotic
Syndrome, Neurogenic Bladder, Nodular Glomerulosclerosis,
Non-Gonococcal, Nutcracker syndrome, Orofaciodigital Syndrome,
Orthostatic Hypotension, Orthostatic Proteinuria, Osmotic Diuresis,
Page Kidney, Papillary Necrosis, Papillorenal Syndrome
(Renal-Coloboma Syndrome, Isolated Renal Hypoplasia), The
Peritoneal-Renal Syndrome, Posterior Urethral Valve,
Post-infectious Glomerulonephritis, Post-streptococcal
Glomerulonephritis, Polyarteritis Nodosa, Polycystic Kidney
Disease, Posterior Urethral Valves, Preeclampsia, Proliferative
Glomerulonephritis with Monoclonal IgG Deposits (Nasr Disease),
Proteinuria (Protein in Urine), Pseudohyperaldosteronism,
Pseudohypoparathyroidism, Pulmonary-Renal Syndrome, Pyelonephritis
(Kidney Infection), Pyonephrosis, Radiation Nephropathy, Refeeding
syndrome, Reflux Nephropathy, Rapidly Progressive
Glomerulonephritis, Renal Abscess, Peripnephric Abscess, Renal
Agenesis, Renal Artery Aneurysm, Renal Artery Stenosis, Renal Cell
Cancer, Renal Cyst, Renal Hypouricemia with Exercise-induced Acute
Renal Failure, Renal Infarction, Renal Osteodystrophy, Renal
Tubular Acidosis, Reset Osmostat, Retrocaval Ureter,
Retroperitoneal Fibrosis, Rhabdomyolysis, Rhabdomyolysis related to
Bariatric Sugery, Rheumatoid Arthritis-Associated Renal Disease,
Sarcoidosis Renal Disease, Salt Wasting, Renal and Cerebral,
Schimke immuno-osseous dysplasia, Scleroderma Renal Crisis,
Serpentine Fibula-Polycystic Kidney Syndrome, Exner Syndrome,
Sickle Cell Nephropathy, Silica Exposure and Chronic Kidney
Disease, Kidney Disease Following Hematopoietic Cell
Transplantation, Kidney Disease Related to Stem Cell
Transplantation, Thin Basement Membrane Disease, Benign Familial
Hematuria, Trigonitis, Tuberous Sclerosis, Tubular Dysgenesis,
Tumor Lysis Syndrome, Uremia, Uremic Optic Neuropathy, Ureterocele,
Urethral Caruncle, Urethral Stricture, Urinary Incontinence,
Urinary Tract Infection, Urinary Tract Obstruction,
Vesicointestinal Fistula, Vesicoureteral Reflux, Von Hippel-Lindau
Disease, Warfarin-Related Nephropathy, Wegener's Granulomatosis,
Granulomatosis with Polyangiitis, and Wunderlich syndrome.
[0110] In some embodiments, nucleic acids described herein (e.g.,
ceDNA) may be useful for delivering gene therapy to ocular tissue.
Accordingly, in some embodiments, nucleic acids described herein
(e.g., ceDNA) may be useful for the treatment of ocular disorders.
As used herein, an "ocular disorder" is a disease or condition of
the eye. A cardiovascular disease may affect the eye, sclera,
cornea, anterior chamber, posterior chamber, iris, pupil, lens,
vitreous humor, retina, or optic nerve. An ocular disorder may be
of a genetic origin, either inherited or acquired through a somatic
mutation. Non-limiting examples of ocular diseases and disorders
include but are not limited to: age-related macular degeneration,
retinopathy, diabetic retinopathy, macula edema, glaucoma,
retinitis pigmentosa, Stargardt's disease, Usher's disease and
Leber's congenital amaurosis and eye cancer.
[0111] In some embodiments, nucleic acids described herein (e.g.,
ceDNA) may be useful for delivering gene therapy to blood tissue
(e.g., blood cells). Accordingly, in some embodiments, nucleic
acids described herein (e.g., ceDNA) may be useful for the
treatment of blood disorders. As used herein, a "blood disorder" is
a disease or condition of the blood. A blood disorder may be of a
genetic origin, either inherited or acquired through a somatic
mutation. Non-limiting examples of blood diseases and disorders
include but are not limited to anemia (e.g., anemia in chronic
kidney disease, aplastic anemia, myelodysplastic anemia, sickle
cell anemia), deep vein thrombosis, hemophilia (e.g., hemophilia A,
hemophilia B, hemophilia C), Henoch-Schonlein Purpura, pulmonary
embolism, thalassemia, and Von Willebrand disease.
[0112] In some embodiments, nucleic acids described herein (e.g.,
ceDNA) may be useful for delivering gene editing molecules (e.g.,
nucleases) to a subject. In some embodiments a nucleic acid
described by the disclosure comprises a heterologous nucleic acid
insert encodes a nuclease. As used herein, the terms "endonuclease"
and "nuclease" refer to an enzyme that cleaves a phosphodiester
bond or bonds within a polynucleotide chain. Nucleases may be
naturally occurring or genetically engineered. Genetically
engineered nucleases are particularly useful for genome editing and
are generally classified into four families: zinc finger nucleases
(ZFNs), transcription activator-like effector nucleases (TALENs),
engineered meganucleases and CRISPR-associated proteins (Cas
nucleases). In some embodiments, the nuclease is a ZFN. In some
embodiments, the ZFN comprises a FokI cleavage domain. In some
embodiments, the ZFN comprises Cys2His2 fold group. In some
embodiments, the nuclease is a TALEN. In some embodiments, the
TALEN comprises a FokI cleavage domain. In some embodiments, the
nuclease is an engineered meganuclease.
[0113] The term "CRISPR" refers to "clustered regularly interspaced
short palindromic repeats", which are DNA loci containing short
repetitions of base sequences. CRISPR loci form a portion of a
prokaryotic adaptive immune system that confers resistance to
foreign genetic material. Each CRISPR loci is flanked by short
segments of "spacer DNA", which are derived from viral genomic
material. In the Type II CRISPR system, spacer DNA hybridizes to
transactivating RNA (tracrRNA) and is processed into CRISPR-RNA
(crRNA) and subsequently associates with CRISPR-associated
nucleases (Cas nucleases) to form complexes that recognize and
degrade foreign DNA. In certain embodiments, the nuclease is a
CRISPR-associated nuclease (Cas nuclease). Examples of CRISPR
nucleases include, but are not limited to Cas9,Cas6 and dCas9.
dCas9 is an engineered Cas protein that binds to a target locus but
does not cleave said locus. In some embodiments, the nuclease is
Cas9. In some embodiments, the Cas9 is derived from the bacteria S.
pyogenes (SpCas9).
[0114] For the purpose of genome editing, the CRISPR system can be
modified to combine the tracrRNA and crRNA in to a single guide RNA
(sgRNA) or just (gRNA). As used herein, the term "guide RNA" or
"gRNA" refers to a polynucleotide sequence that is complementary to
a target sequence in a cell and associates with a Cas nuclease,
thereby directing the Cas nuclease to the target sequence. In some
embodiments, a nucleic acid described by the disclosure comprises a
heterologous nucleic acid insert encoding a guide RNA (gRNA). In
some embodiments, a gRNA ranges between 1 and 30 nucleotides in
length. In some embodiments, a gRNA ranges between 5 and 25
nucleotides in length. In some embodiments, a gRNA ranges between
10 and 20 nucleotides in length. In some embodiments, a gRNA ranges
between 14 and 18 nucleotides in length. In some embodiments, a
nucleic acid described by the disclosure comprises a heterologous
nucleic acid insert encoding a gRNA and a CRISPR nuclease.
[0115] In some aspects, the disclosure relates to a nucleic acid
encoding a heterologous nucleic acid insert that does not encode a
functional protein. For example, in the context of gene therapy,
transgene promoter integration may cause oncogene activation.
Accordingly, in some embodiments, the disclosure relates to a
heterologous nucleic acid insert encoding a promoterless construct.
Without wishing to be bound by any particular theory, a
promoterless expression construct is useful, in some embodiments,
as a substrate for gene editing.
[0116] As used herein, "genome editing" refers to adding,
disrupting or changing genomic sequences (e.g., a gene sequence).
In some embodiments, genome editing is performed using engineered
proteins and related molecules. In some aspects, genome editing
comprises the use of engineered nucleases to cleave a target
genomic locus. In some embodiments, genome editing further
comprises inserting, deleting, mutating or substituting nucleic
acid residues at a cleaved locus. In some embodiments, inserting,
deleting, mutating or substituting nucleic acid residues at a
cleaved locus is accomplished through endogenous cellular
mechanisms such as homologous recombination (HR) and non-homologous
end joining (NHEJ). Exemplary genome editing technologies include,
but are not limited to Transcription Activator-like Effector
Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), engineered
meganuclease re-engineered homing endonucleases, the CRISPR/Cas
system. In some embodiments, the gene editing technologies are
proteins or molecules related to TALENs, including but not limited
to transcription activator-like effectors (TALEs) and restriction
endonucleases (e.g., FokI). In some embodiments, the gene editing
technologies are proteins or molecules related to ZFNs, including
but not limited to proteins comprising the Cys2His2 fold group (for
example Zif268 (EGR1)), and restriction endonucleases (e.g., FokI).
In some embodiments, the gene editing technologies are proteins or
molecules related to the CRISPR/Cas system, including but not
limited to Cas9,Cas6, dCas9, CRISPR RNA (crRNA) and
trans-activating crRNA (tracrRNA). In some embodiments, the
promoterless construct provides a substrate for TALENS, zinc finger
nucleases (ZFNs), meganucleases, Cas9, and other gene editing
proteins.
[0117] In some aspects, the disclosure relates to a nucleic acid
encoding a heterologous nucleic acid insert that encodes a DNA
vaccine. As used herein, "DNA vaccine" refers to a nucleic acid
encoding an antigen that stimulates an immune response (e.g., a
cellular immune response or a humoral immune response) against that
antigen in a host. In some embodiments, the immune response is a
protective response that protects against a future infection or
condition. However, in some embodiments, the immune response treats
(e.g., eradicates or attenuates) an existing infection or
condition. Examples of DNA vaccines include HL chain Ig, scFv,
single-domain Ig derived from camelidae (VhH) or cartilaginous fish
(Vnar), nanobody, and other paratope recognitions peptides and
fusion peptides collectively referred to as Ig (or Ig-like)
molecules.
[0118] In some embodiments, a heterologous nucleic acid insert
encodes an Ig or Ig-like molecule. In some embodiments, the Ig (or
Ig-like) molecules are unmodified protein sequences derived from
monoclonal antibody sequences. In some embodiments, the Ig (or
Ig-like) molecules are unmodified protein sequences derived from
murine or other mammalian monoclonal antibody sequences.
[0119] In some embodiments, the Ig (or Ig-like) molecules are
unmodified protein sequences derived from synthetic randomly
generated peptide libraries. In some embodiments, the libraries
were derived from complimentary DNA obtained from naive vertebrate
species. The species include, but are not limited to mammals, such
as primates (e.g., humans and non-human primates), rodents (e.g.,
mouse, rats), ungulates, camelids, equines, canines, felines,
marsupials, and animals of agricultural interest; Avian species,
including chickens, ducks, and geese; piscine species including
cartlilaginous fish, lamprey eels, and jawed fish species.
[0120] In some embodiments, the heterologous nucleic acid encodes
the heavy and light chains for an immunoglobulin (Ig), such that
when administered to a permissive cell, an assembled Ig is secreted
into the circulatory system. In some embodiments, the Ig molecule
is not secreted and acts internally as a so-called
"intra-body".
[0121] In some embodiments, a heterologous nucleic acid insert
encodes an Ig molecule that is an engineered single-chain antibody
consisting of the heavy and light chain variable regions in one
polypeptide (scFv). The scFv retains avidity and specificity for
the target antigen.
[0122] In some embodiments, a heterologous nucleic acid insert
encodes an Ig molecule that binds to microbial agents and affects
the infectivity of the microbe. In some embodiments, the microbial
agents are prokaryotic organisms. In some embodiments, the
microbial agents are rickettsia, mycoplasma, or other intracellular
life forms.
[0123] In some embodiments, a heterologous nucleic acid insert
encodes an Ig molecule that binds to viral structural protein(s) of
human pathogenic viruses, including but not limited an Ebola virus
viral protein, a human immune deficiency viral protein, a papilloma
viral protein, a herpes simplex 1 viral protein, a herpes simplex 2
viral protein, a HCV A viral protein, a HCV B viral protein, a HCV
C viral protein, a HCV non-A viral protein, a HCV non-B viral
protein, or a dengue hemorrhagic fever viral protein. In some
embodiments, a heterologous nucleic acid insert encodes an Ig
molecule that binds to viral structural protein(s) of a zoonotic
pathogen, including, but not limited to foot and mouth disease
virus and rabies virus.
[0124] In some aspects, nucleic acids described by the disclosure
are useful for the production of modified cells, such as ex vivo
modified cells. As used herein, "ex vivo modified cell" refers to a
cell (e.g., a mammalian cell) that is removed from a subject,
genetically modified (e.g., transfected or transduced with
exogenous nucleic acids, or genetically reprogrammed), cultured or
expanded, and optionally, returned to a subject (e.g., either the
same subject, or a different subject). Generally, ex vivo modified
cells are useful for autologous cell therapy, or allogeneic cell
therapy. For example, cells may be removed from a subject having a
disease associated with a particular genetic defect (e.g.,
overexpression of a particular protein), transfected with a nucleic
acid that corrects the genetic defect (e.g. reduces expression of
the protein), and reintroduced into the subject. In another
non-limiting example, cells are removed from a subject, genetically
reprogrammed (e.g., dedifferentiated or transdifferentiated into
stem cells), expanded, and reintroduced into the subject. In some
embodiments, ex vivo modified cells produced by transfection with a
nucleic acid as described by the disclosure have an improved safety
profile compared to ex vivo cells produced by currently available
gene therapy vectors.
[0125] In some aspects, nucleic acids described by the disclosure
are useful for the production of chimeric antigen T-cells (CARTs).
Chimeric Antigen Receptors (CARs) are engineered T cell receptors
displaying specificity against target antigens based on a single
chain FV (scFv) antibody moiety. Generally, CARTs are produced by
transduction of T-cells with lentiviral vectors comprising DNA
encoding CARs. Lentiviral transduction, in some embodiments, raises
the risk of insertional mutagenesis leading to cancer. As described
by the disclosure, nucleic acids having asymmetric interrupted
self-complementary sequences exhibit reduced likelihood of
insertional mutagenesis compared to other gene therapy modalities.
Accordingly, in some embodiments a nucleic acid described by the
disclosure comprises a heterologous nucleic acid insert (e.g., a
transgene) encoding a CAR. In some embodiments, a CART produced by
transduction with a nucleic acid described by the disclosure
exhibits an improved safety profile compared to a CART produced by
lentiviral transduction.
Additional Components
[0126] In addition to the major elements identified above for the
nucleic acid, the nucleic acid also includes conventional control
elements necessary which are operably linked to the heterologous
nucleic acid insert (e.g., transgene) in a manner which permits its
transcription, translation and/or expression in a cell transfected
with a nucleic acid described by the disclosure. As used herein,
"operably linked" sequences include both expression control
sequences that are contiguous with the gene of interest and
expression control sequences that act in trans or at a distance to
control the gene of interest.
[0127] Expression control sequences include appropriate
transcription initiation, termination, promoter and enhancer
sequences; efficient RNA processing signals such as splicing and
polyadenylation (polyA) signals; sequences that stabilize
cytoplasmic mRNA; sequences that enhance translation efficiency
(i.e., Kozak consensus sequence); sequences that enhance protein
stability; and when desired, sequences that enhance secretion of
the encoded product. A great number of expression control
sequences, including promoters which are native, constitutive,
inducible and/or tissue-specific, are known in the art and may be
utilized.
[0128] In some embodiments, a heterologous nucleic acid insert
(e.g., transgene) comprises a protein coding sequence that is
operably linked to one or more regulatory sequences. As used
herein, a nucleic acid coding sequence and regulatory sequences are
said to be "operably" linked when they are covalently linked in
such a way as to place the expression or transcription of the
nucleic acid sequence (e.g., transgene) under the influence or
control of the regulatory sequences. If it is desired that the
nucleic acid sequence (e.g., transgene) be translated into a
functional protein, two DNA sequences are said to be operably
linked if induction of a promoter in the 5' regulatory sequences
results in the transcription of the coding sequence and if the
nature of the linkage between the two DNA sequences does not (1)
result in the introduction of a frame-shift mutation, (2) interfere
with the ability of the promoter region to direct the transcription
of the coding sequences, or (3) interfere with the ability of the
corresponding RNA transcript to be translated into a protein. Thus,
a promoter region would be operably linked to a nucleic acid
sequence if the promoter region were capable of effecting
transcription of that DNA sequence such that the resulting
transcript might be translated into the desired protein or
polypeptide. Similarly two or more coding regions are operably
linked when they are linked in such a way that their transcription
from a common promoter results in the expression of two or more
proteins having been translated in frame. In some embodiments,
operably linked coding sequences yield a fusion protein. In some
embodiments, operably linked coding sequences yield a functional
RNA (e.g., gRNA).
[0129] For nucleic acids (e.g., transgenes) encoding proteins, a
polyadenylation sequence generally is inserted following the
transgene sequences and before the 3' AAV ITR sequence. A
heterologous nucleic acid insert (e.g., transgene) useful in the
present disclosure may also contain an intron, desirably located
between the promoter/enhancer sequence and the transgene. One
possible intron sequence is derived from SV-40, and is referred to
as the SV-40 T intron sequence. Another vector element that may be
used is an internal ribosome entry site (IRES). An IRES sequence is
used to produce more than one polypeptide from a single gene
transcript. An IRES sequence would be used to produce a protein
that contain more than one polypeptide chains. Selection of these
and other common vector elements are conventional and many such
sequences are available [see, e.g., Sambrook et al, and references
cited therein at, for example, pages 3.18 3.26 and 16.17 16.27 and
Ausubel et al., Current Protocols in Molecular Biology, John Wiley
& Sons, New York, 1989]. In some embodiments, a Foot and Mouth
Disease Virus 2A sequence is included in polyprotein; this is a
small peptide (approximately 18 amino acids in length) that has
been shown to mediate the cleavage of polyproteins (Ryan, M D et
al., EMBO, 1994; 4: 928-933; Mattion, N M et al., J Virology,
November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001;
8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4:
453-459). The cleavage activity of the 2A sequence has previously
been demonstrated in artificial systems including plasmids and gene
therapy vectors (AAV and retroviruses) (Ryan, M D et al., EMBO,
1994; 4: 928-933; Mattion, N M et al., J Virology, November 1996;
p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and
Halpin, C et al., The Plant Journal, 1999; 4: 453-459; de Felipe, P
et al., Gene Therapy, 1999; 6: 198-208; de Felipe, P et al., Human
Gene Therapy, 2000; 11: 1921-1931.; and Klump, H et al., Gene
Therapy, 2001; 8: 811-817).
[0130] The precise nature of the regulatory sequences needed for
gene expression in host cells may vary between species, tissues or
cell types, but shall in general include, as necessary, 5'
non-transcribed and 5' non-translated sequences involved with the
initiation of transcription and translation respectively, such as a
TATA box, capping sequence, CAAT sequence, enhancer elements, and
the like. Especially, such 5' non-transcribed regulatory sequences
will include a promoter region that includes a promoter sequence
for transcriptional control of the operably joined gene. Regulatory
sequences may also include enhancer sequences or upstream activator
sequences as desired. The vectors of the disclosure may optionally
include 5' leader or signal sequences. The choice and design of an
appropriate vector is within the ability and discretion of one of
ordinary skill in the art.
[0131] Examples of constitutive promoters include, without
limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter
(optionally with the RSV enhancer), the cytomegalovirus (CMV)
promoter (optionally with the CMV enhancer) [see, e.g., Boshart et
al, Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate
reductase promoter, the .beta.-actin promoter, the phosphoglycerol
kinase (PGK) promoter, and the EF1.alpha. promoter
[Invitrogen].
[0132] Inducible promoters allow regulation of gene expression and
can be regulated by exogenously supplied compounds, environmental
factors such as temperature, or the presence of a specific
physiological state, e.g., acute phase, a particular
differentiation state of the cell, or in replicating cells only.
Inducible promoters and inducible systems are available from a
variety of commercial sources, including, without limitation,
Invitrogen, Clontech and Ariad. Many other systems have been
described and can be readily selected by one of skill in the art.
Examples of inducible promoters regulated by exogenously supplied
promoters include the zinc-inducible sheep metallothionine (MT)
promoter, the dexamethasone (Dex)-inducible mouse mammary tumor
virus (MMTV) promoter, the T7 polymerase promoter system (WO
98/10088); the ecdysone insect promoter (No et al., Proc. Natl.
Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible
system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551
(1992)), the tetracycline-inducible system (Gossen et al., Science,
268:1766-1769 (1995), see also Harvey et al, Curr. Opin. Chem.
Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al.,
Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther.,
4:432-441 (1997)) and the rapamycin-inducible system (Magari et
al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of
inducible promoters which may be useful in this context are those
which are regulated by a specific physiological state, e.g.,
temperature, acute phase, a particular differentiation state of the
cell, or in replicating cells only.
[0133] In another embodiment, the native promoter for the transgene
will be used. The native promoter may be preferred when it is
desired that expression of the transgene should mimic the native
expression. The native promoter may be used when expression of the
transgene must be regulated temporally or developmentally, or in a
tissue-specific manner, or in response to specific transcriptional
stimuli. In a further embodiment, other native expression control
elements, such as enhancer elements, polyadenylation sites or Kozak
consensus sequences may also be used to mimic the native
expression.
[0134] In some embodiments, the regulatory sequences impart
tissue-specific gene expression capabilities. In some cases, the
tissue-specific regulatory sequences bind tissue-specific
transcription factors that induce transcription in a tissue
specific manner. Such tissue-specific regulatory sequences (e.g.,
promoters, enhancers, etc.) are well known in the art. Exemplary
tissue-specific regulatory sequences include, but are not limited
to the following tissue specific promoters: a liver-specific
thyroxin binding globulin (TBG) promoter, an insulin promoter, a
glucagon promoter, a somatostatin promoter, a pancreatic
polypeptide (PPY) promoter, a synapsin-1 (Syn) promoter, a creatine
kinase (MCK) promoter, a mammalian desmin (DES) promoter, a
.alpha.-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin
T (cTnT) promoter. Other exemplary promoters include Beta-actin
promoter, hepatitis B virus core promoter, Sandig et al., Gene
Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot
et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin
promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone
sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64
(1996)), CD2 promoter (Hansal et al., J. Immunol., 161:1063-8
(1998); immunoglobulin heavy chain promoter; T cell receptor
a-chain promoter, neuronal such as neuron-specific enolase (NSE)
promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15
(1993)), neurofilament light-chain gene promoter (Piccioli et al.,
Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the
neuron-specific vgf gene promoter (Piccioli et al., Neuron,
15:373-84 (1995)), among others which will be apparent to the
skilled artisan.
Production of Closed-Ended Linear Duplex DNA (ceDNA)
[0135] In some aspects, the disclosure provides a method of
producing a nucleic acid as described by the disclosure (e.g.,
ceDNA), comprising: (i) introducing into a permissive cell a
nucleic acid encoding a heterologous nucleic acid insert flanked by
at least one interrupted self-complementary sequence, each
self-complementary sequence having an operative terminal resolution
site and a rolling circle replication protein binding element,
wherein the self-complementary sequence is interrupted by a
cross-arm sequence forming two opposing, lengthwise-symmetric
stem-loops, each of the opposing lengthwise-symmetric stem-loops
having a stem portion in the range of 5 to 15 base pairs in length
and a loop portion having 2 to 5 unpaired deoxyribonucleotides;
and, (ii) maintaining the permissive cell under conditions in which
a rolling circle replication protein in the permissive cell
initiates production of multiple copies of the nucleic acid.
[0136] The number of copies resulting from production of a nucleic
acid can be expressed as a multiple of the original number of
copies of the nucleic acid (e.g., 1, 2, 10, 100, or more original
copies) introduced into the permissive cell. In some embodiments,
production of multiple copies of the nucleic acid results in
between 2-fold and 10,000-fold increase in the number of copies of
the nucleic acid in the permissive cell. In some embodiments,
production of multiple copies of the nucleic acid results in
greater than 10,000-fold increase in the number of copies of the
nucleic acid in the permissive cell.
[0137] In some aspects, the disclosure provides transfected cells
(e.g., transfected permissive cells). The term "transfection" is
used to refer to the uptake of foreign DNA by a cell, and a cell
has been "transfected" when exogenous DNA has been introduced
inside the cell membrane. A number of transfection techniques are
generally known in the art. See, e.g., Graham et al. (1973)
Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a
laboratory manual, Cold Spring Harbor Laboratories, New York, Davis
et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu
et al. (1981) Gene 13:197. Such techniques can be used to introduce
one or more exogenous nucleic acids, such as a nucleotide
integration vector and other nucleic acid molecules, into suitable
cells (e.g., permissive cells).
[0138] A "permissive cell" refers to any cell in which a nucleic
acid as described by the disclosure replicates, or is capable of
supporting replication of a nucleic acid as described by the
disclosure. In some embodiments, the permissive cell does not
express viral capsid proteins capable of packaging replicative
copies of the nucleic acid into a viral particle. Aspects of the
disclosure relate, in part, to the surprising discovery that, in
some embodiments, mammalian cells are not permissive for
replication of nucleic acids described by the disclosure.
Accordingly, in some embodiments, a permissive cell is a
non-mammalian cell (e.g., the permissive cell is not a mammalian
cell). In some embodiments, the permissive cell is an insect cell
line, yeast cell line, or bacterial cell line.
[0139] Examples of permissive insect cells include but are not
limited to Spodoptera frugiperda (e.g., Sf9, Sf21), Spodoptera
exigua, Heliothis virescens, Helicoverpa zea, Heliothis subflexa,
Anticarsia gemmatalis, Trichopulsia ni (e.g., High-Five cells),
Drosophila melanogaster (e.g., S2, S3), Antheraea eucalypti, Bombyx
mori, Aedes alpopictus, Aedes aegyptii, and others.
[0140] Examples of permissive bacterial cells include, but are not
limited to Escherichia coli, Corynebacterium glutamicum, and
Pseudomonas fluorescens.
[0141] Examples of permissive yeast cells include but are not
limited to Saccharomyces cerevisiae, Saccharomyces pombe, Pichia
pastoris, Bacillus sp., Aspergillus sp., Trichoderma sp., and
Myceliophthora thermophila C1.
[0142] Examples of permissive plant cells include but are not
limited to Nicotiana sp., Arabidopsis thaliana, Mays zea, Solanum
sp., or Lemna sp.
[0143] In some embodiments, a permissive cell is a mammalian cell.
Examples of permissive mammalian cells include Henrietta Lacks
tumor (HeLa) cells and baby hamster kidney (BHK-21) cells.
[0144] In some embodiments, a nucleic acid as described by the
disclosure is contained within a vector and delivered to a
permissive cell. As used herein, the term "vector" includes any
genetic element, such as a plasmid, phage, transposon, cosmid,
chromosome, artificial chromosome, virus, virion, etc., which is
capable of replication when associated with the proper control
elements and which can transfer gene sequences between cells. Thus,
the term includes cloning and expression vehicles, as well as viral
vectors. In some embodiments, useful vectors are contemplated to be
those vectors in which the nucleic acid segment to be transcribed
is positioned under the transcriptional control of a promoter.
[0145] In some embodiments, the method comprises expressing a
rolling circle replication protein (e.g., a viral nonstructural
protein, such as an AAV Rep protein) in the permissive cell. In
some embodiments more than one (e.g., 2, 3, 4, or more) rolling
circle replication proteins are expressed in a permissive cell.
Without wishing to be bound by any particular theory, viral
nonstructural protein(s) expressed in the permissive cell
mediate(s) replication of a nucleic acid described by the
disclosure. For example, in some embodiments, AAV Rep78 and Rep52
are expressed in a permissive cell comprising a nucleic acid having
AAV2 ITR-based asymmetric interrupted self-complementary sequences.
In some embodiments, the nonstructural viral protein is selected
from the group consisting of AAV78, AAV52, AAV Rep68, and AAV Rep
40.
[0146] In some embodiments a rolling circle replication protein
(e.g., a viral nonstructural protein, such as an AAV Rep protein)
expressed in a permissive cell is encoded by a helper virus vector.
As used here, "helper virus vector" refers to a viral vector that
expresses molecule(s) (e.g., one or more proteins) required for the
replication of a nucleic acid as described by the disclosure. For
example, in some embodiments a helper virus vector expresses one or
more rolling circle replication proteins which bind to the RBE of
an interrupted self-complementary nucleic acid sequence and
initiate replication of the nucleic acid comprising the interrupted
self-complementary nucleic acid sequence. Helper virus vectors are
generally known and include, for example baculovirus, adenovirus,
herpesvirus, cytomegalovirus, Epstein-Barr virus, and vaccinia
virus vectors. In some embodiments, a helper virus vector is a
baculovirus expression vector (BEV). Baculovirus expression vectors
are generally known in the art, for example as disclosed in Passer
et al. Methods Mol Biol. 2007; 388:55-76. Examples of baculovirus
vectors include but are not limited to Autograph californica
multiple nucleopolyhedrosis virus (AcMNPV) vector, BmNPV, and
Spodoptera exigua multiple nucleopolyhedrovirus. In some
embodiments, the helper virus vector is Autograph californica
multiple nucleopolyhedrosis virus (AcMNPV) vector.
[0147] In some embodiments, methods of producing nucleic acids
described by the disclosure further comprise a step of purifying
the multiple copies of the nucleic acid from a cell (e.g., a
permissive cell). Generally, any suitable nucleic acid purification
method can be used. For example, in some embodiments, the multiple
copies of the nucleic acid described by the disclosure are purified
by plasmid purification kits, such as Qiagen MiniPrep kit, ethanol
precipitation, phenol-chloroform purification, etc. However, the
disclosure relates, in part, to the discovery that nucleic acids
comprising interrupted self-complementary sequences exhibit poor
binding efficiency to weak cation exchange chromatography media
(e.g., diethylaminoethyl media, DEAE) and that purification using
silica gel media produce well-resolved molecular species while
reducing the formation of high molecular weight complexes. Thus, in
some embodiments, the purification comprises contacting the nucleic
acid with a silica gel resin.
[0148] In some embodiments, nucleic acids provided herein may be
used to deliver a heterologous insert to a cell, e.g., for
therapeutic purposes. Furthermore, in some aspects, the disclosure
relates to the delivery of nucleic acids containing heterologous
inserts that encoded therapeutic products (e.g., therapeutic
proteins, therapeutic RNAs) to a subject. In order to avoid
administration of impure or contaminated nucleic acids or to
otherwise characterize the extent or purity, quality or make up of
a nucleic acid preparation, such preparations may be subject to a
quality control (QC) or other analysis procedure prior to use,
e.g., prior to administration to a cell or subject. For example,
methods of analyzing a nucleic acid, in some embodiments, comprise
obtaining a nucleic acid preparation described by the disclosure
and determining a physiochemical property of one or more nucleic
acid components in the preparation, e.g., nucleic acid replication
products.
[0149] Examples of physiochemical properties that may be determined
include but are not limited to solubility, stability, structure
(e.g., primary structure, secondary structure, tertiary structure,
quaternary structure, etc.), hydrophobicity, GC content, molecular
weight (e.g., molecular weight of one or more fragments or portions
of a nucleic acid, for example following restriction digest), etc.
In some embodiments, the physiochemical property is the nucleotide
sequence of one or each self-complementary sequence (e.g.,
determining if a nucleic acid described by the disclosure comprises
a truncated cross-arm sequence).
[0150] In some embodiments, the physiochemical property is the
extent of multimerization (e.g., monomer, dimer, trimer, 4-mer, or
other multimer or concatamer) of a nucleic acid as described by the
disclosure. In some embodiments, the physiochemical property is the
stoichiometry of monomeric and/or multimeric forms of the
replication product in the nucleic acid preparation.
[0151] In some embodiments, the physiochemical property is the
susceptibility of one or more replication products (e.g., obtained
from a nucleic acid preparation) to digestion with a restriction
endonuclease. For example, in some embodiments, a nucleic acid as
described by the disclosure is digested with one or more
restriction enzymes and the fragments of the nucleic acid are
analyzed to determine the size of each fragment. Thus, in some
embodiments, the physiochemical property is the molecular weight of
one or more replication products or of a fragment of a replication
product. In some embodiments, the molecular weight is of a fragment
of the one or more replication products that comprises one or more
self-complementary sequences. In some embodiments, the molecular
weight is determined based on electrophoretic mobility. In some
embodiments, the molecular weight is determined based on mass
spectroscopy.
[0152] In some embodiments, the molecular weight is of a fragment
of the one or more replication products. In some embodiments, the
molecular weight is of fragment of a replication product that is
amplified by a reaction comprising primer extension by a
polymerase. Examples of polymerase-based extension methods include
but are not limited to polymerase chain reaction (PCR), recombinase
polymerase amplification, loop mediated isothermal amplification
(LAMP), etc.
[0153] In some embodiments, the physiochemical property is the
polarity of monomers in a dimeric form of the replication product,
wherein the polarity is head-to-head, head-to-tail or
tail-to-tail.
[0154] Generally, suitable assays for determining physiochemical
properties may be used. Suitable assays may include restriction
digestion analysis, gel electrophoresis (e.g., native gel
electrophoresis, denaturing gel electrophoresis, high resolution
gel electrophoresis), spectrometry (e.g., mass spectrometry, such
as LC/MS, HPLC/MS, ESI-MS, MALDI-TOF, etc.), and nucleic acid
sequencing (e.g., Maxam-Gilbert sequencing, pyrosequencing,
chain-termination sequencing, massively parallel signature
sequencing, single-molecule sequencing, nanopore sequencing,
Illumina sequencing, etc.).
Compositions
[0155] In some aspects, the disclosure relates to compositions
comprising a nucleic acid as described by the disclosure. In some
embodiments, compositions comprising nucleic acids as described
herein are delivered to a subject in need thereof. The nucleic
acids may be delivered to a subject in compositions according to
any appropriate methods known in the art. It should be appreciated
that compositions may comprise one or more (e.g., a plurality) of
nucleic acids as described by the disclosure. In some embodiments,
a plurality of nucleic acids is 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
nucleic acids. In some embodiments, each of the one or more nucleic
acids of a plurality is covalently linked (e.g., linked
end-to-end). In some embodiments, the composition further comprises
a pharmaceutically acceptable carrier.
[0156] The nucleic acid, preferably suspended in a physiologically
compatible carrier (i.e., in a composition), may be administered to
a subject, i.e. host animal, such as a human, mouse, rat, cat, dog,
sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken,
turkey, or a non-human primate (e.g., Macaque). In some embodiments
a host animal does not include a human.
[0157] Delivery of the nucleic acids (e.g., ceDNA) to a mammalian
subject may be by, for example, intramuscular injection or by
administration into the bloodstream of the mammalian subject.
Administration into the bloodstream may be by injection into a
vein, an artery, or any other vascular conduit. In some
embodiments, the nucleic acids are administered into the
bloodstream by way of isolated limb perfusion, a technique well
known in the surgical arts, the method essentially enabling the
artisan to isolate a limb from the systemic circulation prior to
administration of the nucleic acid. A variant of the isolated limb
perfusion technique, described in U.S. Pat. No. 6,177,403, can also
be employed by the skilled artisan to administer the nucleic
acid(s) into the vasculature of an isolated limb to potentially
enhance transfection of muscle cells or tissue. Moreover, in
certain instances, it may be desirable to deliver the nucleic
acid(s) to the CNS of a subject. By "CNS" is meant all cells and
tissue of the brain and spinal cord of a vertebrate. Thus, the term
includes, but is not limited to, neuronal cells, glial cells,
astrocytes, cereobrospinal fluid (CSF), interstitial spaces, bone,
cartilage and the like. Recombinant AAVs may be delivered directly
to the CNS or brain by injection into, e.g., the ventricular
region, as well as to the striatum (e.g., the caudate nucleus or
putamen of the striatum), spinal cord and neuromuscular junction,
or cerebellar lobule, with a needle, catheter or related device,
using neurosurgical techniques known in the art, such as by
stereotactic injection (see, e.g., Stein et al., J Virol
73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000;
Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and
Davidson, Hum. Gene Ther. 11:2315-2329, 2000).
[0158] Suitable carriers may be readily selected by one of skill in
the art in view of the indication for which the nucleic acid(s) is
directed. For example, one suitable carrier includes saline, which
may be formulated with a variety of buffering solutions (e.g.,
phosphate buffered saline). Other exemplary carriers include
sterile saline, lactose, sucrose, calcium phosphate, gelatin,
dextran, agar, pectin, peanut oil, sesame oil, and water. The
selection of the carrier is not a limitation of the present
disclosure.
[0159] Optionally, the compositions of the disclosure may contain,
in addition to the nucleic acid(s) and carrier(s), other
conventional pharmaceutical ingredients, such as preservatives, or
chemical stabilizers. Suitable exemplary preservatives include
chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide,
propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and
parachlorophenol. Suitable chemical stabilizers include gelatin and
albumin.
[0160] The nucleic acid(s) are administered in sufficient amounts
to transfect the cells of a desired tissue and to provide
sufficient levels of gene transfer and expression without undue
adverse effects. Conventional and pharmaceutically acceptable
routes of administration include, but are not limited to, direct
delivery to the selected organ (e.g., intraportal delivery to the
liver), oral, inhalation (including intranasal and intratracheal
delivery), intraocular, intravenous, intramuscular, subcutaneous,
intradermal, intratumoral, and other parental routes of
administration. Routes of administration may be combined, if
desired.
[0161] The dose of nucleic acid(s) required to achieve a particular
"therapeutic effect," will vary based on several factors including,
but not limited to: the route of nucleic acid administration, the
level of gene or RNA expression required to achieve a therapeutic
effect, the specific disease or disorder being treated, and the
stability of the gene or RNA product. One of skill in the art can
readily determine a nucleic acid dose range to treat a patient
having a particular disease or disorder based on the aforementioned
factors, as well as other factors that are well known in the
art.
[0162] Dosage regime may be adjusted to provide the optimum
therapeutic response. For example, the oligonucleotide may be
repeatedly administered, e.g., several doses may be administered
daily or the dose may be proportionally reduced as indicated by the
exigencies of the therapeutic situation. One of ordinary skill in
the art will readily be able to determine appropriate doses and
schedules of administration of the subject oligonucleotides,
whether the oligonucleotides are to be administered to cells or to
subjects.
[0163] Formulation of pharmaceutically-acceptable excipients and
carrier solutions is well-known to those of skill in the art, as is
the development of suitable dosing and treatment regimens for using
the particular compositions described herein in a variety of
treatment regimens.
[0164] Typically, these formulations may contain at least about
0.1% of the active compound or more, although the percentage of the
active ingredient(s) may, of course, be varied and may conveniently
be between about 1 or 2% and about 70% or 80% or more of the weight
or volume of the total formulation. Naturally, the amount of active
compound in each therapeutically-useful composition may be prepared
is such a way that a suitable dosage will be obtained in any given
unit dose of the compound. Factors such as solubility,
bioavailability, biological half-life, route of administration,
product shelf life, as well as other pharmacological considerations
will be contemplated by one skilled in the art of preparing such
pharmaceutical formulations, and as such, a variety of dosages and
treatment regimens may be desirable.
[0165] In certain circumstances it will be desirable to deliver the
nucleic acid-based therapeutic constructs in suitably formulated
pharmaceutical compositions disclosed herein either subcutaneously,
intraopancreatically, intranasally, parenterally, intravenously,
intramuscularly, intrathecally, or orally, intraperitoneally, or by
inhalation. In some embodiments, the administration modalities as
described in U.S. Pat. Nos. 5,543,158; 5,641,515 and 5,399,363
(each specifically incorporated herein by reference in its
entirety) may be used to deliver nucleic acids. In some
embodiments, a preferred mode of administration is by portal vein
injection.
[0166] The pharmaceutical forms suitable for injectable use include
sterile aqueous solutions or dispersions and sterile powders for
the extemporaneous preparation of sterile injectable solutions or
dispersions. Dispersions may also be prepared in glycerol, liquid
polyethylene glycols, and mixtures thereof and in oils. Under
ordinary conditions of storage and use, these preparations contain
a preservative to prevent the growth of microorganisms. In many
cases the form is sterile and fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms, such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (e.g., glycerol, propylene glycol,
and liquid polyethylene glycol, and the like), suitable mixtures
thereof, and/or vegetable oils. Proper fluidity may be maintained,
for example, by the use of a coating, such as lecithin, by the
maintenance of the required particle size in the case of dispersion
and by the use of surfactants. The prevention of the action of
microorganisms can be brought about by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
sorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars or
sodium chloride. Prolonged absorption of the injectable
compositions can be brought about by the use in the compositions of
agents delaying absorption, for example, aluminum monostearate and
gelatin.
[0167] For administration of an injectable aqueous solution, for
example, the solution may be suitably buffered, if necessary, and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, subcutaneous and
intraperitoneal administration. In this connection, a sterile
aqueous medium that can be employed will be known to those of skill
in the art. For example, one dosage may be dissolved in 1 ml of
isotonic NaCl solution and either added to 1000 ml of
hypodermoclysis fluid or injected at the proposed site of infusion,
(see for example, "Remington's Pharmaceutical Sciences" 15th
Edition, pages 1035-1038 and 1570-1580). Some variation in dosage
will necessarily occur depending on the condition of the host. The
person responsible for administration will, in any event, determine
the appropriate dose for the individual host.
[0168] Sterile injectable solutions are prepared by incorporating
the nucleic acid in the required amount in the appropriate solvent
with various of the other ingredients enumerated herein, as
required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the various sterilized
active ingredients into a sterile vehicle which contains the basic
dispersion medium and the required other ingredients from those
enumerated above. In the case of sterile powders for the
preparation of sterile injectable solutions, the preferred methods
of preparation are vacuum-drying and freeze-drying techniques which
yield a powder of the active ingredient plus any additional desired
ingredient from a previously sterile-filtered solution thereof.
[0169] The nucleic acid compositions disclosed herein may also be
formulated in a neutral or salt form. Pharmaceutically-acceptable
salts, include the acid addition salts (formed with the free amino
groups of the protein) and which are formed with inorganic acids
such as, for example, hydrochloric or phosphoric acids, or such
organic acids as acetic, oxalic, tartaric, mandelic, and the like.
Salts formed with the free carboxyl groups can also be derived from
inorganic bases such as, for example, sodium, potassium, ammonium,
calcium, or ferric hydroxides, and such organic bases as
isopropylamine, trimethylamine, histidine, procaine and the like.
Upon formulation, solutions will be administered in a manner
compatible with the dosage formulation and in such amount as is
therapeutically effective. The formulations are easily administered
in a variety of dosage forms such as injectable solutions,
drug-release capsules, and the like.
[0170] As used herein, "carrier" includes any and all solvents,
dispersion media, vehicles, coatings, diluents, antibacterial and
antifungal agents, isotonic and absorption delaying agents,
buffers, carrier solutions, suspensions, colloids, and the like.
The use of such media and agents for pharmaceutical active
substances is well known in the art. Supplementary active
ingredients can also be incorporated into the compositions. The
phrase "pharmaceutically-acceptable" refers to molecular entities
and compositions that do not produce an allergic or similar
untoward reaction when administered to a host.
[0171] Delivery vehicles such as liposomes, nanocapsules,
microparticles, microspheres, lipid particles, vesicles, and the
like, may be used for the introduction of the compositions of the
present disclosure into suitable host cells. In particular, the
nucleic acids may be formulated for delivery either encapsulated in
a lipid particle, a liposome, a vesicle, a nanosphere, or a
nanoparticle or the like.
[0172] Such formulations may be preferred for the introduction of
pharmaceutically acceptable formulations of the nucleic acids
disclosed herein. The formation and use of liposomes is generally
known to those of skill in the art. Recently, liposomes were
developed with improved serum stability and circulation half-times
(U.S. Pat. No. 5,741,516). Further, various methods of liposome and
liposome like preparations as potential drug carriers have been
described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213;
5,738,868 and 5,795,587).
[0173] Liposomes have been used successfully with a number of cell
types that are normally resistant to transfection by other
procedures. In addition, liposomes are free of the DNA length
constraints that are typical of viral-based delivery systems.
Liposomes have been used effectively to introduce genes, drugs,
radiotherapeutic agents, viruses, transcription factors and
allosteric effectors into a variety of cultured cell lines and
animals. In addition, several successful clinical trials examining
the effectiveness of liposome-mediated drug delivery have been
completed.
[0174] Liposomes are formed from phospholipids that are dispersed
in an aqueous medium and spontaneously form multilamellar
concentric bilayer vesicles (also termed multilamellar vesicles
(MLVs). MLVs generally have diameters of from 25 nm to 4 .mu.m.
Sonication of MLVs results in the formation of small unilamellar
vesicles (SUVs) with diameters in the range of 200 to 500 ANG.,
containing an aqueous solution in the core.
[0175] In some embodiments, a liposome comprises cationic lipids.
The term "cationic lipid" includes lipids and synthetic lipids
having both polar and non-polar domains and which are capable of
being positively charged at or around physiological pH and which
bind to polyanions, such as nucleic acids, and facilitate the
delivery of nucleic acids into cells. In some embodiments, cationic
lipids include saturated and unsaturated alkyl and alicyclic ethers
and esters of amines, amides, or derivatives thereof. In some
embodiments, cationic lipids comprise straight-chain, branched
alkyl, alkenyl groups, or any combination of the foregoing. In some
embodiments, cationic lipids contain from 1 to about 25 carbon
atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, or 25 carbon atoms. In some
embodiments, cationic lipids contain more than 25 carbon atoms. In
some embodiments, straight chain or branched alkyl or alkene groups
have six or more carbon atoms. A cationic lipid may also comprise,
in some embodiments, one or more alicyclic groups. Non-limiting
examples of alicyclic groups include cholesterol and other steroid
groups. In some embodiments, cationic lipids are prepared with a
one or more counterions. Examples of counterions (anions) include
but are not limited to Cl.sup.-, Br.sup.-, I.sup.-, F.sup.-,
acetate, trifluoroacetate, sulfate, nitrite, and nitrate.
[0176] Non-limiting examples of cationic lipids include
polyethylenimine, polyamidoamine (PAMAM) starburst dendrimers,
Lipofectin (a combination of DOTMA and DOPE), Lipofectase,
LIPOFECTAMINE.TM. (e.g., LIPOFECTAMINE.TM. 2000), DOPE, Cytofectin
(Gilead Sciences, Foster City, Calif.), and Eufectins (JBL, San
Luis Obispo, Calif.). Exemplary cationic liposomes can be made from
N-[1-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium chloride
(DOTMA), N-[1-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium
methyl sulfate (DOTAP),
3.beta.-[N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol
(DC-Chol),
2,3,-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanamin-
ium trifluoroacetate (DOSPA),
1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide;
and dimethyldioctadecylammonium bromide (DDAB). Nucleic acids
(e.g., ceDNA) can also be complexed with, e.g., poly (L-lysine) or
avidin and lipids may, or may not, be included in this mixture,
e.g., steryl-poly (L-lysine).
[0177] In some embodiments, a nucleic acid described by the
disclosure is delivered using a cationic lipid described in U.S.
Pat. No. 8,158,601, or a polyamine compound or lipid as described
in U.S. Pat. No. 8,034,376, the contents of each of which are
incorporated herein by reference.
[0178] In some embodiments, a nucleic acid described by the
disclosure is conjugated (e.g., covalently bound to an agent that
increases cellular uptake. An "agent that increases cellular
uptake" is a molecule that facilitates transport of a nucleic acid
across a lipid membrane. For example, a nucleic acid may be
conjugated to a lipophilic compound (e.g., cholesterol, tocopherol,
etc.), a cell penetrating peptide (CPP) (e.g., penetratin, TAT,
Syn1B, etc.), and polyamines (e.g., spermine). Further examples of
agents that increase cellular uptake are disclosed, for example, in
Winkler (2013). Oligonucleotide conjugates for therapeutic
applications. Ther. Deliv. 4(7); 791-809, the contents of which are
incorporated herein by reference.
[0179] In some embodiments, a nucleic acid described by the
disclosure is conjugated to a polymer (e.g., a polymeric molecule)
or a folate molecule (e.g., folic acid molecule). Generally,
delivery of nucleic acids conjugated to polymers is known in the
art, for example as described in WO2000/34343 and WO2008/022309,
the contents of which are incorporated herein by reference. In some
embodiments, a nucleic acid described by the disclosure is
conjugated to a poly(amide) polymer, for example as described by
U.S. Pat. No. 8,987,377. In some embodiments, a nucleic acid
described by the disclosure is conjugated to a folic acid molecule
as described in U.S. Pat. No. 8,507,455, the contents of which are
incorporated herein by reference.
[0180] In some embodiments, a nucleic acid described by the
disclosure is conjugated to a carbohydrate, for example as
described in U.S. Pat. No. 8,450,467, the contents of which are
incorporated herein by reference.
[0181] Alternatively, nanocapsule formulations of the nucleic acid
may be used. Nanocapsules can generally entrap substances in a
stable and reproducible way. To avoid side effects due to
intracellular polymeric overloading, such ultrafine particles
(sized around 0.1 .mu.m) should be designed using polymers able to
be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate
nanoparticles that meet these requirements are contemplated for
use.
[0182] In some embodiments, a nucleic acid described by the
disclosure is delivered by a lipid nanoparticle. Generally, lipid
nanoparticles comprise an ionizable amino lipid (e.g.,
heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate,
DLin-MC3-DMA, a phosphatidylcholine
(1,2-distearoyl-sn-glycero-3-phosphocholine, DSPC), cholesterol and
a coat lipid (polyethylene glycol-dimyristolglycerol, PEG-DMG), for
example as disclosed by Tam et al. (2013). Advances in Lipid
Nanoparticles for siRNA delivery. Pharmaceuticals 5(3): 498-507. In
some embodiments, a lipid nanoparticle has a mean diameter between
about 10 and about 1000 nm. In some embodiments, a lipid
nanoparticle has a diameter that is less than 300 nm. In some
embodiments, a lipid nanoparticle has a diameter between about 10
and about 300 nm. In some embodiments, a lipid nanoparticle has a
diameter that is less than 200 nm. In some embodiments, a lipid
nanoparticle has a diameter between about 25 and about 200 nm. In
some embodiments, a lipid nanoparticle preparation (e.g.,
composition comprising a plurality of lipid nanoparticles) has a
size distribution in which the mean size (e.g., diameter) is about
70 nm to about 200 nm, and more typically the mean size is about
100 nm or less.
[0183] In some embodiments, a nucleic acid described by the
disclosure is delivered by a gold nanoparticle. Generally, a
nucleic acid can be covalently bound to a gold nanoparticle or
non-covalently bound to a gold nanoparticle (e.g., bound by a
charge-charge interaction), for example as described by Ding et al.
(2014). Gold Nanoparticles for Nucleic Acid Delivery. Mol. Ther.
22(6); 1075-1083. In some embodiments, gold nanoparticle-nucleic
acid conjugates are produced using methods described, for example,
in U.S. Pat. No. 6,812,334, the contents of which are incorporated
herein by reference.
[0184] In addition to the methods of delivery described above, the
following techniques are also contemplated as alternative methods
of delivering the nucleic acid compositions to a host. Sonophoresis
(e.g., ultrasound) has been used and described in U.S. Pat. No.
5,656,016 as a device for enhancing the rate and efficacy of drug
permeation into and through the circulatory system. Other drug
delivery alternatives contemplated are intraosseous injection (U.S.
Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898),
ophthalmic formulations (Bourlais et al., 1998), transdermal
matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208) and
feedback-controlled delivery (U.S. Pat. No. 5,697,899).
Delivery/Administration
[0185] In some embodiments, the disclosure provides a method of
delivering a heterologous nucleic acid to a cell (e.g., a host
cell), the method comprising delivering to the cell a nucleic acid
as described by the disclosure.
[0186] In some aspects, the disclosure provides transfected host
cells. A "host cell" refers to any cell that harbors, or is capable
of harboring, a substance of interest. A host cell may be used as a
recipient of a nucleic acid as described by the disclosure. The
term includes the progeny of the original cell which has been
transfected. Thus, a "host cell" as used herein may refer to a cell
which has been transfected with an exogenous DNA sequence (e.g., a
nucleic acid as described by the disclosure). It is understood that
the progeny of a single parental cell may not necessarily be
completely identical in morphology or in genomic or total DNA
complement as the original parent, due to natural, accidental, or
deliberate mutation.
[0187] In some embodiments, a host cell is a permissive cell. In
some embodiments, a host cell is not a permissive cell. Often a
host cell is a mammalian cell. In some aspects, the disclosure
provides a method of delivering a heterologous nucleic acid to a
subject comprising administering a host cell having a nucleic acid
as described by the disclosure to the subject. For example, in some
embodiments, a host cell is a blood cell, such as a human blood
cell, comprising a nucleic acid as described by the disclosure
(e.g., a nucleic acid having a heterologous nucleic acid insert
encoding a blood disease-associated transgene). Without wishing to
be bound by any particular theory, delivery of such a host cell is
useful, in some embodiments, for treatment of a disease or disorder
of the blood.
[0188] Aspects of the disclosure relate to the discovery that
nucleic acids as described herein elicit a reduced immune response
(e.g., do not elicit an immune response) in a host relative to
currently used viral and bacterially-derived gene therapy vectors.
In some aspects, the disclosure provides a method of delivering a
heterologous nucleic acid to a subject, the method comprising
delivering to the subject a nucleic acid as described by the
disclosure, wherein the delivery of the nucleic acid does not
result in an immune response against the nucleic acid in the
subject. In some embodiments, the immune response is a humoral
response. Humoral immune response refers to production of
antigen-specific antibodies by B lymphocytes. In some embodiments,
the immune response is a cellular response. A cellular immune
response refers to an immune response that does not involve
antibodies but rather activation of immune cells (e.g., phagocytes,
antigen-specific T-cells, macrophages, natural killer cells, etc.)
by an antigen (e.g., an exogenous nucleic acid).
[0189] Without wishing to be bound by any particular theory, the
lack of immune response elicited by administration of nucleic acids
as described by the disclosure allows the nucleic acids to be
administered to a host on multiple occasions. In some embodiments,
the number of occasions in which a heterologous nucleic acid is
delivered to a subject is in a range of 2 to 10 times (e.g., 2, 3,
4, 5, 6, 7, 8, 9, or 10 times). In some embodiments, a heterologous
nucleic acid is delivered to a subject more than 10 times.
[0190] In some embodiments, a dose of nucleic acid (e.g., ceDNA) is
administered to a subject no more than once per calendar day (e.g.,
a 24-hour period). In some embodiments, a dose of nucleic acid
(e.g., ceDNA) is administered to a subject no more than once per 2,
3, 4, 5, 6, or 7 calendar days. In some embodiments, a dose of
nucleic acid (e.g., ceDNA) is administered to a subject no more
than once per calendar week (e.g., 7 calendar days). In some
embodiments, a dose of nucleic acid (e.g., ceDNA) is administered
to a subject no more than bi-weekly (e.g., once in a two calendar
week period). In some embodiments, a dose of nucleic acid (e.g.,
ceDNA) is administered to a subject no more than once per calendar
month (e.g., once in 30 calendar days). In some embodiments, a dose
of nucleic acid (e.g., ceDNA)is administered to a subject no more
than once per six calendar months. In some embodiments, a dose of
nucleic acid (e.g., ceDNA) is administered to a subject no more
than once per calendar year (e.g., 365 days or 366 days in a leap
year).
[0191] As disclosed herein nucleic acids (including DNA expression
constructs that may be used to express them) may be administered by
any suitable route. For use in therapy, an effective amount of the
nucleic acid (e.g., oligonucleotide) and/or other therapeutic agent
can be administered to a subject by any mode that delivers the
agent to the desired tissue, e.g., muscle tissue. In some
embodiments, agents (e.g., nucleic acids) are administered
intramuscularly. Other suitable routes of administration include
but are not limited to oral, parenteral, intravenous,
intraperitoneal, intranasal, sublingual, intratracheal, inhalation,
subcutaneous, ocular, vaginal, and rectal. Systemic routes include
oral and parenteral. Several types of devices are regularly used
for administration by inhalation. These types of devices include
metered dose inhalers (MDI), breath-actuated MDI, dry powder
inhaler (DPI), spacer/holding chambers in combination with MDI, and
nebulizers.
[0192] For oral administration, the agents can be formulated
readily by combining the active compound(s) with pharmaceutically
acceptable carriers well known in the art. Such carriers enable the
agents of the disclosure to be formulated as tablets, pills,
dragees, capsules, liquids, gels, syrups, slurries, suspensions and
the like, for oral ingestion by a subject to be treated.
Pharmaceutical preparations for oral use can be obtained as solid
excipient, optionally grinding a resulting mixture, and processing
the mixture of granules, after adding suitable auxiliaries, if
desired, to obtain tablets or dragee cores. Suitable excipients
are, in particular, fillers such as sugars, including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for
example, maize starch, wheat starch, rice starch, potato starch,
gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl
cellulose, sodium carboxymethylcellulose, and/or
polyvinylpyrrolidone (PVP). If desired, disintegrating agents may
be added, such as the cross-linked polyvinyl pyrrolidone, agar, or
alginic acid or a salt thereof such as sodium alginate. Optionally
oral formulations may also be formulated in saline or buffers for
neutralizing internal acid conditions or may be administered
without any carriers.
[0193] Pharmaceutical preparations that can be used orally include
push fit capsules made of gelatin, as well as soft, sealed capsules
made of gelatin and a plasticizer, such as glycerol or sorbitol.
The push fit capsules can contain the active ingredients in
admixture with filler such as lactose, binders such as starches,
and/or lubricants such as talc or magnesium stearate and,
optionally, stabilizers. In soft capsules, the active agents may be
dissolved or suspended in suitable liquids, such as fatty oils,
liquid paraffin, or liquid polyethylene glycols. In addition,
stabilizers may be added. Microspheres formulated for oral
administration may also be used. Such microspheres have been well
defined in the art. Formulations for oral administration are
typically in dosages suitable for such administration.
[0194] For buccal administration, the compositions may take the
form of tablets or lozenges formulated in conventional manner.
[0195] For administration by inhalation, agents (e.g., nucleic
acids) for use according to the present disclosure may be
conveniently delivered in the form of an aerosol spray presentation
from pressurized packs or a nebulizer, with the use of a suitable
propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of e.g., gelatin for use in an inhaler or insufflator
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0196] The agents (e.g., nucleic acids), when it is desirable to
deliver them systemically, may be formulated for parenteral
administration by injection, e.g., by bolus injection or continuous
infusion. Formulations for injection may be presented in unit
dosage form, e.g., in ampoules or in multi-dose containers, with an
added preservative. The compositions may take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles,
and may contain formulatory agents such as to suspending,
stabilizing and/or dispersing agents.
[0197] Pharmaceutical formulations for parenteral administration
include aqueous solutions of agents (e.g., antisense nucleic acids)
in water-soluble form. Additionally, suspensions of agents may be
prepared as appropriate oily injection suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame
oil, or synthetic fatty acid esters, such as ethyl oleate or
triglycerides, or liposomes. Aqueous injection suspensions may
contain substances that increase the viscosity of the suspension,
such as sodium carboxymethyl cellulose, sorbitol, or dextran.
Optionally, the suspension may also contain suitable stabilizers or
agents that increase the solubility of the agents to allow for the
preparation of highly concentrated solutions. Alternatively, agents
(e.g., nucleic acids) may be in powder form for constitution with a
suitable vehicle, e.g., sterile pyrogen-free water, before use.
Agents (e.g., nucleic acids) may also be formulated in rectal or
vaginal compositions such as suppositories or retention enemas,
e.g., containing conventional suppository bases such as cocoa
butter or other glycerides.
[0198] Other delivery systems can include time-release, delayed
release or sustained release delivery systems. Such systems can
avoid repeated administrations of the agents (e.g., antisense
nucleic acids), increasing convenience to the subject and the
physician. Many types of release delivery systems are available.
They include polymer base systems such as poly(lactide glycolide),
copolyoxalates, polycaprolactones, polyesteramides,
polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
Delivery systems also include non-polymer systems that are: lipids
including sterols such as cholesterol, cholesterol esters and fatty
acids or neutral fats such as mono, di, and tri glycerides;
hydrogel release systems; silastic systems; peptide-based systems;
wax coatings; compressed tablets using conventional binders and
excipients; partially fused implants; and others disclosed
herein.
EXAMPLES
Example 1
Interrupted Self-Complementary Nucleic Acid Sequences
[0199] FIG. 1A shows a non-limiting example of an interrupted
self-complementary nucleic acid sequence (which is an AAV2 ITR). As
shown in the FIG. 1A, the nucleic acid forms a T-shaped hairpin
structure having a stem portion (D-A-A') and a cross-arm sequence
having opposing lengthwise stem-loops (B-B' and C-C'). The trs and
RBE of the interrupted self-complementary nucleic acid sequence are
also depicted. FIG. 1B shows several non-limiting examples of
truncations in the "C-arm" of an interrupted self-complementary
nucleic acid sequence. A graphic depiction of one example of
asymmetric AAV2 ITRs is shown in FIG. 3.
Replication of ceDNA from Asymmetric AAV ITRs
[0200] Adeno-associated virus (AAV) genomes are linear
single-stranded DNA flanked by terminal palindromes typically
referred to as inverted terminal repeats (ITRs) (FIG. 2A, left
side). Except for 7 unpaired bases, the 145 nt ITR sequence is
self-complementary and forms an energetically stable "T" shaped
hairpin (AG.apprxeq.-72.4 kcal per mol, Tm >80.degree. C.) (FIG.
1A). During virus DNA replication, the cellular DNA polymerase
complex initiates synthesis at the 3'-terminus of the template
strand where the partial duplex formed by the ITR serves as the
primer for primer extension. The replicative intermediate formed is
an intramolecular duplex with the template and nascent strands
covalently connected by the ITR. During a productive infection, a
process called terminal resolution resolves the intra-strand ITR
resulting in two full-length, complementary virus genomes (FIG. 2B,
left side).
[0201] In the absence of AAV cap gene expression, an AAV vector
genome having asymmetrical ITRs undergoes inefficient replication,
and the replication products accumulate in a novel conformation of
closed-ended linear duplex DNA (ceDNA). Due to inefficient
replication (e.g., incomplete terminal resolution), the
complementary strands of the intramolecular intermediate are now
covalently linked through the ITRs on both ends of the genome (FIG.
2B, right side). Thus, in native conditions, ceDNA behaves as
linear duplex DNA, however, in denaturing conditions, ceDNA strands
melt apart, but remain linked, therefore transforming the linear
duplex molecule into single-stranded circular DNA.
[0202] In some embodiments, ceDNA production from asymmetric AAV
ITRs is dependent on a truncated ITR at one end and an operative
(e.g., functional), wild-type (wt) or wt-like ITR on the opposite
end of the transgene cassette. In some embodiments, the truncated
ITR is inefficiently processed during the replication cycles of
ceDNA in the Sf9 cells leading to an accumulation of replication
intermediates, duplex monomer, duplex dimers, etc. In the absence
of structural (capsid) protein expression, Rep 78 (or Rep 68)
assembles on the intact ITRs and catalyze the site-specific nicking
at the terminal resolution site. The reaction results in the
formation of a transient tyrosine-phosphodiester (Y156 for AAV2 Rep
78 covalently linked to the 5' thymidine of the terminal resolution
site 5'AGTTGG). The transient nucleoprotein complex then transfers
the donor strand to the free 3'-terminus of the complementary
strand. The ceDNA conformation therefore, results from the
defective ITR on one end of the vector genome, an intact or
operative ITR on the opposite end, and the co-expression of the p5
and p19 Rep proteins, where at least one p5 and one p19 Rep are
expressed. Other parvovirus "small" Rep or NS proteins can
substitute for AAV p19 Rep protein (Rep 52 and Rep 40). Since these
small Rep proteins are non-processive, monomeric helicases, it is
feasible that non-parvoviridae super family 2 (SF2) helicases can
substitute for the AAV Rep proteins.
[0203] The dependovirinae have existed relatively unchanged for
tens of millions (and likely, hundreds of millions) of years. It is
hypothesized that they have developed a homeostatic or symbiotic
relationship with their hosts in which the provirus in latently
infected cells often localizes to the AAVS1 locus on human
chromosome 19q, which appears to have no adverse effect on the host
cell. While in latency, AAV gene expression is repressed by
cellular factors, e.g., YY1, and by the p5 Rep proteins that acting
servomechanistically, negatively regulate expression from the p5
and p40 promoters. Thus, latently infected cells have little or no
detectable AAV proteins and limit the acquired immune response to
cells that are synthesizing virus proteins.
Example 2
Purification of ceDNA
[0204] Plasmid purification protocols typically utilize silica gels
for small plasmid quantities preparations or anion exchange
chromatography diethylaminoethyl sepharose, (DEAE-sepharose, for
example) for larger quantities. For large-scale pDNA purification,
the Escherichia coli bacteria are lysed with sodium dodecyl sulfate
(SDS) and the cell proteins and genomic DNA are precipitated by
denaturation/neutralization cycle retaining the plasmid in
solution. The renatured double-stranded pDNA binds to the
positively charged DEAE group and following washing steps, the pDNA
is displaced and eluted with a high salt buffer solution.
[0205] Alternatively, silica gel membranes may be used for
selective pDNA adsorption from the clarified bacterial lysate under
high salt conditions and eluted in low or no iconicity buffer.
[0206] It was observed that ceDNA can be readily purified with the
small scale silica gel-based process. Using the large-scale anion
exchange protocol, ceDNA recovery was very inefficient and resulted
in low yields.
[0207] A method for large-scale ceDNA purification from
invertebrate Sf9 cells using silica gel membranes is described.
Increasing the surface area of modified silica gel membrane (or
chromatography medium) is one approach to improve the flow rate,
adsorption, and recovery of ceDNA. Standard filter capsules are
available in a wide-range of configurations ranging in size from
0.5 cm diameter to 20 cm diameter or more. The capsule may contain
a single layer of silica gel membrane on a chemically inert
support, or stacks of membranes separated by inert supports, or
pleated membranes utilizing horizontal flow design. Tangential flow
filtration (TFF) and hollow fiber filtration (HFF) are alternatives
for the coaxial flow capsule filtration.
Example 3
ceDNA Constructs for Treatment of Disease
[0208] FIG. 4 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with ocular
disease. The first nucleic acid construct of FIG. 4 depicts a
non-limiting example of a nucleic acid molecule for treatment of
Stargardt's disease. The nucleic acid comprises a pair of
asymmetrical interrupted self-complementary nucleic acid sequences
(e.g., asymmetric AAV2 ITRs) flanking a heterologous nucleic acid
insert encoding the ATP-Binding Cassette, Sub-Family A (ABC1),
Member 4 (ABCA4) protein. The AAV2 ITRs are asymmetric because one
of the AAV2 ITRs (right side) contains a deletion in the C-stem
region. Each interrupted self-complementary nucleic acid sequence
includes an operative Rep-binding element (RBE) and an operative
terminal resolution site (trs). The nucleic acid also encodes a
hBglobin intron 2 positioned 5' to the heterologous nucleic acid
insert, and a hGH poly(A) signal positioned 3' to the heterologous
nucleic acid insert.
[0209] The second nucleic acid construct in FIG. 4 depicts a
non-limiting example of a nucleic acid molecule for treatment of
Usher's disease. The nucleic acid comprises a pair of asymmetrical
interrupted self-complementary nucleic acid sequences (e.g.,
asymmetric AAV2 ITRs) flanking a heterologous nucleic acid insert
encoding usherin protein (USH2A) variant 1. The AAV2 ITRs are
asymmetric because one of the AAV2 ITRs (right side) contains a
deletion in the C-stem region. Each interrupted self-complementary
nucleic acid sequence includes an operative Rep-binding element
(RBE) and an operative terminal resolution site (trs). The nucleic
acid also encodes a CMV promoter and a T7 promoter positioned 5' to
the heterologous nucleic acid insert, and a bGH poly(A) signal
positioned 3' to the heterologous nucleic acid insert.
[0210] The third nucleic acid construct in FIG. 4 depicts a
non-limiting example of a nucleic acid molecule for treatment of
macular degeneration/neovascularization. The nucleic acid comprises
a pair of asymmetrical interrupted self-complementary nucleic acid
sequences (e.g., asymmetric AAV2 ITRs) flanking a heterologous
nucleic acid insert encoding vascular endothelial growth factor
receptor (VEGFR). The AAV2 ITRs are asymmetric because one of the
AAV2 ITRs (right side) contains a deletion in the C-stem region.
Each interrupted self-complementary nucleic acid sequence includes
an operative Rep-binding element (RBE) and an operative terminal
resolution site (trs). The nucleic acid also encodes a CMV promoter
and a T7 promoter positioned 5' to the heterologous nucleic acid
insert, and a bGH poly(A) signal positioned 3' to the heterologous
nucleic acid insert.
[0211] The fourth nucleic acid construct in FIG. 4 depicts a
non-limiting example of a nucleic acid molecule for treatment of
Leber's congenital amaurosis. The nucleic acid comprises a pair of
asymmetrical interrupted self-complementary nucleic acid sequences
(e.g., asymmetric AAV2 ITRs) flanking a heterologous nucleic acid
insert encoding centrosomal protein 290 (CEP290). The AAV2 ITRs are
asymmetric because one of the AAV2 ITRs (right side) contains a
deletion in the C-stem region. Each interrupted self-complementary
nucleic acid sequence includes an operative Rep-binding element
(RBE) and an operative terminal resolution site (trs). The nucleic
acid also encodes a CMV promoter and a T7 promoter positioned 5' to
the heterologous nucleic acid insert, and a bGH poly(A) signal
positioned 3' to the heterologous nucleic acid insert.
[0212] FIG. 5 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with blood
disease. The first nucleic acid construct in FIG. 5 depicts a
non-limiting example of a nucleic acid molecule for treatment of
Hemophilia A. The nucleic acid comprises a pair of asymmetrical
interrupted self-complementary nucleic acid sequences (e.g.,
asymmetric AAV2 ITRs) flanking a heterologous nucleic acid insert
encoding B-domain deleted factor VIII protein (BDD-FVIII). The AAV2
ITRs are asymmetric because one of the AAV2 ITRs (right side)
contains a deletion in the C-stem region. Each interrupted
self-complementary nucleic acid sequence includes an operative
Rep-binding element (RBE) and an operative terminal resolution site
(trs). The nucleic acid also encodes a CMV promoter/enhancer and a
T7 promoter positioned 5' to the heterologous nucleic acid insert,
and a bGH poly(A) signal positioned 3' to the heterologous nucleic
acid insert.
[0213] The second nucleic acid construct in FIG. 5 depicts a
non-limiting example of a nucleic acid molecule for treatment of
Hemophilia A. The nucleic acid comprises a pair of asymmetrical
interrupted self-complementary nucleic acid sequences (e.g.,
asymmetric AAV2 ITRs) flanking a heterologous nucleic acid insert
encoding full-length factor VIII protein (FVIII), which exceeds the
cloning capacity of traditional AAV vectors. The AAV2 ITRs are
asymmetric because one of the AAV2 ITRs (right side) contains a
deletion in the C-stem region. Each interrupted self-complementary
nucleic acid sequence includes an operative Rep-binding element
(RBE) and an operative terminal resolution site (trs). The nucleic
acid also encodes a CMV promoter/enhancer and a T7 promoter
positioned 5' to the heterologous nucleic acid insert, and a bGH
poly(A) signal positioned 3' to the heterologous nucleic acid
insert.
[0214] The third nucleic acid construct in FIG. 5 depicts a
non-limiting example of a nucleic acid molecule for treatment of
von Willebrand factor disease. The nucleic acid comprises a pair of
asymmetrical interrupted self-complementary nucleic acid sequences
(e.g., asymmetric AAV2 ITRs) flanking a heterologous nucleic acid
insert encoding von Willebrand factor (vWF). The AAV2 ITRs are
asymmetric because one of the AAV2 ITRs (right side) contains a
deletion in the C-stem region. Each interrupted self-complementary
nucleic acid sequence includes an operative Rep-binding element
(RBE) and an operative terminal resolution site (trs). The nucleic
acid also encodes a CMV promoter and a T7 promoter positioned 5' to
the heterologous nucleic acid insert, and a bGH poly(A) signal
positioned 3' to the heterologous nucleic acid insert.
[0215] FIG. 6 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with liver
disease. The first nucleic acid construct in FIG. 6 depicts a
non-limiting example of a nucleic acid molecule for treatment of
hypercholesterolemia. The nucleic acid comprises a pair of
asymmetrical interrupted self-complementary nucleic acid sequences
(e.g., asymmetric AAV2 ITRs) flanking a heterologous nucleic acid
insert encoding lecithin cholesterol acetyl transferase. The AAV2
ITRs are asymmetric because one of the AAV2 ITRs (right side)
contains a deletion in the C-stem region. Each interrupted
self-complementary nucleic acid sequence includes an operative
Rep-binding element (RBE) and an operative terminal resolution site
(trs). The nucleic acid also encodes a CMV promoter/enhancer and a
T7 promoter positioned 5' to the heterologous nucleic acid insert,
and a bGH poly(A) signal positioned 3' to the heterologous nucleic
acid insert.
[0216] The second nucleic acid construct in FIG. 6 depicts a
non-limiting example of a nucleic acid molecule for treatment of
phenylketonuria (PKU). The nucleic acid comprises a pair of
asymmetrical interrupted self-complementary nucleic acid sequences
(e.g., asymmetric AAV2 ITRs) flanking a heterologous nucleic acid
insert encoding phenylalanine hydroxylase (PAH). The AAV2 ITRs are
asymmetric because one of the AAV2 ITRs (right side) contains a
deletion in the C-stem region. Each interrupted self-complementary
nucleic acid sequence includes an operative Rep-binding element
(RBE) and an operative terminal resolution site (trs). The nucleic
acid also encodes a CMV promoter/enhancer and a T7 promoter
positioned 5' to the heterologous nucleic acid insert, and a bGH
poly(A) signal positioned 3' to the heterologous nucleic acid
insert.
[0217] The third nucleic acid construct in FIG. 6 depicts a
non-limiting example of a nucleic acid molecule for treatment of
Glycogen Storage Disease 1 (GSD1). The nucleic acid comprises a
pair of asymmetrical interrupted self-complementary nucleic acid
sequences (e.g., asymmetric AAV2 ITRs) flanking a heterologous
nucleic acid insert encoding glucose 6-phosphatase catalytic
subunit (G6PC). The AAV2 ITRs are asymmetric because one of the
AAV2 ITRs (right side) contains a deletion in the C-stem region.
Each interrupted self-complementary nucleic acid sequence includes
an operative Rep-binding element (RBE) and an operative terminal
resolution site (trs). The nucleic acid also encodes a CMV
promoter/enhancer and a T7 promoter positioned 5' to the
heterologous nucleic acid insert, and a bGH poly(A) signal
positioned 3' to the heterologous nucleic acid insert.
[0218] FIG. 7 shows non-limiting examples of nucleic acid
constructs having asymmetric self-complementary nucleic acid
sequences (e.g., AAV2 ITRs) and a transgene associated with lung
disease. The first nucleic acid construct in FIG. 7 depicts a
non-limiting example of a nucleic acid molecule for treatment of
cystic fibrosis. The nucleic acid comprises a pair of asymmetrical
interrupted self-complementary nucleic acid sequences (e.g.,
asymmetric AAV2 ITRs) flanking a heterologous nucleic acid insert
encoding cystic fibrosis transmembrane conductance regulator
(CFTR). The AAV2 ITRs are asymmetric because one of the AAV2 ITRs
(right side) contains a deletion in the C-stem region. Each
interrupted self-complementary nucleic acid sequence includes an
operative Rep-binding element (RBE) and an operative terminal
resolution site (trs). The nucleic acid also encodes a CMV
promoter/enhancer and a T7 promoter positioned 5' to the
heterologous nucleic acid insert, and a bGH poly(A) signal
positioned 3' to the heterologous nucleic acid insert.
[0219] The second nucleic acid construct in FIG. 7 depicts a
non-limiting example of a nucleic acid molecule for treatment of
alpha-1 antitrypsin deficiency. The nucleic acid comprises a pair
of asymmetrical interrupted self-complementary nucleic acid
sequences (e.g., asymmetric AAV2 ITRs) flanking a heterologous
nucleic acid insert encoding alpha-1 antitrypsin (AAT). The AAV2
ITRs are asymmetric because one of the AAV2 ITRs (right side)
contains a deletion in the C-stem region. Each interrupted
self-complementary nucleic acid sequence includes an operative
Rep-binding element (RBE) and an operative terminal resolution site
(trs). The nucleic acid also encodes a CMV promoter/enhancer and a
T7 promoter positioned 5' to the heterologous nucleic acid insert,
and a bGH poly(A) signal positioned 3' to the heterologous nucleic
acid insert.
Example 4
In Vivo Studies: Hydrodynamic Delivery of Naked DNA in Normal Male
ICR Mice
[0220] After infusing pDNA into mouse tail veins, lacZ expression
decreased continuously between 24 hr and 5 weeks, corresponding to
the quantity of pDNA per diploid genome. Mouse livers treated with
ceDNA having asymmetric interrupted self-complementary sequences
showed no change in lacZ activity between 24 hr and 1 week, however
expression was substantially reduced at 5wks. However, ceDNA in
hepatocytes remained essentially unchanged at the 5wk point.
Similar results were obtained with thyroxine binding globulin
promoter (TBG) GFP cassettes: little or no GFP expression and pDNA
were detectable after 10 wks, whereas ceDNA TBG-GFP expression and
DNA levels remained unchanged between 1 and 10 weeks.
Example 5
Ocular Delivery of ceDNA
[0221] Direct GFP fluorescence was observed uniformly in cells
spanning the width of the retina. FIGS. 8A-8D show delivery of
ceDNA having asymmetric interrupted self-complementary sequences to
the eye. Adult mice were anesthetized by Ketamine/Xylazine (100/10
mg/kg) and the transfection agent was delivered intravitreally by a
trans scleral injection of a volume of 1-2 .mu.l. Antibiotic
ointment was applied on cornea to prevent eye from drying while the
mouse was recovering. Mouse was allowed to recover at 37 degree and
then placed back into the mouse room for 2 weeks and the euthanized
by CO.sub.2 asphyxiation. Retina was dissected and processed for
flat mount or section. No GFP antibody staining was necessary to
detect transfected cells. FIG. 8A shows a flat mount of GFP
fluorescence on a mouse retina. FIG. 8B shows GFP fluorescence in a
cross section of the retina. FIG. 8C shows GFP fluorescence and
glial cell staining in a cross section of the retina. FIG. 8D shows
GFP fluorescence in mouse retina after delivery of ceDNA by
sub-retinal electroporation (top) and intravitreal injection
(bottom).
Example 6
In Vivo Studies: Intrastriatal Delivery in Rats
[0222] ceDNA-GFP (ceDNA having asymmetric interrupted
self-complementary sequences) was formulated with a commercially
available transfection reagent, in vivo jetPEI, under an
appropriate concentration (Polyplus Corp.) and injected into
intracranially into rat striatum (FIG. 9A). Rats were sacrificed 3
wks and 20 wks post-injection and following processing, brain
sections were examined using immunohistochemistry (IHC) with
antibodies (Abs) against GFP, MHCII, and Iba1. Similar GFP
expression was seen at 3 wks and 20 wks. At 3 wks, no MHCII or Iba1
antigen was detected in the brain sections, as shown in FIGS.
9B-9C.
Example 7
Sf9 Infection to Produce ceDNA
[0223] Transposition into Bacmid
[0224] DH10Bac competent cells (Invitrogen) were thawed on ice. 50
.mu.l of cells were dispensed into 14 ml tubes, add 50 ng of
plasmid DNA (e.g., a plasmid comprising a protein-encoding
transgene flanked by asymmetric interrupted self-complementary
sequences) and gently mix. The DNA sequence of the plasmid
described in this example is represented by SEQ ID NO: 25. The DNA
sequence of the region of the plasmid comprising a protein-encoding
transgene flanked by asymmetric interrupted self-complementary
sequences is represented by SEQ ID NO: 26
[0225] Sequence analysis of the plasmid DNA interrupted
self-complementary sequences is shown in FIGS. 10A-10E. The 5'
self-complementary sequence (referred to as the head portion, which
is upstream of the coding sequence of the transgene) is shown in
FIGS. 10A-10C. This was sequenced using a primer complementary with
the CMV promoter of the plasmid construct. FIGS. 10A-10C shows a
restriction map of the plasmid in the region of the 5'
self-complementary sequence. Two runs of the plasmid sequence
results are aligned with a reference sequence, which is a wild-type
AAV2 ITR sequence.
[0226] The 3' self-complementary sequence (referred to as the tail
portion, which is downstream of the coding sequence of the
transgene) is shown in FIGS. 10D-10E. This was sequenced using a
primer complementary with the SV40 promoter of the plasmid
construct. FIGS. 10D-10E shows a restriction map of the plasmid in
the region of the 3' self-complementary sequence. Two runs of the
plasmid sequence results are aligned with a reference sequence,
which is a wild-type AAV2 ITR sequence. The results show a
truncation within the self-complementary sequence with corresponds
to one arm of the cross-arm structure.
[0227] These results confirm that the plasmid DNA construct encodes
a transgene flanked by asymmetric interrupted self-complementary
sequences. The asymmetry arises because the 5' self-complementary
sequence encodes a complete cross-arm; whereas the 3'
self-complementary sequence encodes a truncated cross-arm.
[0228] The tubes were then incubated on ice for 30 min and then
heat shocked in 42.degree. C. water bath for 45 sec. Tubes were
then chilled on ice for 2 min. 450 .mu.l of SOC media was added to
the tubes and they were shaken in a 37.degree. C. incubator for 4
hrs. Aliquots were diluted 1:10 and 50 .mu.l were plated on agar
plates containing 50 .mu.g/ml kanamycin, 7 .mu.g/ml gentamicin, 10
.mu.g/ml tetracycline, 100 .mu.g/ml Bluo-gal and 40 .mu.g/ml IPTG.
Plates were incubated 48 hrs at 37.degree. C. or 72 hrs at
30.degree. C. A single white colony was picked, and struck on a
fresh plate to make sure it was not contaminated with a blue
colony, then incubated overnight. Glycerol stocks were created.
Prepare DNA from Bacmid
[0229] The bacmid was incubated into 10 ml LB media with 50
.mu.g/ml kanamycin, 7 .mu.g/ml gentamycin, 10 .mu.g/ml tetracycline
and grown in a 37.degree. C. shaking incubator overnight. The
culture was spun down at 8000 rpm for 10 min. The supernatant was
removed and the pellet was resuspended in 1.5 ml of P1 buffer from
a Qiagen extraction kit. 1.5 ml of Buffer 2 was added and the tube
was inverted 4-6 times. 2.1 ml of Buffer P3 was added and the tube
was inverted 4-6 times. The precipitants were passed through a
Qiagen syringe filter and centrifuged 8000 rpm for 10 min. The
clean lysis solution was transferred to a tube containing 5 ml of
isopropanol and mixed well and centrifuged at 4.degree. C. for 30
min at maximum speed. The supernatant was removed and 3 ml of 70%
ethanol was added to wash the pellet. The pellet was then spun at
8000 rpm for 10 min. The pellet was then washed and air dried. The
DNA was then resuspended in 200 .mu.l TE buffer. An aliquot was
removed and optical density (OD) at 260 nm was read to quantify DNA
concentration.
Production of P1 Baculovirus Expression Vectors (BEV)
[0230] A total of 4.times.10.sup.6 Sf9 cells were seeded in 5 ml of
media in T25 TC flask. The flask was placed on a horizontal surface
during cell attachment so that the cells will be uniformly
distributed. Generally, cells attach within 15 min. 1 .mu.g of
Bacmid DNA was diluted in 75 .mu.l of water. 6 .mu.l of Promega
Fugene HD was diluted into 69 .mu.l of water in a separate tube.
The diluted Fugene HD was mixed with diluted DNA by pipetting up
and down several times. After 15 min, the DNA/lipid complexes were
added to the Sf9 cells. P1 baculovirus expression vector (BEV) were
harvested after 4 days. Briefly, all media was removed from the
flask using a 5 ml pipet and transferred to 15 ml a polystyrene
tube. The container was spun at 1200 g for 10 min to pellet any
cells or debris that might have been picked up. BEV were decanted
into a fresh 15 ml tube and virus was stored at 4.degree. C.
Production of Baculovirus-Infected Insect Cells (Biics)
[0231] 50 ml of Sf9 cells were infected at a concentration of
2.5.times.10.sup.6 cells/ml with 1 ml of BEV (1:50). Cells were
counted and their diameter was checked on day 1 (e.g., checked to
see if the cell count reaches 2.times.10.sup.6/ml and cells measure
.about.15-16 .mu.m in diameter) and day 2 (e.g., checked to see if
the cell count reaches between 4-5.times.10.sup.6 cells/ml and the
diameter measures .about.18-19 .mu.m). Cells were spun down when
they look infected at 300.times.g for 5 min. The supernatant was
removed and the pellet was resuspended in freezing media to have a
final concentration of 20 .times.10.sup.7 cells/ml. Cells can be
frozen at -80.degree. C. in rack with isopropanol for storage.
Test Efficiency of Infectivity for Titerless Infected Baculovirus
Stock (TIPS)
[0232] Four flasks of 20 ml at 2.5.times.10.sup.6 cells/ml were
prepared. Cells were infected with 4 different dilutions of
titerless infected baculovirus stock (TIPS), for example 1/1,000,
1/10,000, 1/50,000, 1/100,000. Cells were grown and diameter,
viability and cell counts were assessed for 3 days. To determine
the efficiency of TIPS stock check which dilution reached the
following criteria after 3 days: viable cells 4 to 5
.times.10.sup.5 cells/ml, viability 85 to 95%, diameter 18 to 20
.mu.m.
Production of ceDNA:
[0233] 2.5 .times.10.sup.6 cells/ml Sf9 cells were co-infected with
TIPS for Rep protein and transgene of interest (e.g., GFP). After
4-5 days cells were observed for diameter and viability. Cells in
the pellet were collected by spinning down in a centrifuge at 4150
rpm for 30 min. Cells were then frozen or ceDNA was extracted, for
example by Qiagen Midi Plus purification protocol.
Analysis of ceDNA
[0234] ceDNA were analyzed by native gel electrophoresis and/or
denaturing gel electrophoresis, with restriction digestion. For
example a single cut restriction enzyme approximately 2/3 into the
ceDNA sequence between ITRs was selected, and the resulting
restriction digest products were run on an agarose gel.
[0235] FIG. 10F shows the .about.4.5 kb of a ceDNA comprising a GFP
transgene (ceDNA-GFP) was electrophoretically separated into
different conformers (e.g., monomer, dimer, trimer, etc.) under
native (left) and denaturing (right) conditions, following
digestion with the single-cutter, XhoI.
[0236] On a native gel (FIG. 10F, left), the monomers were resolved
into two products: 2.1 kb and 0.4 kb. The dimers were resolved into
either 4.1 kb/0.4 kb products, or 4.1 kb/0.8 kb products, depending
upon the orientation (e.g., tail-to-tail, or head-to-head) of the
dimer subunits. The products that result from tail-to-tail
organization of the dimer were indicated by the downward pointing
arrows. The 0.4 kb terminal fragment was obscured by the
fluorescence of the impurities at the bottom of the gel. The upward
facing arrows indicate the products resulting from the head-to-head
dimer. Heavy weighted lines indicate the position of the truncated
ITR. In the monomer, the deleted ITR was on the right side of the
ceDNA molecule and in the tail-to-tail dimer, the truncated ITR was
internal (at the mirror plane). In the head-to-head conformation,
the truncated ITR would be at the ends of the molecule.
[0237] On a denaturing gel (FIG. 10F, right), the dimeric ceDNA-GFP
produced a band at 4.1 kb and 0.8 kb (which correlates to the
denatured 0.4 kb terminal products running on the gel as a 0.8 kb
single-stranded DNA). As described above, the predicted products
for head-to-head ceDNA-GFP dimers were 0.8 kb and 4.1 kb on native
gels, and 0.8 kb and 8.2 kb on denaturing gels. The denaturing gel
shows no band at 8.2 kb and therefore indicates that the
predominant form of the ceDNA-GFP dimer was tail-to-tail.
[0238] While several embodiments of the present invention have been
described and illustrated herein, those of ordinary skill in the
art will readily envision a variety of other means and/or
structures for performing the functions and/or obtaining the
results and/or one or more of the advantages described herein, and
each of such variations and/or modifications is deemed to be within
the scope of the present invention. More generally, those skilled
in the art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the teachings of the present invention
is/are used. Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. It is, therefore, to be understood that the foregoing
embodiments are presented by way of example only and that, within
the scope of the appended claims and equivalents thereto, the
invention may be practiced otherwise than as specifically described
and claimed. The present invention is directed to each individual
feature, system, article, material, and/or method described herein.
In addition, any combination of two or more such features, systems,
articles, materials, and/or methods, if such features, systems,
articles, materials, and/or methods are not mutually inconsistent,
is included within the scope of the present invention.
[0239] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0240] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified unless clearly
indicated to the contrary. Thus, as a non-limiting example, a
reference to "A and/or B," when used in conjunction with open-ended
language such as "comprising" can refer, in one embodiment, to A
without B (optionally including elements other than B); in another
embodiment, to B without A (optionally including elements other
than A); in yet another embodiment, to both A and B (optionally
including other elements); etc.
[0241] As used herein in the specification and in the claims, "or"
should be understood to have the same meaning as "and/or" as
defined above. For example, when separating items in a list, "or"
or "and/or" shall be interpreted as being inclusive, i.e., the
inclusion of at least one, but also including more than one, of a
number or list of elements, and, optionally, additional unlisted
items. Only terms clearly indicated to the contrary, such as "only
one of" or "exactly one of," or, when used in the claims,
"consisting of" will refer to the inclusion of exactly one element
of a number or list of elements. In general, the term "or" as used
herein shall only be interpreted as indicating exclusive
alternatives (i.e. "one or the other but not both") when preceded
by terms of exclusivity, such as "either," "one of" "only one of"
or "exactly one of" "Consisting essentially of" when used in the
claims, shall have its ordinary meaning as used in the field of
patent law.
[0242] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0243] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," and the like are to
be understood to be open-ended, i.e., to mean including but not
limited to. Only the transitional phrases "consisting of" and
"consisting essentially of" shall be closed or semi-closed
transitional phrases, respectively, as set forth in the United
States Patent Office Manual of Patent Examining Procedures, Section
2111.03.
[0244] Use of ordinal terms such as "first," "second," "third,"
etc., in the claims to modify a claim element does not by itself
connote any priority, precedence, or order of one claim element
over another or the temporal order in which acts of a method are
performed, but are used merely as labels to distinguish one claim
element having a certain name from another element having a same
name (but for use of the ordinal term) to distinguish the claim
elements.
Sequence CWU 1
1
14112DNAArtificial SequenceSynthetic Polynucleotide 1gctcgctcgc tc
12242DNAArtificial SequenceSynthetic Polynucleotide 2cgggcgacca
aaggtcgccc gacgcccggg ctttgcccgg gc 42342DNAArtificial
SequenceSynthetic Polynucleotide 3gcccgggcaa agcccgggcg tcgggcgacc
tttggtcgcc cg 424145DNAArtificial SequenceSynthetic Polynucleotide
4ttggccactc cctctctgcg cgctcgctcg ctcactgagg ccgggcgacc aaaggtcgcc
60cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc gagcgcgcag agagggagtg
120gccaactcca tcactagggg ttcct 1455145DNAArtificial
SequenceSynthetic Polynucleotide 5aaccggtgag ggagagacgc gcgagcgagc
gagtgactcc ggcccgctgg tttccagcgg 60gctgcgggcc cgaaacgggc ccgccggagt
cactcgctcg ctcgcgcgtc tctccctcac 120cggttgaggt agtgatcccc aagga
1456145DNAArtificial SequenceSynthetic Polynucleotide 6aggaacccct
agtgatggag ttggccactc cctctctgcg cgctcgctcg ctcactgagg 60ccgggcgacc
aaaggtcgcc cgacgcccgg gctttgcccg ggcggcctca gtgagcgagc
120gagcgcgcag agagggagtg gccaa 1457145DNAArtificial
SequenceSynthetic Polynucleotide 7tccttgggga tcactacctc aaccggtgag
ggagagacgc gcgagcgagc gagtgactcc 60ggcccgctgg tttccagcgg gctgcgggcc
cgaaacgggc ccgccggagt cactcgctcg 120ctcgcgcgtc tctccctcac cggtt
1458144DNAArtificial SequenceSynthetic Polynucleotide 8aggaacccta
gtgatggagt tggccactcc ctctctgcgc gctcgctcgc tcactgaggc 60cgcccgggca
aagcccgggc gtcgggcgac ctttggtcgc ccggcctcag tgagcgagcg
120agcgcgcaga gagggagtgg ccaa 144924DNAArtificial SequenceSynthetic
Polynucleotide 9cccgtgcggg cccaaagggc ccgc 241043DNAArtificial
SequenceSynthetic Polynucleotide 10gcccgctggt ttccagcggg ctgcgggccc
gaaacgggcc cgc 431128DNAArtificial SequenceSynthetic Polynucleotide
11cgggcccgtg cgggcccaaa gggcccgc 281228DNAArtificial
SequenceSynthetic Polynucleotide 12gcccgggcac gcccgggttt cccgggcg
281322DNAArtificial SequenceSynthetic Polynucleotide 13cgtgcgggcc
caaagggccc gc 221443DNAArtificial SequenceSynthetic Polynucleotide
14gcgggccgga aacgggcccg ctgcccgctg gtttccagcg ggc 43
* * * * *