U.S. patent application number 17/690364 was filed with the patent office on 2022-06-23 for tobacco having altered leaf properties and methods of making and using.
This patent application is currently assigned to ALTRIA CLIENT SERVICES LLC. The applicant listed for this patent is ALTRIA CLIENT SERVICES LLC. Invention is credited to Marcos Fernando de Godoy Lusso, Alec J. Hayes, Chengalrayan Kudithipudi, Jerry Whit Morris.
Application Number | 20220192250 17/690364 |
Document ID | / |
Family ID | |
Filed Date | 2022-06-23 |
United States Patent
Application |
20220192250 |
Kind Code |
A1 |
Kudithipudi; Chengalrayan ;
et al. |
June 23, 2022 |
Tobacco Having Altered Leaf Properties and Methods of Making and
Using
Abstract
This disclosure provides tobacco plants containing a PMT RNAi
and tobacco plants having a mutation in PMT, and methods of making
and using such plants.
Inventors: |
Kudithipudi; Chengalrayan;
(Midlothian, VA) ; Hayes; Alec J.; (Chesterfield,
VA) ; de Godoy Lusso; Marcos Fernando; (Chesterfield,
VA) ; Morris; Jerry Whit; (Jetersville, VA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ALTRIA CLIENT SERVICES LLC |
Richmond |
VA |
US |
|
|
Assignee: |
ALTRIA CLIENT SERVICES LLC
Richmond
VA
|
Appl. No.: |
17/690364 |
Filed: |
March 9, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16674838 |
Nov 5, 2019 |
11304440 |
|
|
17690364 |
|
|
|
|
14681166 |
Apr 8, 2015 |
|
|
|
16674838 |
|
|
|
|
61976680 |
Apr 8, 2014 |
|
|
|
International
Class: |
A24D 1/00 20060101
A24D001/00; C12N 15/82 20060101 C12N015/82; A24D 3/04 20060101
A24D003/04; A24B 13/00 20060101 A24B013/00 |
Claims
1.-25. (canceled)
26. A tobacco plant comprising: (a) a first induced mutation in a
first endogenous nucleic acid molecule encoding a putrescine
N-methyltransferase 1a (PMT1a) protein; (b) a second induced
mutation in a second endogenous nucleic acid molecule encoding a
PMT1b protein; (c) a third induced mutation in a third endogenous
nucleic acid molecule encoding a PMT2 protein; (d) a fourth induced
mutation in a fourth endogenous nucleic acid molecule encoding a
PMT3 protein; and (e) a fifth induced mutation in a fifth
endogenous nucleic acid molecule encoding a PMT4 protein, wherein
the tobacco plant is a Nicotiana tabacum plant.
27. The tobacco plant of claim 26, wherein: (a) one wild-type
allele of the first endogenous nucleic acid molecule encodes an
amino acid sequence comprising SEQ ID NO: 2; (b) one wild-type
allele of the second endogenous nucleic acid molecule encodes an
amino acid sequence comprising SEQ ID NO: 4; (c) one wild-type
allele of the third endogenous nucleic acid molecule encodes an
amino acid sequence comprising SEQ ID NO: 6; (d) one wild-type
allele of the fourth endogenous nucleic acid molecule encodes an
amino acid sequence comprising SEQ ID NO: 8; and (e) one wild-type
allele of the fifth endogenous nucleic acid molecule encodes an
amino acid sequence comprising SEQ ID NO: 10.
28. The tobacco plant of claim 26, wherein: (a) the first
endogenous nucleic acid molecule comprises a nucleic acid sequence
at least 95% identical to SEQ ID NO: 1; (b) the second endogenous
nucleic acid molecule comprises a nucleic acid sequence at least
95% identical to SEQ ID NO: 3; (c) the third endogenous nucleic
acid molecule comprises a nucleic acid sequence at least 95%
identical to SEQ ID NO: 5; (d) the fourth endogenous nucleic acid
molecule comprises a nucleic acid sequence at least 95% identical
to SEQ ID NO: 7; and (e) the fifth endogenous nucleic acid molecule
comprises a nucleic acid sequence at least 95% identical to SEQ ID
NO: 9.
29. The tobacco plant of claim 26, wherein: (a) the first
endogenous nucleic acid molecule comprises a nucleic acid sequence
100% identical to SEQ ID NO: 1; (b) the second endogenous nucleic
acid molecule comprises a nucleic acid sequence 100% identical to
SEQ ID NO: 3; (c) the third endogenous nucleic acid molecule
comprises a nucleic acid sequence at 100% identical to SEQ ID NO:
5; (d) the fourth endogenous nucleic acid molecule comprises a
nucleic acid sequence at 100% identical to SEQ ID NO: 7; and (e)
the fifth endogenous nucleic acid molecule comprises a nucleic acid
sequence at least 95% identical to SEQ ID NO: 9.
30. The tobacco plant of claim 26, wherein each of the first
induced mutation, the second induced mutation, the third induced
mutation, the fourth induced mutation, and the fifth induced
mutation comprise a mutation individually selected from the group
consisting of an insertion, a deletion, and a substitution.
31. The tobacco plant of claim 26, wherein the tobacco plant
comprises reduced expression or activity of each of the PMT1a,
PMT1b, PMT2, PMT3, and PMT4 proteins as compared to a control
tobacco plant lacking the first induced mutation, the second
induced mutation, the third induced mutation, the fourth induced
mutation, and the fifth induced mutation.
32. The tobacco plant of claim 26, wherein the tobacco plant
comprises a reduced amount of N-methylputrescine as compared to a
control tobacco plant lacking the first induced mutation, the
second induced mutation, the third induced mutation, the fourth
induced mutation, and the fifth induced mutation.
33. The tobacco plant of claim 26, wherein at least one of the
first induced mutation, the second induced mutation, the third
induced mutation, the fourth induced mutation, and the fifth
induced mutation is within a methyltransferase domain.
34. The tobacco plant of claim 26, wherein at least one of the
first induced mutation, the second induced mutation, the third
induced mutation, the fourth induced mutation, and the fifth
induced mutation results in a truncated protein.
35. The tobacco plant of claim 26, wherein at least one oft the
first induced mutation, the second induced mutation, the third
induced mutation, the fourth induced mutation, and the fifth
induced mutation results in a premature stop codon.
36. The tobacco plant of claim 26, wherein at least one of the
first induced mutation, the second induced mutation, the third
induced mutation, the fourth induced mutation, and the fifth
induced mutation results in a non-conserved amino acid
substitution.
37. The tobacco plant of claim 26, wherein the tobacco plant
comprises a reduced amount of nicotine as compared to a control
tobacco plant lacking t the first induced mutation, the second
induced mutation, the third induced mutation, the fourth induced
mutation, and the fifth induced mutation.
38. The tobacco plant of claim 26, wherein the tobacco plant is of
a type selected from the group consisting of a Burley type, a dark
type, a flue-cured type, and an Oriental type.
39. The tobacco plant of claim 26, wherein the tobacco plant is of
a tobacco variety selected from the group consisting of BU 64, CC
101, CC 200, CC 13, CC 27, CC 33, CC 35, CC 37, CC 65, CC 67, CC
301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, CC 1063, Coker
176, Coker 319, Coker 371 Gold, Coker 48, CU 263, DF911, GL 26H, GL
338, GL 350, GL 395, GL 600, GL 737, GL 939, GL 973, GF 157, GF
318, RJR 901, HB 04P, K 149, K 326, K 346, K 358, K394, K 399, K
730, NC 196, NC 37NF, NC 471, NC 55, NC 92, NC2326, NC 95, NC 925,
PVH 1118, PVH 1452, PVH 2110, PVH 2254, PVH 2275, VA 116, VA 119,
KDH 959, KT 200, KT204LC, KY 10, KY 14, KY 160, KY 17, KY 171, KY
907, KY907LC, KTY14.times.L8 LC, Little Crittenden, McNair 373,
McNair 944, msKY 14.times.L8, Narrow Leaf Madole, NC 100, NC 102,
NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC
606, NC 71, NC 72, NC 810, NC BH 129, NC 2002, Neal Smith Madole,
OXFORD 207, Perique tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R
610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS
1410, Speight 168, Speight 172, Speight 179, Speight 210, Speight
220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight
G-70, Speight H-6, Speight H20, Speight NF3, TI 1406, TI 1269, TN
86, TN86LC, TN 90, TN90LC, TN 97, TN97LC, TN D94, TN 5 D950, TR
(Tom Rosson) Madole, VA 309, and VA359.
40. A tobacco product comprising cured tobacco material from the
tobacco plant of claim 26.
41. The tobacco product of claim 40, wherein the tobacco product is
selected from the group consisting of a cigarette, a cigarillo, a
non-ventilated recess filter cigarette, a vented recess filter
cigarette, a cigar, snuff, pipe tobacco, cigar tobacco, cigarette
tobacco, chewing tobacco, leaf tobacco, shredded tobacco, cut
tobacco, chewing tobacco, and snus.
42. The tobacco product of claim 40, wherein the cured tobacco
material comprises cured leaf material.
43. The tobacco product of claim 40, wherein the tobacco product
further comprises aged, conditioned, or fermented tobacco
material.
44. The tobacco product of claim 40, wherein the tobacco product
comprises an ingredient selected from the group consisting of a
binder, a plasticizer, a stabilizer, and a flavoring.
45. A seed of the tobacco plant of claim 26, wherein the seed
comprises the first induced mutation, the second induced mutation,
the third induced mutation, the fourth induced mutation, and the
fifth induced mutation.
Description
TECHNICAL FIELD
[0001] This disclosure generally relates to transgenic or mutant
Nicotiana tabacum plants and methods of making and using such
plants.
BACKGROUND
[0002] Nicotine is an abundant alkaloid (90-95%) present in
cultivated tobacco. The remaining alkaloid fraction is primarily
comprised of three additional alkaloids: nornicotine, anabasine,
and anatabine. One of the initial steps in the biosynthesis of
nicotine is the conversion of putrescine to N-methylputrescine by
putrescine N-methyltransferase (PMT).
[0003] This disclosure describes methods of modulating the
expression and/or activity of PMT to thereby reduce the amount of
nicotine in the leaf.
SUMMARY
[0004] Provided herein are transgenic tobacco plants comprising a
PMT RNAi and tobacco plants having a mutation in the gene encoding
PMT, as well as methods of making and using such plants.
[0005] In one aspect, a RNA nucleic acid molecule is provided that
includes a first nucleic acid between 15 and 500 nucleotides in
length and a second nucleic acid between 15 and 500 nucleotides in
length. Generally, the first nucleic acid has a region of
complementarity to the second nucleic acid, and the first nucleic
acid comprises at least 15 contiguous nucleotides of the sequence
shown in SEQ ID NO:1, 3, 5, 7 or 9.
[0006] In some embodiments, the second nucleic acid hybridizes
under stringent conditions to a portion of the sequence shown in
SEQ ID NO:1, 3, 5, 7 or 9. In some embodiments, the region of
complementarity is at least 19 nucleotides in length, or at least
100 nucleotides in length. In some embodiments, the nucleic acid
molecule further includes a spacer nucleic acid between the first
nucleic acid and the second nucleic acid.
[0007] In one aspect, a construct is provided that includes a first
RNA nucleic acid molecule having a length of 15 to 500 nucleotides
and having at least 95% sequence identity to a nucleic acid shown
in SEQ ID NO:1, 3, 5, 7 or 9. In some embodiments, the construct
further includes a second RNA nucleic acid molecule that has
complementarity to the first RNA nucleic acid molecule. In some
embodiments, the construct further includes a spacer nucleic acid
between the first and second RNA nucleic acid molecule.
[0008] In one aspect, a method of making a Nicotiana tabacum plant
is provided. Such a method typically includes transforming N.
tabacum cells with a nucleic acid molecule described herein or a
construct described herein to produce transgenic N. tabacum cells;
regenerating transgenic N. tabacum plants from the transgenic N.
tabacum cells; and selecting at least one transgenic N. tabacum
plant that comprises the nucleic acid molecule or the construct.
Such a method can further include identifying at least one
transgenic N. tabacum plant having reduced amount of nicotine
relative to a N. tabacum plant not transformed with the nucleic
acid molecule. Such a method can further include identifying at
least one transgenic N. tabacum plant that, when material from the
at least one transgenic N. tabacum plant is cured, exhibits a
reduced amount of at least one TSNA relative to cured material from
a N. tabacum plant not transformed with the nucleic acid
molecule.
[0009] In some embodiments, leaf from the selected transgenic N.
tabacum plant exhibits comparable or better quality than leaf from
the non-transformed N. tabacum plant. In some embodiments, the N.
tabacum plant is a Burley type, a dark type, a flue-cured type, or
an Oriental type.
[0010] In another aspect, a transgenic Nicotiana tabacum plant is
provided that includes a vector. Typically, the vector includes a
RNA nucleic acid molecule having a length of 15 to 500 nucleotides
and having at least 95% sequence identity to a PMT nucleic acid
shown in SEQ ID NO:1, 3, 5, 7 or 9. Such a transgenic N. tabacum
plant typically exhibits reduced amount of nicotine in the leaf
relative to leaf from a N. tabacum plant lacking the nucleic acid
molecule. Such a transgenic N. tabacum plant, when material from
the at least one transgenic N. tabacum plant is cured, typically
exhibits a reduced amount of at least one TSNA relative to cured
material from a N. tabacum plant lacking the nucleic acid molecule.
In some embodiments, leaf from the transgenic plant exhibits
comparable or better quality than leaf from a N. tabacum plant
lacking the nucleic acid molecule.
[0011] Cured leaf is provided from any of the transgenic N. tabacum
plants described herein. A tobacco product also is provided that
includes such cured leaf. Representative tobacco products include,
without limitation, cigarettes, smokeless tobacco products,
tobacco-derived nicotine products, cigarillos, non-ventilated
recess filter cigarettes, vented recess filter cigarettes, cigars,
snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing
tobacco, leaf tobacco, shredded tobacco, and cut tobacco.
[0012] In one aspect, a method of making a Nicotiana tabacum plant
is provided. Such a method typically includes inducing mutagenesis
in N. tabacum cells to produce mutagenized N. tabacum cells;
obtaining one or more N. tabacum plants from the mutagenized N.
tabacum cells; and identifying at least one of the N. tabacum
plants that comprises a mutated PMT sequence. Such a method can
further include identifying at least one of the N. tabacum plants
that exhibits reduced amounts of nicotine relative to a N. tabacum
plant lacking a mutated PMT. Such a method can further include
identifying at least one of the N. tabacum plants that, when
material from the at least one plant is cured, exhibits a reduced
amount of at least one TSNA relative to cured material from a N.
tabacum plant lacking a mutated PMT.
[0013] In some embodiments, leaf from the mutant N. tabacum plant
exhibits comparable or better quality than leaf from the plant
lacking a mutated PMT sequence. In some embodiments, the N. tabacum
plant is a Burley type, a dark type, a flue-cured type, or an
Oriental type.
[0014] In one aspect, a variety of Nicotiana tabacum is provided.
Generally, the variety includes plants having a mutation in an
endogenous nucleic acid, where the wild type endogenous nucleic
acid encodes the PMT sequence shown in SEQ ID NO:2, 4, 6, 8 or 10.
Typically, leaf from the mutant plants exhibits a reduced amount of
nicotine relative to leaf from a plant lacking the mutation.
Generally, material from the mutant plants, when cured, exhibits a
reduced amount of at least one TSNA relative to cured material from
a plant lacking the mutation. In some embodiments, leaf from the
mutant N. tabacum plant exhibits comparable or better quality than
leaf from the plant lacking a mutated PMT sequence.
[0015] In another aspect, cured leaf is provided from any of the N.
tabacum varieties described herein. A tobacco product also is
provided that includes the cured leaf. In some embodiments, the
tobacco product includes, without limitation, cigarettes, smokeless
tobacco products, tobacco-derived nicotine products, cigarillos,
non-ventilated recess filter cigarettes, vented recess filter
cigarettes, cigars, snuff, electronic cigarettes, e-vapor products,
pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco,
leaf tobacco, shredded tobacco, and cut tobacco.
[0016] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which the methods and compositions of
matter belong. Although methods and materials similar or equivalent
to those described herein can be used in the practice or testing of
the methods and compositions of matter, suitable methods and
materials are described below. In addition, the materials, methods,
and examples are illustrative only and not intended to be limiting.
All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety.
DESCRIPTION OF DRAWINGS
[0017] FIG. 1 is an alignment of PMT nucleotide sequences.
[0018] FIG. 2 is an alignment of PMT polypeptide sequences.
[0019] FIG. 3 is a schematic showing the RNAi construct and the
cloning vector.
[0020] FIG. 4 shows the nucleotide and amino acid sequence of PMT3
(SEQ ID NOs: 7 and 8, respectively), with highlighting to show
representative mutation sites into which a stop codon can be
introduced.
[0021] FIG. 5 is a schematic showing exemplary TALEN constructs for
site-specific mutagenesis of each of the indicated PMT
sequences.
[0022] FIG. 6 shows graphs of the effect of low alkaloids on leaf
quality in flue-cured varieties.
[0023] FIG. 7 shows graphs of the effect of low alkaloids on leaf
quality in Burley varieties.
[0024] FIG. 8 is a graph showing the impact of agronomic practices
on the percent nicotine reduction in select lines.
[0025] FIG. 9 is a graph showing the yield and leaf quality in a
low nicotine variety and a PMT-RNAi variety.
[0026] FIG. 10 is a graph showing the impact of agronomic practices
on the percent nicotine reduction in selected flue cured lines.
[0027] FIG. 11 is a graph showing the yield and leaf quality in
selected flue cured varieties.
DETAILED DESCRIPTION
[0028] Nicotine biosynthesis begins with the methylation of the
polyamine, putrescine, to N-methylputrescine by the enzyme,
putrescine N-methyltransferase (PMT), using S-adenosylmethionine as
the co-factor. This is the first step that commits precursor
metabolites to nicotine biosynthesis. See, for example, Mizusaki et
al., 1971, Plant Cell Physiol., 12:633-40. PMT enzymes are
classified under the enzyme classification system as EC 2.1.1.53.
In the tobacco genome, there are known to be five genes that encode
putrescine N-methyltransferases, designated PMT1a, PMT1b, PMT2,
PMT3, and PMT4.
[0029] The present disclosure describes several different
approaches that can be used to significantly reduce nicotine levels
in tobacco leaf while maintaining leaf quality.
PMT Nucleic Acids and Polypeptides
[0030] Nucleic acids encoding PMT1a, PMT1b, PMT2, PMT3 and PMT4
from N. tabacum are shown in SEQ ID NOs: 1, 3, 5, 7, and 9,
respectively. Unless otherwise specified, nucleic acids referred to
herein can refer to DNA and RNA, and also can refer to nucleic
acids that contain one or more nucleotide analogs or backbone
modifications. Nucleic acids can be single stranded or double
stranded, and linear or circular, both of which usually depend upon
the intended use.
[0031] As used herein, an "isolated" nucleic acid molecule is a
nucleic acid molecule that is free of sequences that naturally
flank one or both ends of the nucleic acid in the genome of the
organism from which the isolated nucleic acid molecule is derived
(e.g., a cDNA or genomic DNA fragment produced by PCR or
restriction endonuclease digestion). Such an isolated nucleic acid
molecule is generally introduced into a vector (e.g., a cloning
vector, or an expression vector) for convenience of manipulation or
to generate a fusion nucleic acid molecule, discussed in more
detail below. In addition, an isolated nucleic acid molecule can
include an engineered nucleic acid molecule such as a recombinant
or a synthetic nucleic acid molecule.
[0032] The sequence of the PMT1a, PMT1b, PMT2, PMT3 and PMT4
polypeptides from N. tabacum are shown in SEQ ID NOs: 2, 4, 6, 8,
and 10, respectively. As used herein, a "purified" polypeptide is a
polypeptide that has been separated or purified from cellular
components that naturally accompany it. Typically, the polypeptide
is considered "purified" when it is at least 70% (e.g., at least
75%, 80%, 85%, 90%, 95%, or 99%) by dry weight, free from the
polypeptides and naturally occurring molecules with which it is
naturally associated. Since a polypeptide that is chemically
synthesized is, by nature, separated from the components that
naturally accompany it, a synthetic polypeptide is "purified."
[0033] Nucleic acids can be isolated using techniques well known in
the art. For example, nucleic acids can be isolated using any
method including, without limitation, recombinant nucleic acid
technology, and/or the polymerase chain reaction (PCR). General PCR
techniques are described, for example in PCR Primer: A Laboratory
Manual, Dieffenbach & Dveksler, Eds., Cold Spring Harbor
Laboratory Press, 1995. Recombinant nucleic acid techniques
include, for example, restriction enzyme digestion and ligation,
which can be used to isolate a nucleic acid. Isolated nucleic acids
also can be chemically synthesized, either as a single nucleic acid
molecule or as a series of oligonucleotides.
[0034] Polypeptides can be purified from natural sources (e.g., a
biological sample) by known methods such as DEAE ion exchange, gel
filtration, and hydroxyapatite chromatography. A polypeptide also
can be purified, for example, by expressing a nucleic acid in an
expression vector. In addition, a purified polypeptide can be
obtained by chemical synthesis. The extent of purity of a
polypeptide can be measured using any appropriate method, e.g.,
column chromatography, polyacrylamide gel electrophoresis, or HPLC
analysis.
[0035] Nucleic acids can be detected using any number of
amplification techniques (see, e.g., PCR Primer: A Laboratory
Manual, 1995, Dieffenbach & Dveksler, Eds., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y.; and U.S. Pat. Nos.
4,683,195; 4,683,202; 4,800,159; and 4,965,188) with an appropriate
pair of oligonucleotides (e.g., primers). A number of modifications
to the original PCR have been developed and can be used to detect a
nucleic acid. Nucleic acids also can be detected using
hybridization.
[0036] Polypeptides can be detected using antibodies. Techniques
for detecting polypeptides using antibodies include enzyme linked
immunosorbent assays (ELISAs), Western blots, immunoprecipitations
and immunofluorescence. An antibody can be polyclonal or
monoclonal. An antibody having specific binding affinity for a
polypeptide can be generated using methods well known in the art.
The antibody can be attached to a solid support such as a
microtiter plate using methods known in the art. In the presence of
a polypeptide, an antibody-polypeptide complex is formed.
[0037] Detection (e.g., of an amplification product, a
hybridization complex, or a polypeptide) is oftentimes accomplished
using detectable labels. The term "label" is intended to encompass
the use of direct labels as well as indirect labels. Detectable
labels include enzymes, prosthetic groups, fluorescent materials,
luminescent materials, bioluminescent materials, and radioactive
materials.
[0038] A construct, sometimes referred to as a vector, containing a
nucleic acid (e.g., a coding sequence or a RNAi nucleic acid
molecule) is provided. Constructs, including expression constructs
(or expression vectors), are commercially available or can be
produced by recombinant DNA techniques routine in the art. A
construct containing a nucleic acid can have expression elements
operably linked to such a nucleic acid, and further can include
sequences such as those encoding a selectable marker (e.g., an
antibiotic resistance gene). A construct can encode a chimeric or
fusion polypeptide (i.e., a first polypeptide operatively linked to
a second polypeptide). Representative first (or second)
polypeptides are those that can be used in purification of the
other (i.e., second (or first), respectively) polypeptide
including, without limitation, 6.times.His tag or glutathione
S-transferase (GST).
[0039] Expression elements include nucleic acid sequences that
direct and regulate expression of nucleic acid coding sequences.
One example of an expression element is a promoter sequence.
Expression elements also can include introns, enhancer sequences,
response elements, or inducible elements that modulate expression
of a nucleic acid.
[0040] Expression elements can be of bacterial, yeast, insect,
mammalian, or viral origin, and vectors can contain a combination
of elements from different origins. As used herein, operably linked
means that a promoter or other expression element(s) are positioned
in a vector relative to a nucleic acid in such a way as to direct
or regulate expression of the nucleic acid (e.g., in-frame).
[0041] Constructs as described herein can be introduced into a host
cell. Many methods for introducing nucleic acids into host cells,
both in vivo and in vitro, are well known to those skilled in the
art and include, without limitation, electroporation, calcium
phosphate precipitation, polyethylene glycol (PEG) transformation,
heat shock, lipofection, microinjection, and viral-mediated nucleic
acid transfer. As used herein, "host cell" refers to the particular
cell into which the nucleic acid is introduced and also includes
the progeny or potential progeny of such a cell. A host cell can be
any prokaryotic or eukaryotic cell. For example, nucleic acids can
be introduced into bacterial cells such as E. coli, or into insect
cells, yeast or mammalian cells (such as Chinese hamster ovary
cells (CHO) or COS cells). Other suitable host cells are known to
those skilled in the art.
RNA Interfering Nucleic Acids and Constructs Containing Same
[0042] RNA interference (RNAi), also called post-transcriptional
gene silencing (PTGS), is a biological process in which RNA
molecules inhibit gene expression, typically by causing the
destruction of specific mRNA molecules. Without being bound by
theory, it appears that, in the presence of an antisense RNA
molecule that is complementary to an expressed message (i.e., a
mRNA), the two strands anneal to generate long double-stranded RNA
(dsRNA), which is digested into short (<30 nucleotide) RNA
duplexes, known as small interfering RNAs (siRNAs), by an enzyme
known as Dicer. A complex of proteins known as the RNA Induced
Silencing Complex (RISC) then unwinds siRNAs, and uses one strand
to identify and thereby anneal to other copies of the original
mRNA. RISC cleaves the mRNA within the complementary sequence,
leaving the mRNA susceptible to further degradation by
exonucleases, which effectively silences expression of the encoding
gene.
[0043] Several methods have been developed that take advantage of
the endogenous machinery to suppress the expression of a specific
target gene and a number of companies offer RNAi design and
synthesis services (e.g., Life Technologies, Applied Biosystems).
In transgenic plants, the use of RNAi can involve the introduction
of long dsRNA (e.g., greater than 50 bps) or siRNAs (e.g., 12 to 23
bps) that have complementarity to the target gene, both of which
are processed by the endogenous machinery. Alternatively, the use
of RNAi can involve the introduction of a small hairpin RNA
(shRNA); shRNA is a nucleic acid that includes the sequence of the
two desired siRNA strands, sense and antisense, on a single strand,
connected by a "loop" or "spacer" nucleic acid. When the shRNA is
transcribed, the two complementary portions anneal
intra-molecularly to form a "hairpin," which is recognized and
processed by the endogenous machinery.
[0044] A RNAi nucleic acid molecule as described herein is
complementary to at least a portion of a target mRNA (i.e., a PMT
mRNA), and typically is referred to as an "antisense strand".
Typically, the antisense strand includes at least 15 contiguous
nucleotides of the DNA sequence (e.g., the PMT nucleic acid
sequence shown in SEQ ID NO:1, 3, 5, 7 or 9); it would be
appreciated that the antisense strand has the "RNA equivalent"
sequence of the DNA (e.g., uracils instead of thymines; ribose
sugars instead of deoxyribose sugars).
[0045] A RNAi nucleic acid molecule can be, for example, 15 to 500
nucleotides in length (e.g., 15 to 50, 15 to 45, 15 to 30, 16 to
47, 16 to 38, 16 to 29, 17 to 53, 17 to 44, 17 to 38, 18 to 36, 19
to 49, 20 to 60, 20 to 40, 25 to 75, 25 to 100, 28 to 85, 30 to 90,
15 to 100, 15 to 300, 15 to 450, 16 to 70, 16 to 150, 16 to 275, 17
to 74, 17 to 162, 17 to 305, 18 to 60, 18 to 75, 18 to 250, 18 to
400, 20 to 35, 20 to 60, 20 to 80, 20 to 175, 20 to 225, 20 to 325,
20 to 400, 20 to 475, 25 to 45, 25 to 65, 25 to 100, 25 to 200, 25
to 250, 25 to 300, 25 to 350, 25 to 400, 25 to 450, 30 to 280, 35
to 250, 200 to 500, 200 to 400, 250 to 450, 250 to 350, or 300 to
400 nucleotides in length).
[0046] In some embodiments, the antisense strand (e.g., a first
nucleic acid) can be accompanied by a "sense strand" (e.g., a
second nucleic acid), which is complementary to the antisense
strand. In the latter case, each nucleic acid (e.g., each of the
sense and antisense strands) can be between 15 and 500 nucleotides
in length (e.g., between 15 to 50, 15 to 45, 15 to 30, 16 to 47, 16
to 38, 16 to 29, 17 to 53, 17 to 44, 17 to 38, 18 to 36, 19 to 49,
20 to 60, 20 to 40, 25 to 75, 25 to 100, 28 to 85, 30 to 90, 15 to
100, 15 to 300, 15 to 450, 16 to 70, 16 to 150, 16 to 275, 17 to
74, 17 to 162, 17 to 305, 18 to 60, 18 to 75, 18 to 250, 18 to 400,
20 to 35, 20 to 60, 20 to 80, 20 to 175, 20 to 225, 20 to 325, 20
to 400, 20 to 475, 25 to 45, 25 to 65, 25 to 100, 25 to 200, 25 to
250, 25 to 300, 25 to 350, 25 to 400, 25 to 450, 30 to 280, 35 to
250, 200 to 500, 200 to 400, 250 to 450, 250 to 350, or 300 to 400
nucleotides in length).
[0047] In some embodiments, a spacer nucleic acid, sometimes
referred to as a loop nucleic acid, can be positioned between the
sense strand and the antisense strand. In some embodiments, the
spacer nucleic acid can be an intron (see, for example, Wesley et
al., 2001, The Plant J., 27:581-90). In some embodiments, although
not required, the intron can be functional (i.e., in sense
orientation; i.e., spliceable) (see, for example, Smith et al.,
2000, Nature, 407:319-20). A spacer nucleic acid can be between 20
nucleotides and 1000 nucleotides in length (e.g., 25-800, 25-600,
25-400, 50-750, 50-500, 50-250, 100-700, 100-500, 100-300, 250-700,
300-600, 400-700, 500-800, 600-850, or 700-1000 nucleotides in
length).
[0048] In some embodiments, a construct can be produced by operably
linking a promoter that is operable in plant cells; a DNA region,
that, when transcribed, produces an RNA molecule capable of forming
a hairpin structure; and a DNA region involved in transcription
termination and polyadenylation. It would be appreciated that the
hairpin structure has two annealing RNA sequences, where one of the
annealing RNA sequences of the hairpin RNA structure includes a
sense sequence identical to at least 20 consecutive nucleotides of
a PMT nucleotide sequence, and where the second of the annealing
RNA sequences includes an antisense sequence that is identical to
at least 20 consecutive nucleotides of the complement of the PMT
nucleotide sequence. In addition, as indicated herein, the DNA
region can include an intron (e.g., a functional intron). When
present, the intron generally is located between the two annealing
RNA sequences in sense orientation such that it is spliced out by
the cellular machinery (e.g., the splicesome). Such a construct can
be introduced into one or more plant cells to reduce the phenotypic
expression of a PMT nucleic acid (e.g., a nucleic acid sequence
that is normally expressed in a plant cell).
[0049] In some embodiments, a construct (e.g., an expression
construct) can include an inverted-duplication of a segment of a
PMT gene, where the inverted-duplication of the PMT gene segment
includes a nucleotide sequence substantially identical to at least
a portion of the PMT gene and the complement of the portion of the
PMT gene. It would be appreciated that a single promoter can be
used to drive expression of the inverted-duplication of the PMT
gene segment, and that the inverted-duplication typically contains
at least one copy of the portion of the PMT gene in the sense
orientation. Such a construct can be introduced into one or more
plant cells to delay, inhibit or otherwise reduce the expression of
a PMT gene in the plant cells.
[0050] The components of a representative RNAi nucleic acid
molecule directed toward PMT3 are shown below. As indicated, SEQ ID
NO:11 is a sense strand to PMT3; SEQ ID NO:12 is an antisense
strand to PMT3; and SEQ ID NO:13 is a spacer or loop sequence.
[0051] It would be appreciated by the skilled artisan that the
region of complementarity, between the antisense strand of the RNAi
and the mRNA or between the antisense strand of the RNAi and the
sense strand of the RNAi, can be over the entire length of the RNAi
nucleic acid molecule, or the region of complementarity can be less
than the entire length of the RNAi nucleic acid molecule. For
example, a region of complementarity can refer to, for example, at
least 15 nucleotides in length up to, for example, 500 nucleotides
in length (e.g., at least 15, 16, 17, 18, 19, 20, 25, 28, 30, 35,
49, 50, 60, 75, 80, 100, 150, 180, 200, 250, 300, 320, 385, 420,
435 nucleotides in length up to, e.g., 30, 35, 36, 40, 45, 49, 50,
60, 65, 75, 80, 85, 90, 100, 175, 200, 225, 250, 280, 300, 325,
350, 400, 450, or 475 nucleotides in length). In some embodiments,
a region of complementarity can refer to, for example, at least 15
contiguous nucleotides in length up to, for example, 500 contiguous
nucleotides in length (e.g., at least 15, 16, 17, 18, 19, 20, 25,
28, 30, 35, 49, 50, 60, 75, 80, 100, 150, 180, 200, 250, 300, 320,
385, 420, 435 nucleotides in length up to, e.g., 30, 35, 36, 40,
45, 49, 50, 60, 65, 75, 80, 85, 90, 100, 175, 200, 225, 250, 280,
300, 325, 350, 400, 450, or 475 contiguous nucleotides in
length).
[0052] It would be appreciated by the skilled artisan that
complementary can refer to, for example, 100% sequence identity
between the two nucleic acids. In addition, however, it also would
be appreciated by the skilled artisan that complementary can refer
to, for example, slightly less than 100% sequence identity (e.g.,
at least 95%, 96%, 97%, 98%, or 99% sequence identity). In
calculating percent sequence identity, two nucleic acids are
aligned and the number of identical matches of nucleotides (or
amino acid residues) between the two nucleic acids (or
polypeptides) is determined. The number of identical matches is
divided by the length of the aligned region (i.e., the number of
aligned nucleotides (or amino acid residues)) and multiplied by 100
to arrive at a percent sequence identity value. It will be
appreciated that the length of the aligned region can be a portion
of one or both nucleic acids up to the full-length size of the
shortest nucleic acid. It also will be appreciated that a single
nucleic acid can align with more than one other nucleic acid and
hence, can have different percent sequence identity values over
each aligned region.
[0053] The alignment of two or more nucleic acids to determine
percent sequence identity can be performed using the computer
program ClustalW and default parameters, which allows alignments of
nucleic acid or polypeptide sequences to be carried out across
their entire length (global alignment). Chenna et al., 2003,
Nucleic Acids Res., 31(13):3497-500. ClustalW calculates the best
match between a query and one or more subject sequences (nucleic
acid or polypeptide), and aligns them so that identities,
similarities and differences can be determined. Gaps of one or more
residues can be inserted into a query sequence, a subject sequence,
or both, to maximize sequence alignments. For fast pairwise
alignment of nucleic acid sequences, the default parameters can be
used (i.e., word size: 2; window size: 4; scoring method:
percentage; number of top diagonals: 4; and gap penalty: 5); for an
alignment of multiple nucleic acid sequences, the following
parameters can be used: gap opening penalty: 10.0; gap extension
penalty: 5.0; and weight transitions: yes. For fast pairwise
alignment of polypeptide sequences, the following parameters can be
used: word size: 1; window size: 5; scoring method: percentage;
number of top diagonals: 5; and gap penalty: 3. For multiple
alignment of polypeptide sequences, the following parameters can be
used: weight matrix: blosum; gap opening penalty: 10.0; gap
extension penalty: 0.05; hydrophilic gaps: on; hydrophilic
residues: Gly, Pro, Ser, Asn, Asp, Gln, Glu, Arg, and Lys; and
residue-specific gap penalties: on. ClustalW can be run, for
example, at the Baylor College of Medicine Search Launcher website
or at the European Bioinformatics Institute website on the World
Wide Web.
[0054] The skilled artisan also would appreciate that complementary
can be dependent upon, for example, the conditions under which two
nucleic acids hybridize. Hybridization between nucleic acids is
discussed in detail in Sambrook et al. (1989, Molecular Cloning: A
Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.; Sections 7.37-7.57, 9.47-9.57, 11.7-11.8,
and 11.45-11.57). Sambrook et al. disclose suitable Southern blot
conditions for oligonucleotide probes less than about 100
nucleotides (Sections 11.45-11.46). The Tm between a nucleic acid
that is less than 100 nucleotides in length and a second nucleic
acid can be calculated using the formula provided in Section 11.46.
Sambrook et al. additionally disclose Southern blot conditions for
oligonucleotide probes greater than about 100 nucleotides (see
Sections 9.47-9.54). The Tm between a nucleic acid greater than 100
nucleotides in length and a second nucleic acid can be calculated
using the formula provided in Sections 9.50-9.51 of Sambrook et
al.
[0055] The conditions under which membranes containing nucleic
acids are prehybridized and hybridized, as well as the conditions
under which membranes containing nucleic acids are washed to remove
excess and non-specifically bound probe, can play a significant
role in the stringency of the hybridization. Such hybridizations
and washes can be performed, where appropriate, under moderate or
high stringency conditions. For example, washing conditions can be
made more stringent by decreasing the salt concentration in the
wash solutions and/or by increasing the temperature at which the
washes are performed. Simply by way of example, high stringency
conditions typically include a wash of the membranes in
0.2.times.SSC at 65.degree. C.
[0056] In addition, interpreting the amount of hybridization can be
affected, for example, by the specific activity of the labeled
oligonucleotide probe, by the number of probe-binding sites on the
template nucleic acid to which the probe has hybridized, and by the
amount of exposure of an autoradiograph or other detection medium.
It will be readily appreciated by those of ordinary skill in the
art that although any number of hybridization and washing
conditions can be used to examine hybridization of a probe nucleic
acid molecule to immobilized target nucleic acids, it is more
important to examine hybridization of a probe to target nucleic
acids under identical hybridization, washing, and exposure
conditions. Preferably, the target nucleic acids are on the same
membrane. A nucleic acid molecule is deemed to hybridize to a
nucleic acid, but not to another nucleic acid, if hybridization to
a nucleic acid is at least 5-fold (e.g., at least 6-fold, 7-fold,
8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold) greater
than hybridization to another nucleic acid. The amount of
hybridization can be quantified directly on a membrane or from an
autoradiograph using, for example, a Phosphorlmager or a
Densitometer (Molecular Dynamics, Sunnyvale, Calif.).
[0057] A construct (also known as a vector) containing a RNAi
nucleic acid molecule is provided. Constructs, including expression
constructs, are described herein and are known to those of skill in
the art. Expression elements (e.g., promoters) that can be used to
drive expression of a RNAi nucleic acid molecule are known in the
art and include, without limitation, constitutive promoters such
as, without limitation, the cassava mosaic virus (CsMVM) promoter,
the cauliflower mosaic virus (CaMV) 35S promoter, the actin
promoter, or the glyceraldehyde-3-phosphate dehydrogenase promoter,
or tissue-specific promoters such as, without limitation,
root-specific promoters such as the putrescine N-methyl transferase
(PMT) promoter or the quinolinate phosphosibosyltransferase (QPT)
promoter. It would be understood by a skilled artisan that a sense
strand and an antisense strand can be delivered to and expressed in
a target cell on separate constructs, or the sense and antisense
strands can be delivered to and expressed in a target cell on a
single construct (e.g., in one transcript). As discussed herein, a
RNAi nucleic acid molecule delivered and expressed on a single
strand also can include a spacer nucleic acid (e.g., a loop nucleic
acid) such that the RNAi forms a small hairpin (shRNA).
Transgenic Plants and Methods of Making Transgenic Plants
[0058] Transgenic N. tabacum plants are provided that contain a
transgene encoding at least one RNAi molecule, which, when
transcribed, silences PMT expression. As used herein, silencing can
refer to complete elimination or essentially complete elimination
of the PMT mRNA, resulting in 100% or essentially 100% reduction
(e.g., greater than 95% reduction; e.g., greater than 96%, 97%, 98%
or 99% reduction) in the amount of PMT polypeptide; silencing also
can refer to partial elimination of the PMT mRNA (e.g., eliminating
about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or more of
the PMT mRNA), resulting in a reduction (e.g., about 5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50% or more, but not complete
elimination) in the amount of the PMT polypeptide.
[0059] A RNAi nucleic acid molecule can be transcribed using a
plant expression vector. Methods of introducing a nucleic acid
(e.g., a heterologous nucleic acid) into plant cells (e.g., N.
tabacum cells) are known in the art and include, for example,
particle bombardment, Agrobacterium-mediated transformation,
microinjection, polyethylene glycol-mediated transformation (e.g.,
of protoplasts, see, for example, Yoo et al. (2007, Nature
Protocols, 2(7):1565-72)), liposome-mediated DNA uptake, or
electroporation.
[0060] Following transformation, the transgenic plant cells can be
regenerated into transgenic tobacco plants. The regenerated
transgenic plants can be screened for the presence of the transgene
(e.g., a RNAi nucleic acid molecule) and/or one or more of the
resulting phenotypes (e.g., reduced amount of PMT mRNA or PMT
polypeptide, reduced activity of a PMT polypeptide, reduced amount
of N-methylputrescine, reduced amount of one or more other
intermediates in the biosynthesis of nicotine (e.g.,
N-methylputrescien, N-methyl.DELTA.-pyrolinium), reduced amount of
nicotine, and/or reduced amount of one or more TSNAs (in cured
tobacco)) using methods described herein, and plants exhibiting the
desired phenotype can be selected.
[0061] Methods of detecting alkaloids (e.g., N-methylputrescine,
nicotine) or TSNAs, and methods of determining the amount of one or
more alkaloids or TSNAs are known in the art. For example, high
performance liquid chromatography (HPLC)-mass spectroscopy (MS)
(HPLC-MS) or high performance thin layer chromatography (HPTLC) can
be used to detect the presence of one or more alkaloids and/or
determine the amount of one or more alkaloids. In addition, any
number of chromatography methods (e.g., gas chromatography/thermal
energy analysis (GC/TEA), liquid chromatography/mass spectrometry
(LC/MS), and ion chromatography (IC)) can be used to detect the
presence of one or more TSNAs and/or determine the amount of one or
more TSNAs.
[0062] As used herein, "reduced" or "reduction" refers to a
decrease (e.g., a statistically significant decrease), in green
leaf or cured leaf, of/in one or more of the following: a) the
amount of PMT mRNA; b) the amount of PMT polypeptide; c) the
activity of the PMT polypeptide; d) the amount of
N-methylputrescine; e) the amount of one or more other
intermediates in the biosynthesis of nicotine; and/or f) the amount
of nicotine. In addition, "reduced" or "reduction" refers to a
decrease (e.g., a statistically significant decrease), in cured
leaf, in the amount of one or more tobacco-specific nitrosamines
(TSNAs; e.g., N'-nitrosonornicotine (NNN),
4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK),
N'-nitrosoanatabine (NAT), N'-nitrosoanabasine (NAB), and
4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanal (NNAL)). As used
herein, "reduced" or "reduction" refers to a decrease in any of the
above by at least about 5% up to about 95% (e.g., about 5% to about
10%, about 5% to about 20%, about 5% to about 50%, about 5% to
about 75%, about 10% to about 25%, about 10% to about 50%, about
10% to about 90%, about 20% to about 40%, about 20% to about 60%,
about 20% to about 80%, about 25% to about 75%, about 50% to about
75%, about 50% to about 85%, about 50% to about 95%, and about 75%
to about 95%) relative to similarly-treated leaf (e.g., green or
cured) from a tobacco plant lacking the transgene. As used herein,
statistical significance refers to a p-value of less than 0.05,
e.g., a p-value of less than 0.025 or a p-value of less than 0.01,
using an appropriate measure of statistical significance, e.g., a
one-tailed two sample t-test.
[0063] Leaf from progeny plants also can be screened for the
presence of the transgene and/or the resulting phenotype, and
plants exhibiting the desired phenotype can be selected. As
described herein, leaf from such transgenic plants exhibit a
reduced amount of N-methylputrescine, a reduced amount of one or
more other intermediates in the biosynthesis of nicotine, a reduced
amount of nicotine, or, in cured tobacco, a reduced amount of one
or more TSNAs (e.g., compared to leaf from a plant lacking or not
transcribing the RNAi). As described herein, transcription of the
transgene results in leaf that exhibits a reduced amount of
N-methylputrescine, a reduced amount of one or more other
intermediates in the biosynthesis of nicotine, a reduced amount of
nicotine, or, in cured tobacco, a reduced amount of one or more
TSNAs relative to leaf from a plant not transcribing the transgene.
Leaf from regenerated transgenic plants can be screened for the
amount of N-methylputrescine, the amount of one or more other
intermediates in the biosynthesis of nicotine, the amount of
nicotine, or, in cured tobacco, the amount of one or more TSNAs,
and plants having leaf that exhibit a reduced amount of
N-methylputrescine, a reduced amount of one or more other
intermediates in the biosynthesis of nicotine, a reduced amount of
nicotine, or, in cured tobacco, a reduced amount of TSNAs, compared
to the amount in a leaf from a corresponding non-transgenic plant,
can be selected.
[0064] Transgenic plants exhibiting the desired phenotype can be
used, for example, in a breeding program. Breeding is carried out
using known procedures. Successful crosses yield F.sub.1 plants
that are fertile and that can be backcrossed with one of the
parents if desired. In some embodiments, a plant population in the
F.sub.2 generation is screened for the presence of a transgene
and/or the resulting phenotype using standard methods (e.g.,
amplification, hybridization and/or chemical analysis of the leaf).
Selected plants are then crossed with one of the parents and the
first backcross (BC.sub.1) generation plants are self-pollinated to
produce a BC.sub.1F.sub.2 population that is again screened. The
process of backcrossing, self-pollination, and screening is
repeated, for example, at least four times until the final
screening produces a plant that is fertile and reasonably similar
to the recurrent parent. This plant, if desired, is self-pollinated
and the progeny are subsequently screened again to confirm that the
plant contains the transgene and exhibits variant gene expression.
Breeder's seed of the selected plant can be produced using standard
methods including, for example, field testing and/or chemical
analyses of leaf (e.g., cured leaf).
[0065] The result of a plant breeding program using the transgenic
tobacco plants described herein are novel and useful varieties,
lines, and hybrids. As used herein, the term "variety" refers to a
population of plants that share constant characteristics which
separate them from other plants of the same species. A variety is
often, although not always, sold commercially. While possessing one
or more distinctive traits, a variety is further characterized by a
very small overall variation between individual with that variety.
A "pure line" variety may be created by several generations of
self-pollination and selection, or vegetative propagation from a
single parent using tissue or cell culture techniques. A "line," as
distinguished from a variety, most often denotes a group of plants
used non-commercially, for example, in plant research. A line
typically displays little overall variation between individuals for
one or more traits of interest, although there may be some
variation between individuals for other traits.
[0066] A variety can be essentially derived from another line or
variety. As defined by the International Convention for the
Protection of New Varieties of Plants (Dec. 2, 1961, as revised at
Geneva on Nov. 10, 1972, On Oct. 23, 1978, and on Mar. 19, 1991), a
variety is "essentially derived" from an initial variety if: a) it
is predominantly derived from the initial variety, or from a
variety that is predominantly derived from the initial variety,
while retaining the expression of the essential characteristics
that result from the genotype or combination of genotypes of the
initial variety; b) it is clearly distinguishable from the initial
variety; and c) except for the differences which result from the
act of derivation, it conforms to the initial variety in the
expression of the essential characteristics that result from the
genotype or combination of genotypes of the initial variety.
Essentially derived varieties can be obtained, for example, by the
selection of a natural or induced mutant, a somaclonal variant, a
variant individual plant from the initial variety, backcrossing, or
transformation.
[0067] Hybrid tobacco varieties can be produced by preventing
self-pollination of female parent plants (i.e., seed parents) of a
first variety, permitting pollen from male parent plants of a
second variety to fertilize the female parent plants, and allowing
F.sub.1 hybrid seeds to form on the female plants. Self-pollination
of female plants can be prevented by emasculating the flowers at an
early stage of flower development. Alternatively, pollen formation
can be prevented on the female parent plants using a form of male
sterility. For example, male sterility can be produced by
cytoplasmic male sterility (CMS), nuclear male sterility, genetic
male sterility, molecular male sterility where a transgene inhibits
microsporogenesis and/or pollen formation, or self-incompatibility.
Female parent plants having CMS are particularly useful. In
embodiments in which the female parent plants are CMS, the male
parent plants typically contain a fertility restorer gene to ensure
that the F.sub.1 hybrids are fertile. In other embodiments in which
the female parents are CMS, male parents can be used that do not
contain a fertility restorer. F.sub.1 hybrids produced from such
parents are male sterile. Male sterile hybrid seed can be
interplanted with male fertile seed to provide pollen for seed-set
on the resulting male sterile plants.
[0068] Varieties and lines described herein can be used to form
single-cross tobacco F.sub.1 hybrids. In such embodiments, the
plants of the parent varieties can be grown as substantially
homogeneous adjoining populations to facilitate natural
cross-pollination from the male parent plants to the female parent
plants. The F.sub.2 seed formed on the female parent plants is
selectively harvested by conventional means. One also can grow the
two parent plant varieties in bulk and harvest a blend of F.sub.1
hybrid seed formed on the female parent and seed formed upon the
male parent as the result of self-pollination. Alternatively,
three-way crosses can be carried out wherein a single-cross F.sub.1
hybrid is used as a female parent and is crossed with a different
male parent. As another alternative, double-cross hybrids can be
created wherein the F.sub.1 progeny of two different single-crosses
are themselves crossed. Self-incompatibility can be used to
particular advantage to prevent self-pollination of female parents
when forming a double-cross hybrid.
[0069] The tobacco plants used in the methods described herein can
be a Burley type, a dark type, a flue-cured type, or an Oriental
type. The tobacco plants used in the methods described herein
typically are from N. tabacum, and can be from any number of N.
tabacum varieties. A variety can be BU 64, CC 101, CC 200, CC 13,
CC 27, CC 33, CC 35, CC 37, CC 65, CC 67, CC 301, CC 400, CC 500,
CC 600, CC 700, CC 800, CC 900, CC 1063, Coker 176, Coker 319,
Coker 371 Gold, Coker 48, CU 263, DF911, Galpao tobacco, GL 26H, GL
338, GL 350, GL 395, GL 600, GL 737, GL 939, GL 973, GF 157, GF
318, RJR 901, HB 04P, K 149, K 326, K 346, K 358, K394, K 399, K
730, NC 196, NC 37NF, NC 471, NC 55, NC 92, NC2326, NC 95, NC 925,
PVH 1118, PVH 1452, PVH 2110, PVH 2254, PVH 2275, VA 116, VA 119,
KDH 959, KT 200, KT204LC, KY 10, KY 14, KY 160, KY 17, KY 171, KY
907, KY907LC, KTY14.times.L8 LC, Little Crittenden, McNair 373,
McNair 944, msKY 14.times.L8, Narrow Leaf Madole, NC 100, NC 102,
NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC
606, NC 71, NC 72, NC 810, NC BH 129, NC 2002, Neal Smith Madole,
OXFORD 207, Perique tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R
610, R 630, R 7-11, R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS
1410, Speight 168, Speight 172, Speight 179, Speight 210, Speight
220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight
G-70, Speight H-6, Speight H20, Speight NF3, TI 1406, TI 1269, TN
86, TN86LC, TN 90, TN90LC, TN 97, TN97LC, TN D94, TN D950, TR (Tom
Rosson) Madole, VA 309, or VA359.
Mutant Plants and Methods of Making
[0070] Methods of making a N. tabacum plant having a mutation are
known in the art. Mutations can be random mutations or targeted
mutations. For random mutagenesis, cells (e.g., N. tabacum cells)
typically are mutagenized using, for example, a chemical mutagen or
ionizing radiation. Representative chemical mutagens include,
without limitation, nitrous acid, sodium azide, acridine orange,
ethidium bromide, and ethyl methane sulfonate (EMS), while
representative ionizing radiation includes, without limitation,
x-rays, gamma rays, fast neutron irradiation, and UV irradiation.
The dosage of the mutagenic chemical or radiation is determined
experimentally for each type of plant tissue such that a mutation
frequency is obtained that is below a threshold level characterized
by lethality or reproductive sterility. The number of M.sub.1
generation seed or the size of M.sub.1 plant populations resulting
from the mutagenic treatments are estimated based on the expected
frequency of mutations. For targeted mutagenesis, representative
technologies include TALEN (see, for example, Li et al., 2011,
Nucleic Acids Res., 39(14):6315-25) or zinc-finger (see, for
example, Wright et al., 2005, The Plant J., 44:693-705). Whether
random or targeted, a mutation can be a point mutation, an
insertion, a deletion, a substitution, or combinations thereof,
which are discussed in more detail below.
[0071] The resultant variety of Nicotiana tabacum includes plants
having a mutation in an endogenous PMT nucleic acid (e.g., SEQ ID
NOs: 1, 3, 5, 7 or 9) encoding a PMT polypeptide sequence (e.g.,
SEQ ID NOs: 2, 4, 6, 8 or 10). A mutation in PMT as described
herein typically results in reduced expression or activity of PMT,
which, in turn, results in a reduced amount of N-methylputrescine,
a reduced amount of one or more other intermediates in the
biosynthesis of nicotine, a reduced amount of nicotine, or, in
cured tobacco, a reduced amount of one or more TSNAs in the mutant
plant relative to a plant lacking the mutation.
[0072] Conserved domains in polypeptides can be important for
polypeptide function as well as cellular or subcellular location.
FIG. 1 shows an alignment of PMT nucleic acid sequences, and FIG. 2
shows an alignment of PMT polypeptide sequences; in the polypeptide
sequences shown in FIG. 2, the methyltransferase domains are
indicated by a box from amino acid position 211 to amino acid
position 320.
[0073] As discussed herein, one or more nucleotides can be mutated
to alter the expression and/or function of the encoded polypeptide,
relative to the expression and/or function of the corresponding
wild type polypeptide. It will be appreciated, for example, that a
mutation in one or more of the highly conserved regions (see, for
example, the alignment shown in FIG. 2) would likely alter
polypeptide function, while a mutation outside of those highly
conserved regions would likely have little to no effect on
polypeptide function. In addition, a mutation in a single
nucleotide can create a stop codon, which would result in a
truncated polypeptide and, depending on the extent of truncation,
loss of function.
[0074] Preferably, a mutation in a PMT nucleic acid results in a
tobacco plant that exhibits reduced expression or activity of PMT,
a reduced amount of N-methylputrescine, a reduced amount of one or
more other intermediates in the biosynthesis of nicotine, a reduced
amount of nicotine, or, in cured tobacco, a reduced amount of one
or more TSNAs. Suitable types of mutations in a PMT coding sequence
include, without limitation, insertions of nucleotides, deletions
of nucleotides, or transitions or transversions in the wild-type
PMT coding sequence. Mutations in the coding sequence can result in
insertions of one or more amino acids, deletions of one or more
amino acids, and/or conservative or non-conservative amino acid
substitutions in the encoded polypeptide. In some cases, the coding
sequence of a PMT comprises more than one mutation and/or more than
one type of mutation.
[0075] Insertion or deletion of amino acids in a coding sequence,
for example, can disrupt the conformation of the encoded
polypeptide. Amino acid insertions or deletions also can disrupt
sites important for recognition of binding ligand(s) or
substrate(s) (e.g., putrescine, S-adenosyl-L-methionine) or for
activity of the polypeptide (i.e., methyltransferase actvity). It
is known in the art that the insertion or deletion of a larger
number of contiguous amino acids is more likely to render the gene
product non-functional, compared to a smaller number of inserted or
deleted amino acids. In addition, one or more mutations (e.g., a
point mutation) can change the localization of the PMT polypeptide,
introduce a stop codon to produce a truncated polypeptide, or
disrupt an active site or domain (e.g., a catalytic site or domain,
a binding site or domain) within the polypeptide.
[0076] A "conservative amino acid substitution" is one in which one
amino acid residue is replaced with a different amino acid residue
having a similar side chain (see, for example, Dayhoff et al.
(1978, in Atlas of Protein Sequence and Structure, 5(Suppl.
3):345-352), which provides frequency tables for amino acid
substitutions), and a non-conservative substitution is one in which
an amino acid residue is replaced with an amino acid residue that
does not have a similar side chain. Non-conservative amino acid
substitutions can replace an amino acid of one class with an amino
acid of a different class. Non-conservative substitutions can make
a substantial change in the charge or hydrophobicity of the gene
product. Non-conservative amino acid substitutions can also make a
substantial change in the bulk of the residue side chain, e.g.,
substituting an alanine residue for an isoleucine residue. Examples
of non-conservative substitutions include a basic amino acid for a
non-polar amino acid, or a polar amino acid for an acidic amino
acid.
[0077] Simply by way of example, a PMT3 amino acid sequence (e.g.,
SEQ ID NO:8) can be mutated to change phenylalanine to leucine,
which may disrupt secondary structure. In addition, a PMT nucleic
acid sequence (e.g., SEQ ID NO:7) can be mutated to change TGG to
TAG or TGA at nucleotide positions 281, 282, 305, 306, 857, 858,
931 or 932; CAG to TAG at nucleotide positions 73, 106, 139, 172,
193, 205, 244, 349, or 841; or CAA to TAA at nucleotide positions
94, 160, 367, 430, 712, 880, 901, or 1045, each of which would
result in a stop codon (see, for example, FIG. 4). Such a mutation
would significantly reduce or essentially eliminate the amount of
PMT mRNA or polypeptide or the activity of PMT in the plant.
Similar mutations can be introduced into any of the other PMT
sequences disclosed herein (e.g., PMT1a, PMT1b, PMT2, or PMT4).
[0078] Following mutagenesis, M.sub.0 plants are regenerated from
the mutagenized cells and those plants, or a subsequent generation
of that population (e.g., M.sub.1, M.sub.2, M.sub.3, etc.), can be
screened for those carrying a mutation in a PMT sequence. Screening
for plants carrying a mutation in a PMT nucleic acid or polypeptide
can be performed directly using methods routine in the art (e.g.,
hybridization, amplification, nucleic acid sequencing, peptide
sequencing, combinations thereof) or by evaluating the phenotype
(e.g., reduced expression or activity of PMT, reduced amounts of
N-methylputrescine, reduced amounts of one or more other
intermediates in the biosynthesis of nicotine, reduced amounts of
nicotine, and/or reduced amounts of one or more TSNAs (in cured
tobacco)). It would be understood that the phenotype of a mutant
plant (e.g., reduced expression or activity of PMT, reduced amounts
of N-methylputrescine, reduced amounts of one or more other
intermediates in the biosynthesis of nicotine, reduced amounts of
nicotine, and/or reduced amounts of one or more TSNAs (in cured
tobacco)) would be compared to a corresponding plant (e.g., having
the same varietal background) that lacks the mutation.
[0079] An M.sub.1 tobacco plant may be heterozygous for a mutant
allele and exhibit a wild type phenotype. In such cases, at least a
portion of the first generation of self-pollinated progeny of such
a plant exhibits a wild type phenotype. Alternatively, an M.sub.1
tobacco plant may have a mutant allele and exhibit a mutant
phenotype (e.g., reduced expression or activity of PMT, reduced
amounts of N-methylputrescine, reduced amounts of one or more other
intermediates in the biosynthesis of nicotine, reduced amounts of
nicotine, and/or reduced amounts of one or more TSNAs (in cured
tobacco)). Such plants may be heterozygous and exhibit a mutant
phenotype due to a phenomenon such as dominant negative
suppression, despite the presence of the wild type allele, or such
plants may be homozygous due to independently induced mutations in
both alleles.
[0080] As used herein, "reduced" or "reduction" refers to a
decrease (e.g., a statistically significant decrease) in the
expression or activity of PMT, or in the amount of
N-methylputrescine, one or more other intermediates in the
biosynthesis of nicotine, or nicotine, in either green or cured
tobacco, or in the amount of one or more TSNAs, in cured tobacco,
by at least about 5% up to about 95% (e.g., about 5% to about 10%,
about 5% to about 20%, about 5% to about 50%, about 5% to about
75%, about 10% to about 25%, about 10% to about 50%, about 10% to
about 90%, about 20% to about 40%, about 20% to about 60%, about
20% to about 80%, about 25% to about 75%, about 50% to about 75%,
about 50% to about 85%, about 50% to about 95%, and about 75% to
about 95%) relative to similarly-treated leaf (e.g., green or
cured) from a tobacco plant lacking the mutation. As used herein,
statistical significance refers to a p-value of less than 0.05,
e.g., a p-value of less than 0.025 or a p-value of less than 0.01,
using an appropriate measure of statistical significance, e.g., a
one-tailed two sample t-test.
[0081] A tobacco plant carrying a mutant allele can be used in a
plant breeding program to create novel and useful lines, varieties
and hybrids. Desired plants that possess the mutation can be
backcrossed or self-pollinated to create a second population to be
screened. Backcrossing or other breeding procedures can be repeated
until the desired phenotype of the recurrent parent is recovered.
DNA fingerprinting, SNP or similar technologies may be used in a
marker-assisted selection (MAS) breeding program to transfer or
breed mutant alleles into other tobaccos, as described herein.
[0082] In some embodiments, an M.sub.1, M.sub.2, M.sub.3 or later
generation tobacco plant containing at least one mutation is
crossed with a second Nicotiana tabacum plant, and progeny of the
cross are identified in which the mutation(s) is present. It will
be appreciated that the second Nicotiana tabacum plant can be one
of the species and varieties described herein. It will also be
appreciated that the second Nicotiana tabacum plant can contain the
same mutation as the plant to which it is crossed, a different
mutation, or be wild type at the locus. Additionally or
alternatively, a second tobacco line can exhibit a phenotypic trait
such as, for example, disease resistance, high yield, high grade
index, curability, curing quality, mechanical harvesting, holding
ability, leaf quality, height, plant maturation (e.g., early
maturing, early to medium maturing, medium maturing, medium to late
maturing, or late maturing), stalk size (e.g., small, medium, or
large), and/or leaf number per plant (e.g., a small (e.g., 5-10
leaves), medium (e.g., 11-15 leaves), or large (e.g., 16-21) number
of leaves).
Cured Tobacco and Tobacco Products
[0083] The methods described herein allow for leaf constituents in
a tobacco plant to be altered while still maintaining high leaf
quality. As described herein, altering leaf constituents refers to
reducing, in green or cured leaf, the amount of N-methylputrescine,
one or more other intermediates in the biosynthesis of nicotine, or
nicotine, or reducing, in cured leaf, the amount of one or more
TSNAs. As described herein, such methods can include the production
of transgenic plants (using, e.g., RNAi or overexpression) or
mutagenesis (e.g., random or targeted).
[0084] Leaf quality can be determined, for example, using an
Official Standard Grade published by the Agricultural Marketing
Service of the US Department of Agriculture (7 U.S.C. .sctn. 511);
Legacy Tobacco Document Library (Bates Document #523267826/7833,
Jul. 1, 1988, Memorandum on the Proposed Burley Tobacco Grade
Index); and Miller et al., 1990, Tobacco Intern., 192:55-7. For
dark-fired tobacco, leaves typically are obtained from stalk
position C, and the average grade index determined based on Federal
Grade and 2004 Price Support for Type 23 Western dark-fired
tobacco.
[0085] Leaf from the tobacco described herein can be cured, aged,
conditioned, and/or fermented. Methods of curing tobacco are well
known and include, for example, air curing, fire curing, flue
curing and sun curing. Aging also is known and is typically carried
out in a wooden drum (e.g., a hogshead) or cardboard cartons in
compressed conditions for several years (e.g., 2 to 5 years), at a
moisture content of from about 10% to about 25% (see, for example,
U.S. Pat. Nos. 4,516,590 and 5,372,149). Conditioning includes, for
example, a heating, sweating or pasteurization step as described in
US 2004/0118422 or US 2005/0178398, while fermenting typically is
characterized by high initial moisture content, heat generation,
and a 10 to 20% loss of dry weight. See, e.g., U.S. Pat. Nos.
4,528,993; 4,660,577; 4,848,373; and 5,372,149. The tobacco also
can be further processed (e.g., cut, expanded, blended, milled or
comminuted), if desired, and used in a tobacco product.
[0086] Tobacco products are known in the art and include any
product made or derived from tobacco that is intended for human
consumption, including any component, part, or accessory of a
tobacco product. Representative tobacco products include, without
limitation, cigarettes, smokeless tobacco products, tobacco-derived
nicotine products, cigarillos, non-ventilated recess filter
cigarettes, vented recess filter cigarettes, cigars, snuff,
electronic cigarettes, e-vapor products, pipe tobacco, cigar
tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, shredded
tobacco, and cut tobacco. Representative smokeless tobacco products
include, for example, chewing tobacco, snus, pouches, films,
tablets, sticks, rods, and the like. Representative cigarettes and
other smoking articles include, for example, smoking articles that
include filter elements or rod elements, where the rod element of a
smokeable material can include cured tobacco within a tobacco
blend. In addition to the reduced-nicotine or reduced-TSNA tobacco
described herein, tobacco products also can include other
ingredients such as, without limitation, binders, plasticizers,
stabilizers, and/or flavorings. See, for example, US 2005/0244521,
US 2006/0191548, US 2012/0024301, US 2012/0031414, and US
2012/0031416 for examples of tobacco products.
[0087] In accordance with the present invention, there may be
employed conventional molecular biology, microbiology, biochemical,
and recombinant DNA techniques within the skill of the art. Such
techniques are explained fully in the literature. The invention
will be further described in the following examples, which do not
limit the scope of the methods and compositions of matter described
in the claims.
EXAMPLES
Example 1--PMT Sequences
[0088] To develop low nicotine transgenic lines, a PMT RNAi
expression vector is designed and transcribed in tobacco using the
nucleic acid sequence of PMT3 (SEQ ID NO:7). The protein sequence
of PMT3 is shown in SEQ ID NO:8. The cloning vector, pBK-CMV, was
used for the construction of a RNAi vector containing a 500 bp
sequence of PMT3 in the sense and antisense orientations (SEQ ID
NOs:11 and 12, respectively). The two fragments are separated by a
660 bp tobacco Cax2 spacer sequence (SEQ ID NO:13). See FIG. 3.
TABLE-US-00001 PMT3 RNAi sense strand (SEQ ID NO: 11)
ACCAACACAAATGGCTCTACTATCTTCAAGAATGGTGCCATTCCCATGA
ACGGTTACCAGAATGGCACTTCCAAACACCAAAACGGCCACCAGAATGG
CACTTCCGAACATCGGAACGGCCACCAGAATGGGATTTCCGAACACCAA
AACGGCCACCAGAATGGCACTTCCGAGCATCAGAACGGCCATCAGAATG
GGACAATCAGCCATGACAACGGCAACGAGCTACAGCTACTGGGAAGCTC
CAACTCTATTAAGCCTGGTTGGTTTTCAGAGTTTAGCGCATTATGGCCA
GGTGAAGCATTCTCACTTAAGGTTGAGAAGTTACTATTCCAGGGGAAGT
CTGATTACCAAGATGTCATGCTCTTTGAGTCAGCAACATATGGGAAGGT
TCTGACTTTGGATGGAGCAATTCAACACACAGAGAATGGTGGATTTCCA
TACACTGAAATGATTGTTCATCTTCCACTTGGTTCCATCCCAAACCCTA AAAAGGTTTT PMT3
RNAi antisense strand (SEQ ID NO: 12)
AAAACCTTTTTAGGGTTTGGGATGGAACCAAGTGGAAGATGAACAATCA
TTTCAGTGTATGGAAATCCACCATTCTCTGTGTGTTGAATTGCTCCATC
CAAAGTCAGAACCTTCCCATATGTTGCTGACTCAAAGAGCATGACATCT
TGGTAATCAGACTTCCCCTGGAATAGTAACTTCTCAACCTTAAGTGAGA
ATGCTTCACCTGGCCATAATGCGCTAAACTCTGAAAACCAACCAGGCTT
AATAGAGTTGGAGCTTCCCAGTAGCTGTAGCTCGTTGCCGTTGTCATGG
CTGATTGTCCCATTCTGATGGCCGTTCTGATGCTCGGAAGTGCCATTCT
GGTGGCCGTTTTGGTGTTCGGAAATCCCATTCTGGTGGCCGTTCCGATG
TTCGGAAGTGCCATTCTGGTGGCCGTTTTGGTGTTTGGAAGTGCCATTC
TGGTAACCGTTCATGGGAATGGCACCATTCTTGAAGATAGTAGAGCCAT TTGTGTTGGT Cax
sequence (SEQ ID NO: 13)
GAATTCGGTGAGTTCCCCCCTCCTCCCCTTTCACTTTTGTTTGTTGGTT
TCTAAGTGCTCTTTCAATTTAGAGGTTGATGTTGGGAAATAATTAAACA
ATACTCTTGTTTTCTAAAATTTCTTGAAAACTACAATGTCTATAGAGGC
AATATATTTGCTTCTAAACGTTGACGGTTTTGCAAGTCTTGCGGAGGAG
CTTTGATCCAGTGTTAAAGAAATATATCATGTCTCTTATTCATCCTCCC
TTTCTTTCCTTTGTGTTTTGCTTCACTCCTGGGGTTTCAACTTTTTTCT
TTCCGTTTAACCTTTCCTTTTTTCTGCAGGATGGAACTTCAAATTACTT
TAAAGGACTGATGCTCCTTCTCTGCTATTGATAGTTGCTGCAAGTTTCT
TTGTGCATATAGATCCAGAGTCTATACGTAAGTTGTGTTTCTTTTTCGT
GAAATTACCATATGACATTGACAGCTCCTGGTCTTCGTTTTATTTATTC
TTTTGGTGTTCCTTTTAACCGATAACATCTGTTATTATTTCACTGTTAC
ACTAATCTGCTTTGCTTATGGTCAGTCAGTTTAGCATTAGATTAGATAA
CCAGTTAACCATTTTGGGTCTCGTTAACGTAATATTGTATTGATAACTA
CCTTATCATATATATATCTCTGTTTTAGTGAATTC
Example 2--Generating a PMT Interfering RNAi
[0089] The 660 bp Cax2 sequence from BAC 57 intron 9 (SEQ ID NO:13)
is cloned directly into pBK-CMK at the EcoRI site. XbaI and HindIII
sites are added to the 5' and 3' ends of a 500 bp sense-orientated
PMT by means of PCR with primers harboring these restriction enzyme
sites.
TABLE-US-00002 PMG546F: (SEQ ID NO: 14) ATTCTAGACCAACACAAATGGCTCTAC
PMG 546R: (SEQ ID NO: 15) ATAAGCTTAAAACCTTTTTAGGGTTTGG
[0090] Similarly, BamHI and Sad sites are created at the 5' and 3'
ends of the corresponding PMT antisense fragment by PCR with
primers harboring these restriction enzyme sites to produce
PBK-CMV-PMT RNAi plasmid.
TABLE-US-00003 PMG 547F: (SEQ ID NO: 16)
ATGAGCTCACCAACACAAATGGCTCTAC PMG 547R: (SEQ ID NO: 17)
ATGGATCCAAAACCTTTTTAGGGTTTGG)
Example 3--Generating a PMT Interfering RNAi Expression
Construct
[0091] To create a plant expression vector capable of mediating the
constitutive transcription of PMT RNAi, the beta-glucuronidase open
reading frame of the binary expression vector, pBI121 (Clontech,
Palo Alto, Calif.), is excised and replaced with the 500 bp
XbaI-HindIII PMT sense fragment, the 660 bp Cax2 spacer sequence
cloned at the EcoRI site, and the 500 bp BamHI-Sad PMT antisense
fragment by cloning into the XbaI/SacI sites of PBI121 to produce a
plasmid designated PBI121-PMT RNAi. See FIG. 3.
Example 4--Production of Transgenic Plants
[0092] TN90 and K326 cultivars are transformed using
Agrobacterium-mediated transformation and selected for kanamycin
resistance. First generation transformants that are
kanamycin-resistant are propagated in the greenhouse. At the
flowering stage, plants are topped. Two weeks post-topping, the 3rd
and 4th leaf from the top are collected, freeze-dried and the
alkaloids are analyzed using GCMS. Relative to controls, PMT RNAi
lines show significant reduction in nicotine content (Table 1). Two
years of field study of selected transgenic lines and a control
also show reduced nicotine content (Table 2).
TABLE-US-00004 TABLE 1 T0 generation of PMT RNAi transgenic plants
Variety Plant ID Nicotine Nornicotine Anabasine Anatabine Total
Alkaloids K326 07T539 0.205 0.0657 0.0359 1.02 1.327 07T541 0.213
0.0566 0.033 0.782 1.085 07T545 0.216 0.0505 0.0286 0.65 0.945
07T548 0.214 0.0384 0.027 0.56 0.839 07T318 0.207 0.0349 0.0187
0.412 0.673 07T331 0.216 0.0346 0.0212 0.398 0.67 Control 1.53
0.0442 0.00746 0.0662 1.648 TN90 06T348 0.196 0.0519 0.035 0.887
1.17 06T347 0.202 0.0491 0.028 0.708 0.987 06TN2009 0.197 0.041
0.0295 0.685 0.953 06TN2083 0.193 0.0532 0.0276 0.575 0.849
06TN2051 0.202 0.0522 0.0222 0.554 0.83 06TN2010 0.213 0.0278
0.0205 0.528 0.789 Control 3.06 0.07132 0.00871 0.07378 3.215
TABLE-US-00005 TABLE 2 Alkaloid levels in T1 and T2 generation PMT
RNAi transgenic plants Line Total Variety Generation ID Nicotine
Nornicotine Anabasine Anatabine Alkaloids K326 T1 T841 0.201 .+-.
0.031 .+-. 0.0204 .+-. 0.319 .+-. 0.572 .+-. 0.008 0.009 0.0038
0.088 0.10 Control 2.73 .+-. 0.051 .+-. 0.009 .+-. 0.039 .+-. 2.83
.+-. 0.46 0.010 0.0016 0.007 0.47 T2 T841 >0.15 .+-. 0.0250 .+-.
0.0178 .+-. 0.371 .+-. 0.414 .+-. 0.0 0.008 0.0031 0.068 0.08
Control 2.5 .+-. 0.048 .+-. 0.008 .+-. 0.049 .+-. 2.61 .+-. 0.28
0.005 0.0012 0.006 0.29 TN90 T1 T841 0.209 .+-. 0.058 .+-. 0.033
.+-. 0.51 .+-. 0.809 .+-. 0.02 0.008 0.005 0.163 0.18 Control 4.95
.+-. 0.104 .+-. 0.014 .+-. 0.073 .+-. 5.14 .+-. 0.56 0.019 0.002
0.011 0.59 T2 T841 >0.15 .+-. 0.037 .+-. 0.032 .+-. 0.555 .+-.
0.635 .+-. 0.0 0.015 0.009 0.142 0.17 Control 4.12 .+-. 0.086 .+-.
0.0146 .+-. 0.105 .+-. 4.33 .+-. 0.45 0.012 0.0025 0.014 0.47
Example 5--Quality of Leaf from Transgenic Plants
[0093] To compare leaf quality in existing low alkaloid tobacco
lines with leaf quality in PMT-silenced lines, plants from stable
K326 PMT RNAi and TN90 PMT RNAi lines along with K326, TN 90, NC
95, LAFC 53 (Ling et al., 2012, PLoS One, 7(4):e35688; referred to
therein as "low pyridine alkaloid" plants (nic1nic.sup.2/aabb
genotype)), B&W Low Nic, Burley 21 (Heggestad et al., 1960,
University of Tennessee Agricultural Experiment Station, Bulletin
321; described therein as having reduced nicotine and nornicotine
levels (nic1nic2 genotype)), HI Burley 21 or LI Burley 21 (Nielsen
et al., 1988, Crop Science, 28:206; described therein as having
intermediate levels of total alkaloids), and LA Burley 21 (Legg et
al., 1970, Crop Science, 10:212; described therein as having
"extremely low alkaloid content") are grown in 1 plot rows with 3
replications. All plants are topped at maturity, cured, and leaf
samples are collected for evaluation. As demonstrated in FIGS. 6
and 7, K326 PMT RNAi and TN90 PMT RNAi lines show significantly
better leaf quality compared to the other low alkaloid lines.
[0094] In addition, plants from stable TN 90 LC PMT RNAi transgenic
lines along with Burley 21, LA Burley 21 and TN 90 LC ("Low
converter" of nicotine to nornicotine) are grown in plots in the
presence of no added nitrogen (0 N), or in the presence of 90 kg/ha
nitrogen (90 N) or 180 kg/ha nitrogen (180 N). Plants are topped at
maturity or not, as indicated ("Topped" or "Untopped"), and leaf
samples are collected after curing for evaluation. FIG. 8 shows
that the TN 90 LC PMT RNAi lines exhibit a significant reduction in
the amount of nicotine (%) relative to the non-transgenic plants,
and also shows that the amount of nicotine in the TN 90 LC PMT RNAi
lines is reduced to a level that is comparable with the LA BU 21
variety, a mutant that exhibits extremely low alkaloid content
(Legg et al., 1970, Crop Science, 10:212). FIG. 9 shows that TN 90
LC PMT RNAi lines exhibit about the same yield as the LA BU 21
variety but exhibits a better leaf quality grade.
Example 6--Random Mutagenesis
[0095] A novel genetic variation in a population of tobacco plants
is created to identify plants for low alkaloids. To induce random
mutation, approximately 10,000 seeds of the selected tobacco
variety are treated with 0.5% ethyl methane sulfonate (EMS; M1
seed), germinated and propagated (into M1 plants). M2 seeds from
self-pollinated M1 plants are collected. A composite of M2 seed is
grown and leaves from M2 plants are collected and the DNA
extracted. Each of the five PMT sequences are amplified and
sequenced, and then analyzed for mutations.
Example 7--Targeted Mutagenesis Using TALENs
[0096] Transcription activator like (TAL) effector protein
sequences for the five PMT genes are designed to target either
individual PMTs or all five PMTs (Table 3). The TALs are
synthesized and cloned into a plant expression vector (Life
Technologies, Inc.) to serve as entry vectors. Depending on the
intention, three different protocols are used to generate mutagenic
tobacco lines: a) one or more entry vectors containing the target
TALs are directly transformed into tobacco protoplasts to generate
random sequence deletion or insertion mutagenic tobacco lines; b) a
donor sequence (e.g., a reporter gene such as, without limitation,
the GUS gene) flanked on the left and right side with sequences
that are homologous to the target insertion sequence is
co-transformed into tobacco protoplasts with one or more entry
vectors to generate mutagenic tobacco lines containing a target
sequence interrupted by the donor sequence; or c) a donor sequence
containing target TALs containing a point mutation is
co-transformed into tobacco protoplasts with one or more entry
vectors to generate tobacco lines having a point mutation within
the target sequence.
TABLE-US-00006 TABLE 3 TALEN Sequences TALEN Target SEQ ID Name
Gene Location* Target Sequence NO: TALen1A All 5 392....448 T
GAAATGATTGTTCATCTACC acttggttccatccc 18 PMTs (PMT1a)
AAACCCAAAAAAGGTTTTG A TALen1B All 5 838...893 T AAATCCAATTGACAAAGA
gacaactcaagtcaa 19 PMTs (PMT1a) GTCCAAATTAGGACCTCTCA A TALen- PMT1a
62....121 T GAACGGCCACCAAAATGG cacttctgaacacct 20 PMT1a
CAACGGCTACCAGAATGGC A TALen- PMT2 57...115 T CCCATGAATGGCCACCATAA
tggcacttccaaacacca 21 PMT2 AAACGGCCACAAGAATGGG A TALen- PMT3
242...290 T ACAGCTACTGGGAAG ctccaactctattaa 22 PMT3
GCCTGGTTGGTTTTCAG A TALen- PMT4 250...308 T CCGAACACCAAAACGGCCAC
cagaatgggacttccg 23 PMT4 AACACCAAAACGGCCACCAG A *Locations are
shown in FIG. 5
Example 8--Agronomic Practices on Nicotine Reduction
[0097] The impact of agronomic practices was examined on the
percent nicotine reduction in the flue cured lines, NC95, LAFC 53
(a nic1/nic2 mutant), K326 wild type, and K326 PMT RNAi (a line
transgenic for a PMT RNAi). FIG. 10 shows that the K326 PMT RNAi
lines exhibited a significant reduction in the amount of nicotine
(%) relative to the non-transgenic plants. FIG. 10 also shows that
the amount of nicotine in the K326 PMT RNAi lines was reduced to a
level comparable to LAFC 53, a mutant line that exhibits extremely
low alkaloid content.
[0098] The yield and leaf quality was examined in the flue cured
lines, LAFC 53, K326 PMT-RNAi, and K326. FIG. 11 shows that the
K326 PMT RNAi lines exhibited a yield and leaf quality that was
similar to the control variety, K326, but exhibited better yield
and leaf quality compared to the nic1/nic2 mutant line, LAFC53.
[0099] Table 4 shows the alkaloid levels in T1 and T2 generations
of K326 PMT RNAi transgenic plants compared to control TN90
plants.
TABLE-US-00007 TABLE 4 Alkaloid levels in T1 and T2 generation PMT
RNAi transgenic plants Line Total Variety Generation ID Nicotine
Nornicotine Anabasine Anatabine Alkaloids K326 T1 T841 0.201 .+-.
0.031 .+-. 0.0204 .+-. 0.319 .+-. 0.572 .+-. PMT 0.008 0.009 0.0038
0.088 0.10 RNAi Control 2.73 .+-. 0.051 .+-. 0.009 .+-. 0.039 .+-.
2.83 .+-. 0.46 0.010 0.0016 0.007 0.47 T2 T841 >0.15 .+-. 0.0250
.+-. 0.0178 .+-. 0.371 .+-. 0.414 .+-. 0.0 0.008 0.0031 0.068 0.08
Control 2.5 .+-. 0.048 .+-. 0.008 .+-. 0.049 .+-. 2.61 .+-. 0.28
0.005 0.0012 0.006 0.29 TN90 T1 T681 0.209 .+-. 0.058 .+-. 0.033
.+-. 0.51 .+-. 0.809 .+-. 0.02 0.008 0.005 0.163 0.18 Control 4.95
.+-. 0.104 .+-. 0.014 .+-. 0.073 .+-. 5.14 .+-. 0.56 0.019 0.002
0.011 0.59 T2 T681 >0.15 .+-. 0.037 .+-. 0.032 .+-. 0.555 .+-.
0.635 .+-. 0.0 0.015 0.009 0.142 0.17 Control 4.12 .+-. 0.086 .+-.
0.0146 .+-. 0.105 .+-. 4.33 .+-. 0.45 0.012 0.0025 0.014 0.47
[0100] It is to be understood that, while the methods and
compositions of matter have been described herein in conjunction
with a number of different aspects, the foregoing description of
the various aspects is intended to illustrate and not limit the
scope of the methods and compositions of matter. Other aspects,
advantages, and modifications are within the scope of the following
claims.
[0101] Disclosed are methods and compositions that can be used for,
can be used in conjunction with, can be used in preparation for, or
are products of the disclosed methods and compositions. These and
other materials are disclosed herein, and it is understood that
combinations, subsets, interactions, groups, etc. of these methods
and compositions are disclosed. That is, while specific reference
to each various individual and collective combinations and
permutations of these compositions and methods may not be
explicitly disclosed, each is specifically contemplated and
described herein. For example, if a particular composition of
matter or a particular method is disclosed and discussed and a
number of compositions or methods are discussed, each and every
combination and permutation of the compositions and the methods are
specifically contemplated unless specifically indicated to the
contrary. Likewise, any subset or combination of these is also
specifically contemplated and disclosed.
Sequence CWU 1
1
2411128DNANicotiana tabacum 1atggaagtca tatctaccaa cacaaatggc
tctaccatct tcaagaatgg tgccattccc 60atgaacggcc accaaaatgg cacttctgaa
cacctcaacg gctaccagaa tggcacttcc 120aaacaccaaa acgggcacca
gaatggcact ttcgaacatc ggaacggcca ccagaatggg 180acatccgaac
aacagaacgg gacaatcagc catgacaatg gcaacgagct actgggaagc
240tccgactcta ttaagcctgg ctggttttca gagtttagcg cattatggcc
aggtgaagca 300ttctcactta aggttgagaa gttactattc caggggaagt
ctgattacca agatgtcatg 360ctctttgagt cagcaactta tgggaaggtt
ctgactttgg atggagcaat tcaacataca 420gagaatggtg gatttccata
cactgaaatg attgttcatc taccacttgg ttccatccca 480aacccaaaaa
aggttttgat catcggcgga ggaattggtt ttacattatt cgaaatgctt
540cgttatcctt caatcgaaaa aattgacatt gttgagatcg atgacgtggt
agttgatgta 600tccagaaaat ttttccctta tctggcagct aattttaacg
atcctcgtgt aaccctagtt 660ctcggagatg gagctgcatt tgtaaaggct
gcacaagcgg gatattatga tgctattata 720gtggactctt ctgatcccat
tggtccagca aaagatttgt ttgagaggcc attctttgag 780gcagtagcca
aagcccttag gccaggagga gttgtatgca cacaggctga aagcatttgg
840cttcatatgc atattattaa gcaaatcatt gctaactgtc gtcaagtctt
taagggttct 900gtcaactatg cttggacaac cgttccaaca tatcccaccg
gtgtgatcgg ttatatgctc 960tgctctactg aagggccaga agttgacttc
aagaatccag taaatccaat tgacaaagag 1020acaactcaag tcaagtccaa
attaggacct ctcaagttct acaactctga tattcacaaa 1080gcagcattca
ttttaccatc tttcgccaga agtatgatcg agtcttaa 11282375PRTNicotiana
tabacum 2Met Glu Val Ile Ser Thr Asn Thr Asn Gly Ser Thr Ile Phe
Lys Asn1 5 10 15Gly Ala Ile Pro Met Asn Gly His Gln Asn Gly Thr Ser
Glu His Leu 20 25 30Asn Gly Tyr Gln Asn Gly Thr Ser Lys His Gln Asn
Gly His Gln Asn 35 40 45Gly Thr Phe Glu His Arg Asn Gly His Gln Asn
Gly Thr Ser Glu Gln 50 55 60Gln Asn Gly Thr Ile Ser His Asp Asn Gly
Asn Glu Leu Leu Gly Ser65 70 75 80Ser Asp Ser Ile Lys Pro Gly Trp
Phe Ser Glu Phe Ser Ala Leu Trp 85 90 95Pro Gly Glu Ala Phe Ser Leu
Lys Val Glu Lys Leu Leu Phe Gln Gly 100 105 110Lys Ser Asp Tyr Gln
Asp Val Met Leu Phe Glu Ser Ala Thr Tyr Gly 115 120 125Lys Val Leu
Thr Leu Asp Gly Ala Ile Gln His Thr Glu Asn Gly Gly 130 135 140Phe
Pro Tyr Thr Glu Met Ile Val His Leu Pro Leu Gly Ser Ile Pro145 150
155 160Asn Pro Lys Lys Val Leu Ile Ile Gly Gly Gly Ile Gly Phe Thr
Leu 165 170 175Phe Glu Met Leu Arg Tyr Pro Ser Ile Glu Lys Ile Asp
Ile Val Glu 180 185 190Ile Asp Asp Val Val Val Asp Val Ser Arg Lys
Phe Phe Pro Tyr Leu 195 200 205Ala Ala Asn Phe Asn Asp Pro Arg Val
Thr Leu Val Leu Gly Asp Gly 210 215 220Ala Ala Phe Val Lys Ala Ala
Gln Ala Gly Tyr Tyr Asp Ala Ile Ile225 230 235 240Val Asp Ser Ser
Asp Pro Ile Gly Pro Ala Lys Asp Leu Phe Glu Arg 245 250 255Pro Phe
Phe Glu Ala Val Ala Lys Ala Leu Arg Pro Gly Gly Val Val 260 265
270Cys Thr Gln Ala Glu Ser Ile Trp Leu His Met His Ile Ile Lys Gln
275 280 285Ile Ile Ala Asn Cys Arg Gln Val Phe Lys Gly Ser Val Asn
Tyr Ala 290 295 300Trp Thr Thr Val Pro Thr Tyr Pro Thr Gly Val Ile
Gly Tyr Met Leu305 310 315 320Cys Ser Thr Glu Gly Pro Glu Val Asp
Phe Lys Asn Pro Val Asn Pro 325 330 335Ile Asp Lys Glu Thr Thr Gln
Val Lys Ser Lys Leu Gly Pro Leu Lys 340 345 350Phe Tyr Asn Ser Asp
Ile His Lys Ala Ala Phe Ile Leu Pro Ser Phe 355 360 365Ala Arg Ser
Met Ile Glu Ser 370 37531110DNANicotiana tabacum 3atggaagtca
tatctaccat cttcaagaat ggtaccattc ccatgaacgg ccaccaaaat 60ggctcttccg
aacacctcaa cggctaccag aatggcattt ccaaacacca aaacgggcac
120cagaatggca cttccgaaca tcggaacggc caccagaatg ggacatccga
acaacagaac 180gggacaatca gccatgacaa tggcaacgag ctactgggaa
gctccaactc tattaagcct 240ggttggtttt cagagtttag cgcattatgg
ccaggtgaag cattctcact taaggtcgag 300aagttactat tccaggggaa
atctgattac caagatgtca tgctctttga gtcagcaact 360tatgggaagg
ttctgacttt ggatggagca attcaacata cagagaatgg tggatttcca
420tacactgaaa tgattgttca tctaccactt ggttccatcc caaacccaaa
aaaggttttg 480atcatcggcg gaggaattgg ttttacatta ttcgaaatgc
ttcgttatcc ttcaatcgaa 540aaaattgaca ttgttgagat cgatgacgtg
gtagttgatg tatccagaaa atttttccct 600tatctggcag ctaattttaa
cgatcctcgt gtaaccctag ttctcggaga tggagctgca 660tttgtaaagg
ctgcacaagc gggatattat gatgctatta tagtggactc ttctgatccc
720attggtccag caaaagattt gtttgagagg ccattctttg aggcagtagc
caaagccctt 780aggccaggag gagttgtatg cacacaggct gaaagcattt
ggcttcatat gcatattatt 840aagcaaatca ttgctaactg tcgtcaagtc
tttaagggtt ctgtcaacta tgcttggaca 900accgttccaa catatcccac
cggtgtgatt ggttatatgc tctgctctac tgaagggcca 960gaagttaact
tcaagaatcc agtaaatcca attgacaaag agacaactca agtcaagtcc
1020aaattaggac ctctcaagtt ctacaactct gatattcaca aagcagcatt
cattttgcca 1080tctttcgccc gaagtatgat cgagtcttaa
11104369PRTNicotiana tabacum 4Met Glu Val Ile Ser Thr Ile Phe Lys
Asn Gly Thr Ile Pro Met Asn1 5 10 15Gly His Gln Asn Gly Ser Ser Glu
His Leu Asn Gly Tyr Gln Asn Gly 20 25 30Ile Ser Lys His Gln Asn Gly
His Gln Asn Gly Thr Ser Glu His Arg 35 40 45Asn Gly His Gln Asn Gly
Thr Ser Glu Gln Gln Asn Gly Thr Ile Ser 50 55 60His Asp Asn Gly Asn
Glu Leu Leu Gly Ser Ser Asn Ser Ile Lys Pro65 70 75 80Gly Trp Phe
Ser Glu Phe Ser Ala Leu Trp Pro Gly Glu Ala Phe Ser 85 90 95Leu Lys
Val Glu Lys Leu Leu Phe Gln Gly Lys Ser Asp Tyr Gln Asp 100 105
110Val Met Leu Phe Glu Ser Ala Thr Tyr Gly Lys Val Leu Thr Leu Asp
115 120 125Gly Ala Ile Gln His Thr Glu Asn Gly Gly Phe Pro Tyr Thr
Glu Met 130 135 140Ile Val His Leu Pro Leu Gly Ser Ile Pro Asn Pro
Lys Lys Val Leu145 150 155 160Ile Ile Gly Gly Gly Ile Gly Phe Thr
Leu Phe Glu Met Leu Arg Tyr 165 170 175Pro Ser Ile Glu Lys Ile Asp
Ile Val Glu Ile Asp Asp Val Val Val 180 185 190Asp Val Ser Arg Lys
Phe Phe Pro Tyr Leu Ala Ala Asn Phe Asn Asp 195 200 205Pro Arg Val
Thr Leu Val Leu Gly Asp Gly Ala Ala Phe Val Lys Ala 210 215 220Ala
Gln Ala Gly Tyr Tyr Asp Ala Ile Ile Val Asp Ser Ser Asp Pro225 230
235 240Ile Gly Pro Ala Lys Asp Leu Phe Glu Arg Pro Phe Phe Glu Ala
Val 245 250 255Ala Lys Ala Leu Arg Pro Gly Gly Val Val Cys Thr Gln
Ala Glu Ser 260 265 270Ile Trp Leu His Met His Ile Ile Lys Gln Ile
Ile Ala Asn Cys Arg 275 280 285Gln Val Phe Lys Gly Ser Val Asn Tyr
Ala Trp Thr Thr Val Pro Thr 290 295 300Tyr Pro Thr Gly Val Ile Gly
Tyr Met Leu Cys Ser Thr Glu Gly Pro305 310 315 320Glu Val Asn Phe
Lys Asn Pro Val Asn Pro Ile Asp Lys Glu Thr Thr 325 330 335Gln Val
Lys Ser Lys Leu Gly Pro Leu Lys Phe Tyr Asn Ser Asp Ile 340 345
350His Lys Ala Ala Phe Ile Leu Pro Ser Phe Ala Arg Ser Met Ile Glu
355 360 365Ser51062DNANicotiana tabacum 5atggaagtca tatctaccaa
cacaaatggc tctaccatct tcaagagtgg tgccattccc 60atgaatggcc accataatgg
cacttccaaa caccaaaacg gccacaagaa tgggacttcc 120gaacaacaga
acgggacaat cagccttgat aatggcaacg agctactggg aaactccaat
180tgtattaagc ctggttggtt ttcagagttt agcgcattat ggccaggtga
agcattctca 240cttaaggttg agaagttact gttccagggg aagtctgact
accaagatgt catgctcttt 300gagtcagcaa cttatgggaa ggttctgact
ttggatggag caattcaaca cacagagaat 360ggtggatttc catacactga
aatgattgtt catcttccac ttggttccat cccaaaccca 420aaaaaggttt
tgatcatcgg cggaggaatt ggttttacat tattcgaaat gcttcgttat
480cctacaatcg aaaaaattga cattgttgag atcgatgacg tggtagttga
tgtatctaga 540aaatttttcc cttatctcgc tgctaatttt aacgatcctc
gtgtaaccct agtccttgga 600gatggggctg catttgtaaa ggctgcacaa
gcagaatatt atgatgctat tatagtggac 660tcttctgatc ccattggtcc
agcaaaagat ttgtttgaga ggccattctt tgaggcagta 720gctaaagccc
taaggccagg aggagttgta tgcacacagg ctgaaagcat ttggcttcat
780atgcatatta ttaagcaaat cattgctaac tgtcgtcaag tctttaaggg
ctctgtcaac 840tatgcttgga ctactgttcc aacatatcca accggtgtga
ttggttatat gctctgctct 900actgaaggac cagaaattga cttcaagaat
ccagtaaatc caattgacaa agagacagct 960caagtcaagt ccaaattagc
acctctcaag ttctacaact ctgatattca caaagcagca 1020ttcattttgc
catctttcgc cagaagtatg atcgagtctt aa 10626353PRTNicotiana tabacum
6Met Glu Val Ile Ser Thr Asn Thr Asn Gly Ser Thr Ile Phe Lys Ser1 5
10 15Gly Ala Ile Pro Met Asn Gly His His Asn Gly Thr Ser Lys His
Gln 20 25 30Asn Gly His Lys Asn Gly Thr Ser Glu Gln Gln Asn Gly Thr
Ile Ser 35 40 45Leu Asp Asn Gly Asn Glu Leu Leu Gly Asn Ser Asn Cys
Ile Lys Pro 50 55 60Gly Trp Phe Ser Glu Phe Ser Ala Leu Trp Pro Gly
Glu Ala Phe Ser65 70 75 80Leu Lys Val Glu Lys Leu Leu Phe Gln Gly
Lys Ser Asp Tyr Gln Asp 85 90 95Val Met Leu Phe Glu Ser Ala Thr Tyr
Gly Lys Val Leu Thr Leu Asp 100 105 110Gly Ala Ile Gln His Thr Glu
Asn Gly Gly Phe Pro Tyr Thr Glu Met 115 120 125Ile Val His Leu Pro
Leu Gly Ser Ile Pro Asn Pro Lys Lys Val Leu 130 135 140Ile Ile Gly
Gly Gly Ile Gly Phe Thr Leu Phe Glu Met Leu Arg Tyr145 150 155
160Pro Thr Ile Glu Lys Ile Asp Ile Val Glu Ile Asp Asp Val Val Val
165 170 175Asp Val Ser Arg Lys Phe Phe Pro Tyr Leu Ala Ala Asn Phe
Asn Asp 180 185 190Pro Arg Val Thr Leu Val Leu Gly Asp Gly Ala Ala
Phe Val Lys Ala 195 200 205Ala Gln Ala Glu Tyr Tyr Asp Ala Ile Ile
Val Asp Ser Ser Asp Pro 210 215 220Ile Gly Pro Ala Lys Asp Leu Phe
Glu Arg Pro Phe Phe Glu Ala Val225 230 235 240Ala Lys Ala Leu Arg
Pro Gly Gly Val Val Cys Thr Gln Ala Glu Ser 245 250 255Ile Trp Leu
His Met His Ile Ile Lys Gln Ile Ile Ala Asn Cys Arg 260 265 270Gln
Val Phe Lys Gly Ser Val Asn Tyr Ala Trp Thr Thr Val Pro Thr 275 280
285Tyr Pro Thr Gly Val Ile Gly Tyr Met Leu Cys Ser Thr Glu Gly Pro
290 295 300Glu Ile Asp Phe Lys Asn Pro Val Asn Pro Ile Asp Lys Glu
Thr Ala305 310 315 320Gln Val Lys Ser Lys Leu Ala Pro Leu Lys Phe
Tyr Asn Ser Asp Ile 325 330 335His Lys Ala Ala Phe Ile Leu Pro Ser
Phe Ala Arg Ser Met Ile Glu 340 345 350Ser71146DNANicotiana tabacum
7atggaagtca tatctaccaa cacaaatggc tctactatct tcaagaatgg tgccattccc
60atgaacggtt accagaatgg cacttccaaa caccaaaacg gccaccagaa tggcacttcc
120gaacatcgga acggccacca gaatgggatt tccgaacacc aaaacggcca
ccagaatggc 180acttccgagc atcagaacgg ccatcagaat gggacaatca
gccatgacaa cggcaacgag 240ctacagctac tgggaagctc caactctatt
aagcctggtt ggttttcaga gtttagcgca 300ttatggccag gtgaagcatt
ctcacttaag gttgagaagt tactattcca ggggaagtct 360gattaccaag
atgtcatgct ctttgagtca gcaacatatg ggaaggttct gactttggat
420ggagcaattc aacacacaga gaatggtgga tttccataca ctgaaatgat
tgttcatctt 480ccacttggtt ccatcccaaa ccctaaaaag gttttgatca
tcggcggagg aattggtttt 540acattattcg aaatgcttcg ttatcctaca
atcgaaaaaa ttgacattgt tgagatcgat 600gacgtggtag ttgatgtatc
tagaaaattt ttcccttatc ttgctgctaa ttttagcgat 660cctcgtgtaa
ccctagtcct tggagatggg gctgcatttg taaaggccgc acaagcagga
720tattatgatg ctattatagt ggactcttct gatcccattg gtccagcaaa
agacttgttt 780gagaggccat tctttgaggc agtagccaaa gccctaaggc
caggaggagt tgtatgcaca 840caggctgaaa gcatttggct tcatatgcat
attattaagc aaatcattgc taactgtcgt 900caagtcttta agggctctgt
caactatgct tggactactg ttccaacata tccaaccggt 960gtgattggtt
atatgctctg ttctactgaa ggaccagaag ttgacttcaa gaatccagta
1020aatccaattg acaaagagac aactcaagtc aagtccaaat tagcacctct
caagttctac 1080aactctgata ttcacaaagc agcattcatt ttgccatctt
tcgccagaag tatgatcgag 1140tcttaa 11468381PRTNicotiana tabacum 8Met
Glu Val Ile Ser Thr Asn Thr Asn Gly Ser Thr Ile Phe Lys Asn1 5 10
15Gly Ala Ile Pro Met Asn Gly Tyr Gln Asn Gly Thr Ser Lys His Gln
20 25 30Asn Gly His Gln Asn Gly Thr Ser Glu His Arg Asn Gly His Gln
Asn 35 40 45Gly Ile Ser Glu His Gln Asn Gly His Gln Asn Gly Thr Ser
Glu His 50 55 60Gln Asn Gly His Gln Asn Gly Thr Ile Ser His Asp Asn
Gly Asn Glu65 70 75 80Leu Gln Leu Leu Gly Ser Ser Asn Ser Ile Lys
Pro Gly Trp Phe Ser 85 90 95Glu Phe Ser Ala Leu Trp Pro Gly Glu Ala
Phe Ser Leu Lys Val Glu 100 105 110Lys Leu Leu Phe Gln Gly Lys Ser
Asp Tyr Gln Asp Val Met Leu Phe 115 120 125Glu Ser Ala Thr Tyr Gly
Lys Val Leu Thr Leu Asp Gly Ala Ile Gln 130 135 140His Thr Glu Asn
Gly Gly Phe Pro Tyr Thr Glu Met Ile Val His Leu145 150 155 160Pro
Leu Gly Ser Ile Pro Asn Pro Lys Lys Val Leu Ile Ile Gly Gly 165 170
175Gly Ile Gly Phe Thr Leu Phe Glu Met Leu Arg Tyr Pro Thr Ile Glu
180 185 190Lys Ile Asp Ile Val Glu Ile Asp Asp Val Val Val Asp Val
Ser Arg 195 200 205Lys Phe Phe Pro Tyr Leu Ala Ala Asn Phe Ser Asp
Pro Arg Val Thr 210 215 220Leu Val Leu Gly Asp Gly Ala Ala Phe Val
Lys Ala Ala Gln Ala Gly225 230 235 240Tyr Tyr Asp Ala Ile Ile Val
Asp Ser Ser Asp Pro Ile Gly Pro Ala 245 250 255Lys Asp Leu Phe Glu
Arg Pro Phe Phe Glu Ala Val Ala Lys Ala Leu 260 265 270Arg Pro Gly
Gly Val Val Cys Thr Gln Ala Glu Ser Ile Trp Leu His 275 280 285Met
His Ile Ile Lys Gln Ile Ile Ala Asn Cys Arg Gln Val Phe Lys 290 295
300Gly Ser Val Asn Tyr Ala Trp Thr Thr Val Pro Thr Tyr Pro Thr
Gly305 310 315 320Val Ile Gly Tyr Met Leu Cys Ser Thr Glu Gly Pro
Glu Val Asp Phe 325 330 335Lys Asn Pro Val Asn Pro Ile Asp Lys Glu
Thr Thr Gln Val Lys Ser 340 345 350Lys Leu Ala Pro Leu Lys Phe Tyr
Asn Ser Asp Ile His Lys Ala Ala 355 360 365Phe Ile Leu Pro Ser Phe
Ala Arg Ser Met Ile Glu Ser 370 375 38091260DNANicotiana tabacum
9atggaagtca tatctaccaa cacaaatggc tcgaccatct tcaagaatgg tgccattccc
60atgaatggcc accagagtgg cacttccaaa cacctcaacg gctaccagaa cggcacttcc
120aaacaccaaa acggccacca taatggcact tccgaacatc ggaacggcca
ccagaatggg 180atttccgaac accaaaacgg ccaccagaat gggacttccg
aacatcggaa cggccaccag 240aatgggattt ccgaacacca aaacggccac
cagaatggga cttccgaaca ccaaaacggc 300caccagaatg ggacttccga
acaacagaac gggacaatca gccatgacaa tggcaacgag 360ctactgggaa
actccaactc tattaagctt ggttggtttt cagagtttag cgcattatgg
420ccaggtgaag cattctccct taaggttgag aagttactat ttcaggggaa
gtctgactac 480caagatgtca tgctctttga gtcagcaaca tatgggaagg
ttttgacttt ggatggagca 540attcaacaca cagagaatgg tggatttcca
tacactgaaa tgattgttca tcttccactt 600ggttccatcc caaacccaaa
aaaggttttg atcatcggcg gaggaattgg ttttacatta 660ttcgaaatgc
ttcgttatcc tacaatcgaa aaaattgaca ttgttgaaat cgatgacgtg
720gtagttgatg tatctagaaa atctttccct tatctcgcag ctaattttaa
tgatcctcgt 780gtaaccctcg ttctcggaga tggggctgca tttgtaaagg
ctgcacaagc aggatattat 840gatgctatta tagtggactc ttctgatccc
attggtccag caaaagattt gtttgagagg 900ccattctttg aggcagtagc
caaagcccta aggccaggag gagttgtatg cacacaggcc 960gaaagcattt
ggcttcatat gcatattatt aagcaaatca ttgctaactg tcgtcaagtc
1020tttaagggct ctgtcaacta cgcttggact actgttccaa catatcccac
tggtgtaatt 1080gggtatatgc tctgctctac tgaagggcca gaagttgact
tcaagaatcc aataaatcca 1140attgacaaag agacaactca agtcaagtcc
aaattagcac ctctcaagtt ttacaattct 1200gatattcaca aagcagcatt
cattttgcca tctttcgcca gaagtatgat cgagtcttaa 126010419PRTNicotiana
tabacum 10Met Glu Val Ile
Ser Thr Asn Thr Asn Gly Ser Thr Ile Phe Lys Asn1 5 10 15Gly Ala Ile
Pro Met Asn Gly His Gln Ser Gly Thr Ser Lys His Leu 20 25 30Asn Gly
Tyr Gln Asn Gly Thr Ser Lys His Gln Asn Gly His His Asn 35 40 45Gly
Thr Ser Glu His Arg Asn Gly His Gln Asn Gly Ile Ser Glu His 50 55
60Gln Asn Gly His Gln Asn Gly Thr Ser Glu His Arg Asn Gly His Gln65
70 75 80Asn Gly Ile Ser Glu His Gln Asn Gly His Gln Asn Gly Thr Ser
Glu 85 90 95His Gln Asn Gly His Gln Asn Gly Thr Ser Glu Gln Gln Asn
Gly Thr 100 105 110Ile Ser His Asp Asn Gly Asn Glu Leu Leu Gly Asn
Ser Asn Ser Ile 115 120 125Lys Leu Gly Trp Phe Ser Glu Phe Ser Ala
Leu Trp Pro Gly Glu Ala 130 135 140Phe Ser Leu Lys Val Glu Lys Leu
Leu Phe Gln Gly Lys Ser Asp Tyr145 150 155 160Gln Asp Val Met Leu
Phe Glu Ser Ala Thr Tyr Gly Lys Val Leu Thr 165 170 175Leu Asp Gly
Ala Ile Gln His Thr Glu Asn Gly Gly Phe Pro Tyr Thr 180 185 190Glu
Met Ile Val His Leu Pro Leu Gly Ser Ile Pro Asn Pro Lys Lys 195 200
205Val Leu Ile Ile Gly Gly Gly Ile Gly Phe Thr Leu Phe Glu Met Leu
210 215 220Arg Tyr Pro Thr Ile Glu Lys Ile Asp Ile Val Glu Ile Asp
Asp Val225 230 235 240Val Val Asp Val Ser Arg Lys Ser Phe Pro Tyr
Leu Ala Ala Asn Phe 245 250 255Asn Asp Pro Arg Val Thr Leu Val Leu
Gly Asp Gly Ala Ala Phe Val 260 265 270Lys Ala Ala Gln Ala Gly Tyr
Tyr Asp Ala Ile Ile Val Asp Ser Ser 275 280 285Asp Pro Ile Gly Pro
Ala Lys Asp Leu Phe Glu Arg Pro Phe Phe Glu 290 295 300Ala Val Ala
Lys Ala Leu Arg Pro Gly Gly Val Val Cys Thr Gln Ala305 310 315
320Glu Ser Ile Trp Leu His Met His Ile Ile Lys Gln Ile Ile Ala Asn
325 330 335Cys Arg Gln Val Phe Lys Gly Ser Val Asn Tyr Ala Trp Thr
Thr Val 340 345 350Pro Thr Tyr Pro Thr Gly Val Ile Gly Tyr Met Leu
Cys Ser Thr Glu 355 360 365Gly Pro Glu Val Asp Phe Lys Asn Pro Ile
Asn Pro Ile Asp Lys Glu 370 375 380Thr Thr Gln Val Lys Ser Lys Leu
Ala Pro Leu Lys Phe Tyr Asn Ser385 390 395 400Asp Ile His Lys Ala
Ala Phe Ile Leu Pro Ser Phe Ala Arg Ser Met 405 410 415Ile Glu
Ser11500DNAArtificial SequenceSynthetic oligonucleotides
11accaacacaa atggctctac tatcttcaag aatggtgcca ttcccatgaa cggttaccag
60aatggcactt ccaaacacca aaacggccac cagaatggca cttccgaaca tcggaacggc
120caccagaatg ggatttccga acaccaaaac ggccaccaga atggcacttc
cgagcatcag 180aacggccatc agaatgggac aatcagccat gacaacggca
acgagctaca gctactggga 240agctccaact ctattaagcc tggttggttt
tcagagttta gcgcattatg gccaggtgaa 300gcattctcac ttaaggttga
gaagttacta ttccagggga agtctgatta ccaagatgtc 360atgctctttg
agtcagcaac atatgggaag gttctgactt tggatggagc aattcaacac
420acagagaatg gtggatttcc atacactgaa atgattgttc atcttccact
tggttccatc 480ccaaacccta aaaaggtttt 50012500DNAArtificial
SequenceSynthetic oligonucleotides 12aaaacctttt tagggtttgg
gatggaacca agtggaagat gaacaatcat ttcagtgtat 60ggaaatccac cattctctgt
gtgttgaatt gctccatcca aagtcagaac cttcccatat 120gttgctgact
caaagagcat gacatcttgg taatcagact tcccctggaa tagtaacttc
180tcaaccttaa gtgagaatgc ttcacctggc cataatgcgc taaactctga
aaaccaacca 240ggcttaatag agttggagct tcccagtagc tgtagctcgt
tgccgttgtc atggctgatt 300gtcccattct gatggccgtt ctgatgctcg
gaagtgccat tctggtggcc gttttggtgt 360tcggaaatcc cattctggtg
gccgttccga tgttcggaag tgccattctg gtggccgttt 420tggtgtttgg
aagtgccatt ctggtaaccg ttcatgggaa tggcaccatt cttgaagata
480gtagagccat ttgtgttggt 50013672DNAArtificial SequenceSynthetic
oligonucleotides 13gaattcggtg agttcccccc tcctcccctt tcacttttgt
ttgttggttt ctaagtgctc 60tttcaattta gaggttgatg ttgggaaata attaaacaat
actcttgttt tctaaaattt 120cttgaaaact acaatgtcta tagaggcaat
atatttgctt ctaaacgttg acggttttgc 180aagtcttgcg gaggagcttt
gatccagtgt taaagaaata tatcatgtct cttattcatc 240ctccctttct
ttcctttgtg ttttgcttca ctcctggggt ttcaactttt ttctttccgt
300ttaacctttc cttttttctg caggatggaa cttcaaatta ctttaaagga
ctgatgctcc 360ttctctgcta ttgatagttg ctgcaagttt ctttgtgcat
atagatccag agtctatacg 420taagttgtgt ttctttttcg tgaaattacc
atatgacatt gacagctcct ggtcttcgtt 480ttatttattc ttttggtgtt
ccttttaacc gataacatct gttattattt cactgttaca 540ctaatctgct
ttgcttatgg tcagtcagtt tagcattaga ttagataacc agttaaccat
600tttgggtctc gttaacgtaa tattgtattg ataactacct tatcatatat
atatctctgt 660tttagtgaat tc 6721427DNAArtificial SequenceSynthetic
oligonucleotides 14attctagacc aacacaaatg gctctac
271528DNAArtificial SequenceSynthetic oligonucleotides 15ataagcttaa
aaccttttta gggtttgg 281628DNAArtificial SequenceSynthetic
oligonucleotides 16atgagctcac caacacaaat ggctctac
281728DNAArtificial SequenceSynthetic oligonucleotides 17atggatccaa
aaccttttta gggtttgg 281856DNAArtificial SequenceSynthetic
oligonucleotides 18tgaaatgatt gttcatctac cacttggttc catcccaaac
ccaaaaaagg ttttga 561955DNAArtificial SequenceSynthetic
oligonucleotides 19taaatccaat tgacaaagag acaactcaag tcaagtccaa
attaggacct ctcaa 552054DNAArtificial SequenceSynthetic
oligonucleotides 20tgaacggcca ccaaaatggc acttctgaac acctcaacgg
ctaccagaat ggca 542159DNAArtificial SequenceSynthetic
oligonucleotides 21tcccatgaat ggccaccata atggcacttc caaacaccaa
aacggccaca agaatggga 592249DNAArtificial SequenceSynthetic
oligonucleotides 22tacagctact gggaagctcc aactctatta agcctggttg
gttttcaga 492358DNAArtificial SequenceSynthetic oligonucleotides
23tccgaacacc aaaacggcca ccagaatggg acttccgaac accaaaacgg ccaccaga
5824496DNAArtificial SequenceSynthetic oligonucleotides
24ccaacacaaa tggctctact atcttcaaga atggtgccat tcccatgaac ggttaccaga
60atggcacttc caaacaccaa aacggccacc agaatggcac ttccgaacat cggaacggcc
120accagaatgg gatttccgaa caccaaaacg gccaccagaa tggcacttcc
gagcatcaga 180acggccatca gaatgggaca atcagccatg acaacggcaa
cgagctacag ctactgggaa 240gctccaactc tattaagcct ggttggtttt
cagagtttag cgcattatgg ccaggtgaag 300cattctcact taaggttgag
aagttactat tccaggggaa gtctgattac caagatgtca 360tgctctttga
gtcagcaaca tatgggaagg ttctgacttt ggatggagca atcaacacac
420agagaatggt ggatttccat acactgaaat gatgttcatc ttccacttgg
ttccatccca 480aaccctaaaa agtttt 496
* * * * *