U.S. patent application number 17/682694 was filed with the patent office on 2022-06-16 for modification of plant lipids containing pufas.
The applicant listed for this patent is BASF PLANT SCIENCE COMPANY GMBH. Invention is credited to Carl Andre, Toralf Senger.
Application Number | 20220184161 17/682694 |
Document ID | / |
Family ID | 1000006170185 |
Filed Date | 2022-06-16 |
United States Patent
Application |
20220184161 |
Kind Code |
A1 |
Senger; Toralf ; et
al. |
June 16, 2022 |
MODIFICATION OF PLANT LIPIDS CONTAINING PUFAS
Abstract
The present invention generally is concerned with the
modification of plant lipids containing PUFAs. In this context, the
invention is particularly concerned with plants and plant materials
for such modifications, wherein the plants preferably are oilseed
plants. Regarding plant parts, the invention is particularly
concerned with seeds of such plants and preferably seeds of oilseed
plants. The invention is also concerned with plant positions
obtainable or obtained by the modification method of the invention,
and with full stuff of feedstuff comprising such liquid
compositions.
Inventors: |
Senger; Toralf; (Research
Triangle Park, NC) ; Andre; Carl; (Research Triangle
Park, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BASF PLANT SCIENCE COMPANY GMBH |
Ludwigshafen |
|
DE |
|
|
Family ID: |
1000006170185 |
Appl. No.: |
17/682694 |
Filed: |
February 28, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15526162 |
May 11, 2017 |
11260095 |
|
|
PCT/EP2015/076630 |
Nov 13, 2015 |
|
|
|
17682694 |
|
|
|
|
62234373 |
Sep 29, 2015 |
|
|
|
62079622 |
Nov 14, 2014 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Y 114/19006 20130101;
A61K 36/31 20130101; C12N 15/8247 20130101; C12Q 1/6895 20130101;
C12Y 114/19003 20130101; C12N 9/0071 20130101; C12Y 602/01003
20130101; A61K 31/202 20130101; C12N 9/93 20130101; C12Y 114/19
20130101 |
International
Class: |
A61K 36/31 20060101
A61K036/31; C12Q 1/6895 20060101 C12Q001/6895 |
Claims
1. A method of producing a Brassica napus plant lipid composition,
the method comprising: a) growing a Brassica napus plant comprising
eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) and
arachidonic acid (ARA), wherein the Brassica napus plant comprises
a Delta-5 elongase gene under the control of a promoter such that
expression of the Delta-5 elongase gene is maintained or increased
in late stage seed development, wherein late stage seed development
starts after 30 days after flowering; b) detecting the peak of ARA
content in developing seeds; c) delaying harvesting of the seeds
until the content of ARA has decreased and the content of EPA
and/or DHA has increased and then harvesting the seeds; and d)
extracting the lipid composition from the seeds to obtain the lipid
composition.
2. The method of claim 1, wherein, in the lipid composition: a) the
content of EPA is at least 5% higher than of ARA, and/or b) the sum
of contents of EPA+DHA is at least 7% higher than ARA and/or c) the
content of ARA is less than 4% and the content of EPA is more than
7% and the content of DHA is more than 2%.
3. The method of claim 1, wherein harvesting is delayed until the
content of ARA decreases at least 0.5% by weight of total
lipids.
4. The method of claim 3, wherein harvesting is delayed until the
content of EPA increases at least 1.0% by weight of total
lipids.
5. The method of claim 1, wherein late stage seed development
starts after 35 days after flowering.
6. The method of claim 1, wherein late stage seed development
starts after 38 days after flowering.
7. The method of claim 1, wherein late stage seed development
starts after 40 days after flowering.
8. The method of claim 1, wherein late stage seed development
starts after 42 days after flowering.
9. The method of claim 1, wherein, in the lipid composition, the
content of EPA is at least 5% higher than of ARA.
10. The method of claim 1, wherein, in the lipid composition, the
sum of contents of EPA+DHA is at least 7% higher than ARA.
11. The method of claim 1, wherein, in the lipid composition, the
content of ARA is less than 4% and the content of EPA is more than
7% and the content of DHA is more than 2%.
12. The method of claim 1, wherein the Delta-5 elongase gene is
under the control of a FAE promoter.
Description
[0001] This application is a continuation of U.S. patent
application Ser. No. 15/526,162, which is a U.S. national stage
application of International Application No. PCT/EP2015/076630,
filed Nov. 13, 2015, which claims the benefit of U.S. Provisional
Patent Application No. 62/079,622, filed on Nov. 14, 2014, and U.S.
Provisional Patent Application No. 62/234,373, filed Sep. 29, 2015;
the entire content of all of the aforementioned applications are
hereby incorporated herein by reference in their entirety.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] This application incorporates by reference in its entirety a
computer-readable nucleotide/amino acid sequence listing identified
as one 14,459 byte ASCII (text) file named
"H150220A_Seqlisting.txt", created Feb. 8, 2022.
FIELD OF THE INVENTION
[0003] The present invention generally is concerned with the
modification of plant lipids containing PUFAs. In this context, the
invention is particularly concerned with plants and plant materials
for such modifications, wherein the plants preferably are oilseed
plants. Regarding plant parts, the invention is particularly
concerned with seeds of such plants and preferably seeds of oilseed
plants. The invention is also concerned with plant compositions
obtainable or obtained by the modification method of the invention,
and with foodstuff of feedstuff comprising such liquid
compositions.
BACKGROUND OF THE INVENTION
[0004] It is generally recognised that polyunsaturated fatty acids
("PUFAs") convey health benefits. In this context, EPA and DHA are
particularly coveted; they are used as dietary supplements for
example to alleviate cardiovascular or neurological pathological
conditions or ailments. Polyunsaturated fatty acids are currently
predominantly obtained from fish oils, because wild-type plants
lack the required enzymes to produce polyunsaturated fatty acids,
particularly EPA and DHA, in sufficient quantities. Efforts have
been made to produce polyunsaturated fatty acids in plants and
particularly in oilseed plants.
[0005] The production of EPA and DHA is a metabolic pathway wherein
fatty acids are treated by desaturases and elongases to produce
ever longer and more unsaturated fatty acids. A depiction of the
pathway can be found in WO 2006/012325, FIG. 9, and WO 2005/083093,
FIG. 1. The desaturases and elongases involved in the pathway
generally react both on omega-3 and omega-6 polyunsaturated fatty
acids. One intermediate in the production of EPA and DHA generally
is arachidonic acid. This polyunsaturated fatty acid is generally
undesirable in dietary compositions, foodstuff and feedstuff due to
its involvement in inflammatory processes. Thus, it is generally
desired to obtain compositions with a high content of EPA and/or
DHA and a low content of arachidonic acid. However, as arachidonic
acid is a metabolit in the production of DHA and because
arachidonic acid can be converted by omega-3 desaturases to and
from EPA, it is generally not possible to avoid concomitant
production of arachidonic acid in transgenic plant metabolism.
[0006] It is thus an object of the present invention to provide
materials and methods for reducing the content of arachidonic acid
in lipid compositions containing EPA and/or DHA. In particular, it
is an object of the invention to provide materials and methods for
reducing the content of arachidonic acid in plant lipid
compositions, preferably in lipid compositions obtainable or
obtained from oilseed plants.
BRIEF SUMMARY OF THE INVENTION
[0007] The invention therefore provides extracted plant lipid
compositions comprising eicosapentaenoic acid (EPA) and
docosahexaenoic acid (DHA) and optionally arachidonic acid (ARA),
wherein [0008] a) the content of EPA is at least 5% higher than of
ARA, and/or [0009] b) the sum of contents of EPA+DHA is at least 7%
higher than ARA and/or [0010] c) the content of ARA is less than 4%
and the content of EPA is more than 7% and the content of DHA is
more than 2%.
[0011] The invention also provides plants or parts thereof,
comprising lipids including eicosapentaenoic acid (EPA) and
docosahexaenoic acid (DHA) and optionally arachidonic acid (ARA),
wherein [0012] a) the content of EPA is at least 5% higher than of
ARA, and/or [0013] b) the sum of contents of EPA+DHA is at least 7%
higher than ARA and/or [0014] c) the content of ARA is less than 4%
and the content of EPA is more than 7% and the content of DHA is
more than 2%.
[0015] Also, the invention provides plants or parts thereof,
comprising lipids including eicosapentaenoic acid (EPA) and
docosahexaenoic acid (DHA) and arachidonic acid (ARA), wherein,
when the plant or part thereof is grown, the content of ARA
decreases while preferably the content of EPA and/or DHA
increases.
[0016] According to the invention is also provided a plant
comprising a nucleic acid comprising [0017] a) a Delta-5 elongase
gene under the control of a promoter such that expression of the
Delta-5 elongase gene is maintained or increased in late stage seed
development, and/or [0018] b) a Delta-5 desaturase gene under the
control of a promoter such that expression of the Delta-5
desaturase gene is reduced or prevented in late stage seed
development.
[0019] The invention also provides seeds of a plant of the present
invention.
[0020] Further, the invention provides plant lipid compositions
obtainable or obtained by a process comprising the steps of [0021]
a) growing a plant of the present invention at least until the
lipids content of ARA has decreased and preferably the lipids
content of EPA and/or DHA has increased, and [0022] b) harvesting
the plant or a part thereof and [0023] c) extracting lipids
composition from the harvested material to obtain said lipid
composition.
[0024] The invention also provides foodstuff or feedstuff
comprising a lipid composition of the present invention.
[0025] Furthermore, the invention provides methods of altering
plant lipids composition, comprising the step of growing a plant of
the invention to produce lipids including eicosapentaenoic acid
(EPA) and docosahexaenoic acid (DHA) and arachidonic acid (ARA),
wherein the step of growing and lipids production is continued
until the content of ARA has decreased while preferably the content
of EPA and/or DHA has increased.
[0026] And the invention provides methods of producing a plant
lipid composition, comprising the steps of [0027] a) growing plants
of the invention, [0028] b) harvesting the plants or a part thereof
when the lipids content of ARA has decreased and preferably the
lipids content of EPA and/or DHA has increased.
DETAILED DESCRIPTION OF THE INVENTION
[0029] The invention provides extracted plant lipid compositions.
The lipid compositions comprise EPA and DHA. The extracted plant
lipid compositions will generally also comprise ARA, even though
this compound is generally not desired as a component but is
normally unavoidable due to its function as intermediate metabolite
in the production of EPA and/or DHA.
[0030] According to the invention, the content of EPA is at least
5% higher than the content of ARA. Unless indicated otherwise, in
the context of the present invention a comparison of content
numbers is to mean the difference between the respective percentage
numbers; such difference is sometimes also called a difference in
points percentage. Thus, when the content of EPA in an exemplary
composition is for example 7 wt.-%, the content of ARA in the
composition is at most 2 wt.-% of total fatty acids of the lipids
composition.
[0031] It is a particular advantage of the present invention to
provide means for the production of lipid compositions exhibiting
such strong difference in contents between EPA and ARA. It was
particularly surprising that such a marked difference could be
maintained in plant lipid compositions, that is in lipid
compositions produced in plant material or extracted therefrom as
described herein, because both ARA and EPA are produced by the same
class of enzymes, that is Delta-5 desaturases, and typically a
Delta-5 desaturase producing EPA will also produce ARA. Also, ARA
and EPA are converted into each other by action of omega 3
desaturases naturally present in material or introduced into the
plant genome for the purposes of polyunsaturated fatty acid
production. It was therefore expected that the composition of plant
lipids could not be tilted in favour of high EPA contents without
also increasing ARA content. However, the inventors have
surprisingly found and provide herein a way not only to increase
the EPA content without correspondingly also increasing the content
of unwanted ARA; instead, the invention surprisingly provides means
for actually decreasing the lipid content of ARA during lipid
production already in the plant. Such decrease in ARA content at a
time of continuing synthesis of EPA had not been observed or been
expected to be possible at all before.
[0032] The invention therefore also advantageously provides
extracted plant lipid compositions wherein the sum of contents of
EPA plus DHA is at least 7% higher than the content of ARA.
Providing such a marked difference in contents is even more
surprising as EPA is converted into DHA by the action of Delta-5
elongase and Delta 4 desaturase. Thus, EPA is effectively consumed
in the production of DHA; it is therefore a particular advantage of
the present invention to maintain a high difference in the contents
of EPA, DHA and ARA. As described hereinafter, achieving such high
difference in contents is possible by the unexpected depletion of
ARA in plant lipids during ongoing synthesis of EPA and DHA.
[0033] The invention also provides extracted plant lipid
compositions wherein the content of ARA is less than 4% and the
content of EPA is more than 7%. Even more preferably, the invention
provides extracted plant lipid compositions wherein the content of
ARA is less than 4%, the content of EPA is more than 7% and the
content of DHA is more than 2%. Such compositions are particularly
advantageous results of the unexpected mechanism of plant lipid
production provided by the invention and simultaneously attain a
high EPA/DHA content and a low ARA content.
[0034] Polyunsaturated fatty acids (PUFAs) are generally known to
the skilled person, important polyunsaturated fatty acids are
categorised into an omega-3, omega-6 and omega-9 series, without
any limitation intended. Polyunsaturated fatty acids of the omega-6
series include, for example, and without limitation, linoleic acid
(18:2 n-6; LA), gamma-linolenic acid (18:3 n-6; GLA),
di-homo-gamma-linolenic acid (C20:3 n-6; DGLA), arachidonic acid
(C20:4 n-6; ARA), adrenic acid (also called docosatetraenoic acid
or DTA; C22:4 n-6) and docosapentaenoic acid (C22:5 n-6).
Polyunsaturated fatty acids of the omega-3 series include, for
example and without limitation, alpha-linolenic acid (18:3 n-3,
ALA), stearidonic acid (18:4 n-3; STA or SDA), eicosatrienoic acid
(C20:3 n-3; ETA), eicosatetraenoic acid (C20:4 n-3; ETA),
eicosapentaenoic acid (C20:5 n-3; EPA), docosapentaenoic acid
(C22:5 n-3; DPA) and docosahexaenoic acid (C22:6 n-3; DHA).
Polyunsaturated fatty acids also include fatty acids with greater
than 22 carbons and 4 or more double bonds, for example and without
limitation, C28:8 (n-3). Polyunsaturated fatty acids of the omega-9
series include, for example, and without limitation, mead acid
(20:3 n-9; 5,8,11-eicosatrienoic acid), erucic acid (22:1 n-9;
13-docosenoic acid) and nervonic acid (24:1 n-9; 15-tetracosenoic
acid). Further polyunsaturated fatty acids are eicosadienoic acid
(C20:2d11,14; EDA) and eicosatrienoic acid (20:3d11,14,17;
ETrA).
[0035] Within the context of the present invention, lipids content
is expressed as weight percentage of a specific fatty acid relative
to total fatty acids determined in the respective lipids
composition. Preferably, the total fatty acids tested for are:
14:0, 16:0, 16:1n-7, 16:1n-9, 16:3n-3, 17:0, 18:0, 18:1n-7,
18:1n-9, 18:2n-6 (LA), 18:2n-9, 18:3n-3 (ALA), 18:3n-6 (GLA),
18:4n-3 (SDA), 20:0, 20:1n-9, 20:2n-6, 20:2n-9, 20:3n-3, 20:3n-6
(DGLA), 20:3n-9, 20:4n-3 (ETA), 20:4n-6 (ARA), 20:5n-3 (EPA), 22:0,
22:1n-9, 22:2n-6, 22:4n-3, 22:4n-6, 22:5n-3 (DPA), 22:5n-6, 22:6n-3
(DHA), 24:0 and 24:1n-9.
[0036] It is a particular advantage of the present invention that
the lipids contents described herein, unless explicitly noted
otherwise, are determined without artificial enrichment or
depletion of one or more fatty acids; the lipid content of a fatty
acid is thus substantially the same as in the plant or part thereof
prior to extraction.
[0037] The extracted lipid preferably is in the form of an oil,
wherein at least 90%, more preferably least 95% and even more
preferably at least about 98%, or between 95% and 98%, by weight of
the oil is the lipid. Such oils can be obtained from plant material
by methods known to the skilled person and/or as described
herein.
[0038] According to the invention, the extracted plant lipid
composition is a composition produced by a plant or plant
material--preferred ways of producing such lipid compositions in
plants and plant materials are also described herein--, and
extracted from such lipids and optionally purified. Preferably, the
extracted plant lipid composition is a composition to which no
additional fatty acids have been added. It is a particular
advantage of the present invention that the high difference between
the contents of EPA and ARA can be achieved without adding
"foreign" EPA to the composition, that is without addition of EPA
that has not been produced by the plant or plant material the
extract is obtained from. In particular, the contents of EPA and
DHA can be achieved according to the invention without addition of
fish oil or of corresponding polyunsaturated fatty acids obtained
from fish oil.
[0039] Within the context of the present invention, reference is
made to plants and to corresponding plant material. The plants (and
correspondingly the plant material) refer to preferably is of
family Brassicaceae. It is a particular advantage of the present
invention that the lipid compositions of the present invention can
be produced in and extracted from plants of this family, because
such plants allow for the production of high amounts of fatty acids
particularly in their seed oil. Also, many species belonging to
this family have a long tradition as crop plants, the contents of
their oil is thus generally considered useful for consumption
and/or easy to obtain and purify for technical purposes or for
purposes of consumption.
[0040] Plants according to the invention and corresponding plant
material preferably belong to the tribus Aethionemeae, Alysseae,
Alyssopsideae, Anastaticeae, Anchonieae, Aphragmeae, Arabideae,
Asteae, Biscutelleae, Bivonaeeae, Boechereae, Brassiceae,
Buniadeae, Calepineae, Camelineae, Cardamineae, Chorisporeae,
Cochlearieae, Coluteocarpeae, Conringieae, Cremolobeae,
Crucihimalayeae, Descurainieae, Dontostemoneae, Erysimeae,
Euclidieae, Eudemeae, Eutremeae, Halimolobeae, Heliophileae,
Hesperideae, Iberideae, Isatideae, Kernereae, Lepidieae,
Malcolmieae, Megacarpaeeae, Microlepidieae, Noccaeeae,
Notothlaspideae, Oreophytoneae, Physarieae, Schizopetaleae,
Scoliaxoneae, Sisymbrieae, Smelowskieae, Stevenieae, Thelypodieae,
Thlaspideae, Turritideae or Yinshanieae, and even more preferably
belong genus Ammosperma, Brassica, Brassica x Raphanus, Cakile,
Carrichtera, Ceratocnemum, Coincya, Cordylocarpus, Crambe,
Crambella, Didesmus, Diplotaxis, Douepea, Enarthrocarpus,
Eremophyton, Eruca, Erucaria, Erucastrum, Euzomodendron, Fezia,
Foleyola, Fortuynia, Guiraoa, Hemicrambe, Henophyton, Hirschfeldia,
Kremeriella, Moricandia, Morisia, Muricaria, Nasturtiopsis,
Orychophragmus, Otocarpus, Physorhynchus, Pseuderucaria, Psychine,
Raffenaldia, Raphanus, Rapistrum, Rytidocarpus, Savignya, Schouwia,
Sinapidendron, Sinapis, Succowia, Trachystoma, Vella or Zilla.
Plants of the aforementioned taxa belong to the family of
Brassicaceae and thus can allow for the easy manifestation of the
advantages described above in view of said taxonomic family.
[0041] Even more preferably the plant or plant material according
to the invention belongs to a crop plant of genus Camelina or
Brassica. Plants of these genera have traditionally been used in
agriculture, their oils have been used for human or animal
consumption for a long time. Also, agricultural practices in view
of these genera have long been established, for example materials
and methods for defense against fungi, insects and weeds. Thus, the
production of plant lipids according to the invention in such
genera is made particularly easy for the person skilled in
agriculture.
[0042] Even more preferably a plant and correspondingly plant
material according to the invention belongs to any of the species
Camelina sativa, Brassica aucheri, Brassica balearica, Brassica
barrelieri, Brassica carinata, Brassica carinata x Brassica napus,
Brassica carinata x Brassica rapa, Brassica cretica, Brassica
deflexa, Brassica desnottesii, Brassica drepanensis, Brassica
elongata, Brassica fruticulosa, Brassica gravinae, Brassica
hilarionis, Brassica hybrid cultivar, Brassica incana, Brassica
insularis, Brassica juncea, Brassica macrocarpa, Brassica maurorum,
Brassica montana, Brassica napus (rape, canola), Brassica napus x
Brassica rapa, Brassica nigra, Brassica oleracea, Brassica oleracea
x Brassica rapa subsp. pekinensis, Brassica oxyrrhina, Brassica
procumbens, Brassica rapa, Brassica rapa x Brassica nigra, Brassica
repanda, Brassica rupestris, Brassica ruvo, Brassica souliei,
Brassica spinescens, Brassica tournefortii or Brassica villosa,
even more preferably to any of the species Brassica carinata,
Brassica carinata x Brassica napus or Brassica napus, most
preferably of species Brassica napus. Plants of genus Brassica
napus are also known as rape seed or canola and have a long
tradition as a cheap and readily available source of plant oils and
lipids fit for human or animal consumption.
[0043] Particularly preferred plants and plant materials are
derived from transgenic Brassica event LBFLFK deposited as ATCC
Designation "PTA-121703" as described herein, Brassica event LBFLFK
contains two insertions of the binary T-plasmid VC-LTM593-1qcz rc
as described in the examples section, or from transgenic Brassica
event LBFDAU deposited as ATCC Designation "PTA-122340" as also
described herein. For these events, particularly high contents of
EPA and DHA can be achieved together with low contents of ARA.
[0044] Plants and plant materials also preferred according to the
invention can be obtained by propagation of these events into other
germplasms of plants of genus Camelina and even more preferably of
genus Brassica. It is particularly preferred to use as plants and
plant materials according to the invention plants resulting from a
crossing of a transgenic event according to the invention,
particularly of the event LBLFK, with plants of the species to
Brassica carinata, even more preferably after backcrossing into
Brassica napus. For such plants particularly high contents of EPA
and/or DHA and low contents of ARA in the plant lipids according to
the invention can be achieved.
[0045] According to the invention, the content of ARA preferably
decreases by at least 0.5% during growth of the plant or plant
material, preferably during seed development. Thus, by analysing
the composition of plant lipids in said plant or plant material, a
peak of ARA content can be observed. For example, when a peak
content of ARA of 4% is observed, the plant or plant material is
harvested only after the content of ARA has decreased to at most
3.5%. It is an advantage of the present invention that a reduction
in lipids content of ARA by 0.5 percentage points can be achieved
without compromising total lipids production and particularly
without compromising the amount and content of EPA and/or DHA
obtainable from such plant or plant material.
[0046] Preferably, when the plant or plant material of the
invention is grown, the lipids content of EPA is maintained even
during the reduction of ARA content. Even more preferably the
lipids content of EPA increases by at least 1% during the period in
which the content of ARA is reduced. Thus, for example the lipids
content of EPA in plant seeds increases from 6% to 7% while
simultaneously the lipids content of ARA in said plant material
decreases from 4% to at most 3.5%. Even more preferably, the lipids
content of EPA and DHA increase during the period of reduction of
ARA lipids content when the plant or plant material of the present
invention is grown. As noted herein before, it is a particular
advantage that the present invention allows for such ongoing
synthesis of EPA and DHA even though the content of the metabolic
intermediate ARA is reduced.
[0047] As described above, the plants and plant material of the
present invention preferably are oilseed plants. When the plants of
the present invention are grown, it is preferred that they reach
their maximum ARA lipids content before late stage seed
development. Thus, sufficient time remains for the plant of the
present invention to produce in its seed the desired quantities and
contents of EPA and/or DHA while reducing the lipids content of
ARA. According to the invention, the maximum of ARA lipids content
is preferably reached in the developing seeds within 25 to 35 days
after flowering where the plants of the present invention belong to
species Brassica napus. Correspondingly late stage seed development
preferably starts 38 days after flowering in Brassica napus, even
more preferably 36 days and even more preferably 35 days after
flowering. The skilled person understands that oilseed plants
develop many flowers and that individual flowers start to bloom at
different days. Thus, the term "days after flowering" refers to the
days after flowering of the individual flower and not to the first
flower detected on for example a field of plants of the present
invention.
[0048] A plant or plant material according to the present invention
preferably comprises a nucleic acid comprising [0049] a) a Delta-5
elongase gene under the control of a promoter such that expression
of the Delta-5 elongase gene is maintained or increased in late
stage seed development, and/or [0050] b) a Delta-5 desaturase gene
under the control of a promoter such that expression of the Delta-5
desaturase gene is reduced or prevented in late stage seed
development.
[0051] The inventors have found that by carefully regulating the
expression particularly of Delta-5 elongase activity it is possible
to achieve the desired reduction in ARA lipids content while
maintaining ongoing synthesis of EPA and/or DHA.
[0052] The promoters according to the present invention preferably
are seed specific promoters. Gene expression can be regulated by
any means available to the skilled person. For example, gene
expression can be achieved by creating the appropriate construct
topology such that transformed nucleic acids (also called "T-DNA"
in the art) will, by their very own arrangement of promoters, genes
and terminators (collectively also called "expression cassette")
achieve the desired regulation pattern. For example, an expression
cassette comprising a promoter and operably linked thereto a
Delta-5 elongase gene located in the vicinity of another promoter
exhibiting strong late stage seed development gene expression can
allow for maintained or increased expression of the Delta-5
elongase gene in late stage seed development. This is particularly
so where the expression cassette comprising the Delta-5 elongase
gene is separated from one border of integrated T-DNA by at most
one expression cassette and from the other border of the T-DNA by
at least 5 expression cassettes. This way the T-DNA is long enough
to effectively insulate the expression cassettes of the T-DNA from,
teen effects of the plant chromosome the T-DNA has integrated into.
Preferably, the expression cassette comprising the Delta-5 the gene
is separated from one border of the T-DNA by at most 3, more
preferably 1 or 2 and even more preferably by 1 other expression
cassette. For the purposes of the present invention, the expression
cassette is preferred to in this paragraph contain genes required
for the synthesis of polyunsaturated fatty acids and particularly
genes coding for desaturases and elongases.
[0053] Increased Delta-5 elongase gene expression can also be
achieved by the action of an inductor, such that at least one
Delta-5 elongase gene is under the control of an inducible
promoter; increase can also be achieved by removal of a repressor,
such that the repressor is only being produced during early stages
of seed development. Preferably, at least one Delta-5 elongase gene
is additionally present and expressed under the control of a
constitutively and strongly active promotor to achieve a high
Delta-5 elongase gene expression also in early and mid seed
development stages.
[0054] Decreased Delta-5 desaturase expression can be
correspondingly achieved by T-DNA topology and/or by placing a
Delta-5 desaturase gene under the control of an inducible promoter,
wherein the inductor is not or to a lesser extent produced during
late seed development, and/or by placing a Delta-5 desaturase gene
under the control of a repressible promoter wherein the repressor
is produced predominantly or only during late stage seed
development.
[0055] Examples of corresponding promoters, inductors and
repressors and their interaction are described in Hull et al.,
Plant Science 114, 181-192, Fujiwara et al., Plant Molecular
Biology 20, 1059-1069 and Vilardell et al., Plant Molecular Biology
24, 561-569, all incorporated herein by reference.
[0056] The invention also provides seeds of a plant of the present
invention. Such seeds are useful for planting of new plants of the
present invention to produce polyunsaturated fatty acids. Seeds of
the present invention are also useful for extraction purposes to
obtain and extracted plant lipid composition of the present
invention. In each case, the benefits described above can be
achieved by the seeds of the present invention.
[0057] The invention also provides a plant lipid composition
obtainable or obtained by a process comprising the steps of [0058]
a) growing a plant of the present invention at least until the
lipids content of ARA has decreased and preferably the lipids
content of EPA and/or DHA has increased, and [0059] b) harvesting
the plant or a part thereof and [0060] c) extracting lipids
composition from the harvested material to obtain said lipid
composition.
[0061] In such process, the beneficial reduction of ARA content in
plant lipids provided for by the present invention can be achieved
and the corresponding benefits for plant lipid compositions can be
materialised.
[0062] The process optionally also comprises the step of storing of
harvested material, preferably of plant seeds. It is a particular
advantage of the present invention that the plant seeds can be
stored without compromising the amount and composition of plant
seed oils and lipids. This was particularly surprising because
polyunsaturated fatty acids are particularly prone to oxidation.
Thus, it is advantageous that the plant seeds according to the
present invention obtained as harvested material in said process
can be stored for example for a month or at least for 7 days at
ambient temperatures without loss of seed oil content and
particularly without decrease of EPA and/or DHA in seed lipids and
seed oil.
[0063] The process preferably also comprises the steps of threshing
and collecting of seats. Particularly for plants of genus Brassica
that a seeds are produced in house gutter and thus need to be
separated from unwanted plant material. It is an advantage it is an
advantage of the present invention that the seeds can be separated
from unwanted plant material for example by threshing without
compromising polyunsaturated fatty acid amount and composition in
seed lipids and seed oil.
[0064] In the process, extraction preferably is performed using
pressure and most preferably under an atmosphere with reduced
oxygen content compared to ambient temperature; preferably,
extraction is performed in the absence of oxygen, for example under
a protective atmosphere. Corresponding extraction procedures are
known to the skilled person, some extraction procedures are also
described herein.
[0065] In the process harvesting of plant materials and preferably
harvesting of seeds is preferably effected on ripe seeds, that is
in late stage seed development. In ripe seeds the lipids content of
ARA has had enough time to decrease and the contents of EPA and/or
DHA could be increased. When such process is applied on plants of
the invention of genus Brassica, harvesting is done preferably
after 30 days after first flowering, preferably after 35 days, even
more preferably after 40 days, even more preferably after 42 days,
even more preferably on or after 43 days and even more preferably
after or on 44 days and even more preferably on or after 45 and
even more preferably on or after 46 days after first flowering of
the plants.
[0066] The process preferably further comprises degumming,
deodorising, bleaching, decolourising, drying, winterizing and/or
fractionating of the extracted lipids to obtain said lipid
composition. This way unwanted impurities of the lipids and/or oil
can be removed. Corresponding processes and techniques are known to
the skilled person.
[0067] The invention also provides foodstuff or feedstuff
comprising a lipid composition of the invention. Such food- and
feedstuff benefit from the high EPA and/or DHA lipids content and
low ARA lipids content achieved by the present invention.
[0068] Correspondingly, the invention also provides a method of
altering plant lipids composition, comprising the step of growing a
plant pf the present invention to produce lipids including
eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) and
arachidonic acid (ARA), wherein the step of growing and lipids
production is continued until the content of ARA has decreased
while preferably the content of EPA and/or DHA has increased. As
described above, the content of ARA is preferably decreased by at
least 0.5% and preferably is finally at most 4%, preferably is at
most 3% and even more preferably at most 2.6% by weight of total
lipids. Also as described above, the content of EPA is preferably
increased by at least 1% and preferably is finally at least 7%,
even more preferably at least 7.5% of total lipids.
[0069] The invention also provides a method of producing a plant
lipid composition, comprising the steps of [0070] a) growing plants
of the present invention, [0071] b) harvesting the plants or a part
thereof when the lipids content of ARA has decreased and preferably
the lipids content of EPA and/or DHA has increased.
[0072] The method allows to materialize the advantages and benefits
described herein.
[0073] Preferably, Brassica plants of the present invention are
grown on a field of commercial scale, preferably at least one acre
of size. After 25 days after first appearance of flowers, samples
of developing seeds and their lipids are analysed as described
herein. Over the next 15 days, preferably over the next 10 days, at
least two additional samples of developing seeds are taken and
their lipids are also analysed. This way the peak of ARA lipids
content can be detected and harvesting can be appropriately delayed
to allow the plants of the invention to decrease ARA content and
increase EPA and/or DHA content in the lipids of developing
seeds.
[0074] Also, the invention provides a method of producing seed,
comprising the steps of [0075] a) growing plants of the present
invention, and [0076] b) harvesting seeds of the plants when the
lipids content of ARA has decreased and preferably the lipids
content of EPA and/or DHA has increased.
[0077] The method allows to materialize the advantages and benefits
described herein.
[0078] The invention is hereinafter further described by way of
examples; the examples are provided for illustrative purposes only
and are not intended to limit the invention or the scope of the
claims.
EXAMPLES
Example 1: Plant Growth and Sampling
[0079] Homozygous T3 plants of event LBFLFK (containing a two
copies VC-LTM593-1qcz rc), homozygous T3 plants of event LBFGKN
(containing one copy of VC-LTM593-1qcz rc), homozygous T4 plants of
event LANPMZ (containing one copy each of VC-UB2197-1qcz and
VC-LLM337-1qcz rc) and homozygous T4 plants of event LAODDN
(containing one copy each of VC-LJB2755-2qcz rc and VC-LLM391-2qcz
rc) were sown in the field. Plants of the events were obtained and
propagated as described in the examples of the priority documents;
these are included herein by reference. All events comprise one
gene coding for a Delta-5 elongase based on that obtained from
Ostreococcus tauri ("d5Elo OT_GA3"). All events further contain one
gene coding for a Delta-5 desaturase based on that obtained from
Thraustochytrium sp. ("d5Des Tc_GA2"). Events LBFLFK and LBFGKN
contain a further copy of the Delta-5 desaturase gene under the
control of another promoter (SETL instead of Conlinin). In the week
following the date of first flower, individual racemes were visibly
marked on the stem just above the most recently opened flower. For
every raceme, the three pods immediately below the mark were
considered to be the same age (i.e. flowered or were pollinated on
the same day). Starting at 14 days after marking and until 46 days
after marking, the three pods below the mark on each raceme were
collected at various time points. At each time point, approximately
150 pods from 50 individual plants were sampled. Each individual
plant was sampled only once in its lifespan. Immature seeds were
dissected from the pods immediately after removal from the raceme
and were promptly frozen on dry ice. The age of the seeds was
determined by the age of the mark on the raceme, meaning that the
three pods (and the seeds inside) taken from immediately below a 15
day-old mark were assumed to be 15 days after flowering. For each
event, at each time point, seeds from about 150 pods were pooled
into a single sample. For analysis, each seed sample was pulverized
to powder while still frozen, and the powder was dispensed into
aliquot amounts to be used as technical replicates for lipid
analysis and gene expression analysis by quantitative real time
PCR.
Example 2: Lipid Extraction and Lipid Analysis of Plant Oils
[0080] Lipids were extracted as described in the standard
literature including Ullman, Encyclopedia of Industrial Chemistry,
Bd. A2, S. 89-90 und S. 443-613, VCH: Weinheim (1985); Fallon, A.,
et al., (1987) "Applications of HPLC in Biochemistry" in:
Laboratory Techniques in Biochemistry and Molecular Biology, Bd.
17; Rehm et al. (1993) Biotechnology, Bd. 3, Kapitel III: "Product
recovery and purification", S. 469-714, VCH: Weinheim; Belter, P.
A., et al. (1988) Bioseparations: downstream processing for
Biotechnology, John Wiley and Sons; Kennedy, J. F., und Cabral, J.
M. S. (1992) Recovery processes for biological Materials, John
Wiley and Sons; Shaeiwitz, J. A., und Henry, J. D. (1988)
Biochemical Separations, in: Ullmann's Encyclopedia of Industrial
Chemistry, Bd. B3; Kapitel 11, S. 1-27, VCH: Weinheim; and Dechow,
F J. (1989) Separation and purification techniques in
biotechnology, Noyes Publications.
[0081] It is acknowledged that extraction of lipids and fatty acids
can be carried out using other protocols than those cited above,
such as described in Cahoon et al. (1999) Proc. Natl. Acad. Sci.
USA 96 (22):12935-12940, and Browse et al. (1986) Analytic
Biochemistry 152:141-145. The protocols used for quantitative and
qualitative analysis of lipids or fatty acids are described in
Christie, William W., Advances in Lipid Methodology, Ayr/Scotland:
Oily Press (Oily Press Lipid Library; 2); Christie, William W., Gas
Chromatography and Lipids. A Practical Guide--Ayr, Scotland: Oily
Press, 1989, Repr. 1992, IX, 307 S. (Oily Press Lipid Library; 1);
"Progress in Lipid Research, Oxford: Pergamon Press, 1 (1952)-16
(1977) u.d.T.: Progress in the Chemistry of Fats and Other Lipids
CODEN.
[0082] The fatty acids analysed were: 14:0, 16:0, 16:1n-7, 16:1n-9,
16:3n-3, 17:0, 18:0, 18:1n-7, 18:1n-9, 18:2n-6 (LA), 18:2n-9,
18:3n-3 (ALA), 18:3n-6 (GLA), 18:4n-3 (SDA), 20:0, 20:1n-9,
20:2n-6, 20:2n-9, 20:3n-3, 20:3n-6 (DGLA), 20:3n-9, 20:4n-3 (ETA),
20:4n-6 (ARA), 20:5n-3 (EPA), 22:0, 22:1n-9, 22:2n-6, 22:4n-3,
22:4n-6, 22:5n-3 (DPA), 22:5n-6, 22:6n-3 (DHA), 24:0, 24:1n-9.
[0083] The content (levels) of fatty acids is expressed throughout
the present invention as percentage (weight of a particular fatty
acid) of the (total weight of all fatty acids).
Example 3: Quantitative Real Time PCR Protocol
[0084] RNA was extracted according to the protocol "SG-MA_0007-2009
RNA isolation" using Spectrum Plant Total RNA-KIT part number
STRN50 (SIGMA-ALDRICH GmbH, Munich, Germany). In average the
concentration of total RNA was about 450 ng/.mu.l. The 260/280
ratio was at 2.2 and the 260/230 ratio at 2.3.
[0085] For cDNA synthesis for qPCR 1 .mu.g of total RNA was treated
with DNAseI (DEOXYRIBUNUCLEASE I (AMP-D1, Amplification Grade from
SIGMA-Aldrich, GmbH) according to the supplier's protocol. After
DNAseI treatment, the reverse transcription reaction was performed
with the SuperScript.TM. III First-Strand Synthesis SuperMix for
qRT-PCR (Invitrogen, Cat. No. 11752-250) and with a combination of
oligo dT and random hexamers to ensure thorough and even
representation of all transcripts, regardless of length.
[0086] Transcript measurement by quantitative real time PCR was
carried out using procedures considered standard to those skilled
in the art; see Livak and Schmittgen (2001). The qPCR reactions
were done as simplex TaqMan reactions. The endogenous reference
gene was isolated in house and used due to predicted stability of
the transcript based on the observed stability of the transcript
corresponding to the orthologue in Arabidopsis thaliana during
development. The Brassica napus ortholog was isolated and the gene,
SEQ ID, was part of the glycosyl-phosphatidylinositol
aminotransferase pathway (GPI). The cDNA reactions, described
above, were diluted 1:4. 2 .mu.l cDNA, which corresponded to 25 ng
of total RNA, was used per 10 .mu.l qPCR reaction with JumpStart
TAQ ReadyMix (P2893-400RXN Sigma-Aldrich, GmbH). Primer/probe
concentrations were 900 nmol for forward and reverse primer and 100
nmol TaqMan probe. The TaqMan probes for targets of interest were
labeled with FAM/BHQ1, and the reference gene was labeled with
Yakima Yellow/BHQ1.
[0087] Each qPCR assay included a 1:1 dilution curve (5 dilution
steps) with cDNA from the pool VC-RTP10690-1qcz_F, a no template
control, three-RT controls (VC-RTP10690-1qcz_F, VC-LTM593-1qcz rc
(.about.4 w) and co-transformation VC-UB2197-1qcz+VC-LLM337-1qcz
rc). From each pool three independent aliquots of cDNA were
measured as technical repeats. The ABI PRISM.RTM. 7900 sequence
detection system (Applied Biosystem) was used with the following
PCR Conditions:
TABLE-US-00001 Initial denaturation 95.degree. C. for 300 seconds 1
cycle Amplification 95.degree. C. for 15 seconds/ repete for
60.degree. C. for 60 seconds 40 cycles
[0088] The raw data were the Ct values for the target and the
endogenous reference gene, respectively. The dCt values were
calculated by subtraction: Ct(GOI)-Ct(Ref). The Reference dCt value
was set to equal zero, which was interpreted as meaning that if
there was no difference between GPI and the gene of interest
(dCt=0) the expression was =1. The fold expression was equal to
2.sup.-dCt (where the dCt=(Ct(GOI)-Ct(Ref)-0)). Three samples from
each pool were taken and the geometric mean was calculated. The
slopes of dilution curves were calculated for each gene of interest
and the endogenous reference gene (GPI) as a measure for the
amplification efficiency. Table PCR1, Table PCR2 and Table PCR3
indicate the probes and primers used to amplify the genes for qPCR
assays.
TABLE-US-00002 TABLE PCR1 Probes used in the qPCR reactions Target
of Interest Probe Name Probe Oligo D12Des(PS-GA) D12DESPS-138Fam
TGCCTGGATACCTCTTCTTCAACGCTACTG d6-Des(Otfebit) D6DES-653FAM
ACTCCATGCACAACAAGCACCACGC d6Elo(Pp GA) D6Elo-296-FAM
TGTGCGTGGGTATCGCTTACCAAGC d6Elo(Tp GA) D6Elo-280-FAM
AGGAACGGATACACCGTTATGCCATGC d5DES(Tc_GA) D5DES-652-FAM
TTGGAGCACGATGTGGATTTGA d5DES(Tc_GA)3' D5DES-1147-Fam
CAACCGCTCCACAATTCAGGTTCAAGG o3DES(Pi_GA2) o3DES-594FAM
CGCTCACTTCTTCGTTGCTGGACTCTC o3DES(PIR_GA) o3DESPIR-198FAM
ATCATCTCTCTCGGAGTTC d5Elo(Ot_GA3) E011 TGACAAACAAGCCACCAAGCCCAA
d4DES(TC_GA) D4DES-Tc-FAM TGCTTCCCCAATGTACGTTGCTAGGTTCT
d4Des(Eg_GA) D4DES-Eg-FAM AAGGCACATCCTCC d4Des(PI_GA2)
D4DES-PI-770FAM AGCTTCTTTTCTTGGACGCCCTTGAGC GPI Exp3-78-YAK
GGATTCGACATTCCATCGGCTTTGA
TABLE-US-00003 TABLE PCR2 Forward primers used in qPCR Target of
Interest Forward Primer Name Forward Primer Oligo D12Des(PS-GA)
D12DESPS-112F CGTGTACATGTTGGTTGTTGGAT d6-Des(Otfebit) D6DES-629F
TGGCTGGATCTGGAGATATGTG d6Elo (Pp GA) D6Elo-271F
TTCTGCTTCGCTTTGTCTCTTTAC d6Elo(Tp GA) D6Elo-259F
GAGGCTGGATTCCTCGCTTA d5DES(Tc_GA) D5DES-631Fa CACCACGCTGCTCCAAACAG
d5DES(Tc_GA)3' D5DES-1120F ACTTCCAAATCGAGCACCACTT o3DES(Pi_GA2)
o3DES-572F CCGCTGTGGTTATCTCTTTGC o3DES(PIR_GA) o3DESPIR-160F
CTTGGGAGGCTATGTATGTTAGAAGA d5Elo(Ot_GA3) MA54 GCAATCGTTGGTAGCCATGA
d4DES(TC_GA) D4DES-Tc-F CAAATCGATGCTGAGTGCAGAT d4Des(Eg_GA)
D4DES-EG-F TGACAAGTAAGCCATCCGTCAGT d4Des(PI_GA2) D4DES-PI-746-F
CTGGTGAGGCTATGTACGCTTTT GPI Exp 3-52F GATGAATATCCTCCTGATGCTAACC
TABLE-US-00004 TABLE PCR3 Reverse primers used for qPCR Target of
Interest Reverse Primer Name Reverse Primer Oligo D12Des(PS-GA)
D12DESPS-201R TGAGACCTAGACTTTCCCCAGTACTT d6-Des(Otfebit) D6DES-706R
CCATATCGTGCCTCACTTTTTG d6Elo (Pp GA) D6Elo-345R
CCACAAGGAATATCTCCAGGTGAT d6Elo(Tp GA) D6Elo-330R
TGGATCGTTCACGTTGAAGTG d5DES(Tc_GA) D5DES-695R AAAGCAACGAGTGGCAAGGT
d5DES(Tc_GA)3' D5DES-1200R AGAGAGCCTCAACTCTTGGAGAGA o3DES(Pi_GA2)
o3DES-652R TCTTAAGTCCCAACTGGAGAGACA o3DES(PIR_GA) o3DESPIR-262R
AAACCAAGGAGCGTCAAGTCTAGA d5Elo(Ot_GA3) MA55 CGTGTACCACCACGCTTTGT
d4DES(TC_GA) D4DES-Tc-988R AACACGGTCAAAGCCTTCATAATC d4Des(Eg_GA)
D4DES-Eg-R ACTTTTCACCACCGACGAAGTT d4Des(PI_GA2) D4DES-PI-817R
CCTCCCACCTCCAAGCAA GPI Exp 3-128R CTTGCATGATGATCAGGAAAGC
Example 4
[0089] According to the procedures in example 3 mRNA concentrations
in seed were determined for each event at various times after
flowering. Tables QPCR1 and QPCR2 describe the amounts of mRNA
coding for Delta-5 elongase and Delta-5 desaturase genes,
respectively. Missing values indicated that no measurements were
taken at the respective day for the plants of the respective event.
The mRNA concentrations are given in arbitrary units; within each
table QPCR1 and QPCR2 the values are thus commensurate; absolute
values cannot be compared within tables but comparisons can be
validly made for tendencies and trends.
[0090] Table QPCR1 shows that expression of the only Delta-5
elongase gene of the events LBFGKN and LBFLFK continued even after
30 days after flowering, whereas expression of the Delta-S elongase
gene of the events LANPMZ and LAODDN was severely reduced or only
marginally detectable after 30 days of flowering. Table QPCR2 shows
that for all events clearly detectable Delta-5 desaturase mRNA
could be detected at all assay dates.
TABLE-US-00005 TABLE QPCR1 Total Delta-5 elongase (d5Elo(Ot_GA3))
mRNA quantity, assay-specific units Days after event flowering
LANPMZ LAODDN LBFGKN LBFLFK 14 13.3 14.5 11.0 20.7 17 55.7 10.1 6.0
18 15.7 21 38.8 66.8 29.4 55.5 24 53.6 9.5 40.1 25 19.7 28 15.7
26.6 10.0 45.1 31 10.6 13.4 23.6 32 0.9 35 0.9 0.8 10.5 17.9 38 9.0
10.2 13.3 39 0.5 42 1.3 1.7 19.1 45 0.9 10.4 30.8 46 1.5 35.7
TABLE-US-00006 TABLE QPCR2 Total Delta-5 desaturase mRNA quantity,
assay-specific units Days after Event flowering LANPMZ LAODDN
LBFGKN LBFLFK 14 55.0 72.7 80.9 124.4 17 168.0 98.1 45.0 18 70.5 21
199.2 364.7 302.5 292.6 24 308.6 453.4 722.4 25 388.1 28 615.8
864.2 440.8 1767.1 31 2072.5 763.8 1076.8 32 996.8 35 452.9 578.6
558.3 38 2987.3 391.5 302.6 39 369.1 42 497.4 914.4 602.8 45 679.0
472.5 762.9 46 385.7 1396.4
Example 5: Lipids Composition Data
[0091] The composition of seed lipids of the events was analysed as
described above in example 2. As can be seen in Table FA1, the
content of ARA in total extracted seed lipids of events LANPMZ and
LAODDN did not significantly decrease over time, whereas the
content of ARA ARA in total extracted seed lipids of events LBFGKN
and LBFLFK decreases by 0.53% and 0.72%, respectively. Table FA2
shows that EPA content continued to increase in total extracted
seed lipids for all events; Table FA3 shows that also DHA content
increased in total extracted seed lipids for all events.
[0092] Table FA4 summarizes the seed lipids compositions in the
last extracts obtained for each event. The table shows that only
for events LBFGKN and LBFLFK a difference in EPA and ARA content of
more than 5% could be achieved and a difference in (EPA+DHA) and
ARA content of more than 7% could be achieved.
TABLE-US-00007 TABLE FA1 ARA content of seed lipids Days after
event flowering LANPMZ LAODDN LBFGKN LBFLFK 14 0.1 0.1 0.2 0.2 17
0.3 0.3 0.6 18 0.9 21 2.0 0.9 1.2 1.9 24 1.2 1.8 2.5 25 2.8 28 3.1
1.5 2.6 3.0 31 1.5 3.0 3.3 32 3.3 35 3.6 1.48 2.8 3.1 38 1.4 2.6
2.8 39 3.6 42 3.6 1.4 2.6 45 1.3 2.5 2.6 46 3.6 2.5
TABLE-US-00008 TABLE FA2 EPA contents of seed lipids Days after
event flowering LANPMZ LAODDN LBFGKN LBFLFK 14 0.1 0.2 0.1 0.0 17
0.4 0.4 1.0 18 0.7 21 1.7 1.6 2.0 3.3 24 2.4 3.2 4.8 25 3.2 28 3.9
3.2 4.7 6.2 31 4.0 6.1 7.5 32 4.7 35 5.2 4.53 6.7 7.8 38 4.6 6.8
8.1 39 5.3 42 5.5 4.9 7.3 45 4.5 7.6 8.3 46 5.6 8.6
TABLE-US-00009 TABLE FA3 DHA seeds lipid content Days after event
flowering LANPMZ LAODDN LBFGKN LBFLFK 14 0.0 0.0 0.0 0.0 17 0.0 0.1
0.2 18 0.1 21 0.3 0.2 0.4 0.4 24 0.3 0.5 0.6 25 0.5 28 0.7 0.5 0.8
0.8 31 0.7 1.1 1.0 32 0.9 35 1.1 0.87 1.4 1.1 38 1.0 1.4 1.2 39 1.2
42 1.3 1.0 1.6 45 0.9 1.7 1.3 46 1.3 1.4
TABLE-US-00010 TABLE FA4 composition of last lipids extract
obtained for each event Event Content of: LANPMZ LAODDN LFGKN LBLFK
EPA 5.55 4.54 7.64 8.57 DHA 3 2.46 2.39 3.61 ARA 3.59 1.26 2.47
2.54 EPA - ARA 1.96 3.28 5.17 6.03 (EPA + 4.96 5.74 7.56 9.64 DHA)
- ARA
Sequence CWU 1
1
39130DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(30)/mol_type="DNA" /note="Oligo Table
PCR1; D12Des(PS-GA) / D12DESPS-138Fam" /organism="Artificial
Sequence"source(1)..(30) 1tgcctggata cctcttcttc aacgctactg
30225DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(25)/mol_type="DNA" /note="Oligo Table
PCR1; d6-Des(Otfebit) / D6DES-653FAM" /organism="Artificial
Sequence" 2actccatgca caacaagcac cacgc 25325DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(25)/mol_type="DNA"
/note="Oligo Table PCR1; d6Elo (Pp GA) / D6Elo-296-FAM"
/organism="Artificial Sequence" 3tgtgcgtggg tatcgcttac caagc
25427DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(27)/mol_type="DNA" /note="Oligo Table
PCR1; d6Elo(Tp GA) / D6Elo-280-FAM" /organism="Artificial Sequence"
4aggaacggat acaccgttat gccatgc 27522DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(22)/mol_type="DNA" /note="Oligo Table
PCR1; d5DES(Tc_GA) / D5DES-652-FAM" /organism="Artificial Sequence"
5ttggagcacg atgtggattt ga 22627DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(27)/mol_type="DNA" /note="Oligo Table
PCR1; d5DES(Tc_GA)3 / D5DES-1147-Fam" /organism="Artificial
Sequence" 6caaccgctcc acaattcagg ttcaagg 27727DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(27)/mol_type="DNA"
/note="Oligo Table PCR1; o3DES(Pi_GA2) / o3DES-594FAM"
/organism="Artificial Sequence" 7cgctcacttc ttcgttgctg gactctc
27819DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(19)/mol_type="DNA" /note="Oligo Table
PCR1; o3DES(PIR_GA) / o3DESPIR-198FAM" /organism="Artificial
Sequence" 8atcatctctc tcggagttc 19924DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(24)/mol_type="DNA"
/note="Oligo Table PCR1; d5Elo(Ot_GA3) / E011"
/organism="Artificial Sequence" 9tgacaaacaa gccaccaagc ccaa
241029DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(29)/mol_type="DNA" /note="Oligo Table
PCR1; d4DES(TC_GA) / D4DES-Tc-FAM" /organism="Artificial Sequence"
10tgcttcccca atgtacgttg ctaggttct 291114DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(14)/mol_type="DNA"
/note="Oligo Table PCR1; d4Des(Eg_GA) / D4DES-Eg-FAM"
/organism="Artificial Sequence" 11aaggcacatc ctcc
141227DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(27)/mol_type="DNA" /note="Oligo Table
PCR1; d4Des(Pl_GA2) / D4DES-PI-770FAM" /organism="Artificial
Sequence" 12agcttctttt cttggacgcc cttgagc 271325DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(25)/mol_type="DNA"
/note="Oligo Table PCR1; GPI / Exp3-78-YAK" /organism="Artificial
Sequence" 13ggattcgaca ttccatcggc tttga 251423DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(23)/mol_type="DNA"
/note="Oligo Table PCR2; D12Des(PS-GA) / D12DESPS-112F"
/organism="Artificial Sequence" 14cgtgtacatg ttggttgttg gat
231522DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(22)/mol_type="DNA" /note="Oligo Table
PCR2; d6-Des(Otfebit) / D6DES-629F" /organism="Artificial Sequence"
15tggctggatc tggagatatg tg 221624DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(24)/mol_type="DNA" /note="Oligo Table
PCR2; d6Elo (Pp GA) / D6Elo-271F" /organism="Artificial Sequence"
16ttctgcttcg ctttgtctct ttac 241720DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(20)/mol_type="DNA" /note="Oligo Table
PCR2; d6Elo(Tp GA) / D6Elo-259F" /organism="Artificial Sequence"
17gaggctggat tcctcgctta 201820DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(20)/mol_type="DNA" /note="Oligo Table
PCR2; d5DES(Tc_GA) / D5DES-631Fa" /organism="Artificial Sequence"
18caccacgctg ctccaaacag 201922DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(22)/mol_type="DNA" /note="Oligo Table
PCR2; d5DES(Tc_GA)3 / D5DES-1120F" /organism="Artificial Sequence"
19acttccaaat cgagcaccac tt 222021DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(21)/mol_type="DNA" /note="Oligo Table
PCR2; o3DES(Pi_GA2) / o3DES-572F" /organism="Artificial Sequence"
20ccgctgtggt tatctctttg c 212126DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(26)/mol_type="DNA" /note="Oligo Table
PCR2; o3DES(PIR_GA) / o3DESPIR-160F" /organism="Artificial
Sequence" 21cttgggaggc tatgtatgtt agaaga 262220DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(20)/mol_type="DNA"
/note="Oligo Table PCR2; d5Elo(Ot_GA3) / MA54"
/organism="Artificial Sequence" 22gcaatcgttg gtagccatga
202322DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(22)/mol_type="DNA" /note="Oligo Table
PCR2; d4DES(TC_GA) / D4DES-Tc-F" /organism="Artificial Sequence"
23caaatcgatg ctgagtgcag at 222423DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(23)/mol_type="DNA" /note="Oligo Table
PCR2; d4Des(Eg_GA) / D4DES-EG-F" /organism="Artificial Sequence"
24tgacaagtaa gccatccgtc agt 232523DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(23)/mol_type="DNA" /note="Oligo Table
PCR2; d4Des(Pl_GA2) / D4DES-PI-746-F" /organism="Artificial
Sequence" 25ctggtgaggc tatgtacgct ttt 232625DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(25)/mol_type="DNA"
/note="Oligo Table PCR2; GPI / Exp 3-52F" /organism="Artificial
Sequence" 26gatgaatatc ctcctgatgc taacc 252726DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(26)/mol_type="DNA"
/note="Oligo Table PCR3; D12Des(PS-GA) / D12DESPS-201R"
/organism="Artificial Sequence" 27tgagacctag actttcccca gtactt
262822DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(22)/mol_type="DNA" /note="Oligo Table
PCR3; d6-Des(Otfebit) / D6DES-706R" /organism="Artificial Sequence"
28ccatatcgtg cctcactttt tg 222924DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(24)/mol_type="DNA" /note="Oligo Table
PCR3; d6Elo (Pp GA) / D6Elo-345R" /organism="Artificial Sequence"
29ccacaaggaa tatctccagg tgat 243021DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(21)/mol_type="DNA" /note="Oligo Table
PCR3; d6Elo(Tp GA) / D6Elo-330R" /organism="Artificial Sequence"
30tggatcgttc acgttgaagt g 213120DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(20)/mol_type="DNA" /note="Oligo Table
PCR3; d5DES(Tc_GA) / D5DES-695R" /organism="Artificial Sequence"
31aaagcaacga gtggcaaggt 203224DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(24)/mol_type="DNA" /note="Oligo Table
PCR3; d5DES(Tc_GA)3 / D5DES-1200R" /organism="Artificial Sequence"
32agagagcctc aactcttgga gaga 243324DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(24)/mol_type="DNA" /note="Oligo Table
PCR3; o3DES(Pi_GA2) / o3DES-652R" /organism="Artificial Sequence"
33tcttaagtcc caactggaga gaca 243424DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(24)/mol_type="DNA" /note="Oligo Table
PCR3; o3DES(PIR_GA) / o3DESPIR-262R" /organism="Artificial
Sequence" 34aaaccaagga gcgtcaagtc taga 243520DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(20)/mol_type="DNA"
/note="Oligo Table PCR3; d5Elo(Ot_GA3) / MA55"
/organism="Artificial Sequence" 35cgtgtaccac cacgctttgt
203624DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(24)/mol_type="DNA" /note="Oligo Table
PCR3; d4DES(TC_GA) / D4DES-Tc-988R" /organism="Artificial Sequence"
36aacacggtca aagccttcat aatc 243722DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(22)/mol_type="DNA" /note="Oligo Table
PCR3; d4Des(Eg_GA) / D4DES-Eg-R" /organism="Artificial Sequence"
37acttttcacc accgacgaag tt 223818DNAArtificial SequenceSynthetic
polynucelotidesource(1)..(18)/mol_type="DNA" /note="Oligo Table
PCR3; d4Des(Pl_GA2) / D4DES-PI-817R" /organism="Artificial
Sequence" 38cctcccacct ccaagcaa 183922DNAArtificial
SequenceSynthetic polynucelotidesource(1)..(22)/mol_type="DNA"
/note="Oligo Table PCR3; GPI / Exp 3-128R" /organism="Artificial
Sequence" 39cttgcatgat gatcaggaaa gc 22
* * * * *