U.S. patent application number 17/541812 was filed with the patent office on 2022-05-26 for epitopes in the rna recognition motif 1 (rrm1) of tdp-43 and misfolding-selective antibodies thereto.
The applicant listed for this patent is THE UNIVERSITY OF BRITISH COLUMBIA. Invention is credited to Neil R. Cashman, Xubiao Peng, Steven S. Plotkin.
Application Number | 20220162293 17/541812 |
Document ID | / |
Family ID | |
Filed Date | 2022-05-26 |
United States Patent
Application |
20220162293 |
Kind Code |
A1 |
Plotkin; Steven S. ; et
al. |
May 26, 2022 |
EPITOPES IN THE RNA RECOGNITION MOTIF 1 (RRM1) OF TDP-43 AND
MISFOLDING-SELECTIVE ANTIBODIES THERETO
Abstract
The disclosure pertains to conformational epitopes in TDP-43,
antibodies thereto and methods of making and using immunogens and
antibodies specific thereto.
Inventors: |
Plotkin; Steven S.;
(Vancouver, CA) ; Cashman; Neil R.; (Vancouver,
CA) ; Peng; Xubiao; (Beijing, CN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE UNIVERSITY OF BRITISH COLUMBIA |
Vancouver |
|
CA |
|
|
Appl. No.: |
17/541812 |
Filed: |
December 3, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16616832 |
Nov 25, 2019 |
11214613 |
|
|
PCT/CA2018/050634 |
May 30, 2018 |
|
|
|
17541812 |
|
|
|
|
62512647 |
May 30, 2017 |
|
|
|
62570582 |
Oct 10, 2017 |
|
|
|
62595866 |
Dec 7, 2017 |
|
|
|
International
Class: |
C07K 16/18 20060101
C07K016/18; C07K 5/12 20060101 C07K005/12; C07K 14/47 20060101
C07K014/47; G01N 33/68 20060101 G01N033/68 |
Claims
1. A cyclic compound comprising: a TDP-43 peptide comprising 1)
TTE; 2) TTEQ (SEQ ID NO:1) or 3) TEQ and up to 6 TDP-43 contiguous
residues, and a linker, wherein the linker is covalently coupled to
the TDP-43 peptide N-terminus residue and the peptide C-terminus
residue, wherein at least one amino acid in the TDP-43 peptide is
an alternate conformation than T, E, and/or Q in a corresponding
linear and/or native TDP-43.
2. The cyclic compound of claim 1, wherein the TDP-43 peptide is
selected from TTEQ (SEQ ID NO: 1), TTE, TEQ, KTTE (SEQ ID NO: 10),
KTTEQ (SEQ ID NO:12), TEQD (SEQ ID NO:8) or TTEQD (SEQ ID NO: 9)
optionally wherein the cyclic compound is a compound selected from
any one of SEQ ID NOs: 2, 3, 13, 22-39, and 42-44.
3. The cyclic compound of claim 1, wherein the TDP-43 peptide is
TTEQ (SEQ ID NO: 1), TEQ or TTE.
4. The cyclic compound of claim 1, wherein the linker comprises or
consists of 1-8 amino acids and/or one or more functionalizable
moieties.
5. The cyclic compound of claim 4, wherein the linker amino acids
are selected from A and G, and/or wherein the functionalizable
moiety is C.
6. The cyclic compound of claim 1, wherein the linker comprises or
consists of GGCGG (SEQ ID NO: 40), GCGG (SEQ ID NO: 41) or GCG.
7. The cyclic compound of claim 1, wherein the linker comprises one
or more PEG molecules.
8. The cyclic compound of claim 1, wherein the cyclic compound has
a sequence selected from any one of SEQ ID NOs: 2, 3, 13, 22-39,
and 42-44.
9. An immunogen comprising a cyclic compound: comprising a TDP-43
peptide comprising 1) TTE; 2) TTEQ (SEQ ID NO:1) or 3) TEQ and up
to 6 TDP-43 contiguous residues, and a linker, wherein the linker
is covalently coupled to the TDP-43 peptide N-terminus residue and
the peptide C-terminus residue, wherein at least one amino acid in
the TDP-43 peptide is an alternate conformation than T, E, and/or Q
in a corresponding linear and/or native TDP-43.
10. The immunogen of claim 9, wherein the cyclic compound, is
coupled to a carrier protein or immunogenicity enhancing component
and/or formulated with an adjuvant.
11. The immunogen of claim 10, wherein the carrier protein is
bovine serum albumin (BSA) or the immunogenicity-enhancing
component is keyhole limpet haemocyanin (KLH).
12. The immunogen of claim 11, wherein the adjuvant is selected
from aluminum phosphate, aluminum hydroxide alum, monophosphoryl
lipid A and QS21.
13.-41. (canceled)
42. A composition comprising the cyclic compound of claim 1 or an
immunogen comprising the cyclic compound, optionally with a
diluent.
43.-45. (canceled)
46. A kit comprising the cyclic compound of claim 1, an immunogen
comprising the cyclic compound or a composition comprising the
cyclic compound or immunogen.
47.-50. (canceled)
51. The cyclic compound of claim 1, wherein the cyclic compound has
a sequence selected from any one of SEQ ID NOs: 2, 3, 22, 23, 28,
29, 30, 31, 32, 33, 34, 35 and 42.
52. The cyclic compound of claim 1, wherein the cyclic compound has
a sequence selected from any one of SEQ ID NOs: 2, 3, 22, 23 and
42.
53. The immunogen of claim 9, wherein the TDP-43 peptide is
selected from TTEQ (SEQ ID NO: 1), TTE, TEQ, KTTE (SEQ ID NO: 10),
KTTEQ (SEQ ID NO:12), TEQD (SEQ ID NO:8) or TTEQD (SEQ ID NO: 9),
optionally wherein the TDP-43 peptide is TTEQ (SEQ ID NO: 1), TEQ
or TTE, and/or wherein the linker comprises or consists of 1-8
amino acids, optionally selected from A and G, and/or one or more
functionalizable moieties, optionally selected from C.
54. The immunogen of claim 9, wherein the cyclic compound has a
sequence selected from any one of SEQ ID NOs: 2, 3, 13, 22-39, and
42-44.
55. The immunogen of claim 9, wherein the cyclic compound has a
sequence selected from any one of SEQ ID NOs: 2, 3, 22, 23, 28, 29,
30, 31, 32, 33, 34, 35 and 42.
56. The immunogen of claim 9, wherein the cyclic compound has a
sequence selected from any one of SEQ ID NOs: 2, 3, 22, 23 and 42.
Description
RELATED APPLICATIONS
[0001] This application is a division of U.S. patent application
Ser. No. 16/616,832, filed Nov. 25, 2019, which is a National stage
entry of International Application No. PCT/CA2018/050634, filed May
30, 2018, which claims the benefit of 35 U.S.C. .sctn. 119 based on
the priority of U.S. Provisional Patent Application Nos.
62/512,647, filed May 30, 2017; 62/570,582, filed Oct. 10, 2017;
and 62/595,866, filed Dec. 7, 2017; each of these applications
being incorporated herein in their entirety by reference.
INCORPORATION OF SEQUENCE LISTING
[0002] A computer readable form of the Sequence Listing
"P51866US04_ST25" (29,299 bytes), submitted via EFS-WEB and created
on Dec. 1, 2021, is herein incorporated by reference.
FIELD
[0003] The present disclosure relates to TDP-43 epitopes and
antibodies thereto and more specifically to conformational TDP-43
epitopes that are predicted to be selectively accessible in
misfolded TDP-43, and related antibody compositions.
BACKGROUND
[0004] Transactive response (TAR) element DNA binding protein of 43
kDa (TDP-43), is a 414 amino acid protein, and is comprised of an
N-terminal ubiquitin like domain (NTD, residues 1-102), two RNA
recognition motifs (RRMs) composed of residues 106-177 (RRM1), and
residues 192-259 (RRM2), and a C-terminal domain (CTD, residues
274-414). The NTD contains a nuclear localization signal (NLS,
residues 82-98). RRM2 includes a nuclear export signal (NES) from
residue 239 to 250.
[0005] TDP-43 is predominantly a nuclear protein that plays a
central role in RNA metabolism. TDP-43 has become a focal point of
research in the amyotrophic lateral sclerosis (ALS) and
frontotemporal dementia (FTD) disease spectrum, since pathogenic
inclusions within affected neurons can contain post-translationally
modified TDP-43. The CTD of TDP-43 is particularly relevant to
disease, as it is where nearly all familial ALS/FTD-associated
mutations are found in TDP-43.
[0006] Other mutations include D169G which is located in RRM1
between beta strands 4 and 5, A90V which is a mutation in the NLS
region, and the mutations K263E and N267S which are in the linker
between RRM2 and the C-terminal domain.
[0007] RRM1 and RRM2 have been structurally determined by NMR. For
example, RRM1 is available in the Protein Data Bank (PDB), a
database of atomic resolution three dimensional structural data, as
PDB entry 41UF, while RRM2 is available as PDB entry 1WF0, and the
NTD is available as PDB entry 2N4P.
[0008] The structure of 41UF is reported in Kuo et al. [1]. The
structure of 1WF0 is reported in He et al [2]. The structure of
2N4P is reported in Mompean et al. [3].
[0009] TDP-43 was found to be hyperphosphorylated, ubiquitinated,
and fragmented in neuronal inclusions of patients with both
sporadic and familial forms of ALS and FTD [4].
[0010] Aggregates of TDP-43 have now been found in nearly all
(approx. 97%) cases of ALS and roughly half (approx. 45%) of the
cases of FTD. TDP-43 is one of the main components of the
cytoplasmic inclusions found in the motor neurons of ALS
patients.
[0011] Pathological precursors of TDP-43 inclusions may have
concentration far below that of functional TDP-43. The low
concentration of misfolded TDP-43 makes this target elusive.
Antibodies or drugs targeting healthy TDP-43 could be fatal for the
cell. TDP-43 is an RNA regulatory protein that is essential for
embryonic development [5].
[0012] Antibodies that bind TDP-43 have been described.
[0013] WO2012174666 titled METHODS FOR THE PROGNOSTIC AND/OR
DIAGNOSTIC OF NEURODEGENERATIVE DISEASE, METHODS TO IDENTIFY
CANDIDATE COMPOUNDS AND COMPOUNDS FOR TREATING NEURODEGENERATIVE
DISEASE discloses methods for diagnosing neurodegenerative diseases
such as ALS and FTD through assessing the interaction between
TDP-43 and NF-.kappa.B p65 using an anti-TDP-43 antibody.
[0014] WO2016086320 titled TDP-43-BINDING POLYPEPTIDES USEFUL FOR
THE TREATMENT OF NEURODEGENERATIVE DISEASES disclose antibodies
that binds to the RRM1 domain of TDP-43 to disrupt its interaction
with NF-.kappa.B for the treatment of ALS and FTD.
[0015] Antibodies that preferentially or selectively bind misfolded
TDP-43 over natively folded TDP-43 are desirable.
SUMMARY
[0016] Described herein is a conformational epitope in TDP-43
comprising and/or consisting of residues TTEQ (SEQ ID NO: 1) or a
part thereof, and antibodies thereto. The epitope is identified as
an epitope that may be selectively exposed in the misfolded species
of TDP-43, in a conformation that distinguishes it from that in the
native protein.
[0017] An aspect includes a compound, optionally a cyclic compound
comprising: a TDP-43 peptide comprising 1) TTE 2) TTEQ (SEQ ID
NO:1); 3) TEQ or a part thereof and up to 6 TDP-43 contiguous
residues, and a linker, wherein the linker is covalently coupled to
the TDP-43 peptide N-terminus residue and/or the peptide C-terminus
residue, wherein at least one amino acid in the TDP-43 peptide is
an alternate conformation than T, E, and/or Q in a corresponding
linear and/or native TDP-43.
[0018] In an embodiment, the TDP-43 peptide is selected from TTEQ
(SEQ ID NO: 1), TTE, TEQ, KTTE (SEQ ID NO: 10), KTTEQ (SEQ ID
NO:12). TEQD (SEQ ID NO:8) or TTEQD (SEQ ID NO: 9), optionally
wherein the cyclic compound is a compound selected from any one of
SEQ ID NOs: 2, 3, 13, 22-39, and 42-44.
[0019] In an embodiment, the cyclic compound is selected from a
cyclic structure described herein, preferably wherein the cyclic
compound has a sequence selected from any one of SEQ ID NOs: 2, 3,
13, 22-39, and 42-44, more preferably SEQ ID NOs: 2, 3, 22, 23, 28,
29, 30, 31, 32, 33, 34, 35 and 42, optionally a sequence selected
from any one of SEQ ID NOs: 28, 29, 30, 31, 32, 33, 34, 35 and 42
or a sequence selected from SEQ ID NO: 2, 3, 22, 23 and 42.
[0020] Also provided in another aspect is an immunogen comprising a
cyclic compound described herein.
[0021] In an embodiment, the cyclic compound, is coupled to a
carrier protein or immunogenicity enhancing component and/or
formulated with an adjuvant.
[0022] In an embodiment, the carrier protein is bovine serum
albumin (BSA) or the immunogenicity-enhancing component is keyhole
limpet haemocyanin (KLH) and/or the adjuvant is selected from
aluminum phosphate, aluminum hydroxide alum, monophosphoryl lipid A
and QS21.
[0023] Another aspect provides an antibody that selectively binds
an epitope in the TDP-43 peptide in the cyclic compound described
herein compared to a corresponding linear compound and/or native
TDP-43 polypeptide.
[0024] In an embodiment, the antibody selectively binds to a cyclic
compound comprising 1) TTE, 2) TEQ, 3) TTEQ (SEQ ID NO:1), 4) KTTE,
(SEQ ID NO: 10), 5) KTTEQ (SEQ ID NO:12). 6) TEQD (SEQ ID NO:8)
and/or 7) TTEQD (SEQ ID NO: 9) compared to a corresponding linear
compound and/or native TDP-43 polypeptide.
[0025] In another embodiment, the antibody is at least 2 fold, 3
fold, at least 5 fold, at least 10 fold or at least 20 fold, more
selective for the cyclic compound compared to a corresponding
linear compound and/or native TDP-43 polypeptide.
[0026] Also provided in an embodiment is an antibody that competes
for binding misfolded TDP-43 or a cyclic peptide comprising the
same or overlapping TDP-43 peptide as an antibody described herein,
preferably one that shares at least 80%, or more sequence identity
to a heavy chain and/or light chain variable region provided in
Table 10.
[0027] In an embodiment, the antibody is raised or screened using a
cyclic compound or an immunogen described herein.
[0028] In an embodiment, the antibody comprises a set of CDRs as
described for example in Table 10.
[0029] In another embodiment, the antibody comprises a heavy chain
variable region comprising: i) an amino acid sequence as set forth
in Table 10; ii) an amino acid sequence with at least 50%, at least
60%, at least 70%, at least 80% or at least 90% sequence identity
to said heavy chain variable region sequence, wherein the CDR
sequences are as set forth in said heavy chain variable region
sequence, or iii) a conservatively substituted amino acid sequence
of i); and/or wherein the antibody comprises a light chain variable
region comprising i) an amino acid sequence as set forth in Table
10, ii) an amino acid sequence with at least 50%, at least 60%, at
least 70%, at least 80% or at least 90% sequence identity to said
light chain variable region sequence wherein the CDR sequences are
as set forth in said light chain variable region sequence, or iii)
a conservatively substituted amino acid sequence of i); optionally
wherein the heavy chain variable region amino acid sequence is
encoded by a nucleotide sequence as set out in Table 10 or a codon
degenerate or optimized version thereof and/or wherein the light
chain variable region amino acid sequence is encoded by a
nucleotide sequence as set out in Table 10 or a codon degenerate or
optimized version thereof.
[0030] In another embodiment, the antibody is a monoclonal
antibody, humanized antibody and/or a single chain antibody or a
binding fragment of any of the foregoing.
[0031] Another aspect includes an immunoconjugate comprising the
antibody described herein and a detectable label or a transport
moiety, optionally a molecule that facilitates transport across the
blood brain barrier and/or into a cell.
[0032] A further aspect provides a nucleic acid encoding the amino
acid residues of the compound, immunogen, antibody or proteinaceous
immunoconjugate described herein, or any part thereof.
[0033] Another aspect provides a cell expressing an antibody
described herein, optionally wherein the cell is a hybridoma.
[0034] Another aspect is a composition comprising a cyclic
compound, immunogen, antibody, immunoconjugate, nucleic acid or
cell described herein, optionally with a diluent.
[0035] In an embodiment, the composition comprises a cyclic
compound or immunogen described herein and an adjuvant.
[0036] In an embodiment, the adjuvant is aluminum phosphate,
aluminum hydroxide aluminum hydroxide alum, monophosphoryl lipid A
and/or QS21.
[0037] Also provided is a kit comprising one or more components
described herein for example a compound, immunogen, antibody,
immunoconjugate, nucleic acid, cell or composition described
herein.
[0038] Also provides in another aspect is a method of making the
antibody described herein, comprising administering an immunogen
described herein or a composition comprising the immunogen to a
subject and isolating antibody and/or cells expressing antibody
selective or specific for the TDP43 peptide of the immunogen
administered.
[0039] A further aspect includes a method of determining if a
sample suspected of comprising misfolded TDP-43 polypeptides
contains misfolded TDP-43 polypeptide the method comprising: [0040]
contacting the sample with an antibody described herein under
conditions permissive for forming an antibody: misfolded TDP-43
polypeptide complex; and [0041] detecting the presence of any
complex; [0042] wherein the presence of detectable complex is
indicative that the sample may contain misfolded TDP-43
polypeptide.
[0043] In an embodiment, the sample comprises brain tissue extract,
spinal cord tissue and/or CSF. In another embodiment, the sample is
a human sample, optionally from a subject with or suspected of
having ALS or FTD.
[0044] Other features and advantages of the present disclosure will
become apparent from the following detailed description. It should
be understood, however, that the detailed description and the
specific examples while indicating preferred embodiments of the
disclosure are given by way of illustration only, since various
changes and modifications within the spirit and scope of the
disclosure will become apparent to those skilled in the art from
this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] An embodiment of the present disclosure will now be
described in relation to the drawings in which:
[0046] FIGS. 1A to C are graphs plotting different metrics used to
predict exposure of an epitope in misfolded TDP-43. FIG. 1A, is a
graph that represents the epitope predictions arising from native
structure PDB 41UF, using the increase in SASA (.DELTA.SASA) as a
criterion to choose epitopes. The TTE epitope emerges as a
prediction for PDB structure 41UF. FIG. 1B is a graph that shows
the epitope predictions arising from structure PDB 41UF, using the
loss of native contacts as a criterion for epitope choice. The TTEQ
epitope (SEQ ID NO: 1) emerges as a prediction using this metric.
FIG. 1C shows several metrics, including increased SASA
(.DELTA.SASA), increased root mean squared fluctuations (RMSF) of
the atomic positions, which represents the increased dynamics of
the epitope, and the decrease in the number of native contacts,
.DELTA.contacts. These 3 different metrics predict epitopes TTE,
TTE, and TTEQ (SEQ ID NO: 1) respectively.
[0047] FIGS. 2A-J are graphs that show the Dihedral angle
distributions for several dihedral angles that may conformationally
distinguish misfolded TTEQ (SEQ ID NO: 1) from natively folded TTEQ
(SEQ ID NO: 1). Distributions of the native ensemble (dotted line),
biased ensemble (solid line) (a representation of misfolded RRM1 of
TDP-43), and cyclic CGGTTEQGG (SEQ ID NO: 2) (shaded histogram)
scaffold (for use in conjugating to an immunogen) are shown for the
following dihedral angles defined by 4 atoms:
C--C.alpha.-C.beta.-O.gamma.1 (FIG. 2A), C--C.alpha.-N--HN (FIG.
2B), O--C--C.alpha.-N (FIG. 2C), involving the side chain and
backbone atoms of residue Threonine 115 (T115). Dihedral angle
distributions for residue T116 are shown for angles
C.beta.-C.alpha.-N--HN (FIG. 2D), N--C.alpha.-C.beta.-O.gamma.1
(FIG. 2E), and O--C--C.alpha.-N (FIG. 2F), involving the side chain
and backbone atoms of residue T116. Dihedral angle distributions
for residue E117 are shown for angles
C.alpha.-C.beta.-C.gamma.-C.delta. (FIG. 2G),
O.epsilon.1-C.delta.-C.gamma.-C.beta. (FIG. 2H). Dihedral angle
distributions for residue Q118 are shown for angle
O--C--C.alpha.-C.beta. (FIG. 2I), and for angle
C.alpha.-C.beta.-C.gamma.-C.delta. (FIG. 2J). This latter dihedral
angle distribution is shown as an illustration of an angle that
does not distinguish between native, biased, and cyclic. The
overlapping percentage values are provided in Table 1A. The peak
values of the dihedral angles for the distributions are given in
Table 2A.
[0048] FIGS. 3A to H: Equilibrium backbone Ramachandran angles (phi
or .PHI., and psi or .psi.) for residues 115T, 116T and 117E, and
118Q in Native ensemble (dotted line), Biased ensemble (Solid
line), and cyclic CGGTTEQGG (SEQ ID NO: 2) (Shaded histogram).
Ramachandran angle distributions for residue T115 are shown for
backbone angles C'--N--C.alpha.-C' (hereafter, phi) (FIG. 3A),
N--C.alpha.-C'--N (hereafter, psi) (FIG. 3B). Phi and psi are also
shown for T116 (FIGS. 3C, and D), E117 (FIGS. 3E and F), and Q118
(FIGS. 3G and H). The overlap probabilities of these Ramachandran
angles are shown in Table 3A. The peak angles of the corresponding
distributions are shown in Table 4A.
[0049] FIG. 4A is a graph that shows the solubility as a function
of residue index, for all amino acids in RRM1 of TDP-43, with TTEQ
(SEQ ID NO: 1) delineated by vertical dashed lines. The epitope is
in a region of higher than average solubility along the primary
sequence.
[0050] FIG. 4B shows the SASA for residues TTEQ (SEQ ID NO: 1)
where TTEQ (SEQ ID NO: 1) in the cyclic peptide cyclo(CGGTTEQGG)
(SEQ ID NO: 2) is represented as a solid line with circle symbols,
TTEQ (SEQ ID NO: 1) in the biased, partially-unfolded peptide is
represented in dashed line with square symbols, and TTEQ (SEQ ID
NO: 1) in the context of the native structure 41UF is represented
in light grey line with triangle symbols.
[0051] FIG. 4C shows the SASA for residues TTEQ (SEQ ID NO: 1)
where TTEQ (SEQ ID NO: 1) in the cyclic peptide cyclo(CGTTEQG) (SEQ
ID NO:3) is represented as a solid line with circle symbols, TTEQ
(SEQ ID NO: 1) in the biased, partially-unfolded peptide is
represented in dashed line with square symbols, and TTEQ (SEQ ID
NO: 1) in the context of the native structure 41UF is represented
in light grey line with triangle symbols.
[0052] FIGS. 5A and B are Centroid structures of the cyclic and
native ensemble ensembles of TTEQ (SEQ ID NO: 1) epitope. The black
colored conformation is the centroid of the largest cluster of the
cyclic peptide, and so best represents the typical conformation of
the cyclic peptide. The white colored conformation is the centroid
of the largest cluster of TTEQ (SEQ ID NO: 1) in the native
ensemble (also referred to as the "native peptide"), and so should
best represent the typical conformation of TTEQ (SEQ ID NO: 1) in
the native ensemble. FIG. 5A shows the aligned centroid structures
of residues T115, T116, E117, and Q118 (TTEQ SEQ ID NO: 1) in
cyclic CGGTTEQGG (SEQ ID NO: 2) and native peptides are overlapped
in the figure. FIG. 5B is the same as FIG. 5A, for cyclic peptide
structure CGTTEQG (SEQ ID NO: 3), and native peptide structure TTEQ
(SEQ ID NO:1), both rendered in licorice representation so the
orientations of the side chains can be seen.
[0053] FIGS. 6A to E are schematic representations of the TTE/TTEQ
epitopes in native and biased representations. The SASA of the
epitope TTEQ (SEQ ID NO:1) is shown in the context of the native,
biased, and the cyclic peptides of sequence CGGTTEQGG (SEQ ID NO:
2) and CGTTEQG (SEQ ID NO: 3). T115 and E117 are labeled. FIG. 6A
shows the SASA of the epitope TTEQ (SEQ ID NO:1) in the native
ensemble. FIG. 6B shows the SASA of the epitope TTEQ (SEQ ID NO:1)
in the biased ensemble. FIG. 6C shows the SASA of the epitope TTEQ
(SEQ ID NO:1) in the cyclic peptide cyclo(CGGTTEQGG) (SEQ ID NO: 2)
ensemble. FIG. 6D shows the SASA of the epitope TTEQ (SEQ ID NO:1)
in the cyclic peptide cyclo(CGTTEQG) (SEQ ID NO: 3) ensemble. These
panels show qualitatively that the antigenic surface presented by
the cyclic peptide is more similar to that of the biased centroid
structure, and distinct from the surface in the native structure.
This is corroborated by analyzing interactions present in the
native ensemble, but broken in the biased ensemble. Specifically,
FIG. 6E shows a salt bridge between the sidechains of residues E117
and K137. This salt bridge is present in the native ensemble (FIG.
6E left panel), but is broken in the biased ensemble (FIG. 6E right
panel). Breaking of this salt bridge facilitates exposure to
sidechain of E117, rendering it available for antibody binding.
[0054] FIGS. 7A to J are a series of plots comparing linear,
cyclic, biased and/or native conformations. FIGS. 7A, B Clustering
plots by RMSD; axes correspond to the RMSD of TTEQ (SEQ ID NO:1)
relative to TTEQ (SEQ ID NO:1) in the centroid structure of the
cyclic peptide ensemble, the RMSD of TTEQ (SEQ ID NO:1) to TTEQ
(SEQ ID NO: 1) in the centroid structure of the native ensemble
ensemble, and the RMSD of TTEQ (SEQ ID NO:1) to TTEQ (SEQ ID NO:1)
in the centroid structure of the native structural ensemble of PDB
ID 41UF. FIG. 7A is a plot. Each point corresponds to a given
conformation taken from either the cyclic peptide cyclo(CGGTTEQGG)
(SEQ ID NO: 2) equilibrium ensemble (circles as noted in the
legend), the linear peptide equilibrium ensemble (+ symbols as
noted in the legend), the native structure equilibrium ensemble
starting from PDB ID 41UF (inverted triangles as noted in the
legend), or the biased structural ensemble (asterisks as noted in
the legend). FIG. 7B is similar to FIG. 7A, but linear ensemble is
not shown, and biased ensemble is now represented by + symbols.
FIG. 7C is a plot that shows the overlap percentages between the
different ensembles, as a function of the number of configurations
sampled, to show convergence. The numeric overlapping percentages
are given in Table 6A. FIGS. 7D and E show the same information as
FIGS. 7A and B, but for cyclic peptide cyclo(CGTTEQG) (SEQ ID NO:
3). FIG. 7F shows the same information as FIG. 7C, but for cyclic
peptide cyclo(CGTTEQG) (SEQ ID NO: 3). FIG. 7G shows the
correlation coefficient between the cyclic and native
distributions, as defined by first finding the parts of the
distributions having density greater than a cutoff value, such that
a given percentage of both of the total distributions are
encompassed, e.g. a density cutoff for the cyclic and native
distributions that give 60% of the total distributions. Then for
these subdistributions, the correlation coefficient is defined as
.intg.f(.tau.)g(.tau.)d.tau. {square root over
(.intg.f(.tau.).sup.2 d.tau.)} {square root over
(.intg.g(.tau.).sup.2d.tau.)}. Thus defined, the correlation
coefficient between the native and CGGTTEQGG (SEQ ID NO: 2) cyclic
distributions converges to about 4.5% when 100% of the respective
distributions are included. FIG. 7H plots the same correlation
coefficient for cyclic peptide cyclo(CGTTEQG) (SEQ ID NO: 3)
ensemble and the native ensemble, which converges to about 8% when
100% of the respective distributions are included. FIG. 7I examines
the effects of single residue deletions on the structural overlap
between the cyclo CGGTTEQGG (SEQ ID NO: 2) ensemble and the native
ensemble. The average of the overlaps, cyclic in native and native
in cyclic, as defined above, is used. The x-axis corresponds to the
number of sampled conformations and is used as a measure of
convergence of the result; the ordinate value at the largest value
of the abscissa is the most reliable value. FIG. 7J corresponds to
cyclic peptide cyclo(CGTTEQG) (SEQ ID NO: 3). The conclusion is the
same for this epitope scaffold: T115 confers significant
conformational selectivity.
[0055] FIGS. 8A and B show RMSD clustering plots for cyclo (CGTTEG)
(SEQ ID NO: 28) (FIG. 8A) and cyclo(CGTTEGG) (SEQ ID NO: 29) (FIG.
8B).
[0056] FIGS. 9A and B are plots plotting the overlap percentages
between different ensembles for cyclo(CGTTEG) (SEQ ID NO: 28) (FIG.
9A) and cyclo (CGTTEGG) (SEQ ID NO: 29) (FIG. 9B).
[0057] FIGS. 10A, 10B, 10C and 10D are a series of
immunofluorescent images of misfolded TDP-43. FIG. 10A is an image
showing nuclear staining of HEK293FT cells expressing
TDP-43.sup..DELTA.NLS; FIG. 10B is an image of HEK293FT cells
expressing TDP-43.sup..DELTA.NLS stained with anti-HA; FIG. 10C is
an image of HEK293FT cells expressing TDP-43.sup..DELTA.NLS stained
with a monoclonal antibody produced using cyclo(CGGTTEQGG) (SEQ ID
NO: 2); and FIG. 10D is an image showing co-localization of
staining between the anti-HA antibody and the monoclonal antibody
produced using cyclo(CGGTTEQGG) (SEQ ID NO: 2.
[0058] FIG. 11A is an immuno dot blot showing background binding of
negative control IgG1 antibody to spinal cord homogenates.
[0059] FIG. 11B is an immuno dot-blot showing binding of positive
control anti-TDP43 polyclonal antibody to spinal cord
homogenates.
[0060] FIG. 11C is an immuno dot-blot showing binding of antibodies
raised to cyclic peptides cyclo(CGGTTEQGG) (SEQ ID NO: 2) and
cyclo(CGTTEQG) (SEQ ID NO: 3) to spinal cord homogenates.
[0061] FIG. 12A is image of HEK293FT cells expressing
TDP-43.sup..DELTA.NLS stained with DAPI.
[0062] FIG. 12B is an image of HEK293FT cells expressing
TDP-43.sup..DELTA.NLS stained with anti-HA.
[0063] FIG. 12C is an image of HEK293FT cells expressing
TDP-43.sup..DELTA.NLS stained with an antibody raised against an
immunogen comprising cyclo(CGGTTEQGG) (SEQ ID NO: 2).
[0064] FIG. 12D is an image showing colacalization of staining
between the anti-HA antibody and antibody raised against an
immunogen comprising cyclo(CGGTTEQGG) (SEQ ID NO: 2).
[0065] FIG. 13A is an alignment of the variable region for the
protein sequence of sequenced antibody heavy chains. The CDR
regions are boxed.
[0066] FIG. 13B is an alignment of the variable region for the
protein sequence of sequenced antibody light chains. The CDR
regions are boxed.
DETAILED DESCRIPTION OF THE DISCLOSURE
[0067] Generation of misfolding-specific antibodies can be
accomplished through the identification of targets on the misfolded
TDP-43 peptide that are not present, or present to a lesser degree,
in the native structure. Misfolding-specific epitopes need not
differ in primary sequence from the corresponding segment in the
native structure, however they should be conformationally-distinct
in the context of the misfolded ensemble. That is, the epitope
would present distinct conformations in terms of backbone and/or
sidechain conformation in the misfolded ensemble that would not be
present (or would be unfavourable) in the native structure.
[0068] Antibodies raised to native protein regions tend not to be
selective for misfolded protein, and thus bind to native functional
protein as well.
[0069] As described herein, to develop antibodies that may be
selective for misfolded forms of TDP-43, the inventors sought to
identify a region of TDP-43 sequence that is prone to disruption in
the context of the native fold, and that may be exposed as well on
the surface of the misfolded protein.
[0070] As described in the Examples, computational simulations,
using molecular dynamics with standardized force-fields, were
employed. An experimentally-validated structural model of the
folded structure is globally biased away from its "native"
conformation to be partially unfolded, using molecular dynamics, to
yield one or more regions of contiguous primary sequence that are
prone to be disordered upon an external challenge in an anomalous
cellular environment.
[0071] It was hypothesized that these weakly-stable regions may be
exposed in nascent misfolded proteins, or misfolded pathogenic
species, and that in this context they are present in an alternate
conformation than they are in the native ensemble. They may thus
constitute misfolded protein-specific epitope predictions.
[0072] Without wishing to be bound by theory, these sequence
regions in misfolded proteins may be exposed in conformations
distinct from that of the native fold--for example, being on the
surface, they may be exposed in turn regions that have higher
exposed surface area, or alternate side chain conformations, as
seen by different dihedral angle distributions, and/or different
overall conformation as measured by structural alignment, than the
corresponding quantities exhibit in native TDP-43.
[0073] As described the Examples, the inventors have identified
minimal epitopes in a region predicted to be prone to disruption in
the context of the native structure, so that it would be likely to
be exposed in a partially-formed native structure. The inventors
designed cyclic compounds comprising the identified epitope to
satisfy criteria of an alternate conformation such as a higher
exposed surface area, and/or that did not readily align by root
mean squared deviation (RMSD) to the native ensemble, but would
align more favorably to a biased, partially disordered
ensemble.
[0074] Antibodies raised to these epitopes are shown by
immunofluorescence to recognize misfolded TDP-43 in cell culture
and by immuno dot-blotting to bind to pathogenic TDP43 in spinal
cord homogenates from ALS patients vs controls.
I. Definitions
[0075] As used herein, the term "TDP-43" alternately referred to as
"TDP43", or "TDP" as used herein means all forms of TDP-43
including wildtype TDP-43, native TDP-43, as well as misfolded
forms including mutant forms and analogs thereof from all species,
particularly human TDP-43 (i.e. hTDP-43). Human TDP-43 is a protein
of typically 414 amino acid residues and the amino acid sequence
(e.g. Uniprot Accession number Q13148) and the nucleotide sequence
(e.g. Accession number HGNC:11571) have been previously
characterized. TDP-43 comprises RRM1 and RRM2 domains. The RRM1 of
TDP-43 refers to the first RNA-recognition motif of the protein,
consisting of amino acids 106-177. A structure of the RRM1 domain
of TDP-43 has been determined and is listed on the protein databank
as PDB entry 41UF. The PDB 41UF structure can be equilibrated on a
computer to obtain an equilibrium ensemble, which was used for all
measurements of the native conformations of the epitopes in the
native structure of TDP-43, referred to herein variably as "native
structure of RRM1", "equilibrium native ensemble of TDP-43",
"equilibrium native ensemble of RRM1 of TDP-43", or "TDP-43 native
structural ensemble".
[0076] "Wild type" as used herein refers to the primary amino acid
sequence of non-mutant or naturally occurring protein.
[0077] "Native" as used herein refers to the normal three
dimensional structure of a specific protein or part thereof (e.g.
the atomic level coordinates of the crystal structure of native
TDP-43 RRM1 domain is available at Protein Data Bank Accession
Number 41UF). Native TDP-43 is optionally referred to as "natively
folded" TDP-43 "normally folded" TPD-43 and/or "healthy" TDP-43.
Similarly native RRM1 domain of TDP-43 is optionally referred to as
"natively folded" RRM1 domain of TDP-43 or "normally folded" RRM1
domain of TPD-43. Accordingly the term "native TDP-43", or
"natively folded TDP-43", herein refers to TDP-43 as natively
folded after nascent translation and/or dimeric TDP-43 as folded in
non-disease states (e.g. healthy cells) with a molecular structure
that comprises a non-covalently associated, individual TDP-43
peptide which shows native structure under in x-ray crystallography
or as reconstructed from a nuclear magnetic resonance measurement.
The native structure of RRM1 has an alpha/beta structure,
consisting of both alpha helices and beta sheets.
[0078] "Misfolded" as used herein refers to the secondary and
tertiary structure of a polypeptide or part thereof, and indicates
that the polypeptide has adopted a conformation that is not normal
for that polypeptide in its properly functioning state. Although
misfolding can be caused by mutations in a protein, such as amino
acid deletion, substitution, or addition, wild-type sequence
protein can also be misfolded in disease, and expose
disease-specific epitopes for instance, as a result of
microenvironmental conditions and/or amino acid modification such
as nitration, oxidation, carbonylation or other modification. Other
post-translational modifications include aberrant ubiquitination,
phosphorylation, acetylation, sumoylation, and cleavage into
C-terminal fragments ubiquitylation. Accordingly, "misfolded TDP-43
polypeptide", or "misfolded TDP-43" when referring to the
polypeptide herein refers to TDP-43 polypeptide that displays a
plurality of conformations of TDP-43 wherein the conformations are
partially-ordered, containing parts of the native structure, and
partially-disordered, containing polymer segments of amino acids
that have alternate conformations than native TDP-43, and often
show an increase in SASA, and sample a more diverse conformational
ensemble than that explored in the native equilibrium ensemble.
[0079] Misfolded TDP-43 is prone to the formation of aggregates
resulting in a loss of protein function, toxicity and propagation
of pathogenic aggregates.
[0080] The term "mutant TDP-43" refers to forms of TDP-43, and
particularly endogenous forms of TDP-43 that occur as a result of
genetic mutation that result for instance in amino acid
substitution, such as those substitutions characteristic for
instance of FTD or familial ALS including for example the mutations
described in the bioinformatics tool described in [6].
[0081] The term "TTEQ (SEQ ID NO: 1)" means the amino acid
sequence: threonine, threonine, glutamic acid, glutamine; as shown
in SEQ ID NO: 1. Similarly TTE, TEQ, KTTE (SEQ ID NO:10), KTTEQD
(SEQ ID NO: 7), TTEQD (SEQ ID NO: 9), TTEQDL (SEQ ID NO: 11), TEQD
(SEQ ID NO: 8) refer to the amino acid sequences identified by the
1-letter amino acid code. Depending on the context, the reference
of the amino acid sequence can refer to a sequence in TDP-43 or an
isolated peptide, such as the amino acid sequence of a cyclic
compound. The sequence TTEQ (SEQ ID NO: 1) consists of residues
115-118 in the amino acid primary sequence.
[0082] The term "TTEQ (SEQ NO: 1) or a related epitope and/or part
of any of the foregoing" as used herein minimally comprises amino
acid T115 and/or T116 and/or E117, and includes for example TTE,
KTT or TEQ. Reference to TTEQ (SEQ NO: 1) or a related epitope
and/or part of any of the foregoing can refer to the region on
TDP-43 that is bound by an antibody raised for example by a cyclic
compound comprising a TDP-43 peptide sequence. For example the
antibody may selectively or specifically bind T115, T116 or E117, a
particular part of T115 and/or T116 and/or E117, or a combination
of any of the foregoing. Alternatively, it can refer to the TDP-43
peptide sequence that is comprised in a cyclic compound for making
antibodies.
[0083] The term "alternate conformation than occupied by 115T,
116T, 117E and/or 118Q in the native" as used herein means having
one or more differing conformational properties selected from
solvent accessibility, (e.g. in the context of a peptide comprising
TTEQ (SEQ ID NO: 1) as measured for example in the cyclic peptide
described in the examples, RMSD structural alignment, and dihedral
angle of one or more backbone or side chain dihedral angles
compared to said property for 115T, 116T, 117E and/or 118Q in the
TDP-43 native structural ensemble, as shown for example in PDB
41UF, and shown in the Figures, and/or in the Tables. Similarly,
the term "alternate conformation" than occupied by one or more of
the T's, E and/or Q in the native structure as used herein means
having one or more differing conformational properties selected
from solvent accessibility, (e.g. in the context of a corresponding
linear peptide comprising TTEQ (SEQ ID NO: 1) or TTE, and dihedral
angle of one or more backbone or side chain dihedral angles
compared to said property for one or more of T, E and/or Q, for
example T, E and/or Q in native TDP-43 as shown for example in PDB
41UF and shown in FIGS. 1-9 and/or in the Tables. For example,
according to FIG. 2, for residue 115T, dihedrals C--CA-CB--OG1 and
C--CA-N--HN distinguish both cyclic peptide cyclo(CGGTTEQGG) (SEQ
ID NO:2) and the biased ensemble from the corresponding dihedral
angles in the native. Specifically, for example, dihedral
C-CA-CB--OG1 shows a peak at 180 degrees for cyclic and biased
ensembles that is not present in the native ensemble.
[0084] An "epitope" as used herein means a region of a protein that
is recognized by a B cell or T-cell receptor, or an antibody or a
binding fragment thereof. The epitope is optionally represented
herein by a linear amino acid sequence or the region of the protein
recognized by the antibody. An epitope can comprise one or more
antigenic determinants. For example an antibody generated against
an isolated peptide corresponding to a misfolded epitope recognizes
part or all of said epitope sequence.
[0085] As used herein, the term "misfolded epitope" or
"conformational epitope" refers to a sequence of amino acids or an
antigenic determinant thereof that have a particular
three-dimensional structure wherein at least an aspect of the
three-dimensional structure not present in a corresponding native
structure is recognized by the cognate antibody. The "misfolded- or
conformational epitope" becomes exposed or accessible in the
misfolded protein (e.g. as present in ALS and FTD). Antibodies
which selectively bind a misfolded epitope recognize the spatial
arrangement of one or more of the amino acids of that
conformation-specific epitope. For example, a TTEQ (SEQ ID NO: 1)
conformational epitope refers to an epitope of TTEQ (SEQ ID NO: 1)
that is recognized by antibodies selectively, for example at least
2 fold, 3 fold, 5 fold, 10 fold, 50 fold, 100 fold, 250 fold, 500
fold or 1000 fold or greater more selectivity as compared to the
epitope on native TDP-43 or for example antibodies raised using a
linear peptide comprising TTEQ (SEQ ID NO: 1).
[0086] The term "analog" as used herein includes parts, extensions,
substitutions, variants, modifications or chemical equivalents and
derivatives thereof of the amino acid and nucleotide sequences of
the present invention that perform substantially the same function
as the peptide, protein or nucleic acid molecules of described
herein in substantially the same way. Analogs of the cyclic
compounds such as the cyclic peptides also include additions and
deletions to the TDP-43 peptides. Analogs of nucleic acids include
degenerate nucleotide substitutions that encode an isolated peptide
of the invention. In addition, analog peptides and analog
nucleotide sequences include derivatives thereof.
[0087] The term "amino acid" includes all of the naturally
occurring amino acids as well as modified L-amino acids. The atoms
of the amino acid can for example include different isotopes. For
example, the amino acids can comprise deuterium substituted for
hydrogen, nitrogen-15 substituted for nitrogen-14, and carbon-13
substituted for carbon-12 and other similar changes.
[0088] A "conservative amino acid substitution" as used herein, is
one in which one amino acid residue is replaced with another amino
acid residue without abolishing the protein's desired properties.
Suitable conservative amino acid substitutions can be made by
substituting amino acids with similar hydrophobicity, polarity, and
R-group size for one another. Examples of conservative amino acid
substitution include:
TABLE-US-00001 Conservative Substitutions Type of Amino Acid
Substitutable Amino Acids Hydrophilic Ala, Pro, Gly, Glu, Asp, Gln,
Asn, Ser, Thr Sulphydryl Cys Aliphatic Val, Ile, Leu, Met Basic
Lys, Arg, His Aromatic Phe, Tyr, Trp
[0089] The term "sequence identity" as used herein refers to the
percentage of sequence identity between two polypeptide sequences
or two nucleic acid sequences. To determine the percent identity of
two amino acid sequences or of two nucleic acid sequences, the
sequences are aligned for optimal comparison purposes (e.g., gaps
can be introduced in the sequence of a first amino acid or nucleic
acid sequence for optimal alignment with a second amino acid or
nucleic acid sequence). The amino acid residues or nucleotides at
corresponding amino acid positions or nucleotide positions are then
compared. When a position in the first sequence is occupied by the
same amino acid residue or nucleotide as the corresponding position
in the second sequence, then the molecules are identical at that
position. The percent identity between the two sequences is a
function of the number of identical positions shared by the
sequences (i.e., % identity=number of identical overlapping
positions/total number of positions.times.100%). In one embodiment,
the two sequences are the same length. The determination of percent
identity between two sequences can also be accomplished using a
mathematical algorithm. A preferred, non-limiting example of a
mathematical algorithm utilized for the comparison of two sequences
is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad.
Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993,
Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is
incorporated into the NBLAST and XBLAST programs of Altschul et
al., 1990, J. Mol. Biol. 215:403. BLAST nucleotide searches can be
performed with the NBLAST nucleotide program parameters set, e.g.,
for score=100, word length=12 to obtain nucleotide sequences
homologous to a nucleic acid molecules of the present application.
BLAST protein searches can be performed with the XBLAST program
parameters set, e.g., to score-50, word length=3 to obtain amino
acid sequences homologous to a protein molecule described herein.
To obtain gapped alignments for comparison purposes, Gapped BLAST
can be utilized as described in Altschul et al., 1997, Nucleic
Acids Res. 25:3389-3402. Alternatively, PSI-BLAST can be used to
perform an iterated search which detects distant relationships
between molecules (Id.). When utilizing BLAST, Gapped BLAST, and
PSI-Blast programs, the default parameters of the respective
programs (e.g., of XBLAST and NBLAST) can be used (see, e.g., the
NCBI website). Another preferred non-limiting example of a
mathematical algorithm utilized for the comparison of sequences is
the algorithm of Myers and Miller, 1988, CABIOS 4:11-17. Such an
algorithm is incorporated in the ALIGN program (version 2.0) which
is part of the GCG sequence alignment software package. When
utilizing the ALIGN program for comparing amino acid sequences, a
PAM120 weight residue table, a gap length penalty of 12, and a gap
penalty of 4 can be used. The percent identity between two
sequences can be determined using techniques similar to those
described above, with or without allowing gaps. In calculating
percent identity, typically only exact matches are counted.
[0090] For antibodies, percentage sequence identities can be
determined when antibody sequences maximally aligned by IMGT or
other (e.g. Kabat numbering convention). After alignment, if a
subject antibody region (e.g., the entire mature variable region of
a heavy or light chain) is being compared with the same region of a
reference antibody, the percentage sequence identity between the
subject and reference antibody regions is the number of positions
occupied by the same amino acid in both the subject and reference
antibody region divided by the total number of aligned positions of
the two regions, with gaps not counted, multiplied by 100 to
convert to percentage.
[0091] The term "antibody" as used herein is intended to include
monoclonal antibodies, polyclonal antibodies, single chain,
humanized and other chimeric antibodies as well as binding
fragments thereof. The antibody may be from recombinant sources
and/or produced in transgenic animals. Also included are human
antibodies that can be produced through using biochemical
techniques or isolated from a library. Humanized or chimeric
antibody may include sequences from one or more than one isotype or
class.
[0092] The phrase "isolated antibody" refers to antibody produced
in vivo or in vitro that has been removed from the source that
produced the antibody, for example, an animal, hybridoma or other
cell line (such as recombinant cells that produce antibody). The
isolated antibody is optionally "purified", which means at least:
80%, 85%, 90%, 95%, 98% or 99% purity.
[0093] The term "binding fragment" as used herein to a part or
portion of an antibody or antibody chain comprising fewer amino
acid residues than an intact or complete antibody or antibody chain
and which binds the antigen or competes with intact antibody.
Exemplary binding fragments include without limitations Fab, Fab',
F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies,
diabodies, and multimers thereof. Fragments can be obtained via
chemical or enzymatic treatment of an intact or complete antibody
or antibody chain. Fragments can also be obtained by recombinant
means. For example, F(ab')2 fragments can be generated by treating
the antibody with pepsin. The resulting F(ab')2 fragment can be
treated to reduce disulfide bridges to produce Fab' fragments.
Papain digestion can lead to the formation of Fab fragments. Fab,
Fab' and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies,
diabodies, bispecific antibody fragments and other fragments can
also be constructed by recombinant expression techniques.
[0094] The terms "IMGT numbering" or "ImMunoGeneTics database
numbering", which are recognized in the art, refer to a system of
numbering amino acid residues which are more variable (i.e.
hypervariable) than other amino acid residues in the heavy and
light chain variable regions of an antibody, or antigen binding
portion thereof.
[0095] The CDR sequences referred to herein are based IGBlast
identification which searches sequences with BLAST against the IMGT
or NCBI germline V gene database. The sequences were also confirmed
to correspond to IMGT numbering. As the full sequences for the
variable regions are provided, it is possible to identify the CDRs
based on other conventions such as Kabat as well.
[0096] When an antibody is said to bind to an epitope within
specified residues, such as TTEQ (SEQ ID NO:1), what is meant is
that the antibody selectively or specifically binds to a
polypeptide containing the specified residues or a part thereof for
example at least 1 residue or at least 2 residues in a
conformation-selective manner. Such an antibody does not
necessarily contact every residue of TTEQ (SEQ ID NO:1), and every
single amino acid substitution or deletion within said epitope does
not necessarily significantly affect or equally affect binding
affinity.
[0097] The term "detectable label" as used herein refers to
moieties such as peptide sequences, fluorescent proteins that can
be appended or introduced into a peptide or compound described
herein and which is capable of producing, either directly or
indirectly, a detectable signal. For example, the label may be
radio-opaque, positron-emitting radionuclide (for example for use
in PET imaging), or a radioisotope, such as .sup.3H, .sup.13N,
.sup.14C, .sup.18F, .sup.32F, .sup.35S, .sup.123I, .sup.125I,
.sup.131I; a fluorescent (fluorophore) or chemiluminescent
(chromophore) compound, such as fluorescein isothiocyanate,
rhodamine or luciferin; an enzyme, such as alkaline phosphatase,
beta-galactosidase or horseradish peroxidase; an imaging agent; or
a metal ion. The detectable label may be also detectable indirectly
for example using secondary antibody.
[0098] The term "epitope selectively presented or accessible in
misfolded TDP-43" as used herein refers to an epitope that is
selectively presented or accessible on misfolded TDP-43 as present
in ALS or FTD (e.g. disease associated misfolded TDP-43) whether in
monomeric, dimeric or aggregated forms, but not on the molecular
surface of the native, correctly folded, homodimeric form of
TDP-43.
[0099] The phrase as used herein "epitope consists of TTEQ",
indicates an epitope, optionally a conformational epitope, that is
bound specifically and preferentially by an antibody that
preferentially binds TTEQ (SEQ ID NO: 1) peptide compared to a
mutated TTEQ (SEQ ID NO: 1) peptide where any one or more of the
residues are mutated for example to alanine. Similarly, the phrase
as used herein of "conformational epitope consists of TTEQ"
indicates an epitope that is bound specifically by an antibody that
preferentially binds TTEQ (SEQ ID NO: 1) in a particular
conformation (e.g. misfolded protein, cyclic compound or some other
constrained conformation) over another conformation (e.g. native)
and optionally over, when at least one or more of the residues, are
mutated to for example alanine (e.g cyclic conformation of a
peptide comprising TTEQ (SEQ ID NO: 1), versus cyclic conformation
of a peptide wherein one or more of the residues are mutated).
[0100] The phrase "epitope consisting of TTEQ or a part thereof"
indicates an epitope that is bound specifically by an antibody that
specifically and preferentially binds TTEQ (SEQ ID NO: 1) peptide
compared to a peptide when at least one or more of the residues,
optionally 115T, 116T, 117E and/or 118Q, are mutated to alanine or
absent. Similarly, the phrase as used herein of "conformational
epitope consists of TTEQ or a part thereof" indicates an epitope
that is bound specifically by an antibody that preferentially binds
TTEQ (SEQ ID NO: 1) or a part thereof when it is in a particular
conformation (e.g. misfolded protein, cyclic, or some other
constrained conformation) over another conformation (e.g. native
conformation) and optionally over, when at least one or more of the
residues, optionally 115T, 116T, 117E and/or 118Q, are mutated to
alanine or absent (e.g cyclic conformation of a peptide comprising
TTEQ (SEQ ID NO: 1), versus cyclic conformation of a peptide
wherein one or more of the residues are mutated or absent).
[0101] The term "greater affinity" as used herein refers to a
degree of antibody binding where an antibody X binds to target Y
more strongly (K.sub.on) and/or with a smaller dissociation
constant (K.sub.off) than to target Z, and in this context antibody
X has a greater affinity for target Y than for Z. Likewise, the
term "lesser affinity" herein refers to a degree of antibody
binding where an antibody X binds to target Y less strongly and/or
with a larger dissociation constant than to target Z, and in this
context antibody X has a lesser affinity for target Y than for Z.
The affinity of binding between an antibody and its target antigen,
can be expressed as KA equal to 1/K.sub.D where K.sub.D is equal to
k.sub.on/k.sub.off. The k.sub.on and k.sub.off values can be
measured using surface plasmon resonance (measurable for example
using a Biacore system).
[0102] Also as used herein, the term "immunogenic" refers to
substances which elicit the production of antibodies, activate
T-cells and other reactive immune cells directed against an
antigenic portion of the immunogen.
[0103] An "immunogen" as used herein means a substance which
provokes an immune response and/or causes production of an
antibody. In addition to immunogenic compounds, conjugates and
fusions described herein, including for example the isolated
compounds conjugated to KLH, peptide mimetics which elicit
cross-reactive antibodies to the epitopes identified, e.g. TTEQ
and/or related epitopes such as TTE can be employed. To serve as a
useful immunogen, the TDP-43 peptide desirably incorporates a
minimum of about 3, 4, 5, 6, or 7 TDP-43 residues, comprising
minimally T115 and/or T116 and/or E117 and optionally incorporates
an immunogenicity enhancing agent such as KLH. As the number of
residues in the cyclic peptide increases, the construct becomes
more similar conformationally to the linear peptide. The optimal
degree of similarity to misfolded states as compared to native
structures occurs around 7 to 9 residues (see Table 6C and Table
8A).
[0104] The term "corresponding linear compound" with regard to a
cyclic compound refers to a compound, optionally a peptide,
comprising or consisting of the same sequence or chemical moieties
as the cyclic compound but in linear (non-cyclized) form.
[0105] The term "nucleic acid sequence" as used herein refers to a
sequence of nucleoside or nucleotide monomers consisting of
naturally occurring bases, sugars and intersugar (backbone)
linkages. The term also includes modified or substituted sequences
comprising non-naturally occurring monomers or portions thereof.
The nucleic acid sequences of the present application may be
deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences
(RNA) and may include naturally occurring bases including adenine,
guanine, cytosine, thymidine and uracil. The sequences may also
contain modified bases. Examples of such modified bases include aza
and deaza adenine, guanine, cytosine, thymidine and uracil; and
xanthine and hypoxanthine. The nucleic acid can be either double
stranded or single stranded, and represents the sense or antisense
strand. Further, the term "nucleic acid" includes the complementary
nucleic acid sequences as well as codon optimized or synonymous
codon equivalents. The term "isolated nucleic acid sequences" as
used herein refers to a nucleic acid substantially free of cellular
material or culture medium when produced by recombinant DNA
techniques, or chemical precursors, or other chemicals when
chemically synthesized. An isolated nucleic acid is also
substantially free of sequences which naturally flank the nucleic
acid (i.e. sequences located at the 5' and 3' ends of the nucleic
acid) from which the nucleic acid is derived.
[0106] Operatively linked" is intended to mean that the nucleic
acid is linked to regulatory sequences in a manner which allows
expression of the nucleic acid. Suitable regulatory sequences may
be derived from a variety of sources, including bacterial, fungal,
viral, mammalian, or insect genes. Selection of appropriate
regulatory sequences is dependent on the host cell chosen and may
be readily accomplished by one of ordinary skill in the art.
Examples of such regulatory sequences include: a transcriptional
promoter and enhancer or RNA polymerase binding sequence, a
ribosomal binding sequence, including a translation initiation
signal. Additionally, depending on the host cell chosen and the
vector employed, other sequences, such as an origin of replication,
additional DNA restriction sites, enhancers, and sequences
conferring inducibility of transcription may be incorporated into
the expression vector.
[0107] The term "vector" as used herein comprises any intermediary
vehicle for a nucleic acid molecule which enables said nucleic acid
molecule, for example, to be introduced into prokaryotic and/or
eukaryotic cells and/or integrated into a genome, and include
plasmids, phagemids, bacteriophages or viral vectors such as
retroviral based vectors, Adeno Associated viral vectors and the
like. The term "plasmid" as used herein generally refers to a
construct of extrachromosomal genetic material, usually a circular
DNA duplex, which can replicate independently of chromosomal
DNA.
[0108] By "at least moderately stringent hybridization conditions"
it is meant that conditions are selected which promote selective
hybridization between two complementary nucleic acid molecules in
solution. Hybridization may occur to all or a portion of a nucleic
acid sequence molecule. The hybridizing portion is typically at
least 15 (e.g. 20, 25, 30, 40 or 50) nucleotides in length. Those
skilled in the art will recognize that the stability of a nucleic
acid duplex, or hybrids, is determined by the Tm, which in sodium
containing buffers is a function of the sodium ion concentration
and temperature (Tm=81.5.degree. C.-16.6 (Log10 [Na+])+0.41(%
(G+C)-600/1), or similar equation). Accordingly, the parameters in
the wash conditions that determine hybrid stability are sodium ion
concentration and temperature. In order to identify molecules that
are similar, but not identical, to a known nucleic acid molecule a
1% mismatch may be assumed to result in about a 1.degree. C.
decrease in Tm, for example if nucleic acid molecules are sought
that have a >95% identity, the final wash temperature will be
reduced by about 5.degree. C. Based on these considerations those
skilled in the art will be able to readily select appropriate
hybridization conditions. In preferred embodiments, stringent
hybridization conditions are selected. By way of example the
following conditions may be employed to achieve stringent
hybridization: hybridization at 5.times. sodium chloride/sodium
citrate (SSC)/5.times.Denhardt's solution/1.0% SDS at Tm--5.degree.
C. based on the above equation, followed by a wash of
0.2.times.SSC/0.1% SDS at 60.degree. C. Moderately stringent
hybridization conditions include a washing step in 3.times.SSC at
42.degree. C. It is understood, however, that equivalent
stringencies may be achieved using alternative buffers, salts and
temperatures. Additional guidance regarding hybridization
conditions may be found in: Current Protocols in Molecular Biology,
John Wiley & Sons, N.Y., 2002, and in: Sambrook et al.,
Molecular Cloning: a Laboratory Manual, Cold Spring Harbor
Laboratory Press, 2001.
[0109] As used herein "specifically binds" in reference to an
antibody means that the antibody recognizes its target antigen and
binds its target with greater affinity than it does to a
structurally different antigen and/or to an antigen with modified
or mutated sequence. For example a multivalent antibody binds its
target with K.sub.D of at least 1e-6, at least 1e-7, at least 1e-8,
at least 1e-9 or at least 1e-10. Affinities greater than at least
1e-8 are preferred. An antigen binding fragment such as Fab
fragment comprising one variable domain, may find its target with a
10 fold or 100 fold less affinity than a multivalent interaction
with a non-fragmented antibody.
[0110] The term "selective" as used herein with respect to an
antibody that preferentially binds a form of TDP-43 (e.g. native,
or misfolded protein) means that the binding protein binds the form
with at least 3 fold, or at least 5 fold, at least 10 fold, at
least 20 fold, at least 100 fold, at least 250 fold, at least 500
fold or at least 1000 fold or more greater affinity. Accordingly an
antibody that is more selective for a particular conformation (e.g.
misfolded protein, cyclic peptide) preferentially binds the
particular form of TDP-43 with at least 3 fold etc greater affinity
compared to another form.
[0111] The term "linker" as used herein means a chemical moiety
that can be covalently linked to the peptide comprising TTEQ (SEQ
ID NO:1) epitope peptide, optionally linked to TTEQ (SEQ ID NO:1)
peptide N- and C-termini to produce a cyclic compound. The linker
can comprise a spacer and/or one or more functionalizable moieties
such as a cysteine residue. The linker can be linked via the
functionalizable moieties to a carrier protein or an immunogen
enhancing component such as keyhole limpet hemocyanin (KLH). The
linker can be for example 1 to 9 amino acids.
[0112] The term "spacer" as used herein means any non-immunogenic
or poorly immunogenic chemical moiety that can be covalently-linked
directly or indirectly to a peptide N- and C-termini to produce a
cyclic compound of longer length than the peptide itself, for
example the spacer can be linked to the N- and C-termini of a
peptide consisting of TTEQ (SEQ ID NO:1) to produce a cyclic
compound of longer backbone length than the TTEQ (SEQ ID NO:1)
sequence itself. That is, when cyclized the peptide with a spacer
(for example of 3 amino acid residues) makes a larger closed circle
than the peptide without a spacer. The spacer may include, but is
not limited to, non-immunogenic moieties such as G, A, or PEG
repeats, e.g. when in combination with the peptide being GTTEQG
(SEQ ID NO: 4) TTEQG (SEQ ID NO: 5), GTTEQ (SEQ ID NO: 6), etc. The
spacer may comprise or be coupled to one or more functionalizing
moieties, such as one or more cysteine (C) residues, which can be
interspersed within the spacer or covalently linked to one or both
ends of the spacer. Where a functionalizable moiety such as a C or
D residue is covalently linked to one or more termini of the
spacer, the spacer is indirectly covalently linked to the peptide.
The spacer can also comprise the functionalizable moiety in a
spacer residue as in the case where a biotin molecule is introduced
into an amino acid residue.
[0113] The term "functionalizable moiety" as used herein refers to
a chemical entity with a "functional group" which as used herein
refers to a group of atoms or a single atom that will react with
another group of atoms or a single atom (so called "complementary
functional group") to form a chemical interaction between the two
groups or atoms. In the case of cysteine, the functional group can
be --SH which can be reacted to form a disulfide bond. Accordingly
the linker can for example be CCC. The reaction with another group
of atoms can be covalent or a strong non-covalent bond, for example
as in the case of biotin-streptavidin bonds, which can have
Kd.about.1e-14. A strong non-covalent bond as used herein means an
interaction with a Kd of at least 1e-9, at least 1e-10, at least
1e-11, at least 1e-12, at least 1e-13 or at least 1e-14.
[0114] Proteins and/or other agents may be functionalized (e.g.
coupled) to the cyclic compound, either to aid in immunogenicity,
or to act as a probe in in vitro studies. For this purpose, any
functionalizable moiety capable of reacting (e.g. making a covalent
or non-covalent but strong bond) may be used. In one specific
embodiment, the functionalizable moiety is a cysteine residue which
is reacted to form a disulfide bond with an unpaired cysteine on a
protein of interest, which can be, for example, an immunogenicity
enhancing component such as Keyhole limpet hemocyanin (KLH), or a
carrier protein such as Bovine serum albumin (BSA) used for in
vitro immunoblots or immunohistochemical assays.
[0115] The term "reacts with" as used herein generally means that
there is a flow of electrons or a transfer of electrostatic charge
resulting in the formation of a chemical interaction.
[0116] The term "animal" or "subject" as used herein includes all
members of the animal kingdom including mammals, optionally
including or excluding humans.
[0117] In understanding the scope of the present disclosure, the
term "consisting" and its derivatives, as used herein, are intended
to be close ended terms that specify the presence of stated
features, elements, components, groups, integers, and/or steps, and
also exclude the presence of other unstated features, elements,
components, groups, integers and/or steps.
[0118] The recitation of numerical ranges by endpoints herein
includes all numbers and fractions subsumed within that range (e.g.
1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to
be understood that all numbers and fractions thereof are presumed
to be modified by the term "about." Further, it is to be understood
that "a", "an" and "the" include plural referents unless the
content clearly dictates otherwise. The term "about" means plus or
minus 0.1 to 50%, 5-50%, or 10-40%, preferably 10-20%, more
preferably 10% or 15%, of the number to which reference is being
made.
[0119] Further, the definitions and embodiments described in
particular sections are intended to be applicable to other
embodiments herein described for which they are suitable as would
be understood by a person skilled in the art. For example, in the
following passages, different aspects of the invention are defined
in more detail. Each aspect so defined may be combined with any
other aspect or aspects unless clearly indicated to the contrary.
In particular, any feature indicated as being preferred or
advantageous may be combined with any other feature or features
indicated as being preferred or advantageous.
II. Epitopes and Binding Proteins
[0120] The inventors have identified epitopes in TDP-43 including
TTEQ (SEQ ID NO: 1) at amino acids 115 to 118 on TDP-43 protein and
TTE at amino acids 115 to 117 on TDP-43 protein. They have further
identified that these epitopes or parts thereof are conformational
epitopes, and that TTE, TEQ or TTEQ (SEQ ID NO: 1) or a part
thereof may be selectively accessible to antibody binding in
misfolded proteinic species of TDP-43.
[0121] Based on one or more conformational differences identified
between the epitopes identified in native and biased TDP-43
ensembles, the inventors have designed conformationally restricted
compounds and immunogens for producing antibodies that selectively
or specifically binds misfolded TDP-43.
[0122] Antibodies raised using said immunogens may be useful for
detecting misfolded TDP-43.
[0123] As described in the Examples, cyclic compounds such as
cyclic peptides cyclo (CGGTTEQGG) (SEQ ID NO: 2), cyclo (CGTTEQG)
(SEQ ID NO: 3), cyclo (CGTTEG) (SEQ ID NO: 28) and cyclo (CGTTEGG)
(SEQ ID NO: 29) may capture the conformational differences of the
epitope in misfolded TDP-43 relative to the native species. For
example, solvent accessible surface area, RMSD structural
alignment, and the dihedral angle distributions for amino acids in
the cyclic 9-mer cyclo (CGGTTEQGG) (SEQ ID NO: 2) were found to be
significantly different than the corresponding quantities in the
native ensemble. This suggests that the cyclic compound may provide
for a conformational epitope that is conformationally-distinct from
the sequence presented in the native ensemble.
III. TTEQ (SEQ ID NO:1) and TTE "Epitope" Compounds
[0124] Accordingly, the present disclosure identifies a
conformational epitope in TDP-43 consisting of amino acids TTEQ
(SEQ ID NO: 1) or TTE corresponding to amino acids residues 115-117
on TDP-43 and TEQ corresponding to amino acids 116-118. As
demonstrated in the Examples, TTEQ (SEQ ID NO: 1) and TTE were
identified as regions prone to disorder in TDP-43. The residues TTE
and TTEQ (SEQ ID NO:1) emerged in computational predictions.
[0125] There are differences in the conformation occupied by the
native RRM1 and RRM1 biased to identify regions that may be exposed
in misfolded TDP-43. For example, Table 5 shows that E117 is more
exposed in the biased protein than in the native protein, and more
exposed still in the cyclic peptide cyclo(CGGTTEQGG) (SEQ ID NO:
2). In the native protein this residue participates in a salt
bridge with Lys 137 which is disrupted in the biased
configuration.
[0126] An aspect includes a compound comprising a TDP-43 peptide
comprising or consisting of TTEQ (SEQ ID NO: 1), a related epitope
and/or part of any of the foregoing such as TTE, wherein if the
peptide is TTEQ (SEQ ID NO: 1), the peptide is in a conformation
that is distinct in at least one feature from TTE and/or TTEQ (SEQ
ID NO: 1) in native TDP-43. In an embodiment, the TDP-43 peptide is
selected from TTE, TTEQ (SEQ ID NO: 1), KTTE, (SEQ ID NO: 10),
KTTEQ (SEQ ID NO:12), TEQ, TEQD (SEQ ID NO:8) or TTEQD (SEQ ID NO:
9). The TDP-43 peptides TTEQD (SEQ ID NO:9), TEQD (SEQ ID NO:8),
KTTEQ (SEQ ID NO:12), TTE, and TEQ can be used to raise antibodies
that are included in the epitopes collectively referred to herein
as TTEQ (SEQ ID NO: 1) and related epitopes. In an embodiment, the
related epitope comprises or consists of TTE, TEQD (SEQ ID NO: 8),
KTTE (SEQ ID NO: 10) and epitopes that comprise 1, 2 or 3 amino
acids in TDP-43 either N-terminal or C-terminal to TTE.
[0127] In some embodiments, the peptide, a conformational peptide,
comprising TTE, TEQ or TTEQ (SEQ ID NO: 1) can include 1, or 2
additional residues in TDP-43 N- and/or C-terminus of TTEQ (SEQ ID
NO: 1) for example TTEQD (SEQ ID NO:9) or KTTEQD (SEQ ID NO:7). For
example, the 3 amino acids N-terminal to TTEQ (SEQ ID NO:1) in
TDP-43 are PWK and the 3 amino acids C-terminal to TTEQ (SEQ ID
NO:1) are DLK. In an embodiment, the TDP-43 peptide is a maximum of
6 TDP-43 residues. In an embodiment, the TDP-43 peptide is a
maximum of 5 TDP-43 residues. In yet another embodiment, the TDP-43
peptide (e.g. in the compound such as a cyclic compound) is 4
TDP-43 residues, optionally TTEQ (SEQ ID NO: 1).
[0128] In an embodiment, the compound further includes a linker.
The linker comprises a spacer and/or one or more functionalizable
moieties. The linker can for example comprise 1, 2, 3, 4, 5, 6, 7,
8 or 9 amino acids and/or equivalently functioning molecules such
as polyethylene glycol (PEG) moieties, and/or a combination
thereof. In an embodiment, the spacer amino acids are selected from
non-immunogenic or poorly immunogenic amino acid residues such as G
and A, for example the spacer can be GGG, GAG, G(PEG)G, PEG-PEG
(also referred to as PEG2)-GG and the like. One or more
functionalizable moieties e.g. amino acids with a functional group
may be included for example for coupling the compound to an agent
or detectable tag or a carrier such as BSA or an immunogenicity
enhancing component such as KLH.
[0129] In an embodiment the linker comprises GC-PEG, PEG-GC, GCG or
PEG2-CG.
[0130] In an embodiment, the linker comprises 1, 2, 3, 4, 5, 6, 7,
8 or 9 amino acids.
[0131] In embodiments wherein the peptide comprising TTE or TTEQ
(SEQ ID NO: 1) includes 1, 2 or 3 additional residues found in
TDP-43 that are N- and/or C-terminal to TTEQ (SEQ ID NO: 1) the
linker in the cyclized compound is covalently linked to the N-
and/or C-termini of the TDP-43 residues (e.g. where the peptide is
KTTEQ (SEQ ID NO:12), the linker is covalently linked to K and Q
residues). Similarly, where the TDP-43 peptide is TTEQ (SEQ ID NO:
1), the linker is covalently linked to residues T and Q and where
the TDP-43 peptide is TTEQD (SEQ ID NO: 9), the linker is
covalently linked to residues T and D.
[0132] Proteinaceous portions of compounds (or the compound wherein
the linker is also proteinaceous) may be prepared by chemical
synthesis using techniques well known in the chemistry of proteins
such as solid phase synthesis or synthesis in homogenous
solution.
[0133] In an embodiment, the compound is a cyclic compound e.g the
TDP-43 peptide comprising TTE or TTEQ (SEQ ID NO: 1) is comprised
in a cyclic compound. Reference to the "cyclic peptide" herein can
refer to a fully proteinaceous compound (e.g. wherein the linker is
2, 3, 4, 5, 6, 7, 8 or 9 amino acids). It is understood that
properties described for the cyclic peptide determined in the
examples can be incorporated in other compounds (e.g. cyclic
compounds) comprising non-amino acid linker molecules.
[0134] An aspect therefore provides a cyclic compound comprising
peptide TTEQ (SEQ ID NO:1) (or a part thereof such as TTE) and a
linker, wherein the linker is covalently coupled directly or
indirectly to the peptide comprising TTE or TTEQ (SEQ ID NO:1),
optionally wherein at least the one of the T115, the T116, the
E117, and/or Q118 residues is in an alternate conformation than the
T, T, E, and Q residues in a native ensemble comprising TTEQ (SEQ
ID NO:1), as may be manifest in native TDP-43, and optionally
wherein at least T, T, E, and/or Q, is in either a more solvent
exposed conformation, or an alternative conformation, than the
conformation occupied in a native ensemble comprising TTEQ (SEQ ID
NO:1), as may be manifest for example in TDP-43 dimer.
[0135] In an embodiment, the cyclic compound comprises a TDP-43
peptide comprising TTE or TTEQ (SEQ ID NO:1) and up to 6 TDP-43
residues (e.g. 1 or 2 (or 3 in the case of TTE) amino acids N
and/or C terminus to TTE or TTEQ (SEQ ID NO:1)) and a linker,
wherein the linker is covalently coupled directly or indirectly to
the peptide N-terminus residue and the C-terminus residue of the
TDP-43 peptide and optionally wherein at least T115, T116, E or Q
is in an alternate conformation than T115, T116, E, or Q in the
native ensemble comprising TTEQ (SEQ ID NO: 1), and/or the
conformation of T115, T116, E, or Q in TTEQ (SEQ ID NO: 1) in the
native and optionally wherein at least T115, T116, E, or Q, has
more surface exposure than the conformation occupied in the native
ensemble comprising TTEQ (SEQ ID NO: 1).
[0136] The cyclic compound can be synthesized as a linear molecule
with the linker covalently attached to the N-terminus or C-terminus
of the peptide comprising the TDP-43 peptide, optionally TTEQ (SEQ
ID NO: 1) or related epitope, prior to cyclization. Alternatively
part of the linker is covalently attached to the N-terminus and
part is covalently attached to the C-terminus prior to cyclization.
In either case, the linear compound is cyclized for example in a
head to tail cyclization (e.g. amide bond cyclization).
[0137] In an embodiment the cyclic compound comprises a peptide
comprising or consisting of TTEQ (SEQ ID NO: 1) and a linker,
wherein the linker is coupled to the N- and C-termini of the
peptide (e.g. the T and the Q residues when the peptide consists of
TTEQ (SEQ ID NO: 1). In an embodiment, at least one of the T, E
and/or Q residues is in an alternate conformation in the cyclic
compound than occupied by at least one of the T, E and/or Q
residues in a native ensemble comprising TTEQ (SEQ ID NO: 1).
[0138] In an embodiment, at least one of the T, E, and/or Q
residues is in an alternate conformation in the cyclic compound
than occupied by a residue, optionally by T, E, and/or Q, in the
native ensemble.
[0139] In an embodiment, at least one of the T, E, and/or Q
residues is in an alternate conformation in the cyclic compound
than occupied by a residue in the native.
[0140] In an embodiment, the alternate conformation is a more
solvent-exposed conformation.
[0141] In an embodiment, at least T115, optionally alone or in
combination with T116, is in an alternate conformation than the
conformation occupied in a native ensemble comprising TTEQ (SEQ ID
NO: 1).
[0142] For example, the alternate conformation can include one or
more differing dihedral angles in residue T115, differing from the
dihedral angles in the native ensemble.
[0143] For example, the alternate conformation can include one or
more differing backbone dihedral angles (Ramachandran angles) in
residue T115, differing from the dihedral angles in the native
ensemble.
[0144] In an embodiment, the cyclic compound comprises a minimum
average side-chain/backbone dihedral angle difference between the
cyclic compound and native ensemble.
[0145] In an embodiment, the cyclic compound comprises a residue
selected from T, E, and Q, wherein one or more side-chain or
backbone dihedral angles are at least 30 degrees, at least 40
degrees, at least 50 degrees, at least 60 degrees, at least 70
degrees, at least 80 degrees, at least 90 degrees, at least 100
degrees, at least 110 degrees, at least 120 degrees, at least 130
degrees, at least 140 degrees, at least 150 degrees, at least 160
degrees or at least 170 degrees, different in the cyclic compound,
than the corresponding dihedral angle in the context of the native
ensemble.
[0146] As shown in FIGS. 2 and 3, several backbone and sidechain
dihedral angle distributions of T115 and T116 are substantially
different in the cyclic peptide ensemble compared to the native
ensemble. For example, Table 2A indicates that for simulated native
ensembles and cyclic peptides, the difference in the dihedral angle
C--CA-CB--OG1 of T115 is most likely about -160 degrees between
cyclic and native. In an embodiment, the cyclic compound comprises
a T residue comprising an C--CA-CB--OG1 dihedral angle that is at
least 30 degrees, at least 40 degrees, at least 50 degrees, at
least 60 degrees, at least 70 degrees, at least 80 degrees, at
least 90 degrees, at least 100 degrees, at least 110 degrees, at
least 120 degrees, at least 130 degrees, at least 140 degrees, at
least 150 degrees or at least 160 degrees than the corresponding
dihedral angle in the context of the native ensemble. Similarly,
the differences in dihedral angles between cyclic and native
ensembles for T116 dihedral N-CA-CB--OG1 is most likely about 150
degrees. Accordingly in an embodiment, the cyclic compound
comprises a T comprising a dihedral angle N--CA-CB--OG1 that is at
least 30 degrees different, at least 40 degrees different, at least
50 degrees different, at least 60 degrees different, at least 70
degrees different, at least 80 degrees different, at least 90
degrees different, at least 100 degrees different, and so on up to
at least 150 degrees different, than the corresponding dihedral
angle in the context of the linear compound. The corresponding
differences in most-likely dihedral angles between cyclic peptide
and native ensembles for T115 dihedral C--CA-N--HN is 50 degrees.
Accordingly in an embodiment, the cyclic compound comprises a T
comprising dihedral angle for C--CA-N--HN that is at least 30
degrees different, at least 40 degrees different or at least 50
degrees different, than the corresponding dihedral angle in the
context of the native ensemble. The corresponding differences in
most-likely dihedral angles between cyclic peptide and native
ensembles for T116 dihedral CB-CA-N--HN is -70 degrees. Accordingly
in an embodiment, the cyclic compound comprises a T comprising
dihedral angle for CB--CA-N--HN that is at least 30 degrees
different, at least 40 degrees different, at least 50 degrees
different, at least 60 degrees different or at least 70 degrees
different than the corresponding dihedral angle in the context of
either the native ensemble or the native. The above angle
differences can for example be positive or negative, (+) or
(-).
[0147] According to the peak values of Ramachandran angles given in
Table 4A, the most-likely Ramachandran .PHI. and .psi. values are
different between the cyclic and native ensembles for residues
T115, T116, E117, and Q118, as also presented in Table 4B. The
respective differences .DELTA..PHI. between the cyclic and native
peak .PHI. values are 50, -65, -40, and -35 degrees, and the
respective differences .DELTA..psi. between the .psi. values of the
cyclic and native peaks are -45, 30, 40, and 50 degrees. Overall
the .PHI., .psi. values are significantly different between cyclic
and native peptides. Table 3A gives the overlap of the
distributions of .PHI., .psi. values in the cyclic and native
ensembles. The average overlap of .PHI. and .psi. distributions for
T115, T116, E117, and Q118 is 28%, 63%, 55% and 23% respectively.
Together these numbers indicate different distributions of dihedral
angles for the cyclic and native ensembles.
[0148] In an embodiment, the cyclic compound comprises a Q
comprising an Ramachandran backbone angle that is at least 30
degrees, at least 40 degrees different, at least 50 degrees or at
least 60 degrees different than the corresponding Ramachandran
angle in the context of the native compound.
[0149] The angle difference can for example be positive or
negative, (+) or (-).
[0150] The alternate conformation can comprise an alternate
backbone orientation. For example, the backbone orientation that
the cyclic epitope exposes for an antibody differs compared to the
native form.
[0151] In an embodiment, T, T, E, Q, TT, TE, EQ, TTE, TEQ, and/or
TTEQ (SEQ ID NO: 1) are in an alternate conformation, for example
as compared to what is occupied by these residues in a
non-misfolded proteinic conformation, such as the native
ensemble.
[0152] The cyclic compound in some embodiments that comprises a
peptide comprising TTEQ (SEQ ID NO: 1), TTE or KTTE (SEQ ID NO:10)
can include 1, or 2 or more residues in TDP-43 upstream and/or
downstream of one of the foregoing, for example of TTEQ (SEQ ID NO:
1). In such cases the spacer is covalently linked to the N- and
C-termini of the ends of the corresponding residues of the TDP-43
sequence.
[0153] In an embodiment, the cyclic compound has a sequence
selected from any one of SEQ ID NOs: 2, 3, 22, 23, 28, 29, 30, 31,
32, 33, 34, 35 and 42 or any subset thereof. In an embodiment, the
cyclic compound comprises a sequence selected from any one of SEQ
ID NOs: 28, 29, 30, 31, 32, 33, 34 and 35. In another embodiment,
the cyclic compound comprises a sequence selected from SEQ ID NO:
2, 3, 22, 23 and 42. In yet other embodiments, the cyclic compound
comprises a sequence selected from any one of SEQ ID NOs: 29, 32
and 34. In yet other embodiments, the cyclic compound comprises a
sequence selected from any one of SEQ ID NOs: 2, 3, 22 and 23.
[0154] Methods for making cyclized peptides are known in the art
and include SS-cyclization or amide cyclization (head-to-tail, or
backbone cyclization). Methods are further described in in the
Example section. For example, a peptide with "C" residues at its N-
and C-termini, e.g. CGTTEQGC (SEQ ID NO: 13), can be reacted by
SS-cyclization to produce a cyclic peptide. As described in the
Examples, cyclic compounds were assessed for their relatedness to
the conformational epitopes identified. A cyclic compound
comprising TTEQ (SEQ ID NO: 1) or TTE TDP-43 peptide for example
may be used to raise antibodies selective for misfolded TDP-43.
[0155] The epitope TTEQ (SEQ ID NO: 1) and/or a part thereof, as
described herein may be a potential target in misfolded propagating
strains of TDP-43, and antibodies that recognize the conformational
epitope may for example be useful in detecting such propagating
strains.
[0156] Another aspect includes an immunogen comprising a compound
comprising a TTE, TTEQ (SEQ ID NO: 1) or related epitope,
optionally a cyclic compound described herein. In an embodiment,
the immunogen comprises an immunogenicity enhancing component such
as Keyhole Limpet Hemocyanin (KLH) and/or is formulated for
co-injection with an adjuvant (e.g. alum, monophosphoryl lipid A or
QS21). Other similar components are known in the art and additional
adjuvants are described below. The adjuvant is typically formulated
in a composition with the compound as is further described below.
The immunogenicity enhancing component can be coupled to the
compound either directly, such as through an amide bond, disulfide
bond, or indirectly through a chemical linker. In another
embodiment, the immunogen is a multi-antigenic peptide (MAP). For
example, the MAP can be synthesized by preparing a linear compound
to be cyclized, cyclizing the peptide, optionally using head to
tail cyclization and conjugating the cyclized peptide to a MAP
resin through an amino acid in the linker, optionally through a C
or D residue in the linker. MAPs have been constructed for cyclic
structures (see for example Misumi et al J. Virol. December 2001
vol. 75 no. 23 11614-11620) and similar methods to those described
therein can be used.
[0157] The immunogen with an immunogenicity enhancing component can
be produced by conjugating the cyclic compound containing the
constrained epitope peptide and a linker comprising a
functionalizable moiety such as cysteine to an immunogenicity
enhancing component such as Keyhole Limpet Hemocyanin (KLH) or a
carrier such bovine serum albumin (BSA) using for example the
method described in Lateef et al 2007, herein incorporated by
reference. In an embodiment, the method described in Example 3 is
used.
[0158] A further aspect is an isolated nucleic acid encoding the
proteinaceous portion of a compound or immunogen described
herein.
IV. Antibodies, Cells and Nucleic Acids
[0159] Accordingly, the compounds and particularly the cyclic
compounds comprising epitope TTEQ (SEQ ID NO: 1) or a related
epitope described above can be used to raise antibodies. Cyclic
compounds comprising TTEQ (SEQ ID NO: 1) or a related epitope for
example KTTE (SEQ ID NO:10), TTE, TEQ, TTEQD (SEQ ID NO:9), KTTEQD
(SEQ ID NO: 7), KTTEQDL (SEQ ID NO:14) and/or other related epitope
sequences described herein can be used to raise antibodies that
selectively bind misfolded TDP-43.
[0160] Accordingly, the compounds and particularly the cyclic
compounds described herein including for example those comprising
epitope or cyclic compound sequences listed in Table 11 can be used
to raise antibodies that specifically or selectively bind the
epitope in TDP-43 that they comprise and/or which recognize
specific conformations of these residues in misfolded TDP-43,
including one or more differential features described herein.
[0161] Accordingly, an aspect includes an antibody that
specifically or selectively bind an epitope on TDP-43, the epitope
comprising or consisting TTEQ (SEQ ID NO: 1), a related epitope
thereof or a part thereof or a conformational epitope of any of the
foregoing. In an embodiment, wherein when the epitope consists of
TTEQ (SEQ ID NO: 1) it is a conformational epitope.
[0162] In an embodiment the antibody is isolated.
[0163] In an embodiment, the antibody does not specifically bind
and/or is not selective for native TDP-43 e.g. wherein the
conformation of TTEQ (SEQ ID NO:1) or a related epitope such as TTE
is as present in native TDP-43. Selective binding can be measured
using an ELISA or surface plasmon resonance measurement, as
described herein.
[0164] Accordingly a further aspect is an antibody which
specifically or selectively binds an epitope present on TDP-43,
wherein the epitope comprises or consists of at least one amino
acid residue predominantly involved in binding to the antibody,
wherein at least one amino acid is T115, T116, E, or Q embedded
within the sequence TTEQ (SEQ ID NO:1), TEQ, or KTTE (SEQ ID
NO:10), optionally wherein the epitope when consisting of TTEQ (SEQ
ID NO:1) is a conformational epitope (e.g. selectively binds a
peptide in an alternate optionally solvent-exposed conformation
relative to the corresponding native ensemble, for example where at
least one amino acid of the epitope is more solvent-exposed). In an
embodiment, the epitope comprises or consists of at least two
consecutive amino acid residues predominantly involved in binding
to the antibody, wherein the at least two consecutive amino acids
are TE, or EQ embedded within TTEQ (SEQ ID NO:1), TTE or TEQ
[0165] In another embodiment, the epitope is a conformational
epitope and consists of TTEQ (SEQ ID NO:1), TTE or TEQ. In an
embodiment, the antibody selectively binds TTEQ (SEQ ID NO:1), TTE
or TEQ or other related epitope in a cyclic compound, optionally
cyclic peptide, optionally cyclo(CGTTEQG) (SEQ ID NO: 3) or a
cyclic peptide having a sequence of any one SEQ ID NOs: 2, 3, 22,
23, 28, 29, 30, 31, 32, 33, 34, 35 and 42, or any subset thereof,
relative to a corresponding linear peptide and/or a native
ensemble.
[0166] In an embodiment, the antibody specifically binds a cyclic
compound comprising an epitope peptide described herein comprising
at least one alternate conformational feature described herein
(e.g. of the epitope in a cyclic compound compared to a native
structural ensemble). For example an antibody that binds a
particular epitope conformation can be referred to as a
conformation specific antibody. The conformation specific antibody
can differentially recognize a particular misfolded TDP-43 species,
and can have a higher affinity for one species or group of species
compared to the native species.
[0167] For example, in an embodiment, the antibody specifically
binds a cyclic compound comprises a residue selected from T, E, and
Q, wherein at least one dihedral angle is at least 30 degrees, at
least 40 degrees, at least 50 degrees, at least 60 degrees, at
least 70 degrees, at least 80 degrees, at least 90 degrees, at
least 100 degrees, at least 110 degrees, at least 120 degrees, at
least 130 degrees, at least 140 degrees or at least 150 degrees
different in the cyclic compound, than the corresponding dihedral
angle in the context of the native structure.
[0168] In an embodiment, the antibody selectively binds a cyclic
compound comprising TTEQ (SEQ ID NO:1) or a part thereof,
optionally in the context of cyclo (CGGTTEQGG) (SEQ ID NO:2)
relative to a native ensemble comprising TTEQ (SEQ ID NO:1),
optionally in the context of linear cyclo (CGTTEQG) (SEQ ID NO: 3)
relative to a native ensemble comprising TTEQ (SEQ ID NO:1). For
example, in an embodiment the antibody selectively binds TTEQ (SEQ
ID NO:1) or TTE in a cyclic conformation and has at least 2 fold,
at least 3 fold, at least 5 fold, at least 8 fold, at least 10,
fold, at least 15 fold, at least 20 fold, at least 30 fold, at
least 40 fold, at least 50 fold, at least 100 fold, at least 500
fold or at least 1000 fold more selective greater selectivity (e.g.
binding affinity) for TTEQ (SEQ ID NO:1) or TTE in the cyclic
conformation compared to TTEQ (SEQ ID NO:1) or TTE in a native
ensemble, for example as measured by ELISA, immunohistochemistry or
surface plasmon resonance, optionally using a method described
herein.
[0169] In an embodiment, the cyclic compound selectively bound
and/or used to produce antibodies is a compound of Table 11. In
another embodiment, said cyclic compound is a cyclic compound
selected from SEQ ID NOs: 2, 3, 22, 23, 28, 29, 30, 31, 32, 33, 34,
35 and 42, or any subset thereof. In an embodiment, the cyclic
compound comprises a sequence selected from any one of SEQ ID NOs:
28, 29, 30, 31, 32, 33, 34 and 35. In another embodiment, the
cyclic compound comprises a sequence selected from SEQ ID NO: 2, 3,
22, 23 and 42. In yet other embodiments, the cyclic compound
comprises a sequence selected from any one of SEQ ID NOs: 29, 32
and 34. In yet other embodiments, the cyclic compound comprises a
sequence selected from any one of SEQ ID NOs: 2, 3, 22 and 23.
[0170] In an embodiment, the cyclic compound selectively bound is a
compound of Table 11. In an embodiment, the selectivity is at least
2 fold, at least 3 fold, at least 5 fold, at least 10 fold, at
least 20 fold, at least 30 fold, at least 40 fold, at least 50
fold, at least 100 fold, at least 500 fold or at least 1000 fold
more selective for the cyclic compound and/or Misfolded TDP-43
polypeptide over a species of TDP-43 selected from native
TDP-43.
[0171] In yet another aspect, the disclosure provides an antibody
that competes for selectively binds to a cyclic peptide having a
sequence selected from any one of SEQ ID NOs: 2, 3, 22, 23, 28, 29,
30, 31, 32, 33, 34, 35 and 42.
[0172] To produce monoclonal antibodies, antibody producing cells
(lymphocytes) can be harvested from a subject immunized with an
immunogen described herein, and fused with myeloma cells by
standard somatic cell fusion procedures thus immortalizing these
cells and yielding hybridoma cells. Such techniques are well known
in the art, (e.g. the hybridoma technique originally developed by
Kohler and Milstein (Nature 256:495-497 (1975)) as well as other
techniques such as the human B-cell hybridoma technique (Kozbor et
al., Immunol. Today 4:72 (1983)), the EBV-hybridoma technique to
produce human monoclonal antibodies (Cole et al., Methods Enzymol,
121: 140-67 (1986)), and screening of combinatorial antibody
libraries (Huse et al., Science 246:1275 (1989)). Hybridoma cells
can be screened immunochemically for production of antibodies
specifically reactive with the desired epitopes and the monoclonal
antibodies can be isolated.
[0173] Specific antibodies, or antibody fragments, reactive against
particular antigens or molecules, may also be generated by
screening expression libraries encoding immunoglobulin genes, or
portions thereof, expressed in bacteria with cell surface
components. For example, complete Fab fragments, VH regions and FV
regions can be expressed in bacteria using phage expression
libraries (see for example Ward et al., Nature 41:544-546 (1989);
Huse et al., Science 246:1275-1281 (1989); and McCafferty et al.,
Nature 348:552-554 (1990)).
[0174] The humanization of antibodies from non-human species has
been well described in the literature. See for example EP-B1 0
239400 and Carter & Merchant 1997 (Curr Opin Biotechnol 8,
449-454, 1997 incorporated by reference in their entirety herein).
Humanized antibodies are also readily obtained commercially (e.g.
Scotgen Limited, 2 Holly Road, Twickenham, Middlesex, Great
Britain).
[0175] Humanized forms of rodent antibodies are readily generated
by CDR grafting (Riechmann et al. Nature, 332:323-327, 1988). In
this approach the six CDR loops comprising the antigen binding site
of the rodent monoclonal antibody are linked to corresponding human
framework regions. CDR grafting often yields antibodies with
reduced affinity as the amino acids of the framework regions may
influence antigen recognition (Foote & Winter. J Mol Biol, 224:
487-499, 1992). To maintain the affinity of the antibody, it is
often necessary to replace certain framework residues by site
directed mutagenesis or other recombinant techniques and may be
aided by computer modeling of the antigen binding site (Co et al. J
Immunol, 152: 2968-2976, 1994).
[0176] Humanized forms of antibodies are optionally obtained by
resurfacing (Pedersen et al. J Mol Biol, 235: 959-973, 1994). In
this approach only the surface residues of a rodent antibody are
humanized.
[0177] Human antibodies specific to a particular antigen may be
identified by a phage display strategy (Jespers et al.
Bio/Technology, 12: 899-903, 1994). In one approach, the heavy
chain of a rodent antibody directed against a specific antigen is
cloned and paired with a repertoire of human light chains for
display as Fab fragments on filamentous phage. The phage is
selected by binding to antigen. The selected human light chain is
subsequently paired with a repertoire of human heavy chains for
display on phage, and the phage is again selected by binding to
antigen. The result is a human antibody Fab fragment specific to a
particular antigen. In another approach, libraries of phage are
produced where members display different human antibody fragments
(Fab or Fv) on their outer surfaces (Dower et al., WO 91/17271 and
McCafferty et al., WO 92/01047). Phage displaying antibodies with a
desired specificity are selected by affinity enrichment to a
specific antigen. The human Fab or Fv fragment identified from
either approach may be recloned for expression as a human antibody
in mammalian cells.
[0178] Human antibodies are optionally obtained from transgenic
animals (U.S. Pat. Nos. 6,150,584; 6,114,598; and 5,770,429). In
this approach the heavy chain joining region (JH) gene in a
chimeric or germ-line mutant mouse is deleted. Human germ-line
immunoglobulin gene array is subsequently transferred to such
mutant mice. The resulting transgenic mouse is then capable of
generating a full repertoire of human antibodies upon antigen
challenge.
[0179] Humanized or human antibodies are selected from any class of
immunoglobulins including: IgM, IgG, IgD, IgA or IgE; and any
isotype, including: IgG1, IgG2, IgG3 and IgG4. The humanized or
human antibody may include sequences from one or more than one
isotype or class. Further, these antibodies are typically produced
as antigen binding fragments such as Fab, Fab' F(ab')2, Fd, Fv and
single domain antibody fragments, or as single chain antibodies in
which the heavy and light chains are linked by a spacer. Also, the
human or humanized antibodies may exist in monomeric or polymeric
form. The humanized antibody optionally comprises one non-human
chain and one humanized chain (i.e. one humanized heavy or light
chain).
[0180] Additionally, antibodies specific for the epitopes described
herein are readily isolated by screening antibody phage display
libraries. For example, an antibody phage library is optionally
screened by using a disease specific epitope of the current
invention to identify antibody fragments specific for the disease
specific epitope. Antibody fragments identified are optionally used
to produce a variety of recombinant antibodies that are useful with
different embodiments of the present invention. Antibody phage
display libraries are commercially available, for example, through
Xoma (Berkeley, Calif.) Methods for screening antibody phage
libraries are well known in the art.
[0181] As indicated below, several antibodies that were positive
for detecting misfolded, disease-associated TDP-43 in transfected
cells or ALS spinal cord homogenates were sequenced.
[0182] Accordingly, in another embodiment, the antibody described
herein comprises a light chain variable region and a heavy chain
variable region, optionally fused, the heavy chain variable region
comprising complementarity determining regions CDR-H1, CDR-H2 and
CDR-H3, the light chain variable region comprising complementarity
determining region CDR-L1, CDR-L2 and CDR-L3 and with the amino
acid sequences of said CDRs comprising the sequences:
TABLE-US-00002 CDR-H1: SEQ ID NO: 67 GYTFTDYS; CDR-H2: SEQ ID NO:
68 INTETGEP; CDR-H3: SEQ ID NO: 69 ASRRWYPYYFDY; CDR-L1: SEQ ID NO:
70 TGAVTTSNY; CDR-L2: SEQ ID NO: 71 GPN; and CDR-L3: SEQ ID NO: 72
ALWYSNHWV.
[0183] In another embodiment, the antibody described herein
comprises a light chain variable region and a heavy chain variable
region, optionally fused, the heavy chain variable region
comprising complementarity determining regions CDR-H1, CDR-H2 and
CDR-H3, the light chain variable region comprising complementarity
determining region CDR-L1, CDR-L2 and CDR-L3 and with the amino
acid sequences of said CDRs comprising the sequences:
TABLE-US-00003 CDR-H1: SEQ ID NO: 73 GFTFSDYY; CDR-H2: SEQ ID NO:
74 ISNGGGST; CDR-H3: SEQ ID NO: 75 AREGGTAWFAY; CDR-L1: SEQ ID NO:
76 QSIVHSNGNTY; CDR-L2: SEQ ID NO: 77 KVS; and CDR-L3: SEQ ID NO:
78 FQGSHVPYT.
[0184] In another embodiment, the antibody described herein
comprises a light chain variable region and a heavy chain variable
region, optionally fused, the heavy chain variable region
comprising complementarity determining regions CDR-H1, CDR-H2 and
CDR-H3, the light chain variable region comprising complementarity
determining region CDR-L1, CDR-L2 and CDR-L3 and with the amino
acid sequences of said CDRs comprising the sequences:
TABLE-US-00004 CDR-H1: SEQ ID NO: 73 GFTFSDYY; CDR-H2: SEQ ID NO:
79 ISDGGSYT; CDR-H3: SEQ ID NO: 80 ARDYYGSSSYTSGFAY; CDR-L1: SEQ ID
NO: 76 QSIVHSNGNTY; CDR-L2: SEQ ID NO: 77 KVS; and CDR-L3: SEQ ID
NO: 81 FQGSHVPGT.
[0185] In another embodiment, the antibody described herein
comprises a light chain variable region and a heavy chain variable
region, optionally fused, the heavy chain variable region
comprising complementarity determining regions CDR-H1, CDR-H2 and
CDR-H3, the light chain variable region comprising complementarity
determining region CDR-L1, CDR-L2 and CDR-L3 and with the amino
acid sequences of said CDRs comprising the sequences:
TABLE-US-00005 CDR-H1: SEQ ID NO: 67 GYTFTDYS; CDR-H2: SEQ ID NO:
68 INTETGEP; CDR-H3: SEQ ID NO: 82 ARGYGNWFAY; CDR-L1: SEQ ID NO:
83 SSVSSSY; CDR-L2: SEQ ID NO: 84 STS; and CDR-L3: SEQ ID NO: 85
HQYHRSPLT.
[0186] In yet another embodiment, the antibody described herein
comprises a light chain variable region and a heavy chain variable
region, optionally fused, the heavy chain variable region
comprising complementarity determining regions CDR-H1, CDR-H2 and
CDR-H3, the light chain variable region comprising complementarity
determining region CDR-L1, CDR-L2 and CDR-L3 and with the amino
acid sequences of said CDRs comprising the sequences:
TABLE-US-00006 CDR-H1: SEQ ID NO: 86 GFTFSDFY; CDR-H2: SEQ ID NO:
87 SRSKAHDYTT; and CDR-H3: SEQ ID NO: 88 ARDTWYGSWFAY; CDR-L1: SEQ
ID NO: 76 QSIVHSNGNTY; CDR-L2: SEQ ID NO: 77 KVS; and CDR-L3: SEQ
ID NO: 92 FQGSHVPPT.
[0187] In yet another embodiment, the antibody described herein
comprises a light chain variable region and a heavy chain variable
region, optionally fused, the heavy chain variable region
comprising complementarity determining regions CDR-H1, CDR-H2 and
CDR-H3, the light chain variable region comprising complementarity
determining region CDR-L1, CDR-L2 and CDR-L3 and with the amino
acid sequences of said CDRs comprising the sequences:
TABLE-US-00007 CDR-H1: SEQ ID NO: 89 GYAFTNYL; CDR-H2: SEQ ID NO:
90 INPGSGGT; and CDR-H3: SEQ ID NO: 91 ARWGGNYSGYAMDY; CDR-L1: SEQ
ID NO: 76 QSIVHSNGNTY; CDR-L2: SEQ ID NO: 77 KVS; and CDR-L3: SEQ
ID NO: 92 FQGSHVPPT.
[0188] As shown in FIGS. 13A and B, the CDRS share structural
similarity. In particular, the light chain sequences of several
clones are similar.
[0189] In an embodiment, the antibody is a monoclonal antibody. In
an embodiment, the antibody is a chimeric antibody such as a
humanized antibody comprising the CDR sequences as recited in Table
10.
[0190] Also provided in another embodiment, is an antibody
comprising the CDRs in Table 10 and a light chain variable region
and a heavy chain variable region, optionally in the context of a
single chain antibody.
[0191] In yet another aspect, the antibody comprises a heavy chain
variable region comprises: i) an amino acid sequence as set forth
in SEQ ID NO: 46; ii) an amino acid sequence with at least 50%, at
least 60%, at least 70%, at least 80% or at least 90% sequence
identity to SEQ ID NO: 46, wherein the CDR sequences are as set
forth in SEQ ID NO: 67, 68 and 69, or iii) a conservatively
substituted amino acid sequence i). In another aspect the antibody
comprises a light chain variable region comprising i) an amino acid
sequence as set forth in SEQ ID NO: 48, ii) an amino acid sequence
with at least 50%, at least 60%, at least 70%, at least 80% or at
least 90% sequence identity to SEQ ID NO: 48 wherein the CDR
sequences are as set forth in SEQ ID NO: 70, 71 and 72, or iii) a
conservatively substituted amino acid sequence of i). In another
embodiment, the heavy chain variable region amino acid sequence is
encoded by a nucleotide sequence as set out in SEQ ID NO: 45 or a
codon degenerate or optimized version thereof. In another
embodiment, the antibody comprises a light chain variable region
amino acid sequence encoded by a nucleotide sequence as set out in
SEQ ID NO: 47 or a codon degenerate or optimized version thereof.
In an embodiment, the heavy chain variable region comprises an
amino acid sequence as set forth in SEQ ID NO: 46. In an
embodiment, the light chain variable region comprises an amino acid
sequence as set forth in SEQ ID NO: 48.
[0192] In yet another aspect, the antibody comprises a heavy chain
variable region comprises: i) an amino acid sequence as set forth
in SEQ ID NO: 50; ii) an amino acid sequence with at least 50%, at
least 60%, at least 70%, at least 80% or at least 90% sequence
identity to SEQ ID NO: 50, wherein the CDR sequences are as set
forth in SEQ ID NO: 73, 74 and 75, or iii) a conservatively
substituted amino acid sequence i). In another aspect the antibody
comprises a light chain variable region comprising i) an amino acid
sequence as set forth in SEQ ID NO: 52, ii) an amino acid sequence
with at least 50%, at least 60%, at least 70%, at least 80% or at
least 90% sequence identity to SEQ ID NO: 52 wherein the CDR
sequences are as set forth in SEQ ID NO: 76, 77 and 78, or iii) a
conservatively substituted amino acid sequence of i). In another
embodiment, the heavy chain variable region amino acid sequence is
encoded by a nucleotide sequence as set out in SEQ ID NO: 49 or a
codon degenerate or optimized version thereof. In another
embodiment, the antibody comprises a light chain variable region
amino acid sequence encoded by a nucleotide sequence as set out in
SEQ ID NO: 51 or a codon degenerate or optimized version thereof.
In an embodiment, the heavy chain variable region comprises an
amino acid sequence as set forth in SEQ ID NO: 50. In an
embodiment, the light chain variable region comprises an amino acid
sequence as set forth in SEQ ID NO: 52.
[0193] In yet another aspect, the antibody comprises a heavy chain
variable region comprises: i) an amino acid sequence as set forth
in SEQ ID NO: 54; ii) an amino acid sequence with at least 50%, at
least 60%, at least 70%, at least 80% or at least 90% sequence
identity to SEQ ID NO: 54, wherein the CDR sequences are as set
forth in SEQ ID NO: 73, 79 and 80, or iii) a conservatively
substituted amino acid sequence i). In another aspect the antibody
comprises a light chain variable region comprising i) an amino acid
sequence as set forth in SEQ ID NO: 56, ii) an amino acid sequence
with at least 50%, at least 60%, at least 70%, at least 80% or at
least 90% sequence identity to SEQ ID NO: 56 wherein the CDR
sequences are as set forth in SEQ ID NO: 76, 77 and 81, or iii) a
conservatively substituted amino acid sequence of i). In another
embodiment, the heavy chain variable region amino acid sequence is
encoded by a nucleotide sequence as set out in SEQ ID NO: 53 or a
codon degenerate or optimized version thereof. In another
embodiment, the antibody comprises a light chain variable region
amino acid sequence encoded by a nucleotide sequence as set out in
SEQ ID NO: 55 or a codon degenerate or optimized version thereof.
In an embodiment, the heavy chain variable region comprises an
amino acid sequence as set forth in SEQ ID NO: 54. In an
embodiment, the light chain variable region comprises an amino acid
sequence as set forth in SEQ ID NO: 56.
[0194] In yet another aspect, the antibody comprises a heavy chain
variable region comprises: i) an amino acid sequence as set forth
in SEQ ID NO: 58; ii) an amino acid sequence with at least 50%, at
least 60%, at least 70%, at least 80% or at least 90% sequence
identity to SEQ ID NO: 58, wherein the CDR sequences are as set
forth in SEQ ID NO: 67, 68 and 82, or iii) a conservatively
substituted amino acid sequence i). In another aspect the antibody
comprises a light chain variable region comprising i) an amino acid
sequence as set forth in SEQ ID NO: 60, ii) an amino acid sequence
with at least 50%, at least 60%, at least 70%, at least 80% or at
least 90% sequence identity to SEQ ID NO: 60 wherein the CDR
sequences are as set forth in SEQ ID NO: 83, 84 and 85, or iii) a
conservatively substituted amino acid sequence of i). In another
embodiment, the heavy chain variable region amino acid sequence is
encoded by a nucleotide sequence as set out in SEQ ID NO: 57 or a
codon degenerate or optimized version thereof. In another
embodiment, the antibody comprises a light chain variable region
amino acid sequence encoded by a nucleotide sequence as set out in
SEQ ID NO: 59 or a codon degenerate or optimized version thereof.
In an embodiment, the heavy chain variable region comprises an
amino acid sequence as set forth in SEQ ID NO: 58. In an
embodiment, the light chain variable region comprises an amino acid
sequence as set forth in SEQ ID NO: 60.
[0195] In yet another aspect, the antibody comprises a heavy chain
variable region comprises: i) an amino acid sequence as set forth
in SEQ ID NO: 62; ii) an amino acid sequence with at least 50%, at
least 60%, at least 70%, at least 80% or at least 90% sequence
identity to SEQ ID NO: 62, wherein the CDR sequences are as set
forth in SEQ ID NO: 86, 87 and 88, or iii) a conservatively
substituted amino acid sequence i). In another aspect the antibody
comprises a light chain variable region comprising i) an amino acid
sequence as set forth in SEQ ID NO: 64, ii) an amino acid sequence
with at least 50%, at least 60%, at least 70%, at least 80% or at
least 90% sequence identity to SEQ ID NO: 64 wherein the CDR
sequences are as set forth in SEQ ID NO: 76, 77 and 92, or iii) a
conservatively substituted amino acid sequence of i). In another
embodiment, the heavy chain variable region amino acid sequence is
encoded by a nucleotide sequence as set out in SEQ ID NO: 61 or a
codon degenerate or optimized version thereof. In another
embodiment, the antibody comprises a light chain variable region
amino acid sequence encoded by a nucleotide sequence as set out in
SEQ ID NO: 63 or a codon degenerate or optimized version thereof.
In an embodiment, the heavy chain variable region comprises an
amino acid sequence as set forth in SEQ ID NO: 62. In an
embodiment, the light chain variable region comprises an amino acid
sequence as set forth in SEQ ID NO: 64.
[0196] In yet another aspect, the antibody comprises a heavy chain
variable region comprises: i) an amino acid sequence as set forth
in SEQ ID NO: 66; ii) an amino acid sequence with at least 50%, at
least 60%, at least 70%, at least 80% or at least 90% sequence
identity to SEQ ID NO: 66, wherein the CDR sequences are as set
forth in SEQ ID NO: 89, 90 and 91, or iii) a conservatively
substituted amino acid sequence i). In another aspect the antibody
comprises a light chain variable region comprising i) an amino acid
sequence as set forth in SEQ ID NO: 64, ii) an amino acid sequence
with at least 50%, at least 60%, at least 70%, at least 80% or at
least 90% sequence identity to SEQ ID NO: 64 wherein the CDR
sequences are as set forth in SEQ ID NO: 76, 77 and 92, or iii) a
conservatively substituted amino acid sequence of i). In another
embodiment, the heavy chain variable region amino acid sequence is
encoded by a nucleotide sequence as set out in SEQ ID NO: 65 or a
codon degenerate or optimized version thereof. In another
embodiment, the antibody comprises a light chain variable region
amino acid sequence encoded by a nucleotide sequence as set out in
SEQ ID NO: 63 or a codon degenerate or optimized version thereof.
In an embodiment, the heavy chain variable region comprises an
amino acid sequence as set forth in SEQ ID NO: 66. In an
embodiment, the light chain variable region comprises an amino acid
sequence as set forth in SEQ ID NO: 64.
[0197] Another aspect is an antibody that specifically binds a same
epitope as the antibody with CDR sequences as recited in Table
10.
[0198] Another aspect includes an antibody that competes for
binding to a cyclic compound described herein and/or to human
misfolded TDP43 with an antibody described herein such as an
antibody comprising the CDR sequences as recited in Table 10.
[0199] Competition between antibodies can be determined for example
using an assay in which an antibody under test is assessed for its
ability to inhibit specific binding of a reference antibody to the
common antigen. A test antibody competes with a reference antibody
if an excess of a test antibody (e.g., at least a 2 fold, 5, fold,
10 fold or 20 fold) inhibits binding of the reference antibody by
at least 50%, at least 75%, at least 80%, at least 90% or at least
95% as measured in a competitive binding assay.
[0200] A further aspect is an antibody conjugated to a detectable
label. In an embodiment, the detectable label is a
positron-emitting radionuclide. A positron-emitting radionuclide
can be used for example in PET imaging. In an embodiment, the
antibody is conjugated to a transport moiety that permits transport
across the blood brain barrier and/or into a cell. For example the
antibody can be covalently linked to the iron-transport protein
melanotransferrin (p97) or fused to antibody fragments specific for
BBB receptors such as the transferrin receptor, insulin receptor,
lipoprotein receptor, basigin, Glut1 or CD98hc. Another example is
fusion to the BBB-permeable single domain antibody FC5 or single
domain antibodies directed against other BBB surface receptors. In
an embodiment, the antibody is conjugated to a transport moiety
that facilitates entry into a cell for diagnostic detection of
intracellular aggregated TDP43. For example, the antibody can be
chemically linked or recombinantly fused to cell-penetrating
peptides such as trans-activating transcriptional activator (TAT)
and TAT derivatives, penetratin or transportan, and the like.
[0201] A further aspect relates to an antibody complex comprising
an antibody described herein and/or a binding fragment thereof and
misfolded TDP-43. A further aspect is an isolated nucleic acid
encoding an antibody or part thereof described herein.
[0202] Nucleic acids encoding a heavy chain or a light chain are
also provided, for example encoding a heavy chain comprising
CDR-H1, CDR-H2 and/or CDR-H3 regions described herein or encoding a
light chain comprising CDR-L1, CDR-L2 and/or CDR-L3 regions
described herein.
[0203] The present disclosure also provides variants of the nucleic
acid sequences that encode for the antibody and/or binding fragment
thereof disclosed herein. For example, the variants include
nucleotide sequences that hybridize to the nucleic acid sequences
encoding the antibody and/or binding fragment thereof disclosed
herein under at least moderately stringent hybridization conditions
or codon degenerate or optimized sequences In another embodiment,
the variant nucleic acid sequences have at least 50%, at least 60%,
at least 70%, most preferably at least 80%, even more preferably at
least 90% and even most preferably at least 95% sequence identity
to nucleic acid sequences encoding any one of SEQ ID NOs: 45, 47,
49, 51, 53, 55, 57, 59, 61, 63 and 65.
[0204] Another aspect is an expression cassette or vector
comprising the nucleic acid herein disclosed. In an embodiment, the
vector is an isolated vector.
[0205] The vector can be any vector, including vectors suitable for
producing an antibody and/or binding fragment thereof or expressing
a peptide sequence described herein.
[0206] The nucleic acid molecules may be incorporated in a known
manner into an appropriate expression vector which ensures
expression of the protein. Possible expression vectors include but
are not limited to cosmids, plasmids, or modified viruses (e.g.
replication defective retroviruses, adenoviruses and
adeno-associated viruses). The vector should be compatible with the
host cell used. The expression vectors are "suitable for
transformation of a host cell", which means that the expression
vectors contain a nucleic acid molecule encoding the peptides
corresponding to epitopes or antibodies described herein.
[0207] In an embodiment, the vector is suitable for expressing for
example single chain antibodies by gene therapy. The vector can be
adapted for specific expression in neural tissue, for example using
neural specific promoters and the like. In an embodiment, the
vector comprises an IRES and allows for expression of a light chain
variable region and a heavy chain variable region. Such vectors can
be used to deliver antibody in vivo.
[0208] Suitable regulatory sequences may be derived from a variety
of sources, including bacterial, fungal, viral, mammalian, or
insect genes.
[0209] Examples of such regulatory sequences include: a
transcriptional promoter and enhancer or RNA polymerase binding
sequence, a ribosomal binding sequence, including a translation
initiation signal. Additionally, depending on the host cell chosen
and the vector employed, other sequences, such as an origin of
replication, additional DNA restriction sites, enhancers, and
sequences conferring inducibility of transcription may be
incorporated into the expression vector.
[0210] In an embodiment, the regulatory sequences direct or
increase expression in neural tissue and/or cells.
[0211] In an embodiment, the vector is a viral vector.
[0212] The recombinant expression vectors may also contain a marker
gene which facilitates the selection of host cells transformed,
infected or transfected with a vector for expressing an antibody or
epitope peptide described herein.
[0213] The recombinant expression vectors may also contain
expression cassettes which encode a fusion moiety (i.e. a "fusion
protein") which provides increased expression or stability of the
recombinant peptide; increased solubility of the recombinant
peptide; and aid in the purification of the target recombinant
peptide by acting as a ligand in affinity purification, including
for example tags and labels described herein. Further, a
proteolytic cleavage site may be added to the target recombinant
protein to allow separation of the recombinant protein from the
fusion moiety subsequent to purification of the fusion protein.
Typical fusion expression vectors include pGEX (Amrad Corp.,
Melbourne, Australia), pMAL (New England Biolabs, Beverly, Mass.)
and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione
S-transferase (GST), maltose E binding protein, or protein A,
respectively, to the recombinant protein.
[0214] Systems for the transfer of genes for example into neurons
and neural tissue both in vitro and in vivo include vectors based
on viruses, most notably Herpes Simplex Virus, Adenovirus,
Adeno-associated virus (AAV) and retroviruses including
lentiviruses. Alternative approaches for gene delivery include the
use of naked, plasmid DNA as well as liposome-DNA complexes.
Another approach is the use of AAV plasmids in which the DNA is
polycation-condensed and lipid entrapped and introduced into the
brain by intracerebral gene delivery (Leone et al. US Application
No. 2002076394).
[0215] Accordingly, in another aspect, the compounds, immunogens,
nucleic acids, vectors and antibodies described herein may be
formulated in vesicles such as liposomes, nanoparticles, and viral
protein particles, for example for delivery of antibodies,
compounds, immunogens and nucleic acids described herein. In
particular synthetic polymer vesicles, including polymersomes, can
be used to administer antibodies.
[0216] Also provided in another aspect is a cell expressing an
antibody or part thereof described herein. In an embodiment, the
cell is an isolated and/or recombinant cell, expressing an antibody
described herein or comprising a vector herein disclosed. In an
embodiment, the cell is a fused cell such as a hybridoma.
[0217] The recombinant cell can be generated using any cell
suitable for producing a polypeptide, for example suitable for
producing an antibody and/or binding fragment thereof. For example
to introduce a nucleic acid (e.g. a vector) into a cell, the cell
may be transfected, transformed or infected, depending upon the
vector employed.
[0218] Suitable host cells include a wide variety of prokaryotic
and eukaryotic host cells. For example, the proteins described
herein may be expressed in bacterial cells such as E. coli, insect
cells (using baculovirus), yeast cells or mammalian cells.
[0219] In an embodiment, the cell is a eukaryotic cell selected
from a yeast, plant, worm, insect, avian, fish, reptile and
mammalian cell.
[0220] In another embodiment, the mammalian cell is a myeloma cell,
a spleen cell, or a hybridoma cell.
[0221] In an embodiment, the cell is a neural cell.
[0222] Yeast and fungi host cells suitable for expressing an
antibody or peptide include, but are not limited to Saccharomyces
cerevisiae, Schizosaccharomyces pombe, the genera Pichia or
Kluyveromyces and various species of the genus Aspergillus.
Examples of vectors for expression in yeast S. cerivisiae include
pYepSec1, pMFa, pJRY88, and pYES2 (Invitrogen Corporation, San
Diego, Calif.). Protocols for the transformation of yeast and fungi
are well known to those of ordinary skill in the art.
[0223] Mammalian cells that may be suitable include, among others:
COS (e.g., ATCC No. CRL 1650 or 1651), BHK (e.g. ATCC No. CRL
6281), CHO (ATCC No. CCL 61), HeLa (e.g., ATCC No. CCL 2), 293
(ATCC No. 1573) and NS-1 cells. Suitable expression vectors for
directing expression in mammalian cells generally include a
promoter (e.g., derived from viral material such as polyoma,
Adenovirus 2, cytomegalovirus and Simian Virus 40), as well as
other transcriptional and translational control sequences. Examples
of mammalian expression vectors include pCDM8 and pMT2PC.
[0224] In an embodiment, the cell is a fused cell such as a
hybridoma cell, the hybridoma cell producing an antibody specific
and/or selective for an epitope or epitope sequence described
herein, including for example that selectively binds TDP-43
pathological oligomers over TDP43 native structures, selectively
binds an epitope sequence presented in a cyclic compound relative
to a linear compound or lacks or has negligible plaque binding.
[0225] A further aspect is a hybridoma cell line producing an
antibody specific for an epitope described herein.
V. Compositions
[0226] A further aspect is a composition comprising a compound,
immunogen, nucleic acid, vector or antibody described herein.
[0227] In an embodiment, the composition comprises a diluent.
[0228] Suitable diluents for nucleic acids include but are not
limited to water, saline solutions and ethanol.
[0229] Suitable diluents for polypeptides, including antibodies or
fragments thereof and/or cells include but are not limited to
saline solutions, pH buffered solutions and glycerol solutions or
other solutions suitable for freezing polypeptides and/or
cells.
[0230] In an embodiment comprising a compound or immunogen
described herein, the composition comprises an adjuvant.
[0231] In an embodiment, the adjuvant is selected from. alum,
monophosphoryl lipid A and QS21.
[0232] Adjuvants that can be used for example, include Intrinsic
adjuvants (such as lipopolysaccharides) normally are the components
of killed or attenuated bacteria used as vaccines. Extrinsic
adjuvants are immunomodulators which are typically non-covalently
linked to antigens and are formulated to enhance the host immune
responses. Aluminum hydroxide, aluminum sulfate and aluminum
phosphate (collectively commonly referred to as alum) are routinely
used as adjuvants. A wide range of extrinsic adjuvants can provoke
potent immune responses to immunogens. These include saponins such
as Stimulons (QS21, Aquila, Worcester, Mass.) or particles
generated therefrom such as ISCOMs and (immunostimulating
complexes) and ISCOMATRIX, complexed to membrane protein antigens
(immune stimulating complexes), pluronic polymers with mineral oil,
killed mycobacteria and mineral oil, Freund's complete adjuvant,
bacterial products such as muramyl dipeptide (MDP) and
lipopolysaccharide (LPS), as well as lipid A, and liposomes.
[0233] In an embodiment, the adjuvant is aluminum hydroxide. In
another embodiment, the adjuvant is aluminum phosphate. Oil in
water emulsions include squalene; peanut oil; MF59 (WO 90/14387);
SAF (Syntex Laboratories, Palo Alto, Calif.); and Ribi.TM. (Ribi
Immunochem, Hamilton, Mont.). Oil in water emulsions may be used
with immunostimulating agents such as muramyl peptides (for
example, N-acetylmuramyl-L-threonyl-D-isoglutamine (thr-MDP),
-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP),
N-acetylmuramyl-L-alanyl-D-isoglutamyl-L-alanine-2-(1'-2'dipalmitoyl-sn-g-
lycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE),
N-acetylglucsaminyl-N-acetylmuramyl-L-Al-D-isoglu-L-Ala-dipalmitoxy
propylamide (DTP-DPP) theramide (TM)), or other bacterial cell wall
components.
[0234] The adjuvant may be administered with an immunogen as a
single composition.
[0235] Alternatively, an adjuvant may be administered before,
concurrent and/or after administration of the immunogen.
[0236] In an embodiment, the composition comprises an antibody or
part thereof described herein. In another embodiment, the
composition comprises an antibody or part thereof described herein
and a diluent. In an embodiment, the composition is a sterile
composition.
[0237] In an embodiment, the composition is for a method described
herein such as detecting misfolded TDP-43.
VI. Kits
[0238] A further aspect relates to a kit comprising i) an antibody
and/or binding fragment thereof, ii) a nucleic acid, iii) peptide
or immunogen, iv) composition or v) recombinant cell described
herein, comprised in a vial such as a sterile vial or other housing
and optionally a reference agent and/or instructions for use
thereof.
[0239] In an embodiment, the kit is an ELISA.
[0240] In an embodiment, the kit comprises an antibody or binding
fragment described herein contained in a container such as a
sterile vial.
VII. Methods
[0241] Included are methods for making the compounds, immunogens
and antibodies described herein.
[0242] In particular, provided are methods of making an antibody
selective for a conformational epitope of TTEQ (SEQ ID NO:1) or
related epitope. In an embodiment, the method comprises
administering an immunogen described herein to a subject and
isolating antibodies that selectively bind the TDP-43 peptide of
the immunogen and/or misfolded TDP-43.
[0243] A further aspect provides a method of detecting whether a
sample comprises misfolded TDP-43, for example misfolded TDP-43
comprising TTE, TTEQ (SEQ ID NO:1) or related conformational
epitope and/or wherein at least one of the residues T115, T116, E,
or Q is in an alternate conformation than occupied by T, E, and/or
Q in a non-misfolded proteinic conformation.
[0244] In an embodiment, the method comprises:
[0245] a. contacting the sample with the antibody described herein
under conditions permissive to produce an antibody:misfolded TDP-43
polypeptide complex; and
[0246] b. detecting the presence of any complex;
[0247] wherein the presence of detectable complex is indicative
that the sample may contain misfolded TDP-43 polypeptide.
[0248] In another embodiment, the method comprises:
[0249] (a) contacting a test sample of said subject with an
antibody described herein, under conditions permissive to produce
an antibody-antigen complex;
[0250] (b) measuring the amount of the antibody-antigen complex in
the test sample; and
[0251] (c) comparing the amount of antibody-antigen complex in the
test sample to a control;
wherein detecting antibody-antigen complex in the test sample as
compared to the control indicates that the sample comprises TDP-43
comprising TTEQ (SEQ ID NO:1) or related epitope such as TTE (e.g.
misfolded TDP-43).
[0252] In an embodiment, the sample is a biological sample. In an
embodiment, the sample comprises brain tissue, spinal cord tissue
or an extract thereof and/or CSF. In an embodiment, the sample is
obtained from a human subject.
[0253] In an embodiment, the sample is from a subject with ALS. In
another embodiment, the sample is from a subject with FTD.
[0254] A number of methods can be used to determine if misfolded
TDP-43 polypeptides is present in a sample using the antibodies
described herein, including immunoassays such as flow cytometry,
dot or slot blots, Western blots, ELISA, and immunoprecipitation
followed by SDS-PAGE immunocytochemistry. In an embodiment, the
method used comprises one or more of the steps described in Example
7, 8 or 10.
[0255] Surface plasmon resonance can be used to assess conformation
specific binding.
[0256] A labelled antibody described herein can also be
administered to a subject detect location of misfolded TDP-43.
[0257] A further aspect includes a method of inducing an immune
response in a subject, comprising administering to the subject a
compound, immunogen and/or composition comprising a compound
described herein; and optionally isolating cells and/or antibodies
that specifically bind the compound or immunogen administered. The
above disclosure generally describes the present application. A
more complete understanding can be obtained by reference to the
following specific examples. These examples are described solely
for the purpose of illustration and are not intended to limit the
scope of the application. Changes in form and substitution of
equivalents are contemplated as circumstances might suggest or
render expedient. Although specific terms have been employed
herein, such terms are intended in a descriptive sense and not for
purposes of limitation.
[0258] The following non-limiting examples are illustrative of the
present disclosure:
EXAMPLES
Example 1
TDP-43 Epitope Predictions
[0259] Although most ALS/FTD mutations are in the C-terminus, the
effects of mutation can lead to pathological aggregates of TDP-43,
and these multimeric aggregates can induce the disorder of the
structured domains. Accordingly, the RRM1 domain was assessed for
the presence of conformation specific epitopes present in misfolded
TDP-43.
[0260] Putative misfolded epitopes in TDP-43 were predicted with
the aid of a method referred to as "Collective Coordinates biasing"
which is described in WO/2017/079836, SYSTEMS AND METHODS FOR
PREDICTING MISFOLDED PROTEIN EPITOPES BY COLLECTIVE COORDINATE
BIASING filed Nov. 9, 2016. As described therein, the method uses
molecular-dynamics-based simulations which impose a global
coordinate bias on a protein (or peptide-aggregate) to force the
protein (or peptide-aggregate) to misfold and then predict the most
likely unfolded regions of the partially unstructured protein (or
peptide aggregate). Biasing simulations were performed and the
solvent accessible surface area (SASA) corresponding to each
residue index (compared to that of the initial structure of the
protein under consideration). SASA represents a surface area that
is accessible to H.sub.2O. A positive change in SASA (compared to
that of the initial structure of the protein under consideration)
may be considered to be indicative of unfolding in the region of
the associated residue index. Two other methods were used in
addition to SASA to identify candidate epitopes. These were the
loss of native contacts, defined by non-hydrogen atoms within a
cut-off length, and root mean squared fluctuations (RMSF),
measuring the extent of deviations about the average in a
structural ensemble; here an increase in RMSF for some amino acids
indicates an increase in the dynamics of those amino acids.
[0261] The methods were applied to the natively folded RRM1 domain
of TDP-43 (PDB entry 4IUF).
[0262] Simulations were performed for each initial structure using
the a method as described in WO/2017/079836 and the CHARMM
force-field parameters described in: K. Vanommeslaeghe, E. Hatcher,
C. Acharya, S. Kundu, S. Zhong, J. Shim, E. Darian, 0. Guvench, P.
Lopes, I. Vorobyov, and A. D. Mackerell. Charmm general force
field: A force field for drug-like molecules compatible with the
charmm all-atom additive biological force fields. Journal of
Computational Chemistry, 31(4):671-690, 2010; and P. Bjelkmar, P.
Larsson, M. A. Cuendet, B. Hess, and E. Lindahl. Implementation of
the CHARMM force field in GROMACS: analysis of protein stability
effects from correlation maps, virtual interaction sites, and water
models. J. Chem. Theo. Comp., 6:459-466, 2010, both of which are
hereby incorporated herein by reference, with TIP3P water as
solvent.
I. Conformation Specific Epitopes
[0263] This disclosure pertains to antibodies that may be selective
for misfolded TDP-43.
[0264] A prerequisite for the generation of misfolding-specific
antibodies is the identification of targets on TDP-43 peptide that
are not present (e.g. not accessible to binding) in the context of
the native structure. These misfolding-specific epitopes would not
differ in primary sequence from the corresponding segment in native
TDP-43, however they would be conformationally distinct in the
context of the misfolded protein. That is, they would present a
distinct conformation in the misfolded protein that would not be
present in the natively folded protein.
[0265] Antibodies directed either against native ensemble regions
tend not to be selective for misfolded protein, and thus bind to
healthy protein as well. Because the concentration of normal
protein may be substantially higher than that of misfolded protein,
such antibodies would likely suffer from "target distraction",
primarily binding to healthy protein and promoting clearance of
functional TDP-43, rather than selectively targeting and clearing
misfolded proteinic species. This may interfere with critical RNA
binding and stress response functions vital to the survival of the
cell.
[0266] To develop antibodies selective for misfolded proteinic
forms of TDP-43, a region in the native protein that is likely to
be disrupted upon application of external perturbing forces was
identified, using the Collective Coordinates algorithm. Without
wishing to be bound to theory, it was hypothesized that disruptions
in the context of the native may be exposed as well on the surface
of the misfolded protein. On misfolded proteins however, these
sequence regions may be exposed in conformations distinct from
native TDP-43. For example, being on the surface, they may be
exposed in turn regions that have higher exposed surface area,
different dihedral angle distribution and/or overall different
conformational geometry as determined by structural alignment than
the corresponding quantities exhibit in either the native
ensemble.
[0267] Cyclic compounds comprising TTEQ (SEQ ID NO: 1) and TTE are
described herein. The cyclic compounds have been designed to
satisfy one or more of the above criteria.
II. Epitope Predictions
[0268] The epitopes TTEQ (SEQ ID NO: 1) and TTE emerge as predicted
epitopes.
[0269] The TTEQ (SEQ ID NO: 1) epitope emerges as a prediction for
PDB structure 41UF when considering loss of native contacts. (FIG.
1 Panel B). TTE emerges as an epitope for structure 41UF when
considering increased SASA. TTE emerges as an epitope for structure
41UF when considering increased RMSF.
[0270] For the plots in FIGS. 1-9 discussed herein, the data are
obtained from equilibrium simulations in explicit solvent (TIP3P)
using the Charmm36 force field. The simulation time and number of
configurations for each ensemble are as follows. Cyclic peptide
ensemble: simulation time 100 ns, containing 5000 frames in total;
Biased ensemble: simulation time 90 ns for each unfolding
trajectory; trajectories were repeated run 10 times (equivalently
90'10=900 ns), containing 40000 frames in total. 8000 frames were
uniformly sampled from the 40000 frames for simplicity. Native 41UF
ensemble: 140 ns, containing 7000 frames.
III. Dihedral Angle Distributions
[0271] Further computational support for the identification of a
misfolded protein-selective epitope, is provided by both the side
chain dihedral angle distributions, and the Ramachandran, and
distributions for the backbone dihedral angles in the cyclic
peptide, a proxy for an exposed epitope in the misfolded protein.
Some angles have substantially different distributions than the
corresponding distributions in native TDP-43.
[0272] The side-chain and backbone dihedral distributions were
examined for the four residues T115, T116, E117, and Q118. Percent
overlap of distribution e.g. "native" in distribution "cyclic" is
obtained by dividing the angles into elements of 5.degree., then
decreasing a cutoff in probability amplitude from infinity, until
90% of the cyclic distribution is above the cutoff, and 10% remains
below. This defines one or more regions in the allowable angles.
Percent of the native distribution within this region was then
found. The recipe is non-reciprocal and generally yields different
numbers between pairs of distributions. The average of the
overlaps, e.g. average of both native in cyclic and cyclic in
native, is generally considered.
[0273] As shown in FIG. 2, for residue T115, dihedrals
C--CA-CB--OG1, C--CA-N--HN, O--C--CA-N clearly distinguish the
cyclic peptides of TTEQ (SEQ ID NO: 1) from the corresponding
dihedral angles in the native ensemble. For residue T116, dihedral
angle O--C--CA-N distinguishes the cyclic dihedral angle
distribution from the corresponding distribution in the native
ensemble. As shown in Table 1B, the dihedral overlap between the
cyclic and biased ensemble is significantly increased over the
overlap between the cyclic and native ensemble, for residues T115
and T116.
[0274] According to FIG. 3, the backbone Ramachandran angles .PHI.
and .psi. of T115 and T116 distinguishes the cyclic peptide from
the native ensemble. For E117 and Q118, the cyclic peptide
distribution is distinct from but has overlap with the native and
biased distributions, which are not significantly distinct from
each other.
[0275] From the dihedral distributions shown in FIG. 2, the
probability that the native ensemble occupies a dihedral within the
range of almost all (90%) of the cyclic peptide dihedral angles may
be found. Likewise, the probability that the cyclic ensemble
occupies a dihedral within the range of almost all (90%) of the
native peptide dihedral angles may be found. The average of these
over select dihedral angles in FIG. 2 is, for the residues TTEQ
(SEQ ID NO:1): T115: O--C--CA-N 28%; T115: C--CA-CB--OG1, 53%. All
overlap probabilities are given in Table 1A. For residues T115 and
T116, the overlap between the cyclic and biased ensembles is
generally higher than the overlap between the cyclic and native
ensembles.
[0276] The accumulation of relatively small differences in
individual dihedral angles can result in a large and significant
difference in global conformation of the peptide, and thus
significant deviations in the structural alignment, as described
further below.
[0277] Based on FIG. 2, Table 1A shows the percent overlap of
dihedral angle distributions for backbone and side-chain angles of
residues T115, T116, E117, and Q118 in linear, cyclic peptide
cyclo(CGGTTEQGG) (SEQ ID NO: 2) and native (41UF) forms relative to
each other. Column 1 is the specific dihedral angles considered.
Columns 2-7 represent the percentage overlap of dihedral angle
considered of one ensemble in another ensemble. For instance,
column 2 shows the percentage overlap between a given dihedral
angle in the native ensemble and the same angle in the cyclic
peptide cyclo(CGGTTEQGG) (SEQ ID NO: 2).
[0278] Table 1B is derived from the numbers in Table 1A. The
numbers in Table 1B show that the average overlap of the dihedral
angle distributions between the cyclic and native forms is less
than the average overlap of the dihedral angle distributions
between the cyclic and biased forms, specifically for residues T115
and T116. This implies that residues T115 and T116 may be residues
which confer the largest conformational selectivity against the
native form.
TABLE-US-00008 TABLE 1A Percent overlap of dihedral angle
distribution, for cyclo (CGGTTEQGG) (SEQ ID NO: 2) Dihedral Native
in Biased in Cyclic in Biased in Cyclic in Native in angle cyclic
cyclic native native biased biased 115T:C-CA- 57% 81% 49% 63% 91%
89% CB-OG1 115T:C-CA- 40% 64% 63% 72% 98% 94% N-HN 115T:O-C- 40%
63% 15% 53% 86% 99% CA-N 116T:CB-CA- 75% 84% 47% 76% 82% 95% N-HN
116T:N-CA- 72% 62% 89% 65% 89% 87% CB-OG1 116T:O-C- 51% 82% 69% 61%
95% 91% CA-N 117E:CA-CB- 76% 74% 90% 84% 87% 86% CG-CD 117E:OE1-CD-
87% 85% 89% 85% 93% 93% CG-CB 118Q:CA-CB- 87% 80% 89% 86% 92% 92%
CG-CD 118Q:O-C-CA- 41% 47% 7% 85% 10% 98% CB
TABLE-US-00009 TABLE 1B Average overlap between cyclic and biased
or native, and corresponding difference difference of (cyclic-
average native- average biased- biased)-(cyclic- Dihedral angle
cyclic overlap cyclic overlap native) 115T:C-CA-CB-OG1 53% 86% 33%
115T:C-CA-N-HN 51% 81% 30% 115T:O-C-CA-N 27% 75% 47%
116T:CB-CA-N-HN 61% 83% 22% 116T:N-CA-CB-OG1 81% 75% -6%
116T:O-C-CA-N 60% 88% 28% 117E:CA-CB-CG-CD 83% 81% -2%
117E:OE1-CD-CG-CB 88% 89% 1% 118Q:CA-CB-CG-CD 88% 86% -2%
118Q:O-C-CA-CB 24% 28% 4%
[0279] Based on the data shown in FIG. 2, Table 2A lists the peak
values of the dihedral angle distributions for those dihedral
angles whose distributions show differences between the cyclic
peptide cyclo(CGGTTEQGG) (SEQ ID NO: 2) and the native ensemble.
Column 1 is the specific dihedral considered, column 2 is the peak
value of the dihedral distribution for that angle in the context of
the cyclic peptide cyclo(CGGTTEQGG) (SEQ ID NO: 2), column 3 is the
peak value of the dihedral distribution for the peptide TTEQ (SEQ
ID NO: 1) in the context of the native structural ensemble, column
4 is the peak value of the dihedral distribution for the peptide
TTEQ (SEQ ID NO: 1) in the context of the biased structural
ensemble, and column 5 is the difference of the peak values of the
dihedral distributions for the cyclic and native ensembles. As
shown in Table 2B, the differences are generally larger between the
cyclic and native forms then they are between the cyclic and biased
forms. Moreover, averaging over the various dihedral angles for a
given residue, the magnitude of the difference (cyclic to native)
minus (cyclic to biased) is largest for T115, and decreases
monotonically from T115 to Q118.
TABLE-US-00010 TABLE 2A Peak Values of the Dihedral Angle
Distributions, for cyclic CGGTTEQGG (SEQ ID NO: 2) Cyclic- Native
Dihedral angle Cyclic Native Biased difference 115T:C-CA-CB-OG1 -80
80 -75 -160 115T:C-CA-N-HN 85 35 110 50 115T:O-C-CA-N -60 -25 -45
-35 116T:CB-CA-N-HN -95 -25 -20 -70 116T:N-CA-CB-OG1 -175 35 -165
150 116T:O-C-CA-N -30 -65 -20 35 117E:CA-CB-CG-CD -175 165 175 20
117E:OE1-CD-CG-CB 115 70 120 45 118Q:CA-CB-CG-CD -45 -45 -50 0
118Q:O-C-CA-CB -50 -95 -95 45
TABLE-US-00011 TABLE 2B Differences in peak values between cyclic,
native, biased and averages over residues |cyclic- average native|-
difference |cyclic- over Dihedral cyclic-native cyclic-biased
biased| residues 115T:C-CA-CB-OG1 -160 -5 155 66.7 115T:C-CA-N-HN
50 -25 25 115T:O-C-CA-N -35 -15 20 116T:CB-CA-N-HN -70 -75 5 56.7
116T:N-CA-CB-OG1 150 -10 140 116T:O-C-CA-N 35 -10 25
117E:CA-CB-CG-CD 20 10 10 25 117E:OE1-CD-CG-CB 45 -5 40
118Q:CA-CB-CG-CD 0 5 5 2.5 118Q:O-C-CA-CB 45 45 0
IV. Ramachandran Angles
[0280] The backbone orientation that the epitope exposes to an
antibody differs depending on whether the peptide is in the cyclic,
biased, or native form. This discrepancy can be quantified by
plotting the Ramachandran angles phi and psi (or .PHI. and .psi.),
along the backbone, for each residue T115, T116, E117 and Q118 in
the above 3 ensembles. FIG. 3 plots the phi and psi angles sampled
in equilibrium simulations, for residues T115, T116, E117 and Q118.
From FIG. 3 panels A and B, it can be seen that the distributions
of backbone dihedral angles for T115 and T116 in the cyclic peptide
are different from the distributions of dihedral angles sampled for
either the native ensemble, and more similar to the biased
ensemble. This is further quantified in Table 3A.
[0281] The overlap of the Ramachandran angle distributions, as
defined above, is given in Table 3A. Table 3A shows the overlap
probabilities of Ramachandran angles of the residues T115, T116,
E117, and Q118 presented in FIG. 3. Specifically, the average of
the fraction of the cyclic peptide cyclo(CGGTTEQGG) (SEQ ID NO: 2)
ensemble that adopts conformations consistent with the native
ensemble and the fraction of native ensemble that adopts
conformations consistent with the cyclic ensemble is 28%, 63%, 55%,
23% for T115, T116, E117, and Q118 respectively. This is obtained
by averaging both the psi and phi overlap numbers. This indicates
for example that the orientations around T115 and Q118 in the
cyclic peptide ensemble are conformationally distinct from
conformations of those residues in the native ensemble.
[0282] Table 3B shows the overlap probabilities, averaged over both
Ramachandran angles, and averaged for example in column 2 for
cyclic in native, and native in cyclic; likewise column 3 averages
over phi, psi, cyclic in biased and biased in cyclic of Table 3A,
to achieve a net overlap percentage for a given residue Table 3B
shows that the Ramachandran angles of T115 and T116 confer the
greatest conformational selectivity against the native form, and
towards biased, misfolded forms.
TABLE-US-00012 TABLE 3A Overlap probabilities for Ramachandran
angles phi and psi, for cyclic CGGTTEQGG (SEQ ID NO: 2). cyclic
native cyclic biased biased native in in in in in in native cyclic
biased cyclic native biased phi 115T 42% 31% 98% 61% 60% 94% 116T
35% 80% 82% 89% 77% 93% 117E 24% 87% 25% 71% 83% 93% 118Q 8% 36%
12% 37% 87% 96% psi 115T 12% 28% 85% 59% 51% 99% 116T 70% 66% 94%
83% 63% 81% 117E 23% 87% 30% 73% 84% 97% 118Q 6% 43% 8% 50% 88%
98%
TABLE-US-00013 TABLE 3B Average overlap probabilities for
Ramachandran angles, for cyclic CGGTTEQGG (SEQ ID NO: 2), native
and biased protein difference of (cyclic- avg of avg of biased)-
cyclic- cyclic- (cyclic- Residue native biased native) 115T 28% 76%
48% 116T 63% 87% 24% 117E 55% 50% -6% 118Q 23% 27% 3%
[0283] Table 4A gives the peak (most-likely) values of the
Ramachandran Cy angles plotted in FIG. 3 for residues T115, T116,
E117 and Q118. The 2.sup.nd, 3.sup.rd and 4.sup.th columns indicate
the peak values of the Ramachandran phi/psi angles for each residue
in the context of the cyclic peptide cyclo(CGGTTEQGG) (SEQ ID NO:
2), native ensemble, and non-native biased ensemble respectively.
The most-likely Ramachandran phi and psi values are different
between the cyclic and native ensembles for residues T115, T116,
E117 and Q118. As shown in Table 4B, the differences are slightly
larger between the cyclic and native forms then they are between
the cyclic and biased forms. When averaged over phi and psi angles,
T115 shows the greatest distinction between the above differences,
so that the cyclic has stronger overlap with the biased form than
the native from specifically for residue T115.
TABLE-US-00014 TABLE 4A Peak values of distributions of backbone
phi/psi angles (degrees) phi Cyclic native biased 115T -100 -150
-60 116T -150 -85 -65 117E -100 -60 -55 118Q -95 -60 -60 psi cyclic
native biased 115T 115 160 135 116T 150 120 155 117E 5 -35 -40 118Q
10 -40 -40
TABLE-US-00015 TABLE 4B Differences cyclic to native, cyclic to
biased, and difference between those differences, for the numbers
in Table 4A. |cyclic- native|- avg cyclic- avg cyclic- |cyclic-
Residue native biased biased| 115T 47.5 30 17.5 116T 47.5 45 2.5
117E 40 45 -5 118Q 42.5 42.5 0
V. Solubility and Solvent-Exposure of the Epitope
[0284] FIG. 4 Panel A plots the intrinsic solubility of each amino
acid in TDP-43 RRM1. It can be seen that the epitope sequence TTEQ
(SEQ ID NO: 1) is among one of the more soluble regions in the
protein sequence, indicating that upon biasing forces implementing
an external challenge to the protein structure, that particular
region will not be averse to increasing it's solvent
accessibility.
[0285] FIG. 4 Panel B and Table 5 gives the mean solvent accessible
surface area (SASA) of each residue in the equilibrium ensemble of
the cyclic peptide; the biased, partially unfolded protein
ensemble; and the native ensemble. This shows that the SASA of
residues TTEQ (SEQ ID NO: 1) in the biased ensemble is increased
over the native, and as well, the SASA of the cyclic peptide is
increased over that in the biased ensemble, indicating more surface
would be exposed and thus accessible to antibody binding. The
increase in exposure is most significant for residues T115 and
E117, which shows the largest increase in SASA over the native
ensemble. For T115, this difference is 101 .ANG..sup.2, while for
E117, this difference is 67 .ANG..sup.2.
[0286] FIG. 4C gives the mean SASA of each residue as in FIG. 4B,
but now for the cyclic peptide of sequence cyclo(CGTTEQG) (SEQ ID
NO: 3). The results recapitulate those for cyclic peptide
cyclo(CGGTTEQGG) (SEQ ID NO:2).
[0287] Table 5 shows the SASA of residues T115, T116, E117, and
Q118 in the context of the cyclic cyclo(CGGTTEQGG) (SEQ ID NO: 2)
ensemble, the biased ensemble, and the native ensemble.
TABLE-US-00016 TABLE 5 SASA by residue, and total SASA, for native,
biased and cyclic CGGTTEQGG (SEQ ID NO: 2) ensembles SASA by
residue, and total (.ANG..sup.2) CGGTTEQGG (SEQ ID NO: 2) cyclic
biased native 115T 111.3 35.5 10.3 116T 52.3 68.3 68.2 117E 131 92
64 118Q 133.6 119.2 119.3 Total 428.2 315 261.8
VI. The Ensemble of Cyclic Peptide Conformations Clusters
Differently than the Ensemble of Either Linear or Fibril
Conformations
[0288] Definitive evidence that the sequence TTEQ (SEQ ID No: 1)
displays a different conformation in the context of the cyclic
peptide than in the native ensemble can be seen by using standard
structural alignment metrics between conformations, and then
implementing clustering analysis. Equilibrium ensembles of
conformations are obtained for the native RRM1 (PDB 41UF), biased
RRM1, and cyclic peptides cyclo(CGGTTEQGG) (SEQ ID No: 2).
Snapshots of conformations from these ensembles for residues TTEQ
(SEQ ID NO: 1) are collected and then structurally aligned to the
centroids of the largest cluster of the cyclic peptide ensemble,
the largest cluster of the native ensemble, and the largest cluster
of TTEQ (SEQ ID NO: 1) in the biased ensemble; the three values of
the root mean squared deviation (RMSD) are then recorded and
plotted. The clustering is performed here by the maxcluster
algorithm. The 3 corresponding RMSD values for the cyclic, biased,
and native ensembles are plotted as a 3-dimensional scatter plot in
FIG. 7. FIG. 7 Panel A also includes results for an equilibrium
ensemble of the linear peptide CGGTTEQGG (SEQ ID NO: 2). FIG. 7C
plots the overlap percentages between several ensembles. Two
overlap numbers are particularly important. One is the overlap with
the cyclic or native ensemble ensembles with the non-native biased
ensemble. The non-native biased ensemble is the part of the biased
ensemble that does not include configurations overlapping with the
native ensemble. I.e. any biased conformations that overlap with
part of the native ensemble are removed, so it is those biased
conformations that are different than native conformations. The
higher this number, the better that epitope scaffold at selectively
targeting locally unfolded states. The overlap between cyclic
peptide ensemble and non-native biased ensemble is larger than the
overlap between linear peptide ensemble and non-native biased
ensemble. This justifies the use of using the cyclic scaffold as a
proxy for non-native misfolded states. The cyclic peptide has
substantially larger overlap with the non-native biased ensemble
than it does with the native ensemble.
[0289] The other number that is important is the overlap between
either the cyclic or linear structural ensembles with the native
structural ensemble. This number should be low. The lower this
number, the less that antibodies raised to the epitope scaffold
will target the native structure. The numeric overlapping
percentages are given in Table 6A. It is evident from FIG. 7 and
Table 6A below that the 3 ensembles cluster differently from each
other. In particular, the cyclic peptide structural ensemble is
distinct from the native ensemble, implying that antibodies
specific to the cyclic peptide epitope may have low affinity to the
conformations presented in the linear or native ensembles. An
antibody raised to the cyclic peptide could be conformationally
selective and preferentially bind misfolded proteinic forms over
the native conformations of TDP-43. The distinction between the
ensembles occurs in spite of the overlap between several side chain
and backbone dihedral angle distributions; the numerous often small
differentiating features described above lead to globally different
conformational distributions.
[0290] FIG. 7 Panels D, E, F plots the corresponding quantities as
FIG. 7A, B, C, but now for cyclic peptide cyclo(CGTTEQG) (SEQ ID
NO:3). The results are similar to the above: The cyclic peptide has
substantially larger overlap with the non-native biased ensemble
than it does with the native ensemble, and the cyclic peptide is a
better epitope scaffold for non-native biased states than is the
linear peptide.
[0291] Table 6A gives the overlap percentages in the RMSD
clustering scatter plot of the cyclic, biased, and native (41UF)
peptide conformations, as presented in FIG. 7. Column 1 shows the
percentage overlap from the cyclic to the native form is quite
small, only 5% for CGGTTEQGG (SEQ ID NO: 2) and 4% for CGTTEQG (SEQ
ID NO: 3). On the other hand, the percent overlap from the cyclic
to the biased ensembles is almost 3 times greater, about 14% for
CGGTTEQGG (SEQ ID NO: 2) and about 10.times. greater or 42% for
CGTTEQG (SEQ ID NO: 3). The cyclic ensemble is sampling
non-native-like conformations about 95% of the time.
[0292] The overlap of the cyclic peptide in the non-native biased
ensemble gives the fraction of scaffolds in the equilibrium
ensemble that accurately represent misfolded non-native states.
Likewise, the overlap of the cyclic peptide in the native biased
ensemble gives the fraction of scaffolds in the equilibrium
ensemble that accurately represent native states. The overlap of
the non-native biased ensemble in the cyclic peptide ensemble gives
the similarity of non-native misfolded states to the cyclic
ensemble, and likewise, the overlap of the native biased ensemble
in the cyclic peptide ensemble gives the similarity of native
misfolded states to the cyclic ensemble. This latter quantity is
not of particular interest, however the reciprocal overlaps between
biased ensemble and cyclic ensemble are both measures quantifying
the appropriateness of using the cyclic scaffold. In Table 6B we
take an average of these two measures, divided by the cyclic in
native ensemble overlap as a measure of the goodness in using a
given cyclic scaffold to target non-native misfolded states vs. the
native to provide a goodness ratio for cyclic peptides in targeting
non-native misfolded conformations vs. native conformations. Column
1 gives the sequence, column 2 gives the average of the overlap of
the cyclic peptide in the non-native biased ensemble and the
overlap of the non-native biased ensemble in the cyclic peptide
ensemble, Column 3 gives the overlap of the cyclic peptide in the
native ensemble, Column 4 gives the difference of Column 2 and
Column 3, and Column 5 gives the ratio of Column 2 divided by
Column 3, which is defined as the goodness ratio for the cyclic
peptide construct.
TABLE-US-00017 TABLE 6A Percentage overlap of RMSD clustering non-
cyclic cyclic native cyclic biased native biased native in non- in
in in in in in biased native native cyclic biased cyclic biased
native in cyclic biased CGGTTEQGG 5% 19% 14% 24% 85% 30% 25% 14%
(SEQ ID NO: 2) CGTTEQG 4% 17% 55% 24% 84% 24% 26% 42% (SEQ ID NO:
3)
TABLE-US-00018 TABLE 6B Goodness ratio for cyclic peptides in
targeting non-native misfolded conformations vs. native
conformations A) avg cyclic- non-native B) cyclic biased scaffold
difference Ratio Sequence overlap in native in A-B B/A CGGTTEQGG
20% 5% 15% 3.9 (SEQ ID NO: 2) CGTTEQG 34% 4% 30% 8.5 (SEQ ID NO:
3)
TABLE-US-00019 TABLE 6C Goodness ratio for several candidate cyclic
scaffolds non- cyclic in native cyclic non-native biased in cyclic
sequence biased in cyclic native ratio CGTTEQG 42% 26% 4% 8.50 (SEQ
ID NO: 3) CGGTTEQGG 25% 14% 5% 3.90 (SEQ ID NO: 2) CGGTTEQGGG 10%
42% 8% 3.25 (SEQ ID NO: 22) CGTTEQGG 28% 42% 15% 2.33 (SEQ ID NO:
23)
TABLE-US-00020 TABLE 6D Overlap between the cyclic and the linear
forms linear cyclic in Cyclic sequence in cyclic linear CGTTEQG
(SEQ ID NO: 3) 7.5% 21% CGGTTEQGG (SEQ ID NO: 2) 12% 24% CGTTEG
(SEQ ID NO: 28) 12% 39% CGTTEGG (SEQ ID NO: 29) 13% 43%
[0293] Table 6C lists the goodness ratio as defined in Table
6B--the ability of cyclic peptides to target non-native misfolded
conformations vs. native conformations--for several candidate
cyclic scaffolds as a function of several different cyclic radii,
sorted in decreasing order of goodness ratio. Two cyclic scaffolds
analyzed, constructs CGTTEQG (SEQ ID NO: 3) and CGGTTEQGG (SEQ ID
NO: 2) have the largest goodness ratio, and so would be predicted
to be the best proxies for non-native misfolded structures using
these measures.
[0294] Table 6D lists the overlap percentage between the cyclic and
linear conformational ensembles. The ensembles are different as
seen by their small to moderate overlap percentage; this indicates
that the cyclic peptide ensemble is conformationally distinct from
the linear peptide ensemble, and also likely to be conformationally
distinct from the nascent unfolded peptide chain.
[0295] The overlap between the ensembles was calculated as follows.
The fraction (percent) of the biased ensemble that overlaps with
the cyclic ensemble is obtained by first dividing the volume of
this 3-dimensional RMSD space up into cubic elements of length 0.1
Angstrom. Then a "cutoff density" of points in the cyclic
distribution is found such that the cubes with cyclic distribution
density equal to or higher than the cutoff density contain 90% of
the cyclic distribution. This defines a volume (which may be
discontiguous) that gives the characteristic volume containing the
cyclic distribution and removes any artifacts due to outliers. Then
the fraction of points from the biased distribution that are within
this region is found. With this method, it is possible to find the
overlapping percentages for cyclic in native, cyclic in biased,
etc.
[0296] FIG. 7 Panels C and F illustrate that the ensembles are
large enough that the overlap values have converged.
[0297] FIG. 7 Panel G shows the correlation coefficient between
both the cyclic-CGGTTEQGG (SEQ ID NO: 2) ensemble and the native
ensemble, and the cyclic-CGGTTEQGG (SEQ ID NO: 2) ensemble and the
non-native biased ensemble, computed as follows. The correlation
coefficient between two ensembles is defined by first finding the
parts of the distributions having density greater than a cutoff
value, such that a given percentage of the total distributions are
encompassed, e.g. a density cutoff for the cyclic and linear
distributions that give 60% of the total distributions. Then for
these subdistributions, the correlation coefficient is defined as
.intg.f(.tau.)g(.tau.)d.tau. {square root over
(.intg.f(.tau.).sup.2 d.tau.)} {square root over
(.intg.g(.tau.).sup.2d.tau.)}, where f (T) and g (T) are the
densities in each voxel T and the result is integrated (summed)
over all voxels. Thus defined, the correlation coefficient between
the native and cyclic distributions converges to about 4.5% when
100% of the respective distributions are included, and the
correlation coefficient between the non-native biased and cyclic
distributions converges to about 10.5% when 100% of the respective
distributions are included, or about double the overlap.
[0298] FIG. 7 Panel H shows the correlation coefficient between
both the cyclic-(CGTTEQG) (SEQ ID NO: 3) ensemble and the native
ensemble, and the cyclic-(CGTTEQG) (SEQ ID NO: 3) ensemble and the
non-native biased ensemble, analogously to FIG. 7G. The correlation
coefficient between the native and cyclic distributions converges
to about 7% when 100% of the respective distributions are included,
and the correlation coefficient between the non-native biased and
cyclic distributions converges to about 25% when 100% of the
respective distributions are included, or about 3.6 times the
overlap.
[0299] FIG. 7 Panel I examines the effects of single residue
deletions on the structural overlap, as defined by averaging the
overlap of the native ensemble with the 90% cyclic (CGGTTEQGG) (SEQ
ID NO: 2) ensemble, and the cyclic ensemble with 90% of the native
ensemble. If a single amino acid confers conformational selectivity
against the native conformation, then removing it from the
structural alignment will result in a significantly higher overlap
between the distributions. By this test, T115 stands out as
conferring the most conformational selectivity to the cyclic
peptide.
[0300] FIG. 7 Panel J plots the effects of single residue deletions
for the cyclic peptide cyclo(CGTTEQG) (SEQ ID NO: 3), analogously
with FIG. 7I. Again residue T115 stands out as conferring the
conformational selectivity to the cyclic peptide.
[0301] A schematic of the atomic structure of the
most-representative conformation of TTEQ (SEQ ID NO: 1) from the
cyclic peptide ensemble of CGGTTEQGG (SEQ ID NO: 2), constituting
the centroid of the largest cluster from the cyclic peptide
ensemble of structures, is shown in FIG. 5 Panel A in black. As
well, the most-representative conformation in the native structural
ensemble, constituting the centroid of the largest cluster, is
shown in light grey in FIG. 5, optimally superimposed on the cyclic
peptide shown in black by aligning them using RMSD, to make
explicit their different orientations. In particular, T115 has a
significantly different orientation between the two centroid
conformations. FIG. 5 Panel B shows the corresponding centroid
conformations for the cyclic peptide and native ensemble for the
cyclic sequence CGTTEQG (SEQ ID NO: 3), again optimally
superimposed by aligning with respect to RMSD. Both cyclic
constructs show T115 is in an alternate conformation, and to a
lesser extent Q118 appears in an alternate conformation.
[0302] Table 7 lists values of the Ramachandran backbone and side
chain dihedral angles occupied by residues T115, T116, E117, and
Q118 in the centroid structure of the cyclic CGGTTEQGG (SEQ ID NO:
2) peptide ensemble, the centroid structure of the native ensemble,
and the centroid structure of the non-native biased ensemble;
cyclic and native centroid conformations are plotted in FIG. 5. The
centroid structures exhibit several dihedral angles that are
substantially different between the cyclic conformation and the
native conformation. Column 1 of Table 7 gives the residue and
dihedral angle of interest, column 2 gives the value of the
dihedral angle in the centroid structure of the cyclic ensemble,
column 3 gives the value of the dihedral in the native ensemble
centroid, column 4 gives the value of the dihedral in the
non-native biased ensemble centroid, column 5 is the magnitude of
the difference in cyclic and native dihedrals, column 6 is the
magnitude of the difference in cyclic and non-native biased
dihedrals, column 7 gives the values of column 5 averaged over the
dihedrals in each amino acid and column 8 gives the values of
column 6 averaged over the dihedrals in each amino acid. It is
apparent that many of the cyclic dihedral angles are significantly
different then the corresponding dihedral angles in the linear or
native centroids, as described above for the peak values of the
dihedral distributions. Note however that the dihedral angles of
the centroid structures need not be the same as the peak values of
the dihedral distributions. For an example of the differences here,
the dihedral OG1-CB--CG2-2HG2 in residue 115T shows a difference of
100 degrees between the cyclic and native, but only 15 degrees
between the cyclic and non-native biased. The average difference
between cyclic and native for 115T is 87.6 degrees, while the
average difference between cyclic and non-native biased for 115T is
51.9 degrees. Again note that these differences are only for one
conformation in each of the respective ensembles--the centroid
conformation.
TABLE-US-00021 TABLE 7 Dihedral angles in the centroid structures
of the linear, cyclic, and native ensembles. avg avg cyclic-
cyclic- cyclic - cyclic - Residue:Dihedral cyclic native biased
native biased native biased 115T:C-CA-CB-CG2 60 -25 0 85 60 87.6
51.9 115T:C-CA-CB-HB -60 -150 -115 90 55 115T:C-CA-CB-OG1 180 95
130 85 50 115T:C-CA-N-HN 75 25 65 50 10 115T:CA-CB-CG2-1HG2 60 -50
45 110 15 115T:CA-CB-CG2-2HG2 175 80 170 95 5 115T:CA-CB-CG2-3HG2
-65 -165 -70 100 5 115T:CA-CB-OG1-HG1 45 80 50 35 5 115T:CB-CA-N-HN
-45 -100 -60 55 15 115T:CG2-CB-OG1-HG1 170 -155 -175 145 165
115T:HA-CA-CB-CG2 -50 -150 -110 100 60 115T:HA-CA-CB-HB -170 90 130
80 120 115T:HA-CA-CB-OG1 70 -25 15 95 55 115T:HA-CA-N-HN -175 135
175 130 170 115T:HB-CB-CG2-1HG2 -175 70 165 65 160
115T:HB-CB-CG2-2HG2 -60 -160 -70 100 10 115T:HB-CB-CG2-3HG2 60 -45
50 105 10 115T:HB-CB-OG1-HG1 -80 -40 -65 40 15 115T:N-CA-CB-CG2 180
90 125 90 55 115T:N-CA-CB-HB 60 -35 10 95 50 115T:N-CA-CB-OG1 -65
-145 -105 80 40 115T:O-C-CA-CB 50 90 90 40 40 115T:O-C-CA-HA 170
-145 -155 135 145 115T:O-C-CA-N -70 -30 -40 40 30
115T:OG1-CB-CG2-1HG2 -60 -175 -85 115 25 115T:OG1-CB-CG2-2HG2 55
-45 40 100 15 115T:OG1-CB-CG2-3HG2 175 70 160 105 15
116T:C-CA-CB-CG2 -55 -70 -75 15 20 68.1 58.7 116T:C-CA-CB-HB -165
165 175 150 160 116T:C-CA-CB-OG1 75 45 55 30 20 116T:C-CA-N-HN 45
85 100 40 55 116T:CA-CB-CG2-1HG2 80 -30 -60 110 140
116T:CA-CB-CG2-2HG2 -155 85 60 60 35 116T:CA-CB-CG2-3HG2 -40 -150
175 110 35 116T:CA-CB-OG1-HG1 110 150 50 40 60 116T:CB-CA-N-HN -70
-45 -25 25 45 116T:CG2-CB-OG1-HG1 -120 -85 180 35 120
116T:HA-CA-CB-CG2 -170 175 175 165 165 116T:HA-CA-CB-HB 80 55 65 25
15 116T:HA-CA-CB-OG1 -45 -65 -55 20 10 116T:HA-CA-N-HN 165 -160
-140 145 125 116T:HB-CB-CG2-1HG2 -170 85 55 75 45
116T:HB-CB-CG2-2HG2 -45 -160 175 115 40 116T:HB-CB-CG2-3HG2 70 -40
-70 110 140 116T:HB-CB-OG1-HG1 -10 40 -65 50 55 116T:N-CA-CB-CG2 65
60 60 5 5 116T:N-CA-CB-HB -45 -65 -50 20 5 116T:N-CA-CB-OG1 -165
175 -170 160 5 116T:O-C-CA-CB 115 105 100 10 15 116T:O-C-CA-HA -125
-145 -150 20 25 116T:O-C-CA-N -5 -25 -30 20 25 116T:OG1-CB-CG2-1HG2
-55 -155 170 100 45 116T:OG1-CB-CG2-2HG2 70 -40 -75 110 145
116T:OG1-CB-CG2-3HG2 -170 85 40 75 30 117E:C-CA-CB-CG 180 165 175
15 5 52.2 63.3 117E:C-CA-CB-HB1 -60 -70 -55 10 5 117E:C-CA-CB-HB2
65 45 50 20 15 117E:C-CA-N-HN 75 125 135 50 60 117E:CA-CB-CG-CD
-165 165 95 150 80 117E:CA-CB-CG-HG1 -45 -70 -140 25 95
117E:CA-CB-CG-HG2 65 45 -25 20 90 117E:CB-CA-N-HN -45 -5 5 40 50
117E:HA-CA-CB-CG 65 55 60 10 5 117E:HA-CA-CB-HB1 -175 180 -170 175
5 117E:HA-CA-CB-HB2 -50 -60 -65 10 15 117E:HA-CA-N-HN -160 -125
-110 35 50 117E:HB1-CB-CG-CD 65 45 -30 20 95 117E:HB1-CB-CG-HG1
-175 170 90 165 85 117E:HB1-CB-CG-HG2 -65 -75 -155 10 90
117E:HB2-CB-CG-CD -50 -80 -145 30 95 117E:HB2-CB-CG-HG1 70 50 -25
20 95 117E:HB2-CB-CG-HG2 180 160 90 20 90 117E:N-CA-CB-CG -60 -70
-60 10 0 117E:N-CA-CB-HB1 65 55 70 10 5 117E:N-CA-CB-HB2 -175 175
180 170 175 117E:O-C-CA-CB -65 -85 -70 20 5 117E:O-C-CA-HA 45 30 45
15 0 117E:O-C-CA-N 175 150 165 25 10 117E:OE1-CD-CG-CB -75 10 125
85 20 117E:OE1-CD-CG-HG1 165 -115 5 100 160 117E:OE1-CD-CG-HG2 55
130 -115 75 170 117E:OE2-CD-CG-CB 100 -175 -55 95 155
117E:OE2-CD-CG-HG1 -15 55 -175 70 160 117E:OE2-CD-CG-HG2 -125 -60
70 65 15 118Q:C-CA-CB-CG -175 175 180 170 175 76.5 54.7
118Q:C-CA-CB-HB1 -55 -65 -60 10 5 118Q:C-CA-CB-HB2 60 50 60 10 0
118Q:C-CA-N-HN 85 130 115 45 30 118Q:CA-CB-CG-CD -35 -65 -65 30 30
118Q:CA-CB-CG-HG1 85 60 50 25 35 118Q:CA-CB-CG-HG2 -150 180 170 150
140 118Q:CB-CA-N-HN -45 5 -15 50 30 118Q:CG-CD-NE2-1HE2 -175 -25 35
150 30 118Q:CG-CD-NE2-2HE2 20 180 -170 160 10 118Q:HA-CA-CB-CG 80
60 65 20 15 118Q:HA-CA-CB-HB1 -160 -175 -175 15 15
118Q:HA-CA-CB-HB2 -45 -65 -60 20 15 118Q:HA-CA-N-HN -170 -110 -130
60 40 118Q:HB1-CB-CG-CD -160 175 170 155 150 118Q:HB1-CB-CG-HG1 -40
-60 -75 20 35 118Q:HB1-CB-CG-HG2 85 60 45 25 40 118Q:HB2-CB-CG-CD
90 60 60 30 30 118Q:HB2-CB-CG-HG1 -150 -175 170 25 140
118Q:HB2-CB-CG-HG2 -25 -55 -65 30 40 118Q:N-CA-CB-CG -45 -60 -50 15
5 118Q:N-CA-CB-HB1 75 65 70 10 5 118Q:N-CA-CB-HB2 -170 175 -175 165
5 118Q:NE2-CD-CG-CB -55 160 -110 35 55 118Q:NE2-CD-CG-HG1 180 35
135 145 45 118Q:NE2-CD-CG-HG2 65 -85 15 150 50 118Q:O-C-CA-CB -35
-100 -90 65 55 118Q:O-C-CA-HA 85 15 20 70 65 118Q:O-C-CA-N -165 135
140 120 125 118Q:OE1-CD-CG-CB 130 -15 85 145 45 118Q:OE1-CD-CG-HG1
5 -140 -30 145 35 118Q:OE1-CD-CG-HG2 -110 100 -155 30 45
118Q:OE1-CD-NE2-1HE2 0 145 -160 145 160 118Q:OE1-CD-NE2-2HE2 -165
-5 -5 160 160
[0303] FIG. 6 again shows TTEQ (SEQ ID NO:1) in the native
centroid, biased centroid, and cyclic peptide centroids for
CGGTTEQGG (SEQ ID NO: 2) and CGTTEQG (SEQ ID NO: 3), now using a
surface area representation for residues TTEQ (SEQ ID NO: 1). The
surface area profile, which would be presented to an antibody, is
different between the centroid conformations. Conformations have
been shown separately, but all have been aligned. Comparing the
centroid configurations of the native, biased, and cyclic
ensembles, the exposed surface area of E117 and as well T115,
monotonically increase consistently with the SASA plotted in FIGS.
4B and 4C. Thus, antibodies raised to this region in a cyclic
ensemble of TDP-43 will be unlikely to bind (e.g. equally or with
similar selectivity) TTEQ (SEQ ID NO: 1) in native TDP-43.
[0304] FIG. 6E shows an example of interactions that are present in
the native ensemble of RRM1 of TDP-43, which bury surface area of
the side chain of E117, but which are disrupted upon biasing the
protein to be partially unfolded. In the native ensemble, E117
forms a salt-bridge with Lysine 137 (K137), which constrains the
side chains of each residue, and reduces the exposed surface area
of E117 in the native ensemble. In the biased ensemble however
(FIG. 6E, right panel), the salt-bridge is broken, exposing the
side chain of E117. Other interactions within the protein are also
sufficiently weakened that the exposure of T115 also increases, as
plotted in FIGS. 4B and C.
Example 2
Clustering by RMSD for TTE in the Cyclic Compounds CGTTEG (SEQ ID
NO: 28) and CGTTEGG (SEQ ID NO: 29)
[0305] A similar set of experiments were performed for TTE in the
cyclic compounds CGTTEG (SEQ ID NO: 28) and CGTTEGG (SEQ ID NO:
29).
[0306] RMSD was analysed as in Example 1 for TTE cyclic compounds.
Clustering plots by root mean squared deviation (RMSD) are shown in
FIG. 8. The axes correspond to the RMSD of TTE relative to TTE in
the centroid structure of the cyclic peptide ensemble cyclo
(CGTTEG) (SEQ ID NO: 28) (panel A) or cyclo (CGTTEGG) (SEQ ID NO:
29) (panel B), the RMSD of TTE to TTE in the centroid structure of
the native structural ensemble (equilibration starting from PDB ID
41UF) and the RMSD of TTE to TTE in the centroid structure of the
non-native biased ensemble (the biased ensemble with the points
overlapping with the native ensemble removed). Each point
corresponds to a given conformation taken from either the cyclic
peptide equilibrium ensemble (circles as noted in the legend), the
non-native biased equilibrium ensemble (+ symbols as noted in the
legend), or the native structure equilibrium ensemble starting from
PDB ID 41UF (inverted triangles as noted in the legend).
[0307] FIG. 9 shows the overlap of percentages between the
different ensembles, as a function of the number of configurations
sampled, to show convergence. Cyclic ensemble corresponds to the
sequence cyclo(CGTTEG) (SEQ ID NO: 28) (Panel A) or cyclo(CGTTEGG)
(SEQ ID NO: 29) (Panel B). Analogous to FIG. 7, the percent overlap
for each pair of ensembles shows the percent overlap of a
particular ensemble with 90% of the comparator structure ensemble,
as described in the text in Example 2. The numeric overlapping
percentages are given in Table 8A below. The overlap of the cyclic
ensemble with the native ensemble is zero within the numerical
accuracy of the simulations; low similarity to the native structure
is again a desirable feature for a cyclic peptide scaffold.
TABLE-US-00022 TABLE 8A ratio of (cyclic in cyclic non- biased +
biased in non- native cyclic in cyclic)/ cyclic native biased in in
(2*(cyclic sequence biased cyclic native in native)) CGTTEG 22% 17%
0% inf CGTTEGG 25% 21% 0% inf CGGTTEGG 37% 20% 5% 5.7 CGGGTTEGG 10%
22% 2% 8.0 CGGTTEGGG 25% 27% 3% 8.7 CGGGTTEGGG 20% 35% 5% 5.5
CGGGGTTEGGG 20% 42% 10% 3.1 CGGGGTTEGGGG 45% 52% 16% 3.0
[0308] Table 8A shows the overlapping percentage of the RMSD
clustering between the cyclic in native, cyclic in non-native
biased, and non-native biased in cyclic forms of the cyclopeptides
as presented in FIG. 9 panels for the scaffolds cyclo(CGTTEG) (SEQ
ID NO: 28) and cyclo(CGTTEGG) (SEQ ID NO: 29). The last column
gives the ratio defined by the mean of Columns 2 and 3 divided by
column 4 column 4 (provided in the right most column). The two
scaffolds cyclo(CGTTEG) (SEQ ID NO: 28) and cyclo(CGTTEGG) (SEQ ID
NO: 29) show the largest discrimination between the non-native
biased ensemble and the native ensemble, having a ratio of overlap
equal to infinity (the cyclic ensemble has no overlap with the
native ensemble).
[0309] Additional computational simulations were performed to
measure the similarity bewen various ensembles by measuring the
Jensen-Shannon distance [Lindorff-Larsen K, Ferkinghoff-Borg J
(2009) Similarity Measures for Protein Ensembles. PLOS ONE 4(1):
e4203] between the cyclic-native, cyclic-biased, and
cyclic-(unfolded monomer) ensemble pairs. Applying weights to these
measurement criteria along with uncertainties in the weights allows
the use of multiple criteria decision-making analysis [Hwang C L,
Yoon K. Multiple attribute decision making: methods and
applications a state-of-the-art survey. vol. 186. Springer Science
& Business Media; (2012)] to select viable candidates that
differentiate misfolded/biased TDP-43 from native TDP-43 as well as
pre-folded TDP-43 monomer (i.e. transient unfolded TDP-43 monomer).
A sequence of length 77 residues in RRM1 was used to model an
unfolded monomer of the RRM1 domain, starting from amino acid 103
and ending at amino acid 179. The analysis was performed and used
to assess the similarity of TTE and TTEQ (SEQ ID NO:1) epitopes in
the context of biased TDP-43 RRM1 domain and various cyclic
peptides comprising said epitopes, in the context of different
scaffolds consisting of variable numbers of glycine spacers. The
ensemble overlap was also measured, for the same simulation data,
in terms of the number of standard deviations between two separated
Gaussian distributions. All of the ensemble overlap data is shown
in Table 8B.
TABLE-US-00023 TABLE 8B 1- cyclic- (cyclic- cyclic- cyclic- d max-
cyclic- native- biased- monomer- native- (cyclic- monomer- Sequence
JSD JSD) JSD d biased-d) d CGTTEG 1.000 0.072 0.984 7.744 3.496
5.594 CGTTEGG 1.000 0.116 0.961 7.704 3.944 4.822 CGTTEQG 0.998
0.100 0.970 7.658 3.825 5.093 CGGTTEGG 1.000 0.080 0.989 7.778
3.533 5.810 CGTTEQGG 0.994 0.126 0.969 7.129 4.049 5.088 CGGTTEGGG
0.998 0.148 0.903 7.146 4.209 3.969 CGGTTEQGG 0.993 0.106 0.958
6.256 3.888 4.806 CGGGTTEGG 0.999 0.094 0.881 7.414 3.778 3.784
CGGGTTEGGG 0.980 0.157 0.868 5.420 4.247 3.677 CGGTTEQGGG 0.971
0.162 0.857 5.144 4.295 3.639 CGGGTTEQGG 0.980 0.128 0.928 5.574
4.043 4.314 CGGGGTTEGGG 0.979 0.172 0.815 5.373 4.368 3.327
CGGGGTTEGGGG 0.889 0.321 0.846 3.933 5.064 3.505
[0310] Cyclic peptides which overlapped significantly with TTE and
TTEQ (SEQ ID NO:1) epitopes in the context of biased TDP-43 RRM1
domain as measured by the JSD data in Table 8B, but had small
overlap with either natively folded TDP-43 or transient unfolded
TDP-43, included scaffolds (linker) with up to 9 amino acids (SEQ
ID NO: 35) and are given in Table 8C.
TABLE-US-00024 TABLE 8C Cyclic peptide SEQ ID NO CGTTEG SEQ ID NO:
28 CGTTEGG SEQ ID NO: 29 CGTTEQG SEQ ID NO: 3 CGGTTEGG SEQ ID NO:
30 CGTTEQGG SEQ ID NO: 23 CGGTTEGGG SEQ ID NO: 32 CGGTTEQGG SEQ ID
NO: 2 CGGGTTEGG SEQ ID NO: 31 CGGGTTEGGG SEQ ID NO: 33 CGGTTEQGGG
SEQ ID NO: 22 CGGGTTEQGG SEQ ID NO: 42 CGGGGTTEGGG SEQ ID NO: 34
CGGGGTTEGGGG SEQ ID NO: 35
Example 3
Cyclic Compound Construction Comprising a Conformationally
Constrained Epitope
[0311] Peptides comprising TTEQ (SEQ ID NO: 1) or TTE such as cyclo
(CGTTEQG) (SEQ ID NO:3) or cyclo(CGTTEG) (SEQ ID NO: 28) can be
cyclized head to tail.
[0312] A native ensemble comprising TTEQ (SEQ ID NO:1) or TTE and a
linker, preferably comprising 2, 3, or 4 amino acids and/or PEG
units, can be synthesized using known methods such as Fmoc based
solid phase peptide synthesis alone or in combination with other
methods. PEG molecules can be coupled to amine groups at the N
terminus for example using coupling chemistries described in Hamley
2014 [7] and Roberts et al. 2012 [8], each incorporated herein by
reference. The native ensemble compound may be cyclized by
covalently bonding 1) the amino terminus and the carboxy terminus
of the peptide+linker to form a peptide bond (e.g. cyclizing the
backbone), 2) the amino or carboxy terminus with a side chain in
the peptide+linker or 3) two side chains in the peptide+linker.
[0313] The bonds in the cyclic compound may be all regular peptide
bonds (homodetic cyclic peptide) or include other types of bonds
such as ester, ether, amide or disulfide linkages (heterodetic
cyclic peptide).
[0314] Peptides may be cyclized by oxidation of thiol- or
mercaptan-containing residues at the N-terminus or C-terminus, or
internal to the peptide, including for example cysteine and
homocysteine. For example two cysteine residues flanking the
peptide may be oxidized to form a disulphide bond. Oxidative
reagents that may be employed include, for example, oxygen (air),
dimethyl sulphoxide, oxidized glutathione, cystine, copper (II)
chloride, potassium ferricyanide, thallium (III) trifluro acetate
or other oxidative reagents such as may be known to those of skill
in the art and used with such methods as are known to those of
skill in the art.
[0315] Methods and compositions related to cyclic peptide synthesis
are described in US Patent Publication 2009/0215172. US Patent
publication 2010/0240865, US Patent Publication 2010/0137559 and
U.S. Pat. No. 7,569,541 describe various methods for cyclization.
Other examples are described in PCT Publication WO01/92466, and
Andreu et al., 1994. Methods in Molecular Biology 35:91-169.
[0316] More specifically, a cyclic peptide comprising the TTEQ (SEQ
ID NO: 1) epitope, TEQ epitope or TTE epitope can be constructed by
adding a linker comprising a spacer with cysteine residues flanking
and/or inserted in the spacer. The peptide can be structured into a
cyclic conformation by creating a disulfide linkage between the
non-native cysteines residues added to the N- and C-termini of the
peptide. It can also be synthesized into a cyclic compound by
forming a peptide bond between the N- and C-termini amino acids
(e.g. head to tail cyclization).
[0317] Peptide synthesis is performed by CPC Scientific Inc.
(Sunnyvale Calif., USA) following standard manufacturing
procedures. The structure of the cyclic peptide was designed to
mimic the conformation and orientation of the amino acid backbone
and side chains of TTEQ (SEQ ID NO: 1) in misfolded TDP-43
polypeptide.
Cyclo (CGTTEQG) (SEQ ID NO: 3)
[0318] Cyclo (CGTTEQG) (SEQ ID NO: 3) and cyclo (CGGTTEQGG) (SEQ ID
NO: 2) may be synthesized using the following method (CPC
Scientific Inc, Sunnyvale Calif.). The protected native ensemble
was synthesized by standard conventional Fmoc-based solid-phase
peptide synthesis on 2-chlorotrityl chloride resin, followed by
cleavage from the resin with 30% HFIP/DCM. Protected native
ensemble was cyclized to the corresponding protected cyclic peptide
by using EDC. HCl/HOBt/DIEA in DMF at low concentration. The
protected cyclic peptide was deprotected by TFA to give crude
cyclic peptide and the crude peptide was purified by RP HPLC to
give pure cyclic peptide after lyophilize.
[0319] Cyclo (CGTTEQG) (SEQ ID NO: 3) and cyclo (CGGTTEQGG) (SEQ ID
NO: 2) can be prepared by amide condensation of the linear peptide
CGTTEQG (SEQ ID NO: 3) or CGGTTEQGG (SEQ ID NO: 2)
respectively.
[0320] Cyclo (C-PEG2-TTEQG) (SEQ ID NO: 24) and cyclo
(C-PEG2-TTEQGG) (SEQ ID NO: 25) can be prepared by amide
condensation of the linear compound C-PEG2-TTEQG (SEQ ID NO: 24) or
C-PEG2-TTEQGG (SEQ ID NO: 25) respectively.
[0321] Cyclo (CGTTEQ-PEG2) (SEQ ID NO: 26) and cyclo (CGGTTEQ-PEG2)
(SEQ ID NO: 27) can be prepared by amide condensation of the linear
compound CGTTEQ-PEG2 (SEQ ID NO: 26) or CGGTTEQ-PEG2 (SEQ ID NO:
27) respectively.
[0322] Linear (CGTTEQG) (SEQ ID NO: 3) or Linear (CGGTTEQGG) (SEQ
ID NO: 2) may be prepared (CPC Scientific Inc, Sunnyvale Calif.).
The protected native ensemble was synthesized by standard
conventional Fmoc-based solid-phase peptide synthesis on
Fmoc-Gly-Wang resin, then the protected peptide was cleaved by TFA
to give crudepeptide and the crude peptide was purified by RP HPLC
to give pure peptide after lyophilize, and which was used to
conjugate BSA.
[0323] Similarly, cyclo (CGTTEG) (SEQ ID NO: 28) and Cyclo(CGTTEGG)
(SEQ ID NO: 29) can be prepared by amide condensation of the linear
peptide CGTTEG (SEQ ID NO: 28) or CGTTEGG (SEQ ID NO: 29)
respectively.
[0324] Cyclo(C-PEG2-TTEG) (SEQ ID NO: 36) and Cyclo(C-PEG2-TTEGG)
(SEQ ID NO: 37) can be prepared by amide condensation of the linear
compound C-PEG2-TTEG (SEQ ID NO: 36) or C-PEG2-TTEGG (SEQ ID NO:
37) respectively.
[0325] Cyclo(CGTTE-PEG2) (SEQ ID NO: 38) and Cyclo(CGGTTE-PEG2)
(SEQ ID NO: 39) can be prepared by amide condensation of the linear
compound CGTTE-PEG2 (SEQ ID NO: 38) or CGGTTE-PEG2 (SEQ ID NO: 39)
respectively.
[0326] Cyclic and Linear (CGTTEG) (SEQ ID NO: 28) or Linear
(CGGTTEGG) (SEQ ID NO: 30) peptides may be prepared (CPC Scientific
Inc, Sunnyvale Calif.). The protected was synthesized by standard
conventional Fmoc-based solid-phase peptide synthesis on
Fmoc-Gly-Wang resin, then the protected peptide was cleaved by TFA
to give crudepeptide and the crude peptide was purified by RP HPLC
to give pure peptide after lyophilize, and which was used to
conjugate BSA.
Immunogen Construction
[0327] The cyclic compounds cyclo (CGTTEQG) (SEQ ID NO: 3), cyclo
(CGGTTEQGG) (SEQ ID NO: 2), cyclo (CGTTEG) (SEQ ID NO: 28) and
cyclo (CGTTEGG) (SEQ ID NO: 29) are synthesized as described above
and then conjugated to KLH (for immunizing) or BSA (for screening)
(CPC Scientific Inc, Sunnyvale Calif.). BSA or KLH is re-activated
by SMCC in PBS buffer, then a solution of the pure peptide in PBS
buffer is added to the conjugation mixture, the conjugation mixture
is stirred at room temperature for 2 h. Then the conjugation
mixture is lyophilized after dialysis to give the conjugation
product.
[0328] Peptides can also be conjugated to KLH (for immunizing) and
BSA (for screening) using a trifluoroacetate counter ion protocol.
Peptides are desalted and checked by MS and HPLC to confirm at
least 95% pure.
Example 4
Antibody Generation and Selection
[0329] A conformationally constrained compound optionally a cyclic
compound such as a cyclic peptide comprising TTEQ (SEQ ID NO: 1) or
TTE such as cyclo (CGTTEQG) (SEQ ID NO: 3), cyclo(CGGTTEQGG) (SEQ
ID NO: 2), cyclo (CGTTEG) (SEQ ID NO: 28) or cyclo (CGTTEGG) (SEQ
ID NO: 29) is linked to Keyhole Limpet Hemocyanin (KLH). The linked
peptide or peptides are sent to Immunoprecise Antibodies LTD
(Victoria BC, Canada) for mouse monoclonal antibody production,
following protocols approved by the Canadian Council on Animal
Care.
Immunization
[0330] Briefly, female BALB/c mice (Charles River Laboratories,
Quebec) are immunized. A series of subcutaneous aqueous injections
containing antigen but no adjuvant are given over a period of 19
days. Mice are immunized with 100 .mu.g per mouse per injection of
a 0.5 mg/mL solution in sterile saline of cyclic peptide-KLH. All
mice are euthanized on Day 19 and lymphocytes are harvested for
hybridoma cell line generation.
Fusion/Hybridoma Development
[0331] Lymphocytes are isolated and fused with murine SP2/0 myeloma
cells in the presence of poly-ethylene glycol (PEG 1500). Fused
cells are cultured using HAT selection. This method uses a
semi-solid methylcellulose-based HAT selective medium to combine
the hybridoma selection and cloning into one step. Single
cell-derived hybridomas grow to form monoclonal colonies on the
semi-solid media. Approximately 10 days after the fusion event,
resulting hybridoma clones are transferred to 96-well tissue
culture plates and grown in HT containing medium until mid-log
growth is reached (approximately 5 days).
Hybridoma Analysis (Screening)
[0332] Tissue culture supernatants from the hybridomas can be
tested by indirect ELISA on screening antigen (cyclic or linear
peptide-BSA) and probed for both IgG and IgM antibodies using a
Goat anti-IgG/IgM(H&L)-HRP secondary and developed with TMB
substrate.
[0333] Clones >0.2 OD in this assay are taken to the next round
of testing. Positive cultures are retested on screening antigen to
confirm secretion and on an irrelevant antigen (Human Transferrin).
Clones of interest are isotyped by antibody trapping ELISA to
determine if they are IgG or IgM isotype and can be tested by
indirect ELISA on other cyclic peptide-BSA conjugates as well as
native-BSA conjugates to evaluate cross-reactivity.
[0334] Positive IgG-secreting clones are subjected to large-scale
production.
Direct Binding Assays
[0335] Binding of clones to linear and cyclic peptides (conjugated
to BSA) can be examined by surface plasmon resonance using a
Biacore.TM. 3000 instrument (GE Healthcare).
[0336] Binding analysis is carried out using a high density (at
least 1000 response units (RU)) of antigen immobilized on flow
cells. Dilutions of a selected clone are sequentially injected over
the surface to assess binding.
[0337] For affinity kinetics and specificity analysis, a
conformational peptide comprising TTEQ (SEQ ID NO: 1) or TTE and
BSA, for example a cyclic peptide having the sequence of SEQ ID
NO:2, 3 28 or 29 conjugated to BSA via amine conjugation, are
immobilized at low densities (50-100 RU) on adjacent flow cells.
Serial 2-fold dilutions of a selected clone (4.7 nM to 75 nM) are
then sequentially injected over the surfaces at 60 .mu.l/minute for
3 minutes, followed by a dissociation phase. Following a
double-reference subtraction, the sensorgrams are fitted to a
Langmuir 1:1 binding model. Up to three separate analyses are
performed on 3 consecutive days using the same sensorchip and the
same conditions.
[0338] Binding analysis can be carried out also using Molecular
Affinity Screening System (MASS-1) (Sierra Sensors GmbH, Hamburg,
Germany). MASS-1 is a Surface Plasmon Resonance (SPR) Imaging
analytical biosensor that employs high intensity laser light and
high speed optical scanning to monitor binding interactions in real
time. The peptide-BSA conjugates are covalently immobilized on
separate flow cells of a High Amine Capacity (HAC) sensor chip,
using standard amine-coupling chemistry, and unreacted sites
blocked. Adjacent flow cells are similarly immobilized with BSA as
a reference control surface.
[0339] Tissue culture supernatants are screened for the presence of
antibody binding against their cognate cyclic peptide. Each sample
is diluted and injected in duplicate over the immobilized peptide
and BSA reference surfaces for 2 minutes, followed by injection of
running buffer only for a 5-min dissociation phase. After every
analytical cycle, the sensor chip surfaces are regenerated.
Sensorgrams are double-referenced by subtracting out binding from
the BSA reference surfaces and blank running buffer injections, and
binding response report points measured at 20 seconds before the
end of the injection in a 20 second window of data.
Isotyping
[0340] The hybridoma antibodies are isotyped using antibody trap
experiments. Trap plates are coated with 1:10,000 Goat anti-mouse
IgG/IgM(H&L) antibody at 100 uL/well carbonate coating buffer
pH9.6 overnight at 4 C. Primary antibody (hybridoma supernatants)
is added at 100 ug/mL. Secondary Antibody is added at 1:5,000. Goat
anti-mouse IgGy-HRP or 1:10,000 Goat anti-mouse IgMp-HRP is added
at 100 uL/well in PBS-Tween for 1 hour at 37 C with shaking. All
washing steps are performed for 30 mins with PBS-Tween. The
substrate TMB is added at 50 uL/well, developed in the dark and
stopped with equal volume 1M HCl.
Example 5
[0341] Monoclonal antibodies were made using the methods in Example
4. Specifically cyclo(CGGTTEQGG) (SEQ ID NO: 2) conjugated to KLH
or cyclo(CGTTEQG) (SEQ ID NO:3) conjugated to KLH via the cysteine
residues were injected into mice and monoclonal antibodies were
generated.
[0342] Antibody-containing hybridoma tissue culture supernatants
were typed for immunoglobulin type and screened against negative
control peptide and BSA. IgG producing clones that did not bind the
negative control peptide or BSA were tested by ELISA for binding to
the immunizing cyclic peptides, to corresponding linear peptides
and related cyclic peptides cyclo(CGGTTEGGG) (SEQ ID NO: 32), cyclo
(CGTTEGG) (SEQ ID NO: 29) as described below.
ELISA Conditions:
[0343] ELISA plates were coated with 0.1 .mu.g/well with peptide
cyclo(CGGTTEQGG) (SEQ ID NO: 2) or cyclo(CGTTEQG) (SEQ ID NO: 3) or
the linear versions thereof at 100 .mu.L/well in carbonate Coating
Buffer (pH 9.6) overnight at 4 C. In other assays, cyclo(CGGTTEGGG)
(SEQ ID NO: 32) or cyclo (CGTTEGG) (SEQ ID NO: 29) were also used
to coat the ELISA plates.
[0344] The plates were blocked with 3% skim milk powder in PBS for
1 hour at room temperature. The primary antibody, hybridoma tissue
culture supernatant neat at 100 uL/well, was incubated for 1 hour
at 37 C with shaking. The secondary antibody, goat anti-mouse
IgGy-HRP at a 1:10,000 dilution was added at 100 uL/well in
PBS-Tween and incubated for 1 hour at 37 C with shaking. All
washing steps were performed for 30 mins with PBS-Tween. TMB
Substrate was added at 50 uL/well, developed in the dark and
stopped with equal volume 1M HCl. The development time was 1-2 min
and the plate was read at 450 nm.
[0345] The ELISA results are presented in Table 9 A and B for which
shows the binding affinity of monoclonal antibodies generated
against the immunizing peptide versus the corresponding linear
peptide. As shown therein, IgG antibodies were produced that showed
preferential binding to the immunizing cyclic peptides compared to
the linear peptide.
TABLE-US-00025 TABLE 9A Affinity for cyclo (CGGTTEQGG) (SEQ ID NO:
2) compared to linear peptide 2H10 3H5 6C5 9B10 9C5 9G4 11F3 Cyclo
2.516 2.835 1.101 1.877 2.286 1.896 1.105 (CGGTTEQGG) SEQ ID NO: 2
Linear 0.104 0.068 0.191 0.074 0.115 0.083 0.071 CGGTTEQGG SEQ ID
NO: 2
TABLE-US-00026 TABLE 9B Binding affinity for cyclo (CGTTEQG) (SEQ
ID NO: 3) compared to linear peptide 1G10 2G4 5B11 3C11 5D3 4B3 4D3
4E2 4G5 11D5 Cyclo 2.186 1.907 1.97 1.567 2.222 2.296 1.712 1.743
1.71 2.962 (CGTTEQ G) SEQ ID NO: 3 Linear 0.07 0.08 0.122 0.109
0.064 0.073 0.07 0.084 0.064 0.05 CGTTEQG SEQ ID NO: 3
[0346] In addition antibodies were tested for binding to related
cyclic peptides cyclo(CGGTTEGGG) (SEQ ID NO: 32) and cyclo
(CGTTEGG) (SEQ ID NO: 29) comprising the TTE epitope. Fifteen of 17
antibodies, had greater affinity for a related cyclic peptide
compared to the linear peptide corresponding to the immunogen and
14 of the 17 antibodies tested had about a 2 fold or greater
selectivity for a related cyclic peptide compared to the linear
peptide corresponding to the immunogen.
Example 6
Misfolded TDP-43 Characterization
[0347] Antibodies will be tested for their ability to bind native
TDP-43 polypeptide as well as misfolded TDP-43 polypeptide using
surface plasmon resonance and immunohistochemistry.
Surface Plasmon Resonance (Biacore) of Biological Samples.
[0348] Homogenization: Human and mouse neurological tissue samples
are weighed and subsequently submersed in a volume of fresh, ice
cold TBS (supplemented with 5 mM EGTA, 5 mM EDTA, (both from Sigma)
and EDTA-free protease inhibitor cocktail from Roche Diagnostics,
Laval QC, Canada) such that the final concentration of tissue is
20% (w/v). Tissue is homogenized in this buffer using a mechanical
probe homogenizer (3.times.30 sec pulses with 30 sec pauses in
between, all performed on ice). TBS homogenized samples are then
subjected to ultracentrifugation (70,000.times.g for 90 min).
Supernatants are collected, aliquoted and stored at -80.degree. C.
The protein concentration of TBS homogenates is determined using a
BCA protein assay (Pierce Biotechnology Inc, Rockford Ill.,
USA).
[0349] Surface Plasmon Resonance Analysis: CSF samples and
neurological tissue samples from ALS patients and/or FTD patients
and age-matched controls are analyzed. Test antibodies and an IgG1
isotype control are directly immobilized at high densities (10,000
RU) on 2 separate flow cells of a sensor chip. Using a Biacore
3000, diluted neurological tissue samples, homogenized in TBS are
injected sequentially over the surfaces for 300 seconds, followed
by 150 seconds of dissociation in buffer and surface regeneration.
Binding responses are double-referenced by subtraction of IgG1
reference surface binding and normalized with assay buffer, and the
different groups of samples compared.
Example 7
[0350] Human embryonic kidney cells (HEK293FT) were transiently
transfected with a modified form of TDP-43 with an HA-tag and
lacking a nuclear localization signal (TDP-43.sup..DELTA.NLS). This
form of the protein accumulates in the cytoplasm and forms
misfolded aggregates. Empty vector was used as a negative
control.
[0351] The cells were stained overnight at 4.degree. C. with 1
.mu.g/ml polyclonal rabbit antibody against the HA tag (to detect
misfolded cytoplasmic TDP-43) or with 10 .mu.g/ml of test antibody.
Bound antibodies were then detected by staining for 1 hour at room
temperature with fluorescently-labeled anti-rabbit (red Alexa Fluor
647) or anti-mouse (green Alexa Fluor 488) secondary antibody.
Nuclear DNA was stained with Hoeschst 33342 dye (blue). Micrographs
were acquired on a confocal Leica SP8 microscope in a Z-stack
fashion with 0.3 .mu.m steps. Included images represent a Z-plane
projection of the entire cell thickness. Z-stacked images (20-30
steps) of single fluorescence channels and merged signals were
captured.
[0352] The results are presented in FIG. 10. Panel A shows Hoechst
33342 dye stained cells and reveals the cell nuclei. FIG. 10B shows
cells stained for the HA tagged recombinant TDP-43.sup..DELTA.NLS.
Only the recombinant protein is detected. As expected the
exogenously expressed TDP-43 lacking a NLS was found in the
cytoplasm and is present in misfolded aggregates. FIG. 10C shows
results with a monoclonal antibody produced using cyclo(CGGTTEQGG)
(SEQ ID NO: 2). Predominantly cytoplasmic staining is present
suggesting the test antibody does not bind wild type nuclear
TDP-43. FIG. 10D shows a merged image wherein there is substantial
overlap (co-localization) between detection of HA tagged
recombinant TDP-43.sup..DELTA.NLS cytoplasmic aggregates and test
antibody staining of TDP-43.
Example 8
[0353] Human spinal cord homogenates were prepared from control and
sporadic ALS patients and were analysed by dot blot with selected
antibodies.
[0354] Tissue from a human without ALS was used as the control and
two different sporadic ALS tissue samples were assessed. One was a
tissue sample obtained from a patient carrying the C90rf72 mutation
and another was a tissue sample obtained from a patient with
unknown mutation status.
[0355] PVDF membranes were dotted with 10 micrograms of homogenate
in duplicate and the test antibodies and control antibody (mIgG1)
were used at a 500 fold dilution of 2 microgram/microliter stock
solution. Rabbit polyclonal TDP-43 antibody (ProteinTech, Rosemont
Ill.) was used as a positive control.
[0356] As shown in FIG. 11A, the IgG1 negative control produced low
background staining for all samples and as shown in FIG. 11B, the
positive control antibody produced a robust positive signal for all
tested samples.
[0357] Selective staining of sALS samples was seen using the test
antibodies. Antibody 1 is clone IG10, antibody 2 is clone 2H10,
antibody 3 is clone 11F3, antibody 4, is clone 3H5, antibody 5 is
4G5 and antibody 6 is clone 9C5. Antibody 6C5 also showed selective
staining of sALS samples.
Example 9
[0358] Several of the antibodies positive for binding aggregated
TDP-43 were sequenced. Immunoglobulin gene transcripts expressed by
the hybridomas were amplified with sets of proprietary primers from
cDNA generated from the hybridoma cells using standard RT-PCR
protocol and sequenced using a standard dye-terminator capillary
sequencing method (Immunoprecise, Victoria BC Canada).
[0359] Complementarity determining regions (CDRs) CDR1, CDR2 and
CDR3 are highlighted are bolded and underlined, and were identified
according to IgBLAST (available using ncbi tools (Ye et al.,
Nucelic Acids Research 2013, Vol. 41, Web Server Issue
doi:10:1093|nar|gkt382). Using this tool a query is searched with
BLAST against the IMGT or NCBI germline V gene database (the
sequences in such databases have been pre-annotated for the FR/CDR
boundaries). The top database sequence hit is used to map the
pre-annotated FR/CDR boundary information to the query sequence.
The BLAST search parameters are Expect cut-off, 20; word size 9;
mismatch penalty, -1; Dust filtering, off.
TABLE-US-00027 TABLE 10 Antibody variable domain sequences
Translated Protein Clone Isotype Consensus DNA Sequence Sequence
3H5 Heavy - CAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGA
QIQLVQSGPELKKPGETVK IgG1
CAGTCAAGATCTCCTGCAAGGCTTCTGGTTATACCTTCACAGACTATTC
ISCKASGYTFTDYSMHWVK SEQ ID
AATGCACTGGGTGAAACAGGCTCCAGGAAGGGTTTAAAGTGGATGGGCT
QAPGKGLKWMGWINTETGE NO: 45,
GGATAAACACTGAGACTGGTGAGCCAACATATGCAGATGACTTCAAGGG
PTYADDFKGRFAFSLETSA 46
ACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAG
STAYLQINNLKNEDTATYF
ATCAACAACTCAAAAATGAGGACACGGCTACATATTTCTGTGCTAGTCG
CASRRWYPYYFDYWGQGTT
ACGATGGTACCCGTACTACTTTGACTACTGGGGCCAAGGCACCACTCTC LTVSS
ACAGTCTCCTCA Light -
CAGGCTGTTGTGACTCAGGAATCTGCACTCACCACATCACCTGGTGAAA
QAVVTQESALTTSPGETVT Lambda
CAGTCACACTCACTTGTCGCTCAAGTACTGGGGCTGTTACAACTAGTAA
LTCRSSTGAVTTSNYANWV SEQ ID
CTATGCCAACTGGGTCCAAGAAAAACCAGATCATTTATTCACTGGTCTA
QEKPDHLFTGLIGGPNNRA NO: 47,
ATAGGTGGTCCCAACAACCGAGCTCCAGGTGTTCCTGCCAGATTCTCAG
PGVPARFSGSLIGDKAALT 48
GCTCCCTGATTGGAGACAAGGCTGCCCTCACCATCACAGGGGCACAGAC
ITGAQTEDEAIYFCALWYS
TGAGGATGAGGCATATATTTCTGTGCTCTATGGTACAGCAACCATTGGG NHWVFGGGTKLTVL
TGTTCGGTGGAGGAACCAAACTGACTGTCCTA 6C5 Heavy -
GAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGCAGCCTGGAGGGT
EVKLVESGGGLVQPGGSLK IgG1
CCCTGAAACTCTCCTGTGCAACCTCTGGATTCACTTTCAGTGACTATTA
LSCATSGFTFSDYYMYWVR SEQ ID
CATGTATTGGGTTCGCCAGACTCCAGAGAGAGGCTGGAGTGGGTCGCAT
QTPEKRLEWVAYISNGGGS NO: 49,
ACATTAGTAATGGTGGTGGTAGCACCTATTATCCAGACACTGTAAAGGG
TYYPDTVKGRFTISRDNAK 50
CCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAA
NTLYLQMSRLKSEDTAMYY
ATGAGCCGTTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAAGAGA
CAREGGTAWFAYWGQGTLV
GGGGGGTACCGCCTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACT TVSA GTCTCTGCA
Light - GATGTTTTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAG
DVLMTQTPLSLPVSLGDQA Kappa
ATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAGCATTGTACATAGTAA
SISCRSSQSIVHSNGNTYL SEQ ID
TGGAAACACCTATTTAGAATGGTACCTGCGAAACCAGGCCAGTCTCCAA
EWYLQKPGQSPKLLIYKVS NO: 51,
AGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAG
NRFSGVPDRFSGSGSGTDF 52
GTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGA
TLKISRVEAEDLGVYYCFQ
GTGGAGGCTAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGT GSHVPYTFGGGTKLEIK
TCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA 9C5 Heavy -
GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGT
EVQLVESGGGLVKPGGSLK IgG3
CCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTGACTATTA
LSCAASGFTFSDYYMYWVR SEQ ID
CATGTATTGGGTTCGCCAGACTCCGGAAAGAGGCTGGAGTGGGTCGCAA
QTPEKRLEWVATISDGGSY NO: 53,
CCATTAGTGATGGTGGTAGTTACACCTCCTATCCAGACAGTGTGAAGGG
TSYPDSVKGRFTISRDNAK 54
ACGATTCACCATCTCCAGAGACAATGCCAAGAACAACCTGTACCTGCAA
NNLYLQMSSLRSEDTAMYY
ATGAGCAGTTGAGGTCTGAGGACACAGCCATGTATTACTGTGCAAGAGA
CARDYYGSSSYTSGFAYWG
TTACTATGGTAGTAGTAGCTACACCTCGGGCTTTGCTTACTGGGGCCAA QGTLVTVSA
GGGACTCTGGTCACTGTCTCTGCA Light -
GATGTTTTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAG
DVLMTQTPLSLPVSLGDQA Kappa
ATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAGCATTGTACATAGTAA
SISCRSSQSIVHSNGNTYL SEQ ID
TGGAAACACCTATTTAGAATGGTACCTGCGAAACCAGGCCAGTCTCCAA
EWYLQKPGQSPKLLIYKVS NO: 55,
AGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAG
NRFSGVPDRFSGSGSGTDF 56
GTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGA
TLKISRVEAEDLGVYYCFQ
GTGGAGGCTAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGT GSHVPGTFGGGTKLEIK
TCCTGGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA 11F3 Heavy -
CAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGA
QIQLVQSGPELKKPGETVK IgG1
CAGTCAAGATCTCCTGCAAGGCTTCTGGTTATACCTTCACAGACTATTC
ISCKASGYTFTDYSMHWVK SEQ ID
AATGCACTGGGTGAAGCACTCTCCAGGAAGGGTTTAAAGTGGATGGGCT
HSPGKGLKWMGWINTETGE NO: 57,
GGATAAACACTGAGACTGGTGAGCCAACATATGCAGATGACTTCAAGGG
PTYADDFKGRFAFSLETSA 58
ACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGCACTGCCTATTTGCAG
STAYLQINNLKNEDTATYF
ATCAACAACTCAAAAATGAGGACACGGCTACATATTTCTGTGCTAGAGG
CARGYGNWFAYWGQGTLVT
GTATGGCAACTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTC VSA TCTGCA Light
- CAAATTGTTCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCTAGGGG
QIVLTQSPAIMSASLGERV Kappa
AACGGGTCACCATGACCTGCACTGCCAGCTCAAGTGTAAGTTCCAGTTA
TMTCTASSSVSSSYLHWYQ SEQ ID
CTTACACTGGTACCAGCAGAAGCCAGGATCTCCCCCAAACTCTGGATTT
QKPGSSPKLWIYSTSNLAS NO: 59,
ATAGCACATCCAACCTGGCTTCTGGAGTCCCAGCTCGCTTCAGTGGCAG
GVPARFSGSGSGTSYSLTI 60
TGGGTCTGGGACCTCTTACTCTCTCACAATCAGCAGCATGGAGGCTGAA
SSMEAEDAATYYCHQYHRS
GATGCTGCCCTTATTACTGCCACCAGTATCATCGTTCCCCGCTCACGTT PLTFGAGTKLELK
CGGTGCTGGGACCAAGCTGGAGCTGAAA 2H10 Heavy -
GAGGTGAAGCTGGTGGAATCTGGAGGAGGCTTGGTACAGCCTGGGGGTT
EVKLVESGGGLVQPGGSLR IgG1
CTCTGAGACTCTCCTGTGCAACTTCTGGGTTCACCTTCAGTGATTTCTA
LSCATSGFTFSDFYINWVR SEQ ID
CATAAACTGGGTCCGCCAGCCTCCAGGGAGAGACTGGAGTGGATTGCTA
QPPGKRLEWIATSRSKAHD NOs: 61,
CAAGTAGGAGCAAAGCTCATGATTATACAACAGAGTACAGTGCATCTGT
YTTEYSASVKGRFIVSRDT 62
GAAGGGTCGGTTCATCGTCTCCAGAGACACTTCCCAAAGCATCCTCTAC
SQSILYLQMDALKPEDTAI VH1
CTTCAGATGATGCCCTAAAACCTGAGGACACTGCCATTTATTACTGTGC
YYCARDTWYGSWFAYWGQG
AAGAGATACATGGTATGGTTCCTGGTTTGCTTACTGGGGCCAAGGGACT TLVTVST
CTGGTCACTGTCTCTACA Light -
GATGTTTTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAG
DVLMTQTPLSLPVSLGDQA Kappa
ATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAGCATTGTACATAGTAA
SISCRSSQSIVHSNGNTYL SEQ ID
TGGAAACACCTATTTAGAATGGTACCTGCGAAACCAGGCCAGTCTCCAA
EWYLQKPGQSPKLLIYKVS NOs: 63,
AGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAG
NRFSGVPDRFSGSGSGTDF 64
GTTCAGTGGCAGTGGATCAGGAACAGATTTCACACTCAAGATCAGCAGA
TLKISRVEAEDLGVYYCFQ
GTGGAGGCTAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGT GSHVPPTFGGGSKLE1K
TCCTCCGACGTTCGGTGGAGGCTCCAAGCTGGAAATCAAA 2H10 Heavy -
CAGGTCCAGCTGCAGCAGTCTGGAACTGAACTGGTGAGGCCTGGGACTT
QVQLQQSGTELVRPGTSVK IgG1
CAGTGAAGGTGTCCTGCAAGGCTTCTGGATACGCCTTCACTAATTACTT
VSCKASGYAFTNYLIEWVK SEQ ID
GATAGAGTGGGTAAAGCAGAGGCCTGGACGGGCCTTGAGTGGATTGGAG
QRPGQGLEWIGVINPGSGG NOs: 65,
TGATTAATCCTGGAAGTGGTGGTACTAGGTACAATGAGAAGTTCAAGGG
TRYNEKFKGKATLTADKSS 66
CAAGGCAACACTGACTGCAGACAAATCCTCCACCACTGCCCACATGCAG
TAHMQLSSLTSDDSAVYFC VH2
CTCAGCAGCTGACATCTGATGACTCTGCGGTCTATTTCTGTGCAAGATG
ARWGGNYSGYAMDYWGQGT
GGGGGGAAACTACTCTGGCTATGCTATGGACTACTGGGGTCAAGGAACC SVTVSS
TCAGTCACCGTCTCCTCA Light -
GATGTTTTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAG
DVLMTQTPLSLPVSLGDQA Kappa
ATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAGCATTGTACATAGTAA
SISCRSSQSIVHSNGNTYL SEQ ID
TGGAAACACCTATTTAGAATGGTACCTGCGAAACCAGGCCAGTCTCCAA
EWYLQKPGQSPKLLIYKVS NOs: 63,
AGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAG
NRFSGVPDRFSGSGSGTDF 64
GTTCAGTGGCAGTGGATCAGGAACAGATTTCACACTCAAGATCAGCAGA
TLKISRVEAEDLGVYYCFQ
GTGGAGGCTAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACATGT GSHVPPTFGGGSKLE1K
TCCTCCGACGTTCGGTGGAGGCTCCAAGCTGGAAATCAAA
[0360] Two heavy chains were identified for antibody 2H10 which are
labelled VH1 and VH2.
[0361] Whether one or both heavy chains produce antibodies
selective for its cyclic peptide immunogen, can be confirmed by
expressing each heavy chain (or variable region) with the light
chain (or variable region) and assessing target binding.
[0362] Antibody 2H10-VH1 heavy chain alignment is more closely
related to the heavy chains for 6C5 and 9C5 compared to
2H10-V2.
Example 10
Immunofluorescent Staining of TDP-43 Using Antibody 9C5
[0363] Misfolded TDP-43 was recombinantly expressed using the
construct and protocol described in Example 7 with the following
modifications to reduce background. The primary and secondary
antibodies were spun for 10 min at 10000 RPM prior to use, and the
sections were blocked with 10% NGS for 1 hour at RT prior to
primary addition. DAPI stain is used to identify the nucleus.
[0364] As shown in FIG. 12C, 9C5 antibody detected TDP-43
cytoplasmic inclusions of misfolded TDP-43. FIG. 12A shows DAPI
stained cells confirming that the TDP43 detected is cytoplasmic.
Staining was also performed for HA (FIG. 12B) as the TDP-43
recombinantly expressed is HA tagged which primarily colocalized
with 9C5 staining (FIG. 12D).
TABLE-US-00028 TABLE 11 Epitope and Cyclic Compound Sequences 1.
TTEQ (SEQ ID NO: 1) 2. CGGTTEQGG, cyclo (CGGTTEQGG) (SEQ ID NO: 2)
3. CGTTEQG, cyclo (CGTTEQG) (SEQ ID NO: 3) 4. GTTEQG (SEQ ID NO: 4)
5. TTEQG (SEQ ID NO: 5) 6. GTTEQ (SEQ ID NO: 6) 7. KTTEQD (SEQ ID
NO: 7) 8. TEQD (SEQ ID NO: 8) 9. TTEQD (SEQ ID NO: 9) 10. KTTE (SEQ
ID NO: 10) 11. TTEQDL (SEQ ID NO: 11) 12. KTTEQ (SEQ ID NO: 12) 13.
CGTTEQGC, cyclic (CGTTEQGC) (SEQ ID NO: 13) 14. KTTEQDL (SEQ ID NO:
14) 15. TEQDLK (SEQ ID NO: 15) 16. TEQDLKE (SEQ ID NO: 16) 17.
TEQDLKEY (SEQ ID NO: 17) 18. TEQDLKEYF (SEQ ID NO: 18) 19. EQDL
(SEQ ID NO: 19) 20. VVKTTEQ (SEQ ID NO: 20) 21. TTEQDLKEYFSTFGEV
(SEQ ID NO: 21) 22. CGGTTEQGGG, cyclo (CGGTTEQGGG) (SEQ ID NO: 22)
23. CGTTEQGG, cyclo (CGTTEQGG) (SEQ ID NO: 23) 24. C-PEG2-TTEQG,
cyclo (C-PEG2-TTEQG), CTTEQG (SEQ ID NO: 24) 25. C-PEG2-TTEQGG,
cyclo (C-PEG2-TTEQGG), CTTEQGG (SEQ ID NO: 25) 26. CGTTEQ-PEG2,
cyclo (CGTTEQ-PEG2), CGTTEQ (SEQ ID NO: 26) 27. CGGTTEQ-PEG2,
cyclol (CGTTEQ-PEG2), CGTTEQ (SEQ ID NO: 27) 28. CGTTEG, cyclo
(CGTTEG) (SEQ ID NO: 28) 29. CGTTEGG, cyclo (CGTTEGG), (SEQ ID NO:
29) 30. CGGTTEGG, cyclo (CGGTTEGG), (SEQ ID NO: 30) 31. CGGGTTEGG,
cyclo (CGGGTTEGG), (SEQ ID NO: 31) 32. CGGTTEGGG, cyclo
(CGGTTEGGG), (SEQ ID NO: 32) 33. CGGGTTEGGG, cyclo (CGGGTTEGGG),
(SEQ ID NO: 33) 34. CGGGGTTEGGG, cyclo (CGGGGTTEGGG), (SEQ ID NO:
34) 35. CGGGGTTEGGGG, cyclo (CGGGGTTEGGGG), (SEQ ID NO: 35) 36.
C-PEG2-TTEG, cyclo (C-PEG2-TTEG), CTTEG (SEQ ID NO: 36) 37.
C-PEG2-TTEGG, cyclo (C-PEG2-TTEGG), CTTEGG (SEQ ID NO: 37) 38.
CGTTE-PEG2, cyclo (CGTTE-PEG2), CGTTE (SEQ ID NO: 38) 39.
CGGTTE-PEG2, cyclol (CGGTTE-PEG2), CGGTTE (SEQ ID NO: 39) 40. GGCGG
(SEQ ID NO: 40) 41. GCGG (SEQ ID NO: 41) 42. CGGGTTEQGG, cyclo
(CGGGTTEQGG), (SEQ ID NO: 42) 43. CGGGGTTEQGGG, cyclo
(CGGGGTTEQGGG), (SEQ ID NO: 43) 44. CGGGGTTEQGGGG, cyclo
(CGGGGTTEQGGGG), (SEQ ID NO: 44)
[0365] While the present application has been described with
reference to what are presently considered to be the preferred
examples, it is to be understood that the application is not
limited to the disclosed examples. To the contrary, the application
is intended to cover various modifications and equivalent
arrangements included within the spirit and scope of the appended
claims.
[0366] All publications, patents and patent applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety. Specifically, the sequences associated
with each accession numbers provided herein including for example
accession numbers and/or biomarker sequences (e.g. protein and/or
nucleic acid) provided in the Tables or elsewhere, are incorporated
by reference in its entirely.
[0367] The scope of the claims should not be limited by the
preferred embodiments and examples, but should be given the
broadest interpretation consistent with the description as a
whole.
CITATIONS FOR REFERENCES REFERRED TO IN THE SPECIFICATION
[0368] [1] Kuo P H, Chiang C H, Wnag Y T, Doudeva L G, Yuan H S,
The Crystal Structure of TDP-43 RRM1-DNA Complex Reveals the
Specific Recognition for UG- and TG-Rich Nucleic Acids. Nucleic
Acids Res., 2014, vol 42, 4712. [0369] [2] DOI: 10.2210/pdb1wf0/pdb
(No publication). [0370] [3] Mompean, M., Romano, V.,
Pantoja-Uceda, D., Stuani, C., Baralle, F. E., Buratti, E., and
Laurents, D. V. The TDP-43 N-Terminal Domain Structure at High
Resolution. FEBS J., 2016, 283, 1242. [0371] [4] Arai, T.,
Hasegawa, M., Akiyama, H., Ikeda, K., Nonaka, T., Mori, H., Mann,
D., Tsuchiya, K., Yoshida, M., Hashizume, Y., and Oda, T. TDP-43 is
a component of ubiquitin-positive tau-negative inclusions in
frontotemporal lobar degeneration and amyotrophic lateral
sclerosis. Biochem. Biophys. Res. Commun., 2006, 351, 602-611.
[0372] [5] Chantelle F. Sephton, Shannon K. Good, Stan Atkin,
Colleen M. Dewey, Paul Mayer III, Joachim Herz, and Gang Yu J.
Biol. Chem. 2010, vol. 285, No. 9, 6826-6834. [0373] [6] Abel, O.,
Powell, J. F., Andersen, P. M., and Al-Chalabi, A. Hum Mutat, 2012,
33:1345-51. [0374] [7] Hamley, I. W. PEG-Peptide Conjugates 2014;
15, 1543-1559; dx.doi.org/10.1021/bm500246w [0375] [8] Roberts, M J
et al Chemistry for peptide and protein PEGylation 64: 116-127.
Sequence CWU 1
1
9214PRTHomo Sapiens 1Thr Thr Glu Gln129PRTArtificial
SequenceSynthetic Construct 2Cys Gly Gly Thr Thr Glu Gln Gly Gly1
537PRTArtificial SequenceSynthetic Construct 3Cys Gly Thr Thr Glu
Gln Gly1 546PRTArtificial SequenceSynthetic Construct 4Gly Thr Thr
Glu Gln Gly1 555PRTArtificial SequenceSynthetic Construct 5Thr Thr
Glu Gln Gly1 565PRTArtificial SequenceSynthetic Construct 6Gly Thr
Thr Glu Gln1 576PRTHomo Sapiens 7Lys Thr Thr Glu Gln Asp1
584PRTHomo Sapiens 8Thr Glu Gln Asp195PRTHomo Sapiens 9Thr Thr Glu
Gln Asp1 5104PRTHomo Sapiens 10Lys Thr Thr Glu1116PRTHomo Sapiens
11Thr Thr Glu Gln Asp Leu1 5125PRTHomo Sapiens 12Lys Thr Thr Glu
Gln1 5138PRTArtificial SequenceSynthetic Construct 13Cys Gly Thr
Thr Glu Gln Gly Cys1 5147PRTHomo Sapiens 14Lys Thr Thr Glu Gln Asp
Leu1 5156PRTHomo Sapiens 15Thr Glu Gln Asp Leu Lys1 5167PRTHomo
Sapiens 16Thr Glu Gln Asp Leu Lys Glu1 5178PRTHomo Sapiens 17Thr
Glu Gln Asp Leu Lys Glu Tyr1 5189PRTHomo Sapiens 18Thr Glu Gln Asp
Leu Lys Glu Tyr Phe1 5194PRTHomo Sapiens 19Glu Gln Asp
Leu1206PRTHomo Sapiens 20Trp Lys Thr Thr Glu Gln1 52116PRTHomo
Sapiens 21Thr Thr Glu Gln Asp Leu Lys Glu Tyr Phe Ser Thr Phe Gly
Glu Val1 5 10 152210PRTArtificial SequenceSynthetic Construct 22Cys
Gly Gly Thr Thr Glu Gln Gly Gly Gly1 5 10238PRTArtificial
SequenceSynthetic Construct 23Cys Gly Thr Thr Glu Gln Gly Gly1
5246PRTArtificial SequenceSynthetic Construct 24Cys Thr Thr Glu Gln
Gly1 5257PRTArtificial SequenceSynthetic Construct 25Cys Thr Thr
Glu Gln Gly Gly1 5266PRTArtificial SequenceSynthetic Construct
26Cys Gly Thr Thr Glu Gln1 5276PRTArtificial SequenceSynthetic
Construct 27Cys Gly Thr Thr Glu Gln1 5286PRTArtificial
SequenceSynthetic Construct 28Cys Gly Thr Thr Glu Gly1
5297PRTArtificial SequenceSynthetic Construct 29Cys Gly Thr Thr Glu
Gly Gly1 5308PRTArtificial SequenceSynthetic Construct 30Cys Gly
Gly Thr Thr Glu Gly Gly1 5319PRTArtificial SequenceSynthetic
Construct 31Cys Gly Gly Gly Thr Thr Glu Gly Gly1 5329PRTArtificial
SequenceSynthetic Construct 32Cys Gly Gly Thr Thr Glu Gly Gly Gly1
53310PRTArtificial SequenceSynthetic Construct 33Cys Gly Gly Gly
Thr Thr Glu Gly Gly Gly1 5 103411PRTArtificial SequenceSynthetic
Construct 34Cys Gly Gly Gly Gly Thr Thr Glu Gly Gly Gly1 5
103512PRTArtificial SequenceSynthetic Construct 35Cys Gly Gly Gly
Gly Thr Thr Glu Gly Gly Gly Gly1 5 10365PRTArtificial
SequenceSynthetic Construct 36Cys Thr Thr Glu Gly1
5376PRTArtificial SequenceSynthetic Construct 37Cys Thr Thr Glu Gly
Gly1 5385PRTArtificial SequenceSynthetic Construct 38Cys Gly Thr
Thr Glu1 5396PRTArtificial SequenceSynthetic Construct 39Cys Gly
Gly Thr Thr Glu1 5405PRTArtificial SequenceLinker 40Gly Gly Cys Gly
Gly1 5414PRTArtificial SequenceLinker 41Gly Cys Gly
Gly14210PRTArtificial SequenceSynthetic Construct 42Cys Gly Gly Gly
Thr Thr Glu Gln Gly Gly1 5 104312PRTArtificial SequenceSynthetic
Construct 43Cys Gly Gly Gly Gly Thr Thr Glu Gln Gly Gly Gly1 5
104413PRTArtificial SequenceSynthetic Construct 44Cys Gly Gly Gly
Gly Thr Thr Glu Gln Gly Gly Gly Gly1 5 1045355DNAMus musculus
45cagatccagt tggtgcagtc tggacctgag ctgaagaagc ctggagagac agtcaagatc
60tcctgcaagg cttctggtta taccttcaca gactattcaa tgcactgggt gaaacaggct
120ccaggaaggg tttaaagtgg atgggctgga taaacactga gactggtgag
ccaacatatg 180cagatgactt caagggacgg tttgccttct ctttggaaac
ctctgccagc actgcctatt 240tgcagatcaa caactcaaaa atgaggacac
ggctacatat ttctgtgcta gtcgacgatg 300gtacccgtac tactttgact
actggggcca aggcaccact ctcacagtct cctca 35546119PRTMus musculus
46Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu1
5 10 15Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp
Tyr 20 25 30Ser Met His Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys
Trp Met 35 40 45Gly Trp Ile Asn Thr Glu Thr Gly Glu Pro Thr Tyr Ala
Asp Asp Phe 50 55 60Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala
Ser Thr Ala Tyr65 70 75 80Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp
Thr Ala Thr Tyr Phe Cys 85 90 95Ala Ser Arg Arg Trp Tyr Pro Tyr Tyr
Phe Asp Tyr Trp Gly Gln Gly 100 105 110Thr Thr Leu Thr Val Ser Ser
11547326DNAMus musculus 47caggctgttg tgactcagga atctgcactc
accacatcac ctggtgaaac agtcacactc 60acttgtcgct caagtactgg ggctgttaca
actagtaact atgccaactg ggtccaagaa 120aaaccagatc atttattcac
tggtctaata ggtggtccca acaaccgagc tccaggtgtt 180cctgccagat
tctcaggctc cctgattgga gacaaggctg ccctcaccat cacaggggca
240cagactgagg atgaggcata tatttctgtg ctctatggta cagcaaccat
tgggtgttcg 300gtggaggaac caaactgact gtccta 32648109PRTMus musculus
48Gln Ala Val Val Thr Gln Glu Ser Ala Leu Thr Thr Ser Pro Gly Glu1
5 10 15Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val Thr Thr
Ser 20 25 30Asn Tyr Ala Asn Trp Val Gln Glu Lys Pro Asp His Leu Phe
Thr Gly 35 40 45Leu Ile Gly Gly Pro Asn Asn Arg Ala Pro Gly Val Pro
Ala Arg Phe 50 55 60Ser Gly Ser Leu Ile Gly Asp Lys Ala Ala Leu Thr
Ile Thr Gly Ala65 70 75 80Gln Thr Glu Asp Glu Ala Ile Tyr Phe Cys
Ala Leu Trp Tyr Ser Asn 85 90 95His Trp Val Phe Gly Gly Gly Thr Lys
Leu Thr Val Leu 100 10549352DNAMus musculus 49gaagtgaagc tggtggagtc
tgggggaggc ttagtgcagc ctggagggtc cctgaaactc 60tcctgtgcaa cctctggatt
cactttcagt gactattaca tgtattgggt tcgccagact 120ccagagagag
gctggagtgg gtcgcataca ttagtaatgg tggtggtagc acctattatc
180cagacactgt aaagggccga ttcaccatct ccagagacaa tgccaagaac
accctgtacc 240tgcaaatgag ccgttgaagt ctgaggacac agccatgtat
tactgtgcaa gagagggggg 300taccgcctgg tttgcttact ggggccaagg
gactctggtc actgtctctg ca 35250118PRTMus musculus 50Glu Val Lys Leu
Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5 10 15Ser Leu Lys
Leu Ser Cys Ala Thr Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30Tyr Met
Tyr Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val 35 40 45Ala
Tyr Ile Ser Asn Gly Gly Gly Ser Thr Tyr Tyr Pro Asp Thr Val 50 55
60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr65
70 75 80Leu Gln Met Ser Arg Leu Lys Ser Glu Asp Thr Ala Met Tyr Tyr
Cys 85 90 95Ala Arg Glu Gly Gly Thr Ala Trp Phe Ala Tyr Trp Gly Gln
Gly Thr 100 105 110Leu Val Thr Val Ser Ala 11551334DNAMus musculus
51gatgttttga tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaagcctcc
60atctcttgca gatctagtca gagcattgta catagtaatg gaaacaccta tttagaatgg
120tacctgcgaa accaggccag tctccaaagc tcctgatcta caaagtttcc
aaccgatttt 180ctggggtccc agacaggttc agtggcagtg gatcagggac
agatttcaca ctcaagatca 240gcagagtgga ggctaggatc tgggagttta
ttactgcttt caaggttcac atgttccgta 300cacgttcgga ggggggacca
agctggaaat aaaa 33452112PRTMus musculus 52Asp Val Leu Met Thr Gln
Thr Pro Leu Ser Leu Pro Val Ser Leu Gly1 5 10 15Asp Gln Ala Ser Ile
Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser 20 25 30Asn Gly Asn Thr
Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Lys Leu
Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60Asp Arg
Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75
80Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly
85 90 95Ser His Val Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile
Lys 100 105 11053367DNAMus musculus 53gaagtgcagc tggtggagtc
tgggggaggc ttagtgaagc ctggagggtc cctgaaactc 60tcctgtgcag cctctggatt
cactttcagt gactattaca tgtattgggt tcgccagact 120ccggaaagag
gctggagtgg gtcgcaacca ttagtgatgg tggtagttac acctcctatc
180cagacagtgt gaagggacga ttcaccatct ccagagacaa tgccaagaac
aacctgtacc 240tgcaaatgag cagttgaggt ctgaggacac agccatgtat
tactgtgcaa gagattacta 300tggtagtagt agctacacct cgggctttgc
ttactggggc caagggactc tggtcactgt 360ctctgca 36754123PRTMus musculus
54Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly1
5 10 15Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp
Tyr 20 25 30Tyr Met Tyr Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu
Trp Val 35 40 45Ala Thr Ile Ser Asp Gly Gly Ser Tyr Thr Ser Tyr Pro
Asp Ser Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Asn Leu Tyr65 70 75 80Leu Gln Met Ser Ser Leu Arg Ser Glu Asp
Thr Ala Met Tyr Tyr Cys 85 90 95Ala Arg Asp Tyr Tyr Gly Ser Ser Ser
Tyr Thr Ser Gly Phe Ala Tyr 100 105 110Trp Gly Gln Gly Thr Leu Val
Thr Val Ser Ala 115 12055334DNAMus musculus 55gatgttttga tgacccaaac
tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60atctcttgca gatctagtca
gagcattgta catagtaatg gaaacaccta tttagaatgg 120tacctgcgaa
accaggccag tctccaaagc tcctgatcta caaagtttcc aaccgatttt
180ctggggtccc agacaggttc agtggcagtg gatcagggac agatttcaca
ctcaagatca 240gcagagtgga ggctaggatc tgggagttta ttactgcttt
caaggttcac atgttcctgg 300gacgttcggt ggaggcacca agctggaaat caaa
33456112PRTMus musculus 56Asp Val Leu Met Thr Gln Thr Pro Leu Ser
Leu Pro Val Ser Leu Gly1 5 10 15Asp Gln Ala Ser Ile Ser Cys Arg Ser
Ser Gln Ser Ile Val His Ser 20 25 30Asn Gly Asn Thr Tyr Leu Glu Trp
Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Lys Leu Leu Ile Tyr Lys
Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu
Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly 85 90 95Ser His Val
Pro Gly Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105
11057349DNAMus musculus 57cagatccagt tggtgcagtc tggacctgag
ctgaagaagc ctggagagac agtcaagatc 60tcctgcaagg cttctggtta taccttcaca
gactattcaa tgcactgggt gaagcactct 120ccaggaaggg tttaaagtgg
atgggctgga taaacactga gactggtgag ccaacatatg 180cagatgactt
caagggacgg tttgccttct ctttggaaac ctctgccagc actgcctatt
240tgcagatcaa caactcaaaa atgaggacac ggctacatat ttctgtgcta
gagggtatgg 300caactggttt gcttactggg gccaagggac tctggtcact gtctctgca
34958117PRTMus musculus 58Gln Ile Gln Leu Val Gln Ser Gly Pro Glu
Leu Lys Lys Pro Gly Glu1 5 10 15Thr Val Lys Ile Ser Cys Lys Ala Ser
Gly Tyr Thr Phe Thr Asp Tyr 20 25 30Ser Met His Trp Val Lys His Ser
Pro Gly Lys Gly Leu Lys Trp Met 35 40 45Gly Trp Ile Asn Thr Glu Thr
Gly Glu Pro Thr Tyr Ala Asp Asp Phe 50 55 60Lys Gly Arg Phe Ala Phe
Ser Leu Glu Thr Ser Ala Ser Thr Ala Tyr65 70 75 80Leu Gln Ile Asn
Asn Leu Lys Asn Glu Asp Thr Ala Thr Tyr Phe Cys 85 90 95Ala Arg Gly
Tyr Gly Asn Trp Phe Ala Tyr Trp Gly Gln Gly Thr Leu 100 105 110Val
Thr Val Ser Ala 11559322DNAMus musculus 59caaattgttc tcacccagtc
tccagcaatc atgtctgcat ctctagggga acgggtcacc 60atgacctgca ctgccagctc
aagtgtaagt tccagttact tacactggta ccagcagaag 120ccaggatctc
ccccaaactc tggatttata gcacatccaa cctggcttct ggagtcccag
180ctcgcttcag tggcagtggg tctgggacct cttactctct cacaatcagc
agcatggagg 240ctgaagatgc tgcccttatt actgccacca gtatcatcgt
tccccgctca cgttcggtgc 300tgggaccaag ctggagctga aa 32260108PRTMus
musculus 60Gln Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser
Leu Gly1 5 10 15Glu Arg Val Thr Met Thr Cys Thr Ala Ser Ser Ser Val
Ser Ser Ser 20 25 30Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Ser Ser
Pro Lys Leu Trp 35 40 45Ile Tyr Ser Thr Ser Asn Leu Ala Ser Gly Val
Pro Ala Arg Phe Ser 50 55 60Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu
Thr Ile Ser Ser Met Glu65 70 75 80Ala Glu Asp Ala Ala Thr Tyr Tyr
Cys His Gln Tyr His Arg Ser Pro 85 90 95Leu Thr Phe Gly Ala Gly Thr
Lys Leu Glu Leu Lys 100 10561361DNAMus musculus 61gaggtgaagc
tggtggaatc tggaggaggc ttggtacagc ctgggggttc tctgagactc 60tcctgtgcaa
cttctgggtt caccttcagt gatttctaca taaactgggt ccgccagcct
120ccagggagag actggagtgg attgctacaa gtaggagcaa agctcatgat
tatacaacag 180agtacagtgc atctgtgaag ggtcggttca tcgtctccag
agacacttcc caaagcatcc 240tctaccttca gatgatgccc taaaacctga
ggacactgcc atttattact gtgcaagaga 300tacatggtat ggttcctggt
ttgcttactg gggccaaggg actctggtca ctgtctctac 360a 36162121PRTMus
musculus 62Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro
Gly Gly1 5 10 15Ser Leu Arg Leu Ser Cys Ala Thr Ser Gly Phe Thr Phe
Ser Asp Phe 20 25 30Tyr Ile Asn Trp Val Arg Gln Pro Pro Gly Lys Arg
Leu Glu Trp Ile 35 40 45Ala Thr Ser Arg Ser Lys Ala His Asp Tyr Thr
Thr Glu Tyr Ser Ala 50 55 60Ser Val Lys Gly Arg Phe Ile Val Ser Arg
Asp Thr Ser Gln Ser Ile65 70 75 80Leu Tyr Leu Gln Met Asp Ala Leu
Lys Pro Glu Asp Thr Ala Ile Tyr 85 90 95Tyr Cys Ala Arg Asp Thr Trp
Tyr Gly Ser Trp Phe Ala Tyr Trp Gly 100 105 110Gln Gly Thr Leu Val
Thr Val Ser Thr 115 12063334DNAMus musculus 63gatgttttga tgacccaaac
tccactctcc ctgcctgtca gtcttggaga tcaagcctcc 60atctcttgca gatctagtca
gagcattgta catagtaatg gaaacaccta tttagaatgg 120tacctgcgaa
accaggccag tctccaaagc tcctgatcta caaagtttcc aaccgatttt
180ctggggtccc agacaggttc agtggcagtg gatcaggaac agatttcaca
ctcaagatca 240gcagagtgga ggctaggatc tgggagttta ttactgcttt
caaggttcac atgttcctcc 300gacgttcggt ggaggctcca agctggaaat caaa
33464112PRTMus musculus 64Asp Val Leu Met Thr Gln Thr Pro Leu Ser
Leu Pro Val Ser Leu Gly1 5 10 15Asp Gln Ala Ser Ile Ser Cys Arg Ser
Ser Gln Ser Ile Val His Ser 20 25 30Asn Gly Asn Thr Tyr Leu Glu Trp
Tyr Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro Lys Leu Leu Ile Tyr Lys
Val Ser Asn Arg Phe Ser Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser
Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile65 70 75 80Ser Arg Val Glu
Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln Gly 85 90 95Ser His Val
Pro Pro Thr Phe Gly Gly Gly Ser Lys Leu Glu Ile Lys 100 105
11065361DNAMus musculus 65caggtccagc tgcagcagtc tggaactgaa
ctggtgaggc ctgggacttc agtgaaggtg 60tcctgcaagg cttctggata cgccttcact
aattacttga tagagtgggt aaagcagagg 120cctggacggg ccttgagtgg
attggagtga ttaatcctgg aagtggtggt actaggtaca 180atgagaagtt
caagggcaag gcaacactga ctgcagacaa atcctccacc actgcccaca
240tgcagctcag cagctgacat ctgatgactc tgcggtctat ttctgtgcaa
gatggggggg 300aaactactct ggctatgcta tggactactg gggtcaagga
acctcagtca ccgtctcctc 360a 36166121PRTMus musculus 66Gln Val Gln
Leu Gln Gln Ser Gly Thr Glu Leu Val Arg Pro Gly Thr1 5 10 15Ser Val
Lys Val Ser Cys Lys Ala Ser Gly Tyr Ala Phe Thr Asn Tyr 20 25 30Leu
Ile Glu Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile 35 40
45Gly Val Ile Asn Pro Gly Ser Gly Gly Thr Arg Tyr Asn Glu Lys Phe
50
55 60Lys Gly Lys Ala Thr Leu Thr Ala Asp Lys Ser Ser Thr Thr Ala
His65 70 75 80Met Gln Leu Ser Ser Leu Thr Ser Asp Asp Ser Ala Val
Tyr Phe Cys 85 90 95Ala Arg Trp Gly Gly Asn Tyr Ser Gly Tyr Ala Met
Asp Tyr Trp Gly 100 105 110Gln Gly Thr Ser Val Thr Val Ser Ser 115
120678PRTMus musculus 67Gly Tyr Thr Phe Thr Asp Tyr Ser1 5688PRTMus
musculus 68Ile Asn Thr Glu Thr Gly Glu Pro1 56912PRTMus musculus
69Ala Ser Arg Arg Trp Tyr Pro Tyr Tyr Phe Asp Tyr1 5 10709PRTMus
musculus 70Thr Gly Ala Val Thr Thr Ser Asn Tyr1 5713PRTMus musculus
71Gly Pro Asn1729PRTMus musculus 72Ala Leu Trp Tyr Ser Asn His Trp
Val1 5738PRTMus musculus 73Gly Phe Thr Phe Ser Asp Tyr Tyr1
5748PRTMus musculus 74Ile Ser Asn Gly Gly Gly Ser Thr1 57511PRTMus
musculus 75Ala Arg Glu Gly Gly Thr Ala Trp Phe Ala Tyr1 5
107611PRTMus musculus 76Gln Ser Ile Val His Ser Asn Gly Asn Thr
Tyr1 5 10773PRTMus musculus 77Lys Val Ser1789PRTMus musculus 78Phe
Gln Gly Ser His Val Pro Tyr Thr1 5798PRTMus musculus 79Ile Ser Asp
Gly Gly Ser Tyr Thr1 58016PRTMus musculus 80Ala Arg Asp Tyr Tyr Gly
Ser Ser Ser Tyr Thr Ser Gly Phe Ala Tyr1 5 10 15819PRTMus musculus
81Phe Gln Gly Ser His Val Pro Gly Thr1 58210PRTMus musculus 82Ala
Arg Gly Tyr Gly Asn Trp Phe Ala Tyr1 5 10837PRTMus musculus 83Ser
Ser Val Ser Ser Ser Tyr1 5843PRTMus musculus 84Ser Thr
Ser1859PRTMus musculus 85His Gln Tyr His Arg Ser Pro Leu Thr1
5868PRTMus musculus 86Gly Phe Thr Phe Ser Asp Phe Tyr1 58710PRTMus
musculus 87Ser Arg Ser Lys Ala His Asp Tyr Thr Thr1 5 108812PRTMus
musculus 88Ala Arg Asp Thr Trp Tyr Gly Ser Trp Phe Ala Tyr1 5
10898PRTMus musculus 89Gly Tyr Ala Phe Thr Asn Tyr Leu1 5908PRTMus
musculus 90Ile Asn Pro Gly Ser Gly Gly Thr1 59114PRTMus musculus
91Ala Arg Trp Gly Gly Asn Tyr Ser Gly Tyr Ala Met Asp Tyr1 5
10929PRTMus musculus 92Phe Gln Gly Ser His Val Pro Pro Thr1 5
* * * * *