U.S. patent application number 17/568066 was filed with the patent office on 2022-05-19 for compositions, methods, and kits for amplifying nucleic acids.
The applicant listed for this patent is APPLIED BIOSYSTEMS, LLC. Invention is credited to Shoulian DONG, Danny H. LEE, Junko F. STEVENS.
Application Number | 20220154265 17/568066 |
Document ID | / |
Family ID | |
Filed Date | 2022-05-19 |
United States Patent
Application |
20220154265 |
Kind Code |
A1 |
DONG; Shoulian ; et
al. |
May 19, 2022 |
COMPOSITIONS, METHODS, AND KITS FOR AMPLIFYING NUCLEIC ACIDS
Abstract
The present teachings are directed to compositions, methods, and
kits for amplifying target nucleic acids while reducing
non-specific fluorescence and undesired amplification products,
sometimes referred to as secondary amplification products or
spurious side-products. The enzyme inhibitors disclosed herein
comprise a nucleotide sequence and at least one quencher. Complexes
comprising an enzyme inhibitor associated with an enzyme, wherein
at least one enzymatic activity of the enzyme is inhibited, are
also provided. Methods for amplifying a target nucleic acid while
reducing undesired amplification products are disclosed, as are
methods for reducing non-specific fluorescence. Kits for expediting
the performance of certain disclosed methods are also provided.
Inventors: |
DONG; Shoulian; (Mountain
View, CA) ; STEVENS; Junko F.; (Menlo Park, CA)
; LEE; Danny H.; (Union City, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
APPLIED BIOSYSTEMS, LLC |
Carlsbad |
CA |
US |
|
|
Appl. No.: |
17/568066 |
Filed: |
January 4, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16746216 |
Jan 17, 2020 |
11225686 |
|
|
17568066 |
|
|
|
|
14876711 |
Oct 6, 2015 |
10604796 |
|
|
16746216 |
|
|
|
|
13902742 |
May 24, 2013 |
|
|
|
14876711 |
|
|
|
|
12633759 |
Dec 8, 2009 |
8470531 |
|
|
13902742 |
|
|
|
|
11537409 |
Sep 29, 2006 |
|
|
|
12633759 |
|
|
|
|
60723383 |
Oct 3, 2005 |
|
|
|
International
Class: |
C12Q 1/6844 20060101
C12Q001/6844; C12Q 1/6848 20060101 C12Q001/6848; C12P 19/34
20060101 C12P019/34; G01N 21/64 20060101 G01N021/64; C12N 15/115
20060101 C12N015/115 |
Claims
1. A DNA polymerase inhibitor comprising a nucleotide sequence and
a quencher, wherein the nucleotide sequence comprises
5'-TCTGGGATA(deaza-dA)TT(deaza-dA)TGGTA(deaza-dA)ATATG(Tn)C(deaza-dA)TATT-
TATT(deaza-dA)TA(deaza-dA)TTATC-3', and wherein Tn comprises TT,
TTT, TTTT, TTTTT, or TTTTTT.
2. The DNA polymerase inhibitor of claim 1, wherein the quencher
comprises at least two different quenchers.
3. The DNA polymerase inhibitor of claim 1, further comprising a
minor groove binder.
4. The DNA polymerase inhibitor of claim 1, wherein the nucleotide
sequence comprises:
5'-TCTGGGATA(deaza-dA)TT(deaza-dA)TGGTA(deaza-dA)ATATGTTTTC(deaza-dA)TATT-
TATT(deaza-dA)TA(deaza-dA)TTATC-3', and the quencher comprises at
least two different quenchers.
5. The DNA polymerase inhibitor of claim 4, further comprising a
minor groove binder.
6. The DNA polymerase inhibitor of claim 5, wherein: the first
quencher comprises at least one of DABCYL, DABSYL, TAMRA, TET, and
ROX; and the minor groove binder further comprises the second
quencher.
7. A method for amplifying a target nucleic acid comprising:
forming a reaction composition comprising a DNA polymerase, a DNA
polymerase inhibitor comprising a nucleotide sequence and a
quencher, a NTP, the target nucleic acid, a primer, a nucleic acid
dye, and optionally a nucleotide analog, at a first temperature,
wherein the nucleotide sequence comprises at least one
double-stranded segment, wherein the DNA polymerase and the DNA
polymerase inhibitor associate to form a complex, and wherein the
quencher inhibits fluorescence associated with the double-stranded
segment of the nucleotide sequence; heating the reaction
composition to a second temperature to dissociate the complex; and
subjecting the reaction composition to at least one cycle of
amplification to generate a multiplicity of amplicons.
8. The method of claim 7, wherein the target nucleic acid comprises
RNA.
9. The method of claim 7, wherein the target nucleic acid comprises
DNA.
10. The method of claim 7, wherein the primer comprises a primer
pair and the at least one cycle of amplification comprises PCR.
11. The method of claim 7, wherein the DNA polymerase the DNA
polymerase inhibitor, and optionally a NTP and/or a nucleotide
analog, are incubated together to form a complex prior to the
forming the reaction composition at the first temperature.
12. The method of claim 7, wherein the nucleotide sequence of the
DNA polymerase inhibitor comprises a first region, a second region,
a third region, and optionally, a fourth region; and wherein the
first region is complementary to the third region.
13. The method of claim 12, wherein the nucleotide sequence of the
DNA polymerase inhibitor is not extendible by the DNA
polymerase.
14. The method of claim 7, wherein the DNA polymerase inhibitor
further comprises a minor groove binder.
15. The method of claim 7, wherein the nucleotide sequence of the
DNA polymerase inhibitor comprises a first oligonucleotide and a
second oligonucleotide, wherein the first oligonucleotide comprises
a first region and the second oligonucleotide comprises a third
region and optionally, a fourth region, and wherein the first
region of the first oligonucleotide is complementary to the third
region of the second oligonucleotide.
16. The method of claim 15, wherein the first oligonucleotide is
not extendible by the DNA polymerase, the second oligonucleotide is
not extendible by the DNA polymerase, or the first oligonucleotide
and the second oligonucleotide are not extendible by the DNA
polymerase.
17. The method of claim 7, wherein the nucleotide sequence of the
DNA polymerase inhibitor comprises an aptamer.
18. The method of claim 7, wherein the DNA polymerase inhibitor
comprise sat least two different quenchers.
19. The method of claim 7, wherein the DNA polymerase inhibitor
comprises a nucleotide analog.
20. The method of claim 19, wherein the nucleotide analog comprises
a deaza-dA, a deaza-dG, a ddN, a LNA, a PNA, or combinations
thereof.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S. patent
application Ser. No. 16/746,216, filed Jan. 17, 2020, which is a
divisional application of U.S. patent application Ser. No.
14/876,711, filed Oct. 6, 2015, which is a continuation application
of U.S. patent application Ser. No. 13/902,742, filed May 24, 2013
(now Abandoned), which is a continuation application of U.S. patent
application Ser. No. 12/633,759, filed Dec. 8, 2009 (now U.S. Pat.
No. 8,470,531 granted Jun. 25, 2013), which is a divisional
application of U.S. patent application Ser. No. 11/537,409, filed
Sep. 29, 2006 (now Abandoned), which claims a priority benefit
under 35 U.S.C. .sctn. 119(e) from U.S. Provisional Patent
Application No. 60/723,383, filed Oct. 3, 2005, the contents of
which are incorporated herein by reference in their entireties.
SEQUENCE LISTING
[0002] This application includes a Sequence Listing submitted
electronically in ASCII format. The ASCII copy of the Sequence
Listing, created on Jan. 3, 2022, is named 11398.275.1-SL.txt and
is 1,768 bytes in size. The ASCII copy of the Sequence Listing is
expressly incorporated herein by this reference.
INTRODUCTION
[0003] While the polymerase chain reaction (PCR) and related
techniques are highly useful for a variety of applications, the
amplification of non-target nucleic acids due to undesired
side-reactions can present a significant problem. Such side
reactions can occur as a result of mis-priming of non-target
nucleic acids and/or primer oligomerization, sometimes referred to
as primer dimer formation, and the subsequent amplification of
these priming artifacts. This is especially true in applications in
which PCR is carried out using a mixture of nucleic acids with
significant background nucleic acids while the target nucleic acid
is present in low copy number (see, e.g., Chou et al., Nucl. Acids
Res. 20:1717-1723 (1992). The generation of non-specifically
amplified products has been attributed at least in part to DNA
polymerase activity at ambient temperature that extends
non-specifically annealed primers. (see, e.g., id.; Li et al.,
Proc. Natl. Acad. Sci. 87:4580 (1990). Accordingly, inhibition of
DNA polymerase activity at ambient temperature is beneficial in
controlling the generation of secondary amplicons.
[0004] Several techniques have been described which reportedly
decrease the formation of undesired secondary amplification
products. According to certain "manual hot start" techniques, a
component critical to DNA polymerase activity (e.g., divalent ions
and/or the DNA polymerase itself) is not added to the reaction
mixture until the temperature of the mixture is high enough to
prevent non-specific primer annealing (see, e.g., Chou et al.,
Nucl. Acids Res. 20:1717-1723 (1992); and D'Aquila et al., Nucl.
Acids Res. 19:3749 (1991)). Less labor-intensive techniques employ
the physical separation or reversible inactivation of at least one
component of the amplification reaction. For example, the magnesium
or the DNA polymerase can be sequestered in a wax bead, which melts
as the reaction temperature increases, releasing the sequestered
component only at the elevated temperature. According to other
techniques, the DNA polymerase is reversibly inactivated or
modified, for example by a reversible chemical modification of the
DNA polymerase or the binding of an antibody (see, e.g., Birch et
al., U.S. Pat. No. 5,677,152). At elevated reaction temperatures,
the chemical modification is reversed or the antibody molecule is
denatured, releasing a functional DNA polymerase. However, some of
these techniques appear to be leaky, in that some DNA polymerase
activity is detectable at lower reaction temperatures, or they
require extended exposure of the reaction mixture at high
temperatures to fully activate the DNA polymerase.
[0005] Certain currently used nucleic acid amplification techniques
include a step for detecting and/or quantifying amplification
products that comprise a nucleic acid dye, for example but not
limited to, SYBR.RTM. Green I (Molecular Probes, Eugene, Oreg.),
including certain real-time and/or end-point detection techniques
(see, e.g., Ririe et al., Analyt. Biochem. 245:154-60 (1997).
Typically the nucleic acid dye associates with double-stranded
segments of the amplification products and/or primer-template
duplexes and emit a detectable fluorescent signal at a wavelength
that is characteristic of the particular nucleic acid dye. Certain
amplification methods comprise a detection step for evaluating the
purity of the amplification product(s) that comprises a nucleic
acid dye, for example but not limited to, post-PCR dissociation
curve analysis, also known as melting curve analysis. Since the
melting curve of an amplicon is dependent on, among other things,
its length and sequence, amplicons can generally be distinguished
by their melting curves (see, e.g., Zhang et al., Hepatology
36:723-28 (2002)). A dissociation or melting curve can be obtained
during certain amplification reactions by monitoring the nucleic
acid dye fluorescence as the reaction temperatures pass through the
melting temperature of the amplicon(s). The dissociation of a
double-stranded amplicon is observed as a sudden decrease in
fluorescence at the emission wavelength characteristic of the
nucleic acid dye. According to certain dissociation curve analysis
techniques, an amplification product is classified as "pure" when
the melting curve shows a single, consistent melting temperature,
sometimes graphically displayed as a peak on a plot of the negative
derivative of fluorescent intensity versus temperature (-dF/dt vs.
T). For example, the appearance of multiple peaks in such a
dissociation curve from a single-plex amplification typically
indicates the presence of undesired side reaction products. When
such nucleic acid dye-based amplification product detection
techniques are employed, it is often desirable to: 1) at least
decrease and preferably eliminate the formation of undesired
side-reaction products and 2) at least decrease and preferably
eliminate fluorescence peaks resulting from the denaturing of
double-stranded segments of other nucleic acids, i.e.,
non-amplification products.
[0006] Certain other amplification techniques may also yield
undesired amplification products due to, among other things,
non-specific annealing of primers, ligation probes, cleavage
probes, promoter-primers, and so forth, and subsequent enzyme
activity at sub-optimal temperatures. For example, while reaction
components are being combined, often at room temperature, or while
the reaction composition is being heated to a desired reaction
temperature. At least some of these techniques can benefit from a
reduction in background fluorescence.
SUMMARY
[0007] The present teachings are directed to compositions, methods,
and kits for amplifying target nucleic acids while reducing
non-specific fluorescence and undesired amplification products,
sometimes referred to in the art as secondary amplicons or spurious
side-products.
[0008] Enzyme inhibitors comprising a nucleotide sequence and a
quencher are disclosed. The disclosed inhibitors are designed to
inhibit at least one enzymatic activity of an enzyme. In certain
embodiments, the nucleotide sequence of the enzyme inhibitor
comprises an aptamer. In some embodiments, an enzyme inhibitor
comprises an aptamer that is capable of forming at least one
double-stranded segment (see, e.g., Yakimovich et al., Biochem.
(Mose.) 68(2):228-35 (2003); Nickens et al., RNA 9:1029-33 (2003);
Nishikawa et al., Oligonucleotides 14:114-29 (2004); and Umehara et
al., J. Biochem. 137:339-74 (2005)). In some embodiments, an enzyme
inhibitor comprises a multiplicity of different quenchers. In
certain embodiments, the enzyme inhibitor can assume a conformation
comprising at least one double-stranded segment at a first
temperature, but is single-stranded or substantially
single-stranded when heated to a second temperature. According to
certain embodiments, an enzyme inhibitor comprising at least one
double-stranded segment can form a complex with at least one of: a
DNA polymerase, including without limitation a reverse
transcriptase; an RNA polymerase; a cleaving enzyme, including
without limitation, a structure-specific nuclease; a helicase; and
a ligase. In certain embodiments, an enzyme inhibitor is an
ineffective substrate for the corresponding enzyme because the
inhibitor comprises a blocking group, a nucleotide analog, an
uncleavable internucleotide linkage, or combinations thereof.
[0009] DNA polymerase inhibitors comprising a nucleotide sequence
and a quencher are disclosed. Some DNA polymerase inhibitors
comprise two or more quenchers that can be the same quencher or
different quenchers. In certain embodiments, a DNA polymerase
inhibitor further comprises a minor groove binder that, in some
embodiments, comprises a quencher. In some embodiments, the 3-end
of a nucleotide sequence of a DNA polymerase inhibitor is not
extendible by a DNA polymerase, typically due to the presence of a
blocking group or non-extendible nucleotide. In some embodiments,
the nucleotide sequence of a DNA polymerase inhibitor comprises an
aptamer capable of forming at least one double-stranded segment
(see, e.g., Yakimovich et al., Biochem. (Mose.) 68(2):228-35
(2003)).
[0010] Complexes comprising an enzyme and an enzyme inhibitor are
provided. Certain complexes comprise: a DNA polymerase and a DNA
polymerase inhibitor; a ligase and a ligase inhibitor; an RNA
polymerase and an RNA polymerase inhibitor; a cleaving enzyme and a
cleaving enzyme inhibitor; or a helicase and a helicase inhibitor.
Certain complexes further comprise a deoxyribonucleotide, a
ribonucleotide, a nucleotide analog, an accessory protein, for
example but not limited to a single-stranded binding protein (SSB)
or a proliferating cell nuclear antigen (PCNA), or combinations
thereof. Typically the enzyme-enzyme inhibitor complex can form at
a first temperature, and while associated with the inhibitor in the
complex, at least one catalytic activity of the enzyme is
inhibited. When the complex is heated to a second temperature, the
complex dissociates, releasing the enzyme.
[0011] In certain embodiments, an enzyme-enzyme inhibitor complex
comprises a DNA polymerase and a DNA polymerase inhibitor. In
certain embodiments, a DNA polymerase-DNA polymerase inhibitor
complex further comprises a nucleotide triphosphate (NTP) and/or a
nucleotide analog. Certain complex embodiments comprise a DNA
polymerase inhibitor in a stem-loop conformation associated with a
DNA polymerase, and optionally, a NTP and/or a nucleotide analog.
Certain complex embodiments comprise a DNA polymerase associated
with a DNA polymerase inhibitor comprising at least two
oligonucleotides that are annealed to form a duplex comprising at
least one double-stranded segment, and optionally, a NTP and/or a
nucleotide analog. Typically, the DNA synthesis activity of the DNA
polymerase is inhibited when it is complexed with a DNA polymerase
inhibitor of the current teachings, and optionally, a NTP and/or a
nucleotide analog.
[0012] Methods for reducing non-specific fluorescence comprising
the enzyme inhibitors of the present teachings are disclosed.
According to certain methods, an enzyme is contacted with an enzyme
inhibitor under conditions suitable for an enzyme-enzyme inhibitor
complex to form. At least one enzymatic activity of the enzyme is
inhibited while the enzyme is in the complex. When the
enzyme-enzyme inhibitor complex is heated to a suitable second
temperature, the complex dissociates, releasing the enzyme.
[0013] Some methods for reducing non-specific fluorescence comprise
a DNA polymerase inhibitor of the present teachings. According to
certain such methods, a reaction composition is formed at a first
temperature comprising: a DNA polymerase, a DNA polymerase
inhibitor comprising a nucleotide sequence and a quencher, a NTP
and/or a nucleotide analog, a target nucleic acid, a primer, and a
nucleic acid dye. In certain embodiments, the primer comprises a
primer pair. At the first temperature, the DNA polymerase inhibitor
comprises at least one double-stranded segment and can form a
complex with the DNA polymerase. The quencher of the DNA polymerase
inhibitor can absorb at least some of the fluorescent signal of the
nucleic acid dye associated with the double-stranded segment of the
DNA polymerase inhibitor. The reaction composition is heated to a
second reaction temperature that is typically near, at, or above
the melting temperature of the DNA polymerase inhibitor, causing at
least some of the DNA polymerase inhibitor-DNA polymerase complexes
to dissociate. The reaction composition is subjected to at least
one cycle of amplification and a multiplicity of amplicons is
generated. The double-stranded amplicons can be detected, either in
"real time" or after the amplification reaction is completed, due
to the fluorescence of the nucleic acid dye associated with the
amplicons, while the fluorescence of the nucleic acid dye
associated with the double-stranded segments of the DNA polymerase
inhibitors is at least reduced by the quencher.
[0014] Methods for amplifying a target nucleic acid using the
enzyme inhibitors of the present teachings are also disclosed.
According to certain such methods, a reaction composition is formed
at a first temperature comprising: a DNA polymerase, a DNA
polymerase inhibitor comprising a nucleotide sequence and a
quencher, a NTP, a target nucleic acid, a primer, and a nucleic
acid dye. In certain embodiments, the primer comprises a primer
pair. At the first temperature, the DNA polymerase inhibitor
comprises at least one double-stranded segment and can form a
complex with the DNA polymerase. The quencher of the DNA polymerase
inhibitor can absorb at least some of the fluorescence emitted by
the nucleic acid dye associated with the double-stranded segment of
the DNA polymerase inhibitor. The reaction composition is heated to
a second reaction temperature that is typically near, at, or above
the melting temperature of the DNA polymerase inhibitor, causing at
least some of the DNA polymerase inhibitor-DNA polymerase complexes
to dissociate. The reaction composition is subjected to at least
one cycle of amplification and a multiplicity of amplicons is
generated. In certain embodiments, the amount of amplicon that is
generated is increased due to the presence of the DNA polymerase
inhibitor in the reaction composition.
[0015] According to certain methods, a reaction composition
comprises a target nucleic acid, an enzyme, an enzyme inhibitor, a
nucleic acid dye, and at least one of: a NTP, a nucleotide analog,
a primer, a ligation probe pair, a cleavage probe pair, a
promoter-primer, a cofactor, for example but not limited to a
substance comprising NAO+, and an accessory protein, including
without limitation a PCNA and/or an SSB.
[0016] According to certain methods, a ligase is contacted with a
ligase inhibitor and under suitable conditions, a ligase-ligase
inhibitor complex is formed. According to certain methods, a
cleaving enzyme is contacted with a cleaving enzyme inhibitor and
under suitable conditions, a cleaving enzyme-cleaving enzyme
inhibitor complex is formed. According to certain methods, a
helicase is contacted with a helicase inhibitor and under suitable
conditions, a helicase-helicase inhibitor complex is formed.
According to some methods, an RNA polymerase is contacted with an
RNA polymerase inhibitor and under suitable conditions, an RNA
polymerase-RNA polymerase inhibitor complex is formed.
[0017] Kits for performing certain of the instant methods are also
disclosed. In some embodiments, kits comprise an enzyme inhibitor
comprising a nucleotide sequence and a quencher. In certain
embodiments, kits comprise two or more different enzyme inhibitors.
In some embodiments, an enzyme inhibitor can form a complex with an
RNA polymerase, a helicase, a cleaving enzyme, or a ligase. Certain
kit embodiments further comprise a cleavage probe set, a ligation
probe set, a primer, a promoter-primer, or combinations
thereof.
[0018] Certain kit embodiments include at least one DNA polymerase
inhibitor comprising a nucleotide sequence and a quencher. In some
embodiments, a kit comprises two or more DNA polymerase inhibitors.
In certain embodiments, a DNA polymerase inhibitor comprises a
minor groove binder. Certain kit embodiments further comprise at
least one of: a primer, a primer pair, a nucleic acid dye, a DNA
polymerase, and a reporter probe. In some embodiments, a kit
comprises a DNA-dependent DNA polymerase and a reverse
transcriptase.
[0019] These and other features of the present teachings are set
forth herein.
DRAWINGS
[0020] The skilled artisan will understand that the drawings,
described below, are for illustration purposes only. These figures
are not intended to limit the scope of the present teachings in any
way.
[0021] FIGS. 1A through 1F: schematically depicts illustrative
embodiments of certain exemplary enzyme inhibitors comprising a
single oligonucleotide.
[0022] FIGS. 2A through 2E: schematically depicts illustrative
embodiments of certain exemplary enzyme inhibitors comprising a
multiplicity of oligonucleotides.
[0023] FIG. 3: depicts dissociation curves obtained using certain
exemplary DNA polymerase inhibitors, plotted as the negative
derivative of fluorescence (-dF/dt) versus temperature in .degree.
C.
[0024] FIG. 4: depicts dissociation curves obtained using certain
exemplary DNA polymerase inhibitors, plotted as the negative
derivative of fluorescence versus temperature in .degree. C.
[0025] FIG. 5: depicts dissociation curves obtained using certain
exemplary DNA polymerase inhibitors, plotted as the negative
derivative of fluorescence versus temperature in .degree. C.
[0026] FIG. 6: depicts dissociation curves obtained using certain
exemplary DNA polymerase inhibitors, plotted as the negative
derivative of fluorescence versus temperature in .degree. C.
[0027] FIG. 7: depicts a photograph of agarose gel. Aliquots of a
series of thermocycled reaction compositions comprising amplicons
generated in varying concentrations of an exemplary enzyme
inhibitor were electrophoresed in separate lanes of a
non-denaturing agarose gel and visualized with ethidium bromide, as
described in Example 2. Lanes A and J: size ladder comprising 1200
base pair, 800 base pair, 400 base pair, 200 base pair, and 100
base pair size standards; lanes B-G: aliquots of the thermocycled
reaction compositions comprising 5, 10, 25, 50, 75 or 100 nM DNA
polymerase inhibitor E, respectively; lane H: no template control
reaction composition comprising 50 nM DNA polymerase inhibitor E;
lane I: blank.
[0028] FIG. 8: depicts a photograph of an agarose gel. Aliquots of
a series of thermocycled reaction compositions comprising amplicons
generated in varying concentrations of an exemplary DNA polymerase
inhibitor were electrophoresed in separate lanes of a
non-denaturing agarose gel and visualized with ethidium bromide, as
described in Example 3. Lanes A and J: size ladder comprising 1200
base pair, 800 base pair, 400 base pair, 200 base pair, and 100
base pair size standards; lanes B-H: aliquots of thermocycled
reaction compositions comprising 0, 5, 10, 25, 50, 75, or 100 nM
DNA polymerase inhibitor E, respectively; lane I: no template
control reaction composition comprising 50 nM DNA polymerase
inhibitor E.
[0029] FIG. 9: depicts a photograph of a non-denaturing agarose
gel, showing a decrease in secondary amplicons due to the presence
of an exemplary DNA polymerase inhibitor, as described in Example
4.
[0030] FIGS. 10A and 108: depicts exemplary dissociation curves
generated according to an exemplary method of the current
teachings, as described in Example 5.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0031] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not intended to limit the scope of the
current teachings. As used in this specification, the word "a" or
"an" means at least one, unless specifically stated otherwise. In
this specification, the use of the singular includes the plural
unless specifically stated otherwise. For example but not as a
limitation, "a target nucleic acid" means that more than one target
nucleic acid can be present; for example, one or more copies of a
particular target nucleic acid species, as well as two or more
different species of target nucleic acid. Also, the use of
"comprise", "comprises", "comprising", "contain", "contains",
"containing", "include", "includes", and "including" are not
intended to be limiting. The term "and/or" means that the terms
before and after can be taken together or separately. For
illustration purposes, but not as a limitation, "X and/or Y" can
mean "X" or "Y" or "X and Y".
[0032] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the described
subject matter in any way. All literature cited in this
specification, including but not limited to, patents, patent
applications, articles, books, and treatises are expressly
incorporated by reference in their entirety for any purpose. In the
event that any of the incorporated literature contradicts any term
defined in this specification, this specification controls. While
the present teachings are described in conjunction with various
embodiments, it is not intended that the present teachings be
limited to such embodiments. On the contrary, the present teachings
encompass various alternatives, modifications, and equivalents, as
will be appreciated by those of skill in the art.
[0033] U.S. patent application Ser. No. 10/762,222, entitled
"Competitive Kinetic Nucleic Acid DNA polymerase Inhibitors", by
John W. Brandis, filed Jan. 11, 2004, is hereby expressly
incorporated by reference in its entirety for any purpose.
Some Definitions
[0034] The term "absorb at least some of" when used in reference to
the fluorescent signal emitted from a nucleic acid dye refers to
the reduction of detectable fluorescence due to the presence of one
or more quenchers of an enzyme inhibitor. To absorb at least some
of the fluorescence emitted by the nucleic acid dye associated with
double-stranded segments of an enzyme inhibitor means that there is
a measurable decrease in detectable fluorescence at the emission
wavelength that is characteristic of the nucleic acid dye relative
to the detectable fluorescence in a reaction composition comprising
the same components except that the enzyme inhibitor does not
comprise the quencher. In some embodiments, a measurable decrease
in detectable fluorescence means a 30%, a 40%, a 50%, a 60%, a 70%,
an 80%, a 90%, a 95%, a 97%, a 98%, a 99%, or a greater than a 99%
relative decrease in fluorescence. In certain embodiments wherein
the at least one quencher comprises a fluorescent quencher, there
can be a measurable decrease in the detectable fluorescence at the
wavelength that is characteristic of the nucleic acid dye and a
measurable increase in the detectable fluorescence at the
characteristic emission wavelength of at least one fluorescent
quencher of the enzyme inhibitor.
[0035] The terms "amplicon" and "amplification product" as used
herein generally refers to the product of an amplification
reaction. An amplicon can be double-stranded or single-stranded,
and can include the separated component strands obtained by
denaturing a double-stranded amplification product. In some
embodiments, an amplicon comprises a ligation product (for example
but not limited to a ligated probe), the complement of at least
part of a ligation product, or both. In certain embodiments, the
amplicon of one amplification cycle can serve as a template in a
subsequent amplification cycle.
[0036] The terms "annealing" and "hybridizing", including without
limitation variations of the root words hybridize and anneal, are
used interchangeably and mean the nucleotide base-pairing
interaction of one nucleic acid with another nucleic acid that
results in the formation of a duplex, triplex, or other
higher-ordered structure. In some embodiments of the present
teachings, annealing or hybridization refers to the interaction
between at least some of the nucleotides in at least two regions of
the same enzyme inhibitor to form a hairpin or stem-loop structure,
sometimes referred to as self-annealing. The primary interaction is
typically nucleotide base specific, e.g., AT, A:U, and G:C, by
Watson-Crick and Hoogsteen-type hydrogen bonding. In certain
embodiments, base-stacking and hydrophobic interactions may also
contribute to duplex stability. Conditions under which primers and
probes anneal to complementary sequences are well known in the art,
e.g., as described in Nucleic Acid Hybridization, A Practical
Approach, Hames and Higgins, eds., IRL Press, Washington, D.C.
(1985) and Wetmur and Davidson, Mal. Biol. 31:349, 1968. In
general, whether such annealing takes place is influenced by, among
other things, the length of the complementary portions of the
corresponding first and third regions and/or fourth and sixth
regions of certain enzyme inhibitors, the complementary portions of
the primers and their corresponding binding sites in the target
flanking sequences and/or amplicons, the complementary portions of
the cleavage probes or the ligation probes and the corresponding
binding portions of the target nucleic acid or amplicon, or the
corresponding complementary portions or a reporter probe and its
binding site; the pH; the temperature; the presence of mono- and
divalent cations; the proportion of G and C nucleotides in the
hybridizing region; the viscosity of the medium; and the presence
of denaturants. Such variables influence the time required for
hybridization. In certain enzyme inhibitor embodiments, the
presence of certain nucleotide analogs or minor groove binders in
the inhibitor, probes, and/or primers can also influence
hybridization conditions. Thus, the preferred annealing conditions
will depend upon the particular application. Such conditions,
however, can be routinely determined by persons of ordinary skill
in the art, without undue experimentation. Preferably, annealing
conditions are selected to allow the primers and/or probes to
selectively hybridize with a complementary sequence in the
corresponding target flanking sequence or amplicon, but not
hybridize to any significant degree to different target nucleic
acids or non-target sequences in the reaction composition at the
second reaction temperature.
[0037] The term "selectively hybridize" and variations thereof
means that, under appropriate stringency conditions, a given
sequence (for example but not limited to a primer) anneals with a
second sequence comprising a complementary string of nucleotides
(for example but not limited to a target flanking sequence or a
primer-binding site of an amplicon), but does not anneal to
undesired sequences, such as non-target nucleic acids, probes, or
other primers. Typically, as the reaction temperature increases
toward the melting temperature of a particular double-stranded
sequence, the relative amount of selective hybridization generally
increases and mis-priming generally decreases. In this
specification, a statement that one sequence hybridizes or
selectively hybridizes with another sequence encompasses situations
where the entirety of both of the sequences hybridize or
selectively hybridize to one another, and situations where only a
portion of one or both of the sequences hybridizes or selectively
hybridizes to the entire other sequence or to a portion of the
other sequence.
[0038] As used herein, the term "stringency" is used to define the
temperature and solvent composition existing during hybridization
and the subsequent processing steps at which a hybrid comprised of
two complementary nucleotide sequences will form. Stringency also
defines the amount of homology, the conditions necessary, and the
stability of hybrids formed between two nucleotide sequences. As
the stringency conditions increase, selective hybridization is
favored and non-specific cross-hybridization is disfavored.
Increased stringency conditions typically correspond to higher
incubation temperatures, lower salt concentrations, and/or higher
pH, relative to lower stringency conditions at which mis-priming,
including without limitation, the mis-annealing of ligation probes
and/or cleavage probes, is more likely to occur. Those in the art
understand that appropriate stringency conditions to enable the
selective hybridization of a primer or primer pair, a ligation
probe pair, and/or a cleavage probe pair to a corresponding target
flanking sequence and/or amplicon can be routinely determined using
well known techniques and without undue experimentation (see, e.g.,
PCR: The Basics from background to bench, McPherson and Moller,
Bias Scientific Publishers (2000; hereinafter "McPherson")).
[0039] In this specification, a statement that one nucleic acid
sequence is the same as or substantially the same as another
nucleotide sequence encompasses situations where both of the
nucleotide sequences are completely the same as or substantially
the same as the other sequence, and situations where only a portion
of one of the sequences is the same as or substantially the same as
a portion of the entire other sequence. Likewise, a statement that
one nucleic acid sequence is complementary to or substantially
complementary to another nucleotide sequence encompasses situations
where both of the nucleotide sequences are completely complementary
or substantially complementary to one another, and situations where
only a portion of one of the sequences is complementary to or
substantially complementary to a portion of the entire other
sequence.
[0040] The term "aptamer" as used herein refers to a DNA or RNA
oligonucleotide that: 1) is typically identified originally using
an in vitro selection process, for example but not limited to the
"systematic evolution of ligands by exponential enrichment" (SELEX)
process or a variation thereof, and 2) recognizes and binds to a
binding partner, for example but not limited to an enzyme, in a
highly specific, conformation-dependent manner.
[0041] The term "or combinations thereof" as used herein refers to
all permutations and combinations of the listed items preceding the
term. For example, "A, B, C, or combinations thereof" is intended
to include at least one of: A, B, C, AB, AC, BC, or ABC, and if
order is important in a particular context, also BA, CA, CB, ACB,
CBA, BCA, BAC, or CAB. Continuing with this example, expressly
included are combinations that contain repeats of one or more item
or term, such as BB, AAA, AAB, BBC, AAABCCCC, CBBAAA, CABABB, and
so forth. The skilled artisan will understand that typically there
is no limit on the number of items or terms in any combination,
unless otherwise apparent from the context.
[0042] As used herein, the terms "complementary" and
"complementarity" are used in reference to at least two nucleic
acids that are related by the base-pairing rules. For example but
without limitation, the sequence "A-C-T" is complementary to the
sequence "T-G-A." Complementarity may be partial, in which case
only some of the nucleotides are matched according to the
base-pairing rules. Or, there may be complete or total
complementarity between the nucleic acids. The degree of
complementarity between nucleic acid strands has a significant
effect on the efficiency and strength of hybridization between the
nucleic acid strands. Complementarity need not be total for a
stable duplex to form, i.e., stable duplexes may contain mismatched
base pairs or unmatched bases. Those in the art can determine
duplex stability empirically considering a number of variables
including without limitation, the length of the nucleic acid, base
composition and sequence of the nucleic acid, ionic strength, and
incidence of mismatched base pairs. The stability of a nucleic acid
duplex is typically measured by its melting temperature.
[0043] As used herein, the terms "complex" and "enzyme
inhibitor-enzyme complex" refer to the association between an
enzyme inhibitor of the present teachings and the corresponding
enzyme. In some embodiments, an enzyme inhibitor-enzyme complex
comprises a DNA polymerase, an RNA polymerase, a ligase, a cleaving
enzyme, or a helicase. The terms inhibit, inhibits, and variations
thereof, when used in reference to an enzyme, are relative terms
and refer to a measurable decrease in enzymatic activity compared
to the activity of the enzyme under the same amplifying conditions
but in the absence of the enzyme inhibitor. In certain embodiments,
the enzymatic activity of the enzyme is decreased by about 40%,
about 50%, about 60%, about 70%, about 80%, about 85%, about 90%,
about 95%, about 96%, about 97%, about 98%, about 99%, or greater
than 99%, when complexed with the enzyme inhibitor, as determined
by the quantity of desired amplicon generated in parallel
amplification reactions in the presence and the absence of the
enzyme inhibitor. In certain embodiments, optimal inhibition is
obtained when the complex further comprises an accessory protein, a
NTP, a nucleotide analog, a substance comprising NAO+, or
combinations thereof.
[0044] The term "corresponding" as used herein refers to at least
one specific relationship between the elements to which the term
relates. For illustration purposes but not as a limitation, at
least one forward primer of a particular primer pair corresponds to
at least one reverse primer of the same primer pair; at least one
primer is designed to anneal with the flanking region of the
corresponding target nucleic acid and/or the primer-binding portion
of at least one corresponding amplicon; a first probe of a ligation
probe set anneals to a target nucleic acid and/or an amplicon
upstream of, and typically adjacent to, the ligation site and the
corresponding second ligation probe anneals to the target nucleic
acid and/or an amplicon downstream of, and typically adjacent to,
the ligation site; in certain enzyme inhibitor embodiments, a first
oligonucleotide anneals with the corresponding second
oligonucleotide to form a duplex comprising at least one
double-stranded segment; and so forth.
[0045] The terms "denaturing" and "denaturation" as used herein
refer to any process in which a double-stranded polynucleotide,
including without limitation, a gDNA fragment comprising at least
one target nucleic acid, a double-stranded amplicon, or a
polynucleotide comprising at least one double-stranded segment, for
example but not limited to an enzyme inhibitor at a first
temperature, is converted to two single-stranded polynucleotides or
to a single-stranded or substantially single-stranded
polynucleotide, as appropriate. Denaturing a double-stranded
polynucleotide or a double-stranded segment of an enzyme inhibitor
includes without limitation, a variety of thermal and chemical
techniques which render a double-stranded nucleic acid or a
double-stranded segment of an enzyme inhibitor single-stranded or
substantially single-stranded, for example but not limited to,
releasing the two individual single-stranded components of a
double-stranded polynucleotide or a duplex comprising two
oligonucleotides. Those in the art will appreciate that the
denaturing technique employed is generally not limiting unless it
substantially interferes with a subsequent annealing or enzymatic
step of an amplification reaction or, in certain methods, the
detection of a fluorescent signal.
[0046] The term "double-stranded," as used herein refers to one or
two nucleic acid strands that have hybridized along at least a
portion of their lengths. Thus, in certain contexts,
"double-stranded" can refer to a portion of a single
oligonucleotide that can fold so that at least one segment of the
first region of the oligonucleotide hybridizes to at least one
segment of the third region of the same oligonucleotide, at least
one segment of the fourth region of the oligonucleotide hybridizes
with at least one segment of the sixth region of the
oligonucleotide, or both, thereby forming one or more
double-stranded segments and one or more single-stranded portions.
Hence, a single nucleic acid strand can form hairpin or stem-loop
conformations that have double-stranded and single-stranded
segments (see, e.g., FIG. 1). Similarly, two complementary
oligonucleotides can hybridize with each other to form a duplex
(see, e.g., FIG. 2). Hence, "double-stranded" does not mean that a
nucleic acid must be entirely double-stranded. Instead, a
double-stranded nucleic acid can have one or more single-stranded
segment and one or more double-stranded segment.
[0047] The term "first temperature" refers to the temperature,
often a range of temperatures, at which an enzyme-enzyme inhibitor
complex can form. The term "second temperature" refers to the
temperature, often a range of temperatures, at which an
enzyme-enzyme inhibitor complex dissociates or does not form. As
those in the art will appreciate, the second temperature is
typically at or near the Tm of the enzyme inhibitor, while the
first temperature is typically below the Tm of the enzyme inhibitor
to allow the enzyme inhibitor to assume a conformation comprising
at least one double-stranded segment. An exemplary first
temperature can be ambient or "room temperature".
[0048] As used herein, the term "Tm" is used in reference to
melting temperature. The melting temperature is the temperature at
which a population of double-stranded nucleic acid molecules
becomes half dissociated into single strands.
[0049] A "microfluidics device" is a reaction vessel comprising at
least one microchannel, generally including an internal dimension
of one millimeter or less. Microfluidics devices typically employ
very small reaction volumes, often on the order of one or a few
microliters (.mu.L), nanoliters, or picoliters. Those in the art
will appreciate that the size, shape, and composition of a
microfluidics device is generally not a limitation of the current
teachings. Rather, any suitable microfluidics devices can be
employed in performing one or more steps of the disclosed methods.
Descriptions of exemplary microfluidics devices and uses thereof
can be found in, among other places, Fiorini and Chiu,
BioTechniques 38:429-46 (2005); Kelly and Woolley, Analyt. Chem.
77(5):96A-102A (2005); Cheuk-Wai Kan et al., Electrophoresis
25:3564-88 (2004); and Yeun et al., Genome Res. 11:405-12
(2001).
[0050] The term "minor groove binder" as used herein refers to a
small molecule that fits into the minor groove of double-stranded
DNA, sometimes in a sequence specific manner. Generally, minor
groove binders are long, flat molecules that can adopt a
crescent-like shape and thus, fit snugly into the minor groove of a
double helix, often displacing water. Minor groove binding
molecules typically comprise several aromatic rings connected by
bonds with torsional freedom, for example but not limited to,
furan, benzene, or pyrrole rings.
[0051] "Mis-priming" or "mis-primed," as used herein, refer to the
hybridization of a primer or a probe to a non-target nucleic acid.
As is known in the art, primers (excluding random primers) are
generally designed to hybridize to a selected sequence that flanks
a target nucleic acid or to a primer-binding site of an amplicon
and to direct DNA synthesis or primer extension starting at that
site. Mis-priming can occur when a primer or a probe hybridizes to
a non-target nucleic acid, oftentimes at low or decreased
stringency conditions, and then serves as the initiation point for
primer extension from that non-target site, giving rise to
synthesis of certain undesired secondary amplification products.
Ligation probe pairs and cleavage probe pairs can also mis-anneal
to a non-target nucleic acid, oftentimes at low or decreased
stringency conditions, which can also result in the formation of
undesired amplification products.
[0052] The term "non-extendable nucleotide" as used herein refers
to a nucleotide to which substantially no other nucleotide can be
added by a polymerase. In some embodiments, the non-extendable
nucleotides are nucleotide analogs that do not have optimal
functional groups for formation of a phosphodiester linkage with
another nucleotide. In certain embodiments, the non-extendable
nucleotides are chain-terminating nucleotides that allow
essentially no primer extension, for example dideoxynucleotides
(ddNs), such as ddA, ddC, ddG, ddl, ddT, and ddU. In some
embodiments, a polymerase can link other nucleotides to the
non-extendable nucleotide, but at slow rate.
[0053] The terms "non-specific" or "background" when used in
reference to fluorescence refer to the detectable signal emitted
from nucleic acid dye molecules associated with double-stranded
nucleic acids other than desired amplicons. Desired amplicons
comprise the amplification products of target nucleic acids,
including in some embodiments, internal standard or control
sequences that may be included in certain reaction compositions of
the current teachings for, among other things, normalization and/or
quantitation purposes. Thus, the fluorescent signal resulting from
the association of nucleic acid dye molecules with spurious,
secondary amplicons, often the result of mispriming, misligation,
and/or primer dimer formation, is one source of non-specific
fluorescence. Those in the art will appreciate that when the enzyme
inhibitors of the present teachings comprise at least one
double-stranded segment at a first temperature to which nucleic
acid dye molecules can associate, the inhibitor's quencher moiety
can absorb at least some of the detectable fluorescent signal from
the associated nucleic acid dye, a second source of background,
thereby reducing the non-specific fluorescence of the reaction
composition.
[0054] The term "nucleotide base", sometimes referred to as a
nitrogenous base or a nitrogen heterocyclic base, refers to a
substituted or unsubstituted aromatic ring or rings that can serve
as a component of a nucleotide. In certain embodiments, the
aromatic ring or rings contain a nitrogen atom. In certain
embodiments, the nucleotide base is capable of forming Watson-Crick
or Hoogsteen-type hydrogen bonds with a complementary nucleotide
base. Exemplary nucleotide bases and analogs thereof include, the
naturally-occurring nucleotide bases adenine, guanine, cytosine, 5
methylcytosine, uracil, and thymine, and analogs of the naturally
occurring nucleotide bases, including, 7-deazaadenine,
7-deazaguanine, 7-deaza-8-azaguanine, 7-deaza-8-azaadenine,
N6-l:i2-isopentenyladenine (6iA),
N6-l:i2-isopentenyl-2-methylthioadenine (2ms6iA),
N2-dimethylguanine (dmG), 7-methylguanine (7mG), inosine,
nebularine, 2-aminopurine, 2-amino-6-chloropurine,
2,6-diaminopurine, hypoxanthine, pseudouridine, pseudocytosine,
pseudoisocytosine, 5-propynylcytosine, isocytosine, isoguanine,
2-thiopyrim idine, 6-thioguanine, 4-thiothymine, 4-thiouracil,
O.sup.6-methylguanine, N.sub.6-methyladenine,
O.sup.4-methylthymine, 5,6-dihydrothymine, 5,6-dihydrouracil,
pyrazolo[3,4-D]pyrimidines (see, e.g., U.S. Pat. Nos. 6,143,877 and
6,127,121 and PCT Published Application WO 01/38584),
ethenoadenine, indoles such as nitroindole and 4-methylindole, and
pyrroles such as nitropyrrole. Non-limiting examples of nucleotide
bases can be found, e.g., in Fasman, Practical Handbook of
Biochemistry and Molecular Biology, pp. 385-394, CRC Press, Boca
Raton, Fla. (1989) and the references cited therein.
[0055] The term "nucleotide" as used herein refers to a phosphate
ester of a nucleoside, e.g., a triphosphate ester, wherein the most
common site of esterification is the hydroxyl group attached to the
C-5 position of the pentose. The term "nucleotide" is also used to
generally refer to a set of compounds including both nucleosides
and nucleotides, unless otherwise apparent from the context. The
term "nucleoside", as used herein, refers to a compound comprising
a nucleotide base linked to the C-1' carbon of a sugar, such as
ribose, arabinose, xylose, and pyranose, and sugar analogs thereof.
The sugar may be substituted or unsubstituted. Substituted ribose
sugars include, but are not limited to, those riboses in which one
or more of the carbon atoms, for example the 2'-carbon atom, is
substituted with one or more of the same or different, --R, --OR,
--NR2 azide, cyanide or halogen groups, where each R is
independently H, C1-Ce alkyl, C2-C7 acyl, or Cs-C14 aryl. Exemplary
riboses include, but are not limited to, 2'-(C1-C6)alkoxyribose,
2'-(C5-C14)aryloxyribose, 2',3'-didehydroribose,
2'-deoxy-3'-haloribose, 2'-deoxy-3'-fluororibose,
2'-deoxy-3'-chlororibose, 2'-deoxy-3'-aminoribose,
2'-deoxy-3'-(C1-C6)alkylribose, 2'-deoxy-3'-(C1-C6)alkoxyribose and
2'-deoxy-3'-(C5-C14)aryloxyribose, ribose, 2'-deoxyribose,
2',3'-dideoxyribose, 2'-haloribose, 2'-fluororibose,
2'-chlororibose, and 2'-alkylribose, e.g., 2'-O-methyl,
4'-a-anomeric nucleotides, 1'-a-anomeric nucleotides, 2'-4'- and
3'-4'-linked and other "locked" or "LNA", bicyclic sugar
modifications (see, e.g., PCT Published Application Nos. WO
98/22489, WO 98/39352, and WO 99/14226; and Braasch and Corey,
Chem. Biol. 8:1-7, 2001; and U.S. Pat. No. 6,268,490). "LNA" or
"locked nucleic acid" is a nucleotide analog that is
conformationally locked such that the ribose ring is constrained by
a methylene linkage between, for example but not limited to, the
2'-oxygen and the 3'- or 4'-carbon or a 3'-4' LNA with a 2'-5'
backbone (see, e.g., Imanishi and Obika, U.S. Pat. No. 6,268,490;
and Wengel and Nielsen, U.S. Pat. No. 6,670,461). The conformation
restriction imposed by the linkage often increases binding affinity
for complementary sequences and increases the thermal stability of
such duplexes. Exemplary LNA sugar analogs within a polynucleotide
include the structures:
##STR00001##
where B is any nucleotide base.
[0056] The 2'- or 3'-position of ribose can be modified to include
hydrogen, hydroxy, methoxy, ethoxy, allyloxy, isopropoxy, butoxy,
isobutoxy, methoxyethyl, alkoxy, phenoxy, azido, cyano, amido,
imido, amino, alkylamino, fluoro, chloro and bromo. Nucleotides
include the natural D optical isomer, as well as the L optical
isomer forms (see, e.g., Garbesi et al., Nucl. Acids Res.
21:4159-65 (1993); Fujimori et al., J. Amer. Chem. Soc. 112:7436-38
(1990); Urata et al., Nucl. Acids Symposium Ser. No. 29:69-70
(1993)). When the nucleotide base is a purine, e.g., A or G, the
ribose sugar is attached to the N.sup.9-position of the nucleotide
base. When the nucleotide base is a pyrimidine, e.g. C, T, or U,
the pentose sugar is attached to the N.sup.1-position of the
nucleotide base, except for pseudouridines, in which the pentose
sugar is attached to the C5 position of the uracil nucleotide base
(see, e.g., Kornberg and Baker, DNA Replication, 2.sup.nd Ed.
(1992), Freeman, San Francisco, Calif.).
[0057] One or more of the pentose carbons of a nucleotide may be
substituted with a phosphate ester having the formula:
##STR00002##
where .alpha. is an integer from 0 to 4. In certain embodiments, a
is 2 and the phosphate ester is attached to the 3- or 5-carbon of
the pentose. In certain embodiments, the nucleotides are those in
which the nucleotide base is a purine, a 7-deazapurine, a
pyrimidine, or an analog thereof. The term "nucleotide
5'-triphosphate" refers to a nucleotide with a triphosphate ester
group at the 5' position, and is sometimes denoted as "rNTP", or
"dNTP" and "ddNTP" to particularly point out the structural
features of the ribose sugar, or generically as "NTP". The
triphosphate ester group may include sulfur substitutions for the
various oxygens, e.g., a-thio-nucleotide 5-triphosphates. Reviews
of nucleotide chemistry can be found in, among other places,
Miller, Bioconjugate Chem. 1:187-91 (1990); Shabarova, Z. and
Bogdanov, A Advanced Organic Chemistry of Nucleic Acids, VCH, New
York (1994); and Nucleic Acids in Chemistry and Biology, 2d ed.,
Blackburn and Gait, eds., Oxford University Press (1996;
hereinafter "Blackburn and Gait").
[0058] The term "nucleotide analogs" refers to synthetic analogs
having modified nucleotide base portions, modified pentose
portions, and/or modified phosphate portions, and, in the case of
polynucleotides, modified internucleotide linkages, as generally
described herein and elsewhere (e.g., Scheit, Nucleotide Analogs,
John Wiley, New York, 1980; Englisch, Angew. Chem. Int. Ed. Engl.
30:613-29, 1991; Agarwal, Protocols for Polynucleotides and
Analogs, Humana Press, 1994; and S. Verma and F. Eckstein, Ann.
Rev. Biochem. 67:99-134, 1998). Generally, modified phosphate
portions comprise analogs of phosphate wherein the phosphorous atom
is in the +5 oxidation state and one or more of the oxygen atoms is
replaced with a non-oxygen moiety, for example but not limited to,
sulfur. Some non-limiting examples of phosphate analogs include
phosphorothioate, phosphorodithioate, phosphoroselenoate,
phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate,
phosphoramidate, boronophosphates, including associated
counterions, e.g., H+, NH4+, Na+, if such counterions are present.
Non-limiting examples of modified nucleotide base portions include
5-methylcytosine (5mC); C-5-propynyl analogs, including but not
limited to, C-5 propynyl-C and C-5 propynyl-U; 2,6-diaminopurine,
also known as 2-amino adenine or 2-amino-dA; hypoxanthine,
pseudouridine, 2-thiopyrimidine, isocytosine (isoC), 5-methyl isoC,
and isoguanine (isoG; see, e.g., U.S. Pat. No. 5,432,272).
Non-limiting examples of modified pentose portions include LNA
analogs including without limitation Bz-A-LNA, 5-Me-Bz-C-LNA,
dmf-G-LNA, and T-LNA (see, e.g., The Glen Report, 16(2):5 (2003);
Koshkin et al., Tetrahedron 54:3607-30 (1998)), and 2'- or
3'-modifications where the 2'- or 3-position is hydrogen, hydroxy,
alkoxy (e.g., methoxy, ethoxy, allyloxy, isopropoxy, butoxy,
isobutoxy and phenoxy), azido, amino, alkylamino, fluoro, chloro,
or bromo. Modified internucleotide linkages include phosphate
analogs, analogs having achiral and uncharged intersubunit linkages
(e.g., Sterchak, E. P. et al., Organic Chem. 52:4202 (1987)), and
uncharged morpholino-based polymers having achiral intersubunit
linkages (see, e.g., U.S. Pat. No. 5,034,506). Some non-limiting
examples of internucleotide linkage analogs include morpholidate,
acetal, and polyamide-linked heterocycles. In one class of
nucleotide analogs, known as peptide nucleic acids, including
without limitation pseudocomplementary peptide nucleic acids
(collectively "PNA"), a conventional sugar and internucleotide
linkage has been replaced with a 2-aminoethylglycine amide backbone
polymer (see, e.g., Nielsen et al., Science, 254:1497-1500 (1991);
Egholm et al., J. Am. Chem. Soc., 114: 1895-1897 (1992); Demidov et
al., Proc. Natl. Acad. Sci. 99:5953-58 (2002); Peptide Nucleic
Acids: Protocols and Applications, Nielsen, ed., Horizon Bioscience
(2004)). A wide range of nucleotide analogs for use in enzymatic
incorporation or chemical synthesis are available as triphosphates,
phosphoramidates, or CPG derivatives from, among other sources,
Glen Research, Sterling, MD; Link Technologies, Lanarkshire,
Scotland, UK; and TriLink BioTechnologies, San Diego, Calif.
Descriptions of oligonucleotide synthesis and certain nucleotide
analogs, can be found in, among other places, S. Verma and F.
Eckstein, Ann. Rev. Biochem. 67:99-134 (1999); Goodchild, Bioconj.
Chem. 1:165-87 (1990); Current Protocols in Nucleic Acid Chemistry,
Beaucage et al., eds., John Wiley & Sons, New York, N.Y.,
including updates through August 2005 (hereinafter "Beaucage et
al."); and Blackburn and Gait.
[0059] As used herein, the term "primer-binding site" refers to a
region of a polynucleotide sequence, typically a target nucleic
acid and/or an amplicon that can serve directly, or by virtue of
its complement, as the template upon which a primer can anneal for
any suitable primer extension reaction known in the art, for
example but not limited to, PCR. It will be appreciated by those of
skill in the art that when two primer-binding sites are present on
a single polynucleotide, the orientation of the two primer-binding
sites is generally different. For example, one primer of a primer
pair is complementary to and can hybridize with to the first
primer-binding site, while the corresponding primer of the primer
pair is designed to hybridize with the complement of the second
primer-binding site. Stated another way, in some embodiments the
first primer-binding site can be in a sense orientation, and the
second primer-binding site can be in an antisense orientation. A
primer-binding site of an amplicon may, but need not comprise the
same sequence as or at least some of the sequence of the target
flanking sequence or its complement.
[0060] Those in the art understand that as a target nucleic acid
and/or an amplification product is amplified by certain
amplification means, the complement of the primer-binding site is
synthesized in the complementary amplicon or the complementary
strand of the amplicon. Thus, it is to be understood that the
complement of a primer-binding site is expressly included within
the intended meaning of the term primer-binding site, as used
herein.
[0061] As used herein, the term "probe-binding site" refers to a
region of a polynucleotide sequence, typically a target nucleic
acid and/or an amplicon that can serve directly, or by virtue of
its complement, as the template upon which probe can anneal. It
will be appreciated by those of skill in the art that the
probe-binding site for a ligation probe pair comprise an upstream
probe-binding site and a downstream probe binding site and that
these two sites are typically adjacent to each other. In certain
embodiments, the upstream ligation probe-binding site and the
downstream probe-binding site are not adjacent to each other and an
amplifying step can comprises a gap-filling reaction. It will also
be appreciated by those of skill in the art that the probe-binding
site for a cleavage probe pair comprises an upstream probe-binding
site that is adjacent to, and may but need not overlap at least
part of the downstream cleavage probe-binding site.
[0062] Those in the art understand that as a target nucleic acid
and/or an amplification product is amplified by certain
amplification means, the complement of the probe-binding site is
synthesized in the complementary amplicon or the complementary
strand of the amplicon. Thus, it is to be understood that the
complement of a probe-binding site is expressly included within the
intended meaning of the term probe-binding site, as used
herein.
[0063] As used herein, the terms "polynucleotide",
"oligonucleotide", and "nucleic acid" are used interchangeably and
refer to single-stranded and double-stranded polymers of nucleotide
monomers, including without limitation 2'-deoxyribonucleotides
(DNA) and ribonucleotides (RNA) linked by internucleotide
phosphodiester bond linkages, or internucleotide analogs, and
associated counter ions, e.g., H+, NH4+, trialkylammonium,
Mg.sup.2+, Na+, and the like. A polynucleotide may be composed
entirely of deoxyribonucleotides, entirely of ribonucleotides, or
chimeric mixtures thereof and can include nucleotide analogs. The
nucleotide monomer units may comprise any of the nucleotides
described herein, including, but not limited to, nucleotides and/or
nucleotide analogs. Polynucleotides typically range in size from a
few monomeric units, e.g. 5-40 when they are sometimes referred to
in the art as oligonucleotides, to several thousands of monomeric
nucleotide units. Unless denoted otherwise, whenever a
polynucleotide sequence is represented, it will be understood that
the nucleotides are in 5' to 3' order from left to right and that
"A" denotes deoxyadenosine, "C" denotes deoxycytosine, "G" denotes
deoxyguanosine, "T" denotes thymidine, and "U" denotes
deoxyuridine, unless otherwise noted.
[0064] The term "quencher" as used herein refers to a moiety that
absorbs at least some of the intensity of a fluorescent emission.
Quenchers can be categorized as fluorescent quenchers and dark
quenchers (sometimes also referred to as non-fluorescent
quenchers). A fluorescent quencher is a moiety, typically a
fluorophore, that can absorb the fluorescent signal emitted from a
source of fluorescence at a first wavelength, for example but not
limited to, a nucleic acid dye associated with a double-stranded
segment of nucleic acid, and after absorbing enough fluorescent
energy, the fluorescent quencher can emit fluorescence at a second
wavelength that is characteristic of the quencher, a process termed
"fluorescent resonance energy transfer" or FRET. For example but
not as a limitation, the FAM fluorophore associated with a TAMRA
fluorescent quencher can be illuminated at 492 nm, the excitation
peak for FAM, and emit fluorescence at 580 nm, the emission peak
for TAMRA. A dark quencher, appropriately paired with a source of
fluorescence, absorbs the fluorescent energy from the source, but
does not itself fluoresce. Rather, the dark quencher dissipates the
absorbed energy, typically as heat. In certain embodiments, a dark
quencher comprises a chromophore that acts as an energy transfer
acceptor from a fluorescent source, such as a nucleic acid dye
associated with a double-stranded segment of an enzyme inhibitor of
the present teachings, but does not emit a detectable fluorescent
signal of its own. Non-limiting examples of dark or non-fluorescent
quenchers include DABCYL (4-(4'-dimethylaminophenylazo) sulfonic
acid); Black Hole Quenchers series quenchers, for example but not
limited to BHQ-1, BHQ-2, and BHQ-3; Iowa Black; QSY series
quenchers, for example but not limited to QSY-7; AbsoluteQuencher;
Eclipse non-fluorescent quencher; nanocrystals for example but not
limited to quantum dots; metals such as gold nanoparticles; and the
like.
[0065] As used herein, the term "reaction vessel" generally refers
to any container, chamber, device, or assembly, in which a reaction
can occur in accordance with the present teachings. In some
embodiments, a reaction vessel can be a microtube, for example but
not limited to a 0.2 ml or a 0.5 ml reaction tube such as a
MicroAmp.RTM. Optical tube (Applied Biosystems) or a
micro-centrifuge tube, or other containers of the sort in common
practice in molecular biology laboratories. In some embodiments, a
reaction vessel comprises a well of a multi-well plate, a spot on a
glass slide, or a channel or chamber of a microfluidics device,
including without limitation an Applied Biosystems TaqMan Low
Density Array. For example but not as a limitation, a plurality of
reaction vessels can reside on the same support. In some
embodiments, lab-on-a-chip like devices, available for example from
Caliper and Fluidgm, can serve as reaction vessels in the disclosed
methods. It will be recognized that a variety of reaction vessels
are commercially available or can be designed for use in the
context of the present teachings.
[0066] The term "reporter group" is used in a broad sense herein
and refers to any identifiable tag, label, or moiety.
[0067] The term "small RNA molecule" is used in a broad sense
herein and refers to any nucleic acid sequence comprising
ribonucleotides that are non-coding and typically have a length of:
150 nucleotides or less, 100 nucleotides or less, 75 nucleotides or
less, 30 nucleotides or less, between 19 and 27 nucleotides, and
between 21 and 23 nucleotides. A small RNA molecule can be
single-stranded, double-stranded, or can comprise at least one
single-stranded region and at least one double-stranded region,
including without limitation, stem-loop or hairpin structures.
Non-limiting examples of small RNA molecules include untranslated
functional RNA, non-coding RNA (ncRNA), small non-messenger RNA
(snmRNA), small interfering RNA (siRNA), tRNA, tiny non-coding RNA
(tncRNA), small modulatory RNA (smRNA), snoRNA, stRNA, snRNA,
microRNA (miRNA) including without limitation miRNA precursors such
as primary miRNA (pri-miRNA) and precursor miRNA (pre-miRNA), and
small interfering RNA (siRNA) (see, e.g., Eddy, Nature Reviews
Genetics 2:919-29 (2001); Storz, Science 296:1260-63 (2002);
Buckingham, Horizon Symposia: Understanding the RNAissance: 1-3
(2003)). In certain embodiments, a target nucleic acid comprises a
small RNA molecule. Those enzyme inhibitors of the current
teachings that comprise ribonucleotides and/or ribonucleotide
analogs are expressly excluded from the intended scope of the term
small RNA molecule as used in this specification.
[0068] The term "thermostable" when used in reference to an enzyme,
indicates that the enzyme is functional or active (i.e., can
perform catalysis) at an elevated temperature, for example but not
limited to, at about 55.degree. C. or higher. Thermostable enzymes
that may be suitable for use in the current teachings are
commercially available from various vendors, including without
limitation, Applied Biosystems (Foster City, Calif.), Promega
(Madison, Wis.), Stratagene (LaJolla, Calif.), and New England
Biolabs (Beverly, Mass.). Those in the art will understand that
thermostable enzymes can be isolated from a variety of thermophilic
and/or hyperthermophilic organisms, for example but not limited to,
certain species of eubacteria and archaea, including without
limitation, certain viruses that infect such organisms and that
such thermostable enzymes may be suitable for use in the disclosed
complexes, methods, and kits.
[0069] The terms "universal base" or "universal nucleotide" are
generally used interchangeably herein and refer to a nucleotide
analog that can substitute for more than one species of
naturally-occurring nucleotide in a polynucleotide, including
without limitation, an enzyme inhibitor. Universal bases typically
contain an aromatic ring moiety that may or may not contain
nitrogen atoms and generally use aromatic ring stacking to
stabilize a duplex. In certain embodiments, a universal base may be
covalently attached to the C-1' carbon of a pentose sugar to make a
universal nucleotide. In certain embodiments, a universal base does
not hydrogen bond specifically with another nucleotide base. In
certain embodiments, a nucleotide base may interact with adjacent
nucleotide bases on the same nucleic acid strand by hydrophobic
stacking. Non-limiting examples of universal nucleotides and
universal bases include deoxy-7-azaindole triphosphate (d7AITP),
deoxyisocarbostyril triphosphate (dICSTP),
deoxypropynylisocarbostyril triphosphate (dPICSTP),
deoxymethyl-7-azaindole triphosphate (dM7AITP), deoxylmPy
triphosphate (dlmPyTP), deoxyPP triphosphate (dPPTP),
deoxypropynyl-7-azaindole triphosphate (dP7AITP), 3-methyl
isocarbostyril (MICS), 5-methyl isocarbyl (5MICS),
imidazole-4-carboxamide, 3-nitropyrrole, 5-nitroindole,
hypoxanthine, inosine, deoxyinosine, 5-fluorodeoxyuridine,
4-nitrobenzimidizole, and certain PNA-bases, including without
limitation certain pseudocomplementary PNA (pcPNA) bases.
Descriptions of universal bases can be found in, among other
places, Loakes, Nucl. Acids Res. 29:2437-47 (2001); Berger et al.,
Nucl. Acids Res. 28:2911-14 (2000); Loakes et al., J. Mal. Biol.
270:426-35 (1997); Verma and Eckstein, Ann. Rev. Biochem. 67:99-134
(1998); Published PCT Application No. US02/33619, and Patron and
Pervin, U.S. Pat. No. 6,433,134.
[0070] When two different oligonucleotides anneal to different
regions of the same linear complementary nucleic acid, and the
3'-end of one oligonucleotide faces or opposes the 5'-end of the
other oligonucleotide, the former may be referred to as the
"upstream" oligonucleotide and the latter the "downstream"
oligonucleotide.
[0071] Certain Exemplary Components
[0072] The term "cleaving enzyme" refers to any polypeptide that
can, when combined with a nucleic acid cleavage structure
(sometimes referred to as an overlap flap structure or an invasive
cleavage reaction substrate) and under appropriate conditions,
cleave the non-annealed flap portion of the downstream cleavage
probe to generate a structure comprising a ligatable nick.
Non-limiting examples of cleaving enzymes include
structure-specific nucleases, for example but not limited to,
certain DNA polymerases from bacteria and bacteriophages, including
isolated 5'exonuclease domains thereof; Cleavase.RTM. enzymes
(Third Wave Technologies, Inc., Madison, Wis.); eukaryotic flap
endonucleases; and archaeal flap endonucleases (see, e.g.,
Lyamichev et al., Science 260:778-83 (1993); Li et al., J. Biol.
Chem. 270:22109-12 (1995); Wu et al., Nucl. Acids Res. 24:2036-43
(1996); Hosfield et al., J. Biol. Chem. 273:27154-61 (1998); Kaiser
et al., J. Biol. Chem. 274:21387-94 (1999); Allawi et al., J. Mal.
Biol. 328:537-54 (2003); and U.S. Pat. Nos. 5,614,402 and
6,706,471).
[0073] A nucleic acid cleavage structure typically comprises a
template strand (generally a target nucleic acid, a single-stranded
amplicon, or a separated strand of a double-stranded amplicon)
hybridized with a cleavage probe pair comprising two overlapping
probes that hybridize with the template strand to form a "flap".
The first or upstream cleavage probe comprises a sequence that is
complementary with a first portion of the template strand and
overlaps the 5'-end of the template-complementary sequence of the
second or downstream cleavage probe, which comprises (1) a sequence
that is complementary with a second portion of the template strand
that is adjacent to the first portion of the template strand and
(2) a 5'-region comprising at least one nucleotide that may or may
not be complementary with the template strand, but when hybridized
with the template strand, is displaced by the 3'-end of the
upstream cleavage probe (see, e.g., Lyamichev et al., Nat.
Biotechnol. 17:292-96 (1999), particularly FIG. 1; Neville et al.,
BioTechniques 32:S34-43 (2002), particularly FIG. 2 A; Allawi et
al., J. Mal. Biol. 328:537-54 (2003), particularly FIG. 2; and Brow
et al., U.S. Pat. No. 6,706,471, for example at FIGS. 32 and 65).
Certain cleaving enzyme inhibitors of the present teachings are
designed to assume a conformation at a first temperature that
resembles or mimics a nucleic acid cleavage structure. Certain
disclosed cleaving enzyme inhibitors can form a nucleic acid
cleavage structure at a first temperature, but at least one
oligonucleotide comprises at least one nucleotide analog and/or at
least one internucleotide linkage that can not be cleaved or is
slowly cleaved by the cleaving enzyme (an "uncleavable
internucleotide linkage"). Non-limiting examples of uncleavable
internucleotide linkages include phosphorothioates, including
without limitation phosphorodithioates; methyl phosphonates;
phosphoram idates; and boranophosphates.
[0074] A "ligase" is a polypeptide that, under appropriate
conditions, catalyzes phosphodiester bond formation between the
3'-OH and the 5'-phosphate of adjacently hybridized probes,
including without limitation, a first and second ligation probe of
a ligation probe set or a first cleavage probe and the hybridized
fragment of a second cleavage probe that has been cleaved by a
cleaving enzyme. Temperature sensitive ligases, include but are not
limited to, bacteriophage T4 ligase and E. coli ligase.
Non-limiting examples of thermostable ligases include Afuligase,
Taq ligase, Tflligase, Mth ligase, Tth ligase, Tth HB8 ligase, Tse
ligase, Thermus species AK16D ligase, Ape ligase, LigTk ligase, Aae
ligase, Rm ligase, and Pfu ligase (see, e.g., Housby et al., Nucl.
Acids Res. 28:e10, 2000; Tong et al., Nucl. Acids Res. 28:1447-54,
2000; Nakatani et al., Eur. J. Biochem. 269:650-56, 2002; and
Sriskanda et al., Nucl. Acids Res. 11:2221-28, 2000). The skilled
artisan will appreciate that any number of mesophilic,
thermostable, and/or hyperthermophilic ligases, including DNA
ligases and RNA ligases, can be obtained from mesophilic,
thermophilic, or hyperthermophilic organisms, for example, certain
species of eubacteria and archaea, and including certain viruses
that infect such mesophilic, thermophilic, or hyperthermophilic
organisms; and that such ligases may be suitable in the disclosed
complexes, methods and kits.
[0075] The term "nucleic acid dye" as used herein refers to a
fluorescent molecule that is specific for a double-stranded
polynucleotide or that at least shows a substantially greater
fluorescent enhancement when associated with double-stranded
polynucleotide acid than with a single-stranded polynucleotide.
Typically nucleic acid dye molecules associate with double-stranded
segments of polynucleotides by intercalating between the base pairs
of the double-stranded segment, by binding in the major or minor
grooves of the double-stranded segment, or both. Non-limiting
examples of nucleic acid dyes include ethidium bromide, DAPI,
Hoechst derivatives including without limitation Hoechst 33258 and
Hoechst 33342, intercalators comprising a lanthanide chelate (for
example but not limited to a nalthalene diimide derivative carrying
two fluorescent tetradentate pi-diketone-Eu3+ chelates
(NDI-(BHHCT-Eu.sup.3+)2), see, e.g., Nojima et al., Nucl. Acids
Res. Supplement No. 1, 105-06 (2001)), ethidium bromide, and
certain unsymmetrical cyanine dyes such as SYBR Green.RTM.,
PicoGreen.RTM., and BOXTO.
[0076] The nucleic acid sequences of certain disclosed enzyme
inhibitors comprise an aptamer. Aptamers bind target molecules in a
highly specific, conformation-dependent manner, typically with very
high affinity, although those in the art will understand that
aptamers with lower binding affinity can be selected if desired.
Aptamers have been shown to distinguish between targets based on
very small structural differences such as the presence or absence
of a methyl or hydroxyl group and certain aptamers can distinguish
between D- and L-enantiomers. Aptamers have been obtained that bind
small molecular targets, including drugs, metal ions, and organic
dyes, peptides, biotin, and proteins, including but not limited to
streptavidin, VEGF, viral proteins, and various enzymes, including
without limitation DNA-dependent DNA polymerase, RNA-dependent DNA
polymerase, RNA-dependent RNA polymerase, helicase, and protease
(see, e.g., Lin and Jayasena, J. Mal. Biol. 271:100-11 (1997);
Thomas et al., J. Biol. Chem. 272:27980-86 (1997); Kulbachinskiy et
al., Eur. J. Biochem. 271:4921-31 (2004); Hannoush et al.,
Chembiochem. 5:527-33 (2004); Bellecave et al., Oligonucleotides
13:455-63 (2003); and Nishikawa et al., Nucl. Acids Res. 31:1935-43
(2003)). Aptamers have been shown to retain functional activity
after biotinylation, fluorescein labeling, and when attached to
glass surfaces and microspheres.
[0077] Aptamers, including speigelmers, are identified by an in
vitro selection process, for example but not limited to the process
known as systematic evolution of ligands by exponential
amplification (SELEX). In the SELEX process very large
combinatorial libraries of oligonucleotides, for example 10.sup.1
to 10.sup.11 individual sequences, often as large as 60-100
nucleotides long, are routinely screened by an iterative process of
in vitro selection and amplification. Most targets are affinity
enriched within 8-15 cycles and the process has been automated
allowing for faster aptamer isolation. The skilled artisan will
understand that aptamers can be obtained following conventional
procedures and without undue experimentation. Descriptions of
aptamers and their selection can be found in, among other places,
L. Gold, J. Biol. Chem., 270(23):13581-84 (1995); L. Gold et al.,
Ann. Rev. Biochem. 64:763-97 (1995); Wilson and Szostak, Ann. Rev.
Biochem. 68:611-47 (1999); Cox et al., Nucl. Acids Res. 30:e108
(2002); Hermann and Patel, Science 287:820-25 (2000); Vuyisich and
Beal, Chem. & Biol. 9:907-13 (2002); S. Jayasena, Clin. Chem.,
45:1628-50 (1999); Cox and Ellington, Bioorg. Med. Chem. 9:2525-31
(2001); Eulberg et al., Nucl. Acids Res. 33:e5 (2005); and Jayasena
and Gold, U.S. Pat. No. 6,183,967.
[0078] The term "DNA polymerase" is used in a broad sense herein
and refers to any polypeptide that can catalyze the 5'-3'extension
of a hybridized primer by the addition of deoxyribonucleotides
and/or certain nucleotide analogs in a template-dependent manner.
For example but not limited to, the sequential addition of
deoxyribonucleotides to the 3'-end of a primer that is annealed to
a nucleic acid template during a primer extension reaction.
Non-limiting examples of DNA polymerases include RNA-dependent DNA
polymerases, including without limitation reverse transcriptases,
and DNA-dependent DNA polymerases. It is to be appreciated that
certain DNA polymerases (for example but not limited to certain
eubacterial Type A DNA polymerases and Taq DNA polymerase) may
further comprise a structure-specific nuclease activity and that
when an amplification reaction comprises an invasive cleavage
reaction, for example but not limited to, FEN-LCR or PCR-FEN (see,
e.g., Bi et al., U.S. Pat. No. 6,511,810; and Neville et al.,
BioTechniques 32:S34-43 (2002)), wherein the cleaving enzyme
comprises a DNA polymerase, such polymerase is referred to herein
as a cleaving enzyme in the invasive cleavage context and the
corresponding enzymatic activity comprises structure-specific
oligonucleotide cleavage. In certain embodiments, a DNA polymerase
provides both a polymerization activity and a structure-specific
cleaving activity. The term "RNA polymerase" refers to a
DNA-dependent RNA polymerase or an RNA-dependent polymerase
(sometimes referred to as an RNA replicase), and includes any
polypeptide that can catalyze the 5'-3' addition of ribonucleotides
in a template-dependent manner. In certain embodiments, an RNA
polymerase binds to a promoter sequence and catalyzes
transcription. Non-limiting examples of RNA polymerases include the
RNA polymerases from the bacteriophages T3, T7, SP6, f2, MS2, and
Q.beta..
[0079] The term "primer" refers to a polynucleotide, generally an
oligonucleotide comprising a "target" binding portion that is
typically about 12 to about 35 nucleotides long, that is designed
to selectively hybridize with a target nucleic acid flanking
sequence or to a corresponding primer-binding site of an
amplification product under appropriate stringency conditions, and
serve as the initiation point for the synthesis of a nucleotide
sequence that is complementary to the corresponding polynucleotide
template from its 3'-end.
[0080] The terms "forward" and "reverse" when used in reference to
the primers of a primer pair indicate the relative orientation of
the primers on a polynucleotide sequence. For illustration purposes
but not as a limitation, consider a single-stranded polynucleotide
drawn in a horizontal, left to right orientation with its 5'-end on
the left. The "reverse" primer is designed to anneal with the
downstream primer-binding site at or near the "3'-end" of this
illustrative polynucleotide in a 5' to 3' orientation, right to
left. The corresponding "forward primer is designed to anneal with
the complement of the upstream primer-binding site at or near the
"5-end" of the polynucleotide in a 5' to 3' "forward" orientation,
left to right. Thus, the reverse primer comprises a sequence that
is complementary to the reverse or downstream primer-binding site
of the polynucleotide and the forward primer comprises a sequence
that is the same as or substantially the same as the forward or
upstream primer-binding site. It is to be understood that the terms
"3-end" and "5'-end" as used in this paragraph are illustrative
only and do not necessarily refer literally to the respective ends
of the polynucleotide. Rather, the only limitation is that the
reverse primer of this exemplary primer pair anneals with a reverse
primer-binding site that is downstream of the forward
primer-binding site that comprises the same sequence or
substantially the same sequence as the "target" binding portion of
the corresponding forward primer. As will be recognized by those of
skill in the art, these terms are not intended to be limiting, but
rather to provide illustrative orientation in a given
embodiment.
[0081] A "primer pair" of the current teachings comprises a forward
primer and a corresponding reverse primer. The forward primer
comprises a first target-specific portion that comprises a sequence
that is the same as or substantially the same as the nucleotide
sequence of the first or upstream target flanking sequence, and
that is designed to selectively hybridize with the complement of
the upstream target flanking sequence that is present in, among
other places, the reverse amplification product. The reverse primer
of the primer pair comprises a second target-specific portion that
comprises a sequence that is complementary to or substantially
complementary to, and that is designed to selectively hybridize
with, the second or downstream target region flanking sequence that
is present in among other places, the forward amplification
product. In certain embodiments, a forward primer, a reverse
primer, or a forward primer and a reverse primer of a primer pair
further comprises a reporter-probe binding site, a universal
primer-binding site, and/or a reporter group, for example but not
limited to a fluorescent reporter group. In some embodiments, a
sequencing primer comprises a fluorescent reporter group. In
certain embodiments, a forward primer and the corresponding reverse
primer of a primer pair have different melting temperatures to
permit temperature-based asymmetric PCR.
[0082] A universal primer or primer set may be employed according
to certain embodiments of the current teachings. In certain
embodiments, a universal primer or a universal primer set
hybridizes with and can be used to amplify two or more different
target nucleic acid species and/or two or more different species of
desired amplicon.
[0083] The term "probe" refers to a polynucleotide that comprises a
portion that is designed to hybridize in a sequence-specific manner
with a complementary probe-binding site on a particular nucleic
acid sequence, for example but not limited to a target nucleic acid
or an amplification product. In certain embodiments, corresponding
probes of a ligation probe set are ligated together to form a
ligated probe. In some embodiments, corresponding probes of a
cleavage probe set anneal with a template strand to form a nucleic
acid cleavage structure, which can be cleaved by an appropriate
cleaving enzyme under suitable conditions to form a hybridization
structure comprising the template strand, the upstream cleavage
probe, and a hybridized fragment of the second cleavage probe. In
certain embodiments, the annealed upstream cleavage probe and the
hybridized fragment of the downstream cleavage probe are ligated
together to form a ligated probe. In certain embodiments, a probe
comprises a reporter group, for example but not limited to, a
reporter probe. In some embodiments, a probe comprises a
primer-binding iste.
[0084] The sequence-specific portions of probes and primers of the
current teachings are of sufficient length to permit specific
annealing to complementary sequences in target nucleic acids and
desired amplicons. Detailed descriptions of primer and probe design
can be found in, among other places, Dieffenbach and Dveksler, PCR
Primer, A Laboratory Manual, Cold Spring Harbor Press (1995;
hereinafter "PCR Primer"); R. Rapley, The Nucleic Acid Protocols
Handbook (2000), Humana Press, Totowa, N.J. (hereinafter "Rapley");
Schena; and Kwok et al., Nucl. Acid Res. 18:999-1005 (1990). Primer
and probe design software programs are also commercially available,
including without limitation, Primer Express, Applied Biosystems,
Foster City, Calif.; Primer Premier and Beacon Designer software,
PREMIER Biosoft International, Palo Alto, Calif.; Primer Designer
4, Sci-Ed Software, Durham, N.C.; Primer Detective, ClonTech, Palo
Alto, Calif.; Lasergene, DNASTAR, Inc., Madison, Wis.; Oligo
software, National Biosciences, Inc., Plymouth, Minn.; iOligo,
Caesar Software, Portsmouth, N.H.; and RTPrimerDB on the world wide
web at realtimeprimerdatabase.ht.st or at
medgen31.urgent.be/primerdatabase/index (see a/so, Pattyn et al.,
Nucl. Acid Res. 31:122-23 (2003)).
[0085] The skilled artisan will appreciate that the complement of
the disclosed probes and primers, target nucleic acids, desired
amplicons, or combinations thereof, may be employed in certain
embodiments of the current teachings. For example, without
limitation, a genomic DNA sample may comprise both the target
nucleic acid sequence and its complement. Thus, in certain
embodiments, when a genomic sample is denatured, both the target
nucleic acid and its complement are present in the sample as
single-stranded sequences. In certain embodiments, a primer, a
ligation probe pair, a cleavage probe pair, or combinations thereof
may be designed to selectively hybridize to an appropriate
sequence, including without limitation, a target nucleic acid, the
complement of a target nucleic acid, an amplicon, and/or the
complement of an amplicon.
[0086] The term "reporter probe" refers to a sequence of
nucleotides and/or nucleotide analogs, that anneals with a target
nucleic acid and/or an amplicon, and when detected, including but
not limited to a change in intensity or of emitted wavelength, is
used to identify and/or quantify the corresponding target nucleic
acid in an end-point or real-time detection technique, for example
but not limited to a Q-PCR technique. Most reporter probes can be
categorized based on their mode of action, for example but not
limited to: nuclease probes, including without limitation
TaqMan.RTM. probes (see, e.g., Livak, Genetic Analysis:
Biomolecular Engineering 14:143-149 (1999); Yeung et al.,
BioTechniques 36:266-75 (2004)); extension probes such as scorpion
primers, Lux.TM. primers, Amplifluors, and the like; hybridization
probes such as molecular beacons, Eclipse probes, light-up probes,
pairs of singly-labeled reporter probes, hybridization probe pairs,
and the like; or combinations thereof. In certain embodiments,
reporter probes comprise a PNA, an LNA, a universal base, or
combinations thereof, and can include stem-loop and stem-less
reporter probe configurations. Certain reporter probes are
singly-labeled, while other reporter probes are doubly-labeled.
Dual probe systems that comprise FRET between adjacently hybridized
probes are within the intended scope of the term reporter probe
(see, e.g., Zhang et al., Hepatology 36:723-28 (2003)).
[0087] An "unsymmetrical cyanine dye", sometimes described in the
art as an asymmetric cyanine dye or an asymmetrical cyanine dye,
refers to a dye molecule with the general formula
R2N[CH.dbd.CH]nCH.dbd.NR2, where n is a small number and the R
groups typically comprise at least one benzazole group and at least
one quinoline group or at least one pyridine group. Non-limiting
examples of unsymmetrical cyanine dyes include
[2-[N-(3-dimethylaminopropyl)-N-propylamino]-4-[2,3-dihydro-3-methyl-(ben-
zo-1,3-thiazol-2-yl)-methylidene]-1-phenyl-quinolinium] (SYBR.RTM.
Green), [2-[N-bis-(3-dimethylam
inopropyl)-amino)-amino]-4-[2,3-dihydro-3-methyl-(benzo-1,3-thiazol-2-yl)-
-methylidene]-1-phenyl-quinolinium] (PicoGreen.RTM.),
4-[(3-methyl-6-(benzothiazol-2-yl)-2,3-dihydro-(benzo-1,3-thiazole)-2-met-
hylidene)]-1-methyl-pyridinium iodide (BEBO), BOXTO, and BETO.
Descriptions of unsymettrical cyanine dyes can be found in, among
other places, Karlsson et al., Nucl. Acids Res. 31:6227-34 (2003);
Zipper et al., Nucl. Acids Res. 32:e103 (2004); Bengtsson et al.,
Nucl. Acids Res. 31:e45 (2003); and Goransson et al., Asymettric
cyanine dyes, DNA-Technology 2005, Chalmers University Technology
(2005; available on the world wide web at:
molbiotech.Chalmers.se/research/mk/Asymmetric % cyanine %
dyes.doc).
[0088] The term "target nucleic acid" or "target" refers to the
nucleic acid sequence that is specifically amplified and/or
detected using the compositions, methods, and kits of the present
teachings (in contrast to a secondary amplification product, which
is the result of a spurious side-reaction, typically due to
mis-priming). In certain embodiments, a target nucleic acid serves
as a template in a primer extension reaction. In some embodiments,
a target nucleic acid serves as a ligation template. In some
embodiments, a target nucleic acid serves as a template strand in a
nucleic acid cleavage structure. In certain embodiments, the target
nucleic acid comprises DNA and is present in genomic DNA (gDNA) or
mitochondrial DNA (mtDNA). In certain embodiments, the target
nucleic acid comprises RNA, for example but not limited to,
ribosomal RNA (rRNA), messenger RNA (mRNA), transfer RNA (tRNA), or
an RNA molecule such as a miRNA precursor, including without
limitation, a pri-miRNA, a pre-miRNA, or a pri-miRNA and a
pre-miRNA. In some embodiments, the target nucleic acid comprises a
small RNA molecule, including without limitation, a miRNA, a siRNA,
a stRNA, a snoRNA, or other ncRNA. The target nucleic acid need not
constitute the entirety of a nucleic acid molecule. For example but
not as a limitation, a large nucleic acid, for example a gDNA
fragment, can comprise a multiplicity of different target nucleic
acids. Typically, a target nucleic acid has at least one defined
end. In many nucleic acid amplification reactions the target has
two defined ends.
[0089] In certain embodiments, a target nucleic acid is located
between two flanking sequences, a first target flanking sequence
and a second target flanking sequence, located on either side of,
but not necessarily immediately adjacent to, the target nucleic
acid. In some embodiments, a polynucleotide such as a gDNA fragment
comprises a plurality of different target nucleic acids. In some
embodiments, a target nucleic acid is contiguous with or adjacent
to one or more different target nucleic acids. In some embodiments,
a given target nucleic acid can overlap one target nucleic acid on
its 5'-end, another target nucleic acid on its 3'-end, or both. In
other embodiments, for example but not limited to when the target
comprises a small RNA molecule, the target may not comprise a
flanking region and a primer is designed to anneal with a portion
of the small RNA target, typically an end of the target nucleic
acid (see, e.g., Chen et al., U.S. patent application Ser. No.
10/947,460.
[0090] Certain Exemplary Component Techniques
[0091] According to the instant teachings, a target nucleic acid
may be obtained from any living or once living organism, including
a prokaryote, an archaea, or a eukaryote, for example but not
limited to: an insect, including without limitation Drosophila; a
worm, including without limitation C. elegans; a plant, including
without limitation Arabidopsis; and an animal, including without
limitation a human, a mouse, a domesticated animal, or a non-human
primate, and including prokaryotic cells and cells, tissues, and
organs obtained from a eukaryote, for example but not limited to,
clinical biopsy material, buccal swabs, cultured cells, and blood
cells. Viral nucleic acid is also within the scope of the current
teachings. In certain embodiments, the target nucleic acid may be
present in a double-stranded or single-stranded form. The skilled
artisan appreciates that gDNA includes not only full length
material, but also fragments generated by any number of means, for
example but not limited to, enzyme digestion, sonication, shear
force, and the like, and that all such material, whether full
length or fragmented, represent forms of gDNA that can serve as
templates for an amplifying reaction of the current teachings.
[0092] A target nucleic acid can be either synthetic or naturally
occurring. Certain target nucleic acid, including flanking
sequences where appropriate, can be synthesized using
oligonucleotide synthesis methods that are well-known in the art.
Detailed descriptions of such techniques can be found in, among
other places, Beaucage; and Blackburn and Gait. Automated DNA
synthesizers useful for synthesizing target nucleic acids and other
oligonucleotides, including without limitation certain enzyme
inhibitors, probes, and primers are commercially available from
numerous sources, including for example, the Applied Biosystems DNA
Synthesizer Models 381A, 391, 392, and 394 (Applied Biosystems,
Foster City, Calif.). Target nucleic acid, including flanking
regions where appropriate, and other oligonucleotides can also be
generated biosynthetically, using in vivo methodologies and/or in
vitro methodologies that are well known in the art. Descriptions of
such technologies can be found in, among other places, Sambrook et
al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor
Press (1989) (hereinafter "Sambrook et al."); and Ausubel et al.,
Current Protocols in Molecular Biology, John Wiley & Sons,
Inc., including supplements through Sep. 26, 2005 (hereinafter
"Ausubel et al.").
[0093] Target nucleic acids for use in the methods of the current
teachings, including but not limited to, gDNA can be obtained from
biological materials using any suitable sample preparation
technique known in the art. Commercially available nucleic acid
extraction instruments and systems include, among others, the ABI
PRISM.RTM. 6100 Nucleic Acid PrepStation and the ABI PRISM.RTM.
6700 Nucleic Acid Automated Work Station. Nucleic acid sample
preparation reagents and kits are also commercially available,
including without limitation, NucPrep.TM. Chemistry, BloodPrep.TM.
Chemistry, the ABI PRISM.RTM. TransPrep System, and PrepMan.TM.
Ultra Sample Preparation Reagent (all from Applied Biosystems); and
the miRvana RNA Isolation kit (Ambion, Austin, Tex.). Purified or
partially purified nucleic acid, including without limitation, gDNA
and total RNA and tissue-specific nucleic acid preparations, is
commercially available from numerous commercial sources, including
but not limited to Coriell Cell Repositories, Coriell Institute for
Medical Research, Camden, N.J.; Serologicals Corp., Norcross, Ga.;
Stratagene, La Jolla Calif.; Ambion, Austin, Tex.; and the American
Type Culture Collection (ATCC), Manassas, Va.
[0094] The terms "amplifying" and "amplification" are used in a
broad sense and refer to any technique known in the art in which a
target nucleic acid, an amplicon, at least part of a target nucleic
acid, or at least part of an amplicon, is reproduced or copied
(including the synthesis of a complementary strand or the formation
of a ligation probe), typically in a template-dependent manner,
including a broad range of techniques for amplifying nucleic acid
sequences, either linearly or exponentially. Some amplifying
techniques are performed isothermally; some amplification
techniques are performed using temperature cycling; some
amplification techniques comprise at least one isothermal
amplifying step and at least one amplifying step comprising
thermocycling. Some non-limiting examples of amplification
techniques include primer extension, including without limitation
PCR, RT-PCR, asynchronous PCR (A-PCR), asymmetric PCR, quantitative
or Q-PCR; ligase chain reaction (LCR), ligase detection reaction
(LOR), including without limitation gap-filling and gap
oligonucleotide versions of each (see, e.g., Cao, Chapter 1.3 in
DNA Amplification: Current Techniques and Applications, Demidov and
Broude, eds., Horizon Bioscience (2004; hereinafter "Demidov and
Broude"); Abravaya et al., Nucl. Acids Res. 23:675-82 (1995);
Lizardi et al., Nat. Genetics 19:225-32 (1998); and Segev, U.S.
Pat. No. 6,004,826); rolling circle amplification (RCA), sometimes
referred to as rolling circle replication (RCR); strand
displacement amplification (SDA) and multiple displacement
amplification (MDA); nucleic acid strand-based amplification
(NASBA), sometimes referred to as transcription-mediated
amplification (TMA) or self-sustained replication (3SR); SPIA.TM.
and RiboSPIA.TM. amplification (see, e.g., Kurn, U.S. Pat. No.
6,251,639 and U.S. Patent Application Publication No. US
2003/0017591A1); and helicase-dependent amplification (HOA; see,
e.g., Vincent et al., EMBO Reports 5:795-800 (2004)), and including
without limitation multiplex versions and/or combinations thereof,
for example but not limited to, OLA/PCR, PCR/LDR, PCR/LCR, also
known as combined chain reaction (CCR). Descriptions of certain
amplification techniques can be found in, among other places,
Molecular Cloning, A Laboratory Manual, Sambrook and Russell, eds.,
Cold Spring Harbor Press, 3d ed. (2001; hereinafter "Sambrook and
Russell"); Sambrook et al.; Ausubel et al.; PCR Primer; McPherson;
Rapley; Lizardi et al., Nat. Genetics 19:225-32 (1998); Wiedmann et
al., S51-64, in PCR Methods and Applications, Cold Spring Harbor
Laboratory Press (1994); Cao, Trends in Biotechnol. 22:38-44
(2004); and Wenz and Schroth, U.S. Patent Application Publication
No. US 2003/0190646A1.
[0095] In certain embodiments, amplification techniques comprise at
least one cycle of amplification, for example, but not limited to,
the steps of: denaturing a double-stranded nucleic acid to separate
the component strands; hybridizing a primer to a target flanking
sequence or a primer-binding site of an amplicon (or complements of
either, as appropriate); and synthesizing a strand of nucleotides
in a template-dependent manner using a DNA polymerase. In certain
embodiments, a cycle of amplification comprises the steps of:
denaturing a double-stranded nucleic acid to separate the component
strands; hybridizing a first ligation probe and a corresponding
second ligation probe to (1) the target nucleic acid or the
complement of the target nucleic acid or (2) an amplicon; and
ligating the adjacently hybridized probes with a ligase to form a
ligated probe (an exemplary amplicon). In certain embodiments, a
cycle of amplification comprises the steps of: denaturing a
double-stranded nucleic acid to separate the component strands;
hybridizing an upstream cleavage probe and a corresponding
downstream cleavage probe to (1) the target nucleic acid or the
complement of the target nucleic acid or (2) an amplicon, to form a
nucleic acid cleavage structure; cleaving the cleavage structure to
release the flap and form a hybridization structure comprising the
upstream cleavage probe annealed adjacent to the hybridized
fragment of the downstream cleavage probe; and optionally ligating
the adjacently hybridized probes with a ligase to form a ligated
probe. The cycle may or may not be repeated. In certain
embodiments, a cycle of amplification comprises a multiplicity of
amplification cycles, for example but not limited to 20 cycles, 25
cycles, 30 cycles, 35 cycles, 40 cycles, 45 cycles or more than 45
cycles of amplification.
[0096] In some embodiments, amplifying comprises thermocycling
using an instrument, for example but not limited to, a GeneAmp.RTM.
PCR System 9700, 9600, 2700, or 2400 thermocycler (all from Applied
Biosystems). In certain embodiments, single-stranded amplicons are
generated in an amplification reaction, for example but not limited
to asymmetric PCR or A-PCR.
[0097] Devices have been developed that can perform a thermal
cycling reaction and detection with reaction compositions
containing a nucleic acid dye, emit a light beam of a specified
wavelength, read the intensity of the fluorescent signal emitted
from the nucleic acid dye molecules associated with double-stranded
nucleic acids, and display the intensity of fluorescence after each
cycle. Devices comprising a thermal cycler, light beam emitter, and
a fluorescent signal detector, have been described, e.g., in U.S.
Pat. Nos. 5,928,907; 6,015,674; and 6,174,670, and include, but are
not limited to the ABI Prism.RTM. 7700 Sequence Detection System
(Applied Biosystems, Foster City, Calif.) and the ABI GeneAmp.RTM.
5700 Sequence Detection System (Applied Biosystems, Foster City,
Calif.).
[0098] In certain embodiments, these functions may be performed by
separate devices. For example but not as a limitation, if one
employs a Q-beta replicase reaction for amplification, the reaction
may not take place in a thermal cycler, but in a reaction vessel in
an instrument that could include a light beam emitted at a specific
wavelength, detection of the fluorescent signal, and calculation
and display of the amount of amplification product on a monitor or
other read-out device.
[0099] In certain embodiments, combined thermal cycling and
fluorescence detecting devices can be used for precise
quantification of target nucleic acid sequences in samples. In
certain embodiments, fluorescent signals can be detected and
displayed during and/or after one or more thermal cycles, thus
permitting monitoring of amplification products as the reactions
occur in "real time." In certain embodiments, one can use the
amount of amplification product and number of amplification cycles
to calculate how much of the target nucleic acid sequence was in
the sample prior to amplification.
[0100] In some embodiments, one ligation probe set is provided for
a target nucleic acid and the target is amplified linearly, for
example but not limited to LOR. In certain embodiments, two
ligation probe sets are provided for a target nucleic acid and the
target is amplified exponentially, for example but not limited to
LCR. In some embodiments, a first cleavage probe and a
corresponding second cleavage probe anneal with the target nucleic
acid to form a nucleic acid cleavage structure comprising a
overlapping or flap sequence that forms a suitable substrate for a
cleaving enzyme. In certain embodiments, after cleavage, the first
cleavage probe and the hybridized fragment of the second cleavage
probe can be ligated to form a ligated probe. In some embodiments,
a ligated probe comprises a primer-binding site and can serve as
the template for a primer extension reaction, for example but not
limited to PCR.
[0101] Primer extension according to the present teachings is an
amplification process comprising elongating a primer that is
annealed to a template in the 5' to 3' direction using a DNA
polymerase. According to certain embodiments, with appropriate
buffers, salts, pH, temperature, and appropriate NTPs (which may,
but need not, comprise a nucleotide analog), a DNA polymerase
incorporates nucleotides complementary to the template strand
starting at the 3'-end of an annealed primer, to generate a
complementary strand. In certain embodiments, the DNA polymerase
used for primer extension lacks or substantially lacks
5'-exonuclease activity, 3'-exonuclease activity, or both. In some
embodiments, primer extension comprises reverse transcription and
the DNA polymerase comprises a reverse transcriptase or a
DNA-dependent DNA polymerase that under certain conditions
comprises reverse transcriptase activity, for example but not
limited to, Thermus thermophilus (Tth) DNA polymerase, recombinant
Tth DNA polymerase (rTth pol), GeneAmp AccuRT RNA PCR Enzyme, or
Thermus species Z05 (TZ05) DNA polymerase (see, e.g., Smith et al.,
in PCR Primer, at pages 211-219). In certain embodiments, primer
extension comprises a reverse transcriptase and a DNA-dependent DNA
polymerase. In certain such embodiments, the reaction composition
may comprise one DNA polymerase inhibitor or at least two different
DNA polymerase inhibitors, for example but not limited to a first
DNA polymerase that can form a complex with the reverse
transcriptase and a second DNA polymerase inhibitor that can form a
complex with the DNA-dependent DNA polymerase. Descriptions of
certain primer extension reactions can be found in, among other
places, Sambrook et al., Sambrook and Russell, Ausubel et al. and
Chen et al., U.S. patent application Ser. No. 10/947,460.
[0102] In some embodiments of the current teachings, amplification
comprises a two-step reaction including without limitation a
pre-amplification step wherein a limited number of cycles of
amplification occur (for example but not limited to 2, 3, 4, or 5
cycles of amplification), then the resulting amplicon is generally
diluted and portions of the diluted amplicon are subjected to
additional cycles of amplification in a subsequent amplification
step (see, e.g., Marmara and Gordes, U.S. Pat. No. 6,605,451; and
Andersen and Ruff, U.S. Patent Application Publication No. US
2004/0175733). In some embodiments, a pre-amplification step, a
subsequent amplification step, or both, comprise a DNA polymerase
inhibitor.
[0103] In certain embodiments, an amplification reaction comprises
multiplex amplification, in which a multiplicity of different
target nucleic acids and/or a multiplicity of different
amplification product species are simultaneously amplified using a
multiplicity of different primer sets, a multiplicity of different
ligation probe sets, a multiplicity of different cleavage probe
sets, or combinations thereof (see, e.g., Henegariu et al.,
BioTechniques 23:504-11, 1997; Belgrader et al., Development of a
Multiplex Ligation Detection Reaction DNA Typing Assay, Sixth
International Symposium on Human Identification (1995); and Rapley,
particularly in Chapter 79). Certain embodiments of the disclosed
methods comprise a multiplex amplification reaction and a
single-plex amplification reaction, including a multiplicity of
single-plex or lower-plexy reactions (for example but not limited
to a two-plex, a three-plex, a four-plex, a five-plex, or a
six-plex reaction) performed in parallel.
[0104] In certain embodiments, an amplifying reaction comprises
asymmetric PCR. According to certain embodiments, asymmetric PCR
comprises a reaction composition comprising (i) at least one primer
pair in which there is an excess of one primer, relative to the
corresponding primer of the primer pair, for example but not
limited to a five-fold, a ten-fold, or a twenty-fold excess; (ii)
at least one primer pair that comprises only a forward primer or
only a reverse primer; (iii) at least one primer pair that, during
given amplification conditions, comprises a primer that results in
amplification of one strand and a corresponding primer that is
disabled; or (iv) at least one primer pair that meets the
description of both (i) and (iii) above. Consequently, when the
target nucleic acid and/or amplicon is amplified, an excess of one
strand of the subsequent amplification product (relative to its
complement) is generated. Descriptions of asymmetric PCR, can be
found in, among other places, McPherson, particularly in Chapter 5;
and Rapley, particularly in Chapter 64.
[0105] In certain embodiments, one may use at least one primer pair
wherein the Tm of one of the primers is higher than the Tm of the
other primer, sometimes referred to as A-PCR (see, e.g., Chen et
al., U.S. Patent Application Publication No. US 200310207266A 1).
In certain embodiments, the Tm of the forward primer is at least
4-15.degree. C. different from the Tm of the corresponding reverse
primer. In certain embodiments, the Tm of the forward primer is at
least 8-15.degree. C. different from the Tm of the corresponding
reverse primer. In certain embodiments, the Tm of the forward
primer is at least 10-15.degree. C. different from the Tm of the
corresponding reverse primer. In certain embodiments, the Tm of the
forward primer is at least 10-12.degree. C. different from the Tm
of the corresponding reverse primer. In certain embodiments, in at
least one primer pair, the Tm of a forward primer differs from the
Tm of the corresponding reverse primer by at least about 4.degree.
C., by at least about 8.degree. C., by at least about 10.degree.
C., or by at least about 12.degree. C.
[0106] In certain embodiments of A-PCR, in addition to the
difference in Tm of the primers in a primer pair, there is also an
excess of one primer relative to the other primer in the primer
pair. In certain embodiments, there is a five- to twenty-fold
excess of one primer relative to the other primer in the primer
pair. In certain embodiments of A-PCR, the primer concentration is
at least 50 nM.
[0107] According to certain A-PCR embodiments, one may use
conventional PCR in the first cycles of amplification such that
both primers anneal and both strands of a double-stranded amplicon
or target nucleic acid are amplified. By raising the temperature in
subsequent cycles of the same amplification reaction, however, one
may disable the primer with the lower Tm such that only one strand
is amplified. Thus, the subsequent cycles of A-PCR in which the
primer with the lower Tm is disabled result in asymmetric
amplification. Consequently, when the target nucleic acid or an
amplification product is amplified, an excess of one strand of the
subsequent amplification product (relative to its complement) is
generated.
[0108] According to certain A-PCR embodiments, the level of
amplification can be controlled by changing the number of cycles
during the first phase of conventional PCR cycling. In such
embodiments, by changing the number of initial conventional cycles,
one may vary the amount of the double-stranded amplification
products that are subjected to the subsequent cycles of PCR at the
higher temperature in which the primer with the lower Tm is
disabled.
[0109] Certain methods of optimizing amplification reactions are
known to those skilled in the art. For example, it is known that
PCR may be optimized by altering times and temperatures for
annealing, polymerization, and denaturing, as well as changing the
buffers, salts, and other reagents in the reaction composition.
Optimization may also be affected by the design of the probes
and/or primers used. For example, the length of the probes and/or
primers, as well as the G-C:A-T ratio may alter the efficiency of
annealing, thus altering the amplification reaction. Descriptions
of amplification optimization can be found in, among other places,
James G. Wetmur, "Nucleic Acid Hybrids, Formation and Structure,"
in Molecular Biology and Biotechnology, pp. 605-8, (Robert A Meyers
ed., 1995); McPherson, particularly in Chapter 4; Rapley; and
Protocols & Applications Guide, rev. 9/04, Promega.
[0110] Certain reaction compositions further comprise dUTP and
uracil-N-glycosylase (UNG; e.g., AmpErase.RTM., Applied Biosystems)
or uracil-DNA glycosylase (UDG; New England Biolabs, Beverly,
Mass.). Discussion of the use of dUTP and UNG in amplification
reactions may be found, for example, in Kwok et al., Nature,
339:237-238, 1989; McPherson; Longo et al., Gene, 93:125-128, 1990;
and Gelfand et al., U.S. Pat. No. 5,418,149.
[0111] In certain method embodiments, amplification comprises a
helicase, including without limitation, E. coli UvrD helicase, DnaB
helicase, or bacteriophage T7 gene 4 protein; a DNA polymerase,
including without limitation DNA polymerase III or the Kienow
fragment of DNA polymerase I; a helicase accessory protein,
including without limitation, MutI protein; a single-stranded
binding protein (SSB), including without limitation, E. coli SSB,
T7 gene 2.5 SSB, T4 gene 32 protein, and/or RB49 gene 32 protein;
or combinations thereof. In certain embodiments, an enzyme
inhibitor comprising a nucleotide sequence and a quencher is
designed to inhibit the enzymatic activity of a helicase when the
enzyme inhibitor and the helicase are associated with each other in
a complex at a first temperature, but not at a second temperature,
at which the enzyme inhibitor and the helicase have dissociated. In
certain embodiments, the nucleotide sequence of a helicase
inhibitor comprises an aptamer. In some embodiments, the nucleotide
sequence of a helicase inhibitor can form a double-stranded segment
at the first temperature, but typically not at the second
temperature.
[0112] In some embodiments, amplification comprises ligase-mediated
amplification techniques, for example but not limited to, LOR, LCR,
FEN-LCR, gap oligonucleotide and gap-filling versions of ligation
mediated-amplification procedures, padlock versions of
ligase-mediated amplification, and ligation approaches coupled with
PCR and/or other amplification approaches and including multiplex
versions thereof (see, e.g., Demidov and Broude, particularly
Chapter 1.3; Lizardi et al., Nat. Genetics 19:225-32 (1998); Bi et
al., U.S. Pat. No. 6,511,810; and Wenz and Schroth, U.S. Patent
Application Publication No. US 200310190646A 1). According to
certain methods comprising ligase-mediated amplification, a ligase
and a ligase inhibitor that comprises a nucleotide sequence and a
quencher associate at a first temperate to form a ligase-ligase
inhibiter complex. When associated with the ligase inhibitor, the
enzymatic activity of the ligase is inhibited, which decreases at
least some of the misligation that could occur in the absence of
the ligase inhibitor, thus decreasing certain secondary amplicons
and reducing background fluorescence. When the reaction composition
comprising the ligase-ligase inhibitor complex is heated to a
second temperature, the ligase inhibitor dissociates from the
ligase and adjacently hybridized probes can be efficiently ligated.
In certain embodiments, the 5'-end downstream ligation probe and
the 3'-end of the corresponding upstream ligation probe are not
immediately adjacent when they hybridize to the target nucleic acid
or its complement, and a gap-filling step is employed to extend the
3'-end of the upstream probe into juxtaposition with the 5-end of
the downstream probe. In other embodiments, there is a gap between
the 5'-end of the downstream probe and the 3'-end of the upstream
probe such that a "gap oligonucleotide" can hybridize in the gap
between the opposing ends of the ligation probes. In certain such
embodiments, the 5'-end downstream probe can be ligated to the
3'-end of the gap oligonucleotide and the 3'-end of the upstream
probe can be ligated to the 5'-end of the gap oligonucleotide.
[0113] In certain embodiments, the nucleotide sequence of the
ligase inhibitor comprises an aptamer. In some embodiments, the
nucleotide sequence of a ligase inhibitor can form a
double-stranded segment at the first temperature, but typically not
at the second temperature.
[0114] According to certain gap-filling LCR or gap-filling LOR
amplification techniques, a complex comprising a DNA polymerase and
a DNA polymerase inhibitor can form at a first temperature,
inhibiting the DNA polymerase activity. In certain embodiments, a
ligase and a ligase inhibitor form a complex at a first temperature
to inhibit ligation of mis-annealed ligation probes, sometimes
referred to as misligation.
[0115] Those in the art will appreciate that the disclosed enzyme
inhibitors, complexes, methods, and kits can be applied in a
variety of different contexts in which an enzyme-mediated
amplification reaction is performed that may be subject to
mis-annealing of primers and/or probes and the subsequent formation
of undesired secondary amplicons. Any enzyme-mediated amplification
technique that can benefit from the use of an enzyme inhibitor
comprising a quencher to at least decrease background fluorescence
is within the intended scope of the current teachings.
[0116] An amplified or sequenced target nucleic acid can be
detected by any suitable technique known in the art that comprises
measuring, quantitating, and/or observing directly or indirectly, a
quenchable emission, including without limitation, fluorescence,
chemiluminescence, bioluminescence, phosphorescence, and so forth,
for example but not limited to, laser-induced fluorescence and
electrochemiluminescence. According to some embodiments of the
disclosed methods, detecting can comprise any suitable real-time or
end-point detection technique. Some non-limiting examples of
suitable detection techniques include melting curve analysis, Q-PCR
or other real-time technique comprising a nucleic acid dye, and in
some embodiments, at least one reporter probe, and electrophoresis
techniques, including without limitation gel electrophoresis. Those
in the art will appreciate that various quencher moieties are
available that collectively cover a broad range of detectable
emissions and that by pairing a quencher with an appropriate
absorption spectra with an emission source, at least some of the
emission from that source can be reduced.
[0117] In some embodiments, the methods of the current teachings
comprise Q-PCR. The term "quantitative PCR", or "Q-PCR", also known
as real-time PCR, refers to a variety of methods used to quantify
PCR amplification products, either specifically, non-specifically,
or both (see, e.g., Raeymakers, Mal. Biotechnol. 15:115-22 (2000);
Joyce, Quantitative RT-PCR, in Methods in Mal Biol., vol. 193,
O'Connell, ed., Humana Press; Pierson et al., Nucl. Acids Res.
31(14):e73 (2003)). Such methods typically are categorized as
kinetics-based systems, that generally determine or compare the
amplification factor, such as determining the threshold cycle (Ct),
or as co-amplification methods, that generally compare the amount
of product generated from simultaneous amplification of target and
standard templates. Q-PCR techniques typically comprise reporter
probes, a nucleic acid dye, or both. For example but not limited to
TaqMan.RTM. probes (Applied Biosystems), i-probes, molecular
beacons, Eclipse probes, scorpion primers, Lux.TM. primers, FRET
primers, ethidium bromide, and unsymmetrical cyanine dyes, for
example but not limited to, SYBR.RTM. Green I (Molecular Probes),
YO-PRO-1, Hoechst 33258, BOXTO (TATAA Biocenter, Goteborg, Sweden)
and PicoGreen.RTM. (Molecular Probes).
[0118] In some embodiments, the methods of the current teachings
are performed before or in conjunction with a sequencing reaction.
The term "sequencing" is used in a broad sense herein and refers to
any technique known in the art that allows the order of at least
some consecutive nucleotides in at least part of a polynucleotide,
for example but not limited to a target nucleic acid or an
amplicon, to be identified. Some non-limiting examples of
sequencing techniques include Sanger's dideoxy terminator method
and the chemical cleavage method of Maxam and Gilbert, including
variations of those methods; sequencing by hybridization;
sequencing by synthesis; and restriction mapping. Some sequencing
methods comprise electrophoreses, including capillary
electrophoresis and gel electrophoresis; sequencing by
hybridization including microarray hybridization; mass
spectrometry; and single molecule detection. In some embodiments,
sequencing comprises direct sequencing, duplex sequencing, cycle
sequencing, single base extension sequencing (SBE), solid-phase
sequencing, or combinations thereof. In some embodiments,
sequencing comprises detecting the sequencing product using an
instrument, for example but not limited to an ABI PRISM.RTM. 377
DNA Sequencer, an ABI PRISM.RTM. 310, 3100, 3100-Avant, 3730, or
3730xl Genetic Analyzer, an ABI PRISM.RTM. 3700 DNA Analyzer (all
from Applied Biosystems), or a mass spectrometer. In some
embodiments, sequencing comprises incorporating a dNTP, including a
dATP, a dCTP, a dGTP, a dTTP, a dUTP, a dITP, or combinations
thereof and including dideoxyribonucleotide analogs of dNTPs, into
an amplification product.
[0119] Those in the art will appreciate that the sequencing method
employed is not typically a limitation of the present methods.
Rather any sequencing technique that provides the order of at least
some consecutive nucleotides of at least part of the corresponding
amplicon or target nucleic acid can typically be used with the
current methods. In some embodiments, unincorporated primers and/or
dNTPs are removed prior to a sequencing step by enzymatic
degradation, including without limitation exonuclease I and shrimp
alkaline phosphatase digestion, for example but not limited to the
ExoSAP-IT.RTM. reagent (USB Corp., Cleveland, Ohio). In some
embodiments, unincorporated primers, dNTPs, and/or ddNTPs are
removed by gel or column purification, sedimentation, filtration,
beads, magnetic separation, or hybridization-based pull out, as
appropriate (see, e.g., ABI PRISM.RTM. Duplex.TM. 384 Well F/R
Sequence Capture Kit, Applied Biosystems P/N 4308082). In certain
embodiments, a reaction composition comprising an amplification
product, or at least part of such a reaction composition, is
subjected to a sequencing reaction without an intervening
purification step (see, e.g., Baskin et al., U.S. Patent
Application Publication No. US 2002/0137047 A1). Descriptions of
sequencing techniques can be found in, among other places,
McPherson, particularly in Chapter 5; Sambrook and Russell; Ausubel
et al.; Siuzdak, The Expanding Role of Mass Spectrometry in
Biotechnology, MCC Press, 2003, particularly in Chapter 7; and
Rapley, particularly in Part VI.
[0120] In some embodiments, the disclosed methods and kits comprise
a microfluidics device, "lab on a chip", or micrototal analytical
system (.mu.TAS). In some embodiments, sample preparation is
performed using a microfluidics device. In some embodiments, an
amplification reaction is performed using a microfluidics device.
In some embodiments, a sequencing or real-time PCR reaction is
performed using a microfluidic device. In some embodiments, the
nucleotide sequence of at least a part of an amplification product
is obtained using a microfluidics device. Descriptions of exemplary
microfluidic devices can be found in, among other places, Published
PCT Application Nos. WO/0185341 and WO 04/011666; Kartalov and
Quake, Nucl. Acids Res. 32:2873-79, 2004; and Fiorini and Chiu,
BioTechniques 38:429-46, 2005.
Certain Exemplary Embodiments
[0121] The present teachings provide compositions, methods, and
kits for amplifying a target nucleic acid and for decreasing
background fluorescence, typically in a reaction composition
comprising at least one enzyme and at least one enzyme inhibitor
that includes at least one nucleotide sequence and at least one
quencher.
[0122] The instant enzyme inhibitors comprise a nucleotide sequence
and a quencher. The nucleotide sequence of such enzyme inhibitors
are designed to decrease the formation of undesired amplification
products, particularly due to mispriming events at non-target
sequences, mis-annealing of ligation and/or cleavage probes, and
primer dimer formation, by inhibiting enzyme activity at a first
temperature, but not at a second temperature. The decreased level
of secondary amplicon formation reduces at least one component of
non-specific fluorescence in the reaction composition. The
disclosed enzyme inhibitors are also designed to be self-quenching
under appropriate conditions. The quencher moiety of the disclosed
inhibitors are designed to absorb at least some of the fluorescent
signal generated by the association of nucleic acid dye molecules
with double-stranded segment(s) of the enzyme inhibitor at the
first temperature range, either when the enzyme inhibitor is free
in solution or complexed with an enzyme. Thus, the quencher of the
enzyme inhibitor reduces at least some of this second source of
background fluorescence, further decreasing the non-specific
fluorescence in the reaction composition.
[0123] Certain Exemplary Enzyme Inhibitors
[0124] According to the current teachings, enzyme inhibitors
comprising a nucleotide sequence and a quencher are designed to
inhibit at least one enzymatic activity of an enzyme while the
enzyme inhibitor is associated with the enzyme in an enzyme
inhibitor-enzyme complex. The nucleotide sequence of the enzyme
inhibitors are designed so that they can form a structure
comprising at least one double-stranded segment and the quencher(s)
are selected to be able to absorb at least some of the fluorescence
emitted from a nucleic acid dye when associated with the
double-stranded segment of the enzyme inhibitor. The enzyme-enzyme
inhibitor complexes can form and/or remain associated at a first
temperature, for example but not limited to, room temperature
(typically about 22.degree. C.-28.degree. C.) and temperatures
below, at, or slightly above the desired template extension
temperature. When a reaction composition comprising an
enzyme-enzyme inhibitor complex is heated to a second temperature,
the enzyme is released as the complex dissociates. The disclosed
RNA polymerase inhibitors are designed to inhibit the
polymerization activity of an RNA polymerase when the inhibitor and
the RNA polymerase are associated in a complex. The disclosed
ligase inhibitors are designed to inhibit the formation of a
phosphodiester between two adjacently hybridized nucleotide strands
on a template when the ligase inhibitor and the ligase are
associated in a complex, including the ligation of mis-annealed
ligation probes. The disclosed helicase inhibitors are designed to
inhibit the helicase's ability to catalyze the unwinding of
double-stranded nucleic acids when the helicase inhibitor and the
helicase are associated in a complex. Certain disclosed cleaving
enzyme inhibitors are designed to inhibit the 5'-nuclease activity
of the cleaving enzyme when the cleaving enzyme inhibitor and the
cleaving enzyme are associated in a complex. In certain
embodiments, the nucleotide sequence of a ligase inhibitor, an RNA
polymerase inhibitor, a helicase inhibitor, and/or a cleaving
enzyme inhibitor comprises an aptamer. The inhibitory ability of
the enzyme inhibitors of the current teachings are typically not
significantly dependent on the exact sequence of the inhibitor.
Rather, the overall structure of the enzyme inhibitor and its
melting temperature are the major determinants of whether an enzyme
inhibitor will inhibit the intended enzymatic activity of the
corresponding enzyme. In certain embodiments, an enzyme inhibitor
is designed to assume a conformation at a first temperature that
mimics the substrate of the corresponding enzyme, allowing the
enzyme to associate with the inhibitor to form a complex in which
the enzymatic activity of the enzyme is inhibited. At a second
temperature, the conformation of the enzyme inhibitor can change so
that it no longer mimics the substrate and the enzyme is released
from the complex. Thus, the disclosed inhibitors typically exhibit
significantly less, if any, inhibitory effect when they are
substantially single-stranded and/or not in a complex with the
enzyme. In some embodiments, the nucleotide sequence of an enzyme
inhibitor comprises a deoxyribonucleotide, a ribonucleotide, a
nucleotide analog, a non-nucleotide linker, or combinations
thereof.
[0125] The disclosed ligase inhibitors do not significantly
interfere with the annealing of ligation probes or cleavage probes
to corresponding sequences on a target nucleic acid or a desired
amplicon, for example but not limited to a ligated probe. The
disclosed helicase inhibitors do not significantly interfere with
the hybridization of primers to corresponding target flanking
sequences or amplicons. The disclosed cleaving enzyme inhibitors do
not significantly interfere with the annealing or cleavage probes
or ligation probes to corresponding sequences on a target nucleic
acid or desired amplicon or the hybridization of primers with
corresponding target flanking sequences and/or amplicons.
[0126] The disclosed DNA polymerase inhibitors are designed to
inhibit the polymerization activity of a DNA polymerase when the
inhibitor is associated with the DNA polymerase, and optionally a
NTP and/or a nucleotide analog, in a DNA polymerase inhibitor-DNA
polymerase complex at a first temperature, for example but not
limited to, temperatures approximately the same as or below the Tm
of the primer. The inhibitory ability of the DNA polymerase
inhibitor of the current teachings is generally not significantly
dependent on the exact sequence of the inhibitor. Rather, the
overall structure of the DNA polymerase inhibitor and its melting
temperature are the major determinants of whether a DNA polymerase
inhibitor will inhibit the enzymatic activity of the DNA
polymerase, i.e., polymerization. Typically, the disclosed DNA
polymerase inhibitors will interfere with the polymerization
activity of the DNA polymerase when they comprise a double-stranded
segment and are associated with the DNA polymerase, and optionally
a NTP and/or a nucleotide analog, in a complex. The disclosed DNA
polymerase inhibitors, however, exhibit substantially less, if any,
inhibitory effect when they are single-stranded and not in a
complex with the DNA polymerase. In certain embodiments, the Tm of
the DNA polymerase inhibitors is selected to be approximately the
same as or lower than the temperature used for primer extension of
the annealed primers employed in the selected polymerization or
primer extension reaction, but not always. In some embodiments, the
melting temperatures of the DNA polymerase inhibitors are somewhat
above the primer extension temperature, for example but not limited
to reaction compositions wherein the DNA polymerase inhibitors are
used at low concentrations.
[0127] Typically, a DNA polymerase inhibitor of the current
teachings comprises at least one double-stranded segment at or
below the first temperature, but is single-stranded or
substantially single-stranded at or above the second temperature.
Thus at a first temperature, the enzymatic activity of the DNA
polymerase in a complex is inhibited, while at the second
temperature, the DNA polymerase is active and amplification
reactions can occur.
[0128] Exemplary first temperatures include 22.degree. C.,
23.degree. C., 24.degree. C., 25.degree. C., 26.degree. C.,
27.degree. C., 28.degree. C., 29.degree. C., 30.degree. C., about
22.degree. C. to about 40.degree. C., about 25.degree. C. to about
35.degree. C., and about 22.degree. C. to about 28.degree. C., and
expressly including all intervening temperatures in the specified
first temperature ranges. Exemplary second temperatures include:
42.degree. C., 43.degree. C., 44.degree. C., 45.degree. C.,
46.degree. C., 47.degree. C., 48.degree. C., 49.degree. C.,
50.degree. C., 51.degree. C., 52.degree. C., 53.degree. C.,
54.degree. C., 55.degree. C., 56.degree. C., 57.degree. C.,
58.degree. C., 59.degree. C., 60.degree. C., 61.degree. C.,
62.degree. C., 63.degree. C., 64.degree. C., 65.degree. C.,
66.degree. C., 67.degree. C., 68.degree. C., 69.degree. C.,
70.degree. C., 71.degree. C., 72.degree. C., 73.degree. C., about
48.degree. C. to about 73.degree. C., about 53.degree. C. to about
67.degree. C., about 63.degree. C. to about 67.degree. C., and
about 64.degree. C. to about 66.degree. C., and expressly including
all intervening temperatures in the specified second temperature
ranges. Those in the art will understand that the appropriate first
and second temperatures for a given amplification reaction will
depend, at least in part, on the enzyme, the Tm of the enzyme
inhibitor, and/or the Tm of the primer(s) and/or probes, but that
appropriate temperatures can be routinely determined, without undue
experimentation, using methods known in the art and informed by the
current teachings.
[0129] In certain embodiments, the nucleotide sequence of a DNA
polymerase inhibitor of the present teachings comprises a single
oligonucleotide. In some embodiments, such DNA polymerase
inhibitors comprise a first region, a second region, a third
region, and optionally, a fourth region; and the first region is
complementary to the third region. Under appropriate conditions,
including at a first temperature, the first region and the third
region of such DNA polymerase inhibitors can anneal and form at
least one double-stranded segment so that the DNA polymerase
inhibitor assumes a stem-loop or hairpin conformation. In certain
embodiments, only a subset of nucleotides in the first region are
complementary with the corresponding subset of nucleotides in the
third region. In some embodiments, the disclosed DNA polymerase
inhibitors comprise a nucleotide analog that may or may not affect
the Tm of the DNA polymerase inhibitor.
[0130] Some exemplary DNA polymerase inhibitors comprising one
oligonucleotide are depicted schematically in FIG. 1. The
illustrative DNA polymerase inhibitor shown in FIG. 1A comprises a
first region (1) shown with black stripes throughout FIG. 1, a
second region (2) shown with a wavy line throughout FIG. 1, a third
region (3), and an optional fourth region ([4], shown in brackets
to indicate that it is optional in this embodiment) shown shaded in
black throughout FIG. 1. The 3'-end of this exemplary inhibitor is
non-extendable due to the terminal nucleotide comprising a
dideoxycytosine (shown as ddC). The first region (1) further
comprises a quencher (5). The exemplary inhibitor is shown with the
first region (1) annealed to the third region (3) to form a
double-stranded segment, so that the inhibitor is in a stem-loop
conformation with the second region (2) forming the loop and the
fourth region (4) as a 5' single-stranded overhang. In certain
embodiments, the single-stranded overhang of the fourth region of
such a DNA polymerase inhibitor comprises at least some
ribonucleotides, particularly when the inhibitor is designed to
complex with certain reverse transcriptases. The exemplary DNA
polymerase inhibitor depicted in FIG. 1B comprises a first region
(1), a second region (2), and a third region (3), but not a fourth
region. The first region (1) and third region (3) are shown
annealed to form a stem and the second region (2) forming a loop
structure and further comprising a quencher (5). The illustrative
DNA polymerase inhibitor shown in FIG. 1C comprises a first region
(1) comprising a first quencher (6), shown as 01, a second region
(2) comprising a second quencher (7), shown as 02, a third region
(3), and an optional fourth region ([4]). The exemplary DNA
polymerase inhibitor shown in FIG. 1D comprises a first region (1),
a second region (2), a third region (3), and an optional fourth
region ([4]) that comprises a quencher (5) at the 5'-end, shown as
0.
[0131] In certain DNA polymerase inhibitor embodiments, the
nucleotide sequence comprises a first region, a second region, a
third region, a fourth region, a fifth region, and a sixth region;
wherein the first region is complementary with the third region and
the first region and the third region can form at least one
double-stranded segment at a first temperature; wherein the fourth
region is complementary with the sixth region and the fourth region
and the sixth region can form at least one double-stranded segment
at a first temperature; wherein there is at least one
single-stranded region between the 3'-end of the sixth region and
the 5'-end of the first region; and wherein the 3'-end of the sixth
region comprises a non-extendible nucleotide.
[0132] In other DNA polymerase inhibitor embodiments, the
nucleotide sequence comprises at least two different
oligonucleotides, for example but not limited to, a first
oligonucleotide and a second oligonucleotide. In certain
embodiments wherein the DNA polymerase inhibitor comprises two
oligonucleotides, the first oligonucleotide comprises a first
region and the second oligonucleotide comprises a third region and
optionally, a fourth region, and the first region of the first
oligonucleotide is complementary to the third region of the second
oligonucleotide. In certain embodiments, only a subset of
nucleotides in the first region is complementary with the
corresponding segment(s) of the third region. Under appropriate
conditions, including at a first temperature, the first region of
the first oligonucleotide and the third region of the second
oligonucleotide can anneal to form a duplex comprising at least one
double-stranded segment. When the DNA polymerase inhibitors of the
current teachings are heated to a second temperature, for example
but not limited to in a second temperature range, they assume a
single-stranded or substantially single-stranded conformation, not
a stem-loop or a duplex conformation.
[0133] Some illustrative enzyme inhibitors comprising two or more
oligonucleotides are depicted schematically in FIG. 2. The
exemplary DNA polymerase inhibitor shown in FIG. 2A comprises a
first oligonucleotide comprising first region (1) shown with black
stripes throughout FIG. 2, annealed to a second oligonucleotide
that comprises a third region (3) and a fourth region (4) shown
shaded in black throughout FIG. 2. The first oligonucleotide of
this exemplary DNA polymerase inhibitor further comprises a
quencher, shown as Q. The exemplary DNA polymerase inhibitor
depicted in FIG. 2B comprises a first oligonucleotide comprising a
first region (1), annealed to a second oligonucleotide comprising a
third region (3) and a fourth region (4). In this illustrative DNA
polymerase inhibitor, the quencher (Q) is shown attached to the
fourth region (4). The illustrative DNA polymerase inhibitor shown
in FIG. 2C comprises a first oligonucleotide comprising a first
region (1) comprising a first quencher (shown as 01) and a second
oligonucleotide comprising a third region (3), and a fourth region
(4) comprising a second quencher (shown as 02). The exemplary DNA
polymerase inhibitor shown in FIG. 2D comprises a first
oligonucleotide comprising a first region (1) annealed to a second
oligonucleotide comprising a third region (3), wherein the second
oligonucleotide comprises a quencher (shown as 0). The illustrative
DNA polymerase inhibitor shown in FIG. 2E comprises a first
oligonucleotide comprising a first region (1) and annealed to a
second oligonucleotide comprising a third region (3), wherein both
the first oligonucleotide and the second oligonucleotide comprise a
quencher (shown as 01 and 02).
[0134] In certain embodiments, the nucleotide sequence of the DNA
polymerase inhibitor comprises an aptamer that binds to and
inhibits the enzymatic activity of the DNA polymerase when bound by
the aptamer. In some embodiments, a DNA polymerase inhibitor
comprises an aptamer that comprises at least one double-stranded
segment. When the aptamer is free in solution or is bound to the
DNA polymerase in a complex, the quencher absorbs at least some of
the fluorescent signal generated by nucleic acid dye molecules
associated with the aptamer.
[0135] The disclosed DNA polymerase inhibitors do not significantly
interfere with primer hybridization with corresponding target
flanking sequences and/or amplicons. In addition to decreasing the
fluorescent intensity of the nucleic acid dye molecules associated
with the double-stranded segment of DNA polymerase inhibitors and
decreasing formation of secondary amplicons, some DNA polymerase
inhibitors of the current teachings increase the yield of desired
amplicons relative to parallel amplification reactions not
comprising the DNA polymerase inhibitors.
[0136] In some embodiments, the 3'-end of a nucleotide sequence of
a DNA polymerase inhibitor is not extendible by a DNA polymerase,
typically due to the presence of a non-extendible nucleotide,
including without limitation a terminal nucleotide comprising a
blocking group. A blocking group is a chemical moiety that can be
added to a nucleotide or a nucleic acid to prevent or minimize
nucleotide addition by a DNA polymerase. By adding a blocking group
to the terminal 3'-OH, the nucleotide is no longer able to
participate in phosphodiester bond formation catalyzed by the DNA
polymerase. Some non-limiting examples of blocking groups include
an alkyl group, non-nucleotide linkers, phosphorothioate,
alkane-diol residues, PNA, LNA, nucleotide analogs comprising 3'
amino groups in place of the 3'-hydroxyl group, nucleotide analogs
comprising 5' hydroxyl groups in place of the 5' phosphate group,
and nucleotide derivatives lacking a 3' OH group. An alkyl blocking
group is a saturated hydrocarbon that can be straight chained,
branched, cyclic, or combinations thereof. Some non-limiting
examples of non-extendable nucleotides include nucleotides that
have a 3'-hydroxyl group that has been modified such as by
substitution with hydrogen or fluorine or by formation of an ester,
amide, sulfate or glycoside. These nucleotides are generally not
chain extendable. Other examples of non-extendable nucleotides that
can be used include nucleotides that have modified ribose moieties.
In certain embodiments, ribonucleotides may serve as non-extendable
nucleotides because oligonucleotides terminating in ribonucleotides
cannot be extended by certain DNA polymerases. The ribose can be
modified to include 3'-deoxy derivatives including those in which
the 3'-hydroxy is replaced by a functional group other than
hydrogen, for example, as an azide group. In certain embodiments, a
non-extendible nucleotide comprises a dideoxynucleotide (ddN), for
example but not limited to, a dideoxyadenosine (ddA), a
dideoxycytosine (ddC), a dideoxyguanosine (ddG), a dideoxythymidine
(ddT), or a dideoxyuridine (ddU).
[0137] In some embodiments, an enzyme inhibitor comprises two
quenchers, three quenchers, or more than three quenchers. In
certain inhibitor embodiments, a first region comprises a quencher
and/or a third region comprises a third quencher. In certain
embodiments, a second region comprises a quencher. In some
embodiments, a fourth region comprises a quencher. In certain
embodiments, a fifth region comprises a quencher. In certain
embodiments, a sixth region comprises a quencher. In some
embodiments, an enzyme inhibitor comprises a quencher at the 3'-end
of the nucleotide sequence, the 5'-end of the nucleotide sequence,
and/or internally. In some embodiments, an enzyme inhibitor
comprises a second region and in some embodiments a fifth region
that forms the loop of a stem-loop conformation. In certain
embodiments, a loop comprises a quencher.
[0138] The disclosed ligase inhibitors do not significantly
interfere with ligation probe annealing, and in certain
embodiments, cleavage probe annealing and/or primer annealing, with
corresponding target nucleic acids and/or amplicons. The disclosed
cleaving enzyme inhibitors do not significantly interfere with
cleavage probe annealing, and in certain embodiments, ligation
probe annealing and/or primer annealing, with corresponding target
nucleic acids or amplicons. The disclosed helicase inhibitors do
not significantly interfere with primer annealing, and in certain
embodiments, cleavage probe and/or ligation probe annealing, with
corresponding target nucleic acids and/or amplicons. In addition to
decreasing the fluorescent intensity of the nucleic acid dye
molecules associated with the double-stranded segment of enzyme
inhibitors and decreasing formation of secondary amplicons, some
enzyme inhibitors of the current teachings may increase the yield
of desired amplicons relative to parallel amplification reactions
not comprising the enzyme inhibitors.
[0139] In certain embodiments, a double-stranded segment of an
enzyme inhibitor comprises an internal base pair mismatch. In
certain embodiments, an enzyme inhibitor comprises a loop
structure, typically stem-loop structures comprising a
double-stranded segment and a single-stranded loop. In certain
embodiments, an enzyme inhibitor comprises two loop structures. In
some embodiments, a second region and/or a fifth region of an
enzyme inhibitor can form a loop structure at a first temperature
when complementary sequences of the inhibitor anneal with each
other, for example but not limited to the first region annealing
with the third region; and/or the fourth region annealing with the
sixth region. In certain embodiments, the second region, a fifth
region, or a second region and a fifth region of the nucleotide
sequence comprises 2-12 nucleotides and/or nucleotide analogs, and
in some embodiments, 2-6 nucleotides and/or nucleotide analogs. In
some embodiments, the second and/or fifth region comprises a
non-nucleotide linker. In certain embodiments, the second region,
the fifth region, or the second and the fifth region of an enzyme
inhibitor consists of, consists essentially of, or comprises the
sequence (T)n, wherein n is any number of T nucleotides between 1
and 8, for example but not limited to, TT, TTT, TTTT, or TTTTT. In
other embodiments, the second region and/or the fifth region,
consists of, consists essentially of, or comprises the nucleotides
A, C, and/or G, including without limitation nucleotide analogs of
any of these. In some embodiments, the second region and/or the
fifth region comprises (1) at least one nucleotide analog, for
example but not limited to a PNA and/or an LNA and/or (2) a
non-nucleotide linker, for example but not limited to a
non-nucleotide comprising a hydrocarbon group (--CH2-), including
without limitation, linkers comprising an alkane, alkene, or alkyne
portion, and ethylene glycol, including without limitation
polyethylene glycol (PEG). Typically the linker group is not
hydrophobic. In certain embodiments, a linker is hydrophilic or at
least portions of the linker have hydrophilic properties. Those in
the art will appreciate that the composition of a linker in the
disclosed enzyme inhibitors is generally not a limitation, provided
that the linker does not interfere with the enzyme-enzyme inhibitor
interaction and that the linker is sufficiently flexible to allow
the enzyme inhibitor to self anneal at the first temperature.
[0140] In some embodiments, a DNA polymerase inhibitor comprises a
minor groove binder on the 3'-end, the 5'-end, or both the 3'-end
and the 5-end of the nucleotide sequence. In some embodiments, the
minor groove binder is located internally. In certain embodiments,
the minor groove binder further comprises a quencher, for example
but not limited to, a MGB-NFQ (Applied Biosystems). Non-limiting
examples of minor groove binders include, antibiotics such as
netropsin, distamycin, berenil, pentamidine and other aromatic
diamidines, Hoechst 33258, SN 6999, aureolic anti-tumor drugs such
as chromomycin and mithramycin, CC-1065, dihydrocyclopyrroloindole
tripeptide (DPb),
1,2-dihydro-(3H)-pyrrolo[3,2-e]indole-7-carboxylate (CDPb), and
related compounds and analogs. Descriptions of minor groove binders
can be found in, among other places, Nucleic Acids in Chemistry and
Biology, 2d ed., Blackburn and Gait, particularly in section 8.3;
Kumar et al., Nucl. Acids Res. 26:831-38, 1998; Kutyavin et al.,
Nucl. Acids Res. 28:655-61, 2000; Turner and Denny, Curr. Drug
Targets 1:1-14, 2000; Kutyavin et al., Nucl. Acids Res. 25:3718-25,
1997; Lukhtanov et al., Bioconjug. Chem. 7:564-7, 1996; Lukhtanov
et al., Bioconjug. Chem. 6: 418-26, 1995; U.S. Pat. No. 6,426,408;
and PCT Published Application No. WO 03/078450. Those in the art
understand that minor groove binders typically increase the Tm of
the oligonucleotide to which they are attached, allowing such
oligonucleotides to effectively hybridize at higher temperatures.
Minor groove binders are commercially available from, among other
sources, Applied Biosystems (Foster City, Calif.) and Epoch
Biosciences (Bothell, Wash.).
[0141] In some embodiments, the nucleotide sequence of an enzyme
inhibitor comprises a universal base. In some embodiments, a DNA
polymerase inhibitor includes a fourth region or a sixth region
that comprises a universal base. In certain embodiments, the
nucleotide of the fourth region that is immediately adjacent to the
third region of the DNA polymerase inhibitor comprises a universal
base. In certain embodiments, the nucleotide of the sixth region
that is immediately adjacent to the single-stranded region between
the sixth region and the first region of the DNA polymerase
inhibitor comprises a universal base. In some embodiments, the
universal base interacts with a NTP in a DNA polymerase
inhibitor-DNA polymerase complex.
[0142] Those in the art will appreciate that the Tm of an enzyme
inhibitor can be determined empirically, using well-known methods
and instructed by the current teachings, and without undue
experimentation; or the Tm can be estimated using algorithms.
Several formulas and computer algorithms for calculating an
estimated Tm, including chimeric oligomers comprising conventional
nucleotides and/or nucleotide analogs, are well-known in the art.
According to one such predictive formula for oligonucleotides,
Tm=(4.times.number of G+C)+(2.times.number of A+T). The Tm for a
particular oligonucleotide, such as an enzyme inhibitor, a probe,
or a primer, can also be routinely determined using known methods,
without undue experimentation. Descriptions of Tm/melting
temperatures and their calculation can be found in, among other
places, Rapley; Nielsen, Exiqon Technical Note LNA 02/07.2002,
Exiqon A/S; McPherson; Finn et al., Nucl. Acids Res. 17:3357-63,
1996.
[0143] The melting temperature of the enzyme inhibitors of the
current teachings can be modulated in a variety of ways. For
example, those in the art understand that the length and/or
composition of the complementary sequences of the first and third
regions, and in certain embodiments, the fourth and sixth regions,
can be varied to increase or decrease the melting temperature of an
enzyme inhibitor; in certain inhibitor embodiments, the length
and/or composition of the complementary sequences of the fourth and
sixth regions can be varied to increase or decrease the Tm of the
enzyme inhibitor. Hence, in general, a double-stranded segment with
greater numbers of hybridizing base pairs will usually melt at
higher temperatures than a double-stranded segment with lesser
numbers of hybridizing base pairs. However, if a long
double-stranded segment is desired, one of skill in the art can
introduce base pair mismatches, for example but not limited to, G:T
base pairs, to modulate the melting temperature. In certain
embodiments, a double-stranded segment of an enzyme inhibitor
comprises one mismatched base pair, two mismatched base pairs,
three mismatched base pairs, four mismatched base pairs, or more
than four mismatched base pairs, wherein two or more mismatched
base pairs can, but need not be, contiguous.
[0144] Therefore, the double-stranded segment of the disclosed
enzyme inhibitors need not be 100% complementary. Instead, a
double-stranded segment can have a number, or a certain percentage,
of mismatches or wobble base pairs. For example, the
double-stranded segment can have about 2%, about 3%, about 4%,
about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about
11%, about 12%, about 13%, about 14%, about 15%, about 16%, about
17%, about 18%, about 19%, or about 20% base pair mismatches. In
certain embodiments, the melting temperature of an enzyme inhibitor
is modulated by designing a a double-stranded segment that
comprises an abasic nucleotide analog, for example but not limited
to an analog comprising a sugar or a sugar analog and a phosphate
or a phosphate analog, but not a nucleotide base or a nucleotide
base analog, which among other things, eliminates a base pair in
the double-stranded region.
[0145] The melting temperature of an enzyme inhibitor comprising a
second region and/or a fifth region can also be modulated by
increasing or decreasing the number of nucleotides and/or
nucleotide analogs in the loop. The melting temperature of an
enzyme inhibitor comprising a single oligonucleotide can also be
modulated by the presence or absence of one or more "GC clamp" at
the junction between a region that can comprise at least one
double-stranded segment at a first temperature and a region that
does not comprise a double-stranded segment at the first
temperature. For example but not limited to the base of a loop
structure, including without limitation, in certain embodiments,
the nucleotide(s) of the first region that are adjacent to the
second region and that anneal with the nucleotide(s) of the third
region that are adjacent to the second region (see, e.g., FIG. 1A),
and/or in some embodiments, the nucleotide(s) of the fourth region
that are adjacent to the fifth region and that anneal with the
nucleotide(s) of the sixth region that are adjacent to the fifth
region (see, e.g., FIG. 1E). Likewise, the Tm of enzyme inhibitors
comprising two or more oligonucleotides can be modulated by the
presence or absence of GC clamps, particularly when they are
located at one or both ends of complementary segments of the first
and third regions of the enzyme inhibitors, including without
limitation, the base of a loop, if appropriate; and in certain
embodiments, at one of both ends of complementary segments of the
fourth and sixth regions of the enzyme inhibitors. The melting
temperature of an enzyme inhibitor can also be modulated by
nucleotide analogs in the first and/or third regions of the
nucleotide sequence, and in certain embodiments, the fourth and/or
sixth regions of the nucleotide sequence, for example but not
limited to deaza-dA. Some non-limiting examples of nucleotide
analogs that increase the Tm include C-5 propynyl-dC or
5-methyl-2'-deoxycytidine substituted for dC; 2,6-diaminopurine
2'-deoxyriboside (2-amino-dA) substituted for dA; and C-5
propynyl-dU for dT; which increase the relative melting temperature
approximately 2.8.degree. C., 1.3.degree. C., 3.0.degree. C., and
1.7.degree. C. per substitution, respectively.
[0146] When considering the length of the double-stranded
segment(s), the melting temperature of the enzyme inhibitor should
be considered. For example but not as a limitation, if the Tm of a
DNA polymerase inhibitor is too high, it may denature at a
temperature above the temperature used in the amplification for
primer extension, thereby causing inhibition of the desired
polymerization reaction and a decreased yield of the desired
amplicon. If the Tm is too low, the DNA polymerase inhibitor may
melt and become inactive at temperatures that permit the primers to
hybridize to non-target nucleic acids and be extended. When the DNA
polymerase is able to amplify such non-target nucleic acids, many
undesirable products will be present in the final amplified product
mixture, including primer-dimers. In certain embodiments, an enzyme
inhibitor has a melting temperature that is close to, but not
significantly greater than, the selected extension. ligation,
and/or cleavage reaction temperature of the amplification reaction,
as appropriate. In some embodiments, particularly when the enzyme
inhibitors are used at low concentrations, enzyme inhibitors with
melting temperatures above the primer extension temperature, the
ligation temperature, or the cleavage reaction temperature, as
appropriate, can be used. Typically, one of skill in the art can
determine the melting temperature of an enzyme inhibitor under the
conditions in which it will be used, for example, under nucleic
acid polymerization conditions.
[0147] An exemplary DNA polymerase inhibitor comprises, consists
of, or consists essentially of:
TABLE-US-00001 (SEQ ID NO: 3)
5'-[TCTGG]GATA(deazadA)TT(deazadA)TGGTA(deazadA)AT ATG
T(DABCYL-T)TTC(deazadA)TATTTATT(deazadA)TA
(deazadA)TTATC(MGB-NFQ)-3',
wherein the fourth region is shown in brackets, the third region is
shown underlined, the second region is shown in bold, and the first
region is shown in italics, and wherein the second region comprises
a first quencher (shown as DABCYL in this example) and the first
region comprises a minor groove binder comprising a second quencher
(shown as MGB-NFQ in this example). The first region is
substantially complementary to the third region due to the two
internal G:T base pair mismatches between the two regions but the
DNA polymerase inhibitor is still self-annealing at a first
temperature. In some embodiments of this illustrative DNA
polymerase inhibitor, the terminal C nucleotide on the 3'-end of
the DNA polymerase inhibitor comprises the nucleotide analog
dideoxycytosine (ddC). In some embodiments, the second region
comprises, consists of, or consists essentially of TT, TTT, or
TTTTT. In other embodiments, the second region comprises a
non-nucleotide linker. In some embodiments, the second region does
not comprise a quencher. In certain embodiments, the 5'-end of the
DNA polymerase inhibitor further comprises a quencher. In certain
embodiments, at least one of the G nucleotides of the DNA
polymerase inhibitor comprises the nucleotide analog deaza-dG. In
some embodiments, the first quencher comprises: a TAMRA.TM.
(carboxytetramethylrhodamine); a Black Hole Quencher dye, for
example but not limited to BHQ-1, BHQ-2, or BHQ-3 (Biosearch
Technologies, Inc.); an OREGON GREEN.RTM. dye (Molecular Probes); a
ROX.TM. (carboxy-X-rhodamine); a DABSYL
(4-dimethylaminoazobenzene-4'-sulfonyl chloride); or a TET
(tetrachlorofluorescein), instead of or in addition to the DABCYL
moiety. In some embodiments, the second quencher comprises a
DABSYL, a DABCYL, a TAMRA, a Black Hole Quencher, a ROX, an OREGON
GREEN, or a TET, instead of or in addition to the MGB-NFQ. The
choice of quencher(s) is typically not a limitation of the current
teachings provided that the selected quencher(s) can absorb
fluorescence at the wavelength that is characteristic of the
nucleic acid dye and that the quencher and/or the location of the
quencher in the inhibitor does not substantially decrease the
ability of the inhibitor to self-anneal and/or complex with the
enzyme.
[0148] Another exemplary DNA polymerase inhibitor comprises,
consists of, or consists essentially of:
TABLE-US-00002 (SEQ ID NO: 2) 5'-(TET)-[TTCTGG]GATAATTATGGTAAATATAT
TTTATATATTTA TTATAATTATddC-3',
wherein the fourth region is shown in brackets, the third region is
shown underlined, the second region is shown in bold, and the first
region is shown in italics, and wherein the fourth region comprises
a quencher (shown as TET in this example). The first region is
complementary to the third region. The terminal C nucleotide on the
3'-end of the first region of the DNA polymerase inhibitor
comprises the nucleotide analog dideoxycytosine (ddC), rendering
this illustrative DNA polymerase inhibitor non-extendible. In some
embodiments, the second region comprises, consists of, or consists
essentially of TT, TTTT, or TTTTT. In some embodiments, the second
region comprises a non-nucleotide linker. In certain embodiments,
the second region does not comprise a quencher. In certain
embodiments, the 5'-end of the DNA polymerase inhibitor further
comprises a quencher. In certain embodiments, at least one of the G
nucleotides comprises the nucleotide analog deaza-dG, at least one
A nucleotide comprises the nucleotide analog deaza-dA, or at least
one of the G nucleotides comprises a deaza-dG and at least one A
nucleotide a deaza-dA. In some embodiments, the quencher comprises
a TAMRA, a Black Hole Quencher dye, a ROX, an OREGON GREEN, a
DABCYL, or a DABSYL instead of or in addition to the TET
moiety.
[0149] Those in the art will appreciate that typically the length
and nucleotide and/or nucleotide analog composition of the
disclosed enzyme inhibitors can be varied to optimize the stability
of the inhibitor, particularly the double-stranded segment(s) and
to increase its ability to inhibit the enzymatic activity of the
corresponding enzyme when associated in a complex. Those in the art
will also appreciate that the disclosed enzyme inhibitors are
typically more effective in inhibiting the formation of secondary
amplification products when the dissociation rate, sometimes
referred to as the "off-rate", of the enzyme-enzyme inhibitor
complex at the first temperature is slow. However, in certain
applications, one may be able to compensate for "faster" off-rates
by using higher concentrations of the enzyme inhibitor. Those in
the art will understand that an appropriate concentration of enzyme
inhibitor for a particular application can be determined
empirically.
[0150] The enzyme inhibitors of the current teachings are
particularly useful when detecting comprises a melting curve
analysis, sometimes referred to as dissociation curve analysis. To
generate a melting or dissociation curve, the reaction composition
is heated, typically in a step-wise or incremental fashion, and the
fluorescence of the reaction mixture is detected at appropriate
intervals. Initially, the non-specific fluorescence in the reaction
composition is reduced during the initial heating process due to
the quencher moiety in the enzyme inhibitor, which reduces the
fluorescence emitted from the nucleic acid dye molecules associated
with the double-stranded segment(s) of the enzyme inhibitor in the
first temperature range. As the temperature increases to the second
temperature, the double-stranded segment(s) of the enzyme inhibitor
begin to melt, releasing the nucleic acid dye molecules that had
been associated with the double-stranded segments of the enzyme
inhibitor. A peak in the dissociation curve (plotted as the first
derivative of the fluorescence versus temperature) would be
expected to appear due to the enzyme inhibitor dissociating which
could complicate the evaluation of one or more amplicons. Due to
the presence of the quencher in the enzyme inhibitor, the
dissociation peak associated with the melting of the inhibitor is
decreased or not detected because the quencher absorbs at least
some of the fluorescence emitted from the associated dye molecules,
which at least diminishes the dissociation peak of the enzyme
inhibitor (see, e.g., FIGS. 3-6).
[0151] In general, the DNA polymerase inhibitors of the present
teachings may be used in any amplification method in which a DNA
polymerase is employed. For example, the disclosed DNA polymerase
inhibitors can be used in one or more of the following methods: DNA
sequencing, DNA amplification, RNA amplification, reverse
transcription, DNA synthesis and/or primer extension. The disclosed
DNA polymerase inhibitors can be used in reaction compositions for
amplifying target nucleic acids by primer extension, for example
but not limited to, PCR and/or reverse transcription. The DNA
polymerase inhibitors of the current teachings can also be used in
certain sequencing techniques. The disclosed DNA polymerase
inhibitors can be used in tests for single nucleotide polymorphisms
(SNPs) by single nucleotide primer extension using terminator
nucleotides. Any such procedures including variations thereof, for
example but not limited to, polynucleotide or primer labeling,
mini-sequencing and the like are contemplated for use with the DNA
polymerase inhibitors disclosed herein.
[0152] In some embodiments, a ligase inhibitor comprises an
oligonucleotide that can serve, at a first temperature, as a
ligation substrate mimic, that is a substrate comprising a nick
that can not be ligated by the ligase. In some embodiments, a
ligase inhibitor comprises two adjacently hybridized nucleic acid
ends, but at least one terminal nucleotide of at least one of the
ends is not hybridized to the "template" strand of the inhibitor
and the two ends can not be ligated together. In certain
embodiments, a ligase inhibitor comprises two adjacently hybridized
nucleic acid ends, but at least one end comprises a terminal
nucleotide that is not ligatable by the ligase. For example, the 3'
terminal nucleotide does not comprise a 3-hydroxyl group, the 5'
terminal nucleotide does not comprise a 5'-phosphate group. or
both. An illustrative ligase inhibitor embodiment comprising a nick
that can not be closed by a ligase is shown in FIG. 1 E. This
exemplary ligase inhibitor comprises a first region (1), a second
region (2), a third region (3), a fourth region (4), a fifth region
(8), and a sixth region (9). The second region (2), shown as a loop
structure, further comprises a first quencher (6); and the fifth
region (8), also shown as a loop structure, further comprises a
second quencher (7). The first region (1) is shown annealed with
the third region (3) to form a first double-stranded segment; and
the fourth region (4) is shown annealed with the sixth region (9)
to form a second double-stranded segment, for example, as can occur
at the first temperature. The 3-end of the sixth region (9)
comprises a non-ligatable end (10), for example but not limited to,
a terminal nucleotide that lacks a 3'--OH group (shown as X). In
certain embodiments, either the 3-end of the sixth region and/or
the 5'-end of the first region of such an illustrative ligase
inhibitor is not annealed with the "template strand" (in this
illustration, the fourth region (4) and/or the third region (3),
respectively. In certain embodiments, the upstream end of a ligase
inhibitor (shown as 9 in the illustrative ligase inhibitor depicted
in FIG. 1E) comprises 8 nucleotides, 9 nucleotides, 10 nucleotides,
11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15
nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19
nucleotides, 20 nucleotides, or more than 20 nucleotides. It is to
be appreciated that the length of the "upstream strand" of a ligase
inhibitor will typically be designed to be at least as long as the
footprint of the desired ligase and may be longer,
[0153] In certain embodiments, a ligase inhibitor comprises two
oligonucleotides that can adjacently hybridize with a template
strand, but the opposed ends at the nick are not suitable for
ligation together, for example but not limited to the 3'-end of the
upstream strand does not comprise a 3'--OH group, the 5'-end of the
downstream strand does not comprise a 5'-phosphate group, or
both.
[0154] Some ligase inhibitor embodiments comprise at least three
oligonucleotides, a first oligonucleotide, a second
oligonucleotide, and a third oligonucleotide, wherein the first
oligonucleotide comprises a first region, the second
oligonucleotide comprises a third region and a fourth region, and
the third oligonucleotide comprises a sixth region, wherein the
first region is complementary with the third region and the fourth
region is complementary with the sixth region.
[0155] Certain ligase inhibitors comprise two oligonucleotides,
including a first oligonucleotide and a second oligonucleotide,
wherein the first oligonucleotide comprises a first region, a
second region, a third region and a fourth region and the second
oligonucleotide comprises a sixth region, and wherein the first
region is complementary with the third region and the fourth region
is complementary with the sixth region. Under appropriate
conditions, including at a first temperature, the first region and
the third region can anneal and form at least one double-stranded
segment and the fourth region and the sixth region can anneal to
form at least one double-stranded segment. Other ligase inhibitor
embodiments comprise more than two oligonucleotides that can, under
appropriate conditions including at a first temperature, anneal to
form hybridization structure comprising a nick or a gap between two
adjacently hybridized oligonucleotide ends that can not be closed
by a ligase. In certain ligase inhibitor embodiments, at least one
nucleotide at or near the 3-end of the upstream oligonucleotide,
the 5'-end of the downstream oligonucleotide, or both, is not
complementary with the corresponding nucleotide(s) of the third
oligonucleotide, to which the first and second oligonucleotides
adjacently anneal. Thus at least one of the opposing ends is not
efficiently annealed with the template and the ligase is unable to
ligate them together.
[0156] In certain embodiments, a cleaving enzyme inhibitor
comprises a flap sequence comprising at least one internucleotide
linkage that is not cleavable or is slowly cleaved by the cleaving
enzyme. An exemplary embodiment of such an inhibitor is shown
schematically in FIG. 1 F. The illustrative inhibitor comprises a
first region (1), a second region (2), a third region (3)
comprising a first quencher (6), a fourth region (4), a fifth
region (8), and a sixth region (9) that in this illustrative
inhibitor comprises a second quencher (7). The first region (1) and
the third region (3) are shown annealed to form a first
double-stranded segment, the fourth region (4) and the sixth region
(9) are annealed to form a second double-stranded segment, and the
second region (2) and the fifth region (8) are each shown as loop
structures. Upstream from the first region (1) is a flap sequence
(11) that in this exemplary embodiment, comprises a multiplicity of
internucleotide linkages that can not be cleaved by the cleaving
enzyme (12). In this conformation, the illustrative enzyme
inhibitor forms a cleavage structure mimic, that is a secondary
structure that resembles a nucleic acid cleavage structure but
which serves as an ineffective substrate for the cleaving enzyme.
In certain embodiments, for example but not limited to, when the
cleaving enzyme comprises a DNA polymerase with polymerization
activity and/or when the reaction composition comprises a cleaving
enzyme and a DNA polymerase, the 3'-end of the cleaving enzyme
inhibitor comprises a non-extendible nucleotide, including without
limitation a ddN.
[0157] In certain embodiments, the nucleotide sequence of an enzyme
inhibitor comprises an aptamer that comprises at least one
double-stranded segment and that binds to and inhibits the
enzymatic activity of the enzyme when bound by the aptamer. When
the aptamer is free in solution below the second temperature or is
bound to the enzyme in a complex, the quencher absorbs at least
some of the fluorescent signal generated by nucleic acid dye
molecules associated with the aptamer.
[0158] Certain Exemplary Complexes
[0159] A complex according to the present teachings comprises an
enzyme inhibitor associated with an enzyme such that at least one
enzymatic activity of the enzyme is inhibited. In certain
embodiments, a complex comprises an enzyme inhibitor associated
with an amplifying enzyme, for example, any enzyme that is included
in an amplification reaction. In some embodiments, a complex
comprises an RNA polymerase associated with an RNA polymerase
inhibitor. In some embodiments, a complex comprises a ligase
inhibitor associated with a ligase. In some embodiments, a complex
comprises a helicase inhibitor associated with a helicase. In
certain embodiments, a complex comprises a cleaving enzyme
associated with a cleaving enzyme inhibitor. Some complexes further
comprise additional components, for example but not limited to, a
deoxyribonucleotide (dNTP), a ribonucleotide (rNTP), a nucleotide
analog, a helicase accessory protein, an SSB, or an enzyme cofactor
including without limitation, ATP and nicotinamide adenine
dinucleotide (NAO+), and including non-cleavable analogs thereof
that can participate in the formation and/or stabilization of
certain enzyme-enzyme inhibitor complexes, or combinations
thereof.
[0160] In certain embodiments, an enzyme-enzyme inhibitor complex
comprises a DNA polymerase associated with a DNA polymerase
inhibitor. In certain embodiments, a complex comprising a DNA
polymerase inhibitor and a DNA polymerase further comprises a NTP
and/or a nucleotide analog that can participate in the DNA
polymerase inhibitor-DNA polymerase complex. According to the
present teachings, when a DNA polymerase is complexed (i.e.,
associated in a complex) with a DNA polymerase inhibitor and
optionally a NTP and/or a nucleotide analog, the enzymatic activity
of the DNA polymerase with respect to its ability to catalyze the
addition of nucleotides to the 3'-end of a primer or a nascent
polynucleotide strand is inhibited. Typically, the disclosed DNA
polymerase inhibitors are designed to form at least one
double-stranded segment and complex with a DNA polymerase at a
first temperature. When the complex is heated to a second
temperature, the double-stranded segment of the DNA polymerase
inhibitor denatures and the complex dissociates. When released from
the complex, the synthetic activity of the DNA polymerase is
restored and, under appropriate conditions, certain nucleic acid
sequences can be amplified.
[0161] According to certain embodiments, a complex comprises a DNA
polymerase inhibitor associated with a DNA polymerase such that the
enzymatic activity of the DNA polymerase is inhibited. In some
embodiments, a complex comprises a DNA polymerase inhibitor in a
single or double stem-loop conformation associated with a DNA
polymerase. In some embodiments, a complex comprises a DNA
polymerase associated with a DNA polymerase inhibitor comprising at
least two oligonucleotides that are annealed to form at least one
double-stranded segment.
[0162] Typically, the first and third regions of a DNA polymerase
inhibitor anneal to form a double-stranded segment at the first
temperature and the DNA polymerase inhibitor assumes a stem-loop
conformation or a duplex conformation, as appropriate. In certain
embodiments, the fourth and sixth regions of a DNA polymerase
inhibitor anneal to form a double-stranded segment at the first
temperature and the DNA polymerase inhibitor assumes a stem-loop
conformation, a double stem-loop conformation, or a duplex
conformation, as appropriate. When a DNA polymerase inhibitor in a
stem-loop or a duplex conformation is combined with a DNA
polymerase, the DNA polymerase inhibitor and the DNA polymerase can
associate to form a complex, wherein the DNA polymerase activity is
inhibited. As the reaction temperature is increased, the
double-stranded segment(s) of the DNA polymerase inhibitors
denature at or near the second temperature, causing the complex to
dissociate and releasing the inhibition of the DNA polymerase.
[0163] The DNA polymerases of the current teachings typically
include but are not limited to, DNA-dependent DNA polymerases and
RNA-dependent DNA polymerases, including reverse transcriptases.
Certain reverse transcriptases possess DNA-dependent DNA polymerase
activity under certain reaction conditions, including AMV reverse
transcriptase and MMLV reverse transcriptase. Such reverse
transcriptases with DNA-dependent DNA polymerase activity may be
suitable for use with the disclosed methods and are expressly
within the contemplation of the current teachings. Descriptions of
DNA polymerases can be found in, among other places, Lehninger
Principles of Biochemistry, 3d ed., Nelson and Cox, Worth
Publishing, New York, N.Y., 2000, particularly Chapters 26 and 29;
Twyman, Advanced Molecular Biology: A Concise Reference, Bias
Scientific Publishers, New York, N.Y., 1999; Ausubel et al.; Linand
Jaysena, J. Mal. Biol. 271:100-11, 1997; Pavlov et al., Trends in
Biotechnol. 22:253-60, 2004; and Enzymatic Resource Guide: DNA
polymerases, 1998, Promega, Madison, Wis.
[0164] Inhibition of DNA polymerase activity can be observed with
respect to the synthesis of secondary amplicons or more generally,
with respect to overall nucleic acid synthesis by the DNA
polymerase. In general, one of skill in the art may choose to
optimize synthesis of desired amplicons while minimizing synthesis
of spurious side-products. Hence, when generating a desired
amplicon, the disclosed DNA polymerase inhibitors can inhibit
synthesis of secondary amplicons by about 5%, about 10%, about 15%,
about 20%, about 25%, about 30%, about 35%, about 40%, about 45%,
about 50%, about 55%, about 60%, about 65%, about 70%, about 75%,
about 85%, about 90%, about 95%, about 96%, about 97%, about 98%,
about 99%, or greater than about 99%, when compared to the amount
of secondary amplicons synthesized in the absence of the selected
DNA polymerase inhibitor.
[0165] Inhibition of ligase activity can be observed with respect
to the synthesis of undesired side-products, including without
limitation, misligation products, or more generally, with respect
to overall nucleic acid amplification in the reaction composition,
for example but not limited to, a reaction composition in which
LCR, LOR, LDRPCR, PCR-LDR, or FEN-LCR occurs. In general, one of
skill in the art may choose to optimize synthesis of desired
amplicons while minimizing synthesis of spurious side-products.
Hence, when generating a desired amplicon, the disclosed ligase
inhibitors can inhibit synthesis of undesired side products by
about 5%, about 10%, about 15%, about 20%, about 25%, about 30%,
about 35%, about 40%, about 45%, about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 85%, about 90%, about 95%,
about 96%, about 97%, about 98%, about 99%, or greater than about
99%, when compared to the amount of secondary amplicons synthesized
in the absence of the selected ligase inhibitor.
[0166] Inhibition of cleaving enzyme activity can be observed with
respect to the synthesis of undesired side-products or more
generally, with respect to overall nucleic acid amplification in
the reaction composition, for example but not limited to a reaction
composition in which FEN-LCR occurs. In general, one of skill in
the art may choose to optimize synthesis of desired amplicons while
minimizing synthesis of spurious side-products. Hence, when
generating a desired amplicon, the disclosed cleaving enzyme
inhibitors can inhibit synthesis of undesired side products by
about 5%, about 10%, about 15%, about 20%, about 25%, about 30%,
about 35%, about 40%, about 45%, about 50%, about 55%, about 60%,
about 65%, about 70%, about 75%, about 85%, about 90%, about 95%,
about 96%, about 97%, about 98%, about 99%, or greater than about
99%, when compared to the amount of secondary amplicons synthesized
in the absence of the selected cleaving enzyme inhibitor.
[0167] Inhibition of helicase activity can be observed with respect
to the synthesis of secondary amplicons or more generally, with
respect to overall nucleic acid synthesis in the reaction
composition, for example but not limited to a reaction composition
in which HOA occurs. In general, one of skill in the art may choose
to optimize synthesis of desired target nucleic acids while
minimizing synthesis of spurious side-products. Hence, when
generating a desired amplicon, the disclosed helicase inhibitors
can inhibit synthesis of secondary amplicons by about 5%, about
10%, about 15%, about 20%, about 25%, about 30%, about 35%, about
40%, about 45%, about 50%, about 55%, about 60%, about 65%, about
70%, about 75%, about 85%, about 90%, about 95%, about 96%, about
97%, about 98%, about 99%, or greater than about 99%, when compared
to the amount of secondary amplicons synthesized in the absence of
the selected helicase inhibitor.
[0168] The disclosed enzyme inhibitors can be combined with the
enzymes in a variety of ratios or concentrations to form complexes.
In some embodiments, the enzyme inhibitor is present at a larger
molar concentration than the enzyme. In other embodiments, the
enzyme inhibitor is present at about the same or a lesser molar
concentration than the enzyme. One of skill in the art may choose
to use a molar ratio of enzyme inhibitor to enzyme that is greater
than 1:1 (inhibitor: enzyme) in order to insure that sufficient
enzyme inhibitor is present so that every enzyme molecule can
associate with an enzyme inhibitor to form a complex. In general,
highly effective enzyme inhibitors may be used at lower
concentrations than less effective enzyme inhibitors. Hence, enzyme
inhibitors can be provided in a reaction composition at a variety
of concentrations. Such concentrations can vary, for example, from
about 1 nM to about 10 mM, or from about 5 nM to about 1 mM, or
from about 10 nM to about 100 .mu.M, or other convenient
concentrations selected by one of skill in the art.
[0169] The enzyme inhibitors disclosed herein can be combined with
an enzyme either before or during an amplification reaction to form
a complex provided that the amplification reaction conditions
comprise at least one step at the first temperature. In certain
embodiments, an enzyme and an enzyme inhibitor are combined at the
first temperature before the reaction composition is formed. Such a
pre-incubation step may facilitate the formation of an enzyme
inhibitor-enzyme complex and help decrease or eliminate the
synthesis of undesired side-products such as mis-primed amplicons,
misligated probes, and oligomerized primers.
Certain Exemplary Methods
[0170] The disclosed enzyme inhibitors serve at least two functions
in the methods of the current teachings. First, the disclosed
enzyme inhibitors serve to inhibit the enzymatic activity of a
corresponding enzyme at a first temperature, decreasing secondary
amplicon formation due to, among other things, mis-annealing or
primers and/or probes to sequences other than target nucleic acids
and primer dimer formation. Those in the art will appreciate that
by decreasing the formation of secondary amplification products,
the enzyme inhibitors of the current teachings can reduce the
non-specific fluorescence of the reaction composition. Second, the
disclosed enzyme inhibitors can also reduce the non-specific
fluorescence in the reaction composition due to the self-quenching
ability of the enzyme inhibitor, as the at least one quencher
moiety can absorb at least some of the fluorescence emitted by the
nucleic acid dye molecules associated with the double-stranded
segment(s) of the enzyme inhibitor. In certain embodiments, enzyme
inhibitors also increase the amplicon yield in the disclosed
methods.
[0171] Methods for amplifying a target nucleic acid are provided.
According to certain method embodiments, a reaction composition is
formed at a first temperature, wherein the reaction composition
comprises a DNA polymerase, a DNA polymerase inhibitor comprising a
nucleotide sequence and a quencher, a nucleoside triphosphate
(NTP), typically a mixture of deoxyribonucleotide triphosphates
(dNTPs), a target nucleic acid, a primer, and a nucleic acid dye.
In certain embodiments, a reaction composition further comprises a
nucleotide analog. In some embodiments, the DNA polymerase, the DNA
polymerase inhibitor, and optionally a NTP and/or a nucleotide
analog, are combined prior to forming the reaction composition. In
certain embodiments, the DNA polymerase and the DNA polymerase
inhibitor are pre-incubated at the first temperature prior to
forming the reaction composition. At the first temperature, the
nucleotide sequence of the DNA polymerase inhibitor comprises at
least one double-stranded segment and the DNA polymerase and the
DNA polymerase inhibitor can associate to form a complex. The
quencher absorbs at least some of the fluorescent signal emitted by
the nucleic acid dye molecules associated with the double-stranded
segment of the nucleotide sequence, relative to the signal that is
detected in a parallel reaction composition comprising the same DNA
polymerase inhibitor nucleotide sequence but lacking the
quencher(s). The reaction composition is then heated to a second
temperature that is near, at, or above the melting temperature of
the DNA polymerase inhibitor, causing the double-stranded segment
to denature and dissociating the complex. With the release of the
DNA polymerase inhibitor, from the complex, the enzymatic activity
of the DNA polymerase is no longer inhibited. The reaction
composition is subjected to at least one cycle of amplification to
generate a multiplicity of amplicons.
[0172] Methods for reducing non-specific fluorescence in a reaction
composition are provided. According to certain such methods, a
reaction composition is formed at a first temperature, wherein the
reaction composition comprises a DNA polymerase, a DNA polymerase
inhibitor comprising a nucleotide sequence and a quencher, a NTP,
typically a mixture of dNTPs, a target nucleic acid, a primer, and
a nucleic acid dye. In certain embodiments, a reaction composition
further comprises a nucleotide analog. In some embodiments, the DNA
polymerase, the DNA polymerase inhibitor, and optionally a NTP
and/or nucleotide analog, are combined prior to forming the
reaction composition. In certain embodiments, the DNA polymerase
and the DNA polymerase inhibitor are pre-incubated at the first
temperature to form a complex prior to forming the reaction
composition. The quencher absorbs at least some of the fluorescent
signal emitted by the nucleic acid dye molecules associated with
the double-stranded segment of the nucleotide sequence, relative to
the signal that is detected in a parallel reaction composition
comprising the same DNA polymerase inhibitor nucleotide sequence
but lacking the quencher(s). The reaction composition is then
heated to a second temperature that is near, at, or above the
melting temperature of the DNA polymerase inhibitor, causing the
double-stranded segment to denature and dissociating the complex.
With the release of the DNA polymerase, from the complex, the
polymerization activity of the DNA polymerase is no longer
inhibited. The reaction composition is subjected to at least one
cycle of amplification to generate a multiplicity of amplicons.
Under appropriate detection conditions, the fluorescence of the
nucleic acid dye associated with the multiplicity of amplicons in
the reaction composition can be detected, while the fluorescence of
the nucleic acid dye associated with the double-stranded segment of
the nucleotide sequence of the DNA polymerase inhibitor is at least
reduced by the quencher.
[0173] In some embodiments, the at least one cycle of amplification
comprises a multiplicity of cycles of amplification, for example
but not limited to, at least 10 cycles, at least 15, cycles, at
least 20 cycles, at least 25 cycles, at least 30 cycles, at least
35 cycles, at least 40 cycles, or more than 40 cycles of
amplification. In some embodiments, the subjecting the reaction
composition to at least one cycle of amplification comprises PCR,
including variations of PCR, for example but not limited to,
RT-PCR, asymmetric PCR, or quantitative or real-time PCR (see,
e.g., Rapley, particularly Part VII; Protocols & Applications
Guide, rev. 9/04, Promega; McPherson).
[0174] Certain embodiments of the disclosed methods comprise a
multiplex amplification step, including but not limited to a
multiplicity of parallel single-plex or lower plexy amplification
reactions (for example 2-plex, 3-plex, 4-plex, 5-plex, or 6-plex
amplification reactions), a multiplex detection step, including but
not limited to a multiplicity of parallel single-plex of lower
plexy detection steps (for example wherein two, three, four, five,
or six different amplicons are detected in the same reaction
composition), or both a multiplex amplification reaction and a
multiplex detection procedure. In some embodiments, the target
nucleic acid comprises a multiplicity of different target nucleic
acids, the primer comprises a multiplicity of different primers or
a multiplicity of different primer pairs, the multiplicity of
amplicons comprises a multiplicity of different amplicons, and the
detecting comprises detecting the fluorescence of the nucleic acid
dye associated with the multiplicity of different amplicons.
[0175] The degree of enzymatic inhibition obtained using the
disclosed DNA polymerase inhibitors can vary and may depend upon
the method employed, the DNA polymerase, the structure and melting
point of the selected DNA polymerase inhibitor and other factors
such as the primer extension temperature. Each of these variables
can be optimized by one of skill in the art to using the teachings
herein and/or available procedures to obtain optimal production of
the desired product with minimal production or non-target nucleic
acids. Likewise, the level of non-specific fluorescence reduction
can vary, depending upon, among other things, the particular
quencher(s) in the nucleotide sequence, the number of quenchers
employed per DNA polymerase inhibitor, the nucleic acid dye
employed, the reaction conditions, and the effectiveness of the DNA
polymerase inhibitor at decreasing the amount on secondary
amplification products. Those in the art will appreciate that the
number and placement of a particular quencher or quenchers in a
particular DNA polymerase inhibitor, the pairing of a particular
DNA polymerase with a particular DNA polymerase inhibitor, and the
pairing of a particular quencher with a particular nucleic acid
dye, can be evaluated empirically using routine methods known in
the art and without undue experimentation to optimize the reduction
of non-specific fluorescence in a particular reaction composition
and amplification technique.
[0176] According to certain method embodiments, a ligase forms a
complex with a ligase inhibitor at a first temperature in a
reaction composition comprising a target nucleic acid and a
ligation probe pair. In certain embodiments, the ligase and the
ligase inhibitor are combined and pre-incubated prior to forming a
reaction composition. At a first second temperature, the
ligase-ligase inhibitor complex dissociates, releasing the ligase.
The upstream and downstream ligation probes of the ligation probe
pair selectively hybridize with the target nucleic acid and the
ligase catalyzes the formation of a ligated probe. Some such
embodiments comprise a multiplicity of cycles of amplification
comprising the steps of denaturing, annealing the upstream and
downstream ligation probes, and ligating the probes to generate a
ligated probe. In certain embodiments, the reaction composition
comprises a ligation probe pair that is designed to specifically
hybridize with at least a portion of the complement of a ligated
probe. In some embodiments, a ligated probe comprises a
primer-binding site and the reaction composition comprises a primer
and a DNA polymerase-DNA polymerase complex.
[0177] According to certain disclosed methods, a cleaving enzyme
forms a complex with a cleaving enzyme inhibitor and a ligase forms
a complex with a ligase inhibitor at a first temperature. In
certain embodiments, at a first second temperature, the cleaving
enzyme-cleaving enzyme inhibitor complex dissociates. The released
cleaving enzyme can then cleave flap portions from certain overlap
flap structures comprising (1) a target nucleic acid or a
single-stranded amplicon, (2) a upstream cleavage probe, and (3) a
corresponding downstream cleavage probe that comprises a
5'-overhang or flap sequence that overlaps the 3'-end of the
upstream cleavage probe by at least one nucleotide. When the flap
is cleaved by the cleaving enzyme, a hybridization structure
comprising the template strand, the upstream cleavage probe, and
the hybridized fragment of the downstream cleavage probe, with a
ligatable nick between the 3'-end of the upstream cleavage probe
and the 5'-end of the hybridized fragment of the downstream
cleavage probe. In some embodiments, at a second temperature the
ligase-ligase inhibitor complex dissociates and the released ligase
can ligate the nick in the hybridization structure to generate a
duplex comprising a ligated probe and a template strand. In certain
embodiments, a ligated probe comprises at least one primer-binding
site. Those in the art will appreciate that the first second
temperature and the second second temperature can be approximately
the same temperatures or they can be different temperatures.
[0178] Some method embodiments further comprise a DNA
polymerase-DNA polymerase inhibitor complex at a first temperature.
At an appropriate third second temperature the DNA polymerase-DNA
polymerase inhibitor complex dissociates. Under suitable
conditions, a primer specifically hybridizes with the
primer-binding portion of a ligated probe and primer extension can
occur. Those in the art will appreciate that when different enzyme
inhibitors are employed in a reaction composition, at least two of:
the first second temperature, the second second temperature, and
the third second temperature can be approximately the same
temperatures or they can all be different temperatures.
[0179] Exemplary cleaving enzymes for use in the disclosed
complexes, methods and kits include without limitation, E. coli DNA
polymerase I, Thermus aquaticus DNA polymerase I, Thermus
thermophilus DNA polymerase I, mammalian FEN-1, Archaeoglobus
fulgidus FEN-1, Methanococcus jannaschii FEN-1, Pyrococcus furiosus
FEN-1, Methanobacterium thermoautotrophicum FEN-1, Thermus
thermophilus FEN-1, Cleavase.RTM. enzymes (Third Wave, Inc.,
Madison, Wis.), Saccharomyces cerevisiae RTH1, S. cerevisiae RAD27
Schizosaccharomyces pombe rad2, bacteriophage T5 5'-3' exonuclease,
Pyroccus horikoshii FEN-1, human exonuclease 1, calf thymus 5'-3'
exonuclease, including homologs thereof in eubacteria, eukaryotes,
and archaea, such as members of the class II family of
structure-specific enzymes. Descriptions of cleaving enzymes can be
found in, among other places, Lyamichev et al., Science 260:778-83
(1993); Eis et al., Nat. Biotechnol. 19:673-76 (2001); Shen et al.,
Trends in Bio. Sci. 23:171-73 (1998); Kaiser et al. J. Biol. Chem.
274:21387-94 (1999); Ma et al., J. Biol. Chem. 275:24693-700
(2000); Allawi et al., J. Mal. Biol. 328:537-54 (2003); Sharma et
al., J. Biol. Chem. 278:23487-96 (2003); and Feng et al., Nat.
Struct. Mal. Biol. 11:450-56 (2004).
[0180] According to certain disclosed methods, a DNA polymerase is
combined with a DNA polymerase inhibitor, and optionally a NTP
and/or a nucleotide analog, to form a complex. In certain
embodiments, the DNA polymerase comprises a reverse transcriptase,
a DNA-dependent DNA polymerase, including without limitation a
thermostable DNA polymerase, or a reverse transcriptase and a
DNA-dependent DNA polymerase. In some embodiments, the DNA
polymerase inhibitor comprises (1) a first DNA polymerase inhibitor
that can form a complex with the reverse transcriptase at a
suitable first temperature, (2) a second DNA polymerase inhibitor
that can form a complex with the DNA-dependent DNA polymerase at a
suitable first temperature, or (3) a first DNA polymerase inhibitor
that can form a complex with the reverse transcriptase at a
suitable first temperature and a second DNA polymerase inhibitor
that can form a complex with the DNA-dependent DNA polymerase at a
suitable first temperature, wherein the first DNA polymerase
inhibitor and the second DNA polymerase inhibitor comprise the same
nucleotide sequence or a different nucleotide sequence, and wherein
the suitable first temperature for the first DNA polymerase
inhibitor and the suitable first temperature for the second DNA
polymerase inhibitor are the same temperature or different
temperatures.
[0181] According to certain disclosed methods, amplification
comprises a two phase PCR reaction comprising two different
reaction compositions, a first reaction composition and a second
reaction composition, each comprising a DNA polymerase and a DNA
polymerase inhibitor. In certain such embodiments, a first reaction
composition comprises a first DNA polymerase, a first DNA
polymerase inhibitor, a NTP, typically a mixture of NTPs, and a
primer, typically a multiplicity of different primer pairs. In
certain embodiments, the DNA polymerase, the DNA polymerase
inhibitor, and optionally a NTP and/or a nucleotide analog are
combined prior to forming the first reaction composition. The first
reaction composition is subjected to a limited number of cycles of
amplification, for example but not limited to two, three, four,
five, six, seven, eight, nine, ten, eleven, twelve, thirteen,
fourteen, or fifteen cycles of amplification. The first reaction
composition is diluted after the limited first stage amplification
and a portion of the diluted first reaction composition is combined
with a second DNA polymerase, a second DNA polymerase inhibitor, a
NTP, typically a mixture of NTPs, and a primer, typically a primer
pair. In certain embodiments, the DNA polymerase, the DNA
polymerase inhibitor, and optionally a NTP and/or a nucleotide
analog, are combined prior to forming the second reaction
composition. The second reaction composition is subjected to a
multiplicity of cycles of amplification, for example but not
limited to, 10-45 cycles of amplification or 20-40 cycles of
amplification, including any number of cycles of amplification in
the listed ranges, as if each and every number of cycles was
expressly recited herein. In some embodiments, there is enough
residual first DNA polymerase in the diluted first reaction
composition that a second DNA polymerase is not necessary. In some
embodiments, there is enough residual first DNA polymerase
inhibitor in the diluted first reaction composition that a second
DNA polymerase inhibitor is not necessary. In certain embodiments,
the first DNA polymerase and the second DNA polymerase are the same
polymerase or different polymerases, including without limitation,
a reverse transcriptase and a DNA-dependent DNA polymerase. In some
embodiments, the first DNA polymerase inhibitor and the second DNA
polymerase inhibitor are the same inhibitor or a different
inhibitor. For illustration purposes but not as a limitation of
such embodiments, consider an exemplary RT-PCR reaction that
comprises a first reaction comprising a reverse transcriptase, a
first DNA polymerase inhibitor, and optionally, a NTP and/or a
nucleotide analog and a second reaction composition comprising a
thermostable DNA-dependent DNA polymerase, a second DNA polymerase
inhibitor, and optionally a NTP and/or a nucleotide analog. The
first DNA polymerase inhibitor can be designed to inhibit the
reverse transcriptase activity at temperatures below the optimal
temperature for reverse transcription (i.e., an exemplary first
phase first temperature), but not at or above the optimal reverse
transcription temperature (i.e., an exemplary first phase second
temperature). The second DNA polymerase inhibitor can be designed
to inhibit the enzymatic activity of the thermostable DNA
polymerase at temperatures below the second phase first
temperature, for example but not limited to, a temperature about
5.degree. C. to about 10.degree. C. below or about 4.degree. C.
below to about 6.degree. C. below the Tm of at least one of the PCR
primers (i.e., an exemplary second phase first temperature), but
not above the Tm of the PCR primers (i.e., an exemplary first phase
second temperature).
[0182] The methods of the current teachings can typically be used
with any target nucleic acid. The disclosed methods are useful not
only for producing large amounts of a desired amplicon, but also
for producing or sequencing nucleic acids that are known to exist
but are not completely sequenced or purified. One need know only
the identity of a sufficient number of bases at one or two ends of
the target, i.e., a target flanking sequence, in sufficient detail
so that at least one primer can be prepared that can serve as a
sequencing primer. After sequencing and identification of an
acceptable second target flanking sequence, a second primer can be
made and the target nucleic acid lying between the flanking
sequences can be exponentially amplified and in some embodiments,
quantified. In other embodiments, when sufficient sequence has been
obtained, an appropriate ligation probe set and/or an appropriate
cleavage probe set can be synthesized.
[0183] In certain embodiments of the disclosed methods, detecting
comprises evaluating an internal standard or a control sequence,
and may include comparing the quantity of a desired amplicon with a
standard curve or an internal size standard. In some embodiments, a
control sequence, a passive reference dye, or both are included in
a reaction composition to account for lane-to-lane,
capillary-to-capillary, and/or assay-to-assay variability.
[0184] Certain embodiments of the current methods further comprise
a multi-well reaction vessel, including without limitation, a
multi-well plate or a multi-chambered microfluidic device, in which
a multiplicity of amplification reactions and, in some embodiments,
detection are performed, typically in parallel. In certain
embodiments, one or more multiplex reactions for generating
amplicons are performed in the same reaction vessel, including
without limitation, a multi-well plate, such as a 96-well, a
384-well, a 1536-well plate, and so forth; or a microfluidic
device, for example but not limited to, a TaqMan.RTM. Low Density
Array (Applied Biosystems). In some embodiments, a massively
parallel amplifying step comprises a multi-well reaction vessel,
including a plate comprising multiple reaction wells, for example
but not limited to, a 24-well plate, a 96-well plate, a 384-well
plate, or a 1536-well plate; or a multi-chamber microfluidics
device, for example but not limited to a TaqMan Low Density Array
wherein each chamber or well comprises an appropriate primer(s),
primer set(s), and/or reporter probe(s), as appropriate. Typically
such amplification steps occur in a series of parallel single-plex,
two-plex, three-plex, four-plex, five-plex, or six-plex reactions,
although higher levels of parallel multiplexing are also within the
intended scope of the current teachings.
[0185] In certain embodiments, the reaction composition further
comprises a passive reference dye. The passive reference dye is
included in the reaction composition as an internal control to
allow for normalization of non-PCR related variations in
fluorescence, for example but not limited to, well-to-well,
tube-to-tube, plate-to-plate, and assay-to-assay variation. The
passive reference provides a baseline for normalization because its
fluorescence does not change during the course of the amplification
reaction. Typically, the passive reference does not interfere with
amplification reactions. The use of a passive reference dye and
normalization calculations based on the passive reference, for
example but not limited to, Rn and L1 Rn, are well known in the art
(see, e.g., Killigore et al., J. Clin. Micro., 38:2516-19, 2000;
TaqMan.RTM. PCR Reagent Kit With AmpliTaq Gold.RTM. DNA polymerase
Protocol, Applied Biosystems P/N 402823 Rev. D 2003; Brilliant.RTM.
SYBR.RTM. Green QRT-PCR Master Mix Kit, 1-step Instruction Manual,
Rev. #75003a, Stratagene, 2005; and Essential of Real Time PCR,
Applied Biosystems). In some embodiments, the passive reference dye
comprises ROX.TM. or TAMRA.TM..
[0186] Certain Exemplary Kits
[0187] The instant teachings also provide kits designed to expedite
performing certain of the disclosed methods. Kits may serve to
expedite the performance of certain disclosed methods by assembling
two or more components required for carrying out the methods. In
certain embodiments, kits contain components in pre-measured unit
amounts to minimize the need for measurements by end-users. In some
embodiments, kits include instructions for performing one or more
of the disclosed methods. Preferably, the kit components are
optimized to operate in conjunction with one another.
[0188] Certain disclosed kits comprise an enzyme inhibitor
comprising a nucleotide sequence and a quencher. In certain
embodiments, kits comprise at least one of: a ligase inhibitor, a
helicase inhibitor, a RNA polymerase inhibitor, a cleaving enzyme
inhibitor, and/or a DNA polymerase inhibitor. Certain kits of the
current teachings further comprise at least one of: a ligase, a
helicase, an RNA polymerase, and a cleaving enzyme. Certain kits
comprise an enzyme inhibitor and further comprise at least one of:
a primer, including without limitation a random primer or a primer
comprising oligo dT, or a primer pair; a ligation probe pair; a
cleavage probe set; a ligase cofactor including without limitation,
ATP or NAO; an SSB; and/or a helicase accessory protein. In some
embodiments, kits comprise a primer, a DNA polymerase, a ligase, or
combinations thereof. In certain embodiments, kits comprise a NTP,
a nucleotide analog, or both.
[0189] Certain kit embodiments comprise a DNA polymerase inhibitor
comprising a nucleotide sequence and a quencher. In certain
embodiments, a kit comprises a DNA polymerase; a control sequence,
for example but not limited to an internal standard sequence such
as a housekeeping gene and/or a coamplification sequence (see,
e.g., Siebert and Larrick, BioTechniques 14:244-49 (1993); Joyce,
Quantitative RT-PCR, 83-92, in Methods in Mal Biol., vol. 193,
O'Connell, ed., Humana Press; Raeymaekers, Mal. Biotechnol. 115-22
(2000)) or a polynucleotide ladder comprising molecular size or
weight standards; a primer and/or a primer pair; a reporter probe;
a nucleic acid dye; a passive reference dye; or combinations
thereof. In certain embodiments, kits comprise a multiplicity of
different primer pairs. In some embodiments, kits comprise a
forward primer, a reverse primer, or a forward primer and a reverse
primer, that further comprises a reporter group. In some such
embodiments, the reporter group of a forward primer of a primer
pair is different from the reporter group of the reverse primer of
the primer pair.
[0190] The skilled artisan will appreciate that many different
species of reporter groups can be used in the present teachings,
either individually or in combination with one or more different
reporter group. In certain embodiments, a reporter group emits a
fluorescent, a chemiluminescent, a bioluminescent, a
phosphorescent, or an electrochemiluminescent signal. Some
non-limiting examples of reporter groups include fluorophores,
radioisotopes, chromogens, enzymes, antigens including but not
limited to epitope tags, semiconductor nanocrystals such as quantum
dots, heavy metals, dyes, phosphorescence groups, chemiluminescent
groups, electrochemical detection moieties, binding proteins,
phosphors, rare earth chelates, transition metal chelates,
near-infrared dyes, electrochemiluminescence labels, and mass
spectrometer-compatible reporter groups, such as mass tags, charge
tags, and isotopes (see, e.g., Haff and Smirnov, Nucl. Acids Res.
25:3749-50, 1997; Xu et al., Anal. Chem. 69:3595-3602, 1997; Sauer
et al., Nucl. Acids Res. 31:e63, 2003). Detailed protocols for
attaching reporter groups to nucleic acids can be found in, among
other places, Hermanson, Bioconjugate Techniques, Academic Press,
San Diego, 1996; Current Protocols in Nucleic Acid Chemistry,
Beaucage et al., eds., John Wiley & Sons, New York, N.Y.
(2000), including supplements through August 2005; and Haugland,
Handbook of Fluorescent Probes and Research Products, 10.sup.th
ed., Molecular Probes-Invitrogen, 2005.
[0191] In certain embodiments, a kit comprises two or more
different enzyme inhibitors, for example but not limited to a
ligase inhibitor and a cleaving enzyme inhibitor; a cleaving enzyme
inhibitor, a ligase inhibitor, and a DNA polymerase inhibitor; or a
helicase inhibitor and a DNA polymerase inhibitor. In some
embodiments, a kit comprises two or more different DNA polymerase
inhibitors. In certain embodiments, kits comprise two different
enzymes, including without limitation, a DNA-dependent DNA
polymerase and an RNA-dependent DNA polymerase, such as a reverse
transcriptase; a ligase and a cleaving enzyme; an RNA polymerase
and a DNA polymerase, for example but not limited to, a reverse
transcriptase; and a helicase and a DNA polymerase. In certain
embodiments, a kit comprises a thermostable DNA polymerase.
[0192] The current teachings, having been described above, may be
better understood by reference to examples. The following examples
are intended for illustration purposes only, and should not be
construed as limiting the scope of the teachings herein in any
way.
Example 1
[0193] To evaluate the effect of the quencher moiety of certain
illustrative enzyme inhibitors to absorb at least some of the
fluorescence emitted from nucleic acid dye molecules associated
with double-stranded segments of the illustrative enzyme
inhibitors, five exemplary DNA polymerase inhibitors were
synthesized, as shown in Table 1 (below). The identity, location,
and number of quencher moieties were varied.
TABLE-US-00003 TABLE 1 Designation Sequence (shown in 5' to 3'
orientation) "DNA TCTGGGATAATTATGGTAAATATATGTTTTCATATATT polymerase
TATTATAATTATddC (SEQ ID NO: 1) inhibitor" A DNA
(Dabcyl)TCTGGGATAATTATGGTAAATATATGTTTTC polymerase
ATATATTTATTATAATTAT.sup.ddC (SEQ ID NO: 1) inhibitor B DNA
(ROX)TCTGGGATAATTATGGTAAATATATGTTTTCAT polymerase
ATATTTATTATAATTAT.sup.ddC (SEQ ID NO: 1) inhibitor C DNA
TCTGGGATAATTATGGTAAATATATGTTTTCATATATT polymerase
TATTATAATTATC(MGB-NFQ) inhibitor D (SEQ ID NO: 1) DNA
TCTGGGATA(deazaA)TT(deazaA)TGGTA(deazaA) polymerase
ATATGT(Dabcyl-T)TTC(deazaA)TATTTATTATAA inhibitor E TTATC(MGB-NFQ)
(SEQ ID NO: 3)
[0194] A series of parallel compositions, each comprising
1.times.SYBR Green I nucleic acid dye (Molecular Probes) in
1.times. reaction buffer (50 mM Tris buffer, pH 9, 5 mM MgCl2, 250
.mu.M dATP, dCTP and dGTP, 500 .mu.M dUTP, 60 nM ROX passive
reference dye, and one of the exemplary DNA polymerase inhibitors
shown in Table 1 at concentrations of 5 nM, 10 nM, 25 nM, 50 nM, 75
nM, or 100 nM, as appropriate, were formed at room temperature. As
seen in Table 1, "DNA polymerase inhibitor" A, DNA polymerase
inhibitor B, DNA polymerase inhibitor C, and DNA polymerase
inhibitor D share the same nucleotide sequence except the
nucleotide at the 3'-end of DNA polymerase inhibitor D is a C,
while the nucleotide at the 3'-end of "DNA polymerase inhibitor" A,
DNA polymerase inhibitor B, and DNA polymerase inhibitor Call
comprise the nucleotide analog dideoxycytosine (ddC). "DNA
polymerase inhibitor" A lacks a quencher moiety (thus A is not a
true DNA polymerase inhibitor of the current teachings, indicated
by the use of quotation marks: "DNA polymerase inhibitor"); DNA
polymerase inhibitor B comprises a DABCYL quencher moiety at its
5'-end; DNA polymerase inhibitor C comprises a ROX quencher moiety
at its 5'-end; and DNA polymerase inhibitor D comprises a minor
groove binder comprising a non-fluorescent quencher (MGB-NFQ) at
its 3'-end. DNA polymerase inhibitor E comprises a nucleotide
sequence that includes four deaza-dA nucleotide analogs (shown as
deazaA) and two G:T base pair mismatches in its first and third
regions. DNA polymerase inhibitor E also comprises two quencher
moieties, a DABCYL moiety in the second region loop and a MGB-NFQ
at its 3'-end.
[0195] A dissociation curve was generated for each of the
compositions using an ABI PRISM 7900HT Real-Time Sequence Detection
System instrument (Applied Biosystems) for the temperature range
30.degree. C. to 95.degree. C. The derivative of fluorescence
versus temperature was calculated using the associated dissociation
curve software. As shown in FIG. 3, the dissociation peak obtained
from the composition comprising 100 nM "DNA polymerase inhibitor" A
(shown as 100 nM A) at the Tm of this nucleotide sequence
(approximately 56.degree. C.) was much higher than the dissociation
peaks obtained from the compositions comprising 100 nM, 75 nM, or
50 nM DNA polymerase inhibitor B (shown as 100 nM B, 75 nM B, and
50 nM B, respectively). As demonstrated in FIG. 3, the background
fluorescence, presumably attributable to the fluorescent signal
emitted from the nucleic acid dye molecules associated with the
double-stranded segment of DNA polymerase inhibitor B, is reduced
relative to "DNA polymerase inhibitor" A.
[0196] The dissociation curves obtained from the compositions
comprising 100 nM "DNA polymerase inhibitor" A, 100 nM DNA
polymerase inhibitor C, 75 nM DNA polymerase inhibitor C, and 50 nM
DNA polymerase inhibitor C are shown in FIG. 4. As seen in FIG. 4,
the dissociation peak obtained with 100 nM "DNA polymerase
inhibitor" A is substantially higher that the dissociation peaks
associated with 100 nM, 75 nM, or 50 nM of DNA polymerase inhibitor
C.
[0197] The dissociation curves obtained from the composition
comprising 50 nM "DNA polymerase inhibitor" A and the composition
comprising 50 nM DNA polymerase inhibitor Dare shown in FIG. 5. The
dissociation peak obtained from the composition comprising 50 nM
"DNA polymerase inhibitor" A (shown as A in FIG. 5) is
substantially higher than the dissociation peak obtained form the
composition comprising 50 nM DNA polymerase inhibitor D (shown as
D).
[0198] FIG. 6 shows the dissociation curves obtained from the
compositions comprising 100 nM, 75 nM, 50 nM, 25 nM, 10 nM or 5 nM
"DNA polymerase inhibitor" A (shown as 100 nM/Std, 75 nM/Std, 50
nM/Std, 25 nM/Std, 10 nM/Std, and 5 nM/Std, respectively) and 100
nM, 75 nM, 50 nM, 25 nM, 10 nM or 5 nM DNA polymerase inhibitor E.
As shown in FIG. 6, the dissociation peaks obtained from each of
the compositions comprising "DNA polymerase inhibitor" A are
detectably higher and generally substantially higher than the
dissociation peak(s) obtained from the composition comprising DNA
polymerase inhibitor E, which are essentially lost in the
"baseline" and not readily distinguishable.
[0199] It is to be appreciated that these illustrative DNA
polymerase inhibitors are intended as non-limiting examples of
various DNA polymerase inhibitor designs, for example but not
limited to, nucleotide sequence variations, with and without a
minor groove binder, and different quencher moieties, including
without limitation different numbers of quenchers per inhibitor,
different quencher locations within the inhibitor (e.g., 3'-end,
5'-end and internal), and different specific quenchers (e.g.,
DABCYL, ROX, and NFQ). Those in the art will understand that
various DNA polymerase inhibitor designs are possible and that a
suitable DNA polymerase inhibitor can be obtained by routine
evaluation of various designs, informed by the present teachings,
for use with a particular DNA polymerase and a given set of
reaction conditions.
Example 2: Inhibition of Secondary Amplicons During PCR
Amplification of an Illustrative Target Nucleic Acid in the
Plasminogen Activator Urokinase (PAU) Gene of gDNA
[0200] To evaluate the inhibitory ability of DNA polymerase
inhibitor E in the amplification of a target nucleic acid in gDNA,
a PCR reaction was performed. Six parallel 20 .mu.L reaction
compositions were formed at room temperature, with each reaction
composition comprising: 40 ng human gDNA (Coriell); a PAU target
nucleic acid-specific primer pair comprising 2.25 .mu.M forward
primer: 5'-TGTAAAACGACGGCCAGTTCTCATATTCTCTCATCCTCCTGTCCC-3'(SEQ ID
NO: 4) and 2.25 .mu.M reverse primer:
5'-CAGGAAACAGCTATGACCAAGCGGCTTTAGGCCCACCT-3' (SEQ ID NO: 5); and a
final concentration of either 5, 10, 25, 50, 75 or 100 nM DNA
polymerase inhibitor E, in 1.times.PCR buffer (50 mM Tris-HCl, pH
9, 250 .mu.M dATP, dCTP and dGTP, 500 .mu.M dUTP, 5 mM MgCl2, 0.6 U
AmpliTaq DNA polymerase (Applied Biosystems), 60 nM ROX passive
reference dye, 8% glycerol, 0.01% Tween-20, 0.01% NaN3,
1.times.SYBR Green I nucleic acid dye). A no template control was
included in a seventh parallel reaction composition comprising the
same formulation as the other six, except that there was no gDNA
and the final concentration of DNA polymerase inhibitor E was 50
nM.
[0201] The reaction compositions were incubated at room temperature
for approximately 15 min and then thermal cycled in an ABI
PRISM.RTM. 7900HT Real-Time Sequence Detection System instrument
(Applied Biosystems). The following cycles were used: 95.degree. C.
for 2 min, 40 cycles of 96.degree. C. for 5 sec and 60.degree. C.
for 2 min. To evaluate the amplification products generated in each
of the thermocycled reaction compositions, 15 .mu.L of each
reaction composition was loaded into separate lanes of a
non-denaturing 4% agarose E-gel (InVitrogen, Carlsbad, Calif.),
along with two lanes loaded with a molecular size ladder comprising
markers of 500 base pairs, 400 base pairs, 300 base pairs, 200 base
pairs, and 100 base pairs (Low Range DNA Marker, InVitrogen). The
reaction compositions were loaded in lanes of the gel as follows:
lane B, 5 nM inhibitor E; lane C, 10 nM inhibitor E; lane D, 25 nM
inhibitor E; lane E, 50 nM inhibitor E; lane F, 75 nM inhibitor E;
lane G, 100 nM inhibitor E; lane H, 50 nM inhibitor E, no template
control. The samples were electrophoresed for 15 min, and
visualized by ethidium bromide. As shown in FIG. 7, the amount of
desired amplicon (11) increased as the concentration of DNA
polymerase inhibitor increased until a concentration of about 75 nM
(lane F). The intensity of the secondary amplicon bands, by
contrast, decreased as the DNA polymerase inhibitor concentration
increased.
Example 3: Inhibition of Secondary Amplicons During PCR
Amplification of an Exemplary Target Nucleic Acid of Human
Cytochrome P450 in cDNA
[0202] Seven parallel 20 .mu.L reaction compositions were formed at
room temperature, with each composition comprising: 10 ng universal
reference human cDNA (Stratagene); a P450 target nucleic
acid-specific primer pair comprising 200 nM forward primer:
5'-TGGGAGTCCTGGAAGCAGC-3' (SEQ ID NO: 6) and 200 nM reverse primer:
5'-TGGCTTCTGGTCAACAAGTGC-3' (SEQ ID NO: 7); and a final
concentration of either 0, 5, 10, 25, 50, 75 or 100 nM DNA
polymerase inhibitor E; in 1.times.PCR buffer (50 mM Tris-HCl, pH
9, 250 .mu.M dATP, dCTP and dGTP, 500 .mu.M dUTP, 5 mM MgCl2, 1.5 U
AmpliTaq DNA polymerase, 60 nM ROX passive reference dye, 8%
glycerol, 0.01% Tween-20, 0.01% NaN3, 1.times.SYBR Green I nucleic
acid dye). A no template control was included in an eighth parallel
reaction composition comprising the same formulation as the other
seven except that there was no cDNA and the final concentration of
DNA polymerase inhibitor E was 50 nM. The reaction compositions
were incubated at room temperature for 15 min, then thermal cycled
in an ABI PRISM.RTM. 7900HT Real-Time Sequence Detection System
instrument and the amplification products were analyzed on a
non-denaturing agarose gel, as described in Example 2. The reaction
compositions were loaded in lanes of the gel as follows: lane B, 0
nM inhibitor E; lane C, 5 nM inhibitor E; lane d, 10 nM inhibitor
E; lane E, 25 nM inhibitor E; lane F, 50 nM inhibitor E; lane G, 75
nM inhibitor E; lane H, 100 nM inhibitor E; and lane 1, 50 nM
inhibitor E, no template control.
[0203] As seen from the gel, shown in FIG. 8, the amount of desired
amplicon (21) increased as the concentration of DNA polymerase
inhibitor increased until a concentration of about 75 nM. Little to
no desired amplicon was seen in the reaction composition comprising
no DNA polymerase inhibitor E (lane A). The intensity of the
secondary amplicon bands decreased as the DNA polymerase inhibitor
concentration increased.
Example 4: Inhibiting Secondary Amplification Products Comprising
Primer Dimers
[0204] Five commercially available primer pairs and corresponding
TaqMan reporter probes for validated gene expression assays,
including assays for interleukin 1, beta (IL113; assay ID
Hs00174097_m1), TRAF family member-associated NFKB activator (TANK;
assay ID Hs00370305_ml), fatty acid synthase (FASN; assay ID
Hs00188012_m1), solute carrier family 2, member 1 (SLC2A1; assay ID
Hs00197884_m1), and phospholipase D1, phosphatidylcholine-specific
(PLD1; assay ID Hs00160118_m1) were obtained (Applied
Biosystems).
[0205] To evaluate the effect of an exemplary enzyme inhibitor on
the formation of primer dimer amplicons, five pairs of
corresponding reaction compositions lacking target nucleic acid
were prepared in parallel. Each 20 .mu.L reaction composition pair
comprised the appropriate primer pair and the corresponding
TaqMan.RTM. probe at a 1.times. concentration; 250 .mu.M dATP, dCTP
and dGTP; 500 .mu.M dUTP; 5 mM MgCl2; 2 U AmpliTaq DNA polymerase;
60 nM ROX passive reference; 8% glycerol; 0.01% Tween-20; 0.01%
NaN3; 1.times.SYBR Green.RTM. I in 50 mM pH 9 Tris-HCl buffer; and
either 50 nM polymerase inhibitor E or no inhibitor. The five sets
of parallel reaction compositions were incubated at room
temperature for 30 min and then transferred to an ABI PRISM.RTM.
7900HT Real-Time Sequence Detection System instrument. The reaction
compositions were heated to 95.degree. C. for 2 min, then subjected
to 40 cycles of amplification comprising 96.degree. C. for 5 sec
and 60.degree. C. for 2 min. Fifteen .mu.L of the thermocycled
reaction compositions was loaded in individual lanes of a 4%
agarose E-gel (Invitrogen) as follows: IL113 assay, lanes B (no
inhibitor) and C (50 nM polymerase inhibitor E); TANK assay, lanes
D (no inhibitor) and E (50 nM polymerase inhibitor E); FASN assay,
lanes F (no inhibitor) and G (50 nM polymerase inhibitor E); SLC2A1
assay, lanes (no inhibitor) H and I (50 nM polymerase inhibitor E);
and PLD1 assay, lanes J (no inhibitor) and K (50 nM polymerase
inhibitor E). A molecular weight standard comprising markers for
1200, 800, 400, 200, and 100 base pairs was added to lanes A and L.
The gel was electrophoresed for 15 min, and visualized by staining
with the nucleic acid dye ethidium bromide (shown in FIG. 9). The
amount of undesired primer dimer product was at least reduced in
reaction compositions comprising the inhibitor when compared with
the corresponding reaction composition lacking the inhibitor, e.g.,
compare lanes B (IL113 assay, no inhibitor) and C (IL113 assay, 50
nM polymerase inhibitor E) or D (TANK assay, no inhibitor) and E
(TANL assay, 50 nM polymerase inhibitor E).
Example 5: Decreasing Non-Specific Fluorescence Associated with
Enzyme Inhibitors
[0206] To evaluate the effect of an exemplary quencher moiety of an
illustrative polymerase inhibitor using PCR amplification and
melting curve analysis, two reaction compositions were prepared.
Each 20 .mu.L reaction composition comprised primers and reporter
probes from the TANK assay (described in Example 4) at a 1.times.
concentration; 10 ng universal reference human cDNA (Stratagene);
250 .mu.M dATP, dCTP and dGTP; 500 .mu.M dUTP; 5 mM MgCl2; 2 U
AmpliTaq DNA polymerase, 60 nM ROX passive reference, 8% glycerol,
0.01% Tween-20, 0.01% NaN3, 1.times.SYBR Green I in 50 mM pH 9
Tris-HCl buffer and either 50 nM "polymerase inhibitor A" or 50 nM
polymerase inhibitor E. The reaction compositions were incubated at
room temperature for 15 min, then transferred to an ABI PRISM.RTM.
7900HT Real-Time Sequence Detection System instrument and
thermocycled as described in Example 4. The instrument's associated
software, set at default conditions, was used to generate the
dissociation curves for the two thermocycled reaction compositions,
shown in FIG. 10. Two dissociation peaks were observed when the
thermocycled reaction composition comprised "polymerase inhibitor
A", including peak A ("polymerase inhibitor A") and peak B (the
TANK amplicon). The dissociation curve obtained with the
thermocycled reaction composition comprising polymerase inhibitor
B, by contrast, contained a peak for the TANK amplicon (shown as C
in the lower panel), but no dissociation curve for polymerase
inhibitor E was readily discernible.
[0207] The enzyme inhibitors, enzyme-enzyme inhibitor complexes,
methods, and kits of the current teachings have been described
broadly and generically herein. Each of the narrower species and
sub-generic groupings falling within the generic disclosure also
form part of the current teachings. This includes the generic
description of the current teachings with a proviso or negative
limitation removing any subject matter from the genus, regardless
of whether or not the excised material is specifically recited
herein.
[0208] The foregoing examples are for illustration purposes and are
not intended to limit the scope of the teachings herein.
[0209] Although the disclosed teachings has been described with
reference to various enzyme inhibitors, enzyme-enzyme inhibitor
complexes, methods, and kits, it will be appreciated that various
changes and modifications may be made without departing from the
teachings herein. The foregoing examples are provided to better
illustrate the present teachings and are not intended to limit the
scope of the teachings herein. Certain aspects of the present
teachings may be further understood in light of the following
claims.
Sequence CWU 1
1
7151DNAArtificial Sequencesynthetic construct 1tctgggataa
ttatggtaaa tatatgtttt catatattta ttataattat c 51249DNAArtificial
Sequencesynthetic construct 2ttctgggata attatggtaa atatatttta
tatatttatt ataattatc 49347DNAArtificial Sequencesynthetic construct
3tctgggataa ttatggtaaa tatgttttca tatttattat aattatc
47445DNAArtificial Sequencesynthetic construct 4tgtaaaacga
cggccagttc tcatattctc tcatcctcct gtccc 45538DNAArtificial
Sequencesynthetic construct 5caggaaacag ctatgaccaa gcggctttag
gcccacct 38619DNAArtificial Sequencesynthetic construct 6tgggagtcct
ggaagcagc 19721DNAArtificial Sequencesynthetic construct
7tggcttctgg tcaacaagtg c 21
* * * * *