U.S. patent application number 17/649568 was filed with the patent office on 2022-05-19 for nucleic acid detection method and assay kit.
This patent application is currently assigned to KABUSHIKI KAISHA TOSHIBA. The applicant listed for this patent is KABUSHIKI KAISHA TOSHIBA. Invention is credited to Koji HASHIMOTO, Mika INADA, Keiko ITO.
Application Number | 20220154261 17/649568 |
Document ID | / |
Family ID | |
Filed Date | 2022-05-19 |
United States Patent
Application |
20220154261 |
Kind Code |
A1 |
HASHIMOTO; Koji ; et
al. |
May 19, 2022 |
NUCLEIC ACID DETECTION METHOD AND ASSAY KIT
Abstract
According to one embodiment, a method for detecting target
nucleic acid includes the following steps. (A) A reaction field is
formed by placing a reaction mixture on an electrode, and the
reaction mixture contains the sample, a primer set, an
amplification enzyme, 4 mM to 30 mM of magnesium ion, and a redox
probe. The redox probe has an oxidation reduction potential, which
generates an electric signal of which amplitude increases. (B) The
reaction field is maintained under an amplification reaction
condition. (C) The electric signal is detected with the electrode.
(D) Existence or quantity of the target nucleic acid is
determined.
Inventors: |
HASHIMOTO; Koji; (Atsugi,
JP) ; ITO; Keiko; (Kawasaki, JP) ; INADA;
Mika; (Tokyo, JP) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
KABUSHIKI KAISHA TOSHIBA |
Tokyo |
|
JP |
|
|
Assignee: |
KABUSHIKI KAISHA TOSHIBA
Tokyo
JP
|
Appl. No.: |
17/649568 |
Filed: |
February 1, 2022 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16723356 |
Dec 20, 2019 |
|
|
|
17649568 |
|
|
|
|
15691337 |
Aug 30, 2017 |
10557165 |
|
|
16723356 |
|
|
|
|
International
Class: |
C12Q 1/6837 20060101
C12Q001/6837; C12Q 1/6823 20060101 C12Q001/6823; C12Q 1/6825
20060101 C12Q001/6825; C12Q 1/6851 20060101 C12Q001/6851 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 4, 2016 |
JP |
2016-216159 |
Claims
1: A method for detecting target nucleic acid in a sample, the
target nucleic acid including a first sequence, the method
comprising: (A) forming a reaction field by placing a reaction
mixture on an electrode, the reaction mixture comprising: the
sample; a primer set for amplifying the first sequence to obtain an
amplification product; an amplification enzyme; 4 mM to 30 mM in
concentration of magnesium ion; and a redox probe, which generates
an electric signal; (B) maintaining the reaction field under an
amplification reaction condition to generate the amplification
product, wherein, with the increase in the amount of the
amplification product, a magnesium pyrophosphate is generated from
the magnesium ion and the magnesium pyrophosphate precipitates with
the redox robe on the electrode; and (C) detecting the electric
signal from the redox probe with the electrode.
2: The method of claim 1, wherein the redox probe is a complex
which contains, as a central metal, ruthenium, rhodium, platinum,
cobalt, chromium, cadmium, nickel, zinc, copper, osmium, iron, or
silver, or a pigment selected from methylene blue, Nile blue and
crystal violet.
3: The method of claim 2, wherein the complex is selected from the
group consisting of an amine complex, a cyano complex, a halogen
complex, a hydroxy complex, a cyclopentadienyl complex, a
phenanthroline complex and a bipyridine complex.
4: The method of claim 1, wherein the redox probe is ruthenium
hexaamine.
5: The method of claim 1, wherein a concentration of the redox
probe is 25 .mu.M or higher and 3 mM or less.
6: The method of claim 1, wherein the electric signal is an
oxidation reduction potential.
7: The method of claim 1, wherein the electric signal is an
oxidation reduction current.
8: The method of claim 1, wherein the amplification reaction
condition is an isothermal amplification reaction condition.
9: The method of claim 8, wherein the isothermal amplification
reaction condition is a LAMP amplification reaction condition.
10: The method of claim 1, wherein the corresponding amplification
enzyme is Bst, GspSSD, or Tin polymerase.
11: The method of claim 1, wherein the electrode is formed of
gold.
12-13. (canceled)
14: The method of claim 1, wherein the redox probe is ruthenium
hexaamine, and no nucleic acid probe is immobilized on the reaction
field.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is based upon and claims the benefit of
priority from Japanese Patent Application No. 2016-216159, filed
Nov. 4, 2016, the entire contents of which are incorporated herein
by reference.
FIELD
[0002] Embodiments described herein relate generally to a nucleic
acid detection method and an assay kit.
BACKGROUND
[0003] At present, with progress of genetic-testing technology, the
nucleic acid testing is carried out in various scenes, such as
clinical diagnosis and criminal investigations. The target genes
are detected or quantified by methods such as the real-time PCR
method or microarray method. For example, the real-time PCP method
is accompanied by the amplification of nucleic acid, and therefore
its sensitivity is high and the quantitative range is wide. On the
other hand, with the microarray method, it is possible to detect
tens of thousands or more kinds of target genes simultaneously.
Further, a detection method which combines these methods has been
proposed.
[0004] Under such circumstances, there is a demand for further
development of a detection method which cart detect nucleic acid
simply at high sensitivity.
BRIEF DESCRIPTION OF THE DRAWINGS
[0005] FIG. 1 is a flowchart showing an example of a nucleic acid
detection method in an embodiment,
[0006] FIG. 2 is a diagram showing an example of a substrate of the
embodiment.
[0007] FIG. 3 is a diagram illustrating a mechanism of the
detection, speculated in the embodiment.
[0008] FIG. 4 is a diagram an example of an electrode array for
carrying out the method of the embodiment.
[0009] FIG. 5 is a diagram an example of an electrode array for
carrying out the method of the embodiment.
[0010] FIG. 6 is a diagram showing the experimental results in
Example 1.
[0011] FIG. 7 is a diagram showing the experimental results in
Example 2.
[0012] FIG. 8 is a diagram showing the experimental results in
Example 2.
[0013] FIG. 9 is a diagram showing the experimental results in
Example 2.
[0014] FIG. 10 is a diagram showing the experimental results in
Example 3.
[0015] FIG. 11 is a diagram showing the experimental results in
Example 4.
[0016] FIG. 12 is a diagram showing the experimental results in
Example 5.
DETAILED DESCRIPTION
[0017] Various embodiments will be described below with reference
to the accompanying drawings. Further, the drawings are schematic
diagrams designed to assist the reader to understand the
embodiments easily. Thus, there may be sections where the shape,
dimensions, ratio, etc., are different from those of the actual
devices, but they can be re-designed as needed with reference to
the following explanations and publicly known techniques.
[0018] In general, according to one embodiment, the nucleic acid
detection method is a method for detect a target nucleic acid in a
sample. The target nucleic acid includes the first sequence. FIG. 1
shows a brief flow of the nucleic acid detection method according
to the embodiment.
[0019] The nucleic acid detection method comprises steps (A) to (D)
set forth below. (A) A reaction field is formed by placing a
reaction mixture on an electrode, and the reaction mixture contains
the sample, a primer set, a corresponding amplification enzyme, 4
mM to 30 mM in concentration of magnesium ion, and a redox probe.
The primer set for amplifying the first sequence to obtain an
amplification product, wherein the primer set contains at least a
first primer complementary to a terminal of the first sequence and
a second primer homologous to the other terminal of the first
sequence. The redox probe has an oxidation reduction potential of
-0.5 V to 0.5 V, which generates a detectable electric signal of
which amplitude increases with an increase in an amount of the
amplification product existing in the reaction field. (B) The
reaction field is maintained under an amplification reaction
condition. (C) The electric signal from the redox probe is
chronologically detected with the electrode while maintaining the
reaction field under the amplification reaction condition. (D)
Existence or quantity of the target nucleic acid is determined
based on chronological variation in the amplitude of the electric
signal, obtained in (C).
[0020] In step (A), a reaction mixture is placed on an electrode,
thus forming a reaction field. A "reaction field" is a region where
an amplification reaction is carried out. The region is defined by
the reaction mixture. In other words, a reaction field may be a
region where a reaction mixture exists.
[0021] The reaction mixture contains a sample, a primer-set, an
amplification enzyme which corresponds thereto, a specific
concentration of magnesium ion and a redox probe.
[0022] The sample is a substance to be examined as to the
presence/absence or quantity of a target nucleic acid. In other
words, the sample may be an object to be analyzed, which may
include a target nucleic acid. The sample may be, for example, in a
liquid form. For example, the sample may be bio-materials including
blood, serum, leukocyte, urine, feces, sweat, saliva, oral mucosa,
expectoration, lymph, spinal fluid, lacrimal fluid, mother milk,
amniotic fluid, semen, tissue, biopsy and culture cells,
environmental materials collected from the environment, artificial
nucleic acids or the like, or mixtures of those. Further, a
preparation formulated using any of above materials may as well be
used as the sample. For example, a pretreatment may be carried out
on any of above materials to be used as a sample in the embodiment.
The pretreatment may be any conventional means known by itself,
such as a fragment, homogenization or extraction, for example. For
example, any of above materials may be collected from an organism
or environment, and formulated into a condition suitable for the
nucleic acid detection. For example, a liquid containing a nucleic
acid component which is obtained by extracting a nucleic acid from
any of above materials by any means can be used as the sample.
[0023] The target nucleic acid is a nucleic acid to be detected.
The target nucleic acid includes a first sequence. The first
sequence is a sequence which can be an index of the target nucleic
acid, and may be selected from a full length of the sequence of the
target nucleic acid. For example, the first sequence may be a
sequence specific to the target nucleic acid. The target nucleic
acid is a single strand nucleic acid. The state of the target
nucleic acid in the sample may be single-stranded. Or, the state of
the target nucleic acid in the sample may be a double strand formed
from a target nucleic acid and a nucleic acid chain complementary
to the target nucleic acid. For example, the sample to be examined
may contain both a single-stranded target nucleic acid and a
double-stranded target nucleic acid. The length of the target
sequence may be, for example, 50 to 500 bases, and preferably, 100
to 300 bases.
[0024] The length of the first sequence may be, for example, 3 to
10 bases, 10 to 20 bases, 20 to 30 bases, 30 to 40 bases, 40 to 50
bases, 50 to 60 bases, 60 to 70 bases, 70 to 80 bases, 80 to 90
bases or 90 to 100 bases, and preferably, 10 to 50 bases.
[0025] The amplification or amplification reaction means a process
in which a target nucleic acid, or a complementary nucleic acid
thereof, or an amplification product of each of these is
continuously replicated using those as a template to produce an
amplification product.
[0026] The amplification method may be, for example, PCR, LAMP,
RT-LAMP, SDA, NASBA, RCA, LCR, TMA, SmartAmp (registered trademark)
or ICAN (registered trademark). Further, a reverse transcription
reaction may be carried out together with the amplification
reaction as needed, for example, simultaneously.
[0027] The primer set is designed and/or selected to amplify the
first sequence as the index using the target nucleic acid as a
template so that an amplification product comprising the first
sequence can be obtain, and the target nucleic acid can be
detected. The primer set contains a first primer complementary to
one terminal of the first sequence and a second primer homologous
to the other terminal of the first sequence. With these primers, a
range to be amplified on the target nucleic acid is specified.
[0028] For example, when the target nucleic acid in a sample is a
single-stranded DNA, a complementary strand is formed by a primer
set, and further the amplification reaction advances using it as a
template. Moreover, when the target nucleic acid is RNA, a reverse
transcription reaction is carried out and the reverse transcription
product is subjected to the amplification reaction.
[0029] For example, in the case of a primer set for PCR, one primer
set may contain one kind of forward primer as the first primer and
one kind of reverse primer as the second primer.
[0030] Moreover, for example, in the case of a primer set for LAMP,
one primer set may contain an FTP primer as the first primer and a
BIP primer as the second primer. The primer set for LAMP may
further contain an F3 primer, B3 primer and LP gas primer, that is,
LF primers and/or LB primers. The LAPM amplification product has a
stem loop structure which includes a loop part which is a
single-stranded region, and a stem part which is double-stranded
region.
[0031] The corresponding amplification enzyme is an amplification
enzyme used for an amplification reaction. The amplification enzyme
may be selected based on the kind of target nucleic acid, the
amplification method, the primer set, and the presence/absence of a
reverse transcription reaction, etc. The amplification enzyme may
be DNA polymerase, RNA polymerase, or the like for example.
[0032] The DNA-polymerase may be Bst, Bst2.0, Bst3.0, GspSSD, GspM,
Tin, Bsm, Csa, 96-7, phi29, Omini-Amp (registered trademark), Aac,
Bca BEST (registered trademark), Displace Ace (registered
trademark), SD, Strand Displace (registered trademark), TOPOTAQ,
Isotherm2G, Taq or a combination of any of these, for example. The
kind of polymerase may be selected as needed. But Bst, GspSSD, or
Tin is preferable since the sensitivity of detection can be
increased therewith. The reaction liquid may further contain any
type of reverse transcriptase in addition to amplification
enzyme.
[0033] Magnesium ion may be contained in the reaction mixture at a
concentration of 4 mM to 30 mM to the reaction mixture.
[0034] The inventors of the embodiments have found that in a
reaction mixture containing the above-specified concentration of
magnesium, the amplitude of the electric signal detected with the
electrode increases with the increase in the amount of the
amplification product present in a reaction field.
[0035] Conversely, Ahmed et al. (Analyst 138, 907-15 (2013)) report
a detection carried out based on the decrease in the electric
signal, caused by the increase in the amplification product, as an
index. Note, however, that the decrease in an electric signal may
occur not only by change in the amount of an amplification product
present, but also by mixing of a reaction inhibiting material or
the like. On the other hand, the increase in the electric signal,
used as the index in this embodiment, is not easily affected by a
reaction inhibiting material or the like. Rather, the change in the
amount of an amplification product is substantially directly
reflected. Thus, higher-precision detection is achievable.
[0036] In the reaction mixture with a concentration of magnesium
ion being 4 mM or higher, the amplification reaction is promoted.
Further, with the generation of the amplification product,
magnesium pyrophosphate, in which pyrophosphoric acid and magnesium
ion are bonded together, is fully generated. As a result, magnesium
pyrophosphate precipitates in the reaction mixture. Although a
detailed explanation will be provided later, due to the generation
of the precipitate, the amount of the amplification product present
in the reaction field is reflected as an increase in the amplitude
of the electric signal from the redox probe.
[0037] The concentration of magnesium ion contained in the reaction
mixture should more preferably 4 to 12 mM, in which case magnesium
pyrophosphate more easily precipitates. Even more preferable
magnesium ion concentration is 5 to 10 mM.
[0038] Magnesium ion can be contained in a reaction mixture by
adding, for example, magnesium sulfide or magnesium chloride in the
reaction mixture.
[0039] With a concentration of magnesium ion of 4 mM to 30 mM in
the reaction mixture, the amplification reaction is promoted,
thereby making it possible to amplify various types of sequences of
a wide range efficiently, for example, without depending on the
sequence. Thus, various types of sequences can be detected
efficiently, for example.
[0040] A redox probe is a substance which has an oxidation
reduction potential of -0.5 V to 0.5 V and generates a detectable
electric signal. The detectable electric signal may be, for
example, an oxidation reduction potential or oxidation reduction
current of the redox probe. An electric signal from the redox probe
is detected with an electrode in contact with the reaction mixture.
Further, the redox probe is electrostatically coupled with the
amplification product in the reaction mixture.
[0041] The redox probe may be a complex, for example. The complex
may contain, for example, ruthenium (Ru), rhodium (Rh), platinum
(Pt), cobalt (Co), chromium (Cr), cadmium (Cd), nickel (Ni), zinc
(Zn), copper (Cu), osmium (Os), iron (Fe), or silver (Ag) as a
central metal. The complex concerned may be, for example, amine
complex, cyano complex, halogen complex, hydroxy complex,
cyclopentadienyl complex, phenanthroline complex or bipyridine
complex.
[0042] The redox probe may be a pigment, for example. The pigment
may be, for example, methylene blue, Nile blue or crystal
violet.
[0043] The redox probe is, for example, ruthenium hexaneamine
(RuHex). In this case, with application of voltage to the
electrode, RuHex.sup.3+ is reduced to RuHex.sup.2+ and electrons
are released. As these electrons flow into the electrode, the
oxidation reduction potential or current of RuHex is detected with
the electrode. The redox probe should preferably be RuHex, since in
which case the oxidation reduction potential is high and the
sensitivity of the detection is enhanced.
[0044] The concentration of the redox probe in the reaction mixture
may be 0.1 .mu.M to 100 mM, for example, preferably, 25 .mu.M to 3
mM, and even more preferably 1 mM, in which case the sensitivity of
the nucleic acid detection is enhanced. In particular, when the
redox probe is RuHex, it is desirable that the redox probe be
contained in a range of 25 .mu.M to 3 mM. If the amount of the
redox probe in the reaction mixture is excessively low, the binding
to the amplification product may be insufficient, which may cause
the deterioration of the detection sensitivity. On the other hand,
when it is excessive, the amplification reaction may be
inhibited.
[0045] The reaction mixture may contain an ingredient required for
the amplification reaction in addition to the above-listed
ingredients. Such an additional ingredient may be, for example,
salt, a substrate such as deoxynucleoside triphosphate (dNTP)
required to form a new polynucleotide chain starting from a primer
as the starting point, a thickener as a reaction reagent, a buffer
for pH control, a surfactant, ion that increases the annealing
specificity, ion used as a cofactor for the amplification enzyme
and/or, when reverse transcription is carried out simultaneously,
reverse transcriptase and a substrate required therefor.
[0046] The salt may be any conventionally known salt used to, for
example, maintain suitable amplification environment in a nucleic
acid amplification reaction. To maintain a suitable amplification
environment in a nucleic acid amplification reaction may mean that,
for example, the amplification enzyme maintains the tertiary
structure so as to optimize the nucleic acid amplification
activity. The salt may be potassium chloride, for example. The
concentration of salt in the reaction mixture should desirably be,
for example, 5 mol/L to 300 mol/L.
[0047] The electrode is configured to detect electric signals. More
specifically, a reaction field is formed on the electrode, and the
surface of at least a part of the electrode is in contact with the
reaction mixture. With this structure, an electric signal from the
redox probe contained therein is detected. The electrode should
preferably comprise a flat plane on a part of the surface thereof.
When a reaction field is formed on this flat plane, the reaction
field may be placed, for example, so as to cover the entire flat
plane of the electrode, or to include the flat plane, or may be
placed in a region partitioned by the flat plane.
[0048] For example, the electrode may be arranged inside the
reaction container, for example, so as to be in contact with the
bottom thereof or to be buried in the bottom, or may be disposed on
a tabular substrate.
[0049] FIG. 2 shows an example of the relationship between the
reaction mixture and the electrode in the nucleic acid detection
method according to the embodiment.
[0050] The reaction field may be supported with a substrate, for
example, which exposes the surface of the electrode from the
surface of the substrate to be flush therewith. In that case, the
reaction field may be formed on the electrode disposed on an upper
surface of the substrate. The substrate 1 is in a solid phase. The
substrate 1 may be, for example, resin, glass or silicon. The
electrode 2 is disposed on the upper surface 1a of the substrate 1.
The electrode 2 may be a metal film formed on the surface of the
substrate 1. The metal film may be, for example, gold. The metal
film should desirably be gold because of its high sensitivity. The
substrate 1 may comprise a reference pole and a counter pole in
addition to the electrode 2.
[0051] With the reaction mixture 4 brought on the electrode 2
described above, the reaction field 10 may be formed from the
reaction mixture 4 present on the electrode 2.
[0052] The ingredients to be contained in the reaction mixture
described above should just be present in the reaction mixture at
the time when it forms the reaction field. Therefore, these
ingredients may be added to the reaction mixture, for example,
before the reaction mixture is brought to the region which gives
rise to the reaction field. Alternatively, some of the ingredients
of the reaction mixture may be prepared separately, and thus some
may be brought to the reaction mixture at the same time as that
when the reaction mixture is brought to the region to become the
reaction field, or before or after that time. Or before the
reaction mixture is brought to the region to become the reaction
field, some of the ingredients may be releasably immobilized to a
solid phase or the like which is in contact with the reaction
field, and brought into the reaction mixture by being released when
the reaction mixture is brought thereto.
[0053] For example, when a primer set is releasably immobilized in
advance, the primer set may be immobilized in, for example, a
primer-immobilized region (not shown) which exists in the solid
phase which is in contact with the reaction field 10 of the
substrate 1.
[0054] In a further embodiment, the overall shape of the substrate
1 may be, for example, a container-like, a tabular, a globular, a
rod-like, or a part of any of these. The size and form of the
substrate 1 may be selected arbitrarily by the operator. Further, a
substrate including a flow channel may be used as the substrate
1.
[0055] In a further embodiment, the substrate may comprise a
plurality of electrodes arranged in an array as will be explained
later.
[0056] In a process (B), the reaction field formed in the process
(A) is maintained under an amplification reaction condition.
[0057] The amplification reaction condition may be selected based
on the amplification method selected, the type of the primer set,
the kind of the target nucleic acid, the kind of the amplification
enzyme, and/or the like. For example, the amplification reaction
condition may be an isothermal or temperature-varying amplification
reaction condition. Here, the isothermal amplification reaction
condition is desirable. The isothermal amplification reaction
condition should desirably be a LAMP amplification reaction
condition. When adopting the isothermal amplification reaction
condition, the reaction temperature may be selected depending on
the kind of the amplification enzyme used for the nucleic acid
detection method. The temperature may be, for example, 25.degree.
C. to 70.degree. C., and preferably, 55.degree. C. to 65.degree.
C.
By maintaining the reaction field under the reaction condition, the
amplification reaction is carried out and the amplification product
can be produced.
[0058] In a process (C), while maintaining the field under the
amplification reaction condition, electric signals from the redox
probe are detected chronologically with the electrode.
[0059] The electric signals can be detected by obtaining, for
example, a current value, a potential value, a capacitance value or
an impedance value with the electrode. The electric signals may be
detected by measuring, for example, values of a plurality of kinds
of electric signals such as a current value and a potential value.
The detection may be performed by, for example, a device which can
detect a current value, a potential value, a capacitance value or
an impedance value. Such a device may be any of the well-known
devices.
[0060] The electric signals may be detected chronologically, which
may be continuous or intermittently, that it, at a plurality of
time points at a predetermined time interval. For example, the
continuous detection of an electric signal may be monitoring of the
electric signal. When an amplification product nucleic acid exists,
a higher value of the electric signal is obtained as compared to
the case where no amplification product nucleic acid exists by
detecting from the start of the amplification reaction
chronologically for a desired time. Or the rise of electric signal
is observed at an earlier time. Or, before the electric signal
increases with the increase in the amplification product, such a
phenomenon is also observed that the peak of the oxidation
reduction potential once shifts in a negative direction. Based on
this, even a higher-precision measurement may be carried out by
combining the shift of the peak potential in the negative
direction, the amount of the electric signal and the peak shift
measurement of the oxidation reduction potential.
[0061] In a process (D), the existence and/or quantity of a target
nucleic acid are determined based on the chronologically change in
the amplitude of the electric signal obtained in the process (C)
above.
[0062] The existence and/or the quantity of the target nucleic acid
may be determined based on the result obtained by measuring the
time required for the detection signal to exceed a predetermined
threshold as a rise time. Alternatively, the existence and/or the
quantity of the target nucleic acid may be determined by
calculating the amount of the target nucleic acid in a sample with
a method comprising the following processing steps: preparing
several different standard sample nucleic acids whose amounts of
nucleic acids existing are already known; measuring using the
standard sample nucleic acids and preparing a calibration curve
from the measurement result obtained for the amount of each nucleic
acid; and comparing the measurement result of the target nucleic
acid with the calibration curve prepared.
[0063] According to the nucleic acid detection method of the
embodiment, it is possible to detect and quantify a target nucleic
acid in more simple way and at higher sensitivity than those of the
conventional techniques. Moreover, according to the nucleic acid
detection method of the embodiment, even many more kinds of target
nucleic acids are detectable than with the conventional
techniques.
[0064] With the embodiment described above, the amount of an
amplification product existing can be reflected as an increase in
electric signal in a simple way. As a result, it becomes possible
to detect or quantify a target nucleic acid in a sample with high
precision in a simple way.
[0065] One reason why the amount of an amplification product
existing can be detected as an increase in electric signal in the
embodiment described above can be considered as follows. The
following explanation will be provided with reference to FIG.
3.
[0066] FIG. 3(a) shows an example of the substrate and the reaction
field, used for the nucleic acid detection method of the
embodiment. The substrate 1 is as described above. The reaction
field 10 is formed from the reaction mixture 4. Here, of the
ingredients contained in the reaction mixture 4, redox probes 5 and
magnesium ion 6a are illustrated for convenience. When
amplification products 7 and pyrophosphoric acid molecules 6b are
produced by the amplification reaction (FIG. 3 (b)), magnesium ions
6a bond to pyrophosphoric acid molecules 6b to form magnesium
pyrophosphate molecules 6. Further, the redox probes 5 may bond to
the amplification products 7 to produce complexes B. The complexes
8 may bond to the magnesium pyrophosphate molecules 6 by
electrostastically. In the reaction mixture 4 having a
concentration of magnesium ion 6a of 4 mM or higher, magnesium
pyrophosphate molecules 6 precipitate on the electrode. Therefore,
the complexes 8 may precipitate on the bottom of the reaction field
with the precipitation of the magnesium pyrophosphate molecules 6
(FIG. 3 (c)). As the amplification products 7 and/or magnesium
pyrophosphate molecules 6 increase, the amount of the precipitate
of the complexes 8 may increases. As the amount of precipitate of
the complexes 8 increases, the redox probes 5 which approach or
contact the electrode 2 increase. Therefore, the electric signal
obtained with the electrode 2 increases. With the above-described
mechanism, the electric signals from the redox probes 5 bonded to
the amplification products 7 existing in the vicinity of the
electrode 2 are directly detectable with the electrode. As a
result, the amount of the amplification product 7 existing may be
reflected as an increase in electric signal in a simple way.
[0067] With use of such a detection principle, according to the
nucleic acid detection method of the embodiment, it is possible to
achieve the detection precisely regardless of the sequence of the
target nucleic acid to be detected. Moreover, according to such a
detection method, a plurality of target nucleic acids can be
detected with high precision in a simple way.
[0068] A further embodiment provides a method of detecting a
plurality of kinds of target nucleic acids, namely, the first to
n-th target nucleic acids.
[0069] The first to n-th target nucleic acids respectively contain
the 1.sub.1-th to 1.sub.n-th sequences, where n is an integer of 2
or greater.
[0070] In order to detect a plurality of kinds of target nucleic
acids such as above, a substrate comprising a plurality of
electrodes, i.e., an electrode array, may be used. The substrate
shown in FIG. 4 comprises a plurality of electrodes 12 arranged on
a surface 11a in contact with a reaction field of the substrate 11,
and pads 9 electrically connected to electrodes 12, respectively.
The data as electric signals obtained with the electrodes 12 may be
extracted from the pads 9.
[0071] In order to detect a plurality of kinds of target nucleic
acids for one kind of sample, it suffices if, for example, the
reaction mixtures each containing primer sets and samples, which
correspond to the target nucleic acids to be measured, are spotted
respectively to the corresponding electrodes. In this case, the
samples should be arranged on the respective electrodes so as not
to be brought into contact with each other but only to the
respective electrodes. Here, a partition may be provided between
electrodes, and further, for example, flow channels independent
from each other may be provided to carry the reaction mixtures to
the respective electrodes. The example provided above is directed
to the case where a plurality of kinds of target nucleic acids are
detected for one kind of sample, but it is also possible to
similarly detect one kind of target nucleic acid or a plurality of
kinds of target nucleic acids by an electrode array for a plurality
of kinds of samples. When detecting a plurality of kinds of target
nucleic acids, a plurality of kinds of primer sets are used. The
plurality of kinds of primer sets may contain primers for
amplifying the 1.sub.1-th to 1.sub.n-th sequences,
respectively.
[0072] Moreover, a plurality of kinds of primer sets may be
immobilized in advance to a plurality of primer-immobilized regions
arranged on a surface in contact with the respective reaction field
in an array to be independent from each other.
[0073] When a plurality of kinds of primer sets are immobilized
onto or near the corresponding electrodes respectively on the
electrode array, a plurality of kinds of target nucleic acids
contained in one kind of sample can be simultaneously detected with
a plurality of electrodes arranged so as to be in contact with the
reaction mixture which forms the reaction field.
[0074] The positions of primer-immobilized regions such as above
are shown in FIG. 5. For example, as shown in FIG. 5, the electrode
array comprises a plurality of electrodes 22 so as to be in contact
with one reaction field. In the vicinity of and/or on each of the
electrodes 22, a primer-immobilized region 30 is formed and a
plurality of primer sets 31 corresponding to the primer-immobilized
regions 30 are immobilized by each type. For example, when the
positions of the electrodes and the primer sets are tied with each
other, it becomes possible to obtain the data of the plurality of
kinds of target nucleic acids and the detection results while being
associated respectively with each other.
[0075] The expression "arranged to be independent from each other"
means that the amplification reactions carried out in the reaction
fields by specific ones of the plurality of kinds of primer sets
are located to be able to achieve the followings: the reactions are
not influenced by those carried out by other kinds of primer sets;
amplification products produced by the specific primer sets are not
mixed with those produced by other kinds of primer sets; and the
detection results of the specific amplification products to be
detected by the corresponding electrodes can be identified with
respect to those of the other amplification products. In order to
achieve these, the intervals between the electrodes arranged on the
electrode array can be adjusted.
[0076] For example, the interval between the electrodes may be 0.1
.mu.m to 10 mm, and the interval between a corresponding electrode
and an immobilized region of a respective primer set may be 0.1
.mu.m to 10 mm.
[0077] With such structure, it is possible to simultaneously detect
a plurality of kinds of target nucleic acids existing in one
reaction field.
[0078] According to the embodiment described above, it becomes
possible to detect a plurality of kinds of sequences efficiently
with high sensitivity regardless of the kind of sequence. Moreover,
by using the reaction mixture of the composition according to the
embodiment, more kinds of sequences can be amplified, for example,
efficiently. Therefore, it is possible to detect more kinds of
target nucleic acids efficiently with high precision, thereby
improving the efficiency of examination.
[0079] According to the embodiment described above, there is
provided a nucleic acid detection method which can simply detect
nucleic acids with high sensitivity.
[0080] According to the further embodiment, there is provided an
assay kit to detect a target nucleic acid in a sample. The target
nucleic acid is as described above, and contains the first
sequence. The assay kit contains the composition ingredients of the
reaction mixture which forms a reaction field for an amplification
reaction to take place.
[0081] The composition ingredients of the reaction mixture include
a primer set, a specific quantity of magnesium ion, and a redox
probe.
[0082] The primer set contains at least a first primer
complementary to a terminal of the first sequence and a second
primer homologous to the other terminal of the first sequence. Such
a primer set may be, for example, the above-described primer
set.
[0083] The magnesium ion may be contained in the assay kit in a
specific quantity by which the final concentration thereof in the
reaction mixture becomes 4 mM to 30 mM. The magnesium ion may be
contained in the kit as magnesium sulfide or magnesium chloride,
for example.
[0084] The redox probe has an oxidation reduction potential of -0.5
V to 0.5 V and generates a detectable electric signal. The
amplitude of the electric signal increases with the increase in the
amount of the amplification product existing in a reaction field.
The redox probe may be, for example, the one described above.
[0085] The assay kit may further contain a reaction reagent. The
reaction reagent may be a reagent required for the amplification
reaction. The reaction reagent may contain, for example, the
above-mentioned corresponding amplification enzyme, a substrate
such as deoxynucleoside triphosphate required when forming a new
polynucleotide chain with starting from the primer as the starting
point, or when reverse transcription to be carried out
simultaneously, an enzyme such as reverse transcriptase and a
substrate required therefor, and further a buffer for maintaining
suitable amplification environment, such as a salt. Further, a
thickener may be contained as a reaction reagent.
[0086] Each of these composition ingredients of the reaction
mixture may be individually contained in the assay kit, or some or
all of them may be mixedly contained in the assay kit.
[0087] With use of the assay kit containing these ingredients, and
for example, the adoption of the above-described nucleic acid
detection method, nucleic acids can be detected simply with high
sensitivity.
[0088] In the further embodiment, the assay kit contains a
substrate.
[0089] The substrate is for supporting a reaction field for the
amplification reaction to take place, formed by the existence of
the above-described reaction mixture. The substrate comprises, on a
surface thereof, an electrode for detecting an electric signal from
a redox probe. The electrode is disposed so as to form the reaction
field on itself. Such a substrate may be, for example, the one
shown in FIG. 2.
[0090] When a substrate is contained in an assay kit, the
composition ingredients of the reaction mixture may be releasably
immobilized to the surface to be brought into contact with a
reaction field of the substrate so as to be brought into the
reaction field.
[0091] For example, a reaction field may be formed from a reaction
mixture containing the composition ingredients, existing on an
electrode of the substrate. With use of the reaction field, it is
possible to detect nucleic acid simply with high sensitivity.
[0092] According to the embodiment described above, there is
provided an assay kit which can detect nucleic acid simply with
high sensitivity.
EXAMPLES
Example 1
[0093] The behavior of the electric signal from RuHex in a LAMP
amplification reaction was evaluated.
[0094] Preparation of Substrate
[0095] Thin films of titanium (500 nm) and gold (2000 nm) were
formed on a surface of a Pyrex (registered trademark) glass plate
(d=0.8 mm) by sputtering. Then, using a resist AZP4620, a gold
electrode (.phi.=200 .mu.m) was formed. After that, top of it was
coated with mercaptohexanol.
[0096] LAMP Amplification Reaction
[0097] A reaction mixture was prepared, which contains an
artificial sequence of parvo virus (10.sup.5 copies, 1 .mu.L)
(listed in Table 1 as SEQ ID NO: 1) as an amplification product, an
F3 primer (SEQ ID NO: 2), a B3 primer (SEQ ID NO: 3), an FIP primer
(SEQ ID NO: 4), a BIP primer (SEQ ID NO: 5), an Lb primer (SEQ ID
NO: 6) as a LAMP primer shown in Table 2, RuHex (25 microM) as a
redox probe, KCl (60 mM), magnesium ion (8 mM), ammonium ion (10
mM), betaine (0.8 M), dNTPs (1.4 mM each) and polymerase (GspSSD)
(8 units).
TABLE-US-00001 TABLE 1 VP gene of Parvo virus (SEQ ID NO: 1)
AAACGCTAATACGACTCACTATAGGGCGATCTACGGGTACTTTCAATAATC
AGACGGAATTTAAATTTTTGGAAAACGGATGGGTGGAAATCACAGCAAACT
CAAGCAGACTTGTACATTTAAATATGCCAGAAAGTGAAAATTATAGAAGAG
TGGTTGTAAATAATTTGGATAAAACTGCAGTTAACGGAAACATGGCTTTAG
ATGATACTCATGCACAAATTGTAACACCTTGGTCATTGGTTGATGCAAATG
CTTGGGGAGTTTGGTTTAATCCAGGAGATTGGCAACTAATTGTTAATACTA
TGAGTGAGTTGCATTTAGTTAGTTTTGAACAAGAAATTTTTAATGTTGTTT
TAAAGACTGTTTCAGAATCTGCTACTCAGCCACCAACTAAAGTTTATAATA
ATGATTTAACTGCATCATTGATGGTTGCATTAGATAGTAATAATACTATGC
CATTTACTCCAGCAGCTATGAGATCTGAGACATTGGGTTTTTATCCATGGA
AACCAACCATACCAACTCCATGGAGATATTATTTTCAATGGGATAGAACAT
TAATACCATCTCATACTGGAACTAGTGGCACACCAACAAATATATACCATG
GTACAGATCCAGATGATGTTCAATTTTATACTATTGAAAATTCTGTGCCAG
TACACTTACTAAGAACAGGTGATGAATTTGCTACAGGAACATTTTTTTTTG
ATTGTAAACCATGTAGACTAACACATACATGGCAAACAAATAGAGCATTGG
GCTTACCACCATTTCTAAATTCTTTGCCTCAAGCTGAAGGAGGTACTAACT
TTGGTTATATAGGAGTTCAACAAGATAAAAGACGTGGTGTAACTCAAATGG
GAAATACAAACTATATTACTGAAGCTACTATTATGAGACCAGCTGAGGTTG
GTTATAGTGCACCATATTATTCTTTTGAGGCGTCTACACAAGGGCCATTTA
AAACACCCTTCCCTTTAGTGAGGGTTAATAA
TABLE-US-00002 TABLE 2 SEQ ID No. Sequence 2 F3
GAGATATTATTTTCAATGGGATAGAAC 3 B3 CAATGCTCTATTTGTTTGCCATG 4 FIP
GAACATCATCTGGATCTGTACCAACCATCTCATACTGGAA CTAGTGGC 5 BIP
CTGTGCCAGTACACTTACTAAGAGTGTTAGTCTACATGGT TTACAATC 6 Lb
ACAGGTGATGAATTTGCTACAGG
[0098] As a negative control, a sample was further prepared in
which the artificial sequence of parvo virus was not added to the
reaction mixture. The reaction mixture was brought onto the surface
of the substrate having the electrode, and they were warmed
isothermally at 67.degree. C., to start the amplification reaction.
As the amplification reaction proceeded, the electric signal was
measured by a square wave voltammetry (SWV) method.
[0099] The results are shown in FIG. 6. FIG. 6(a) is a graph
showing the chronological variation in the reduction peak current
in each of the case where there was zero copy of artificial
sequence (SEQ ID NO: 1) of parvo virus and the case of 10.sup.5
copies. In the case of 10.sup.5 copies, the reduction peak current
remarkably increased. FIG. 6(b) is a graph showing the
chronological variation in the reduction peak potential in each of
the case where there was zero copy of artificial sequence of parvo
virus and the case of 10.sup.5 copies. In the case of 10.sup.5
copies, the reduction peak potential shifted. These results suggest
that when an amplification product exists in the reaction mixture
containing RuHex, the reduction peak current and the reduction peak
potential increase.
Example 2
[0100] The behavior of the electric signal from RuHex in the LAMP
amplification was evaluated for reaction mixtures containing
including different numbers of copies of the amplification
product.
[0101] Five reaction mixtures similar to that of Example 1 were
prepared, which respectively contain zero copy, 10.sup.2 copies,
10.sup.3 copies, 10.sup.4 copies and 10.sup.5 copies of the
artificial sequence (SEQ ID NO: 1) of parvo virus. With use of
substrates similar to that of Example 1, these reaction mixtures
were warmed isothermally at 67.degree. C., to start the
amplification reactions. As the amplification reactions proceeded,
the electric signals were measured by the SWV method.
[0102] The results were shown in FIGS. 7 and 8. FIGS. 7(a) to 7(e)
are each a graph showing the chronological variation in the
reduction peak potential in the reaction mixture containing the
respective number of copies of the artificial sequence of parvo
virus. FIGS. 8(f) to 8(i) are each a graphs showing the difference
in amount of chronological variation in terms of the reduction peak
potential between FIG. 7(a) and each of FIGS. 7(b) to 7(e). In each
graph, an arrow indicates the time (potential rise time) when the
variation amount of the peak reduction potential shifted by 1
mV/min or more. As the number of copies of parvo virus artificial
sequence was greater, the potential rise time was shorter. FIG. 9
is a graph which plotted the potential rise time in each case of
the respective numbers of copies of parvo virus artificial
sequence, together with a calibration curve. The R.sup.2 value of
the calibration curve was 0.9143. From these results, it was
demonstrated that there is a correlation between the quantity of
parvo virus artificial sequence existing and the potential rise
time, thus suggesting that the quantity of amplification product in
early stages of an amplification reaction can be determined
(quantification) based on the potential rise time.
Example 3
[0103] The relationship between the quantity of the redox probe,
the current and the potential rise time was investigated.
[0104] A reaction mixture having the same conditions as those of
Example 1 except that it contained 1 mM of RuHex and another
reaction mixture having the same conditions as that of Example 1
were prepared. With use of a substrate similar to that of Example 1
in the case of 10.sup.5 copies, each of the reaction mixtures was
warmed isothermally at 67.degree. C., to start the amplification
reaction. As the amplification reactions proceeded, the electric
signals were measured by a linear sweep voltammetry (LSV) method
(sweep rate: 0.1 V/s). The results are shown in FIG. 10. The
variation amount of the reduction peak current was greater than
that of the condition where RuHex was 25 .mu.M (FIG. 6(a)). Thus,
it was suggested that when the concentration of the redox probe in
the reaction mixture was 1 mM, the detection sensitivity was
improved as compared to the case of 25 .mu.M. If the concentration
of RuHex was 3 mM or more, the amplification reaction was
inhibited; therefore a preferable range is 25 .mu.M to 3 mM.
Example 4
[0105] The chronological variations of the current and potential
rise time of reaction mixtures containing different numbers of
copies of amplification product were investigated using an array
electrode.
[0106] Production of Chip
[0107] Thin films of titanium (500 nm) and gold (2000 nm) were
formed on a surface of a Pyrex (registered trademark) glass plate
(d=0.8 mm) by sputtering. Then, using a resist AZP4620, sixty gold
electrodes (active electrodes) (.phi.=200 .mu.m) arranged in an
array were formed. For every two active electrodes, a reference
electrode and a counter electrode were formed to corresponding
thereto. After that, top of it was coated with mercaptohexanol.
[0108] LAMP Reaction
[0109] Five reaction mixtures similar to that of Example 1 were
prepared, which respectively contain zero copy, 10.sup.2 copies,
10.sup.3 copies, 10.sup.4 copies and 10.sup.5 copies of the
artificial sequence (SEQ ID NO: 1) of parvo virus. These reaction
mixtures were brought onto the surface of the substrate having
electrodes, and they were warmed isothermally at 67.degree. C., to
start the amplification reactions. As the amplification reactions
proceeded, the electric signals were measured by the LSV method
(sweep rate: 0.5 V/s).
[0110] The results are shown in FIG. 11. FIG. 11(a) is a graph
showing the chronological variation in current value. As the number
of copies of the artificial sequence of parvo virus was greater,
the current rise time was shorter. FIG. 11(b) is a graph which
plotted the current rise time in each case of the respective
numbers of copies of parvo virus artificial sequence, together with
a calibration curve. The R.sup.2 value of the calibration curve was
0.9071. From these results, it was demonstrated that there is a
correlation between the quantity of parvo virus artificial sequence
existing and the current rise time. Thus, it was suggested that
with use of a substrate comprising electrodes arranged in an array,
the quantity of amplification product in early stages of an
amplification reaction can be determined (quantification) based on
the potential rise time.
Example 5
[0111] The chronological variations in peak current value of
reaction mixtures containing different concentrations of magnesium
were investigated. The reaction mixtures were prepared from the
same ingredients as those of Example 1 except that they
respectively contain 2.0 mM, 3.5 mM, 4 mM and 4.5 mM of magnesium
ion, and 10.sup.3 copies of the parvo virus artificial sequence
(SEQ ID NO: 1) and RuHex (1 mM). Each of the reaction mixtures was
brought onto the surface of a substrate such as of Example 1 having
the electrode without application of mercaptohexanol, and was
warmed isothermally at 65.degree. C., to start the amplification
reaction. As the amplification reactions proceeded, the electric
signals were measured by the LSV method (sweep rate: 0.5 V/s).
[0112] The results are shown in FIG. 12. FIG. 12 is a graph showing
the chronological variation in relative value of the peak current
value with respect to the peak current value before the starting of
the amplification reaction start being set to a value of 1. In the
reaction mixture having a magnesium ion concentration of 3.5 mM or
lower, the current value decreased as the amplification reaction
advanced. In the reaction mixture having a magnesium ion
concentration of 4 mM or higher, the current value decreased once,
and then increased. In the case where the magnesium ion
concentration was 4.5 mM, the current rise time was shorter than
the case of 4 mM, and the obtained current value itself was
high.
[0113] Based on these results, it was suggested that when magnesium
ion concentration was 4 or more mM, the amplified nucleic acid can
be detected based on the increase in current value. Further, as the
magnesium ion concentration was higher, the current value was
higher. Therefore, it was estimated that RuHex bonded to the
precipitate of magnesium pyrophosphate and condensed, and thus the
RuHex concentration on the surface of the electrode increased,
thereby raising the current value.
Example 6
[0114] The LAMP amplification reactions in reaction mixtures
containing different concentrations of magnesium ion were
investigated.
[0115] The reaction mixtures were prepared from the same
ingredients as those of Example 1 except that they respectively
contain 2.0 mM to 12 mM of magnesium ion, and 10.sup.3 copies of
the parvo virus artificial sequence (SEQ ID NO: 1). 20 .mu.L of
each of the reaction mixtures was dispensed into a respective
0.2-mL tube, and warmed isothermally at 65.degree. C., to start the
amplification reaction. After 60 minutes of the amplification
reaction in each mixture, the existence of the amplification
product was examined by electrophoresis.
[0116] The results are shown in Table 3. In the reaction mixture
having a magnesium ion concentration of 4 mM or more, a typical
rudder-shaped band was confirmed in the LAMP reaction.
[0117] Based on these results, it was demonstrated that when the
magnesium ion concentration was 4 mM or higher, the amplification
product was produced by the LAMP reaction.
TABLE-US-00003 TABLE 3 Amplification (Presence MgSO.sub.4 (mM) of
band in electrophoresis) 2 x 4 .smallcircle. 6 .smallcircle. 8
.smallcircle. 10 .smallcircle. 12 .smallcircle.
[0118] While certain embodiments have been described, these
embodiments have been presented by way of example only, and are not
intended to limit the scope of the inventions. Indeed, the novel
embodiments described herein may be embodied in a variety of other
forms; furthermore, various omissions, substitutions and changes in
the form of the embodiments described herein may be made without
departing from the spirit of the inventions. The accompanying
claims and their equivalents are intended to cover such forms or
modifications as would fail within the scope and spirit of the
inventions.
Sequence CWU 1
1
611000DNAParvo virus 1aaacgctaat acgactcact atagggcgat ctacgggtac
tttcaataat cagacggaat 60ttaaattttt ggaaaacgga tgggtggaaa tcacagcaaa
ctcaagcaga cttgtacatt 120taaatatgcc agaaagtgaa aattatagaa
gagtggttgt aaataatttg gataaaactg 180cagttaacgg aaacatggct
ttagatgata ctcatgcaca aattgtaaca ccttggtcat 240tggttgatgc
aaatgcttgg ggagtttggt ttaatccagg agattggcaa ctaattgtta
300atactatgag tgagttgcat ttagttagtt ttgaacaaga aatttttaat
gttgttttaa 360agactgtttc agaatctgct actcagccac caactaaagt
ttataataat gatttaactg 420catcattgat ggttgcatta gatagtaata
atactatgcc atttactcca gcagctatga 480gatctgagac attgggtttt
tatccatgga aaccaaccat accaactcca tggagatatt 540attttcaatg
ggatagaaca ttaataccat ctcatactgg aactagtggc acaccaacaa
600atatatacca tggtacagat ccagatgatg ttcaatttta tactattgaa
aattctgtgc 660cagtacactt actaagaaca ggtgatgaat ttgctacagg
aacatttttt tttgattgta 720aaccatgtag actaacacat acatggcaaa
caaatagagc attgggctta ccaccatttc 780taaattcttt gcctcaagct
gaaggaggta ctaactttgg ttatatagga gttcaacaag 840ataaaagacg
tggtgtaact caaatgggaa atacaaacta tattactgaa gctactatta
900tgagaccagc tgaggttggt tatagtgcac catattattc ttttgaggcg
tctacacaag 960ggccatttaa aacacccttc cctttagtga gggttaataa
1000227DNAartificialprimer 2gagatattat tttcaatggg atagaac
27323DNAartificialprimer 3caatgctcta tttgtttgcc atg
23448DNAartificialprimer 4gaacatcatc tggatctgta ccaaccatct
catactggaa ctagtggc 48548DNAartificialprimer 5ctgtgccagt acacttacta
agagtgttag tctacatggt ttacaatc 48623DNAartificialprimer 6acaggtgatg
aatttgctac agg 23
* * * * *