U.S. patent application number 17/348125 was filed with the patent office on 2022-05-12 for methods of treating breast cancer.
The applicant listed for this patent is Cold Spring Harbor Laboratory, Ionis Pharmaceuticals, Inc.. Invention is credited to Gayatri Arun, C. Frank Bennett, Kung-Chi Chang, Sarah Daniela Diermeier, Susan M. Freier, Frank Rigo, David L. Spector.
Application Number | 20220143066 17/348125 |
Document ID | / |
Family ID | |
Filed Date | 2022-05-12 |
United States Patent
Application |
20220143066 |
Kind Code |
A1 |
Spector; David L. ; et
al. |
May 12, 2022 |
METHODS OF TREATING BREAST CANCER
Abstract
Provided herein are methods, compounds, and compositions for
reducing expression of a MaTAR in an animal. Such methods,
compounds, and compositions are useful to treat, prevent, delay, or
ameliorate breast cancer in an individual in need.
Inventors: |
Spector; David L.; (Cold
Spring Harbor, NY) ; Diermeier; Sarah Daniela;
(Centerport, NY) ; Rigo; Frank; (Carlsbad, CA)
; Bennett; C. Frank; (Carlsbad, CA) ; Freier;
Susan M.; (San Diego, CA) ; Arun; Gayatri;
(Huntington, NY) ; Chang; Kung-Chi; (Cold Spring
Harbor, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Cold Spring Harbor Laboratory
Ionis Pharmaceuticals, Inc. |
Cold Spring Harbor
Carlsbad |
NY
CA |
US
US |
|
|
Appl. No.: |
17/348125 |
Filed: |
June 15, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15781249 |
Jun 4, 2018 |
11058709 |
|
|
PCT/US16/64998 |
Dec 5, 2016 |
|
|
|
17348125 |
|
|
|
|
62263484 |
Dec 4, 2015 |
|
|
|
62378125 |
Aug 22, 2016 |
|
|
|
International
Class: |
A61K 31/713 20060101
A61K031/713; A61P 35/00 20060101 A61P035/00; A61K 31/175 20060101
A61K031/175; A61K 31/712 20060101 A61K031/712; A61K 31/7125
20060101 A61K031/7125; C07H 21/04 20060101 C07H021/04; C12N 15/113
20060101 C12N015/113 |
Goverment Interests
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under
CA013106 and GM042694 awarded by National Cancer Institute. The
government has certain rights in the invention.
Claims
1-26. (canceled)
27. A compound comprising a nucleic acid having a nucleobase
sequence that is at least 90% complementary to a Mammary Tumor
Associated RNA (MaTAR).
28. (canceled)
29. The compound of claim 27, wherein the nucleic acid comprises a
modified oligonucleotide.
30. The compound of claim 29, wherein the modified oligonucleotide
comprises a nucleobase sequence that is at least 90% complementary,
at least 95% complementary, or 100% complementary to an equal
length portion of the nucleobase sequence selected from SEQ ID Nos:
1-111 and 193-280.
31. The compound of claim 30, wherein the modified oligonucleotide
is single-stranded.
32. The compound of claim 30, wherein the modified oligonucleotide
is double-stranded.
33. The compound of claim 30, wherein the modified oligonucleotide
consists of 12 to 30 linked nucleosides.
34. The compound of claim 30, wherein the modified oligonucleotide
comprises a portion of at least 8 contiguous nucleobases of the
nucleobase sequence selected from SEQ ID Nos: 112-156 and SEQ ID
Nos: 169-192.
35. The compound of claim 30, wherein the modified oligonucleotide
comprises at least one modified internucleoside linkage, at least
one modified sugar moiety, or at least one modified nucleobase, or
a combination thereof.
36. The compound of claim 35, wherein the at least one modified
internucleoside linkage of the modified oligonucleotide is a
phosphorothioate internucleoside linkage.
37. The compound of claim 35, wherein the at least one modified
sugar moiety is a bicyclic sugar or 2'-O-methyoxyethyl.
38. The compound of claim 35, wherein the at least one modified
nucleobase is a 5-methylcytosine.
39. The compound of claim 30, wherein the modified oligonucleotide
comprises: a gap segment consisting of linked deoxynucleosides; a
5' wing segment consisting of linked nucleosides; and a 3' wing
segment consisting of linked nucleosides, wherein the gap segment
is positioned immediately adjacent to and between the 5' wing
segment and the 3' wing segment, and wherein each nucleoside of
each wing segment comprises a modified sugar.
40-52. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATION(S)
[0001] This application is a divisional of U.S. patent application
Ser. No. 15/781,249, filed on Jun. 4, 2018, which issued as U.S.
Pat. No. 11,058,709 on Jul. 13, 2021, and is a U.S. national stage
entry of International Patent Application No. PCT/US2016/064998,
filed on Dec. 5, 2016, which claims priority to U.S. Provisional
Patent Application No. 62/378,125, filed on Aug. 22, 2016, and U.S.
Provisional Patent Application No. 62/263,484, filed on Dec. 4,
2015, the entire contents of each of which are fully incorporated
herein by reference.
SEQUENCE LISTING
[0003] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled BIOL0280USASEQ_ST25.txt, created on Jun. 1, 2018,
which is 4.92 MB in size. The information in the electronic format
of the sequence listing is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0004] Provided herein are methods, compounds, and compositions
useful for reducing expression of long noncoding RNAs (lncRNAs),
specifically, Mammary Tumor Associated RNAs (hereinafter referred
to as MaTARs) in an animal. Also, provided herein are methods,
compounds, and compositions comprising MaTAR inhibitors, which can
be useful in reducing MaTAR-related diseases or conditions in an
animal. Such methods, compounds, and compositions can be useful,
for example, to treat, prevent, delay or ameliorate breast cancer
in an animal.
BACKGROUND
[0005] Breast cancer is the most frequent malignancy in women
worldwide and the second leading cause of cancer mortality in women
(Siegel et al. Cancer Statistics, 2015. CA: A Cancer Journal for
Clinicians 65: 5-29, 2015). The challenge of finding more efficient
treatments is complicated by the diversity of the disease,
resulting in the classification of numerous breast cancer subtypes.
The most common type, invasive ductal carcinoma, can be stratified
into two fundamental classes: the estrogen receptor (ER) and/or
progesterone receptor (PR) positive subtypes (luminal A and luminal
B) and ER-negative (HER2/neu-amplified and basal-like) disease.
These "intrinsic" breast cancer subtypes differ in gene expression
patterns, histo-pathology, patient prognosis and treatment strategy
(Perou et al. Nature. 406: 747-752, 2000; Sorlie et al. Proc. Natl.
Acad. Sci. USA 100: 8418-8423, 2003; Cancer Genome Atlas Network
Nature. 490: 61-70, 2012; Anderson et al. J. Natl. Cancer Inst.
106, 2014).
[0006] While currently available endocrine and targeted therapies
have lead to improved overall survival rates, many breast tumors
are intrinsically resistant or acquire resistance after initial
responsiveness (Ali and Coombes Nat. Rev. Cancer 2: 101-112, 2002;
Higgins and Baselga J. Clin. Invest. 121: 3797-3803, 2011). To
improve the existing treatment regimens, it is critical to identify
and investigate new molecular targets that have the potential to
inhibit breast cancer progression and metastasis by impacting
alternative pathways and/or restoring drug sensitivity.
SUMMARY
[0007] Provided herein are compositions, compounds and methods for
modulating expression of lncRNAs associated with breast cancer. In
certain embodiments, these compositions, compounds and methods are
for modulating the expression of mammary tumor associated RNAs
(MaTARs). In certain embodiments, the MaTAR modulator is a
MaTAR-specific inhibitor. In certain embodiments, the
MaTAR-specific inhibitor decreases expression of a MaTAR. In
certain embodiments, MaTAR-specific inhibitors include nucleic
acids, proteins and small molecules. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid. In certain embodiments,
the nucleic acid is a compound. In certain embodiments, the
compound comprises a modified oligonucleotide. In certain
embodiments, the modified oligonucleotide can be single stranded or
double stranded.
[0008] Certain embodiments relate to the novel findings of a
comprehensive catalog of lncRNAs that are upregulated in mammary
tumors compared to mammary gland epithelia. Certain embodiments
relate to the novel identification of MaTARs as the key drivers in
tumor progression. Certain embodiments relate to the novel findings
of MaTAR involvement in mammary tumor proliferation and
carcinogenesis. Certain embodiments are directed to MaTAR
inhibitors useful for inhibiting a MaTAR, which can be useful for
treating, ameliorating, or slowing progression of breast
cancer.
DETAILED DESCRIPTION OF THE INVENTION
[0009] It is to be understood that both the foregoing general
description and the following detailed description are exemplary
and explanatory only and are not restrictive of the embodiments, as
claimed. Herein, the use of the singular includes the plural unless
specifically stated otherwise. As used herein, the use of "or"
means "and/or" unless stated otherwise. Furthermore, the use of the
term "including" as well as other forms, such as "includes" and
"included", is not limiting.
[0010] The section headings used herein are for organizational
purposes only and are not to be construed as limiting the subject
matter described. All documents, or portions of documents, cited in
this application, including, but not limited to, patents, patent
applications, articles, books, treatises, and GenBank and NCBI
reference sequence records are hereby expressly incorporated by
reference for the portions of the document discussed herein, as
well as in their entirety.
[0011] It is understood that the sequence set forth in each SEQ ID
NO in the examples contained herein is independent of any
modification to a sugar moiety, an internucleoside linkage, or a
nucleobase. As such, compounds defined by a SEQ ID NO may comprise,
independently, one or more modifications to a sugar moiety, an
internucleoside linkage, or a nucleobase. Compounds described by
ISIS number (ISIS #) indicate a combination of nucleobase sequence,
chemical modification, and motif.
[0012] Unless otherwise indicated, the following terms have the
following meanings:
[0013] "2'-deoxynucleoside" means a nucleoside comprising 2'-H(H)
furanosyl sugar moiety, as found in naturally occurring
deoxyribonucleic acids (DNA). In certain embodiments, a
2'-deoxynucleoside may comprise a modified nucleobase or may
comprise an RNA nucleobase (uracil).
[0014] "2'-O-methoxyethyl" (also 2'-MOE and
2'-O(CH.sub.2).sub.2--OCH.sub.3) refers to an O-methoxy-ethyl
modification at the 2' position of a furanosyl ring. A
2'-O-methoxyethyl modified sugar is a modified sugar.
[0015] "2'-MOE nucleoside" (also 2'-O-methoxyethyl nucleoside)
means a nucleoside comprising a 2'-MOE modified sugar moiety.
[0016] "2'-substituted nucleoside" or "2-modified nucleoside" means
a nucleoside comprising a 2'-substituted or 2'-modified sugar
moiety. As used herein, "2'-substituted" or "2-modified" in
reference to a sugar moiety means a sugar moiety comprising at
least one 2'-substituent group other than H or OH.
[0017] "3' target site" refers to the nucleotide of a target
nucleic acid which is complementary to the 3'-most nucleotide of a
particular compound.
[0018] "5' target site" refers to the nucleotide of a target
nucleic acid which is complementary to the 5'-most nucleotide of a
particular compound.
[0019] "5-methylcytosine" means a cytosine with a methyl group
attached to the 5 position.
[0020] "About" means within .+-.10% of a value. For example, if it
is stated, "the compounds affected about 70% inhibition of a
MaTAR", it is implied that MaTAR levels are inhibited within a
range of 60% and 80%.
[0021] "Administration" or "administering" refers to routes of
introducing a compound or composition provided herein to an
individual to perform its intended function. An example of a route
of administration that can be used includes, but is not limited to
parenteral administration, such as subcutaneous, intravenous, or
intramuscular injection or infusion.
[0022] "Administered concomitantly" or "co-administration" means
administration of two or more compounds in any manner in which the
pharmacological effects of both are manifest in the patient.
Concomitant administration does not require that both compounds be
administered in a single pharmaceutical composition, in the same
dosage form, by the same route of administration, or at the same
time. The effects of both compounds need not manifest themselves at
the same time. The effects need only be overlapping for a period of
time and need not be coextensive. Concomitant administration or
co-administration encompasses administration in parallel or
sequentially.
[0023] "Amelioration" refers to an improvement or lessening of at
least one indicator, sign, or symptom of an associated disease,
disorder, or condition. In certain embodiments, amelioration
includes a delay or slowing in the progression or severity of one
or more indicators of a condition or disease. The progression or
severity of indicators may be determined by subjective or objective
measures, which are known to those skilled in the art.
[0024] "Animal" refers to a human or non-human animal, including,
but not limited to, mice, rats, rabbits, dogs, cats, pigs, and
non-human primates, including, but not limited to, monkeys and
chimpanzees.
[0025] "Antisense activity" means any detectable and/or measurable
activity attributable to the hybridization of an antisense compound
to its target nucleic acid. In certain embodiments, antisense
activity is a decrease in the amount or expression of a target
nucleic acid or protein encoded by such target nucleic acid
compared to target nucleic acid levels or target protein levels in
the absence of the antisense compound to the target.
[0026] "Antisense compound" means a compound comprising an
oligonucleotide and optionally one or more additional features,
such as a conjugate group or terminal group. Examples of antisense
compounds include single-stranded and double-stranded compounds,
such as, oligonucleotides, ribozymes, siRNAs, shRNAs, ssRNAs, and
occupancy-based compounds.
[0027] "Antisense inhibition" means reduction of target nucleic
acid levels in the presence of an antisense compound complementary
to a target nucleic acid compared to target nucleic acid levels in
the absence of the antisense compound.
[0028] "Antisense mechanisms" are all those mechanisms involving
hybridization of a compound with target nucleic acid, wherein the
outcome or effect of the hybridization is either target degradation
or target occupancy with concomitant stalling of the cellular
machinery involving, for example, transcription or splicing.
[0029] "Antisense oligonucleotide" means an oligonucleotide having
a nucleobase sequence that is complementary to a target nucleic
acid or region or segment thereof. In certain embodiments, an
antisense oligonucleotide is specifically hybridizable to a target
nucleic acid or region or segment thereof.
[0030] "Bicyclic nucleoside" or "BNA" means a nucleoside comprising
a bicyclic sugar moiety. "Bicyclic sugar" or "bicyclic sugar
moiety" means a modified sugar moiety comprising two rings, wherein
the second ring is formed via a bridge connecting two of the atoms
in the first ring thereby forming a bicyclic structure. In certain
embodiments, the first ring of the bicyclic sugar moiety is a
furanosyl moiety. In certain embodiments, the bicyclic sugar moiety
does not comprise a furanosyl moiety.
[0031] "Branching group" means a group of atoms having at least 3
positions that are capable of forming covalent linkages to at least
3 groups. In certain embodiments, a branching group provides a
plurality of reactive sites for connecting tethered ligands to an
oligonucleotide via a conjugate linker and/or a cleavable
moiety.
[0032] "Cell-targeting moiety" means a conjugate group or portion
of a conjugate group that is capable of binding to a particular
cell type or particular cell types.
[0033] "cEt" or "constrained ethyl" means a bicyclic furanosyl
sugar moiety comprising a bridge connecting the 4'-carbon and the
2'-carbon, wherein the bridge has the formula:
4'-CH(CH.sub.3)--O-2'.
[0034] "Constrained ethyl nucleoside" (also cEt nucleoside) means a
nucleoside comprising a cEt.
[0035] "Chemical modification" in a compound describes the
substitutions or changes through chemical reaction, of any of the
units in the compound. "Modified nucleoside" means a nucleoside
having, independently, a modified sugar moiety and/or modified
nucleobase. "Modified oligonucleotide" means an oligonucleotide
comprising at least one modified internucleoside linkage, a
modified sugar, and/or a modified nucleobase.
[0036] "Chemically distinct region" refers to a region of a
compound that is in some way chemically different than another
region of the same compound. For example, a region having
2'-O-methoxyethyl nucleotides is chemically distinct from a region
having nucleotides without 2'-O-methoxyethyl modifications.
[0037] "Chimeric antisense compounds" means antisense compounds
that have at least 2 chemically distinct regions, each position
having a plurality of subunits.
[0038] "Cleavable bond" means any chemical bond capable of being
split. In certain embodiments, a cleavable bond is selected from
among: an amide, a polyamide, an ester, an ether, one or both
esters of a phosphodiester, a phosphate ester, a carbamate, a
di-sulfide, or a peptide.
[0039] "Cleavable moiety" means a bond or group of atoms that is
cleaved under physiological conditions, for example, inside a cell,
an animal, or a human.
[0040] "Complementary" in reference to an oligonucleotide means the
nucleobase sequence of such oligonucleotide or one or more regions
thereof matches the nucleobase sequence of another oligonucleotide
or nucleic acid or one or more regions thereof when the two
nucleobase sequences are aligned in opposing directions. Nucleobase
matches or complementary nucleobases, as described herein, are
limited to the following pairs: adenine (A) and thymine (T),
adenine (A) and uracil (U), cytosine (C) and guanine (G), and
5-methyl cytosine (mC) and guanine (G) unless otherwise specified.
Complementary oligonucleotides and/or nucleic acids need not have
nucleobase complementarity at each nucleoside and may include one
or more nucleobase mismatches. By contrast, "fully complementary"
or "100% complementary" in reference to oligonucleotides means that
such oligonucleotides have nucleobase matches at each nucleoside
without any nucleobase mismatches.
[0041] "Conjugate group" means a group of atoms that is attached to
an oligonucleotide. Conjugate groups include a conjugate moiety and
a conjugate linker that attaches the conjugate moiety to the
oligonucleotide.
[0042] "Conjugate linker" means a group of atoms comprising at
least one bond that connects a conjugate moiety to an
oligonucleotide.
[0043] "Conjugate moiety" means a group of atoms that is attached
to an oligonucleotide via a conjugate linker.
[0044] "Contiguous" in the context of an oligonucleotide refers to
nucleosides, nucleobases, sugar moieties, or internucleoside
linkages that are immediately adjacent to each other. For example,
"contiguous nucleobases" means nucleobases that are immediately
adjacent to each other in a sequence.
[0045] "Designing" or "Designed to" refer to the process of
designing a compound that specifically hybridizes with a selected
nucleic acid molecule.
[0046] "Diluent" means an ingredient in a composition that lacks
pharmacological activity, but is pharmaceutically necessary or
desirable. For example, the diluent in an injected composition can
be a liquid, e.g. saline solution.
[0047] "Differently modified" mean chemical modifications or
chemical substituents that are different from one another,
including absence of modifications. Thus, for example, a MOE
nucleoside and an unmodified DNA nucleoside are "differently
modified," even though the DNA nucleoside is unmodified. Likewise,
DNA and RNA are "differently modified," even though both are
naturally-occurring unmodified nucleosides. Nucleosides that are
the same but for comprising different nucleobases are not
differently modified. For example, a nucleoside comprising a 2'-OMe
modified sugar and an unmodified adenine nucleobase and a
nucleoside comprising a 2'-OMe modified sugar and an unmodified
thymine nucleobase are not differently modified.
[0048] "Dose" means a specified quantity of a compound or
pharmaceutical agent provided in a single administration, or in a
specified time period. In certain embodiments, a dose may be
administered in two or more boluses, tablets, or injections. For
example, in certain embodiments, where subcutaneous administration
is desired, the desired dose may require a volume not easily
accommodated by a single injection. In such embodiments, two or
more injections may be used to achieve the desired dose. In certain
embodiments, a dose may be administered in two or more injections
to minimize injection site reaction in an individual. In other
embodiments, the compound or pharmaceutical agent is administered
by infusion over an extended period of time or continuously. Doses
may be stated as the amount of pharmaceutical agent per hour, day,
week or month.
[0049] "Dosing regimen" is a combination of doses designed to
achieve one or more desired effects.
[0050] "Double-stranded compound" means a compound comprising two
oligomeric compounds that are complementary to each other and form
a duplex, and wherein one of the two said oligomeric compounds
comprises an oligonucleotide.
[0051] "Effective amount" means the amount of compound sufficient
to effectuate a desired physiological outcome in an individual in
need of the compound. The effective amount may vary among
individuals depending on the health and physical condition of the
individual to be treated, the taxonomic group of the individuals to
be treated, the formulation of the composition, assessment of the
individual's medical condition, and other relevant factors.
[0052] "Ensembl ID` is an identification number consisting of
letters and numbers assigned to a gene sequence by Ensembl, which
is a joint project between EMBL-EBI and the Wellcome Trust Sanger
Institute to develop a software system that produces and maintains
automatic annotation of selected eukaryotic genomes. Ensembl
annotation helps identify a gene location in a particular genome
and can be used to configure the equivalent gene on another
species' genome.
[0053] "Expression" includes all the functions by which a gene's
coded information is converted into structures present and
operating in a cell. Such structures include, but are not limited
to the products of transcription and translation.
[0054] "Gapmer" means an oligonucleotide comprising an internal
region having a plurality of nucleosides that support RNase H
cleavage positioned between external regions having one or more
nucleosides, wherein the nucleosides comprising the internal region
are chemically distinct from the nucleoside or nucleosides
comprising the external regions. The internal region may be
referred to as the "gap" and the external regions may be referred
to as the "wings."
[0055] "Hybridization" means annealing of oligonucleotides and/or
nucleic acids. While not limited to a particular mechanism, the
most common mechanism of hybridization involves hydrogen bonding,
which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen
bonding, between complementary nucleobases. In certain embodiments,
complementary nucleic acid molecules include, but are not limited
to, an antisense compound and a nucleic acid target. In certain
embodiments, complementary nucleic acid molecules include, but are
not limited to, an oligonucleotide and a nucleic acid target.
[0056] "Immediately adjacent" means there are no intervening
elements between the immediately adjacent elements of the same kind
(e.g. no intervening nucleobases between the immediately adjacent
nucleobases).
[0057] "Individual" means a human or non-human animal selected for
treatment or therapy.
[0058] "Inhibiting the expression or activity" refers to a
reduction or blockade of the expression or activity relative to the
expression of activity in an untreated or control sample and does
not necessarily indicate a total elimination of expression or
activity.
[0059] "Internucleoside linkage" means a group or bond that forms a
covalent linkage between adjacent nucleosides in an
oligonucleotide. "Modified internucleoside linkage" means any
internucleoside linkage other than a naturally occurring, phosphate
internucleoside linkage. Non-phosphate linkages are referred to
herein as modified internucleoside linkages.
[0060] "Intravenous administration" means administration into a
vein.
[0061] "Lengthened oligonucleotides" are those that have one or
more additional nucleosides relative to an oligonucleotide
disclosed herein, e.g. a parent oligonucleotide.
[0062] "lncRNA" means any long transcript that is not classified as
protein-coding, including, but not limited to pseudogenes and
antisense transcripts.
[0063] "Linked nucleosides" means adjacent nucleosides linked
together by an internucleoside linkage.
[0064] "Linker-nucleoside" means a nucleoside that links an
oligonucleotide to a conjugate moiety. Linker-nucleosides are
located within the conjugate linker of a compound.
Linker-nucleosides are not considered part of the oligonucleotide
portion of a compound even if they are contiguous with the
oligonucleotide.
[0065] "MaTAR" means Mammary Tumor Associated RNA and are
potentially oncogenic lncRNAs that differentially expressed in
breast cancer.
[0066] "MaTAR nucleic acid" means any nucleic acid encoding a
MaTAR. For example, in certain embodiments, a MaTAR nucleic acid
includes a DNA sequence encoding the MaTAR, an RNA sequence
transcribed from DNA encoding the MaTAR (including genomic DNA
comprising introns and exons), including a non-protein encoding
(i.e. non-coding) RNA sequence. The target may be referred to in
either upper or lower case.
[0067] "MaTAR-specific inhibitor" refers to any agent capable of
specifically inhibiting the MaTAR expression or activity at the
molecular level. For example, MaTAR-specific inhibitors include
nucleic acids (including antisense compounds), peptides,
antibodies, small molecules, and other agents capable of inhibiting
the expression of the MaTAR.
[0068] "Mismatch" or "non-complementary" means a nucleobase of a
first oligonucleotide that is not complementary to the
corresponding nucleobase of a second oligonucleotide or target
nucleic acid when the first and second oligonucleotides are
aligned. For example, nucleobases including but not limited to a
universal nucleobase, inosine, and hypoxanthine, are capable of
hybridizing with at least one nucleobase but are still mismatched
or non-complementary with respect to nucleobase to which it
hybridized. As another example, a nucleobase of a first
oligonucleotide that is not capable of hybridizing to the
corresponding nucleobase of a second oligonucleotide or target
nucleic acid when the first and second oligonucleotides are aligned
is a mismatch or non-complementary nucleobase.
[0069] "Modulating" refers to changing or adjusting a feature in a
cell, tissue, organ or organism. For example, modulating a MaTAR
can mean to increase or decrease the level of the MaTAR in a cell,
tissue, organ or organism. A "modulator" effects the change in the
cell, tissue, organ or organism. For example, a compound can be a
modulator of MaTAR that decreases the amount of MaTAR in a cell,
tissue, organ or organism.
[0070] "MOE" means methoxyethyl.
[0071] "Monomer" refers to a single unit of an oligomer. Monomers
include, but are not limited to, nucleosides and nucleotides.
[0072] "Motif" means the pattern of unmodified and/or modified
sugar moieties, nucleobases, and/or internucleoside linkages, in an
oligonucleotide.
[0073] "Natural" or "naturally occurring" means found in
nature.
[0074] "Non-bicyclic modified sugar" or "non-bicyclic modified
sugar moiety" means a modified sugar moiety that comprises a
modification, such as a substituent, that does not form a bridge
between two atoms of the sugar to form a second ring.
[0075] "Nucleic acid" refers to molecules composed of monomeric
nucleotides. A nucleic acid includes, but is not limited to,
ribonucleic acids (RNA), deoxyribonucleic acids (DNA),
single-stranded nucleic acids, and double-stranded nucleic
acids.
[0076] "Nucleobase" means a heterocyclic moiety capable of pairing
with a base of another nucleic acid. As used herein a "naturally
occurring nucleobase" is adenine (A), thymine (T), cytosine (C),
uracil (U), and guanine (G). A "modified nucleobase" is a naturally
occurring nucleobase that is chemically modified. A "universal
base" or "universal nucleobase" is a nucleobase other than a
naturally occurring nucleobase and modified nucleobase, and is
capable of pairing with any nucleobase.
[0077] "Nucleobase sequence" means the order of contiguous
nucleobases in a nucleic acid or oligonucleotide independent of any
sugar or internucleoside linkage.
[0078] "Nucleoside" means a compound comprising a nucleobase and a
sugar moiety. The nucleobase and sugar moiety are each,
independently, unmodified or modified. "Modified nucleoside" means
a nucleoside comprising a modified nucleobase and/or a modified
sugar moiety. Modified nucleosides include abasic nucleosides,
which lack a nucleobase.
[0079] "Nulliparous" is the medical term for a female who has never
given birth to a viable, or live, baby.
[0080] "Oligomeric compound" means a compound comprising a single
oligonucleotide and optionally one or more additional features,
such as a conjugate group or terminal group.
[0081] "Oligonucleotide" means a polymer of linked nucleosides each
of which can be modified or unmodified, independent one from
another. Unless otherwise indicated, oligonucleotides consist of
8-80 linked nucleosides. "Modified oligonucleotide" means an
oligonucleotide, wherein at least one sugar, nucleobase, or
internucleoside linkage is modified. "Unmodified oligonucleotide"
means an oligonucleotide that does not comprise any sugar,
nucleobase, or internucleoside modification.
[0082] "Parent oligonucleotide" means an oligonucleotide whose
sequence is used as the basis of design for more oligonucleotides
of similar sequence but with different lengths, motifs, and/or
chemistries. The newly designed oligonucleotides may have the same
or overlapping sequence as the parent oligonucleotide.
[0083] "Parenteral administration" means administration through
injection or infusion. Parenteral administration includes
subcutaneous administration, intravenous administration,
intramuscular administration, intraarterial administration,
intraperitoneal administration, or intracranial administration,
e.g. intrathecal or intracerebroventricular administration.
[0084] "Pharmaceutically acceptable carrier or diluent" means any
substance suitable for use in administering to an animal. For
example, a pharmaceutically acceptable carrier can be a sterile
aqueous solution, such as PBS or water-for-injection.
[0085] "Pharmaceutically acceptable salts" means physiologically
and pharmaceutically acceptable salts of compounds, such as
oligomeric compounds or oligonucleotides, i.e., salts that retain
the desired biological activity of the parent compound and do not
impart undesired toxicological effects thereto.
[0086] "Pharmaceutical agent" means a compound that provides a
therapeutic benefit when administered to an individual.
[0087] "Pharmaceutical composition" means a mixture of substances
suitable for administering to an individual. For example, a
pharmaceutical composition may comprise one or more compounds or
salt thereof and a sterile aqueous solution.
[0088] "Phosphorothioate linkage" means a modified phosphate
linkage in which one of the non-bridging oxygen atoms is replaced
with a sulfur atom. A phosphorothioate internucleoside linkage is a
modified internucleoside linkage.
[0089] "Phosphorus moiety" means a group of atoms comprising a
phosphorus atom. In certain embodiments, a phosphorus moiety
comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
[0090] "Portion" means a defined number of contiguous (i.e.,
linked) nucleobases of a nucleic acid. In certain embodiments, a
portion is a defined number of contiguous nucleobases of a target
nucleic acid. In certain embodiments, a portion is a defined number
of contiguous nucleobases of an oligomeric compound.
[0091] "Prevent" refers to delaying or forestalling the onset,
development or progression of a disease, disorder, or condition for
a period of time from minutes to indefinitely.
[0092] "Prodrug" means a compound in a form outside the body which,
when administered to an individual, is metabolized to another form
within the body or cells thereof. In certain embodiments, the
metabolized form is the active, or more active, form of the
compound (e.g., drug). Typically conversion of a prodrug within the
body is facilitated by the action of an enzyme(s) (e.g., endogenous
or viral enzyme) or chemical(s) present in cells or tissues, and/or
by physiologic conditions.
[0093] "Reduce" means to bring down to a smaller extent, size,
amount, or number.
[0094] "RefSeq No." is a unique combination of letters and numbers
assigned to a sequence to indicate the sequence is for a particular
target transcript (e.g., target gene). Such sequence and
information about the target gene (collectively, the gene record)
can be found in a genetic sequence database. Genetic sequence
databases include the NCBI Reference Sequence database, GenBank,
the European Nucleotide Archive, and the DNA Data Bank of Japan
(the latter three forming the International Nucleotide Sequence
Database Collaboration or INSDC).
[0095] "Region" is defined as a portion of the target nucleic acid
having at least one identifiable structure, function, or
characteristic.
[0096] "RNAi compound" means an antisense compound that acts, at
least in part, through RISC or Ago2, but not through RNase H, to
modulate a target nucleic acid and/or protein encoded by a target
nucleic acid. RNAi compounds include, but are not limited to
double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA,
including microRNA mimics.
[0097] "Segments" are defined as smaller or sub-portions of regions
within a nucleic acid.
[0098] "Side effects" means physiological disease and/or conditions
attributable to a treatment other than the desired effects. In
certain embodiments, side effects include injection site reactions,
liver function test abnormalities, renal function abnormalities,
liver toxicity, renal toxicity, central nervous system
abnormalities, myopathies, and malaise. For example, increased
aminotransferase levels in serum may indicate liver toxicity or
liver function abnormality. For example, increased bilirubin may
indicate liver toxicity or liver function abnormality.
[0099] "Single-stranded" in reference to a compound means the
compound has only one oligonucleotide. "Self-complementary" means
an oligonucleotide that at least partially hybridizes to itself. A
compound consisting of one oligonucleotide, wherein the
oligonucleotide of the compound is self-complementary, is a
single-stranded compound. A single-stranded compound may be capable
of binding to a complementary compound to form a duplex.
[0100] "Sites," are defined as unique nucleobase positions within a
target nucleic acid.
[0101] "Specifically hybridizable" refers to an oligonucleotide
having a sufficient degree of complementarity between the
oligonucleotide and a target nucleic acid to induce a desired
effect, while exhibiting minimal or no effects on non-target
nucleic acids. In certain embodiments, specific hybridization
occurs under physiological conditions.
[0102] "Specifically inhibit" a target nucleic acid means to reduce
or block expression of the target nucleic acid while exhibiting
fewer, minimal, or no effects on non-target nucleic acids reduction
and does not necessarily indicate a total elimination of the target
nucleic acid's expression.
[0103] "Standard cell assay" means assay(s) described in the
Examples and reasonable variations thereof.
[0104] "Standard in vivo experiment" means the procedure(s)
described in the Example(s) and reasonable variations thereof.
[0105] "Sugar moiety" means an unmodified sugar moiety or a
modified sugar moiety. "Unmodified sugar moiety" or "unmodified
sugar" means a 2'-OH(H) furanosyl moiety, as found in RNA (an
"unmodified RNA sugar moiety"), or a 2'-H(H) moiety, as found in
DNA (an "unmodified DNA sugar moiety"). Unmodified sugar moieties
have one hydrogen at each of the 1', 3', and 4' positions, an
oxygen at the 3' position, and two hydrogens at the 5' position.
"Modified sugar moiety" or "modified sugar" means a modified
furanosyl sugar moiety or a sugar surrogate. "Modified furanosyl
sugar moiety" means a furanosyl sugar comprising a non-hydrogen
substituent in place of at least one hydrogen of an unmodified
sugar moiety. In certain embodiments, a modified furanosyl sugar
moiety is a 2'-substituted sugar moiety. Such modified furanosyl
sugar moieties include bicyclic sugars and non-bicyclic sugars.
[0106] "Sugar surrogate" means a modified sugar moiety having other
than a furanosyl moiety that can link a nucleobase to another
group, such as an internucleoside linkage, conjugate group, or
terminal group in an oligonucleotide. Modified nucleosides
comprising sugar surrogates can be incorporated into one or more
positions within an oligonucleotide and such oligonucleotides are
capable of hybridizing to complementary oligomeric compounds or
nucleic acids.
[0107] "Subcutaneous administration" means administration just
below the skin.
[0108] "Target gene" refers to a gene encoding a target.
[0109] "Targeting" means specific hybridization of a compound that
to a target nucleic acid in order to induce a desired effect.
[0110] "Target nucleic acid," "target RNA," "target RNA transcript"
and "nucleic acid target" all mean a nucleic acid capable of being
targeted by compounds described herein.
[0111] "Target region" means a portion of a target nucleic acid to
which one or more compounds is targeted.
[0112] "Target segment" means the sequence of nucleotides of a
target nucleic acid to which a compound described herein is
targeted. "5' target site" refers to the 5'-most nucleotide of a
target segment. "3' target site" refers to the 3'-most nucleotide
of a target segment.
[0113] "Terminal group" means a chemical group or group of atoms
that is covalently linked to a terminus of an oligonucleotide.
[0114] "Therapeutically effective amount" means an amount of a
compound, pharmaceutical agent, or composition that provides a
therapeutic benefit to an individual.
[0115] "Treat" refers to administering a compound or pharmaceutical
composition to an animal in order to effect an alteration or
improvement of a disease, disorder, or condition in the animal.
Certain Embodiments
[0116] Certain embodiments provide methods, compounds, and
compositions for modulating a breast cancer condition, or a symptom
thereof, in an animal by administering a therapeutically effective
amount of the compound or composition to the animal, wherein the
compound or composition comprises a MaTAR modulator. Modulation of
a MaTAR can lead to a decrease of the MaTAR level or expression in
order to treat, prevent, ameliorate or delay breast cancer, or a
symptom thereof. In certain embodiments, the MaTAR modulator is a
MaTAR-specific inhibitor. In certain embodiments, MaTAR-specific
inhibitors are nucleic acids (including antisense compounds),
peptides, antibodies, small molecules, and other agents capable of
inhibiting the expression of the MaTAR.
[0117] In certain embodiments disclosed herein, each MaTAR has the
sequences recited in the Tables of the specification disclosed
herein. In certain embodiments disclosed herein, each MaTAR has the
human sequence recited in SEQ ID Nos: 1-111 and SEQ ID Nos:
193-280.
[0118] Certain embodiments disclosed herein provide compounds or
compositions comprising a MaTAR modulator. In certain embodiments,
the MaTAR modulator is a MaTAR-specific inhibitor. In certain
embodiments, the MaTAR-specific inhibitor is a nucleic acid,
polypeptide, antibody, small molecules, or other agent capable of
inhibiting the expression of a MaTAR. In certain embodiments, the
nucleic acid is a compound or composition targeting a MaTAR. In
certain embodiments, the compound or composition is single
stranded. In certain embodiments, the compound or composition is
double stranded. In certain embodiments, the compound or
composition targeting a MaTAR comprises an oligonucleotide. In
certain embodiments, the oligonucleotide is single stranded. In
certain embodiments, the compound comprises deoxyribonucleotides.
In certain embodiments, the compound is double-stranded and
comprises ribonucleotides. In certain embodiments, the
oligonucleotide is a modified oligonucleotide. In certain
embodiments, the modified oligonucleotide is single stranded. In
any of the foregoing embodiments, the compound can be an antisense
compound or oligomeric compound.
[0119] In any of the foregoing embodiments, the compound can
consist of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to
30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17
to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30,
19 to 50, or 20 to 30 linked nucleosides. In certain embodiments,
these compounds are oligonucleotides.
[0120] Certain embodiments disclosed herein provide a compound or
composition comprising a modified oligonucleotide that is 10 to 30
linked nucleosides in length targeted to a MaTAR. The MaTAR target
can have a nucleobase sequence selected from any one of SEQ ID NOs:
1-111 and SEQ ID Nos: 193-280. In certain embodiments, the
nucleobase sequence of the modified oligonucleotide is at least
70%, 75%, 80%, 85%, 90%, 95% or 100% complementary to the
nucleobase sequences recited in any one of SEQ ID NOs: 1-111 and
SEQ ID Nos: 193-280 as measured over the entirety of the modified
oligonucleotide. In certain embodiments, the modified
oligonucleotide comprises a nucleobase sequence comprising a
portion of at least 8, at least 9, at least 10, at least 11, at
least 12, at least 13, at least 14, at least 15, or 16 contiguous
nucleobases complementary to an equal length portion of SEQ ID NO:
1-111 and SEQ ID Nos: 193-280.
[0121] Certain embodiments provide a compound comprising a modified
oligonucleotide 8 to 80 linked nucleosides in length and having a
nucleobase sequence comprising the nucleobase sequence of any one
of SEQ ID NOs: 112-156 and SEQ ID Nos: 169-192. In certain
embodiments, the compound is an antisense compound or oligomeric
compound. In certain embodiments, the compound is single-stranded.
In certain embodiments, the compound is double-stranded. In certain
embodiments, the modified oligonucleotide consists of 12 to 30
linked nucleosides.
[0122] Certain embodiments provide a compound comprising a modified
oligonucleotide consisting of the nucleobase sequence of any one of
SEQ ID NOs: 112-156 and SEQ ID Nos: 169-192. In certain
embodiments, the compound is an antisense compound or oligomeric
compound. In certain embodiments, the compound is single-stranded.
In certain embodiments, the compound is double-stranded.
[0123] In certain embodiments, the modified oligonucleotide
consists of 10 to 50, 10 to 30, 12 to 30, 13 to 24, 14 to 24, 15 to
30, 15 to 24, 15 to 20, 15 to 18, 16 to 30, 16 to 24, 16 to 20, 16
to 18, 18 to 24 or 19 to 22 linked nucleosides. In certain
embodiments, the modified oligonucleotide consists of 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29 or 30 linked nucleosides or a range defined by any two of these
values.
[0124] In certain embodiments, at least one internucleoside linkage
of said modified oligonucleotide is a modified internucleoside
linkage. In certain embodiments, each internucleoside linkage is a
phosphorothioate internucleoside linkage.
[0125] In certain embodiments, any of the foregoing
oligonucleotides comprises at least one modified sugar. In certain
embodiments, at least one modified sugar comprises a
2'-O-methoxyethyl group. In certain embodiments, at least one
modified sugar is a bicyclic sugar, such as a 4'-CH(CH.sub.3)--O-2'
group, a 4'-CH.sub.2--O-2' group, or a 4'-(CH.sub.2).sub.2--O-2'
group.
[0126] In certain embodiments, at least one nucleoside of said
modified oligonucleotide comprises a modified nucleobase. In
certain embodiments, the modified nucleobase is a
5-methylcytosine.
[0127] Certain embodiments disclosed herein provide a compound or
composition comprising a modified oligonucleotide with: a) a gap
segment consisting of linked deoxynucleosides; b) a 5' wing segment
consisting of linked nucleosides; and c) a 3' wing segment
consisting of linked nucleosides. The gap segment is positioned
between the 5' wing segment and the 3' wing segment and each
nucleoside of each wing segment comprises a modified sugar. In
certain embodiments, at least one internucleoside linkage is a
phosphorothioate linkage. In certain embodiments, and at least one
cytosine is a 5-methylcytosine.
[0128] Certain embodiments disclosed herein provide a method of
reducing a MaTAR expression in an animal comprising administering
to the animal a compound or composition comprising a MaTAR-specific
inhibitor. In certain embodiments, the MaTAR-specific inhibitor is
a nucleic acid, peptide, antibody, small molecule or other agent
capable of inhibiting the expression of the MaTAR. In certain
embodiments, the MaTAR-specific inhibitor comprises a compound
described herein. In certain embodiments, the compound comprises an
antisense compound or an oligomeric compound. In certain
embodiments, the compound comprises a modified oligonucleotide. In
certain embodiments, the compound or composition comprises a
modified oligonucleotide 8 to 80 linked nucleosides in length and
having a nucleobase sequence comprising at least an 8, 9, 10, 11,
12, 13, 14, 15, or 16 contiguous nucleobase portion of any one of
SEQ ID NOs: 112-156 and SEQ ID Nos: 169-192. In certain
embodiments, the modified oligonucleotide consists of 10 to 30
linked nucleosides. In certain embodiments disclosed herein, the
MaTAR has the human sequence recited in SEQ ID Nos: 1-111 and SEQ
ID Nos: 193-280.
[0129] In certain embodiments, the compounds or compositions
disclosed herein further comprise a conjugate group. In certain
embodiments, the conjugate group is a carbohydrate group. In
certain embodiments, the conjugate group is a GalNAc group.
[0130] In certain embodiments, the compounds or compositions
disclosed herein comprise a salt of the compound. In certain
embodiments, the compounds or compositions disclosed herein
comprise a salt of the modified oligonucleotide. In certain
embodiments, the salt is a sodium salt. In certain embodiments, the
salt is a potassium salt.
[0131] In certain embodiments, the compounds or compositions
disclosed herein further comprise a pharmaceutically acceptable
carrier or diluent.
[0132] Certain embodiments disclosed herein provide a method of
treating, preventing, delaying or ameliorating breast cancer in an
animal comprising administering to the animal a compound or
composition comprising a MaTAR-specific inhibitor. In certain
embodiments, the MaTAR-specific inhibitor is a nucleic acid,
peptide, antibody, small molecule or other agent capable of
inhibiting the expression of the MaTAR. In certain embodiments, the
MaTAR-specific inhibitor comprises a compound described herein. In
certain embodiments, the compound comprises an antisense compound
or an oligomeric compound. In certain embodiments, the compound
comprises a modified oligonucleotide In certain embodiments, the
compound or composition comprises a modified oligonucleotide 8 to
80 linked nucleosides in length and having a nucleobase sequence
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16
contiguous nucleobase portion of any one of SEQ ID NOs: 112-156 and
SEQ ID Nos: 169-192. In certain embodiments disclosed herein, the
MaTAR has the human sequence recited in SEQ ID Nos: 1-111 and SEQ
ID Nos: 193-280. In certain embodiments, the modified
oligonucleotide consists of 10 to 30 linked nucleosides.
[0133] Certain embodiments disclosed herein provide a method of
treating an animal at risk for breast cancer comprising
administering to the animal a compound or composition comprising a
MaTAR-specific inhibitor. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of the MaTAR. In certain embodiments, the MaTAR-specific inhibitor
comprises a compound. In certain embodiments, the compound
comprises an antisense compound or an oligomeric compound. In
certain embodiments, the compound comprises a modified
oligonucleotide. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides. In certain embodiments
disclosed herein, the MaTAR has the human sequence recited in SEQ
ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0134] Certain embodiments disclosed herein provide a method of
reducing tumor progression in an animal with breast cancer
comprising administering to the animal a compound or composition
comprising a MaTAR-specific inhibitor. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of the MaTAR. In certain embodiments, the MaTAR-specific inhibitor
comprises a compound described herein. In certain embodiments, the
MaTAR-specific inhibitor comprises an antisense compound or an
oligomeric compound. In certain embodiments, the compound comprises
a modified oligonucleotide. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides. In certain embodiments
disclosed herein, the MaTAR has the human sequence recited in SEQ
ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0135] Certain embodiments disclosed herein provide a method of
reducing metastasis in an animal with breast cancer comprising
administering to the animal a compound or composition comprising a
MaTAR-specific inhibitor. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of the MaTAR. In certain embodiments, the MaTAR-specific inhibitor
comprises a compound described herein. In certain embodiments, the
MaTAR-specific inhibitor comprises an antisense compound or an
oligomeric compound. In certain embodiments, the compound comprises
a modified oligonucleotide. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides. In certain embodiments
disclosed herein, the MaTAR has the human sequence recited in SEQ
ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0136] Certain embodiments disclosed herein provide a method of
reducing cell proliferation in an animal with breast cancer
comprising administering to the animal a compound or composition
comprising a MaTAR-specific inhibitor. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of a MaTAR In certain embodiments, the MaTAR-specific inhibitor
comprises a compound described herein. In certain embodiments, the
MaTAR-specific inhibitor comprises an antisense compound or an
oligomeric compound. In certain embodiments, the compound comprises
a modified oligonucleotide. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides. In certain embodiments
disclosed herein, the MaTAR has the human sequence recited in SEQ
ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0137] Certain embodiments disclosed herein provide a method of
reducing tumor cell invasion in an animal with breast cancer
comprising administering to the animal a compound or composition
comprising a MaTAR-specific inhibitor. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of a MaTAR. In certain embodiments, the MaTAR-specific inhibitor
comprises a compound described herein. In certain embodiments, the
MaTAR-specific inhibitor comprises an antisense compound or an
oligomeric compound. In certain embodiments, the compound comprises
a modified oligonucleotide. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides. In certain embodiments
disclosed herein, the MaTAR has the human sequence recited in SEQ
ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0138] Certain embodiments disclosed herein provide a method of
reducing collective cell migration in an animal with breast cancer
comprising administering to the animal a compound or composition
comprising a MaTAR-specific inhibitor. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of the MaTAR. In certain embodiments, the MaTAR-specific inhibitor
comprises a compound described herein. In certain embodiments, the
MaTAR-specific inhibitor comprises an antisense compound or an
oligomeric compound. In certain embodiments, the compound comprises
a modified oligonucleotide. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides. In certain embodiments
disclosed herein, the MaTAR has the human sequence recited in SEQ
ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0139] Certain embodiments disclosed herein provide a method of
ameliorating breast cancer in an animal comprising administering to
the animal a therapeutically effective amount of a compound or
composition comprising a MaTAR-specific inhibitor. In certain
embodiments, the breast cancer is luminal B breast cancer. In
certain embodiments, the breast cancer is HER2/neu-amplified breast
cancer. In certain embodiments, the MaTAR-specific inhibitor is a
nucleic acid, peptide, antibody, small molecule or other agent
capable of inhibiting the expression of the MaTAR. In certain
embodiments, the MaTAR-specific inhibitor comprises a compound
described herein. In certain embodiments, the MaTAR-specific
inhibitor comprises an antisense compound or an oligomeric
compound. In certain embodiments, the compound comprises a modified
oligonucleotide. In certain embodiments, the therapeutically
effective amount of the compound or composition administered to the
animal ameliorates breast cancer in the animal. In certain
embodiments, the compound or composition comprises a modified
oligonucleotide 8 to 80 linked nucleosides in length and having a
nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13,
14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID
NOs: 112-156 and SEQ ID Nos: 169-192. In certain embodiments, the
modified oligonucleotide consists of 10 to 30 linked nucleosides.
In certain embodiments disclosed herein, the MaTAR has the human
sequence recited in SEQ ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0140] Certain embodiments disclosed herein provide a method for
treating an animal at risk for breast cancer comprising
administering to said animal a therapeutically effective amount of
a compound or composition comprising a MaTAR-specific inhibitor. In
certain embodiments, the breast cancer is luminal B breast cancer.
In certain embodiments, the breast cancer is HER2/neu-amplified
breast cancer. In certain embodiments, the MaTAR-specific inhibitor
is a nucleic acid, peptide, antibody, small molecule or other agent
capable of inhibiting the expression of the MaTAR. In certain
embodiments, the MaTAR-specific inhibitor comprises a compound
described herein. In certain embodiments, the MaTAR-specific
inhibitor comprises an antisense compound or an oligomeric
compound. In certain embodiments, the compound comprises a modified
oligonucleotide. In certain embodiments, the therapeutically
effective amount of the compound or composition administered to the
animal reduces the risk of breast cancer in the animal. In certain
embodiments, the compound or composition comprises a modified
oligonucleotide 8 to 80 linked nucleosides in length and having a
nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13,
14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID
NOs: 112-156 and SEQ ID Nos: 169-192. In certain embodiments, the
modified oligonucleotide consists of 10 to 30 linked nucleosides.
In certain embodiments disclosed herein, the MaTAR has the human
sequence recited in SEQ ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0141] Certain embodiments disclosed herein provide a method of
differentiating a primary breast tumor in an animal comprising
administering to the animal a therapeutically effective amount of a
compound comprising a MaTAR-specific inhibitor. In certain
embodiments, differentiation is specific to breast tumor tissue and
not in normal mammary gland tissue. In certain embodiments, the
MaTAR is expressed in breast tumors and not in normal mammary gland
tissue. In certain embodiments, the breast tumor is luminal B
breast cancer. In certain embodiments, the breast tumor is
HER2/neu-amplified breast cancer. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of the MaTAR. In certain embodiments, the MaTAR-specific inhibitor
comprises a compound described herein. In certain embodiments, the
MaTAR-specific inhibitor comprises an antisense compound or an
oligomeric compound. In certain embodiments, the compound comprises
a modified oligonucleotide. In certain embodiments, the
therapeutically effective amount of the compound or composition
administered to the animal results in differentiation of the
primary breast tumor in the animal. In certain embodiments, the
compound or composition comprises a modified oligonucleotide 8 to
80 linked nucleosides in length and having a nucleobase sequence
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16
contiguous nucleobase portion of any one of SEQ ID NOs: 112-156 and
SEQ ID Nos: 169-192. In certain embodiments, the modified
oligonucleotide consists of 10 to 30 linked nucleosides. In certain
embodiments disclosed herein, the MaTAR has the human sequence
recited in SEQ ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0142] Certain embodiments disclosed herein provide a method of
modulating the gene expression pattern of a breast tumor in an
animal comprising administering to the animal a therapeutically
effective amount of a compound comprising a MaTAR-specific
inhibitor to the animal. In certain embodiments, gene expression
modulation is specific to breast tumor tissue and not in normal
mammary gland tissue. In certain embodiments, the MaTAR is
expressed in breast tumors and not in normal mammary gland tissue.
In certain embodiments, the breast tumor is luminal B breast
cancer. In certain embodiments, the breast tumor is
HER2/neu-amplified breast cancer. In certain embodiments, the
MaTAR-specific inhibitor is a nucleic acid, peptide, antibody,
small molecule or other agent capable of inhibiting the expression
of the MaTAR. In certain embodiments, the MaTAR-specific inhibitor
comprises a compound described herein. In certain embodiments, the
MaTAR-specific inhibitor comprises an antisense compound or an
oligomeric compound. In certain embodiments, the compound comprises
a modified oligonucleotide. In certain embodiments, the
therapeutically effective amount of the compound or composition
administered to the animal results in modulation of the gene
expression of the primary breast tumor in the animal. In certain
embodiments, the compound or composition comprises a modified
oligonucleotide 8 to 80 linked nucleosides in length and having a
nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13,
14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID
NOs: 112-156 and SEQ ID Nos: 169-192. In certain embodiments, the
modified oligonucleotide consists of 10 to 30 linked nucleosides.
In certain embodiments disclosed herein, the MaTAR has the human
sequence recited in SEQ ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0143] In certain embodiments, the breast tumor or cancer is
luminal B or HER2/neu-amplified subtypes of human breast
cancer.
[0144] In certain embodiments, administering the compound or
composition disclosed herein reduces the levels of tumor
progression, metastasis, cell proliferation, tumor cell invasion,
or collective cell migration, or a combination thereof. In certain
embodiments, tumor cell invasion was independently reduced by at
least 5%, at least 10%, at least 20%, at least 30%, at least 35%,
at least 40%, at least 45% or at least 50%. In certain embodiments,
tumor organoid branching was independently reduced by at least 5%,
at least 10%, at least 20%, at least 30%, at least 35%, at least
40%, at least 45% or at least 50%. In certain embodiments, tumor
cell viability was reduced by at least 5%, at least 10%, at least
20%, at least 30%, at least 35%, at least 40%, at least 45% or at
least 50%.
[0145] Certain embodiments provide uses of the compounds and
compositions described herein for inhibiting a MaTAR expression. In
certain embodiments, the compounds or compositions inhibit a MaTAR
by at least 5%, at least 10%, at least 20%, at least 30%, at least
35%, at least 40%, at least 45%, at least 50%, at least 55%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, or at least 90%.
[0146] Certain embodiments provide uses of the compounds and
compositions described herein for use in therapy. In certain
embodiments, the therapy is used in treating, preventing, delaying
the onset or slowing progression of a disease related to elevated
expression of a MaTAR. In certain embodiments, the disease is
breast cancer. In certain embodiments, the breast cancer is luminal
B breast cancer. In certain embodiments, the breast cancer is
HER2/neu-amplified breast cancer. In certain embodiments, the
compound or composition comprises a modified oligonucleotide 8 to
80 linked nucleosides in length and having a nucleobase sequence
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16
contiguous nucleobase portion of any one of SEQ ID NOs: 112-156 and
SEQ ID Nos: 169-192. In certain embodiments, the modified
oligonucleotide consists of 10 to 30 linked nucleosides. In certain
embodiments disclosed herein, the MaTAR has the human sequence
recited in SEQ ID Nos: 1-111 and SEQ ID Nos: 193-280.
[0147] In certain embodiments, the animal is a human.
[0148] In certain embodiments, administration comprises parenteral
administration. In certain embodiments, parenteral administration
comprises subcutaneous administration. In certain embodiments,
parenteral administration comprises intravenous administration.
[0149] In certain embodiments, the compounds or compositions
disclosed herein are designated as a first agent and the methods or
uses disclosed herein further comprise administering a second
agent. In certain embodiments, the first agent and the second agent
are co-administered. In certain embodiments the first agent and the
second agent are co-administered sequentially or concomitantly.
[0150] In certain embodiments, use of a compound or composition
disclosed herein results in tumor cell invasion independently
reduced by at least 5%, at least 10%, at least 20%, at least 30%,
at least 35%, at least 40%, at least 45% or at least 50%. In
certain embodiments, use of a compound or composition disclosed
herein results in tumor organoid branching independently reduced by
at least 5%, at least 10%, at least 20%, at least 30%, at least
35%, at least 40%, at least 45% or at least 50%. In certain
embodiments, use of a compound or composition disclosed herein
results in tumor cell viability reduced by at least 5%, at least
10%, at least 20%, at least 30%, at least 35%, at least 40%, at
least 45% or at least 50%.
[0151] Certain embodiments provide the use of a compound or
composition as described herein in the manufacture of a medicament
for treating, ameliorating, delaying or preventing one or more
diseases, disorders, conditions, symptoms or physiological markers
associated with a MaTAR. In certain embodiments, the compound or
composition as described herein is used in the manufacture of a
medicament for treating, ameliorating, delaying or preventing
breast cancer, or a symptom or physiological marker thereof. In
certain embodiments, the breast cancer is luminal B breast cancer.
In certain embodiments, the breast cancer is HER2/neu-amplified
breast cancer. In certain embodiments, the compound or composition
comprises a modified oligonucleotide 8 to 80 linked nucleosides in
length and having a nucleobase sequence comprising at least an 8,
9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of
any one of SEQ ID NOs: 112-156 and SEQ ID Nos: 169-192. In certain
embodiments, the modified oligonucleotide consists of 10 to 30
linked nucleosides. In certain embodiments disclosed herein, the
MaTAR has the human sequence recited in SEQ ID Nos: 1-111 and SEQ
ID Nos: 193-280.
Certain Indications
[0152] Certain embodiments provided herein relate to methods of
inhibiting a MaTAR expression, which can be useful for treating,
preventing, or ameliorating a disease associated with a MaTAR in an
individual, by administration of a compound that targets a MaTAR.
In certain embodiments, such a compound is a MaTAR-specific
inhibitor. In certain embodiments, the compound is an antisense
compound or an oligomeric compound targeted to a MaTAR. In certain
embodiments, the compound comprises a modified oligonucleotide
targeted to a MaTAR.
[0153] In certain embodiments disclosed herein, MaTARs have the
human and murine coordinates and sequences as set forth in the
Tables in this specification and also as recited in SEQ ID Nos:
1-111 and SEQ ID Nos: 193-280.
[0154] Examples of diseases associated with a MaTAR treatable,
preventable, and/or ameliorable with the methods provided herein
include breast cancer. In certain embodiments, the breast cancer is
luminal B breast cancer. In certain embodiments, the breast cancer
is HER2/neu-amplified breast cancer.
[0155] In certain embodiments, a method of treating, preventing, or
ameliorating a disease associated with a breast cancer in an
individual comprises administering to the individual a specific
inhibitor of a MaTAR, thereby treating, preventing, or ameliorating
the disease. In certain embodiments, the MaTAR-specific inhibitor
is a compound targeted to a MaTAR, such as an oligonucleotide
targeted to a MaTAR. In certain embodiments, the MaTAR-specific
inhibitor is a compound comprising a modified oligonucleotide
consisting of 8 to 80 linked nucleosides and having a nucleobase
sequence complementary to any of the nucleobase sequences of SEQ ID
NOs: 1-111 and SEQ ID Nos: 193-280. In any of the foregoing
embodiments, the compound can be single-stranded. In any of the
foregoing embodiments, the compound can be an antisense compound or
oligomeric compound. In certain embodiments, the compound is
administered to the individual parenterally. In certain
embodiments, administering the compound improves, preserves, or
prevents breast cancer. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides.
[0156] In certain embodiments, a method of treating, preventing, or
ameliorating tumor progression, metastasis, cell proliferation,
tumor cell invasion, or collective migration comprises
administering to the individual a MaTAR-specific inhibitor, thereby
treating, preventing, or ameliorating tumor progression,
metastasis, cell proliferation, tumor cell invasion, or collective
migration. In certain embodiments, the MaTAR-specific inhibitor is
a compound targeted to a MaTAR, such as an oligonucleotide targeted
to a MaTAR. In certain embodiments, the MaTAR-specific inhibitor is
a compound comprising a modified oligonucleotide consisting of 8 to
80 linked nucleosides and having a nucleobase sequence
complementary to any of the nucleobase sequences of SEQ ID NOs:
1-111 and SEQ ID Nos: 193-280. In any of the foregoing embodiments,
the compound can be single-stranded. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound. In certain embodiments, the compound is
administered to the individual parenterally. In certain
embodiments, administering the compound improves, preserves, or
prevents tumor progression, metastasis, cell proliferation, tumor
cell invasion, or collective migration. In certain embodiments, the
individual is identified as having or at risk of having a disease
associated with a MaTAR. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides.
[0157] In certain embodiments, a method of inhibiting expression of
a MaTAR in an individual having, or at risk of having, a disease
associated with breast cancer comprises administering a
MaTAR-specific inhibitor to the individual, thereby inhibiting
expression of a MaTAR in the individual. In certain embodiments,
the individual has, or is at risk of having breast cancer. In
certain embodiments, the breast cancer is luminal B breast cancer.
In certain embodiments, the breast cancer is HER2/neu-amplified
breast cancer. In certain embodiments, the MaTAR-specific inhibitor
is a compound targeted to a MaTAR, such as an oligonucleotide
targeted to a MaTAR. In certain embodiments, the MaTAR-specific
inhibitor is a compound comprising a modified oligonucleotide
consisting of 8 to 80 linked nucleosides and having a nucleobase
sequence complementary to any of the nucleobase sequences of SEQ ID
NOs: 1-111 and SEQ ID Nos: 193-280. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound. In any of the foregoing embodiments, the
compound can be single-stranded or double-stranded. In certain
embodiments, the compound or composition comprises a modified
oligonucleotide 8 to 80 linked nucleosides in length and having a
nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13,
14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID
NOs: 112-156 and SEQ ID Nos: 169-192. In certain embodiments, the
modified oligonucleotide consists of 10 to 30 linked
nucleosides.
[0158] In certain embodiments, a method of inhibiting expression of
a MaTAR in a cell comprises contacting the cell with a
MaTAR-specific inhibitor, thereby inhibiting expression of a MaTAR
in the cell. In certain embodiments, the cell is in an individual
who has, or is at risk of having breast cancer. In certain
embodiments, the breast cancer is luminal B breast cancer. In
certain embodiments, the breast cancer is HER2/neu-amplified breast
cancer. In certain embodiments, the MaTAR-specific inhibitor is a
compound targeted to a MaTAR, such as an oligonucleotide targeted
to a MaTAR. In certain embodiments, the MaTAR-specific inhibitor is
a compound comprising a modified oligonucleotide consisting of 8 to
80 linked nucleosides and having a nucleobase sequence
complementary to any of the nucleobase sequences of SEQ ID NOs:
1-111 and SEQ ID Nos: 193-280. In any of the foregoing embodiments,
the compound can be an antisense compound or oligomeric compound.
In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In certain embodiments, the
compound or composition comprises a modified oligonucleotide 8 to
80 linked nucleosides in length and having a nucleobase sequence
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16
contiguous nucleobase portion of any one of SEQ ID NOs: 112-156 and
SEQ ID Nos: 169-192. In certain embodiments, the modified
oligonucleotide consists of 10 to 30 linked nucleosides.
[0159] In certain embodiments, a method of reducing or inhibiting
tumor progression, metastasis, cell proliferation, tumor cell
invasion, or collective migration in an individual having, or at
risk of having, a disease associated with breast cancer comprises
administering a MaTAR-specific inhibitor to the individual, thereby
reducing or inhibiting tumor progression, metastasis, cell
proliferation, tumor cell invasion, or collective migration in the
individual. In certain embodiments, the individual has, or is at
risk of having, breast cancer. In certain embodiments, the breast
cancer is luminal B breast cancer. In certain embodiments, the
breast cancer is HER2/neu-amplified breast cancer. In certain
embodiments, the MaTAR-specific inhibitor is a compound targeted to
a MaTAR, such as an oligonucleotide targeted to a MaTAR. In certain
embodiments, the MaTAR-specific inhibitor is a compound comprising
a modified oligonucleotide consisting of 8 to 80 linked nucleosides
and having a nucleobase sequence complementary to any of the
nucleobase sequences of SEQ ID NOs: 1-111 and SEQ ID Nos: 193-280.
In any of the foregoing embodiments, the compound can be an
antisense compound or oligomeric compound. In any of the foregoing
embodiments, the compound can be single-stranded or
double-stranded. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides.
[0160] Certain embodiments are drawn to a MaTAR-specific inhibitor
for use in treating a disease associated with breast cancer. In
certain embodiments, the breast cancer is luminal B breast cancer.
In certain embodiments, the breast cancer is HER2/neu-amplified
breast cancer. In certain embodiments, the MaTAR-specific inhibitor
is a compound targeted to a MaTAR, such as an oligonucleotide
targeted to a MaTAR. In certain embodiments, the MaTAR-specific
inhibitor is a compound comprising a modified oligonucleotide
consisting of 8 to 80 linked nucleosides and having a nucleobase
sequence complementary to any of the nucleobase sequences of SEQ ID
NOs: 1-111 and SEQ ID Nos: 193-280. In any of the foregoing
embodiments, the compound can be an antisense compound or
oligomeric compound. In any of the foregoing embodiments, the
compound can be single-stranded or double-stranded. In certain
embodiments, the compound or composition comprises a modified
oligonucleotide 8 to 80 linked nucleosides in length and having a
nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13,
14, 15, or 16 contiguous nucleobase portion of any one of SEQ ID
NOs: 112-156 and SEQ ID Nos: 169-192. In certain embodiments, the
modified oligonucleotide consists of 10 to 30 linked
nucleosides.
[0161] Certain embodiments are drawn to a MaTAR-specific inhibitor
for use in reducing or inhibiting tumor progression, metastasis,
cell proliferation, tumor cell invasion, or collective migration in
an individual having or at risk of having breast cancer. In certain
embodiments, the breast cancer is luminal B breast cancer. In
certain embodiments, the breast cancer is HER2/neu-amplified breast
cancer. In certain embodiments, the MaTAR-specific inhibitor is a
compound targeted to a MaTAR, such as an oligonucleotide targeted
to a MaTAR. In certain embodiments, the MaTAR-specific inhibitor is
a compound comprising a modified oligonucleotide consisting of 8 to
80 linked nucleosides and having a nucleobase sequence
complementary to any of the nucleobase sequences of SEQ ID NOs:
1-111 and SEQ ID Nos: 193-280. In any of the foregoing embodiments,
the compound can be an antisense compound or oligomeric compound.
In any of the foregoing embodiments, the compound can be
single-stranded or double-stranded. In certain embodiments, the
compound or composition comprises a modified oligonucleotide 8 to
80 linked nucleosides in length and having a nucleobase sequence
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16
contiguous nucleobase portion of any one of SEQ ID NOs: 112-156 and
SEQ ID Nos: 169-192. In certain embodiments, the modified
oligonucleotide consists of 10 to 30 linked nucleosides.
[0162] Certain embodiments are drawn to use of a MaTAR-specific
inhibitor for the manufacture of a medicament for treating a
disease associated with breast cancer. Certain embodiments are
drawn to use of a MaTAR-specific inhibitor for the preparation of a
medicament for treating breast cancer. In certain embodiments, the
breast cancer is luminal B breast cancer. In certain embodiments,
the breast cancer is HER2/neu-amplified breast cancer. In certain
embodiments, the MaTAR-specific inhibitor is a compound targeted to
a MaTAR, such as an oligonucleotide targeted to a MaTAR. In certain
embodiments, the MaTAR-specific inhibitor is a compound comprising
a modified oligonucleotide consisting of 8 to 80 linked nucleosides
and having a nucleobase sequence complementary to any of the
nucleobase sequences of SEQ ID NOs: 1-111 and SEQ ID Nos: 193-280.
In any of the foregoing embodiments, the compound can be an
antisense compound or oligomeric compound. In any of the foregoing
embodiments, the compound can be single-stranded or
double-stranded. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides.
[0163] Certain embodiments are drawn to use of a MaTAR-specific
inhibitor for the manufacture of a medicament for reducing or
inhibiting tumor progression, metastasis, cell proliferation, tumor
cell invasion, or collective migration in an individual having or
at risk of having breast cancer. In certain embodiments, the breast
cancer is luminal B breast cancer. In certain embodiments, the
breast cancer is HER2/neu-amplified breast cancer. In certain
embodiments, the MaTAR-specific inhibitor is a compound targeted to
a MaTAR, such as an oligonucleotide targeted to a MaTAR. In certain
embodiments, the MaTAR-specific inhibitor is a compound comprising
a modified oligonucleotide consisting of 8 to 80 linked nucleosides
and having a nucleobase sequence complementary to any of the
nucleobase sequences of SEQ ID NOs: 1-111 and SEQ ID Nos: 193-280.
In any of the foregoing embodiments, the compound can be an
antisense compound or oligomeric compound. In any of the foregoing
embodiments, the compound can be single-stranded or
double-stranded. In certain embodiments, the compound or
composition comprises a modified oligonucleotide 8 to 80 linked
nucleosides in length and having a nucleobase sequence comprising
at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous
nucleobase portion of any one of SEQ ID NOs: 112-156 and SEQ ID
Nos: 169-192. In certain embodiments, the modified oligonucleotide
consists of 10 to 30 linked nucleosides.
[0164] In any of the foregoing methods or uses, the compound can be
an antisense compound targeted to a MaTAR. In certain embodiments,
the compound comprises an oligonucleotide, for example an
oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30
linked nucleosides, 12 to 30 linked nucleosides, or 20 linked
nucleosides. In certain embodiments, the oligonucleotide is at
least 80%, 85%, 90%, 95% or 100% complementary to any of the
nucleobase sequences recited in SEQ ID NOs: 1-111 and SEQ ID Nos:
193-280. In certain embodiments, the oligonucleotide comprises at
least one modified internucleoside linkage, at least one modified
sugar and/or at least one modified nucleobase. In certain
embodiments, the modified internucleoside linkage is a
phosphorothioate internucleoside linkage, the modified sugar is a
bicyclic sugar or a 2'-O-methoxyethyl, and the modified nucleobase
is a 5-methylcytosine. In certain embodiments, the modified
oligonucleotide comprises a gap segment consisting of linked
deoxynucleosides; a 5' wing segment consisting of linked
nucleosides; and a 3' wing segment consisting of linked
nucleosides, wherein the gap segment is positioned immediately
adjacent to and between the 5' wing segment and the 3' wing segment
and wherein each nucleoside of each wing segment comprises a
modified sugar. In certain embodiments, the compound or composition
comprises a modified oligonucleotide 8 to 80 linked nucleosides in
length and having a nucleobase sequence comprising at least an 8,
9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of
any one of SEQ ID NOs: 112-156 and SEQ ID Nos: 169-192. In certain
embodiments, the modified oligonucleotide consists of 10 to 30
linked nucleosides.
[0165] In any of the foregoing embodiments, the oligonucleotide
consists of 12 to 30, 15 to 30, 15 to 25, 15 to 24, 16 to 24, 17 to
24, 18 to 24, 19 to 24, 20 to 24, 19 to 22, 20 to 22, 16 to 20, or
17 or 20 linked nucleosides. In certain aspects, the
oligonucleotide is at least 80%, 85%, 90%, 95% or 100%
complementary to any of the nucleobase sequences recited in SEQ ID
NOs: 1-111 and SEQ ID Nos: 193-280. In certain aspects, the
oligonucleotide comprises at least one modified internucleoside
linkage, at least one modified sugar and/or at least one modified
nucleobase. In certain aspects, the modified internucleoside
linkage is a phosphorothioate internucleoside linkage, the modified
sugar is a bicyclic sugar or a 2'-O-methoxyethyl, and the modified
nucleobase is a 5-methylcytosine. In certain aspects, the modified
oligonucleotide comprises a gap segment consisting of linked
2'-deoxynucleosides; a 5' wing segment consisting of linked
nucleosides; and a 3' wing segment consisting of linked
nucleosides, wherein the gap segment is positioned immediately
adjacent to and between the 5' wing segment and the 3' wing segment
and wherein each nucleoside of each wing segment comprises a
modified sugar. In certain embodiments, the compound or composition
comprises a modified oligonucleotide 8 to 80 linked nucleosides in
length and having a nucleobase sequence comprising at least an 8,
9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of
any one of SEQ ID NOs: 112-156 and SEQ ID Nos: 169-192. In certain
embodiments, the modified oligonucleotide consists of 10 to 30
linked nucleosides.
[0166] In any of the foregoing methods or uses, the compound
comprises or consists of a modified oligonucleotide 12 to 30 linked
nucleosides in length and having a nucleobase sequence
complementary to any one of SEQ ID NOs: 1-111 and SEQ ID Nos:
193-280, wherein the modified oligonucleotide comprises: [0167] a
gap segment consisting of linked 2'-deoxynucleosides; [0168] a 5'
wing segment consisting of linked nucleosides; and [0169] a 3' wing
segment consisting of linked nucleosides;
[0170] wherein the gap segment is positioned between the 5' wing
segment and the 3' wing segment and wherein each nucleoside of each
wing segment comprises a modified sugar. In certain embodiments,
the compound or composition comprises a modified oligonucleotide 8
to 80 linked nucleosides in length and having a nucleobase sequence
comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16
contiguous nucleobase portion of any one of SEQ ID NOs: 112-156 and
SEQ ID Nos: 169-192. In certain embodiments, the modified
oligonucleotide consists of 10 to 30 linked nucleosides.
[0171] In any of the foregoing methods or uses, the compound can be
administered parenterally. For example, in certain embodiments the
compound can be administered through injection or infusion.
Parenteral administration includes subcutaneous administration,
intravenous administration, intramuscular administration,
intraarterial administration, intraperitoneal administration, or
intracranial administration.
Certain Compounds
[0172] In certain embodiments, compounds described herein are
antisense compounds. In certain embodiments, the antisense compound
comprises or consists of an oligomeric compound. In certain
embodiments, the oligomeric compound comprises a modified
oligonucleotide. In certain embodiments, the modified
oligonucleotide has a nucleobase sequence complementary to that of
a target nucleic acid.
[0173] In certain embodiments, a compound described herein
comprises or consists of a modified oligonucleotide. In certain
embodiments, the modified oligonucleotide has a nucleobase sequence
complementary to that of a target nucleic acid.
[0174] In certain embodiments, a compound or antisense compound is
single-stranded. Such a single-stranded compound or antisense
compound comprises or consists of an oligomeric compound. In
certain embodiments, such an oligomeric compound comprises or
consists of an oligonucleotide and optionally a conjugate group. In
certain embodiments, the oligonucleotide is an antisense
oligonucleotide. In certain embodiments, the oligonucleotide is
modified. In certain embodiments, the oligonucleotide of a
single-stranded antisense compound or oligomeric compound comprises
a self-complementary nucleobase sequence.
[0175] In certain embodiments, compounds are double-stranded. Such
double-stranded compounds comprise a first modified oligonucleotide
having a region complementary to a target nucleic acid and a second
modified oligonucleotide having a region complementary to the first
modified oligonucleotide. In certain embodiments, the modified
oligonucleotide is an RNA oligonucleotide. In such embodiments, the
thymine nucleobase in the modified oligonucleotide is replaced by a
uracil nucleobase. In certain embodiments, compound comprises a
conjugate group. In certain embodiments, one of the modified
oligonucleotides is conjugated. In certain embodiments, both the
modified oligonucleotides are conjugated. In certain embodiments,
the first modified oligonucleotide is conjugated. In certain
embodiments, the second modified oligonucleotide is conjugated. In
certain embodiments, each modified oligonucleotide is 12-30 linked
nucleosides in length.
[0176] In certain embodiments, compounds are double-stranded. Such
double-stranded compounds comprise a first oligomeric compound
having a region complementary to a target nucleic acid and a second
oligomeric compound having a region complementary to the first
oligomeric compound. The first oligomeric compound of such double
stranded compounds typically comprises or consists of a modified
oligonucleotide and optionally a conjugate group. The
oligonucleotide of the second oligomeric compound of such
double-stranded compound may be modified or unmodified. Either or
both oligomeric compounds of a double-stranded compound may
comprise a conjugate group. The oligomeric compounds of
double-stranded compounds may include non-complementary overhanging
nucleosides.
[0177] Examples of single-stranded and double-stranded compounds
include but are not limited to oligonucleotides, siRNAs, microRNA
targeting oligonucleotides, and single-stranded RNAi compounds,
such as small hairpin RNAs (shRNAs), single-stranded siRNAs
(ssRNAs), and microRNA mimics.
[0178] In certain embodiments, a compound described herein has a
nucleobase sequence that, when written in the 5' to 3' direction,
comprises the reverse complement of the target segment of a target
nucleic acid to which it is targeted.
[0179] In certain embodiments, a compound described herein
comprises an oligonucleotide 10 to 30 linked subunits in length. In
certain embodiments, compound described herein comprises an
oligonucleotide is 12 to 30 linked subunits in length. In certain
embodiments, compound described herein comprises an oligonucleotide
is 12 to 22 linked subunits in length. In certain embodiments,
compound described herein comprises an oligonucleotide is 14 to 30
linked subunits in length. In certain embodiments, compound
described herein comprises an oligonucleotide is 14 to 20 linked
subunits in length. In certain embodiments, compound described
herein comprises an oligonucleotide is 15 to 30 linked subunits in
length. In certain embodiments, compound described herein comprises
an oligonucleotide is 15 to 20 linked subunits in length. In
certain embodiments, compound described herein comprises an
oligonucleotide is 16 to 30 linked subunits in length. In certain
embodiments, compound described herein comprises an oligonucleotide
is 16 to 20 linked subunits in length. In certain embodiments,
compound described herein comprises an oligonucleotide is 17 to 30
linked subunits in length. In certain embodiments, compound
described herein comprises an oligonucleotide is 17 to 20 linked
subunits in length. In certain embodiments, compound described
herein comprises an oligonucleotide is 18 to 30 linked subunits in
length. In certain embodiments, compound described herein comprises
an oligonucleotide is 18 to 21 linked subunits in length. In
certain embodiments, compound described herein comprises an
oligonucleotide is 18 to 20 linked subunits in length. In certain
embodiments, compound described herein comprises an oligonucleotide
is 20 to 30 linked subunits in length. In other words, such
oligonucleotides are from 12 to 30 linked subunits, 14 to 30 linked
subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits,
16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20
subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits,
20 to 30 subunits, or 12 to 22 linked subunits, respectively. In
certain embodiments, a compound described herein comprises an
oligonucleotide 14 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 16 linked subunits in length. In certain
embodiments, a compound described herein comprises an
oligonucleotide 17 linked subunits in length. In certain
embodiments, compound described herein comprises an oligonucleotide
18 linked subunits in length. In certain embodiments, a compound
described herein comprises an oligonucleotide 19 linked subunits in
length. In certain embodiments, a compound described herein
comprises an oligonucleotide 20 linked subunits in length. In other
embodiments, a compound described herein comprises an
oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14
to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50,
18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to
50, or 20 to 30 linked subunits. In certain such embodiments, the
compound described herein comprises an oligonucleotide 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, or 80 linked subunits in length, or a range defined by any two
of the above values. In some embodiments the linked subunits are
nucleotides, nucleosides, or nucleobases.
[0180] In certain embodiments, the compound may further comprise
additional features or elements, such as a conjugate group, that
are attached to the oligonucleotide. In certain embodiments, such
compounds are antisense compounds. In certain embodiments, such
compounds are oligomeric compounds. In embodiments where a
conjugate group comprises a nucleoside (i.e. a nucleoside that
links the conjugate group to the oligonucleotide), the nucleoside
of the conjugate group is not counted in the length of the
oligonucleotide.
[0181] In certain embodiments, compounds may be shortened or
truncated. For example, a single subunit may be deleted from the 5'
end (5' truncation), or alternatively from the 3' end (3'
truncation). A shortened or truncated compound targeted to a MaTAR
nucleic acid may have two subunits deleted from the 5' end, or
alternatively may have two subunits deleted from the 3' end, of the
compound. Alternatively, the deleted nucleosides may be dispersed
throughout the compound.
[0182] When a single additional subunit is present in a lengthened
compound, the additional subunit may be located at the 5' or 3' end
of the compound. When two or more additional subunits are present,
the added subunits may be adjacent to each other, for example, in a
compound having two subunits added to the 5' end (5' addition), or
alternatively to the 3' end (3' addition), of the compound.
Alternatively, the added subunits may be dispersed throughout the
compound.
[0183] It is possible to increase or decrease the length of a
compound, such as an oligonucleotide, and/or introduce mismatch
bases without eliminating activity (Woolf et al. (Proc. Natl. Acad.
Sci. USA 89:7305-7309, 1992; Gautschi et al. J. Natl. Cancer Inst.
93:463-471, March 2001; Maher and Dolnick Nuc. Acid. Res.
16:3341-3358,1988). However, seemingly small changes in
oligonucleotide sequence, chemistry and motif can make large
differences in one or more of the many properties required for
clinical development (Seth et al. J. Med. Chem. 2009, 52, 10; Egli
et al. J. Am. Chem. Soc. 2011, 133, 16642).
[0184] In certain embodiments, compounds described herein are
interfering RNA compounds (RNAi), which include double-stranded RNA
compounds (also referred to as short-interfering RNA or siRNA) and
single-stranded RNAi compounds (or ssRNA). Such compounds work at
least in part through the RISC pathway to degrade and/or sequester
a target nucleic acid (thus, include microRNA/microRNA-mimic
compounds). As used herein, the term siRNA is meant to be
equivalent to other terms used to describe nucleic acid molecules
that are capable of mediating sequence specific RNAi, for example
short interfering RNA (siRNA), double-stranded RNA (dsRNA),
micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering
oligonucleotide, short interfering nucleic acid, short interfering
modified oligonucleotide, chemically modified siRNA,
post-transcriptional gene silencing RNA (ptgsRNA), and others. In
addition, as used herein, the term RNAi is meant to be equivalent
to other terms used to describe sequence specific RNA interference,
such as post transcriptional gene silencing, translational
inhibition, or epigenetics.
[0185] In certain embodiments, a double-stranded compound described
herein can comprise any of the oligonucleotide sequences targeted
to a MaTAR described herein. In certain embodiments, a
double-stranded compound comprises a first strand comprising
sequence complementary to any one of SEQ ID NOs: 1-111 and SEQ ID
Nos: 193-280 and a second strand.
[0186] In certain embodiments, a double-stranded compound comprises
a first strand comprising the nucleobase sequence complementary to
any one of SEQ ID NOs: 1-111 and SEQ ID Nos: 193-280 and a second
strand. In certain embodiments, the double-stranded compound
comprises ribonucleotides in which the first strand has uracil (U)
in place of thymine (T) and is complementary to any one of SEQ ID
NOs: 1-111 and SEQ ID Nos: 193-280. In certain embodiments, a
double-stranded compound comprises (i) a first strand comprising a
nucleobase sequence complementary to the site on a MaTAR of any of
SEQ ID NOs: 1-111 and SEQ ID Nos: 193-280, and (ii) a second
strand. In certain embodiments, the double-stranded compound
comprises one or more modified nucleotides in which the 2' position
in the sugar contains a halogen (such as fluorine group; 2'-F) or
contains an alkoxy group (such as a methoxy group; 2'-OMe). In
certain embodiments, the double-stranded compound comprises at
least one 2'-F sugar modification and at least one 2'-OMe sugar
modification. In certain embodiments, the at least one 2'-F sugar
modification and at least one 2'-OMe sugar modification are
arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous
nucleobases along a strand of the dsRNA compound. In certain
embodiments, the double-stranded compound comprises one or more
linkages between adjacent nucleotides other than a
naturally-occurring phosphodiester linkage. Examples of such
linkages include phosphoramide, phosphorothioate, and
phosphorodithioate linkages. The double-stranded compounds may also
be chemically modified nucleic acid molecules as taught in U.S.
Pat. No. 6,673,661. In other embodiments, the dsRNA contains one or
two capped strands, as disclosed, for example, by WO 00/63364,
filed Apr. 19, 2000. In certain embodiments, the first strand of
the double-stranded compound is an siRNA guide strand and the
second strand of the double-stranded compound is an siRNA passenger
strand. In certain embodiments, the second strand of the
double-stranded compound is complementary to the first strand. In
certain embodiments, each strand of the double-stranded compound
consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides.
In certain embodiments, the first or second strand of the
double-stranded compound can comprise a conjugate group.
[0187] In certain embodiments, a single-stranded compound described
herein can comprise any of the oligonucleotide sequences targeted
to a MaTAR described herein. In certain embodiments, such a
single-stranded compound is a single-stranded RNAi (ssRNAi)
compound. In certain embodiments, a ssRNAi compound comprises at
least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
contiguous nucleobase portion complementary to any one of SEQ ID
NOs: 1-111 and SEQ ID Nos: 193-280. In certain embodiments, a
ssRNAi compound comprises the nucleobase sequence complementary to
any one of SEQ ID NOs: 1-111 and SEQ ID Nos: 193-280. In certain
embodiments, the ssRNAi compound comprises ribonucleotides in which
uracil (U) is in place of thymine (T). In certain embodiments,
ssRNAi compound comprises a nucleobase sequence complementary to
the site on a MaTAR with any of the sequences of SEQ ID NOs: 1-111
and SEQ ID Nos: 193-280. In certain embodiments, a ssRNAi compound
comprises one or more modified nucleotides in which the 2' position
in the sugar contains a halogen (such as fluorine group; 2'-F) or
contains an alkoxy group (such as a methoxy group; 2'-OMe). In
certain embodiments, a ssRNAi compound comprises at least one 2'-F
sugar modification and at least one 2'-OMe sugar modification. In
certain embodiments, the at least one 2'-F sugar modification and
at least one 2'-OMe sugar modification are arranged in an
alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along
a strand of the ssRNAi compound. In certain embodiments, the ssRNAi
compound comprises one or more linkages between adjacent
nucleotides other than a naturally-occurring phosphodiester
linkage. Examples of such linkages include phosphoramide,
phosphorothioate, and phosphorodithioate linkages. The ssRNAi
compounds may also be chemically modified nucleic acid molecules as
taught in U.S. Pat. No. 6,673,661. In other embodiments, the ssRNAi
contains a capped strand, as disclosed, for example, by WO
00/63364, filed Apr. 19, 2000. In certain embodiments, the ssRNAi
compound consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked
nucleosides. In certain embodiments, the ssRNAi compound can
comprise a conjugate group.
[0188] In certain embodiments, compounds described herein comprise
modified oligonucleotides. Certain modified oligonucleotides have
one or more asymmetric center and thus give rise to enantiomers,
diastereomers, and other stereoisomeric configurations that may be
defined, in terms of absolute stereochemistry, as (R) or (S), as a
or 13 such as for sugar anomers, or as (D) or (L) such as for amino
acids etc. Included in the modified oligonucleotides provided
herein are all such possible isomers, including their racemic and
optically pure forms, unless specified otherwise. Likewise, all
cis- and trans-isomers and tautomeric forms are also included.
Certain Mechanisms
[0189] In certain embodiments, compounds described herein comprise
or consist of modified oligonucleotides. In certain embodiments,
compounds described herein are antisense compounds. In certain
embodiments, such antisense compounds comprise oligomeric
compounds. In certain embodiments, compounds described herein are
capable of hybridizing to a target nucleic acid, resulting in at
least one antisense activity. In certain embodiments, compounds
described herein selectively affect one or more target nucleic
acid. Such selective compounds comprise a nucleobase sequence that
hybridizes to one or more target nucleic acid, resulting in one or
more desired antisense activity and does not hybridize to one or
more non-target nucleic acid or does not hybridize to one or more
non-target nucleic acid in such a way that results in a significant
undesired antisense activity.
[0190] In certain antisense activities, hybridization of a compound
described herein to a target nucleic acid results in recruitment of
a protein that cleaves the target nucleic acid. For example,
certain compounds described herein result in RNase H mediated
cleavage of the target nucleic acid. RNase H is a cellular
endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The
DNA in such an RNA:DNA duplex need not be unmodified DNA. In
certain embodiments, compounds described herein are sufficiently
"DNA-like" to elicit RNase H activity. Further, in certain
embodiments, one or more non-DNA-like nucleoside in the gap of a
gapmer is tolerated.
[0191] In certain antisense activities, compounds described herein
or a portion of the compound is loaded into an RNA-induced
silencing complex (RISC), ultimately resulting in cleavage of the
target nucleic acid. For example, certain compounds described
herein result in cleavage of the target nucleic acid by Argonaute.
Compounds that are loaded into RISC are RNAi compounds. RNAi
compounds may be double-stranded (siRNA) or single-stranded
(ssRNA).
[0192] In certain embodiments, hybridization of compounds described
herein to a target nucleic acid does not result in recruitment of a
protein that cleaves that target nucleic acid. In certain such
embodiments, hybridization of the compound to the target nucleic
acid results in alteration of splicing of the target nucleic acid.
In certain embodiments, hybridization of the compound to a target
nucleic acid results in inhibition of a binding interaction between
the target nucleic acid and a protein or other nucleic acid. In
certain such embodiments, hybridization of the compound to a target
nucleic acid results in alteration of translation of the target
nucleic acid.
[0193] Antisense activities may be observed directly or indirectly.
In certain embodiments, observation or detection of an antisense
activity involves observation or detection of a change in an amount
of a target nucleic acid or protein encoded by such target nucleic
acid, a change in the ratio of splice variants of a nucleic acid or
protein, and/or a phenotypic change in a cell or animal.
Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0194] In certain embodiments, compounds described herein comprise
or consist of an oligonucleotide comprising a region that is
complementary to a target nucleic acid. In certain embodiments, the
target nucleic acid is an endogenous RNA molecule. In certain such
embodiments, the target nucleic acid is selected from: an mRNA and
a pre-mRNA, including intronic, exonic and untranslated regions. In
certain embodiments, the target nucleic acid is a pre-mRNA. In
certain such embodiments, the target region is entirely within an
intron. In certain embodiments, the target region spans an
intron/exon junction. In certain embodiments, the target region is
at least 50% within an intron. In certain embodiments, the target
region is an lncRNA.
[0195] Human gene sequences that encode a MaTAR include, without
limitation, the following gene sequences, as listed in the Tables
below:
TABLE-US-00001 TABLE 1 Bioinformatically identified human gene
sequences for MaTARs identified in murine models of human breast
cancer MaTAR # Human gene sequence SEQ ID NO 1 The complement of
NC_000005.10 truncated from 1 nucleotides 88540779 to 88684803 2
The complement of NC_000016.10 truncated from 2 nucleotides
66932055 to 66934423 3 The complement of NC_000004.12 truncated
from 3 nucleotides 90121784 to 90121954 4 NC_000007.14 truncated
from nucleotides 27096094 to 4 27100258 5 NC_000021.9 truncated
from nucleotides 18857779 to 5 18858276 6 NC_000006.12 truncated
from nucleotides 30766825 to 6 30792250 The complement of
NC_000006.12 truncated from 7 nucleotides 30812866-30830659 7 The
complement of NC_000001.11 truncated from 8 nucleotides 47432133 to
47434641 8 NC_000018.10 truncated from nucleotides 48955665 to 9
48956059 The complement of NC_0000018.10 truncated from 10
nucleotides 48962951 to 48963941 9 NC_000007.14 truncated from
nucleotides 99374675 to 11 99394781 The complement of NC_0000007.14
truncated from 12 nucleotides 99394676 to 99408682 10 The
complement of NC_0000001.11 truncated from 13 nucleotides 183555563
to 183590876 The complement of NC_0000005.10 truncated from 14
nucleotides 56504635 to 56505072 NC_000005.10 truncated from
nucleotides 56381781 to 15 56382075 The complement of N_0000005.10
truncated from 16 nucleotides 56275304 to 56276630 The complement
of NC_0000005.10 truncated from 17 nucleotides 56504635 to 56505073
11 NC_000009.12 truncated from nucleotides 104927553 to 18
104928892 12 The complement of NC_0000003.12 truncated from 19
nucleotides 141050613 to 141052013 The complement of NC_0000003.12
truncated from 20 nucleotides 141115124 to 141124182 13
NC_000002.12 truncated from nucleotides 230125310 to 21 230167494
14 The complement of NC_0000002.12 truncated from 22 nucleotides
230309741 to 230311581 The complement of NC_0000002.12 truncated
from 23 nucleotides 230401360 to 230401793 15 NC_000023.11
truncated from nucleotides 148052233 to 24 148052746 The complement
of NC_000023.11 truncated from 25 nucleotides 30290047 to 30290351
The complement of NC_0000023.11 truncated from 26 nucleotides
30017160 to 30017881 16 NC_000001.11 truncated from nucleotides
55217861 to 27 55234177 NC_000001.11 truncated from nucleotides
55215408 to 28 55217455 17 NC_000007.14 truncated from nucleotides
101299613 to 29 101301270 NC_000007.14 truncated from nucleotides
101308346 to 30 101310985 The complement of NC_0000007.14 truncated
from 31 nucleotides 101287482 to 101289771 18 NC_000001.11
truncated from nucleotides 51329654 to 32 51331281 19 NC_000007.14
truncated from nucleotides 100509717 to 33 100519926 20
NC_000009.12 truncated from nucleotides 137286112 to 34 137287236
The complement of NC_0000009.12 truncated from 35 nucleotides
137293868 to 137295721 21 NC_000022.11 truncated from nucleotides
31617011 to 36 31617070 22 NC_000008.11 truncated from nucleotides
58503588 to 37 58504068 23 The complement of NC_000005.10 truncated
from 38 nucleotides 70968483 to 71025114 24 NC_000013.11 truncated
from nucleotides 81689911 to 39 81691072 The complement of
NC_000009.12 truncated from 40 nucleotides 36303499 to 36304924 25
The complement of NC_000005.10 truncated from 41 nucleotides
50310711 to 50321342 NC_000020.11 truncated from nucleotides
50292720 to 42 50314922 NC_000020.11 truncated from nucleotides
50267486 to 43 50279795 26 NC_000006.12 truncated from nucleotides
144216543 to 44 144216627 The complement of NC_000006.12 truncated
from 45 nucleotides 144200447 to 144200965 27 The complement of NC
? 46 nucleotides 144257034 to 144257624 The complement of NC ? 47
nucleotides 5527155 to 5529569 NC_000023.11 truncated from
nucleotides 53001527 to 48 53001617 NC_000001.11 truncated from
nucleotides 55222379 to 49 55223372 28 NC_000001.11 truncated from
nucleotides 55217861 to 50 55234178 NC_000001.11 truncated from
nucleotides 55215408 to 51 55217456 29 The complement of
NC_000011.10 truncated from 52 nucleotides 59781318 to 59781722 The
complement of NC_0000018.10 truncated from 53 nucleotides 50256036
to 50256461 30 The complement of NC_000015.10 truncated from 54
nucleotides 74976240 to 74976573 The complement of NC_000015.10
truncated from 55 nucleotides 74983274 to 74983376 The complement
of NC_000015.10 truncated from 56 nucleotides 59781318 to
59781723
[0196] The human equivalent gene sequences that were found to be
upregulated in mammary carcinoma tissue (as exemplified in the
Examples below) are further provided in the Table below:
TABLE-US-00002 TABLE 2 Human equivalent gene sequences of lncRNAs
Gene name Gene sequence SEQ ID NO predicted gene, NC_000005.10
truncated from nucleotides 57 OTTMUSG00000005723 154993598 to
154994445 ENSMUST00000180755 NC_000012.12 truncated from
nucleotides 58 6533927 to 6538371 ENSMUST00000180755 The complement
of NC_000004.12 truncated from 59 nucleotides 77350370 to 77351235
ENSMUST00000180755 The complement of NC_000004.12 truncated from 60
nucleotides 77311397 to 77312111 ENSMUST00000180755 The complement
of NC_000004.12 truncated from 62 nucleotides 77216416 to 77216878
ENSMUST00000187117 NC_000006.12 truncated from nucleotides 61
69745871 to 69746851 ENSMUST00000187117 The complement of
NC_000006.12 truncated from 63 nucleotides 69705287 to 69706160
ENSMUST00000187117 The complement of NC_000006.12 truncated from 64
nucleotides 70098390 to 70098676 ENSMUST00000181833 NC_000004.12
truncated from nucleotides 65 128768228 to 128769948
ENSMUST00000181833 The complement of NC_000004.12 truncated from 66
nucleotides 128582999 to 128601400 ENSMUST00000186885 NC_000002.12
truncated from nucleotides 67 125710969 to 125765842
ENSMUST00000186885 The complement of NC_000002.12 truncated from 68
nucleotides 126110099 to 126117985 ENSMUST00000187677 NC_000002.12
truncated from nucleotides 69 192629919 to 192645706
ENSMUST00000187677 The complement of NC_000002.12 truncated from 70
nucleotides 192644102 to 192645387 ENSMUST00000187677 NC_000002.12
truncated from nucleotides 71 192749845 to 192776899
ENSMUST00000189594 The complement of NC_000001.11 truncated from 72
nucleotides 224175476 to 224175706 ENSMUST00000189594 The
complement of NC_000001.11 truncated from 73 nucleotides 224208747
to 224213279 ENSMUST00000189594 NC_000001.11 truncated from
nucleotides 74 224219613 to 224228043 ENSMUST00000191042
NC_000005.10 truncated from nucleotides 75 102144077 to 102146572
ENSMUST00000192612 NC_000003.12 truncated from nucleotides 76
143111802 to 143112359 ENSMUST00000195727 The complement of
NC_000008.11 truncated from 77 nucleotides 81275399 to 81277570
ENSMUST00000195727 The complement of NC_000008.11 truncated from 78
nucleotides 81279871to 81281446 ENSMUST00000195727 NC_000008.11
truncated from nucleotides 79 81154279 to 81159083
ENSMUST00000197386 The complement of NC_000004.12 truncated from 80
nucleotides 106003317 to 106022478 ENSMUST00000199279 NC_000012.12
truncated from nucleotides 81 121190868 to 121191518
ENSMUST00000199279 NC_000012.12 truncated from nucleotides 82
121391962 to 121399859 ENSMUST00000200473 NC_000004.12 truncated
from nucleotides 83 16178939 to 16183120 ENSMUST00000200473
NC_000004.12 truncated from nucleotides 84 16400430 to 16512187
ENSMUST00000123623 NC_000011.10 truncated from nucleotides 85
30584130 to 30630508 ENSMUST00000139492 The complement of
NC_000002.12 truncated from 86 nucleotides 188035596 to 188287691
ENSMUST00000143673 The complement of NC_000017.11 truncated from 87
nucleotides 35540039 to 35540797 ENSMUST00000155384 The complement
of NC_000017.11 truncated from 88 nucleotides 77879027 to 77884087
ENSMUST00000181029 The complement of NC_000006.12 truncated from 89
nucleotides 35733867 to 35736947 ENSMUST00000185425 NC_000002.12
truncated from nucleotides 90 234682668 to 234717764
ENSMUST00000185425 The complement of NC_000002.12 truncated from 91
nucleotides 234882279 to 234888802 ENSMUST00000191737 NC_000001.11
truncated from nucleotides 92 111250254 to 111256715
ENSMUST00000191737 The complement of NC_000001.11 truncated from 93
nucleotides 111184415 to 111185061 ENSMUST00000196337 NC_000004.12
truncated from nucleotides 94 128428070 to 128519394
ENSMUST00000196668 The complement of NC_000001.11 truncated from 95
nucleotides 87353524 to 87371655 ENSMUST00000196668 The complement
of NC_000001.11 truncated from 96 nucleotides 87899909 to 87905714
ENSMUST00000196668 The complement of NC_000001.11 truncated from 97
nucleotides 87805286 to 87808372 ENSMUST00000198677 The complement
of NC_000004.12 truncated from 98 nucleotides 16360686 to 16361826
ENSMUST00000198677 NC_000004.12 truncated from nucleotides 99
16400430 to 16512188 ENSMUST00000200327 NC_000004.12 truncated from
nucleotides 101 104490965 to 104697592 ENSMUST00000200327
NC_000004.12 truncated from nucleotides 100 104973712 to 105120000
ENSMUST00000200327 The complement of NC_000004.12 truncated from
102 nucleotides 104653874 to 104966793 ENSMUST00000188231
NC_000006.12 truncated from nucleotides 103 69745871 to 69746852
ENSMUST00000188231 The complement of NC_000006.12 truncated from
104 nucleotides 69705287 to 69706161 ENSMUST00000188231 The
complement of NC_000006.12 truncated from 105 nucleotides 70098390
to 70098677 ENSMUST00000187714 NC_000006.12 truncated from
nucleotides 106 69745870 to 69746851 ENSMUST00000187714 The
complement of NC_000006.12 truncated from 107 nucleotides 69705286
to 69706160 ENSMUST00000187714 The complement of NC_000006.12
truncated from 108 nucleotides 70098389 to 70098676
ENSMUST00000146576 The complement of NC_000009.12 truncated from
109 nucleotides 36303499 to 36304925 ENSMUST00000195679
NC_000001.11 truncated from nucleotides 110 55215407 to 55217455
ENSMUST00000195679 NC_000001.11 truncated from nucleotides 111
55217860 to 55234177
Hybridization
[0197] In some embodiments, hybridization occurs between a compound
disclosed herein and a MaTAR nucleic acid. The most common
mechanism of hybridization involves hydrogen bonding (e.g.,
Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding)
between complementary nucleobases of the nucleic acid
molecules.
[0198] Hybridization can occur under varying conditions.
Hybridization conditions are sequence-dependent and are determined
by the nature and composition of the nucleic acid molecules to be
hybridized.
[0199] Methods of determining whether a sequence is specifically
hybridizable to a target nucleic acid are well known in the art. In
certain embodiments, the compounds provided herein are specifically
hybridizable with a MaTAR nucleic acid.
Complementarity
[0200] An oligonucleotide is said to be complementary to another
nucleic acid when the nucleobase sequence of such oligonucleotide
or one or more regions thereof matches the nucleobase sequence of
another oligonucleotide or nucleic acid or one or more regions
thereof when the two nucleobase sequences are aligned in opposing
directions. Nucleobase matches or complementary nucleobases, as
described herein, are limited to adenine (A) and thymine (T),
adenine (A) and uracil (U), cytosine (C) and guanine (G), and
5-methyl cytosine (mC) and guanine (G) unless otherwise specified.
Complementary oligonucleotides and/or nucleic acids need not have
nucleobase complementarity at each nucleoside and may include one
or more nucleobase mismatches. An oligonucleotide is fully
complementary or 100% complementary when such oligonucleotides have
nucleobase matches at each nucleoside without any nucleobase
mismatches.
[0201] In certain embodiments, compounds described herein comprise
or consist of modified oligonucleotides. In certain embodiments,
compounds described herein are antisense compounds. In certain
embodiments, compounds comprise oligomeric compounds.
Non-complementary nucleobases between a compound and a MaTAR
nucleic acid may be tolerated provided that the compound remains
able to specifically hybridize to a target nucleic acid. Moreover,
a compound may hybridize over one or more segments of a MaTAR
nucleic acid such that intervening or adjacent segments are not
involved in the hybridization event (e.g., a loop structure,
mismatch or hairpin structure).
[0202] In certain embodiments, the compounds provided herein, or a
specified portion thereof, are, or are at least, 70%, 80%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99%, or 100% complementary to a MaTAR nucleic acid, a target
region, target segment, or specified portion thereof. Percent
complementarity of a compound with a target nucleic acid can be
determined using routine methods.
[0203] For example, a compound in which 18 of 20 nucleobases of the
compound are complementary to a target region, and would therefore
specifically hybridize, would represent 90 percent complementarity.
In this example, the remaining non-complementary nucleobases may be
clustered or interspersed with complementary nucleobases and need
not be contiguous to each other or to complementary nucleobases. As
such, a compound which is 18 nucleobases in length having four
non-complementary nucleobases which are flanked by two regions of
complete complementarity with the target nucleic acid would have
77.8% overall complementarity with the target nucleic acid and
would thus fall within the scope of the present invention. Percent
complementarity of a compound with a region of a target nucleic
acid can be determined routinely using BLAST programs (basic local
alignment search tools) and PowerBLAST programs known in the art
(Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and
Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence
identity or complementarity, can be determined by, for example, the
Gap program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, Madison
Wis.), using default settings, which uses the algorithm of Smith
and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
[0204] In certain embodiments, compounds described herein, or
specified portions thereof, are fully complementary (i.e. 100%
complementary) to a target nucleic acid, or specified portion
thereof. For example, a compound may be fully complementary to a
MaTAR nucleic acid, or a target region, or a target segment or
target sequence thereof. As used herein, "fully complementary"
means each nucleobase of a compound is capable of precise base
pairing with the corresponding nucleobases of a target nucleic
acid. For example, a 20 nucleobase compound is fully complementary
to a target sequence that is 400 nucleobases long, so long as there
is a corresponding 20 nucleobase portion of the target nucleic acid
that is fully complementary to the compound. Fully complementary
can also be used in reference to a specified portion of the first
and/or the second nucleic acid. For example, a 20 nucleobase
portion of a 30 nucleobase compound can be "fully complementary" to
a target sequence that is 400 nucleobases long. The 20 nucleobase
portion of the 30 nucleobase compound is fully complementary to the
target sequence if the target sequence has a corresponding 20
nucleobase portion wherein each nucleobase is complementary to the
20 nucleobase portion of the compound. At the same time, the entire
30 nucleobase compound may or may not be fully complementary to the
target sequence, depending on whether the remaining 10 nucleobases
of the compound are also complementary to the target sequence.
[0205] In certain embodiments, compounds described herein comprise
one or more mismatched nucleobases relative to the target nucleic
acid. In certain such embodiments, antisense activity against the
target is reduced by such mismatch, but activity against a
non-target is reduced by a greater amount. Thus, in certain such
embodiments selectivity of the compound is improved. In certain
embodiments, the mismatch is specifically positioned within an
oligonucleotide having a gapmer motif. In certain such embodiments,
the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the
5'-end of the gap region. In certain such embodiments, the mismatch
is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3'-end of the gap
region. In certain such embodiments, the mismatch is at position 1,
2, 3, or 4 from the 5'-end of the wing region. In certain such
embodiments, the mismatch is at position 4, 3, 2, or 1 from the
3'-end of the wing region. In certain embodiments, the mismatch is
specifically positioned within an oligonucleotide not having a
gapmer motif. In certain such embodiments, the mismatch is at
position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5'-end
of the oligonucleotide. In certain such embodiments, the mismatch
is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the
3'-end of the oligonucleotide.
[0206] The location of a non-complementary nucleobase may be at the
5' end or 3' end of the compound. Alternatively, the
non-complementary nucleobase or nucleobases may be at an internal
position of the compound. When two or more non-complementary
nucleobases are present, they may be contiguous (i.e. linked) or
non-contiguous. In one embodiment, a non-complementary nucleobase
is located in the wing segment of a gapmer oligonucleotide.
[0207] In certain embodiments, compounds described herein that are,
or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases
in length comprise no more than 4, no more than 3, no more than 2,
or no more than 1 non-complementary nucleobase(s) relative to a
target nucleic acid, such as a MaTAR nucleic acid, or specified
portion thereof.
[0208] In certain embodiments, compounds described herein that are,
or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no
more than 6, no more than 5, no more than 4, no more than 3, no
more than 2, or no more than 1 non-complementary nucleobase(s)
relative to a target nucleic acid, such as a MaTAR nucleic acid, or
specified portion thereof.
[0209] In certain embodiments, compounds described herein also
include those which are complementary to a portion of a target
nucleic acid. As used herein, "portion" refers to a defined number
of contiguous (i.e. linked) nucleobases within a region or segment
of a target nucleic acid. A "portion" can also refer to a defined
number of contiguous nucleobases of a compound. In certain
embodiments, the compounds, are complementary to at least an 8
nucleobase portion of a target segment. In certain embodiments, the
compounds are complementary to at least a 9 nucleobase portion of a
target segment. In certain embodiments, the compounds are
complementary to at least a 10 nucleobase portion of a target
segment. In certain embodiments, the compounds are complementary to
at least an 11 nucleobase portion of a target segment. In certain
embodiments, the compounds are complementary to at least a 12
nucleobase portion of a target segment. In certain embodiments, the
compounds are complementary to at least a 13 nucleobase portion of
a target segment. In certain embodiments, the compounds are
complementary to at least a 14 nucleobase portion of a target
segment. In certain embodiments, the compounds are complementary to
at least a 15 nucleobase portion of a target segment. In certain
embodiments, the compounds are complementary to at least a 16
nucleobase portion of a target segment. Also contemplated are
compounds that are complementary to at least a 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target
segment, or a range defined by any two of these values.
Identity
[0210] The compounds provided herein may also have a defined
percent identity to a particular nucleotide sequence, SEQ ID NO, or
compound represented by a specific Isis number, or portion thereof.
In certain embodiments, compounds described herein are antisense
compounds or oligomeric compounds. In certain embodiments,
compounds described herein are modified oligonucleotides. As used
herein, a compound is identical to the sequence disclosed herein if
it has the same nucleobase pairing ability. For example, a RNA
which contains uracil in place of thymidine in a disclosed DNA
sequence would be considered identical to the DNA sequence since
both uracil and thymidine pair with adenine. Shortened and
lengthened versions of the compounds described herein as well as
compounds having non-identical bases relative to the compounds
provided herein also are contemplated. The non-identical bases may
be adjacent to each other or dispersed throughout the compound.
Percent identity of an compound is calculated according to the
number of bases that have identical base pairing relative to the
sequence to which it is being compared.
[0211] In certain embodiments, compounds described herein, or
portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to
one or more of the compounds or SEQ ID NOs, or a portion thereof,
disclosed herein. In certain embodiments, compounds described
herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,
96%, 97%, 98%, or 99% identical, or any percentage between such
values, to a particular nucleotide sequence, SEQ ID NO, or compound
represented by a specific Isis number, or portion thereof, in which
the compounds comprise an oligonucleotide having one or more
mismatched nucleobases. In certain such embodiments, the mismatch
is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the
5'-end of the oligonucleotide. In certain such embodiments, the
mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from
the 3'-end of the oligonucleotide.
[0212] In certain embodiments, compounds described herein are
antisense compounds. In certain embodiments, a portion of the
compound is compared to an equal length portion of the target
nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is
compared to an equal length portion of the target nucleic acid.
[0213] In certain embodiments, compounds described herein are
oligonucleotides. In certain embodiments, a portion of the
oligonucleotide is compared to an equal length portion of the
target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase
portion is compared to an equal length portion of the target
nucleic acid.
Certain Modified Compounds
[0214] In certain embodiments, compounds described herein comprise
or consist of oligonucleotides consisting of linked nucleosides.
Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or
may be modified oligonucleotides. Modified oligonucleotides
comprise at least one modification relative to unmodified RNA or
DNA (i.e., comprise at least one modified nucleoside (comprising a
modified sugar moiety and/or a modified nucleobase) and/or at least
one modified internucleoside linkage).
[0215] A. Modified Nucleosides
[0216] Modified nucleosides comprise a modified sugar moiety or a
modified nucleobase or both a modified sugar moiety and a modified
nucleobase.
[0217] 1. Modified Sugar Moieties
[0218] In certain embodiments, sugar moieties are non-bicyclic
modified sugar moieties. In certain embodiments, modified sugar
moieties are bicyclic or tricyclic sugar moieties. In certain
embodiments, modified sugar moieties are sugar surrogates. Such
sugar surrogates may comprise one or more substitutions
corresponding to those of other types of modified sugar
moieties.
[0219] In certain embodiments, modified sugar moieties are
non-bicyclic modified sugar moieties comprising a furanosyl ring
with one or more acyclic substituent, including but not limited to
substituents at the 2', 4', and/or 5' positions. In certain
embodiments one or more acyclic substituent of non-bicyclic
modified sugar moieties is branched. Examples of 2'-substituent
groups suitable for non-bicyclic modified sugar moieties include
but are not limited to: 2'-F, 2'-OCH.sub.3 ("OMe" or "O-methyl"),
and 2'-O(CH.sub.2).sub.2OCH.sub.3 ("MOE"). In certain embodiments,
2'-substituent groups are selected from among: halo, allyl, amino,
azido, SH, CN, OCN, CF.sub.3, OCF.sub.3, O--C.sub.1-C.sub.10
alkoxy, O--C.sub.1-C.sub.10 substituted alkoxy, O--C.sub.1-C.sub.10
alkyl, O--C.sub.1-C.sub.10 substituted alkyl, S-alkyl,
N(R.sub.m)-alkyl, O-alkenyl, S-alkenyl, N(R.sub.m)-alkenyl,
O-alkynyl, S-alkynyl, N(R.sub.m)-alkynyl, O-alkylenyl-O-alkyl,
alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n)
or OCH.sub.2C(.dbd.O)--N(R.sub.m)(R.sub.n), where each R.sub.m and
R.sub.n is, independently, H, an amino protecting group, or
substituted or unsubstituted C.sub.1-C.sub.10 alkyl, and the
2'-substituent groups described in Cook et al., U.S. Pat. No.
6,531,584; Cook et al., U.S. Pat. No. 5,859,221; and Cook et al.,
U.S. Pat. No. 6,005,087. Certain embodiments of these
2'-substituent groups can be further substituted with one or more
substituent groups independently selected from among: hydroxyl,
amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO.sub.2), thiol,
thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
Examples of 4'-substituent groups suitable for linearly
non-bicyclic modified sugar moieties include but are not limited to
alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et
al., WO 2015/106128. Examples of 5'-substituent groups suitable for
non-bicyclic modified sugar moieties include but are not limited
to: 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain
embodiments, non-bicyclic modified sugars comprise more than one
non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar
moieties and the modified sugar moieties and modified nucleosides
described in Migawa et al., WO 2008/101157 and Rajeev et al.,
US2013/0203836.
[0220] In certain embodiments, a 2'-substituted nucleoside or
2'-non-bicyclic modified nucleoside comprises a sugar moiety
comprising a linear 2'-substituent group selected from: F,
NH.sub.2, N.sub.3, OCF.sub.3, OCH.sub.3, O(CH.sub.2).sub.3NH.sub.2,
CH.sub.2CH.dbd.CH.sub.2, OCH.sub.2CH.dbd.CH.sub.2,
OCH.sub.2CH.sub.2OCH.sub.3, O(CH.sub.2).sub.2SCH.sub.3,
O(CH.sub.2).sub.2ON(R.sub.m)(R.sub.n),
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
N-substituted acetamide (OCH.sub.2C(.dbd.O)--N(R.sub.m)(R.sub.n)),
where each R.sub.m and R.sub.n is, independently, H, an amino
protecting group, or substituted or unsubstituted C.sub.1-C.sub.10
alkyl.
[0221] In certain embodiments, a 2'-substituted nucleoside or
2'-non-bicyclic modified nucleoside comprises a sugar moiety
comprising a linear 2'-substituent group selected from: F,
OCF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.2OCH.sub.3,
O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2ON(CH.sub.3).sub.2,
O(CH.sub.2).sub.2O(CH.sub.2).sub.2N(CH.sub.3).sub.2, and
OCH.sub.2C(.dbd.O)--N(H)CH.sub.3 ("NMA").
[0222] In certain embodiments, a 2'-substituted nucleoside or
2'-non-bicyclic modified nucleoside comprises a sugar moiety
comprising a linear 2'-substituent group selected from: F,
OCH.sub.3, and OCH.sub.2CH.sub.2OCH.sub.3.
[0223] Nucleosides comprising modified sugar moieties, such as
non-bicyclic modified sugar moieties, are referred to by the
position(s) of the substitution(s) on the sugar moiety of the
nucleoside. For example, nucleosides comprising 2'-substituted or
2-modified sugar moieties are referred to as 2'-substituted
nucleosides or 2-modified nucleosides.
[0224] Certain modified sugar moieties comprise a bridging sugar
substituent that forms a second ring resulting in a bicyclic sugar
moiety. In certain such embodiments, the bicyclic sugar moiety
comprises a bridge between the 4' and the 2' furanose ring atoms.
Examples of such 4' to 2' bridging sugar substituents include but
are not limited to: 4'-CH.sub.2-2', 4'-(CH.sub.2).sub.2-2',
4'-(CH.sub.2).sub.3-2', 4'-CH.sub.2--O-2' ("LNA"),
4'-CH.sub.2--S-2', 4'-(CH.sub.2).sub.2--O-2' ("ENA"),
4'-CH(CH.sub.3)--O-2' (referred to as "constrained ethyl" or "cEt"
when in the S configuration), 4'-CH.sub.2--O--CH.sub.2-2',
4'-CH.sub.2--N(R)-2', 4'-CH(CH.sub.2OCH.sub.3)--O-2' ("constrained
MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., U.S.
Pat. No. 7,399,845, Bhat et al., U.S. Pat. No. 7,569,686, Swayze et
al., U.S. Pat. No. 7,741,457, and Swayze et al., U.S. Pat. No.
8,022,193), 4'-C(CH.sub.3)(CH.sub.3)--O-2' and analogs thereof
(see, e.g., Seth et al., U.S. Pat. No. 8,278,283),
4'-CH.sub.2--N(OCH.sub.3)-2' and analogs thereof (see, e.g.,
Prakash et al., U.S. Pat. No. 8,278,425),
4'-CH.sub.2--O--N(CH.sub.3)-2' (see, e.g., Allerson et al., U.S.
Pat. No. 7,696,345 and Allerson et al., U.S. Pat. No. 8,124,745),
4'-CH.sub.2--C(H)(CH.sub.3)-2' (see, e.g., Zhou, et al., J. Org.
Chem., 2009, 74, 118-134), 4'-CH.sub.2--C(.dbd.CH.sub.2)-2' and
analogs thereof (see e.g., Seth et al., U.S. Pat. No. 8,278,426),
4'-C(R.sub.aR.sub.b)--N(R)--O-2', 4'-C(R.sub.aR.sub.b)--O--N(R)-2',
4'-CH.sub.2--O--N(R)-2', and 4'-CH.sub.2--N(R)--O-2', wherein each
R, R.sub.a, and R.sub.b is, independently, H, a protecting group,
or C.sub.1-C.sub.12 alkyl (see, e.g. Imanishi et al., U.S. Pat. No.
7,427,672).
[0225] In certain embodiments, such 4' to 2' bridges independently
comprise from 1 to 4 linked groups independently selected from:
--[C(R.sub.a)(R.sub.b)].sub.n--,
--[C(R.sub.a)(R.sub.b)].sub.n--O--, --C(R.sub.a).dbd.C(R.sub.b)--,
--C(R.sub.a).dbd.N--, --C(.dbd.NR.sub.a)--, --C(.dbd.O)--,
--C(.dbd.S)--, --O--, --Si(R.sub.a).sub.2--, --S(.dbd.O).sub.x--,
and --N(R.sub.a)--; [0226] wherein: [0227] x is 0, 1, or 2; [0228]
n is 1, 2, 3, or 4;
[0229] each R.sub.a and R.sub.b is, independently, H, a protecting
group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted
C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted
C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted
C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted
C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle
radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7
alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical,
halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1,
acyl (C(.dbd.O)--H), substituted acyl, CN, sulfonyl
(S(.dbd.O).sub.2-J.sub.1), or sulfoxyl (S(.dbd.O)-J.sub.1); and
each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12
alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12
alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12
alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20
aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(.dbd.O)--H),
substituted acyl, a heterocycle radical, a substituted heterocycle
radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12
aminoalkyl, or a protecting group.
[0230] Additional bicyclic sugar moieties are known in the art,
see, for example: Freier et al., Nucleic Acids Research, 1997,
25(22), 4429-4443, Albaek et al., J. Org. Chem., 2006, 71,
7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin
et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc.
Natl. Acad. Sci. U S. A., 2000, 97, 5633-5638; Kumar et al.,
Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org.
Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc.,
20017, 129, 8362-8379; Elayadi et al., Curr. Opinion Invens. Drugs,
2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum
et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al.,
U.S. Pat. No. 7,053,207, Imanishi et al., U.S. Pat. No. 6,268,490,
Imanishi et al. U.S. Pat. No. 6,770,748, Imanishi et al., U.S.
RE44,779; Wengel et al., U.S. Pat. No. 6,794,499, Wengel et al.,
U.S. Pat. No. 6,670,461; Wengel et al., U.S. Pat. No. 7,034,133,
Wengel et al., U.S. Pat. No. 8,080,644; Wengel et al., U.S. Pat.
No. 8,034,909; Wengel et al., U.S. Pat. No. 8,153,365; Wengel et
al., U.S. Pat. No. 7,572,582; and Ramasamy et al., U.S. Pat. No.
6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO
91999/014226; Seth et al., WO 2007/134181; Seth et al., U.S. Pat.
No. 7,547,684; Seth et al., U.S. Pat. No. 7,666,854; Seth et al.,
U.S. Pat. No. 8,088,746; Seth et al., U.S. Pat. No. 7,750,131; Seth
et al., U.S. Pat. No. 8,030,467; Seth et al., U.S. Pat. No.
8,268,980; Seth et al., U.S. Pat. No. 8,546,556; Seth et al., U.S.
Pat. No. 8,530,640; Migawa et al., U.S. Pat. No. 9,012,421; Seth et
al., U.S. Pat. No. 8,501,805; and U.S. Patent Publication Nos.
Allerson et al., US2008/0039618 and Migawa et al.,
US2015/0191727.
[0231] In certain embodiments, bicyclic sugar moieties and
nucleosides incorporating such bicyclic sugar moieties are further
defined by isomeric configuration. For example, an LNA nucleoside
(described herein) may be in the .alpha.-L configuration or in the
.beta.-D configuration.
##STR00001##
[0232] .alpha.-L-methyleneoxy (4'-CH.sub.2--O-2') or .alpha.-L-LNA
bicyclic nucleosides have been incorporated into oligonucleotides
that showed antisense activity (Frieden et al., Nucleic Acids
Research, 2003, 21, 6365-6372). Herein, general descriptions of
bicyclic nucleosides include both isomeric configurations. When the
positions of specific bicyclic nucleosides (e.g., LNA or cEt) are
identified in exemplified embodiments herein, they are in the
.beta.-D configuration, unless otherwise specified.
[0233] In certain embodiments, modified sugar moieties comprise one
or more non-bridging sugar substituent and one or more bridging
sugar substituent (e.g., 5'-substituted and 4'-2' bridged
sugars).
[0234] In certain embodiments, modified sugar moieties are sugar
surrogates. In certain such embodiments, the oxygen atom of the
sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen
atom. In certain such embodiments, such modified sugar moieties
also comprise bridging and/or non-bridging substituents as
described herein. For example, certain sugar surrogates comprise a
4'-sulfur atom and a substitution at the 2'-position (see, e.g.,
Bhat et al., U.S. Pat. No. 7,875,733 and Bhat et al., U.S. Pat. No.
7,939,677) and/or the 5' position.
[0235] In certain embodiments, sugar surrogates comprise rings
having other than 5 atoms. For example, in certain embodiments, a
sugar surrogate comprises a six-membered tetrahydropyran ("THP").
Such tetrahydropyrans may be further modified or substituted.
Nucleosides comprising such modified tetrahydropyrans include but
are not limited to hexitol nucleic acid ("HNA"), anitol nucleic
acid ("ANA"), manitol nucleic acid ("MNA") (see e.g., Leumann, C J.
Bioorg. & Med. Chem. 2002, 10, 841-854), fluoro HNA:
##STR00002##
("F-HNA", see e.g., Swayze et al., U.S. Pat. No. 8,088,904; Swayze
et al., U.S. Pat. No. 8,440,803; Swayze et al., U.S.; and Swayze et
al., U.S. Pat. No. 9,005,906, F-HNA can also be referred to as a
F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising
additional modified THP compounds having the formula:
##STR00003##
wherein, independently, for each of said modified THP nucleoside:
Bx is a nucleobase moiety; T.sub.3 and T.sub.4 are each,
independently, an internucleoside linking group linking the
modified THP nucleoside to the remainder of an oligonucleotide or
one of T.sub.3 and T.sub.4 is an internucleoside linking group
linking the modified THP nucleoside to the remainder of an
oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a
hydroxyl protecting group, a linked conjugate group, or a 5' or
3'-terminal group; q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5,
q.sub.6 and q.sub.7 are each, independently, H, C.sub.1-C.sub.6
alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, or
substituted C.sub.2-C.sub.6 alkynyl; and each of R.sub.1 and
R.sub.2 is independently selected from among: hydrogen, halogen,
substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1,
N.sub.3, OC(.dbd.X)J.sub.1, OC(.dbd.X)NJ.sub.1J.sub.2,
NJ.sub.3C(.dbd.X)NJ.sub.1J.sub.2, and CN, wherein X is O, S or
NJ.sub.1, and each J.sub.1, J.sub.2, and J.sub.3 is, independently,
H or C.sub.1-C.sub.6 alkyl.
[0236] In certain embodiments, modified THP nucleosides are
provided wherein q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5,
q.sub.6 and q.sub.7 are each H. In certain embodiments, at least
one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and
q.sub.7 is other than H. In certain embodiments, at least one of
q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 is
methyl. In certain embodiments, modified THP nucleosides are
provided wherein one of R.sub.1 and R.sub.2 is F. In certain
embodiments, R.sub.1 is F and R.sub.2 is H, in certain embodiments,
R.sub.1 is methoxy and R.sub.2 is H, and in certain embodiments,
R.sub.1 is methoxyethoxy and R.sub.2 is H.
[0237] In certain embodiments, sugar surrogates comprise rings
having more than 5 atoms and more than one heteroatom. For example,
nucleosides comprising morpholino sugar moieties and their use in
oligonucleotides have been reported (see, e.g., Braasch et al.,
Biochemistry, 2002, 41, 4503-4510 and Summerton et al., U.S. Pat.
No. 5,698,685; Summerton et al., U.S. Pat. No. 5,166,315; Summerton
et al., U.S. Pat. No. 5,185,444; and Summerton et al., U.S. Pat.
No. 5,034,506). As used here, the term "morpholino" means a sugar
surrogate having the following structure:
##STR00004##
[0238] In certain embodiments, morpholinos may be modified, for
example by adding or altering various substituent groups from the
above morpholino structure. Such sugar surrogates are referred to
herein as "modified morpholinos."
[0239] In certain embodiments, sugar surrogates comprise acyclic
moieties. Examples of nucleosides and oligonucleotides comprising
such acyclic sugar surrogates include but are not limited to:
peptide nucleic acid ("PNA"), acyclic butyl nucleic acid (see,
e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and
nucleosides and oligonucleotides described in Manoharan et al.,
WO2011/133876.
[0240] Many other bicyclic and tricyclic sugar and sugar surrogate
ring systems are known in the art that can be used in modified
nucleosides.
[0241] 2. Modified Nucleobases
[0242] Nucleobase (or base) modifications or substitutions are
structurally distinguishable from, yet functionally interchangeable
with, naturally occurring or synthetic unmodified nucleobases. Both
natural and modified nucleobases are capable of participating in
hydrogen bonding. Such nucleobase modifications can impart nuclease
stability, binding affinity or some other beneficial biological
property to compounds described herein.
[0243] In certain embodiments, compounds described herein comprise
modified oligonucleotides. In certain embodiments, modified
oligonucleotides comprise one or more nucleoside comprising an
unmodified nucleobase. In certain embodiments, modified
oligonucleotides comprise one or more nucleoside comprising a
modified nucleobase. In certain embodiments, modified
oligonucleotides comprise one or more nucleoside that does not
comprise a nucleobase, referred to as an abasic nucleoside.
[0244] In certain embodiments, modified nucleobases are selected
from: 5-substituted pyrimidines, 6-azapyrimi-dines, alkyl or
alkynyl substituted pyrimidines, alkyl substituted purines, and
N-2, N-6 and O-6 substituted purines. In certain embodiments,
modified nucleobases are selected from: 2-aminopropyladenine,
5-hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine,
2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine,
2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine,
5-propynyl (C.dbd.C--CH.sub.3) uracil, 5-propynylcytosine,
6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil
(pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol,
8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines,
5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and
5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine,
2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine,
3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine,
4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl
4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases,
hydrophobic bases, promiscuous bases, size-expanded bases, and
fluorinated bases. Further modified nucleobases include tricyclic
pyrimidines, such as 1,3-diazaphenoxazine-2-one,
1,3-diazaphenothiazine-2-one and
9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified
nucleobases may also include those in which the purine or
pyrimidine base is replaced with other heterocycles, for example
7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
Further nucleobases include those disclosed in Merigan et al., U.S.
Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley
& Sons, 1990, 858-859; Englisch et al., Angewandte Chemie,
International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15,
Antisense Research and Applications, Crooke, S. T. and Lebleu, B.,
Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6
and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press,
2008, 163-166 and 442-443.
[0245] Publications that teach the preparation of certain of the
above noted modified nucleobases as well as other modified
nucleobases include without limitation, Manoharan et al.,
US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S.
Pat. No. 4,845,205; Spielvogel et al., U.S. Pat. No. 5,130,302;
Rogers et al., U.S. Pat. No. 5,134,066; Bischofberger et al., U.S.
Pat. No. 5,175,273; Urdea et al., U.S. Pat. No. 5,367,066; Benner
et al., U.S. Pat. No. 5,432,272; Matteucci et al., U.S. Pat. No.
5,434,257; Gmeiner et al., U.S. Pat. No. 5,457,187; Cook et al.,
U.S. Pat. No. 5,459,255; Froehler et al., U.S. Pat. No. 5,484,908;
Matteucci et al., U.S. Pat. No. 5,502,177; Hawkins et al., U.S.
Pat. No. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et
al., U.S. Pat. No. 5,587,469; Froehler et al., U.S. Pat. No.
5,594,121; Switzer et al., U.S. Pat. No. 5,596,091; Cook et al.,
U.S. Pat. No. 5,614,617; Froehler et al., U.S. Pat. No. 5,645,985;
Cook et al., U.S. Pat. No. 5,681,941; Cook et al., U.S. Pat. No.
5,811,534; Cook et al., U.S. Pat. No. 5,750,692; Cook et al., U.S.
Pat. No. 5,948,903; Cook et al., U.S. Pat. No. 5,587,470; Cook et
al., U.S. Pat. No. 5,457,191; Matteucci et al., U.S. Pat. No.
5,763,588; Froehler et al., U.S. Pat. No. 5,830,653; Cook et al.,
U.S. Pat. No. 5,808,027; Cook et al., 6,166,199; and Matteucci et
al., U.S. Pat. No. 6,005,096.
[0246] In certain embodiments, compounds targeted to a MaTAR
nucleic acid comprise one or more modified nucleobases. In certain
embodiments, the modified nucleobase is 5-methylcytosine. In
certain embodiments, each cytosine is a 5-methylcytosine.
Modified Internucleoside Linkages
[0247] The naturally occurring internucleoside linkage of RNA and
DNA is a 3' to 5' phosphodiester linkage. In certain embodiments,
compounds described herein having one or more modified, i.e.
non-naturally occurring, internucleoside linkages are often
selected over compounds having naturally occurring internucleoside
linkages because of desirable properties such as, for example,
enhanced cellular uptake, enhanced affinity for target nucleic
acids, and increased stability in the presence of nucleases.
[0248] In certain embodiments, compounds targeted to a MaTAR
nucleic acid comprise one or more modified internucleoside
linkages. In certain embodiments, the modified internucleoside
linkages are phosphorothioate linkages. In certain embodiments,
each internucleoside linkage of the compound is a phosphorothioate
internucleoside linkage.
[0249] In certain embodiments, compounds described herein comprise
oligonucleotides. Oligonucleotides having modified internucleoside
linkages include internucleoside linkages that retain a phosphorus
atom as well as internucleoside linkages that do not have a
phosphorus atom. Representative phosphorus containing
internucleoside linkages include, but are not limited to,
phosphodiesters, phosphotriesters, methylphosphonates,
phosphoramidate, and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing linkages are
well known.
[0250] In certain embodiments, nucleosides of modified
oligonucleotides may be linked together using any internucleoside
linkage. The two main classes of internucleoside linking groups are
defined by the presence or absence of a phosphorus atom.
Representative phosphorus-containing internucleoside linkages
include but are not limited to phosphates, which contain a
phosphodiester bond ("P.dbd.O") (also referred to as unmodified or
naturally occurring linkages), phosphotriesters,
methylphosphonates, phosphoramidates, and phosphorothioates
("P.dbd.S"), and phosphorodithioates ("HS--P.dbd.S").
Representative non-phosphorus containing internucleoside linking
groups include but are not limited to methylenemethylimino
(--CH.sub.2--N(CH.sub.3)--O--CH.sub.2--), thiodiester,
thionocarbamate (--O--C(.dbd.O)(NH)--S--); siloxane
(--O--SiH.sub.2--O--); and N,N'-dimethylhydrazine
(--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--). Modified internucleoside
linkages, compared to naturally occurring phosphate linkages, can
be used to alter, typically increase, nuclease resistance of the
oligonucleotide. In certain embodiments, internucleoside linkages
having a chiral atom can be prepared as a racemic mixture, or as
separate enantiomers. Representative chiral internucleoside
linkages include but are not limited to alkylphosphonates and
phosphorothioates. Methods of preparation of phosphorous-containing
and non-phosphorous-containing internucleoside linkages are well
known to those skilled in the art.
[0251] Neutral internucleoside linkages include, without
limitation, phosphotriesters, methylphosphonates, MMI
(3'-CH.sub.2--N(CH.sub.3)--O-5'), amide-3
(3'-CH.sub.2--C(.dbd.O)--N(H)-5'), amide-4
(3'-CH.sub.2--N(H)--C(.dbd.O)-5'), formacetal
(3'-O--CH.sub.2--O-5'), methoxypropyl, and thioformacetal
(3'-S--CH.sub.2--O-5'). Further neutral internucleoside linkages
include nonionic linkages comprising siloxane (dialkylsiloxane),
carboxylate ester, carboxamide, sulfide, sulfonate ester and amides
(See for example: Carbohydrate Modifications in Antisense Research;
Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580;
Chapters 3 and 4, 40-65). Further neutral internucleoside linkages
include nonionic linkages comprising mixed N, O, S and CH2
component parts.
[0252] In certain embodiments, oligonucleotides comprise modified
internucleoside linkages arranged along the oligonucleotide or
region thereof in a defined pattern or modified internucleoside
linkage motif. In certain embodiments, internucleoside linkages are
arranged in a gapped motif. In such embodiments, the
internucleoside linkages in each of two wing regions are different
from the internucleoside linkages in the gap region. In certain
embodiments the internucleoside linkages in the wings are
phosphodiester and the internucleoside linkages in the gap are
phosphorothioate. The nucleoside motif is independently selected,
so such oligonucleotides having a gapped internucleoside linkage
motif may or may not have a gapped nucleoside motif and if it does
have a gapped nucleoside motif, the wing and gap lengths may or may
not be the same.
[0253] In certain embodiments, oligonucleotides comprise a region
having an alternating internucleoside linkage motif. In certain
embodiments, oligonucleotides of the present invention comprise a
region of uniformly modified internucleoside linkages. In certain
such embodiments, the oligonucleotide comprises a region that is
uniformly linked by phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide is uniformly linked by
phosphorothioate. In certain embodiments, each internucleoside
linkage of the oligonucleotide is selected from phosphodiester and
phosphorothioate. In certain embodiments, each internucleoside
linkage of the oligonucleotide is selected from phosphodiester and
phosphorothioate and at least one internucleoside linkage is
phosphorothioate.
[0254] In certain embodiments, the oligonucleotide comprises at
least 6 phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least 8
phosphorothioate internucleoside linkages. In certain embodiments,
the oligonucleotide comprises at least 10 phosphorothioate
internucleoside linkages. In certain embodiments, the
oligonucleotide comprises at least one block of at least 6
consecutive phosphorothioate internucleoside linkages. In certain
embodiments, the oligonucleotide comprises at least one block of at
least 8 consecutive phosphorothioate internucleoside linkages. In
certain embodiments, the oligonucleotide comprises at least one
block of at least 10 consecutive phosphorothioate internucleoside
linkages. In certain embodiments, the oligonucleotide comprises at
least block of at least one 12 consecutive phosphorothioate
internucleoside linkages. In certain such embodiments, at least one
such block is located at the 3' end of the oligonucleotide. In
certain such embodiments, at least one such block is located within
3 nucleosides of the 3' end of the oligonucleotide.
[0255] In certain embodiments, oligonucleotides comprise one or
more methylphosponate linkages. In certain embodiments,
oligonucleotides having a gapmer nucleoside motif comprise a
linkage motif comprising all phosphorothioate linkages except for
one or two methylphosponate linkages. In certain embodiments, one
methylphosponate linkage is in the central gap of an
oligonucleotide having a gapmer nucleoside motif.
[0256] In certain embodiments, it is desirable to arrange the
number of phosphorothioate internucleoside linkages and
phosphodiester internucleoside linkages to maintain nuclease
resistance. In certain embodiments, it is desirable to arrange the
number and position of phosphorothioate internucleoside linkages
and the number and position of phosphodiester internucleoside
linkages to maintain nuclease resistance. In certain embodiments,
the number of phosphorothioate internucleoside linkages may be
decreased and the number of phosphodiester internucleoside linkages
may be increased. In certain embodiments, the number of
phosphorothioate internucleoside linkages may be decreased and the
number of phosphodiester internucleoside linkages may be increased
while still maintaining nuclease resistance. In certain embodiments
it is desirable to decrease the number of phosphorothioate
internucleoside linkages while retaining nuclease resistance. In
certain embodiments it is desirable to increase the number of
phosphodiester internucleoside linkages while retaining nuclease
resistance.
[0257] B. Certain Motifs
[0258] In certain embodiments, compounds described herein comprise
oligonucleotides. Oligonucleotides can have a motif, e.g. a pattern
of unmodified and/or modified sugar moieties, nucleobases, and/or
internucleoside linkages. In certain embodiments, modified
oligonucleotides comprise one or more modified nucleoside
comprising a modified sugar. In certain embodiments, modified
oligonucleotides comprise one or more modified nucleosides
comprising a modified nucleobase. In certain embodiments, modified
oligonucleotides comprise one or more modified internucleoside
linkage. In such embodiments, the modified, unmodified, and
differently modified sugar moieties, nucleobases, and/or
internucleoside linkages of a modified oligonucleotide define a
pattern or motif. In certain embodiments, the patterns of sugar
moieties, nucleobases, and internucleoside linkages are each
independent of one another. Thus, a modified oligonucleotide may be
described by its sugar motif, nucleobase motif and/or
internucleoside linkage motif (as used herein, nucleobase motif
describes the modifications to the nucleobases independent of the
sequence of nucleobases).
[0259] 1. Certain Sugar Motifs
[0260] In certain embodiments, compounds described herein comprise
oligonucleotides. In certain embodiments, oligonucleotides comprise
one or more type of modified sugar and/or unmodified sugar moiety
arranged along the oligonucleotide or region thereof in a defined
pattern or sugar motif. In certain instances, such sugar motifs
include but are not limited to any of the sugar modifications
discussed herein.
[0261] In certain embodiments, modified oligonucleotides comprise
or consist of a region having a gapmer motif, which comprises two
external regions or "wings" and a central or internal region or
"gap." The three regions of a gapmer motif (the 5'-wing, the gap,
and the 3'-wing) form a contiguous sequence of nucleosides wherein
at least some of the sugar moieties of the nucleosides of each of
the wings differ from at least some of the sugar moieties of the
nucleosides of the gap. Specifically, at least the sugar moieties
of the nucleosides of each wing that are closest to the gap (the
3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the
3'-wing) differ from the sugar moiety of the neighboring gap
nucleosides, thus defining the boundary between the wings and the
gap (i.e., the wing/gap junction). In certain embodiments, the
sugar moieties within the gap are the same as one another. In
certain embodiments, the gap includes one or more nucleoside having
a sugar moiety that differs from the sugar moiety of one or more
other nucleosides of the gap. In certain embodiments, the sugar
motifs of the two wings are the same as one another (symmetric
gapmer). In certain embodiments, the sugar motif of the 5'-wing
differs from the sugar motif of the 3'-wing (asymmetric
gapmer).
[0262] In certain embodiments, the wings of a gapmer comprise 1-5
nucleosides. In certain embodiments, the wings of a gapmer comprise
2-5 nucleosides. In certain embodiments, the wings of a gapmer
comprise 3-5 nucleosides. In certain embodiments, the nucleosides
of a gapmer are all modified nucleosides.
[0263] In certain embodiments, the gap of a gapmer comprises 7-12
nucleosides. In certain embodiments, the gap of a gapmer comprises
7-10 nucleosides. In certain embodiments, the gap of a gapmer
comprises 8-10 nucleosides. In certain embodiments, the gap of a
gapmer comprises 10 nucleosides. In certain embodiment, each
nucleoside of the gap of a gapmer is an unmodified 2'-deoxy
nucleoside.
[0264] In certain embodiments, the gapmer is a deoxy gapmer. In
such embodiments, the nucleosides on the gap side of each wing/gap
junction are unmodified 2'-deoxy nucleosides and the nucleosides on
the wing sides of each wing/gap junction are modified nucleosides.
In certain such embodiments, each nucleoside of the gap is an
unmodified 2'-deoxy nucleoside. In certain such embodiments, each
nucleoside of each wing is a modified nucleoside.
[0265] In certain embodiments, a modified oligonucleotide has a
fully modified sugar motif wherein each nucleoside of the modified
oligonucleotide comprises a modified sugar moiety. In certain
embodiments, modified oligonucleotides comprise or consist of a
region having a fully modified sugar motif wherein each nucleoside
of the region comprises a modified sugar moiety. In certain
embodiments, modified oligonucleotides comprise or consist of a
region having a fully modified sugar motif, wherein each nucleoside
within the fully modified region comprises the same modified sugar
moiety, referred to herein as a uniformly modified sugar motif. In
certain embodiments, a fully modified oligonucleotide is a
uniformly modified oligonucleotide. In certain embodiments, each
nucleoside of a uniformly modified comprises the same
2'-modification.
[0266] 2. Certain Nucleobase Motifs
[0267] In certain embodiments, compounds described herein comprise
oligonucleotides. In certain embodiments, oligonucleotides comprise
modified and/or unmodified nucleobases arranged along the
oligonucleotide or region thereof in a defined pattern or motif. In
certain embodiments, each nucleobase is modified. In certain
embodiments, none of the nucleobases are modified. In certain
embodiments, each purine or each pyrimidine is modified. In certain
embodiments, each adenine is modified. In certain embodiments, each
guanine is modified. In certain embodiments, each thymine is
modified. In certain embodiments, each uracil is modified. In
certain embodiments, each cytosine is modified. In certain
embodiments, some or all of the cytosine nucleobases in a modified
oligonucleotide are 5-methylcytosines.
[0268] In certain embodiments, modified oligonucleotides comprise a
block of modified nucleobases. In certain such embodiments, the
block is at the 3'-end of the oligonucleotide. In certain
embodiments the block is within 3 nucleosides of the 3'-end of the
oligonucleotide. In certain embodiments, the block is at the 5'-end
of the oligonucleotide. In certain embodiments the block is within
3 nucleosides of the 5'-end of the oligonucleotide.
[0269] In certain embodiments, oligonucleotides having a gapmer
motif comprise a nucleoside comprising a modified nucleobase. In
certain such embodiments, one nucleoside comprising a modified
nucleobase is in the central gap of an oligonucleotide having a
gapmer motif. In certain such embodiments, the sugar moiety of said
nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the
modified nucleobase is selected from: a 2-thiopyrimidine and a
5-propynepyrimidine.
[0270] 3. Certain Internucleoside Linkage Motifs
[0271] In certain embodiments, compounds described herein comprise
oligonucleotides. In certain embodiments, oligonucleotides comprise
modified and/or unmodified internucleoside linkages arranged along
the oligonucleotide or region thereof in a defined pattern or
motif. In certain embodiments, essentially each internucleoside
linking group is a phosphate internucleoside linkage (P.dbd.0). In
certain embodiments, each internucleoside linking group of a
modified oligonucleotide is a phosphorothioate (P.dbd.S). In
certain embodiments, each internucleoside linking group of a
modified oligonucleotide is independently selected from a
phosphorothioate and phosphate internucleoside linkage. In certain
embodiments, the sugar motif of a modified oligonucleotide is a
gapmer and the internucleoside linkages within the gap are all
modified. In certain such embodiments, some or all of the
internucleoside linkages in the wings are unmodified phosphate
linkages. In certain embodiments, the terminal internucleoside
linkages are modified.
[0272] C. Certain Modified Oligonucleotides
[0273] In certain embodiments, compounds described herein comprise
modified oligonucleotides. In certain embodiments, the above
modifications (sugar, nucleobase, internucleoside linkage) are
incorporated into a modified oligonucleotide. In certain
embodiments, modified oligonucleotides are characterized by their
modification, motifs, and overall lengths. In certain embodiments,
such parameters are each independent of one another. Thus, unless
otherwise indicated, each internucleoside linkage of an
oligonucleotide having a gapmer sugar motif may be modified or
unmodified and may or may not follow the gapmer modification
pattern of the sugar modifications. For example, the
internucleoside linkages within the wing regions of a sugar gapmer
may be the same or different from one another and may be the same
or different from the internucleoside linkages of the gap region of
the sugar motif. Likewise, such gapmer oligonucleotides may
comprise one or more modified nucleobase independent of the gapmer
pattern of the sugar modifications. Furthermore, in certain
instances, an oligonucleotide is described by an overall length or
range and by lengths or length ranges of two or more regions (e.g.,
a regions of nucleosides having specified sugar modifications), in
such circumstances it may be possible to select numbers for each
range that result in an oligonucleotide having an overall length
falling outside the specified range. In such circumstances, both
elements must be satisfied. For example, in certain embodiments, a
modified oligonucleotide consists of 15-20 linked nucleosides and
has a sugar motif consisting of three regions, A, B, and C, wherein
region A consists of 2-6 linked nucleosides having a specified
sugar motif, region B consists of 6-10 linked nucleosides having a
specified sugar motif, and region C consists of 2-6 linked
nucleosides having a specified sugar motif. Such embodiments do not
include modified oligonucleotides where A and C each consist of 6
linked nucleosides and B consists of 10 linked nucleosides (even
though those numbers of nucleosides are permitted within the
requirements for A, B, and C) because the overall length of such
oligonucleotide is 22, which exceeds the upper limit of the overall
length of the modified oligonucleotide (20). Herein, if a
description of an oligonucleotide is silent with respect to one or
more parameter, such parameter is not limited. Thus, a modified
oligonucleotide described only as having a gapmer sugar motif
without further description may have any length, internucleoside
linkage motif, and nucleobase motif. Unless otherwise indicated,
all modifications are independent of nucleobase sequence.
Certain Conjugated Compounds
[0274] In certain embodiments, the compounds described herein
comprise or consist of an oligonucleotide (modified or unmodified)
and optionally one or more conjugate groups and/or terminal groups.
Conjugate groups consist of one or more conjugate moiety and a
conjugate linker which links the conjugate moiety to the
oligonucleotide. Conjugate groups may be attached to either or both
ends of an oligonucleotide and/or at any internal position. In
certain embodiments, conjugate groups are attached to the
2'-position of a nucleoside of a modified oligonucleotide. In
certain embodiments, conjugate groups that are attached to either
or both ends of an oligonucleotide are terminal groups. In certain
such embodiments, conjugate groups or terminal groups are attached
at the 3' and/or 5'-end of oligonucleotides. In certain such
embodiments, conjugate groups (or terminal groups) are attached at
the 3'-end of oligonucleotides. In certain embodiments, conjugate
groups are attached near the 3'-end of oligonucleotides. In certain
embodiments, conjugate groups (or terminal groups) are attached at
the 5'-end of oligonucleotides. In certain embodiments, conjugate
groups are attached near the 5'-end of oligonucleotides.
[0275] In certain embodiments, the oligonucleotide of a compound is
modified. In certain embodiments, the oligonucleotide of a compound
may have any nucleobase sequence. In certain embodiments, the
oligonucleotide of a compound has a nucleobase sequence that is
complementary to a target nucleic acid. In certain embodiments,
oligonucleotides are complementary to a messenger RNA (mRNA). In
certain embodiments, oligonucleotides are complementary to a sense
transcript. In certain embodiments, oligonucleotides are
complementary to a long non-coding RNA (lncRNA).
[0276] Examples of terminal groups include but are not limited to
conjugate groups, capping groups, phosphate moieties, protecting
groups, modified or unmodified nucleosides, and two or more
nucleosides that are independently modified or unmodified.
[0277] A. Certain Conjugate Groups
[0278] In certain embodiments, oligonucleotides are covalently
attached to one or more conjugate groups. In certain embodiments,
conjugate groups modify one or more properties of the attached
oligonucleotide, including but not limited to pharmacodynamics,
pharmacokinetics, stability, binding, absorption, tissue
distribution, cellular distribution, cellular uptake, charge and
clearance. In certain embodiments, conjugate groups impart a new
property on the attached oligonucleotide, e.g., fluorophores or
reporter groups that enable detection of the oligonucleotide.
[0279] Certain conjugate groups and conjugate moieties have been
described previously, for example: cholesterol moiety (Letsinger et
al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
(Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a
thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y.
Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med.
Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et
al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al.,
EMBO 1, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259,
327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a
phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al.,
Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids
Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol
chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,
969-973), or adamantane acetic acid, a palmityl moiety (Mishra et
al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an
octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke
et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol
group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4,
e220; doi:10.1038/mtna.2014.72 and Nishina et al., Molecular
Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g.,
WO2014/179620).
[0280] 1. Conjugate Moieties
[0281] Conjugate moieties include, without limitation,
intercalators, reporter molecules, polyamines, polyamides,
peptides, carbohydrates (e.g., GalNAc), vitamin moieties,
polyethylene glycols, thioethers, polyethers, cholesterols,
thiocholesterols, cholic acid moieties, folate, lipids,
phospholipids, biotin, phenazine, phenanthridine, anthraquinone,
adamantane, acridine, fluoresceins, rhodamines, coumarins,
fluorophores, and dyes.
[0282] In certain embodiments, a conjugate moiety comprises an
active drug substance, for example, aspirin, warfarin,
phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen,
(S)-(+)-pranoprofen, carprofen, dansylsarcosine,
2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic
acid, a benzothiadiazide, chlorothiazide, a diazepine,
indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
[0283] 2. Conjugate Linkers
[0284] Conjugate moieties are attached to oligonucleotides through
conjugate linkers. In certain compounds, a conjugate group is a
single chemical bond (i.e. conjugate moiety is attached to an
oligonucleotide via a conjugate linker through a single bond). In
certain embodiments, the conjugate linker comprises a chain
structure, such as a hydrocarbyl chain, or an oligomer of repeating
units such as ethylene glycol, nucleosides, or amino acid
units.
[0285] In certain embodiments, a conjugate linker comprises one or
more groups selected from alkyl, amino, oxo, amide, disulfide,
polyethylene glycol, ether, thioether, and hydroxylamino. In
certain such embodiments, the conjugate linker comprises groups
selected from alkyl, amino, oxo, amide and ether groups. In certain
embodiments, the conjugate linker comprises groups selected from
alkyl and amide groups. In certain embodiments, the conjugate
linker comprises groups selected from alkyl and ether groups. In
certain embodiments, the conjugate linker comprises at least one
phosphorus moiety. In certain embodiments, the conjugate linker
comprises at least one phosphate group. In certain embodiments, the
conjugate linker includes at least one neutral linking group.
[0286] In certain embodiments, conjugate linkers, including the
conjugate linkers described above, are bifunctional linking
moieties, e.g., those known in the art to be useful for attaching
conjugate groups to parent compounds, such as the oligonucleotides
provided herein. In general, a bifunctional linking moiety
comprises at least two functional groups. One of the functional
groups is selected to bind to a particular site on a compound and
the other is selected to bind to a conjugate group. Examples of
functional groups used in a bifunctional linking moiety include but
are not limited to electrophiles for reacting with nucleophilic
groups and nucleophiles for reacting with electrophilic groups. In
certain embodiments, bifunctional linking moieties comprise one or
more groups selected from amino, hydroxyl, carboxylic acid, thiol,
alkyl, alkenyl, and alkynyl.
[0287] Examples of conjugate linkers include but are not limited to
pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and
6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include
but are not limited to substituted or unsubstituted
C.sub.1-C.sub.10 alkyl, substituted or unsubstituted
C.sub.2-C.sub.10 alkenyl or substituted or unsubstituted
C.sub.2-C.sub.10 alkynyl, wherein a nonlimiting list of preferred
substituent groups includes hydroxyl, amino, alkoxy, carboxy,
benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl,
alkenyl and alkynyl.
[0288] In certain embodiments, conjugate linkers comprise 1-10
linker-nucleosides. In certain embodiments, such linker-nucleosides
are modified nucleosides. In certain embodiments such
linker-nucleosides comprise a modified sugar moiety. In certain
embodiments, linker-nucleosides are unmodified. In certain
embodiments, linker-nucleosides comprise an optionally protected
heterocyclic base selected from a purine, substituted purine,
pyrimidine or substituted pyrimidine. In certain embodiments, a
cleavable moiety is a nucleoside selected from uracil, thymine,
cytosine, 4-N-benzoylcytosine, 5-methylcytosine,
4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine
and 2-N-isobutyrylguanine. It is typically desirable for
linker-nucleosides to be cleaved from the compound after it reaches
a target tissue. Accordingly, linker-nucleosides are typically
linked to one another and to the remainder of the compound through
cleavable bonds. In certain embodiments, such cleavable bonds are
phosphodiester bonds.
[0289] Herein, linker-nucleosides are not considered to be part of
the oligonucleotide. Accordingly, in embodiments in which a
compound comprises an oligonucleotide consisting of a specified
number or range of linked nucleosides and/or a specified percent
complementarity to a reference nucleic acid and the compound also
comprises a conjugate group comprising a conjugate linker
comprising linker-nucleosides, those linker-nucleosides are not
counted toward the length of the oligonucleotide and are not used
in determining the percent complementarity of the oligonucleotide
for the reference nucleic acid. For example, a compound may
comprise (1) a modified oligonucleotide consisting of 8-30
nucleosides and (2) a conjugate group comprising 1-10
linker-nucleosides that are contiguous with the nucleosides of the
modified oligonucleotide. The total number of contiguous linked
nucleosides in such a compound is more than 30. Alternatively, an
compound may comprise a modified oligonucleotide consisting of 8-30
nucleosides and no conjugate group. The total number of contiguous
linked nucleosides in such a compound is no more than 30. Unless
otherwise indicated conjugate linkers comprise no more than 10
linker-nucleosides. In certain embodiments, conjugate linkers
comprise no more than 5 linker-nucleosides. In certain embodiments,
conjugate linkers comprise no more than 3 linker-nucleosides. In
certain embodiments, conjugate linkers comprise no more than 2
linker-nucleosides. In certain embodiments, conjugate linkers
comprise no more than 1 linker-nucleoside.
[0290] In certain embodiments, it is desirable for a conjugate
group to be cleaved from the oligonucleotide. For example, in
certain circumstances compounds comprising a particular conjugate
moiety are better taken up by a particular cell type, but once the
compound has been taken up, it is desirable that the conjugate
group be cleaved to release the unconjugated or parent
oligonucleotide. Thus, certain conjugate may comprise one or more
cleavable moieties, typically within the conjugate linker. In
certain embodiments, a cleavable moiety is a cleavable bond. In
certain embodiments, a cleavable moiety is a group of atoms
comprising at least one cleavable bond. In certain embodiments, a
cleavable moiety comprises a group of atoms having one, two, three,
four, or more than four cleavable bonds. In certain embodiments, a
cleavable moiety is selectively cleaved inside a cell or
subcellular compartment, such as a lysosome. In certain
embodiments, a cleavable moiety is selectively cleaved by
endogenous enzymes, such as nucleases.
[0291] In certain embodiments, a cleavable bond is selected from
among: an amide, an ester, an ether, one or both esters of a
phosphodiester, a phosphate ester, a carbamate, or a disulfide. In
certain embodiments, a cleavable bond is one or both of the esters
of a phosphodiester. In certain embodiments, a cleavable moiety
comprises a phosphate or phosphodiester. In certain embodiments,
the cleavable moiety is a phosphate linkage between an
oligonucleotide and a conjugate moiety or conjugate group.
[0292] In certain embodiments, a cleavable moiety comprises or
consists of one or more linker-nucleosides. In certain such
embodiments, one or more linker-nucleosides are linked to one
another and/or to the remainder of the compound through cleavable
bonds. In certain embodiments, such cleavable bonds are unmodified
phosphodiester bonds. In certain embodiments, a cleavable moiety is
2'-deoxy nucleoside that is attached to either the 3' or
5'-terminal nucleoside of an oligonucleotide by a phosphate
internucleoside linkage and covalently attached to the remainder of
the conjugate linker or conjugate moiety by a phosphate or
phosphorothioate linkage. In certain such embodiments, the
cleavable moiety is 2'-deoxyadenosine.
Compositions and Methods for Formulating Pharmaceutical
Compositions
[0293] Compounds described herein may be admixed with
pharmaceutically acceptable active or inert substances for the
preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical
compositions are dependent upon a number of criteria, including,
but not limited to, route of administration, extent of disease, or
dose to be administered.
[0294] In certain embodiments, the present invention provides
pharmaceutical compositions comprising one or more compounds or a
salt thereof. In certain embodiments, the compounds are antisense
compounds or oligomeric compounds. In certain embodiments, the
compounds comprise or consist of a modified oligonucleotide. In
certain such embodiments, the pharmaceutical composition comprises
a suitable pharmaceutically acceptable diluent or carrier. In
certain embodiments, a pharmaceutical composition comprises a
sterile saline solution and one or more compound. In certain
embodiments, such pharmaceutical composition consists of a sterile
saline solution and one or more compound. In certain embodiments,
the sterile saline is pharmaceutical grade saline. In certain
embodiments, a pharmaceutical composition comprises one or more
compound and sterile water. In certain embodiments, a
pharmaceutical composition consists of one compound and sterile
water. In certain embodiments, the sterile water is pharmaceutical
grade water. In certain embodiments, a pharmaceutical composition
comprises one or more compound and phosphate-buffered saline (PBS).
In certain embodiments, a pharmaceutical composition consists of
one or more compound and sterile PBS. In certain embodiments, the
sterile PBS is pharmaceutical grade PBS. Compositions and methods
for the formulation of pharmaceutical compositions are dependent
upon a number of criteria, including, but not limited to, route of
administration, extent of disease, or dose to be administered.
[0295] A compound described herein targeted to a MaTAR nucleic acid
can be utilized in pharmaceutical compositions by combining the
compound with a suitable pharmaceutically acceptable diluent or
carrier. In certain embodiments, a pharmaceutically acceptable
diluent is water, such as sterile water suitable for injection.
Accordingly, in one embodiment, employed in the methods described
herein is a pharmaceutical composition comprising a compound
targeted to a MaTAR nucleic acid and a pharmaceutically acceptable
diluent. In certain embodiments, the pharmaceutically acceptable
diluent is water. In certain embodiments, the compound comprises or
consists of a modified oligonucleotide provided herein.
[0296] Pharmaceutical compositions comprising compounds provided
herein encompass any pharmaceutically acceptable salts, esters, or
salts of such esters, or any other oligonucleotide which, upon
administration to an animal, including a human, is capable of
providing (directly or indirectly) the biologically active
metabolite or residue thereof. In certain embodiments, the
compounds are antisense compounds or oligomeric compounds. In
certain embodiments, the compound comprises or consists of a
modified oligonucleotide. Accordingly, for example, the disclosure
is also drawn to pharmaceutically acceptable salts of compounds,
prodrugs, pharmaceutically acceptable salts of such prodrugs, and
other bioequivalents. Suitable pharmaceutically acceptable salts
include, but are not limited to, sodium and potassium salts.
[0297] A prodrug can include the incorporation of additional
nucleosides at one or both ends of a compound which are cleaved by
endogenous nucleases within the body, to form the active
compound.
[0298] In certain embodiments, the compounds or compositions
further comprise a pharmaceutically acceptable carrier or
diluent.
RNA-Sequencing
[0299] Total RNA was isolated either directly from cryosections of
the tumor tissue or from organotypic epithelial cultures using
TRIzol (Life Technologies) according to the manufacturer's
instructions. For tissue sections, the tumors were embedded in OCT
and cryosectioned. Sections from the middle of the tumor were
stained using toluidine blue (Sigma) and assayed regarding the
homogeneity of the section. Homogenous 30 .mu.m sections comprising
>90% malignant cells were immediately dispersed and homogenized
in TRIzol. RNA quality was assayed by running an RNA 6000 Nano chip
on a 2100 Bioanalyzer (Agilent). For high-throughput sequencing,
RNA samples were required to have an RNA integrity number
(RIN).gtoreq.9. TruSeq (Illumina) libraries for polyA+ RNA-Seq were
prepared from 0.5-1 .mu.g RNA per sample. To ensure efficient
cluster generation, an additional gel purification step of the
libraries was applied. The libraries were multiplexed (4-6
libraries per lane) and sequenced paired-end 101 bp on the
HiSeq2000 platform (Illumina), resulting in on average 40 Mio reads
per library.
Computational Analysis
[0300] The quality of the raw data was evaluated using FastQC
(http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), and
reads were mapped to mm10 using STAR v2.4.1 (Dobin et al.
Bioinformatics 29: 15-21, 2012), resulting in an overall mapping
efficiency of >90%. The GENCODE mV5 GTF was used as a reference
and the reads per gene record were counted using the HTSeq package
v0.5.4p5 (Anders et al. Bioinformatics 31: 166-169, 2015) and
parameters -m union -s no. Differential gene expression was
performed with DESeq2 v1.8.1 (Love et al. Genome Biol. 15: 550,
2014). An adjusted p-value of <0.1 was set as threshold for
statistical significance of differential gene expression.
Functional analysis of KEGG pathways was carried out using the
R/Bioconductor packages GAGE (Luo et al. BMC Bioinformatics 10:
161, 2009) and Pathview (Luo and Brouwer, Bioinformatics 29:
1830-1831, 2013). Gene set enrichment analysis was performed using
the javaGSEA desktop application (Subramanian et al. 2005). Gene
ontology (GO) analysis was carried out using GOrilla (Eden et al.
BMC Bioinformatics 10: 48, 2009) separately on genes up- or
down-regulated compared to normal mammary gland organoids.
Weighted Gene Coexpression Network Analysis
[0301] Weighted gene coexpression network analysis (WGCNA) was
carried out as described previously (Bergmann et al. Genome Res.
2015). Briefly, ENCODE data sets (CSHL long RNA sequencing), ESC
data as well as the tumor and organoid RNA-Seq datasets were used
as input. We performed variance-stabilizing transformation of
HTSeq-generated counts and averaged the counts from replicate
samples. The WGCNA R package (Langfelder and Horvath BMC
Bioinformatics 9: 559, 2008) was used with a value of 13=5 as
empirically chosen soft-threshold. This analysis identified 39
modules with a median gene number of 274.
Identification of Human MaTAR Counterparts
[0302] To identify human counterparts of MaTARs, mouse and human
transcripts were compared on the level of both sequence
conservation and genomic location.
[0303] First, the mouse MaTAR sequence (mm10) was extracted and
screened for transcripts with sequence overlap in the human genome
(hg38) using the BLAT alignment tool. If the mouse MaTAR sequence
overlapped significantly with an annotated human transcript, this
transcript was defined as the human counterpart. For some
candidates, sequence identities of up to 70% were obtained while
any sequence overlap for others was not observed. Next, the
analysis was extended to conserved genomic location (=synteny) by
analyzing the nearest neighboring genes of each MaTAR. This was
carried out using the UCSC Genome Browser. For instance, if the
genomic location of a MaTAR is in close proximity to a
protein-coding gene, the surrounding genomic position of the same
protein-coding gene in the human genome was screened. Many
non-coding RNAs are conserved between different species on the
level of genomic location rather than based on sequence, implying
functional conservation. Human counterparts for almost all MaTARs
were identified based on synteny. In several cases, we observed
conservation on both sequence and synteny levels.
Advantages of Certain Embodiments
[0304] An RNA-Seq screen was performed to identify lncRNAs that are
up-regulated in mammary tumors. A total of 290 lncRNAs that are
up-regulated at least two-fold in tumors were identified. Antisense
inhibition of several of these transcripts, particularly, MaTAR
transcripts, lead to a reduction or complete loss of organoid
branching. Provided herein, for the first time, are methods and
compositions for the modulation of a MaTAR that can treat, delay,
prevent and/or ameliorate a breast cancer disorder or condition, or
a physiological marker thereof. In a particular embodiment, for the
first time, MaTAR inhibitors (e.g., oligonucleotides targeting a
nucleic acid encoding a MaTAR) are provided for reducing tumor
progression, metastasis, cell proliferation, tumor cell invasion,
an/or collective cell migration in an animal.
EXAMPLES
Non-Limiting Disclosure and Incorporation by Reference
[0305] While certain compounds, compositions and methods described
herein have been described with specificity in accordance with
certain embodiments, the following examples serve only to
illustrate the compounds described herein and are not intended to
limit the same. Each of the references recited in the present
application is incorporated herein by reference in its
entirety.
Example 1: Comparison of the Transcriptome of Mammary Tumors and
Corresponding Organoids
[0306] The expression of several breast cancer markers, such as
estrogen receptor (ER), progesterone receptor (PR), and ER-negative
(HER2/neu-amplified and basal-like), from mammary tumors of
comparable volume and histological profile, were measured. The
mammary tumors were from 3 MMTV-PyMT mice, which is a
physiologically relevant mouse model of luminal B subtype of breast
cancer.
[0307] Organoids from WT nulliparous mammary glands, MMTV-PyMT
tumors and MMTV-Neu-NDL tumors were prepared and cultured as
described in Ewald Cold Spring Harb. Protoc. 2013: 130-133, 2013.
For MMTV-PyMT mice, individual tumors were isolated and organoids
were generated in a tumor-specific manner. Mammary epithelial
fragments (organoids) were mixed with growth factor-reduced
matrigel (Corning) at a concentration of 5 organoids/4 and plated
as 80 .mu.L domes in Cellstar 24-well dishes (Greiner Bio One).
Organoids were grown in DMEM/F12 medium supplemented with
1.times.ITS (insulin, transferrin, and sodium selenite) media
supplement (Sigma), 1% penicillin/streptomycin, and 2.5 nM murine
FGF2 (Peprotech). Comparative RNA-Seq analyses revealed that the
global gene expression signature of mammary organoids correlates
well with the tumor transcriptome (Pearson correlation
coefficient=0.82 for day 0 and 0.84 for day 6). Thus, the first
direct transcriptomic comparison of cultured organoids and the
tumors they were derived from demonstrates that the gene expression
signature of day 6 mammary organoids closely resembles the tumor
transcriptome and represents a reliable model system to study the
expression of non-coding RNAs. The RNA-Seq data presented here is
also publicly available at the NCBI Gene Expression Omnibus (GEO;
http://www.ncbi/nlm/nih.gov/geo) under accession number
GSE72823.
Example 2: Transcriptome of Luminal B and HER2-Amplified Mammary
Tumors
[0308] RNA-Seq analysis was performed on physiologically relevant
transgenic mouse models of luminal B (MMTV-PyMT) and
HER2/neu-amplified (MMTV-Neu-NDL and MMTV-Cre; Flox-Neo-Neu-NT)
subtypes of breast cancer (Guy et al, Mol. Cell Biol. 12: 954-961,
1992; Siegel et al, EMBO J. 18: 2149-2164, 1999; Andrechek et al,
Proc. Natl. Acad. Sci. USA 97: 3444-3449, 2000).
[0309] To identify the complement of lncRNAs expressed in different
subtypes of mammary carcinomas, organoids were generated from 5
MMTV-PyMT and 3 MMTV-Neu-NDL mice. After 6 days in matrigel, the
transcriptome of the organoids was analyzed using RNA-Seq.
Organoids from nulliparous mammary glands of 3 age-matched wild
type FVB females served as controls.
[0310] Gene-set enrichment analyses (GSEA) revealed that the mouse
mammary organoid data resembled the transcriptome of human breast
cancer. For instance, the down-regulated genes of both models
correlated well with expression signatures of invasive breast
cancer and metastatic tumors. A similar correlation was found for
up-regulated genes in both datasets.
[0311] Taken together, the data demonstrated that mouse mammary
carcinoma-derived organoids recapitulated the transcriptome of
luminal B and HER2/neu-amplified breast cancer. The data also
demonstrate that mouse mammary carcinoma-derived organoids are a
reliable model system to study the expression of non-coding
RNAs.
Example 3: Identification of Up-Regulated lncRNAs in Mammary
Tumors
[0312] A catalog of lncRNAs that exhibited altered expression
levels in mammary tumor organoids was generated to provide a useful
resource for research and drug development.
[0313] A total of 484 lncRNAs in MMTV-PyMT and 402 lncRNAs in
MMTV-Neu-NDL were identified with an overlap of 122 between both
models that are differentially expressed in organoids derived from
mammary tumors compared to wild-type (WT) mammary glands.
Approximately, 30% of the identified RNA genes are classified as
`lincRNA` (long intergenic non-coding RNAs), 23% as `processed
pseudogenes`, 16% as `antisense` transcripts, and 13% as
`processed` transcripts. The gene biotypes of the 484 lncRNAs
differentially expressed in MMTV-PyMT tumor organoids and 402
lncRNAs differentially expressed in MMTV-Neu-NDL tumor organoids is
presented in the table below. `TEC` denotes `to be experimentally
confirmed` (GENCODE classification).
TABLE-US-00003 TABLE 3 Gene biotypes (%) of lncRNA Gene biotype
MMTV-PyMT MMTV-Neu-NDL Antisense 18 13 lincRNA 31 27 Processed
pseudogene 16 28 Processed transcript 15 10 TEC 7 5 Unprocessed
pseudogene 4 3 others 9 14
[0314] Of these, 109 lncRNAs in MMTV-PyMT and 207 lncRNAs in
MMTV-Neu-NDL were up-regulated > two-fold, with an overlap of 26
between both models. These up-regulated genes are presented in the
Tables below. The genes marked with an asterisk (*) are the
overlapping 26 genes. `log 2FC` denotes the fold-changes compared
to WT mammary organoids, on a log 2 scale. `adj. p-value` indicates
the false-discovery rate (FDR) adjusted p-value, a statistical
measure of significance. Differentially expressed genes were
included in the Tables below if the log 2FC was .gtoreq.2 and the
adj. p-value was <0.1. These putative oncogenes represent a
diverse group of lncRNAs in terms of their biotypes, length,
expression levels, and genomic location (depicted by their Ensembl
ID).
TABLE-US-00004 TABLE 4 Up-regulated (.gtoreq.2-fold) lncRNAs in
MMTV-PyMT Ensembl ID log2FC adj. p-value Biotype Gene name
ENSMUSG00000085541* 6.5 7.14E-51 antisense Gm16010
ENSMUSG00000091199* 5.4 1.03E-10 transcribed unprocessed Gm2619
pseudogene ENSMUSG00000096802* 4.6 3.21E-06 processed pseudogene
Gm15433 ENSMUSG00000050334* 4.5 8.45E-13 lincRNA C130071CO3Rik
ENSMUSG00000089652* 4.4 8.77E-06 lincRNA Gm16025
ENSMUSG00000090186* 4.2 1.00E-05 transcribed unprocessed Gm7592
pseudogene ENSMUSG00000103440 4.0 6.46E-12 TEC Gm37131
ENSMUSG00000082082 3.8 4.54E-04 transcribed unprocessed Gm13230
ENSMUSG00000097960* 3.6 8.17E-17 lincRNA A330074K22Rik
ENSMUSG00000096292* 3.6 1.14E-03 processed pseudogene Gm2666
ENSMUSG00000094991 3.6 1.25E-03 lincRNA Gm21718 ENSMUSG00000087659
3.3 1.59E-03 lincRNA Gm12606 ENSMUSG00000100816* 3.2 6.01E-04
lincRNA Gm28321 ENSMUSG00000103620 3.0 1.54E-03 antisense Gm37359
ENSMUSG00000104192 3.0 4.69E-05 TEC Gm37253 ENSMUSG00000099693* 3.0
5.35E-03 unprocessed pseudogene Gm29284 ENSMUSG00000098224 2.9
3.41E-03 processed pseudogene Gm7985 ENSMUSG00000086748 2.8
5.56E-03 processed transcript Gm13261 ENSMUSG00000087051 2.7
8.83E-04 lincRNA Gm12730 ENSMUSG00000051832 2.7 1.08E-05 processed
transcript E230016K23Rik ENSMUSG00000073821 2.7 1.16E-05 processed
transcript 8030451A03Rik ENSMUSG00000097804 2.7 3.85E-04 antisense
Gm16685 ENSMUSG00000083563 2.6 1.90E-03 unprocessed pseudogene
Gm13340 ENSMUSG00000083863 2.5 4.59E-06 unprocessed pseudogene
Gm13341 ENSMUSG00000082978 2.5 1.14E-02 processed pseudogene
Rpsa-psll ENSMUSG00000082480 2.5 7.15E-04 processed pseudogene
Gm11687 ENSMUSG00000043903* 2.4 1.32E-08 lincRNA Gm22
ENSMUSG00000084141 2.3 3.39E-03 processed pseudogene 01fr1372-ps1
ENSMUSG00000087028* 2.3 1.33E-06 lincRNA Gm13387 ENSMUSG00000095042
2.3 8.67E-03 processed pseudogene Gm12537 ENSMUSG00000094334 2.2
5.39E-02 processed pseudogene Fabp512 ENSMUSG00000105613 2.2
1.31E-02 TEC RP23-31J24.2 ENSMUSG00000100865 2.2 1.92E-02
transcribed processed Gm9320 ENSMUSG00000084289* 2.2 8.13E-07
processed pseudogene Gm6977 ENSMUSG00000069939 2.1 3.95E-03
processed pseudogene Gm12070 ENSMUSG00000103032 2.1 7.42E-02 TEC
Gm37121 ENSMUSG00000105353 2.1 2.57E-02 lincRNA RP24-230J14.4
ENSMUSG00000067203* 2.1 2.74E-11 unprocessed pseudogene H2-K2
ENSMUSG00000083311 2.1 5.23E-02 processed pseudogene Gm5643
ENSMUSG00000082424 2.1 2.90E-03 processed pseudogene Gm13292
ENSMUSG00000096751 2.1 8.98E-02 processed transcript Gm28373
ENSMUSG00000041449 2.0 4.73E-07 transcribed unprocessed Serpina3h
pseudogene ENSMUSG00000086249 2.0 2.84E-03 processed transcript
Gm12724 ENSMUSG00000101452 2.0 2.17E-02 processed pseudogene
Gm28530 ENSMUSG00000097924* 2.0 7.52E-02 lincRNA A730020E08Rik
ENSMUSG00000085912* 2.0 9.93E-05 lincRNA Trp53cor1
ENSMUSG00000097636 2.0 5.53E-02 lincRNA 5830416P1ORik
ENSMUSG00000100750 2.0 1.98E-02 antisense Gm29084
ENSMUSG00000095419 2.0 1.02E-04 processed pseudogene Gm14328
ENSMUSG00000090063 1.9 7.62E-02 antisense Dlx6osl
ENSMUSG00000092171* 1.9 5.16E-04 lincRNA 4833427F1ORik
ENSMUSG00000105520 1.9 8.31E-03 TEC RP23-105B8.4 ENSMUSG00000082179
1.9 9.69E-02 processed pseudogene Gm11407 ENSMUSG00000096617* 1.8
1.95E-02 processed pseudogene Gm5559 ENSMUSG00000093405 1.8
6.36E-02 processed transcript Gm20684 ENSMUSG00000091553 1.8
3.93E-02 unprocessed pseudogene Serpina3e-ps ENSMUSG00000098113 1.8
2.62E-02 processed pseudogene Gm2445 ENSMUSG00000085471 1.8
7.67E-02 antisense 4933423P22Rik ENSMUSG00000085786 1.7 1.39E-02
antisense Gm15987 ENSMUSG00000102550 1.7 3.13E-02 processed
pseudogene Gm8276 ENSMUSG00000080775 1.7 9.19E-02 processed
pseudogene Gm6368 ENSMUSG00000105356 1.7 6.77E-02 TEC RP23-480P21.3
ENSMUSG00000098019 1.7 2.55E-02 processed pseudogene Gm2546
ENSMUSG00000090307 1.6 1.09E-02 antisense 1700071M16Rik
ENSMUSG00000089728 1.6 8.26E-02 unprocessed pseudogene C1ec2f
ENSMUSG00000063586 1.6 9.97E-02 processed pseudogene Gm5513
ENSMUSG00000026729 1.6 6.21E-02 lincRNA 4930562F07Rik
ENSMUSG00000104693* 1.5 7.23E-02 sense intronic RP23-103P11.1
ENSMUSG00000097728 1.5 4.95E-03 lincRNA Gm26840 ENSMUSG00000103755
1.5 1.18E-05 TEC Gm37805 ENSMUSG00000067389* 1.5 7.68E-05 antisense
Gm17080 ENSMUSG00000097800 1.5 5.87E-03 lincRNA B230344G16Rik
ENSMUSG00000099492 1.4 3.30E-02 processed pseudogene Gm5525
ENSMUSG00000082762 1.4 8.01E-02 processed pseudogene Gm12366
ENSMUSG00000097660* 1.4 7.59E-02 lincRNA Gm26762 ENSMUSG00000099471
1.4 6.99E-03 processed pseudogene Gm8451 ENSMUSG00000079311 1.4
4.13E-03 processed pseudogene Gm3222 ENSMUSG00000104018 1.4
7.37E-02 TEC 4833412K13Rik ENSMUSG00000105263 1.4 8.60E-02 TEC
RP24-230J14.5 ENSMUSG00000074280 1.4 2.95E-05 pseudogene Gm6166
ENSMUSG00000080746 1.4 4.49E-02 processed pseudogene Rpsa-ps12
ENSMUSG00000085399* 1.4 5.59E-02 processed transcript Foxd2os
ENSMUSG00000101249 1.3 1.99E-04 unprocessed pseudogene Gm29216
ENSMUSG00000086321 1.3 5.81E-02 antisense Gm11413
ENSMUSG00000094708 1.3 9.14E-02 processed pseudogene Gm10359
ENSMUSG00000100131 1.3 5.73E-02 unprocessed pseudogene Gm28439
ENSMUSG00000087528* 1.3 8.31E-03 processed transcript 9830144P21Rik
ENSMUSG00000104737* 1.3 2.02E-02 sense intronic RP23-103P11.2
ENSMUSG00000105954 1.2 4.07E-04 TEC RP24-299A7.2 ENSMUSG00000097979
1.2 4.94E-02 transcribed processed Gm4691 pseudogene
ENSMUSG00000103098 1.2 8.37E-02 processed pseudogene Gm37559
ENSMUSG00000104000* 1.2 6.68E-02 lincRNA Gm38335 ENSMUSG00000083773
1.2 1.64E-03 processed pseudogene Gm13394 ENSMUSG00000097113 1.1
1.52E-02 lincRNA Gm19705 ENSMUSG00000097090 1.1 9.31E-02 lincRNA
Gm26724 ENSMUSG00000075391 1.1 2.13E-02 processed pseudogene
Gm13443 ENSMUSG00000081208 1.1 7.94E-03 processed pseudogene
Gm11400 ENSMUSG00000084974 1.1 5.82E-02 processed transcript
Gm15567 ENSMUSG00000043889 1.1 5.82E-03 pseudogene Gm8399
ENSMUSG00000102070 1.1 1.68E-02 unprocessed pseudogene Gm28661
ENSMUSG00000103039 1.1 5.80E-02 TEC Gm37123 ENSMUSG00000066553 1.1
2.54E-02 processed pseudogene Gm6969 ENSMUSG00000105558 1.0
2.97E-02 processed pseudogene RP23-349J3.8 ENSMUSG00000090610 1.0
5.62E-02 pseudogene Gm3571 ENSMUSG00000089776* 1.0 3.73E-02
antisense Gm15684 ENSMUSG00000054418 1.0 3.94E-02 processed
transcript Gm12715 ENSMUSG00000090330 1.0 3.02E-02 antisense
9130221H12Rik ENSMUSG00000059195 1.0 1.66E-05 processed pseudogene
Gm12715 ENSMUSG00000084145 1.0 5.77E-02 processed pseudogene
Gm12263
TABLE-US-00005 TABLE 5 Up-regulated (.gtoreq.2-fold) lncRNAs in
MMTV-Neu-NDL Ensembl ID log2FC adj. p-value Biotype Gene name
ENSMUSG00000085541* 6.2 6.02E-35 antisense Gm16010
ENSMUSG00000091199* 5.8 6.90E-13 transcribed unprocessed Gm2619
pseudogene ENSMUSG00000079457 5.6 2.97E-09 transcribed unprocessed
Gm7609 pseudogene ENSMUSG00000096802* 5.5 1.84E-09 processed
pseudogene Gm15433 ENSMUSG00000087028* 4.8 1.50E-13 lincRNA Gm13387
ENSMUSG00000090186* 4.8 2.24E-07 transcribed unprocessed Gm7592
pseudogene ENSMUSG00000096292* 4.7 2.74E-06 processed pseudogene
Gm2666 ENSMUSG00000104645 4.6 3.40E-08 lincRNA RP23-437C24.2
ENSMUSG00000073902 4.5 1.69E-08 unprocessed pseudogene Gm1966
ENSMUSG00000105811 4.4 2.08E-10 lincRNA RP23-327119.1
ENSMUSG00000082292 4.1 5.28E-09 processed pseudogene Gm12250
ENSMUSG00000075549 4.0 7.07E-10 antisense Gm6878
ENSMUSG00000089652* 4.0 2.50E-04 lincRNA Gm16025 ENSMUSG00000106230
3.9 6.45E-07 lincRNA RP23-447N11.2 ENSMUSG00000085452 3.8 7.54E-04
lincRNA 4930554G24Rik ENSMUSG00000085083 3.7 2.97E-04 antisense
Gm11615 ENSMUSG00000099375 3.6 3.24E-06 lincRNA Gm28187
ENSMUSG00000082305 3.6 2.90E-12 unprocessed pseudogene Gm2420
ENSMUSG00000086964 3.6 7.66E-04 antisense Gm15948
ENSMUSG00000102801 3.6 2.17E-03 TEC Gm37478 ENSMUSG00000084328 3.6
1.42E-04 processed pseudogene Gm14046 ENSMUSG00000085218 3.5
2.91E-04 processed transcript BB218582 ENSMUSG00000100252 3.4
2.33E-04 lincRNA Mir124-2hg ENSMUSG00000097766 3.4 2.36E-09 lincRNA
5730420D15Rik ENSMUSG00000102160 3.3 5.52E-04 TEC Gm36944
ENSMUSG00000081665 3.3 1.27E-05 unprocessed pseudogene Gm15922
ENSMUSG00000083161 3.2 3.34E-03 unprocessed pseudogene Gm11427
ENSMUSG00000099157 3.2 7.23E-03 misc RNA Gm27804 ENSMUSG00000090252
3.2 6.22E-03 antisense Gm16028 ENSMUSG00000085295 3.1 6.40E-04
antisense 4930430E12Rik ENSMUSG00000102389 3.1 3.02E-03 TEC
D630023014Rik ENSMUSG00000097924* 3.1 2.17E-03 lincRNA
A730020E08Rik ENSMUSG00000100009 3.1 2.37E-05 lincRNA Gm7967
ENSMUSG00000099693* 3.1 3.25E-03 unprocessed pseudogene Gm29284
ENSMUSG00000106004 3.0 1.34E-02 antisense RP24-152F23.2
ENSMUSG00000087326 3.0 4.18E-05 processed transcript Gm12503
ENSMUSG00000087107 3.0 7.23E-06 lincRNA A1662270 ENSMUSG00000087248
2.9 6.61E-04 antisense Gm16120 ENSMUSG00000086605 2.9 1.62E-06
lincRNA Gm14290 ENSMUSG00000082433 2.9 6.86E-05 processed
pseudogene Gm9025 ENSMUSG00000063286 2.9 9.43E-05 unprocessed
pseudogene Gm8995 ENSMUSG00000085399* 2.9 2.43E-12 processed
transcript Foxd2os ENSMUSG00000066170 2.8 2.14E-06 lincRNA
E230001N_04Rik ENSMUSG00000085696 2.8 1.12E-02 antisense Hoxaas3
ENSMUSG00000061852 2.8 3.05E-02 unprocessed pseudogene Gm7582
ENSMUSG00000102788 2.8 5.19E-03 TEC Gm38255 ENSMUSG00000081723 2.7
2.79E-04 unprocessed pseudogene Gm15931 ENSMUSG00000073538 2.7
1.53E-02 processed transcript E330020D12Rik ENSMUSG00000099848 2.7
1.13E-04 lincRNA Gm29337 ENSMUSG00000087658 2.7 2.01E-02 antisense
Hotainnl ENSMUSG00000078122 2.7 2.53E-03 antisense F630028010Rik
ENSMUSG00000036322 2.7 1.74E-02 unprocessed pseudogene H2-Ea-ps
ENSMUSG00000104350 2.7 1.52E-04 TEC Gm38244 ENSMUSG00000087139 2.6
1.98E-02 antisense Gm11683 ENSMUSG00000078952 2.6 9.17E-04 lincRNA
Lincencl ENSMUSG00000083489 2.6 4.41E-02 unprocessed pseudogene
Gm11784 ENSMUSG00000100550 2.6 5.94E-03 lincRNA 2310039L15Rik
ENSMUSG00000100816* 2.6 2.41E-02 lincRNA Gm28321 ENSMUSG00000083708
2.6 1.91E-02 processed pseudogene Gm13123 ENSMUSG00000086704 2.6
4.30E-02 antisense Gm14582 ENSMUSG00000050334* 2.5 4.12E-03 lincRNA
C130071CO3Rik ENSMUSG00000099111 2.5 4.71E-02 misc RNA Gm27369
ENSMUSG00000082116 2.5 4.97E-02 processed pseudogene Gm12188
ENSMUSG00000104022 2.5 3.79E-02 sense intronic Gm37214
ENSMUSG00000074465 2.5 2.55E-02 antisense Gm10701
ENSMUSG00000085912* 2.5 1.41E-08 lincRNA Tip53cor1
ENSMUSG00000084243 2.5 4.76E-02 processed pseudogene Gm13784
ENSMUSG00000084826 2.5 5.37E-02 antisense A1847159
ENSMUSG00000105397 2.4 3.11E-03 processed pseudogene RP23-335E20.2
ENSMUSG00000097076 2.4 6.75E-02 lincRNA P1atr7 ENSMUSG00000086109
2.4 6.22E-02 lincRNA Gm13391 ENSMUSG00000078601 2.4 4.57E-02
lincRNA Gm12525 ENSMUSG00000074805 2.4 1.54E-02 antisense Illbos
ENSMUSG00000084108 2.4 6.96E-02 processed pseudogene Gm15794
ENSMUSG00000092171* 2.4 1.52E-05 lincRNA 4833427F1ORik
ENSMUSG00000100301 2.4 9.52E-18 lincRNA 6030407003Rik
ENSMUSG00000085833 2.3 1.07E-02 lincRNA Gm13003 ENSMUSG00000106396
2.3 4.97E-02 antisense RP24-140D11.1 ENSMUSG00000105492 2.3
6.27E-02 processed pseudogene RP24-224P21.1 ENSMUSG00000082072 2.3
3.89E-03 processed pseudogene Gm15785 ENSMUSG00000072683 2.3
7.88E-02 processed transcript Gm7457 ENSMUSG00000097281 2.3
1.29E-02 lincRNA Gm26685 ENSMUSG00000103596 2.3 7.93E-02 TEC
Gm37354 ENSMUSG00000054510 2.3 6.38E-02 lincRNA Gm14461
ENSMUSG00000056716 2.3 8.63E-03 lincRNA Gm5420 ENSMUSG00000087149
2.3 9.63E-05 transcribed unprocessed Itih51-ps pseudogene
ENSMUSG00000044633 2.3 3.87E-04 lincRNA B530045E1ORik
ENSMUSG00000043903* 2.3 1.20E-05 lincRNA Gm22 ENSMUSG00000082127
2.2 7.72E-08 processed pseudogene Gm13577 ENSMUSG00000099757 2.2
1.25E-02 processed transcript BE692007 ENSMUSG00000101210 2.2
3.46E-02 lincRNA Gm28720 ENSMUSG00000097730 2.2 3.06E-02 lincRNA
Gm26588 ENSMUSG00000097673 2.2 2.03E-02 lincRNA Gm26608
ENSMUSG00000087364 2.2 2.59E-02 antisense Gm13398
ENSMUSG00000105374 2.2 8.92E-02 TEC RP24-230L5.2 ENSMUSG00000097639
2.2 3.80E-03 lincRNA P1atr4 ENSMUSG00000102827 2.1 1.46E-02
transcribed processed Gm8242 pseudogene ENSMUSG00000081833 2.1
4.94E-03 processed pseudogene Gm13669 ENSMUSG00000101365 2.1
1.07E-02 lincRNA Gm19325 ENSMUSG00000085702 2.1 7.92E-02 antisense
Mecomos ENSMUSG00000086187 2.0 2.39E-02 lincRNA Gm12860
ENSMUSG00000072387 2.0 8.27E-02 processed pseudogene Gm10356
ENSMUSG00000063388 2.0 1.74E-02 pseudogene BCO23105
ENSMUSG00000082956 2.0 9.02E-02 unprocessed pseudogene Naip3
ENSMUSG00000085182 2.0 1.85E-02 antisense Gm13596
ENSMUSG00000087528* 2.0 8.13E-08 processed transcript 9830144P21Rik
ENSMUSG00000106524 2.0 6.38E-07 lincRNA RP23-229C5.2
ENSMUSG00000105057 2.0 9.56E-02 lincRNA RP23-71G16.7
ENSMUSG00000106654 2.0 5.34E-02 processed pseudogene RP23-118L1.5
ENSMUSG00000101344 2.0 1.68E-07 lincRNA Gm29183 ENSMUSG00000096938
2.0 3.44E-02 lincRNA 9530052E02Rik ENSMUSG00000105260 2.0 2.67E-02
lincRNA RP23-325M18.5 ENSMUSG00000097814 1.9 4.72E-02 antisense
Panct2 ENSMUSG00000087014 1.9 8.43E-03 antisense Gm16364
ENSMUSG00000099604 1.9 3.74E-02 processed pseudogene Gm6651
ENSMUSG00000061728 1.9 7.10E-02 unprocessed pseudogene Btn17-ps
ENSMUSG00000023341 1.9 1.19E-03 polymorphic pseudogene Mx2
ENSMUSG00000091575 1.9 2.46E-03 processed transcript 2010016118Rik
ENSMUSG00000096617* 1.9 1.74E-03 processed pseudogene Gm5559
ENSMUSG00000075027 1.9 2.87E-03 processed transcript 4631405J19Rik
ENSMUSG00000106164 1.9 4.10E-02 lincRNA RP24-292F8.1
ENSMUSG00000083152 1.8 7.09E-02 transcribed processed Apc-ps1
pseudogene ENSMUSG00000086150 1.8 1.23E-02 antisense Bach2os
ENSMUSG00000089711 1.8 5.45E-02 antisense Gm16240
ENSMUSG00000087113 1.8 1.55E-02 processed transcript Gm11714
ENSMUSG00000105326 1.8 3.44E-02 TEC RP24-230L5.3 ENSMUSG00000105453
1.8 9.72E-02 TEC RP23-31L10.4 ENSMUSG00000097887 1.8 3.15E-02
lincRNA Gm26542 ENSMUSG00000093826 1.8 6.52E-04 processed
pseudogene Gm6900 ENSMUSG00000082192 1.7 5.03E-02 processed
pseudogene Gm14719 ENSMUSG00000097242 1.7 1.95E-13 lincRNA Gm16907
ENSMUSG00000097352 1.7 2.75E-02 transcribed unprocessed
C920009B18Rik pseudogene ENSMUSG00000103532 1.7 2.49E-02 TEC Gm4430
ENSMUSG00000104616 1.7 3.71E-02 processed pseudogene RP23-325M18.2
ENSMUSG00000097471 1.7 7.62E-03 lincRNA 5830432E09Rik
ENSMUSG00000105741 1.7 8.53E-03 TEC RP23-396H16.2
ENSMUSG00000100005 1.7 1.34E-02 processed transcript B130024G19Rik
ENSMUSG00000084289* 1.7 1.62E-03 processed pseudogene Gm6977
ENSMUSG00000029605 1.6 1.14E-03 polymorphic pseudogene Oas lb
ENSMUSG00000090399 1.6 8.53E-02 lincRNA Gm38399 ENSMUSG00000096980
1.6 2.71E-02 lincRNA Gm26526 ENSMUSG00000086712 1.6 1.42E-02
lincRNA A1427809 ENSMUSG00000097660* 1.6 5.14E-02 lincRNA Gm26762
ENSMUSG00000084807 1.6 1.67E-02 lincRNA Gm13073 ENSMUSG00000084183
1.6 1.68E-02 processed pseudogene Gm12009 ENSMUSG00000074067 1.6
6.09E-02 lincRNA Gm10619 ENSMUSG00000104693* 1.6 9.42E-02 sense
intronic RP23-103P11.1 ENSMUSG00000084274 1.6 1.20E-02 transcribed
processed Gm12504 pseudogene ENSMUSG00000103009 1.5 1.41E-03 TEC
Gm4430 ENSMUSG00000097960* 1.5 2.72E-02 lincRNA A330074K22Rik
ENSMUSG00000090222 1.5 4.69E-02 unprocessed pseudogene Gm16340
ENSMUSG00000047643 1.5 1.45E-02 processed pseudogene Gm5454
ENSMUSG00000106288 1.5 7.51E-02 TEC RP24-140D11.6
ENSMUSG00000087684 1.5 4.97E-04 lincRNA 1200007C13Rik
ENSMUSG00000093619 1.5 7.54E-03 antisense 4930535L15Rik
ENSMUSG00000067389* 1.5 2.84E-06 antisense Gm17080
ENSMUSG00000104973 1.5 9.91E-02 sense intronic RP23-357D17.3
ENSMUSG00000105324 1.5 8.13E-02 lincRNA RP23-229C5.1
ENSMUSG00000105107 1.5 7.62E-02 TEC RP23-21416.4 ENSMUSG00000052403
1.5 4.74E-02 antisense Fcnaos ENSMUSG00000104126 1.5 1.39E-02
processed pseudogene Gm37486 ENSMUSG00000101431 1.5 3.36E-02
processed pseudogene Gm7901 ENSMUSG00000089755 1.5 1.06E-02
antisense 0610012D04Rik ENSMUSG00000085836 1.5 8.30E-02 lincRNA
Gm13074 ENSMUSG00000067121 1.4 4.63E-08 processed pseudogene Gm7027
ENSMUSG00000102259 1.4 1.01E-02 TEC Gm38230 ENSMUSG00000104263 1.4
5.64E-02 TEC 9430062P05Rik ENSMUSG00000072962 1.4 4.79E-02
antisense Gm16401 ENSMUSG00000106028 1.4 1.83E-02 unprocessed
pseudogene RP23-20307.3 ENSMUSG00000087362 1.4 3.52E-02 lincRNA
Gm13710 ENSMUSG00000097194 1.4 6.75E-02 lincRNA 9330175E14Rik
ENSMUSG00000100147 1.4 9.87E-02 lincRNA 1700047M11Rik
ENSMUSG00000089776* 1.3 3.47E-02 antisense Gm15684
ENSMUSG00000067203* 1.3 4.25E-04 unprocessed pseudogene H2-K2
ENSMUSG00000100701 1.3 7.08E-03 processed pseudogene Gm19587
ENSMUSG00000079671 1.3 3.28E-02 processed transcript 2610203C22Rik
ENSMUSG00000046993 1.3 4.58E-02 processed pseudogene Gm5637
ENSMUSG00000103653 1.3 7.07E-02 processed pseudogene Gm3934
ENSMUSG00000097908 1.3 1.89E-04 lincRNA 4933404012Rik
ENSMUSG00000102813 1.3 1.76E-05 TEC Gm37795 ENSMUSG00000089817 1.2
1.84E-03 processed pseudogene Gm7162 ENSMUSG00000064281 1.2
1.37E-02 processed pseudogene Rp119-ps1 ENSMUSG00000097378 1.2
1.81E-02 lincRNA B230208H11Rik ENSMUSG00000085174 1.2 3.46E-02
antisense Gm16206 ENSMUSG00000074506 1.2 2.87E-02 processed
pseudogene Gm10705 ENSMUSG00000079491 1.2 7.50E-05 polymorphic
pseudogene H2-T10 ENSMUSG00000089769 1.2 8.31E-03 processed
pseudogene Gm16574 ENSMUSG00000084781 1.2 4.72E-02 processed
transcript D930015M05Rik ENSMUSG00000085558 1.2 5.40E-02 processed
transcript 4930412C18Rik ENSMUSG00000081684 1.2 1.48E-02 processed
pseudogene Rps2-ps13 ENSMUSG00000100158 1.2 5.33E-02 sense intronic
Gm28119 ENSMUSG00000093507 1.2 6.27E-02 processed transcript
Gm20627 ENSMUSG00000104000* 1.1 4.87E-02 lincRNA Gm38335
ENSMUSG00000096918 1.1 9.92E-02 lincRNA Gm16863 ENSMUSG00000086894
1.1 5.59E-02 sense intronic Gm15708 ENSMUSG00000101878 1.1 4.59E-03
processed pseudogene Gm8203 ENSMUSG00000092569 1.1 3.53E-02
processed transcript Gm20544 ENSMUSG00000104737* 1.1 6.02E-02 sense
intronic RP23-103P11.2 ENSMUSG00000085873 1.1 1.41E-03 antisense
Ttc39aos1 ENSMUSG00000086453 1.1 9.40E-02 antisense Gm11457
ENSMUSG00000073145 1.1 8.67E-02 antisense Gm12000
ENSMUSG00000082475 1.1 1.49E-02 processed pseudogene Gm7206
ENSMUSG00000106237 1.0 2.33E-02 lincRNA RP23-45G4.3
ENSMUSG00000097092 1.0 2.96E-02 lincRNA Gm26725 ENSMUSG00000097145
1.0 1.69E-03 lincRNA 9230114K14Rik ENSMUSG00000105742 1.0 4.97E-02
TEC RP24-347B12.1 ENSMUSG00000104913 1.0 1.20E-03 processed
pseudogene RP24-324L19.3
[0315] The distribution of lncRNA across chromosomes is further
presented in the Table below. The `Genome` column depicts the total
number of lncRNAs per chromosome according to GENCODE mV5
annotations; the `PyMT` column depicts differentially expressed
lncRNAs in MMTV-PyMT; the `Neu` column depicts the differentially
expressed lncRNAs in MMTV-Neu-NDL.
TABLE-US-00006 TABLE 6 Total and differential gene expression
across chromosomes Chr Genome PyMT Neu 1 3290 49 59 2 3093 36 35 3
2704 33 37 4 2356 33 44 5 2624 27 45 6 1524 25 27 7 2170 18 25 8
1045 10 17 9 1582 17 20 10 967 8 21 11 2436 34 34 12 756 15 8 13
794 18 21 14 885 10 10 15 727 9 8 16 824 11 9 17 1178 16 22 18 463
9 15 19 573 10 6 X 1970 13 20 Y 1417 0 0
[0316] Of the up-regulated lncRNAs, 30 transcripts were selected
for further evaluation based on their overexpression in at least 4
out of 5 sequenced PyMT organoid datasets as well as significant
upregulation in PyMT tumor sections. These transcripts were also
selected based on several stringest criteria: i) statistical
significance (FDR adjusted p-value <0.1; ii) at least two-fold
up-regulation in tumor organoids and/or tumor sections compared to
normal mammary organoids; iii) sufficient read coverage per
transcript to eliminate very lowly abundant RNAs; iv) human
conservation based on sequence and/or synteny; v) location in an
intergenic genomic region; and vi) lack of highly repetitive
elements. RNA-Seq data from MMTV-Cre; Flox-Neo-Neu-NT tumors, a
second model for the HER2/neu-amplified subtype of human breast
cancer, was also included to further refine the candidate lncRNAs.
In addition, transcripts of highest clinical value were selected
applying the following criteria: i) Up-regulation .gtoreq.2-fold
compared to WT mammary gland organoids, ii) statistical
significance (adjusted p-value <0.1), iii) intergenic location
in the genome, iv) lack of highly repetitive regions and v)
conservation in human based on sequence and/or synteny. These
transcripts were termed Mammary Tumor Associated RNA 1-30 (MaTAR
1-30). These MaTARs are further presented in the Table below.
[0317] The expression levels of MaTARs in mammary tumors to other
organs were compared by expression analysis of ENCODE datasets. The
results confirmed tissue-specific expression of lncRNAs. The
results indicated that 20 MaTARs show either exclusive expression
or strong upregulation in mammary tumors.
TABLE-US-00007 TABLE 7 MaTARs in all datasets MaTAR Ensembl ID Gene
Name Biotype 1 ENSMUSG00000050334 C130071CO3Rik lincRNA 2
ENSMUSG00000061852 Gm7582 unprocessed pseudogene 3
ENSMUSG00000097924 A730020E08Rik lincRNA 4 ENSMUSG00000087658
Hotairml, Gm15051, antisense Hoxaasl 5 ENSMUSG00000084328 Gm14046
processed pseudogene 6 ENSMUSG00000092171 4833427F1ORik lincRNA 7
ENSMUSG00000085399 Foxd2os, 9130206I24Rik processed transcript 8
ENSMUSG00000092569 Gm20544, 1ncRNA-Smad7 processed transcript 9
ENSMUSG00000046993 Gm5637 processed pseudogene 10
ENSMUSG00000082433 Gm9025, Ncf2-rs processed pseudogene 11
ENSMUSG00000086712 A1427809, LOC381524 lincRNA 12
ENSMUSG00000085541 Gm16010 antisense 13 ENSMUSG00000096802 Gm15433
processed pseudogene 14 ENSMUSG00000089652 Gm16025 lincRNA 15
ENSMUSG00000084289 Gm6977 processed pseudogene 16
ENSMUSG00000086249 Gm12724 processed transcript 17
ENSMUSG00000097908 4933404012Rik lincRNA 18 ENSMUSG00000085873
Ttc39aos1, Gm12750 antisense 19 ENSMUSG00000082088 Gm15753
unprocessed pseudogene 20 ENSMUSG00000087028 Gm13387 lincRNA 21
ENSMUSG00000082305 Gm2420 unprocessed pseudogene 22
ENSMUSG00000085295 4930430E12Rik antisense Naip3, Birc lc, EG667838
23 ENSMUSG00000082956 Naip3, Naip-r55 unprocessed pseudogene 24
ENSMUSG00000084274 Gm12504 transcribed processed pseudogene 25
ENSMUSG00000087684 1200007C13Rik lincRNA 26 ENSMUSG00000097378
B230208H11Rik lincRNA 27 ENSMUSG00000087235 Gm4750 transcribed
processed pseudogene 28 ENSMUSG00000087051 Gm12730 lincRNA 29
ENSMUSG00000095419 Gm14328 processed pseudogene 30
ENSMUSG00000074280 Gm6166 pseudogene
[0318] To further characterize MaTARs in the context of global gene
expression and to elucidate their potential as `driver genes` in
mammary carcinogenesis, weighed gene correlation network analysis
(WGCNA) (Langfelder and Horvath, BMC Bioinformatics 9: 559, 2008)
was performed. A full list of all MaTARs and their network modules
is provided in the Table below. Of the modules, the `mammary
epithelium` module is enriched for genes that are highly expressed
in our RNA-Seq datasets, both in normal mammary gland organoids as
well as mammary tumors. The module comprises 5,744 genes, of which
only 2,588 genes are classified as `protein coding`. The coding
potential of all MaTARs was tested using CPAT (Wang et al, 2013).
While 63% of the MaTARs were classified as non-coding, 37% were
predicted to be coding, attributed to the pseudogene fraction. This
emphasizes the tissue specificity of non-coding RNA species as well
as their potential functional role. MaTARs were further
characterized according to their total length and number of exons.
MaTARs range from 291-4,867 nucleotides with the majority of MaTARs
being shorted than 1,500 nucleotides.
[0319] Notably, 16 of the 17 MaTARs in the mammary epithelium
module were also highly expressed in tumor tissue compared to
normal organs. This indicates that MaTARs are excellent marker
genes and sufficient to stratify mammary epithelia from other
tissue types.
[0320] As presented in the Table below, `kTotal`=whole network
connectivity; `kWithin`=intramodular connectivity. Both values can
be used to identify hub genes; genes are likely hub genes if their
`kWithin` is high, i.e. close to the `KTotal` value. `Eigengene
corr`=Correlation of the respective MaTAR with the module
Eigengene. The Eigengene represents the first principal component
of the module. The closer this number is to 1, the higher the
correlation of a MaTAR and its eigengene, and the more likely that
the respective MaTAR is a hub gene. Positive values indicate
positive correlation, negative values indicate negative
correlation. `GO` means gene ontology. At least 6 MaTARs (MaTARS,
6, 9, 15, 16, and 30) fall into this region, indicating their
important within the module.
TABLE-US-00008 TABLE 8 Network modules of MaTARs MaTAR Tissue
expression GO terms kTotal kWithin Eigengene corr 1 CNS neuronal
development 1425 702 0.8 2 thymus/spleen immune system 579 62 0.8 3
CNS neuronal development 885 545 0.7 4 adult tissue metabolism 1023
528 -0.8 5 mammary epithelium epithelia 2350 1565 0.9 6 mammary
epithelium epithelia 2424 1615 0.9 7 adult tissue metabolism 699
252 -0.5 8 mammary epithelium epithelia 1311 770 0.7 9 mammary
epithelium epithelia 2768 1811 1.0 10 mammary epithelium epithelia
2120 1436 0.9 11 adult tissue metabolism 845 369 -0.7 12 mammary
epithelium epithelia 784 543 0.4 13 CNS neuronal development 768
312 -0.5 14 PyMT tumor odontogenesis 1371 156 0.9 15 mammary
epithelium epithelia 2925 1923 1.0 16 mammary epithelium epithelia
2518 1633 0.9 17 testis spermatogenesis 1562 1091 0.6 18 embryonic
liver cell cycle 742 74 -0.7 19 mammary epithelium epithelia 2190
1462 0.9 20 mammary epithelium epithelia 979 531 0.5 21 mammary
epithelium epithelia 1717 1131 0.8 22 mammary epithelium epithelia
1644 1132 0.8 23 colon/intestine digestion 442 47 0.9 24 mammary
epithelium epithelia 739 268 0.4 25 mammary epithelium epithelia
1599 1058 0.8 26 mammary epithelium epithelia 1006 522 0.5 27 CNS
neuronal development 1400 720 0.8 28 mammary epithelium epithelia
2308 1489 0.9 29 CNS/embryonic development, 618 44 0.7 liver
proliferation 30 mammary epithelium epithelia 3319 2178 1.0
Example 4: Antisense Inhibition of MaTARs in Primary Tumor
Cells
[0321] Based on the computational results, it was proposed that
MaTARs are driver genes in mammary cancer progression and/or
metastasis and thus, could serve as novel therapeutic targets. This
hypothesis was tested by performing antisense inhibition of MaTARs
with ISIS oligonucleotides.
[0322] Antisense inhibition of 14 MaTARs was performed in primary
MMTV-PyMT tumor cells to understand the role of MaTARs in mammary
cancer progression and/or metastasis. To investigate the functional
impact of MaTAR down-regulation on tumor cells, cell viability and
invasion assays were conducted.
[0323] To generate primary mammary tumor cells, organoids were
treated with 0.25% Trypsin and 0.1% EDTA in PBS for 5 min at
37.degree. C. To stop the reaction, 10 mL DMEM/F12 medium
supplemented with 10% FCS and 4 U/.mu.L of DNase I (Sigma) was
added and incubated for 15 min at 100 rpm and 37.degree. C. The
cell solution was spun down for 10 min at 520 g. The pellet was
resuspended in 10 mL DMEM/F12 with 10% FCS and 1%
penicillin/streptomycin and filtered via a 70 .mu.M cell strainer.
Three additional washing steps (centrifugation for 5 min at 520 g,
resuspension of the pellet in 10 mL DMEM/F12 with 10% FCS and 1%
penicillin/streptomycin) were performed. The final cell pellet was
resuspended and cultured in DMEM/F12 medium supplemented with 10%
FCS, 1% penicillin/streptomycin, and 5 .mu.g/mL insulin
(Sigma).
[0324] ISIS oligonucleotides tested in the assay, were designed as
5-10-5 MOE gapmers, and are 20 nucleosides in length, wherein the
central gap segment is comprised of ten 2'-deoxynucleosides and is
flanked on both sides (in the 5' and 3' directions) by wings
comprising 5 nucleosides each. Each nucleoside in the 5' wing
segment and each nucleoside in the 3' wing segment has a 2'-MOE
modification. The internucleoside linkages throughout the gapmer
are phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout the gapmer are 5-methylcytosines. The ISIS
oligonucleotide sequences are presented in the Table below. The
MaTARs targeted by the ISIS oligonucleotides are also shown in the
Table below. `scASO` is a control oligonucleotide that is a 5-10-5
MOE gapmer with no known murine target.
TABLE-US-00009 TABLE 9 ISIS oligonucleotides targeting MaTARS MaTAR
ISIS No. Sequence SEQ ID NO 1 710749 TTTATGCTGGGACTAGTGAC 157 3
710776 TAACTCACTAATTTGGTAAA 158 4 710763 CGTCACCTACACTGAGGAGC 159 5
710625 CTCAGAGCTCAAAAGTTTTC 160 6 710849 CAGGCCCACAGCAGGCTCAA 112 7
710716 TCCCTCTGAGATCAAGCGGC 161 8 710855 CGGGTTGCTTTAGAGTGTTC 162 9
714133 TGGAGCTGATGGGCTTTTTG 113 10 714110 GCTGCGAGCACCCCTTCATT 137
11 710707 CAGGATCTCTGATGTGCAGG 114 12 710814 GGGATGAGCTCAGCCGGATC
115 13 714039 TATCAGGGTAGGTATCACAT 116 14 714142
TGATGTCTCATGACTGAGAG 139 15 710700 CATTCAGGTAATGTGTCACA 163 16
710798 TAAAGATATTGTCCCGTTGG 117 17 710784 TTACCAATTGAGCGACATCT 118
18 710838 CCCACAGGAGTTAGGGCTGC 119 19 714079 CAGGTGAAGCCACTCCTGCT
164 20 710728 GCTGGTCCAGAGAGCTTTCC 120 21 710640
CAGGCCCAGCCAGGTGCTTA 165 22 710829 TACCTTGACATTCCATGTAG 121 23
714051 AAGAACTTTTTAATATATAG 166 24 710679 TGCTTTATCCCATTGCAAGC 150
25 710806 GAAACACCCAGGTCATCCAG 122 26 710752 TAGCTGATGTTGCTGTAGCT
123 27 714129 CTCATTGTACTGCTTGCTGA 167 28 710740
TCAATCTTACAACAGCAAAG 124 29 714102 AGTCTGGCTTGGCCATGGCA 168 30
714043 TGCTGGTGCTGGACCAGGGC 125 scASO 141923 CCTTCCCTGAAGGTTCCTCC
126
Antisense Inhibition
[0325] MMTV-PyMT primary cells were seeded at a density of 20,000
cells/well into 96-well plates. Transfection-free uptake of
oligonucleotide was accomplished by adding 5 .mu.M of either a
MaTAR-specific oligonucleotide or the scASO to the primary cell
culture medium immediately after seeding the cells. Cells were
incubated for 24 hours at 37.degree. C. and RNA was isolated using
the RNeasy 96 kit (Qiagen), according to the manufacturer's
instructions. RNA samples were used directly in a one-step 384-well
qRT-PCR (QuantiTect SYBR Green RT-PCR Kit, Qiagen) on an Applied
Biosystems 7900HT Fast Real-Time PCR System (Thermo Fisher
Scientific). The results are presented in the Table below, and
indicate knockdown efficiencies ranging from 38% for MaTAR26 to 89%
for MaTAR13 after 24 hours.
TABLE-US-00010 TABLE 10 Antisense inhibition of MaTARs in primary
MMTV-PyMT cells MaTAR ISIS No % inhibition 1 710749 64 3 710776 51
4 710763 32 5 710625 47 6 710849 69 7 710716 68 8 710855 72 9
714133 55 10 714110 61 11 710707 74 12 710814 69 13 714039 89 14
714142 68 15 710700 45 16 710798 47 17 710784 53 18 710838 52 19
714079 68 20 710728 72 21 710640 65 22 710829 54 23 714051 51 24
710679 57 25 710806 64 26 710752 38 27 714129 97 28 710740 69 29
714102 61 30 714043 55
Cell Viability
[0326] MMTV-PyMT primary tumor cells were seeded at a density of
10,000 cells/well into 96-well plates and treated with 5 .mu.M of
either a MaTAR-specific ISIS oligonucleotide or scASO. Cells were
grown for 72 hours at 37.degree. C. MTT solution at 10 .mu.L volume
(Cell Growth Determination Kit, MTT based; Sigma) was added to the
wells and incubated for 4 hours at 37.degree. C. Next, 100 .mu.L
MTT solvent was added directly to the wells to ensure total
solubility of the formazan crystals and incubated for 10 min with
shaking. Measurements of absorbance at 570 nm were performed using
a SpectraMax i3 Multi-Mode Detection Platform (Molecular Devices).
Background absorbance at 690 nm was subtracted. Percent viability
in the ISIS oligonucleotide-treated wells was calculated as a
percentage of the control. Significant changes were defined as a
consistent reduction .gtoreq.25% of viability or invasion compared
to untreated control cells. The results indicated that knockdown of
MaTAR12 lead to a 50% decrease in cell viability. Additionally,
inhibition of MaTAR11, 18, and 20 also had a 20-30% decrease in
cell viability. There was no effect on cell viability with the
scASO.
[0327] To confirm the results obtained with the MTT assay, protease
activity within living cells was measured separately on a subset of
the MaTARs and similar results were obtained.
TABLE-US-00011 TABLE 11 Cell viability (% untreated control) after
antisense inhibition of MaTARs MaTAR ISIS No % viability 1 710749
117 3 710776 99 4 710763 108 5 710625 98 6 710849 77 7 710716 93 8
710855 101 9 714133 88 10 714110 86 11 710707 75 12 710814 49 13
714039 100 14 714142 105 15 710700 105 16 710798 101 17 710784 87
18 710838 73 19 714079 95 20 710728 70 21 710640 94 22 710829 95 23
714051 103 24 710679 102 25 710806 106 26 710752 90 27 714129 102
28 710740 104 29 714102 83 30 714043 81
Invasion Potential
[0328] The invasion potential of MMTV-PyMT primary tumor cells was
assessed using the QCM 96-well Invasion Assay Kit (ECM555;
Millipore). Cells were starved in DMEM/F12 serum-free medium for 24
hours, then harvested and seeded at a density of 1.times.10.sup.5
cells/well into the invasion chamber. MaTAR-specific ISIS
oligonucleotide or scASO at 5 .mu.M was added to the growth medium.
The plate was incubated at 37.degree. C. for 24 hours and the assay
was performed according to the manufacturer's instructions.
Briefly, the tumor cells that invaded the ECM layer and attached to
the bottom of the invasion chamber were collected using cell
detachment solution and lysed in 1: 75 CyQuant GR dye lysis buffer.
As a negative control, serum-free medium was used that did not
stimulate cell invasion through the ECM. 150 .mu.L of cell lysates
were transferred to a new 96-well plate and the fluorescence was
measured with a SpectraMax i3 Multi-Mode Detection Platform
(Molecular Devices) using the 480 nm/520 nm filter set. The results
are presented in the Table below. Significant reduction of tumor
cell invasion upon antisense inhibition of MaTAR13 (49% inhibition)
and MaTAR9 (36% inhibition) was detected. Furthermore, 25-45%
reduction of invasive potential was observed upon independent
knockdown of 15 candidates; MaTAR8, 9, 13, 14, 15, 16, 17, 19, 20,
21, 23, 24, 25, 28, and 29.
TABLE-US-00012 TABLE 12 Invasive potential (% control) after
antisense inhibition of MaTARs MaTAR % invasion 25 55 16 58 21 59
24 60 23 65 15 65 17 65 9 65 20 68 8 69 13 70 29 70 19 72 14 74 28
75 7 79 30 82 22 83 11 87 10 88 18 88 3 88 27 94 5 95 26 95 6 101 4
102 1 111 12 121 scASO 77 Serum-free control 14
[0329] While 9 of the 14 tested MaTARs seem to impact either the
viability or the invasive potential of mammary tumor cells,
indicating specific roles of the different non-coding transcripts
in cellular processes, two MaTARs (11 and 20) show effects in both
assays. Viability and invasion potential also correlated well with
knockdown efficiency of the ISIS oligonucleotides. The data is
summarized in the Table below. Reduction of viability, invasive
potential or branching of >25% compared to untreated cells is
defined as a significant difference and is marked with an asterisk.
These results also confirm that the initial computational selection
of up-regulated lncRNAs indeed identified transcripts that have the
potential to act as driver genes in tumor progression.
TABLE-US-00013 TABLE 13 Observed effects after antisense inhibition
of MaTARs Viability Invasion Branching MaTAR1 117 111 99 MaTAR3 99
88 83 MaTAR4 108 102 88 MaTAR5 98 95 83 MaTAR6 77* 101 75* MaTAR7
93 79* 87 MaTAR8 101 69* 87 MaTAR9 88 65* 82 MaTAR10 86 88 78
MaTAR11 75 87 72 MaTAR12 49* 121 50* MaTAR13 100 70* 80 MaTAR14 105
74* 81 MaTAR15 105 65* 85 MaTAR16 101 58* 62* MaTAR17 87 65* 61*
MaTAR18 73* 88 60* MaTAR19 95 72* 71* MaTAR20 70* 68* 68* MaTAR21
94 59* 86 MaTAR22 95 83 83 MaTAR23 103 65* 84 MaTAR24 102 60* 86
MaTAR25 106 55* 56* MaTAR26 90 95 65* MaTAR27 102 94 77 MaTAR28 104
75* 57* MaTAR29 83 70* 78 MaTAR30 81 82 85
Example 5: Effect of Antisense Inhibition of MaTARs in
Organoids
[0330] To further elucidate the functional role of MaTARs in a more
physiological context, antisense inhibition was performed in
mammary tumor organoids (Barcellos-Hoff et al, Development 105:
223-235, 1989; Fata et al, Dev. Biol. 306: 193-207, 2007; Ewald et
al, Dev. Cell 14: 570-581, 2008; Nguyen-Ngoc et al, Proc. Natl.
Acad. Sci. USA 109: E2595-604, 2012). Organoids mimic aspects of
the three-dimensional organization of an organ more closely than
individual cells cultured in two-dimension.
[0331] Organoids were prepared and cultured as described in the
Examples above. ISIS oligonucleotides tested in the assay, were
designed as 5-10-5 MOE gapmers, and are 20 nucleosides in length,
wherein the central gap segment is comprised of ten
2'-deoxynucleosides and is flanked on both sides (in the 5' and 3'
directions) by wings comprising 5 nucleosides each. Each nucleoside
in the 5' wing segment and each nucleoside in the 3' wing segment
has a 2'-MOE modification. The internucleoside linkages throughout
the gapmer are phosphorothioate (P.dbd.S) linkages. All cytosine
residues throughout the gapmer are 5-methylcytosines. The ISIS
oligonucleotide sequences are presented in the Table below. The
MaTARs targeted by the ISIS oligonucleotides are also shown in the
Table below. For some MaTARs, multiple ISIS oligonucleotides were
designed to different regions of the transcript.
TABLE-US-00014 TABLE 14 ISIS oligonucleotides tested in mammary
tumor organoids ISIS SEQ ID MaTAR No. sequence NO 1 710743
AAAGCCATCGGCAGTTTCCA 127 3 710773 AGTCCTGCTCGGCATGAATT 128 4 710765
GAAACCTCGGACTTTATTCA 129 5 710631 TTAGAGTTGTTCACAGTCGG 130 6 710845
CTGGAGGAGGAACAGTTTCA 131 7 710712 TGTAGCCACTGCCACCACCA 132 710719
ACCCATTGCTTCTGAGCAGA 133 8 710856 CCTTTCTAAGATGACACATT 134 710858
ACATTAGGAGGCCAACTCAG 135 9 714132 CCGGAGGATGACCAGTGTGG 136 10
714110 GCTGCGAGCACCCCTTCATT 137 11 710707 CAGGATCTCTGATGTGCAGG 114
12 710814 GGGATGAGCTCAGCCGGATC 115 13 714039 TATCAGGGTAGGTATCACAT
116 714040 AAGGGTACAGTTTGCTCTGC 138 14 714142 TGATGTCTCATGACTGAGAG
139 15 710697 GTTGGTTCTGCAGCTTTATC 140 16 710795
CTTTCACACTGGGTGAGTAT 141 710797 CACTTCCAGTAAGATTACAT 142 710798
TAAAGATATTGTCCCGTTGG 117 17 710783 CATCTTCAAAGGCAACTGGC 143 710784
TTACCAATTGAGCGACATCT 118 18 710833 CTGGCATAGCTGCAGGCAAA 144 710836
TTCAAGCCCATATGTGAGGC 145 710838 CCCACAGGAGTTAGGGCTGC 119 19 714077
TGCAGCCAGGGAGAGGCACA 146 20 710728 GCTGGTCCAGAGAGCTTTCC 120 21
710635 GCTGCTTCCTCTGCCAGAAG 147 22 710828 TTGTCCATAGGTTCAGAGGT 148
23 714057 CAGGACCCATAGTGGTTTGC 149 24 710679 TGCTTTATCCCATTGCAAGC
150 25 710804 GAGTCTGGACACATGATACT 151 26 710752
TAGCTGATGTTGCTGTAGCT 123 710759 GCCTCAAGTTTACCAGTAGG 152 710761
CCCCAAGACATTATTTAAGG 153 27 714128 AGCCACTGATCCATTTATTG 154 28
710740 TCAATCTTACAACAGCAAAG 124 710741 GTGGATCTTGGATTGGCTGC 155 29
714107 TCCCATTGCTGGTGCTGGAC 156 30 714043 TGCTGGTGCTGGACCAGGGC 125
scASO 141923 CCTTCCCTGAAGGTTCCTCC 126
[0332] Organoids were seeded at a density of 5 organoids/4 and
plated as 80 .mu.L domes in Cellstar 24-well dishes (Greiner Bio
One). Transfection-free uptake of ISIS oligonucleotides was
accomplished by adding 4 .mu.M of either a MaTAR-specific
oligonucleotide or scASO to the organoid medium 15-20 min after the
organoids were plated in the matrigel domes. Organoids were
incubated for 6 days at 37.degree. C. and both medium and
oligonucleotide were replenished at day 3. Knockdown efficiencies
in the organoids ranged from 30-68% after 6 days of treatment. The
results are presented in the Table below.
TABLE-US-00015 TABLE 15 Antisense inhibition of MaTARs in mammary
tumor organoids MaTAR % inhibition 1 34 3 44 4 30 5 49 6 42 7 52 8
67 9 53 10 56 11 68 12 50 13 66 14 55 15 36 16 48 17 51 18 47 19 50
20 50 21 64 22 48 23 46 24 37 25 46 26 43 27 60 28 61 29 50 30
34
[0333] Culturing organoids for several days also allowed
observation of phenotypic changes caused by the knockdown.
Untreated MMTV-PyMT organoids, as well as organoids treated with
scASO, generally exhibited branching in about 70-75% of all
organoids. Treatment with ISIS oligonucleotides resulted in a
decrease by 25-50% in branching morphogenesis for MaTAR6, 11,
MaTAR12, 16, 17, 18, 19, 20, 25, 26, and 28. There was also a
decrease of 20-30% for MaTAR6, 10, 11, 19, 27, and 29. The results
are presented in the Table below. The mean of two biological
replicates is shown; the total number of assayed organoids per
treatment was 200.
[0334] Many of the MaTARs that interfered with cell viability
and/or invasion in 2D assays also inhibited branching defects in
the organoids. For instance, antisense inhibition of MaTAR17 and
MaTAR28 caused a reduction in organoid branching and both
transcripts demonstrate a role in invasion in 2D culture (as shown
in Tables 9 and 10).
TABLE-US-00016 TABLE 16 Quantification of tumor organoid branching
in mammary tumor organoids % branched organoids Untreated cells 73
scASO 70 MaTAR12 37 MaTAR25 41 MaTAR28 42 MaTAR18 44 MaTAR17 45
MaTAR16 46 MaTAR26 47 MaTAR20 50 MaTAR19 52 MaTAR11 53 MaTAR6 55
MaTAR27 56 MaTAR10 57 MaTAR29 57 MaTAR13 59 MaTAR14 59 MaTAR9 60
MaTAR5 60 MaTAR22 61 MaTAR3 61 MaTAR23 61 MaTAR30 62 MaTAR15 62
MaTAR24 63 MaTAR21 63 MaTAR7 63 MaTAR8 64 MaTAR4 65 MaTAR1 72
[0335] Further studies were conducted with antisense inhibition of
MaTAR16 (ENSMUSG00000086249, Gm12724), MaTAR18 (ENSMUSG00000085873,
Ttc39aos1), and MaTAR26 (ENSMUSG00000097378, B230208H11Rik). The
three lncRNA represent different gene biotypes; MaTAR16 is
classified as `processed transcript`, MaTAR18 as `antisense`, and
MaTAR26 as `lincRNA`. Both MaTAR16 and MaTAR26 are part of the
"mammary epithelium" module, while MaTAR18 resides in another
highly interesting module that is comprised of the gene-expression
signature for embryonic stem cells and embryonic liver. Knockdown
experiments were performed with three different ISIS
oligonucleotides for each transcript to ensure that the observed
phenotypes were not caused by off-target effects. Treatment with
ISIS oligonucleotides followed the same protocol as described
above. The potency of each ISIS oligonucleotide is presented in the
Table below.
[0336] Phenotypes of the organoids after treatment with the two
most potent ISIS oligonucleotides per transcript are shown in
comparison to organoids that were either untreated or treated with
scASO (FIG. 1). Knockdown of MaTAR16 and MaTAR26 completely
abolished organoid branching, while down-regulation of MaTAR18
resulted in organoids without defined branches and only tiny
protrusions. In addition, it was observed that organoids treated
with ISIS oligonucleotides targeting MaTAR16 were smaller than
untreated or scASO-treated organoids. Individual knockdown
efficiencies correlate well with the quantitation of branching, as
shown in the Table below. Compared to untreated controls, there was
reduction in branching of 48% for MaTAR16, 40% for MaTAR18, and 35%
for MaTAR26, with the most potent ISIS oligonucleotide,
respectively.
TABLE-US-00017 TABLE 17 Effectof inhibition of MaTARs on branching
% % branched ISIS No inhibition organoids MaTAR16 710797 24 60
710795 47 47 710798 61 39 MaTAR18 710833 33 62 710836 51 43 710838
68 45 MaTAR26 710761 32 59 710752 41 44 710759 41 46
[0337] To further support the role of MaTAR16, MaTAR18, and MaTAR26
as key genes in tumor progression, antisense inhibition of these
MaTARs was performed in control organoids derived from WT
nulliparous mammary glands. Antisense inhibition of each MaTAR is
presented in the Table below. Knockdown efficiencies of the ISIS
oligonucleotides were comparable to that in tumor organoids.
However, there was no observed loss of branching in the normal
mammary gland organoids after ISIS oligonucleotide treatment,
strongly indicating the cancer-specific role of these three lncRNAs
(FIG. 2). In addition, this experiment served as another control,
confirming that the observed reduction in branching morphogenesis
of tumor organoids is not due to ASO-induced toxicity or off-target
effects.
[0338] Data on branching quantitation is also presented in the
Table below. The mean of three biological replicates is shown; the
total number of assayed organoids per treatment was 300. Branching
in untreated organoids was 67% and in scASO-treated organoids was
57%.
TABLE-US-00018 TABLE 18 Effectof inhibition of MaTARs on branching
in normal mammary organoids % % branched ISIS No inhibition
organoids MaTAR16 710795 60 46 710798 50 51 MaTAR18 710836 44 54
710838 30 50 MaTAR26 710752 40 49 710759 38 49
[0339] In order to exclude the possibility that the results were
dependent on the genomic background of the mice, these findings
were confirmed in organoids derived from C57/Bl6 MMTV-PyMT mice.
Knockdown efficiencies and branching quantification in that model
are presented in the Table below and FIG. 3. The mean of three
biological replicates is shown; totally number of assayed organoids
per treatment was 300. The results indicate that treatment with
ISIS oligonucleotides resulted in very similar phenotypes for
MMTV-PyMT organoids generated from both FVB and C57/Bl6
backgrounds.
TABLE-US-00019 TABLE 19 Effectof inhibition of MaTARs in C57/B16
MMTV-PyMT mammary organoids % % branched ISIS No inhibition
organoids MaTAR16 710795 50 47 710798 41 46 MaTAR18 710836 43 44
710838 43 47 MaTAR26 710752 43 51 710759 39 46
Example 6: Identification of Human Orthologs of MaTAR Genes
[0340] To confirm the relevance of MaTARs in breast cancer, the
human orthologs of many of the MaTAR genes were identified.
[0341] Mouse and human transcripts were compared on the level of
both sequence conservation and genomic location. If the mouse MaTAR
sequence matched an annotated human gene using BLAT (BLAST-like
alignment tool), the respective transcript was defined as the human
counterpart of the mouse MaTAR. Since many non-coding RNAs are
conserved between different species on the level of genomic
location rather than based on sequence, the analysis was extended
to synteny by analyzing the neighboring genes of each hMaTAR gene.
The complete list of the genomic location of potential human MaTARs
(hMaTARs) are provided in the Table below. Many hMaTARs are located
in clusters of two or more non-coding genes in the genome,
resulting in a total of 41 identified potential hMaTARs. `r.i.`
indicates a retained intron; `p.t.` indicates a processed
transcript.
TABLE-US-00020 TABLE 20 Potential human counterparts of MaTARs
(hMaTARs) Human Human Human gene Mouse counterpart counterpart
location SEQ ID MaTAR gene name (seq, hg38) (synteny, hg38) (hg38)
NOs MaTAR1 C130071CO3Rik LINC00461 LINC00461 chr5: 88540779- 1
88684803 (-) MaTAR2 Gm7582 FAM96B -- chr16: 66932055- 2 66934423
(-) MaTAR3 A730020E08Rik AF065393.1 un-annotated sequence chr4:
90121784- 3 upstream of Ccserl 90121954 (-) (seq and synteny)
MaTAR4 Hotairm1, HOTAIRM1 HOTAIRM1 chr7: 27096094- 4 Gm15051,
27100258 (+) Hoxaas1 MaTAR5 Gm14046 PPIAP22 -- chr21: 18857779- 5
18858276 (+) MaTAR6 4833427F10Rik HCG20 cluster of lncRNAs in chr6:
30766825- 6-7 both mouse and 30792250 (+), human. HCG20 or chr6:
30812866- LINC00243 30830659 (-) MaTAR7 Foxd2os, FOXD2-AS1 -- chr1:
47432133- 8 9130206I24Rik 47434641 (-) MaTAR8 Gm20544, --
un-annotated sequence chr18: 48955665- 9-10 lncRNA-Smad7 upstream
of Smad7 48956059 (+) (seq and synteny); alternatively: RP11-
1058N17.1 MaTAR9 Gm5637 ARPC1B r.i./ -- chr7: 99374675- 11-12 p.t.,
PDAP1 99394781 (+), chr7: 99394676- 99408682 (-) MaTAR10 Gm9025,
NCF2 cluster of many chr1: 183555563- 13-17 Ncf2-rs lncRNAS
upstream of 183590876 (-) MAP3K1, most likely: RPL26P19 MaTAR11
AI427809, -- un-annotated sequence chr9: 104927553- 18 LOC381524
upstream of ABCA1 104928892 (+) within a cluster of non- coding
RNAs, most likely: RP11-217B7.2 MaTAR12 Gm16010 -- un-annotated
sequence chr3: 141050613- 19-20 upstream/exonl of 141052013 (-),
SPSB4; alternatively: chr3: 141115124- RP11-231L11.1 141124182 (-)
MaTAR13 Gm15433 -- AC009950.2 chr2: 230125310- 21 230167494 (+)
MaTAR14 Gm16025 SP140 r.i. -- chr2: 230309741- 22-23 230311581 (-),
chr2: 230401360- 230401793 (-) MaTAR15 Gm6977 FTH1P8 cluster of
non-coding chrX: 148052233- 24-26 RNAs and 148052746 (+),
retrotransposons chrX: 30290047- downstream of 30290351 (-) MAGEB1,
most likely: GS1-383H3.7 MaTAR16 Gm12724 -- RP11-101C11.1 chr1:
55217861- 27-28 55234177 (+) MaTAR17 4933404O12Rik AF065393.1
RP11-132A1.4 chr7: 101308346- 29-31 101310985 (+) MaTAR18
Ttc39aos1, TTC39A- TTC39A-AS1 chr1: 51329654- 32 Gm12750 AS1
51331281 (+) MaTAR19 Gm15753 -- RP11-44M6.1 chr7: 100509717- 33
100519926 (+) MaTAR20 Gm13387 -- RP13-122B23.8 chr9: 137293868-
34-35 137295721 (-) MaTAR21 Gm2420 SFI1 r.i./p.t. -- chr22:
31617011- 36 31617070 (+) MaTAR22 4930430E12Rik -- RP11-114M5.3
chr8: 58503588- 37 58504068 (+) MaTAR23 Naip3, Birc1c, NAIP --
chr5: 70968483- 38 EG667838, 71025114 (-) Naip-r55 MaTAR24 Gm12504
PTMAP5 HMGB3P24 chr13: 81689911- 39-40 81691072 (+), chr9:
36303499- 36304924 (-) MaTAR25 1200007C13Rik -- cluster of
four/three chr20: 50310711- 41-43 lncRNAs in both 50321342 (-),
mouse and human. chr20: 50292720- LINC01271, 50314922 (+),
LINC01270 or chr20: 50267486- LINC01272 50279795 (+) MaTAR26
B230208H11Rik -- un-annotated sequence chr6: 144200447- 44-46
downstream of STX11 144200965 (-), (seq and synteny), chr6:
144257034- alternatively: TPT1P4 144257624 (-) or RP1-91J24.1
MaTAR27 Gm4750 ACTB AC234031.1 chr7: 5527155- 47-48 5529569 (-),
chrX: 53001527- 53001617 (+) MaTAR28 Gm12730 -- RP11-101C11.1 or
chr1: 55217861- 49-51 GYG1P3 55234177 (+), chr1: 55222379- 55223372
(+) MaTAR29 Gm14328 -- RP11-699C17.1 chr18: 50256036- 52-53
50256461 (-) MaTAR30 Gm6166 -- RP11-151H2.3 chr15: 74976240- 54-56
74976573 (-)
[0342] To evaluate the expression status of the potential hMaTARs,
RNA-seq data of The Cancer Genome Atlas (TCGA) was analyzed by
comparing breast tumors to matched normal tissues of 103
individuals. The analysis was performed on the Cancer Genomics
Cloud hosted by Seven Bridges Genomics (http://www.sbgenomics.com).
Raw RNA-seq reads were mapped to hg38 and counted. The GENCODE v24
GTF was used as a reference. For each individual, the tumor and
matched normal sample datasets were analyzed independently. Fold
changes calculated for individuals were averaged and statistical
significance was calculated using Wilcoxon rank tests; p-values
were adjusted using the Benjamini & Hochberg method.
[0343] Out of 41 hMaTARs, there was differential gene expression
observed in 40, as shown in the Table below. hMaTAR3 was dropped
out due to insufficient read coverage (denoted as na). Notably, at
least 28 hMaTARs were found to be up-regulated in breast tumors, 19
of these with high statistical significance (adj. p0.05),
confirming the results from the initial RNA-seq screen in mouse
models that identified multiple lncRNAs as potentially clinically
relevant. `log 2FC` indicates a log 2-fold change in an average of
103 patients; `DE` indicates differential gene expression; `adj.
p-value` indicates Wilcoxon rank sum test, p-value adjusted using
the Benjamini & Hochberg method.
TABLE-US-00021 TABLE 21 Differential expression of hMaTARs in
breast tumors compared to normal tissue hMaTAR Gene ID Ensembl ID
log2FC DE adj. p-value hMaTAR1 LINC00461 ENSG00000245526 0.81 1.76
6.40E-05 hMaTAR2 FAM96B ENSG00000166595 0.14 1.10 2.75E-02 hMaTAR3
AF065393.1 ENSG00000274152 na na na hMaTAR4 HOTAIRM1
ENSG00000233429 -1.42 0.37 6.70E-15 hMaTAR5 PPIAP22 ENSG00000198618
0.72 1.65 1.78E-15 hMaTAR6.1 HCG20 ENSG00000228022 0.23 1.17
1.14E-02 hMaTAR6.2 L1NC00243 ENSG00000214894 1.03 2.04 1.60E-08
hMaTAR7 FOXD2-AS1 ENSG00000237424 0.54 1.45 2.29E-07 hMaTAR8
RP11-1058N17.1 ENSG00000266905 0.03 1.02 1.00E+00 hMaTAR9 PDAP1
ENSG00000106244 0.40 1.32 4.02E-09 hMaTAR10.1 NCF2 ENSG00000116701
0.44 1.35 7.94E-04 hMaTAR10.2 RPL26P19 ENSG00000226221 -0.43 0.74
9.44E-07 hMaTAR11 RP11-217B7.2 ENSG00000226334 -0.39 0.76 1.85E-04
hMaTAR12.1 SPSB4 ENSG00000175093 0.03 1.02 1.00E+00 hMaTAR12.2
RP11-231L11.1 ENSG00000251270 -0.03 0.98 1.00E+00 hMaTAR13
AC009950.2 ENSG00000225963 -0.11 0.93 8.49E-01 hMaTAR14 SP140
ENSG00000079263 0.74 1.67 2.58E-08 hMaTAR15.1 FTH1P8
ENSG00000219507 0.10 1.07 1.69E-01 hMaTAR15.2 GS1-383H3.7
ENSG00000270794 0.05 1.03 4.85E-02 hMaTAR16 RP11-101C11.1
ENSG00000231090 0.02 1.01 7.40E-01 hMaTAR17.1 AZGP1P2
ENSG00000214252 0.22 1.16 8.88E-01 hMaTAR17.2 RP11-132A1.4
ENSG00000232445 0.90 1.87 3.09E-07 hMaTAR18 TTC39A-AS1
ENSG00000261664 0.62 1.54 2.16E-03 hMaTAR19 RP11-44M6.1
ENSG00000225807 -0.32 0.80 7.49E-07 hMaTAR20 RP13-122B23.8
ENSG00000260996 0.38 1.30 2.26E-05 hMaTAR21 SFI1 ENSG00000198089
0.29 1.22 2.87E-03 hMaTAR22 RP11-114M5.3 ENSG00000254103 -0.07 0.95
8.20E-02 hMaTAR23 NAIP ENSG00000249437 0.09 1.07 1.00E+00
hMaTAR24.1 PTMAP5 ENSG00000214182 0.47 1.38 2.46E-08 hMaTAR24.2
HMGB3P24 ENSG00000215283 -0.16 0.90 7.66E-02 hMaTAR25.1 LINC01270
ENSG00000203999 0.33 1.25 3.14E-02 hMaTAR25.2 LINC01271
ENSG00000233077 0.25 1.19 9.42E-03 hMaTAR25.3 L1NC01272
ENSG00000224397 0.24 1.18 1.12E-01 hMaTAR26.1 TPT1P4
ENSG00000217027 -0.71 0.61 3.27E-09 hMaTAR26.2 RP1-91J24.1
ENSG00000216475 -0.08 0.95 2.83E-01 hMaTAR27.1 ACTB ENSG00000075624
0.45 1.37 1.36E-08 hMaTAR27.2 AC234031.1 ENSG00000278536 0.00 1.00
1.00E+00 hMaTAR28.1 RP11-101C11.1 ENSG00000231090 0.02 1.01
7.40E-01 hMaTAR28.2 GYG1P3 ENSG00000231095 0.05 1.03 2.66E-01
hMaTAR29 RP11-699C17.1 ENSG00000277310 0.33 1.26 2.97E-04 hMaTAR30
RP11-151H2.3 ENSG00000261813 -0.02 0.99 1.00E+00
[0344] Further investigation was conducted on whether hMaTARs are
expressed in subtype-specific manner by analyzing all TCGA breast
tumor samples with subtype information (463 datasets). The analysis
of raw RNA-Seq reads was performed as described above. Transcript
abundances were quantified using RSEM quantification suite (li and
Dewey, 2011) with default parameters. For each resultant RNA
expression profile, normalized read counts of individual genes were
obtained by applying the DESeq normalization implemented in the
DESeq Bioconductor package. Genes whose median expression count
across profiles was zero were excluded from further consideration.
Kruskal-Wallis non-parametric test was used to assess differential
expression for each of the remaining genes and for three different
data partitions: by molecular subtype, by the estrogen receptor
status, and by the progesterone receptor status.
[0345] Of the 19 up-regulated hMaTARs, 11 had significantly
different expression (q<5.00E-11, same range as PAM50 genes
(Parker et al, 2009)) among the five TCGA subtypes "basal",
"Her2-amplified", "luminal A", "luminal B", and "normal-like". The
results are presented in the Tables below. `Subtype` indicates the
correlation with breast cancer subtype, q-values were determined by
Kruskal-Wallis test; `ER` indicates the correlation with the
estrogen receptor status, q-values were determined by Wilcoxon
test; `PR` indicates correlation with the progesterone receptor
status, q-values were determined by Wilcoxon test. A decimal point
and number after each MaTAR signifies that there is more than one
possible ortholog for that MaTAR.
TABLE-US-00022 TABLE 22 Correlation of hMaTAR expression and breast
cancer subtype or hormone receptor status hMaTAR Ensembl ID Subtype
q-value ER q-value PR q-value hMaTAR1 ENSG00000245526 1.80E-17
4.46E-11 3.98E-11 hMaTAR2 ENSG00000166595 2.60E-11 1.47E-06
5.64E-07 hMaTAR4 ENSG00000233429 1.77E-24 6.88E-07 2.02E-04
hMaTAR6.1 ENSG00000228022 4.03E-10 1.43E-07 2.06E-04 hMaTAR6.2
ENSG00000214894 3.46E-15 1.10E-11 4.64E-04 hMaTAR7 ENSG00000237424
1.71E-06 1.03E-01 8.10E-02 hMaTAR9 ENSG00000106244 6.63E-09
8.09E-08 4.88E-06 hMaTAR10.1 ENSG00000116701 5.47E-07 3.07E-03
9.89E-02 hMaTAR11 ENSG00000226334 4.11E-03 5.26E-02 2.44E-01
hMaTAR12.1 ENSG00000175093 3.70E-06 1.94E-02 2.12E-01 hMaTAR13
ENSG00000225963 5.41E-05 4.76E-03 2.56E-02 hMaTAR14 ENSG00000079263
2.37E-07 6.56E-05 2.43E-03 hMaTAR17.2 ENSG00000232445 2.81E-11
5.86E-08 5.13E-04 hMaTAR18 ENSG00000261664 5.54E-37 2.88E-29
1.46E-17 hMaTAR20 ENSG00000260996 2.06E-10 4.93E-07 9.96E-05
hMaTAR21 ENSG00000198089 5.84E-23 1.03E-21 5.66E-15 hMaTAR23
ENSG00000249437 1.76E-12 1.11E-15 5.48E-10 hMaTAR25.1
ENSG00000203999 1.62E-07 6.06E-06 1.03E-02 hMaTAR25.2
ENSG00000233077 1.25E-06 1.91E-04 6.48E-02 hMaTAR25.3
ENSG00000224397 1.14E-26 3.11E-16 3.79E-10 hMaTAR27.1
ENSG00000075624 1.25E-11 9.31E-11 4.80E-05 hMaTAR29 ENSG00000277310
3.01E-17 1.98E-14 1.55E-13
TABLE-US-00023 TABLE 23 Expression levels (log) of hMaTARs Basal
Her2 LumA LumB Normal ENSG00000245526 4.1 1.4 0.0 1.0 1.0 (hMaTAR1)
ENSG00000233429 6.1 4.5 5.1 4.2 6.2 (hMaTAR4) ENSG00000214894 1.8
3.5 3.5 3.1 3.6 (hMaTAR6.2) ENSG00000261664 2.8 4.9 5.9 5.7 5.3
(hMaTAR18) ENSG00000198089 9.0 9.3 9.8 9.9 9.5 (hMaTAR21)
ENSG00000224397 7.3 7.0 5.0 6.1 6.4 (hMaTAR25.3) ENSG00000075624
17.6 17.6 17.2 17.1 17.3 (hMaTAR27.1) ENSG00000277310 1.1 1.7 2.4
2.1 1.3 (hMaTAR29)
[0346] In addition, hMaTAR4 and hMaTAR23 showed strong
subtype-specificity, indicating that these lncRNAs may be
clinically relevant in certain subtypes despite not being
significantly up-regulated across the board, as shown in Table
21.
[0347] hMaTAR1 lncRNA was up-regulated the most in the original
screen (Tables 4 and 5) by 80- and >100-fold in Her2-amplified
and PyMT tumors, respectively). hMATAR1 is also significantly
over-expressed in breast tumors compared to normal breast tissue
(Table 21). This analysis was confirmed using previously published
TCGA datasets (Yan et al, 2015). A slight, but significant
up-regulation was also detected in kidney carcinoma as well as
substantial over-expression in lung squamous cell carcinoma, as
shown in the Table below. FDR<0.00001; KIRC=kidney renal clear
cell carcinoma; BRCA--breast invasive carcinoma; LUSC=lung squamous
cell carcinoma.
TABLE-US-00024 TABLE 24 Expression fold-change compared to normal
of hMATAR1 published TCGA RNA-seq datasets Cancer type Fold-change
KIRC 0.08 BRCA 5.26 LUSC 5.88
[0348] Moreover, statistically significant differences in the
expression levels of hMaTAR1 comparing different subtypes of breast
cancer were observed with lowest level in the luminal A and highest
levels in the basal subtype (Table 22). Notable, there was a strong
correlation of high hMaTAR1 levels and negative ER/PR status,
matching the subtype data. Similar observations were made for 7
additional hMaTARs (Table 23, and as shown in the Tables
below).
TABLE-US-00025 TABLE 25 Differential gene expression levels (log)
of hMaTARs associated with estrogen receptor (ER) status ER ER
Negative Positive ENSG00000245526 3.7 0.6 (hMaTAR1) ENSG00000214894
2.0 3.4 (hMaTAR6.2) ENSG00000261664 3.2 5.7 (hMaTAR18)
ENSG00000198089 9.1 9.8 (hMaTAR21) ENSG00000249437 9.0 10.0
(hMaTAR23) ENSG00000224397 7.2 5.6 (hMaTAR25.3) ENSG00000075624
17.6 17.2 (hMaTAR27.1) ENSG00000277310 1.2 2.3 (hMaTAR29)
TABLE-US-00026 TABLE 26 Differential gene expression levels (log)
of hMaTARs associated with progestrone receptor (PR) status PR PR
Negative Positive ENSG00000245526 2.9 0.0 (hMaTAR1) ENSG00000261664
4.4 5.7 (hMaTAR18) ENSG00000198089 9.3 9.8 (hMaTAR21)
ENSG00000249437 9.2 10.0 (hMaTAR23) ENSG00000224397 6.8 5.6
(hMaTAR25.3) ENSG00000277310 1.4 2.3 (hMaTAR29)
[0349] For hMaTAR1, the effect of its expression on overall patient
survival was assessed using the log-rank test to compare outcomes
for patients in the top quartile by the expression of the candidate
gene to those in the bottom quartile. Notably, the survival
analysis revealed that patients with low levels of hMaTAR1 survive
an average of 1,500 days (approximately 4 years) longer than
patients with high levels of this lncRNA, as shown in the Table
below.
TABLE-US-00027 TABLE 27 Surival probability curve for luminal B
subtype breast cancer Upper Quartile Survival time (days) Sample 1
612 Sample 2 811 Sample 3 825 Sample 4 1365 Sample 5 1563 Sample 6
1694 Sample 7 1699 Sample 8 2551 Lower Quartile Survival time
(days) Sample 9 558 Sample 10 1542 Sample 11 2097 Sample 12 2422
Sample 13 2469 Sample 14 3941
[0350] Pathway analysis of TCGA data was also performed and a
significant positive correlation of pathways, such as cell cycle
and DNA replication, was observed, indicating the high
proliferative rate of tumors with elevated hMaTAR1 levels. The data
is presented in the Table below. The canonical pathways that are
significantly over-represented among genes strongly correlated with
hMaTAR1 were determined. Gene lists for each of the reactome
canonical pathways were downloaded from the Reactome database in
GMT format and Wilcoxon rank tests were conducted to compare
correlations with hMaTAR1 of the genes in the pathway to those of
the genes outside the pathway. The resulting p-values were
Bonferroni-corrected to account for the number of pathways for
which the tests were conducted.
TABLE-US-00028 TABLE 28 Reactome pathways positively or negatively
correlated to hMaTAR1 expression Reactome ID p-value Positive
Correlation Cell cycle 5.30E-17 DNA replication 8.96E-17 Cell cycle
mitotic 3.92E-16 Mitotic MM G1 Phases 1.27E-13 DNA strand
elongation 8.80E-08 Mitotic G1 G1 S Phases 1.86E-06 Activation of
the pre-replicative complex 3.50E-06 Chromosome maintenance
4.46E-06 G2 M Checkpoints 6.83E-06 Mitotic prometaphase 8.38E-06
Synthesis of DNA 9.30E-05 S phase 1.20E-04 Activation of ATR in
1.30E-04 response to replication stress M G1 transition 1.50E-04 G1
S Transition 3.15E-04 G1 S specific transcription 1.01E-03
Extension of telomeres 1.63E-03 Unwinding of DNA 1.86E-03 Negative
Correlation Phospholipid metabolism 1.01E-04 Signaling of PDGF
6.53E-04 Metabolism of lipids and lipoproteins 8.82E-04 Signaling
of NGF 1.01E-03 NGF signaling via TRKA 1.79E-03 from plasma
membrane
Example 7: Antisense Inhibition of MaTARs In Vivo
[0351] To further elucidate the functional role of MaTARs,
antisense inhibition of selected MaTARs was performed in MMTV-PyMT
nice, representing the luminal B type of breast cancer. The effect
of antisense inhibition of MaTAR in vivo by subcutaneous injections
of antisense oligonucleotides into MMTV-PyMT (FVB) mice was
conducted and tumor growth, progression, and metastasis were
monitored.
[0352] Groups of 4 mice each were first injected with tumor cells.
The treatment with antisense oligonucleotide was started when
tumors were palpable (4-5 mm in diameter). Mice were injected
subcutaneously three times a week with 50 mg antisense
oligonucleotide per kg body weight per day, resulting in a weekly
dose of 150 mg/kg of antisense oligonucleotide. Scrambled antisense
oligonucleotide served as the control. Each Table represents an
independent experiment. Tumor size was measured twice a week using
calipers. Treatments continued until one of tumors reached 2 cm in
diameter, after which the mice were euthanized. Antisense
oligonucleotides complementary to MaTAR20, MaTAR28, MaTAR17,
MaTAR25, and MaTAR3 were tested. The data is presented in the Table
below. The results show that antisense inhibition resulted 52%
reduction of tumor volume for MaTAR3, 22% reduction for MaTAR17,
17% reduction for MaTAR20, and 40% reduction for MaTAR25.
TABLE-US-00029 TABLE 29 Mean tumor volume (mm.sup.3) after
antisense inhibition of MaTAR20 and MaTAR28 expression Time point
scASO MaTAR20 MaTAR28 Week 1 46 38 21 58 59 26 Week 2 147 73 71 143
82 64 Week 3 148 129 85 147 124 134 Week 4 130 203 179 172 302 167
Week 5 155 286 221 210 242 382 Week 6 263 219 446 232 193 554 Week
7 269 244 277
TABLE-US-00030 TABLE 30 Mean tumor volume (mm.sup.3) after
antisense inhibition of MaTAR17 and MaTAR25 expression Time point
scASO MaTAR17 MaTAR25 Week 1 0 0 1 0 0 0 Week 2 0 10 4 6 21 11 Week
3 4 16 10 22 25 24 Week 4 30 25 29 63 43 61 Week 5 78 44 69 90 42
65 Week 6 179 66 102 261 129 166 Week 7 268 190 189 278 182 172
Week 8 519 268 303 506 316 354 Week 9 648 561 478 898 702 541
TABLE-US-00031 TABLE 31 Mean tumor volume (mm.sup.3) after
antisense inhibition of MaTAR3 expression Time point scASO MaTAR3
Week 1 144 156 142 131 Week 2 139 133 143 137 Week 3 143 145 144
150 Week 4 269 230 399 283 Week 5 591 330 719 329 Week 6 1123
546
[0353] All the mice were euthanized when one of the tumors reached
2 cm in diameter. The lungs were then examined for the presence of
metastatic nodules. Nodules were counted and the data is presented
in the Tables below. There was a 68% reduction in metastases in the
lungs with antisense inhibition of MaTAR20 and 31% reduction with
antisense inhibition of MaTAR3.
TABLE-US-00032 TABLE 32 Average number of metastatic modules after
antisense inhibition of MaTAR expression Treatment Average
metastatic nodules scASO 15 MaTAR17 20 MaTAR20 5 MaTAR25 19 MaTAR28
17
TABLE-US-00033 TABLE 33 Average number of metastatic modules after
antisense inhibition of MaTAR3 expression Treatment Average
metastatic nodules scASO 20 MaTAR3 14
[0354] The results of the in vivo knockdown experiment are
summarized in the Table below.
TABLE-US-00034 TABLE 34 Summary of antisense inhibition of MaTAR
expression Candidate ASO (Ionis no.) Metastasis Tumor growth MaTAR3
710772 -31% -52% MaTAR17 710783 +36% -22% MaTAR20 710725 -68% -17%
MaTAR25 710806 +23% -40% MaTAR28 710740 +15% +95%
Example 8: CRISPR/Cas9-Mediated Knockout of MaTAR25
[0355] To confirm the results observed on antisense inhibition of
MaTAR25, the CRISPR-Cas9 system (Ran et al, 2013) was used to
generate genetic knockout clones of MaTAR25 in the highly
metastatic mammary cell line 4T1. The results show that the genetic
loss of MaTAR25 significantly reduced tumor cell invasion,
recapitulating the antisense oligonucleotide-mediated
knockdown.
[0356] By introducing Cas9 and two guide RNAs (gRNAs) targeting
regions upstream and downstream of the transcription start site of
MaTAR25, deletions of the MaTAR25 promoter region were generated,
resulting in an efficient depletion of MaTAR25 expression. The
results are presented in the Table below. As a negative control,
Cas9 and a gRNA targeting Renilla luciferase was introduced into
4T1 cells, which is referred to as `4T1 control` below.
TABLE-US-00035 TABLE 35 Relative MaTAR25 expression compared to 4T1
control in the MaTAR25 knockout (KO) clones Expression 4T1 control
1.00 MaTAR25 0.03 KO clone1 MaTAR25 0.01 KO clone2 MaTAR25 0.03 KO
clone3
[0357] The MaTAR25 KO cells were functionally compared with the 4T1
control cells. For this, 50,000 cells of each clone were seeded and
manual cell counting was performed after 48 h and 72 h. The results
show significant decrease in the cell proliferation rate in MaTAR25
KO clones (approximately 62% compared to control at day 4). The
average of 3 cell counts is presented in the Table below.
TABLE-US-00036 TABLE 36 Number of cells of 4T1 control and MaTAR25
knockout (KO) clones 0 h 48 h 72 h 4T1 control 0.5 3.0 10.8 MaTAR25
0.5 1.7 5.5 KO clone1 MaTAR25 0.5 1.7 6.1 KO clone2 MaTAR25 0.5 1.7
4.6 KO clone3
[0358] To further characterize the MaTAR25 KO clones, a cell
migration assay was performed using live cell imaging. An Observer
Live Cell Microscope (Zeiss) was used to acquire images every 5
minuted of the same image field in 12-well tissue culture plates
for 8 hours, and images of 5 individual fields per group were
collected for migration analysis. The collected images were
analyzed using the CellTracker image processing software. Reduced
cell motility by 40% was observed upon genetic loss of MaTAR25. The
results are presented of the relative migration distance.
TABLE-US-00037 TABLE 37 Relative migration distance (.mu.m) of 4T1
control and MaTAR25 knockout (KO) clones Distance 4T1 control 1.0
MaTAR25 0.6 KO clone1 MaTAR25 0.7 KO clone2 MaTAR25 0.5 KO
clone3
[0359] In addition, invasion assays were performed using 24-well
Boyden chambers (TREVIGEN) in 24 hours. The results showed reduced
cell invasion by 45% of MaTAR25 KO cells compared to 4T1 control
cells. The results are presented as the average of 3 relative
invasions in the Table below. `No serum` denotes a positive control
where cells should not invade in the absence of serum.
TABLE-US-00038 TABLE 37 Relative invaded cells Distance No serum
0.2 4T1 control 1.0 MaTAR25 0.4 KO clone1 MaTAR25 0.5 KO clone2
MaTAR25 0.6 KO clone3
Example 9: Further Identification of Human Orthologs of MaTAR
Genes
[0360] Human orthologs of sever other MaTAR genes were identified
using the methodology described in Example 6. The complete list of
the genomic location of potential human MaTARs (hMaTARs) are
provided in the Table below.
TABLE-US-00039 TABLE 38 Potential human counterparts of MaTARs
(hMaTARs) Human counterpart Human gene SEQ (sequence, location
human synteny ID Ensembl ID MaTAR transcript ID hg38) (sequence,
hg38) (hg38) NO ENSMUSG00000085399 MaTAR31 ENSMUST00000123272 (also
MaTAR7) ENSMUSG00000100816 MaTAR32 ENSMUST00000187677 intron of
non- chr3: 1473111- ENST00000414394.1 193- coding RNA 1473137 (+),
(chr2: 192,629,919- 196 CNIH3 chr1: 224490851- 192,645,706),
224490882 (-) ENST00000422017.1 (chr2: 192,644,102- 192,645,387)
ENSMUSG00000096617 MaTAR33 ENSMUST00000180755 retro- RP11-62517.1
197 GAPDH (chr4: 77,394,491- 77,494,286) ENSMUSG00000104000 MaTAR34
ENSMUST00000195727 chr3: 35423136- ENST00000615633.1 198- 35423173
(+) (chr8: 81,356,161- 201 81,356,274), ENST00000518880.1 (chr8:
81,279,871- 81,281,446), ENST00000606235.1 (chr8: 81,275,399-
81,277,570) ENSMUSG00000104645 MaTAR35 ENSMUST00000200327 intron of
chr14: 68,214,801- ENST00000515649.1 202- RAD51B 68,214,832 (chr4:
104,907,406- 206 104,970,084), ENST00000580856.2 (chr4:
104,796,128- 104,796,221), ENST00000515127.1 ( chr4: 104,653,874-
104,966,793), ENST00000508358.1 (chr4: 104,556,960- 104,568,877)
ENSMUSG00000105811 MaTAR36 ENSMUST00000196668 chr1: 87673467-
ENST00000437598.1 207- 87673600 (+) (chr1: 87,899,909- 211
87,905,714); chr1: 87900099- 87976514; chr1: 87,805,286-
87,808,372; chr1: 87526364- 87529941 ENSMUSG00000082292 MaTAR37
ENSMUST00000164282 intron of chr19: 34,709,167- ENST00000408204.2
212- CAMTA1 34,709,419; (chr5: 155,024,714- 215 chr1: 7,032,170-
155,024,800); 7,032,239 chr5: 155116572- 155119608
ENSMUSG00000106230 MaTAR38 ENSMUST00000197386 chr4: 87,891,842-
ENST00000513220.1 216- 87,892,832 (chr4: 106,003,317- 217
106,022,478) ENSMUSG00000099375 MaTAR39 ENSMUST00000186885 intron
of chr1: 30,026,649- ENST00000430692.1 218- LINC01648 30,027,342
(chr2: 125,710,969- 221 125,765,842); ENST00000455174.2 (chr2:
126,110,099- 126,117,985); ENST00000435352.1 (chr2: 126,308,510-
126,343,992) ENSMUSG00000085218 MaTAR40 ENSMUST00000123623 chr11:
30,635,647- ENST00000531002.1 222- 30,638,513 (chr11: 30,584,130-
226 30,630,508); chr11: 30686409- 30695389; chr11: 30687409-
30697149; chr11: 30741556- 30793130 ENSMUSG00000100009 MaTAR41
ENSMUST00000191042 intron of chr1: 155,696,325- ENST00000411055.1
227- DAP3 155,696,501 (chr5: 102,302,504- 231 102,302,810);
ENST00000506058.1 (chr5: 102,144,077- 102,146,572);
ENST00000362916.1 (chr5: 102,131,007- 102,131,135);
ENST00000615759.1 (chr5: 102,108,666- 102,108,764)
ENSMUSG00000087326 MaTAR42 ENSMUST00000146576 intron of chr15:
69,631,165- chr9: 36307042- 232- PCAT29 69,631,311 36315279; 234
chr9: 36313547- 36315321 ENSMUSG00000087107 MaTAR43
ENSMUST00000143673 intron of chr1: 49,319,395- ENST00000587012.1
235- AGBL4 49,319,493 (chr17: 35,406,684- 238 35,409,768);
ENST00000592117.1 (chr17: 35,403,837- 35,404,373);
ENST00000589099.1 (chr17: 35,400,878- 35,403,006)
ENSMUSG00000066170 MaTAR44 ENSMUST00000181029 chr1: 61,652,871-
LOC285847 239- 61,653,084 (chr6: 35726762- 241 35736947);
ENST00000452048.1 (chr6: 35,733,867- 35,736,947) ENSMUSG00000099848
MaTAR45 ENSMUST00000185425 intron of chr6: 167,686,270-
ENST00000629370.1 242- TCONS_ 167,686,755 (chr2: 234,682,668- 245
00011243 234,717,764); ENST00000427619.5 (chr2: 234,834,315-
234,913,384); ENST00000413842.1 (chr2: 234,882,279- 234,888,802)
ENSMUSG00000104350 MaTAR46 ENSMUST00000191737 chr2: 107,615,711-
ENST00000610049.1 246- 107,615,781 (chr1: 111,184,415- 248
111,185,061); chr1: 111251780- 111252513 ENSMUSG00000097639 MaTAR47
ENSMUST00000181833 intron of chr7: 4,176,549- ENST00000487657.2
249- SDK1 4,176,613; (chr4: 128,582,999- 253 chr3: 114,206,658-
128,601,400); 114,207,102 ENST00000514265.1 (chr4: 128,567,972-
128,570,531); ENST00000608228.1 (chr4: 128,552,590- 128,553,416)
ENSMUSG00000105260 MaTAR48 ENSMUST00000196337 intron of chr4:
86,369,041- ENST00000511497.5 254- MAPK10 86,369,080 (chr4:
128,428,070- 256 128,519,394); ENST00000505133.5 (chr4:
128,292,751- 128,466,661) ENSMUSG00000087362 MaTAR49
ENSMUST00000139492 intron of chrX: 97,035,752- ENST00000434418.2
257- DIAPH2 97,035,829 (chr2: 187,712,816- 258 188,287,691)
ENSMUSG00000100147 MaTAR50 ENSMUST00000189594 chr1: 195,728,884-
ENST00000436706.1 259- 195,728,916 (chr1: 224,208,747- 260
224,213,279) ENSMUSG00000104192 MaTAR51 ENSMUST00000195679 chr1:
102,480,764- ENST00000451250.1 261- 102,480,794 (chr1: 55,217,861-
263 55,234,177); LOC100507634 (chr1: 55215408- 55217455)
ENSMUSG00000105613 MaTAR52 ENSMUST00000199279 chr12: 121,299,793-
chr12: 121375393- 264- 121,302,026 121392412 265 ENSMUSG00000105353
MaTAR53 ENSMUST00000198677 intron of chr20: 2,219,060- chr4:
16114342- 266- TCONS_ 2,219,103 16120917 267 00028092
ENSMUSG00000103755 MaTAR54 ENSMUST00000192612 chr3: 143,118,914-
ENST00000492307.1 268- 143,119,438 (chr3: 143,111,802- 269
143,112,359) ENSMUSG00000105263 MaTAR55 ENSMUST00000200473 chr10:
14,991,910- chr4: 16114342- 270- 14,992,564 16120917 271
ENSMUSG00000101249 MaTAR56 ENSMUST00000187117 intron of non- chr7:
69,331,847- -- 272 coding RNA 69,332,251 RP11-3P22.2
ENSMUSG00000100131 MaTAR57 ENSMUST00000187714 chr16: 10,722,204- --
273 10,722,741 ENSMUSG00000097113 MaTAR58 ENSMUST00000181524 intron
of chr1: 77,981,610- ENST00000367355.5 274- DNAJB4 77,983,203
(chr1: 200,342,544- 275 200,373,792) ENSMUSG00000102070 MaTAR59
ENSMUST00000188231 intron of chr2: 202,614,880- -- 276- RP11-
202,615,460, 277 3P22.2 chr7: 69,330,777- 69,331,342
ENSMUSG00000054418 MaTAR60 ENSMUST00000155384 chr17: 77,904 130-
chr17: 77934751- 278- 77,904,532 77935349; 280 ENST00000374983.3
(chr17: 77,879,027- 77,884,087)
Example 10: Antisense Inhibition of MaTARs in Primary Tumor
Cells
[0361] Antisense inhibition of the MaTARs described in the previous
Example was performed in primary MMTV-PyMT tumor cells.
[0362] ISIS oligonucleotides tested in the assay were designed as
5-10-5 MOE gapmers, and are 20 nucleosides in length, wherein the
central gap segment is comprised of ten 2'-deoxynucleosides and is
flanked on both sides (in the 5' and 3' directions) by wings
comprising 5 nucleosides each. Each nucleoside in the 5' wing
segment and each nucleoside in the 3' wing segment has a 2'-MOE
modification. The internucleoside linkages throughout the gapmer
are phosphorothioate (P.dbd.S) linkages. All cytosine residues
throughout the gapmer are 5-methylcytosines. The ISIS
oligonucleotide sequences are presented in the Table below. The
MaTARs targeted by the ISIS oligonucleotides are also shown in the
Table below.
TABLE-US-00040 TABLE 39 ISIS oligonucleotides targeting MaTARS
MaTAR ISIS No. sequence SEQ ID 31 850592 CCCCTAGGCAAGGTGGGTCC 169
33 850868 GCCAGCCCCGGCATCGAAGG 170 36 850797 CAAAAGCACACCCCGATGTC
171 37 850578 CACCAGCTTGTCCGCCACAG 172 38 850701
GATGCCTGAGGAAGCGCGCC 173 39 850637 GGTTCAGGTAGATGTACTTC 174 40
850718 GGCTGCCCAACCACTATGGT 175 41 850671 GATACTCATGATAAGGGATT 176
42 850746 TTACCCTCGCGGGTCCAGGC 177 43 850744 CAACCCGAGAATCACAAGAG
178 44 850766 GCCCGTTCCTCACAGCGGAT 179 45 850831
TCGCTCAGCTGCTCTGGTGT 180 46 850779 ATGTGGTGATCAACACTGGC 181 49
850727 GCCGCTGAAGCTGCACAGTA 182 50 850664 GGATGCCCCGTGGGTAGCAC 183
51 850794 GGCCCCTGATAGGTAGGCTC 184 52 850706 GCCACCGGGTGAGCGAGCCC
185 53 850855 CCGCTCTAACTTTCGCCCGA 186 54 850678
GGGACACCAGTGCTGACCGC 187 55 850823 GAGCTTGGTAGGCTCCATCT 188 56
850598 GGCGAAGTGGGCTTTTGCTC 189 57 850621 CGTCTAAGGTGTGTGTTGTG 190
58 850819 CGCTCCAGCCACGCGCAGAT 191 59 850610 GGCAGAACGACTCGGTTATC
192
Antisense Inhibition
[0363] MMTV-PyMT primary cells were seeded at a density of 20,000
cells/well into 96-well plates. Transfection-free uptake of
oligonucleotide was accomplished by adding 5 .mu.M of either a
MaTAR-specific oligonucleotide or the scASO to the primary cell
culture medium immediately after seeding the cells. Cells were
incubated for 24 hours at 37.degree. C. and RNA was isolated using
the RNeasy 96 kit (Qiagen), according to the manufacturer's
instructions. RNA samples were used directly in a one-step 384-well
qRT-PCR (QuantiTect SYBR Green RT-PCR Kit, Qiagen) on an Applied
Biosystems 7900HT Fast Real-Time PCR System (Thermo Fisher
Scientific). The results are presented in the Table below, and
indicate knockdown efficiencies ranging from 4% for MaTAR50 to 89%
for MaTAR56 after 24 hours.
TABLE-US-00041 TABLE 40 Antisense inhibition of MaTARs in primary
MMTV-PyMT cells MaTAR ISIS No. % inhibition 31 850592 26 33 850868
50 36 850797 36 37 850578 13 38 850701 13 39 850637 21 40 850718 20
41 850671 16 42 850746 40 43 850744 14 44 850766 57 45 850831 84 46
850779 53 49 850727 53 50 850664 4 51 850794 37 52 850706 59 53
850855 76 54 850678 27 55 850823 25 56 850598 89 57 850621 74 58
850819 74 59 850610 82
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20220143066A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(https://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20220143066A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References