U.S. patent application number 17/456204 was filed with the patent office on 2022-05-05 for methods, compositions, kits, and uses for analysis of nucleic acids comprising repeating a/t-rich segments.
The applicant listed for this patent is Asuragen, Inc.. Invention is credited to Gary J. Latham, Sachin Sah.
Application Number | 20220136044 17/456204 |
Document ID | / |
Family ID | |
Filed Date | 2022-05-05 |
United States Patent
Application |
20220136044 |
Kind Code |
A1 |
Latham; Gary J. ; et
al. |
May 5, 2022 |
METHODS, COMPOSITIONS, KITS, AND USES FOR ANALYSIS OF NUCLEIC ACIDS
COMPRISING REPEATING A/T-RICH SEGMENTS
Abstract
Described herein are methods, compositions, kits, and uses
thereof for analysis of nucleic acid segments comprising a
repeating A/T-rich segment, wherein the repeating A/T-rich segment
is: (i) a homopolymeric segment comprising at least 10 A residues,
at least 10 T residues, or at least 10 U residues, wherein the at
least 10 A, T, or U residues are consecutive or interrupted once by
one to three other nucleotides; or (ii) a segment comprising
(T.sub.nA).sub.m, (AT.sub.n).sub.m, (TA.sub.n).sub.m, or
(A.sub.nT).sub.m, wherein n is 2 or greater and m is such that the
length of the repeating A/T-rich segment is 10 or more
residues.
Inventors: |
Latham; Gary J.; (Austin,
TX) ; Sah; Sachin; (Cedar Park, TX) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Asuragen, Inc. |
Austin |
TX |
US |
|
|
Appl. No.: |
17/456204 |
Filed: |
November 23, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15744149 |
Sep 26, 2018 |
11214829 |
|
|
PCT/US2016/043503 |
Jul 22, 2016 |
|
|
|
17456204 |
|
|
|
|
62196239 |
Jul 23, 2015 |
|
|
|
International
Class: |
C12Q 1/6844 20180101
C12Q001/6844 |
Claims
1-73. (canceled)
74. A kit comprising: at least two primers; and NTPs in an AT/GC
ratio of 8 or higher, wherein the at least two primers are capable
of amplifying at least one DNA template comprising: (i) a
homopolymeric segment of at least 10 consecutive A residues or at
least 10 consecutive T residues; or (ii) a repeating A/T-rich
segment comprising (T.sub.nA).sub.m, (AT.sub.n).sub.m,
(TA.sub.n).sub.m, or (A.sub.nT).sub.m, wherein n is 2 or greater
and m is such that the length of the repeating NT-rich segment is
10 or more residues; wherein the at least one DNA template further
comprises target and non-target nucleic acid sequences.
75. The kit of claim 74, wherein the at least two primers comprise
at least one primer comprising a covalently attached label.
76. The kit of claim 74, wherein the at least two primers comprise
a first primer that hybridizes upstream of the rs10524523 variable
length polymorphism of the TOMM40 gene and a second primer that
hybridizes downstream of the rs10524523 variable length
polymorphism of the TOMM40 gene.
77. The kit of claim 74, wherein the kit further comprises at least
one polymerase.
78. The kit of claim 74, wherein the AT/GC ratio is a value in the
range from about 10 to about 40.
79. The kit of claim 74, wherein the NTPs comprise dNTPs or rNTPs,
and are present in a total NTP concentration ranging from about 0.5
mM to about 5 mM.
80. The kit of claim 74, wherein dGTP is present in a concentration
ranging from about 10 .mu.M to about 400 .mu.M and cytidine is
present in a concentration ranging from about 10 .mu.M to about 400
.mu.M.
81. The kit of claim 74, wherein dTTP is present in a concentration
ranging from about 700 .mu.M to about 2000 .mu.M and adenosine is
present in a concentration ranging from about 700 .mu.M to about
2000 .mu.M.
82. The kit of claim 74 further comprising Mg.sup.2+, wherein the
Mg.sup.2+ is present in a molarity ranging from about 80% to about
150% of the molarity of total NTPs.
83. The kit of claim 74 further comprising Mg.sup.2+, wherein the
Mg.sup.2+ is present in a concentration ranging from about 1.5 mM
to about 3 mM.
84. The kit of claim 74, wherein the at least one nucleic acid
template comprises a homopolymeric segment comprising 10 to 40
consecutive A residues or 10 to 40 consecutive T residues.
85. The kit of claim 74, wherein the at least one nucleic acid
template comprises a homopolymeric segment of at least 10
consecutive T residues.
86. The kit of claim 74, wherein the at least one nucleic acid
template comprises a segment comprising (T.sub.nA).sub.m,
(AT.sub.n).sub.m, (TA.sub.n).sub.m, or (A.sub.nT).sub.m, wherein n
is 2 or greater and m is such that the length of the repeating
A/T-rich segment is 10 or more residues.
87. The kit of claim 74, wherein at least one primer comprises a
3'-terminal sequence that specifically hybridizes to two or more
consecutive A residues or to two or more consecutive T
residues.
88. The kit of claim 87, wherein the at least one primer comprises
a 3'-terminal sequence comprising 4 to 9 consecutive A residues or
4 to 9 consecutive T residues.
89. The kit of claim 74, wherein at least one primer comprises a
covalently attached label.
90. The kit of claim 77, wherein the at least one polymerase
comprises a hot-start DNA polymerase.
91. The kit of claim 74, wherein the at least one nucleic acid
template comprises a homopolymeric segment comprising at least 12
consecutive A residues or at least 12 consecutive T residues.
92. The kit of claim 74 wherein the at least one nucleic acid
template comprises a homopolymeric segment in a genetic locus
associated with late-onset Alzheimer's disease.
93. The kit of claim 74, wherein the at least one nucleic acid
template comprises a subset of TOMM40 sequence comprising a
homopolymeric segment of at least 10 consecutive T residues.
Description
[0001] This is a divisional of application Ser. No. 15/744,149,
filed Sep. 26, 2018, which is a national stage application under 3
U.S.C. .sctn. 371 of International Application No.
PCT/US2016/043503, filed Jul. 22, 2016, which claims the benefit of
U.S. Provisional Application No. 62/196,239, filed Jul. 23, 2015,
each of which is incorporated herein by reference.
[0002] The present application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Sep. 26, 2016, is named 10256_0050-00304_SL.txt and is 1,867
bytes in size.
[0003] This invention is in the field of nucleic acid analysis. In
particular, the invention relates to improved methods for analyzing
nucleic acids comprising repeating A/T-rich segments.
[0004] Many molecular biology techniques involve nucleic acid
synthesis, e.g., synthesis of DNA or RNA. Nucleic acid synthesis
therefore plays a central role in numerous biotechnological,
medical, and research discovery applications. For example,
polymerase chain reaction (PCR) is a DNA synthesis reaction that
rapidly amplifies DNA template molecules. A typical PCR reaction
mixture comprises primer sequences which are complementary to the
ends of a desired template, deoxynucleotide triphosphates (dNTPs),
various buffer components, and a DNA polymerase. The reaction
mixture is admixed with a DNA sample known or suspected of
harboring the desired template. The resulting mixture is then
subjected through repeated cycles of template denaturation, primer
annealing to the denatured template, and primer extension by the
DNA polymerase, creating copies of the template. Because the
product of each cycle can act as a template for subsequent reaction
cycles, amplification generally proceeds in an exponential fashion.
See, e.g., U.S. Pat. No. 4,683,202, and M. J. McPherson & S. G.
Moller, PCR: The Basics (2nd Ed., Taylor & Francisco) (2006).
PCR is a widely used technique due to its rapidity, low cost,
sensitivity, and adaptability to high-throughput applications and
automation.
[0005] A notable application of PCR is the detection and analysis
of repetitive nucleotide sequences which can occur in the genome.
Analysis of repeating A/T-rich segments, including homopolymeric
repeat sequences of highly variable lengths (e.g., repeat length
polymorphisms), can be useful for, e.g., genotyping, forensics,
diagnostics, population genetics, and taxonomic studies.
[0006] For example, certain repeat length polymorphisms are known
to be associated with disease states. Detection of such
polymorphisms can therefore be helpful in disease diagnosis and
treatment. For example, intron 6 of the TOMM40 gene contains a
poly-T repeat length polymorphism (rs10524523), which has potential
applications in Alzheimer's disease (AD) diagnosis. TOMM40 is also
known as TOM40, PEREC-1, PER-EC1, C19orf1, D19S1177E, or P38.5.
Three allelic categories were defined for this locus based on
variation in its poly-T repeat length: Short (S, T.ltoreq.19), Long
(L, 20.ltoreq.T.ltoreq.29) and `Very Long` (VL, T.gtoreq.30). See
Roses et. al., Alzheimer's & Dementia 9:132-136 (2013). The
TOMM40 poly-T size polymorphism was recently reported as being
associated with late-onset Alzheimer's disease (LOAD) and with
cognitive performance in the elderly. See Roses et. al., The
Pharmacogenetics Journal 10:375-384 (2010); Alzheimer's &
Dementia 9:132-136 (2013).
[0007] An unfortunate limitation to the accuracy of DNA synthesis
is the problem of polymerase slippage and stuttering. Repeating
A/T-rich segments, such as homopolymeric nucleic acid segments
(also referred to as mononucleotide repeat regions), are
particularly susceptible to slippage and stuttering events. During
polymerase slippage, the polymerase stalls and dissociates from the
template strand during replication of the repeating A/T-rich
segment, resulting in separation of the growing strand from the
template strand. Slippage often then gives rise to polymerase
stuttering, wherein the growing strand re-anneals to the template
strand in an out-of-register manner such that one or more bases in
either the growing or template strand are unpaired, forming a
bubble. Such bubble formation at the growing or template strand
results in expansion or truncation of the repeating A/T-rich
segment, respectively (sometimes referred to as frameshift error).
In particular, bubble formation on the growing or primer strand
results in expansion of the repeating NT-rich segment. And bubble
formation on the template strand results in contraction of the
repeating A/T-rich segment. Polymerase slippage and stuttering are
known to cause high error rates in amplification and analysis of
repeating A/T-rich segments. For example, slippage during PCR
amplification can generate a complex mixture of amplicons of
varying lengths, making it difficult to accurately determine the
length of the repeating A/T-rich segment. As noted by Fazekas et.
al. with respect to homopolymeric segments, "as the repeat number
increases, the number of ambiguous bases increases
disproportionately . . . to the point where sequence data cannot be
used at all past the repeat." See Fazekas et. al., Taxon
59(3):694-697 at 694 (2010).
[0008] The difficulty due to slippage and stuttering may be
compounded in the case of samples containing two alleles with
repeating A/T-rich segments of similar lengths, e.g., lengths
differing by a number of nucleotides such as 1, 2, 3, or 4. In such
cases, slippage and stuttering may make it difficult to distinguish
the products of the longer and shorter alleles, such that
determining whether a sample is, e.g., homozygous for an allele
with a repeating A/T-rich segment of length n or heterozygous for
alleles with repeating A/T-rich segments of length n-1 and n+1 may
not be possible, or may not be possible with high confidence.
[0009] Attempts have been made to mitigate the problem of
slippage/stuttering. See Fazekas et al., BioTechniques 48:277-285
(2010). There, improved sequence quality was reported only for
homopolymeric segments that are 15 nucleotides or less. "In . . .
samples that possessed repeats greater than 15 bp, the sequence
quality was not improved." See BioTechniques 48:277-285 at 695
(2010). Other attempts to improve amplification of homopolymeric
segments by including a portion of the repeat region in the primer
sequence were reported to "improve scoring of . . . repeats less
than 20 bp." See Flores-Renteria et al., American Journal of
Botany: e1-e3 (2011) at e2 (doi:10.3732/ajb.1000428).
[0010] Due to the issues of polymerase slippage/stuttering, TOMM40
poly-T polymorphisms are difficult to amplify and genotype,
particularly those in the L (20.ltoreq.T.ltoreq.29) and VL
(T.gtoreq.30) categories. Because of this difficulty, researchers
have been forced to engage in data manipulation in order to
classify the polymorphic alleles. Such data manipulation includes,
e.g., (1) calling only the most abundant peak in a complex
distribution of amplicon sizes, or (2) using pattern recognition
algorithms to match peak patterns to known genotypes (e.g.,
genotypes obtained from known clonal populations). Therefore, there
exists a need for methods that reduce slippage/stutter, including
methods that reduce slippage/stutter in synthesis of repeating
A/T-rich segments such as homopolymeric segments, including long
repeating A/T-rich segments or homopolymeric segments (e.g.,
greater than about 15 nucleotides, or about 20 nucleotides or
greater). Such methods can be used for accurate analysis of nucleic
acids containing repeating A/T-rich segments such as homopolymeric
segments. Such methods can also be used for analysis of repeat
length polymorphisms such as, e.g., the TOMM40 poly-T
polymorphism.
[0011] In an embodiment, provided is a method of extending at least
one nucleic acid template comprising a repeating A/T-rich segment,
the method comprising performing a nucleic acid amplification
reaction in an aqueous solution comprising the at least one nucleic
acid template; at least one polymerase; at least one primer;
magnesium; and NTPs in an AT/GC ratio of about 2 or higher; wherein
the repeating A/T-rich segment is: (i) a homopolymeric segment
comprising at least 10 A residues, at least 10 T residues, or at
least 10 U residues, wherein the at least 10 A, T, or U residues
are consecutive or interrupted once by one to three other
nucleotides; or (ii) a segment comprising (T.sub.nA).sub.m,
(AT.sub.n).sub.m, (TA.sub.n).sub.m, or (A.sub.nT).sub.m, wherein n
is 2 or greater and m is such that the length of the repeating
A/T-rich segment is 10 or more residues.
[0012] In an embodiment, provided is a method of amplifying at
least one DNA template comprising a homopolymeric segment, the
method comprising performing a DNA amplification reaction in an
aqueous solution comprising the at least one DNA template; at least
one hot-start DNA polymerase; at least two primers; magnesium at a
concentration in the range from 1.5 mM to 3 mM; dNTPs in an AT/GC
ratio of 5 or higher and a total concentration in the range from
1500 .mu.M to 2500 .mu.M; wherein the homopolymeric segment
comprises at least 12 consecutive A residues or at least 12
consecutive T residues.
[0013] In an embodiment, provided is a method of detecting a
genotype associated with late-onset Alzheimer's disease, comprising
performing a DNA amplification reaction on at least one genetic
locus associated with late-onset Alzheimer's disease, the genetic
locus comprising a homopolymeric segment of at least 10 consecutive
A residues or at least 10 consecutive T residues, wherein the DNA
amplification reaction is performed in an aqueous solution
comprising at least one DNA polymerase; at least two primers;
magnesium; and dNTPs in an AT/GC ratio of 2 or higher; and wherein
the DNA amplification reaction produces a product comprising a
homopolymeric segment of at least 10 consecutive A residues or at
least 10 consecutive T residues.
[0014] In an embodiment, provided is a kit comprising at least two
distinct primers and NTPs in an AT/GC ratio greater than 2, the at
least two primers being suitable for amplifying a genetic locus
comprising either of (i) a homopolymeric segment of at least 10
consecutive A residues or at least 10 consecutive T residues or
(ii) a repeating A/T-rich segment comprising (T.sub.nA).sub.m,
(AT.sub.n).sub.m, (TA.sub.n).sub.m, or (A.sub.nT).sub.m, wherein n
is 2 or greater and m is such that the length of the repeating
A/T-rich segment is 10 or more residues.
[0015] In an embodiment, provided is a kit comprising reagents for
use in amplifying at least one template comprising either of (i) a
homopolymeric segment of at least 10 consecutive A residues or at
least 10 consecutive T residues or (ii) a repeating A/T-rich
segment comprising (T.sub.nA).sub.m, (AT.sub.n).sub.m,
(TA.sub.n).sub.m, or (A.sub.nT).sub.m, wherein n is 2 or greater
and m is such that the length of the repeating A/T-rich segment is
10 or more residues, wherein the reagents comprise NTPs in an AT/GC
ratio greater than 2.
[0016] In an embodiment, provided is a reaction solution comprising
at least one polymerase; one or more primers; magnesium; and NTPs
in an AT/GC ratio of 2 or higher.
[0017] In an embodiment, provided is a use of NTPs in an AT/GC
ratio of 2 or higher for amplifying a nucleic acid template
comprising a repeating A/T-rich segment that is: (i) a
homopolymeric segment of at least 10 A residues, at least 10 T
residues, or at least 10 U residues, wherein the at least 10 A, T,
or U residues are consecutive or interrupted once by one to three
other nucleotides; or (ii) a segment comprising (T.sub.nA).sub.m,
(AT.sub.n).sub.m, (TA.sub.n).sub.m, or (A.sub.nT).sub.m, wherein n
is 2 or greater and m is such that the length of the repeating
A/T-rich segment is 10 or more residues.
BRIEF DESCRIPTION OF DRAWING(S)
[0018] FIG. 1A depicts an exemplary workflow of a method disclosed
herein.
[0019] FIG. 1B depicts an exemplary reaction solution disclosed
herein.
[0020] FIG. 2 depicts an exemplary desired capillary
electrophoresis (CE) peak profile and an exemplary undesired CE
peak profile for two alleles with similar repeat numbers.
[0021] FIG. 3A depicts capillary electrophoresis results from an
experiment testing the effect of AT/GC biased ratios on polymerase
slippage/stutter, using DNA standard samples containing 35 T/36 T
alleles for the TOMM40 poly-T polymorphism. Information regarding
experimental conditions for the data in this and subsequent figures
is provided in the Examples section below.
[0022] FIG. 3B depicts capillary electrophoresis results from an
experiment testing the effect of AT/GC biased ratios on polymerase
slippage/stutter, using DNA standard samples containing 16 T/36 T
alleles for the TOMM40 poly-T polymorphism, in the vicinity of the
16 T peak.
[0023] FIG. 3C depicts capillary electrophoresis results from an
experiment testing the effect of AT/GC biased ratios on polymerase
slippage/stutter, using DNA standard samples containing 16 T/36 T
alleles for the TOMM40 poly-T polymorphism, in the vicinity of the
36 T peak.
[0024] FIG. 3D depicts capillary electrophoresis results from an
experiment testing the effect of AT/GC biased ratios on polymerase
slippage/stutter, using DNA standard samples containing 34 T/36 T
alleles for the TOMM40 poly-T polymorphism.
[0025] FIG. 4 depicts capillary electrophoresis results from an
experiment testing the effects of Mg.sup.2+ concentration and total
dNTP concentration on polymerase slippage/stutter.
[0026] FIG. 5 depicts capillary electrophoresis results from an
experiment testing the effects of Mg.sup.2+ concentration, total
dNTP concentration, and AT/GC biased ratios on polymerase
slippage/stutter.
[0027] FIG. 6 depicts the effects of DMSO and betaine titration on
polymerase slippage/stutter during amplification of a 16 T TOMM40
polymorphism.
[0028] FIG. 7 depicts the effects of DMSO and betaine titration on
polymerase slippage/stutter during amplification of a 36 T TOMM40
polymorphism.
[0029] FIG. 8 depicts the effects of reduced PCR cycles on
polymerase slippage/stutter during amplification of a 16 T/36 T
TOMM40 polymorphism.
[0030] FIG. 9 depicts the effects of reduced PCR cycles on
polymerase slippage/stutter during amplification of a 34 T/36 T
TOMM40 polymorphism.
[0031] FIG. 10 depicts the effects of an increased AT/GC
concentration ratio, lowered PCR cycle number (all in Condition B,
relative to Condition A), 1M Betaine, and 1% DMSO on detection of
short (16 T) and very long (36 T) TOMM40 polymorphic alleles.
[0032] FIG. 11 depicts the effects of an increased AT/GC
concentration ratio, lowered PCR cycle number, 1M Betaine, and 1%
DMSO (all in Condition B, relative to Condition A) on detection of
long polymorphic poly-T alleles that have adjacent lengths.
[0033] FIG. 12 depicts the effects of an increased AT/GC
concentration ratio, lowered PCR cycle number, 1M Betaine, and 1%
DMSO (all in Condition B, relative to Condition A) on detection of
long polymorphic poly-T alleles that are separated in length by 1
nucleotide.
[0034] FIG. 13A shows products amplified from RS1310 (35 T/36 T)
samples using condition C.
[0035] FIG. 13B shows products amplified from RS1310 (35 T/36 T)
samples using condition B.
[0036] FIG. 14A shows products amplified from RS1311 (16 T/36 T)
samples using condition C.
[0037] FIG. 14B shows products amplified from RS1311 (16 T/36 T)
samples using condition B.
[0038] FIG. 15A shows products amplified from RS1317 (29 T/36 T)
samples using condition C.
[0039] FIG. 15B shows products amplified from RS1317 (29 T/36 T)
samples using condition B.
[0040] FIG. 16A shows products amplified from RS1318 (16 T) samples
using condition C.
[0041] FIG. 16B shows products amplified from RS1318 (16 T) samples
using condition B.
[0042] FIG. 17A shows products amplified from RS1319 (34 T/36 T)
samples using condition C.
[0043] FIG. 17B shows products amplified from RS1319 (34 T/36 T)
samples using condition B.
[0044] FIG. 18A shows products amplified from NA07541 (34 T/38 T)
samples using condition C.
[0045] FIG. 18B shows products amplified from NA07541 (34 T/38 T)
samples using condition B.
[0046] FIG. 19A shows products amplified from NA20243 (16 T/20 T)
samples using condition C.
[0047] FIG. 19B shows products amplified from NA20243 (16 T/20 T)
samples using condition B.
[0048] FIG. 20A shows products from a synthetic DNA template
containing a 48 T homopolymeric segment amplified using condition
A.
[0049] FIG. 20B shows products from a synthetic DNA template
containing a 48 T homopolymeric segment amplified using condition
B.
DETAILED DESCRIPTION
[0050] The use of the word "a", "an" or "the" when used in
conjunction with the term "comprising" in the claims and/or the
specification can mean "one," but it is also consistent with the
meaning of "one or more," "at least one," and "one or more than
one." In this application, the use of the singular includes the
plural unless specifically stated otherwise. Also in this
application, the use of "or" means "and/or" unless stated
otherwise. Furthermore, the use of the term "including," as well as
other forms, such as "includes" and "included," are not limiting.
Any range described herein will be understood to include the
endpoints and all values between the endpoints.
[0051] The term "nucleotides" refers to molecules or ions capable
of forming nucleic acids. Nucleotides can comprise a base moiety, a
sugar moiety, and one or more phosphates (e.g., diphosphate or
triphosphate). The sugar moiety can be deoxyribose, ribose, or
another sugar moiety. The sugar moiety can be a modified sugar
moiety, e.g., wherein one or more of the hydroxyl groups are
replaced with halogen atoms or aliphatic groups, are functionalized
as ethers, amines, or the like. Exemplary base moieties include
purine and pyrimidine bases, and other heterocyclic bases that have
been modified. Exemplary modified bases include, e.g., methylated
purines, methylated pyrimidines, acylated purines or pyrimidines,
alkylated riboses, and other heterocycles. Nucleotides can also
comprise labeled moieties, such as those labeled with hapten,
biotin, fluorescent, or chemiluminescent labels.
[0052] "NTP" refers to any nucleotide triphosphate, including
ribonucleotide triphosphates (rNTPs) and deoxyribonucleotide
triphosphates (dNTPs) and analogs of a nucleotide triphosphate.
Deoxyribonucleotide triphosphates include, e.g., dATP, dCTP, dGTP,
dTTP, dUTP, and analogs thereof. As used herein, a "dNTP mix"
refers to a mix of two or more of dATP, dCTP, dCTP, dTTP, dUTP, and
analogs thereof. Similarly, ribonucleotide triphosphates include,
e.g., rATP, rCTP, rGTP, rTTP, rUTP, and analogs thereof. As used
herein, an "rNTP mix" refers to a mix of two or more of rATP, rCTP,
rCTP, rTTP, rUTP, and analogs thereof.
[0053] The term "AT/GC ratio" refers to the ratio of (i) the sum of
the concentrations of ATP, TTP, UTP, and any analogs thereof, to
(ii) the sum of the concentrations of CTP, GTP, and any analogs
thereof, in a given solution or mixture. As noted above, an "NTP"
includes rNTPs and dNTPs. Thus, for example, ATP includes rATP and
dATP.
[0054] "Nucleotide analogs" refer to molecules or ions comprising a
base moiety other than the natural bases adenine (A), cytosine (C),
guanine (G), thymine (T), or uracil (U), a sugar moiety (which can
be identical or similar to deoxyribose or ribose), and at least one
phosphate or multiple phosphate (e.g., diphosphate or triphosphate)
moiety. The nucleotide analog can be an analog of a specific
nucleotide, such as ATP, CTP, GTP, TTP, or UTP, when it comprises a
triphosphate and a sugar moiety, the structure and configuration of
both of which are suitable for incorporation into a nucleic acid
double helix by a polymerase, and a base whose base pairing
properties in a nucleic acid double helix and loci of incorporation
by DNA polymerases in a nucleic acid double helix are most similar
to one of the five previously listed nucleotides, with the
exception that analogs of TTP can also be analogs of UTP and vice
versa.
[0055] The terms "template", "template strand", and "template
nucleic acid" are used interchangeably herein to refer to a nucleic
acid that is bound by a primer for extension by a nucleic acid
synthesis reaction.
[0056] The term "locus" refers to a gene, nucleotide, or sequence
on a chromosome. A locus can be "polymorphic" or exhibit a
"polymorphism" if alternative forms of the locus exist in a
population. An "allele" of a locus, as used herein, refers to a
species of the locus.
[0057] The term "repeating A/T-rich segment" as used herein refers
to a homopolymeric segment, defined below, or a segment comprising
(T.sub.nA).sub.m, (AT.sub.n).sub.m, (TA.sub.n).sub.m, or
(A.sub.nT).sub.m, wherein n is 2 or greater and m is such that the
length of the repeating A/T-rich segment is 10 or more residues.
The value of n need not be constant throughout the segment. Thus,
examples of repeating A/T-rich segments include AATAATAATAAT (SEQ
ID NO: 3), AATAAATAAT (SEQ ID NO: 4), AAATAAAAAT (SEQ ID NO: 5),
AATAAAAAAT (SEQ ID NO: 6), etc. With respect to a segment
comprising (T.sub.nA).sub.m, (AT.sub.n).sub.m, (TA.sub.n).sub.m, or
(A.sub.nT).sub.m, in some embodiments, n is a value ranging from 2
to 10. In some embodiments, n is a value ranging from 3 to 10. In
some embodiments, n is a value ranging from 4 to 10. In some
embodiments, n is a value ranging from 2 to 8. In some embodiments,
n is a value ranging from 3 to 8. In some embodiments, n is a value
ranging from 4 to 8. In some embodiments, n is a value ranging from
2 to 6. In some embodiments, n is a value ranging from 3 to 6. In
some embodiments, m is a value ranging from 2 to 20. In some
embodiments, m is a value ranging from 3 to 20. In some
embodiments, m is a value ranging from 4 to 20. In some
embodiments, m is a value ranging from 2 to 15. In some
embodiments, m is a value ranging from 3 to 15. In some
embodiments, m is a value ranging from 4 to 15. In some
embodiments, m is a value ranging from 2 to 10. In some
embodiments, m is a value ranging from 3 to 10. In some
embodiments, m is a value ranging from 4 to 10. In some
embodiments, m is a value ranging from 2 to 8. In some embodiments,
m is a value ranging from 3 to 8. In some embodiments, m is a value
ranging from 4 to 8. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 10 to about
60 residues. In some embodiments, the length of the repeating
A/T-rich segment is in the range from about 10 to about 40
consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 15 to about
40 consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 20 to about
40 consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 5 to about 50
consecutive residues. In some embodiments, the length of the
repeating NT-rich segment is in the range from about 10 to about 50
consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 15 to about
50 consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 20 to about
50 consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 5 to about 60
consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 10 to about
60 consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 15 to about
60 consecutive residues. In some embodiments, the length of the
repeating A/T-rich segment is in the range from about 20 to about
60 consecutive residues. Unless otherwise indicated, a repeating
A/T-rich segment can comprise an interruption as explained in the
following paragraph. In some embodiments, a repeating A/T-rich
segment does not comprise an interruption.
[0058] The term "homopolymeric segment" as used herein refers to
segments of nucleic acid which comprise a nucleotide such as A, T,
or U repeated in series. Unless otherwise indicated, a
homopolymeric segment can comprise an interruption in an otherwise
consecutive series of nucleotides. The interruption can be 3 or
fewer nucleotides differing from the other nucleotides making up
the series. In some embodiments, the interruption is a single
nucleotide. An example of a homopolymeric segment comprising an
interruption is a first number of T residues, then one C residue,
and then a second number of T residues. Another example of a
homopolymeric segment comprising an interruption is a first number
of U residues, then one C residue, and then a second number of U
residues. Another example of a homopolymeric segment comprising an
interruption is a first number of A residues, then one G residue,
and then a second number of A residues. The first and second
numbers of A, T, or U residues in the foregoing examples can be,
e.g., in the range of 5 to 10. In some embodiments, the first and
second numbers of A, T, or U residues in the foregoing examples are
in the range of 6 to 10. In some embodiments, the first and second
numbers of A, T, or U residues in the foregoing examples are in the
range of 7 to 10. In some embodiments, the first and second numbers
of A, T, or U residues in the foregoing examples are in the range
of 8 to 10. In some embodiments, the first and second numbers of A,
T, or U residues in the foregoing examples are in the range of 9 to
10. Alternatively, a homopolymeric segment can comprise a
consecutive series of nucleotides (which is not interrupted).
[0059] The terms "variable length polymorphism", "size
polymorphism", "repeat length polymorphism" can be used
interchangeably to refer to polymorphisms in the length of a
segment at a given locus.
[0060] FIG. 1A depicts an exemplary workflow of a method disclosed
herein. The method can be used for the assessment of a nucleic acid
comprising a homopolymeric segment. The method can comprise
admixing a sample 100 with a reaction solution 110 to create a
reaction mixture. The reaction solution 110 can be an aqueous
solution. The sample 100 can be known or suspected to comprise a
nucleic acid comprising a homopolymeric segment. The method can
further comprise subjecting the reaction mixture to a reaction 120.
The reaction 120 can comprise a nucleic acid synthesis reaction.
The method can optionally further comprise performing an analysis
130 of a reaction product generated by the reaction 120.
[0061] FIG. 1B depicts an exemplary reaction solution 110. The
reaction solution 110 can comprise NTPs 112. In some embodiments,
the NTPs comprise dNTPs. In some embodiments, the NTPs comprise
rNTPs. The reaction solution 110 can further comprise a polymerase
114. The reaction solution can further comprise one or more primers
116. The reaction mixture can further comprise one or more
additives 118.
[0062] The sample 100 can be a nucleic acid sample. The nucleic
acid sample can be any substance containing or presumed to contain
nucleic acid. The nucleic acid can be RNA, DNA, or any combination
thereof. The DNA can be, e.g., genomic DNA, mitochondrial DNA,
viral DNA, synthetic DNA, or cDNA reverse transcribed from RNA. The
RNA can be rRNA, tRNA, mRNA, siRNA, shRNA, miRNA, snoRNA, primary
transcript RNA, or synthetic RNA. A nucleic acid in the sample can
be fused to one or more nucleic acid adaptors. In some embodiments,
the adaptors are heterologous. An adaptor is heterologous if fusion
of the adaptor to the nucleic acid results in a non-naturally
occurring sequence. The adaptors can be, e.g., sequencing library
adaptors or universal primer adaptors. The adaptors can comprise
one or more barcodes. In some cases, a nucleic acid in the sample
need not be ligated to one or more adaptors.
[0063] The nucleic acid sample can be a biological sample. The
nucleic acid sample can be an enriched nucleic acid sample. The
enriched nucleic acid sample can be derived from a biological
sample that has undergone a purification process. In some
embodiments, the nucleic acid is purified from a biological sample,
e.g., by a process which comprises removing one or more non-nucleic
acid components from the biological sample. The nucleic acid sample
can comprise nucleic acid synthesized in vitro. Examples of in
vitro nucleic acid synthesis include an amplification reaction such
as PCR, in vitro transcription, in vitro reverse transcription, in
vitro primer extension, a sequencing reaction,
phosphoramidite-based nucleic acid synthesis, and combinations
thereof.
[0064] The biological sample can comprise liquid. It can be a fluid
sample. Exemplary fluid biological samples include, e.g., whole
blood, plasma, serum, soluble cellular extract, extracellular
fluid, cerebrospinal fluid, ascites, urine, sweat, tears, saliva,
buccal sample, a cavity rinse, or an organ rinse. The biological
sample can comprise a solid substance, e.g., feces or tissue.
Exemplary tissues include, e.g., brain, bone, marrow, lung, heart,
esophagus, stomach, duodenum, liver, prostate, nerve, meninges,
kidneys, endometrium, cervix, breast, lymph node, muscle, hair, and
skin, among others. The biological sample can be obtained from a
living subject, or can be obtained from a subject post-mortem. The
biological sample can comprise cell culture, cells, and/or cell
components. For example, the biological sample can comprise cell
culture constituents, such as, e.g., cultured cells, conditioned
media, recombinant cells, and cell components. In some embodiments,
the biological sample comprises cells. The cells can be primary
cells, can be immortalized cells from a cell line, can be
mammalian, or can be non-mammalian (e.g., bacteria, yeast). The
biological sample can comprise a microbe, such as a virus,
bacterium, protist, archaeon, or unicellular fungus. In some
embodiments, the microbe is a virus. In some embodiments, the
microbe is a bacterium. In some embodiments, the biological sample
comprises cell components.
[0065] The biological sample can be obtained from a subject. The
subject can be any biological entity comprising genetic material.
The subject can be an animal, plant, fungus, or microorganism, such
as, e.g., a bacterium, virus, archaeon, microscopic fungus, or
protist. The subject can be a mammal. The mammal can be a
human.
[0066] In some embodiments, the subject is not diagnosed with a
disease. In some embodiments, the subject is diagnosed with a
disease. In some embodiments, the subject is not suspected of being
at risk for a disease. In some embodiments, the subject is
suspected of being at risk for a disease. The disease can be a
degenerative disorder. The degenerative disorder can be a
neurodegenerative disorder. In some embodiments, the
neurodegenerative disorder is Alzheimer's disease.
[0067] In some embodiments, the sample 100 is known to harbor or
suspected of harboring a nucleic acid template. The nucleic acid
template can comprise one or more repeating A/T-rich segments, such
as homopolymeric segments. The nucleic acid template can be known
to comprise one or more repeating A/T-rich segments, such as
homopolymeric segments. The nucleic acid template can be suspected
of comprising one or more repeating A/T-rich segments, such as
homopolymeric segments.
[0068] The homopolymeric segment can comprise consecutive T and/or
U residues (wherein the segment can contain consecutive T residues,
consecutive U residues, or consecutive residues that include both U
and T residues), called a "T-homopolymeric segment." The
homopolymeric segment can comprise consecutive residues which are
either (i) A or (ii) T and/or U residues, but not both (i) and
(ii). The homopolymeric segment can comprise consecutive residues
which are either (i) A or (ii) T residues, but not both (i) and
(ii). The homopolymeric segment can comprise consecutive residues
which are (i) A or (ii) U residues, but not both (i) and (ii). The
homopolymeric segment can comprise consecutive A residues, called
an "A-homopolymeric segment." The homopolymeric segment can
comprise consecutive T residues. The homopolymeric segment can
comprise consecutive U residues.
[0069] The homopolymeric segment can comprise more than 10, more
than 11, more than 12, more than 13, more than 14, more than 15,
more than 16, more than 17, more than 18, more than 19, more than
20, more than 21, more than 22, more than 23, more than 24, more
than 25, more than 26, more than 27, more than 28, more than 29,
more than 30, more than 31, more than 32, more than 33, more than
34, more than 35, more than 36, more than 37, more than 38, more
than 39, more than 40, more than 41, more than 42, more than 43,
more than 44, more than 45, more than 46, more than 47, more than
48, more than 49, more than 50, more than 51, more than 52, more
than 53, more than 54, more than 55, more than 56, more than 57,
more than 58, more than 59, or more than 60 consecutive
residues.
[0070] The homopolymeric segment can comprise a number of
consecutive residues ranging from about 5 to about 40 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 10 to about 40 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 15 to about 40 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 20 to about 40 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 5 to about 50 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 10 to about 50 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 15 to about 50 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 20 to about 50 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 5 to about 60 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 10 to about 60 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 15 to about 60 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 20 to about 60 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 25 to about 40 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 5 to about 38 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 10 to about 38 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 15 to about 38 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 20 to about 38 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 25 to about 38 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 5 to about 36 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 10 to about 36 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 15 to about 36 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 20 to about 36 consecutive
residues. The homopolymeric segment can comprise a number of
consecutive residues ranging from about 25 to about 36 consecutive
residues.
[0071] The nucleic acid template can be known to comprise or
suspected of comprising a locus. The locus can comprise a repeating
A/T-rich segment, such as a homopolymeric segment. The locus can be
known to comprise or suspected of comprising a polymorphism. The
polymorphism can be a variable length polymorphism. The variable
length polymorphism can be an A/T rich polymorphism. In some cases,
the polymorphism is rs10524523. The locus can be in a gene. The
gene can be associated with a disease. The disease can be a
neurodegenerative disease. The neurodegenerative disease can be
Alzheimer's disease. The Alzheimer's disease can be late-onset
Alzheimer's disease. In some cases, the gene is TOMM40. In some
cases, the locus is in intron 6 of TOMM40.
[0072] The NTPs 112 can comprise an AT/GC ratio. As used herein, an
"AT/GC ratio" can refer to a ratio of the total concentration of
the sum of nucleotide triphosphates comprising A, T, or U to the
total concentration of the the sum of nucleotide triphosphates
comprising G or C. For example, an "AT/GC" ratio can refer to a
ratio of the total concentration of the sum of dATP, dUTP, and dTTP
([dATP]+[dUTP]+[dTTP]) to the total concentration of the sum of
dGTP and dCTP (e.g., can equal
([dATP]+[dUTP]+[dTTP])/([dGTP]+[dCTP]). The AT/GC ratio can be
biased, e.g., a ratio greater than 1. For example, the AT/GC ratio
can be about 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,
67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83,
84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,
113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125,
126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138,
139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151,
152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,
165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177,
178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190,
191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203,
204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216,
217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229,
230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242,
243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255,
256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268,
269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281,
282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294,
295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307,
308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320,
321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333,
334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346,
347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359,
360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372,
373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385,
386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398,
399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411,
412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424,
425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437,
438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450,
451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463,
464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476,
477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489,
490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, or higher
than 500.
[0073] The AT/GC ratio can be about 2 or higher, about 5 or higher,
about 6 or higher, about 7 or higher, about 8 or higher, about 9 or
higher, about 10 or higher, about 12.5 or higher, about 15 or
higher, about 17.5 or higher, about 20 or higher, about 25 or
higher, about 30 or higher, about 35 or higher, about 40 or higher,
about 45 or higher, about 50 or higher, about 55 or higher, or
about 60 or higher, about 70 or higher, about 80 or higher, about
90 or higher, about 100 or higher, about 120 or higher, about 140
or higher, about 160 or higher, about 180 or higher, about 200 or
higher, about 250 or higher, about 300 or higher, about 350 or
higher, about 400 or higher, about 450 or higher, or about 500 or
higher.
[0074] The AT/GC ratio can range from about 2 to about 25, range
from about 2 to about 60, range from about 5 to about 60, range
from about 10 to about 40, range from about 15 to about 30, range
from about 5 to about 25, range from about 8 to about 25, range
from about 10 to about 25, range from about 15 to about 25, or
range from about 18 to about 22. The AT/GC ratio can range from a
value of about X to about Y, wherein X and Y have values described
herein provided that Y is greater than X. X can be 2. X can be 5. X
can be 10. X can be 15. X can be 18. X can be 20. X can be 22. X
can be 25. X can be 30. X can be 35. X can be 40. X can be 45. X
can be 50. X can be 55. X can be 60. X can be 70. X can be 80. X
can be 90. X can be 100. X can be 120. X can be 140. X can be 160.
X can be 180. X can be 200. X can be 250. X can be 300. X can be
350. X can be 400. X can be 450. Y can be 5. Y can be 10. Y can be
15. Y can be 18. Y can be 20. Y can be 22. Y can be 25. Y can be
30. Y can be 35. Y can be 40. Y can be 45. Y can be 50. Y can be
55. Y can be 60. Y can be 70. Y can be 80. Y can be 90. Y can be
100. Y can be 120. Y can be 140. Y can be 160. Y can be 180. Y can
be 200. Y can be 250. Y can be 300. Y can be 350. Y can be 400. Y
can be 450. Y can be 500.
[0075] The NTPs 112 can comprise one of, more than one of, or all
of a dNTP complementary to cytidine, a dNTP complementary to
guanosine, a dNTP complementary to adenosine, and a dNTP
complementary to thymidine. For example, the NTPs 112 can comprise
one of, more than one of, or all of dATP, dTTP, dCTP, dGTP, and
dUTP. In some embodiments, the NTPs comprise dATP. dTTP, dCTP, and
dGTP. In some embodiments, the NTPs comprise dATP. In some
embodiments, the NTPs comprise a dNTP complementary to dATP. In
some embodiments, the NTPs comprise dCTP. In some embodiments, the
NTPs comprise a dNTP complementary to dCTP. In some embodiments,
the NTPs comprise dGTP. In some embodiments, the NTPs comprise a
dNTP complementary to dGTP. In some embodiments, the NTPs comprise
dTTP. In some embodiments, the NTPs comprise a dNTP complementary
to dTTP. In some embodiments, the NTPs comprise dUTP. In some
embodiments, the NTPs comprise a dNTP complementary to dUTP. In
some embodiments, the NTPs comprise diaminopurine. In some
embodiments, the NTPs comprise 2-thiothymine. In some embodiments,
the NTPs comprise 2-aminoadenine. In some embodiments, the NTPs
comprise at least one dideoxy-NTP (ddNTP). In some embodiments, the
NTPs comprise ddATP. In some embodiments, the NTPs comprise ddCTP.
In some embodiments, the NTPs comprise ddGTP. In some embodiments,
the NTPs comprise ddTTP. In some embodiments, the NTPs comprise
ddUTP.
[0076] The NTP complementary to cytidine can be present at a
concentration that is about 5 .mu.M or greater. The NTP
complementary to cytidine can be present at a concentration that is
about 10 .mu.M or greater. The NTP complementary to cytidine can be
present at a concentration that is about 40 .mu.M or greater. The
NTP complementary to cytidine can be present at a concentration
that ranges from about 10 .mu.M to about 400 .mu.M. The NTP
complementary to cytidine can be present at a concentration that
ranges from about 40 .mu.M to about 400 .mu.M. For example, the NTP
complementary to cytidine can be present at a concentration that is
about 10 .mu.M, about 20 .mu.M, about 30 .mu.M, about 40 .mu.M,
about 41 .mu.M, about 42 .mu.M, about 43 .mu.M, about 44 .mu.M,
about 45 .mu.M, about 46 .mu.M, about 47 .mu.M, about 48 .mu.M,
about 49 .mu.M, about 50 .mu.M, about 51 .mu.M, about 52 .mu.M,
about 53 .mu.M, about 54 .mu.M, about 55 .mu.M, about 56 .mu.M,
about 57 .mu.M, about 58 .mu.M, about 59 .mu.M, about 60 .mu.M,
about 61 .mu.M, about 62 .mu.M, about 63 .mu.M, about 64 .mu.M,
about 65 .mu.M, about 66 .mu.M, about 67 .mu.M, about 68 .mu.M,
about 69 .mu.M, about 70 .mu.M, about 71 .mu.M, about 72 .mu.M,
about 73 .mu.M, about 74 .mu.M, about 75 .mu.M, about 76 .mu.M,
about 77 .mu.M, about 78 .mu.M, about 79 .mu.M, about 80 .mu.M,
about 81 .mu.M, about 82 .mu.M, about 83 .mu.M, about 84 .mu.M,
about 85 .mu.M, about 86 .mu.M, about 87 .mu.M, about 88 .mu.M,
about 89 .mu.M, about 90 .mu.M, about 91 .mu.M, about 92 .mu.M,
about 93 .mu.M, about 94 .mu.M, about 95 .mu.M, about 96 .mu.M,
about 97 .mu.M, about 98 .mu.M, about 99 .mu.M, about 100 .mu.M,
about 125 .mu.M, about 150 .mu.M, about 175 .mu.M, about 200 .mu.M,
about 225 .mu.M, about 250 .mu.M, about 275 .mu.M, about 300 .mu.M,
about 325 .mu.M, about 350 .mu.M, about 375 .mu.M, or about 400
.mu.M.
[0077] The NTP complementary to guanosine can be present at a
concentration that is about 5 .mu.M or greater. The NTP
complementary to guanosine can be present at a concentration that
is about 10 .mu.M or greater. The NTP complementary to guanosine
can be present at a concentration that is about 40 .mu.M or
greater. The NTP complementary to guanosine can be present at a
concentration that ranges from about 10 .mu.M to about 400 .mu.M.
The NTP complementary to guanosine can be present at a
concentration that ranges from about 40 .mu.M to about 400 .mu.M.
For example, the NTP complementary to guanosine can be present at a
concentration that is about 10 .mu.M, about 20 .mu.M, about 30
.mu.M, about 40 .mu.M, about 41 .mu.M, about 42 .mu.M, about 43
.mu.M, about 44 .mu.M, about 45 .mu.M, about 46 .mu.M, about 47
.mu.M, about 48 .mu.M, about 49 .mu.M, about 50 .mu.M, about 51
.mu.M, about 52 .mu.M, about 53 .mu.M, about 54 .mu.M, about 55
.mu.M, about 56 .mu.M, about 57 .mu.M, about 58 .mu.M, about 59
.mu.M, about 60 .mu.M, about 61 .mu.M, about 62 .mu.M, about 63
.mu.M, about 64 .mu.M, about 65 .mu.M, about 66 .mu.M, about 67
.mu.M, about 68 .mu.M, about 69 .mu.M, about 70 .mu.M, about 71
.mu.M, about 72 .mu.M, about 73 .mu.M, about 74 .mu.M, about 75
.mu.M, about 76 .mu.M, about 77 .mu.M, about 78 .mu.M, about 79
.mu.M, about 80 .mu.M, about 81 .mu.M, about 82 .mu.M, about 83
.mu.M, about 84 .mu.M, about 85 .mu.M, about 86 .mu.M, about 87
.mu.M, about 88 .mu.M, about 89 .mu.M, about 90 .mu.M, about 91
.mu.M, about 92 .mu.M, about 93 .mu.M, about 94 .mu.M, about 95
.mu.M, about 96 .mu.M, about 97 .mu.M, about 98 .mu.M, about 99
.mu.M, about 100 .mu.M, about 125 .mu.M, about 150 .mu.M, about 175
.mu.M, about 200 .mu.M, about 225 .mu.M, about 250 .mu.M, about 275
.mu.M, about 300 .mu.M, about 325 .mu.M, about 350 .mu.M, about 375
.mu.M, or about 400 .mu.M.
[0078] In some cases, a NTP complementary to cytidine and a NTP
complementary to guanosine are both present at concentrations that
are about 10 .mu.M or greater. In some cases, a NTP complementary
to cytidine and a NTP complementary to guanosine are both present
at concentrations that are about 20 .mu.M or greater. In some
cases, a NTP complementary to cytidine and a NTP complementary to
guanosine are both present at concentrations that are about 30
.mu.M or greater. In some cases, a NTP complementary to cytidine
and a NTP complementary to guanosine are both present at
concentrations that are about 40 .mu.M or greater. In some cases,
the NTP complementary to cytidine and NTP complementary to
guanosine are both present at concentrations that are between about
10 .mu.M and 400 .mu.M. In some cases, the NTP complementary to
cytidine and NTP complementary to guanosine are both present at
concentrations that are between about 40 .mu.M and 400 .mu.M.
[0079] The NTP complementary to adenosine can be present at a
concentration that is about 20 .mu.M or greater. For example, the
NTP complementary to adenosine can be present at a concentration
that is about 20 .mu.M, about 30 .mu.M, about 40 .mu.M, about 50
.mu.M, about 60 .mu.M, about 70 .mu.M, about 80 .mu.M, about 90
.mu.M, about 100 .mu.M, about 125 .mu.M, about 150 .mu.M, about 175
.mu.M, about 200 .mu.M, about 225 .mu.M, about 250 .mu.M, about 275
.mu.M, about 300 .mu.M, about 325 .mu.M, about 350 .mu.M, about 375
.mu.M, about 400 .mu.M, about 425 .mu.M, about 450 .mu.M, about 475
.mu.M, about 500 .mu.M, about 525 .mu.M, about 550 .mu.M, about 575
.mu.M, about 600 .mu.M, about 625 .mu.M, about 650 .mu.M, about 675
.mu.M, about 700 .mu.M, about 725 .mu.M, about 750 .mu.M, about 775
.mu.M, about 800 .mu.M, about 825 .mu.M, about 850 .mu.M, about 875
.mu.M, about 900 .mu.M, about 925 .mu.M, about 950 .mu.M, about 975
.mu.M, about 1000 .mu.M (1 mM), about 1.2 mM, about 1.4 mM, about
1.6 mM, about 1.8 mM, about 2 mM, or higher. The NTP complementary
to adenosine can be present at a concentration that ranges from
about 20 .mu.M and about 5 mM. The NTP complementary to adenosine
can be present at a concentration that ranges from about 50 .mu.M
and about 5 mM. The NTP complementary to adenosine can be present
at a concentration that ranges from about 100 .mu.M and about 5 mM.
The NTP complementary to adenosine can be present at a
concentration that ranges from about 250 .mu.M and about 5 mM. The
NTP complementary to adenosine can be present at a concentration
that ranges from about 20 .mu.M and about 3 mM. The NTP
complementary to adenosine can be present at a concentration that
ranges from about 50 .mu.M and about 3 mM. The NTP complementary to
adenosine can be present at a concentration that ranges from about
100 .mu.M and about 3 mM. The NTP complementary to adenosine can be
present at a concentration that ranges from about 250 .mu.M and
about 3 mM. The NTP complementary to adenosine can be present at a
concentration that ranges from about 20 .mu.M and about 2 mM. The
NTP complementary to adenosine can be present at a concentration
that ranges from about 50 .mu.M and about 2 mM. The NTP
complementary to adenosine can be present at a concentration that
ranges from about 100 .mu.M and about 2 mM. The NTP complementary
to adenosine can be present at a concentration that ranges from
about 250 .mu.M and about 2 mM. The NTP complementary to adenosine
can be present at a concentration that ranges from about 700 .mu.M
and about 1.5 mM. The NTP complementary to adenosine can be present
at a concentration that ranges from about 700 .mu.M and about 2
mM.
[0080] The NTP complementary to thymidine can be present at a
concentration that is about 20 .mu.M or greater. For example, the
NTP complementary to thymidine can be present at a concentration
that is about 20 .mu.M, about 30 .mu.M, about 40 .mu.M, about 50
.mu.M, about 60 .mu.M, about 70 .mu.M, about 80 .mu.M, about 90
.mu.M, about 100 .mu.M, about 125 .mu.M, about 150 .mu.M, about 175
.mu.M, about 200 .mu.M, about 225 .mu.M, about 250 .mu.M, about 275
.mu.M, about 300 .mu.M, about 325 .mu.M, about 350 .mu.M, about 375
.mu.M, about 400 .mu.M, about 425 .mu.M, about 450 .mu.M, about 475
.mu.M, about 500 .mu.M, about 525 .mu.M, about 550 .mu.M, about 575
.mu.M, about 600 .mu.M, about 625 .mu.M, about 650 .mu.M, about 675
.mu.M, about 700 .mu.M, about 725 .mu.M, about 750 .mu.M, about 775
.mu.M, about 800 .mu.M, about 825 .mu.M, about 850 .mu.M, about 875
.mu.M, about 900 .mu.M, about 925 .mu.M, about 950 .mu.M, about 975
.mu.M, about 1000 .mu.M (1 mM), about 1.2 mM, about 1.4 mM, about
1.6 mM, about 1.8 mM, about 2 mM, or higher. The NTP complementary
to thymidine can be present at a concentration that ranges from
about 20 .mu.M and about 5 mM. The NTP complementary to thymidine
can be present at a concentration that ranges from about 50 .mu.M
and about 5 mM. The NTP complementary to thymidine can be present
at a concentration that ranges from about 100 .mu.M and about 5 mM.
The NTP complementary to thymidine can be present at a
concentration that ranges from about 250 .mu.M and about 5 mM. The
NTP complementary to thymidine can be present at a concentration
that ranges from about 20 .mu.M and about 3 mM. The NTP
complementary to thymidine can be present at a concentration that
ranges from about 50 .mu.M and about 3 mM. The NTP complementary to
thymidine can be present at a concentration that ranges from about
100 .mu.M and about 3 mM. The NTP complementary to thymidine can be
present at a concentration that ranges from about 250 .mu.M and
about 3 mM. The NTP complementary to thymidine can be present at a
concentration that ranges from about 20 .mu.M and about 2 mM. The
NTP complementary to thymidine can be present at a concentration
that ranges from about 50 .mu.M and about 2 mM. The NTP
complementary to thymidine can be present at a concentration that
ranges from about 100 .mu.M and about 2 mM. The NTP complementary
to thymidine can be present at a concentration that ranges from
about 250 .mu.M and about 2 mM. The NTP complementary to thymidine
can be present at a concentration that ranges from about 700 .mu.M
and about 1.5 mM. The NTP complementary to thymidine can be present
at a concentration that ranges from about 700 .mu.M and about 2
mM.
[0081] In some cases, a NTP complementary to adenosine and a NTP
complementary to thymidine are both present at concentrations that
are about 20 .mu.M or greater, about 50 .mu.M or greater, about 150
.mu.M or greater, about 200 .mu.M or greater, about 250 .mu.M or
greater, about 500 .mu.M or greater, about 750 .mu.M or greater,
about 1000 .mu.M or greater, about 2000 .mu.M or greater, about
3000 .mu.M or greater or about 4000 .mu.M or greater. In some
cases, the NTP complementary to adenosine and NTP complementary to
thymidine are both present at concentrations that are between about
50 .mu.M and about 4000 .mu.M. In some cases, the NTP complementary
to adenosine and NTP complementary to thymidine are both present at
concentrations that are between about 250 .mu.M and about 2000
.mu.M. In some cases, the NTP complementary to adenosine and NTP
complementary to thymidine are both present at concentrations that
are between about 700 .mu.M and 1500 .mu.M. In some cases, the NTP
complementary to adenosine and NTP complementary to thymidine are
both present at concentrations that are between about 700 .mu.M and
2000 .mu.M.
[0082] The reaction solution 110 can comprise a total NTP
concentration. The total NTP concentration can be about 0.1 mM,
about 0.2 mM, about 0.3 mM, about 0.4 mM, about 0.5 mM, about 0.6
mM, about 0.7 mM, about 0.8 mM, about 0.9 mM, about 1 mM, about 1.2
mM, about 1.5 mM, about 2 mM, about 2.1 mM, about 2.2. mM, about
2.3 mM, about 2.4 mM, about 2.5 mM, about 2.6 mM, about 2.7 mM,
about 2.8 mM, about 2.9 mM, about 3 mM, about 3.1 mM, about 3.2 mM,
about 3.3 mM, about 3.4 mM, about 3.5 mM, about 3.6 mM, about 3.7
mM, about 3.8 mM, about 3.9 mM, about 4 mM, about 4.1 mM, about 4.2
mM, about 4.3 mM, about 4.4 mM, about 4.5 mM, about 4.6 mM, about
4.7 mM, about 4.8 mM, about 4.9 mM, about 5 mM, about 5.1 mM, about
5.2 mM, about 5.3 mM, about 5.4 mM, about 5.5 mM, about 5.6 mM,
about 5.7 mM, about 5.8 mM, about 5.9 mM, about 6 mM, about 6.1 mM,
about 6.2 mM, about 6.3 mM, about 6.4 mM, about 6.5 mM, about 6.6
mM, about 6.7 mM, about 6.8 mM, about 6.9 mM, about 7 mM, about 7.1
mM, about 7.2 mM, about 7.3 mM, about 7.4 mM, about 7.5 mM, about
7.6 mM, about 7.7 mM, about 7.8 mM, about 7.9 mM, about 8 mM, about
8.1 mM, about 8.2 mM, about 8.3 mM, about 8.4 mM, about 8.5 mM,
about 8.6 mM, about 8.7 mM, about 8.8 mM, about 8.9 mM, about 9 mM,
about 9.1 mM, about 9.2 mM, about 9.3 mM, about 9.4 mM, about 9.5
mM, about 9.6 mM, about 9.7 mM, about 9.8 mM, about 9.9 mM, about
10 mM, about 10.1 mM, about 10.2 mM, about 10.3 mM, about 10.4 mM,
about 10.5 mM, about 10.6 mM, about 10.7 mM, about 10.8 mM, about
10.9 mM, or about 11 mM. In some cases, the total NTP concentration
is about 2.1 mM. In some cases, the total NTP concentration is
about 4.1 mM. In some cases, the total NTP concentration is about
6.1 mM. In some cases, the total NTP concentration is about 4.2
mM.
[0083] In some cases, the total NTP concentration ranges from about
0.4 mM to about 8 mM. In some cases, the total NTP concentration
ranges from about 0.5 mM to about 5 mM. In some cases, the total
NTP concentration ranges from about 2 mM to about 4.5 mM. In some
cases, the total NTP concentration ranges from about 2 mM to about
2.5 mM. In some cases, the total NTP concentration ranges from
about 2.5 mM to about 3.5 mM. In some cases, the total NTP
concentration ranges from about 3.5 mM to about 4.5 mM. In some
cases, the total NTP concentration ranges from about 3.5 mM to
about 4.2 mM.
[0084] The polymerase 114 can be a DNA polymerase. The DNA
polymerase can comprise a wild-type polymerase. The DNA polymerase
can comprise a modified polymerase. The DNA polymerase can comprise
a thermophilic polymerase. The DNA polymerase can comprise a
chimeric polymerase. The DNA polymerase can comprise an engineered
polymerase. The DNA polymerase can comprise a mixture of more than
one polymerase. Exemplary DNA polymerases include, e.g., a
high-fidelity DNA polymerase (EXACT POLYMERASE.TM. (5 PRIME GmbH),
ACCUSURE.TM. DNA Polymerase (Bioline), PHUSION.TM. ACCUPRIME.TM.
Pfx (Invitrogen), Extensor Hi-Fidelity PCR Enzyme (ABgene),
ACCUZYME.TM. DNA Polymerase (Bioline), OPTIMASE.RTM. DNA Polymerase
(Transgenomic, Inc.), VELOCITY DNA Polymerase (Bioline),
GENECHOICE.RTM. ACCUPOL.TM. DNA Polymerase (GeneChoice, Inc.), KOD
HIFI.TM. DNA Polymerase (Novagen), EASY-A.TM. High-Fidelity PCR
Cloning Enzyme (Stratagene), EXL.TM. DNA Polymerase (Stratagene),
KAPA HIFI.TM. DNA Polymerase (Kapa Biosystems), HERCULASE.RTM. II
Fusion DNA Polymerase (Stratagene), BIO-X-ACT.TM. Long DNA
Polymerase (Bioline), BIO-X-ACT.TM. Short DNA Polymerase (Bioline),
EU-Taq DNA Polymerase (EENZYME.RTM. LLC), PYROPHAGE.RTM. 3173 DNA
Polymerase, Pwo DNA Polymerase (Roche Applied Science), or PLATINUM
Taq DNA Polymerase High Fidelity (Invitrogen)), a hot-start DNA
polymerase (PHIRE.TM. Hot Start DNA Polymerase (New England
Biolabs), PHUSION.TM. Hot Start High-Fidelity DNA Polymerase (New
England Biolabs), JUMPSTART.TM. REDTAQ.TM. DNA Polymerase
(Sigma-Aldrich), PFUULTRA.TM. Hotstart DNA Polymerase (Stratagene),
PFUTURBO.RTM. Cx Hotstart DNA Polymerase (Stratagene),
PRIMESTAR.TM. HS DNA Polymerase (Takara), HotMaster.TM. Taq DNA
Polymerase (5 PRIME GmbH), HOTTAQ.TM. DNA Polymerase (Abnova
Corporation), AMPLITAQ GOLD.RTM. DNA Polymerase (Applied
Biosystems), RED HOT DNA Polymerase (ABgene), ACCUPRIME.TM. GC-Rich
DNA Polymerase (Invitrogen), PAQ5000.TM. DNA Polymerase
(Stratagene), or SAHARA.TM. DNA Polymerase (Bioline)), a mixture of
more than one polymerase (GENECHOICE.RTM. UNIPOL.TM. DNA Polymerase
(GeneChoice, Inc.), KOD XL.TM. DNA Polymerase (Novagen), LA TAQ DNA
Polymerase (Takara), EXPAND.RTM. 20 kb PLUS Thermostable DNA
polymerase mixture (Roche Applied Science), EXPAND High Fidelity
PLUS Thermostable DNA polymerase mixture (Roche Applied Science),
EXPAND High Fidelity Thermostable DNA polymerase mixture (Roche
Applied Science), EXPAND.RTM. Long Template Thermostable DNA
polymerase mixture (Roche Applied Science), HERCULASE.RTM. Enhanced
DNA Polymerase (Stratagene), KAPA LONGRANGE.TM. DNA Polymerase
(Kapa Biosystems), Synergy Taq DNA Polymerase (EENZYME.RTM. LLC),
or ELONGASE.RTM. Enzyme Mix (Invitrogen)), a chimeric DNA
polymerase (PFX50.TM. DNA Polymerase (Invitrogen), BIOLINE
HYBRIPOL.TM. DNA Polymerase (Bioline), or PHUSION.TM. DNA
Polymerase (New England Biolabs)), a modified DNA polymerase
(KAPA2G.TM. Robust DNA Polymerase (Kapa Biosystems), KAPA2G.TM.
Robust HotStart DNA Polymerase (Kapa Biosystems), KAPA2G.TM. Fast
DNA Polymerase (Kapa Biosystems), KAPA2G.TM. Fast HotStart DNA
Polymerase (Kapa Biosystems), 9 DEGREES NORTH.TM. (Modified) DNA
Polymerase (New England Biolabs), or THERMINATOR.TM. DNA Polymerase
(New England Biolabs)), an exo-DNA polymerase (Exo-Pfu DNA
Polymerase (Stratagene), Bst DNA Polymerase Lg Frag (New England
Biolabs), MASTERAMP.TM. Tfl DNA Polymerase (EPICENTRE
Biotechnologies), Thermoprime Plus DNA Polymerase (ABgene), Taq-red
DNA Polymerase (AppliChem GmbH), BIOTHERM.TM. Taq DNA Polymerase
(EENZYME.RTM. LLC), GENECHOICE.RTM. REDPOL.TM. DNA Polymerase
(GeneChoice, Inc.), or Exo Minus (Lucigen)), a high-yield DNA
polymerase (YIELDACE.TM. DNA Polymerase (Stratagene) or E2TAK.TM.
DNA Polymerase (Takara)), or naturally occurring DNA polymerases
from P. kodakaraensis, P. furiosus, T. gorgonarius, T. zilligii, T.
litoralis "Vent.TM.", P. GB-D "Deep Vent", T. 9N-7, T. aggregans,
T. barossii, T. fumicolans, T. celer, Pyrococcus sp. strain ST700,
T. pacificus, P. abysii, T. profundus, T. siculi, T.
hydrothermalis, Thermococcus sp. strain GE8, T. thioreducens, P.
horikoshii or T. onnurineus NA1, Thermococcus sp. 9.degree. N-7,
Thermococcus sp. GI-J, Thermococcus sp. MAR-13, Thermococcus sp.
GB-C, Thermococcus sp. GI-H, Thermus aquaticus, Thermus
thermophilus, Thermus caldophilus, Thermus filiformis, Thermus
flavus, Thermotoga maritima, Bacillus stearothermophilus, or
Bacillus caldotenax, for example. In certain embodiments, the DNA
polymerase is Phoenix Hot Start Taq Polymerase.RTM.. In certain
embodiments, the DNA polymerase is Phusion.sup.a Hot Start
High-Fidelity DNA Polymerase (New England Biolabs). In certain
embodiments, the DNA polymerase is Herculase.RTM. II Fusion DNA
Polymerase (Stratagene).
[0085] The DNA polymerase can be a hot-start DNA polymerase.
Exemplary hot-start DNA polymerases include, e.g., Phoenix Hot
Start Taq Polymerase.RTM. (Enzymatics), Phire.TM. Hot Start DNA
Polymerase (New England Biolabs), Phusion.sup.a Hot Start
High-Fidelity DNA Polymerase (New England Biolabs), JumpStart.TM.
REDTaq.TM. DNA Polymerase (Sigma-Aldrich), PfuUltra.TM. Hotstart
DNA Polymerase (Stratagene), PfuTurbo.RTM. Cx Hotstart DNA
Polymerase (Stratagene), PrimeSTAR.TM. HS DNA Polymerase (Takara),
among others. In some cases, the polymerase 114 is an RNA
polymerase.
[0086] One or more primers 116 can prime polymerase-mediated
extension into, across, or within a locus. The one or more primers
116 can hybridize to a template comprising the locus. The one or
more primers 116 can amplify the template comprising the locus.
Exemplary loci are described herein. The locus can be known to
harbor or suspected of harboring a segment that comprises one or
more homopolymeric segments. Exemplary homopolymeric segments are
described herein.
[0087] The one or more primers 116 can comprise a forward primer.
The forward primer can anneal to a 5' end of a template. For
example, the forward primer can anneal to about 15-30, 15-25,
15-20, 20-30, or 20-25 nucleotides at a 5' end of the template. The
one or more primers can also comprise a reverse primer. The reverse
primer can anneal to a 3' end of a template (e.g., to a 5' end of a
reverse strand of the template). For example, the reverse primer
can anneal to about 15-30, 15-25, 15-20, 20-30, or 20-25
nucleotides at a 3' end of the template.
[0088] The one or more primers 116 can comprise a first primer that
hybridizes to a location upstream of a variable length
polymorphism. In some cases, a portion of the first primer can
hybridize to a portion of the variable length polymorphism. The one
or more primers 116 can comprise a second primer that hybridizes to
a location downstream of the variable length polymorphism. In some
cases, a portion of the second primer can hybridize to a portion of
the variable length polymorphism. The second primer can hybridize
to a portion of the variable length polymorphism that is smaller
than the smallest known allele of the variable length polymorphism.
For instance, if the smallest known allele of a variable length
polymorphism of interest is 10 nucleotides, the second primer can
hybridize to 9 or fewer nucleotides of the variable length
polymorphism. In some cases, a first or second primer can comprise
a 3'-terminal sequence that preferentially hybridizes to about 4 to
about 9 consecutive A or T residues.
[0089] The variable length polymorphism can be a TOMM40
polymorphism. In some embodiments, the variable length polymorphism
is the rs10524523 polymorphism.
[0090] In some embodiments, the one or more primers 116 comprises a
first primer that hybridizes to a location upstream of a variable
length polymorphism, such as within 500, 300, 200, 100, or 50
nucleotides of the variable length polymorphism. In some
embodiments, the first primer specifically hybridizes to a location
separated from a variable length polymorphism by 1 to about 500
nucleotides. In some embodiments, the first primer specifically
hybridizes to a location separated from a variable length
polymorphism by 1 to about 300 nucleotides. In some embodiments,
the first primer specifically hybridizes to a location separated
from a variable length polymorphism by 1 to about 200 nucleotides.
In some embodiments, the first primer specifically hybridizes to a
location separated from a variable length polymorphism by 1 to
about 100 nucleotides. In some embodiments, the first primer
specifically hybridizes to a location separated from a variable
length polymorphism by 1 to about 50 nucleotides. In some
embodiments, the first primer specifically hybridizes to a location
separated from a variable length polymorphism by about 50 to about
500 nucleotides. In some embodiments, the first primer specifically
hybridizes to a location separated from a variable length
polymorphism by about 50 to about 300 nucleotides. In some
embodiments, the first primer specifically hybridizes to a location
separated from a variable length polymorphism by about 50 to about
200 nucleotides. In some embodiments, the first primer specifically
hybridizes to a location separated from a variable length
polymorphism by about 50 to about 100 nucleotides. The one or more
primers 116 can comprise a second primer that hybridizes to a
location downstream of the variable length polymorphism, such as
within 500, 300, 200, 100, or 50 nucleotides of the variable length
polymorphism. In some embodiments, the second primer specifically
hybridizes to a location separated from a variable length
polymorphism by 1 to about 500 nucleotides. In some embodiments,
the second primer specifically hybridizes to a location separated
from a variable length polymorphism by 1 to about 300 nucleotides.
In some embodiments, the second primer specifically hybridizes to a
location separated from a variable length polymorphism by 1 to
about 200 nucleotides. In some embodiments, the second primer
specifically hybridizes to a location separated from a variable
length polymorphism by 1 to about 100 nucleotides. In some
embodiments, the second primer specifically hybridizes to a
location separated from a variable length polymorphism by 1 to
about 50 nucleotides. In some embodiments, the second primer
specifically hybridizes to a location separated from a variable
length polymorphism by about 50 to about 500 nucleotides. In some
embodiments, the second primer specifically hybridizes to a
location separated from a variable length polymorphism by about 50
to about 300 nucleotides. In some embodiments, the second primer
specifically hybridizes to a location separated from a variable
length polymorphism by about 50 to about 200 nucleotides. In some
embodiments, the second primer specifically hybridizes to a
location separated from a variable length polymorphism by about 50
to about 100 nucleotides. The variable length polymorphism can be a
TOMM40 polymorphism. In some embodiments, the variable length
polymorphism is the rs10524523 polymorphism. Specific hybridization
to a location means that a primer preferentially binds to that
location over other locations in the sample under a primer binding
condition suitable for a nucleic acid synthesis reaction, such as a
solution comprising 50 mM KCl, pH 8, at one or more hybridization
temperatures such as 42.degree. C., 45.degree. C., 50.degree. C.,
55.degree. C., 56.degree. C., 57.degree. C., 58.degree. C.,
59.degree. C., 60.degree. C., 61.degree. C., 62.degree. C.,
63.degree. C., 64.degree. C., 65.degree. C., 66.degree. C.,
67.degree. C., 68.degree. C., 69.degree. C., 70.degree. C.,
71.degree. C., or 72.degree. C.
[0091] Exemplary primers include, e.g., CCAAAGCATTGGGATTACTGGC
(primer 001) (SEQ ID NO: 1) and GATTGCTTGAGCCTAGGCATTC (primer 002)
(SEQ ID NO: 2). In some embodiments, primer 001 is detectably
labeled. In some embodiments, primer 001 is detectably labeled with
a fluorophore. In some embodiments, primer 001 is detectably
labeled with FAM. In some embodiments, primer 002 is detectably
labeled. In some embodiments, primer 002 is detectably labeled with
a fluorophore. In some embodiments, primer 002 is detectably
labeled with FAM.
[0092] In some embodiments, the one or more primers 116 comprises a
set of primers. The set of primers can comprise at least one primer
described herein. In some embodiments, the set of primers is
capable of priming polymerase-mediated extension into more than one
locus. In some embodiments, the set of primers comprises primers
collectively capable of hybridizing specifically to a plurality of
templates that comprise or are suspected of harboring a locus of
interest. In some embodiments, the set of primers is capable of
amplifying a plurality of templates comprising a plurality of loci
of interest.
[0093] The one or more additives 118 can comprise a buffer.
Exemplary buffers include, e.g., tris(hydroxymethyl)aminomethane
(Tris), bis-tris propane, bicarbonate, phosphate, glycine,
histidine, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
(HEPES), 3-(N-morpholino)propanesulfonic acid (MOPS), and various
conjugate bases/acids and salts thereof.
[0094] The one or more additives 118 can comprise magnesium (Mg).
The term magnesium, as used herein, includes magnesium in solution
(solute and solvated/hydrated forms) and in its ionized forms. The
magnesium can be in the form of a magnesium salt, including solute
and solvated/hydrated forms, e.g., magnesium ions and counterions
in solution. The magnesium salt can be a chemical compound
containing magnesium and the conjugate base of an acid. Exemplary
magnesium salts include, without limitation, magnesium chloride,
magnesium acetate, magnesium sulfate, magnesium bromide, or
magnesium iodide. The magnesium salts can be provided in such
quantity that the final concentration of magnesium can be in a
given range. In some embodiments, the magnesium concentration
ranges from about 1 to about 11 mM. In some embodiments, the
magnesium concentration ranges from about 1 to about 10 mM. In some
embodiments, the magnesium concentration ranges from about 1 to
about 7.5 mM. In some embodiments, the magnesium concentration
ranges from about 1 to about 5 mM. In some embodiments, the
magnesium concentration ranges from about 1 to about 4.5 mM. In
some embodiments, the magnesium concentration ranges from about 1
to about 4 mM. In some embodiments, the magnesium concentration
ranges from about 1 to about 3.5 mM. In some embodiments, the
magnesium concentration ranges from about 1 to about 3 mM. In some
embodiments, the magnesium concentration ranges from about 1.5 to
about 3 mM. In some embodiments, the magnesium concentration ranges
from about 2 to about 5 mM. In some embodiments, the magnesium
concentration ranges from about 2 to about 11 mM. In some
embodiments, the magnesium concentration ranges from about 2 to
about 10 mM. In some embodiments, the magnesium concentration
ranges from about 2 to about 7.5 mM. In some embodiments, the
magnesium concentration ranges from about 2.5 to about 11 mM. In
some embodiments, the magnesium concentration ranges from about 2.5
to about 10 mM. In some embodiments, the magnesium concentration
ranges from about 2.5 to about 7.5 mM. In some embodiments, the
magnesium concentration ranges from about 2.5 to about 5 mM. In
some embodiments, the magnesium concentration ranges from about 3
to about 11 mM. In some embodiments, the magnesium concentration
ranges from about 3 to about 10 mM. In some embodiments, the
magnesium concentration ranges from about 3 to about 7.5 mM. In
some embodiments, the magnesium concentration ranges from about 3
to about 5 mM. In some embodiments, the magnesium concentration
ranges from about 1.5 to about 4.5 mM. In some embodiments, the
magnesium concentration ranges from about 2 to about 4 mM. For
example, the final concentration of magnesium can be about 1, 1.5,
2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10, or 11 mM. In some
embodiments, the magnesium concentration ranges from about 1 mM to
7 mM more than the total NTP concentration. In some embodiments,
the magnesium concentration ranges from about 1 mM to 6 mM more
than the total NTP concentration. In some embodiments, the
magnesium concentration ranges from about 1 mM to 5 mM more than
the total NTP concentration. In some embodiments, the magnesium
concentration ranges from about 1 mM to 4 mM more than the total
NTP concentration. In some embodiments, the magnesium concentration
ranges from about 1 mM to 3 mM more than the total NTP
concentration. In some embodiments, the magnesium concentration
ranges from about 1 mM to 2 mM more than the total NTP
concentration. In some embodiments, the magnesium concentration
ranges from about 1 mM to 1 mM more than the total NTP
concentration. The magnesium can be present at a molarity that
ranges from about 70% to about 300% of the molarity of total NTPs.
The magnesium can be present at a molarity that ranges from about
80% to about 300% of the molarity of total NTPs. The magnesium can
be present at a molarity that ranges from about 70% to about 250%
of the molarity of total NTPs. The magnesium can be present at a
molarity that ranges from about 80% to about 250% of the molarity
of total NTPs. The magnesium can be present at a molarity that
ranges from about 70% to about 200% of the molarity of total NTPs.
The magnesium can be present at a molarity that ranges from about
80% to about 200% of the molarity of total NTPs. The magnesium can
be present at a molarity that ranges from about 70% to about 150%
of the molarity of total NTPs. The magnesium can be present at a
molarity that ranges from about 80% to about 150% of the molarity
of total NTPs. The magnesium can be present at a molarity that
ranges from about 90% to about 125% of the molarity of total
NTPs.
[0095] The one or more additives 118 can comprise one or more
enhancers. In some cases, the one or more enhancers comprises one
or more of betaine, DMSO, and a neutral detergent. In some cases,
the one or more enhancers comprises one or more of betaine, a
betaine analog, DMSO, and a neutral detergent. "Betaine" refers to
N,N,N-trimethylglycine. A "betaine analog" is any neutral chemical
compound with a positively charged cationic functional group which
bears no hydrogen atom, for example, an ammonium ion or phosphonium
ion, and with a negatively charged functional group such as a
carboxylate group which may not be adjacent to the cationic site.
In some embodiments, the betaine analog has a molecular weight less
than or equal to about 600 Da. The betaine analog can have a
molecular weight less than or equal to about 300 Da. The betaine
analog can have a molecular weight ranging from about 75 to about
600 Da. The betaine analog can have a molecular weight ranging from
about 75 to about 300 Da. Additionally or alternatively, the
betaine analog can comprise an ammonium moiety and/or a carboxylate
moiety. The one or more additives 118 can comprise betaine and/or a
betaine analog. Betaine and/or a betaine analog can be present at a
molar concentration ranging from 0.01 to 5 M, 0.01 to 4 M, 0.01 to
3 M, 0.01 to 2.5 M, 0.02 to 5 M, 0.03 to 5 M, 0.04 to 5 M, 0.05 to
5M, 0.07 to 5M, 0.1 to 5 M, 0.2 to 5 M, 0.3 to 5 M, 0.4 to 5 M, 0.5
to 5 M, 0.7 to 5 M, 1 to 5 M, 1.5 to 5M, 0.1 to 4 M, 0.5 to 3 M,
0.5 to 2.5 M, or 0.5 to 2.5 M, for example, about 0.01, 0.02, 0.05,
0.1, 0.2, 0.5, 0.75, 1, 1.25, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1,
2.2, 2.3, 2.4, 2.5, 3, 3.5, 4, 4.5, or 5 M. In some cases, the one
or more additives 118 comprise about 1 M betaine.
[0096] The one or more additives 118 can comprise DMSO. DMSO can be
present in the reaction solution at a concentration that ranges
from about 0.1% to about 10% (v/v). DMSO can be present in the
reaction solution at a concentration that ranges from about 0.5% to
about 5%. DMSO can be present in the reaction solution at a
concentration that ranges from about 0.5% to about 10%. DMSO can be
present in the reaction solution at a concentration that ranges
from about 0.1% to about 5%. DMSO can be present in the reaction
solution at a concentration that ranges from about 0.5% to about
3%. The DMSO can be present in the reaction solution at a
concentration that is about 0.1%, about 0.2%, about 0.3%, about
0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%,
about 1%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about
1.5%, about 1.6%, about 1.7%, about 1.8%, about 1.9%, about 2%,
about 2.1%, about 2.2%, about 2.3%, about 2.4%, about 2.5%, about
2.6%, about 2.7%, about 2.8%, about 2.9%, about 3%, about 3.1%,
about 3.2%, about 3.3%, about 3.4%, about 3.5%, about 3.6%, about
3.7%, about 3.8%, about 3.9%, about 4%, about 4.1%, about 4.2%,
about 4.3%, about 4.4%, about 4.5%, about 4.6%, about 4.7%, about
4.8%, about 4.9%, about 5%, about 5.1%, about 5.2%, about 5.3%,
about 5.4%, about 5.5%, about 5.6%, about 5.7%, about 5.8%, about
5.9%, about 6%, about 6.1%, about 6.2%, about 6.3%, about 6.4%,
about 6.5%, about 6.6%, about 6.7%, about 6.8%, about 6.9%, about
7%, about 7.1%, about 7.2%, about 7.3%, about 7.4%, about 7.5%,
about 7.6%, about 7.7%, about 7.8%, about 7.9%, about 8%, about
8.1%, about 8.2%, about 8.3%, about 8.4%, about 8.5%, about 8.6%,
about 8.7%, about 8.8%, about 8.9%, about 9%, about 9.1%, about
9.2%, about 9.3%, about 9.4%, about 9.5%, about 9.6%, about 9.7%,
about 9.8%, about 9.9%, or about 10%. In some cases, the one or
more additives 118 comprise about 1% DMSO. In some cases, the one
or more additives 118 comprise about 2% DMSO.
[0097] In some cases, the reaction solution comprises two
enhancers. In some cases, the reaction solution comprises three
enhancers. In some cases, the reaction solution comprises betaine
and DMSO. In some cases, the reaction solution comprises a betaine
analog and DMSO. In some cases, the reaction solution comprises
betaine, DMSO, and a neutral detergent. Exemplary concentrations of
betaine and DMSO are disclosed herein.
[0098] Other additives that can be present in the reaction solution
include, but are not limited to, non-specific background/blocking
nucleic acids (e.g., salmon sperm DNA), biopreservatives (e.g.
sodium azide), and inhibitors (e.g. RNAse inhibitors).
[0099] Some embodiments of a reaction solution 110 comprise a NTPs
112 with an AT/GC ratio of about 2 or greater. In some embodiments,
the reaction solution comprises about 100 .mu.M each dATP and dTTP,
and 50 .mu.M each dGTP and dCTP. In some embodiments, the NTPs 112
have an AT/GC ratio of about 5. In some embodiments, the reaction
solution comprises about 250 .mu.M each dATP and dTTP, and 50 .mu.M
each dGTP and dCTP. In some embodiments, the NTPs 112 have an AT/GC
ratio of about 10. In some embodiments, the reaction solution
comprises about 500 .mu.M each dATP and dTTP, and 50 .mu.M each
dGTP and dCTP. In some embodiments, the NTPs 112 have an AT/GC
ratio of about 20. For example, the reaction solution can comprise
about 1000 .mu.M each dATP and dTTP, and 50 .mu.M each dGTP and
dCTP. In some embodiments, the reaction solution comprises about
2000 .mu.M each dATP and dTTP, and 100 .mu.M each dGTP and
dCTP.
[0100] The reaction solution can further comprise about 1.5 mM to
about 4 mM Mg.sup.2+. In some embodiments, the reaction solution
comprises about 2.5 mM Mg.sup.2+. In some embodiments, the reaction
solution comprises about 2 mM Mg.sup.2+. In some embodiments, the
reaction solution comprises about 4 mM Mg.sup.2+. The reaction
solution can further comprise betaine. The betaine can be present
in a molarity that ranges from about 0.1 to 2 M betaine, for
example, between about 0.5 to about 1.5 M betaine. In some
embodiments, the betaine is present at a 1 M concentration. The
reaction solution can further comprise DMSO. The DMSO can be
present at a concentration that can be between about 0.1% and about
10%, for example, between about 0.5% and about 4%.
[0101] Table 1 below lists exemplary embodiments of reaction
solutions disclosed herein.
TABLE-US-00001 TABLE 1 Exemplary embodiments of reaction solutions
110 Embodiment Embodiment Embodiment Embodiment Component 1 2 3 4
[dATP], 1000, 1000 1000, 1000 2000, 2000 2000, 2000 [dTTP] (.mu.M)
[dGTP], 50, 50 50, 50 50, 50 100, 100 [dCTP] (.mu.M) Mg.sup.2+ 2.5
2 4 4 Betaine (M) 0 or 1 0 or 1 0 or 1 0 or 1 DMSO (%) 0 or 1 0 or
1 0 or 1 0 or 1
[0102] In some cases, the reaction solution comprises one or more
labels suitable for labeling a reaction product. In some
embodiments, one or more labels are covalently attached to one or
more primers. In some embodiments, a primer comprises a covalently
attached label. In some embodiments, one or more labels are
covalently attached to one or more nucleotide triphosphates. In
some embodiments, a nucleotide triphosphate comprises a covalently
attached label. Labels include, but are not limited to:
light-emitting, light-scattering, and light-absorbing compounds
which generate or quench a detectable fluorescent,
chemiluminescent, or bioluminescent signal (see, e.g., Kricka, L.,
Nonisotopic DNA Probe Techniques, Academic Press, San Diego (1992)
and Garman A., Non-Radioactive Labeling, Academic Press
(1997)).
[0103] In some embodiments, a fluorophore is used as a label.
Fluorophores useful as labels include, but are not limited to,
fluoresceins (see, e.g., U.S. Pat. Nos. 5,188,934, 6,008,379, and
6,020,481), rhodamines (see, e.g., U.S. Pat. Nos. 5,366,860,
5,847,162, 5,936,087, 6,051,719, and 6,191,278), benzophenoxazines
(see, e.g., U.S. Pat. No. 6,140,500), coumarins, energy-transfer
fluorescent dyes, comprising pairs of donors and acceptors (see,
e.g., U.S. Pat. Nos. 5,863,727; 5,800,996; and 5,945,526), cyanines
(see, e.g., WO 9745539), lissamines, phycoerythrins,
pyrenyloxytrisulfonic acid-based fluorophores (e.g., Cascade
Blue.RTM.), and any derivatives thereof. Examples of fluorescein
dyes include, but are not limited to, Fluorescein Isothiocyanate
("FITC"); 6-carboxyfluorescein ("FAM"); 5-Tetrachloro-Fluorescein,
("TET"); 2',4',1,4,-tetrachlorofluorescein;
2',4',5',7',1,4-hexachlorofluorescein;
6-carboxy-2',4,4',5',7,7'-hexachlorofluorescein ("HEX");
fluorinated analogs of fluorescein (such as Oregon Green.RTM. 488,
Oregon Green.RTM. 500, and Oregon Green.RTM. 514); and
6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein ("JOE").
Exemplary cyanine dyes include, without limitation, Cy2, Cy3,
Cy3.5, Cy5, Cy5.5, Cy7, and the WellRed.RTM. infrared dyes D1, D2,
D3 and D4. Exemplary rhodamine dyes include, e.g., Rhodamine Green,
Rhodamine Red, Tetramethylrhodamine, carboxytetramethylrhodamine
("TAMRA"), sulforhodamine 101 acid chloride (Texas Red), and
carboxy-X-rhodamine ("ROX"). Exemplary coumarin dyes include, e.g.,
6,8-Difluoro-7-hydroxycoumarin-3-carboxylic acid (Pacific Blue.TM.)
and am inomethylcoumarin acetate ("AMCA"). Additional labels can be
derived from, e.g., FluorX (Amersham). Fluorophores can include
Alexa Fluor.RTM. dyes (e.g., sulfonated versions of dye molecules
such as, without limitation, fluorescein, rhodamine, cyanine,
coumarin, and the like). Exemplary Alexa Fluor.RTM. dyes include,
e.g., Alexa 350, Alexa 430, Alexa 430, Alexa 488, Alexa 532, Alexa
546, Alexa 568, and Alexa 594. Fluorophores can include BODIPY.TM.
dyes (comprising the core structure
4,4-difluoro-4-bora-3a,4a-diaza-s-indacene), such as, e.g., BODIPY
630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR,
BODIPY-TRX. In certain aspects, the fluorescent label is selected
from fluorescent labels that are compatible with CE analysis such
as FAM, TET, ROX, NED.TM., VIC.TM., or JOE.
[0104] In some embodiments, the label is a radioactive label. The
radioactive label can be .sup.32P. The radioactive label can be
.sup.33P. The radioactive label can be .sup.35S. In some
embodiments, the label is an electrochemical label. The
electrochemical label can be ferrocene. In some embodiments, the
label is an affinity label. The affinity label can be biotin. The
affinity label can be digoxygenin.
[0105] The reaction solution can comprise more than one label. In
some embodiments, the reaction solution comprises different
fluorophores capable of emitting light at different,
spectrally-resolvable wavelengths (e.g., 4 differently colored
fluorophores); certain such labeled probes are known in the art and
described above, and in U.S. Pat. No. 6,140,054. A dual labeled
fluorescent probe that includes a reporter fluorophore and a
quencher fluorophore is used in some embodiments. Other examples
can include Freedom.RTM. dyes that are commercially available
surrogates for common dyes. It will be appreciated that pairs of
fluorophores can be chosen to have distinct emission spectra so
that they can be easily distinguished.
[0106] The reaction 120 (see FIG. 1A) can comprise a nucleic acid
synthesis step. The nucleic acid synthesis step can comprise
annealing the one or more primers 116 to a nucleic acid template.
The nucleic acid synthesis step can further comprise
polymerase-mediated extension of the one or more primers 116 along
the template. In some embodiments, the one or more primers 116 are
extended into a locus of interest. In some embodiments, the one or
more primers 116 are extended within a locus of interest. In some
embodiments, the one or more primers 116 are extended across a
locus of interest. Exemplary loci are described herein. In some
cases, the reaction 120 generates reaction products which are
subjected to analysis 130. For example, polymerase-mediated
extension of the one or more primers 116 can generate extension
products which are subjected to analysis 130.
[0107] The reaction 120 can comprise an amplification reaction. The
amplification reaction can generate amplification products (e.g.,
amplicons). The amplification products can be subjected to analysis
130. Examples of amplification reactions include, without
limitation, PCR, NASBA (nucleic acid sequence based amplification),
SDA (strand displacement amplification), LAMP (loop-mediated
isothermal amplification), and RCA (rolling circle amplification).
See, e.g., U.S. Pat. No. 4,683,202 (PCR); U.S. Pat. No. 6,326,173
and Journal of Virological Methods 151:283-293 (2008) (NASBA); U.S.
Pat. No. 5,648,211 (SDA); U.S. Pat. No. 6,410,278 (LAMP); and U.S.
Pat. No. 6,287,824 (RCA). All of the foregoing are incorporated
herein by reference. The skilled artisan will understand what
reagents are appropriate to provide. Each of these methods involves
DNA synthesis, and as such involves the use of DNA polymerases,
nucleotides, and divalent cations (supplied as a salt),
particularly magnesium, in a solution conducive to DNA
polymerization and in which the template is present. The methods
can vary in terms of providing additional catalytic activities, the
use of thermocycling or isothermal incubation, and the use and
structure of primers. A buffer at a suitable pH is also typically
provided. In some embodiments, the suitable pH ranges from about 7
to about 8. In some embodiments, the suitable pH ranges from about
6.5 to about 8.5. In some embodiments, the suitable pH ranges from
about 6 to about 9. In some embodiments, the suitable pH ranges
from about 7.4 to about 7.5.
[0108] In some cases, the reaction 120 comprises PCR. PCR can
comprise repeated rounds of amplification. A "round" or "cycle" of
amplification can comprise a denaturation step, a primer annealing
step, and a polymerase-mediated extension step. The reaction can be
thermocycled so as to drive denaturation of nucleic acids in a high
temperature step, annealing of the primers to templates at a lower
temperature step, and extension at a temperature which can be but
is not necessarily higher than that of the annealing step. In some
cases, the PCR comprises an annealing step at a temperature at or
below 75.degree. C. In some cases, the PCR comprises an annealing
step at a temperature at or below 70.degree. C. In some cases, the
PCR comprises an annealing step at a temperature at or below
65.degree. C. In some cases, the PCR comprises an annealing step at
a temperature that ranges from about 50.degree. C. to about
75.degree. C. In some cases, the PCR comprises an annealing step at
a temperature that ranges from about 57.degree. C. and about
63.degree. C. In some cases, the PCR comprises an annealing step at
a temperature that ranges from about 52.degree. C. and about
58.degree. C. In some cases, the PCR comprises an annealing step at
a temperature that ranges from about 62.degree. C. and about
68.degree. C. Amplification can proceed as the amplification
products of one cycle can serve as template in the next cycle.
Amplification can proceed in a linear or exponential fashion. In
linear PCR, the reaction mixture can comprise one or more forward
primers to be extended into, within, or across a region of
interest. In exponential PCR, the reaction mixture can comprise
forward and reverse primers which flank a region of interest. In
some embodiments, a touchdown annealing procedure is used. In a
touchdown annealing procedure, a first annealing temperature is
used in an early cycle, such as the first cycle, and a second
annealing temperature, lower than the first annealing temperature,
is used a later cycle later than the early cycle. The touchdown
annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in one or more cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 1 to 20 cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 1 to 15 cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 1 to 10 cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 5 to 20 cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 5 to 15 cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 5 to 10 cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 10 to 20 cycles. The
touchdown annealing procedure can comprise using a lower annealing
temperature than in the previous cycle in 10 to 15 cycles. In some
embodiments, the touchdown annealing procedure comprises a cycle
with a first annealing temperature ranging from about 58.degree. C.
to about 72.degree. C. In some embodiments, the touchdown annealing
procedure comprises a cycle with a first annealing temperature
ranging from about 60.degree. C. to about 70.degree. C. In some
embodiments, the touchdown annealing procedure comprises a cycle
with a first annealing temperature ranging from about 62.degree. C.
to about 68.degree. C. In some embodiments, the touchdown annealing
procedure comprises a cycle with a first annealing temperature
ranging from about 64.degree. C. to about 66.degree. C. In some
embodiments, the touchdown annealing procedure comprises a cycle
with a second annealing temperature ranging from about 48.degree.
C. to about 62.degree. C. In some embodiments, the touchdown
annealing procedure comprises a cycle with a second annealing
temperature ranging from about 50.degree. C. to about 60.degree. C.
In some embodiments, the touchdown annealing procedure comprises a
cycle with a second annealing temperature ranging from about
52.degree. C. to about 58.degree. C. In some embodiments, the
touchdown annealing procedure comprises a cycle with a second
annealing temperature ranging from about 54.degree. C. to about
56.degree. C. The second annealing temperature can be lower than
the first annealing temperature. The second annealing temperature
can be used in a cycle later that the cycle in which the first
annealing temperature is used, such as 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 cycles after the
cycle in which the first annealing temperature is used. When the
second annealing temperature is used in a cycle more than one cycle
after the first annealing temperature is used, the annealing
temperatures in the intervening cycle or cycles can be about the
same as the first annealing temperature. Alternatively, the
annealing temperatures in the intervening cycle or cycles can be
about the same as the second annealing temperature. Alternatively,
the annealing temperatures in the intervening cycle or cycles can
be or between the first and the second annealing temperature. For
example, the annealing temperature in an intervening cycle or
cycles can decrease linearly. The rate of linear decrease can range
from, e.g., 0.2.degree. C. per cycle to 10.degree. C. per cycle.
The rate of linear decrease can range from 0.5.degree. C. per cycle
to 5.degree. C. per cycle. The rate of linear decrease can range
from 0.5.degree. C. per cycle to 3.degree. C. per cycle. The rate
of linear decrease can range from 0.5.degree. C. per cycle to
2.degree. C. per cycle. The rate of linear decrease can range from
0.5.degree. C. per cycle to 1.5.degree. C. per cycle. The rate of
linear decrease can range from 0.7.degree. C. per cycle to
1.3.degree. C. per cycle.
[0109] The reaction 120 can comprise between about 1 to about 40
amplification cycles. For example, the reaction 120 can comprise
between about 10 to about 40 cycles. For example, the reaction 120
can comprise between about 15 to about 35 cycles. The reaction 120
can comprise about 2, about 3, about 4, about 5, about 6, about 7,
about 8, about 9, about 10, about 11, about 12, about 13, about 14,
about 15, about 16, about 17, about 18, about 19, about 20, about
21, about 22, about 23, about 24, about 25, about 26, about 27,
about 28, about 29, about 30, about 31, about 32, about 33, about
34, about 35, about 36, about 37, about 38, about 39, or about 40
amplification cycles. In some cases, the reaction 120 comprises no
more than 35 amplification cycles. In some cases, the reaction 120
comprises no more than 30 amplification cycles. In some cases, the
reaction 120 comprises no more than 25 amplification cycles.
[0110] In NASBA, an RNA polymerase (RNAP) is provided in addition
to the DNA polymerase, which can also be a reverse transcriptase
(RT) (e.g., an enzyme that can catalyze DNA synthesis using either
an RNA or DNA template). Primers can be provided that are similar
to those used in PCR except that at least one primer can
additionally comprise a promoter sequence that is recognized by the
RNAP. Thus, the product of the RT serves as template for the RNAP,
which synthesizes RNA that serves as template for the RT, leading
to amplification. In some forms of NASBA, RNase H is provided to
produce single-stranded DNA after synthesis of an RNA-DNA hybrid by
RT. Amplification occurs via the combined action of the RT and
RNAP, in the absence of repeated thermal denaturation.
[0111] SDA is a technique in which DNA is amplified in an
isothermal and asynchronous manner, meaning that cyclic thermal
denaturation is not used to separate the strands; instead, strand
displacement occurs through DNA synthesis itself, wherein extension
of a 3' OH causes displacement of the downstream strand. The 3' OH
is provided initially by an exterior primer and subsequently by a
nicking reaction. Two pairs of primers can be provided. One
`interior` pair binds surrounding the amplicon and additionally
comprises 5' flaps containing a restriction site. The other,
`exterior` pair is positioned distally, i.e., further from the
target region. An interior primer can bind the template, be
extended, and then be displaced by synthesis from the corresponding
exterior primer. Subsequently, the displaced DNA is made
double-stranded, e.g., by second strand synthesis. The next step is
to nick one strand of the double stranded molecule, which can be
done by using modified nucleotides and a restriction site wherein
the cleavage site is inactivated on one strand (but not the other)
by the modified nucleotide. The restriction enzyme corresponding to
this site is provided in the reaction and generates the nick. The
3' OH at the resulting nick is then extended by the DNA polymerase,
displacing one strand (which can again serve as a template) and the
regenerated double strand molecule is again a substrate for nicking
followed by extension and displacement, leading to amplification.
Repeated thermal denaturation is not necessary.
[0112] LAMP is an amplification procedure designed to be highly
specific, that is, it can discriminate between templates differing
by only a single nucleotide polymorphism (SNP), in that one allele
is a substrate for amplification and the other is not. It is also
isothermal. As in SDA, two pairs of primers, interior and exterior,
can be provided; the interior primers can also have a 5' flap.
However, in LAMP, the 5' flap of each interior primer contains a
sequence matching a sequence within the template strand to which it
binds, interior to the site where the 3' portion of the primer
binds. For example, if the primer anneals to the (+) strand of a
template molecule, which contains the downstream sequence A, then
the primer flap can also contain sequence A. Notably, the SNP locus
which is to be discriminated by this reaction is located at the
edge of the region bound by the flap, corresponding to the last
base at the 5' end of the flap. The last base at the 5' end of the
reverse interior primer flap also corresponds to the SNP locus. As
in SDA, the interior primer is extended and then displaced by
extension of the exterior primer. When this occurs, the 5' flap
forms a loop by binding its complement (which is now part of the
same molecule; continuing the above example, the displaced strand
contains the reverse complement of sequence A, designated sequence
T, and the sequence A in the flap binds intramolecularly to
sequence T). The reverse interior primer anneals to the looped
displaced strand, interior to its 3' end (which corresponds to the
reverse exterior primer) and primes synthesis, which displaces the
loop and forms a partially double-stranded, partially single
stranded DNA. Then, a reverse exterior primer anneals to the single
stranded portion and primes synthesis, causing strand displacement.
The displaced strand can now form a loop wherein its 3' end is
paired to an internal portion of the molecule. Only if the SNP
locus matches the 3' end (which is derived from an interior primer
flap that was exogenously supplied) does extension occur. Further
primer annealing, looping, and extension/displacement events,
described in the reference cited above, result in selective
amplification of templates with the SNP allele matching the primer
flap.
[0113] In RCA, a circular DNA template is used. A primer anneals to
the circle and is extended continuously, with the polymerase
displacing the DNA synthesized during the previous revolution as it
proceeds. This reaction proceeds with linear kinetics and produces
long, concatemerized products. In double-primed RCA, a second
primer is provided that anneals to the concatemerized product of
the above reaction. This version of the reaction allows use of
product as template, and therefore results in exponential kinetics.
As in other isothermal reactions, product is made suitable for
annealing to primer in double-primed RCA through strand
displacement due to extension of upstream primers; in this case the
primers can be bound to other concatemers further upstream in the
template strand.
[0114] Reaction products generated by a reaction 120 can be
subjected to analysis 130 (see FIG. 1A). The analysis can be useful
for assessment of genomic regions comprising repeating A/T rich
segments and homopolymeric segments, such as homopolymeric segments
of A, T, or U residues, which can be consecutive or interrupted
once by one to three other nucleotides.
[0115] In some cases, the analysis comprises determining a sequence
of a reaction product. The term "determining a sequence" as used
herein refers to a method by which the identities of at least 8
consecutive nucleotides of a polynucleotide are obtained. In some
embodiments, the identities of at least 10 consecutive nucleotides
of a polynucleotide are obtained. In some embodiments, the
identities of at least 12 consecutive nucleotides of a
polynucleotide are obtained. In some embodiments, the identities of
at least 16 consecutive nucleotides of a polynucleotide are
obtained. In some embodiments, the sequence of a homopolymeric
segment is determined by comparing capillary electrophoresis data
for an amplification reaction product generated from a sample
comprising the homopolymeric segment. The capillary electrophoresis
data can be interpreted by comparing it to calibration data from
one or more standards. The one or more standards can comprise one
or more amplification reaction products generated from a reference
sample. The reference sample can comprise a nucleic acid having a
known sequence. The reference sample can comprise an artificially
synthesized nucleic acid. The reference sample can comprise a
nucleic acid containing a homopolymeric segment of a known length.
Sequencing methods can comprise a sequencing reaction that creates
or modifies nucleic acid molecules artificially so as to make them
detectable, thereby allowing sequence determination. Sequencing
methods can comprise using a sequencing apparatus which can detect
a nucleic acid molecule in an electromagnetic manner, e.g., based
on electromagnetic radiation (e.g., fluorescent or radioactive
emission) or electromagnetic field effects (as in, e.g., nanopore
sequencing). Sequencing methods suitable for analysis of reaction
products described herein can include Sanger sequencing or
next-generation sequencing. Next generation sequencing can involve
sequencing of clonally amplified DNA templates or single DNA
molecules in a massively parallel fashion. Exemplary sequencing
methods include, but are not limited to, sequencing-by-synthesis,
ion pyrosequencing, reversible dye terminator sequencing,
semiconductor sequencing, sequencing by ligation, single-molecule
sequencing, sequencing by hybridization, and nanopore sequencing.
Platforms for sequencing by synthesis can include those available
from IIlumina, 454 Life Sciences, Helicos Biosciences, Thermo
Fisher/Ion Torrent (e.g., Personal Genome Machine, Proton), and
Oxford Nanopore (eg, MinION) and Qiagen. Exemplary Illumina
platforms are described in Gudmundsson et al (Nat. Genet. 2009
41:1122-6), Out et al (Hum. Mutat. 2009 30:1703-12) and Turner
(Nat. Methods 2009 6:315-6), U.S. Patent Application Publication
No. US20080160580, U.S. Pat. Nos. 6,306,597 and 7,115,400.
Exemplary Helicos Biosciences platforms include the True Single
Molecule Sequencing platform. Exemplary platforms for ion
semiconductor sequencing are described in U.S. Pat. No. 7,948,015
and include, e.g., the Ion Torrent Personal Genome Machine (PGM).
Exemplary platforms for pryosequencing are described in U.S. Pat.
Nos. 7,211,390; 7,244,559; and 7,264,929, and can include the GS
Flex. Exemplary platforms for sequencing by ligation are described
in U.S. Pat. No. 5,750,341 and include, e.g., the SOLiD sequencing
platform. Exemplary platforms for single-molecule sequencing
include the Helicos True Single Molecule Sequencing platform and
the SMRT.RTM. system from Pacific Biosciences. In some cases,
extension products are subjected to nucleic acid sequencing,
without requiring amplification prior to sequencing. For example,
sequencing by, e.g., the SMRT.RTM. system by Pacific Biosciences
can comprise sequencing an extension product described herein as it
is being synthesized.
[0116] In some cases, analysis 130 comprises size analysis. Size
analysis can comprise determining the size of one or more reaction
products generated by a method described herein. Size analysis can
comprise determining an amount of reaction products having a
certain size.
[0117] Size analysis can comprise an electrophoresis method.
Exemplary electrophoresis methods include, e.g., gel
electrophoresis and capillary electrophoresis (CE). In some cases,
size analysis comprises CE analysis. CE analysis can comprise use
of instrumentation such as the ABI 3100, 3130, 3730, or 3500
models. Other implementations include any instrument capable of
electrophoretic sizing of DNA and multicolor resolution. For
example, the Beckman Vidiera or SEQ6000 capillary electrophoresis
systems for the detection of WellRed infrared dyes (D1, D2, D3 and
D4) can also be used, or the Li-Cor instrument incorporating
IRDyes. Other methods that can be used include microfluidic CE
systems such as the Agilent 2100 Bioanalyzer and similar platforms,
mass spectrometry, agarose gel electrophoresis followed by scan
densitometry, and analysis of radiolabeled products using
phosphorImager or scan densitometry of autoradiographs. In some
cases, size analysis comprises assessing intensities of peaks
observed in CE electropherograms, phosphorimager scans,
densitometric scans, mass spectra, or other forms of data. Size
analysis can comprise determination of peak height, area under the
curve (integration), or curve fitting. In some embodiments, size
analysis comprises comparing data from a sample to data from one or
more standards with one or more repeating nucleotide segments of
known length. In some embodiments, size analysis comprises
comparing data from a sample to data from one or more standards
with one or more repeating NT rich segments or homopolymeric
nucleotide segments of known length. The comparison can comprise
regression analysis. An example of using of standards with similar
AT/GC content to extrapolate a length of a nucleic acid segment is
provided in Filipovic-Sadic S, et al., "A novel FMR1 PCR method for
the routine detection of low abundance expanded alleles and full
mutations in fragile X syndrome," Clin Chem. 2010 March;
56(3):399-408 (doi: 10.1373/clinchem.2009.136101, Epub 2010 January
7). This approach can be adapted for use with repeating A/T rich
segments or homopolymeric segments, among others.
[0118] Methods described herein can be used to determine a length
of a repeating A/T rich segment or homopolymeric segment, such as a
homopolymeric segment of A, T, or U residues, which can be
consecutive or interrupted once by one to three other
nucleotides.
[0119] Methods described herein can detect a repeating A/T rich
segment or homopolymeric segment above 10 nucleotides in length,
which can be consecutive or interrupted once by one to three other
nucleotides. For example, methods described herein can detect A- or
T-homopolymeric segments or repeating A/T rich segments that are
above 8, above 9, above 10, above 11, above 12, above 13, above 14,
above 15, above 16, above 17, above 18, above 19, above 20, above
21, above 22, above 23, above 24, above 25, above 26, above 27,
above 28, above 29, above 30, above 31, above 32, above 33, above
34, above 35, above 36, above 37, above 38, above 39, above 40,
above 41, above 42, above 43, above 44, above 45, above 46, above
47, above 48, above 49, above 50, above 51, above 52, above 53,
above 54, above 55, above 56, above 57, above 58, above 59, or
above 60 nucleotides in length. Methods described herein can detect
A- or T-homopolymeric segments or repeating A/T rich segments that
range from about 10 to about 40 nucleotides in length. Methods
described herein can detect A- or T-homopolymeric segments or
repeating A/T rich segments that range from about 10 to about 50
nucleotides in length. Methods described herein can detect A- or
T-homopolymeric segments or repeating A/T rich segments that range
from about 10 to about 48 nucleotides in length. Methods described
herein can detect A- or T-homopolymeric segments or repeating A/T
rich segments that range from about 10 to about 60 nucleotides in
length. Methods described herein can detect A- or T-homopolymeric
segments or repeating A/T rich segments that range from about 8 to
about 60 nucleotides in length. Methods described herein can detect
A- or T-homopolymeric segments or repeating A/T rich segments that
range from about 15 to about 40 nucleotides in length. Methods
described herein can detect A- or T-homopolymeric segments or
repeating NT rich segments that range from about 20 to about 40
nucleotides in length. Methods described herein can detect A- or
T-homopolymeric segments or repeating A/T rich segments that range
from about 30 to about 40 nucleotides in length. Methods described
herein can detect A- or T-homopolymeric segments or repeating A/T
rich segments that range from about 15 to about 50 nucleotides in
length. Methods described herein can detect A- or T-homopolymeric
segments or repeating A/T rich segments that range from about 20 to
about 50 nucleotides in length. Methods described herein can detect
A- or T-homopolymeric segments or repeating A/T rich segments that
range from about 30 to about 50 nucleotides in length. Methods
described herein can detect A- or T-homopolymeric segments or
repeating A/T rich segments that range from about 15 to about 48
nucleotides in length. Methods described herein can detect A- or
T-homopolymeric segments or repeating A/T rich segments that range
from about 20 to about 48 nucleotides in length. Methods described
herein can detect A- or T-homopolymeric segments or repeating NT
rich segments that range from about 30 to about 48 nucleotides in
length. Methods described herein can detect A- or T-homopolymeric
segments or repeating A/T rich segments that range from about 15 to
about 60 nucleotides in length. Methods described herein can detect
A- or T-homopolymeric segments or repeating A/T rich segments that
range from about 20 to about 60 nucleotides in length. Methods
described herein can detect A- or T-homopolymeric segments or
repeating A/T rich segments that range from about 30 to about 60
nucleotides in length.
[0120] Methods described herein can be used to detect and
distinguish a plurality of repeat length polymorphisms in a single
sample or across a plurality of samples. For example, methods
described herein can distinguish amplicons containing A- or
T-homopolymeric segments or repeating A/T rich segments that are
below 20 nucleotides in length, between 20 and 29 nucleotides in
length, and 30 or more nucleotides in length. In some cases,
methods described herein can distinguish amplicons containing A- or
T-homopolymeric segments or repeating A/T rich segments that differ
in size by 1 nucleotide. In some cases, methods described herein
can distinguish amplicons containing A- or T-homopolymeric segments
or repeating A/T rich segments that differ in size by 2 nucleotides
or less. In some cases, methods described herein can distinguish
amplicons containing A- or T-homopolymeric segments or repeating NT
rich segments that differ in size by 3 nucleotides or less. In some
cases, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that differ in size by 4 nucleotides or less. In some
cases, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that differ in size by 5 nucleotides or less. In some
cases, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that differ in size by 6 nucleotides or less. In some
cases, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that differ in size by 7 nucleotides or less. In some
cases, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that differ in size by 8 nucleotides or less. In some
cases, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that differ in size by 9 nucleotides or less. In some
cases, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating NT rich
segments that differ in size by 10 nucleotides or less. In some
embodiments, the methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that are at least 20 nucleotides long and that differ in
size by a number of nucleotides as discussed above. In some
embodiments, methods described herein can distinguish amplicons
containing A- or T-homopolymeric segments or repeating A/T rich
segments that are at least 30 nucleotides long and that differ in
size by a number of nucleotides as discussed above.
[0121] In some cases, methods described herein are capable of
distinguishing a first sample comprising a first template with a
homopolymeric segment of length (n+1) and a second template with a
homopolymeric segment of length (n-1) from a sample comprising a
template with a homopolymeric segment of length (n), wherein n is
greater than about 20 and less than about 40. In some cases, n is
greater than about 30 and less than about 40. In some cases, n is
greater than about 35 and less than about 40. In some cases,
methods described herein are capable of distinguishing a first
sample comprising a first template with a repeating A/T rich
segment of length (n+1) and a second template with a repeating A/T
rich segment of length (n-1) from a sample comprising a template
with a repeating A/T rich segment of length (n), wherein n is
greater than about 20 and less than about 40. In some cases, n is
greater than about 30 and less than about 40. In some cases, n is
greater than about 35 and less than about 40.
[0122] For example, methods described herein can be capable of
distinguishing a first sample comprising true 34 T and 36 T alleles
of an rs10524523 locus from a sample comprising non-target 35 T
segments which result from polymerase slippage/stutter. FIG. 2
depicts an exemplary desired peak profile from CE analysis of a
sample known to be heterozygous for the 34 T/36 T alleles. In a
desired peak profile, one or both of the 34 T and 36 T peaks have a
greater intensity than the intensity of a non-target 35 T peak. By
contrast, in an exemplary undesired peak profile, a non-target 35 T
peak intensity is higher than intensity of the 34 T and 36 T
peaks.
[0123] Disclosed herein are kits useful for performing one or more
methods described herein. A kit can comprise NTPs, such as dNTPs,
having an AT/GC ratio greater than 2. A kit can include individual
aliquots of NTPs and instructions for preparing a reaction solution
comprising NTPs as described herein. A kit can further comprise a
primer suitable for extension into, within, or across a
homopolymeric segment of at least 10 consecutive A or T residues. A
kit can further comprise a primer suitable for extension into,
within, or across a repeating A/T rich segment of at least 10
consecutive A or T residues. In some cases, a kit comprises at
least two primers. The primers can be suitable for amplifying a
genetic locus comprising a homopolymeric segment of at least 10
consecutive A residues or at least 10 consecutive T residues. In
some cases, the homopolymeric segment is the rs10524523
polymorphism of the TOMM40 gene. In some cases, a kit comprises at
least one primer that hybridizes upstream of the rs10524523
polymorphism of the TOMM40 gene. In some cases, a kit comprises a
second primer that hybridizes downstream of the rs10524523
polymorphism of the TOMM40 gene. In some cases, the AT/GC ratio has
a value described herein, such as a value that ranges from about 10
to about 40 or a value that ranges from about 15 and about 30. In
some cases, a kit further comprises a polymerase, which can be a
polymerase described herein. In some cases, a kit further comprises
magnesium in a molar amount in a range disclosed herein, e.g., in
the range from about 80% to about 150% of the molar amount of total
NTPs. In some embodiments, a kit further comprises a magnesium
stock solution. In some embodiments, a kit further comprises a
solution comprising magnesium in a concentration of about 10 mM to
about 2.5 M. In some embodiments, a kit further comprises a
solution comprising magnesium in a concentration of about 10 mM to
about 3 M. In some cases, a kit further comprises one or more
additives, which can be one or more additives described herein.
Exemplary additives are described herein. In some cases, a kit
further comprises betaine. In some cases, a kit further comprises a
betaine analog. In some cases, a kit further comprises DMSO. In
some cases, a kit further comprises betaine and DMSO.
[0124] A kit can include reference standards. The reference
standards can comprise one or more repeating A/T-rich segments,
such as one or more homopolymeric segments, of known lengths.
Exemplary homopolymeric segments are described herein.
[0125] A kit can include a packaging material. As used herein, the
term "packaging material" can refer to a physical structure housing
the components of the kit. The packaging material can maintain
sterility of the kit components, and can be made of material
commonly used for such purposes (e.g., paper, corrugated fiber,
glass, plastic, foil, ampules, etc.). A kit can also include a
buffering agent, a preservative, or a protein/nucleic acid
stabilizing agent.
[0126] Methods and kits described herein can have many
applications. For example, methods described herein can be useful
in disease diagnosis, disease prediction, selection of a
therapeutic regimen, genotyping, identification, forensics, nucleic
acid profiling, kinship analysis, genetic linkage analysis,
marker-assisted selection, assessment of gene regulation,
population genetics, and taxonomic studies, among others.
[0127] Methods and kits described herein can be useful for of
detecting a genotype associated with late-onset Alzheimer's
disease. For example, methods described herein can be useful for
genotyping a rs10524523 polymorphism of the TOMM40 gene.
EXAMPLES
[0128] The following examples illustrate various embodiments and
are not intended to limit the scope of the invention.
Example 1. Effect of Biased dNTP Ratios on Polymerase
Slippage/Stuttering
[0129] Heterozygous DNA samples, each containing two known poly-T
repeat lengths for the TOMM40 poly-T polymorphism, were provided as
described in Table 2.
TABLE-US-00002 TABLE 2 Sample names and poly-T repeat lengths.
rs10524523 Repeat length genotype Sample Name (nt/nt) RS1310 35/36
RS1311 16/36 RS1319 34/36
[0130] 10 ng of sample DNA were amplified using Phoenix Taq
(Enzymatics) in a PCR reaction mixture comprising 1.times. Phoenix
buffer and 2.5 mM Mg2+. The primers were
/56-FAM/CCAAAGCATTGGGATTACTGGC (SEQ ID NO: 1) (Forward) and
GATTGCTTGAGCCTAGGCATTC (SEQ ID NO: 2) (Reverse). The following
final concentrations of dNTPs were used in the reactions: 250 .mu.M
each dNTP; 100 .mu.M each of dATP and dTTP with 50 .mu.M each of
dCTP and dGTP ("100/50" AT/GC ratio); 250 .mu.M each of dATP and
dTTP with 50 .mu.M each of dCTP and dGTP ("250/50"), 500 .mu.M each
of dATP and dTTP with 50 .mu.M each of dCTP and dGTP ("500/50"),
and 1000 .mu.M each of dATP and dTTP with 50 .mu.M each of dCTP and
dGTP ("1000/50"). PCR was conducted for 35 cycles and the crude
product was diluted 100-fold prior to capillary electrophoresis
(CE) analysis. CE analysis was performed on an ABI 3500.times.L.
PCR products were injected at 2.5 kv for 20 seconds. ROX 400HD was
used as ladder. Mobility and correction factor (as described in
Filipovic-Sadic et al., 2010, supra) were obtained from standards
of known polyT length (8 T, 12 T, 16 T, 20 T, 24 T, 48 T) and
extrapolated to determine the genotype of the unknown sample.
[0131] FIGS. 3A-3D depict CE peak profiles for each DNA sample
listed in Table 2, with the target peaks labeled. Because the
poly-T lengths are known for each sample, polymerase
slippage/stuttering can be quantified by the number of extra
non-target peaks and/or by the ratio of the target peak (N) height
to one or more non-target peak heights, such as the height of the
N-1 non-target peak. For example, a reduction in the number of
non-target peaks (e.g., that exceed a threshold relative to the
target or maximum peak) or a higher target peak height as compared
to one or more non-target peak heights can be used, separately or
together, to assess whether slippage/stuttering is reduced.
[0132] CE peak profiles from the RS1310 samples (35 T/36 T) are
depicted in FIG. 3A. Peak profiles from the RS1310 samples
demonstrate that, compared to the non-biased dNTP ratio, there was
an increase in the ratios of heights of the 35 T and 36 T target
peaks to non-target peak heights at 250/50 AT/GC. The increase in
the peak height ratios for the 35 T and 36 T target peaks were more
pronounced for the 500/50 AT/GC and 1000/50 AT/GC reaction
products. For the 1000/50 AT/GC ratio, the heights of the 35 T and
36 T peaks increased, the heights of the non-target peaks
decreased, and fewer non-target peaks were apparent, as compared to
the non-biased dNTP ratio of 250/250 AT/GC.
[0133] CE peak profiles from the RS1311 samples (16 T/36 T) are
depicted in FIGS. 3B and 3C. Peak profiles from the RS1311 samples
demonstrate that, compared to the non-biased dNTP ratio, the 500/50
and 1000/50 AT/GC reactions products exhibited an increase in the
target/non-target peak height ratios for the 16 T and 36 T target
peaks, with the greatest increase apparent for the 1000/50 ratio.
There was also a reduction in non-target peak number and intensity
relative to the results when the non-biased dNTP ratio of 250/250
AT/GC was used.
[0134] CE peak profiles from the RS1319 samples (34 T/36 T) are
depicted in FIG. 3D. The relative height of the non-target 35 T
peak as compared to target 34 T and 36 T peak heights can be used
to indicate polymerase slippage/stuttering errors, with shorter 35
T peak heights generally indicating reduced slippage/stuttering.
FIG. 3C demonstrates that the 35 T peak was shortest relative to
the target 34 T and 36 T peaks at the 1000/50 AT/GC ratio.
[0135] These results, taken together, demonstrate that AT/GC ratios
such as, e.g., 250/50, 500/50, and 1000/50 reduced polymerase
slippage and stuttering, and improved A or T homopolymer repeat
length analysis.
Example 2: Effect of AT/GC Ratios, Mg.sup.2+ Concentration and
Total dNTP Concentration on Polymerase Slippage/Stutter
[0136] The effects of AT/GC ratio, Mg.sup.2+ concentration, and
total dNTP concentration on polymerase slippage/stuttering were
measured by conducting a series of reactions with varying AT/GC
concentrations (250/250, 500/500, 1000/1000, 2000/2000, 1000/50,
2000/50, 3000/50, and 2000/100), varying MgSO.sub.4 concentration
(2, 2.5, 4, 6, 8, and 10 mM), and varying total dNTP concentration
(1-8 mM). All reaction mixtures were admixed with 10 ng of RS1319
sample DNA (34 T/36 T). PCR was conducted for 27 cycles. CE
analysis was performed as described in Example 1.
[0137] Results are depicted in FIGS. 4 and 5. FIG. 4 depicts
results of varying Mg.sup.2+ concentration and total dNTP
concentration when AT/GC ratios were not biased. FIG. 4 confirmed
that excess dNTP concentrations relative to Mg.sup.2+ can inhibit
DNA polymerase by sequestering magnesium ions.
[0138] FIG. 5 depicts results from varying Mg.sup.2+ concentration
and total dNTP concentration under different AT/GC ratio
conditions. As shown in FIG. 5, the non-target 35 T peak height was
shorter than at least one of the 34 T and 36 T target peaks for
multiple reaction conditions including: 1000/50 AT/GC, 2 mM
Mg.sup.2+; 1000/50 AT/GC, 2.5 mM Mg.sup.2+; 1000/50 AT/GC, 4 mM
Mg.sup.2+; 2000/50 AT/GC, 4 mM Mg.sup.2+; and 2000/100 AT/GC, 4 mM
Mg.sup.2+.
Example 3: Effect of Betaine and DMSO on Polymerase
Slippage/Stuttering
[0139] To further evaluate reaction conditions for analysis of A-
or T-rich homopolymeric regions, the effects of AT/GC ratio,
betaine, and DMSO were assessed by conducting a series of reactions
with varying AT/GC ratios (250/250, 250/25, 500/25, 500/50, and
1000/50), varying betaine amounts (0M, 1M), and varying DMSO
concentrations (0%, 1%, 2%, and 4%). All reaction mixtures were
admixed with 10 ng of RS1311 sample DNA (16 T/36 T). PCR was
conducted for 35 cycles. CE analysis was performed as described in
Example 1.
[0140] Results are depicted in FIGS. 6 and 7. FIG. 6 depicts the
effects of DMSO and betaine titration in the vicinity of the 16 T
peak. Peak stutter generally decreased with biased AT/GC ratio
conditions as compared to unbiased AT/GC ratio conditions, with the
greatest decrease apparent at the 1000/50 ratio. The presence of 1M
Betaine improved stutter, including in unbiased AT/GC ratio
conditions.
[0141] FIG. 7 depicts the effects of DMSO and betaine titration in
the vicinity of the 36 T peak. Peak stutter generally decreased
with biased AT/GC ratio conditions as compared to unbiased AT/GC
ratio conditions, with the greatest decrease apparent at the
1000/50 ratio. 1M Betaine and 1% DMSO were also beneficial in
reducing the stutter ratio (N-1/N).
Example 4: Effect of Reducing Number of PCR Cycles on Polymerase
Stutter/Slippage
[0142] The effect of lowering number of PCR cycles on polymerase
slippage/stutter was assessed by varying PCR cycle numbers (25, 30,
or 35 cycles). 10 ng of either RS1311 (16 T/36 T) or RS1319 (34
T/36 T) DNA samples were admixed with a PCR reaction mixture
containing an AT/GC ratio of 1000/50, 1% DMSO, 1M Betaine, and 2.0
mM MgSO.sub.4. PCR was run for 25, 30, or 35 cycles prior to CE
analysis.
[0143] Results are depicted in FIGS. 8 and 9. FIG. 8 depicts the
effect of PCR cycle numbers on 16 T and 36 T peak stutter. Because
RS1311 samples are known to contain 16 T and 36 T alleles in a 1:1
ratio, 36/16 peak height ratios that approach 1 indicate reduced
bias toward amplification of the shorter target allele. FIG. 8
shows that among the PCR cycle numbers tested, 25 cycles of PCR
resulted in the 36/16 peak height ratio closest to 1.
[0144] FIG. 9 depicts the effect of PCR cycle numbers on 34 T and
36 T peak stutter. As shown in FIG. 9, the 35 T non-target peak was
shorter relative to the 34 T and 36 T peak heights with 25 or 30
PCR cycles as compared to 35 PCR cycles, with the shortest height
demonstrated under 25 PCR cycle conditions.
Example 5: Combination of Biased dNTPs, Betaine, DMSO, and Lowered
PCR Cycles Improved Polymerase Slippage/Stutter
[0145] Heterozygous DNA samples described in Table 2 were provided.
Samples were subjected to PCR reaction conditions as shown in Table
3.
TABLE-US-00003 TABLE 3 Reaction conditions. A B AT/GC concentration
250/250 1000/50 ratio (.mu.M/.mu.M) Mg++ 2.5 mM MgCl.sub.2 2.0 mM
MgSO.sub.4 Betaine (M) 0 1 DMSO (%) 0 1 PCR cycles 35 27
[0146] Results are depicted in FIGS. 10-12. FIG. 10 depicts results
from the RS1311 (16 T/36 T) samples. As compared to the condition
A, the increased AT/GC concentration ratio, lowered PCR cycle
number, 1M Betaine, and 1% DMSO in condition B increased
target/non-target peak height ratios for the 16 T and 36 T target
peaks, and also increased the 36 T/16 T peak height ratio closer to
1.
[0147] FIG. 11 depicts results from the RS1310 (35 T/36 T) samples.
As compared to condition A, the increased AT/GC concentration
ratio, lowered PCR cycle number, 1M Betaine, and 1% DMSO in
condition B increased target/non-target peak height ratios for the
35 T and 36 T target peaks, and reduced the number of non-target
peaks.
[0148] FIG. 12 depicts results from the RS1319 samples. As compared
to condition A, the increased AT/GC concentration ratio, lowered
PCR cycle number, 1M Betaine, and 1% DMSO in condition B reduced
the 35 T non-target peak height relative to the 34 T and 36 T peak
heights.
Example 6: Comparison of Conditions with and without DMSO and
Betaine
[0149] Samples were subjected to PCR reaction conditions and
analyzed by capillary electrophoresis as follows.
TABLE-US-00004 TABLE 4 Reaction conditions. B C AT/GC concentration
1000/50 1000/50 ratio (.mu.M/.mu.M) Mg++ 2.0 mM MgSO.sub.4 2.0 mM
MgSO.sub.4 Betaine (M) 1 0 DMSO (%) 1 0
[0150] For both conditions, MgSO.sub.4 was supplied via Phoenix Hot
Start Taq buffer. The PCR program was 95.degree. C. 5 min;
10.times. (95.degree. C., 30 s; 65.degree. C. to 56.degree. C.
touchdown 1.degree. C. per cycle, 30 s; 64.degree. C., 30 s);
17.times. (95.degree. C., 30 s; 55.degree. C., 60 s).
[0151] FIG. 13A shows products amplified from RS1310 (35 T/36 T)
samples using condition C. The products were loaded at 2.5 kV for 5
seconds. The n-1/n ratio for the 34 T and 35 T peaks was 0.46.
[0152] FIG. 13B shows products amplified from RS1310 (35 T/36 T)
samples using condition B. The products were loaded at 2.5 kV for
20 seconds. The n-1/n ratio for the 34 T and 35 T peaks was
0.38.
[0153] FIG. 14A shows products amplified from RS1311 (16 T/36 T)
samples using condition C. The products were loaded at 2.5 kV for 5
seconds. The n-1/n ratio for the 35 T and 36 T peaks was 0.49. The
peak height ratio of the 36 T peak to the 16 T peak was 0.57.
[0154] FIG. 14B shows products amplified from RS1311 (16 T/36 T)
samples using condition B. The products were loaded at 2.5 kV for
20 seconds. The n-1/n ratio for the 35 T and 36 T peaks was 0.46.
The peak height ratio of the 36 T peak to the 16 T peak was
0.49.
[0155] FIG. 15A shows products amplified from RS1317 (29 T/36 T)
samples using condition C. The products were loaded at 2.5 kV for 5
seconds. The n-1/n ratio for the 28 T and 29 T peaks was 0.42.
[0156] FIG. 15B shows products amplified from RS1317 (29 T/36 T)
samples using condition B. The products were loaded at 2.5 kV for
20 seconds. The n-1/n ratio for the 28 T and 29 T peaks was
0.34.
[0157] FIG. 16A shows products amplified from RS1318 (16 T) samples
using condition C. The products were loaded at 2.5 kV for 5
seconds.
[0158] FIG. 16B shows products amplified from RS1318 (16 T) samples
using condition B. The products were loaded at 2.5 kV for 20
seconds.
[0159] FIG. 17A shows products amplified from RS1319 (34 T/36 T)
samples using condition C. The products were loaded at 2.5 kV for 5
seconds. The n-1/n ratio for the 33 T and 34 T peaks was 0.45. The
peak height ratio of the 35 T peak to the 34 T peak was 0.88.
[0160] FIG. 17B shows products amplified from RS1319 (34 T/36 T)
samples using condition B. The products were loaded at 2.5 kV for
20 seconds. The n-1/n ratio for the 33 T and 34 T peaks was 0.39.
The peak height ratio of the 35 T peak to the 34 T peak was
0.86.
[0161] FIG. 18A shows products amplified from NA07541 (34 T/38 T)
samples using condition C. The products were loaded at 2.5 kV for 5
seconds.
[0162] FIG. 18B shows products amplified from NA07541 (34 T/38 T)
samples using condition B. The products were loaded at 2.5 kV for
20 seconds.
[0163] FIG. 19A shows products amplified from NA20243 (16 T/20 T)
samples using condition C. The products were loaded at 2.5 kV for 5
seconds. The n-1/n ratio for the 15 T and 16 T peaks was 0.26.
[0164] FIG. 19B shows products amplified from NA20243 (16 T/20 T)
samples using condition B. The products were loaded at 2.5 kV for
20 seconds. The n-1/n ratio for the 15 T and 16 T peaks was
0.16.
[0165] The foregoing results generally show that condition C gave
greater amplification efficiency, in that compared to condition B,
four-fold lower load amounts (2.5 kV for 5 seconds) of products
from condition C gave target peak heights similar to or moderately
lower (less than 50% decrease) than peak heights for condition B
products loaded at 2.5 kV for 20 seconds. The results also show
that condition B permitted greater target vs. non-target peak
discrimination in that, e.g., the n-1/n peak height ratios were
generally lower. Furthermore, the results from condition C show
that betaine and DMSO are not essential. Thus, conditions B and C
illustrate how reaction conditions can be tailored to focus on
amplification efficiency or target vs. non-target peak
discrimination. High amplification efficiency can facilitate
amplification procedures with reduced cycle numbers, and it was
shown above that reduced cycle numbers can improve target vs.
non-target peak discrimination.
Example 7: Amplification of 48 T Homopolymeric Segment
[0166] A sample of a synthetic DNA template containing a 48 T
homopolymeric segment was amplified using conditions A and B as in
Example 5 and analyzed by capillary electrophoresis. Results from
condition A are shown in FIG. 20A. Results from condition B are
shown in FIG. 20B. The highest peak in FIG. 20B represents the 48 T
target peak. Non-target peaks containing 49 T, 50 T, 51 T, 52 T,
and 53 T segments were also detectable. Thus, homopolymeric
segments of 48 nucleotides or more can be amplified and analyzed
according to this disclosure.
[0167] Other embodiments of the invention will be apparent to those
skilled in the art from consideration of the specification and
practice of the invention disclosed herein. It is intended that the
specification and examples be considered as exemplary only, with a
true scope and spirit of the invention being indicated by the
following claims. The listing of steps in a method in a particular
order is not to be construed as an indication that the steps must
be performed in that order, except where there is an explicit
indication to the contrary or the result of one step is required
for occurrence of another step.
Sequence CWU 1
1
6122DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 1ccaaagcatt gggattactg gc
22222DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic primer" 2gattgcttga gcctaggcat tc
22312DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 3aataataata at
12410DNAArtificial Sequencesource/note="Description of Artificial
Sequence Synthetic oligonucleotide" 4aataaataat 10510DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 5aaataaaaat 10610DNAArtificial
Sequencesource/note="Description of Artificial Sequence Synthetic
oligonucleotide" 6aataaaaaat 10
* * * * *