U.S. patent application number 17/533347 was filed with the patent office on 2022-04-21 for compositions and methods for the treatment of prader-willi syndrome.
The applicant listed for this patent is Duke University, The University of North Carolina at Chapel Hill. Invention is credited to Yong-hui Jiang, Jian Jin, Yuna Kim, Hyeong-min Lee, Bryan L. Roth.
Application Number | 20220117967 17/533347 |
Document ID | / |
Family ID | 1000006066163 |
Filed Date | 2022-04-21 |
View All Diagrams
United States Patent
Application |
20220117967 |
Kind Code |
A1 |
Jiang; Yong-hui ; et
al. |
April 21, 2022 |
Compositions and Methods for the Treatment of Prader-Willi
Syndrome
Abstract
The invention provides pharmaceutical compositions and methods
of use thereof for treating Prader-Willi syndrome. More
specifically, the invention provides pharmaceutical compositions
that when administered inhibit the G9a driven methylation of
histone H3 lysine 9.
Inventors: |
Jiang; Yong-hui; (Durham,
NC) ; Kim; Yuna; (Durham, NC) ; Lee;
Hyeong-min; (Durham, NC) ; Jin; Jian; (Durham,
NC) ; Roth; Bryan L.; (Durham, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Duke University
The University of North Carolina at Chapel Hill |
Durham
Chapel Hill |
NC
NC |
US
US |
|
|
Family ID: |
1000006066163 |
Appl. No.: |
17/533347 |
Filed: |
November 23, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16301511 |
Nov 14, 2018 |
|
|
|
PCT/US2017/033171 |
May 17, 2017 |
|
|
|
17533347 |
|
|
|
|
62337637 |
May 17, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07D 401/02 20130101;
A61K 31/517 20130101; A61P 43/00 20180101; A61K 31/551 20130101;
C07D 401/14 20130101 |
International
Class: |
A61K 31/517 20060101
A61K031/517; C07D 401/14 20060101 C07D401/14; C07D 401/02 20060101
C07D401/02; A61P 43/00 20060101 A61P043/00; A61K 31/551 20060101
A61K031/551 |
Goverment Interests
PRIORITY AND FEDERAL FUNDING LEGEND
[0002] This disclosure was produced in part using funds from the
Federal Government under NIH grant no. HD077197 entitled,
"Therapeutic Potential for Prader-Willi Syndrome." Accordingly, the
Federal government has certain rights in this disclosure.
Claims
1. A method of activating at least one maternal copy of candidate
Prader-Willi syndrome (PWS) associated genes, the method comprising
inhibiting G9a activity by administering an interfering
molecule.
2. The method according to claim 1, wherein inhibiting G9a activity
comprises inhibiting the methylation of the histone H3 protein.
3. The method according to claim 2, wherein the methylation of
histone H3 at lysine 9 (H3K9) is inhibited.
4. The method according to claim 3, wherein inhibiting the
methylation of H3K9 comprises a selective reduction of
dimethylation of histone 3 lysine 9.
5. The method according to claim 1, wherein the candidate PWS
associated genes are located on the 15q11-q13 region between the
MAGEL2 and UBE3A genes.
6. The method according to claim 1, wherein the candidate PWS
associated genes comprise MAGEL2, NDN, SNRPN and SnoRNAs genes.
7. The method according to claim 6, wherein the SnoRNAs genes
comprise SNORD116 and SNORD115.
8. The method according to claim 1, wherein the interfering
molecule is a G9a inhibitor.
9. The method according to claim 8, wherein the G9a inhibitor is
UNC617, UNC618, UNC0638, UNC0642, or any combination thereof.
10. The method according to claim 1, wherein the activation of at
least one maternal copy of candidate PWS associated genes is
carried out in a mammalian subject in need thereof.
11. The method according to claim 10, wherein the subject is a
human.
12. A method of treating Prader-Willi syndrome (PWS) in a subject
in need thereof, the method comprising unsilencing candidate PWS
associated genes on the maternal chromosome by administering a
therapeutically effective amount of an interfering molecule.
13. The method of claim 12, wherein administering a therapeutically
effective amount of an interfering molecule reduces the methylation
of H3K9.
14. The method according to claim 12, wherein the interfering
molecule is a G9a inhibitor.
15. The method according to claim 14, wherein the G9a inhibitor is
UNC617, UNC618, UNC0638, UNC0642, or any combination thereof.
16. The method according to claim 12, wherein the therapeutically
effective amount of an interfering molecule activates at least one
gene within the PWS critical region or the PWS-IC-controlled
region.
17. The method of claim 16, wherein the at least one gene within
the PWS critical region that is activated is SNORD116.
18. The method according to claim 12, wherein the subject is a
mammal.
19. The method according to claim 17, wherein the subject is a
human.
20.-24. (canceled)
25. The method according to claim 1, wherein the method further
comprises inhibiting DNA methylation of the PWS associated
genes.
26. (canceled)
27. The method according to claim 1, wherein the interfering
molecule is of Formula I: ##STR00007## wherein R.sup.1 is
--C.sub.1-C.sub.8 alkyl, --C.sub.3-C.sub.8 cycloalkyl, or
--C.sub.3-C.sub.8 heterocycle comprising 1-3 heteroatoms, each of
which may be optionally substituted with one or more halogens; each
X is independently --CH-- or --N--; R.sup.2 is --C.sub.3-C.sub.8
cycloalkyl or --C.sub.3-C.sub.8 heterocycle comprising 1-3
heteroatoms, each of which may be optionally substituted with one
or more alkyl groups, with one or more halogens, or with a
combination thereof; R.sup.3 is --H, --C.sub.1-C.sub.8 alkyl,
halogen, --CN, --CF.sub.3, --NO.sub.2 or --OR.sup.5; wherein
R.sup.5 is --C.sub.1-C.sub.8 alkyl; and m and n are each
independently 1, 2, 3, 4, or 5.
28. The method according to claim 1, wherein the interfering
molecule is of Formula II: ##STR00008## wherein R.sup.2 is
--C.sub.3-C.sub.8 cycloalkyl or --C.sub.3-C.sub.8 heterocycle
comprising 1-3 heteroatoms, each of which may be optionally
substituted with one or more alkyl groups, with one or more
halogens, or with a combination thereof.
Description
[0001] This application is a US national phase application of
International Application No. PCT/US2017/033171, filed on May 17,
2017, which claims the benefit of U.S. Provisional Patent
Application No. 62/337,637, filed May 17, 2016, the disclosure of
which is explicitly incorporated herein in its entirety by
reference.
FIELD OF THE INVENTION
[0003] The present disclosure relates generally to the field of
neurobiology. Specifically, the present disclosure relates to novel
compositions for and methods of inhibiting histone H3K9 methylation
for the treatment of genomic imprinting disorders, including
Prader-Willi syndrome. More particularly, the disclosure provides
compositions and methods for unsiliencing the maternal copy of
Prader-Willi syndrome candidate genes.
BACKGROUND OF THE INVENTION
[0004] Prader-Willi syndrome (PWS) is clinically characterized by
neonatal hypotonia, childhood onset obesity, intellectual
disability, and increased risk for psychosis in adults (Cassidy
& Driscoll. Eur. J. Hum. Genet. 17, 3-13 (2009)). Although
paternal deficiency of the 15q11-q13 chromosomal region is well
documented as the etiology of PWS, the precise molecular basis
underlying the clinical features remains elusive. Several genes
from the 15q11-q13 region have paternal-specific expression which
is coordinately regulated by the PWS-imprinting center (PWS-IC)
(Buiting, K. Am J Med Genet C Semin Med Genet. 154C, 365-376
(2010)). Although the specific role of MAGEL2 in PWS remains a
subject of debate due to the conflicting findings in different
reports (Buiting, K., et al., Orphanet J. Rare Dis. 9, 40 (2014);
Schaaf, C. P., et al., Nat. Genet. 45, 1405-1408 (2013); Kanber,
D., et al., Eur J Hum Genet 17, 582-590 (2009)), genomic copy
number variant (CNV) analyses indicate that the SnoRNA cluster
SNORD116 (HBII-85) located between SNRPN and UBE3A plays a critical
role in PWS etiology (Sahoo, T., et al., Nat Genet. 40, 719-721
(2008); de Smith, A. J., et al., Hum Mol Genet. 18, 3257-3265
(2009); Duker, A. L., et al., Eur J Hum Genet. 18, 1196-1201
(2010); Bieth, E., et al., Eur J Hum Genet.: EJHG 23, 252-255
(2015)). SNORD116 is processed from its host transcript, a long
non-coding RNA of which transcription is believed to initiate at
the PWS-IC (Runte, M., et al., Hum. Mol. Genet. 10, 2687-2700
(2001)). Human and mouse SNORD116, including host transcripts, have
the same genomic organization and imprinted expression patterns
(Runte, M., et al., Hum. Mol. Genet. 10, 2687-2700 (2001); de los
Santos, et al., Am. J. Hum. Genet. 67, 1067-1082 (2000); Gallagher,
et al., Am. J. Hum. Genet. 71, 669-678 (2002)), and yet the
mechanism underlying the imprinted expressions of SNRPN and
SNORD116 is still unclear. The PWS-IC contains a CpG island and the
promoter of SNRPN and exhibits differential patterns of DNA
methylation and histone modifications (Buiting, K. Am J Med Genet C
Semin Med Genet. 154C, 365-376 (2010)). The CpG island within the
PWS-IC is fully methylated in the maternal chromosome but
unmethylated in the paternal chromosome (Saitoh, S., et al., Proc
Natl Acad Sci USA, 93, 7811-7815 (1996)). Allele-specific histone
modifications such as the acetylation of H3K4 (histone 3 lysine 4)
and the methylation of H3K9 (histone 3 lysine 9) are also found in
the PWS-IC. DNA methylation inhibitors can unsilence the expression
of maternal-originated SNRPN in vitro (Fulmer-Smentek &
Francke, Hum. Mol. Genet. 10, 645-652 (2001); Saitoh & Wada, Am
J Hum Genet. 66, 1958-1962 (2000)). However, a similar result has
not been reported in vivo.
SUMMARY OF THE DISCLOSURE
[0005] It is against the above background that the present
disclosure provides certain advantages and advancements over the
prior art.
[0006] Although the disclosure herein is not limited to specific
advantages or functionalities, the disclosure provides compounds
and a method of using those compounds for unsilencing at least one
maternal copy of Prader-Willi syndrome (PWS) candidate genes, the
method comprising inhibiting protein lysate methyltransferase
activity by way of an interfering molecule.
[0007] In certain embodiments, the interfering molecule is of
Formula I:
##STR00001## [0008] wherein [0009] R.sup.1 is --C.sub.1-C.sub.8
alkyl, --C.sub.3-C.sub.8 cycloalkyl, or --C.sub.3-C.sub.8
heterocycle comprising 1-3 heteroatoms, each of which may be
optionally substituted with one or more halogens; [0010] each X is
independently --CH-- or --N--; [0011] R.sup.2 is --C.sub.3-C.sub.8
cycloalkyl or --C.sub.3-C.sub.8 heterocycle comprising 1-3
heteroatoms, each of which may be optionally substituted with one
or more alkyl groups, with one or more halogens, or with a
combination thereof; [0012] R.sup.3 is --H, --C.sub.1-C.sub.8
alkyl, halogen, --CN, --CF.sub.3, --NO.sub.2 or --OR.sup.5; [0013]
wherein R.sup.5 is --C.sub.1-C.sub.8 alkyl; and [0014] m and n are
each independently 1, 2, 3, 4, or 5.
[0015] In certain embodiments of the method of unsilencing at least
one maternal copy of Prader-Willi syndrome candidate genes, the
interfering molecule is a G9a inhibitor.
[0016] In certain embodiments of the method of unsilencing at least
one maternal copy of Prader-Willi syndrome candidate genes, the G9a
inhibitor is selected from UNC617, UNC618, UNC0638, UNC0642, or any
combination thereof.
[0017] In certain aspects, the disclosure provides a method of
treating Prader-Willi syndrome in a subject in need thereof, the
method comprising unsilencing Prader-Willi syndrome candidate genes
on the maternal chromosome by administering a therapeutically
effective amount of an interfering molecule.
[0018] In certain aspects, Prader-Willi syndrome is treated by by
administering a therapeutically effective amount of an interfering
molecule, wherein the interfering molecule is a G9a inhibitor.
[0019] In certain aspects of the method for treating Prader-Willi
syndrome by administering a therapeutically effective amount of an
interfering molecule, wherein the interfering molecule is a G9a
inhibitor, and further wherein the G9a inhibitor is UNC617, UNC618,
UNC0638, UNC0642, or any combination thereof.
[0020] Certain aspects of the disclosure provide a pharmaceutical
composition comprising at least one protein lysate
methyltransferase inhibitor and a pharmaceutically acceptable
carrier, excipient, or adjuvant.
[0021] In certain aspects of the pharmaceutical composition, the
inhibitor is UNC617, UNC618, UNC0638, UNC0642, or any combination
thereof.
[0022] Certain aspects of the disclosure provide a kit useful for
the treatment of Prader-Willi syndrome in a subject, the kit
comprising a therapeutically effective amount of the pharmaceutical
composition comprising a protein lysate methyltransferase inhibitor
and instructions for use.
[0023] Certain aspects of the disclosure provide a G9a inhibitor
composition (herein identified as UNC617) comprising:
##STR00002##
[0024] Specific embodiments of the invention will become evident
from the following more detailed description of certain embodiments
and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1. Identification of small molecules that unsilence the
expression of Snrpn from the maternal chromosome. (a) Screening
strategy using a cell-based model. (b) High content imaging of
Snrpn-EGFP following immunofluorescence staining by GFP antibody.
(c) Chemical structures of some identified hits. (d)
Concentration-response curves of UNC0638, UNC0642 or UNC617 in
maternal Snrpn-EGFP MEFs. (e) Validation of Snrpn-EGFP mRNA
expressions in G9a inhibitor- or 5-Aza-dC-treated MEFs using
qRT-PCR.
[0026] FIG. 2. Synthesis of UNC617. Where (a) is 1-methyl
hoomopiperazine, CF.sub.3COOH, i-PrOH, 160.degree. C., 72%.
[0027] FIG. 3. Summarized data plot and positive active compounds
from HCS. (a) Validation of HCS screening results. (b) Summarized
data plot with all 9,157 compounds, including constitutively active
paternal Snrpn-EGFP as positive control (c) 32 potential compounds
activating Snrpn-EGPF at over 125%.
[0028] FIG. 4. Effects of UNC0638 on unsilencing of candidate PWS
genes in a human PWS cell model. (a) Schematic of genomic
organization at the human chromosome 15q11q13 region IC, imprinting
center. (b) Schematic of in vitro treatment used in (c-e). (c)
RT-PCR (left) and concentration-response curves (right) of SNRPN
and SNORD116 in UNC0638-treated human fibroblasts (PWS, cell line
derived from a PWS patient; ctrl, from a non-PWS individual; M, lkb
DNA ladder). (d) Western blot and quantification of SNRPN protein
in human PWS fibroblasts with or without UNC0638 treatment (4 .mu.M
for 72 hr). (e) RT-PCR analysis of genes and transcripts from
15q11-q13 in human PWS fibroblasts treated with UNC0638, UNC0642,
UNC617, UNC618, or 5-Aza-dC.
[0029] FIG. 5. Evaluation of drug toxicity. (a) The brightfield
images of human PWS fibroblast cells treated with UNC0638 for 72
hours are shown to provide gross cell morphology at various dosage
increments. (b) Quantification of cytotoxicity.
[0030] FIG. 6. Representation of UNC0642 improves survival and
growth in mouse model with paternal deletion from Snrpn to Ube3a
(m.sup.+/p.sup..DELTA.S-U). (a) Changes in weight gain in m+/p S-U
mice with or without the treatment of UNC0642. Box-and-whisker
plots correspond to body weight of PBS-treated m+/p S-U (open blue,
n=25 mice at P7 and n=2 mice at P25); UNC0642-treated m+/p S-U
(blue, n=27 mice at P7 and n=6 mice at P25) (Student's t test;
*P<0.05; between two groups of PWS_UNC0642 and PWS_PBS from P10
to P19). (b) Changes in weight gain in WT mice with or without the
treatment of UNC0642 (open black line, n=22 mice at P7 and n=22
mice at P25); treated WT (black, n=14 mice at P7 and n=14 mice at
P25). Two-way ANOVA; treatment; P<0.0001; F=863.3, genotype;
P<0.0001; F=14.86, interaction; P<0.0001; F=2.86 from P10 to
P19; data are means with max and min.
[0031] FIG. 7. Photomicrographs of UNC0642-treated PWS and
vehicle-treated WT animals at age of 3 months. Hematoxylin and
eosin stained sagittal sections of brain (scale bar, 1000 .mu.m),
liver and kidney (scale bar, 1000 .mu.m). Histopathologic
examination revealed no significant compound related lesions in any
of the tissues examined (lung and heart, not shown).
[0032] FIG. 8. UNC0642 improves survivability and unsilences
candidate PWS genes in mouse models with a paternal deletion from
Snrpn to Ube3a (m.sup.+/p.sup..DELTA.S-U)(a) Schematic of in vivo
treatment of m.sup.+/p.sup..DELTA.S-U mice. (b) Improved survival
of UNC0642-treated PWS pups (Kaplan-Meier Log rank test, p=0.0086;
X.sup.-=6.9041; df=1). (c) and (d) Expression analysis of Snrpn,
Snord116, host transcript 116HG, and Ube3a-AS by conventional
RT-PCR (c) and qRT-PCR (d) of brain and liver from P15-16
m.sup.+/p.sup..DELTA.S-U pups with or without treatment. (e)
Western blot and quantification of Ube3a and Snrpn proteins in
brain. (f) Schematic of treatment in 6 week-old mice. The
expression of Egfp by RT-PCR (g) and qRT-PCR (h) in brain
demonstrates efficacy of treatment and long-term effects in adult
mice.
[0033] FIG. 9. Angelman syndrome UBE3A expression was not affected
by UNC0642. Normalized protein levels of UBE3A and SNPRN in
cerebellum following in vivo treatment with PBS (-) or UNC0642 (+,
5 mg/kg, three daily i.p. injections). The lane marked neu,
represents cultured primary cortical neurons, and was included as
internal control (*p<0.05; t-test; n=3-4 mice per group).
[0034] FIG. 10. Unsilencing of PWS candidate genes by UNC0638 and
UNC0642 is associated with demethylation of H3K9 and enhanced
chromatin accessibility. (a) Comparison of the DNA methylation in
PWS-IC between vehicle- and UNC0642 or UNC0638 treated in liver of
m.sup.+/p.sup..DELTA.s-u mice and in a human PWS fibroblast cell
lines. (b) Genomic DNA PCR following chromatin immunoprecipitation
of H3K9me2 or H3K9me3 in PWS fibroblasts. (c) ChIP-qPCR
quantification of H3K9me2 and H3K9me3. (d) Increased chromatin
accessibility in the PWS imprinted domain by UNC0638. (e) Schematic
of the histone mechanism for maternal unsilencing of the PWS
region.
[0035] FIG. 11. Verification of ChIP assay in the PWS/AS cell
lines.
[0036] FIG. 12. Enrichment of H3K9me2 at different PWS candidate
gene loci. (a) The positions of PCR primer pairs used for chromatin
assays across the 15q11-q13 region including NDN (the promoter
region of NDN); U-SNR (the region at the most upstream of
untranslated exons of SNRPN; PWS-IC (the region overlap with the
CpG island of SNRPN and PWS-IC); and S116dw (the 3' region of
SNORD116 cluster). (b) ChIP-qPCR analysis of H3K9me2 in PWS
imprinted domain.
[0037] FIG. 13. Chromatin state at the silent maternal PWS region
is H3K9me2-dependent. (a) Schematic diagram of chromatin
accessibility assay along with qPCR was used to determine the
amount of indicated DNA. (b) The chromatin accessibility of genomic
loci across PWS region assessed by genomic qPCR.
DETAILED DESCRIPTION OF EMBODIMENTS
[0038] The present disclosure provides protein lysine
methyltransferase inhibitor compounds that unsilence and/or
activate candidate genes causing genomic imprinting disorders.
Definitions
[0039] Unless otherwise defined, all technical terms used herein
have the same meaning as commonly understood by one of ordinary
skill in the art to which this disclosure belongs.
[0040] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e. at least one) of the grammatical object of
the article. By way of example, "an element" means at least one
element and can include more than one element.
[0041] The term "alkyl" as used herein means a straight or branched
chain hydrocarbon containing from 1 to 10 carbon atoms unless
otherwise specified. Representative examples of alkyl include, but
are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl,
sec-butyl, iso-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl,
n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl,
n-heptyl, n-octyl, n-nonyl, and n-decyl. When an "alkyl" group is a
linking group between two other moieties, then it may also be a
straight or branched chain; examples include, but are not limited
to --CH.sub.2--, --CH.sub.2CH.sub.2--,
--CH.sub.2CH.sub.2CHC(CH.sub.3)--,
--CH.sub.2CH(CH.sub.2CH.sub.3)CH.sub.2--.
[0042] The term "cycloalkyl" as used herein includes saturated and
partially unsaturated cyclic hydrocarbon groups having 3 to 12
carbons unless otherwise specified. As such, "cycloalkyl" includes
C3, C4, C5, C6, C7, Ce, C9, C10, C11 and C12 cyclic hydrocarbon
groups. Representative cycloalkyl groups include, without
limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl,
cyclohexyl, cyclohexenyl, cycloheptyl, and cyclooctyl.
[0043] The terms "heterocycle," "heterocyclyl" or "heterocyclic"
refer to a ring structure having, unless otherwise specified, from
3 to 12 atoms, (3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 atoms), for
example 4 to 8 atoms, wherein one or more ring atoms are
heteroatoms selected from the group consisting of N, O, and S, and
the remainder of the ring atoms are quaternary or carbonyl carbons.
The ring carbons of the heterocyclic group are optionally
independently substituted. The heterocyclic group is also
optionally independently substituted on nitrogen with alkyl, aryl,
aralkyl, alkylcarbonyl, alkylsulfonyl, arylcarbonyl, arylsulfonyl,
alkoxy carbonyl, or aralkoxy carbonyl, and on sulfur with oxo or
lower alkyl. Examples of heterocyclic groups include, without
limitation, epoxy, azetidinyl, aziridinyl, tetrahydrofuranyl,
tetrahydropyranyl, pyrrolidinyl, piperidinyl, piperazinyl,
imidazolidinyl, thiazolidinyl, dithianyl, trithianyl, dioxolanyl,
oxazolidinyl, oxazolidinonyl, decahydroquinolinyl, piperidonyl,
4-piperidonyl, thiomorpholinyl, and morpholinyl.
[0044] The term "halogen" or "halo" as used herein refers to
chlorine, bromine, fluorine, or iodine.
[0045] As used herein, the term "subject" and "patient" are used
interchangeably and refer to both human and nonhuman animals. The
term "nonhuman animals" of the disclosure includes all vertebrates,
e.g., mammals and non-mammals, such as nonhuman primates, sheep,
dog, cat, horse, cow, chickens, amphibians, reptiles, and the like.
Preferably, the subject is a human patient.
[0046] As indicated, nucleic acid molecules of the present
invention may be in the form of RNA, such as mRNA, are in the form
of DNA, including, for instance, cDNA and genomic DNA obtained by
cloning or produced synthetically. The DNA may be double-stranded
or single-stranded. Single-stranded DNA or RNA may be the coding
strand, also known as the sense strand, or it may be the non-coding
strand, also referred to as the anti-sense strand.
[0047] As used herein, the term "unsilence" refers to the
expressing of a gene which is silenced, repressed, or deactivated
from its normally active state. In some disease states, including
Prade-Willi, functional copies of proteins are not expressed, or
silenced, whereas these functional copies are expressed in the
non-disease state. In this disclosure, the term "unsilence" can be
used interchangeably with the term "activate," "express," and the
like.
[0048] The terms "activate," "express," "increase," "upregulate,"
"unsilence," "suppress," "inhibit," "block," "decrease,"
"attenuate," "downregulate," or the like, denote quantitative
differences between two states, preferably referring to at least
statistically significant differences between the two states.
[0049] The terms "DNA sequence encoding," "DNA encoding," and
"nucleic acid encoding" refer to the order or sequence of
deoxyribonucleotides along a strand of deoxyribonucleic acid. The
order of these deoxyribonucleotides determines the order of amino
acids along the polypeptide chain. The DNA sequence thus codes for
the amino acid sequence.
[0050] The term "control sequences" refers to DNA sequences
necessary for the expression of an operably linked coding sequence
in a particular host organism. The control sequences that are
suitable for prokaryotes, for example, include a promoter,
optionally an operator sequence, a ribosome binding site, and
possibly, other as yet poorly understood sequences. Eukaryotic
cells are known to utilize promoters, polyadenylation signals, and
enhancer.
[0051] In the context of the present disclosure, the terms "cell,"
"cell line," "cell model," and "cell culture" are used
interchangeably, and all such designations include progeny. This
includes the primary subject cell, either established from a
transgenic animal or created in the laboratory, and cultures
derived therefrom without regard for the number of transfers. It is
also understood that all progeny may not be precisely identical in
DNA content, due to deliberate or inadvertent mutations. Mutant
progeny that have the same function or biological activity as
screened for in the originally transformed cell are included. Where
distinct designations are intended, it will be clear from the
context.
[0052] "Animal model," "mouse model," and "transgenic animal" are
terms used interchangeably and all such terms are used to describe
animals that have had an exogenous element deliberately inserted
into their genome. Such animals are most commonly created by the
micro-injection of DNA into the pronuclei of a fertilized egg which
is subsequently implanted into the oviduct of a pseudopregnant
surrogate mother. These such designations also include the primary
subject animal and progeny derived therefrom without regard for the
number of progeny and generations.
[0053] An "exogenous" element is defined herein to mean nucleic
acid sequence that is foreign to the cell, or homologous to the
cell but in a position within the host cell nucleic acid in which
the element is ordinarily not found.
[0054] The term "administering" or "administered" as used herein is
meant to include both parenteral and/or oral administration, all of
which are described in more detail in the "pharmaceutical
compositions" section below. By "parenteral" is meant intravenous,
subcutaneous or intramuscular administration. In the methods of the
subject disclosure, the interfering molecules of the present
disclosure may be administered alone, simultaneously with one or
more other interfering molecule, or the compounds may be
administered sequentially, in either order. It will be appreciated
that the actual preferred method and order of administration will
vary according to, inter alia, the particular preparation of
interfering molecules being utilized, the particular formulation(s)
of the one or more other interfering molecules being utilized. The
optimal method and order of administration of the compounds of the
disclosure for a given set of conditions can be ascertained by
those skilled in the art using conventional techniques and in view
of the information set out herein. The term "administering" or
"administered" also refers to oral sublingual, buccal, transnasal,
transdermal, rectal, intramuscular, intravenous, intraventricular,
intrathecal, and subcutaneous routes. In accordance with good
clinical practice, it is preferred to administer the instant
compounds at a concentration level which will produce effective
beneficial effects without causing any harmful or untoward side
effects.
[0055] The terms "effective amount" and "therapeutically effective
amount" when used in reference to a pharmaceutical composition
comprising one or more protein lysine methyltransferase inhibitor
compounds refer to an amount or dosage sufficient to produce a
desired therapeutic result. More specifically, a therapeutically
effective amount is an amount of a protein lysine methyltransferase
inhibitor compound sufficient to inhibit, for some period of time,
one or more of the clinically defined pathological processes
associated with the condition being treated. The effective amount
may vary depending on the specific protein lysine methyltransferase
inhibitor that is being used, and also depends on a variety of
factors and conditions related to the patient being treated. For
example, if the protein lysine methyltransferase inhibitor is to be
administered in vivo, factors such as the age, weight, and health
of the patient as well as dose response curves and toxicity data
obtained in preclinical animal work would be among those factors
considered. The determination of an effective amount or
therapeutically effective amount of a given pharmaceutical
composition is well within the ability of those skilled in the
art.
[0056] As used herein, the term "treat" refers to the ability to
make better, or more tolerable, or reduce, the clinical
characterization of Prader-Willi syndrome. The terms "treating,"
"treatment," or "treat" as used herein refer to both therapeutic
treatment and prophylactic or preventative measures. Those in need
of treatment include those having the disorder as well as those
prone to have the disorder or those in which the disorder is to be
prevented. "Therapeutic treatment" refers to the caring for, or
dealing with, a subject's Prader-Willi syndrome condition either
medically or surgically, and can include "ameliorating" and/or
"limiting progression." Also within the scope of the term
"treating" is the acting upon a subject presenting the clinical
features of Prader-Willi syndrome by the use of some agent, such as
an interfering molecule, to amelioriate, improve, alter, or reduce
the condition.
[0057] The terms "pharmaceutical composition" or "therapeutic
composition" as used herein refer to a compound or composition
capable of inducing a desired therapeutic effect when properly
administered to a patient.
[0058] The term "pharmaceutically acceptable carrier" or
"physiologically acceptable carrier" as used herein refers to one
or more formulation materials suitable for accomplishing or
enhancing the delivery of a protein lysine methyltransferase
inhibitor.
[0059] One embodiment of the invention provides a pharmaceutical
composition comprising a pharmaceutically acceptable carrier and a
therapeutically effective amount of protein lysine
methyltransferase inhibiting compound.
[0060] The term "dosage unit form" or "unit dosage" means
physically discrete coherent units suitable for medical
administration, each containing a daily dose or a multiple (up to
four times) or a sub-multiple (down to a fortieth) of a daily dose
of the active compound in association with a carrier and/or
enclosed within an envelope. Whether the composition contains a
daily dose, or for example, a half, a third or a quarter of a daily
dose, will depend on whether the pharmaceutical composition is to
be administered once or, for example, twice, three times or four
times a day, respectively.
Protein Lysine Methyltransferase Inhibitor Compounds and Uses
Thereof
[0061] The present disclosure provides compounds comprising
interfering molecules and a method of using those compounds for the
treatment of genomic imprinting disorders. Certain embodiments of
the disclosure comprise compounds which activate at least one
maternal copy of candidate Prader-Willi syndrome (PWS) genes.
Certain embodiments of the compounds comprise at least one
interfering molecule which inhibits protein lysine
methyltransferase activity.
[0062] Protein lysine methyltransferases (PKMT) contain the
evolutionarily conserved catalytic SET [Su(var)3-9,
Enhancer-of-zeste, Trithorax] domain which catalyze the transfer of
methyl groups from S-Adenosyl methionine (SAM) to e-amino group of
target lysine residues by an SN-2 mechanism. Representative
families of methyltransferases include, but are not limited to, EZ,
SET1, SET2, SMYD, SUV39, SUV4-20, RIZ, SET8/PR-SET7, and SETT/9.
Histone marks created by these enzymes can either activate
transcription, for example H3K4me, or repress transcription, for
example H3K27me and H2K9me. Hence the activity of these enzymes
together helps in creation of bivalent chromatin marks in order to
keep genes in a poised state (activation/repression).
[0063] The term "histone modification" is used herein to refer to
post-translational modifications of histones. Post-translational
modification of histones is a function of various enzymes that
catalyze the addition of various chemical groups e.g. acetyl-,
methyl-, phosphate-, ubiquitin-, etc. from one substrate to
another. These modifications include, but are not limited to,
arginine citrullination, arginine methylation, lysine acetylation,
lysine biotinylation, lysine methylation, lysine ribosylation,
lysine ubiquitination, serine/threonine/tyrosine phosphorylation.
In certain embodiments, predominant targets for acetylation and
methylation are the lysine and arginine residues present in the
Histone peptides. The histone modifications are performed by a
number of modifying enzymes including, but not limited to,
methyltransferases, deiminases, acetyltransferases, biotinases,
ribosylases, ubiquitinases, serine/threonine/tyrosine kinases,
demethylases, deacetylases, deribosylases, deubiquitinases,
serine/threonine/tyrosine phosphatases. Histone modifications play
an important role in many cellular processes like DNA replication,
cell cycle progression, cytokinesis, transcriptional regulation of
Hox genes and tumour suppressor genes, DNA damage response,
replication stress response, X chromosome inactivation, and energy
homeostasis. Another significant contribution of histone
modifications is the regulation of master regulators like p53 and
components of the NF-kB pathway. Histone modifications are also
involved in maintenance of chromatin structure by creating marks
that recruit heterochromatin protein (HP1) in order to initiate the
process of heterochromatinisation.
[0064] In certain aspects, the method of activating at least one
maternal copy of Prader-Willi syndrome candidate genes comprises
inhibiting G9a activity. G9a (UniprotKB Accession Q96KQ7; also
known as KMT1C or EHMT2) and GLP (UniprotKB Accession Q9H9B1; also
known as EHMT1) are both protein lysine methyltransferases (PKMT)
known to modulate the transcriptional repression of a variety of
genes via dimethylation of Lys9 on histone H3. In certain aspects
of the disclosure, the method of activating at least one maternal
copy of Prader-Willi syndrome candidate genes comprises inhibiting
G9a activity whereby the inhibition of G9a activity comprises
inhibiting the methylation of the Histone H3 protein. In certain
aspects, the method comprises inhibiting the methylation of Histone
H3 at lysine 9.
[0065] In certain embodiments, the method comprises inhibiting the
methylation of H3K9 through a selective reduction of demethylation
of histone 3 lysine 9.
[0066] In certain embodiments, the method of unsilencing at least
one maternal copy of Prader-Willi syndrome candidate genes, the PWS
candidate genes are located on the 15q11-q13 region between the
MAGEL2 and UBE3A genes.
[0067] In certain aspects, the method of unsilencing at least one
maternal copy of Prader-Willi syndrome candidate genes, the PWS
candidate genes comprise MAGEL2, NDN, SNRPN, and SnoRNAs genes.
[0068] In certain aspects of the method of unsilencing at least one
maternal copy of Prader-Willi syndrome candidate genes, the SnoRNAs
gene comprises SNORD116, and/or SNORD115.
[0069] In certain embodiments of the method of unsilencing at least
one maternal copy of Prader-Willi syndrome candidate genes, the
interfering molecule is a G9a inhibitor.
[0070] In certain embodiments of the method of unsilencing at least
one maternal copy of Prader-Willi syndrome candidate genes, the G9a
inhibitor is selected from UNC617, UNC618, UNC0638, UNC0642, or any
combination thereof. As used herein, "any combination thereof" or
"combination" is intended to refer to any combination of 2 or more
inhibitors, in any ratio. Thus, in non-limiting examples, a
combination may include UNC617 and UNC618, a combination may
include UNC617, UNC618, and UNC638, or a combination may include
UNC617, UNC618, UNC0638, or UNC0642. The combination includes the
use of multiple inhibitors either sequentially or concurrently.
[0071] In certain embodiments, the methods of unsilencing at least
one maternal copy of Prader-Willi syndrome candidate genes may be
achieved through use of a combination of an interfering molecule as
disclosed herein and an inhibitor of DNA methylation. The inhibitor
of DNA methylation may include, but is not limited to, azacytidine
and decitabine.
[0072] In certain aspects, the disclosure provides a method of
treating Prader-Willi syndrome in a subject in need thereof, the
method comprising unsilencing Prader-Willi syndrome candidate genes
on the maternal chromosome by administering a therapeutically
effective amount of an interfering molecule, wherein the
methylation of H3K9 is reduced.
[0073] In certain aspects of the method for treating Prader-Willi
syndrome by administering a therapeutically effective amount of an
interfering molecule, the interfering molecule is a G9a
inhibitor.
[0074] In certain aspects of the method for treating Prader-Willi
syndrome by administering a therapeutically effective amount of an
interfering molecule, the interfering molecule is a G9a inhibitor,
and the G9a inhibitor is UNC617, UNC618, UNC0638, UNC0642, or any
combination thereof.
[0075] In certain aspects of the method for treating Prader-Willi
syndrome by administering a therapeutically effective amount of an
interfering molecule, the interfering molecule is a G9a inhibitor,
and the therapeutically effective amount of interfering molecule
unsilences at least one gene within the PWS critical region (or
PWS-IC-controlled region).
[0076] In certain aspects of the method for treating Prader-Willi
syndrome by administering a therapeutically effective amount of an
interfering molecule, the interfering molecule is a G9a inhibitor,
the therapeutically effective amount of interfering molecule
unsilences at least one gene within the PWS critical region (or
PWS-IC-controlled region), and the at least one unsilenced gene
within the PWS critical region is SNORD116.
[0077] In certain aspects of the method for treating Prader-Willi
syndrome in a subject in need thereof by administering a
therapeutically effective amount of an interfering molecule,
methylation of H3K9 is reduced, wherein the subject is a
mammal.
[0078] In certain aspects of the method for treating Prader-Willi
syndrome in a subject in need thereof by administering a
therapeutically effective amount of an interfering molecule,
methylation of H3K9 is reduced, wherein the subject is a human.
[0079] In certain embodiments, the methods for treating
Prader-Willi syndrome in a subject in need thereof may be achieved
through the administration of a combination of an interfering
molecule as disclosed herein and an inhibitor of DNA methylation.
The inhibitor of DNA methylation may include, but is not limited
to, azacytidine and decitabine.
[0080] One aspect of the disclosure comprises an interfering
molecule. As used herein, an interfering molecule refers to any
molecule that is capable of disrupting histone modification. In
preferred embodiments, the "interfering molecule" is capable of
interfering with histone H3 modification. Certain embodiment, the
interfering molecule is capable of interfering with histone H3
lysine 9 modification carried out by protein lysine
methyltransferases.
[0081] In certain embodiments, the interfering molecule may be a
small molecule. In such embodiments, the small molecules generally
have a molecular weight of approximately 600 Da or less and may
include, but are not limited to amino acids, monosaccharides,
oligosaccharides, nucleotides, olionucleotides, salt compositions,
and their derivatives. In certain embodiments, the small molecules
are capable of crossing the blood brain barrier.
[0082] In certain embodiments, the interfering molecule is a
protein lysine methyltransferase inhibitor. As used herein, protein
lysine methyltransferase inhibitor refers to a compound creating a
difference between two states, one state comprising a protein
lysine methyltransferase (PKMT) and the other state comprising a
PKMT and a PKMT inhibitor. In the latter state, there is a
statistically significant decrease in the activity of the PKMT when
compared to the first state. PKMT inhibitors can exhibit
substrate-competitive behavior, showing competition with the
peptide substrate, showing the K.sub.m of the peptide increases
linearly with the PKMT inhibitor concentration.
[0083] In one aspect of the disclosure, the interfering molecule is
of Formula I:
##STR00003##
wherein R.sup.1 is --C.sub.1-C.sub.8 alkyl, --C.sub.3-C.sub.8
cycloalkyl, or --C.sub.3-C.sub.8 heterocycle comprising 1-3
heteroatoms, each of which may be optionally substituted with one
or more halogens; each X is independently --CH-- or --N--; R.sup.2
is --C.sub.3-C.sub.8 cycloalkyl or --C.sub.3-C.sub.8 heterocycle
comprising 1-3 heteroatoms, each of which may be optionally
substituted with one or more alkyl groups, with one or more
halogens, or with a combination thereof; R.sup.3 is --H,
--C.sub.1-C.sub.8 alkyl, halogen, --CN, --CF.sub.3, --NO.sub.2 or
--OR.sup.5; [0084] wherein R.sup.5 is --C.sub.1-C.sub.8 alkyl; and
m and n are each independently 1, 2, 3, 4, or 5.
[0085] In certain embodiments, R.sup.1 is alkyl. In certain
embodiments, R.sup.1 is isopropyl.
[0086] In certain embodiments, both occurrences of X are --N--.
[0087] In certain embodiments, R.sup.2 is a 6-7 membered cycloalkyl
or heterocyclic ring. In certain embodiments, R.sup.2 is
substituted with one or more halogens. In certain embodiments,
R.sup.2 is substituted with C.sub.1-C.sub.3 alkyl, including but
not limited to methyl and isopropyl. In certain embodiments,
R.sup.2 is selected from the group consisting of:
##STR00004##
[0088] In certain embodiments, R.sup.3 is --OCH.sub.3.
[0089] In certain embodiments, m is 3 and n is 2 or 3.
[0090] It will be understood by one of skill in the art that the
various embodiments of Formula I disclosed herein may be combined
in any manner, even if such combinations are not specifically
delineated.
[0091] In certain embodiments, the interfering molecule is of
Formula II:
##STR00005##
wherein R.sup.2 is as defined above.
[0092] The interfering molecules of the invention include
pharmaceutically acceptable salts, esters, amides, and prodrugs
thereof, including but not limited to carboxylate salts, amino acid
addition salts, esters, amides, and prodrugs of the compounds of
the present invention which are, within the scope of sound medical
judgment, suitable for use in contact with the tissues of patients
without undue toxicity, irritation, allergic response, and the
like, commensurate with a reasonable benefit/risk ratio, and
effective for their intended use, as well as the zwitterionic
forms, where possible, of the compounds of the invention.
[0093] Certain embodiments disclosed herein include inhibitors to
the PKMT G9a. These G9a inhibitors include, but are not limited to,
UNC617, UNC618, UNC0638, UNC0642, or combinations thereof. The
structures of UNC617, UNC618, UNC0638, and UNC0642 are shown in
FIG. 1c.
[0094] UNC617 (MW=554.4177) is an inhibitor of G9a showing a
similar potency to G9a as UNC0638 (FIG. 1e).
[0095] UNC618 (MW=523.54) is an inhibitor of G9a displaying an
IC50=6 nM. See Liu, F., et al., J. of Med. Chem., 54, 6139-6150
(2011).
[0096] UNC0638 (MW=509.735) is a potent, substrate-competitive
inhibitor of G9a (IC.sub.50<15 nM, Ki=3 nM) and the closely
related GLP (IC.sub.50=19 nM). UNC0638 is selective for G9a and GLP
over a wide range of epigenetic and non-epigenetic targets. UNC0638
is highly active in cells: at 250 nM concentration, it reduces the
levels of H3K9me2 by .about.60-80% in a variety of cell lines,
similar to the reductions seen for shRNA knockdown of G9a and GLP,
and modulates expression of known G9a-regulated genes (see Vedadi,
M., et al., Nat. Chem. Biol., 7, 566-574 (2011)).
[0097] UNC0642 (MW=529.64) is a potent and selective inhibitor of
G9a and GLP shown in biochemical and cellular assays with an
IC50<2.5 nM. UNC0642 is also selective for G9a and GLP over
several methyltransferases (greater than 2000-fold over PRC2-EZH2
and greater than 20,000 over 13 other methyltransferases) as well
as over a broad range of kinases, GPCRs, ion channels, and
transporters (greater than 300-fold selectivity). UNC0642 exhibits
high potency for H3K9me2 mark, low cell toxicity, and suitable
separation of functional potency and cell toxicity in a several
cell lines. UNC0642 also shows pharmacokinetic properties superior
to UNC0638, such as, central nervous system penetration (see Liu,
F., et al., J. of Med. Chem., 56, 8931-8942 (2013)).
[0098] Certain aspects of the present disclosure provide a G9a
inhibitor composition (herein identified as UNC617) comprising:
##STR00006##
[0099] Additional aspects of the disclosure provide a G9a inhibitor
composition comprising UNC617 and further comprising a
pharmaceutically acceptable salt thereof.
Pharmaceutical Compositions
[0100] Certain aspects of the disclosure provide a pharmaceutical
composition comprising at least one G9a inhibitor for inhibiting
methylation of H3K9 in a subject with Prader-Willi syndrome and a
pharmaceutically acceptable carrier, excipient, or adjuvant.
[0101] Certain aspects of the disclosure provide a pharmaceutital
composition comprising at least one G9a inhibitor for inhibiting
methylation of H3K9 in a subject with Prader-Willi syndrome and the
G9a inhibitor can be UNC617, UNC618, UNC0638, UNC0642, or any
combinations thereof.
[0102] In certain aspects, disclosed herein is a pharmaceutical
composition comprising the disclosed composition for unsilencing
and activating candidate Prader-Willi genes. In certain embodiments
the pharmaceutical composition comprises the compositions disclosed
herein and a pharmaceutically acceptable carrier, excipient or
adjuvant.
[0103] In some embodiments, the pharmaceutical compositions of the
disclosure may further comprise a DNA methylation inhibitor.
[0104] Acceptable formulation materials preferably are nontoxic to
recipients at the dosages and concentrations employed. The
pharmaceutical composition can contain formulation materials for
modifying, maintaining or preserving, for example, the pH,
osmolarity, viscosity, clarity, color, isotonicity, odor,
sterility, stability, rate of dissolution or release, adsorption or
penetration of the composition. Suitable formulation materials
include, but are not limited to, amino acids (such as glycine,
glutamine, asparagine, arginine or lysine); antimicrobials;
antioxidants (such as ascorbic acid, sodium sulfite or sodium
hydrogen-sulfite); buffers (such as borate, bicarbonate, Tris-HCl,
citrates, phosphates or other organic acids); bulking agents (such
as mannitol or glycine); chelating agents (such as ethylenediamine
tetraacetic acid (EDTA)); complexing agents (such as caffeine,
polyvinylpyrrolidone, beta-cyclodextrin or
hydroxypropyl-beta-cyclodextrin); fillers; monosaccharides,
disaccharides, and other carbohydrates (such as glucose, mannose or
dextrins); proteins (such as serum albumin, gelatin or
immunoglobulins); coloring, flavoring and diluting agents;
emulsifying agents; hydrophilic polymers (such as
polyvinylpyrrolidone); low molecular weight polypeptides;
salt-forming counterions (such as sodium); preservatives (such as
benzalkonium chloride, benzoic acid, salicylic acid, thimerosal,
phenethyl alcohol, methylparaben, propylparaben, chlorhexidine,
sorbic acid or hydrogen peroxide); solvents (such as glycerin,
propylene glycol or polyethylene glycol); sugar alcohols (such as
mannitol or sorbitol); suspending agents; surfactants or wetting
agents (such as pluronics, polyethylene glycol (PEG), sorbitan
esters, polysorbates such as polysorbate 20 and polysorbate 80,
Triton, trimethamine, lecithin, cholesterol, or tyloxapal);
stability enhancing agents (such as sucrose or sorbitol); tonicity
enhancing agents (such as alkali metal halides, preferably sodium
or potassium chloride, mannitol, or sorbitol); delivery vehicles;
diluents; excipients and/or pharmaceutical adjuvants (see, for
example, Remington's Pharmaceutical Sciences, 18th Edition, (A. R.
Gennaro, ed.), 1990, Mack Publishing Company).
[0105] Additional pharmaceutical compositions of the invention will
be evident to those skilled in the art, including formulations
involving G9a inhibitor compounds in sustained- or
controlled-delivery formulations. Techniques for formulating a
variety of other sustained- or controlled-delivery means, such as
liposome carriers, bio-erodible microparticles or porous beads and
depot injections, are also known to those skilled in the art.
Additional examples of sustained-release preparations include
semipermeable polymer matrices in the form of shaped articles, e.g.
films, or microcapsules. Sustained release matrices can include
polyesters, hydrogels, polylactides, copolymers of L-glutamic acid
and gamma ethyl-L-glutamate, poly(2-hydroxyethyl-methacrylate),
ethylene vinyl acetate, or poly-D(-)-3-hydroxybutyric acid.
Sustained-release compositions can also include liposomes, which
can be prepared by any of several methods known in the art.
[0106] Pharmaceutical compositions of the invention to be used for
in vivo administration typically must be sterile. This can be
accomplished by filtration through sterile filtration membranes.
Where the composition is lyophilized, sterilization using this
method can be conducted either prior to, or following,
lyophilization and reconstitution. The composition for parenteral
administration can be stored in lyophilized form or in a solution.
In addition, parenteral compositions generally are placed into a
container having a sterile access port, for example, an intravenous
solution bag or vial having a stopper pierceable by a hypodermic
injection needle.
[0107] Once the pharmaceutical composition has been formulated, it
can be stored in sterile vials as a solution, suspension, gel,
emulsion, solid, or as a dehydrated or lyophilized powder. Such
formulations can be stored either in a ready-to-use form or in a
form (e.g., lyophilized) requiring reconstitution prior to
administration.
[0108] In a non-limiting example, the G9a inhibitor UNC0642 was
administered to mice to examine the pharmacological effects
thereof. For intraperitoneal injection, the solution of UNC0642 was
prepared to the concentration of 0.5 mg/ml in sterile saline, and
was administered to mice daily at a volume of 5-10 microliter per g
body weight. The dosage and duration of UNC0642 used is 2.5-5.0
mg/kg and 5-7 consecutive injections. The dosage and duration vary
depending on the age and condition of animals. For example,
neonatal treatment of PWS mice used 2.5 mg/kg and 5 daily
injections starting at 1 week-old, and adult mice treatment used 5
mg/kg and 7 daily injections.
[0109] Certain aspects of the disclosure encompass kits for
producing a single-dose administration unit. Certain aspects of the
disclosure provide a kit useful for the treatment of Prader-Willi
syndrome in a subject. The kit comprising both a therapeutically
effective amount of a pharmaceutical composition comprising a G9a
inhibitor for the methylation of H3K9 and instructions for use. The
kits can each contain both a first container having a dried protein
and a second container having an aqueous formulation. Also included
within the scope of this disclosure are kits containing single and
multi-chambered pre-filled syringes (e.g., liquid syringes and
lyosyringes).
[0110] As described herein, the effective amount of a G9a inhibitor
pharmaceutical composition to be employed therapeutically will
depend, for example, upon the therapeutic context and objectives.
One skilled in the art will appreciate that the appropriate dosage
levels for treatment will thus vary depending, in part, upon the
molecule delivered, the indication for which the G9a inhibitor is
being used, the route of administration, and the size (body weight,
body surface, or organ size) and condition (the age and general
health) of the patient. Accordingly, the clinician can titer the
dosage and modify the route of administration to obtain the optimal
therapeutic effect. A typical dosage can range from about 0.1
.mu.g/kg to up to about 100 mg/kg or more, depending on the factors
mentioned above. In other embodiments, the dosage can range from
0.1 .mu.g/kg up to about 100 mg/kg; or 1 .mu.g/kg up to about 100
mg/kg; or 5 .mu.g/kg, 10 .mu.g/kg, 15 .mu.g/kg, 20 .mu.g/kg, 25
.mu.g/kg, 30 .mu.g/kg, 35 .mu.g/kg, 40 .mu.g/kg, 45 .mu.g/kg, 50
.mu.g/kg, 55 .mu.g/kg, 60 .mu.g/kg, 65 .mu.g/kg, 70 .mu.g/kg, 75
.mu.g/kg, up to about 100 mg/kg.
[0111] Dosing frequency will depend upon the pharmacokinetic
parameters of the G9a inhibitor in the formulation being used.
Typically, a clinician will administer the composition until a
dosage is reached that achieves the desired effect. The composition
can therefore be administered as a single dose, as two or more
doses (which may or may not contain the same amount of the desired
molecule) over time, or as a continuous infusion via an
implantation device or catheter. Further refinement of the
appropriate dosage is routinely made by those of ordinary skill in
the art and is within the ambit of tasks routinely performed by
them. Appropriate dosages can be ascertained through use of
appropriate dose-response data.
[0112] The route of administration of the pharmaceutical
composition is in accord with known methods, e.g., orally; through
injection by intravenous, intraperitoneal, intracerebral
(intraparenchymal), intracerebroventricular, intramuscular,
intraocular, intraarterial, intraportal, or intralesional routes;
by sustained release systems; or by implantation devices. Where
desired, the compositions can be administered by bolus injection or
continuously by infusion, or by implantation device.
[0113] The composition can also be administered locally via
implantation of a membrane, sponge, or other appropriate material
onto which the desired molecule has been absorbed or encapsulated.
Where an implantation device is used, the device can be implanted
into any suitable tissue or organ, and delivery of the desired
molecule can be via diffusion, timed-release bolus, or continuous
administration.
EXAMPLES
[0114] The Examples which follow are illustrative of specific
embodiments of the invention, and various uses thereof. They set
forth for explanatory purposes only, and are not to be taken as
limiting the invention.
General Methods
Cell Culture
[0115] To generate primary mouse embryonic fibroblasts (MEFs)
carrying maternal Snrpn-EGFP (m.sup.S-EGFP/p.sup.+), Snrpn-EGFP/+
heterozygous females were crossed with wild-type males and embryos
were isolated at E12.5 to E14.5 day. In addition, MEFs carrying
paternal Snrpn-EGFP (m.sup.+/p.sup.S-EGFP) were isolated from the
embryos of wild-type females crossing with Snrpn-EGFP/+
heterozygous males. Human PWS fibroblasts were obtained from Baylor
College of Medicine cell repository and NIGMS Human Genetic Mutant
Cell Repository. Mouse embryonic fibroblast cells were maintained
in Dulbecco's modified Eagle's media (Gibco 11995-065) supplemented
with 10% fetal bovine serum (Gibco 10082-147), 1% Gentamicin (Gibco
15710-064), 1% Glutamine (Gibco 25030-149), 1% non-essential amino
acid (Gibco 11140-050), 0.1% beta-mercaptoethanol (Gibco
21985-023), 100 Units/mL penicillin and 100 .mu.g/mL streptomycin
(Gibco 15240-062) at 37.degree. C. and 5% CO.sub.2. Human
fibroblast cells were maintained in Minimum Essential Medium Alpha
media (Gibco 12571-063) supplemented with 10% fetal bovine serum
(Gibco 10082-147), 1% L-Glutamine (Gibco 25030-081), 100 Units/mL
penicillin and 100 micrograms/mL streptomycin (Gibco 15240-062) at
37.degree. C. and 5% CO.sub.2.
High Content Screening of Small Molecule Libraries
[0116] High content screenings of small molecules were performed as
described in Huang, et al. Nature 481, 185-189 (2012). HCS
comprises a 384-well high-content screen using primary mouse
embryonic fibroblasts (MEFs) from m.sup.S-EGFP/p.sup.+, and
searched for drug-like molecules that could unsilence the maternal
S-EFGP allele. As seen in FIG. 1. FIG. 2, then shows the use of
paternal expression of Snrpn-EGPF in m.sup.+/p.sup.S-EGFP MEFs as a
positive control and vehicle treated m.sup.S-EGFP/p.sup.+ MEFs as a
negative control, the unsilencing of Snrpn-EGFP was determined by
nuclear EDFP signal in UNC0638 treated m.sup.S-EGFP/p.sup.+ MEFs.
To perform the screen, primary MEFs were isolated from E12.5-14.5
embryos of m.sup.S-EGFP/p.sup.+ and cultured for 7 days in
Dulbecco's modified Eagle's media supplemented with 10% fetal
bovine serum, 100 Units/mL penicillin and 100 .mu.g/mL
streptomycin, at 37.degree. C. and 5% CO.sub.2. One day before
treatment with small molecules, 5,000 cells per well were plated
onto 384-well plates. The cells were then treated with compounds
(10 .mu.M for 72 hours) from multiple small molecule libraries
(Figure if and FIG. 2). In total, 9,157 small molecules were
screened in quadruplicate, normalizing values to vehicle-treatment
(0.2% DMSO) (Table 1). The unsilencing of Snrpn-EGFP was determined
three days after drug treatment. The immunofluorescence-processed
fibroblasts were imaged for Hoechst and Alexa Fluor 488
fluorescence using a BD Pathway 855 high content imaging
microscope. Antibody-enhanced Snrpn-EGPF fluorescence intensity was
determined in drug-treated cells individually and normalized to
cells treated with vehicle control. In order to identify
potentially active compounds, an arbitrary cutoff of 125% was used
where 100% indicates basal fluorescence in the vehicle-treated
MEFs. Analysis was performed using Cell Profiler with custom macro
and algorithms. Potential active drugs were defined as the increase
in drug-mediated EGFP fluorescence consistently observed across
quadruplicate wells and minimal or no cytotoxicity measured by
Hoechst-stained nuclear structure (and the changes in total number
of cells). After initial validation of all potential active drugs
(e.g., to determine whether active compounds show inherent
fluorescence, the wild-type fibroblasts were also treated), only
effective hit compounds further validated in dose-response tests to
determine relative efficacy (E.sub.max) and potency (EC.sub.50).
The dose-response results were analyzed by using Graphpad Prism
(Graphpad Software). The calculated EC.sub.50 values (potencies)
and estimated E.sub.max (efficacy, Y-value top plateau) enabled
comparative analyses of the relative potency and efficacy of the
identified compounds.
In Vitro and In Vivo Drug Treatment
[0117] Human fibroblast cells were grown to .about.80% confluence
and were treated with compounds (UNC617, UNC0638, and UNC0642 at 4
.mu.M; UNC618 at 8 .mu.M; or 5-aza-dC at 10 .mu.M final
concentration) diluted in culture medium for 72 hours. For the
treatment in PWS animal model, m.sup.+/p.sup..DELTA.S-U litters
were given UNC0642 (2.5 mg/kg) diluted in isotonic saline solution
(PBS) containing 0.02% DMSO by daily intraperitoneal (i.p.)
injection starting at P7 and then five following days. For testing
long lasting drug effects, the 6 week-old m.sup.S-EGFP/p.sup.+ mice
were treated daily by i.p. injection for seven consecutive
days.
General Chemistry Procedures
[0118] HPLC spectra for UNC617 was acquired using an Agilent 6110
Series system with UV detector set to 254 nm. Samples (5 .mu.l)
were injected onto an Agilent Eclipse Plus 4.6.times.50 mm, 1.8 M,
C18 column at room temperature. A linear gradient from 10% to 100%
B (MeOH+0.1% acetic acid) in 5.0 min was followed by pumping 100% B
for another 2 min with A being H2O+0.1% acetic acid. The flow rate
was 1.0 m/min. Mass spectra (MS) data was acquired in positive-ion
mode using an Agilent 6110 single-quadrupole mass spectrometer with
an electrospray ionization (ESI) source. High-resolution mass
spectra (HRMS) was acquired using an Aglient 6210 LCMS
orthogonal-axis time-of-flight (TOF) mass spectrometer. Nuclear
magnetic resonance (NMR) spectra was recorded at Varian Mercury
spectrometer with 400 MHz for proton (1H NMR) and 100 MHz for
carbon (13C NMR); chemical shifts are reported in p.p.m. (.delta.).
Preparative HPLC was performed on Agilent Prep 1200 series with UV
detector set to 220 nm. Samples were injected onto a Phenomenex
Luna 75.times.30 mm, 5 M, C.sub.18 column at room temperature. The
flow rate was 30 ml/min. A linear gradient with 10% of MeOH (A) in
0.1% TFA in H2O (B) to 100% of MeOH (A) was used. HPLC was used to
establish the purity of target compounds.
Immunoblotting
[0119] Western blot analysis was performed as previously described
by Wang, et al., Molecular Autism 5, 30 (2014). Briefly, total
protein was extracted from collected tissues (liver and brain)
using modified RIPA buffer (1.times.PBS, 1% Triton X-100, 0.1% SDS,
2 mM EDTA, and protease inhibitors). SDS-PAGE resolved 25 .mu.g of
total proteins and they were transferred to polyvinylidene
difluoride (PVDF) membranes. The PVDF membranes were blocked with
BLOTTO (5% skim milk and 0.1% Tween-20 in 1.times.TBS buffer), and
incubated with primary target antibodies, rabbit anti-Snrpn
(Protein Tech, cat. no. 11070-1-AP) at 1:400, and rabbit anti-Ube3a
(Bethyl Lab, cat. no. A300-352A-T) at 1:1,000 working concentration
in BLOTTO at 4.degree. C. overnight. The next day, following
incubation with horseradish peroxidase-conjugated secondary
antibodies, the membranes were incubated with a Pierce
chemiluminescent substrate and exposed to X-ray film or imaged by
AI600 (GE Healthcare Life Science).
Immunocytochemistry
[0120] Immunofluorescence staining was performed to detect any
up-regulated Snrpn-EGFP.
[0121] Three days after drug treatment, the cells were fixed at 4%
paraformaldehyde at room temperature for 10 min, followed by
rinsing with 1.times.PBS. The cells were permeabilized with 0.5%
Triton X-100 in 1.times.PBS at room temperature for 10 min,
followed by blocking with 5% normal goat serum in 0.1% Triton X-100
in 1.times.PBS at room temperature for 30 minutes. Primary rabbit
anti-GFP antibody (1:1000, Novus Biologicals cat. no. NB100-1770)
was incubated at 4.degree. C. overnight. The next day, the cells
were rinsed with 1.times.PBS and incubated with goat anti-rabbit
Alexa Fluor 488 (Invitrogen cat. no. A-11008) and Hoechst at room
temperature. One hour after incubation, the cells were rinsed with
1.times.PBS and imaged for Hoechst and Alexa Fluor 488 fluorescence
using a BD Pathway 855 high content imaging microscope.
Cell Viability Assays
[0122] Cell viability was measured by fluorescence using
CellTox.TM. Green Cytotoxicity Assay (Promega, cat. no. G8741)
according to the manufacturer's instructions.
Histopathological Analysis
[0123] Brain, liver, lung, kidney and heart tissues from
3-month-old mice were fixed in 10% neutral buffered formalin (NBF:
10 mL of Formalin (37% stock), 90 mL of deionized water, 4 g/liter
of NaH2PO4, 6.5 g/liter Na2HPO4), embedded in paraffin, sectioned
at 5 .mu.m, stained with hematoxylin and eosin, and images examined
by a board-certified toxicological pathologist.
Blood Chemistry and Hematological Analysis
[0124] Blood was collected from 3-month-old mice into
microcontainers or hematology assay tubes using jugular vein
bleeding puncture. A serum metabolic panel was obtained using the
Heska Dry Chem analyzer (Cuattro Veterinary USA). The metabolic
panel contained chem and electrolyte, liver and kidney functions.
For hematology analysis, we tested whole blood using Procyte
(IDEXX).
RT-PCR and qRT-PCR
[0125] For reverse-transcription PCR (RT-PCR) and quantitative real
time RT-PCR (qRT-PCR), first total RNA was extracted from the
fibroblasts and/or collected tissues (liver and brain) using
Direct-zol RNA Miniprep kit (Zymo Research cat. no. R2070). 2 .mu.g
of total RNA was directly used for single strand cDNA synthesis
with Superscript III reverse transcriptase (Invitrogen cat. no.
18080-093) according to the manufacturer's protocols. The
conditions for RT-PCR were 95.degree. C./5 min, 35-40 cycles of
95.degree. C./30 sec, 56-60.degree. C./60 sec, 72.degree. C./60
sec. Quantification of target gene expression was performed in a
LightCycler480 instrument (Roche) using SsoAdvanced Universal SYBR
green Supermix (Biorad cat. no. 172-5271) according to the
manufacturer's instructions. See Table 4 for primer sequences and
conditions used for experiments for RT-PCR, qRT-PCR, bisulfate
genomic sequencing, ChIP-qPCR, and chromatin accessibility
assay.
Bisulfite Genomic Sequencing
[0126] Genomic DNA was isolated from human PWS fibroblasts or mouse
tissues. DNA (1 .mu.g) was then treated by bisulfite using the
Epi-Tect bisulfite kit (Qiagen), and 125 ng input DNA was used per
PCR amplification. PCR products were sub-cloned into pGEM-T easy
vector (Promega) and an average of 15 clones were sequenced. DNA
sequencing results were analyzed using BISMA web-based analysis
platform with a setting for individual clones with <95%
bisulfite conversion and <90% sequence identity to be excluded
in the analysis.
Chromatin Immunoprecipitation Assays
[0127] Histone methylations on the SNRPN locus in human fibroblasts
were analyzed by chromatin immunoprecipitation assay (ChIP) using
the protocol as previously reported (see Fulmer-Smentek et al.,
Human molecular genetics 10, 645-652 (2001)). ChIP assay was
performed using ChIP-IT Express magnetic kit (Active Motif)
according to the manufacturer's instructions with modification for
the fixation and reverse-crosslinking steps. Briefly, native
chromatin was prepared without fixation and enzymatic digestions to
average 150-500 bp sized chromatin. 20 .mu.g of chromatin was added
to the specific antibodies (2 .mu.g) or species control isotype
antibodies for each immunoprecipitation reaction. The
antibody-chromatin complexes were bound to protein G magnetic beads
for recovering chromatin immunoprecipitates. RNase- and proteinase
K-treated DNA was purified using PCR purification columns
(Promega). DNA recovery was quantified by real time PCR performed
on the LightCycler480 instrument (Roche) using SsoAdvanced
Universal SYBR green Supermix (Biorad). Antibodies were anti-rabbit
acetylated H3 (Millipore 06-599), anti-mouse monoclonal Histone H3
dimethyl K9 (Abcam 1220) and Histone H3 trimethyl K9 (Millipore,
07-442) antibodies. qPCR reactions were performed with the
following cycling parameters: at 95.degree. C./5 min followed by 40
cycles of 95.degree. C./30 sec, 60.degree. C./60 sec. Data was
normalized to the total input.
Chromatin Accessibility Assays
[0128] Chromatin accessibility assay was performed to investigate
whether G9a inhibitors change open/close state of the imprinted
cluster in the PWS-IC region according to Pai, C. C., et al. Nature
communications 5, 4091 (2014) with slight modifications. Briefly, 3
days after drug treatment in human PWS fibroblasts, the cells were
harvested and lysed with lysis buffer (0.5% NP-40, 15 mM Tris-HCl
[pH 7.4], 0.15 mM Spermidine, 0.5 mM Spermine, 15 mM NaCl, 60 mM
KCl, 1 mM DTT, 0.1 mM PMSF, 0.5M Sucrose, Protease and Phosphatase
inhibitor cocktail (Roche)). The lysed cells were collected by
centrifugation (3000 RPM/10 min/4.degree. C.) and rinsed with
digestive buffer (15 mM Tris-HCl [pH 7.4], 15 mM NaCl, 60 mM KCl, 4
mM MgCl2, 1 mM DTT, 0.1 mM PMSF, 0.35 M Sucrose). After rinsing the
cell pellets, MNase (NEB) was added to digest open status of
chromatins, followed by genomic qPCR to determine changes in amount
of SNRPN and other imprinted genes.
Gross Neurological Screening
[0129] General health of mice was evaluated using a modified
version of standard test battery for behavioral phenotyping (see
57). Observational assessment included the evaluation of body
weight, body core temperature, overt behavioral signs (coat
appearance, body posture and secretary signs) and sensory functions
(visual ability, audition, tactile percep-tion and vestibular
function). Table 6 indicates the mouse sex and age information.
Statistical Analysis
[0130] Graphpad Prism (Graphpad Software) was used for the
statistical analysis. Student t-tests were used to examine the
statistical significance between groups (vehicle controls vs. drug
treated experiments). p<0.05 was considered statistically
significant. For the comparison of survival rate after drug
treatment, Kaplan-Meier Log rank test was used. All data were
expressed as mean.+-.s.e.m. The number of mice (or cell cultures)
in each experimental group was indicated in text. No data points
were excluded.
EXAMPLES ILLUSTRATIVE OF SPECIFIC EMBODIMENTS
[0131] The Examples which follow are illustrative of specific
embodiments of the invention, and various uses thereof. They set
forth for explanatory purposes only, and are not to be taken as
limiting the invention.
Example 1
Identification of Small Molecules that Activate the Expression of
SNORD116 from the Maternal Chromosome
[0132] It is not feasible to design a screen for noncoding RNA.
Alternatively, SNRPN/Snprn is paternally expressed but maternally
silenced in all human and mouse tissues. The allele-specific
expression of human SNRPN is regulated by the PWS-IC, which also
controls the expression of host transcripts for SnoRNAs, including
the SNORD116 cluster between SNRPN and UBE3A. see Le Meur, E. et
al., Dev. Biol. 286, 587-600 (2005). Thus, the Snrpn-EGFP fusion
protein (hereafter S-EGFP) was used as a marker for high content
screening (HCS). It was determined that small molecules that can
unsilence S-EGFP would also be effective in reactivating the host
transcript of SNORD116. Thus, mouse embryonic fibroblasts (MEFs)
were established from mice carrying S-EGFP inherited either
maternally (m.sup.S-EGFP/p.sup.+) or paternally
(m.sub.+/p.sup.S-EGFP) as previously described by Wu, M. Y., et al.
Genes & development 20, 2859-2870 (2006). S-EGFP was confirmed
to be expressed in m.sup.+/p.sup.S-EGFP and silenced in
m.sup.S-EGFP/p.sup.+ MEFs (FIG. 2a). The MEFs of
m.sup.S-EGFP/p.sup.+ were then subjected to a HCS using the
protocol previously described Huang, H. S., et al., Nature 481,
185-189 (2012) (FIG. 1a). Screening was performed in quadruplicate
using 13 small-molecule libraries (10 .mu.M in 0.2% DMSO; Table 1),
chosen to ensure chemical diversity and pharmacological and
bilogical activity. Using an initial arbitrary cut-off of 125%
(100% indicates basal fluorescence in the vehicle-treated MEFs),
out of 9,157 compounds (FIG. 2b), 32 potentially active compounds
were identified from the primary screen (FIG. 2c and Table 2). As
seen in FIG. 1, two of these compounds, UNC0638 and UNC0642, were
validated and shown to be active in concentration responses (FIG.
1d) and quantitative reverse transcription PCR (RT-qPCR)(FIG. 1e).
FIG. 1a represents screening strategy using a cell-based model.
FIG. 1b represents high content imaging of Snrpn-EGFP following
immunofluorescence staining by GFP antibody. Representative images
of maternal Snrpn-EGFP MEFs are shown. FIG. 1c shows chemical
structures of the identified hits. FIG. 1d shows concentration
response curves of UNC0638, UNC0642, and UNC617 in maternal
Snrpn-EGFP MEFs. FIG. 1e represents validation of Snrpn-EGFP mRNA
expressions in G9a inhibitor- or 5-Aza-dC-treated MEFs using
qRT-PCR (Livak methods, normalization to .beta.-actin, p<0.05;
t-test, n=3, three independent experiments).
[0133] Both UN0638 and UNC0642 have been characterized as
G9a-selective inhibitors which bind to and block the G9a catalytic
domain. Through an extended screening of 23 additional analogues of
UNC0638 and UNC0642, two additional compounds that also activated
the expression of S-EGFP in m.sup.S-EGFP/p.sup.+ MEFs were
identified: UNC617 and UNC618 (FIG. 1c). UNC0638, UNC0642, and
UNC617 displayed similar potency as shown by the concentration
response curves (FIG. 1d, half-maximal effective concentration
(EC.sub.50)=1.6 .mu.M for UNC0638; 2.7 .mu.M for UNC0642; and 2.1
.mu.M for UNC617). The estimated maximal effectiveness (E.sub.max)
was similar for these three compounds whereas UNC618 was only
effective at 30 .mu.M. Next, qRT-PCR was performed to measure the
changes in mRNA of S-EGFP. These compounds upregulated the mRNA of
S-EGPF to an extent comparable to or greater than 5-aza
deoxycytidine (5-Aza-dC), an inhibitor of DNA methyltransferases
(DNMTs) (FIG. 1e). Because other allele-specific histone
modifications, such as acetylation, occur in the PWS-IC, it was
determined whether the modulation of other classes of histone
modifying enzymes could activate S-EGFP. However, it was found that
histone deacetylase (HDAC) inhibitors such as trichostatin A (TSA),
vorinostat (suberoylanilide hydroxamic acid: SAHA), entinostat
(MS-275), and valproic acid as well as S-adenosyl-methionine and
sinefungin, the cofactor and a broad inhibitor of histone
methyltransferases, did not have an effect on activation of S-EGFP
(Table 3). Interestingly, BIX01294, the first reported G9a
inhibitor, which is less potent than UNC0638 and UNC0642, did not
have a substantial effect on activation of S-EGFP (Table 3). These
data illustrate that the activating effects of the compounds
identified herein are relatively specific and probably result from
targeting specific histone methyltransferases.
Example 2
Synthesis of Compound which Activates the Expression of S-EGFP in
m.sup.S-EGFP/p.sup.+ MEFs
[0134]
N-(1-isopropylpiperidin-4-yl)-6-mehtoxy-2-(4-methyl-1,4-diazepan-1--
yl)-7-(3-(piperidin-1-yl)propoxy) quinazolin-4-amine, named UNC617,
was synthesized as follows and as represented in FIG. 3. A mixture
of compound 1 (70 mg, 0.15 mmol), 1-methyl homopiperazine (34 mg,
0.30 mmol), and TFA (46 .mu.L, 0.60 mmol) in i-PrOH (0.2 mL) in a
sealed tube was heated by microwave irradiation to 160.degree. C.
for 15 min. After concentration in vacuo, the crude product was
purified by preparative HPLC with a gradient from 10% of MeOH in
0.1% TFA in H.sub.2O to 100% MeOH. The resulting product was
basified with saturated aq. NaHCO.sub.3 and extracted with CH2Cl2
to afford the title compound as a yellow solid (60 mg, 0.11 mmol,
72% yield). 1H NMR (400 MHz, CDCl.sub.3) .delta. 6.87 (s, 1H), 6.72
(s, 1H), 5.00 (d, J=8.0 Hz, 1H), 4.11 (t, J=6.0 Hz, 2H), 4.05-4.01
(m, 1H), 3.96-3.94 (m, 2H), 3.87-3.83 (m, 5H), 2.89 (app. d, J=12.0
Hz, 2H), 2.77-2.70 (m, 1H), 2.69-2.66 (m, 2H), 2.56-2.53 (m, 2H),
2.43 (t, J=8.0 Hz, 2H), 2.38-2.26 (m, 9H) 2.15 (app. d, J=12.0 Hz
2H), 2.06-1.95 (m, 4H), 1.60-1.50 (m, 6H), 1.42-1.39 (m, 2H), 1.05
(d, J=4.0 Hz, 6H). 13C HNMR (100 MHz, CDCl3, 5 overlapping peaks)
.delta. 158.5, 157.9, 153.9, 149.6, 145.1, 106.9, 102.6, 101.5,
67.3, 58.9, 57.3, 56.6, 55.7, 54.5 (2C), 54.4 (2C), 48.6, 47.7,
46.7, 45.8, 45.8, 32.5, 27.8, 26.4 (2C), 25.9 (2C), 24.4, 18.4
(2C). HPLC: 98%; tR 0.56 min. HRMS (TOF) calculated for C31H52N7O2
[M+H]+, 554.4177; found 554.4192.
[0135] Synthesis of UNC0638, UNC0642, and their analogs can be seen
in previous publications, Vedadi, M., et al., Nat. Chem. Biol. 7,
566-574 (2011); Liu, F. et al., J. Med. Chem. 56, 8931-8942 (2013);
Liu, F. et al., 1 Med. Chem. 54, 6139-6150 (2011); Liu, F. et al.,
J. Med. Chem. 52, 7950-7953 (2009); and Liu, F. et al., J Med Chem
53, 5844-5857 (2010), all of which are incorporated herein by
reference in their entirety.
Example 3
Examining Effects of Unsilencing Molecules in a PWS Patient Driven
Cell Model
[0136] A skin fibroblast cell line containing a typical large (5-6
Mb) deletion of the paternal copy of the 15q11-q13 region was used
to determine if UNC0638 and UNC0642 could depress the maternal
genes in a patient-driven cell model of PWS. FIG. 4a represents a
schematic of genomic organization at the human chromosome 15q11-q13
region imprinting center. Because imprinting of SNPRN is known to
be ubiquitous, the G9a-inhibitor effect on its activation is
expected to be representative of all tissues and cell types.
[0137] For cell-based studies as represented in FIG. 4b, UNC0638
was chosen due to its high potency and selectivity, low toxicity,
and thoroughly characterized cellular activity. UNC0638 treatment
(1-4 .mu.M) effectively activated SNRPN and SNORD116 transcripts,
as assessed by RT-PCR (FIG. 4c) with a minimal cytotoxicity (FIG.
5). PWS fibroblasts treated with 4 .mu.M UNC0638 expressed
approximately 30% of normal SNRPN protein levels as shown by
Western blot in FIG. 4d. Additional genes regulated by the PWS-IC,
including SNRPN, host transcripts of SNORD116 (HG116) and SNORD115
(HG115), and NDN were further examined. FIG. 4e shows RT-PCR
analysis of genes and transcripts from 15q11-q13 in human PWS
fibroblasts treated with UNC617, UNC618, UNC0638, UNC0642, or
5-Aza-dC (ctrl, control; HG116, host transcript for SNORD116;
HG115, host transcript of SNORD115; RTase: +/-, with/without
reverse transcriptase). The effectiveness of four identified
compounds and 5-Aza-dC as a control were compared. All showed
activating effects on the SNRPN mRNA expression. However, only
UNC0638 and UNC0642 were effective for SNORD116, and its putative
host transcript (116HG). While a single PCR product for 116HG was
detected in the control, multiple bands were seen in the drug
treated cells. These products were verified by sequencing analysis
and were mapped to the region of the host transcripts for SNORD116.
The additional host transcripts in the drug-treated cells may
suggest the activation of cryptic splicing or the promoter by drug
treatment for the host transcripts. Drug treatments also
reactivated the expression ofNDN that is 1 Mb proximal to PWS-IC.
MAGEL2 activation was unable to be determined because MAGEL2 is not
normally expressed in skin fibroblasts. Taken together, these
expression analyses strongly indicate that UNC0638 and UNC0642 are
capable of unsilencing the maternal copy of paternal expressed
genes from the PWS region in cells derived from both mice and
humans.
Example 4
Examining the Effects of Unsilencing Compounds In Vivo
[0138] Using a mouse PWS model which carries a paternal deletion
from Snrpn to Ube3a (m.sup.+/p.sup..DELTA.S-U), the effects of
UNC0642 in vivo were examined. UNC0642 was chosen due to the
qualities of it not only having a high potency and selectivity for
G9a in biochemical and cellular assays, but also pharmacokinetic
(PK) properties including CNS penetration superior to UNC0638. A
single dose of 5 mg/kg intraperitoneal (i.p.) injection of UNC0642
is sufficient to inhibit G9a activity in adult mice. The
m.sup.+/p.sup..DELTA.S-U pups were treated between postnatal day 7
(P7) and P12, as most m.sup.+/p.sup..DELTA.S-U pups died before
weaning. For neonatal PWS mice, a lower dose regimen of 2.5 mg/kg
i.p.
[0139] injections for 5 consecutive days was used. FIG. 6a shows a
schematic of in vivo treatment of m.sup.+/p.sup..DELTA.S-U mice.
Pups at postnatal day 7 (P7) were treated with a daily dose of 2.5
mg/kg for 5 days. As shown in FIG. 6b, the UNC0642 treatment was
well tolerated in both wild type and the m.sup.+/p.sup..DELTA.S-U
pups and significantly attenuated lethality of PWS mice as compared
to the untreated control group (Kaplan-Meier Log rank test,
p=0.0086). The difference in the survival rates of PWS pups was
most notable during the first week after drug administration and
diminished over time. Six UNC0642-treated m+/p S-U pups survived to
>P90 (15%; n=40), and they had normal physical appearance and
activity in their home cages. Body-weight measurements revealed
that there was a significant improvement of growth between P10 and
P19 in treated m+/p S-U pups (FIG. 6a). These results indicate the
partial rescue of lethality and growth-delay phenotypes of the PWS
mouse model, and hence the potential of such treatment for
humans.
[0140] To assess the potential toxicity associated with UNC0642
treatment, we monitored body weight in WT groups. Notably, loss of
body weight, a sign of general health deficiency, was not observed
in WT mice treated with UNC0642 (FIG. 6b). We also performed a
general health and neurological screening in a blinded fashion, and
it did not reveal any substantial abnormalities (Table 6). In
additional toxicity tests, we did not include vehicle-treated PWS
mice because of the small sample size. Despite our breeding effort
that produced a total number of 60 m+/p S-U pups, only two
vehicle-treated m+/p S-U mice survived to P90. In hematological
analysis, the measurements of treated m+/p S-U and WT mice were
within normal ranges, as measured by liver and kidney functions as
well as normal lipid and protein metabolism, which are indicative
of normal health conditions (Table 7). Histopathological analyses
also did not reveal any abnormalities associated with UNC0642
treatment in the brain, liver, kidney, lung and heart from mice at
P90, both in m+/p S-U and WT mice (FIG. 7).
[0141] RNA and protein expression was assessed in
m.sup.+/p.sup..DELTA.S-U mice at around P14 following the treatment
(FIG. 8a, c-e). Whereas the expression of Snrpn and Snord116 was
readily detectable in the brain and liver of UNC0642 treated
m.sup.+/p.sup..DELTA.S-U mice, PBS treated m.sup.+/p.sup..DELTA.S-U
mice had no detectable transcripts as shown by conventional and
quantitative RT-PCR as represented in FIGS. 8c and 8d,
respectfully. The effect of this activation on the maternal
expression of Ube3a was determined because the Ube3a antisense
transcript (Ube3 a-AS) is essential in silencing the paternal copy
of Ube3a in the brain and is only expressed paternally.
Importantly, FIG. 8d shows that the level of Ubea3-AS RNA was not
affected in the brain. Similarly, FIG. 8e shows the Ube3a protein
level was not changed in the whole brain or specifically in the
cerebellum where the maternal-specific Ube3A transcript is
predominantly expressed (FIG. 9). The unsilencing effect of UNC0642
was confirmed in an adult Snrpn-EGFP mouse model (FIG. 5).
Treatment with UNC0642 exerted a long lasting effect as shown by
the maternal expression of Snrpn-EGFP at 1, 4, and 12 weeks after
the last dose of UNC0642 by conventional RT-PCR (FIG. 8g) and
qRT-PCR (FIG. 8h). However, it is worth noting that the level of
expression at 12 weeks was significantly lower than that at 4 weeks
(p=0.03). These results demonstrate the in vivo efficacy of the
UNC0642 in a PWS mouse model and provide sufficient
proof-of-principle to evaluate therapeutic intervention targeted at
the molecular etiology of PWS.
Example 5
Determining Mechanistic Association of Pharmacological Inhibition
of G9a by Unsilencing Compounds
[0142] The underlying mechanism for the unsilencing of the maternal
chromosome 15q11-q13 by UNC0638 and UNC0642 was investigated to
examine whether the activation of PWS genes is directly associated
with pharmacological inhibition of G9a by these compounds. The
allele-specific methylation of the PWS-IC is thought to implicate
the imprinted regulation of candidate PWS-associated genes. G9a is
also known to have capacity to modulate DNA methylation. Although
it has been shown that UNC0638 does not significantly alter the
global DNA methylation, concentration-dependent hypomethylation of
long terminal repeats (LTR) for individual genomic loci was
observed in cells treated with UNC0638. It was first examined
whether the DNA methylation of the PWS-IC was affected in liver
tissues from m.sup.+/p.sup..DELTA.S-U mice and human PWS cells
treated with UNC0642 and UNC0638, respectively. As a positive
control, it was confirmed that 5-Aza-dC significantly decreased DNA
methylation of the PWS-IC. In contrast, UNC0638 and UNC0642 did not
significantly alter DNA methylation of the PWS-IC either in human
PWS cells or in livers from PWS mouse models. As FIG. 10a shows,
the square plot illustrates the methylation pattern for individual
CpG sites (filled square for the methylated and open square for the
unmethylated CG site). The graph is the average methylation
measured by the number of methylated CG sites divided by the total
number of CG sites analyzed. (*p<0.05; t-test, n=7-13 per
group).
[0143] Next, chromatin immunoprecipitation (ChIP) assays were
performed to examine whether the G9a-mediated methylation of H3K9
is affected. Both H3K9me2 (dimethylation of H3K9) and H3K9me3
(trimethylation of H3K9) are associated with gene silencing and
facilitate the heterochromatin formation. FIG. 11 shows assay
verification by confirming that H3K9me2 and H3ac (acetylation of
H3) were enriched at the maternal or paternal PWS-IC, respectively.
Using the MAGE-A2 promoter (MAGE) and a centromere sequence (CEN)
as controls, UNC0638 drastically reduced the level of H3K9me2 and
H3K9me3 in the PWS-IC and SNORD116 regions (FIGS. 10b and c).
Importantly, H3K9me2 enriched at the PWS-IC was significantly
reduced in the UNC0638-treated cells compared to the untreated
(empty black arrowhead and black arrow in FIG. 10b; empty black
block arrow in FIG. 10c; reduction of 17-fold to 3-fold,
p<0.05). The treatment of 5-Aza-dC also reduced H3K9me2 in the
PWS-IC of the maternal chromosome in cultured cells (FIG. 11). As
seen in FIG. 12b, UNC0638 also reduced H3K9me2 in the region
associated with NDN. At the region of the host transcript of
SNORD116, both H3K9me2 and H3K9me3 were enriched (FIG. 10b open
arrowheads in the upper panel of SNO116) and UNC0638 treatment
reduced both H3K9me2 and H3K9me3 as compared to untreated controls
(FIG. 10c H3K9me2: reduction of 122-fold to 4-fold, p<0.05; and
H3K9me3: reduction of 24-fold to 2-fold, p<0.05).
[0144] H3K9me2 facilitates heterochromatin formation to regulate
transcription; therefore, it was determined whether the reduction
of H3K9 methylation could result in more open chromatin across the
imprinted domain. Quantitative PCR (qPCR) of genomic DNA following
in situ nuclease digestion was performed to measure chromatin
accessibility (FIG. 10d and FIG. 13a) using the protocol as
previously described in Pai et al Nature communications 5, 4091
(2014). The following controls were used in this study: the
constitutively expressed GAPDH (GAP) which was highly susceptible
to nuclease digestion, and constitutively silent RHODOPSIN (RHO)
which displayed minimal chromatin accessibility, regardless of the
UNC0638 treatment (FIG. 13b). As a result of the treatment with
UNC0638, the target regions across the imprinted domains, including
the SNRPN and SNORD116, were more open and accessible than
vehicle-treated controls (FIG. 10d). The effect of UNC0638 and
UNC0642 seemed to be bidirectional in reference to the PWS-IC in
the PWS domain. These results suggest that the reduction of H3K9
methylation, but not DNA demethylation of PWS-IC, by the UNC0638
and UNC0642 treatment leads to more open chromatin, which, in turn,
activates candidate PWS-associated genes from the maternal
chromosome. FIG. 10e represents a schematic of the histone
mechanism for maternal unsilencing of the PWS region where the
modulation of H3K9me2 deposited on the maternally inherited PWS
region is the basis to develop potential treatments for PWS. The
pharmacological inhibition of G9a leads to the loss of H3K9me2 and
hence changes chromatin to permissive states for the activation of
the PWS genes.
[0145] The G9a inhibitors UNC0642 and UNC0638 identified from a HCS
activate the candidate PWS-associated genes from the maternal
chromosome both in human PWS patient-derived cells and in a PWS
mouse model. Treatment with UNC0642 afforded a clear therapeutic
benefit for PWS-related phenotypes, including perinatal lethality
and poor growth, which resemble the common clinical features of
failure to thrive in individuals with PWS during the first year of
life. Further studies will determine whether G9a inhibitors might
offer therapeutic benefit to other major clinical problems of PWS,
such as obesity, hyperphagia and behavioral impairment, that occur
in childhood or later, when appropriate animal models of PWS become
available.
[0146] UNC0642 treatment does not affect the expression of Ube3a, a
maternally expressed gene whose loss causes Angelman syndrome (AS).
The activation of PWS-associated genes on the maternal chromosome
raises a concern because it may activate Ube3a antisense RNA
(Ube3a-ATS), which normally represses paternal Ube3a expression but
is not expressed from the maternal chromosome. It is unclear how
the derepression of the PWS-associated genes Snrpn and Snord116
occurs without affecting the expression of Ube3a-ATS. The
generation and the processing of host transcripts from the interval
between PWS-IC and Ube3a are not well understood. In contrast to
the current notion of a long transcript IC--SNURF-SNRPN, we
speculate that the expressions of Snord116 host transcript and
Ube3a-ATS are regulated differently. A recent study in human
tissues from healthy individuals found potential transcription
start sites (TSSs) within the interval between PWS-IC and UBE3A
(see Galiveti, C. R., et al., Sci. Rep. 4, 6445 (2014)): one
between SNORD116 and SNORD115 clusters and another between SNORD115
and the 3 end of UBE3A. The large host transcript from the PWS-IC,
which overlaps with the SNRPN promoter, might stop before these
additional TSSs, and UBE3A-ATS might be initiated from one of
potential TSSs, probably the one close to the 3' end of UBE3A. It
seems that the disclosed G9a-inhibitor treatment derepresses the
PWS-IC overlapping with Snrpn promoter, but not the TSS of
Ube3a-ATS on the maternal chromosome. The continuous distribution
of H3K9me2 along the PWS domain does not extend to the distal
region, which then makes the TSS of Ube3a-ATS not targetable by the
G9a inhibitor. Another possibility is that the effect of the G9a
inhibitor might become weaker at the farther end distal to the
PWS-IC.
[0147] It is not well understood how the functions of histone
methylation and DNA methylation are linked for the repression of
the PWS-associated imprinting domain in vivo. A previous genetic
study showed that the PWS-IC was demethylated in G9a-deficient
embryonic stem (ES) cells, whereas it was not affected in
G9a-deficient mouse embryos (Xin, Z. et al., J. Biol. Chem. 278,
14996-15000 (2003)). Unfortunately, the expressions of
PWS-associated genes have not been examined specifically in
G9a-deficient embryos (which died at E9.5), presumably owing to
technical difficulties associated with determining their
allele-specific expression in embryonic tissue. The present
disclosure demonstrates that the repressed SNRPN and SNORD116 are
activated by the pharmacological inhibition of G9a, and that the
reactivation occurred without any alteration of DNA methylation
(5-methylcytosine, 5mC) of the PWS-IC both in vitro and in vivo. It
should be noted that the possibility of modifications other than
5mC in PWS-IC being affected by the G9a inhibitor cannot be ruled
out because the bisulfate method used for our DNA-methylation
analysis cannot distinguish between 5mC and 5-hydroxymethylcytosine
(5hmC), or between cytocine (C) and 5-carboxycytosine (5CaC).
Nevertheless, the finding provides novel insight into the
regulation of imprinting, whereby H3K9 methylation has a decisive
role in the repression of PWS-associated genes on the maternal
chromosome.
[0148] Previous genome-wide chromatin profiling has revealed an
organized chromatin H3K9me2 modification in the PWS imprinted
domain. H3K9me2 is associated with the silent maternal chromosome
and G9a inhibitors selectively reduced di- and tri-methylation of
H3K9. Such reductions are likely to alter the chromatin state to
become permissive for unsilencing PWS genes. These findings
uncovered by the pharmacological approach are supported by a
previous genetic study that Snrpn is unsilenced in G9a-deficienct
embryonic stem (ES) cells. Distinct from G9a inhibitors, which did
not change DNA methylation, the CpG sites of the PWS-IC in the
maternal chromosome are demethylated in G9a null embryonic cells.
G9a deficiency causes early embryonic lethality at E8.5 day in
mice. Interestingly, the DNA methylation of CpG sites in the PWS-IC
of G9a null embryos is comparable with that in wild-type and the
expression of Snprn has not been examined, presumably due to
technical difficulty to determine the allele-specific expression of
Snrpn in mouse embryos. In significant contrast with previous
reports that methylation of the PWS-IC is important for silencing
the expression of PWS genes in the maternal chromosome (see
Fulmer-Smentek et al., Human Molecular Genetics 10, 645-652 (2001);
Saitoh et al., American Journal of Human Genetics 66, 1958-1962
(2000)), the findings presented in this disclosure show that H3K9
methylation plays a decisive role in silencing the PWS genes. In
support of this conclusion, treatment with 5-Aza-dC reduced H3K9
methylation in addition to DNA methylation in the PWS-IC. These
findings support an imprinting mechanism in which the imprinted
expression of PWS genes is regulated by H3K9 methylation mediated
chromatin accessibility (FIG. 11e).
[0149] In the present disclosure, the G9a inhibitor UNC0642 is
shown to improve the survival of m.sup.+/p.sup..DELTA.S-U pups,
produce long-lasting unsilencing of PWS genes, be well tolerated,
and not interfere with the expression of the Angelman syndrome
Ube3a gene. Such results achieve a critical step toward the
development of a molecularly specific therapy for human PWS. Based
on these results, comprehensive evaluation of the efficacy and
tolerability of G9a inhibitors in preclinical studies is warranted
to fully explore therapeutic potential of G9a inhibitors for
treating PWS.
[0150] Any patents or publications mentioned in this specification
are indicative of the levels of those skilled in the art to which
the invention pertains.
[0151] One of skill in the art will readily appreciate that the
present invention is well adapted to carry out the objects and
obtain the ends and advantages mentioned, as well as those inherent
therein. The present examples along with the methods, procedures,
treatments, molecules, and specific compounds described herein are
presently representative of preferred embodiments, are exemplary,
and are not intended as limitations on the scope of the invention.
Changes therein and other uses will occur to those skilled in the
art which are encompassed within the spirit of the invention as
defined by the scope of the claims.
TABLE-US-00001 TABLE 1 Library No. Description Potential actives
NCC1 446 NIH Clinical Collection 1 - most anti-cancer drugs NCC2
320* NIH Clinical Collection 2 - most anti-cancer drugs X-901 271
NIMH CNS drugs SMART 320 CNS penetrating drugs/IRSF Roth 456 CNS
and GPCR targeting/Roth Lab Library, UNC Tocris Mini 1120
Biologically active compounds/Commercial/Tocris PKIS** 367
GlaxoSmithKline kinase inhibitors Prestwick 1120 FDA, EMA approved
drug/Commercial/Prestwick Chemicals LOPAC 1280 Pharmacologically
active compounds/Commercial/Sigma Spectrum 2400 Biologically active
compounds/Commercial/MicroSource Epigenetic collection A 959 UNC
synthetic epigenetic compounds/random collection Epigenetic
collection B 73 UNC synthetic epigenetic compounds/random
collection UNC.Epigenetic collection C 25 UNC synthetic epigenetic
compounds/random collection UNC0638 UNC0642 Subtotal 9157 Selected
compounds 295 Selectively chosen compounds that were tested to
validate or repeat Total 9452
TABLE-US-00002 TABLE 2 True / Name of compounds AFU SEM False Note
UNC0638 1.331 0.047 T G9a inhibition UNC0642 1.331 0.032 T G9a
inhibition (d,l)-Tetrahydroberberine 1.357 0.04 F DA
antagonist/intrinsic fluorescence 6-Hydroxydopamine hydrochloride
1.247 0.051 F Selective catecholaminergic neurotoxin
7-Methoxychlorpromazine hydrochloride 1.331 0.119 F Potential
anticoagulant 7-Nitroindazole 1.282 0.02 F Neuronal nitric oxide
synthase inhibition Amphotericin B 1.349 0.045 F Antifungal drug
Bestatin 1.254 0.045 F Protease inhibitor Bezafibrate 1.298 0.028 F
Fibrate drug Cefaclor 1.253 0.064 F Cephalosporin antibiotic
Chlordiazepoxide 1.258 0.062 F Sedative/hypnotic drug Clozapine
1.299 0.072 F Atypical antipsychotic drug Flufenamic acid 1.25
0.026 F Anthranilic acid derivatives Fluphenazine HCl 1.254 0.032 F
Typical antipsychotic drug Furosemide 1.357 0.047 F Treatment of
hypertension and edema Gabazine 1.321 0.02 F GABAa antagonist
Iodipamide 1.318 0.044 F Contrast medium. Iohexol 1.257 0.026 F
Contrast medium. Mebendazole 1.286 0.043 F Treating infections by
worms Meclozine dihydrochloride 1.28 0.023 F Antihistamine
Myricetin 1.287 0.084 F Flavonoid class of polyphenolic compounds/
intrinsic fluorescence Palonosetron HCl 1.292 0.054 F 5-HT3
antagonist Phenylbenzene-omega-phosphono-alpha- 1.251 0.021 F
Glycine antagonist amino acid Puromycin dihydrochloride 1.29 0.013
F Aminonuclease antibiotic Ricinine 1.316 0.039 F An alkaloid
extracted from the seeds Salbutamol 1.257 0.038 F
.beta.2-adrenergic receptor agonist Salsolinol hydrobromide 1.291
0.01 F Metabolite of acetaldehyde and dopamine. Selegiline
hydrochloride 1.333 0.034 F Substituted phenethylamine Synephrine
1.286 0.021 F An alkaloid, occurring naturally in some plants and
animals Terbutaline hemisulfate 1.307 0.083 F .beta.2-adrenergic
receptor agonist Tetracaine hydrochloride 1.346 0.048 F Potent
local anesthetic of the ester group Tiaprofenic acid 1.287 0.097 F
Non-steroidal anti-inflammatory drug (NSAID)
TABLE-US-00003 TABLE 3 Effectiveness in Name Target/MOA this study
5-Aza deoxcytidine DNA methyltransferase/Inhibition .largecircle.
BIX01294 G9a/Inhibition X S-Adenosyl methionine G9a/Cofactor X
Sinefungin G9a/Pan inhibitor X 4-Phenylbutyrate (PBA)
HDAC/Inhibition X Entinostat (MS-275) HDAC/Inhibition X NSC 3852
HDAC/Inhibition X Vorinostat (SAHA) HDAC/Inhibition X Scriptaid
HDAC/Inhibition X Splitomicin HDAC/Inhibition X Trichostatin A
(TSA) HDAC/Inhibition X Valproic acid (VPA) HDAC/Inhibition X
TABLE-US-00004 TABLE 4 SEQ SEQ gene/region forward ID reverse ID
annealing RT-PCR and qRT-PCR Primers SNRPN gctgcagcacattgactatagaat
1 cacagtcatggataccaagttctc 2 60.degree. C. SNORD116.sup.1
tggatcgatgatgagtcc 3 tggacctcagttccgatgaga 4 60.degree. C.
116HG.sup.1 ctggtggatcccacaggt 5 agaagcccacgccacata 6 60.degree. C.
115HG.sup.1 cttcctcacaccctggtctc 7 gacttcaagaaatgcgtgctc 8
60.degree. C. NDN ggggtgggtcattatagtattcag 9
acaaaaatccaagaaaggtagcac 10 56.degree. C. MAGEL2
ctaagaagctcatcaccgaag 11 ggcagatacgaaaccaagttg 12 56.degree. C.
.RTM.-ACTIN agagctacgagctgcctgac 13 agcactgtgttggcgtacag 14
60.degree. C. mSnrpn ttggttctgaggagtgatttgc 15 ccttgaattccaccaccttg
16 58.degree. C. mSnord116 ggatctatgatgattcccag 17
ggacctcagttccgatga 18 58.degree. C. m116HG ggttgcattccctttccagtatg
19 cagcaattcccatgttccttacc 20 58.degree. C. mUbe3a-ATS.sup.2
acagaacaataggtcaccaggtt 21 aagcaagactgttcacctcat 22 60.degree. C.
GFP acatgaagcagcacgacttct 23 gacgttgtggctgttgtagttgta 24 60.degree.
C. Gapdh ggcaaattcaacggcacagt 25 gggtctcgctcctggaagat 26 60.degree.
C. Bisulfite Genomic Sequencing SNRPNbis
ggtggttttttttaagagatagtttggg 27 catccccctaatccactaccataac 28
55.degree. C. Snrpnbis-outer3 tatgtaatatgatatagtttagaaattag 29
aataaacccaaatctaaaatattttaatc 30 52.degree. C. Snrpnbis-inner3
aatttgtgtgatgtttgtaattatttgg 31 ataaaatacactttcactactaaaatcc 32
54.degree. C. Chromatin IP and Accessibility Assays MAGEA2.sup.4
gcctcaggatccccgtcccaat 33 tggaaccggattctgcccggat.sup.4 34
65.degree. C. CEN.sup.5 gtctctttcttgtttttaagctggg 35
tgagctcattgagacatttgg 36 60.degree. C. NDN taaccctgttttccaggtatgg
37 aagctgctgatgagaagaaacc 38 62.degree. C. PWS-IC.sup.5
ctagaggccccctctcattgcaac 39 cttcgcacacatccccgcctgagc 40 65.degree.
C. SNORD116.sup.6 tcttcaaatgtgcttggatcga 41 gcaacgtgctggacctcagt 42
65.degree. C. U-SNRPN.sup.7 caatggaccaagagcattgata 43
atagggtattgaaaccccgagt 44 60.degree. C. SNORD116dw.sup.7
tgagtcccacaaggaagttttt 45 acattcaaagaggcaggacatt 46 60.degree. C.
UBE3A.sup.7 ttgcttcctgagcaagtcataa 47 tccgaaagcatgacatatcaac 48
60.degree. C. GAPDH gcatcacccggaggagaaaatcgg 49
gtcacgtgtcgcagaggagc 50 65.degree. C. RHODOPSIN
caagtcatgcagaagttagggg 51 acccttataaagtgacctcccc 52 60.degree.
C.
TABLE-US-00005 TABLE 5 SEQ ID NO. Description Sequence 1 SNRPN
Primer Forward gctgcagcacattgactatagaat 2 SNRPN Primer Reverse
cacagtcatggataccaagttctc 3 SNORD116 Primer Forward
tggatcgatgatgagtcc 4 SNORD116 Primer Reverse tggacctcagttccgatgaga
5 116HG Primer Forward ctggtggatcccacaggt 6 116HG Primer Reverse
agaagcccacgccacata 7 115HG Primer Forward cttcctcacaccctggtctc 8
115HG Primer Reverse gacttcaagaaatgcgtgctc 9 NDN Primer Forward
ggggtgggtcattatagtattcag 10 NDN Primer Reverse
acaaaaatccaagaaaggtagcac 11 MAGEL2 Primer Forward
ctaagaagctcatcaccgaag 12 MAGEL2 Primer Reverse
ggcagatacgaaaccaagttg 13 .beta.-actin Primer Forward
agagctacgagctgcctgac 14 .beta.-actin Primer Reverse
agcactgtgttggcgtacag 15 mSnrpn Primer Forward
ttggttctgaggagtgatttgc 16 mSnrpn Primer Reverse
ccttgaattccaccaccttg 17 mSnord116 Primer Forward
ggatctatgatgattcccag 18 mSnord116 Primer Reverse ggacctcagttccgatga
19 m116HG Primer Forward ggttgcattccctttccagtatg 20 m116HG Primer
Reverse cagcaattcccatgttccttacc 21 mUbe3a-ATS Primer Forward
acagaacaataggtcaccaggtt 22 mUbe3a-ATS Primer Reverse
aagcaagactgttcacctcat 23 GFP Primer Forward acatgaagcagcacgacttct
24 GFP Primer Reverse gacgttgtggctgttgtagttgta 25 Gapdh Primer
Forward ggcaaattcaacggcacagt 26 Gapdh Primer Reverse
gggtctcgctcctggaagat 27 SNRPNbis Primer Forward
ggtggttttttttaagagatagtttggg 28 SNRPNbis Primer Reverse
catccccctaatccactaccataac 29 Snrpnbis-outer Primer Forward
tatgtaatatgatatagtttagaaattag 30 Snrpnbis-outer Primer Reverse
aataaacccaaatctaaaatattttaatc 31 Snrpnbis-inner Primer Forward
aatttgtgtgatgtttgtaattatttgg 32 Snrpnbis-inner Primer Reverse
ataaaatacactttcactactaaaatcc 33 MAGEA2-chromatin Primer Forward
gcctcaggatccccgtcccaat 34 MAGEA2-chromatin Primer Reverse
tggaaccggattctgcccggat 35 CEN Primer Forward
gtctctttcttgtttttaagctggg 36 CEN Primer Reverse
tgagctcattgagacatttgg 37 NDN-chromatin Primer Forward
taaccctgttttccaggtatgg 38 NDN-chromatin Primer Reverse
aagctgctgatgagaagaaacc 39 PWS-IC Primer Forward
ctagaggccccctctcattgcaac 40 PWS-IC Primer Reverse
cttcgcacacatccccgcctgagc 41 SNORD116-chromatin Primer Forward
tcttcaaatgtgcttggatcga 42 SNORD116-chromatin Primer Reverse
gcaacgtgctggacctcagt 43 U-SNRPN Primer Forward
caatggaccaagagcattgata 44 U-SNRPN Primer Reverse
atagggtattgaaaccccgagt 45 SNORD116dw Primer Forward
tgagtcccacaaggaagttttt 46 SNORD116dw Primer Reverse
acattcaaagaggcaggacatt 47 UBE3A-chromatin Primer Forward
ttgcttcctgagcaagtcataa 48 UBE3A-chromatin Primer Reverse
tccgaaagcatgacatatcaac 49 GAPDH-chromatin Primer Forward
gcatcacccggaggagaaaatcgg 50 GAPDH-chromatin Primer Reverse
gtcacgtgtcgcagaggagc 51 RHODOPSIN Primer Forward
caagtcatgcagaagttagggg 52 RHODOPSIN Primer Reverse
acccttataaagtgacctcccc
TABLE-US-00006 TABLE 6 mouse Geno- Age Weight Temp Hair ID Sex type
Drug Tx (week) (g) (.degree. C.) Loss Barbering Boli Urine 535-2 F
PWS vehicle 12 17.6 38.8 none none 0 0 536-30 M PWS vehicle 12 19.6
38.9 none none 1 1 439-10 F PWS UNC0642 12 17.4 38.6 none none 0 0
439-30 F PWS UNC0642 12 19.9 38.8 none none 1 0 935-3 F PWS UNC0642
12 17.4 38.9 none none 0 0 935-10 F PWS UNC0642 12 15.1 39.2 none
none 0 0 935-30 F PWS UNC0642 12 14.4 39.2 none none 1 0 574-10 F
PWS UNC0642 14 15.9 38.3 none none 2 0 580-10 F PWS UNC0642 14 23.1
38.5 none none 1 0 580-30 F PWS UNC0642 14 16.7 38.6 none none 3 0
739-10 M PWS UNC0642 15 23.0 38.4 none none 1 1 739-20 M PWS
UNC0642 15 23.0 37.7 none none 2 0 739-30 M PWS UNC0642 15 23.0
36.8 none none 2 1 431-10 F WT vehicle 12 20.2 37.6 none none 1 1
431-20 F WT vehicle 12 20.5 38.4 none none 0 1 431-30 F WT vehicle
12 21.4 37.1 none none 2 0 535-1 F WT vehicle 12 21.0 38.0 none
none 1 1 536-20 F WT vehicle 12 19.1 37.9 none none 1 0 431-1 F WT
vehicle 12 20.0 38.6 none none 0 0 431-2 F WT vehicle 12 20.1 38.4
none none 0 1 431-3 F WT vehicle 12 19.3 38.5 none none 1 0 933-10
M WT vehicle 14 30.9 37.8 none none 0 1 933-1 M WT vehicle 14 31.1
38.3 none none 0 0 933-3 M WT vehicle 14 31.4 37.6 none none 1 1
933-30 M WT vehicle 14 34.2 37.1 none none 2 0 436-1 M WT UNC0642
12 22.4 37.3 none none 1 0 436-2 M WT UNC0642 12 22.6 37.3 none
none 1 0 436-3 M WT UNC0642 12 22.5 38.0 none none 1 0 436-10 F WT
UNC0642 12 19.8 37.1 none none 1 0 436-30 F WT UNC0642 12 20.8 37.5
none none 0 1 439-3 F WT UNC0642 12 22.8 37.8 none none 1 1 935-1 F
WT UNC0642 12 22.4 37.6 none none 1 0 574-1 F WT UNC0642 14 23.6
37.1 none none 1 1 580-1 F WT UNC0642 14 26.4 38.1 none none 1 0
159-1 F WT UNC0642 15 30.0 37.3 none none 1 0 159-2 F WT UNC0642 15
29.0 37.0 none none 2 0 159-3 F WT UNC0642 15 25.0 36.8 H, E* none
2 0 *on head and between ears
TABLE-US-00007 TABLE 7 Normal Range (Unit) WT_UNC0642 PWS_UNC0642
BUN 20.0-88.0 mg/dl 25.03 .+-. 2.67 25.5 .+-. 2.69 Creatine 0.5-1.6
mg/dl 0.6 .+-. 0.30 0.43 .+-. 0.09 BUN/creatine ratio 66.8 .+-.
25.23 61 .+-. 10.61 Phosphorus 5.6-9.2 mg/dl 7.67 .+-. 0.29 6.43
.+-. 0.30 Calcium 7.9-10.5 mg/dl 11.3 .+-. 0.95 9.7 .+-. 0.46 Total
Protein 4.5-6.0 g/dl 6.1 .+-. 0.95 5.77 .+-. 0.35 Albumin 3.0-4.0
g/dl 2.97 .+-. 0.52 2.63 .+-. 0.15 Globulin g/dl 2.7 .+-. 0 3.13
.+-. 0.33 Albumin/globulin ratio 0.9 .+-. 0 0.87 .+-. 0.09 Glucose
190-280 mg/dl 267.67 .+-. 56.16 254.33 .+-. 29.72 Cholesterol 0-0
mg/dl 82.5 .+-. 6.12 95.67 .+-. 2.19 ALT (GPT) 10-89 U/l 28.67 .+-.
6.12 24.67 .+-. 4.0 AST (GOT) 10-380 U/l 52 .+-. 18.00 46.5 .+-.
7.76 ALP 0-185 U/l 88.33 .+-. 6.01 67.67 .+-. 9.17 GGT 0-0 U/l n.d.
n.d. Total bilirubin 0.2-0.8 mg/dl 0.5 .+-. 0.06 0.43 .+-. 0.15
Sodium 143-150 mEq/l 147 .+-. 1.53 151.33 .+-. 0.67 Potassium
3.8-10.0 mEq/l 7.37 .+-. 1.57 7.2 .+-. 0.67 Chloride 0-0 mEq/l
111.67 .+-. 0.33 115.67 .+-. 0.88 Na/K ratio 21.67 .+-. 3.8 21.67
.+-. 2.19 Red Blood Cell 7.14-12.20 [M/UL] 10.62 .+-. 0.388 9.303
.+-. 1.651 Hb Concentration 10.8-19.2 [G/dL] 16.3 .+-. 0.529 14.03
.+-. 2.547 Hematocrit 37.2-67.2 [%] 65.1 .+-. 2.042 47.97 .+-.
8.772 Mean Corpuscular Vol 42.6-56.0 [fL] 61.33 .+-. 1.859 51.43
.+-. 0.371 Mean Corpuscular Hb 11.7-16.8 [pg] 15.37 .+-. 0.524 15.1
.+-. 0.231 Mean Corpuscular Hb 29.1-38.0 [g/dL] 25.03 .+-. 0.033
29.3 .+-. 0.503 concentration Reticulocyte [K/uL] 228 .+-. 63.10
335.5 .+-. 163.2 Platelet 565-2159 [K/uL] 1044 .+-. 59.92 679.3
.+-. 226.4 White Blood Cells 3.9-13.96 [K/uL] 4.967 .+-. 0.639
5.467 .+-. 3.743 Neutrophil 0.42-3.09 [K/uL] 1.063 .+-. 0.295 0.557
.+-. 0.393 Lymphocyte 2.88-11.15 [K/uL] 3.55 .+-. 0.559 4.723 .+-.
3.302 Monocyte 0.00-0.94 [K/uL] 0.227 .+-. 0.024 0.063 .+-. 0.030
Eosinophil 0.01-0.5 [K/uL] 0.126 .+-. 0.042 0.123 .+-. 0.027
Basophil 0.00-0.14 [K/uL] 0 0
Sequence CWU 1
1
52124DNAArtificial SequencePrimer 1gctgcagcac attgactata gaat
24224DNAArtificial SequencePrimer 2cacagtcatg gataccaagt tctc
24318DNAArtificial SequencePrimer 3tggatcgatg atgagtcc
18421DNAArtificial SequencePrimer 4tggacctcag ttccgatgag a
21518DNAArtificial SequencePrimer 5ctggtggatc ccacaggt
18618DNAArtificial SequencePrimer 6agaagcccac gccacata
18720DNAArtificial SequencePrimer 7cttcctcaca ccctggtctc
20821DNAArtificial SequencePrimer 8gacttcaaga aatgcgtgct c
21924DNAArtificial SequencePrimer 9ggggtgggtc attatagtat tcag
241024DNAArtificial SequencePrimer 10acaaaaatcc aagaaaggta gcac
241121DNAArtificial SequencePrimer 11ctaagaagct catcaccgaa g
211221DNAArtificial SequencePrimer 12ggcagatacg aaaccaagtt g
211320DNAArtificial SequencePrimer 13agagctacga gctgcctgac
201420DNAArtificial SequencePrimer 14agcactgtgt tggcgtacag
201522DNAArtificial SequencePrimer 15ttggttctga ggagtgattt gc
221620DNAArtificial SequencePrimer 16ccttgaattc caccaccttg
201720DNAArtificial SequencePrimer 17ggatctatga tgattcccag
201818DNAArtificial SequencePrimer 18ggacctcagt tccgatga
181923DNAArtificial SequencePrimer 19ggttgcattc cctttccagt atg
232023DNAArtificial SequencePrimer 20cagcaattcc catgttcctt acc
232123DNAArtificial SequencePrimer 21acagaacaat aggtcaccag gtt
232221DNAArtificial SequencePrimer 22aagcaagact gttcacctca t
212321DNAArtificial SequencePrimer 23acatgaagca gcacgacttc t
212424DNAArtificial SequencePrimer 24gacgttgtgg ctgttgtagt tgta
242520DNAArtificial SequencePrimer 25ggcaaattca acggcacagt
202620DNAArtificial SequencePrimer 26gggtctcgct cctggaagat
202728DNAArtificial SequencePrimer 27ggtggttttt tttaagagat agtttggg
282825DNAArtificial SequencePrimer 28catcccccta atccactacc ataac
252929DNAArtificial SequencePrimer 29tatgtaatat gatatagttt
agaaattag 293029DNAArtificial SequencePrimer 30aataaaccca
aatctaaaat attttaatc 293128DNAArtificial SequencePrimer
31aatttgtgtg atgtttgtaa ttatttgg 283228DNAArtificial SequencePrimer
32ataaaataca ctttcactac taaaatcc 283322DNAArtificial SequencePrimer
33gcctcaggat ccccgtccca at 223422DNAArtificial SequencePrimer
34tggaaccgga ttctgcccgg at 223525DNAArtificial SequencePrimer
35gtctctttct tgtttttaag ctggg 253621DNAArtificial SequencePrimer
36tgagctcatt gagacatttg g 213722DNAArtificial SequencePrimer
37taaccctgtt ttccaggtat gg 223822DNAArtificial SequencePrimer
38aagctgctga tgagaagaaa cc 223924DNAArtificial SequencePrimer
39ctagaggccc cctctcattg caac 244024DNAArtificial SequencePrimer
40cttcgcacac atccccgcct gagc 244122DNAArtificial SequencePrimer
41tcttcaaatg tgcttggatc ga 224220DNAArtificial SequencePrimer
42gcaacgtgct ggacctcagt 204322DNAArtificial SequencePrimer
43caatggacca agagcattga ta 224422DNAArtificial SequencePrimer
44atagggtatt gaaaccccga gt 224522DNAArtificial SequencePrimer
45tgagtcccac aaggaagttt tt 224622DNAArtificial SequencePrimer
46acattcaaag aggcaggaca tt 224722DNAArtificial SequencePrimer
47ttgcttcctg agcaagtcat aa 224822DNAArtificial SequencePrimer
48tccgaaagca tgacatatca ac 224924DNAArtificial SequencePrimer
49gcatcacccg gaggagaaaa tcgg 245020DNAArtificial SequencePrimer
50gtcacgtgtc gcagaggagc 205122DNAArtificial SequencePrimer
51caagtcatgc agaagttagg gg 225222DNAArtificial SequencePrimer
52acccttataa agtgacctcc cc 22
* * * * *