U.S. patent application number 17/494762 was filed with the patent office on 2022-04-14 for bis-octahydrophenanthrene carboxamides and protein conjugates thereof.
The applicant listed for this patent is REGENERON PHARMACEUTICALS, INC.. Invention is credited to Amy HAN, Andrew J. Murphy, William Olson.
Application Number | 20220112158 17/494762 |
Document ID | / |
Family ID | |
Filed Date | 2022-04-14 |
View All Diagrams
United States Patent
Application |
20220112158 |
Kind Code |
A1 |
HAN; Amy ; et al. |
April 14, 2022 |
BIS-OCTAHYDROPHENANTHRENE CARBOXAMIDES AND PROTEIN CONJUGATES
THEREOF
Abstract
Provided herein are compounds, compositions and methods for the
treatment of diseases and disorders associated with the liver X
receptor, including bis-octahydrophenanthrene carboxamides and
protein (e.g., antibody) drug conjugates thereof.
Inventors: |
HAN; Amy; (Hockessin,
DE) ; Murphy; Andrew J.; (Croton-on-Hudson, NY)
; Olson; William; (Yorktown Heights, NY) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
REGENERON PHARMACEUTICALS, INC. |
Tarrytown |
NY |
US |
|
|
Appl. No.: |
17/494762 |
Filed: |
October 5, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15975654 |
May 9, 2018 |
|
|
|
17494762 |
|
|
|
|
62508327 |
May 18, 2017 |
|
|
|
International
Class: |
C07C 237/52 20060101
C07C237/52; A61K 47/64 20060101 A61K047/64; A61P 29/00 20060101
A61P029/00; A61P 3/06 20060101 A61P003/06; A61P 25/28 20060101
A61P025/28; A61K 47/68 20060101 A61K047/68; C07C 233/90 20060101
C07C233/90 |
Claims
1.-53. (canceled)
54. A compound of Formula A ##STR00341## or a pharmaceutically
acceptable salt, or stereoisomeric form thereof, wherein L is a
linker or X--Y--Z, wherein X is --NH-- or --O--; Y is an
enzymatically cleavable moiety, a self-immolative group, an
acid-labile moiety, PEG.sub.n, a sugar moiety, or an enhancement
group; and Z is a binding agent linker (BL) wherein Z is covalently
bound to BA; BA is a binding agent; k is an integer from one to
thirty; each of Q.sup.1 and Q.sup.2 is independently --CH.sub.2--,
--C(O)--, --C(H)(OH)--, or --C(OH).sub.2--; W is --CH.sub.2--,
--N(H)--, or --O--; R is independently hydrogen, --OH, C.sub.1-6
alkyl, or --OP(O)(OR.sup.6)(OH); and each R.sup.6 is, independently
in each instance, hydrogen, an amino acid residue, a peptide, or
alkyl; and each R.sup.7 is independently halo, C.sub.1-6 alkyl,
C.sub.1-6 alkoxy, --CN, 0-glucose, O-amino acid residue, or
O-PEG.sub.n, wherein each n is an integer from zero to three.
55. The compound of claim 54, comprising BA linked via a linker L
to a compound selected from the group consisting of ##STR00342##
##STR00343## ##STR00344## ##STR00345## ##STR00346## or a
regioisomer, stereoisomeric form, pharmaceutically acceptable salt,
or solvate thereof, wherein k is an integer from one to four.
56. The compound of claim 54, comprising BA linked to a compound
selected from the group consisting of ##STR00347## ##STR00348##
##STR00349## ##STR00350## ##STR00351## ##STR00352## ##STR00353##
##STR00354## ##STR00355## or a regioisomer, stereoisomeric form,
pharmaceutically acceptable salt, or solvate thereof, wherein k is
an integer from one to four.
57. The compound of claim 54, selected from the group consisting of
##STR00356## ##STR00357## ##STR00358## ##STR00359## ##STR00360##
##STR00361## ##STR00362## ##STR00363## ##STR00364## ##STR00365##
##STR00366## ##STR00367## ##STR00368## ##STR00369## ##STR00370##
##STR00371## ##STR00372## ##STR00373## or a regioisomer,
stereoisomeric form, pharmaceutically acceptable salt, or solvate
thereof, wherein k is an integer from one to four.
58. The compound of claim 57, wherein k is two.
59. The compound of claim 57, wherein k is four.
60. The compound of claim 57, wherein BA is an antibody or antigen
binding fragment thereof having binding specificity for an antigen
selected from the group consisting of class A-J scavenger
receptors.
61. The compound of claim 57, wherein BA is an antibody or antigen
binding fragment thereof having binding specificity for an antigen
selected from the group consisting of MSR1, MARCO, SRCL, SCARA5,
COLEC12, CD36, LIMPII, SRBI, SRBII, CD68, LAMP, LOX-1, Dectin-1,
SREC-I, SREC-II, MEGF, CXCL16, Fasciclin, FEEL-1, FEEL-2, CD163,
RAGE, C-type lectin superfamily members, DEC205, CD206, Dectin-2,
Mincle, DC-SIGN, DNGR-1, VSIG4, CSF1R, ASGPR, and APLP-2.
62. The compound of claim 57, wherein BA is an antibody or antigen
binding fragment thereof having binding specificity for Her2 or
PRLR.
63. The compound of claim 57, wherein BA is an antibody or antigen
binding fragment thereof having binding specificity for MSR1.
64. The compound of claim 57, wherein BA is an antibody or antigen
binding fragment thereof linked through one or more N295
residues.
65. The compound of claim 57, wherein BA is an antibody or antigen
binding fragment thereof linked through one or more N295 and N297Q
residues.
66. The compound of claim 54, having the structure ##STR00374##
##STR00375## wherein BA is a binding agent; and k is an integer
from one to thirty.
67. The compound of claim 54, having the structure ##STR00376##
##STR00377## wherein BA is a binding agent; and k is an integer
from one to thirty.
68. The compound of claim 54, having the structure ##STR00378##
##STR00379## wherein BA is a binding agent; and k is an integer
from one to thirty.
69. The compound of claim 54, having the structure ##STR00380##
##STR00381## wherein BA is a binding agent; and k is an integer
from one to thirty.
70. The compound of claim 54, selected from the group consisting of
##STR00382## ##STR00383## ##STR00384## ##STR00385## ##STR00386##
##STR00387## ##STR00388## ##STR00389## ##STR00390## ##STR00391##
##STR00392## ##STR00393## ##STR00394## ##STR00395## ##STR00396##
##STR00397## ##STR00398## ##STR00399## ##STR00400## ##STR00401##
##STR00402## ##STR00403## ##STR00404## ##STR00405## ##STR00406## or
a regioisomer, stereoisomeric form, pharmaceutically acceptable
salt, or solvate thereof, wherein k is an integer from one to
four.
71. The compound of claim 54, comprising BA linked via a linker to
a compound as depicted in the following formula ##STR00407##
72. The compound of claim 56, wherein BA is an antibody or antigen
binding fragment thereof conjugated to a primary amine compound at
a glutamine residue, and L is bonded to BA through the primary
amine compound.
73. The compound of claim 72, wherein the primary amine compound
comprises a divalent PEG group.
74. A method for the treatment of dyslipidemia, a metabolic
disease, inflammation, or a neurodegenerative disease in a subject
comprising the administration to the subject an effective treatment
amount of the compound of claim 54.
75. A method for the treatment of dyslipidemia in a subject
comprising the administration to the subject an effective treatment
amount of the compound of claim 54.
76. A method for the treatment of a metabolic disease in a subject
comprising the administration to the subject an effective treatment
amount of the compound of claim 54.
77. A method for the treatment of inflammation in a subject
comprising the administration to the subject of an effective
treatment amount of the compound of claim 54.
78. A method for the treatment of a neurodegenerative disease in a
subject comprising the administration to the subject of an
effective treatment amount of the compound of claim 54.
79. A pharmaceutical composition comprising the compound of claim
54 and a pharmaceutically acceptable excipient, carrier, or
diluent.
80. A method for the treatment of dyslipidemia, a metabolic
disease, inflammation, or a neurodegenerative disease in a subject
comprising the administration to the subject an effective treatment
amount of the pharmaceutical composition of claim 79.
81. A method for the treatment of dyslipidemia in a subject
comprising the administration to the subject an effective treatment
amount of the pharmaceutical composition of claim 79.
82. A method for the treatment of a metabolic disease in a subject
comprising the administration to the subject an effective treatment
amount of the pharmaceutical composition of claim 79.
83. A method for the treatment of inflammation in a subject
comprising the administration to the subject an effective treatment
amount of the pharmaceutical composition of claim 79.
84. A method for the treatment of a neurodegenerative disease in a
subject comprising the administration to the subject an effective
treatment amount of the pharmaceutical composition of claim 79.
85. A compound of Formula I ##STR00408## or a pharmaceutically
acceptable salt, solvate, or stereoisomeric form thereof, wherein
each of Q.sup.1 and Q.sup.2 is independently --CH.sub.2--,
--C(O)--, --C(H)(OH)--, --C(OH).sub.2--, --SO.sub.2--, --SO--,
--PO(OR.sup.11)--, --PO(NR.sup.11NR.sup.12)--, --NR.sup.11--, or
--N.dbd.; W is --CH.sub.2--, --N(H)--, or --O--; R.sup.1 is
independently hydrogen, --OH, --NH.sub.2, alkyl, or
--OP(O)(OR.sup.6).sub.2; R.sup.2 is independently hydrogen, halide,
--SO.sub.2NR.sup.11R.sup.12, --CONR.sup.11R.sup.12,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5;
wherein R.sup.1 and R.sup.2 are not simultaneously hydrogen;
R.sup.3 is --N(R.sup.6).sub.2; R.sup.4 is --X--Y--Z; X is selected
from the group consisting of --O-- and --N(H)--; Y is selected from
the group consisting of alkylene, substituted alkylene,
heteroalkylene, and substituted heteroalkylene; Z is selected from
the group consisting of --OH and --NH.sub.2; R.sup.5 is alkyl,
heterocycloalkyl, or substituted heterocycloalkyl, wherein each
heterocycloalkyl or substituted heterocycloalkyl comprises one,
two, or three heteroatoms selected from nitrogen and oxygen, and
includes at least one --OH and --CH.sub.2OH, or at least one
primary or secondary nitrogen; each R.sup.6 is, independently in
each instance, hydrogen, an amino acid residue, an N-alkyl amino
acid residue, a peptide, a biodegradable moiety, or alkyl; each
R.sup.7 is independently halo, C.sub.1-6 alkyl, C.sub.1-6 alkoxy,
--CN, O-glucose, O-amino acid residue, or O-PEG.sub.n, wherein each
n is an integer from zero to three; and each R.sup.11 and R.sup.12
are independently hydrogen, alkyl, or aryl.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit under 35 U.S.C. .sctn.
119 of U.S. provisional application No. 62/508,327, filed May 18,
2017, the content of which is hereby incorporated by reference in
its entirety.
SEQUENCE LISTING
[0002] This application incorporates by reference the computer
readable sequence listing in the file "10286WO01 Sequence
Listing.txt," created Nov. 3, 2021, having 2.84 KB.
FIELD
[0003] Provided herein are novel, bis-octahydrophenanthrene
carboxamides and protein conjugates thereof, and methods for
treating a variety of diseases, disorders, and conditions including
administering the bis-octahydrophenanthrene carboxamides, and
protein conjugates thereof.
BACKGROUND
[0004] Antibody-drug conjugates (ADCs) are antibodies that are
attached to biologically active small molecule drugs, thus
combining the targeting specificity of antibodies with the
mode-of-action and potency of small molecule drugs. The therapeutic
utility of ADCs has been validated in cancer treatment and is a
major ongoing focus of study. ADCETRIS.RTM. (bentruximab vedotin)
and KADCYLA.RTM. (ado-trastuzumab emtansine) are two ADCs approved
for the treatment of certain cancer types, and at least forty ADCs
are currently in clinical development.
[0005] Liver X Receptor (LXR) includes LXR.alpha. and LXR.beta.
which are ligand-dependent transcription factors that control the
expression of genes involved in cholesterol, lipid and glucose
homeostasis, inflammation, and innate immunity. LXR.alpha. is
highly expressed in liver, intestine, adipose tissue, and
differentiated macrophages; and LXR.beta. is ubiquitously
expressed. LXRs have various biological functions including (i)
stimulating the expression of cholesterol transporters, for
example, ABCA1 and ABCG1, both of which mediate cellular
cholesterol efflux; and (ii) negatively regulating macrophage
inflammatory gene expression via repression of NF-kB activation.
LXRs have also been implicated in atherosclerosis, proliferative
disorders, neurodegenerative disorders, and inflammation.
Proliferative disorders include melanomas, lung cancer, oral
squamous carcinoma, and prostate cancer. (Pencheva et al. 2004; Wu
et al. 2015; Kaneko et al. 2015; Chuu et al. 2006)
Neurodegenerative disorders include Alzheimer's disease and myelin
gene expression. (Terwel et al. 2011; Sandoval-Hernandez et al.
2016; Meffre et al. 2014) Inflammation includes inflammatory bowel
disease, ulcerative colitis, Crohn's disease, and arthritis.
(Anderson et al. 2011; Huang et al. 2015; Cui et al. 2012).
Macrophage LXRs are known to include anti-atherogenic activity. LXR
agonists are believed to be capable of (i) inhibiting the
initiation and delay the progression of atherosclerosis; (ii)
mitigating atherosclerosis and stabilizing established
atherosclerotic lesions; and (iii) reducing lesion macrophage
content by apoptosis.
[0006] The therapeutic potential of small molecule LXR modulators
is limited by, for example, undesired modulation of LXR at
non-target cells and/or low bioavailability. Modulation of LXR at
non-target cells can lead to undesirable side effects, and low
bioavailability may manifest for myriad reasons including, without
limitation, low solubility that further exacerbates poor
therapeutic windows for treatment. The development of ADCs
comprising LXR modulators would allow for target-specific
modulation of LXR, thereby avoiding side-effects caused by
off-target modulation of LXR. Furthermore, such ADCs would provide
improved modulation of biological targets, improved
bioavailability, and improved therapeutic window. Therefore, there
is a continuing need for effective treatments of, for example,
metabolic diseases using small molecule ADCs of LXR modulators.
SUMMARY
[0007] Provided herein are compounds useful, for example, for the
treatment of metabolic diseases including, without limitation,
dyslipidemia. Also provided herein are compounds useful, for
example, for the treatment of inflammation or a neurodegenerative
disease. The compounds provided herein are according to Formula
I.
[0008] In one embodiment, provided herein are compounds according
to Formula I.
##STR00001##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, wherein [0009] each of Q.sup.1 and Q.sup.2 includes,
independently, --CH.sub.2--, --C(O)--, --C(H)(OH)--,
--C(OH).sub.2--, --SO.sub.2--, --SO--, --PO(OR.sup.11)--,
--PO(NR.sup.11NR.sup.12)--, --NR.sup.11--, or --N.dbd.; [0010] W
includes --CH.sub.2--, --N(H)--, or --O--; [0011] R.sup.1 includes
--H, --OR.sup.6, --OH, --NH.sub.2, alkyl, or
--OP(O)(OR.sup.6).sub.2; [0012] R.sup.2 includes --H, --OH,
--OR.sup.1, halide, --SO.sub.2NR.sup.11R.sup.12,
--CONR.sup.11R.sup.12, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4,
R.sup.5, or --O--R.sup.5, wherein R.sup.1 and R.sup.2 are not
simultaneously --H; [0013] R.sup.3 includes --N(R.sup.6).sub.2;
[0014] R.sup.4 includes --X--Y--Z; [0015] X includes the group
consisting of --O-- and --N(H)--; [0016] Y includes the group
consisting of alkylene, substituted alkylene (including oxo, i.e.,
.dbd.O), heteroalkylene, and substituted heteroalkylene (including
oxo, i.e., .dbd.O); [0017] Z includes the group consisting of --OH
and --NH.sub.2; [0018] R.sup.5 includes alkyl, heterocycloalkyl, or
substituted heterocycloalkyl, wherein each heterocycloalkyl or
substituted heterocycloalkyl comprises one, two, or three
heteroatoms selected from nitrogen and oxygen, and includes at
least one --OH or --CH.sub.2OH, or at least one primary or
secondary nitrogen; [0019] each R.sup.6 includes, independently in
each instance, --H, an amino acid residue, an N-alkyl amino acid
residue, a peptide, a biodegradable moiety, or alkyl; [0020] each
R.sup.7 independently includes halo, C.sub.1-6 alkyl, C.sub.1-6
alkoxy, --CN, O-glucose, O-amino acid residue, and O-PEG.sub.n,
wherein each n is an integer from 0-3; and [0021] each R.sup.11 and
R.sup.12 are independently selected from --H, alkyl, and aryl.
[0022] In one embodiment, provided herein are compounds according
to Formula I.
##STR00002##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, wherein [0023] each of Q.sup.1 and Q.sup.2 includes,
independently, --CH.sub.2--, --C(O)--, --C(H)(OH)--, or
--C(OH).sub.2--; [0024] W includes --CH.sub.2--, --N(H)--, or
--O--; [0025] R.sup.1 includes --H, --OH, --NH.sub.2, alkyl, or
--OP(O)(OR.sup.6).sub.2; [0026] R.sup.2 includes --H, --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5,
wherein R.sup.1 and R.sup.2 are not simultaneously --H; [0027]
R.sup.3 includes --N(R.sup.6).sub.2; [0028] R.sup.4 includes
--X--Y--Z; [0029] X includes the group consisting of --O-- and
--N(H)--; [0030] Y includes the group consisting of alkylene,
substituted alkylene (including, without limitation, oxo
substitution (i.e., .dbd.O)), heteroalkylene, and substituted
heteroalkylene (including, without limitation, oxo substitution
(i.e., .dbd.O)); [0031] Z includes the group consisting of --OH and
--NH.sub.2; [0032] R.sup.5 includes alkyl, heterocycloalkyl, or
substituted heterocycloalkyl, wherein each heterocycloalkyl or
substituted heterocycloalkyl includes one, two, or three
heteroatoms selected from nitrogen and oxygen, and includes at
least one --OH or --CH.sub.2OH substituent, or at least one primary
or secondary nitrogen, for instance, O-glucose; [0033] each R.sup.6
includes, independently in each instance, --H, an amino acid
residue, an N-alkyl amino acid residue, a peptide, or alkyl; and
[0034] each R.sup.7 independently includes halo, C1-6 alkyl, C1-6
alkoxy, --CN, O-glucose, O-amino acid residue, and O-PEG.sub.n,
wherein each n is an integer from 0-3.
[0035] In another embodiment, set forth herein is a linker-payload
having a compound according to Formula I, above.
[0036] In another embodiment, set forth herein is an antibody-drug
conjugate having a compound of Formula I or linker-payload, above,
bonded to an antibody or an antigen binding fragment thereof.
[0037] In another embodiment, set forth herein are compounds
according to Formula A:
##STR00003##
or a pharmaceutically acceptable salt, or stereoisomeric form
thereof, wherein [0038] L is a linker; [0039] BA is a binding
agent; [0040] k is an integer from 1 to 30; [0041] each of Q.sup.1
and Q.sup.2 is independently --CH.sub.2--, --C(O)--, --C(H)(OH)--,
or --C(OH).sub.2--; [0042] W is --CH.sub.2--, --N(H)--, or --O--;
[0043] R is independently --H, --OH, or --OP(O)(OR.sup.6).sub.2;
and [0044] each R.sup.6 is, independently in each instance, --H, an
amino acid residue, an N-alkyl amino acid residue, a peptide, or
alkyl; and [0045] each R.sup.7 is independently halo, C.sub.1-6
alkyl, C.sub.1-6 alkoxy, --CN, O-glucose, O-amino acid residue, and
O-PEG.sub.n, wherein each n is an integer from 0-3.
[0046] In another embodiment, set forth herein is a pharmaceutical
composition, including a compound, linker-payload, or antibody-drug
conjugate described herein and a pharmaceutically acceptable
excipient, carrier, or diluent.
[0047] In another embodiment, set forth herein is a method for the
treatment of dyslipidemia, a metabolic disease, inflammation, or a
neurodegenerative disease in a subject including the administration
to the subject of an effective treatment amount of a compound,
linker-payload, or antibody-drug conjugate, or pharmaceutical
composition described herein.
[0048] In another embodiment, set forth herein are methods for
making the compounds, linker-payloads, or antibody-drug conjugates,
and compositions described herein.
BRIEF DESCRIPTIONS OF THE DRAWING
[0049] FIGS. 1, 1a-1i, 2, 3a-3e, and 4-10 show synthetic chemistry
schemes for bis-octahydrophenanthrene carboxamides,
cyclodextrin-based linker-payloads, and protein conjugates
thereof.
[0050] FIG. 11 shows Coomassie-stained SDS-PAGE Gel of anti-Her2
antibody, anti-Her2-PEG.sub.3-N.sub.3, and anti-Her2-LP8.
[0051] FIG. 12 shows SEC of anti-Her2 Ab,
anti-Her2-PEG.sub.3-N.sub.3, and anti-Her2-LP8.
[0052] FIG. 13 shows Activation of ABCA1 and ABCG1 genes by LXR
agonists.
[0053] FIG. 14 shows EC.sub.50 values using a four-parameter
logistic equation over a 10-point dose response curve.
[0054] FIG. 15 is a graph illustrating percentage of dose-dependent
cholesterol efflux in THP-1 macrophages for an exemplary MSR1
antibody-LXR conjugate, its unconjugated counterpart, an isotype
control-LXR conjugate, and the corresponding free payload.
[0055] FIG. 16 provides a series of bar graphs illustrating the
effect of an exemplary MSR1 antibody-LXR agonist conjugate and its
unconjugated counterpart on serum lipid levels in a mouse model of
atherosclerosis.
[0056] FIG. 17 provides a series of bar graphs illustrating the
effect of an exemplary MSR1 antibody-LXR agonist conjugate and its
unconjugated counterpart on lesion lipid area and macropphage
(CD68) content in a mouse model of atherosclerosis.
[0057] FIG. 18 provides a series of bar graphs illustrating the
effect of an exemplary MSR1 antibody-LXR agonist conjugate and its
unconjugated counterpart on hepatic triglyceride and cholesterol
levels in a mouse model of atherosclerosis.
[0058] FIG. 19 provides a series of bar graphs illustrating the
effect of an exemplary MSR1 antibody-LXR agonist conjugate and its
unconjugated counterpart on de novo lipogenesis in a mouse model of
atherosclerosis.
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0059] Provided herein are compounds, compositions, and methods
useful for treating, for example, dyslipidemia, a metabolic
disease, inflammation, or a neurodegenerative disease, in a
subject.
Definitions
[0060] When referring to the compounds provided herein, the
following terms have the following meanings unless indicated
otherwise. Unless defined otherwise, all technical and scientific
terms used herein have the same meaning as is commonly understood
by one of ordinary skill in the art. In the event that there is a
plurality of definitions for a term provided herein, these
Definitions prevail unless stated otherwise.
[0061] As used herein, "alkyl" refers to a monovalent and saturated
hydrocarbon radical moiety. Alkyl is optionally substituted and can
be linear, branched, or cyclic, i.e., cycloalkyl. Alkyl includes,
but is not limited to, those radicals having 1-20 carbon atoms,
i.e., C.sub.1-20 alkyl; 1-12 carbon atoms, i.e., C.sub.1-12 alkyl;
1-8 carbon atoms, i.e., C.sub.1-8 alkyl; 1-6 carbon atoms, i.e.,
C.sub.1-6 alkyl; and 1-3 carbon atoms, i.e., C.sub.1-3 alkyl.
Examples of alkyl moieties include, but are not limited to methyl,
ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, i-butyl, a
pentyl moiety, a hexyl moiety, cyclopropyl, cyclobutyl,
cyclopentyl, and cyclohexyl. A pentyl moiety includes, but is not
limited to, n-pentyl and i-pentyl. A hexyl moiety includes, but is
not limited to, n-hexyl.
[0062] As used herein, "alkylene" refers to a divalent alkyl group.
Unless specified otherwise, alkylene includes, but is not limited
to, 1-20 carbon atoms. The alkylene group is optionally substituted
as described herein for alkyl. In some embodiments, alkylene is
unsubstituted.
[0063] As used herein, the term "O-amino acid" or "HO-amino acid"
designates an amino acid wherein the native amino group at the
N-terminus of an amino acid or an amino acid sequence has been
replaced with an oxygen or hydroxyl group, respectively. For
example, "O-AAAA" or "HO-AAAA" is intended to designate an amino
acid sequence (AAAA) wherein the native amino group at the
N-terminus has been replaced with an oxygen or hydroxyl group,
respectively (e.g.,
##STR00004##
where each R is an amino acid side chain). Similarly, the terms
"O-amino acid residue" or "HO-amino acid residue" refers to the
chemical moiety within a compound that remains after a chemical
reaction. For example, "O-amino acid residue" or "HO-amino acid
residue" refers to the product of an amide coupling or peptide
coupling of an O-amino acid or a HO-amino acid to a suitable
coupling partner; wherein, for example, a water molecule is
expelled after the amide or peptide coupling of the O-amino acid or
a HO-amino acid, resulting in the product having the O-amino acid
residue or a HO-amino acid residue incorporated therein.
[0064] Designation of an amino acid or amino acid residue without
specifying its stereochemistry is intended to encompass the L form
of the amino acid, the D form of the amino acid, or a racemic
mixture thereof.
[0065] As used herein, "haloalkyl" refers to alkyl, as defined
above, wherein the alkyl includes at least one substituent selected
from a halogen, for example, fluorine (F), chlorine (Cl), bromine
(Br), or iodine (I). Examples of haloalkyl include, but are not
limited to, --CF.sub.3, --CH.sub.2CF.sub.3, --CCl.sub.2F, and
--CCl.sub.3.
[0066] As used herein, "alkenyl" refers to a monovalent hydrocarbon
radical moiety containing at least two carbon atoms and one or more
non-aromatic carbon-carbon double bonds. Alkenyl is optionally
substituted and can be linear, branched, or cyclic. Alkenyl
includes, but is not limited to, those radicals having 2-20 carbon
atoms, i.e., C.sub.2-20 alkenyl; 2-12 carbon atoms, i.e.,
C.sub.2-12 alkenyl; 2-8 carbon atoms, i.e., C.sub.2-8 alkenyl; 2-6
carbon atoms, i.e., C.sub.2-6 alkenyl; and 2-4 carbon atoms, i.e.,
C.sub.2-4 alkenyl. Examples of alkenyl moieties include, but are
not limited to vinyl, propenyl, butenyl, and cyclohexenyl.
[0067] As used herein, "alkynyl" refers to a monovalent hydrocarbon
radical moiety containing at least two carbon atoms and one or more
carbon-carbon triple bonds. Alkynyl is optionally substituted and
can be linear, branched, or cyclic. Alkynyl includes, but is not
limited to, those radicals having 2-20 carbon atoms, i.e.,
C.sub.2-20 alkynyl; 2-12 carbon atoms, i.e., C.sub.2-12 alkynyl;
2-8 carbon atoms, i.e., C.sub.2-8 alkynyl; 2-6 carbon atoms, i.e.,
C.sub.2-6 alkynyl; and 2-4 carbon atoms, i.e., C.sub.2-4 alkynyl.
Examples of alkynyl moieties include, but are not limited to
ethynyl, propynyl, and butynyl.
[0068] As used herein, "alkoxy" refers to a monovalent and
saturated hydrocarbon radical moiety wherein the hydrocarbon
includes a single bond to an oxygen atom and wherein the radical is
localized on the oxygen atom, e.g., CH.sub.3CH.sub.2--O for ethoxy.
Alkoxy substituents bond to the compound which they substitute
through this oxygen atom of the alkoxy substituent. Alkoxy is
optionally substituted and can be linear, branched, or cyclic,
i.e., cycloalkoxy. Alkoxy includes, but is not limited to, those
having 1-20 carbon atoms, i.e., C.sub.1-20 alkoxy; 1-12 carbon
atoms, i.e., C.sub.1-12 alkoxy; 1-8 carbon atoms, i.e., C.sub.1-8
alkoxy; 1-6 carbon atoms, i.e., C.sub.1-6 alkoxy; and 1-3 carbon
atoms, i.e., C.sub.1-3 alkoxy. Examples of alkoxy moieties include,
but are not limited to methoxy, ethoxy, n-propoxy, i-propoxy,
n-butoxy, s-butoxy, t-butoxy, i-butoxy, a pentoxy moiety, and a
hexoxy moiety, cyclopropoxy, cyclobutoxy, cyclopentoxy, and
cyclohexoxy (i.e.,
##STR00005##
respectively).
[0069] As used herein, "haloalkoxy" refers to alkoxy, as defined
above, wherein the alkoxy includes at least one substituent
selected from a halogen, e.g., F, Cl, Br, or I.
[0070] As used herein, "aryl" refers to a monovalent moiety that is
a radical of an aromatic compound wherein the ring atoms are carbon
atoms. Aryl is optionally substituted and can be monocyclic or
polycyclic, e.g., bicyclic or tricyclic. Examples of aryl moieties
include, but are not limited to, those having 6 to 20 ring carbon
atoms, i.e., C.sub.6-20 aryl; 6 to 15 ring carbon atoms, i.e.,
C.sub.6-15 aryl, and 6 to 10 ring carbon atoms, i.e., C.sub.6-10
aryl. Examples of aryl moieties include, but are not limited to
phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, and
pyrenyl.
[0071] As used herein, "arylalkyl" refers to a monovalent moiety
that is a radical of an alkyl compound, wherein the alkyl compound
is substituted with an aromatic substituent, i.e., the aromatic
compound includes a single bond to an alkyl group and wherein the
radical is localized on the alkyl group. An arylalkyl group bonds
to the illustrated chemical structure via the alkyl group. An
arylalkyl can be represented by the structure, e.g.,
##STR00006##
wherein B is an aromatic moiety, e.g., phenyl. Arylalkyl is
optionally substituted, i.e., the aryl group and/or the alkyl
group, can be substituted as disclosed herein. Examples of
arylalkyl include, but are not limited to, benzyl.
[0072] As used herein, "alkylaryl" refers to a monovalent moiety
that is a radical of an aryl compound, wherein the aryl compound is
substituted with an alkyl substituent, i.e., the aryl compound
includes a single bond to an alkyl group and wherein the radical is
localized on the aryl group. An alkylaryl group bonds to the
illustrated chemical structure via the aryl group. An alkylaryl can
be represented by the structure, e.g.,
##STR00007##
wherein B is an aromatic moiety, e.g., phenyl. Alkylaryl is
optionally substituted, i.e., the aryl group and/or the alkyl
group, can be substituted as disclosed herein. Examples of
alkylaryl include, but are not limited to, toluyl.
[0073] As used herein, "aryloxy" refers to a monovalent moiety that
is a radical of an aromatic compound wherein the ring atoms are
carbon atoms and wherein the ring is substituted with an oxygen
radical, i.e., the aromatic compound includes a single bond to an
oxygen atom and wherein the radical is localized on the oxygen
atom, e.g.,
##STR00008##
for phenoxy. Aryloxy substituents bond to the compound which they
substitute through this oxygen atom. Aryloxy is optionally
substituted. Aryloxy includes, but is not limited to, those
radicals having 6 to 20 ring carbon atoms, i.e., C.sub.6-20
aryloxy; 6 to 15 ring carbon atoms, i.e., C.sub.6-15 aryloxy, and 6
to 10 ring carbon atoms, i.e., C.sub.6-10 aryloxy. Examples of
aryloxy moieties include, but are not limited to phenoxy,
naphthoxy, and anthroxy.
[0074] As used herein, "R.sup.aR.sup.bN-aryloxy" refers to a
monovalent moiety that is a radical of an aromatic compound wherein
the ring atoms are carbon atoms and wherein the ring is substituted
with at least one R.sup.aR.sup.bN-- substituent and at least one
oxygen radical, i.e., the aromatic compound includes a single bond
to an R.sup.aR.sup.bN-- substituent and a single bond to an oxygen
atom and wherein the radical is localized on the oxygen atom,
e.g.,
##STR00009##
R.sup.aR.sup.bN-aryloxy substituents bond to the compound which
they substitute through this oxygen atom. R.sup.aR.sup.bN-aryloxy
is optionally substituted. R.sup.aR.sup.bN-aryloxy includes, but is
not limited to, those having 6 to 20 ring carbon atoms, for
example, C.sub.6-20 (R.sup.aR.sup.bN).sub.n-aryloxy, 6 to 15 ring
carbon atoms, for example, C.sub.6-15
(R.sup.aR.sup.bN).sub.n-aryloxy, and 6 to 10 ring carbon atoms, for
example, C.sub.6-10 (R.sup.aR.sup.bN).sub.n-aryloxy, wherein n
represents the number of R.sup.aR.sup.bN-- substituents. An example
of an R.sup.aR.sup.bN-aryloxy moiety includes, but is not limited
to 4-(dimethylamino)-phenoxy,
##STR00010##
[0075] As used herein, "arylene" refers to a divalent moiety of an
aromatic compound wherein the ring atoms are only carbon atoms.
Arylene is optionally substituted and can be monocyclic or
polycyclic, e.g., bicyclic or tricyclic. Examples of arylene
moieties include, but are not limited to those having 6 to 20 ring
carbon atoms, i.e., C.sub.6-20 arylene; 6 to 15 ring carbon atoms,
i.e., C.sub.6-15 arylene, and 6 to 10 ring carbon atoms, i.e.,
C.sub.6-10 arylene.
[0076] As used herein, "heteroalkyl" refers to an alkyl in which
one or more carbon atoms are replaced by heteroatoms. As used
herein, "heteroalkenyl" refers to an alkenyl in which one or more
carbon atoms are replaced by heteroatoms. As used herein,
"heteroalkynyl" refers to an alkynyl in which one or more carbon
atoms are replaced by heteroatoms. Suitable heteroatoms include,
but are not limited to, nitrogen, oxygen, and sulfur atoms.
Heteroalkyl is optionally substituted. Examples of heteroalkyl
moieties include, but are not limited to, aminoalkyl,
sulfonylalkyl, and sulfinylalkyl. Examples of heteroalkyl moieties
also include, but are not limited to, methylamino, methylsulfonyl,
and methylsulfinyl.
[0077] As used herein, "heteroaryl" refers to a monovalent moiety
that is a radical of an aromatic compound wherein the ring atoms
contain carbon atoms and at least one oxygen, sulfur, nitrogen, or
phosphorus atom. Examples of heteroaryl moieties include, but are
not limited to those having 5 to 20 ring atoms; 5 to 15 ring atoms;
and 5 to 10 ring atoms. Heteroaryl is optionally substituted.
[0078] As used herein, "heteroarylene" refers to an arylene in
which one or more ring atoms of the aromatic ring are replaced with
an oxygen, sulfur, nitrogen, or phosphorus atom. Heteroarylene is
optionally substituted.
[0079] As used herein, "heterocycloalkyl" refers to a cycloalkyl in
which one or more carbon atoms are replaced by heteroatoms.
Suitable heteroatoms include, but are not limited to, nitrogen,
oxygen, and sulfur atoms. Heterocycloalkyl is optionally
substituted. Examples of heterocycloalkyl moieties include, but are
not limited to, morpholinyl, piperidinyl, tetrahydropyranyl,
pyrrolidinyl, imidazolidinyl, oxazolidinyl, thiazolidinyl,
dioxolanyl, dithiolanyl, oxanyl, or thianyl.
[0080] As used herein, "Lewis acid" refers to a molecule or ion
that accepts an electron lone pair. The Lewis acids used in the
methods described herein are those other than protons. Lewis acids
include, but are not limited to, non-metal acids, metal acids, hard
Lewis acids, and soft Lewis acids. Lewis acids include, but are not
limited to, Lewis acids of aluminum, boron, iron, tin, titanium,
magnesium, copper, antimony, phosphorus, silver, ytterbium,
scandium, nickel, and zinc. Illustrative Lewis acids include, but
are not limited to, AlBr.sub.3, AlCl.sub.3, BCl.sub.3, boron
trichloride methyl sulfide, BF.sub.3, boron trifluoride methyl
etherate, boron trifluoride methyl sulfide, boron trifluoride
tetrahydrofuran, dicyclohexylboron trifluoromethanesulfonate, iron
(III) bromide, iron (III) chloride, tin (IV) chloride, titanium
(IV) chloride, titanium (IV) isopropoxide, Cu(OTf).sub.2,
CuCl.sub.2, CuBr.sub.2, zinc chloride, alkylaluminum halides
(R.sub.nAlX.sub.3-n, wherein R is hydrocarbyl), Zn(OTf).sub.2,
ZnCl.sub.2, Yb(OTf).sub.3, Sc(OTf).sub.3, MgBr.sub.2, NiCl.sub.2,
Sn(OTf).sub.2, Ni(OTf).sub.2, and Mg(OTf).sub.2.
[0081] As used herein, "N-containing heterocycloalkyl," refers to a
cycloalkyl in which one or more carbon atoms are replaced by
heteroatoms and wherein at least one heteroatom is a nitrogen atom.
Suitable heteroatoms in addition to nitrogen, include, but are not
limited to oxygen and sulfur atoms. N-containing heterocycloalkyl
is optionally substituted. Examples of N-containing
heterocycloalkyl moieties include, but are not limited to,
morpholinyl, piperidinyl, pyrrolidinyl, imidazolidinyl,
oxazolidinyl, or thiazolidinyl.
[0082] As used herein, "optionally substituted," when used to
describe a radical moiety, for example, optionally substituted
alkyl, means that such moiety is optionally bonded to one or more
substituents. Examples of such substituents include, but are not
limited to, halo, cyano, nitro, optionally substituted haloalkyl,
azido, epoxy, optionally substituted heteroaryl, optionally
substituted heterocycloalkyl,
##STR00011##
wherein R.sup.A, R.sup.B, and R.sup.C are, independently at each
occurrence, a hydrogen atom, alkyl, alkenyl, alkynyl, aryl,
alkylaryl, arylalkyl, heteroalkyl, heteroaryl, or heterocycloalkyl,
or R.sup.A and R.sup.B together with the atoms to which they are
bonded, form a saturated or unsaturated carbocyclic ring, wherein
the ring is optionally substituted, and wherein one or more ring
atoms is optionally replaced with a heteroatom. In certain
embodiments, when a radical moiety is optionally substituted with
an optionally substituted heteroaryl, optionally substituted
heterocycloalkyl, or optionally substituted saturated or
unsaturated carbocyclic ring, the substituents on the optionally
substituted heteroaryl, optionally substituted heterocycloalkyl, or
optionally substituted saturated or unsaturated carbocyclic ring,
if they are substituted, are not substituted with substituents
which are further optionally substituted with additional
substituents. In some embodiments, when a group described herein is
optionally substituted, the substituent bonded to the group is
unsubstituted unless otherwise specified.
[0083] As used herein, "binding agent" refers to any molecule,
e.g., protein, capable of binding with specificity to a given
binding partner, e.g., antigen.
[0084] As used herein, "linker" refers to a divalent, trivalent, or
multivalent moiety that covalently links the binding agent to one
or more compounds described herein, for instance payload compounds
and enhancement agents.
[0085] As used herein, "amide synthesis conditions" refers to
reaction conditions suitable to effect the formation of an amide,
e.g., by the reaction of a carboxylic acid, activated carboxylic
acid, or acyl halide with an amine. In some examples, amide
synthesis conditions refers to reaction conditions suitable to
effect the formation of an amide bond between a carboxylic acid and
an amine. In some of these examples, the carboxylic acid is first
converted to an activated carboxylic acid before the activated
carboxylic acid reacts with an amine to form an amide. Suitable
conditions to effect the formation of an amide include, but are not
limited to, those utilizing reagents to effect the reaction between
a carboxylic acid and an amine, including, but not limited to,
dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIC),
(benzotriazol-1-yloxy)tris(dimethylamino)phosphonium
hexafluorophosphate (BOP),
(benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate
(PyBOP), (7-azabenzotriazol-1-yloxy)tripyrrolidinophosphonium
hexafluorophosphate (PyAOP), bromotripyrrolidinophosphonium
hexafluorophosphate (PyBrOP),
O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
hexafluorophosphate (HBTU),
O-(benzotriazol-1-yl)-N,N,N',N'-tetramethyluronium
tetrafluoroborate (TBTU),
1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium
3-oxid hexafluorophosphate (HATU),
N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline (EEDQ),
N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide (EDC),
2-chloro-1,3-dimethylimidazolidinium hexafluorophosphate (CIP),
2-chloro-4,6-dimethoxy-1,3,5-triazine (CDMT), and
carbonyldiimidazole (CDI). In some examples, a carboxylic acid is
first converted to an activated carboxylic ester before treating
the activated carboxylic ester with an amine to form an amide bond.
In certain embodiments, the carboxylic acid is treated with a
reagent. The reagent activates the carboxylic acid by deprotonating
the carboxylic acid and then forming a product complex with the
deprotonated carboxylic acid as a result of nucleophilic attack by
the deprotonated carboxylic acid onto the protonated reagent. The
activated carboxylic esters for certain carboxylic acids are
subsequently more susceptible to nucleophilic attack by an amine
than the carboxylic acid is before it is activated. This results in
amide bond formation. As such, the carboxylic acid is described as
activated. Exemplary reagents include DCC and DIC.
[0086] As used herein, "regioisomer," "regioisomers," or "mixture
of regioisomers" refers to the product(s) of 1,3-cycloadditions or
strain-promoted alkyne-azide cycloadditions (SPAACs)--otherwise
known as click reactions--that derive from suitable azides (e.g.,
--N.sub.3, or PEG-N.sub.3 derivatized antibodies) treated with
suitable alkynes. In certain embodiments, for example, regioisomers
and mixtures of regioisomers are characterized by the click
reaction products shown below:
##STR00012##
In certain embodiments, more than one suitable azide and more than
one suitable alkyne can be utilized within a synthetic scheme en
route to a product, where each pair of azide-alkyne can participate
in one or more independent click reactions to generate a mixture of
regioisomeric click reaction products. For example, a person of
skill will recognize that a first suitable azide may independently
react with a first suitable alkyne, and a second suitable azide may
independently react with a second suitable alkyne, en route to a
product, resulting in the generation of four possible click
reaction regioisomers or a mixture of the four possible click
reaction regioisomers in a sample of an ADC described herein. By
way of further example, a person of skill will recognize that a
first suitable azide may independently react with a first suitable
alkyne, and a second suitable azide may independently react with a
second suitable alkyne, en route to a product, resulting in the
generation of four possible click reaction regioisomers or a
mixture of the four possible click reaction regioisomers in a
sample of an LP described herein.
[0087] As used herein, the term "residue" refers to the chemical
moiety within a compound that remains after a chemical reaction.
For example, the term "amino acid residue" or "N-alkyl amino acid
residue" refers to the product of an amide coupling or peptide
coupling of an amino acid or a N-alkyl amino acid to a suitable
coupling partner; wherein, for example, a water molecule is
expelled after the amide or peptide coupling of the amino acid or
the N-alkylamino acid, resulting in the product having the amino
acid residue or N-alkyl amino acid residue incorporated
therein.
[0088] As used herein, "therapeutically effective amount" refers to
an amount (e.g., of a compound) that is sufficient to provide a
therapeutic benefit to a patient in the treatment or management of
a disease or disorder, or to delay or minimize one or more symptoms
associated with the disease or disorder.
[0089] Certain groups, moieties, substituents, and atoms are
depicted with a wiggly line that intersects a bond or bonds to
indicate the atom through which the groups, moieties, substituents,
atoms are bonded. For example, a phenyl group that is substituted
with a propyl group depicted as:
##STR00013##
has the following structure:
##STR00014##
As used herein, illustrations showing substituents bonded to a
cyclic group (e.g., aromatic, heteroaromatic, fused ring, and
saturated or unsaturated cycloalkyl or heterocycloalkyl) through a
bond between ring atoms are meant to indicate, unless specified
otherwise, that the cyclic group may be substituted with that
substituent at any ring position in the cyclic group or on any ring
in the fused ring group, according to techniques set forth herein
or which are known in the field to which the instant disclosure
pertains. For example, the group,
##STR00015##
wherein subscript q is an integer from 0 to 4 and in which the
positions of substituent R.sup.1 are described generically, i.e.,
not directly attached to any vertex of the bond line structure,
i.e., specific ring carbon atom, includes the following,
non-limiting examples of groups in which the substituent R.sup.1 is
bonded to a specific ring carbon atom:
##STR00016## ##STR00017## ##STR00018##
[0090] As used herein, the phrase "reactive linker," or the
abbreviation "RL" refers to a monovalent group that includes a
reactive group and spacer group, depicted for example, as
##STR00019##
wherein RG is the reactive group and SP is the spacer group. As
described herein, a reactive linker may include more than one
reactive group and more than one spacer group. The spacer group is
any divalent moiety that bridges the reactive group to another
group, such as a payload. The reactive linkers (RL), together with
the payloads to which they are bonded, provide intermediates
("linker-payloads") useful as synthetic precursors for the
preparation of the antibody conjugates described herein. The
reactive linker includes a reactive group ("RG"), which is a
functional group or moiety that is capable of reacting with a
reactive portion of another group, for instance, an antibody,
modified antibody, or antigen binding fragment thereof, or an
enhancement group. The moiety resulting from the reaction of the
reactive group with the antibody, modified antibody, or antigen
binding fragment thereof, together with the linking group, include
the "binding agent linker" ("BL") portion of the conjugate,
described herein. In certain embodiments, the "reactive group" is a
functional group or moiety (e.g., maleimide or N-hydroxysuccinimide
(NHS) ester) that reacts with a cysteine or lysine residue of an
antibody or antigen-binding fragment thereof. In certain
embodiments, the "reactive group" is a functional group or moiety
that is capable of undergoing a click chemistry reaction (see,
e.g., click chemistry, Huisgen Proc. Chem. Soc. 1961, Wang et al.
J. Am. Chem. Soc. 2003, and Agard et al. J. Am. Chem. Soc. 2004).
In some embodiments of said click chemistry reaction, the reactive
group is an alkyne that is capable of undergoing a
1,3-cycloaddition reaction with an azide. Such suitable reactive
groups include, but are not limited to, strained alkynes, e.g.,
those suitable for strain-promoted alkyne-azide cycloadditions
(SPAAC), cycloalkynes, e.g., cyclooctynes, benzannulated alkynes,
and alkynes capable of undergoing 1,3-cycloaddition reactions with
alkynes in the absence of copper catalysts. Suitable alkynes also
include, but are not limited to, dibenzoazacyclooctyne or
##STR00020##
dibenzocyclooctyne or
##STR00021##
biarylazacyclooctynone or
##STR00022##
difluorinated cyclooctyne or
##STR00023##
substituted, e.g., fluorinated alkynes, aza-cycloalkynes,
bicycle[6.1.0]nonyne or
##STR00024##
and derivatives thereof. Particularly useful alkynes include
and
##STR00025##
Linker-payloads including such reactive groups are useful for
conjugating antibodies that have been functionalized with azido
groups. Such functionalized antibodies include antibodies
functionalized with azido-polyethylene glycol groups. In certain
embodiments, such a functionalized antibody is derived by treating
an antibody having at least one glutamine residue, e.g., heavy
chain Gln295, with a compound bearing an an amino a group and an
azide group, in the presence of the enzyme transglutaminase.
[0091] In some examples, the reactive group is an alkyne, e.g.,
##STR00026##
which can react via click chemistry with an azide, e.g.,
##STR00027##
to form a click chemistry product, e.g.,
##STR00028##
In some examples, the group reacts with an azide on a modified
antibody or antigen binding fragment thereof. In some examples, the
reactive group is an alkyne, e.g.,
##STR00029##
which can react via click chemistry with an azide, e.g.,
##STR00030##
to form a click chemistry product, e.g.,
##STR00031##
In some examples, the reactive group is an alkyne, e.g.,
##STR00032##
which can react via click chemistry with an azide, e.g.,
##STR00033##
to form a click chemistry product, e.g.,
##STR00034##
In some examples, the reactive group is a functional group,
e.g.,
##STR00035##
which reacts with a cysteine residue on an antibody or
antigen-binding fragment thereof, to form a bond thereto, e.g.,
##STR00036##
wherein Ab refers to an antibody or antigen-binding fragment
thereof and S refers to the S atom on a cysteine residue through
which the functional group bonds to the Ab. In some examples, the
reactive group is a functional group, e.g.,
##STR00037##
which reacts with a lysine residue on an antibody or
antigen-binding fragment thereof, to form a bond thereto, e.g.,
##STR00038##
wherein Ab refers to an antibody or antigen-binding fragment
thereof and NH refers to the NH atom on a lysine side chain residue
through which the functional group bonds to the Ab.
[0092] As used herein, the phrase "biodegradable moiety" refers to
a moiety that degrades in vivo to non-toxic, biocompatible
components which can be cleared from the body by ordinary
biological processes. In some embodiments, a biodegradable moiety
completely or substantially degrades in vivo over the course of
about 90 days or less, about 60 days or less, or about 30 days or
less, where the extent of degradation is based on percent mass loss
of the biodegradable moiety, and wherein complete degradation
corresponds to 100% mass loss. Exemplary biodegradable moieties
include, without limitation, aliphatic polyesters such as
poly(s-caprolactone) (PCL), poly(3-hydroxybutyrate) (PHB),
poly(glycolic acid) (PGA), poly(lactic acid) (PLA) and its
copolymers with glycolic acid (i.e., poly(D,L-lactide-coglycolide)
(PLGA) (Vert M, Schwach G, Engel R and Coudane J (1998) J Control
Release 53(1-3):85-92; Jain R A (2000) Biomaterials
21(23):2475-2490; Uhrich K E, Cannizzaro S M, Langer R S and
Shakesheff K M (1999) Chemical Reviews 99(11):3181-3198; and Park T
G (1995) Biomaterials 16(15):1123-1130, each of which are
incorporated herein by reference in their entirety).
[0093] As used herein, the phrases "effective amount,"
"physiolocally effective amount," or "prophylactically effective
amount" refer to that amount of compound that is sufficient to
effect treatment, when administered to a subject in need of such
treatment. A "physiologically effective amount" of an active
substance indicates an efficacious amount of the active substances
to have a significant, externally observable effect on the patient.
Thus, a physiologically effective amount affects one or more of the
characteristics (e.g., phenotype) in the patient without the need
for special equipment to determine the effect. For example, a
physiologically effective amount of a compound disclosed herein has
a significant, externally observable effect on the behavior of the
patient by reducing one or more of the symptoms of the condition to
be treated. Accordingly, one can determine whether an efficacious
amount of the active substance has been administered by observing
the patient and observing whether changes have occurred in the
patient due to the active substance.
[0094] As used herein, the phrase "binding agent linker," or "BL"
refers to any divalent, trivalent, or multi-valent group or moiety
that links, connects, or bonds a binding agent (e.g., an antibody
or an antigen-binding fragment thereof) with a payload compound set
forth herein (e.g., bis-octahydrophenanthrene carboxamides) and,
optionally, with one or more side chain compounds. Generally,
suitable binding agent linkers for the antibody conjugates
described herein are those that are sufficiently stable to exploit
the circulating half-life of the antibody and, at the same time,
capable of releasing its payload after antigen-mediated
internalization of the conjugate. Linkers can be cleavable or
non-cleavable. Cleavable linkers are linkers that are cleaved by
intracellular metabolism following internalization, e.g., cleavage
via hydrolysis, reduction, or enzymatic reaction. Non-cleavable
linkers are linkers that release an attached payload via lysosomal
degradation of the antibody following internalization. Suitable
linkers include, but are not limited to, acid-labile linkers,
hydrolysis-labile linkers, enzymatically cleavable linkers,
reduction labile linkers, self-immolative linkers, and
non-cleavable linkers. Suitable linkers also include, but are not
limited to, those that are or comprise peptides, glucuronides,
succinimide-thioethers, polyethylene glycol (PEG) units,
hydrazones, mal-caproyl units, dipeptide units, valine-citruline
units, and para-aminobenzyl (PAB) units. In some embodiments, the
binding agent linker (BL) includes a moiety that is formed by the
reaction of the reactive group (RG) of a reactive linker (RL) and
reactive portion of the binding agent, e.g., antibody, modified
antibody, or antigen binding fragment thereof.
[0095] In some examples, the BL includes the following moiety:
##STR00039##
or the triazolyl regioisomer, wherein is the bond to the binding
agent. In some examples, the BL includes the following moiety:
##STR00040##
wherein is the bond to the binding agent. In some examples, the BL
includes the following moiety:
##STR00041##
or the triazolyl regioisomer, wherein is the bond to the binding
agent. In some examples, the BL includes the following moiety:
##STR00042##
wherein is the bond to the cysteine of the antibody or
antigen-binding fragment thereof. In some examples, the BL includes
the following moiety:
##STR00043##
wherein is the bond to the lysine of the antibody or
antigen-binding fragment thereof.
Compounds and Payloads
[0096] In some examples, set forth herein is a compound having the
structure of Formula (I):
##STR00044##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form wherein [0097] each of Q.sup.1 and Q.sup.2 is, independently,
--CH.sub.2--, --C(O)--, --C(H)(OH)--, or --C(OH).sub.2--; [0098] W
is --CH.sub.2--, --N(H)--, or --O--; [0099] R.sup.1 is --H, --OH,
--NH.sub.2, alkyl, or --OP(O)(OR.sup.6).sub.2; [0100] R.sup.2 is
--H, --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5, wherein R.sup.1 and R.sup.2 are not simultaneously
--H; [0101] R.sup.3 is --N(R.sup.6).sub.2; [0102] R.sup.4 is
--X--Y--Z; [0103] X is selected from the group consisting of --O--
and --N(H)--; [0104] Y is selected from the group consisting of
alkylene, substituted alkylene (including, without limitation, oxo
substitution, i.e., .dbd.O), heteroalkylene, and substituted
heteroalkylene (including without limitation, oxo substitution
(i.e., .dbd.O)); [0105] Z is selected from the group consisting of
--OH and --NH.sub.2; [0106] R.sup.5 is alkyl, heterocycloalkyl or
substituted heterocycloalkyl, wherein each heterocycloalkyl or
substituted heterocycloalkyl includes one, two, or three
heteroatoms selected from nitrogen and oxygen, and includes at
least one --OH and --CH.sub.2OH substituent, or at least one
primary or secondary nitrogen, for instance, O-glucose; [0107] each
R.sup.6 is in each instance, --H, an amino acid residue, an N-alkyl
amino acid residue, a peptide, or alkyl; and [0108] each R.sup.7
is, independently, halo, C.sub.1-6 alkyl, C.sub.1-6 alkoxy, --CN,
O-glucose, O-amino acid residue, and O-PEG.sub.n, wherein each n is
an integer from 0-3.
[0109] In Formula I, in certain embodiments, R.sup.5 is
heterocycloalkyl or substituted heterocycloalkyl. Useful
heterocycloalkyl groups include tetrahydropyranyl, glycosidyl, and
piperazinyl. These groups can be substituted or unsubstituted. In
certain embodiments, they are unsubstituted. In certain
embodiments, they are substituted. Exemplary substituents include
at least one hydroxyl, at least one primary nitrogen, or at least
one secondary nitrogen.
[0110] In certain embodiments of Formula I, R.sup.6 is
independently in each instance an amino acid residue, an N-alkyl
amino acid residue, or a peptide. Those of skill in the art will
recognize that the amino acid residue may be achiral or chiral, for
example, L-amino acid or D-amino acid. The amino acids generally
include an amino acid side chain. The side chain can be the side
chain of any amino acids known to those of skill. In certain
embodiments, the side chain is the side chain of histidine,
alanine, isoleucine, arginine, leucine, asparagine, lysine,
aspartic acid, methionine, cysteine, phenylalanine, glutamic acid,
threonine, glutamine, tryptophan, valine, ornithine,
selenocysteine, serine, glycine, homoglycine (e.g.,
.beta.-homoglycine), or tyrosine. Those of skill in the art will
recognize that the peptide may be achiral or chiral, for example,
including racemic DL-amino acids or non-racemic D- or L-amino acids
and diastereomeric mixtures thereof. The side chains of the
peptides are as described in the context of amino acids, above.
Those of skill in the art will recognize that the N-alkyl amino
acid residue includes an alkyl substituent, as defined herein, at
the terminal amino group of the amino acid residue or the terminal
amino group of the peptide. Examples include N-methyl amino acids
and N-ethyl amino acids.
[0111] In Formula I, in certain embodiments, each R.sup.7 is halo,
C.sub.1-6 alkyl, C.sub.1-6 alkoxy, --CN, O-glucose, O-amino acid
residue, or O-PEG.sub.n, wherein each n is an integer from 0-3. In
certain embodiments, O-amino acid residue includes HO-amino acid
residue as defined above. In one embodiment, O-PEG.sub.n is where
n=0. In another embodiment, O-PEG.sub.n is where n=1. In another
embodiment, O-PEG.sub.n is where n=2. In another embodiment,
O-PEG.sub.n is where n=3.
[0112] In some examples, set forth herein is a compound having the
structure of Formula (Ia):
##STR00045##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form, wherein [0113] each of Q.sup.1 and Q.sup.2 is, independently,
--CH.sub.2--, --C(O)--, --C(H)(OH)--, or --C(OH).sub.2--; [0114] W
is --CH.sub.2--, --N(H)--, or --O--; [0115] R.sup.1 is --H, --OH,
--NH.sub.2, alkyl, or --OP(O)(OR.sup.6)(OH)--OP(O)(OR.sup.6).sub.2;
[0116] R.sup.2 is --H, --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4,
R.sup.5, or --O--R.sup.5, wherein R.sup.1 and R.sup.2 are not
simultaneously --H; [0117] R.sup.3 is --N(R.sup.6).sub.2; [0118]
R.sup.4 is --X--Y--Z; [0119] X is selected from the group
consisting of --O-- and --N(H)--; [0120] Y is selected from the
group consisting of alkylene, substituted alkylene (including,
without limitation, oxo substitution, i.e., .dbd.O),
heteroalkylene, and substituted heteroalkylene (including, without
limitation, oxo substitution (i.e., .dbd.O)); [0121] Z is selected
from the group consisting of --OH and --NH.sub.2; [0122] R.sup.5 is
alkyl, heterocycloalkyl, or substituted heterocycloalkyl, wherein
each heterocycloalkyl or substituted heterocycloalkyl includes one,
two, or three heteroatoms selected from nitrogen and oxygen, and
includes at least one --OH and --CH.sub.2OH substituent, or at
least one primary or secondary nitrogen, for instance, O-glucose;
[0123] each R.sup.6 is in each instance, --H, an amino acid
residue, an N-alkyl amino acid residue, a peptide, or alkyl; and
[0124] each R.sup.7 is, independently, halo, C.sub.1-6 alkyl,
C.sub.1-6 alkoxy, --CN, O-glucose, O-amino acid residue, and
O-PEG.sub.n, wherein each n is an integer from 0-3.
[0125] In Formula Ia, in certain embodiments, R.sup.5 is
heterocycloalkyl or substituted heterocycloalkyl. Useful
heterocycloalkyl groups include tetrahydropyranyl, glycosidyl, and
piperazinyl. These groups can be substituted or unsubstituted. In
certain embodiments, they are unsubstituted. In certain
embodiments, they are substituted. Exemplary substituents include
at least one hydroxyl, at least one primary nitrogen, or at least
one secondary nitrogen.
[0126] In certain embodiments of Formula Ia, R.sup.6 is
independently in each instance an amino acid residue, N-alkyl amino
acid residue, or a peptide. Those of skill in the art will
recognize that the amino acid residue may be achiral or chiral, for
example, L-amino acid or D-amino acid. The amino acids generally
include an amino acid side chain. The side chain can be the side
chain of any amino acids known to those of skill. In certain
embodiments, the side chain is the side chain of histidine,
alanine, isoleucine, arginine, leucine, asparagine, lysine,
aspartic acid, methionine, cysteine, phenylalanine, glutamic acid,
threonine, glutamine, tryptophan, valine, ornithine,
selenocysteine, serine, glycine, homoglycine (e.g.,
.beta.-homoglycine), or tyrosine. Those of skill in the art will
recognize that the peptide may be achiral or chiral, for example,
including racemic DL-amino acids or non-racemic D- or L-amino acids
and diastereomeric mixtures thereof. The side chains of the
peptides are as described in the context of amino acids, above.
Those of skill in the art will recognize that the N-alkyl amino
acid residue includes an alkyl substituent, as defined herein, at
the terminal amino group of the amino acid or the terminal amino
group of the peptide.
[0127] In Formula Ia, in certain embodiments, R.sup.7 is halo,
C.sub.1-6 alkyl, C.sub.1-6 alkoxy, --CN, O-glucose, O-amino acid
residue, or O-PEG.sub.n, wherein each n is an integer from 0-3. In
certain embodiments, O-amino acid residue includes HO-amino acid
residue as defined above. In one embodiment, O-PEG.sub.n is where
n=0. In another embodiment, O-PEG.sub.n is where n=1. In another
embodiment, O-PEG.sub.n is where n=2. In yet another embodiment,
O-PEG.sub.n is where n=3.
[0128] In one embodiment of Formula I or Ia, Q.sup.1 is
--CH.sub.2-- and Q.sup.2 is --C(O)--. In another embodiment,
Q.sup.1 is --C(H)(OH)-- and Q.sup.2 is --C(O)--. In another
embodiment, Q.sup.1 is --C(O)-- and Q.sup.2 is --C(O)--. In yet
another embodiment, Q.sup.1 is --C(O)-- and Q.sup.2 is
--CH.sub.2--. In still yet another embodiment, Q.sup.1 is --C(O)--
and Q.sup.2 is --C(H)(OH)--.
[0129] In one embodiment of Formula I or Ia, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, and W is --CH.sub.2--. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --CH.sub.2NH.sub.2.
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.3. In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.4. In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
--O--R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and
R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00046##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --OH and R.sup.2 is selected from the group consisting
of amino, dimethylamino, hydroxyl,
##STR00047##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2
is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2
and R.sup.2 is --OH. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --NH.sub.2 and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.3. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.4.
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2
is R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2
is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --NH.sub.2 and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00048##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is alkyl and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is alkyl and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is alkyl and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is alkyl and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--,
and R.sup.1 is alkyl and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00049##
[0130] In another embodiment of Formula I or Ia, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OP(O)(OR.sup.6)(OH) and R.sup.2 is
--H. In any one of the foregoing embodiments in this paragraph,
R.sup.6 may be selected from the group consisting of hydroxyl and
methyl.
[0131] In one embodiment of Formula I or Ia, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, and W is --O--. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2,
R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --H and R.sup.2 is --OH. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--H and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --H and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --H and R.sup.2 is R.sup.4. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --H and R.sup.2 is R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --H and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--,
and R.sup.1 is --H and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00050##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is selected from the
group consisting of amino, dimethylamino, hydroxyl,
##STR00051##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--RS. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --CH.sub.2NH.sub.2.
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
R.sup.3. In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
R.sup.4. In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--O--R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2
and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00052##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is selected from the
group consisting of amino, dimethylamino, hydroxyl,
##STR00053##
[0132] In another embodiment of Formula I or Ia, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0133] In one embodiment of Formula I or Ia, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, and W is --NH--. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2,
R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--W is --NH--, and
R.sup.1 is --H and R.sup.2 is --OH. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--H and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is R.sup.4. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--,
and R.sup.1 is --H and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00054##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is selected from the
group consisting of amino, dimethylamino, hydroxyl,
##STR00055##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --CH.sub.2--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00056##
In another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is
--C(O)--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.1, or --O--RS. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In
another embodiment, Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is selected from
the group consisting of amino, dimethylamino, hydroxyl,
##STR00057##
[0134] In another embodiment of Formula I or Ia, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --CH.sub.2--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0135] In one embodiment of Formula I or Ia, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, and W is --CH.sub.2--. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --CH.sub.2NH.sub.2.
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.3. In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.4. In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --H and
R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00058##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --OH and R.sup.2 is selected from the group consisting
of amino, dimethylamino, hydroxyl,
##STR00059##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2
is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2
and R.sup.2 is --OH. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --NH.sub.2 and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.3. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.4.
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2
is R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2
is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --NH.sub.2 and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00060##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is alkyl and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--W is --CH.sub.2--, and R.sup.1 is
alkyl and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is alkyl and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is alkyl and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--,
and R.sup.1 is alkyl and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00061##
[0136] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --OH or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OP(O)(OR.sup.6)(OH) and R.sup.2 is
--H. In any one of the foregoing embodiments in this paragraph,
R.sup.6 may be selected from the group consisting of hydroxyl and
methyl.
[0137] In one embodiment of Formula I or Ia, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, and W is --O--. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2,
R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(H,OH)--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --H and R.sup.2 is --OH. In another embodiment, Q.sup.1
is --C(H,OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1
is --C(H,OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--C(H,OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--C(H,OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is
--C(H,OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--CH.sub.2--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1
is --H and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00062##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00063##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --NH.sub.2 and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00064##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O-- and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00065##
[0138] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0139] In one embodiment of Formula I or Ia, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, and W is --NH--. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2,
R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is --OH. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--H and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is R.sup.4. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is R.sup.5. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00066##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--RS. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH-- and R.sup.1 is --OH and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00067##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(H)(OH)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --NH.sub.2 and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00068##
In another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is
--C(O)--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is alkyl and R.sup.2 is selected from the
group consisting of amino, dimethylamino, hydroxyl,
##STR00069##
[0140] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --C(H)(OH)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0141] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, and W is --CH.sub.2--. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3,
R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is
--H and R.sup.2 is --OH. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is
--H and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --H and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --H and R.sup.2 is R.sup.4. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --H and R.sup.2 is R.sup.5. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --H and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and
R.sup.1 is --H and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00070##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is
--OH and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00071##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --OH. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2
and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2
and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2
and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2
and R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00072##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is
alkyl and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00073##
[0142] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --CH.sub.2--, and R.sup.1 is
--OH or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--CH.sub.2--, and R.sup.1 is --OP(O)(OR.sup.6)(OH) and R.sup.2 is
--H. In any one of the foregoing embodiments in this paragraph,
R.sup.6 may be selected from the group consisting of hydroxyl and
methyl.
[0143] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, and W is --O--. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5,
or --O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H and R.sup.2 is
--OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --H and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --H and R.sup.2 is
R.sup.3. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(O)--, W is --O--, and R.sup.1 is --H and R.sup.2 is R.sup.4. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --H and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --H and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --H and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00074##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1
is --OH and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --OH and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --OH and R.sup.2 is
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(O)--, W is --O--, and R.sup.1 is --OH and R.sup.2 is
selected from the group consisting of amino, dimethylamino,
hydroxyl,
##STR00075##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is selected from the group
consisting of amino, dimethylamino,
##STR00076##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--,
and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1
is alkyl and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is alkyl and R.sup.2
is --O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is alkyl and R.sup.2
is selected from the group consisting of amino, dimethylamino,
hydroxyl,
##STR00077##
[0144] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is --OH or
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1
is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --O--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0145] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, and W is --NH--. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1
is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4,
R.sup.5, or --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --H and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --H and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --H and R.sup.2 is
R.sup.3. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(O)--, W is --NH--, and R.sup.1 is --H and R.sup.2 is R.sup.4.
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is --H and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--,
and R.sup.1 is --H and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--,
and R.sup.1 is --H and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00078##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--,
and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--,
and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1
is --OH and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --OH and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --OH and R.sup.2
is --O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --OH and R.sup.2
is selected from the group consisting of amino, dimethylamino,
hydroxyl,
##STR00079##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.3. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.4. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is selected from the
group consisting of amino, dimethylamino, hydroxyl,
##STR00080##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W
is --NH--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is
--NH--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--,
and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--,
and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1
is alkyl and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is alkyl
and R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is alkyl and R.sup.2
is --O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is alkyl and R.sup.2
is selected from the group consisting of amino, dimethylamino,
hydroxyl,
##STR00081##
[0146] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is --OH or
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1
is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(O)--, W is --NH--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0147] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, and W is --CH.sub.2--. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --CH.sub.2NH.sub.2.
In another embodiment, Q.sup.1 is --C(O)--Q.sup.2 is --CH.sub.2--,
W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is R.sup.3. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is R.sup.4. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is selected from
the group consisting of amino, dimethylamino, hydroxyl,
##STR00082##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2
is --OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00083##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.3. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.4.
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00084##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is alkyl and R.sup.2
is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1 is alkyl
and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and
R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--,
and R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--,
and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--,
and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is selected from the
group consisting of amino, dimethylamino, hydroxyl,
##STR00085##
[0148] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --CH.sub.2--, and R.sup.1
is --OH or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--CH.sub.2--, and R.sup.1 is --OP(O)(OR.sup.6)(OH) and R.sup.2 is
--H. In any one of the foregoing embodiments in this paragraph,
R.sup.6 may be selected from the group consisting of hydroxyl and
methyl.
[0149] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, and W is --O--. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and
R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3,
R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is
--H and R.sup.2 is --OH. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --H
and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is
--H and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --H
and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --H and R.sup.2
is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --O--, and R.sup.1 is --H and R.sup.2 is
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --CH.sub.2--, W is --O--, and R.sup.1 is --H and R.sup.2 is
selected from the group consisting of amino, dimethylamino,
hydroxyl,
##STR00086##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --O--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --O--, and
R.sup.1 is --OH and R.sup.2 is --OH. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is
--OH and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is R.sup.4. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is R.sup.5. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is --O--RS. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is selected from the group consisting
of amino, dimethylamino, hydroxyl,
##STR00087##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --CH.sub.2--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2
is --OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00088##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00089##
[0150] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --O--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0151] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, and W is --NH--. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3,
R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --CH.sub.2--W is --NH--, and R.sup.1 is --H
and R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --H and
R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --H
and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --H and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --H and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --H and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --H
and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00090##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00091##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --CH.sub.2--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2
is --OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --OH
and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00092##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --CH.sub.2--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is
--OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--CH.sub.2--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH-- and R.sup.1 is alkyl
and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00093##
[0152] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --CH.sub.2--, W is --NH--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0153] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, and W is --CH.sub.2--. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--CH.sub.2--, and R.sup.1 is --H and R.sup.2 is --CH.sub.2NH.sub.2.
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.3. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.4. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2 is
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --H and R.sup.2
is selected from the group consisting of amino, dimethylamino,
hydroxyl
##STR00094##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.1. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2
is --OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --OH and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1
is --OH and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00095##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is --CH.sub.2NH.sub.2. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.3. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and R.sup.2 is R.sup.4.
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is --O--R.sup.5. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--,
and R.sup.1 is --NH.sub.2 and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00096##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is alkyl and R.sup.2
is --OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is alkyl and
R.sup.2 is --OH. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1 is alkyl
and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and
R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)-- W is --CH.sub.2--, and
R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--,
and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--,
and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--CH.sub.2--, and R.sup.1 is alkyl and R.sup.2 is selected from the
group consisting of amino, dimethylamino, hydroxyl,
##STR00097##
[0154] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --CH.sub.2--, and R.sup.1
is --OH or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--CH.sub.2--, and R.sup.1 is --OH and R.sup.2 is --H. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--CH.sub.2--, and R.sup.1 is --OP(O)(OR.sup.6)(OH) and R.sup.2 is
--H. In any one of the foregoing embodiments in this paragraph,
R.sup.6 may be selected from the group consisting of hydroxyl and
methyl.
[0155] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, and W is --O--. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and
R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3,
R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is
--H and R.sup.2 is --OH. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is
--H and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --H
and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --H and R.sup.2
is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --O--, and R.sup.1 is --H and R.sup.2 is
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --O--, and R.sup.1 is --H and R.sup.2 is
selected from the group consisting of amino, dimethylamino,
hydroxyl,
##STR00098##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --O--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --O--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --O--, and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is --OH and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00099##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2
is --OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --O--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00100##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--O--, and R.sup.1 is alkyl and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00101##
[0156] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --O--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0157] In one embodiment of Formula I or Ia, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, and W is --NH--. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and
R.sup.1 is --H and R.sup.2 is --OH, --CH.sub.2NH.sub.2, R.sup.3,
R.sup.4, R.sup.5, or --O--R.sup.5. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is
--H and R.sup.2 is --OH. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --H
and R.sup.2 is --CH.sub.2NH.sub.2. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is
--H and R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --H
and R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --H and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --H and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --H
and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00102##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or --O--R.sup.5. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is --OH. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --CH.sub.2NH.sub.2. In
another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W
is --NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.3. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.4. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is --O--R.sup.5. In another
embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is
--NH--, and R.sup.1 is --OH and R.sup.2 is selected from the group
consisting of amino, dimethylamino, hydroxyl,
##STR00103##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2
is --OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --NH--, and R.sup.1 is --NH.sub.2 and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --NH.sub.2 and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is
--NH.sub.2 and R.sup.2 is selected from the group consisting of
amino, dimethylamino, hydroxyl,
##STR00104##
In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is
--OH, --CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.5, or
--O--R.sup.5. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2
is --C(H)(OH)--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is
--OH. In another embodiment, Q.sup.1 is --C(O)--, Q.sup.2 is
--C(H)(OH)--, W is --NH--, and R.sup.1 is alkyl and R.sup.2 is
--CH.sub.2NH.sub.2. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.3. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.4. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is R.sup.5. In another embodiment, Q.sup.1 is --C(O)--,
Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is alkyl and
R.sup.2 is --O--R.sup.5. In another embodiment, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is
alkyl and R.sup.2 is selected from the group consisting of amino,
dimethylamino, hydroxyl,
##STR00105##
[0158] In another embodiment of Formula I or Ia, Q.sup.1 is
--C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is --OH
or --OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In another embodiment,
Q.sup.1 is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and
R.sup.1 is --OH and R.sup.2 is --H. In another embodiment, Q.sup.1
is --C(O)--, Q.sup.2 is --C(H)(OH)--, W is --NH--, and R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --H. In any one of the
foregoing embodiments in this paragraph, R.sup.6 may be selected
from the group consisting of hydroxyl and methyl.
[0159] In some examples, set forth herein is a compound having the
structure of Formula (Ib):
##STR00106##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form, wherein [0160] W is --CH.sub.2--, --N(H)--, or --O--; [0161]
R.sup.1 is --H, --OH, --NH.sub.2, alkyl, or
--OP(O)(OR.sup.6).sub.2; [0162] R.sup.2 is --H, --OH,
--CH.sub.2NH.sub.2, R.sup.3, R.sup.4, R.sup.1, or --O--R.sup.1,
wherein R.sup.1 and R.sup.2 are not simultaneously --H; [0163]
R.sup.3 is --N(R.sup.6).sub.2; [0164] R.sup.4 is --X--Y--Z; [0165]
X is selected from the group consisting of --O-- and --N(H)--;
[0166] Y is selected from the group consisting of alkylene,
substituted alkylene (including, without limitation, oxo
substitution, (i.e., .dbd.O)), heteroalkylene, and substituted
heteroalkylene (including, without limitation, oxo substitution
(i.e., .dbd.O)); [0167] Z is selected from the group consisting of
--OH and --NH.sub.2; [0168] R.sup.5 is alkyl, heterocycloalkyl, or
substituted heterocycloalkyl, wherein each heterocycloalkyl or
substituted heterocycloalkyl includes one, two, or three
heteroatoms selected from nitrogen and oxygen, and includes at
least one --OH and --CH.sub.2OH substituent, or at least one
primary or secondary nitrogen, for instance, O-glucose; [0169] each
R.sup.6 is in each instance, --H, an amino acid residue, an N-alkyl
amino acid residue, a peptide, or alkyl; and [0170] each R.sup.7
is, independently, halo, C.sub.1-6 alkyl, C.sub.1-6 alkoxy, --CN,
O-glucose, O-amino acid residue, and O-PEG.sub.n, wherein each n is
an integer from 0-3.
[0171] In Formula Ib, in certain embodiments, R.sup.5 is
heterocycloalkyl or substituted heterocycloalkyl. Useful
heterocycloalkyl groups include tetrahydropyranyl, glycosidyl, and
piperazinyl. These groups can be substituted or unsubstituted. In
certain embodiments, they are unsubstituted. In certain
embodiments, they are substituted. Exemplary substituents include
at least one hydroxyl, at least one primary nitrogen, or at least
one secondary nitrogen.
[0172] In certain embodiments of Formula Ib, R.sup.6 is
independently in each instance an amino acid residue, N-alkyl amino
acid residue, or a peptide. Those of skill in the art will
recognize that the amino acid residue may be achiral or chiral, for
example, L-amino acid or D-amino acid. The amino acids generally
include an amino acid side chain. The side chain can be the side
chain of any amino acids known to those of skill. In certain
embodiments, the side chain is the side chain of histidine,
alanine, isoleucine, arginine, leucine, asparagine, lysine,
aspartic acid, methionine, cysteine, phenylalanine, glutamic acid,
threonine, glutamine, tryptophan, valine, ornithine,
selenocysteine, serine, glycine, homoglycine (e.g.,
.beta.-homoglycine), or tyrosine. Those of skill in the art will
recognize that the peptide may be achiral or chiral, for example,
including racemic DL-amino acids or non-racemic D- or L-amino acids
and diastereomeric mixtures thereof. The side chains of the
peptides are as described in the context of amino acids, above.
Those of skill in the art will recognize that the N-alkyl amino
acid residue includes an alkyl substituent, as defined herein, at
the terminal amino group of the amino acid or the terminal amino
group of the peptide.
[0173] In Formula Ib, in certain embodiments, R.sup.7 is halo,
C.sub.1-6 alkyl, C.sub.1-6 alkoxy, --CN, O-glucose, O-amino acid
residue, or O-PEG.sub.n, wherein each n is an integer from 0-3. In
certain embodiments, O-amino acid residue includes HO-amino acid
residue as defined above. In one embodiment, O-PEG.sub.n is where
n=0. In another embodiment, O-PEG.sub.n is where n=1. In another
embodiment, O-PEG.sub.n is where n=2. In yet another embodiment,
O-PEG.sub.n is where n=3.
[0174] In one embodiment of Formula Ib, R.sup.1 is --OH. In another
embodiment, R.sup.1 is --OH and R.sup.2 is
--O--(CH.sub.2).sub.n--Z, where n is an integer from one to four.
In certain embodiments, R.sup.1 is --OH, R.sup.2 is
--O--(CH.sub.2).sub.n--Z, and n is one. In certain embodiments,
R.sup.1 is --OH, R.sup.2 is --O--(CH.sub.2).sub.n--Z, and n is two.
In certain embodiments, R.sup.1 is --OH, R.sup.2 is
--O--(CH.sub.2).sub.n--Z, and n is three. In certain embodiments,
R.sup.1 is --OH, R.sup.2 is --O--(CH.sub.2).sub.n--Z, and n is
four.
[0175] In one embodiment of Formula Ib, R.sup.1 is --OH and R.sup.2
is --N(H)C(O)--(CH.sub.2).sub.n--NH.sub.2, where n is an integer
from one to four. In certain embodiments, R.sup.1 is --OH, R.sup.2
is --N(H)C(O)--(CH.sub.2).sub.n--NH.sub.2, and n is one. In certain
embodiments, R.sup.1 is --OH, R.sup.2 is
--N(H)C(O)--(CH.sub.2).sub.n--NH.sub.2, and n is two. In certain
embodiments, R.sup.1 is --OH, R.sup.2 is
--N(H)C(O)--(CH.sub.2).sub.n--NH.sub.2, and n is three. In certain
embodiments, R.sup.1 is --OH, R.sup.2 is
--N(H)C(O)--(CH.sub.2).sub.n--NH.sub.2, and n is four.
[0176] In one embodiment of Formula Ib, R.sup.1 is --OH and R.sup.2
is --N(H)C(O)--(CRR).sub.n--NH.sub.2, where each R is --H, --OH, or
--CH.sub.2OH, and where n is an integer from one to four. In
certain embodiments, R.sup.1 is --OH, R.sup.2 is
--N(H)C(O)--(CRR).sub.n--NH.sub.2, each R is --H, and n is an
integer from one to four. In certain embodiments, R.sup.1 is --OH,
R.sup.2 is --N(H)C(O)--(CRR).sub.n--NH.sub.2, each R is --OH, and n
is an integer from one to four. In certain embodiments, R.sup.1 is
--OH, R.sup.2 is --N(H)C(O)--(CRR).sub.n--NH.sub.2, each R is
--CH.sub.2OH, and n is an integer from one to four. In any one of
the foregoing embodiments in this paragraph, n is one. In any one
of the foregoing embodiments in this paragraph, n is two. In any
one of the foregoing embodiments in this paragraph, n is three. In
any one of the foregoing embodiments in this paragraph, n is
four.
[0177] In one embodiment of Formula Ib, R.sup.1 is --OH and R.sup.2
is N-piperazinyl. In another embodiment, R.sup.1 is --OH and
R.sup.2 is --N(R.sup.6).sub.2. In another embodiment, R.sup.1 is
--OH and R.sup.2 is N-serinyl. In yet another embodiment, R.sup.1
is --OH and R.sup.2 is O-glycosyl.
[0178] In one embodiment of Formula Ib, R.sup.1 is
--OP(O)(OR.sup.6)(OH) and R.sup.2 is --NH.sub.2.
[0179] In certain embodiments, provided herein are compounds
according to any of Formulae I, Ia, and Ib may be selected from the
group consisting of:
##STR00107## ##STR00108## ##STR00109##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof.
Conjugates Antibody Drug Conjugates (ADCs)
[0180] Provided herein are conjugates of Formula A:
##STR00110##
[0181] or a pharmaceutically acceptable salt, solvate, or
stereoisomeric form thereof, wherein
[0182] L is a linker or X--Y--Z, wherein X is --NH-- or --O--; Y is
an enzymatically cleavable moiety, a self-immolative group, an
acid-labile moiety, PEG.sub.n, a sugar moiety, or an enhancement
group; and Z is a binding agent linker (BL) wherein Z is covalently
bound to BA; [0183] BA is a binding agent; [0184] k is an integer
from 1 to 30; [0185] each of Q.sup.1 and Q.sup.2 is independently
--CH.sub.2--, --C(O)--, --C(H)(OH)--, or --C(OH).sub.2--; [0186] W
is --CH.sub.2--, --N(H)--, or --O--; R is --H, --OR.sup.6, --OH,
--NH.sub.2, alkyl, or --OP(O)(OR.sup.6).sub.2; [0187] each R.sup.6
is, independently in each instance, --H, an amino acid residue, a
peptide, or alkyl; and [0188] wherein R.sup.1, R.sup.2, R.sup.3,
R.sup.4, and R.sup.5 are as described in the context of Formula I.
Exemplary enzymatically cleavable moieties include, but are not
limited to, any di- or tri-peptides (e.g., VC-PAB and VA, as
described elsewhere herein). Exemplary self-immolative groups are
described elsewhere herein. Exemplary acid-labile moieties include,
but are not limited to, alkoxamines, ketoxamines, carbonates, or
phosphonates. Exemplary enhancement groups are described elsewhere
herein. Exemplary reactive moieties are described elsewhere herein.
In certain embodiments, Y does not include PEG. In certain
embodiments, an amino acid may be used to connect the payload,
enhancement group, and antibody (each as described elsewhere
herein) to one another, as described and apparent elsewhere herein.
Connection of the payload, enhancement group, and antibody via the
amino acid may be carried out by amide coupling reactions,
thio-Michael additions, or phenol-O-alkylations as would be
appreciated by those of skill in the art. For example, the amino
acid that connects the payload, enhancement group, and antibody is
lysine. By way of further example, in one embodiment, the amino
acid that connects the payload, enhancement group, and antibody is
D-lysine. By way of further example, in one embodiment, the amino
acid that connects the payload, enhancement group, and antibody is
aspartic acid. By way of further example, in one embodiment, the
amino acid that connects the payload, enhancement group, and
antibody is glutamic acid. By way of further example, in one
embodiment, the amino acid that connects the payload, enhancement
group, and antibody is serine. By way of further example, in one
embodiment, the amino acid that connects the payload, enhancement
group, and antibody is cysteine. By way of further example, in one
embodiment, the amino acid that connects the payload, enhancement
group, and antibody is tyrosine.
[0189] Provided herein are conjugates of Formula (A):
##STR00111##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, wherein
[0190] L is a linker;
[0191] BA is a binding agent;
[0192] k is an integer from 1 to 30;
[0193] R is --H, R.sup.1 or R.sup.2; and
[0194] Q.sup.1, Q.sup.2, W, R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.5, R.sup.6, R.sup.7, X, Y, and Z are as described in the
context of Formula I. In certain embodiments, R is R.sup.1.
[0195] Provided herein are compounds of Formula (Aa):
##STR00112##
or a pharmaceutically acceptable salt thereof, wherein
[0196] L is a linker;
[0197] BA is a binding agent;
[0198] k is an integer from 1 to 30;
[0199] R is --H, R.sup.1 or R.sup.2; and
[0200] Q.sup.1, Q.sup.2, W, R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.5, R.sup.6, R.sup.7, X, Y, and Z are as described in the
context of Formula Ia. In certain embodiments, R is R.sup.1.
[0201] Provided herein are compounds of Formula (Ab):
##STR00113##
or a pharmaceutically acceptable salt thereof, wherein
[0202] L is a linker;
[0203] BA is a binding agent;
[0204] k is an integer from 1 to 30;
[0205] R is --H, R.sup.1 or R.sup.2; and
[0206] R.sup.1, R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6,
R.sup.7, X, Y, and Z are as described in the context of Formula Ib.
In certain embodiments, R is R.sup.1.
Binding Agents
[0207] Suitable binding agents for any of the conjugates provided
in the instant disclosure include, but are not limited to,
antibodies, lymphokines, hormones, growth factors, viral receptors,
interleukins, or any other cell binding or peptide binding
molecules or substances.
[0208] In some embodiments, the binding agent is an antibody or an
antigen-binding fragment thereof. The antibody can be in any form
known to those of skill in the art. The term "antibody", as used
herein, refers to any antigen-binding molecule or molecular complex
comprising at least one complementarity determining region (CDR)
that specifically binds to or interacts with a particular antigen.
The term "antibody" includes immunoglobulin molecules comprising
four polypeptide chains, two heavy (H) chains and two light (L)
chains inter-connected by disulfide bonds, as well as multimers
thereof (e.g., IgM). Each heavy chain comprises a heavy chain
variable region (abbreviated herein as HCVR or V.sub.H) and a heavy
chain constant region. The heavy chain constant region comprises
three domains, C.sub.H1, C.sub.H2 and C.sub.H3. Each light chain
comprises a light chain variable region (abbreviated herein as LCVR
or V.sub.L) and a light chain constant region. The light chain
constant region comprises one domain (C.sub.L1). The V.sub.H and
V.sub.L regions can be further subdivided into regions of
hypervariability, termed complementarity determining regions
(CDRs), interspersed with regions that are more conserved, termed
framework regions (FR). Each V.sub.H and V.sub.L is composed of
three CDRs and four FRs, arranged from amino-terminus to
carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3,
CDR3, FR4. In different embodiments of the invention, the FRs of
the antibodies (or antigen-binding portion thereof) suitable for
the compounds herein may be identical to the human germline
sequences, or may be naturally or artificially modified. An amino
acid consensus sequence may be defined based on a side-by-side
analysis of two or more CDRs. The term "antibody", as used herein,
also includes antigen-binding fragments of full antibody molecules.
The terms "antigen-binding portion" of an antibody,
"antigen-binding fragment" of an antibody, and the like, as used
herein, include any naturally occurring, enzymatically obtainable,
synthetic, or genetically engineered polypeptide or glycoprotein
that specifically binds an antigen to form a complex.
Antigen-binding fragments of an antibody may be derived, e.g., from
full antibody molecules using any suitable, standard technique(s)
such as proteolytic digestion or recombinant genetic engineering
technique(s) involving the manipulation and expression of DNA
encoding antibody variable and optionally constant domains. Such
DNA is known and/or is readily available from, e.g., commercial
sources, DNA libraries (including, e.g., phage-antibody libraries),
or can be synthesized. The DNA may be sequenced and manipulated
chemically or by using molecular biology techniques, for example,
to arrange one or more variable and/or constant domains into a
suitable configuration, or to introduce codons, create cysteine
residues, modify, add, or delete amino acids, etc. Non-limiting
examples of antigen-binding fragments include: (i) Fab fragments;
(ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v)
single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii)
minimal recognition units consisting of the amino acid residues
that mimic the hypervariable region of an antibody (e.g., an
isolated CDR such as a CDR3 peptide), or a constrained FR3-CDR3-FR4
peptide. Other engineered molecules, such as domain-specific
antibodies, single domain antibodies, domain-deleted antibodies,
chimeric antibodies, CDR-grafted antibodies, diabodies, triabodies,
tetrabodies, minibodies, nanobodies (e.g. monovalent nanobodies,
bivalent nanobodies, etc.), small modular immunopharmaceuticals
(SMIPs), and shark variable IgNAR domains, are also encompassed
within the expression "antigen-binding fragment," as used herein.
An antigen-binding fragment of an antibody will typically comprise
at least one variable domain. The variable domain may be of any
size or amino acid composition and will generally comprise at least
one CDR which is adjacent to or in frame with one or more framework
sequences. In antigen-binding fragments having a V.sub.H domain
associated with a V.sub.L domain, the V.sub.H and V.sub.L domains
may be situated relative to one another in any suitable
arrangement. For example, the variable region may be dimeric and
contain V.sub.H--V.sub.H, V.sub.H-V.sub.L or V.sub.L-V.sub.L
dimers. Alternatively, the antigen-binding fragment of an antibody
may contain a monomeric V.sub.H or V.sub.L domain. In certain
embodiments, an antigen-binding fragment of an antibody may contain
at least one variable domain covalently linked to at least one
constant domain. Non-limiting, exemplary configurations of variable
and constant domains that may be found within an antigen-binding
fragment of an antibody of the present invention include: (i)
V.sub.H-C.sub.H1; (ii) V.sub.H-C.sub.H2; (iii) V.sub.H-C.sub.H3;
(iv) V.sub.H-C.sub.H1-C.sub.H2; (v)
V.sub.H-C.sub.H1-C.sub.H2-CH.sub.3; (vi) V.sub.H-C.sub.H2-C.sub.H3;
(vii) V.sub.H-C.sub.L; (viii) V.sub.L-C.sub.H1; (ix)
V.sub.L-C.sub.H2; (x) V.sub.L-C.sub.H3; (xi)
V.sub.L-C.sub.H1-C.sub.H2; (xii)
V.sub.L-C.sub.H1-C.sub.H2-C.sub.H3; (xiii)
V.sub.L-C.sub.H2-C.sub.H3; and (xiv) V.sub.L-C.sub.L. In any
configuration of variable and constant domains, including any of
the exemplary configurations listed above, the variable and
constant domains may be either directly linked to one another or
may be linked by a full or partial hinge or linker region. A hinge
region may consist of at least 2 (e.g., 5, 10, 15, 20, 40, 60, or
more) amino acids which result in a flexible or semi-flexible
linkage between adjacent variable and/or constant domains in a
single polypeptide molecule. As with full antibody molecules,
antigen-binding fragments may be monospecific or multispecific
(e.g., bispecific). A multispecific antigen-binding fragment of an
antibody will typically comprise at least two different variable
domains, wherein each variable domain is capable of specifically
binding to a separate antigen or to a different epitope on the same
antigen. Any multispecific antibody format, including the exemplary
bispecific antibody formats disclosed herein, may be adapted for
use in the context of an antigen-binding fragment of an antibody of
the present invention using routine techniques available in the
art. In certain embodiments described herein, antibodies described
herein are human antibodies. The term "human antibody", as used
herein, is intended to include antibodies having variable and
constant regions derived from human germline immunoglobulin
sequences. The human antibodies of the invention may include amino
acid residues not encoded by human germline immunoglobulin
sequences (e.g., mutations introduced by random or site-specific
mutagenesis in vitro or by somatic mutation in vivo), for example,
in the CDRs and in particular CDR3. However, the term "human
antibody", as used herein, is not intended to include antibodies in
which CDR sequences derived from the germline of another mammalian
species, such as a mouse, have been grafted onto human framework
sequences. The term "human antibody" does not include naturally
occurring molecules that normally exist without modification or
human intervention/manipulation, in a naturally occurring,
unmodified living organism. The antibodies of the invention may, in
some embodiments, be recombinant human antibodies. The term
"recombinant human antibody", as used herein, is intended to
include all human antibodies that are prepared, expressed, created,
or isolated by recombinant means, such as antibodies expressed
using a recombinant expression vector transfected into a host cell
(described further below), antibodies isolated from a recombinant,
combinatorial human antibody library (described further below),
antibodies isolated from an animal (e.g., a mouse) that is
transgenic for human immunoglobulin genes (see e.g., Taylor et al.
(1992) Nucl. Acids Res. 20:6287-6295) or antibodies prepared,
expressed, created, or isolated by any other means that involves
splicing of human immunoglobulin gene sequences to other DNA
sequences. Such recombinant human antibodies have variable and
constant regions derived from human germline immunoglobulin
sequences. In certain embodiments, however, such recombinant human
antibodies are subjected to in vitro mutagenesis (or, when an
animal transgenic for human Ig sequences is used, in vivo somatic
mutagenesis) and thus the amino acid sequences of the V.sub.H and
V.sub.L regions of the recombinant antibodies are sequences that,
while derived from and related to human germline V.sub.H and
V.sub.L sequences, may not naturally exist within the human
antibody germline repertoire in vivo. Human antibodies can exist in
two forms that are associated with hinge heterogeneity. In one
form, an immunoglobulin molecule comprises a stable four chain
construct of approximately 150-160 kDa in which the dimers are held
together by an interchain heavy chain disulfide bond. In a second
form, the dimers are not linked via inter-chain disulfide bonds and
a molecule of about 75-80 kDa is formed composed of a covalently
coupled light and heavy chain (half-antibody). These forms have
been extremely difficult to separate, even after affinity
purification. The frequency of appearance of the second form in
various intact IgG isotypes is due to, but not limited to,
structural differences associated with the hinge region isotype of
the antibody. A single amino acid substitution in the hinge region
of the human IgG4 hinge can significantly reduce the appearance of
the second form (Angal et al. (1993) Molecular Immunology 30:105)
to levels typically observed using a human IgG1 hinge. The instant
disclosure encompasses antibodies having one or more mutations in
the hinge, C.sub.H2 or C.sub.H3 region which may be desirable, for
example, in production, to improve the yield of the desired
antibody form. The antibodies described herein may be isolated
antibodies. An "isolated antibody," as used herein, refers to an
antibody that has been identified and separated and/or recovered
from at least one component of its natural environment. For
example, an antibody that has been separated or removed from at
least one component of an organism, or from a tissue or cell in
which the antibody naturally exists or is naturally produced, is an
"isolated antibody" for purposes of the instant disclosure. An
isolated antibody also includes an antibody in situ within a
recombinant cell. Isolated antibodies are antibodies that have been
subjected to at least one purification or isolation step. According
to certain embodiments, an isolated antibody may be substantially
free of other cellular material and/or chemicals. The antibodies
used herein can comprise one or more amino acid substitutions,
insertions and/or deletions in the framework and/or CDR regions of
the heavy and light chain variable domains as compared to the
corresponding germline sequences from which the antibodies were
derived. Such mutations can be readily ascertained by comparing the
amino acid sequences disclosed herein to germline sequences
available from, for example, public antibody sequence databases.
The present invention includes antibodies, and antigen-binding
fragments thereof, which are derived from any of the amino acid
sequences disclosed herein, wherein one or more amino acids within
one or more framework and/or CDR regions are mutated to the
corresponding residue(s) of the germline sequence from which the
antibody was derived, or to the corresponding residue(s) of another
human germline sequence, or to a conservative amino acid
substitution of the corresponding germline residue(s) (such
sequence changes are referred to herein collectively as "germline
mutations"). A person of ordinary skill in the art, starting with
the heavy and light chain variable region sequences disclosed
herein, can produce numerous antibodies and antigen-binding
fragments which comprise one or more individual germline mutations
or combinations thereof. In certain embodiments, all of the
framework and/or CDR residues within the V.sub.H and/or V.sub.L
domains are mutated back to the residues found in the original
germline sequence from which the antibody was derived. In other
embodiments, only certain residues are mutated back to the original
germline sequence, e.g., only the mutated residues found within the
first 8 amino acids of FRI or within the last 8 amino acids of FR4,
or only the mutated residues found within CDR1, CDR2 or CDR3. In
other embodiments, one or more of the framework and/or CDR
residue(s) are mutated to the corresponding residue(s) of a
different germline sequence (i.e., a germline sequence that is
different from the germline sequence from which the antibody was
originally derived). Furthermore, the antibodies of the present
disclosure may contain any combination of two or more germline
mutations within the framework and/or CDR regions, e.g., wherein
certain individual residues are mutated to the corresponding
residue of a particular germline sequence while certain other
residues that differ from the original germline sequence are
maintained or are mutated to the corresponding residue of a
different germline sequence. Once obtained, antibodies and
antigen-binding fragments that contain one or more germline
mutations can be tested for one or more desired property such as,
improved binding specificity, increased binding affinity, improved
or enhanced antagonistic or agonistic biological properties (as the
case may be), reduced immunogenicity, etc. Antibodies and
antigen-binding fragments obtained in this general manner are
encompassed within the present disclosure. Antibodies useful for
the compounds herein also include antibodies comprising variants of
any of the HCVR, LCVR, and/or CDR amino acid sequences disclosed
herein having one or more conservative substitutions. The term
"epitope" refers to an antigenic determinant that interacts with a
specific antigen-binding site in the variable region of an antibody
molecule known as a paratope. A single antigen may have more than
one epitope. Thus, different antibodies may bind to different areas
on an antigen and may have different biological effects. Epitopes
may be either conformational or linear. A conformational epitope is
produced by spatially juxtaposed amino acids from different
segments of the linear polypeptide chain. A linear epitope is one
produced by adjacent amino acid residues in a polypeptide chain. In
certain circumstance, an epitope may include moieties of
saccharides, phosphoryl groups, or sulfonyl groups on the
antigen.
[0209] In certain embodiments, the antibody comprises a light
chain. In certain embodiments, the light chain is a kappa light
chain. In certain embodiments, the light chain is a lambda light
chain. In certain embodiments, the antibody comprises a heavy
chain. In some aspects, the heavy chain is an IgA. In some aspects,
the heavy chain is an IgD. In some aspects, the heavy chain is an
IgE. In some aspects, the heavy chain is an IgG. In some aspects,
the heavy chain is an IgM. In some aspects, the heavy chain is an
IgG1. In some aspects, the heavy chain is an IgG2. In some aspects,
the heavy chain is an IgG3. In some aspects, the heavy chain is an
IgG4. In some aspects, the heavy chain is an IgA1. In some aspects,
the heavy chain is an IgA2.
[0210] In some embodiments, the antibody is an antibody fragment.
In some aspects, the antibody fragment is an Fv fragment. In some
aspects, the antibody fragment is a Fab fragment. In some aspects,
the antibody fragment is a F(ab').sub.2 fragment. In some aspects,
the antibody fragment is a Fab' fragment. In some aspects, the
antibody fragment is an scFv (sFv) fragment. In some aspects, the
antibody fragment is an scFv-Fc fragment.
[0211] In some embodiments, the antibody is a monoclonal antibody.
In some embodiments, the antibody is a polyclonal antibody.
[0212] In some embodiments, the antibody is a chimeric antibody. In
some embodiments, the antibody is a humanized antibody. In some
embodiments, the antibody is a human antibody.
[0213] The antibody can have binding specificity for any antigen
deemed suitable to those of skill in the art. In certain
embodiments, the antigen is a transmembrane molecule (e.g.,
receptor) or a growth factor. Exemplary antigens include, but are
not limited to, molecules such as class A scavenger receptors
including scavenger receptor A (SR-A, or MSR1), macrophage receptor
with collagenous structure (MARCO), scavenger receptor with C-type
lectin (SRCL), and scavenger receptor A-5 (SCARA5), COLEC12, class
B macrophage scavenger receptors including CD36, LIMPII, SRBI,
SRBII, class D scavenger receptor CD68, and lysosomal membrane
glycoprotein (LAMP), class E scavenger receptor including
lectin-like oxidized low density lipoprotein receptor 1 LOX-1 and
Dectin-1, class F scavenger receptors including scavenger receptor
expressed by endothelial cells-I (SREC-I) and SREC-II as well as
multiple epidermal growth factor (EGF)-like domains (MEGF)10, class
G scavenger receptor CXC chemokine ligand 16 (CXCL16), class H
scavenger receptors including Fasciclin, EGF-like, lamin type
EGF-like and link domain-containing scavenger receptor-1 (FEEL-1)
and -2 (FEEL-2), class I scavenger receptor CD163, and class J
scavenger receptor receptor for advanced glycation end products
(RAGE), other C-type lectin superfamily members including DEC205,
CD206, Dectin-2, Mincle, DC-SIGN, and DNGR-1, and other membrane
proteins such as B7 family-related member including V-set and Ig
domain-containing 4 (VSIG4), Colony stimulating factor 1 receptor
(CSF1R), asialoglycoprotein receptor (ASGPR), and Amyloid beta
precursor-like protein 2 (APLP-2). In some embodiments, the antigen
is PRLR or HER2. In some embodiments, the antibody is an anti-PRLR
or anti HER2 antibody.
[0214] The binding agent linkers can be bonded to the binding
agent, e.g., antibody or antigen-binding molecule, through an
attachment at a particular amino acid within the antibody or
antigen-binding molecule. Exemplary amino acid attachments that can
be used in the context of this aspect of the disclosure include,
e.g., lysine (see, e.g., U.S. Pat. No. 5,208,020; US 2010/0129314;
Hollander et al., Bioconjugate Chem., 2008, 19:358-361; WO
2005/089808; U.S. Pat. No. 5,714,586; US 2013/0101546; and US
2012/0585592), cysteine (see, e.g., US 2007/0258987; WO
2013/055993; WO 2013/055990; WO 2013/053873; WO 2013/053872; WO
2011/130598; US 2013/0101546; and U.S. Pat. No. 7,750,116),
selenocysteine (see, e.g., WO 2008/122039; and Hofer et al., Proc.
Natl. Acad. Sci., USA, 2008, 105:12451-12456), formyl glycine (see,
e.g., Carrico et al., Nat. Chem. Biol., 2007, 3:321-322; Agarwal et
al., Proc. Natl. Acad. Sci., USA, 2013, 110:46-51, and Rabuka et
al., Nat. Protocols, 2012, 10:1052-1067), non-natural amino acids
(see, e.g., WO 2013/068874, and WO 2012/166559), and acidic amino
acids (see, e.g., WO 2012/05982). Linkers can also be conjugated to
an antigen-binding protein via attachment to carbohydrates (see,
e.g., US 2008/0305497, WO 2014/065661, and Ryan et al., Food &
Agriculture Immunol., 2001, 13:127-130).
[0215] In some examples, the binding agent is an antibody or
antigen binding molecule, and the antibody is bonded to the linker
through a lysine residue. In some embodiments, the antibody or
antigen binding molecule is bonded to the linker through a cysteine
residue.
[0216] Linkers can also be conjugated to one or more glutamine
residues via transglutaminase-based chemo-enzymatic conjugation
(see, e.g., Dennler et al., Bioconjugate Chem. 2014, 25, 569-578,
and WO 2017/147542). For example, in the presence of
transglutaminase, one or more glutamine residues of an antibody can
be coupled to a primary amine compound. Briefly, in some
embodiments, an antibody having a glutamine residue (e.g., a Gln295
residue) is treated with a primary amine compound, described in
more detail below, in the presence of the enzyme transglutaminase.
Primary amine compounds include, e.g., payloads or linker-payloads,
which directly provide antibody drug conjugates via
transglutaminase-mediated coupling. Primary amine compounds also
include linkers and spacers that are functionalized with reactive
groups that can be subsequently treated with further compounds
towards the synthesis of antibody drug conjugates. Antibodies
comprising glutamine residues can be isolated from natural sources
or engineered to comprise one or more glutamine residues.
Techniques for engineering glutamine residues into an antibody
polypeptide chain (glutaminyl-modified antibodies or antigen
binding molecules) are within the skill of the practitioners in the
art. In certain embodiments, the antibody is aglycosylated.
[0217] In certain embodiments, the antibody or a
glutaminyl-modified antibody or antigen binding molecule comprises
at least one glutamine residue in at least one polypeptide chain
sequence. In certain embodiments, the antibody or a
glutaminyl-modified antibody or antigen binding molecule comprises
two heavy chain polypeptides, each with one Gln295 residue. In
further embodiments, the antibody or a glutaminyl-modified antibody
or antigen binding molecule comprises one or more glutamine
residues at a site other than a heavy chain 295. Included herein
are antibodies of this section bearing Asn297Gln (N297Q)
mutation(s) described herein. Included herein are antibodies of
this section bearing Gln55 (Q55) residues.
Primary Amine Compounds
[0218] The primary amine compound useful for the transglutaminase
mediated coupling of an antibody (or antigen binding compound)
comprising a glutamine can be any primary amine compound deemed
useful by the practitioner of ordinary skill. Generally, the
primary amine compound has the formula H.sub.2N--R, where R can be
any group compatible with the antibody and reaction conditions. In
certain embodiments, R is alkyl, substituted alkyl, heteroalkyl, or
substituted heteroalkyl.
[0219] In some embodiments, the primary amine compound comprises a
reactive group or protected reactive group. Useful reactive groups
include azides, alkynes, cycloalkynes, thiols, alcohols, ketones,
aldehydes, acids, esters, hydrazides, anilines, and amines. In
certain embodiments, the reactive group is selected from the group
consisting of azide, alkyne, sulfhydryl, cycloalkyne, aldehyde, and
carboxyl.
[0220] In certain embodiments, the primary amine compound is
according to the formula H.sub.2N-LL-X, where LL is a divalent
spacer and X is a reactive group or protected reactive group. In
particular embodiments, LL is a divalent polyethylene glycol (PEG)
group. In certain embodiments, X is selected from the group
consisting of --SH, --N.sub.3, alkyne, aldehyde, and tetrazole. In
particular embodiments, X is --N.sub.3.
[0221] In certain embodiments, the primary amine compound is
according to one of the following formulas:
H.sub.2N--(CH.sub.2).sub.n--X;
H.sub.2N--(CH.sub.2CH.sub.2O).sub.n--(CH.sub.2).sub.p--X;
H.sub.2N--(CH.sub.2).sub.n--N(H)C(O)--(CH.sub.2).sub.m--X;
H.sub.2N--(CH.sub.2CH.sub.2O).sub.n--N(H)C(O)--(CH.sub.2CH.sub.2O).sub.m-
--(CH.sub.2).sub.p--X;
H.sub.2N--(CH.sub.2).sub.n--C(O)N(H)--(CH.sub.2).sub.m--X;
H.sub.2N--(CH.sub.2CH.sub.2O).sub.n--C(O)N(H)--(CH.sub.2CH.sub.2O).sub.m-
--(CH.sub.2).sub.p--X;
H.sub.2N--(CH.sub.2).sub.n--N(H)C(O)--(CH.sub.2CH.sub.2O).sub.m--(CH.sub-
.2).sub.p--X;
H.sub.2N--(CH.sub.2CH.sub.2O).sub.n--N(H)C(O)--(CH.sub.2).sub.m--X;
H.sub.2N--(CH.sub.2).sub.n--C(O)N(H)--(CH.sub.2CH.sub.2O).sub.m--(CH.sub-
.2).sub.p--X; and
H.sub.2N--(CH.sub.2CH.sub.2O).sub.n--C(O)N(H)--(CH.sub.2).sub.m--X;
where n is an integer selected from 1 to 12; m is an integer
selected from 0 to 12; p is an integer selected from 0 to 2; and X
is selected from the group consisting of --SH, --N.sub.3,
--C.ident.CH, --C(O)H, tetrazole, and any of
##STR00114##
[0222] In the above, any of the alkyl (i.e., --CH.sub.2--) groups
can optionally be substituted, for example, with C.sub.1-8alkyl,
methylformyl, or --SO.sub.3H. In certain embodiments, the alkyl
groups are unsubstituted.
[0223] In certain embodiments, the primary amine compound is
selected from the group consisting of:
##STR00115##
[0224] In particular embodiments, the primary amine compound is
##STR00116##
Exemplary conditions for the above reactions are provided in the
Examples below.
Linkers
[0225] The linker L portion of the conjugates described herein is a
moiety, for instance, a divalent moiety, that covalently links a
binding agent to a payload compound described herein. In other
instances, the linker L is a trivalent or multivalent moiety that
covalently links a binding agent to a payload compound described
herein. Suitable linkers may be found, for example, in
Antibody-Drug Conjugates and Immunotoxins; Phillips, G. L., Ed.;
Springer Verlag: New York, 2013; Antibody-Drug Conjugates; Ducry,
L., Ed.; Humana Press, 2013; Antibody-Drug Conjugates; Wang, J.,
Shen, W.-C., and Zaro, J. L., Eds.; Springer International
Publishing, 2015, the contents of each incorporated herein in their
entirety by reference. Payload compounds include compounds of
Formula I, Ia, and Ib above, and their residues following bonding
or incorporation with linker L. Those of skill in the art will
recognize that certain functional groups of the payload moieties
are convenient for linking to linkers and/or binding agents. Those
groups include amines, hydroxyls, phosphates, and sugars.
[0226] In certain embodiments, the linkers are stable in
physiological conditions. In certain embodiments, the linkers are
cleavable, for instance, able to release at least the payload
portion in the presence of an enzyme or at a particular pH range or
value. In some embodiments, a linker comprises an enzyme-cleavable
moiety. Illustrative enzyme-cleavable moieties include, but are not
limited to, peptide bonds, ester linkages, hydrazones, and
disulfide linkages. In some embodiments, the linker comprises a
cathepsin-cleavable linker.
[0227] In some embodiments, the linker comprises a non-cleavable
moiety. In some embodiments, the non-cleavable linker is derived
from
##STR00117##
or a residue thereof. In some embodiments, the non-cleavable
linker-payload is
##STR00118##
or a regioisomer thereof. In some embodiments, the non-cleavable
linker is derived from
##STR00119##
or a residue thereof. In some embodiments, the non-cleavable
linker-payload is
##STR00120##
or a regioisomer thereof. In one embodiment, the linker is
maleimide cyclohexane carboxylate or
4-(N-maleimidomethyl)cyclohexanecarboxylic acid (MCC). In the
structures, indicates a bond to a binding agent. In the structures,
in some examples, indicates a click chemistry residue which results
from the reaction of, for example, a binding agent and a linker
payload.
[0228] In some embodiments, suitable linkers include, but are not
limited to, those that are chemically bonded to two cysteine
residues of a single binding agent, e.g., antibody. Such linkers
can serve to mimic the antibody's disulfide bonds that are
disrupted as a result of the conjugation process.
[0229] In some embodiments, the linker comprises one or more amino
acids. Suitable amino acids include natural, non-natural, standard,
non-standard, proteinogenic, non-proteinogenic, and L-, or
D-.alpha.-amino acids. In some embodiments, the linker comprises
alanine, valine, glycine, leucine, isoleucine, methionine,
tryptophan, phenylalanine, proline, serine, threonine, cysteine,
tyrosine, asparagine, glutamine, aspartic acid, glutamic acid,
lysine, arginine, histidine, or citrulline, a derivative thereof,
or combination thereof. In certain embodiments, one or more side
chains of the amino acids is linked to a side chain group,
described below. In some embodiments, the linker comprises valine
and citrulline. In some embodiments, the linker comprises lysine,
valine, and citrulline. In some embodiments, the linker comprises
lysine, valine, and alanine. In some embodiments, the linker
comprises valine and alanine.
[0230] In some embodiments, the linker comprises a self-immolative
group. The self-immolative group can be any such group known to
those of skill. In particular embodiments, the self-immolative
group is p-aminobenzyl (PAB), or a derivative thereof. Useful
derivatives include p-aminobenzyloxycarbonyl (PABC). Those of skill
will recognize that a self-immolative group is capable of carrying
out a chemical reaction which releases the remaining atoms of a
linker from a payload.
[0231] In some embodiments, the linker is:
##STR00121##
wherein: [0232] SP.sup.1 is a spacer; [0233] SP.sup.2 is a spacer;
[0234] is one or more bonds to the binding agent; [0235] is one or
more bonds to the payload; [0236] each AA is an amino acid; and
[0237] n is an integer from 1 to 10.
[0238] The SP.sup.1 spacer is a moiety that connects the (AA),
moiety to the binding agent (BA) or to a reactive group residue
which is bonded to BA. Suitable SP.sup.1 spacers include, but are
not limited to, those comprising alkylene or polyether, or both.
The ends of the spacers, e.g., the portion of the spacer bonded to
the binding agent or an AA, can be moieties derived from reactive
moieties that are used for purposes of coupling the antibody or an
AA to the spacer during chemical synthesis of the conjugate. In
certain embodiments, n is 1, 2, 3, or 4. In particular embodiments,
n is 2. In particular embodiments, n is 3. In particular
embodiments, n is 4.
[0239] In some embodiments, the SP.sup.1 spacer comprises an
alkylene. In some embodiments, the SP.sup.1 spacer comprises a
C.sub.57 alkylene. In some embodiments, the SP.sup.1 spacer
comprises a polyether. In some embodiments, the SP.sup.1 spacer
comprises a polymer of ethylene oxide such as polyethylene
glycol.
[0240] In some embodiments, the SP.sup.1 spacer is:
##STR00122##
wherein: [0241] RG' is a reactive group residue following reaction
of a reactive group RG with a binding agent; [0242] is a bond to
the binding agent; [0243] is a bond to (AA).sub.n; and [0244] b is
an integer from 2 to 8.
[0245] The reactive group RG can be any reactive group known to
those of skill in the art to be capable of forming one or more
bonds to the binding agent. The reactive group RG is a moiety
comprising a portion in its structure that is capable of reacting
with the binding agent (e.g., reacting with an antibody at its
cysteine or lysine residues, or at an azide moiety, for example, a
PEG-N.sub.3 functionalized antibody at one or more glutamine
residues) to form a compound of Formula A, Aa, or Ab. Following
conjugation to the binding agent, the reactive group becomes the
reactive group residue (RG'). Illustrative reactive groups include,
but are not limited to, those that comprise haloacetyl,
isothiocyanate, succinimide, N-hydroxysuccinimide, or maleimide
portions that are capable of reacting with the binding agent.
[0246] In certain embodiments, reactive groups include, but are not
limited to, alkynes. In certain embodiments, the alkynes are
alkynes capable of undergoing 1,3-cycloaddition reactions with
azides in the absence of copper catalysts such as strained alkynes.
Strained alkynes are suitable for strain-promoted alkyne-azide
cycloadditions (SPAAC), cycloalkynes, e.g., cyclooctynes, ane
benzannulated alkynes. Suitable alkynes include, but are not
limited to, dibenzoazacyclooctyne or
##STR00123##
dibenzocyclooctyne or
##STR00124##
biarylazacyclooctynone or
##STR00125##
difluorinated cyclooctyne or
##STR00126##
substituted, e.g., fluorinated alkynes, aza-cycloalkynes,
bicycle[6.1.0]nonyne or
##STR00127##
and derivatives thereof. Particularly useful alkynes include
##STR00128##
[0247] In certain embodiments, the binding agent is bonded directly
to RG'. In certain embodiments, the binding agent is bonded to RG'
via a spacer, for instance SP.sup.4, below. In particular
embodiments, the binding agent is bonded to RG' via a PEG spacer.
As discussed in detail below, in certain embodiments, the binding
agent is prepared by functionalizing with one or more azido groups.
Each azido group is capable of reacting with RG to form RG'. In
particular embodiments, the binding agent is derivatized with
-PEG-N.sub.3 linked to a glutamine residue. Exemplary --N.sub.3
derivatized binding agents, methods for their preparation, and
methods for their use in reacting with RG are provided herein. In
certain embodiments, RG is an alkyne suitable for participation in
1,3-cycloadditions, and RG' is a 1,2,3-triazolyl moiety formed from
the reaction of RG with an azido-functionalized binding agent. By
way of further example, in certain embodiments, RG' is linked to
the binding agent as shown in
##STR00129##
or a mixture of each regioisomer. Each R and R' is as described
herein.
[0248] The SP.sup.2 spacer is a moiety that connects the (AA).sub.n
moiety to the payload. Suitable spacers include, but are not
limited to, those described above as SP.sup.1 spacers. Further
suitable SP.sup.2 spacers include, but are not limited to, those
comprising alkylene or polyether, or both. The ends of the SP.sup.2
spacers, e.g., the portion of the spacer directly bonded to the
payload or an AA, can be moieties derived from reactive moieties
that are used for purposes of coupling the payload or AA to the
SP.sup.2 spacer during the chemical synthesis of the conjugate. In
some examples, the ends of the SP.sup.2 spacers, e.g., the portion
of the SP.sup.2 spacer directly bonded to the payload or an AA, can
be residues of reactive moieties that are used for purposes of
coupling the payload or an AA to the spacer during the chemical
synthesis of the conjugate.
[0249] In some embodiments, the SP.sup.2 spacer is selected from
the group consisting of --O--, --N(R.sup.6)--, --R.sup.4'--,
--R.sup.5'--, --OR.sup.5'--, and --OP(O)(OR.sup.6)O--, wherein:
[0250] R.sup.4' is --Z'--Y--X--;
[0251] X is selected from the group consisting of --O-- and
--N(H)--;
[0252] Y is selected from the group consisting of alkylene,
substituted alkylene (including, without limitation, oxo
substitution, i.e., .dbd.O), heteroalkylene, and substituted
heteroalkylene;
[0253] Z' is selected from the group consisting of --O-- and
--N(H)--;
[0254] R.sup.5' is heterocycloalkylene or substituted
heterocycloalkylene, wherein each heterocycloalkylene or
substituted heterocycloalkylene includes one, two, or three
heteroatoms selected from nitrogen and oxygen, including at least
two moieties selected from the group consisting of --O--, --N(H)--,
and
##STR00130##
useful for bonding to the remainder of the molecule; and
[0255] each R.sup.6 is --H, an amino acid residue, a peptide, or
alkyl.
[0256] In certain embodiments, the SP.sup.2 spacer is selected from
the group consisting of --O--, --N(H)--,
##STR00131## ##STR00132##
In certain embodiments, each is a bond to the payload, and each is
a bond to (AA).sub.n.
[0257] In the above formulas, each AA is an amino acid or,
optionally, ap-aminobenzyloxycarbonyl residue (PABC). If PABC is
present, preferably only one PABC is present. Preferably, the PABC
residue, if present, is a terminal AA in the (AA).sub.n group,
proximal to the payload. Suitable amino acids for each AA include
natural, non-natural, standard, non-standard, proteinogenic,
non-proteinogenic, and L-, or D-.alpha.-amino acids. In some
embodiments, the linker comprises alanine, valine, leucine,
isoleucine, methionine, tryptophan, phenylalanine, proline, serine,
threonine, cysteine, tyrosine, asparagine, glutamine, aspartic
acid, glutamic acid, lysine, arginine, histidine, or citrulline, a
derivative thereof, or a combination thereof. In certain
embodiments, one or more side chains of the amino acids is linked
to a side chain group, described below. In some embodiments, n is
two. In some embodiments, the (AA).sub.n is valine-citrulline. In
some embodiments, (AA).sub.n is citrulline-valine. In some
embodiments, (AA).sub.n is valine-alanine. In some embodiments,
(AA).sub.n is alanine-valine. In some embodiments, (AA).sub.n is
valine-glycine. In some embodiments, (AA).sub.n is glycine-valine.
In some embodiments, n is three. In some embodiments, the
(AA).sub.n is valine-citrulline-PABC. In some embodiments,
(AA).sub.n is citrulline-valine-PABC. In some embodiments,
(AA).sub.n is glutamate-valine-citrulline. In some embodiments,
(AA).sub.n is glutamine-valine-citrulline. In some embodiments,
(AA).sub.n is lysine-valine-alanine. In some embodiments,
(AA).sub.n is lysine-valine-citrulline. In some embodiments, n is
four. In some embodiments, (AA).sub.n is
glutamate-valine-citrulline-PAB. In some embodiments, (AA).sub.n is
glutamine-valine-citrulline-PABC. Those of skill will recognize
PABC as a residue of p-aminobenzyloxycarbonyl with the following
structure:
##STR00133##
The PABC residue has been shown to facilitate cleavage of certain
linkers in vitro and in vivo.
[0258] In some embodiments, the linker is:
##STR00134##
wherein: [0259] each is a bond to the binding agent; [0260] each is
a bond to the payload; [0261] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0262] each A is --O--,
--N(H)--,
##STR00135##
[0262] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent.
[0263] In some embodiments, the linker is:
##STR00136##
wherein: [0264] each is a bond to the binding agent; [0265] each is
a bond to the payload; [0266] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0267] each A is --O--,
--N(H)--,
##STR00137##
[0267] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent.
[0268] In any of the above embodiments, the (AA).sub.n group can be
modified with one or more enhancement groups. Advantageously, the
enhancement group can be linked to the side chain of any amino acid
in (AA).sub.n. Useful amino acids for linking enhancement groups
include lysine, asparagine, aspartate, glutamine, glutamate, and
citrulline. The link to the enhancement group can be a direct bond
to the amino acid side chain, or the link can be indirect via a
spacer and/or reactive group. Useful spacers and reactive groups
include any described above. The enhancement group can be any group
deemed useful by those of skill in the art. For example, the
enhancement group can be any group that imparts a beneficial effect
to the compound, payload, linker payload, or antibody conjugate
including, but not limited to, biological, biochemical, synthetic,
solubilizing, imaging, detecting, and reactivity effects, and the
like. In certain embodiments, the enhancement group is a
hydrophilic group. In certain embodiments, the enhancement group is
a cyclodextrin. In certain embodiments, the enhancement group is an
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid.
The cyclodextrin can be any cyclodextrin known to those of skill.
In certain embodiments, the cyclodextrin is alpha cyclodextrin,
beta cyclodextrin, or gamma cyclodextrin, or mixtures thereof. In
certain embodiments, the cyclodextrin is alpha cyclodextrin. In
certain embodiments, the cyclodextrin is beta cyclodextrin. In
certain embodiments, the cyclodextrin is gamma cyclodextrin. In
certain embodiments, the enhancement group is capable of improving
solubility of the remainder of the conjugate. In certain
embodiments, the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl
sulfonic acid is substituted or non-substituted. In certain
embodiments, the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl
sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.mC(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-
-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In some
embodiments, the linker is:
##STR00138##
wherein: [0269] SP.sup.1 is a spacer; [0270] SP.sup.2 is a spacer;
[0271] SP.sup.3 is a spacer, linked to one AA of (AA).sub.n; [0272]
is one or more bonds to the binding agent; [0273] is one or more
bonds to the payload; [0274] is one or more bonds to the
enhancement group EG; [0275] each AA is an amino acid; and [0276] n
is an integer from 1 to 10. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent.
[0277] The SP.sup.1 spacer group is as described above. The
SP.sup.2 spacer group is as described above. Each (AA).sub.n group
is as described above.
[0278] The SP.sup.3 spacer is a moiety that connects the (AA).sub.n
moiety to the enhancement group (EG). Suitable SP.sup.3 spacers
include, but are not limited to, those comprising alkylene or
polyether, or both. The ends of the SP.sup.3 spacers, i.e., the
portion of the SP.sup.3 spacer directly bonded to the enhancement
group or an AA, can be moieties derived from reactive moieties that
are used for purposes of coupling the enhancement group or an AA to
the SP.sup.3 spacer during the chemical synthesis of the conjugate.
In some examples, the ends of the SP.sup.3 spacers, i.e., the
portion of the spacer directly bonded to the enhancement group or
an AA, can be residues of reactive moieties that are used for
purposes of coupling the enhancement group or an AA to the spacer
during the chemical synthesis of the conjugate. In certain
embodiments, SP.sup.3 is a spacer, linked to one and only one AA of
(AA).sub.n. In certain embodiments, the SP.sup.3 spacer is linked
to the side chain of a lysine residue of (AA).sub.n.
[0279] In some embodiments, the SP.sup.3 spacer is:
##STR00139##
wherein: [0280] RG' is a reactive group residue following reaction
of a reactive group RG with an enhancement agent EG; [0281] is a
bond to the enhancement agent; [0282] is a bond to (AA).sub.n; and
[0283] a is an integer from 2 to 8.
[0284] The reactive group RG can be any reactive group known to
those of skill in the art to be capable of forming one or more
bonds to the enhancement agent. The reactive group RG is a moiety
comprising a portion in its structure that is capable of reacting
with the binding agent (e.g., reacting with an antibody at its
cysteine or lysine residues, or at an azide moiety) to form a
compound of Formula A, Aa, or Ab. Following conjugation to the
binding agent, the reactive group becomes the reactive group
residue (RG'). The reactive group RG can be any reactive group
described above. Illustrative reactive groups include, but are not
limited to, those that comprise haloacetyl, isothiocyanate,
succinimide, N-hydroxysuccinimide, or maleimide portions that are
capable of reacting with the binding agent.
[0285] In certain embodiments, reactive groups include, but are not
limited to, alkynes. In certain embodiments, the alkynes are
alkynes capable of undergoing 1,3-cycloaddition reactions with
azides in the absence of copper catalysts such as strained alkynes.
Strained alkynes are suitable for strain-promoted alkyne-azide
cycloadditions (SPAAC), cycloalkynes, e.g., cyclooctynes, ane
benzannulated alkynes. Suitable alkynes include, but are not
limited to, dibenzoazacyclooctyne or
##STR00140##
dibenzocyclooctyne or
##STR00141##
biarylazacyclooctynone or
##STR00142##
difluorinated cyclooctyne or
##STR00143##
substituted, e.g., fluorinated alkynes, aza-cycloalkynes,
bicycle[6.1.0]nonyne or
##STR00144##
and derivatives thereof. Particularly useful alkynes include
##STR00145##
[0286] In some embodiments, the linker is:
##STR00146##
wherein: [0287] RG' is a reactive group residue following reaction
of a reactive group RG with a binding agent; [0288] PEG is PEG3;
[0289] SP.sup.2 is a spacer; [0290] SP.sup.3 is a spacer, linked to
one AA of (AA).sub.n; [0291] is one or more bonds to the binding
agent; [0292] is one or more bonds to the payload; [0293] is one or
more bonds to the enhancement group EG; [0294] each AA is an amino
acid; and [0295] n is an integer from 1 to 10. As discussed above,
the bond to the binding agent can be direct, or via a spacer. In
certain embodiments, the bond to the binding agent is via a PEG
spacer to a glutamine residue of the binding agent.
[0296] In certain embodiments, the linker is:
##STR00147##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or a mixture of
regioisomers thereof, wherein: [0297] each is a bond to the binding
agent; [0298] each is a bond to the payload; [0299] each is a bond
to the enhancement agent; [0300] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0301] each A is --O--,
--N(H)--,
##STR00148##
[0301] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, 1,3-cycloaddition
or SPAAC regioisomers, or mixture of regioisomers, are derived from
PEG-N.sub.3 derivatized antibodies treated with suitable alkynes.
For example, in one embodiment, the linker is:
##STR00149##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or a mixture of
regioisomers thereof. By way of further example, the linker is:
##STR00150##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or a mixture of
regioisomers thereof. By way of further example, in one embodiment,
the linker is:
##STR00151##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or a mixture of
regioisomers thereof.
[0302] As discussed above, the bond to the binding agent can be
direct, or via a spacer. In certain embodiments, the bond to the
binding agent is via a PEG spacer to a glutamine residue of the
binding agent. In certain embodiments, the enhancement agent is a
hydrophilic group. In certain embodiments, the enhancement agent is
cyclodextrin. In certain embodiments, the enhancement group is an
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid.
The cyclodextrin can be any cyclodextrin known to those of skill.
In certain embodiments, the cyclodextrin is alpha cyclodextrin,
beta cyclodextrin, or gamma cyclodextrin, or mixtures thereof. In
certain embodiments, the cyclodextrin is alpha cyclodextrin. In
certain embodiments, the cyclodextrin is beta cyclodextrin. In
certain embodiments, the cyclodextrin is gamma cyclodextrin. In
certain embodiments, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5.
[0303] In some embodiments, the linker is:
##STR00152##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or mixture of regioisomers
thereof, wherein: [0304] each is a bond to the binding agent;
[0305] each is a bond to the enhancement agent; [0306] each is a
bond to the payload; [0307] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0308] each A is --O--,
--N(H)--,
##STR00153##
[0308] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent. In certain embodiments, the
enhancement agent is a hydrophilic group. In certain embodiments,
the enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5.
[0309] In some embodiments, the linker is:
##STR00154## ##STR00155##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or mixture of regioisomers
thereof, wherein: [0310] each is a bond to the binding agent;
[0311] each is a bond to the payload; [0312] R.sup.9 is --CH.sub.3
or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0313] A is --O--,
--N(H)--,
##STR00156##
[0313] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent. In some embodiments, the
linker is:
##STR00157## ##STR00158##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or mixture of regioisomers
thereof, wherein: [0314] each is a bond to the binding agent;
[0315] each is a bond to the payload; [0316] R.sup.9 is --CH.sub.3
or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0317] A is --O--,
--N(H)--,
##STR00159##
[0317] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent.
[0318] In some embodiments, the linker is:
##STR00160##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or mixture of regioisomers
thereof, wherein: [0319] each is a bond to the binding agent;
[0320] each is a bond to the payload; [0321] each is a bond to the
enhancement group; [0322] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0323] each A is --O--,
--N(H)--,
##STR00161##
[0323] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl.
[0324] As discussed above, the bond to the binding agent can be
direct, or via a spacer. In certain embodiments, the bond to the
binding agent is via a PEG spacer to a glutamine residue of the
binding agent. In certain embodiments, the enhancement agent is a
hydrophilic group. In certain embodiments, the enhancement agent is
cyclodextrin. In certain embodiments, the enhancement group is an
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid.
The cyclodextrin can be any cyclodextrin known to those of skill.
In certain embodiments, the cyclodextrin is alpha cyclodextrin,
beta cyclodextrin, or gamma cyclodextrin, or mixtures thereof. In
certain embodiments, the cyclodextrin is alpha cyclodextrin. In
certain embodiments, the cyclodextrin is beta cyclodextrin. In
certain embodiments, the cyclodextrin is gamma cyclodextrin. In
certain embodiments, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5.
[0325] In some embodiments, the linker is:
##STR00162##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or mixture of regioisomers
thereof, wherein: [0326] each is a bond to the binding agent;
[0327] each is a bond to the payload; [0328] each R.sup.9 is
--CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0329] each A
is --O--, --N(H)--,
##STR00163##
[0329] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent. In certain embodiments, the
enhancement agent is a hydrophilic group. In certain embodiments,
the enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.mC(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-
-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5.
[0330] In some embodiments, the linker is:
##STR00164## ##STR00165##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or mixture of regioisomers
thereof, wherein: [0331] each is a bond to the binding agent;
[0332] each is a bond to the payload; [0333] R.sup.9 is --CH.sub.3
or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0334] A is --O--,
--N(H)--,
##STR00166##
[0334] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent.
[0335] In some embodiments, the linker is:
##STR00167## ##STR00168##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, or mixture of regioisomers
thereof, wherein: [0336] each is a bond to the binding agent;
[0337] each is a bond to the payload; [0338] R.sup.9 is --CH.sub.3
or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and
##STR00169##
[0338] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl.
[0339] As discussed above, the bond to the binding agent can be
direct, or via a spacer. In certain embodiments, the bond to the
binding agent is via a PEG spacer to a glutamine residue of the
binding agent.
[0340] The above linkers are useful for providing the following
conjugates.
[0341] In some embodiments, the conjugate is:
##STR00170##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0342] BA is a
binding agent; [0343] each SP.sup.1, SP.sup.2, and SP.sup.3 is a
spacer group as described above, where SP.sup.3 is linked to one AA
of (AA).sub.n; [0344] EG is an enhancement agent; [0345] k is an
integer from 1 to 30; [0346] R is --H, R.sup.1, or R.sup.2; and
[0347] Q.sup.1, Q.sup.2, W, R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and n are as described in the
context of Formula I; [0348] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0349] each A,
independently in each instance, is --O--, --N(H)--,
##STR00171##
[0349] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent. In certain embodiments, the
enhancement agent is a hydrophilic group. In certain embodiments,
the enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In certain
embodiments, R is R.sup.1.
[0350] In some embodiments, the conjugate is:
##STR00172##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0351] BA is a
binding agent; [0352] each RG' is the residue of a reactive group,
as described herein; [0353] EG is an enhancement agent; [0354] k is
an integer from 1 to 30; [0355] R is --H, R.sup.1, or R.sup.2; and
[0356] Q.sup.1, Q.sup.2, W, R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and n are as described in the
context of Formula I; [0357] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0358] each A is --O--,
--N(H)--,
##STR00173##
[0358] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent. In certain embodiments, the
enhancement agent is a hydrophilic group. In certain embodiments,
the enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.mC(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-
-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In certain
embodiments, R is R.sup.1.
[0359] In some embodiments, the conjugate is:
##STR00174##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0360] BA is a
binding agent; [0361] each RG' is the residue of a reactive group,
as described herein; [0362] EG is an enhancement agent; [0363] k is
an integer from 1 to 30; [0364] R is --H, R.sup.1, or R.sup.2; and
[0365] Q.sup.1, Q.sup.2, W, R.sup.1, R.sup.2, R.sup.3, R.sup.4,
R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and n are as described in the
context of Formula I; [0366] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0367] each A is --O--,
--N(H)--,
##STR00175##
[0367] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. As discussed above, the bond to the
binding agent can be direct, or via a spacer. In certain
embodiments, the bond to the binding agent is via a PEG spacer to a
glutamine residue of the binding agent. In certain embodiments, the
enhancement agent is a hydrophilic group. In certain embodiments,
the enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In certain
embodiments, R is R.sup.1.
[0368] In some embodiments, the conjugate is:
##STR00176##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0369] BA is a
binding agent; [0370] k is an integer from 1 to 30; [0371] R is
--H, R.sup.1, or R.sup.2; and [0372] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0373] each is a
bond to the enhancement group; [0374] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0375] each A is --O--,
--N(H)--,
##STR00177##
[0375] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-8 heteroalkyl. In certain embodiments, the enhancement
agent is a hydrophilic group. In certain embodiments, the
enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In certain
embodiments, R is R.sup.1.
[0376] In some embodiments, the conjugate is:
##STR00178##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0377] BA is a
binding agent; [0378] k is an integer from 1 to 30; [0379] R is
--H, R.sup.1, or R.sup.2; and [0380] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0381] each is a
bond to the enhancement group; [0382] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0383] each A is --O--,
--N(H)--,
##STR00179##
[0383] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, the enhancement
agent is a hydrophilic group. In certain embodiments, the
enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.mC(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-
-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In certain
embodiments, R is R.sup.1.
[0384] In some embodiments, the conjugate is:
##STR00180## ##STR00181## ##STR00182##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0385] BA is a
binding agent; [0386] k is an integer from 1 to 30; [0387] R is
--H, R.sup.1, or R.sup.2; and [0388] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0389] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0390]
each A is --O--, --N(H)--,
##STR00183##
[0390] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0391] In some embodiments, the conjugate is:
##STR00184## ##STR00185##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0392] BA is a
binding agent; [0393] k is an integer from 1 to 30; [0394] R is
--H, R.sup.1, or R.sup.2; and [0395] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0396] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0397]
each A is --O--, --N(H)--,
##STR00186##
[0397] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0398] In some embodiments, the conjugate is:
##STR00187##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0399] BA is a
binding agent; [0400] k is an integer from 1 to 30; [0401] R is
--H, R.sup.1, or R.sup.2; and [0402] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0403] each is a
bond to the enhancement group; [0404] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0405] each A is --O--,
--N(H)--,
##STR00188##
[0405] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, the enhancement
agent is a hydrophilic group. In certain embodiments, the
enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In certain
embodiments, R is R.sup.1.
[0406] In some embodiments, the conjugate is:
##STR00189##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0407] BA is a
binding agent; [0408] k is an integer from 1 to 30; [0409] R is
--H, R.sup.1, or R.sup.2; and [0410] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0411] each is a
bond to the enhancement group; [0412] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0413] each A is --O--,
--N(H)--,
##STR00190##
[0413] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, the enhancement
agent is a hydrophilic group. In certain embodiments, the
enhancement agent is cyclodextrin. In certain embodiments, the
enhancement group is an alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid. The cyclodextrin can be any
cyclodextrin known to those of skill. In certain embodiments, the
cyclodextrin is alpha cyclodextrin, beta cyclodextrin, or gamma
cyclodextrin, or mixtures thereof. In certain embodiments, the
cyclodextrin is alpha cyclodextrin. In certain embodiments, the
cyclodextrin is beta cyclodextrin. In certain embodiments, the
cyclodextrin is gamma cyclodextrin. In certain embodiments, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2CH.sub.2O).sub.m--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2,
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.-
1-5SO.sub.3H).sub.2, or
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein n is 1, 2, 3, 4, or 5, and m is 1, 2,
3, 4, or 5. In one embodiment, the alkyl, heteroalkyl, alkylenyl,
or heteroalkylenyl sulfonic acid is --(CH.sub.2).sub.1-5SO.sub.3H.
In another embodiment, the alkyl, heteroalkyl, alkylenyl, or
heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n is
1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)NH--(CH.sub.2).sub.1-5SO.sub.3H, wherein n
is 1, 2, 3, 4, or 5. In another embodiment, the alkyl, heteroalkyl,
alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2CH.sub.2O).sub.mC(O)NH--(CH.sub.2).sub.1-5SO.sub.3H,
wherein m is 1, 2, 3, 4, or 5. In another embodiment, the alkyl,
heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.sub.3H-
).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment, the
alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid is
--(CH.sub.2).sub.n--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub.1-5SO.su-
b.3H).sub.2, wherein n is 1, 2, 3, 4, or 5. In another embodiment,
the alkyl, heteroalkyl, alkylenyl, or heteroalkylenyl sulfonic acid
is
--(CH.sub.2CH.sub.2O).sub.m--C(O)N((CH.sub.2).sub.1-5C(O)NH(CH.sub.2).sub-
.1-5SO.sub.3H).sub.2, wherein m is 1, 2, 3, 4, or 5. In certain
embodiments, R is R.sup.1.
[0414] In some embodiments, the conjugate is:
##STR00191##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0415] BA is a
binding agent; [0416] k is an integer from 1 to 30; [0417] R is
--H, R.sup.1, or R.sup.2; and [0418] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0419] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0420]
each A is --O--, --N(H)--,
##STR00192##
[0420] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0421] In some embodiments, the conjugate is:
##STR00193##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0422] BA is a
binding agent; [0423] k is an integer from 1 to 30; [0424] R is
--H, R.sup.1, or R.sup.2; and [0425] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0426] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0427]
each A is --O--, --N(H)--,
##STR00194##
[0427] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0428] In each of the above embodiments, the conjugates can be
prepared from binding agents functionalized with azide groups, and
residues thereof, as described in the sections below. For
convenience, the triazole residue in several structures above is
depicted within parentheses. Those of skill will recognize that the
trazole can be formed from an azide group of an azide-derivatized
binding agent and an alkyne of the linker payload L-P.
[0429] In some embodiments, the conjugate is selected from:
##STR00195## ##STR00196## ##STR00197## ##STR00198## ##STR00199##
##STR00200## ##STR00201## ##STR00202## ##STR00203## ##STR00204##
##STR00205## ##STR00206## ##STR00207## ##STR00208##
##STR00209##
or a regioisomer, or stereoisomeric form pharmaceutically
acceptable salt, solvate, thereof. In the above embodiments, k is
an integer from 1 to 30. In certain embodiments, k is an integer
from 1 to 8. In certain embodiments, k is an integer from 1 to 4.
In certain embodiments, k is 8, 7, 6, 5, 4, 3, 2, or 1. In certain
embodiments, k is 4. In certain embodiments, k is 3. In certain
embodiments, k is 2. In certain embodiments, k is 1.
Reactive Linker-Paylaods
[0430] Conjugates provided here can be prepared from reactive
linker-paylaods with reactive groups RG as described above. The
reactive linker payloads can be linked to enhancement groups and/or
binding agents according to the methods described below.
[0431] In some embodiments, the reactive linker-payload is:
##STR00210##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0432] each RG is
a reactive group, as described herein; [0433] R is --H, R.sup.1, or
R.sup.2; and [0434] Q.sup.1, Q.sup.2, W, R.sup.1, R.sup.2, R.sup.3,
R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and n are as described
in the context of Formula I; [0435] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0436] each A is --O--,
--N(H)--,
##STR00211##
[0436] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0437] In some embodiments, the reactive linker-payload is:
##STR00212##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0438] each RG is
a reactive group, as described herein; [0439] R is --H, R.sup.1, or
R.sup.2; and [0440] Q.sup.1, Q.sup.2, W, R.sup.1, R.sup.2, R.sup.3,
R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and n are as described
in the context of Formula I; [0441] each R.sup.9 is --CH.sub.3 or
--(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0442] each A is --O--,
--N(H)--,
##STR00213##
[0442] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0443] In some embodiments, the reactive linker-payload is:
##STR00214##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0444] R is --H,
R.sup.1, or R.sup.2; and [0445] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0446] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0447]
each A is --O--, --N(H)--,
##STR00215##
[0447] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0448] In some embodiments, the reactive linker-payload is:
##STR00216##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0449] R is --H,
R.sup.1, or R.sup.2; and [0450] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0451] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0452]
each A is --O--, --N(H)--,
##STR00217##
[0452] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0453] In some embodiments, the reactive linker-payload is:
##STR00218## ##STR00219##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein. [0454] R is --H,
R.sup.1, or R.sup.2; and [0455] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0456] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0457]
each A is --O--, --N(H)--,
##STR00220##
[0457] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0458] In some embodiments, the reactive linker-payload is:
##STR00221## ##STR00222##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0459] R is --H,
R.sup.1, or R.sup.2; and [0460] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0461] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0462]
each A is --O--, --N(H)--,
##STR00223##
[0462] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0463] In some embodiments, the reactive linker-payload is:
##STR00224##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0464] R is --H,
R.sup.1, or R.sup.2; and [0465] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0466] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0467]
each A is --O--, --N(H)--,
##STR00225##
[0467] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0468] In some embodiments, the reactive linker-payload is:
##STR00226##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0469] R is --H,
R.sup.1, or R.sup.2; and [0470] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0471] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0472]
each A is --O--, --N(H)--,
##STR00227##
[0472] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0473] In some embodiments, the reactive linker-payload is:
##STR00228## ##STR00229##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0474] R is --H,
R.sup.1, or R.sup.2; and [0475] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0476] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0477]
each A is --O--, --N(H)--,
##STR00230##
[0477] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0478] In some embodiments, the reactive linker-payload is:
##STR00231## ##STR00232##
or a pharmaceutically acceptable salt, solvate, or stereoisomeric
form thereof, or a regioisomer thereof, wherein: [0479] R is --H,
R.sup.1, or R.sup.2; and [0480] Q.sup.1, Q.sup.2, W, R.sup.1,
R.sup.2, R.sup.3, R.sup.4, R.sup.5, R.sup.6, R.sup.7, X, Y, Z, and
n are as described in the context of Formula I; [0481] each R.sup.9
is --CH.sub.3 or --(CH.sub.2).sub.3N(H)C(O)NH.sub.2; and [0482]
each A is --O--, --N(H)--,
##STR00233##
[0482] where ZZ is hydrogen, or a side chain for an amino acid as
discussed elsewhere herein. For example, in one embodiment, ZZ is
C.sub.1-6 alkyl. By way of further example, in one embodiment, ZZ
is C.sub.1-6 heteroalkyl. In certain embodiments, R is R.sup.1.
[0483] In some embodiments, the reactive linker-payload is selected
from:
##STR00234## ##STR00235## ##STR00236## ##STR00237## ##STR00238##
##STR00239## ##STR00240## ##STR00241## ##STR00242##
or a regioisomer, or stereoisomeric form pharmaceutically
acceptable salt, solvate, thereof.
Methods of Preparing Compounds
[0484] The compounds provided herein can be prepared, isolated, or
obtained by any method apparent to those of skill in the art.
Exemplary methods of preparation are described in detail in the
examples below. In certain embodiments, compounds provided herein
can be prepared according to Scheme A:
##STR00243##
[0485] In the Exemplary Preparation Scheme, Q.sup.1, Q.sup.2,
R.sup.1, R.sup.2, R.sup.7, W, and n are defined as described in the
context of Formula (I). Initial esterification is followed by
either protection of R.sup.1 and/or amination of R.sup.1 to beget
R.sup.2P. Following protection of R.sup.1, a saponification and
activation of, for example, a carboxylic acid moiety provides a
first coupling partner having Q.sup.1. Following amination,
saponification, and amidation of, for example, a carboxylic acid
moiety, provides a second coupling partner having Q.sup.2.
Unification of coupling partners having Q.sup.1 and Q.sup.2,
respectively, followed by deprotections of R.sup.1 and R.sup.2,
respectively, provides compounds of Formula I. Exemplary methods of
preparation are described in detail in the Examples below.
[0486] In certain embodiments, one or more protection or
deprotection steps may be included in the methods of preparation
described in Scheme A, above.
[0487] The linker-payloads described herein can be synthesized by a
series of coupling steps.
##STR00244##
For instance, the payload at the right side can be linked to
SP.sup.2 via one or more standard coupling reactions. In
advantageous embodiments, the payload compounds described herein
include free amino groups available for coupling by amide synthesis
conditions, described herein. The amino acids of (AA).sub.n can be
added by amide synthesis conditions, for instance, peptide
synthesis conditions. The spacer SP.sup.2 can be linked to
(AA).sub.n via one or more standard coupling reactions. In
advantageous embodiments, the SP.sup.2 and (AA).sub.n groups
described herein include free amino or carboxyl groups available
for coupling by amide synthesis conditions, described herein. When
present, the spacer SP.sup.3 can be linked to (AA).sub.n via one or
more standard coupling reactions. In advantageous embodiments, the
SP.sup.3 and (AA).sub.n groups described herein include free amino
or carboxyl groups available for coupling by amide synthesis
conditions, described herein.
[0488] The spacer SP.sup.3, when present, terminates with a
reactive group RG. This reactive group can be linked to the
enhancement agent EG via coupling conditions deemed suitable to
those of skill in the art. In certain embodiments, spacer SP.sup.3
is linked to enhancement agent EG via amide synthesis conditions.
In certain embodiments, spacer SP.sup.3 is linked to enhancement
agent EG via click chemistry. In these embodiments, spacer SP.sup.3
terminates with a reactive group suitable for a click reaction, for
instance, an azide or an alkyne, and enhancement agent EG comprises
a complementary reactive group suitable for a click reaction, for
instance an alkyne or an azide. In preferred embodiments, SP.sup.3
terminates with a strained alkyne and EG comprises an azide; or
SP.sup.3 terminates with an carboxylic acid and EG comprises an
amine. When EG is a cyclodextrin moiety, the cyclodextrin can
comprise an azide. Azido cyclodextrins can be prepared
synthetically or obtained from commercial sources. When EG is a
sulfonic acid moiety, one end(s) of the EG terminate with a
sulfonic acid group(s), and the other end terminates with a primary
or secondary amine.
[0489] The conjugates described herein can be synthesized by
coupling the linker-payloads described herein with a binding agent,
for example, an antibody under standard conjugation conditions
(see, e.g., Doronina et al. Nature Biotechnology 2003, 21, 7, 778,
which is incorporated herein by reference in its entirety). When
the binding agent is an antibody, the antibody may be coupled to a
linker-payload via one or more cysteine or lysine residues of the
antibody. Linker-payloads can be coupled to cysteine residues, for
example, by subjecting the antibody to a reducing agent, for
example, dithiotheritol, to cleave the disulfide bonds of the
antibody, purifying the reduced antibody, for example, by gel
filtration, and subsequently treating the antibody with a
linker-payload containing a suitable reactive moiety, for example,
a maleimido group. Suitable solvents include, but are not limited
to water, DMA, DMF, and DMSO. Linker-payloads containing a reactive
group, for example, an activated ester or acid halide group, can be
coupled to lysine residues of the antibody. Suitable solvents
include, but are not limited to water, DMA, DMF, and DMSO.
Conjugates can be purified using known protein techniques,
including, for example, size exclusion chromatography, dialysis,
and ultrafiltration/diafiltration.
[0490] Binding agents, for example antibodies, can also be
conjugated via click chemistry reactions. In some embodiments of
said click chemistry reactions, the linker-payload includes a
reactive group, for example an alkyne, that is capable of
undergoing a 1,3-cycloaddition reaction with an azide. Such
suitable reactive groups are described above. The antibody includes
one or more azide groups. Such antibodies include antibodies
functionalized with, for example, azido-polyethylene glycol groups.
In certain embodiments, such functionalized antibody is derived by
treating an antibody having at least one glutamine residue, for
example, heavy chain Gln295 or Gln55, with a primary amine compound
in the presence of the enzyme transglutaminase. In certain
embodiments, such functionalized antibody is derived by treating an
antibody having at least one glutamine residue, for example, heavy
chain Gln297, with a primary amine compound in the presence of the
enzyme transglutaminase. Such antibodies include Asn297Gln (N297Q)
mutants. In certain embodiments, such functionalized antibody is
derived by treating an antibody having at least two glutamine
residues, for example, heavy chain Gln295 and heavy chain Gln297,
with a primary amine compound in the presence of the enzyme
transglutaminase. Such antibodies include Asn297Gln (N297Q)
mutants. In certain embodiments, the antibody has two heavy chains
as described in this paragraph for a total of two or a total of
four glutamine residues.
[0491] In certain embodiments, the antibody comprises a glutamine
residue at one or more heavy chain positions numbered 295 in the EU
numbering system. In the present disclosure, this position is
referred to as glutamine 295, or as Gln295, or as Q295. Those of
skill will recognize that this is a conserved glutamine residue in
the wild type sequence of many antibodies. In other useful
embodiments, the antibody can be engineered to comprise a glutamine
residue. Techniques for modifying an antibody sequence to include a
glutamine residue are within the skill of those in the art (see,
e.g., Ausubel et al. Current Protoc. Mol. Biol.).
[0492] In certain embodiments, the antibody comprises two glutamine
residues, one in each heavy chain. In particular embodiments, the
antibody comprises a Q295 residue in each heavy chain. In further
embodiments, the antibody comprises one, two, three, four, five,
six, seven, eight, or more glutamine residues. These glutamine
residues can be in heavy chains, light chains, or in both heavy
chains and light chains. Exemplary glutamine residues include Q55.
These glutamine residues can be wild-type residues, or engineered
residues. The antibodies can be prepared according to standard
techniques.
[0493] Those of skill will recognize that antibodies are often
glycosylated at residue N297, near residue Q295 in a heavy chain
sequence. Glycosylation at residue N297 can interfere with a
transglutaminase at residue Q295 (Dennler et al., supra).
Accordingly, in advantageous embodiments, the antibody is not
glycosylated. In certain embodiments, the antibody is deglycoslated
or aglycosylated. In particular embodiments, an antibody heavy
chain has an N297 mutation. Alternatively stated, the antibody is
mutated to no longer have an asparagine residue at position 297. In
particular embodiments, an antibody heavy chain has an N297Q
mutation. Such an antibody can be prepared by site-directed
mutagenesis to remove or disable a glycosylation sequence or by
site-directed mutagenesis to insert a glutamine residue at a site
without resulting in disabled antibody function or binding. In some
embodiments, an antibody having a Q295 residue and/or an N297Q
mutation contains one or more additional naturally occurring
glutamine residues in their variable regions, which can be
accessible to transglutaminase and therefore capable of conjugation
to a linker or a linker-payload. An exemplary naturally occurring
glutamine residue can be found, e.g., at Q55 of the light chain. In
such instances, the antibody conjugated via transglutaminase can
have a higher than expected DAR value (e.g., a DAR higher than 4).
Any such antibodies can be isolated from natural or artificial
sources.
[0494] The antibody without interfering glycosylation is then
reacted with a primary amine compound. In certain embodiments, an
aglycosylated antibody is reacted with a primary amine compound to
produce a glutaminyl-modified antibody. In certain embodiments, a
deglycosylated antibody is reacted with a primary amine compound to
produce a glutaminyl-modified antibody.
[0495] The primary amine can be any primary amine that is capable
of forming a covalent bond with a glutamine residue in the presence
of a transglutaminase. Useful primary amines are described below.
The transglutaminase can be any transglutaminase deemed suitable by
those of skill in the art. In certain embodiments, the
transglutaminase is an enzyme that catalyzes the formation of an
isopeptide bond between a free amine group on the primary amine
compound and the acyl group on the side chain of a glutamine
residue. Transglutaminase is also known as
protein-glutamine-.gamma.-glutamyltransferase. In particular
embodiments, the transglutaminase is classified as EC 2.3.2.13. The
transglutaminase can be from any source deemed suitable. In certain
embodiments, the transglutaminase is microbial. Useful
transglutaminases have been isolated from Streptomyces mobaraense,
Streptomyces cinnamoneum, Streptomyces griseo-carneum, Streptomyces
lavendulae, and Bacillus subtilis. Non-microbial transglutaminases,
including mammalian transglutaminases, can also be used. In certain
embodiments, the transglutaminase can be produced by any technique
or obtained from any source deemed suitable by the practitioner of
skill. In particular embodiments, the transglutaminase is obtained
from a commercial source.
[0496] In particular embodiments, the primary amine compound
comprises a reactive group capable of further reaction after
transglutamination. In these embodiments, the glutaminyl-modified
antibody can be reacted or treated with a reactive payload compound
or a reactive linker-payload compound to form an antibody-payload
conjugate. In certain embodiments, the primary amine compound
comprises an azide.
[0497] In certain embodiments, the glutaminyl-modified antibody is
reacted or treated with a reactive linker-payload to form an
antibody-payload conjugate. The reaction can proceed under
conditions deemed suitable by those of skill in the art. In certain
embodiments, the glutaminyl-modified antibody is contacted with the
reactive linker-payload compound under conditions suitable for
forming a bond between the glutaminyl-modified antibody and the
linker-payload compound. Suitable reaction conditions are well
known to those in the art.
[0498] Exemplary reactions are provided in the Examples below.
Pharmaceutical Compositions and Methods of Treatment
[0499] Provided herein are methods of treating and preventing
diseases, conditions, or disorders comprising administering a
therapeutically or prophylactically effective amount or one or more
of the compounds disclosed herein, for example, one or more of the
compounds of a formula provided herein. Diseases, disorders, and/or
conditions include, but are not limited to, those associated with
the antigens listed herein.
[0500] The compounds described herein can be administered alone or
together with one or more additional therapeutic agents. The one or
more additional therapeutic agents can be administered just prior
to, concurrent with, or shortly after the administration of the
compounds described herein. The present disclosure also includes
pharmaceutical compositions comprising any of the compounds
described herein in combination with one or more additional
therapeutic agents, and methods of treatment comprising
administering such combinations to subjects in need thereof.
[0501] Suitable additional therapeutic agents include, but are not
limited to: a second glucocorticoid, an autoimmune therapeutic
agent, a hormone, a biologic, or a monoclonal antibody. Suitable
therapeutic agents also include, but are not limited to any
pharmaceutically acceptable salts, acids, or derivatives of a
compound set forth herein.
[0502] In some embodiments of the methods described herein,
multiple doses of a compound described herein (or a pharmaceutical
composition comprising a combination of an compound described
herein and any of the additional therapeutic agents mentioned
herein) may be administered to a subject over a defined time
course. The methods according to this aspect of the disclosure
comprise sequentially administering to a subject multiple doses of
a compound described herein. As used herein, "sequentially
administering" means that each dose of the compound is administered
to the subject at a different point in time, e.g., on different
days separated by a predetermined interval (e.g., hours, days,
weeks, or months). The present disclosure includes methods which
comprise sequentially administering to the patient a single initial
dose of a compound described herein, followed by one or more
secondary doses of the compound, and optionally followed by one or
more tertiary doses of the compound.
[0503] The terms "initial dose," "secondary doses," and "tertiary
doses," refer to the temporal sequence of administration of the
compounds described herein. Thus, the "initial dose" is the dose
which is administered at the beginning of the treatment regimen
(also referred to as the "baseline dose"); the "secondary doses"
are the doses which are administered after the initial dose; and
the "tertiary doses" are the doses which are administered after the
secondary doses. The initial, secondary, and tertiary doses can all
include the same amount the compound described herein, but
generally can differ from one another in terms of frequency of
administration. In certain embodiments, the amount of the compound
included in the initial, secondary, and/or tertiary doses varies
from one another (e.g., adjusted up or down as appropriate) during
the course of treatment. In certain embodiments, two or more (e.g.,
2, 3, 4, or 5) doses are administered at the beginning of the
treatment regimen as "loading doses" followed by subsequent doses
that are administered on a less frequent basis (e.g., "maintenance
doses").
[0504] In certain exemplary embodiments of the present disclosure,
each secondary and/or tertiary dose is administered 1 to 26 (e.g.,
1, 11/2, 2, 21/2, 3, 31/2, 4, 41/2, 5, 51/2, 6, 61/2, 7, 71/2, 8,
81/2, 9, 91/2, 10, 101/2, 11, 111/2, 12, 121/2, 13, 131/2, 14,
141/2, 15, 151/2, 16, 161/2, 17, 171/2, 18, 181/2, 19, 191/2, 20,
201/2, 21, 211/2, 22, 221/2, 23, 231/2, 24, 241/2, 25, 251/2, 26,
261/2, or more) weeks after the immediately preceding dose. The
phrase "the immediately preceding dose," as used herein, means, in
a sequence of multiple administrations, the dose the compound which
is administered to a patient prior to the administration of the
very next dose in the sequence with no intervening doses.
[0505] The methods according to this aspect of the disclosure may
comprise administering to a patient any number of secondary and/or
tertiary doses of the compound. For example, in certain
embodiments, only a single secondary dose is administered to the
patient. In other embodiments, two or more (e.g., 2, 3, 4, 5, 6, 7,
8, or more) secondary doses are administered to the patient.
Likewise, in certain embodiments, only a single tertiary dose is
administered to the patient. In other embodiments, two or more
(e.g., 2, 3, 4, 5, 6, 7, 8, or more) tertiary doses are
administered to the patient. The administration regimen may be
carried out indefinitely over the lifetime of a particular subject,
or until such treatment is no longer therapeutically needed or
advantageous.
[0506] In embodiments involving multiple secondary doses, each
secondary dose may be administered at the same frequency as the
other secondary doses. For example, each secondary dose may be
administered to the patient 1 to 2 weeks or 1 to 2 months after the
immediately preceding dose. Similarly, in embodiments involving
multiple tertiary doses, each tertiary dose may be administered at
the same frequency as the other tertiary doses. For example, each
tertiary dose may be administered to the patient 2 to 12 weeks
after the immediately preceding dose. In certain embodiments of the
disclosure, the frequency at which the secondary and/or tertiary
doses are administered to a patient can vary over the course of the
treatment regimen. The frequency of administration may also be
adjusted during the course of treatment by a physician depending on
the needs of the individual patient following clinical
examination.
[0507] The present disclosure includes administration regimens in
which 2 to 6 loading doses are administered to a patient at a first
frequency (e.g., once a week, once every two weeks, once every
three weeks, once a month, once every two months, etc.), followed
by administration of two or more maintenance doses to the patient
on a less frequent basis. For example, according to this aspect of
the disclosure, if the loading doses are administered at a
frequency of once a month, then the maintenance doses may be
administered to the patient once every six weeks, once every two
months, once every three months, etc.
[0508] The present disclosure includes pharmaceutical compositions
of the compounds and/or conjugates described herein, e.g., the
compounds of Formula I, Ia, Ib A, Aa, or Ab, e.g., compositions
comprising a compound described herein, a salt, stereoisomer,
polymorph thereof, and a pharmaceutically acceptable carrier,
diluent, and/or excipient. Examples of suitable carriers, diluents
and excipients include, but are not limited to, buffers for
maintenance of proper composition pH (e.g., citrate buffers,
succinate buffers, acetate buffers, phosphate buffers, lactate
buffers, oxalate buffers, and the like), carrier proteins (e.g.,
human serum albumin), saline, polyols (e.g., trehalose, sucrose,
xylitol, sorbitol, and the like), surfactants (e.g., polysorbate
20, polysorbate 80, polyoxolate, and the like), antimicrobials, and
antioxidants.
[0509] In some examples, set forth herein is a method of treating a
disease, disorder or condition comprising administering to a
patient having said disorder a therapeutically effective amount of
a compound of Formula I, Ia, Ib A, Aa, or Ab or a pharmaceutical
composition thereof.
[0510] In some examples, set forth herein is a method of preventing
a disease, disorder or condition comprising administering to a
patient having said disorder a prophylactically effective amount of
a compound of Formula I, Ia, Ib A, Aa, or Ab or a pharmaceutical
composition thereof.
[0511] In some examples, set forth herein are methods for treating
or preventing any disease, disorder, or condition responsive to
modulation of LXR signaling. In some examples, the disease or
disorder is associated with LXR function, LXR polymorphisms, LXR
agonist activity, or LXR antagonist activity. In some examples, set
forth herein is a method of treating or preventing a disease,
disorder, or condition selected from the group consisting of a
proliferative disorder, a neurodegenerative disorder, an
immunological disorder, an autoimmune disease, an inflammatory
disorder, a dermatological disease, a metabolic disease,
cardiovascular disease, and a gastrointestinal disease.
[0512] The proliferative disorder can be any proliferative disorder
known to those of skill. In certain embodiments, proliferative
disorders include, without limitation, oncology disorders, where
the oncology disorder can be any cancer disorder known to those of
skill. In certain embodiments, provided herein are methods of
treating or preventing a melanoma. In certain embodiments, provided
herein are methods of treating or preventing metastatic melanoma.
In certain embodiments, provided herein are methods of treating or
preventing lung cancer. In certain embodiments, provided herein are
methods of treating or preventing EGFR-tyrosine kinase inhibitor
resistant lung cancer. In certain embodiments, provided herein are
methods of treating or preventing oral cancer. In certain
embodiments, provided herein are methods of treating or preventing
oral squamous cell carcinoma. In certain embodiments, provided
herein are methods of treating or preventing prostate cancer. In
certain embodiments, provided herein are methods of treating or
preventing Hodgkin's lymphoma. In certain embodiments, provided
herein are methods of treating or preventing breast cancer.
[0513] The neurodegenerative disorder can be any neurodegenerative
disorder known to those of skill. In certain embodiments, provided
herein are methods of treating or preventing Alzheimer's disease.
In certain embodiments, provided herein are methods of treating or
preventing Parkinson's disease. In certain embodiments, provided
herein are methods of treating or preventing Huntington's disease.
In certain embodiments, provided herein are methods of treating or
preventing amyotrophic lateral sclerosis. In certain embodiments,
provided herein are methods of treating or preventing myelin gene
expression. In certain embodiments, provided herein are methods of
treating or preventing myelination and remyelination conditions,
diseases, or disorders.
[0514] The immunological disorder can be any immunological disorder
known to those of skill. In certain embodiments, provided herein
are methods of treating or preventing imflammatory bowel disease.
In certain embodiments, provided herein are methods of treating or
preventing ulcerative colitis. In certain embodiments, provided
herein are methods of treating or preventing Crohn's disease.
[0515] The inflammatory disorder can be any inflammatory disorder
known to those of skill. In certain embodiments, provided herein
are methods of treating or preventing arthritis. In certain
embodiments, provided herein are methods of treating or preventing
rheumatoid arthritis.
[0516] The metabolic disease can be any metabolic disease known to
those of skill. In certain embodiments, the metabolic disease is
dyslipidemia. Dyslipidemia can be any dyslipidemia known to those
of skill. In certain embodiments, dyslipidemia is selected from the
group consisting of hyperlipidemia, hypercholesterolemia,
hypertriglyceridemia, hyperlipoproteinemia, HDL deficiency, ApoA-I
deficiency, and cardiovascular disease such as coronary artery
disease (including, for example, treatment and prevention of
angina, myocardial infarction, and sudden cardiac death);
atherosclerosis (including, for example, treatment and prevention
of atherosclerosis); and restenosis (including, for example,
preventing or treating atherosclerotic plaques which develop as a
consequence of medical procedures such as balloon angioplasty). In
certain embodiments, provided herein are methods of treating or
preventing diabetes.
[0517] The cardiovascular disease can be any cardiovascular disease
known to those of skill. In certain embodiments, provided herein
are methods of treating or preventing atherosclerosis. In certain
embodiments, provided herein are methods of treating or preventing
atherosclerosis derived from abnormal macrophage processing. In
certain embodiments, provided herein are methods of treating or
preventing atherosclerosis derived from the formation of oxidized
low-density lipoproteins (oxLDLs), where marcrophages fail to
process oxLDLs. In certain embodiments, provided herein are methods
of treating or preventing ischemic heart disease. In certain
embodiments, provided herein are methods of treating or preventing
stroke. In certain embodiments, provided herein are methods of
treating or preventing hypertensive heart disease. In certain
embodiments, provided herein are methods of treating or preventing
aortic aneurysm. In certain embodiments, provided herein are
methods of treating or preventing endocarditis. In certain
embodiments, provided herein are methods of treating or preventing
peripheral artery disease. In certain embodiments, provided herein
are methods of treating or preventing combinations of any of the
diseases provided in this paragraph.
[0518] In some examples, set forth herein is a method for
modulating the function of a nuclear receptor. By way of
non-limiting example, the function may be selected from
expression/secretion of inflammatory mediators (e.g. cytokines,
chemokines), cholesterol regulation, cholesterol intake,
cholesterol efflux, cholesterol oxidation, migration, chemotaxis,
apoptosis and necrosis, an inflammatory activity, lipid regulation,
apoptosis, migration, chemotaxis, gene transcription, and protein
expression.
EXAMPLES
[0519] Provided herein are novel bis-octahydrophenanthrene
carboxamides, protein conjugates thereof, and methods for treating
diseases, disorders, and conditions including administering the
bis-octahydrophenanthrene carboxamides and conjugates.
[0520] In some examples, the compound of Formula (I) is a compound
identified in Table 1.
TABLE-US-00001 TABLE 1 List of Payloads Cpd # Structure MF MW 9a
##STR00245## C.sub.34H.sub.43NO.sub.4 529.71 9b ##STR00246##
C.sub.36H.sub.47NO.sub.5 573.76 9c ##STR00247##
C.sub.36H.sub.48N.sub.2O.sub.4 695.85 9d ##STR00248##
C.sub.34H.sub.44N.sub.2O.sub.3 528.72 9e ##STR00249##
C.sub.38H.sub.51N.sub.3O.sub.3 694.85 9f ##STR00250##
C.sub.36H.sub.48N.sub.2O.sub.3 556.78 9g ##STR00251##
C.sub.39H.sub.52N.sub.2O.sub.5 628.85 9h ##STR00252##
C.sub.36H.sub.47N.sub.3O.sub.4 585.78 9i ##STR00253##
C.sub.37H.sub.49N.sub.3O.sub.4 599.80 9j ##STR00254##
C.sub.37H.sub.49N.sub.3O.sub.4 615.80 9k ##STR00255##
C.sub.37H.sub.49N.sub.3O.sub.4 599.37 9l ##STR00256##
C.sub.40H.sub.56N.sub.4O.sub.4 656.43 9m ##STR00257##
C.sub.40H.sub.51N.sub.5O.sub.4 665.39 9n ##STR00258##
C.sub.38H.sub.49N.sub.3O.sub.6 643.81 9o ##STR00259##
C.sub.39H.sub.51N.sub.3O.sub.6 657.38 9p ##STR00260##
C.sub.35H.sub.46N.sub.2O.sub.3 542.35 9q ##STR00261##
C.sub.39H.sub.50N.sub.2O.sub.6 642.82 9r ##STR00262##
C.sub.38H.sub.49N.sub.3O.sub.6 643.83 9t ##STR00263##
C.sub.37H.sub.50N.sub.2O.sub.2 554.81 9u ##STR00264##
C.sub.34H.sub.45NO.sub.3 515.73 15b ##STR00265##
C.sub.40H.sub.53NO.sub.9 691.85 17b ##STR00266##
C.sub.34H.sub.45N.sub.2P.sub.6P 608.70 17c ##STR00267##
C.sub.35H.sub.47N.sub.2O.sub.6P 622.73
##STR00268##
[0521] Examples of linker-payloads of the instant disclosure
include, but are not limited to, those described in Table 2
below.
TABLE-US-00002 TABLE 2 List of Linker-payloads Cpd # Structures LP1
24c ##STR00269## LP2 22d1 ##STR00270## LP3 22d2 ##STR00271## LP4
22j ##STR00272## LP5 27d1 ##STR00273## LP15 27j ##STR00274## LP6
29c1 ##STR00275## LP7 29c2 ##STR00276## LP8 29d1 ##STR00277## LP9
29d2 ##STR00278## LP10 29d3 ##STR00279## LP11 29d4 ##STR00280##
LP12 29h ##STR00281## LP13 29j ##STR00282## LP14 33 ##STR00283##
LP39 -- ##STR00284## LP311 -- ##STR00285## LP18 -- ##STR00286##
LP36 -- ##STR00287## LP32 -- ##STR00288##
[0522] Certain embodiments of the invention are illustrated by the
following non-limiting examples.
[0523] Reagents and solvents were obtained from commercial sources
such as Sinopharm Chemical Reagent Co. (SCRC), Sigma-Aldrich, Alfa,
or other vendors, unless explicitly stated otherwise.
[0524] .sup.1H NMR and other NMR spectra were recorded on a Bruker
AVIII 400 or Bruker AVIII 500. The data were processed with Nuts
software or MestReNova software, measuring proton shifts in parts
per million (ppm) downfield from an internal standard
tetramethylsilane (TMS).
[0525] HPLC-MS measurements were run on an Agilent 1200 HPLC/6100
SQ System using the follow conditions:
[0526] Method A for HPLC-MS measurements included, as the Mobile
Phase: A: Water (0.01% trifluoroacetic acid (TFA)), B: acetonitrile
(0.01% TFA); Gradient Phase: 5% of B increased to 95% of B within
15 minutes (min); Flow Rate: 1.0 mL/min; Column: SunFire C18,
4.6.times.50 mm, 3.5 .mu.m; Column Temperature: 50.degree. C.
Detectors: Analog to Digital Converter (ADC) Evaporative
Light-scattering Detector (ELSD), Diode array detector (DAD) (214
nm and 254 nm), electrospray ionization-atmospheric ionization
(ES-API).
[0527] Method B for HPLC-MS measurements included, as the Mobile
Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: acetonitrile;
Gradient Phase: 5% to 95% of B within 15 min; Flow Rate: 1.0
mL/min; Column: XBridge C18, 4.6.times.50 mm, 3.5 .mu.m; Column
Temperature: 50.degree. C. Detectors: ADC ELSD, DAD (214 nm and 254
nm), mass selective detector (MSD) (ES-API).
[0528] LC-MS measurements were run on an Agilent 1200 HPLC/6100 SQ
System using the following conditions:
[0529] Method A for LC-MS measurement included, as the Instrument:
WATERS 2767; column: Shimadzu Shim-Pack, PRC-ODS, 20.times.250 mm,
15 .mu.m, two connected in series; Mobile Phase: A: Water (0.01%
TFA), B: acetonitrile (0.01% TFA); Gradient Phase: 5% of B
increased to 95% of B within 3 min; Flow Rate: 1.8-2.3 mL/min;
Column: SunFire C18, 4.6.times.50 mm, 3.5 .mu.m; Column
Temperature: 50.degree. C. Detectors: ADC ELSD, DAD (214 nm and 254
nm), ES-API.
[0530] Method B for LC-MS measurement included, as the Instrument:
Gilson GX-281; column: Xbridge Prep C18 10 um OBD, 19.times.250 mm;
Mobile Phase: A: Water (10 mM NH.sub.4HCO.sub.3), B: Acetonitrile;
Gradient Phase: 5% to 95% of B within 3 min; Flow Rate: 1.8-2.3
mL/min; Column: XBridge C18, 4.6.times.50 mm, 3.5 .mu.m; Column
Temperature: 50.degree. C. Detectors: ADC ELSD, DAD (214 nm and 254
nm), MSD (ES-API).
[0531] Preparative high-pressure liquid chromatography (Prep-HPLC)
in an acidic or basic solvent system was utilized on a Gilson
GX-281 instrument. The acidic solvent system used a Waters SunFire
10 .mu.m C18 column (100 .ANG., 250.times.19 mm), and solvent A for
prep-HPLC was water/0.05% TFA and solvent B was acetonitrile. The
elution conditions were a linear gradient increase of solvent B
from 5% to 100% over a time period of 20 min at a flow rate of 30
mL/min. The basic solvent system included a Waters Xbridge 10 .mu.m
C18 column (100 .ANG., 250.times.19 mm), and solvent A used for
prep-HPLC was water/10 mM ammonium bicarbonate (NH.sub.4HCO.sub.3)
and solvent B was acetonitrile. The elution conditions were a
linear gradient increase of solvent B from 5% to 100% over a time
period of 20 min at a flow rate of 30 mL/min.
[0532] Flash chromatography was performed on a Biotage instrument,
with Agela Flash Column silica-CS cartridges; Reversed phase flash
chromatography was performed on Biotage instrument, with Boston ODS
or Agela C18 cartridges.
[0533] As used herein, the symbols and conventions used in these
processes, schemes, and examples, regardless of whether a
particular abbreviation is specifically defined, are consistent
with those used in the contemporary scientific literature, for
example, the Journal of the American Chemical Society or the
Journal of Biological Chemistry. Specifically, but without
limitation, the following abbreviations may be used in the Examples
and throughout the specification:
TABLE-US-00003 Abbreviation Term ADC Antibody-drug conjugate
Aglycosylated Antibody does not have any glycan antibody API
Atmospheric pressure ionization aq Aqueous Boc
N-tert-butoxycarbonyl BupH .TM. Thermo Scientific Prod# 28372,
containing 100 mM sodium phosphate and 150 mM sodium chloride,
potassium free, pH was adjusted from 7.2 to 7.6-7.8 MQ, unless
otherwise noted. CD Cyclodextrin COT Cyclooctynol Da Dalton DAD
Diode array detector DAR Drug to antibody ratio DCM Dichloromethane
DIBAC 11,12-didehydro-5,6-dihydro-Dibenz[b,g]azocine DIBAC-Suc
11,12-didehydro-5,6-dihydro-Dibenz[b,f]azocine succinamic acid
DIBAC-Suc- {4-[(2S)-2-[(2S)-2-[1-(4-{2- PEG4-VC-
azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9),5,7,13,15- pAB-PNP
hexaen-10-yn-2-yl{-4-oxobutanamido)-3,6,9,12-
tetraoxapentadecan-15-amido]-3-methylbutanamido]-
5-(carbamoylamino)pentanamido]phenyl}methyl 4- nitrophenyl
carbonate DIBACT
3H-Benzo[c]-1,2,3-triazolo[4,5-e][1]benzazocine,8,9- dihydro- DIPEA
Diisopropylethylamine DMF N,N-dimethylformamide DMSO
Dimethylsulfoxide EC Enzyme commission ELSD Evaporative light
scattering detector ESI Electrospray ionization Fmoc
N-(9-fluorenylmethyloxycarbonyl) Fmoc-vcPAB-
N-Fmoc-L-valine-L-citrulline-p-aminobenzyl alcohol PNP
p-nitrophenyl carbonate g Gram HATU
2-(7-Aza-1H-benzotriazole-1-yl)-1,1,3,3- tetramethyluronium
hexafluorophosphate HC Heavy chain of immunoglobulin HEK Human
embryonic kidney (cells) HPLC High performance liquid
chromatography hr, h, or hrs Hours LC Light chain of immunoglobulin
LCh Liquid chromatography MALDI Matrix-assisted laser
desorption/ionization MC Maleimidocaproyl mg milligrams min minutes
mL milliliters mmh myc-myc-hexahistidine tag uL microliters mM
millimolar uM micromolar MMAE Monomethyl auristatin E MS Mass
spectrometry MsCl Methanesulfonyl chloride MSD Mass-selective
detector MTG Microbial transglutaminase (MTG EC 2.3.2.13, Zedira,
Darmstadt, Germany) MW Molecular weight ncADC Non-Cytotoxic
antibody drug conjugate NHS N-hydroxy succinimide nM nanomolar NMR
Nuclear magnetic resonance NOESY Nuclear Overhauser effect
spectroscopy PAB Para-aminobenzyloxy(carbonyl) PBS 10 mM sodium
phosphate buffer and 150 mM sodium chloride PBSg 10 mM phosphate,
150 mM sodium chloride, 5% glycerol PEG Polyethyleneglycol PNP
p-nitrophenyl MC-VC-PAB-
Maleimidocaproyl-L-valine-L-citrulline-p-aminobenzyl PNP alcohol
p-nitrophenyl carbonate ppm Parts per million (chemical shift,
.delta.) RP Reversed phase rt or RT Room temperature SDS-PAGE
Sodium dodecylsulfate polyacrylamide gel electrophoresis SEC Size
exclusion chromatography Suc Succinic acid TCEP
Tris(2-carboxyethyl)phosphine hydrochloride TEA Triethylamine TMS
tetramethylsilane TFA Trifluoroacetic acid TG Transglutaminase THF
Tetrahydrofuran TOF Time-of-flight UPLC Ultra Performance Liquid
Chromatography UV Ultraviolet VA Valine-alanine VC
Valine-citrulline VC-PAB
Valine-citrulline-para-aminobenzyloxy(carbonyl)
PREPARATION METHODS
Example 1
[0534] This example demonstrates general methods for the synthesis
of the podocarpic derivatives, 9a to 9r, 9t, and 9u in Table 1,
above. This example refers to the compounds numbered from 1 to 9a-p
in FIG. 1.
[0535] In FIG. 1, the starting material podocarpic acid 1 was
originally discovered in plant resins in 1873, and later was
reported from several species of Podocarpus (See, e.g., J. Chem.
Soc. 1938, 1006-1013). The synthesis of compound 4 from podocarpic
acid 1 was reported previously (See, e.g., Bioorg. Med. Chem. Lett.
2005 15, 2824; Bioorg. Med. Chem. Lett. 2005, 15, 4574). Acyl
chloride 6a was prepared from treatment of 4 with thionyl chloride;
and active ester 6b was prepared from treatment of 4 with 5. The
symmetric imide 8a was synthesized from treatment of amide 7a with
acid chloride 6a or activated ester 6b, and was then subjected to
de-benzylation via hydrogenation to afford imide 9a. Similarly, the
asymmetric imides 8b-e and 8g were synthesized from coupling
reactions of amides 7b-g with activated ester 6b or acid chloride
6a. Yields for asymmetric imides 8b-e and 8g from 6a were lower
compared to yields for symmetric imide 8a, but the yields for 8b-e
and 8g using activated ester 6b, were increased from .about.40% to
50-85%.
[0536] Imides 9a-e were obtained from 8a-e via de-protections of
the corresponding protective groups--Bn in 8a, TBS in 8b, or Boc in
8c, 8d, and 8e, respectively. N,N-dimethylated analog 9f was
obtained from hydrogenation of 8d in methanol to remove the benzyl
group while concomitantly N,N-dimethylating the aniline nitrogen;
N-Boc analog 9g was obtained from de-benzylation of 8d. Compounds
9h-o were obtained from amide coupling reactions of 9d with the
amino-acid derivatives in the presence of HATU and DIPEA, followed
by de-protection of the Boc groups with 10-25% TFA in DCM or by
de-protection of the Fmoc groups with 20% piperidine in an organic
solvent. The amide coupling reactions of 9d with Fmoc-Gly-OH
followed by deprotection of Fmoc provided 9h; Boc-beta-Ala-OH
followed by deprotection of Boc provided 9i; Boc-Ser-OH followed by
deprotection of Boc provided 9j; Boc-Sar-OH followed by
deprotection of Boc provided 9k; Boc-Lys(Boc)-OH followed by
deprotection of Boc provided 9l; Boc-His-OH followed by
deprotection of Boc provided 9m; Boc-Asp-OtBu followed by
deprotection of Boc and --OtBu provided 9n in one pot; and
Boc-Glu-OtBu followed by deprotection of Boc and --OtBu provided 9o
in one pot, respectively. Compound 9p was synthesized from the
amide coupling reaction of 7g with 6b in the presence of LiHMDS to
form 8g, followed by Raney Nickel catalyzed reduction of the
nitrile to the amine and debenzylation with boron tribromide
(BBr.sub.3). Compound 9q was obtained from the amide coupling
reaction of 9d with glutaric anhydride. Compound 9r was obtained
from the amide coupling reaction of 9d with Boc-iminodiacetic acid
followed by Boc deprotection. Compound 9t was obtained from the
amide coupling reaction of 7d with an activated ester of
dehydroabietic acid (Cas No. 1740-19-8) followed by Boc
deprotection.
Example 1a
Synthesis of Payload 9d (FIG. 1a)
Methyl
(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydro-
phenanthrene-1-carboxylate (P1-2)
##STR00289##
[0538] To a solution of podocarpic acid (P1-1, 90 g, 0.33 mol) in
methanol (200 mL) and toluene (600 mL) was added with
(trimethylsilyl)diazomethane (2 M in hexane, 200 mL). The reaction
mixture was stirred at room temperature for 2 hours. The podocarpic
acid was then totally consumed according to LCMS. The volatiles
were removed in vacuo, and the residue was triturated from
petroleum ether (2 L) to give compound P1-2 (91 g, 96% yield) as a
white solid. ESI m/z: 289 (M+H)+. .sup.1H NMR (400 MHz,
DMSO.sub.d6) .delta. 8.95 (s, 1H), 6.79 (d, J=8.2 Hz, 1H), 6.63 (d,
J=2.4 Hz, 1H), 6.48 (dd, J=8.2, 2.4 Hz, 1H), 3.58 (s, 3H),
2.80-2.55 (m, 2H), 2.20-2.02 (m, 3H), 1.96-1.71 (m, 2H), 1.56-1.45
(m, 2H), 1.27 (t, J=13.5 Hz, 1H), 1.21 (s, 3H), 1.09 (td, J=13.5,
4.1 Hz, 1H), 0.91 (s, 3H) ppm.
Methyl
(1S,4aS,10aR)-1,4a-dimethyl-6-(trifluoromethanesulfonyloxy)-1,2,3,4-
,4a,9,10,10a-octahydrophenanthrene-1-carboxylate (P1-3)
##STR00290##
[0540] To a solution of compound P1-2 (10 g, 35 mmol) in methylene
chloride (200 mL) were added pyridine (3.3 g, 42 mmol) and DMAP
(0.84 g, 6.9 mmol) under nitrogen atmosphere. The mixture was
cooled to -78.degree. C. and was added triflic anhydride (12 g, 42
mmol), and the resulting mixture was allowed to warm to 25.degree.
C. and stirred at 25.degree. C. for another 4 hours. The reaction
mixture was diluted with DCM (500 mL), washed with water (100 mL),
aq. hydrochloride (1 N, 150 mL) and brine (100 mL), dried over
sodium sulfate and concentrated in vacuo to give crude compound
P1-3 (14 g, 97% crude yield) as viscous oil, which was pure enough
for the next step. The crude compound P1-3 could be purified by
flash chromatography (0-10% ethyl acetate in petroleum ether) to
give pure product as viscous oil. ESI m/z: 421.2 (M+1).sup.+.
.sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.12 (d, J=2.5 Hz, 1H),
7.10 (d, J=8.5 Hz, 1H), 6.97 (dd, J=8.5, 2.5 Hz, 1H), 3.67 (s,
J=3.4 Hz, 3H), 2.93 (dd, J=17.2, 4.4 Hz, 1H), 2.85-2.71 (m, 1H),
2.29 (d, J=13.5 Hz, 1H), 2.25-2.14 (m, 2H), 2.03-1.89 (m, 2H),
1.71-1.61 (m, 1H), 1.56-1.48 (m, 1H), 1.40 (td, J=13.4, 4.2 Hz,
1H), 1.30-1.22 (m, 3H), 1.09 (td, J=13.6, 4.2 Hz, 1H), 1.02 (s, 3H)
ppm.
Methyl
(1S,4aS,10aR)-6-((tert-butoxycarbonyl)amino)-1,4a-dimethyl-1,2,3,4,-
4a,9,10,10a-octahydrophenanthrene-1-carboxylate (P1-4)
##STR00291##
[0542] To a solution of compound P1-3 (14 g, 34 mmol) and
tert-butyl carbamate (BocNH.sub.2, 7.9 g, 68 mmol) in tert-butanol
(100 mL) were added, successively, cesium carbonate (22 g, 68
mmol), tris(dibenzylideneacetone)dipalladium(0)
(Pd.sub.2(dba).sub.3, 1.8 g, 2.0 mmol) and X-Phos (1.8 g, 4.0 mmol)
at room temperature. The mixture was de-gassed and purged with
argon 3 times and was then stirred at 80.degree. C. under argon
(balloon) overnight until compound P1-3 was totally consumed, as
monitored by TLC. After cooling to room temperature, the reaction
mixture was diluted with ethyl acetate and filtered through Celite.
The solid was washed with ethyl acetate for 3 times. The combined
filtrate was concentrated in vacuo and the residue was purified by
silica gel column chromatography (0-6.25% ethyl acetate in
petroleum ether) to give compound P1-4 (11 g, 82% yield) as a white
solid. ESI m/z: 410 (M+23).sup.+. .sup.1H NMR (500 MHz,
DMSO.sub.d6) .delta. 9.07 (s, 1H), 7.39 (s, 1H), 7.13 (d, J=8.5 Hz,
1H), 6.87 (d, J=8.3 Hz, 1H), 3.59 (s, 3H), 2.76 (dd, J=16.4, 4.5
Hz, 1H), 2.70-2.61 (m, 1H), 2.16-2.05 (m, 3H), 2.00-1.75 (m, 2H),
1.65-1.50 (m, 2H), 1.45 (s, 9H), 1.31-1.25 (m, 1H), 1.21 (s, 3H),
1.10 (td, J=13.5, 4.1 Hz, 1H), 0.92 (s, 3H) ppm.
(1S,4aS,10aR)-6-{[(tert-Butoxy)carbonyl]amino}-1,4a-dimethyl-1,2,3,4,4a,9,-
10,10a-octahydrophenanthrene-1-carboxylic Acid (P1-5)
##STR00292##
[0544] To a solution of compound P1-4 (4.9 g, 13 mmol) in DMSO was
added potassium tert-butoxide (15 g, 0.13 mol) in one portion at
room temperature. The reaction mixture was stirred at 60.degree. C.
for 3 hours under argon until the reaction was completed according
to LCMS. After cooling to room temperature, the reaction mixture
was poured into ice and acidified slowly with aq. hydrochloride
(0.5 M) to pH 5, during which the temperature did not exceed
25.degree. C. The precipitates were collected by filtration and
washed with water several times. The crude product was further
purified by silica gel column chromatography (0-20% ethyl acetate
in petroleum ether) to give compound P1-5 (4.5 g, 93% yield) as a
white solid. ESI m/z: 318 (M-55).sup.+. .sup.1H NMR (500 MHz,
DMSO.sub.d6) .delta. 12.08 (s, 1H), 9.08 (s, 1H), 7.40 (s, 1H),
7.11 (s, 1H), 6.87 (d, J=8.3 Hz, 1H), 2.79-2.68 (m, 1H), 2.65 (d,
J=12.6 Hz, 1H), 2.17-2.03 (m, 4H), 1.94-1.76 (m, 2H), 1.53 (d,
J=13.7 Hz, 1H), 1.46 (d, J=7.4 Hz, 9H), 1.29-1.14 (m, 5H), 1.04 (s,
3H) ppm.
tert-Butyl
N-[(4bS,8S,8aR)-8-carbamoyl-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-oc-
tahydrophenanthren-3-yl]carbamate (P1-6)
##STR00293##
[0546] To a solution of P1-5 (4.5 g, 12 mmol) and HATU (4.9 g, 13
mmol) in DMF (50 mL) was added diisopropylethylamine (20 mL, 0.12
mol), and the mixture was stirred at 25.degree. C. for an hour. To
the mixture was then added ammonium chloride (16 g, 0.30 mol) and
the mixture was stirred at room temperature overnight. The
resulting mixture was diluted with ethyl acetate, washed with water
and brine, dried over sodium sulfate and concentrated in vacuo. The
residue was purified by flash chromatography (0-20% ethyl acetate
in petroleum ether) to give compound P1-6 (4.2 g, 94% yield) as a
white solid. ESI m/z: 373.3 (M+1).sup.+.
[0547] .sup.1H NMR (500 MHz, methanol.sub.d4) .delta. 7.20 (s, 1H),
6.97 (d, J=7.7 Hz, 1H), 6.80 (d, J=8.3 Hz, 1H), 2.77-2.68 (m, 2H),
2.66-2.55 (m, 1H), 2.20 (d, J=12.9 Hz, 1H), 2.13 (dd, J=13.2, 5.3
Hz, 1H), 2.08 (d, J=14.0 Hz, 1H), 2.03-1.86 (m, 2H), 1.54 (d,
J=11.1 Hz, 1H), 1.40 (s, 9H), 1.26 (t, J=26.7 Hz, 1H), 1.18 (s,
3H), 1.14-1.03 (m, 4H) ppm.
Methyl
(1S,4aS,10aR)-6-(benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octah-
ydrophenanthrene-1-carboxylate (P1-8)
##STR00294##
[0549] A mixture of compound P1-2 (12 g, 40 mmol) and cesium
carbonate (14 g, 44 mmol) in DMF (100 mL) was stirred at
20-25.degree. C. for 15 minutes. To the mixture was added benzyl
bromide (7.1 mL, 60 mmol) at room temperature. After stirring at
room temperature for 4 hours, the resulting mixture was poured into
cold water and extracted with ethyl acetate. The combined organic
solution was washed with water and brine, dried over sodium sulfate
and concentrated in vacuo. The crude product was purified by flash
chromatography (0-10% ethyl acetate in petroleum ether) to give the
title compound P1-8 (13 g, 89% yield) as a white solid. ESI m/z:
379 (M+H).sup.+. .sup.1H NMR (500 MHz, methanol.sub.d4) .delta.
7.60-7.20 (m, 5H), 7.00-6.82 (m, 2H), 6.73 (d, J=7.1 Hz, 1H), 5.03
(s, 2H), 3.66 (s, 3H), 2.95-2.58 (m, 2H), 2.36-2.10 (m, 3H),
2.10-1.85 (m, 2H), 1.70-1.48 (m, 2H), 1.44-1.21 (m, 4H), 1.15 (t,
J=17.2 Hz, 1H), 1.01 (s, 3H) ppm.
1S,4aS,10aR)-6-(Benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophen-
anthrene-1-carboxylic Acid (P1-9)
##STR00295##
[0551] A mixture of compound P1-8 (11 g, 29 mmol) and potassium
tert-butoxide (33 g, 0.29 mol) in DMSO (0.19 L) was stirred at
100.degree. C. for an hour until the methyl group was totally
removed, as monitored by LCMS and TLC. After cooling to 25.degree.
C., the mixture was quenched with aqueous hydrochloride (1 N) and
extracted with ethyl acetate. The combined organic solution was
washed with brine, dried over sodium sulfate and concentrated in
vacuo. The residue was purified by silica gel column chromatography
(0-24% ethyl acetate in petroleum ether) to give compound P1-9 (7.5
g, 71% yield) as a white solid. ESI m/z: 365 (M+H).sup.+. .sup.1H
NMR (500 MHz, methanol.sub.d4) .delta. 7.42 (d, J=7.4 Hz, 2H), 7.36
(t, J=7.5 Hz, 2H), 7.30 (t, J=7.3 Hz, 1H), 6.92 (d, J=8.4 Hz, 1H),
6.87 (d, J=2.5 Hz, 1H), 6.72 (dd, J=8.4, 2.5 Hz, 1H), 5.02 (s, 2H),
2.82 (dd, J=16.3, 4.4 Hz, 1H), 2.77-2.65 (m, 1H), 2.24 (d, J=13.2
Hz, 2H), 2.19 (dd, J=13.8, 6.0 Hz, 1H), 2.11-1.96 (m, 2H),
1.64-1.56 (m, 1H), 1.53 (d, J=11.0 Hz, 1H), 1.35 (td, J=13.3, 3.7
Hz, 1H), 1.30 (s, 3H), 1.13 (s, 3H), 1.11-1.05 (m, 1H) ppm.
Pentafluorophenyl
(1S,4aS,10aR)-6-(benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydroph-
enanthrene-1-carboxylate_(P1-10)
##STR00296##
[0553] To a solution of P1-9 (9.6 g, 26 mmol) in DMF (100 mL) was
added DIPEA (14 mL, 79 mmol), and perfluorophenyl
2,2,2-trifluoroacetate (15 g, 53 mmol). This mixture was stirred at
room temperature overnight, and monitored by LCMS. The reaction
mixture was then diluted with ether (200 mL) and washed with water
(300 mL) and brine (200 mL). The organic solution was dried over
sodium sulfate, and concentrated in vacuo. The residue was purified
by flash chromatography (0-10% ethyl acetate in petroleum ether) to
give compound P1-10 (12 g, 88% yield) as a white solid. ESI m/z:
531 (M+H).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 7.43
(d, J=7.1 Hz, 2H), 7.38 (t, J=7.4 Hz, 2H), 7.31 (t, J=7.2 Hz, 1H),
6.93 (dd, J=10.2, 5.5 Hz, 2H), 6.76 (dd, J=8.4, 2.5 Hz, 1H), 5.05
(s, 2H), 2.81 (dd, J=16.3, 4.5 Hz, 1H), 2.77-2.68 (m, 1H),
2.28-2.19 (m, 2H), 2.18 (dd, J=13.4, 5.6 Hz, 1H), 2.00-1.83 (m,
2H), 1.74 (d, J=11.8 Hz, 1H), 1.65 (d, J=14.1 Hz, 1H), 1.47 (s,
3H), 1.38-1.27 (m, 2H), 1.08 (s, 3H) ppm.
tert-Butyl
N-[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-(benzyloxy)-1,4a-dimethyl--
1,2,3,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dim-
ethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamate
(P1-11)
##STR00297##
[0555] To a solution of compound P1-6 (2.3 g, 6.2 mmol) in THF (20
mL) was added dropwise n-BuLi (2.5 M in hexane, 5.5 mL, 14 mmol) at
-78.degree. C. The reaction was stirred at this temperature for 1
hour. To the mixture was added a solution of P1-10 (3.0 g, 5.6
mmol) in THF (20 mL), and the resulting mixture was then stirred at
10-20.degree. C. overnight until compound P1-10 was consumed, as
monitored by LCMS. The reaction was quenched with sat. aq. ammonium
chloride and extracted with ethyl acetate. The combined organic
solution was washed with water and brine, dried over sodium sulfate
and concentrated in vacuo. The residue was purified by flash
chromatography (0-30% ethyl acetate in petroleum ether) to give
compound P1-11 (1.59 g, 51% yield) as a white solid. ESI m/z: 719
(M+1).sup.+.
tert-Butyl
N-[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,-
3,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethy-
l-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamate
(P1-12)
##STR00298##
[0557] To a solution of P1-11 (2.0 g, 2.78 mmol) in ethyl acetate
(40 mL) was added wet palladium on carbon (10% Pd, 0.9 g) under
nitrogen protection. The mixture was degassed and purged with
hydrogen and stirred at room temperature under hydrogen balloon
overnight until P1-11 was totally consumed, which was monitored by
LCMS. The mixture was filtered through Celite and the filtration
was concentrated in vacuo. The residue was purified by silica gel
column chromatography (0-55% ethyl acetate in petroleum ether) to
give P1-12 (1.06 g, 61% yield) as a white solid. ESI m/z: 629
(M+H).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 9.10 (s,
1H), 8.98 (s, 1H), 8.11 (s, 1H), 7.40 (s, 1H), 7.15 (d, J=7.5 Hz,
1H), 6.90 (d, J=8.4 Hz, 1H), 6.81 (d, J=8.3 Hz, 1H), 6.63 (d, J=2.3
Hz, 1H), 6.50 (dd, J=8.2, 2.4 Hz, 1H), 2.84 (td, J=16.3, 3.8 Hz,
2H), 2.77-2.64 (m, 2H), 2.30-2.22 (m, 2H), 2.14 (t, J=10.9 Hz, 4H),
2.00-1.80 (m, 4H), 1.65-1.54 (m, 4H), 1.45 (s, 9H), 1.34-1.28 (m,
2H), 1.27 (d, J=2.5 Hz, 6H), 1.15-1.08 (m, 2H), 0.99 (s, 6H)
ppm.
(1S,4aS,10aR)--N-[(1S,4aS,10aR)-6-Amino-1,4a-dimethyl-1,2,3,4,4a,9,10,10a--
octahydrophenanthrene-1-carbonyl]-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,-
10a-octahydrophenanthrene-1-carboxamide (9d)
##STR00299##
[0559] To the solution of compound P1-12 (0.17 g, 0.27 mmol) in DCM
(10 mL) was added dropwise TFA (3 mL) at room temperature. The
reaction mixture was stirred at room temperature for an hour until
Boc was removed according to LCMS. The volatiles were removed in
vacuo and the residue was purified by prep-HPLC (method B) to give
9d (0.10 g, 70% yield) as a white solid.
[0560] ESI m/z: 529.3 (M+1).sup.+.
[0561] .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.14 (s, 1H), 6.92
(d, J=8.3 Hz, 1H), 6.86 (d, J=8.1 Hz, 1H), 6.73 (d, J=2.5 Hz, 1H),
6.65-6.57 (m, 2H), 6.50 (dd, J=8.1, 2.3 Hz, 1H), 4.75 (s, 1H), 3.49
(s, 1H), 2.99-2.85 (m, 2H), 2.79 (tt, J=11.6, 5.8 Hz, 2H),
2.34-2.14 (m, 6H), 2.15-1.95 (m, 4H), 1.74-1.51 (m, 5H), 1.46-1.34
(m, 2H), 1.30 (s, 6H), 1.21-1.06 (m, 8H) ppm.
[0562] .sup.1H NMR (400 MHz, DMSO.sub.d6) .delta. 8.99 (s, 1H),
8.09 (s, 1H), 6.81 (d, J=8.0 Hz, 1H), 6.68 (d, J=8.0 Hz, 1H), 6.63
(d, J=2.5 Hz, 1H), 6.50 (dd, J=8.0, 2.5 Hz, 1H), 6.48 (d, J=2.5 Hz,
1H), 6.34 (dd, J=8.0, 2.5 Hz, 1H), 4.69 (s, 2H), 2.86-2.60 (m, 4H),
2.28-2.10 (m, 6H), 1.94-1.75 (m, 4H), 1.65-1.53 (m, 4H), 1.35-1.20
(m, 8H), 1.20-1.06 (m, 2H), 0.98 (s, 6H) ppm.
[0563] .sup.13C NMR (100 MHz, DMSO.sub.d6) .delta. 174.03, 173.92,
155.34, 148.39, 147.63, 146.43, 129.56, 129.09, 124.60, 121.65,
113.23, 112.58, 111.81, 110.77, 52.32, 52.09, 45.56, 45.52, 39.20,
39.36, 38.23, 38.17, 37.18, 37.12, 31.08, 31.00, 27.65, 27.64,
23.08, 23.03, 21.43, 21.27, 19.64, 19.61 ppm.
[0564] HPLC (method B): Retention time: 8.92 min, purity: 99.4%.
chiral HPLC: >99.9% (in column AD, AS, OD, and OJ).
[0565] Optical rotation (.alpha.): +2.53.degree. (1.7 g/100 mL THF,
25.degree. C.).
Example 1b
Synthesis of LP8 (FIG. 1b)
(1S,4aS,10aR)-6-((S)-2-((S)-2-Amino-3-methylbutanamido)propanamido)-N-((1S-
,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthre-
ne-1-carbonyl)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-c-
arboxamide (LP1-2)
##STR00300##
[0567] To a solution of 9d (53 mg, 0.10 mmol) in DMF (1 mL) were
added Fmoc-Val-Ala-OH (41 mg, 0.10 mmol), HATU (38 mg, 0.1 mmol)
and diisopropylethylamine (26 mg, 0.20 mmol) successively. After
stirring at 25.degree. C. for 24 hours until 9d was consumed
according to LCMS, to the mixture was added piperidine (0.1 mL) and
the resulting solution was stirred at 25.degree. C. for another 3
hours. After filtration, the filtrate was directly purified by
prep-HPLC (method B) to give compound LP1-2 (45 mg, 64% yield) as a
white solid. ESI m/z: 699 (M+1).sup.+. .sup.1H NMR (500 MHz,
methanol.sub.d4) .delta. 8.40 (s, 1H), 7.47 (s, 1H), 7.32 (d, J=8.0
Hz, 1H), 7.03 (d, J=8.3 Hz, 1H), 6.88 (d, J=8.2 Hz, 1H), 6.72 (d,
J=2.4 Hz, 1H), 6.56 (dd, J=8.3, 2.4 Hz, 1H), 4.60-4.48 (m, 1H),
3.22-3.11 (m, 1H), 3.02-2.93 (m, 1H), 2.92-2.76 (m, 3H), 2.74-2.70
(m, 1H), 2.43-2.31 (m, 3H), 2.28 (d, J=14.1 Hz, 3H), 2.16-1.96 (m,
3H), 1.81 (s, 1H), 1.78-1.65 (m, 4H), 1.53-1.42 (m, 4H), 1.38 (d,
J=5.3 Hz, 6H), 1.33-1.22 (m, 2H), 1.14 (d, J=6.6 Hz, 6H), 1.09 (d,
J=18.6 Hz, 6H) ppm.
(1S,4aS,10aR)-6-((2S)-2-((2S)-2-((2R)-2-Amino-6-(2-(cyclooct-2-ynyloxy)ace-
tamido)hexanamido)-3-methylbutanamido)propanamido)-N-((1S,4aS,10aR)-6-hydr-
oxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,-
4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide
(LP1-4)
##STR00301##
[0569] To a solution of compound LP1-3 (35 mg, 0.064 mmol) in DMF
(1 mL) were added HATU (24 mg, 0.064 mmol) and compound LP1-2 (45
mg, 0.064 mmol) in succession at room temperature. The mixture was
stirred for a few minutes at room temperature until the mixture was
homogenous. To this mixture was added diisopropylethylamine (41 mg,
0.32 mmol) at room temperature by syringe. The resulting mixture
was stirred at room temperature overnight (16 hours) until LP1-2
was mostly consumed according to LCMS. To this reaction mixture was
then added piperidine (0.1 mL, excess) dropwise at room temperature
and the mixture was stirred for another 3 hours until Fmoc was
removed, as monitored by LCMS. The reaction mixture was directly
purified by reversed phase flash chromatography or prep-HPLC
(method B, basic condition) to give compound LP1-4 (30 mg, 47%
yield) as a white solid. ESI m/z: 991 (M+1).sup.+. .sup.1H NMR (500
MHz, methanol.sub.d4) .delta. 7.51 (d, J=1.5 Hz, 1H), 7.37 (dd,
J=8.3, 2.0 Hz, 1H), 7.02 (d, J=8.3 Hz, 1H), 6.89 (d, J=8.4 Hz, 1H),
6.72 (d, J=2.4 Hz, 1H), 6.56 (dd, J=8.3, 2.5 Hz, 1H), 4.64-4.57 (m,
1H), 4.48 (q, J=7.1 Hz, 1H), 4.33-4.27 (m, 1H), 4.20 (d, J=6.7 Hz,
1H), 3.93 (m, 2H), 3.43 (t, J=6.6 Hz, 1H), 3.24 (t, J=6.9 Hz, 2H),
3.02-2.93 (m, 2H), 2.92-2.76 (m, 3H), 2.40-2.32 (m, 2H), 2.33-2.23
(m, 4H), 2.22-2.12 (m, 3H), 2.12-2.00 (m, 5H), 1.99-1.91 (m, 1H),
1.91-1.81 (m, 2H), 1.78-1.66 (m, 6H), 1.66-1.58 (m, 1H), 1.58-1.49
(m, 2H), 1.45 (d, J=7.1 Hz, 6H), 1.38 (d, J=4.0 Hz, 6H), 1.34-1.22
(m, 4H), 1.14 (d, J=7.0 Hz, 6H), 1.06-0.98 (m, 6H) ppm.
(1S,4aS,10aR)-N-{[(1S,4aS,10aR)-6-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-{2-[(1-{-
[31,32,33,34,35,36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-pentakis-
(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo[26.2.2-
.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetracontan-5--
yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy]acetam-
ido}hexanamido]-3-methylbutanamido]propanamido]-1,4a-dimethyl-1,2,3,4,4a,9-
,10,10a-octahydrophenanthren-1-yl]carbonyl}-6-hydroxy-1,4a-dimethyl-1,2,3,-
4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (LP1-5)
##STR00302##
[0571] To a solution of compound LP1-4 (30 mg, 30 .mu.mol) in DMF
(0.5 mL) was added a solution of CD-N.sub.3 (60 mg, 60 .mu.mol) in
DMF (0.5 mL) at room temperature by syringe. The mixture was
stirred at 20-25.degree. C. for 3 days. Compound LP1-4 was mostly
consumed according to LCMS. The reaction mixture was directly
purified by prep-HPLC (method B) to give compound LP1-5 (14 mg, 23%
yield) as a white solid. ESI m/z: 995 (M/2+1).sup.+. .sup.1H NMR
(500 MHz, methanol.sub.d4) .delta. 8.40 (s, 1H), 7.56-7.52 (m, 1H),
7.32 (t, J=7.7 Hz, 1H), 7.03 (d, J=8.4 Hz, 1H), 6.88 (d, J=8.3 Hz,
1H), 6.72 (d, J=2.4 Hz, 1H), 6.56 (dd, J=8.2, 2.3 Hz, 1H),
5.24-5.16 (m, 1H), 5.01-4.95 (m, 6H), 4.65-4.59 (m, 1H), 4.52-4.44
(m, 1H), 4.31-4.22 (m, 2H), 4.13-3.73 (m, 22H), 3.63-3.43 (m, 14H),
3.14-2.72 (m, 7H), 2.45-2.32 (m, 3H), 2.28 (d, J=13.8 Hz, 3H),
2.22-1.85 (m, 11H), 1.82-1.59 (m, 9H), 1.55-1.41 (m, 8H), 1.38 (d,
J=5.3 Hz, 6H), 1.31-1.26 (m, 3H), 1.14 (d, J=7.2 Hz, 6H), 1.06-0.93
(m, 6H) ppm.
1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9),5,7,13,15-hexaen--
10-yn-2-yl}-4-oxobutanamido)-N-[(1R)-1-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8--
({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophen-
anthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydr-
ophenanthren-3-yl]carbamoyl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-{-
2-[(1-{[31,32,33,34,35,36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-p-
entakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo-
[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetraco-
ntan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy-
]acetamido}pentyl]-3,6,9,12-tetraoxapentadecan-15-amide (LP8)
##STR00303##
[0573] To a solution of compound LP1-5 (14 mg, 7.4 .mu.mol) and
DIBAC-Suc-PEG.sub.4-OSu (6.5 mg, 10 .mu.mol) in DMF (1 mL) was
added triethylamine (2.0 mg, 20 .mu.mol) and the mixture was
stirred at 20-25.degree. C. for 16 hours. Most of the volatiles
were removed in vacuo and the residue was purified by prep-HPLC
(method B) to give compound LP8 (5.0 mg, 27% yield) as a white
solid. ESI m/z: 1261 (M/2+1).sup.+. .sup.1H NMR (500 MHz,
methanol.sub.d4) .delta. 7.69-7.44 (m, 6H), 7.41-7.30 (m, 3H), 7.26
(d, J=6.8 Hz, 1H), 7.04-6.96 (m, 1H), 6.88 (d, J=8.4 Hz, 1H), 6.72
(d, J=1.9 Hz, 1H), 6.56 (dd, J=8.3, 2.4 Hz, 1H), 5.25-5.18 (m, 1H),
5.17-5.08 (m, 1H), 5.01-4.94 (m, 4H), 4.61 (s, 16H), 4.53-4.13 (m,
5H), 4.03-3.80 (m, 18H), 3.74-3.64 (m, 3H), 3.63-3.41 (m, 23H),
3.28-2.76 (m, 12H), 2.76-2.65 (m, 1H), 2.56-2.44 (m, 2H), 2.42-2.31
(m, 4H), 2.30-2.23 (m, 4H), 2.18-1.92 (m, 9H), 1.79-1.55 (m, 9H),
1.49-1.34 (m, 9H), 1.33-1.22 (m, 3H), 1.18-1.10 (m, 6H), 1.06-0.94
(m, 6H) ppm.
Example 1c
Synthesis of LP32 (FIG. 1c)
(1S,4aS,10aR)-N-{[(1S,4aS,10aR)-6-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-{2-[(1-{-
[41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56-hexadecahydroxy-10,15,20,-
25,30,35,40-heptakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29,32,34,-
37,39-hexadecaoxanonacyclo[36.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.1-
8,21.2.sup.23,26.2.sup.28,31.2.sup.33,36]hexapentacontan-5-yl]methyl}-1H,4-
H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy]acetamido}hexanamido]-
-3-methylbutanamido]propanamido]-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahyd-
rophenanthren-1-yl]carbonyl}-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-o-
ctahydrophenanthrene-1-carboxamide (LP2-5)
##STR00304##
[0575] To a solution of compound LP1-4 (30 mg, 0.030 mmol) in DMF
(2 mL) was added .gamma.CD-N.sub.3 (0.12 mg, 0.091 mmol). The
mixture was stirred at RT for 16 hours, which was monitored by
LCMS. The mixture was filtered through membrane and the filtrate
was then purified by prep-HPLC (method A) to give compound LP2-5
(40 mg, 57% yield) as a white solid. ESI m/z: 1157.6 (M/2+1).sup.+.
.sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 9.82 (s, 1H), 9.00 (s,
1H), 8.55 (d, J=9.0 Hz, 1H), 8.39 (d, J=6.5 Hz, 1H), 8.11-8.04 (m,
4H), 7.93-7.88 (m, 1H), 7.45 (s, 1H), 7.35 (d, J=8.0 Hz, 1H), 6.97
(d, J=8.5 Hz, 1H), 6.81 (d, J=8.5 Hz, 1H), 6.63 (s, 1H), 6.50 (d,
J=11 Hz, 1H), 5.89-5.68 (m, 16H), 5.16-4.32 (m, 19H), 3.94-3.80 (m,
4H), 3.69-3.51 (m, 50H), 3.18-2.64 (m, 8H), 2.33-1.85 (m, 12H),
1.65-1.11 (m, 25H), 0.99 (d, J=9.5 Hz, 6H), 0.89-0.83 (m, 6H)
ppm.
1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9),5,7,13,15-hexaen--
10-yn-2-yl}-4-oxobutanamido)-N-[(1R)-1-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8--
({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophen-
anthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydr-
ophenanthren-3-yl]carbamoyl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-{-
2-[(1-{[41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56-hexadecahydroxy-10-
,15,20,25,30,35,40-heptakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-
,32,34,37,39-hexadecaoxanonacyclo[36.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.-
2.sup.18,21.2.sup.23,26.2.sup.28,31.2.sup.33,36]hexapentacontan-5-yl]methy-
l}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy]acetamido}pent-
yl]-3,6,9,12-tetraoxapentadecan-15-amide (LP32)
##STR00305##
[0577] To a solution of compound LP2-6 (4.3 mg, 7.8 .mu.mol) in
anhydrous DMF (1 mL) was added HATU (3.0 mg, 7.8 .mu.mol). The
mixture was stirred at 10.degree. C. for 10 minutes before compound
LP2-5 (15 mg, 6.5 .mu.mol) and DIPEA (1.7 mg, 13 .mu.mol) was
added. The mixture was stirred at RT for 2 hours until LP2-5 was
totally consumed, as monitored by LCMS. The mixture was filtered
through a membrane and the filtrate was purified by prep-HPLC
(method B) to give compound LP32 (6.0 mg, 32% yield) as a white
solid. ESI m/z: 1424.2 (M/2+1).sup.+. .sup.1H NMR (500 MHz,
DMSO.sub.d6) .delta. 9.26 (s, 1H), 8.95 (s, 1H), 8.24-7.98 (m, 4H),
7.81 (d, J=5.6 Hz, 1H), 7.72 (t, J=5.5 Hz, 1H), 7.67 (d, J=8.1 Hz,
1H), 7.61 (d, J=7.4 Hz, 1H), 7.55 (s, 1H), 7.53-7.25 (m, 7H), 6.95
(d, J=8.5 Hz, 1H), 6.81 (d, J=8.4 Hz, 1H), 6.63 (d, J=2.1 Hz, 1H),
6.50 (dd, J=8.2, 2.1 Hz, 1H), 5.94-5.58 (m, 15H), 5.39-4.43 (m,
17H), 4.37-4.24 (m, 3H), 4.13-4.08 (m, 1H), 3.98-3.33 (m, 52H),
3.26-2.52 (m, 18H), 2.40-1.18 (m, 48H), 1.18-0.63 (m, 19H) ppm.
Solubility: 0.075 mg/mL H.sub.2O.
Example 1d
Synthesis of LP13 (FIG. 1d)
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-{2-[(1-{[31,32,33,34,35,36,37,38,39,40,-
41,42-dodecahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4,7,9,12,14,1-
7,19,22,24,27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,-
16.2.sup.18,21.2.sup.23,26]dotetracontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-
-cycloocta[d][1,2,3]triazol-4-yl)oxy]acetamido}hexanamido]-3-methylbutanam-
ido]-5-(carbamoylamino)pentanamido]phenyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (LP5-1)
##STR00306##
[0579] To a solution of compound LP15 (20 mg, 15 .mu.mol) in DMF (1
mL) was added a solution of CD-N.sub.3 (46 mg, 45 .mu.mol) in
acetonitrile (2 mL) and water (2 mL) at RT. The mixture was stirred
at 30.degree. C. for 16 hours. Compound LP15 was mostly consumed
according to LCMS. The reaction mixture was directly purified by
prep-HPLC (method B) to give compound LP5-1 (20 mg, 57% yield) as a
white solid. ESI m/z: 1156.0 (M/2+1).sup.+.
{4-[(2S)-2-[(2S)-2-[(2R)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-
-1(12),4(9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraox-
apentadecan-15-amido]-6-{2-[(1-{[31,32,33,34,35,36,37,38,39,40,41,42-dodec-
ahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,-
27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18-
,21.2.sup.23,26]dotetracontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[-
d][1,2,3]triazol-4-yl)oxy]acetamido}hexanamido]-3-methylbutanamido]-5-(car-
bamoylamino)pentanamido]phenyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (LP13)
##STR00307##
[0580] To a solution of DIBAC-PEG.sub.4-acid LP5-2 (4.3 mg, 7.8
.mu.mol) in DMF (1 mL) were added HATU (3.0 mg, 3.6 .mu.mol) and
DIPEA (1.7 mg, 13 .mu.mol) at RT. The resulting mixture was stirred
at RT for 10 minutes. To the mixture was then added LP5-1 (15 mg,
6.5 .mu.mol). The reaction mixture was stirred at 30.degree. C. for
2 hours until the reaction completed, as monitored by LCMS. The
reaction mixture was filtered and purified by prep-HPLC (method B)
to give LP13 (10 mg, 42% yield) as a white solid. ESI m/z: 1424.3
(M/2+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 9.81-9.67
(m, 2H), 8.99 (s, 1H), 8.20-8.06 (m, 5H), 7.85-7.22 (m, 18H),
6.97-6.49 (m, 2H), 5.98 (s, 1H), 5.65-5.33 (m, 15H), 5.14-4.92 (m,
5H), 4.82-4.72 (m, 6H), 4.60-4.54 (m, 4H), 4.36-4.28 (m, 3H),
4.18-3.96 (m, 3H), 3.85-3.55 (m, 27H), 3.49-3.39 (m, 23H),
3.28-3.08 (m, 8H), 2.94-2.57 (m, 4H), 2.42-2.07 (m, 8H), 1.99-1.45
(m, 22H), 1.28-1.11 (m, 23H), 1.05-0.95 (m, 6H), 0.89-0.79 (m, 7H)
ppm.
Example 1e
Synthesis of LP36 (FIG. 1e)
1-Azido-15-oxo-3,6,9,12-tetraoxa-16-azaoctadecane-18-sulfonic Acid
(L6-2)
##STR00308##
[0582] To a solution of azido-PEG.sub.4-NHS (L6-1, 0.10 g, 0.26
mmol) in anhydrous DMF (4 mL) were added taurine (39 mg, 0.31 mmol)
and DIPEA (15 mg, 0.52 mmol). The mixture was stirred at 25.degree.
C. overnight. The mixture was filtered and the filtrate was
purified by prep-HPLC (method A) to give compound LP6-2 (80 mg, 78%
yield) as colorless oil. ESI m/z: 399.1 (M+H).sup.+. .sup.1H NMR
(500 MHz, D.sub.2O) .delta. 3.69 (t, J=6.0 Hz, 2H), 3.64-3.59 (m,
14H), 3.49 (t, J=6.5 Hz, 2H), 3.41 (t, J=4.5 Hz, 2H), 3.00 (t,
J=7.0 Hz, 2H), 2.45 (t, J=6.0 Hz, 2H) ppm.
2-{1-[4-({[(5R)-5-Amino-5-{[(1S)-1-{[(1S)-1-({4-[({[(1S)-1-{[(4bS,8S,8aR)--
8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydroph-
enanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahy-
drophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]carbamoyl}oxy)methyl]phenyl}-
carbamoyl)-4-(carbamoylamino)butyl]carbamoyl}-2-methylpropyl]carbamoyl}pen-
tyl]carbamoyl}methoxy)-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-1-y-
l]-3,6,9,12-tetraoxapentadecan-15-amido}ethane-1-sulfonic Acid
(LP6-3)
##STR00309##
[0584] To a solution of compound LP6-2 (20 mg, 50 .mu.mol) in water
(1 mL) was added dropwise sat. aq. sodium bicarbonate solution at
0.degree. C. until pH.about. 7. To the stirred solution was then
added a solution of compound LP15 (28 mg, 21 .mu.mol) in
acetontrile (1 mL) by syringe. The mixture was stirred at
25.degree. C. overnight. The reaction mixture was monitored by LCMS
until compound LP15 was totally consumed. The reaction mixture was
filtered and purified by prep-HPLC (method A) to give compound
LP6-3 (15 mg, 41% yield) as a white solid. ESI m/z: 856.5
(M/2+1).sup.+.
2-{1-[4-({[(5R)-5-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9-
),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentadeca-
n-15-amido]-5-{[(1S)-1-{[(1S)-1-({4-[({[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS-
,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthren-1--
yl]formamido}carbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthr-
en-3-yl]carbamoyl}-2-hydroxyethyl]carbamoyl}oxy)methyl]phenyl}carbamoyl)-4-
-(carbamoylamino)butyl]carbamoyl}-2-methylpropyl]carbamoyl}pentyl]carbamoy-
l}methoxy)-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-1-yl]-3,6,9,12--
tetraoxapentadecan-15-amido}ethane-1-sulfonic Acid (LP36)
##STR00310##
[0586] To a solution of compound LP6-3 (15 mg, 8.8 .mu.mol) and
commercially available DIBAC-Suc-PEG.sub.4-OSu LP6-4 (5.7 mg, 8.8
.mu.mol, CAS 1427004-19-0) in DMF (1 mL) was added DIPEA (2.3 mg,
18 .mu.mol) and the mixture was stirred at RT for 2 hours. Most of
the volatiles were removed in vacuo and the residue was purified by
prep-HPLC (method B) to give LP36 (6.0 mg, 30% yield) as a white
solid. ESI m/z: 1123.8 (M/2+H).sup.+, 749.5 (M/3+H).sup.+. .sup.1H
NMR (500 MHz, methanol.sub.d4) .delta. 7.76-7.16 (m, 14H),
7.06-7.00 (m, 1H), 6.88 (d, J=8.5 Hz, 1H), 6.72-6.71 (m, 1H),
6.56-6.55 (m, 1H), 5.39-5.33 (m, 1H), 5.14-5.09 (m, 5H), 4.61 (s,
18H), 4.50-4.43 (m, 2H), 4.33-4.30 (m, 1H), 3.99 (s, 2H), 3.89-3.85
(m, 3H), 3.73-3.42 (m, 28H), 3.25-2.72 (m, 8H), 2.45 (t, J=7.5 Hz,
2H), 2.36-1.96 (m, 18H), 1.81-1.51 (m, 12H), 1.45-1.32 (m, 15H),
1.12-0.89 (m, 12H) ppm.
Example 1f
Synthesis of LP18 (FIG. 1f)
1-Azido-15-oxo-3,6,9,12-tetraoxa-16-azaoctadecane-18-sulfonic Acid
(L18-2)
##STR00311##
[0588] To a solution of azido-PEG.sub.4-NHS (L18-1, 0.10 g, 0.26
mmol) in anhydrous DMF (4 mL) were added taurine (39 mg, 0.31 mmol)
and DIPEA (15 mg, 0.52 mmol). The mixture was stirred at 25.degree.
C. overnight. The mixture was filtered and the filtrate was
purified by prep-HPLC (method A) to give compound LP18-2 (80 mg,
78% yield) as colorless oil. ESI m/z: 399.1 (M+H).sup.+. .sup.1H
NMR (500 MHz, D.sub.2O) .delta. 3.69 (t, J=6.0 Hz, 2H), 3.64-3.59
(m, 14H), 3.49 (t, J=6.5 Hz, 2H), 3.41 (t, J=4.5 Hz, 2H), 3.00 (t,
J=7.0 Hz, 2H), 2.45 (t, J=6.0 Hz, 2H) ppm.
1-(4-(2-((R)-5-Amino-6-((S)-1-((S)-1-((4bS,8S,8aR)-8-((1S,4aS,10aR)-6-hydr-
oxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonylcarb-
amoyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-ylamino)-1--
oxopropan-2-ylamino)-3-methyl-1-oxobutan-2-ylamino)-6-oxohexylamino)-2-oxo-
ethoxy)-4,5,6,7,8,9-hexahydro-1H-cycloocta[d][1,2,3]triazol-1-yl)-15-oxo-3-
,6,9,12-tetraoxa-16-azaoctadecane-18-sulfonic acid (LP18-3)
##STR00312##
[0590] To a solution of compound LP1-4 (40 mg, 40 .mu.mol) in DMF
(1 mL) was added azide LP18-2 (40 mg, 0.10 mmol) at RT. The
reaction was stirred at RT for 16 hours, until LCMS showed complete
reaction. The reaction mixture was directly purified by prep-HPLC
to give compound LP18-3 (43 mg, 77% yield) as a white solid. ESI
m/z: 695.4 (M/2+H).sup.+.
2-{1-[4-({[(5R)-5-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9-
),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentadeca-
n-15-amido]-5-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydrox-
y-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}ca-
rbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamo-
yl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}pentyl]carbamoyl}methoxy)-1H,-
4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-1-yl]-3,6,9,12-tetraoxapentad-
ecan-15-amido}ethane-1-sulfonic Acid (LP18)
##STR00313##
[0592] To a solution of compound LP18-3 (30 mg, 22 .mu.mol) in DMF
(1 mL) were added a solution of DIBAC-suc-PEG.sub.4-OSu (LP18-4, 14
mg, 22 .mu.mol) in DMF (1 mL) and DIPEA (4 mg, 32 .mu.mol)
successively at RT. The reaction mixture was stirred at RT for 2
hours. The reaction mixture was directly purified by prep-HPLC
(method B) to give compound LP18 (15 mg, 37% yield) as a white
solid. ESI m/z: 642 (M/3+H).sup.+. .sup.1H NMR (400 MHz,
DMSO.sub.d6) .delta. 9.68-9.27 (m, 1H), 8.99 (s, 1H), 8.23-7.85 (m,
4H), 7.79-7.71 (m, 2H), 7.76-7.42 (m, 6H), 7.39-7.28 (m, 3H), 7.21
(s, 1H), 7.09 (s, 1H), 6.96-6.93 (m, 2H), 6.81 (d, J=8.4 Hz, 1H),
6.63 (d, J=2.4 Hz, 1H), 6.50 (dd, J=8.4 Hz, 2.4 Hz, 1H), 5.02 (d,
J=14.0 Hz, 1H), 4.93-4.72 (m, 1H), 4.53-4.09 (m, 5H), 3.82-3.75 (m,
4H), 3.62-3.53 (m, 3H), 3.51-3.38 (m, 23H), 3.30-3.27 (m, 6H),
3.12-2.67 (m, 10H), 2.61-2.54 (m, 4H), 2.39-1.52 (m, 31H),
1.45-1.08 (m, 18H), 1.01-0.98 (m, 6H), 0.90-0.82 (m, 6H) ppm.
Example 1g
Synthesis of Payload 9j, Payload 9o, and Payload 9l
TABLE-US-00004 ##STR00314## [0593] ##STR00315## Cpd R PG Yield 9j
NHC(O)(S)--CH(CH.sub.2OH)NH.sub.2 (Ser) Fmoc 51% 9o
NHC(O)(S)--CH(CH.sub.2CH.sub.2COOH)NH.sub.2 tBu, Boc 46% (Glu) 9l
NHC(O)(S)--CH((CH.sub.2).sub.4NH.sub.2)NH.sub.2 Boc, Boc 49%
(Lys)
Payload 9j
(1S,4aS,10aR)-6-((S)-2-Amino-3-hydroxypropanamido)-N-((1S,4aS,10aR)-6-hydr-
oxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,-
4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide
(9j)
##STR00316##
[0595] To a solution of Fmoc-Ser-OH (33 mg, 0.1 mmol) in DMF (1 mL)
were added HATU (38 mg, 0.1 mmol), and DIPEA (39 mg, 0.3 mmol) at
25.degree. C. The resulting mixture was stirred at this temperature
for an hour. To the mixture was then added 9d (30 mg, 0.06 mmol).
After the reaction mixture was stirred at 25.degree. C. for 16
hours and 9d was totally consumed (monitored by LCMS), piperidine
(0.2 mL) was added into the mixture, which was stirred for another
30 min at room temperature. The residue was directly purified by
prep-HPLC (method B) to give 9j (18 mg, 51% yield) as a white
solid. ESI m/z: 616 (M+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6)
.delta. 9.74 (br s, 1H), 9.00 (s, 1H), 8.11 (s, 1H,), 7.58 (s, 1H),
7.41 (dd, J=8.2, 2.0 Hz, 1H), 6.96 (d, J=8.4 Hz, 1H), 6.82 (d,
J=8.3 Hz, 1H), 6.63 (d, J=2.3 Hz, 1H), 6.50 (dd, J=8.2, 2.4 Hz,
1H), 4.82 (t, J=5.5 Hz, 1H), 3.62-3.45 (m, 2H), 2.97-2.67 (m, 4H),
2.67-2.61 (m, 2H), 2.33-2.21 (m, 2H), 2.21-2.03 (m, 4H), 1.96-1.77
(m, 4H), 1.70-1.50 (m, 4H), 1.43-1.37 (m, 1H), 1.36-1.20 (m, 8H),
1.23-1.06 (m, 2H), 1.06-0.93 (m, 6H) ppm.
Payload 9o
(4S)-4-Amino-4-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,-
2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethy-
l-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}butanoic
acid; Trifluoroacetic Acid Salt (9o)
##STR00317##
[0597] To a solution of OtBu-N-Boc-Glu-OH (15 mg, 0.05 mmol) in DMF
(1 mL) was added HATU (19 mg, 0.05 mmol), and DIPEA (13 mg, 0.1
mmol) at 25.degree. C. The resulting mixture was stirred at this
temperature for an hour. To the mixture was then added 9d (14 mg,
0.026 mmol). After stirring at 25.degree. C. for 16 hours and 9d
was totally consumed (monitored by LCMS), the reaction mixture was
diluted with ethyl acetate and washed with water and brine. The
organic solution was dried over sodium sulfate and concentrated in
vacuo. The residue was dissolved in DCM (1 mL) and to the solution
was added TFA (0.1 mL) slowly at room temperature. The mixture was
stirred at room temperature for 2 hours. The volatiles were removed
in vacuo and the residue was purified by prep-HPLC (method A) to
give 9o (8 mg, 46% yield) as a white solid. ESI m/z: 658.3
(M+1).sup.+. .sup.1H NMR (400 MHz, DMSO.sub.d6) .delta. 10.32 (s,
1H), 9.00 (s, 1H), 8.12 (s, 1H), 7.48 (s, 1H), 7.35 (d, J=8.2 Hz,
1H), 7.02 (d, J=8.4 Hz, 1H), 6.82 (d, J=8.3 Hz, 1H), 6.63 (d, J=2.1
Hz, 1H), 6.50 (dd, J=8.2, 2.3 Hz, 1H), 3.87 (t, J=6.5 Hz, 1H),
2.97-2.67 (m, 4H), 2.41-2.22 (m, 4H), 2.22-2.08 (m, 4H), 2.05-1.97
(m, 2H), 1.94-1.80 (m, 4H), 1.69-1.52 (m, 4H), 1.42-1.22 (m, 8H),
1.22-1.06 (m, 2H), 1.02 (s, 3H), 0.99 (s, 3H) ppm. .sup.19F NMR
(376 MHz, DMSO.sub.d6) 8-73.50 ppm.
Payload 9l
(1S,4aS,10aR)--N-[(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10-
a-octahydrophenanthrene-1-carbonyl]-6-[(2S)-2,6-diaminohexanamido]-1,4a-di-
methyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide;
Trifluoroacetic Acid Salt (9l)
##STR00318##
[0599] To a solution of Boc-Lys-OH (15 mg, 0.05 mmol) in DMF (1 mL)
was added HATU (19 mg, 0.05 mmol), and DIPEA (13 mg, 0.1 mmol) at
25.degree. C. The resulting mixture was stirred at this temperature
for an hour. To the mixture was then added 9d (15 mg, 0.028 mmol).
After stirring at 25.degree. C. for 16 hours and 9d was totally
consumed (monitored by LCMS), the reaction mixture was diluted with
ethyl acetate and washed with water and brine. The organic solution
was dried over sodium sulfate and concentrated in vacuo. The
residue (Boc-9l) was dissolved in DCM (1 mL) and to the solution
was added TFA (0.1 mL) slowly at room temperature. The mixture was
stirred at room temperature for 2 hours. The volatiles were removed
in vacuo and the residue was purified by prep-HPLC (method A) to
give 9l (9 mg, 49% yield) as a white solid. ESI m/z: 657.5
(M+1).sup.+. .sup.1H NMR (400 MHz, DMSO.sub.d6) .delta. 10.33 (s,
1H), 9.01 (s, 1H), 8.13 (s, 1H), 7.78 (br s, 6H), 7.51 (s, 1H),
7.34 (d, J=8.1 Hz, 1H), 7.02 (d, J=8.5 Hz, 1H), 6.82 (d, J=8.6 Hz,
1H), 6.63 (s, 1H), 6.51 (d, J=8.3 Hz, 1H), 3.82 (s, 1H), 2.89 (s,
1H), 2.82-2.67 (m, 5H), 2.29 (s, 2H), 2.15 (s, 4H), 1.85 (s, 6H),
1.64-1.51 (m, 6H), 1.28 (d, J=6.8 Hz, 10H), 1.13 (s, 2H), 1.01 (s,
3H), 0.99 (s, 3H) ppm. .sup.19F NMR (376 MHz, DMSO.sub.d6) .delta.
-73.53 ppm.
Example 1h
Synthesis of LP15 (FIG. 1g)
{4-[(2S)-2-[(2S)-2-Amino-3-methylbutanamido]-5-(carbamoylamino)pentanamido-
]phenyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (LP4-2)
##STR00319##
[0601] To a solution of Fmoc-vc-PAB-PNP (LP4-1, 58 mg, 76 .mu.mol)
and 9j (36 mg, 58 .mu.mol) in DMF (3 mL) was added HOBt (7.9 mg, 58
.mu.mol) and DIPEA (15 mg, 0.12 mmol), and the mixture was stirred
at 30.degree. C. for 16 hours. Compound 9j was then totally
consumed according to LCMS. To the resulting mixture was added
diethylamine (0.1 mL) and the reaction was stirred at RT for an
hour until Fmoc was removed, as monitored by LCMS. After the
reaction was filtered, the filtrate was directly purified by
prep-HPLC (method B) to give compound LP4-2 (36 mg, 48% yield) as a
light yellow solid. ESI m/z: 1021 (M+1).sup.+.
[0602] .sup.1H NMR (400 MHz, DMSO.sub.d6) .delta. 10.02 (s, 1H),
9.82 (s, 1H), 9.00 (s, 1H), 8.69-8.65 (m, 1H), 8.11-8.00 (m, 4H),
7.65-7.53 (m, 3H), 7.40-7.30 (m, 3H), 7.30-7.20 (m, 1H), 6.96 (d,
J=8.0 Hz, 1H), 6.81 (d, J=8.0 Hz, 1H), 6.65-6.61 (m, 1H), 6.50 (dd,
J=8.0 Hz, 2.0 Hz, 1H), 6.00-5.95 (m, 1H), 5.48 (s, 2H), 5.00-4.95
(m, 3H), 4.60-4.40 (m, 1H), 4.25-4.20 (m, 1H), 3.65-3.55 (m, 4H),
3.15-2.55 (m, 10H), 2.40-2.20 (m, 3H), 2.20-2.00 (m, 5H), 2.00-1.80
(m, 4H), 1.86-1.55 (m, 6H), 1.27 (d, J=4.8 Hz, 9H), 1.20-1.10 (m,
2H), 0.97-0.90 (m, 6H) ppm.
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-[2-(cyclooct-2-yn-1-yloxy)acetamido]hex-
anamido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (LP15)
##STR00320##
[0604] To a solution of compound LP4-3 (24 mg, 44 .mu.mol) in DMF
(2 mL) was added HATU (17 mg, 44 .mu.mol) and compound LP4-2 (35
mg, 34 .mu.mol) in succession at RT. The mixture was stirred for a
few minutes at RT until the mixture was homogenous. To this mixture
was added DIPEA (8.8 mg, 68 .mu.mol) at RT by syringe. The
resulting mixture was stirred at RT for 2 hours until the LP4-2 was
mostly consumed according to LCMS. To this reaction mixture was
then added diethylamine or piperidine (0.1 mL, excess) dropwise at
RT and the mixture was stirred for an hour until Fmoc group was
removed, as monitored by LCMS. (Note: Both diethylamine and
piperidine were effective.) The reaction mixture was directly
purified by prep-HPLC (method B) to give compound LP15 (15 mg, 33%
yield) as a white solid. ESI m/z: 1313.6 (M+H).sup.+. .sup.1H NMR
(500 MHz, methanol.sub.d4) .delta. 7.59 (d, J=8.5 Hz, 2H), 7.51 (s,
1H), 7.36-7.26 (m, 3H), 7.01 (d, J=8.5 Hz, 1H), 6.88 (d, J=8.0 Hz,
1H), 6.72-6.71 (m, 1H), 6.57-6.54 (m, 1H), 5.09 (s, 2H), 4.64-4.52
(m, 1H), 4.35-4.28 (m, 2H), 4.21 (d, J=7.0 Hz, 1H), 4.01-3.98 (m,
1H), 3.88-3.84 (m, 3H), 3.43 (t, J=6.5 Hz, 1H), 3.26-3.10 (m, 4H),
3.00-2.76 (m, 3H), 2.38-2.24 (m, 7H), 2.19-2.02 (m, 9H), 1.98-1.78
(m, 4H), 1.74-1.54 (m, 12H), 1.45-1.26 (m, 14H), 1.13 (s, 6H), 1.00
(t, J=7.5 Hz, 6H) ppm.
Example 1i
Synthesis of LP311 (FIG. 1h)
tert-Butyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimet-
hyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-d-
imethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-5-{[(9H-fl-
uoren-9-ylmethoxy)carbonyl]amino}pentyl] Carbamate (LP11-1)
##STR00321##
[0606] To a solution of N-Boc-N-Fmoc-L-Lysine (0.21 g, 0.45 mmol)
in DMF (2 mL) was added HATU (0.24 g, 0.64 mmol) and DIPEA (0.15 g,
1.1 mmol) at RT. The resulting mixture was stirred at RT for 3
minutes. To the mixture was then added payload 9d (0.20 g, 0.38
mmol). The reaction mixture was stirred at RT for 15 minutes until
the reaction completed, as monitored by LCMS. The reaction mixture
was filtered and purified by prep-HPLC (method B) to give compound
LP11-1 (0.10 g, 27% yield) as a white solid. ESI m/z: 979
(M+1).sup.+.
9H-Fluoren-9-ylmethyl
N-[(5S)-5-amino-5-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethy-
l-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dim-
ethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}pentyl]carbam-
ate (LP11-2)
##STR00322##
[0608] To a solution of compound LP11-1 (0.10 g, 0.10 mmol) in DCM
was added TFA (2 mL) at RT. The resulting mixture was stirred at RT
for an hour until Boc was totally removed according to LCMS. The
volatiles were removed in vacuo. The residue was purified by
reversed phase flash chromatography (0-100% acetonitrile in aq.
ammonium bicarbonate (10 mM)) to give compound LP11-2 (77 mg, 86%
yield) as a white solid. ESI m/z: 879 (M+1).sup.+. .sup.1H NMR (400
MHz, DMSO.sub.d6) .delta. 9.87-9.52 (m, 1H), 9.00 (s, 1H), 8.11 (s,
1H), 7.92-7.81 (m, 2H), 7.71-7.48 (m, 3H), 7.44-7.22 (m, 6H),
7.00-6.90 (m, 1H), 6.82 (d, J=8.3 Hz, 1H), 6.66-6.60 (m, 1H),
6.54-6.47 (m, 1H), 4.38-4.14 (m, 3H), 3.27-3.17 (m, 1H), 3.01-2.93
(m, 2H), 2.90-2.66 (m, 4H), 2.33-2.06 (m, 7H), 1.94-1.78 (m, 4H),
1.67-1.51 (m, 5H), 1.48-1.07 (m, 16H), 1.03-0.92 (m, 6H) ppm.
{4-[(2S)-2-[(2S)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(-
9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentadec-
an-15-amido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}meth-
yl
N-[(1S)-1-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,-
3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethyl--
4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-5-{[(9H-fluoren-9--
ylmethoxy)carbonyl]amino}pentyl]carbamate (LP11-3)
##STR00323##
[0610] To a mixture of compound LP11-2 (57 mg, 65 .mu.mol) and
compound LP9-5 (0.10 g, 96 .mu.mol) in DMF (3 mL) were added HOBt
(30 mg, 0.22 mmol) and DIPEA (0.11 g, 0.81 mmol), and the mixture
was stirred at RT for an hour, which was monitored by LCMS. The
reaction mixture was purified by reversed phase flash
chromatography (0-100% acetonitrile in aq. ammonium bicarbonate (10
mM)) to give compound LP11-3 (97 mg, 81% yield) as a white solid.
ESI m/z: 909 (M/2+1).sup.+.
{4-[(2S)-2-[(2S)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(-
9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentadec-
an-15-amido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}meth-
yl
N-[(1S)-5-amino-1-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimet-
hyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-d-
imethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}pentyl]carb-
amate (LP311)
##STR00324##
[0612] To a solution of compound LP11-3 (97 mg, 53 .mu.mol) in DMF
(3 mL) was added diethylamine (45 mg, 0.62 mmol). The mixture was
stirred at RT for 2 hours until Fmoc was totally removed according
to LCMS. The reaction mixture was directly purified by prep-HPLC
(method B) to give compound LP311 (40 mg, 47% yield) as a white
solid. ESI m/z: 798 (M/2+1).sup.+. .sup.1H NMR (500 MHz,
DMSO.sub.d6) .delta. 9.99 (s, 1H), 9.85 (s, 1H), 9.00 (s, 1H),
8.21-8.10 (m, 2H), 7.88 (d, J=8.5 Hz, 1H), 7.82-7.59 (m, 6H),
7.55-7.43 (m, 5H), 7.41-7.29 (m, 5H), 6.98 (d, J=8.2 Hz, 1H), 6.84
(d, J=8.3 Hz, 1H), 6.66 (s, 1H), 6.53 (d, J=8.1 Hz, 1H), 6.06-5.96
(m, 1H), 5.50-5.38 (m, 2H), 5.09-4.92 (m, 3H), 4.45-4.35 (m, 1H),
4.28-4.21 (m, 1H), 4.14-4.04 (m, 1H), 3.67-3.58 (m, 4H), 3.52-3.45
(m, 13H), 3.14-2.69 (m, 9H), 2.63-2.56 (m, 1H), 2.50-2.44 (m, 1H),
2.43-2.37 (m, 1H), 2.33-2.13 (m, 7H), 2.06-1.85 (m, 6H), 1.82-1.56
(m, 9H), 1.51-1.23 (m, 17H), 1.21-1.13 (m, 2H), 1.10-0.80 (m, 12H)
ppm.
Example 1j
Synthesis of LP39 (FIG. 1i)
1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9),5,7,13,15-hexaen--
10-yn-2-yl}-4-oxobutanamido)-N-[(1S)-1-{[(1S)-4-(carbamoylamino)-1-{[4-(hy-
droxymethyl)phenyl]carbamoyl}butyl]carbamoyl}-2-methylpropyl]-3,6,9,12-tet-
raoxapentadecan-15-amide (LP9-3)
##STR00325##
[0614] To a solution of compound LP9-2 (0.30 g, 0.54 mmol) in DMF
(10 mL) were added HATU (0.31 g, 0.81 mmol) and DIPEA (0.14 g, 1.1
mmol) successively at room temperature. The mixture was stirred at
room temperature for 15 minutes. To the reaction solution was added
VC-PAB-OH (LP9-1, CAS: 159857-79-1, 0.21 g, 0.54 mmol) at RT, and
the resulting mixture was stirred at RT for 3 hours; reaction
progress monitored by LCMS. The reaction mixture was filtered
through a filtering membrane and the filtrate was directly purified
by reversed flash chromatography (0-100% acetonitrile in water
(with 10 mmol/L ammonium bicarbonate)) to give compound LP9-2 (0.30
g, 60% yield) as a white solid. ESI m/z: 617 (M+H).sup.+.
{4-[(2S)-2-[(2S)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(-
9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentadec-
an-15-amido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}meth-
yl 4-nitrophenyl Carbonate (LP9-5)
##STR00326##
[0616] To a solution of compound LP9-3 (0.15 g, 0.16 mmol) in DMF
(10 mL) was added bis(4-nitrophenyl) carbonate (LP9-4, 0.15 g, 0.49
mmol) and DIPEA (63 mg, 0.49 mmol) successively at 0.degree. C. The
mixture was then stirred at RT for 3 hours until LP9-3 was mostly
consumed, as monitored by LCMS. The reaction mixture was filtered
through a filtering membrane and the filtrate was directly purified
by reversed flash chromatography (0-100% acetonitrile in water
(with 10 mmol/L ammonium bicarbonate)) to give compound LP9-5 (50
mg, 28% yield) as a white solid. ESI m/z: 1079 (M+H).sup.+.
(4S)-4-{[({4-[(2S)-2-[(2S)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadec-
a-1(12),4(9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetrao-
xapentadecan-15-amido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]p-
henyl}methoxy)carbonyl]amino}-4-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-
-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]
carbamoyl}-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]car-
bamoyl}butanoic Acid (LP39)
##STR00327##
[0618] To a mixture of compound 9o (50 mg, 76 .mu.mol) and compound
LP9-5 (0.10 g, 96 .mu.mol) in DMF (1 mL) were added HOBt (16 mg,
0.12 mmol) and DIPEA (39 mg, 0.31 mmol), and the mixture was
stirred at RT for an hour, which was monitored by LCMS. The
reaction mixture was purified by prep-HPLC (method B) to give
compound LP39 (40 mg, 33% yield) as a white solid. ESI m/z: 799
(M/2+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 10.02 (s,
1H), 9.03 (s, 1H), 8.20-8.07 (m, 2H), 7.94-7.87 (m, 1H), 7.82-7.76
(m, 1H), 7.70-7.57 (m, 4H), 7.54-7.42 (m, 4H), 7.40-7.26 (m, 6H),
6.99-6.91 (m, 1H), 6.85-6.79 (m, 1H), 6.63 (s, 1H), 6.53-6.47 (m,
1H), 6.03 (s, 1H), 5.44 (s, 2H), 5.07-4.88 (m, 3H), 4.42-4.32 (m,
1H), 4.27-4.20 (m, 1H), 4.11-4.02 (m, 1H), 3.63-3.55 (m, 3H),
3.51-3.41 (m, 13H), 3.11-2.58 (m, 10H), 2.40-2.10 (m, 11H),
2.00-1.55 (m, 15H), 1.46-1.09 (m, 14H), 1.05-0.94 (m, 6H),
0.99-0.77 (m, 7H) ppm.
Example 2
[0619] This example demonstrates general methods for making the key
intermediates, 7b-7f. The chemical syntheses for making 7b-7e were
shown in FIG. 2.
[0620] The amide 7f was prepared from an amide coupling reaction of
1 with NH.sub.4Cl catalyzed by HATU. The intermediates 7b and 7c
were prepared from phenol-O-alkylation of 7f with 10b and 10c,
respectively. The intermediates 7d and 7e were synthesized starting
from conversion of phenol 2 to triflate 11, followed by Buchwald
coupling conditions to introduce the masked amino functionality of
12d and 12e; then acidic de-protection of 12d and 12e followed by
basic hydrolysis to convert the esters to the acids 13d and 13e,
respectively; finally, Boc-protection of 13d and 13e provided 14d
and 14e, respectively, which were further carried into the amide
coupling reactions with ammonium salt to provide 7d and 7e,
respectively. The intermediate 7g was prepared from an amide
coupling reaction of 1 with 2,4-dimethoxybenzylamine to form 7g-1,
followed by conversion to the triflate analog 7g-2 with triflic
anhydride. The cyano analog 7g-3 was prepared using zinc cyanide,
and a final deprotection was achieved with TFA to remove
2,4-dimethoxy-benzyl moiety.
[0621] Alternatively, 13d was prepared starting from Boc-protection
of podocarpic acid 1 to form E2, followed by conversion to triflate
E3. Intermediate E3 was stable to purification via normal-phase
column chromatography, and was further treated with
diphenylmethanimine under Buchwald conditions to afford a mixture
of E4-1, E4-2, E4-3, and 13d, which were hydrolyzed in aq. HCl in
THF (v/v=1:1) in one pot to provide 13d in 28% total yield.
Example 3
[0622] This example demonstrates a method for making the
intermediate 7a. This example refers to the compound numbering in
FIG. 1.
Step 1: making
(1S,4aS,10aR)-Methyl-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydr-
ophenanthrene-1-carboxylate (2)
[0623] To a solution of podocarpic acid (1, 0.20 g, 0.73 mmol) in
methanol (1.4 mL) and toluene (5.2 mL) was added
(trimethylsilyl)diazomethane (2M in hexane, 0.45 mL). The reaction
mixture was stirred at 10-25.degree. C. overnight. After podocarpic
acid was totally consumed based on LC-MS, the volatiles were
removed in vacuo, and the residue was purified by flash
chromatography (0-35% ethyl acetate in petroleum ether) to provide
compound 2 (0.21 g, 98% yield) as a white solid. ESI m/z: 289
(M+H).sup.+. .sup.1H NMR (400 MHz, DMSO-.sub.d6) .delta. 8.95 (s,
1H), 6.79 (d, J=8.2 Hz, 1H), 6.63 (d, J=2.4 Hz, 1H), 6.48 (dd,
J=8.2, 2.4 Hz, 1H), 3.58 (s, 3H), 2.80-2.55 (m, 2H), 2.20-2.02 (m,
3H), 1.96-1.71 (m, 2H), 1.56-1.45 (m, 2H), 1.27 (t, J=13.5 Hz, 1H),
1.21 (s, 3H), 1.09 (td, J=13.5, 4.1 Hz, 1H), 0.91 (s, 3H) ppm.
Step 2: making (1S,4aS,10aR)-Methyl
6-(benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-c-
arboxylate (3)
[0624] To a solution of compound 2 (0.10 g, 0.35 mmol) in DMF (1.2
mL) was added cesium carbonate (0.12 g, 0.38 mmol) and the mixture
was stirred at 20-25.degree. C. for 15 min. To the mixture was then
added benzyl bromide (88 mg, 0.52 mmol) at rt, and the resulting
mixture was stirred for an additional 4 hours, then poured into
water and extracted with ethyl acetate. The combined organics were
washed with water and brine, dried over sodium sulfate, and
concentrated in vacuo. The crude product was purified by flash
chromatography (10-35% ethyl acetate in petroleum ether) to give
compound 3 (0.13 g, 99% yield) as a white solid. ESI m/z: 379
(M+H).sup.+. .sup.1H NMR (500 MHz, methanol.sub.d4) .delta.
7.60-7.20 (m, 5H), 7.00-6.82 (m, 2H), 6.73 (d, J=7.1 Hz, 1H), 5.03
(s, 2H), 3.66 (s, 3H), 2.95-2.58 (m, 2H), 2.36-2.10 (m, 3H),
2.10-1.85 (m, 2H), 1.70-1.48 (m, 2H), 1.44-1.21 (m, 4H), 1.15 (t,
J=17.2 Hz, 1H), 1.01 (s, 3H) ppm.
Step 3: making
(1S,4aS,10aR)-6-(Benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydroph-
enanthrene-1-carboxylic Acid (4)
[0625] To a mixture of compound 3 (0.10 g, 0.26 mmol) in DMSO (1.7
mL) was added potassium tert-butoxide (0.30 g, 2.6 mmol), and the
mixture was stirred at 100.degree. C. for 2 hours until the
reaction was completed, as monitored by LC-MS and TLC. After the
reaction was cooled to 25.degree. C., the mixture was quenched with
aqueous hydrochloride (1N) to pH 2, and extracted with ethyl
acetate. The combined organics were washed with brine, dried over
sodium sulfate, and concentrated in vacuo. The residue was purified
by flash chromatography (20-35% ethyl acetate in petroleum ether)
to provide compound 4 (92 mg, 95% yield) as a white solid. ESI m/z:
365 (M+H).sup.+. .sup.1H NMR (500 MHz, methanol.sub.d4) .delta.
7.42 (d, J=7.4 Hz, 2H), 7.36 (t, J=7.5 Hz, 2H), 7.30 (t, J=7.3 Hz,
1H), 6.92 (d, J=8.4 Hz, 1H), 6.87 (d, J=2.5 Hz, 1H), 6.72 (dd,
J=8.4, 2.5 Hz, 1H), 5.02 (s, 2H), 2.82 (dd, J=16.3, 4.4 Hz, 1H),
2.77-2.65 (m, 1H), 2.24 (d, J=13.2 Hz, 2H), 2.19 (dd, J=13.8, 6.0
Hz, 1H), 2.11-1.96 (m, 2H), 1.64-1.56 (m, 1H), 1.53 (d, J=11.0 Hz,
1H), 1.35 (td, J=13.3, 3.7 Hz, 1H), 1.30 (s, 3H), 1.13 (s, 3H),
1.11-1.05 (m, 1H) ppm.
Step 4: making
(1S,4aS,10aR)-6-(Benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydroph-
enanthrene-1-carbonyl chloride (6a)
[0626] To a solution of compound 4 (0.10 g, 0.27 mmol) in
1,2-dichloroethane (DCE) (2 mL) was added thionyl chloride (0.20
mL), and the reaction was then stirred at 90.degree. C. for 3 h.
After the reaction was cooled to rt, the volatiles were removed in
vacuo and the crude product was used for the next step without
further purification.
Alternative Step 4: making
(1S,4aS,10aR)-Perfluorophenyl-6-(benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10-
,10a-octahydrophenanthrene-1-carboxylate (6b)
[0627] To a solution of 4 (0.50 g, 1.4 mmol) in DMF (5 mL) was
added DIPEA (0.51 g, 4.1 mmol), and then perfluorophenyl
2,2,2-trifluoroacetate 5 (0.77 g, 2.7 mmol). This mixture was
stirred at 25.degree. C. overnight, and was then diluted with ether
(80 mL). The organic mixture was washed with water (10 mL) and
brine (10 mL), dried over sodium sulfate, and concentrated in
vacuo. The residue was purified by flash chromatography (0-15%
ethyl acetate in petroleum ether) to give ester 6b (0.46 g, 63%
yield) as a white solid. .sup.1H NMR (500 MHz, acetone.sub.d6)
.delta. 7.33 (d, J=7.4 Hz, 2H), 7.24 (t, J=7.5 Hz, 2H), 7.17 (t,
J=7.3 Hz, 1H), 6.86-6.80 (m, 2H), 6.63 (dd, J=8.4, 2.5 Hz, 1H),
4.95 (s, 2H), 2.78-2.57 (m, 3H), 2.28-2.19 (m, 2H), 2.14 (dd,
J=13.5, 5.9 Hz, 1H), 2.02-1.81 (m, 1H), 1.63 (d, J=11.5 Hz, 1H),
1.60-1.52 (m, 1H), 1.40 (s, 3H), 1.29 (td, J=13.4, 3.8 Hz, 1H),
1.22 (td, J=13.8, 4.1 Hz, 1H), 1.05 (s, 3H) ppm.
Step 5: making
(1S,4aS,10aR)-6-(Benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydroph-
enanthrene-1-carboxamide (7a)
[0628] A solution of compound 4 (50 mg, 0.14 mmol) and HATU (57 mg,
0.15 mmol) in DMF was stirred at 25.degree. C. for 15 min. To the
solution were added DIPEA (89 mg, 0.69 mmol) and ammonium chloride
(25 mg, 0.48 mmol) at 25.degree. C., and the resulting mixture was
then stirred for additional 4 h, poured into water, and extracted
with ethyl acetate. The combined organics were washed with water
and brine, dried over sodium sulfate, and concentrated in vacuo.
The crude product was purified by flash chromatography (0-35% ethyl
acetate in petroleum ether) to give 7a (48 mg, 91% yield) as a
white solid. ESI m/z: 364 (M+1).sup.+. .sup.1H NMR (500 MHz,
methanol.sub.d4) .delta. 7.63-7.22 (m, 5H), 7.02-6.82 (m, 2H), 6.78
(d, J=7.1 Hz, 1H), 5.10 (s, 2H), 2.95-2.58 (m, 2H), 2.36-2.10 (m,
3H), 2.10-1.85 (m, 2H), 1.70-1.48 (m, 2H), 1.44-1.21 (m, 4H), 1.15
(t, J=17.2 Hz, 1H), 1.01 (s, 3H) ppm.
Example 4
[0629] This example demonstrates methods for making the
intermediates 7b-7g. This example refers to the compound numbering
in FIG. 2.
(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenant-
hrene-1-carboxamide (7f)
[0630] To a solution of podocarpic acid 1 (0.30 g, 1.1 mmol) in DMF
(4 mL) were added HATU (0.46 g, 1.2 mmol), DIPEA (0.57 g, 4.4 mmol)
and ammonium chloride (0.23 g, 4.4 mmol), and the solution was
stirred at 10-25.degree. C. for 16 h. The mixture was poured into
water, and extracted with ethyl acetate. The combined organics were
washed with brine, dried over sodium sulfate, and concentrated in
vacuo. The residue was purified by flash chromatography (0-35%
ethyl acetate in petroleum ether) to give the desired compound
(0.77 g, 100% yield) as an oil. ESI m/z: 274.1 (M+1).sup.+. .sup.1H
NMR (500 MHz, methanol.sub.d4) .delta. 6.82 (d, J=8.3 Hz, 1H), 6.71
(d, J=2.4 Hz, 1H), 6.58-6.47 (m, 1H), 2.79 (dd, J=16.1, 4.1 Hz,
1H), 2.71-2.60 (m, 1H), 2.29-2.13 (m, 3H), 2.13-1.95 (m, 2H),
1.67-1.56 (m, 1H), 1.48 (d, J=11.6 Hz, 1H), 1.36 (td, J=13.2, 4.0
Hz, 1H), 1.27 (s, 3H), 1.19 (dt, J=8.9, 4.5 Hz, 1H), 1.16 (s, 3H)
ppm.
(1S,4aS,10aR)-6-(2-(tert-Butyldimethylsilyloxy)ethoxy)-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (7b)
[0631] To a solution of 7f (0.33 g, 0.47 mmol) in DMF (2.5 mL) was
added cesium carbonate (0.60 g, 1.8 mmol) and
(2-bromoethoxy)(tert-butyl)dimethylsilane (10b, 0.45 g, 2.1 mmol).
After the reaction was stirred for 8 h under nitrogen, the mixture
was poured into water (30 mL) and ethyl acetate (30 mL). The
organics were separated and washed with brine, dried with anhydrous
sodium sulfate, and concentrated in vacuo. The residue was purified
by silica gel column chromatography (20-35% ethyl acetate in
petroleum ether) to give compound 7b (0.21 g, 87% yield). ESI m/z:
432.2 (M+1).sup.+. .sup.1H NMR (500 MHz, methanol.sub.d4) .delta.
6.79 (d, J=8.4 Hz, 1H), 6.69 (d, J=2.2 Hz, 1H), 6.53 (dd, J=8.3,
1.5 Hz, 1H), 3.84 (dd, J=14.3, 4.1 Hz, 4H), 2.71 (dd, J=16.1, 4.6
Hz, 1H), 2.64-2.47 (m, 1H), 2.20-2.02 (m, 3H), 2.01-1.84 (m, 2H),
1.52 (d, J=14.0 Hz, 1H), 1.37 (d, J=12.2 Hz, 1H), 1.25 (td, J=13.2,
3.3 Hz, 1H), 1.16 (s, 3H), 1.12-0.99 (m, 4H), 0.81 (s, 9H), 0.00
(s, 6H) ppm.
tert-Butyl
2-((4bS,8S,8aR)-8-carbamoyl-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-oc-
tahydrophenanthren-3-yloxy)ethylcarbamate (7c)
[0632] Following the procedure for making 7b, 7c (60 mg, 40% yield)
as a white solid was obtained from 7f treated with 10c. ESI m/z:
360.9 (M-55).sup.+, 438.9 (M+23).sup.+.
tert-Butyl-(4bS,8S,8aR)-8-carbamoyl-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octah-
ydrophenanthren-3-ylcarbamate (7d)
Step 1: making
(1S,4aS,10aR)-Methyl-1,4a-dimethyl-6-(trifluoromethylsulfonyloxy)-1,2,3,4-
,4a,9,10,10a-octahydrophenanthrene-1-carboxylate (11)
[0633] To a solution of compound 2 (0.33 g, 1.1 mmol) in DCM (6 mL)
were added 2,6-lutidine (0.15 g, 1.4 mmol) and DMAP (28 mg, 0.23
mmol). The mixture was cooled to -78.degree. C. and triflic
anhydride (0.39 g, 1.4 mmol) was added. The resulting mixture was
allowed to warm to 25.degree. C. and stirred at 25.degree. C. for
an additional 4 h. The reaction mixture was diluted with ethyl
acetate (50 mL), and the organics were washed with water (6 mL),
aq. hydrochloride (1 N, 10 mL) and brine (10 mL), then dried over
sodium sulfate, and concentrated in vacuo. The residue was purified
by flash chromatography (0-10% ethyl acetate in petroleum ether) to
give compound 11 (0.43 g, 89% yield) as a viscous oil. ESI m/z:
421.2 (M+1).sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 7.12
(d, J=2.5 Hz, 1H), 7.10 (d, J=8.5 Hz, 1H), 6.97 (dd, J=8.5, 2.5 Hz,
1H), 3.67 (s, J=3.4 Hz, 3H), 2.93 (dd, J=17.2, 4.4 Hz, 1H),
2.85-2.71 (m, 1H), 2.29 (d, J=13.5 Hz, 1H), 2.25-2.14 (m, 2H),
2.03-1.89 (m, 2H), 1.71-1.61 (m, 1H), 1.56-1.48 (m, 1H), 1.40 (td,
J=13.4, 4.2 Hz, 1H), 1.30-1.22 (m, 3H), 1.09 (td, J=13.6, 4.2 Hz,
1H), 1.02 (s, 3H) ppm.
Step 2: making
(1S,4aS,10aR)-6-amino-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanth-
rene-1-carboxylic Acid (13d)
[0634] To a mixture of cesium carbonate (0.62 g, 1.9 mmol), X-phos
(50 mg, 0.11 mmol) and Pd.sub.2(dba).sub.3 (50 mg, 55 .mu.mol) in
tert-butanol (5 mL) under an atmosphere of argon were added a
solution of compound 11 (0.40 g, 0.95 mmol) in tert-butanol (5 mL)
and then diphenylmethanimine (0.26 g, 1.4 mmol). After the reaction
was stirred at 100.degree. C. for 30 min under argon, the reaction
mixture was cooled to rt, diluted with DCM, and filtered through
Celite to remove insoluble residues. The filtrate was washed with
water, dried over anhydrous sodium sulfate, and concentrated in
vacuo. To the residue (crude 12d) was added hydrochloride in
methanol (4N, 2 mL) and the resulting solution was stirred at
25.degree. C. for 5 h. The volatiles were removed in vacuo and the
residue was purified by flash chromatography (0-20% ethyl acetate
in petroleum ether) to give 12d'-methyl ester (0.28 g) as a white
solid aniline-ester. ESI m/z: 288 (M+1).sup.+, .sup.1H NMR (400
MHz, DMSO-.sub.d6) .delta. 9.72 (s, 2H), 7.22 (s, 1H), 7.11 (d,
J=8.1 Hz, 1H), 7.01 (d, J=8.1 Hz, 1H), 3.58 (s, 3H), 2.86 (dd,
J=17.0, 4.5 Hz, 1H), 2.79-2.66 (m, 1H), 2.21-2.05 (m, 3H),
1.97-1.76 (m, 2H), 1.55 (t, J=13.7 Hz, 2H), 1.30 (td, J=13.2, 3.7
Hz, 1H), 1.22 (s, 3H), 1.10 (td, J=13.4, 4.0 Hz, 1H), 0.93 (s, 3H)
ppm. To a mixture of 12d'-methyl ester (0.12 g, 0.42 mmol) in DMF
(3 mL) was added with sodium ethanethiolate (0.37 g, 4.2 mmol), and
the resulting mixture was stirred at 60.degree. C. for 16 h. After
the reaction was cooled to rt, the resulting mixture was diluted
with water and acidified with aq. hydrochloride (1 N, 20 mL). The
aqueous solution was extracted with ethyl acetate and the organics
were separated and concentrated in vacuo to give crude 13d (0.14
g), which was used in the next step directly. ESI m/z: 274.2
(M+1).sup.+.
[0635] An alternative way to prepare 13d via E2, E3, and E4 is
described as follows:
Step 1: making (tert-Butyl carbonic)
(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenan-
threne-1-carboxylic Anhydride (E2)
[0636] To a mixture of podocarpic acid (1, 0.40 g, 1.5 mmol) and
sodium carbonate (0.31 g, 2.9 mmol) in t-BuOH (10 mL) was added
di-tert-butyl dicarbonate (0.35 g, 1.6 mmol). The reaction mixture
was stirred at 10-25.degree. C. for 16 h. The reaction was
monitored by TLC and LCMS until the podocarpic acid was consumed.
The resulting mixture was poured into ethyl acetate (100 mL) and
the organics were washed with water (20 mL.times.2) and brine (50
mL). The organic solution was dried over sodium sulfate and
concentrated in vacuo. The crude product was purified by flash
chromatography (0-20% ethyl acetate in petroleum ether) to give the
title compound E2 (0.41 g, 76% yield) as a viscous oil. ESI m/z:
319.2 (M-55).sup.+. .sup.1H NMR (400 MHz, DMSO-.sub.d6) .delta.
8.95 (s, 1H), 6.79 (d, J=8.0 Hz, 1H), 6.64 (d, J=2.5 Hz, 1H), 6.49
(dd, J=8.0, 2.5 Hz, 1H), 2.76-2.72 (m, 1H), 2.67-2.60 (m, 1H),
2.16-2.03 (m, 3H), 1.85-1.78 (m, 2H), 1.60-1.57 (m, 2H), 1.46 (s,
9H), 1.33-1.27 (m, 4H), 1.21-1.15 (m, 1H), 1.04 (s, 3H) ppm.
Step 2: making (tert-Butyl carbonic)
(1S,4aS,10aR)-1,4a-dimethyl-6-(trifluoromethylsulfonyloxy)-1,2,3,4,4a,9,1-
0,10a-octahydrophenanthrene-1-carboxylic Anhydride (E3)
[0637] To a solution of compound E2 (0.30 g, 0.80 mmol) in DCM (16
mL) were added pyridine (95 mg, 1.2 mmol) and DMAP (10 mg, 0.080
mmol) under nitrogen atmosphere. The mixture was cooled to
-20.degree. C. and triflic anhydride (0.27 g, 0.96 mmol) was added
by syringe. The resulting mixture was allowed to warm to 25.degree.
C. and stirred at 25.degree. C. for additional 2 h. The reaction
mixture was diluted with ethyl acetate (50 mL), and the organics
were washed with water (6 mL), aq. hydrochloride (1 N, 10 mL), and
brine (10 mL), then dried over sodium sulfate and concentrated in
vacuo. The residue was purified by flash chromatography (0-10%
ethyl acetate in petroleum ether) to give compound E3 (0.27 g, 66%
yield) as a viscous oil. ESI m/z: 529.2 (M+Na).sup.+. .sup.1H NMR
(400 MHz, DMSO-.sub.d6) .delta. 7.37 (d, J=2.0 Hz, 1H), 7.23-7.17
(m, 2H), 2.95-2.90 (m, 1H), 2.82-2.75 (m, 1H), 2.30-2.28 (m, 1H),
2.12-2.09 (m, 1H), 1.90-1.80 (m, 2H), 1.68-1.66 (m, 1H), 1.62-1.59
(m, 1H), 1.46 (s, 9H), 1.33-1.27 (m, 4H), 1.26-1.17 (m, 1H), 1.08
(s, 3H) ppm.
Step 3: making
(1S,4aS,10aR)-6-Amino-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanth-
rene-1-carboxylic Acid (13d)
[0638] To a stirred solution of compound E3 (0.20 g, 0.40 mmol) and
diphenylmethanimine (0.086 g, 0.48 mmol) in tert-butanol (10 mL)
were added cesium carbonate (0.33 g, 1.0 mmol), X-phos (38 mg, 80
.mu.mol) and Pd.sub.2(dba).sub.3 (37 mg, 40 .mu.mol) under an
atmosphere of argon. The reaction mixture was stirred under argon
at 90.degree. C. for 3 h, monitored by LCMS, and E4-1, E4-2, E4-3,
and 13d were detected in the LCMS spectra at that time. The
reaction mixture was cooled, diluted with DCM (30 ml) and filtered
through Celite to remove inorganics. The filtrate was washed with
water, dried over anhydrous sodium sulfate and concentrated in
vacuo. The residue was dissolved in THF (5 mL) and acidified with
aq. HCl (2 N, 5 mL). The reaction was then stirred at 25.degree. C.
and monitored by LCMS. After 16 h, LCMS showed most of E4-1 and
E4-2 were converted to 13d. The reaction mixture was neutralized
with saturated aq. sodium bicarbonate to pH 8 and extracted with
ethyl acetate (20 mL.times.3). The combined organics were dried
over sodium sulfate and concentrated in vacuo. The crude product
was purified by flash chromatography (0-50% ethyl acetate in
petroleum ether) to give the title compound 13d (30 mg, 56% yield
for 2 steps) as a white solid. ESI m/z: 274.2 (M+H).sup.+.
Step 4: making
(1S,4aS,10aR)-6-(tert-Butoxycarbonylamino)-1,4a-dimethyl-1,2,3,4,4a,9,10,-
10a-octahydrophenanthrene-1-carboxylic Acid (14d)
[0639] To a solution of 13d (0.12 g) in tert-butanol (5 mL) were
added sodium carbonate (0.12 g, 1.1 mmol), di-tert-butyl
dicarbonate (0.48 g, 2.2 mmol), and DMAP (20 mg, 0.16 mmol), and
the mixture was then stirred at 60.degree. C. for 16 h. The
volatiles were removed in vacuo and the residue was diluted with
DCM (20 mL). The organics were separated, washed with saturated
aqueous citric acid, dried over sodium sulfate, and concentrated in
vacuo. The residue was purified by flash chromatography (0-35%
ethyl acetate in petroleum ether) to give compound 14d (0.11 g, 67%
yield in 3 steps from 11) as a white solid. ESI m/z: 318.2
(M-tBu+1).sup.+. .sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 12.08
(s, 1H), 9.08 (s, 1H), 7.40 (s, 1H), 7.11 (s, 1H), 6.87 (d, J=8.3
Hz, 1H), 2.79-2.68 (m, 1H), 2.65 (d, J=12.6 Hz, 1H), 2.17-2.03 (m,
4H), 1.94-1.76 (m, 2H), 1.53 (d, J=13.7 Hz, 1H), 1.46 (d, J=7.4 Hz,
9H), 1.29-1.14 (m, 5H), 1.04 (s, 3H) ppm.
Step 5: making
tert-Butyl-(4bS,8S,8aR)-8-carbamoyl-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octa-
hydrophenanthren-3-ylcarbamate (7d)
[0640] To a solution of 14d (0.11 g, 0.30 mmol) in DMF (2.4 mL)
were added HATU (0.12 g, 0.32 mmol) and DIPEA (0.5 mL, 3.0 mmol),
and the mixture was stirred at 25.degree. C. for an hour. To the
mixture was then added ammonium chloride (0.40 g, 7.5 mmol), and
the mixture was stirred at 15-25.degree. C. for additional 16 h.
The resulting mixture was diluted with ethyl acetate (40 mL); the
organics were separated and washed with water (10 mL) and brine (10
mL), dried over sodium sulfate, and concentrated in vacuo. The
residue was purified by flash chromatography (0-20% ethyl acetate
in petroleum ether) to give compound 7d (84 mg, 75% yield) as a
white solid. ESI m/z: 373.3 (M+1).sup.+. .sup.1H NMR (500 MHz,
methanol-.sub.d4) .delta. 7.20 (s, 1H), 6.97 (d, J=7.7 Hz, 1H),
6.80 (d, J=8.3 Hz, 1H), 2.77-2.68 (m, 2H), 2.66-2.55 (m, 1H), 2.20
(d, J=12.9 Hz, 1H), 2.13 (dd, J=13.2, 5.3 Hz, 1H), 2.08 (d, J=14.0
Hz, 1H), 2.03-1.86 (m, 2H), 1.54 (d, J=11.1 Hz, 1H), 1.40 (s, 9H),
1.26 (t, J=26.7 Hz, 1H), 1.18 (s, 3H), 1.14-1.03 (m, 4H) ppm.
tert-Butyl-4-((4bS,8S,8aR)-8-carbamoyl-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-oc-
tahydrophenanthren-3-yl)piperazine-1-carboxylate (7e)
Step 1: making
(1S,4aS,10aR)-1,4a-Dimethyl-6-(piperazin-1-yl)-1,2,3,4,4a,9,10,10a-octahy-
drophenanthrene-1-carboxylic Acid (14e)
[0641] To a solution of compound 11 (0.40 g, 0.95 mmol) and
tert-butyl piperazine-1-carboxylate (0.29 g, 1.5 mmol) in
tert-butanol (5 mL) under atmosphere of argon were added cesium
carbonate (0.62 g, 1.9 mmol), X-phos (50 mg, 0.11 mmol) and
Pd.sub.2(dba).sub.3 (50 mg, 55 .mu.mol). After the reaction was
stirred at 100.degree. C. for 30 min under argon, the reaction
mixture was cooled, diluted with DCM and filtered through Celite to
remove inorganics. The filtrate was washed with water, dried over
anhydrous sodium sulfate and concentrated in vacuo. The residue was
purified by silica gel column chromatography (20-35% ethyl acetate
in petroleum ether) to give 12e (0.42 g) as a yellow solid. ESI
m/z: 457.1 (M+1).sup.+. A solution of 12e (0.23 g, 0.5 mmol) in
DMSO (5 mL) was treated with potassium tert-butoxide (0.25 g, 2.2
mmol) at 100.degree. C. for an hour. After the reaction was cooled
to rt, to the mixture of the crude 13e was added di-tertbutyl
dicarbonate (0.92 g, 4.3 mmol) at 20-25.degree. C., and the
resulting mixture was stirred at 25.degree. C. for 4 hours. The
reaction mixture was then diluted with ethyl acetate (100 mL), the
organics were washed with water, dried over sodium sulfate, and
concentrated in vacuo. The residue was purified by silica gel
column chromatography (0-35% ethyl acetate in petroleum ether) to
give compound 14e (0.15 g, 79% yield in 3 steps from 11) as a
yellow solid. ESI m/z: 443 (M+1).sup.+.
Step 2: making
tert-Butyl-4-((4bS,8S,8aR)-8-carbamoyl-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-o-
ctahydrophenanthren-3-yl)piperazine-1-carboxylate (7e)
[0642] To a solution of 14e (0.10 g, 0.30 mmol) and HATU (0.12 g,
0.32 mmol) in DMF (2.4 mL) was added DIPEA (0.5 mL, 3.0 mmol), and
the resulting solution was stirred at 25.degree. C. for an hour. To
the mixture was then added ammonium chloride (0.40 g, 7.5 mmol),
and the resulting mixture was stirred at 15-25.degree. C. for
additional 16 h. The resulting mixture was diluted with ethyl
acetate (40 mL), and the organics were washed with water (10 mL)
and brine (10 mL), dried over sodium sulfate, and concentrated in
vacuo. The residue was purified by flash chromatography (0-20%
ethyl acetate in petroleum ether) to give compound 7e (96 mg, 87%
yield) as a white solid. ESI m/z: 442 (M+1).sup.+.
(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenant-
hrene-1-carboxamide (7g)
Step 1: making
(1S,4aS,10aR)-N-(2,4-Dimethoxybenzyl)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,-
9,10,10a-octahydrophenanthrene-1-carboxamide (7g-1)
[0643] Following the procedure for making 7f, the coupling reaction
of compound 1 with 2,4-dimethoxybenzylamine provided 7g-1 (0.57 g,
93% yield) as a light yellow solid. ESI m/z: 424.1 (M+1).sup.+.
.sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 8.90 (s, 1H), 7.33 (t,
J=5.7 Hz, 1H), 7.06 (d, J=8.3 Hz, 1H), 6.77 (d, J=8.2 Hz, 1H), 6.60
(d, J=2.4 Hz, 1H), 6.51 (d, J=2.3 Hz, 1H), 6.48-6.42 (m, 2H),
4.28-4.02 (m, 2H), 3.77 (s, 3H), 3.72 (s, 3H), 2.74-2.67 (m, 1H),
2.62-2.53 (m, 1H), 2.24-2.05 (m, 3H), 2.02-1.90 (m, 1H), 1.90-1.78
(m, 1H), 1.56-1.45 (m, 1H), 1.42-1.22 (m, 2H), 1.19 (s, 3H),
1.09-1.01 (m, 1H), 0.87 (s, 3H) ppm.
Step 2: making
(4bS,8S,8aR)-8-(2,4-Dimethoxybenzylcarbamoyl)-4b,8-dimethyl-4b,5,6,7,8,8a-
,9,10-octahydrophenanthren-3-yl trifluoromethanesulfonate
(7g-2)
[0644] Following the procedure of for making 11, 7g-2 was obtained
(0.59 g, 96% yield) as a white solid. ESI m/z: 556.2 (M+1).sup.+.
.sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 7.43 (t, J=5.7 Hz, 1H),
7.31 (d, J=2.3 Hz, 1H), 7.22-7.11 (m, 2H), 7.06 (d, J=8.3 Hz, 1H),
6.52 (d, J=2.3 Hz, 1H), 6.45 (dd, J=8.3, 2.3 Hz, 1H), 4.17 (d,
J=5.7 Hz, 2H), 3.77 (s, 3H), 3.72 (s, 3H), 2.92-2.82 (m, 1H),
2.78-2.65 (m, 1H), 2.27-2.15 (m, 3H), 2.03-1.86 (m, 2H), 1.57-1.48
(m, 1H), 1.42-1.17 (m, 5H), 1.10-1.05 (m, 1H), 0.91 (s, J=5.9 Hz,
3H) ppm.
Step 3: making
(1S,4aS,10aR)-6-Cyano-N-(2,4-dimethoxybenzyl)-1,4a-dimethyl-1,2,3,4,4a,9,-
10,10a-octahydrophenanthrene-1-carboxamide (7g-3)
[0645] To a solution of compound 7g-2 (0.20 g, 0.36 mmol) in DMF
(3.6 mL) were added tetrakis(triphenylphosphine)palladium (42 mg,
36 .mu.mol) and zinc cyanide (84 mg, 0.72 mmol) under nitrogen. The
mixture was stirred under nitrogen at 110.degree. C. for 4 h until
the reaction was completed, monitored by LCMS. After the reaction
was cooled to rt, the reaction mixture was diluted with ethyl
acetate (100 mL) and the organics were washed with water (20 mL)
and brine (20 mL). The organics were dried over sodium sulfate and
concentrated in vacuo. The residue was purified by flash
chromatography (10-20% ethyl acetate in petroleum ether) to give
the title compound 7g-3 (0.13 g, 82% yield) as a white solid. ESI
m/z: 433.2 (M+1).sup.+. .sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta.
7.74 (d, J=1.1 Hz, 1H), 7.47 (dd, J=7.9, 1.4 Hz, 1H), 7.44 (t,
J=5.7 Hz, 1H), 7.20 (d, J=8.0 Hz, 1H), 7.06 (d, J=8.3 Hz, 1H), 6.51
(d, J=2.3 Hz, 1H), 6.45 (dd, J=8.3, 2.3 Hz, 1H), 4.16 (d, J=5.6 Hz,
2H), 3.77 (s, 3H), 3.72 (s, 3H), 3.05-2.87 (m, 1H), 2.82-2.70 (m,
1H), 2.36-2.28 (m, 1H), 2.26-2.16 (m, 2H), 2.01-1.85 (m, 2H),
1.58-1.48 (m, 1H), 1.45-1.17 (m, 5H), 1.13-1.05 (m, 1H), 0.91 (s,
3H) ppm.
Step 4: making
(1S,4aS,10aR)-6-Cyano-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanth-
rene-1-carboxamide (7g)
[0646] To a solution of compound 7g-3 (0.12 g, 0.28 mmol) in DCM (3
mL) was added TFA (3 mL) dropwise at 0.degree. C. The resulting
mixture was allowed to warm and then stirred at 25.degree. C. for
48 h. The desired mass was detected by LCMS as major peak. The
volatiles were removed in vacuo and the residue was purified by
flash chromatography (20-40% ethyl acetate in petroleum ether) to
give the title compound 7g (70 mg, 71% yield) as a white solid. ESI
m/z: 283.2 (M+1).sup.+. .sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta.
7.76 (d, J=1.3 Hz, 1H), 7.48 (dd, J=7.9, 1.5 Hz, 1H), 7.21 (d,
J=8.0 Hz, 1H), 6.84 (d, J=11.8 Hz, 2H), 3.00-2.85 (m, 1H),
2.84-2.69 (m, 1H), 2.41-2.27 (m, 1H), 2.22-2.15 (m, 1H), 2.15-2.09
(m, 1H), 2.04-1.89 (m, 2H), 1.56-1.48 (m, 1H), 1.40-1.20 (m, 2H),
1.16 (s, 3H), 1.11-1.00 (m, 4H) ppm.
Example 5
[0647] This example demonstrates methods for making the
intermediates 8a-e and 8g. This example refers to the compound
numbering in FIG. 1.
[0648] General Procedures for Compounds 8a-e and 8g:
[0649] A solution of one of intermediates 7a-g (40-100 mg) in THF
(0.5-2 mL) was prepared to make the concentration 0.06-0.28 M. To
the solution was added lithium bis(trimethylsilyl)amide (LiHMDS) (1
M in hexane, 1.2 equiv.) dropwise at -78.degree. C., and the
resulting mixture was stirred at -78.degree. C. for 2 h. To the
mixture was added a solution of 6a (0.9-2.2 equiv.) or 6b (1.2
equiv.) in THF (1 mL), and the resulting mixture was then stirred
at 10-20.degree. C. overnight. After 7a-g was consumed as monitored
by LCMS, the reaction was quenched with saturated. aq. ammonium
chloride and extracted with ethyl acetate. The combined organics
were washed with water and brine, dried over sodium sulfate, and
concentrated in vacuo. The residue was purified by flash
chromatography (0-35% ethyl acetate in petroleum ether) to give
8a-e and 8g as a white solid.
[0650]
(1S,4aS,10aR)-6-(Benzyloxy)-N-((1S,4aS,10aR)-6-(benzyloxy)-1,4a-dim-
ethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl--
1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (8a): The
synthetic procedure of 8a was similar to what was reported in
Bioorg. Med. Chem. Lett. 2005, 15, 2824-2828, but LiHMDS was
replaced with NaHMDS. 8a (60 mg, 31% yield) was obtained from
treatment of 7a (0.10 g, 0.28 mmol) with 6a (0.10 g, 0.26 mmol).
ESI m/z: 710 (M+1).sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) .delta.
8.16 (s, 1H), 7.46-7.28 (m, 10H), 6.97 (dd, J=8.4, 3.0 Hz, 2H),
6.88 (dd, J=5.8, 2.6 Hz, 2H), 6.75 (dt, J=8.4, 2.9 Hz, 2H), 5.02
(s, 4H), 2.98-2.89 (m, 1H), 2.89-2.71 (m, 3H), 2.33-2.14 (m, 6H),
2.12-1.93 (m, 4H), 1.72-1.61 (m, 4H), 1.45-1.40 (m, 2H), 1.38 (s,
3H), 1.31 (s, 3H), 1.22-1.09 (m, 8H) ppm.
[0651]
(1S,4aS,10aR)-6-(Benzyloxy)-N-((1S,4aS,10aR)-6-(2-(tert-butyldimeth-
ylsilyloxy)ethoxy)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-
-1-carbonyl)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-car-
boxamide (8b): Compound 8b (34 mg, 38% yield) was obtained from
treatment of 7b (50 mg, 0.12 mmol) with 6a (0.10 g, 0.26 mmol). ESI
m/z: 779 (M+1).sup.+.
[0652] tert-Butyl
2-((4bS,8S,8aR)-8-((1S,4aS,10aR)-6-(benzyloxy)-1,4a-dimethyl-1,2,3,4,4a,9-
,10,10a-octahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-dimethyl-4b,5,6,7,-
8,8a,9,10-octahydrophenanthren-3-yloxy)ethylcarbamate (8c):
Compound 8c (0.11 g, 60% yield) was obtained from treatment of 7c
(0.10 g, 0.24 mmol) with 6b (0.15 g, 0.29 mmol). ESI m/z: 763
(M+1).sup.+. .sup.1H NMR (500 MHz, CDCl.sub.3) .delta. 8.14 (s,
1H), 7.37-7.33 (m, 2H), 7.32-7.28 (m, 2H), 7.26-7.22 (m, 1H), 6.91
(s, 1H), 6.90 (s, 1H), 6.80 (d, J=2.5 Hz, 1H), 6.72 (s, 1H), 6.69
(dd, J=8.4, 2.6 Hz, 1H), 6.60 (dd, J=8.4, 2.5 Hz, 1H), 4.95 (s,
2H), 3.90 (t, J=5.0 Hz, 2H), 3.61 (s, 1H), 3.44 (s, 2H), 2.87 (dd,
J=16.2, 4.1 Hz, 2H), 2.80-2.67 (m, 2H), 2.25-2.11 (m, 6H),
2.06-1.89 (m, 4H), 1.67-1.54 (m, 4H), 1.45-1.29 (m, 11H), 1.24 (s,
6H), 1.14-1.03 (m, 8H) ppm.
[0653]
tert-Butyl-(4bS,8S,8aR)-8-((1S,4aS,10aR)-6-(benzyloxy)-1,4a-dimethy-
l-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-dime-
thyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-ylcarbamate (8d):
Compound 8d (37 mg, 46% yield) was obtained from treatment of 7d
(42 mg, 0.11 mmol) with 6b (72 mg, 0.14 mmol). ESI m/z: 719
(M+1).sup.+.
[0654]
tert-Butyl-4-((4bS,8S,8aR)-8-((1S,4aS,10aR)-6-(benzyloxy)-1,4a-dime-
thyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-d-
imethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl)piperazine-1-carboxyl-
ate (8e): Compound 8e (80 mg, 99% yield) was obtained from
treatment of 7e (45 mg, 0.10 mmol) with 6b (65 mg, 0.12 mmol). ESI
m/z: 788.4 (M+1).sup.+.
[0655]
(1S,4aS,10aR)-6-(Benzyloxy)-N-((1S,4aS,10aR)-6-cyano-1,4a-dimethyl--
1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,-
4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (8g): Compound 8g
(83 mg, 67% yield) was obtained from treatment of 7g (56 mg, 0.20
mmol) with 6b (0.16 g, 0.30 mmol). ESI m/z: 629.2 (M+1).sup.+.
.sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 8.14 (s, 1H), 7.79 (s,
1H), 7.51 (dd, J=7.9, 1.4 Hz, 1H), 7.44-7.40 (m, 2H), 7.40-7.35 (m,
2H), 7.33-7.29 (m, 1H), 7.25 (d, J=8.0 Hz, 1H), 6.94 (d, J=8.6 Hz,
1H), 6.89 (d, J=2.5 Hz, 1H), 6.78-6.71 (m, 1H), 5.04 (s, 2H),
3.20-2.98 (m, 1H), 2.92-2.80 (m, 2H), 2.78-2.68 (m, 1H), 2.39-2.21
(m, 5H), 2.22-2.11 (m, 2H), 1.95-1.79 (m, 4H), 1.69-1.53 (m, 4H),
1.31-1.22 (m, 7H), 1.21-1.08 (m, 2H), 1.02 (s, 3H), 1.01 (s, 3H)
ppm.
Example 6
[0656] This example demonstrates methods for making the final
compound 9a in Table 1, above. This example refers to the compound
numbering in FIG. 1.
[0657]
(1S,4aS,10aR)-6-Hydroxy-N-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,-
2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,4,-
4a,9,10,10a-octahydrophenanthrene-1-carboxamide (9a) was reported
in Bioorg. Med. Chem. Lett. 2005, 15, 2824-2828; the synthetic
procedure was similar as reported, and the hydrogenation was under
atmospheric pressure instead of 45 psi. To a solution of 8a (50 mg,
70 .mu.mol) in ethyl acetate (2 mL) was added wet Pd/C (10%, 20 mg)
under nitrogen. The mixture was purged with hydrogen 3 times, and
stirred at 15-25.degree. C. under an atmosphere of hydrogen for 16
h. The mixture was filtered through Celite to remove Pd/C, and the
filtrate was concentrated in vacuo. The residue was purified by
flash chromatography (0-20% ethyl acetate in petroleum ether) to
give 9a (10 mg, 27% yield) as a white solid. ESI m/z: 530
(M+1).sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.16 (s,
1H), 6.93 (d, J=8.4 Hz, 2H), 6.73 (d, J=2.6 Hz, 2H), 6.64-6.59 (m,
2H), 3.00-2.85 (m, 2H), 2.88-2.71 (m, 2H), 2.34-2.16 (m, 6H),
2.15-1.96 (m, 4H), 1.49-1.35 (m, 4H), 1.31 (s, 6H), 1.30-1.08 (m,
4H), 1.08 (s, 6H) ppm.
Example 7
[0658] This example demonstrates methods for making the final
compound 9b in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-6-Hydroxy-N-((1S,4aS,10aR)-6-(2-hydroxyethoxy)-1,4a-dimethyl-
-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (9b)
[0659] Step 1:
[0660] To a solution of 8b (37 mg, 44 .mu.mol) in THF (1.4 mL) was
added TBAF (1 M in THF, 0.09 mL) and the mixture was stirred at
25.degree. C. for 2 h. Removing THF in vacuo afforded the crude
hydroxyl intermediate, which was used in the next step without
purification. ESI m/z: 664 (M+1). .sup.1H NMR (500 MHz,
methanol-.sub.d4) .delta. 7.42 (d, J=7.4 Hz, 2H), 7.36 (t, J=7.5
Hz, 2H), 7.29 (t, J=7.3 Hz, 1H), 6.97 (d, J=2.3 Hz, 1H), 6.96 (d,
J=2.3 Hz, 1H), 6.87 (dd, J=4.4, 2.6 Hz, 2H), 6.75 (dd, J=8.4, 2.5
Hz, 1H), 6.72 (dd, J=8.4, 2.5 Hz, 1H), 5.03 (s, 2H), 4.02-3.98 (m,
2H), 3.87-3.83 (m, 2H), 2.94 (d, J=16.3 Hz, 2H), 2.82 (dd, J=18.2,
8.2 Hz, 2H), 2.40-2.20 (m, 5H), 2.16-1.95 (m, 4H), 1.77-1.62 (m,
3H), 1.59-1.49 (m, 1H), 1.48-1.32 (m, 8H), 1.25 (tt, J=13.8, 3.8
Hz, 2H), 1.12 (d, J=13.3 Hz, 6H), 0.98 (t, J=7.4 Hz, 1H) ppm.
[0661] Step 2:
[0662] To a solution of the crude hydroxyl intermediate (20 mg, 30
.mu.mol) in ethyl acetate (2 mL) was added wet Pd/C (10%, 20 mg)
under nitrogen. This mixture was purged with hydrogen 3 times, and
stirred at 20-25.degree. C. under an atmosphere of hydrogen for 16
h. The mixture was filtered through Celite to remove Pd/C and the
filtrate was concentrated in vacuo. The residue was purified by
flash chromatography (0-35% ethyl acetate in petroleum ether) to
give 9b (4 mg, 23% yield) as a white solid. ESI m/z: 574.2
(M+1).sup.+. .sup.1H NMR (500 MHz, CDCl.sub.3) .delta. 8.16 (s,
1H), 7.02-6.87 (m, 2H), 6.85-6.72 (m, 2H), 6.72-6.57 (m, 2H),
4.08-4.01 (m, 2H), 3.99-3.89 (m, 2H), 3.01-2.87 (m, 2H), 2.87-2.68
(m, 2H), 2.33-2.15 (m, 6H), 2.14-1.97 (m, 4H), 1.78-1.58 (m, 5H),
1.50-1.35 (m, 2H), 1.36-1.25 (m, 7H), 1.22-1.07 (m, 8H) ppm.
Example 8
[0663] This example demonstrates methods for making the final
compound 9c in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-6-(2-Aminoethoxy)-N-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1-
,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,4-
,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (9c)
[0664] Method 1: To a solution of 8c (0.11 g, 0.16 mmol) in ethyl
acetate (5 mL) was added wet Pd/C (10%, 30 mg) under nitrogen. The
mixture was purged with hydrogen 3 times and stirred at
15-25.degree. C. for 16 h. The mixture was filtered through Celite
and the filtrate was concentrated in vacuo to give the
de-benzylated intermediate (94 mg) as a white solid. ESI m/z: 673
(M+1).sup.+. .sup.1H NMR (400 MHz, methanol-.sub.d4) .delta. 6.95
(d, J=8.5 Hz, 1H), 6.90-6.82 (m, 2H), 6.72-6.66 (m, 2H), 6.54 (dd,
J=8.3, 2.4 Hz, 1H), 3.94 (t, J=5.6 Hz, 2H), 3.43-3.34 (m, 2H),
2.98-2.86 (m, 2H), 2.86-2.72 (m, 2H), 2.38-2.30 (m, 3H), 2.26 (d,
J=13.8 Hz, 3H), 2.15-1.94 (m, 4H), 1.75-1.63 (m, 4H), 1.44 (s, 9H),
1.39-1.32 (m, 8H), 1.31-1.20 (m, 2H), 1.12 (d, J=5.0 Hz, 6H) ppm. A
mixture of the de-benzylated intermediate (90 mg) in methanol (0.5
mL) was treated with HCl in dioxane (4 M, 0.5 mL) at 15-25.degree.
C. for 16 h. The volatiles were removed in vacuo and the residue
was purified by prep-HPLC (method B) to give 9c (40 mg, 52% yield)
as a white solid. ESI m/z: 573.3 (M+1).sup.+. .sup.1H NMR (400 MHz,
methanol-.sub.d4) .delta. 8.41 (s, 1H, NH of imidine), 6.99 (d,
J=8.4 Hz, 1H), 6.90 (d, J=2.5 Hz, 1H), 6.87 (d, J=8.4 Hz, 1H), 6.76
(dd, J=8.3, 2.5 Hz, 1H), 6.69 (d, J=2.5 Hz, 1H), 6.54 (dd, J=8.3,
2.5 Hz, 1H), 4.17 (t, J=5.0 Hz, 2H), 3.40-3.22 (m, 2H), 2.99-2.71
(m, 4H), 2.41-2.21 (m, 6H), 2.15-1.93 (m, 4H), 1.75-1.64 (m, 4H),
1.47-1.33 (m, 8H), 1.27-1.25 (m, 2H), 1.12 (s, 3H), 1.09 (s, 3H)
ppm.
[0665] Method 2: To a solution of 9b (25 mg, 44 .mu.mol) in toluene
(1 mL) were added phthalimide (10 mg, 65 .mu.mol),
triphenylphosphine (23 mg, 88 .mu.mol) and diisopropyl
azodicarboxylate (DIAD, 18 mg, 88 .mu.mol). After the reaction was
stirred at 20-25.degree. C. for 24 h, the reaction mixture was
diluted with ethyl acetate (40 mL), the organics were washed with
water (20 mL), dried over anhydrous sodium sulfate, and
concentrated. The residue was dissolved in ethanol (5 mL) and the
ethanolic solution was then treated with hydrazine (0.3 mL). This
mixture was stirred at 90.degree. C. for 3 h. After the reaction
was cooled, the volatiles were removed in vacuo, and the residue
was triturated with acetonitrile (10 mL). The mixture was stirred
at 25.degree. C. for 10 minutes and filtered. The solids were
washed with acetonitrile (10 mL) and the combined filtrate was
concentrated in vacuo. The crude product was purified by prep-HPLC
(method B) to give 9c (11 mg, 44% yield) as a white solid. ESI m/z:
573.4 (M+1).sup.+.
Example 9
[0666] This example demonstrates methods for making the final
compound 9d in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-6-Amino-N-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,-
9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,4,4a,9,10,1-
0a-octahydrophenanthrene-1-carboxamide (9d)
[0667] Step 1:
[0668] To a solution of 8d (0.84 g, 1.3 mmol) in ethyl acetate (50
mL) was added wet Pd/C (10%, 0.15 g) under nitrogen. The mixture
was purged with hydrogen and stirred at 15-25.degree. C. under a
hydrogen balloon for 16 h. The mixture was filtered through Celite
and the filtrate was concentrated in vacuo. The residue was
purified by silica gel column chromatography (0-50% ethyl acetate
in petroleum ether) to give 9g (0.66 g, 90% yield) as a white
solid. ESI m/z: 629 (M+1).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 9.12 (s, 1H), 9.00 (s, 1H), 8.12 (s, 1H),
7.39 (d, J=17.8 Hz, 1H), 7.15 (d, J=7.4 Hz, 1H), 6.90 (d, J=8.4 Hz,
1H), 6.82 (d, J=8.3 Hz, 1H), 6.64 (d, J=2.3 Hz, 1H), 6.51 (dd,
J=8.2, 2.4 Hz, 1H), 2.85 (td, J=16.3, 3.8 Hz, 2H), 2.79-2.64 (m,
2H), 2.33-2.22 (m, 2H), 2.21-2.09 (m, 4H), 1.96-1.77 (m, 4H),
1.68-1.54 (m, 4H), 1.46 (s, 9H), 1.34-1.24 (m, 8H), 1.20-1.10 (m,
2H), 0.99 (s, 6H) ppm.
[0669] Step 2:
[0670] To a solution of 9g in methanol (0.5 mL) was added HCl in
dioxane (4 M, 0.5 mL) at 0.degree. C., and the resulting solution
was stirred at 15-25.degree. C. for 16 h. The volatiles were
removed in vacuo and the residue was purified by prep-HPLC (method
B) to give 9d (1.3 mg, 44% yield) as a white solid. ESI m/z: 529.3
(M+1).sup.+.
[0671] The 500 MHz NMR data in DMSO-.sub.d6 (ppm) for 9d were
summarized in Table 3 as follows.
##STR00328##
TABLE-US-00005 TABLE 3 Atom # .sup.1H NMR .sup.13C NMR Atom #
.sup.1H NMR .sup.13C NMR 1 1.30 (Ha), 2.14 (He) 39.2 1' 1.30 (Ha),
2.14 (He) 39.36 2 1.54 (Ha), 1.84 (He) 19.61 2' 1.54 (Ha), 1.84
(He) 19.64 3 1.13 (Ha), 2.14 (He) 37.12 3' 1.13 (Ha), 2.14 (He)
37.18 4 -- 45.52 4' -- 45.56 5 1.6 52.09 5' 1.6 52.32 6 1.84 (Ha),
2.23 (He) 21.27 6' 1.84 (Ha), 2.23 (He) 21.43 7 2.75 31 7' 2.75
31.08 8 -- 121.65 8' -- 124.6 9 -- 147.63 9' -- 148.39 10 -- 38.17
10' -- 38.23 11 6.48 110.77 11' 6.63 111.81 12 -- 146.43 12' --
155.34 13 6.34 112.58 13' 6.5 113.23 14 6.68 129.09 14' 6.81 129.56
15 -- 173.92 15' -- 174.03 16 1.26 27.65 16' 1.26 27.64 17 0.98
23.03 17' 0.98 23.08 18 (N) 4.69 18' (O) 8.99 19 (N) 8.09
[0672] .sup.1H NMR (500 MHz, CDCl.sub.3) .delta. 8.14 (s, 1H), 6.92
(d, J=8.3 Hz, 1H), 6.86 (d, J=8.1 Hz, 1H), 6.73 (d, J=2.5 Hz, 1H),
6.65-6.57 (m, 2H), 6.50 (dd, J=8.1, 2.3 Hz, 1H), 4.75 (s, 1H), 3.49
(s, 1H), 2.99-2.85 (m, 2H), 2.79 (tt, J=11.6, 5.8 Hz, 2H),
2.34-2.14 (m, 6H), 2.15-1.95 (m, 4H), 1.74-1.51 (m, 5H), 1.46-1.34
(m, 2H), 1.30 (s, 6H), 1.21-1.06 (m, 8H) ppm.
[0673] .sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 8.99 (s, 1H),
8.09 (s, 1H), 6.81 (d, J=8.0 Hz, 1H), 6.68 (d, J=8.0 Hz, 1H), 6.63
(d, J=2.5 Hz, 1H), 6.50 (dd, J=8.0, 2.5 Hz, 1H), 6.48 (d, J=2.5 Hz,
1H), 6.34 (dd, J=8.0, 2.5 Hz, 1H), 4.69 (s, 2H), 2.86-2.60 (m, 4H),
2.28-2.10 (m, 6H), 1.94-1.75 (m, 4H), 1.65-1.53 (m, 4H), 1.35-1.20
(m, 8H), 1.20-1.06 (m, 2H), 0.98 (s, 6H) ppm.
[0674] .sup.13C NMR (100 MHz, DMSO-.sub.d6) .delta. 174.03, 173.92,
155.34, 148.39, 147.63, 146.43, 129.56, 129.09, 124.60, 121.65,
113.23, 112.58, 111.81, 110.77, 52.32, 52.09, 45.56, 45.52, 39.20,
39.36, 38.23, 38.17, 37.18, 37.12, 31.08, 31.00, 27.65, 27.64,
23.08, 23.03, 21.43, 21.27, 19.64, 19.61 ppm.
[0675] HPLC (method B): Retention time (Rt): 8.92 min, purity:
99.4%. chiral HPLC: >99.9% (in column AD, AS, OD and OJ).
Optical rotation [.alpha.].sup.25: +2.53.degree. (1.7 g/100 mL
THF).
Example 10
[0676] This example demonstrates methods for making the final
compound 9e in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-N-((1S,4aS,10aR)-1,4a-Dimethyl-6-(piperazin-1-yl)-1,2,3,4,4a-
,9,10,10a-octahydrophenanthrene-1-carbonyl)-6-hydroxy-1,4a-dimethyl-1,2,3,-
4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (9e)
[0677] To a solution of 8e (61 mg, 77 .mu.mol) in ethyl acetate (1
mL) was added wet Pd/C (10%, 5 mg) under nitrogen. The mixture was
purged with hydrogen 3 times and stirred under hydrogen at
30.degree. C. for 16 h. The mixture was filtered through Celite and
the filtrate was concentrated in vacuo to give the de-benzylated
intermediate (54 mg, ESI m/z: 698 (M+1).sup.+), which was dissolved
in methanol (0.5 mL) and treated with HCl in dioxane (4 M, 0.5 mL)
at 15-25.degree. C. for 16 h. The volatiles were removed in vacuo
and the residue was purified by prep-HPLC (method B) to give 9e (10
mg, 22% yield) as a white solid. ESI m/z: 598 (M+1).sup.+. .sup.1H
NMR (400 MHz, methanol-.sub.d4) .delta. 8.40 (s, 1H, NH), 7.00 (d,
J=8.3 Hz, 1H), 6.92 (d, J=2.5 Hz, 1H), 6.87 (d, J=8.3 Hz, 1H), 6.80
(dd, J=8.3, 2.4 Hz, 1H), 6.70 (d, J=2.5 Hz, 1H), 6.54 (dd, J=8.2,
2.4 Hz, 1H), 3.36 (m, 8H), 3.02-2.71 (m, 4H), 2.42-2.20 (m, 6H),
2.15-1.92 (m, 4H), 1.79-1.59 (m, 4H), 1.52-1.18 (m, 10H), 1.12 (d,
J=9.1 Hz, 6H) ppm.
Example 11
[0678] This example demonstrates methods for making the final
compound 9f in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-6-(Dimethylamino)-N-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1-
,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,4-
,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (9f)
[0679] To a solution of compound 8d (36 mg, 50 .mu.mol) in methanol
(0.5 mL) was added with HCl in dioxane (4 N, 0.5 mL, 2 mmol) at
0.degree. C., and the resulting mixture was stirred at
20-25.degree. C. for 16 h. The reaction was monitored by LC-MS
until compound 8d was consumed. The volatiles were removed in vacuo
to give 27 mg of the free amine intermediate, which was dissolved
in methanol (2 mL), followed by the addition of Pd/C (10%, 5 mg)
under nitrogen. The reaction mixture was purged with hydrogen and
stirred at 20-25.degree. C. under a hydrogen balloon for 16 h. The
N-methylation occurred with methanol under acidic conditions. The
mixture was filtered through Celite, and the filtrate was
concentrated in vacuo. The residue was purified by prep-HPLC
(method B) to give 9f (10 mg, 36% yield) as a white solid. ESI m/z:
557 (M+H).sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3) .delta. 8.15 (s,
1H), 6.99-6.90 (m, 2H), 6.73 (d, J=2.6 Hz, 1H), 6.68-6.58 (m, 3H),
4.69 (s, 1H), 2.98-2-2.85 (m, 8H), 2.87-2.72 (m, 2H), 2.35-2.16 (m,
6H), 2.15-1.98 (m, 4H), 1.66 (d, J=14.5 Hz, 4H), 1.5-1.34 (m, 2H),
1.31 (s, 3H), 1.31 (s, 3H) 1.19 (s, 3H), 1.17-1.08 (m, 5H) ppm.
Example 12
[0680] This example demonstrates methods for making the final
compound 9g in Table 1, above. This example refers to the compound
numbering in FIG. 1.
tert-Butyl
(4bS,8S,8aR)-8-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4-
a,9,10,10a-octahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-dimethyl-4b,5,6-
,7,8,8a,9,10-octahydrophenanthren-3-ylcarbamate (9g)
[0681] To a solution of 8d (0.84 g, 1.3 mmol) in ethyl acetate (50
mL) was added wet Pd/C (10%, 0.15 g) under nitrogen. The mixture
was purged with hydrogen and stirred at 15-25.degree. C. under a
hydrogen balloon for 16 h until 8d was totally consumed, which was
monitored by LCMS. The mixture was filtered through Celite and the
filtrate was concentrated in vacuo. The residue was purified by
silica gel column chromatography (0-50% ethyl acetate in petroleum
ether) to give 9g (0.66 g, 90% yield) as a white solid. ESI m/z:
629 (M+1).sup.+. .sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 9.12
(s, 1H), 9.00 (s, 1H), 8.12 (s, 1H), 7.39 (d, J=17.8 Hz, 1H), 7.15
(d, J=7.4 Hz, 1H), 6.90 (d, J=8.4 Hz, 1H), 6.82 (d, J=8.3 Hz, 1H),
6.64 (d, J=2.3 Hz, 1H), 6.51 (dd, J=8.2, 2.4 Hz, 1H), 2.85 (td,
J=16.3, 3.8 Hz, 2H), 2.79-2.64 (m, 2H), 2.33-2.22 (m, 2H),
2.21-2.09 (m, 4H), 1.96-1.77 (m, 4H), 1.68-1.54 (m, 4H), 1.46 (s,
9H), 1.34-1.24 (m, 8H), 1.20-1.10 (m, 2H), 0.99 (s, 6H) ppm.
Example 13
[0682] This example demonstrates methods for making the final
compound 9h in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-6-(2-Aminoacetamido)-N-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethy-
l-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,-
3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (9h)
[0683] To a solution of Fmoc-Gly-OH (30 mg, 0.1 mmol) in DMF (1 mL)
were added HATU (38 mg, 0.1 mmol), and DIPEA (39 mg, 0.3 mmol) at
25.degree. C. The resulting mixture was stirred at this temperature
for an hour. To the mixture was then added 9d (30 mg, 0.06 mmol),
and the reaction mixture was stirred at 25.degree. C. for 16 h
until 9d was totally consumed (as monitored by LCMS). To the
mixture was added piperidine (0.2 mL), and the resulting mixture
was stirred for additional 30 min at rt. The volatiles were removed
in vacuo and the residue was directly purified by prep-HPLC (method
B) to give 9h (17 mg, 51% yield) as a white solid. ESI m/z: 586
(M+1).sup.+. .sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 9.70 (br
s, 1H, CONH-Ph), 9.03 (s, 1H, OH), 8.12 (s, 1H, NH of imidine),
7.52 (s, 1H), 7.41 (dd, J=8.3, 1.8 Hz, 1H), 6.97 (d, J=8.4 Hz, 1H),
6.82 (d, J=8.3 Hz, 1H), 6.64 (d, J=2.3 Hz, 1H), 6.51 (dd, J=8.2,
2.3 Hz, 1H), 3.22 (s, 2H), 2.95-2.63 (m, 4H), 2.33-2.23 (m, 2H),
2.23-2.08 (m, 4H), 1.98-1.77 (m, 4H), 1.71-1.51 (m, 4H), 1.37-1.23
(m, 8H), 1.20-1.09 (m, 2H), 1.01 (s, 3H), 0.99 (s, 3H) ppm.
Example 14
[0684] This example demonstrates methods for making the final
compound 9i in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-6-(3-Aminopropanamido)-N-((1S,4aS,10aR)-6-hydroxy-1,4a-dimet-
hyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,-
2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide (9i)
[0685] To a solution of Boc-.beta.-Ala-OH (38 mg, 0.2 mmol) in DMF
(1 mL) were added HATU (76 mg, 0.2 mmol), and DIPEA (52 mg, 0.4
mmol) at 25.degree. C. The resulting solution was stirred at this
temperature for an hour. To the solution was then added 9d (53 mg,
0.1 mmol), and the resulting mixture was stirred at 25.degree. C.
for 16 h until 9d was totally consumed (as monitored by LCMS). The
reaction mixture was diluted with ethyl acetate, and washed with
water and brine. The organics were dried over sodium sulfate, and
concentrated in vacuo. The residue was dissolved in DCM (2 mL) and
to the solution was slowly added TFA (0.2 mL) at rt. The mixture
was stirred at rt for 2 h, and the volatiles were removed in vacuo
and the residue was purified by prep-HPLC (method B) to give 9i (30
mg, 50% yield) as a white solid. ESI m/z: 600 (M+1).sup.+. .sup.1H
NMR (500 MHz, methanol-.sub.d4) .delta. 7.38 (s, 1H), 7.20 (d,
J=8.2 Hz, 1H), 6.90 (d, J=8.3 Hz, 1H), 6.76 (d, J=8.3 Hz, 1H), 6.60
(d, J=2.3 Hz, 1H), 6.43 (dd, J=8.2, 2.3 Hz, 1H), 2.93 (t, J=6.5 Hz,
2H), 2.90-2.80 (m, 2H), 2.80-2.63 (m, 2H), 2.47 (t, J=6.5 Hz, 2H),
2.30-2.12 (m, 6H), 2.02-1.85 (m, 4H), 1.65-1.54 (m, 4H), 1.37-1.28
(m, 2H), 1.26 (s, 3H), 1.25 (s, 3H), 1.21-1.11 (m, 2H), 1.02 (s,
3H), 1.01 (s, 3H) ppm.
Example 15
[0686] This example demonstrates methods for making the final
compound 9j in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-6-((S)-2-Amino-3-hydroxypropanamido)-N-((1S,4aS,10aR)-6-hydr-
oxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,-
4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide
(9j)
[0687] Using the same procedure for preparing 9h except replacing
Fmoc-Gly-OH with Fmoc-Ser-OH, 9j (18 mg, 51% yield) as a white
solid was obtained. ESI m/z: 616 (M+1).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 9.74 (br s, 1H, CONH-Ph), 9.00 (s, 1H, OH),
8.11 (s, 1H, NH of imidine), 7.58 (s, 1H), 7.41 (dd, J=8.2, 2.0 Hz,
1H), 6.96 (d, J=8.4 Hz, 1H), 6.82 (d, J=8.3 Hz, 1H), 6.63 (d, J=2.3
Hz, 1H), 6.50 (dd, J=8.2, 2.4 Hz, 1H), 4.82 (t, J=5.5 Hz, 1H, OH on
Ser), 3.62-3.45 (m, 3H), 2.97-2.61 (m, 4H), 2.33-2.21 (m, 2H),
2.21-2.03 (m, 4H), 1.96-1.77 (m, 4H), 1.70-1.50 (m, 4H), 1.36-1.20
(m, 8H), 1.23-1.06 (m, 2H), 1.06-0.93 (m, 6H) ppm.
Example 16
[0688] This example demonstrates methods for making the final
compound 9k in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)-N-((1S,4aS,10aR)-1,4a-Dimethyl-6-(2-(methylamino)acetamido)--
1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-6-hydroxy-1,4a-dimet-
hyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide;
Trifluoroacetic Acid Salt (9k)
[0689] Following the procedures for preparing 9i except replacing
Boc-.beta.-Ala-OH with N-Boc-Sar-OH, 9k (27 mg, 28% yield, TFA
salt) was obtained as a white solid after purification by prep-HPLC
(method A). ESI m/z: 600.5 (M+1).sup.+. .sup.1H NMR (400 MHz,
DMSO-.sub.d6) .delta. 10.33 (s, 1H), 8.99 (s, 1H), 8.74 (s, 2H),
8.12 (s, 1H), 7.47 (s, 1H), 7.32 (dd, J=8.3, 1.6 Hz, 1H), 7.03 (d,
J=8.4 Hz, 1H), 6.82 (d, J=8.1 Hz, 1H), 6.63 (d, J=2.3 Hz, 1H), 6.50
(dd, J=8.2, 2.4 Hz, 1H), 3.87 (s, 2H), 2.97-2.66 (m, 4H), 2.62 (s,
3H), 2.37-2.23 (m, 2H), 2.21-2.06 (m, 4H), 2.00-1.77 (m, 4H),
1.70-1.50 (m, 4H), 1.38-1.23 (m, 8H), 1.21-1.08 (m, 2H), 1.01 (s,
3H), 0.99 (s, 3H) ppm. .sup.19F NMR (376 MHz, DMSO-.sub.d6)
.delta.- 73.43 ppm.
Example 17
[0690] This example demonstrates methods for making the final
compound 9l in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)--N-[(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10-
a-octahydrophenanthrene-1-carbonyl]-6-[(2S)-2,6-diaminohexanamido]-1,4a-di-
methyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide;
Trifluoroacetic Acid Salt (9l)
[0691] Following the procedures for preparing 9i except replacing
Boc-.beta.-Ala-OH with Boc-Lys-OH, compound 9l (9 mg, 49% yield)
was obtained as a white solid. ESI m/z: 657.5 (M+1).sup.+. .sup.1H
NMR (400 MHz, DMSO-.sub.d6) .delta. 10.33 (s, 1H), 9.01 (s, 1H),
8.13 (s, 1H), 7.78 (br s, 6H), 7.51 (s, 1H), 7.34 (d, J=8.1 Hz,
1H), 7.02 (d, J=8.5 Hz, 1H), 6.82 (d, J=8.6 Hz, 1H), 6.63 (s, 1H),
6.51 (d, J=8.3 Hz, 1H), 3.82 (s, 1H), 2.89 (s, 1H), 2.82-2.67 (m,
5H), 2.29 (s, 2H), 2.15 (s, 4H), 1.85 (s, 6H), 1.64-1.51 (m, 6H),
1.28 (d, J=6.8 Hz, 10H), 1.13 (s, 2H), 1.01 (s, 3H), 0.99 (s, 3H)
ppm. .sup.19F NMR (376 MHz, DMSO a6) 8-73.53 ppm.
Example 18
[0692] This example demonstrates methods for making the final
compound 9m in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(1S,4aS,10aR)--N-[(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10-
a-octahydrophenanthrene-1-carbonyl]-6-[(2S)-2-amino-3-(1H-imidazol-4-yl)pr-
opanamido]-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbo-
xamide; trifluoroacetic acid salt (9m)
[0693] Following the procedures for preparing 9i except replacing
Boc-.beta.-Ala-OH with Boc-His-OH, 9m (11 mg, 60% yield) was
obtained as a white solid. ESI m/z: 666.3 (M+1).sup.+. .sup.1H NMR
(500 MHz, DMSO-.sub.d6) .delta. 10.39 (s, 1H), 9.02 (s, 1H), 8.74
(s, 1H), 8.45 (br s, 2H), 8.13 (s, 1H), 7.42 (s, 1H), 7.36 (s, 1H),
7.31-7.27 (dd, J=8.3 Hz, 1.7 Hz, 1H), 7.02 (d, J=8.4 Hz, 1H), 6.82
(d, J=8.3 Hz, 1H), 6.63 (d, J=2.2 Hz, 1H), 6.51 (dd, J=8.2, 2.3 Hz,
1H), 4.20 (t, J=6.8 Hz, 1H), 3.28-3.13 (m, 2H), 2.95-2.63 (m, 4H),
2.34-2.22 (m, 2H), 2.22-2.08 (m, 4H), 1.93-1.81 (m, 4H), 1.66-1.56
(m, 4H), 1.37-1.22 (m, 8H), 1.22-1.08 (m, 2H), 1.01 (s, 3H), 0.99
(s, 3H) ppm. .sup.19F NMR (376 MHz, DMSO.sub.d6) .delta. -73.64
ppm.
Example 19
[0694] This example demonstrates methods for making the final
compound 9n in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(3S)-3-Amino-3-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,-
2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethy-
l-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}propanoic
Acid (9n)
[0695] Following the procedures for preparing 9i except replacing
Boc-.beta.-Ala-OH with OtBu-N-Boc-Asp-OH, 9n (11 mg, 62% yield) was
obtained as a white solid. ESI m/z: 644.3 (M+1).sup.+. .sup.1H NMR
(500 MHz, DMSO-.sub.d6) .delta. 10.34 (br s, 1H), 9.03 (br s, 1H),
8.12 (s, 1H), 7.53 (s, 1H), 7.34 (dd, J=8.3, 1.8 Hz, 1H), 6.98 (d,
J=8.4 Hz, 1H), 6.81 (d, J=8.3 Hz, 1H), 6.63 (d, J=2.3 Hz, 1H), 6.50
(dd, J=8.2, 2.3 Hz, 1H), 3.79-3.74 (m, 1H), 2.93-2.69 (m, 5H),
2.37-2.23 (m, 3H), 2.22-2.08 (m, 4H), 1.95-1.78 (m, 4H), 1.66-1.54
(m, 4H), 1.42-1.22 (m, 8H), 1.19-1.09 (m, 2H), 1.00 (s, 3H), 0.99
(s, 3H) ppm.
Example 20
[0696] This example demonstrates methods for making the final
compound 9o in Table 1, above. This example refers to the compound
numbering in FIG. 1.
(4S)-4-Amino-4-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,-
2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethy-
l-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}butanoic
acid; Trifluoroacetic Acid Salt (9o)
[0697] Following the procedures for preparing 9i except replacing
Boc-.beta.-Ala-OH with OtBu-N-Boc-Glu-OH, 9o (8 mg, 46% yield) was
obtained as a white solid. ESI m/z: 658.3 (M+1).sup.+. .sup.1H NMR
(400 MHz, DMSO-.sub.d6) .delta. 10.32 (s, 1H), 9.00 (s, 1H), 8.12
(s, 1H), 7.48 (s, 1H), 7.35 (d, J=8.2 Hz, 1H), 7.02 (d, J=8.4 Hz,
1H), 6.82 (d, J=8.3 Hz, 1H), 6.63 (d, J=2.1 Hz, 1H), 6.50 (dd,
J=8.2, 2.3 Hz, 1H), 3.87 (t, J=6.5 Hz, 1H), 2.97-2.67 (m, 4H),
2.41-2.22 (m, 4H), 2.22-2.08 (m, 4H), 2.05-1.97 (m, 2H), 1.94-1.80
(m, 4H), 1.69-1.52 (m, 4H), 1.42-1.22 (m, 8H), 1.22-1.06 (m, 2H),
1.02 (s, 3H), 0.99 (s, 3H) ppm. .sup.19F NMR (376 MHz,
DMSO-.sub.d6) .delta.- 73.50 ppm.
Example 21
[0698] This example demonstrates methods for making the final
compound 9p in Table 1, above. This example refers to the compound
numbering in FIG. 1 and the synthesis was shown in FIG. 3a.
Step 1: Making
(1S,4aS,10aR)-6-(Aminomethyl)-N-((1S,4aS,10aR)-6-(benzyloxy)-1,4a-dimethy-
l-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,-
3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide;
Trifluoroacetic Acid Salt (9p')
[0699] To a solution of 8g (70 mg, 0.11 mmol) in ethanol (15 mL)
under nitrogen, was added Raney Ni (0.10 g) at 0.degree. C.,
followed by the addition of conc. aq. ammonia solution (1.5 mL).
The resulting mixture was purged with hydrogen and stirred under an
atmosphere of hydrogen via balloon for 18 h. The reduction was
deemed complete by LCMS. The solution was filtered through Celite
and the filtrate was concentrated in vacuo to give a crude material
(67 mg, 95% yield) as a white solid, 7 mg of which was purified by
prep-HPLC (method A) to provide 9p' (4 mg, TFA salt) for NMR
analysis. ESI m/z: 633.4 (M+1).sup.+. .sup.1H NMR (400 MHz,
DMSO-.sub.d6) .delta. 9.21 (s, 2H), 9.01 (s, 1H), 8.13 (s, 1H),
7.52-7.34 (m, 6H), 7.18 (d, J=8.0 Hz, 1H), 7.10 (d, J=7.9 Hz, 1H),
6.82 (d, J=8.3 Hz, 1H), 6.63 (d, J=2.2 Hz, 1H), 6.51 (dd, J=8.2,
2.3 Hz, 1H), 4.19-4.03 (m, 4H), 3.00-2.93 (m, 1H), 2.87-2.77 (m,
2H), 2.75-2.64 (m, 1H), 2.35-2.24 (m, 3H), 2.22-2.09 (m, 3H),
1.96-1.74 (m, 4H), 1.71-1.51 (m, 4H), 1.38-1.22 (m, 8H), 1.21-1.08
(m, 2H), 1.03 (s, 3H), 0.99 (s, 3H) ppm. .sup.19F NMR (376 MHz,
DMSO-.sub.d6) .delta. -73.53 ppm.
Step 2: Making
(1S,4aS,10aR)-6-(Aminomethyl)-N-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,-
2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,4,-
4a,9,10,10a-octahydrophenanthrene-1-carboxamide; Trifluoroacetic
Acid Salt (9p)
[0700] To a solution of compound 9p' (60 mg, 95 .mu.mol) in DCM (5
mL) was added dropwise boron tribromide (1 M in DCM, 1 mL) under an
atmosphere of argon at -78.degree. C. The resulting mixture was
stirred at -78.degree. C. for an hour until the benzyl group was
totally removed according to LCMS. The mixture was then quenched
with methanol (5 mL) dropwise at -78.degree. C. and the reaction
was allowed to warm to room temperature. The solution was diluted
with DCM (50 mL) and washed with sat. aq. sodium bicarbonate (20
mL.times.2). The organics were dried over sodium sulfate and
concentrated in vacuo. The residue was purified by prep-HPLC
(method A) to give the title compound 9p (15 mg, 30% yield, TFA
salt) as a white solid. ESI m/z: 543.2 (M+1).sup.+. .sup.1H NMR
(500 MHz, DMSO-.sub.d6) .delta. 9.02 (s, 1H), 8.14 (s, 1H), 8.09
(br s, 3H), 7.40 (s, 1H), 7.15 (d, J=7.9 Hz, 1H), 7.09 (d, J=7.9
Hz, 1H), 6.82 (d, J=8.3 Hz, 1H), 6.64 (d, J=2.3 Hz, 1H), 6.51 (dd,
J=8.2, 2.4 Hz, 1H), 3.96 (d, J=4.7 Hz, 2H), 3.00-2.91 (m, 1H),
2.87-2.76 (m, 2H), 2.75-2.66 (m, 1H), 2.36-2.24 (m, 3H), 2.22-2.10
(m, 3H), 1.97-1.78 (m, 4H), 1.68-1.53 (m, 4H), 1.35-1.23 (m, 8H),
1.16 (qd, J=14.0, 3.6 Hz, 2H), 1.03 (s, 3H), 0.99 (s, 3H) ppm.
.sup.19F NMR (376 MHz, DMSO.sub.d6) .delta. -73.53 ppm.
Example 22
[0701] This example demonstrates methods for making the final
compound 9q in Table 1, above. This example refers to the compound
numbering in FIG. 1.
4-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10-
,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethyl-4b,5,6,7,8,-
8a,9,10-octahydrophenanthren-3-yl]carbamoyl}butanoic Acid (9q)
[0702] To a 4 mL-screw-capped vial were added compound 9d (15 mg,
28 .mu.mol) and glutaric anhydride (5.0 mg, 43 .mu.mol). The mixed
solids were dissolved in THF (0.2 mL). The mixture was stirred at
rt for 16 hours until the reaction was completed, as monitored by
LCMS. The mixture was diluted with methanol (2 mL). The solution
was filtered and the filtrate was purified by prep-HPLC (method B)
to give compound 9q (10 mg, 56% yield) as a white solid. ESI m/z:
643.3 (M+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 9.73
(s, 1H), 8.99 (s, 1H), 8.11 (s, 1H), 7.48 (s, 1H), 7.33 (dd, J=8.3,
1.7 Hz, 1H), 6.94 (d, J=8.4 Hz, 1H), 6.81 (d, J=8.3 Hz, 1H), 6.63
(d, J=2.3 Hz, 1H), 6.50 (dd, J=8.2, 2.3 Hz, 1H), 2.94-2.60 (m, 4H),
2.33-2.07 (m, 10H), 1.96-1.51 (m, 10H), 1.37-1.21 (m, 8H), 1.14 (t,
J=14.1 Hz, 2H), 1.00 (s, 3H), 0.98 (s, 3H) ppm.
Example 23
[0703] This example demonstrates methods for making the final
compound 9r in Table 1, above. This example refers to the compound
numbering in FIG. 1 and the synthesis was shown in FIG. 3b.
2-[({[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,-
10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethyl-4b,5,6,7,-
8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}methyl)amino]acetic
Acid; Trifluoroacetic Acid Salt (9r)
[0704] To a solution of Boc-iminodiacetic Acid (30 mg, 0.13 mmol)
in DMF (0.5 mL) were added HATU (60 mg, 0.16 mmol), and DIPEA (72
mg, 0.56 mmol) at 25.degree. C. The resulting mixture was stirred
at this temperature for an hour. The reaction mixture was cooled to
10-15.degree. C., and to the mixture was then added 9d (30 mg, 57
.mu.mol). After the reaction was stirred at 10-15.degree. C. for 3
hours, 9d was totally consumed (as monitored by LCMS). To the
reaction mixture was added aq. lithium hydroxide (1 M, 0.5 mL). The
mixture was then stirred at 70.degree. C. for 2 hours. After the
reaction was cooled to rt and filtered through a syringe filter
membrane, the filtrate was directly separated by reversed phase
flash chromatography (5-90% acetonitrile in water (with 0.1% TFA)
to afford white solids. The solids were dissolved in DCM (0.4 mL)
and to the solution was added TFA (0.1 mL) slowly at rt, and the
reaction was stirred at rt for 2 hours. The volatiles were removed
in vacuo and the residue was purified by prep-HPLC (method B) to
give 9r (10 mg, 28% yield) as a white solid. ESI m/z: 644.4
(M+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 10.24 (s,
1H), 9.00 (s, 1H), 8.12 (s, 1H), 7.48 (s, 1H), 7.32 (d, J=7.9 Hz,
1H), 7.01 (d, J=8.5 Hz, 1H), 6.82 (d, J=8.3 Hz, 1H), 6.67-6.60 (m,
1H), 6.51 (d, J=8.4 Hz, 1H), 3.88-3.76 (m, 4H), 2.96-2.61 (m, 5H),
2.32-2.22 (m, 2H), 2.19-2.08 (m, 4H), 1.97-1.78 (m, 4H), 1.69-1.54
(m, 4H), 1.39-1.20 (m, 8H), 1.22-1.08 (m, 2H), 1.01 (s, 3H), 0.99
(s, 3H) ppm. .sup.19F NMR (376 MHz, DMSO.sub.d6) .delta. -73.44
ppm.
Example 24
[0705] This example demonstrates methods for making the final
compound 9t in Table 1, above. This example refers to the compound
numbering in FIG. 1, and the synthesis is shown in FIG. 3c.
(1S,4aS,10aR)-6-Amino-N-((1R,4aS,10aR)-7-isopropyl-1,4a-dimethyl-1,2,3,4,4-
a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,4,4a,9,10-
,10a-octahydrophenanthrene-1-carboxamide (9t)
Step 1: making (1R,4aS,10aR)-Perfluorophenyl
7-isopropyl-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-car-
boxylate (6d)
[0706] Using the same procedure for making 6b except replacing 4
with 14f (dehydroabietic acid, CAS No. 1740-19-8, 0.50 g, 1.7
mmol), compound 6d (0.30 g, 39% yield) as colorless oil was
obtained after flash chromatography (5% ethyl acetate in petroleum
ether). .sup.1HNMR (500 MHz, DMSO.sub.d6) .delta. 7.2 (d, J=7.0 Hz,
1H), 7.00-6.99 (m, 1H), 6.88 (s, 1H), 2.94-2.78 (m, 3H), 2.38-2.36
(m, 1H), 2.25-2.23 (m, 1H), 2.02-1.73 (m, 5H), 1.46-1.40 (m, 2H),
1.36 (s, 3H), 1.19 (s, 3H), 1.15 (d, J=7.0 Hz, 6H) ppm.
Step 2: making tert-Butyl
(4bS,8S,8aR)-8-((1R,4aS,10aR)-7-isopropyl-1,4a-dimethyl-1,2,3,4,4a,9,10,1-
0a-octahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-dimethyl-4b,5,6,7,8,8a,-
9,10-octahydrophenanthren-3-ylcarbamate (8t)
[0707] Using the same procedure for making 8d, an amide coupling
reaction of 7d (40 mg, 0.11 mmol) with 6d (60 mg, 0.13 mmol)
provided pure 8t (10 mg, 14% yield). ESI m/z: 655 (M+1).sup.+.
Step 3: making
(1S,4aS,10aR)-6-Amino-N-((1R,4aS,10aR)-7-isopropyl-1,4a-dimethyl-1,2,3,4,-
4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,4a-dimethyl-1,2,3,4,4a,9,1-
0,10a-octahydrophenanthrene-1-carboxamide (9t)
[0708] To a solution of compound 8t (10 mg, 15 .mu.mol) in DCM (2
mL) was added dropwise TFA (0.2 mL) at 0.degree. C. The reaction
was stirred at 0.degree. C. for an hour until Boc was removed,
which was monitored by LCMS. The reaction mixture was diluted with
DCM (20 mL) and washed with sat. aq. sodium bicarbonate, water and
brine. The organic solution was dried over sodium sulfate and
concentrated in vacuo to give compound 9t (5 mg, 59% yield) as a
white solid. ESI m/z: 555.2 (M+1).sup.+. .sup.1H NMR (500 MHz,
methanol-.sub.d4) .delta. 7.19 (d, J=8.0 Hz, 1H), 7.00 (d, J=9.5
Hz, 1H), 6.88 (s, 1H), 6.81 (d, J=8.5 Hz, 1H), 6.72 (d, J=2.5 Hz,
1H), 6.55-6.53 (m, 1H), 2.88-2.74 (m, 5H), 2.43-2.40 (m, 1H),
2.31-2.28 (m, 3H), 2.11-1.99 (m, 2H), 1.94-1.86 (m, 2H), 1.81-1.67
(m, 4H), 1.52-1.46 (m, 2H), 1.42 (s, 4H), 1.35 (s, 3H), 1.32-1.30
(m, 3H), 1.26 (s, 3H), 1.23 (s, 3H), 1.21 (s, 3H), 1.13 (s, 3H)
ppm.
Example 25
[0709] This example demonstrates methods for making the final
compound 9u in Table 1, above. This example refers to the compound
numbering in FIG. 1, and the synthesis is shown in FIG. 3d.
Step 1: making
(4bS,8S,8aR)-8-(Aminomethyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydroph-
enanthren-3-ol (7f)
[0710] To a solution of compound 7f (0.10 g, 0.37 mmol) in THF (10
mL) was added borane-methyl sulfide complex (2 M in THF, 1.9 mL,
3.7 mmol) by syringe at rt. The mixture was then stirred at
70.degree. C. for 48 hours until the reaction was completed, as
monitored by LC-MS. After the reaction was cooled, the reaction
mixture was poured into cold methanol (50 mL) at 0-5.degree. C. The
volatiles were removed in vacuo. The residue was purified by
prep-HPLC (method B) to afford compound 7f' (45 mg, 47% yield) as a
white solid. ESI m/z: 260.2 (M+1).sup.+.
Step 2: making
(1S,4aS,10aR)-N-{[(1S,4aS,10aR)-6-Hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,1-
0a-octahydrophenanthren-1-yl]methyl}-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,-
10,10a-octahydrophenanthrene-1-carboxamide (9u)
[0711] To a solution of podocarpic acid 1 (10 mg, 36 .mu.mol) in
DMF (0.5 mL) were added HATU (21 mg, 55 .mu.mol) and DIPEA (14 mg,
0.11 mmol) at 25.degree. C. The resulting mixture was stirred at
this temperature for 16 hours. To the mixture was then added
compound 7f' (10 mg, 39 .mu.mol). After the reaction was stirred at
25.degree. C. for 40 hours, which was monitored by LCMS, the
reaction mixture was directly purified by prep-HPLC (method A) to
give compound 9u (9 mg, 48% yield) as a white solid. ESI m/z: 516.3
(M+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 8.93 (br s,
2H), 6.77 (dd, J=8.2, 5.3 Hz, 2H), 6.70 (t, J=5.9 Hz, 1H), 6.62 (s,
2H), 6.47 (dt, J=8.2, 2.1 Hz, 2H), 3.70-3.62 (m, 1H), 2.87-2.55 (m,
5H), 2.22-2.09 (m, 4H), 2.02-1.80 (m, 4H), 1.72-1.13 (m, 14H),
1.10-1.04 (m, 1H), 1.01 (s, 3H), 0.93 (s, 3H), 0.87-0.81 (m, 1H)
ppm.
Example 26
[0712] This example demonstrates a method for making compound 15b
in Table 1, above. This example refers to the compound numbering in
FIG. 1, and the synthesis is shown in FIG. 3e.
[0713] The glucose-analog 15b was obtained from basic hydrolysis of
acetyl ester 15a, where 15a was formed by treating bis-phenol 9a
with bromo-glucose 16.
(1S,4aS,10aR)-N-((1S,4aS,10aR)-1,4a-dimethyl-6-((2S,3R,4S,5S,6R)-3,4,5-tri-
hydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yloxy)-1,2,3,4,4a,9,10,10a--
octahydrophenanthrene-1-carbonyl)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,-
10a-octahydrophenanthrene-1-carboxamide (15b)
[0714] To a solution of 9a (10 mg, 19 .mu.mol) in acetonitrile (0.2
mL) was added
[(2R,3R,4S,5R,6S)-3,4,5-tris(acetyloxy)-6-bromooxan-2-yl]methyl
acetate (16, 10 mg, 24 .mu.mol) and silver(I) oxide (15 mg, 64
.mu.mol). The resulting mixture was stirred at 10-20.degree. C. for
48 h. The mixture was filtered through Celite and the filtrate was
concentrated in vacuo. The residue (crude 15a) was dissolved in
THF/water (v/v=4, 1 mL) and to the solution was added lithium
hydroxide (0.50 mg, 0.021 mmol). After the reaction was stirred at
18.degree. C. for 2 h, the mixture was filtered and the filtrate
was directly purified by prep-HPLC (method B) to give 15b (2 mg,
15% yield) as a white solid. ESI m/z: 692 (M+1).sup.+. .sup.1H NMR
(500 MHz, DMSO-.sub.d6) .delta. 9.01 (s, 1H), 8.13 (s, 1H),
6.96-6.89 (m, 2H), 6.85-6.75 (m, 2H), 6.66-6.61 (m, 1H), 6.57 (s,
1H), 5.26 (d, J=5.1 Hz, 1H), 5.07 (d, J=4.4 Hz, 1H), 4.99 (d, J=6.1
Hz, 1H), 4.80 (d, J=7.8 Hz, 1H), 4.52-4.49 (m, 1H), 2.32-2.22 (m,
4H), 2.21-2.09 (m, 4H), 1.93-1.78 (m, 5H), 1.66-1.54 (m, 4H),
1.32-1.22 (m, 14H), 1.15 (s, 3H), 1.00 (d, J=7.7 Hz, 6H) ppm.
Example 27
[0715] This example demonstrates a method for making compounds 17b
and 17c in Table 1, above. This example refers to the compound
numbering in FIG. 4.
[0716] The phosphoric acid-analog 17a was obtained from the
treatment of phenol 9g with diphosphoryl chloride 18. Compounds 17b
and 17c were obtained from the acidic deprotection of 17a with TFA.
The phosphoric acid-analog 17c was soluble in water under basic and
neutral conditions, but not stable at pH 5, and was converted to
methoxy phosphate 17b in the presence of methanol; the latter was
found to be stable at pH 5-8.
(4bS,8S,8aR)-8-((1S,4aS,10aR)-6-Amino-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-oc-
tahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10--
octahydrophenanthren-3-yl methyl hydrogen phosphate (17b);
(4bS,8S,8aR)-8-((1S,4aS,10aR)-6-Amino-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-o-
ctahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-
-octahydrophenanthren-3-yl dihydrogen phosphate (17c)
[0717] To a stirred solution of 9g (10 mg, 16 .mu.mol) in THF (0.1
mL) at -40.degree. C. was added diphosphoryl chloride 18 (10 mg, 40
.mu.mol) and TEA (16 mg, 0.16 mmol). After the reaction was stirred
at -40.degree. C. for an hour, the reaction mixture was quenched
with water and the pH was adjusted with saturated aqueous sodium
bicarbonate solution to pH 8. The solution was then acidified with
aqueous hydrochloride (1 N) to pH 2, and extracted with ethyl
acetate. The combined organics were washed with brine, dried over
sodium sulfate, and concentrated to provide a crude 17a. To a
solution of 17a (11 mg) in about 1% methanol in methylene chloride
(1 mL) was added TFA (0.1 mL), and the resulting mixture was
stirred at 25.degree. C. for an hour. The volatiles were removed,
and the residue was purified by prep-HPLC (method B) to provide 17b
(3 mg, 310% yield) as a white solid and 17c (2 mg, 20% yield) as a
white solid.
[0718] For 17b: ESI m/z: 623 (M+1).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 8.13 (s, 1H), 7.04 (s, 1H), 7.00 (d, J=8.4
Hz, 1H), 6.96-6.89 (m, 1H), 6.89-6.84 (m, 2H), 6.76-6.67 (m, 1H),
3.60 (d, J=11.4 Hz, 3H), 2.89 (t, J=17.0 Hz, 2H), 2.81-2.68 (m,
1H), 2.56-2.50 (m, 4H), 2.33-2.23 (m, 2H), 2.16 (d, J=12.3 Hz, 4H),
1.93-1.80 (m, 4H), 1.67-1.55 (m, 4H), 1.33-1.20 (m, 8H), 1.15 (t,
J=10.4 Hz, 2H), 1.00 (s, 6H) ppm.
[0719] For 17c: ESI m/z: 609 (M+1).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 8.11 (s, 1H), 7.20 (s, 1H), 7.00-6.91 (m,
2H), 6.86 (d, J=8.5 Hz, 1H), 6.68 (d, J=8.1 Hz, 1H), 6.48 (s, 1H),
6.34 (d, J=7.9 Hz, 1H), 2.87 (d, J=14.4 Hz, 2H), 2.80-2.57 (m, 5H),
2.31-2.22 (m, 2H), 2.19-2.07 (m, 4H), 1.95-1.73 (m, 4H), 1.69-1.48
(m, 4H), 1.27 (d, J=5.9 Hz, 8H), 1.21-1.06 (m, 2H), 0.99 (s, 6H)
ppm.
Example 28
[0720] The structures, calculated Log P values, MS and HPLC results
for the above compounds were summarized in Table 4.
TABLE-US-00006 TABLE 4 Chemical-Physical Properties of Payload
##STR00329## 9u ##STR00330## HPLC MS Purity Rt R1 R2 CLogP M + H
(100%) (%) (min) 9a OH OH +++ 530.3 100 2.01 9b OH
OCH.sub.2CH.sub.2OH +++ 574.2 100 2.00 9c OH
OCH.sub.2CH.sub.2NH.sub.2 +++ 572.4 100 8.72 9d OH NH.sub.2 +++
529.3 95 8.66 9e OH N-Piperazine +++ 598.4 100 8.99 9f OH
N(CH.sub.3).sub.2 +++ 557.4 95 10.07 9h OH NH-Gly +++ 586.2 100
7.51 9i OH NH-.beta.-Ala +++ 600.3 97 8.43 9j OH NH-Ser ++ 616.3 92
6.38 9k OH NH-Sar +++ 599.4 99 7.55 9l OH NH-Lys +++ 657.5 96 6.82
9m OH NH-His +++ 666.3 99 6.85 9n OH NH-Asp ++ 644.3 99 6.69 9o OH
NH-Glu ++ 658.3 100 7.41 9p OH CH.sub.2 NH.sub.2 +++ 526.2 99 7.48
9q OH NHCO(CH.sub.2).sub.3CO.sub.2H +++ 643.3 100 9.35 9r OH
NHCOCH.sub.2NH.sub.2CH.sub.2CO.sub.2H + 644.4 100 7.7 9t NH2 iPr
+++ 555.2 98 11.4 9u OH OH +++ 516.3 100 10.6 15b OH Glucose ++
692.2 90 7.24 17b NH2 OPO.sub.3HMe +++ 623.2 99 6.42 17c NH2
OPO.sub.3H.sub.2 +++ 609.1 98 5.83 6 < +++ < 9; 4 < ++
< 6; 2 < + < 4
Example 29
[0721] This example demonstrates general methods for making
VA-payloads, VC-payloads, and VC-PAB-payloads, represented by
compounds 21c, 21d, 21h, and 21j. This example refers to the
compound numbering in FIG. 5.
[0722] Compound 21d was obtained from an amide coupling reaction of
9d with Fmoc-VA-acid (20) followed by standard Fmoc deprotection
conditions. Compounds 21c, 21d, 21h, and 21j were obtained from
treatment of 9c, 9d, 9h or 9j with
Fmoc-L-valine-L-citrulline-p-aminobenzyl alcohol p-nitrophenyl
carbonate (Fmoc-VC-PAB-PNP, 19) followed by standard Fmoc
deprotection conditions, respectively.
4-((S)-2-((S)-2-Amino-3-methylbutanamido)-5-ureidopentanamido)benzyl
2-((4bS,8S,8aR)-8-((1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,-
10a-octahydrophenanthrene-1-carbonylcarbamoyl)-4b,8-dimethyl-4b,5,6,7,8,8a-
,9,10-octahydrophenanthren-3-yloxy)ethylcarbamate (21c)
[0723] To a solution of 9c (18 mg, 31 .mu.mol) in DMF was added
Fmoc-VC-PAB-PNP 19 (16 mg, 21 .mu.mol) and DIPEA (20 mg, 0.16
mmol), and the mixture was stirred at 20-25.degree. C. for 24 h. To
the resulting mixture was added piperidine (0.1 mL), and the
mixture was stirred at 25.degree. C. for additional 2 h until Fmoc
was removed from the intermediate as monitored by LC-MS. The
mixture was filtered through a membrane, and the filtrate was
directly purified by prep-HPLC (method B) to give 21c (14 mg, 50%
yield) as a white solid. ESI m/z: 978 (M+1).sup.+. .sup.1H NMR (500
MHz, DMSO-.sub.d6) .delta. 10.22 (s, 1H), 9.04 (s, 1H), 8.71 (d,
J=7.5 Hz, 1H), 8.12 (s, 2H), 7.59 (d, J=8.3 Hz, 2H), 7.42 (t, J=5.4
Hz, 1H), 7.29 (d, J=8.2 Hz, 2H), 6.94 (d, J=8.5 Hz, 1H), 6.84-6.76
(m, 2H), 6.67 (d, J=8.4 Hz, 1H), 6.64 (s, 1H), 6.51 (dd, J=8.1, 2.0
Hz, 1H), 6.12 (s, 1H), 5.52 (s, 2H), 4.96 (s, 2H), 4.51 (d, J=5.1
Hz, 1H), 3.92 (s, 2H), 3.66 (d, J=5.7 Hz, 1H), 3.32 (d, J=5.6 Hz,
2H), 3.13-2.93 (m, 2H), 2.85 (t, J=18.0 Hz, 2H), 2.77-2.63 (m, 2H),
2.26 (d, J=7.2 Hz, 2H), 2.22-2.03 (m, 4H), 1.89-1.82 (m, 4H),
1.79-1.69 (m, 1H), 1.68-1.53 (m, 4H), 1.46-1.40 (m, 2H), 1.27 (d,
J=3.3 Hz, 8H), 1.19-1.08 (m, 4H), 1.03-0.89 (m, 12H) ppm.
(1S,4aS,10aR)-6-((S)-2-((S)-2-Amino-3-methylbutanamido)propanamido)-N-((1S-
,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthre-
ne-1-carbonyl)-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-c-
arboxamide (21d)
[0724] To a solution of 9d (53 mg, 0.10 mmol) in DMF (1 mL) were
added Fmoc-Val-Ala-OH 20 (41 mg, 0.10 mmol), HATU (38 mg, 0.1
mmol), and DIPEA (26 mg, 0.20 mmol). After the reaction was stirred
at 25.degree. C. for 24 h, 9d was consumed according to LC-MS. To
the mixture was then added piperidine (0.1 mL) and the resulting
solution was stirred at 25.degree. C. for another 3 h. The mixture
was filtered, and the filtrate was concentrated in vacuo and the
residue was directly purified by prep-HPLC (method B) to give
compound 21d (45 mg, 64% yield) as a white solid. ESI m/z: 699
(M+1).sup.+. .sup.1H NMR (500 MHz, methanol-d4) .delta. 8.40 (s,
1H), 7.47 (s, 1H), 7.32 (d, J=8.0 Hz, 1H), 7.03 (d, J=8.3 Hz, 1H),
6.88 (d, J=8.2 Hz, 1H), 6.72 (d, J=2.4 Hz, 1H), 6.56 (dd, J=8.3,
2.4 Hz, 1H), 4.60-4.48 (m, 1H), 3.22-3.11 (m, 1H), 3.02-2.93 (m,
1H), 2.92-2.76 (m, 3H), 2.74-2.70 (m, 1H), 2.43-2.31 (m, 3H), 2.28
(d, J=14.1 Hz, 3H), 2.16-1.96 (m, 3H), 1.81 (s, 1H), 1.78-1.65 (m,
4H), 1.53-1.42 (m, 4H), 1.38 (d, J=5.3 Hz, 6H), 1.33-1.22 (m, 2H),
1.14 (d, J=6.6 Hz, 6H), 1.09 (d, J=18.6 Hz, 6H) ppm.
{4-[(2S)-2-[(2S)-2-Amino-3-methylbutanamido]-5-(carbamoylamino)pentanamido-
]phenyl} methyl
N-({[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,-
10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethyl-4b,5,6,7,-
8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}methyl)carbamate
(21h)
[0725] Using the same procedure for making 21c, except 9h was used
instead of 9c. 21h (85 mg, 32% yield) was obtained as a white
solid. ESI m/z: 990 (M+1).sup.+. .sup.1H NMR (500 MHz,
methanol-.sub.d4) .delta. 8.40 (s, 1H, NH of imidine), 7.58 (d,
J=8.5 Hz, 2H), 7.50 (s, 1H), 7.37 (d, J=8.5 Hz, 2H), 7.30 (d, J=7.5
Hz, 1H), 7.02 (d, J=8.3 Hz, 1H), 6.88 (d, J=8.3 Hz, 1H), 6.72 (d,
J=2.4 Hz, 1H), 6.56 (dd, J=8.2, 2.5 Hz, 1H), 5.10 (s, 2H),
4.66-4.52 (m, 1H), 3.92 (s, 2H), 3.75 (d, J=5.7 Hz, 1H), 3.26-3.03
(m, 3H), 3.02-2.75 (m, 4H), 2.42-2.22 (m, 7H), 2.14-1.98 (m, 5H),
1.97-1.87 (m, 1H), 1.85-1.59 (m, 6H), 1.40 (t, J=15.9 Hz, 8H),
1.34-1.27 (m, 3H), 1.16-1.12 (m, 6H), 1.10 (d, J=6.9 Hz, 3H), 1.07
(d, J=6.9 Hz, 3H) ppm.
{4-[(2S)-2-[(2S)-2-Amino-3-methylbutanamido]-5-(carbamoylamino)pentanamido-
]phenyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (21j)
[0726] Using the same procedure for making 21c, except 9j was used
instead of 9c. 21j (22 mg, 40% yield) was obtained as a white
solid. ESI m/z: 1021 (M+1).sup.+. .sup.1H NMR (400 MHz,
DMSO-.sub.d6) .delta. 10.02 (s, 1H), 9.82 (s, 1H), 9.00 (s, 1H),
8.69-8.65 (m, 1H), 8.11-8.00 (m, 4H), 7.65-7.53 (m, 3H), 7.40-7.30
(m, 3H), 7.30-7.20 (m, 1H), 6.96 (d, J=8.0 Hz, 1H), 6.81 (d, J=8.0
Hz, 1H), 6.65-6.61 (m, 1H), 6.50 (dd, J=8.0 Hz, 2.0 Hz, 1H),
6.00-5.95 (m, 1H), 5.48 (s, 2H), 5.00-4.95 (m, 3H), 4.60-4.40 (m,
1H), 4.25-4.20 (m, 1H), 3.65-3.55 (m, 4H), 3.15-2.55 (m, 10H),
2.40-2.20 (m, 3H), 2.20-2.00 (m, 5H), 2.00-1.80 (m, 4H), 1.86-1.55
(m, 6H), 1.27 (d, J=4.8 Hz, 9H), 1.20-1.10 (m, 2H), 0.97-0.90 (m,
6H) ppm.
Example 30
[0727] This example demonstrates general methods for making the
linker-payloads 22d1, 22d2, and 22j. This example refers to the
compound numbering in FIG. 5.
[0728] General Procedure to Make Linker-Payload 22:
[0729] To a solution of compound 21 (5-30 mg, 1 equiv.) in DMF (0.5
mL) were added a solution of commercially available
DIBAC-Suc-PEG.sub.4-COOSu or DIBAC-Suc-PEG.sub.4-COOH, or
BCN-PEG.sub.4-COOSu (1.2 equiv.) in THF (0.5 mL) and then TEA (2
equiv.) at rt. The mixture was stirred at rt until 21 was consumed,
as monitored by LC-MS. The reaction mixture was concentrated in
vacuo and the residue was directly purified by prep-HPLC to yield
22 as a white solid.
Example 31
[0730] This example demonstrates general methods for making the
linker-payload 22d1. This example refers to the compound numbering
in FIG. 5.
1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9),5,7,13,15-hexaen--
10-yn-2-yl}-4-oxobutanamido)-N-[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8-{[(1S,4aS-
,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-
-carbonyl]carbamoyl}-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-
-3-yl]carbamoyl}ethyl]carbamoyl}-2-methylpropyl]-3,6,9,12-tetraoxapentadec-
an-15-amide (22d1)
[0731] Using the General procedure to make linker-payload 22, 22d1
(10 mg, 28% yield) was obtained as a white solid. ESI m/z: 1234
(M+H).sup.+. .sup.1H NMR (500 MHz, methanol-.sub.d4) .delta. 7.65
(d, J=7.4 Hz, 1H), 7.62-7.51 (m, 2H), 7.48-7.43 (m, 3H), 7.39-7.30
(m, 2H), 7.27-7.23 (m, 1H), 7.00 (d, J=8.5 Hz, 1H), 6.88 (d, J=8.0
Hz, 1H), 6.72 (d, J=2.4 Hz, 1H), 6.57-6.54 (m, 1H), 5.15-5.10 (m,
1H), 4.62 (s, 6H), 4.52-4.45 (m, 1H), 4.22-4.02 (m, 1H), 3.77-3.64
(m, 3H), 3.60-3.51 (m, 11H), 3.46-3.41 (m, 2H), 3.24 (t, J=5.5 Hz,
2H), 2.99-2.66 (m, 5H), 2.57-2.51 (m, 1H), 2.37-2.24 (m, 6H),
2.21-2.12 (m, 1H), 2.09-1.95 (m, 5H), 1.74-1.65 (m, 4H), 1.47-1.41
(m, 4H), 1.39-1.35 (m, 6H), 1.31-1.22 (m, 2H), 1.14-1.10 (m, 6H),
1.05-0.97 (m, 6H) ppm.
Example 32
[0732] This example demonstrates general methods for making the
linker-payload 22d2. This example refers to the compound numbering
in FIG. 5.
{4-[(2S)-2-[(2S)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(-
9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentadec-
an-15-amido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}meth-
yl
N-[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9-
,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5,6-
,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamate (22d2)
[0733] Using the General procedure to make linker-payload 22, 22d2
(7 mg, 44% yield) was obtained as a white solid. ESI m/z: 735.0
(M/2+H).sup.+. .sup.1H NMR (500 MHz, methanol-.sub.d4) .delta.
7.65-7.62 (m, 3H), 7.59-7.57 (m, 1H), 7.44-7.42 (m, 3H), 7.39-7.18
(m, 7H), 6.96 (d, J=8.5 Hz, 1H), 6.88 (d, J=8.0 Hz, 1H), 6.71 (s,
1H), 6.56-6.54 (m, 1H), 5.15-5.10 (m, 3H), 4.64 (s, 5H), 4.53-4.49
(m, 1H), 4.22 (d, J=8.0 Hz, 1H), 3.77-3.66 (m, 3H), 3.59-3.51 (m,
11H), 3.45-3.42 (m, 2H), 3.24 (t, J=5.5 Hz, 2H), 3.15-3.08 (m, 1H),
2.96-2.90 (m, 2H), 2.84-2.68 (m, 3H), 2.55 (t, J=6.0 Hz, 2H),
2.40-2.33 (m, 3H), 2.28-1.91 (m, 11H), 1.75-1.58 (m, 5H), 1.36-1.22
(m, 11H), 1.12-1.11 (m, 5H), 1.01-0.98 (m, 6H) ppm.
Example 33
[0734] This example demonstrates general methods for making the
linker-payload 22j. This example refers to the compound numbering
in FIG. 5.
{4-[(2S)-2-[(2S)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(-
9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentadec-
an-15-amido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}meth-
yl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2-
,3,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimeth-
yl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]-
carbamate (22j)
[0735] Using the General procedure to make linker-payload 22, 22j
(8 mg, 26% yield) was obtained as a white solid. ESI m/z: 778
(M/2+H).sup.+. .sup.1H NMR (500 MHz, DMSO-.sub.d6) .delta. 10.02
(s, 1H), 9.82 (s, 1H), 9.00 (s, 1H), 8.11 (m, 2H), 7.88 (d, J=8.5
Hz, 1H), 7.80-7.75 (m, 1H), 7.70-7.66 (m, 1H), 7.65-7.53 (m, 4H),
7.53-7.45 (m, 3H), 7.40-7.25 (m, 7H), 6.96 (d, J=8.5 Hz, 1H), 6.81
(d, J=8.0 Hz, 1H), 6.63 (d, J=2.5 Hz, 1H), 6.50 (dd, J=8.0 Hz, 2.0
Hz, 1H), 6.00-5.95 (m, 1H), 5.41 (s, 2H), 5.10-5.05 (m, 4H),
4.43-4.33 (m, 1H), 4.25-4.10 (m, 2H), 3.65-3.55 (m, 5H), 3.50-3.40
(m, 12H), 3.30-3.25 (m, 2H), 3.15-2.55 (m, 10H), 2.40-2.20 (m, 5H),
2.20-2.10 (m, 4H), 2.00-1.90 (m, 2H), 1.86-1.70 (m, 5H), 1.64-1.54
(m, 6H), 1.50-1.25 (m, 9H), 1.20-1.10 (m, 2H), 1.00 (m, 6H), 0.86
(d, J=6.5 Hz, 3H), 0.82 (d, J=6.5 Hz, 3H) ppm.
Example 34
[0736] This example demonstrates general methods for making the
linker-payloads that could be conjugated to an antibody via
cysteine conjugation, represented by compound 24c. This example
refers to the compound numbering in FIG. 6.
[0737] The amide coupling reaction of 21c with substituted Glu-acid
(23c1) afforded 23c, which was treated with MC-PEG.sub.4-CO.sub.2Su
ester (23c2) to afford the linker-payload 24c.
{4-[(2S)-5-(Carbamoylamino)-2-[(2S)-2-[(2R)-2-[1-(2,5-dioxo-2,5-dihydro-1H-
-pyrrol-1-yl)-3,6,9,12-tetraoxapentadecan-15-amido]-4-{[(2R,3S,4S,5S)-2,3,-
4,5,6-pentahydroxyhexyl]carbamoyl}butanamido]-3-methylbutanamido]pentanami-
do]phenyl}methyl
N-(2-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a-
,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5-
,6,7,8,8a,9,10-octahydrophenanthren-3-yl]oxy}ethyl)carbamate
(24c)
[0738] Step 1:
[0739] To a solution of 23c1 (15 mg, 25 .mu.mol) in DMF (1 mL) were
added compound 21c (14 mg, 14 .mu.mol), HATU (9.5 mg, 25 .mu.moL)
and NMM (4.9 mg, 49 .mu.moL). After the reaction was stirred at
25.degree. C. for 4 h, 21c was consumed according to LC-MS. The
resulting mixture was treated with piperidine (0.1 mL) and allowed
to stir for 2 h. The mixture was directly purified by prep-HPLC to
give 23c (8.0 mg, 45% yield) as a white solid. ESI m/z: 675
(M/2+1).sup.+.
[0740] Step 2:
[0741] To a solution of 23c (10 mg, 7.4 .mu.mol) in DMF (1 mL) were
added 23c2 (7 mg, 22 .mu.mol) and N-methylmorpholine (2.0 mg, 20
.mu.mol), and the resulting mixture was stirred at 25.degree. C.
for 4 h. After the volatiles were removed in vacuo, the residue was
then dissolved in DCM (1 mL) and to the solution was added TFA (0.1
mL). The resulting mixture was stirred at 25.degree. C. for 2 h and
was then concentrated in vacuo, and the residue was purified by
prep-HPLC (method B) to give 24c (4.0 mg, 30% yield) as a white
solid. ESI m/z: 1598 (M+1).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 9.71 (s, 1H), 8.98 (s, 1H), 8.20 (d, J=6.9
Hz, 1H), 8.13-8.08 (m, 2H), 8.06 (d, J=8.1 Hz, 1H), 7.74 (t, J=5.5
Hz, 1H), 7.61 (d, J=8.4 Hz, 2H), 7.40 (t, J=5.9 Hz, 1H), 7.27 (d,
J=8.5 Hz, 2H), 7.02 (s, 2H), 6.93 (d, J=8.3 Hz, 1H), 6.84-6.77 (m,
2H), 6.67 (d, J=10.5 Hz, 1H), 6.63 (d, J=2.2 Hz, 1H), 6.50 (dd,
J=8.2, 2.3 Hz, 1H), 5.98 (t, J=5.8 Hz, 1H), 5.40 (s, 2H), 4.95 (s,
2H), 4.33 (s, 3H), 4.23-4.13 (m, 1H), 3.92 (t, J=5.9 Hz, 2H),
3.62-3.54 (m, 6H), 3.51-3.45 (m, 18H), 3.07-2.62 (m, 9H), 2.43-2.35
(m, 2H), 2.32-2.21 (m, 4H), 2.19-2.09 (m, 6H), 2.09-2.01 (m, 1H),
1.93-1.70 (m, 8H), 1.68-1.53 (m, 6H), 1.51-1.33 (m, 2H), 1.27 (d,
J=3.2 Hz, 9H), 1.14 (t, J=12.4 Hz, 2H), 1.00 (d, J=11.9 Hz, 6H),
0.87 (dd, J=20.2, 6.8 Hz, 6H) ppm.
Example 35
[0742] This example demonstrates general methods for making the
linker-payloads that could be conjugated to an antibody via a click
reaction of an azide with an alkyne. The synthesis of the
intermediates for the linkers is shown in FIG. 7, and the synthesis
of the linker-payloads is shown in FIG. 8. This example refers to
the compound numbering in FIGS. 7 and 8.
[0743] FIG. 7 shows the synthesis of
COT-(PEG.sub.4).sub.n-(N.sup.2--Fmoc)dLys 26a and 26b. The amide
coupling reaction of N.sup.2-Fmoc-D-lysine 25a with commercially
available ester 25c provided 26a. The amide coupling reaction of
N.sup.2-Fmoc-D-lysine 25a with commercially available ester 25b1,
followed by Boc deprotection, provided 25b2; the amide coupling
reaction of 25b2 with 25c provided 26b.
[0744] FIG. 8 shows a general synthesis of the linker-payloads 29,
such as 29c1, 29c2, 29d1, 29d2, 29d3, 29d4, 29h, and 29j. The
synthesis of linker-payloads 29 started from the amide coupling
reactions of 26a or 26b with 21c, 21d, 21h, and 21j, independently,
followed by Fmoc deprotection to form 27c, 27d1, 27d2, 27h, and
27j, independently, each of which underwent a 2+3 cyclization with
cyclodextrin-azide to provide 28c, 28d1, 28d2, 28h, and 28j,
respectively. Finally, amide coupling reactions of 28c, 28d1, 28d2,
28h, and 28j, with commercially available DIBAC-Suc-PEG.sub.4-NHS
ester or BCN-Carbamate-PEG.sub.4-acid provided 29c1, 29c2, 29d1,
29d2, 29d3, 29d4, 29h, and 29j, respectively.
Example 36
[0745] This example demonstrates general methods for the synthesis
of the intermediates for the linkers 26a and 26b. This example
refers to the compound numbering in FIG. 7.
(2R)-6-[2-(Cyclooct-2-yn-1-yloxy)acetamido]-2-{[(9H-fluoren-9-ylmethoxy)ca-
rbonyl]amino}hexanoic Acid (26a)
[0746] To a solution of commercially available 25c (65 mg, 0.23
mmol) and Fmoc-D-Lys-OH (85 mg, 0.23 mmol) in DMF (2 mL) was added
TEA (52 mg, 0.51 mmol), and the mixture was then stirred at rt for
30 min. The mixture was then concentrated in vacuo and the residue
was directly purified by reversed phase flash chromatography
(0-100% acetonitrile in water (0.05% TFA)) to give 26a (85 mg,
yield 70%) as a white solid. ESI m/z: 533 (M+H).sup.+. .sup.1H NMR
(500 MHz, methanol-d4): .delta. 7.70 (d, J=7.5 Hz, 2H), 7.59 (t,
J=8.0 Hz, 2H), 7.30 (t, J=7.5 Hz, 2H), 7.22 (t, J=7.4 Hz, 2H),
4.35-4.22 (m, 2H), 4.22-4.09 (m, 2H), 4.09-3.99 (m, 1H), 3.94-3.81
(m, 1H), 3.79-3.67 (m, 1H), 3.15 (t, J=6.9 Hz, 2H), 2.17-1.96 (m,
3H), 1.96-1.86 (m, 1H), 1.85-1.66 (m, 4H), 1.66-1.41 (m, 5H),
1.41-1.25 (m, 3H) ppm.
(24R)-24-(((9H-Fluoren-9-yl)methoxy)carbonylamino)-1-(cyclooct-2-ynyloxy)--
2,18-dioxo-6,9,12,15-tetraoxa-3,19-diazapentacosan-25-oic Acid
(26b)
[0747] Step 1:
[0748] To a mixture of compound 25b1 (4.6 g, 10 mmol) and
Fmoc-(D)Lys-OH (25a, 3.6 g, 10 mmol) in DMF (10 mL) was added
triethylamine (2.0 g, 20 mmol). The reaction mixture was stirred at
25.degree. C. for an hour and then was diluted with DCM (100 mL)
and washed with water and brine. The organics were dried over
anhydrous sodium sulfate and concentrated in vacuo. The residue was
purified by silica gel column chromatography (0-5% methanol in
methylene chloride) to give 25b2' as a colorless oil (5.5 g, 77%
yield). ESI m/z: 716.2 (M+H).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 7.89 (d, J=7.5 Hz, 2H), 7.84-7.80 (m, 1H),
7.74-7.72 (d, J=7.5 Hz, 2H), 7.61-7.59 (m, 1H), 7.42 (t, J=7.5 Hz,
2H), 7.33 (t, J=7.5 Hz, 2H), 6.76-6.74 (m, 1H), 4.28-4.21 (m, 3H),
3.93-3.85 (m, 1H), 3.58 (t, J=6.5 Hz, 2H), 3.48-3.47 (m, 12H), 3.16
(d, J=5.5 Hz, 1H), 3.07-2.97 (m, 3H), 2.28 (t, J=6.5 Hz, 2H),
2.02-1.94 (m, 1H), 1.71-1.56 (m, 2H), 1.36 (s, 9H), 1.23-1.15 (m,
6H) ppm.
[0749] Step 2:
[0750] To a solution of 25b2' (0.60 g, 0.84 mmol) in DCM (10 mL)
was added TFA (2.0 mL) dropwise at 0.degree. C. The reaction
mixture was allowed to warm and stirred at 25.degree. C. overnight
until compound 25b2' was totally consumed by TLC. The volatiles
were removed in vacuo to provide a residue: ESI m/z: 616.3
(M+H).sup.+.
[0751] Step 3:
[0752] To a solution of the above residue in DMF (10 mL) was added
compound 25c (0.27 g, 0.98 mmol). A small amount of the reaction
mixture was tested on wet pH paper and the pH of the reaction
mixture was adjusted from pH 7 to 8 by addition of TEA (about 1.0
mL). The reaction was stirred at 25.degree. C., monitored by LCMS,
and completed in half an hour. The reaction mixture was then
diluted with DCM (100 mL) and water (100 mL). The resulting mixture
was acidified with hydrochloride (2 N) to pH 2. The organics were
washed with water (80 mL) and brine, dried over anhydrous sodium
sulfate, and concentrated in vacuo. The residue was purified by
silica gel column chromatography (0-5% methanol in methylene
chloride) to give the 26b as a colorless oil (0.38 g, 49% yield).
ESI m/z: 780.3 (M+H).sup.+. .sup.1H NMR (400 MHz, CDCl.sub.3)
.delta. 7.75 (d, J=7.6 Hz, 2H), 7.61 (t, J=7.6 Hz, 2H), 7.39 (t,
J=7.6 Hz, 2H), 7.32-7.27 (m, 2H), 7.05-7.01 (m, 1H), 6.86-6.83 (m,
1H), 5.85 (d, J=7.6 Hz, 1H), 4.38-4.37 (m, 3H), 4.27-4.15 (m, 2H),
4.11-4.05 (m, 1H), 3.91-3.87 (m, 1H), 3.69 (t, J=5.6 Hz, 2H),
3.62-3.47 (m, 17H), 3.28-3.19 (m, 2H), 2.46 (t, J=5.6 Hz, 2H),
2.27-2.01 (m, 3H), 1.91-1.72 (m, 5H), 1.66-1.55 (m, 4H), 1.42-1.34
(m, 3H) ppm.
Example 37
[0753] This example demonstrates the methods for making the
linker-payloads 27c, 27d1, 27d2, 27h, and 27j. This example refers
to the compound numbering in FIG. 8.
[0754] General Procedures to Make the Intermediate Linker-Payload
27:
[0755] To a solution of compound 26a or 26b (1 equiv.) in DMF
(30-50 mg of 26a or 26b per mL of DMF) were subsequently added HATU
(1 equiv.) and--independently--compound 21c, 21d, 21h, or 21j (1
equiv.) at rt. The mixture was stirred at rt until the mixture was
homogenous. To this mixture was slowly added DIPEA (5 equiv.) at rt
via a syringe. The resulting mixture was stirred at rt overnight
(16 h) until, independently, 21c, 21d, 21h, or 21j was consumed
according to LC-MS. To the reaction mixture was then added
piperidine (0.1 mL, excess) dropwise at rt, and the mixture was
stirred for an additional 3 h until the Fmoc group was removed as
monitored by LC-MS. The reaction mixture was directly purified by
reversed phase flash chromatography or prep-HPLC (method B, basic
condition) to--independently--give compounds 27c, 27d1, 27d2, 27h,
and 27j, respectively, as white solids.
Example 38
[0756] This example demonstrates the methods for making the
linker-payload 27c. This example refers to the compound numbering
in FIG. 8.
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-{1-[2-(cyclooct-2-yn-1-yloxy)acetamido]-
-3,6,9,12-tetraoxapentadecan-15-amido}hexanamido]-3-methylbutanamido]-5-(c-
arbamoylamino)pentanamido]phenyl}methyl
N-(2-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a-
,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5-
,6,7,8,8a,9,10-octahydrophenanthren-3-yl]oxy}ethyl)carbamate
(27c)
[0757] Compound 27c (40 mg, 30% yield) as a white solid was
obtained from the amide coupling reaction of 21c (85 mg, 87
.mu.mol) with 26b (68 mg, 87 .mu.mol), following the general
procedure to make 27. ESI m/z: 759 (M/2+1).sup.+. .sup.1H NMR (500
MHz, DMSO-.sub.d6) .delta. 10.01 (s, 1H), 9.00 (s, 1H), 8.24-8.09
(m, 1H), 8.06-7.74 (m, 1H), 7.64-7.36 (m, 3H), 7.28 (d, J=8.3 Hz,
2H), 6.94 (d, J=8.5 Hz, 1H), 6.82 (d, J=8.4 Hz, 2H), 6.68 (d, J=7.6
Hz, 1H), 6.64 (s, 1H), 6.51 (d, J=6.4 Hz, 1H), 6.00 (s, 1H), 5.42
(s, 1H), 4.96 (s, 2H), 4.39 (s, 1H), 4.28-2.21 (m, 2H), 4.05 (s,
2H), 3.93 (t, J=5.6 Hz, 2H), 3.86-3.79 (m, 2H), 3.59 (t, J=6.5 Hz,
2H), 3.53-3.47 (m, 11H), 3.43 (t, J=5.9 Hz, 2H), 3.36 (s, 6H), 3.24
(dt, J=12.8, 6.1 Hz, 3H), 3.10-2.91 (m, 4H), 2.85 (t, J=17.2 Hz,
2H), 2.75-2.69 (m, 2H), 2.34-2.10 (m, 10H), 2.10-1.66 (m, 12H),
1.67-1.54 (m, 8H), 1.47-1.24 (m, 16H), 1.14 (t, J=13.3 Hz, 2H),
1.01 (d, J=11.8 Hz, 6H), 0.88 (s, 3H) 0.84 (s, 3H) ppm.
Example 39
[0758] This example demonstrates the methods for making the
linker-payload 27d1. This example refers to the compound numbering
in FIG. 8.
(1S,4aS,10aR)-6-((2S)-2-((2S)-2-((2R)-2-Amino-6-(2-(cyclooct-2-ynyloxy)ace-
tamido)hexanamido)-3-methylbutanamido)propanamido)-N-((1S,4aS,10aR)-6-hydr-
oxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl)-1,-
4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carboxamide
(27d1)
[0759] Compound 27d (30 mg, 47% yield) as a white solid was
obtained from the amide coupling reaction of 26a (35 mg, 0.064
mmol) with 21d1 (45 mg, 0.064 mmol), following the general
procedure to make 27. ESI m/z: 991 (M+1).sup.+. .sup.1H NMR (500
MHz, methanol-.sub.d4) .delta. 7.51 (d, J=1.5 Hz, 1H), 7.37 (dd,
J=8.3, 2.0 Hz, 1H), 7.02 (d, J=8.3 Hz, 1H), 6.89 (d, J=8.4 Hz, 1H),
6.72 (d, J=2.4 Hz, 1H), 6.56 (dd, J=8.3, 2.5 Hz, 1H), 4.64-4.57 (m,
1H), 4.48 (q, J=7.1 Hz, 1H), 4.33-4.27 (m, 1H), 4.20 (d, J=6.7 Hz,
1H), 3.93 (m, 2H), 3.43 (t, J=6.6 Hz, 1H), 3.24 (t, J=6.9 Hz, 2H),
3.02-2.93 (m, 2H), 2.92-2.76 (m, 3H), 2.40-2.32 (m, 2H), 2.33-2.23
(m, 4H), 2.22-2.12 (m, 3H), 2.12-2.00 (m, 5H), 1.99-1.91 (m, 1H),
1.91-1.81 (m, 2H), 1.78-1.66 (m, 6H), 1.66-1.58 (m, 1H), 1.58-1.49
(m, 2H), 1.45 (d, J=7.1 Hz, 6H), 1.38 (d, J=4.0 Hz, 6H), 1.34-1.22
(m, 4H), 1.14 (d, J=7.0 Hz, 6H), 1.06-0.98 (m, 6H) ppm.
Example 40
[0760] This example demonstrates the methods for making the
linker-payload 27d2. This example refers to the compound numbering
in FIG. 8.
N-[(5R)-5-Amino-5-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hyd-
roxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]ca-
rbamoyl}-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbam-
oyl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}pentyl]-1-[2-(cyclooct-2-yn--
1-yloxy)acetamido]-3,6,9,12-tetraoxapentadecan-15-amide (27d2)
[0761] Compound 27d2 (54 mg, 50% yield) as a white solid was
obtained from the amide coupling reaction of 21d (60 mg, 0.086
mmol) with 26b, following the general procedure to make 27. ESI
m/z: 620 (M/2+1).sup.+. .sup.1H NMR (500 MHz, methanol-.sub.d4)
.delta. 7.61-7.48 (m, 1H), 7.35-7.29 (m, 1H), 7.02 (d, J=8.3 Hz,
1H), 6.88 (d, J=8.3 Hz, 1H), 6.71 (d, J=1.8 Hz, 1H), 6.56 (dd,
J=8.2, 1.7 Hz, 1H), 4.52-4.44 (m, 1H), 4.27 (dd, J=21.9, 7.2 Hz,
2H), 4.03 (dd, J=15.1, 2.4 Hz, 1H), 3.96 (dt, J=22.5, 6.5 Hz, 1H),
3.89 (dd, J=15.1, 3.1 Hz, 1H), 3.75 (t, J=5.8 Hz, 2H), 3.64 (t,
J=8.6 Hz, 12H), 3.60-3.54 (m, 3H), 3.44 (dd, J=11.7, 5.9 Hz, 2H),
3.23 (t, J=6.7 Hz, 2H), 3.02-2.91 (m, 1H), 2.91-2.74 (m, 3H), 2.46
(t, J=5.9 Hz, 2H), 2.40-2.31 (m, 3H), 2.26-2.22 (m, 5H), 2.21-1.79
(m, 12H), 1.77-1.65 (m, 6H), 1.62-1.53 (m, 3H), 1.47-1.43 (m, 5H),
1.38 (s, 3H), 1.37 (s, 3H), 1.33-1.22 (m, 3H), 1.14 (s, 3H), 1.12
(s, 3H), 1.06-0.95 (m, 6H) ppm.
Example 41
[0762] This example demonstrates the methods for making the
linker-payload 27h. This example refers to the compound numbering
in FIG. 8.
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-[2-(cyclooct-2-yn-1-yloxy)acetamido]hex-
anamido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}methyl
N-({[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,-
10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethyl-4b,5,6,7,-
8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}methyl)carbamate
(27h)
[0763] Compound 27h (65 mg, 62% yield) as a white solid was
obtained from the amide coupling reaction of 21h (80 mg, 64
.mu.mol) with 26a (53 mg, 97 .mu.mol), following the general
procedure to make 27. ESI m/z: 1283 (M+1).sup.+. .sup.1H NMR (500
MHz, methanol-.sub.d4) .delta. 7.53-7.33 (m, 3H), 7.28-7.14 (m,
3H), 6.89 (d, J=8.4 Hz, 1H), 6.76 (d, J=8.3 Hz, 1H), 6.60 (d, J=2.5
Hz, 1H), 6.43 (dd, J=8.3, 2.5 Hz, 1H), 4.97 (s, 2H), 4.53-4.46 (m,
2H), 4.41 (dd, J=8.9, 5.0 Hz, 1H), 4.18 (t, J=6.0 Hz, 1H), 4.09 (d,
J=7.1 Hz, 1H), 3.92-3.72 (m, 4H), 3.31 (t, J=6.6 Hz, 1H), 3.16-3.05
(m, 3H), 3.06-2.97 (m, 1H), 2.90-2.62 (m, 4H), 2.27-2.09 (m, 7H),
2.09-1.87 (m, 7H), 1.86-1.68 (m, 4H), 1.66-1.40 (m, 12H), 1.36-1.22
(m, 10H), 1.20-1.09 (m, 3H), 1.01 (s, 3H), 1.01 (s, 3H), 0.89 (t,
J=7.0 Hz, 6H) ppm.
Example 42
[0764] This example demonstrates the methods for making the
linker-payload 27j. This example refers to the compound numbering
in FIG. 8.
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-[2-(cyclooct-2-yn-1-yloxy)acetamido]hex-
anamido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (27j)
[0765] Compound 27j (15 mg, 33% yield) was obtained as a white
solid, following the general procedure to make 27. ESI m/z: 1313.6
(M+H).sup.+. .sup.1H NMR (500 MHz, methanol-.sub.d4) .delta. 7.59
(d, J=8.5 Hz, 2H), 7.51 (s, 1H), 7.36-7.26 (m, 3H), 7.01 (d, J=8.5
Hz, 1H), 6.88 (d, J=8.0 Hz, 1H), 6.72-6.71 (m, 1H), 6.57-6.54 (m,
1H), 5.09 (s, 2H), 4.64-4.52 (m, 1H), 4.35-4.28 (m, 2H), 4.21 (d,
J=7.0 Hz, 1H), 4.01-3.98 (m, 1H), 3.88-3.84 (m, 3H), 3.43 (t, J=6.5
Hz, 1H), 3.26-3.10 (m, 4H), 3.00-2.76 (m, 3H), 2.38-2.24 (m, 7H),
2.19-2.02 (m, 9H), 1.98-1.78 (m, 4H), 1.74-1.54 (m, 12H), 1.45-1.26
(m, 14H), 1.13 (s, 6H), 1.00 (t, J=7.5 Hz, 6H) ppm.
Example 43
[0766] This example demonstrates the methods for making the
linker-payloads 28c, 28d1, 28d2, 28h, and 28j. This example refers
to the compound numbering in FIG. 8.
[0767] General Procedure to Make Intermediate Linker-Payload
28:
[0768] To a solution of compound 27 (30 mg, 1 equiv.) in DMF (0.5
mL) was added a solution of .alpha.-cyclodextrin azide (CD-N.sub.3,
ESI m/z: 1020 (M+Na).sup.+, 2 equiv.; see Synthetic Communications,
2002, 32(21), 3367-3372.) in DMF (0.5 mL) at rt via a syringe. The
mixture was stirred at 20-25.degree. C. for 3 days. Compound 27 was
consumed based on LC-MS analysis. The reaction mixture was
concentrated in vacuo and the residue was directly purified by
prep-HPLC (method B) or reversed phase flash chromatography (0-100%
acetonitrile in water with 10% ammonium bicarbonate) to give
compound 28 as a white solid.
Example 44
[0769] This example demonstrates the methods for making the
linker-payload 28c. This example refers to the compound numbering
in FIG. 8.
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-(1-{2-[(1-{[31,32,33,34,35,36,37,38,39,-
40,41,42-dodecahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4,7,9,12,1-
4,17,19,22,24,27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.-
13,16.2.sup.18,21.2.sup.23,26]dotetracontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H-
,9H-cycloocta[d][1,2,3]triazol-9-yl)oxy]acetamido}-3,6,9,12-tetraoxapentad-
ecan-15-amido)hexanamido]-3-methylbutanamido]-5-(carbamoylamino)pentanamid-
o]phenyl}methyl
N-(2-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a-
,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5-
,6,7,8,8a,9,10-octahydrophenanthren-3-yl]oxy}ethyl)carbamate
(28c)
[0770] Compound 28c (51 mg, 78% yield) as a white solid was
obtained from the (2+3) click reaction of 27c (40 mg, 26 .mu.mol)
with CD-N.sub.3 (52 .mu.mol), following the general procedure to
make 28. ESI m/z: 1258 (M/2+1).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 10.08 (s, 1H), 9.09-8.91 (m, 1H), 8.56 (d,
J=8.7 Hz, 1H), 8.39 (d, J=7.3 Hz, 1H), 8.12 (s, 1H), 8.07 (s, 1H),
7.85-7.78 (m, 2H), 7.58 (d, J=8.5 Hz, 2H), 7.41 (s, 1H), 7.29 (d,
J=8.5 Hz, 2H), 6.94 (d, J=8.5 Hz, 1H), 6.85-6.78 (m, 2H), 6.68 (d,
J=8.3 Hz, 1H), 6.63 (s, 1H), 6.51 (d, J=8.2 Hz, 1H), 6.06 (s, 1H),
5.50 (br s, 15H), 5.15 (s, 1H), 4.96 (s, 3H), 4.85-4.78 (m, 12H),
4.70 (s, 3H), 4.56 (s, 3H), 4.39 (s, 5H), 3.89-3.75 (m, 14H),
3.74-3.56 (m, 8H), 3.54-3.39 (m, 8H), 3.38-3.29 (m, 7H), 3.14 (s,
2H), 3.01 (d, J=5.5 Hz, 5H), 2.86-2.8 (m, 2H), 2.74 (s, 4H),
2.32-2.23 (m, 5H), 2.16 (d, J=11.2 Hz, 3H), 2.00 (d, J=6.6 Hz, 2H),
1.93-1.86 (m, 5H), 1.77-1.54 (m, 10H), 1.46-1.42 (m, 6H), 1.30-1.27
(m 11H), 1.14 (s, 3H), 1.00 (d, J=12.5 Hz, 6H), 0.88 (s, 3H) 0.84
(s, 3H) ppm.
Example 45
[0771] This example demonstrates the methods for making the
linker-payload 28d1. This example refers to the compound numbering
in FIG. 8.
(1S,4aS,10aR)-N-{[(1S,4aS,10aR)-6-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-{2-[(1-{-
[31,32,33,34,35,36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-pentakis-
(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo
[26.2.2.23,6.28,11.213,16.218,21.223,26]dotetracontan-5-yl]methyl}-1H,4H,-
5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy]acetamido}hexanamido]-3-
-methylbutanamido]propanamido]-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydro-
phenanthren-1-yl]carbonyl}-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-oct-
ahydrophenanthrene-1-carboxamide (28d1)
##STR00331##
[0773] Compound 28d1 (14 mg, 23% yield) as a white solid was
obtained from the (2+3) click reaction of 27d1 (30 mg, 30 .mu.mol)
with CD-N.sub.3 (60 .mu.mol), following the general procedure to
make 28. ESI m/z: 995 (M/2+1).sup.+. .sup.1H NMR (500 MHz,
methanol-d4) .delta. 8.40 (s, 1H, imide-H), 7.56-7.52 (m, 1H), 7.32
(t, J=7.7 Hz, 1H), 7.03 (d, J=8.4 Hz, 1H), 6.88 (d, J=8.3 Hz, 1H),
6.72 (d, J=2.4 Hz, 1H), 6.56 (dd, J=8.2, 2.3 Hz, 1H), 5.24-5.16 (m,
1H), 5.01-4.95 (m, 6H), 4.65-3.43 (m, 40H), 3.14-2.72 (m, 7H),
2.55-1.26 (m, 44H), 1.16 (s, 3H), 1.13 (s, 3H), 1.09-0.93 (m, 6H)
ppm.
Example 46
[0774] This example demonstrates the methods for making the
linker-payload 28d2. This example refers to the compound numbering
in FIG. 8.
N-[(5R)-5-Amino-5-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hyd-
roxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]ca-
rbamoyl}-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbam-
oyl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}pentyl]-1-{2-[(1-{[31,32,33,-
34,35,36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-pentakis(hydroxyme-
thyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6-
.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetracontan-5-yl]methyl}-
-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-9-yl)oxy]acetamido}-3,6,9-
,12-tetraoxapentadecan-15-amide (28d2)
[0775] Compound 28d2 (30 mg, 72% yield) as a white solid was
obtained from the (2+3) click reaction of 27d2 (23 mg, 19 .mu.mol)
with CD-N.sub.3 (38 .mu.mol), following the general procedure to
make 28. ESI m/z: 1118 (M/2+1).sup.+. .sup.1H NMR (500 MHz,
DMSO-.sub.d6) .delta. 9.91-9.85 (m, 1H), 9.13-8.90 (m, 1H), 8.58
(t, J=9.3 Hz, 2H), 8.50-8.47 (m, 1H), 8.17-8.00 (m, 6H), 7.88-7.78
(m, 2H), 7.53-7.49 (m, 1H), 7.36-7.30 (m, 1H), 6.97 (d, J=8.5 Hz,
1H), 6.82 (d, J=8.3 Hz, 1H), 6.63 (s, 1H), 6.51 (d, J=8.3 Hz, 1H),
5.52-5.50 (m, 11H), 5.14 (s, 1H), 4.86-4.67 (m, 10H), 4.54 (d,
J=12.9 Hz, 2H), 4.46-4.32 (m, 5H), 4.06-3.94 (m, 3H), 3.89-3.76 (m,
4H), 3.73-3.61 (m, 5H), 3.57 (t, J=6.5 Hz, 3H), 3.53-3.34 (m, 12H),
3.33-3.19 (m, 4H), 3.17-3.08 (m, 3H), 3.00 (dd, J=12.6, 6.2 Hz,
3H), 2.91-2.68 (m, 8H), 2.31-2.22 (m, 5H), 2.18-2.07 (m, 6H),
1.93-1.78 (m, 6H), 1.74-1.35 (m, 15H), 1.28 (d, J=6.6 Hz, 17H),
1.19-1.06 (m, 5H), 1.01-0.94 (m, 9H), 0.89-0.79 (m, 6H) ppm.
Example 47
[0776] This example demonstrates the methods for making the
linker-payload 28h. This example refers to the compound numbering
in FIG. 8.
[0777]
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-{2-[(1-{[31,32,33,34,35,36,37,38-
,39,40,
41,42-dodecahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4,7,9-
,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6.2.sup.8,11.2-
.sup.13,16.2.sup.18,21.2.sup.23,26]dotetracontan-5-yl]methyl}-1H,2H,3H,4H,-
5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy]acetamido}hexanamido]-3-
-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}methyl
N-({[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,-
10,10a-octahydrophenanthrene-1-carbonyl]carbamoyl}-4b,8-dimethyl-4b,5,6,7,-
8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}methyl)carbamate
(28h)
[0778] Compound 28h (67 mg, 76% yield) as a white solid was
obtained from the (2+3) click reaction of 27h (60 mg, 47 .mu.mol)
with CD-N.sub.3 (94 .mu.mol), following the general procedure to
make 28. ESI m/z: 1141 (M/2+1).sup.+. .sup.1H NMR (500 MHz,
methanol-.sub.d4) .delta. 8.40 (s, 1H), 7.65-7.45 (m, 3H),
7.40-7.26 (m, 3H), 7.02 (d, J=8.3 Hz, 1H), 6.88 (d, J=8.3 Hz, 1H),
6.72 (d, J=2.4 Hz, 1H), 6.56 (dd, J=8.3, 2.4 Hz, 1H), 5.24-5.16 (m,
1H), 5.10 (s, 2H), 5.02-4.93 (m, 4H), 4.66-4.51 (m, 2H), 4.43-4.22
(m, 2H), 4.15-3.73 (m, 22H), 3.64-3.42 (m, 12H), 3.37 (s, 3H),
3.24-3.03 (m, 4H), 3.01-2.75 (m, 6H), 2.42-2.25 (m, 6H), 2.18-1.98
(m, 8H), 1.94-1.58 (m, 15H), 1.56-1.50 (m, 3H), 1.47-1.40 (m, 3H),
1.38 (s, 3H), 1.37 (s, 3H), 1.34-1.25 (m, 4H), 1.16-1.10 (m, 6H),
1.09-0.93 (m, 7H) ppm.
Example 48
[0779] This example demonstrates the methods for making the
linker-payload 28j. This example refers to the compound numbering
in FIG. 8.
{4-[(2S)-2-[(2S)-2-[(2R)-2-Amino-6-{2-[(1-{[31,32,33,34,35,36,37,38,39,40,-
41,42-dodecahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4,7,9,12,14,1-
7,19,22,24,27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,-
16.2.sup.18,21.2.sup.23,26]dotetracontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-
-cycloocta[d][1,2,3]triazol-4-yl)oxy]acetamido}hexanamido]-3-methylbutanam-
ido]-5-(carbamoylamino)pentanamido]phenyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (28j)
[0780] Compound 28j (20 mg, 57% yield) was obtained as a white
solid from the (2+3) click reaction of 27j with CD-N.sub.3
following the general procedure to make 28. ESI m/z: 1156.0
(M/2+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta. 9.81-9.67
(m, 2H), 8.99 (s, 1H), 8.20-8.06 (m, 5H), 7.85-7.22 (m, 18H),
6.97-6.49 (m, 2H), 5.98 (s, 1H), 5.65-5.33 (m, 15H), 5.14-4.92 (m,
5H), 4.82-4.72 (m, 6H), 4.60-4.54 (m, 4H), 4.36-4.28 (m, 3H),
4.18-3.96 (m, 3H), 3.85-3.55 (m, 27H), 3.49-3.39 (m, 23H),
3.28-3.08 (m, 8H), 2.94-2.57 (m, 4H), 2.42-2.07 (m, 8H), 1.99-1.45
(m, 22H), 1.28-1.11 (m, 23H), 1.05-0.95 (m, 6H), 0.89-0.79 (m, 7H)
ppm.
Example 49
[0781] This example demonstrates the methods for making the
linker-payloads 29c1, 29c2, 29d1, 29d2, 29d3, 29d4, 29h, and 29j.
This example refers to the compound numbering in FIG. 8.
[0782] General Procedure to Make Linker-Payload 29:
[0783] To a solution of compound 28 (5-30 mg, 1 equiv.) in DMF (0.5
mL) were added a solution of commercially available
DIBAC-Suc-PEG.sub.4-OSu or BCN-PEG.sub.4-NHS ester (1.2 equiv.) in
THF (0.5 mL) and then TEA (2 equiv.) at rt. The mixture was stirred
at rt until 28 was consumed, as monitored by LC-MS. The reaction
mixture was concentrated in vacuo and the residue was directly
purified by prep-HPLC to yield 29 as a white solid.
Example 50
[0784] This example demonstrates the methods for making the
linker-payload 29c1. This example refers to the compound numbering
in FIG. 8.
{4-[(2S)-2-[(2S)-2-[(2R)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca--
1(12),4(9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxa-
pentadecan-15-amido]-6-(1-{2-[(1-{[31,32,33,34,35,36,37,38,39,40,41,42-dod-
ecahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,2-
4,27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.-
18,21.2.sup.23,26]dotetracontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cyclooct-
a[d][1,2,3]triazol-9-yl)oxy]acetamido}-3,6,9,12-tetraoxapentadecan-15-amid-
o)hexanamido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}met-
hyl-N-(2-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4-
,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4-
b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]oxy}ethyl)carbamate
(29c1)
##STR00332##
[0786] Compound 29c1 (12 mg, 39% yield) was obtained as a white
solid following the general procedure to make 29.
[0787] C.sub.148H.sub.213N.sub.15O.sub.53, Exact mass: 3048.4. ESI
m/z: 1017 (M/3+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta.
9.68 (s, 1H), 8.21-8.04 (m, 3H), 7.88-7.74 (m, 2H), 7.71-7.56 (m,
3H), 7.52-7.21 (m, 8H), 6.93 (d, J=8.6 Hz, 1H), 6.84-6.77 (m, 1H),
6.70-6.58 (m, 2H), 6.51 (d, J=8.1 Hz, 1H), 6.01 (s, 1H), 5.78-5.33
(m, 12H), 5.22-4.51 (m, 14H), 4.43-4.12 (m, 4H), 4.07-3.55 (m,
35H), 3.53-3.33 (m, 38H), 3.33-2.52 (m, 32H), 2.43-1.21 (m, 41H),
1.20-0.77 (m, 14H) ppm.
Example 51
[0788] This example demonstrates the methods for making the
linker-payload 29c2. This example refers to the compound numbering
in FIG. 8.
{Bicyclo[6.1.0]non-4-yn-9-yl}methyl
N-(14-{[(1R)-1-{[(1S)-1-{[(1S)-1-{[4-({[(2-{[(4bS,8S,8aR)-8-({[(1S,4aS,10-
aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthren-1-yl]-
formamido}carbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren--
3-yl]oxy}ethyl)carbamoyl]oxy}methyl)phenyl]carbamoyl}-4-(carbamoylamino)bu-
tyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-(1-{2-[(1-{[31,32,33,34,35,36,3-
7,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-pentakis
(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo
[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetrac-
ontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-9-yl)ox-
y]acetamido}-3,6,9,12-tetraoxapentadecan-15-amido)pentyl]carbamoyl}-3,6,9,-
12-tetraoxatetradecan-1-yl)carbamate (29c2)
##STR00333##
[0790] Compound 29c2 (5 mg, 210% yield) was obtained as a white
solid following the general procedure to make 29.
[0791] C.sub.140H.sub.2N.sub.14O.sub.53, Exact mass: 2937.4. ESI
m/z: 1470 (M/2+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta.
9.68 (s, 1H), 9.00 (s, 1H), 8.21-8.03 (m, 2H), 7.62 (d, J=8.4 Hz,
2H), 7.27 (d, J=8.3 Hz, 2H), 6.93 (d, J=8.8 Hz, 1H), 6.81 (d, J=8.4
Hz, 1H), 6.80 (s, 1H), 6.67 (d, J=8.6 Hz, 1H), 6.63 (s, 1H), 6.50
(d, J=7.9 Hz, 1H), 5.99 (s, 1H), 5.64-5.37 (m, 12H), 5.14 (s, 1H),
5.00-4.50 (m, 13H), 4.38-4.29 (m, 3H), 4.20-4.13 (m, 1H), 4.09-3.97
(m, 10H), 3.95-3.89 (m, 2H), 3.86-3.54 (m, 23H), 3.52-3.33 (m,
28H), 3.16-2.61 (m, 17H), 2.45-1.20 (m, 66H), 1.18-0.80 (m, 21H)
ppm.
Example 52
[0792] This example demonstrates the methods for making the
linker-payload 29d1. This example refers to the compound numbering
in FIG. 8.
1-(4-{2-Azatricyclo[10.4.0.04,9]hexadeca-1(12),4(9),5,7,13,15-hexaen-10-yn-
-2-yl}-4-oxobutanamido)-N-[(1R)-1-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8-({[(1-
S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthr-
en-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophen-
anthren-3-yl]carbamoyl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-{2-[(1-
-{[31,32,33,34,35,36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-pentak-
is(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo[26.2-
.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetracontan--
5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy]acet-
amido}pentyl]-3,6,9,12-tetraoxapentadecan-15-amide (29d1)
##STR00334##
[0794] Compound 29d1 (5.0 mg, 27% yield) was obtained as a white
solid following the general procedure to make 29.
[0795] C.sub.124H.sub.175N.sub.11O.sub.44, Exact mass: 2522.2. ESI
m/z: 1261 (M/2+1).sup.+. .sup.1H NMR (500 MHz, methanol-.sub.d4)
.delta. 7.69-7.44 (m, 6H), 7.41-7.30 (m, 3H), 7.26 (d, J=6.8 Hz,
1H), 7.04-6.96 (m, 1H), 6.88 (d, J=8.4 Hz, 1H), 6.72 (d, J=1.9 Hz,
1H), 6.56 (dd, J=8.3, 2.4 Hz, 1H), 5.25-4.94 (m, 6H), 4.75-4.55 (m,
16H), 4.53-3.41 (m, 49H), 3.33-1.20 (m, 53H), 1.18-1.10 (m, 6H),
1.06-0.94 (m, 6H) ppm.
Example 53
[0796] This example demonstrates the methods for making the
linker-payload 29d2. This example refers to the compound numbering
in FIG. 8.
{Bicyclo[6.1.0]non-4-yn-9-yl}methyl
N-(14-{[(1R)-1-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydro-
xy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carb-
amoyl}-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoy-
l}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-{2-[(1-{[31,32,33,34,35,36,-
37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4-
,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo[26.2.2.2.sup.3,6.2.sup.8,-
11.2.sup.13,16.2.sup.18,21.2.sup.23,26]
dotetracontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazo-
l-4-yl)oxy]acetamido}pentyl]carbamoyl}-3,6,9,12-tetraoxatetradecan-1-yl)ca-
rbamate (29d2)
##STR00335##
[0798] Compound 29d2 (16 mg, 43% yield) was obtained as a white
solid following the general procedure to make 29.
[0799] C.sub.116H.sub.174N.sub.10O.sub.44, Exact mass: 2411.2. ESI
m/z: 1206 (M/2+1).sup.+. .sup.1H NMR (500 MHz, methanol-d4) .delta.
7.62 (s, 1H), 7.39 (d, J=8.2 Hz, 1H), 7.03 (d, J=8.4 Hz, 1H), 6.89
(d, J=8.3 Hz, 1H), 6.72 (d, J=2.3 Hz, 1H), 6.56 (dd, J=8.2, 2.4 Hz,
1H), 5.21 (t, J=2.8 Hz, 1H), 4.99-4.95 (m, 4H), 4.65-3.43 (m, 57H),
3.31-2.74 (m, 11H), 2.55-1.22 (m, 55H), 1.16 (s, 3H), 1.13 (s, 3H),
1.06-0.87 (m, 9H) ppm.
Example 54
[0800] This example demonstrates the methods for making the
linker-payload 29d3. This example refers to the compound numbering
in FIG. 8.
1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9),5,7,13,15-hexaen--
10-yn-2-yl}-4-oxobutanamido)-N-[(1R)-1-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8--
{[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophena-
nthrene-1-carbonyl]carbamoyl}-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydroph-
enanthren-3-yl]carbamoyl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-(1-{-
2-[(1-{[31,32,33,34,35,36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-p-
entakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo-
[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetraco-
ntan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-9-yl)oxy-
]acetamido}-3,6,9,12-tetraoxapentadecan-15-amido)pentyl]-3,6,9,12-tetraoxa-
pentadecan-15-amide (29d3)
##STR00336##
[0802] Compound 29d3 was obtained as a white solid (8 mg, 32%
yield) following the general procedure to make 29.
[0803] C.sub.135H.sub.196N.sub.12O.sub.49, Exact mass: 2769.3. ESI
m/z: 1385.9 (M/2+1).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6)
.delta. 9.71-9.30 (br s, 0.6H), 9.01 (s, 1H), 8.29-7.99 (m, 4H),
7.89-7.76 (m, 3H), 7.74-7.60 (m, 2H), 7.58-7.27 (m, 7H), 7.01-6.92
(m, 1H), 6.82 (d, J=8.1 Hz, 1H), 6.68-6.48 (m, 2H), 5.71-5.45 (m,
12H), 5.17-4.69 (m, 2H), 4.90-4.50 (m, 12H), 4.44-3.54 (m, 33H),
3.54-3.41 (m, 38H), 3.33-2.54 (m, 15H), 2.43-1.19 (m, 44H),
1.18-0.66 (m, 18H) ppm.
Example 55
[0804] This example demonstrates the methods for making the
linker-payload 29d4. This example refers to the compound numbering
in FIG. 8.
{Bicyclo[6.1.0]non-4-yn-9-yl}methyl
N-(14-{[(1R)-1-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8-{[(1S,4aS,10aR)-6-hydro-
xy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophenanthrene-1-carbonyl]carb-
amoyl}-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoy-
l}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-(1-{2-[(1-{[31,32,33,34,35,-
36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-pentakis(hydroxymethyl)--
2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo
[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetrac-
ontan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-9-yl)ox-
y]acetamido}-3,6,9,12-tetraoxapentadecan-15-amido)pentyl]carbamoyl}-3,6,9,-
12-tetraoxatetradecan-1-yl)carbamate (29d4)
##STR00337##
[0806] Compound 29d4 (2 mg, 14% yield) was obtained as a white
solid following the general procedure to make 29.
[0807] C.sub.148H.sub.213N.sub.15O.sub.53, Exact mass: 3048.4. ESI
m/z: 1017 (M/3+1).sup.+, .sup.1H NMR (500 MHz, DMSO.sub.d6) .delta.
9.68 (s, 1H), 8.21-8.04 (m, 3H), 7.88-7.74 (m, 2H), 7.71-7.56 (m,
3H), 7.52-7.21 (m, 8H), 6.93 (d, J=8.6 Hz, 1H), 6.84-6.77 (m, 1H),
6.70-6.58 (m, 2H), 6.51 (d, J=8.1 Hz, 1H), 6.01 (s, 1H), 5.78-5.33
(m, 12H), 5.22-4.51 (m, 14H), 4.43-4.12 (m, 4H), 4.07-3.55 (m,
35H), 3.53-3.33 (m, 38H), 3.33-2.52 (m, 32H), 2.43-1.21 (m, 41H),
1.20-0.77 (m, 14H) ppm.
Example 56
[0808] This example demonstrates the methods for making the
linker-payload 29h. This example refers to the compound numbering
in FIG. 8.
1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca-1(12),4(9),5,7,13,15-hexaen--
10-yn-2-yl}-4-oxobutanamido)-N-[(1R)-1-{[(1S)-1-{[(1S)-1-{[(4bS,8S,8aR)-8--
({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3,4,4a,9,10,10a-octahydrophen-
anthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-4b,5,6,7,8,8a,9,10-octahydr-
ophenanthren-3-yl]carbamoyl}ethyl]carbamoyl}-2-methylpropyl]carbamoyl}-5-{-
2-[(1-{[31,32,33,34,35,36,37,38,39,40,41,42-dodecahydroxy-10,15,20,25,30-p-
entakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,27,29-dodecaoxaheptacyclo-
[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetraco-
ntan-5-yl]methyl}-1H,4H,5H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy-
]acetamido}pentyl]-3,6,9,12-tetraoxapentadecan-15-amide (29h)
##STR00338##
[0810] Compound 29h (28 mg, 35% yield) was obtained as a white
solid (mixture of regioisomers at the triazole) following the
general procedure to make 29.
[0811] C.sub.137H.sub.191N.sub.15O.sub.48, exact mass: 2814.3. ESI
m/z: 1409 (M/2+1).sup.+. H NMR (500 MHz, DMSO.sub.d6) .delta. 9.79
(s, 1H), 9.68 (s, 1H), 8.99 (s, 1H), 8.24-8.05 (m, 3H), 7.86-7.73
(m, 2H), 7.71-7.58 (m, 3H), 7.54-7.42 (m, 4H), 7.42-7.25 (m, 5H),
6.96 (d, J=8.5 Hz, 1H), 6.81 (d, J=8.4 Hz, 1H), 6.63 (s, 1H),
6.57-6.45 (m, 1H), 5.99 (s, 1H), 5.69-5.31 (m, 12H), 5.17-4.49 (m,
14H), 4.39-3.95 (m, 5H), 3.90-3.51 (m, 25H), 3.50-3.33 (m, 32H),
3.33-2.53 (m, 21H), 2.44-1.20 (m, 41H), 1.21-0.77 (in, 16H)
ppm.
Example 57
[0812] This example demonstrates the methods for making the
linker-payload 29j. This example refers to the compound numbering
in FIG. 8.
{4-[(2S)-2-[(2S)-2-[(2R)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.4,9]hexadeca--
1(12),4(9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxa-
pentadecan-15-amido]-6-{2-[(1-{[31,32,33,34,35,36,37,38,39,40,41,42-dodeca-
hydroxy-10,15,20,25,30-pentakis(hydroxymethyl)-2,4,7,9,12,14,17,19,22,24,2-
7,29-dodecaoxaheptacyclo
[26.2.2.2.sup.3,6.2.sup.8,11.2.sup.13,16.2.sup.18,21.2.sup.23,26]dotetrac-
ontan-5-yl]methyl}-1H,4H,H,6H,7H,8H,9H-cycloocta[d][1,2,3]triazol-4-yl)oxy-
]acetamido}hexanamido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]p-
henyl}methyl
N-[(1S)-1-{[(4bS,8S,8aR)-8-({[(1S,4aS,10aR)-6-hydroxy-1,4a-dimethyl-1,2,3-
,4,4a,9,10,10a-octahydrophenanthren-1-yl]formamido}carbonyl)-4b,8-dimethyl-
-4b,5,6,7,8,8a,9,10-octahydrophenanthren-3-yl]carbamoyl}-2-hydroxyethyl]ca-
rbamate (29j)
##STR00339## ##STR00340##
[0814] Compound 29j (10 mg, 42% yield) was obtained as a white
solid (mixture of regioisomers at the triazole) following the
general procedure to make 29.
[0815] C.sub.138H.sub.193N.sub.15O.sub.49, Exact mass: 2844.3. ESI
m/z: 1424.3 (M/2+H).sup.+. .sup.1H NMR (500 MHz, DMSO.sub.d6)
.delta. 9.81 (s, 1H), 9.65 (s, 1H), 8.97 (s, 1H), 8.28-8.04 (m,
3H), 7.91-7.73 (m, 2H), 7.73-7.16 (m, 12H), 6.95 (d, J=8.8 Hz, 1H),
6.81 (d, J=7.8 Hz, 1H), 6.73-6.59 (m, 1H), 6.59-6.44 (m, 1H), 5.98
(s, 1H), 5.71-5.27 (m, 12H), 5.23-4.48 (m, 14H), 4.43-3.93 (m, 5H),
4.09-3.50 (m, 24H), 3.51-3.33 (m, 31H), 3.33-2.53 (m, 17H),
2.42-1.08 (m, 51H), 1.06-0.67 (m, 14H) ppm.
Example 58
[0816] This example demonstrates the methods for making the
linker-payload 33. This example refers to the compound numbering in
FIG. 9.
{4-[(2S)-2-[(2S)-2-[1-(4-{2-Azatricyclo[10.4.0.0.sup.(4,9)]hexadeca-1(12),-
4(9),5,7,13,15-hexaen-10-yn-2-yl}-4-oxobutanamido)-3,6,9,12-tetraoxapentad-
ecan-15-amido]-3-methylbutanamido]-5-(carbamoylamino)pentanamido]phenyl}me-
thyl
N-{2-[N-methyl(3-{3-[3-ethyl-8-(trifluoromethyl)quinolin-4-yl]phenoxy-
}benzene)sulfonamido]ethyl}carbamate (33)
[0817]
N-(2-Aminoethyl)-3-(3-(3-ethyl-8-(trifluoromethyl)quinolin-4-yl)phe-
noxy)-N-methylbenzenesulfonamide (31) was reported as a potent LXR
agonist having a binding affinity of 1.5 nM to LXR.alpha. and 12 nM
to LXR.beta. (See, Bioconjug Chem. 2015 26(11), 2216-22).
[0818] The synthesis of the linker-payload 33 via two amide
coupling reactions is shown in FIG. 9. The first amide coupling
reaction of 31 with Fmoc-VC-PAB-PNP catalyzed by HOBt followed by
Fmoc deprotection under basic conditions formed 32, and the second
amide coupling reaction of 32 with commercially available
DIBAC-suc-PEG.sub.4-acid formed 33.
[0819] Step 1:
[0820] To a mixture of 31 (0.14 g, 0.26 mmol) in DMF (5 mL) were
subsequently added Fmoc-vc-PAB-PNP (0.26 g, 0.34 mmol), HOBt (46
mg, 0.34 mmol), and DIPEA (89 mg, 0.68 mmol) at rt. After the
reaction was stirred at 20-25.degree. C. for 24 h, 31 was totally
consumed according to LC-MS analysis. To the reaction mixture was
added Et.sub.2NH (0.5 mL) and the resulting mixture was stirred at
25.degree. C. for additional 2 h. LC-MS showed the Fmoc group was
totally removed at that time. The volatiles were removed in vacuo
and the residue was purified by prep-HPLC (Method A) to give 32 (75
mg, 30% yield) as a white solid. ESI m/z: 935 (M+H).sup.+. .sup.1H
NMR (400 MHz, methanol-.sub.d4) .delta. 8.97 (s, 1H), 8.06 (d,
J=7.2 Hz, 1H), 7.71-7.52 (m, 7H), 7.40-7.37 (m, 2H), 7.31-7.27 (m,
3H), 7.18 (d, J=7.2 Hz, 1H), 7.06-7.04 (m, 1H), 5.00 (s, 2H),
4.55-4.52 (m, 1H), 3.25-3.06 (m, 7H), 2.74 (s, 3H), 2.73-2.60 (m,
2H), 2.06-1.54 (m, 5H), 1.18 (t, J=7.2 Hz, 3H), 0.98 (d, J=6.8 Hz,
3H), 0.93 (d, J=6.8 Hz, 3H) ppm.
[0821] Step 2:
[0822] To a solution of DIBAC-suc-PEG.sub.4-acid (8.0 mg, 14
.mu.mol) in DMF (1 mL) was added HATU (8.0 mg, 20 .mu.mol) at rt.
The mixture was stirred at 25.degree. C. for an hour and to the
mixture was subsequently added 32 (13 mg, 14 .mu.mol) and TEA (13
mg, 28 .mu.mol). The mixture was stirred at 25.degree. C. for
additional 2 h. The reaction was monitored by LC-MS until 32 was
consumed. The volatiles were removed in vacuo and the residue was
purified by prep-HPLC (Method B) to give 33 (7.0 mg, 35% yield) as
a white solid. ESI m/z: 735 (M/2+H).sup.+. .sup.1H NMR (400 MHz,
methanol-.sub.d4) .delta. 8.96 (s, 1H), 8.06 (d, J=7.2 Hz, 1H),
7.71-7.52 (m, 9H), 7.43-7.18 (m, 12H), 7.05 (s, 1H), 5.13-5.09 (m,
1H), 5.00 (s, 2H), 4.52-4.46 (m, 1H), 4.20 (d, J=6.8 Hz, 1H),
3.77-3.65 (m, 3H), 3.58-3.51 (m, 12H), 3.44-3.39 (m, 2H), 3.22 (t,
J=6.0 Hz, 4H), 3.14-3.03 (m, 3H), 2.73-2.62 (m, 6H), 2.53 (t, J=6.0
Hz, 2H), 2.40-2.31 (m, 1H), 2.20-1.86 (m, 5H), 1.79-1.51 (m, 3H),
1.17 (t, J=7.6 Hz, 3H), 0.97 (t, J=6.0 Hz, 6H) ppm.
Example 59
[0823] Summarized in Table 2 are the structures of the
linker-payloads 22, 24, 27, 29, and 33. Summarized in Table 5 are
the molecular formulae, molecular weights, calculated Log P values,
MS, and HPLC results for the linker-payloads.
TABLE-US-00007 TABLE 5 Chemical-Physical Properties of
Linker-Payload HPLC R.sub.t MS Method HPLC Cpd m/z A or B Purity #
cLogP MF MW (100%) (min) (%) LP1 24c +
C.sub.81H.sub.116N.sub.10O.sub.23 1597.8 1598.7 6.70 (A) 100 [M +
H] 7.72 (B) LP2 22d1 +++ C.sub.72H.sub.92N.sub.6O.sub.12 1233.53
617.3 9.21 (B) 100 [M/2 + H] LP3 22d2 ++
C.sub.38H.sub.51N.sub.3O.sub.3 597.39 598.4 8.99 (B) 100 [M + H]
LP4 22j ++ C.sub.86H.sub.110N.sub.10O.sub.17 1555.8 778.4 7.21 (B)
96.6 [M/2 + H] LP5 27d1 ++ C.sub.58H.sub.82N.sub.6O.sub.8 990.62
991.3 6.5 (B) 100 [M + H] LP6 29c1 +
C.sub.137H.sub.191N.sub.15O.sub.48 2818.1 939.5 6.62 (B) 100 [M/3 +
H] LP7 29c2 + C.sub.148H.sub.213N.sub.15O.sub.53 3050.3 1017.3 6.68
(B) 96 [M/3 + H] LP8 29d1 + C.sub.124H.sub.175N.sub.11O.sub.44
2523.8 841.8 6.19 (B) 98 [M/3 + H] LP9 29d2 +
C.sub.116H.sub.174N.sub.10O.sub.44 2412.7 1215.2 6.37 (B) 100 [(M +
H2O)/ 2 + H] LP10 29d3 + C.sub.135H.sub.196N.sub.12O.sub.49 2771.1
924.5 6.42 (B) 100 [M/3 + H] LP11 29d4 +
C.sub.127H.sub.195N.sub.11O.sub.49 2660 837.2 6.33 (B) 100
[(M-BCN)/ 3 + H] LP12 29h + C.sub.137H.sub.191N.sub.15O.sub.48
2818.1 939.5 6.62 (B) 100 [M/3 + H] LP13 29j +
C.sub.138H.sub.193N.sub.15O.sub.49 2846.08 1424.3 6.12 (B) 100 [M/2
+ H] LP15 27j ++ C.sub.72H.sub.100N.sub.10O.sub.13 1313.62 657.5
8.16 (B) 96 [M/2 + H] 1313.6 [M + H, 5%] LP14 33 ++
C.sub.76H.sub.87F.sub.3N.sub.10O.sub.15S 1469.6 735.3 9.34 (B) 96
[M/2 + H] 9 < + + +; 7 < + + < 9; -2 < + < 2
Example 60
[0824] This example demonstrates a method for making
non-site-specific conjugated drug(s) to an antibody using a
thiol-maleimide reaction.
[0825] Conjugation through antibody cysteines was performed in two
steps using the methods similar to those for making
Adcetris.RTM.-like ADCs (See, Mol. Pharm. 2015, 12(6),
1863-71).
[0826] A monoclonal antibody (mAb) is reduced with dithiothreitol
or TCEP. After gel filtration, 24c in DMSO solution is added to the
reduced antibody, and the mixture is adjusted to appropriate pH.
The reaction is allowed to stir. The resulting conjugate are
purified by SEC. The DAR (UV) values are determined using the
measured absorbances of the ncADC and the extinction coefficients
of the antibody and 24c.
Example 61
[0827] This example demonstrates a method for site-specific
conjugation, generally, for a payload to an antibody or
antigen-binding fragment thereof. This example refers to FIG.
10.
[0828] In one example, the site-specific conjugates were produced
by Microbial transglutaminase (MTG EC 2.3.2.13, Zedira, Darmstadt,
Germany) (hereinafter "MTG-based") two-step conjugation of N297Q
antibody. The first step was a MTG-based enzymatic attachment of a
small molecule, such as azide-PEG3-amine, to the mutated antibody.
The second step employed the attachment of a linker-payload to the
azido-functionalized antibody via a [2+3] cycloaddition, for
example, the 1,3-dipolar cycloaddition between the azides and the
cyclooctynes (aka copper-free click chemistry). See, Baskin, J. M.;
Prescher, J. A.; Laughlin, S. T.; Agard, N. J.; Chang, P. V.;
Miller, I. A.; Lo, A.; Codelli, J. A.; Bertozzi, C. R. PNAS 2007,
104 (43), 16793-7. Shown in FIG. 10 is an example of a
linker-payload having a DIBAC moiety conjugated with an
azido-functionalized antibody via a [2+3] cycloaddition. This
process provided the site-specific and stoichiometric conjugates in
about 50-80% isolated yield.
Example 62
[0829] This example demonstrates a method for making an
azido-functionalized antibody drug conjugate.
[0830] Aglycosylated human antibody IgG (IgG1, IgG4, etc.) or a
human IgG1 isotype in BupH.TM. (pH 6.5-8.0) was mixed with >200
molar equivalents of azido-dPEG.sub.3-amine (MW=218.26 g/mol). The
resulting solution was mixed with transglutaminase (25 U/mL; 5U MTG
per mg of antibody, from Zedira, Darmstadt, Germany, or Ajinomoto,
Japan) resulting in a final concentration of the antibody at 0.5-5
mg/mL, and the solution was kept at pH 6.5-8.0 and then incubated
at 37.degree. C. for 4-24 h while gently shaking. The reaction was
monitored by ESI-MS. Upon reaction completion, the excess amine and
MTG were removed by SEC (see FIG. 12) or protein A column eluting
with acidic buffer and then neutralizing with Tris buffer (pH8), to
generate the azido-functionalized antibody. This product was
analyzed by SDS-PAGE (see FIG. 11) and ESI-MS (see FIG. 13). The
azido-dPEG.sub.3-amine added to two sites--Q295 and Q297-of the
antibody resulting in an 804 Da increase for the 4DAR aglycosylated
antibody-PEG.sub.3-azide conjugate. The conjugation sites were
identified and confirmed at EEQ.sup.LinkerYQ.sup.LinkerSTYR for the
4DAR azido-functionalized antibody via peptide sequence mapping of
trypsin digested heavy chains.
Example 63
[0831] This example demonstrates a method for making site-specific
conjugates of a drug to an antibody using click chemistry
reactions.
[0832] The site-specific aglycosylated antibody drug conjugates
with a human IgG (IgG1, IgG4, etc.) containing an N297Q mutation
(EU numbering) in Table 6 were prepared by a [2+3] click reaction
between azido-functionalized antibodies with an alkyne containing
linker-payload. As shown in Table 6, Anti Her2-PEG.sub.3-N.sub.3
was conjugated to linker-payloads (LPs) in Table 2: LP2, LP3, LP4,
LP5, LP6, LP7, LP8, LP10, LP11, LP12, LP13, and LP14. As shown in
Table 6, Anti PRLR-PEG.sub.3-N.sub.3 was conjugated to LPs in Table
2: LP5, LP6, LP7, LP8, LP10, LP11, LP12, LP13, and LP14. As shown
in Table 6, isotype-control-PEG3-N3 was conjugated to LP2, LP3,
LP4, LP5, LP6, LP7, LP8, LP10, LP11, LP12, LP13, and LP14 in Table
2.
[0833] For the conjugation, an azido-functionalized aglycosylated
human IgG1 antibody (mAb-PEG.sub.3-N.sub.3) and a linker-payload
(LP) conjugate was prepared by incubating mAb-PEG.sub.3-N.sub.3
(1-3 mg/mL) in an aqueous medium (e.g., PBS, PBS containing 5%
glycerol, HBS) with .gtoreq.6 molar equivalents of an LP dissolved
in a suitable organic solvent, such as DMSO, DMF or DMA (i.e., the
reaction mixture contains 5-20% organic solvent, v/v) at 24.degree.
C. to 37.degree. C. for over 6 h. The progress of the reaction was
monitored by ESI-MS and the absence of mAb-PEG.sub.3-N.sub.3
indicated the completion of the conjugation. The excess amount of
the LP and organic solvent were removed by SEC via elution with
PBS, or via protein A column eluting with acidic buffer followed by
neutralization with Tris (pH 8). The purified conjugates were
analyzed by SEC, SDS-PAGE, and ESI-MS. Shown in Table 6 is a list
of non-cytotoxic antibody conjugates (ncADCs) from the
corresponding LPs, their molecular weights, and ESI-DAR values.
[0834] Summarized in Table 6 were the naked antibodies (anti-Her2
antibody, anti-PRLR antibody, and isotype control antibody),
azido-functionalized antibodies (anti-Her2
antibody-PEG.sub.3-N.sub.3, anti-PRLR antibody-PEG3-N3, and isotype
control antibody-PEG3-N3, and their antibody drug conjugates. In
Table 6, Ab refers to an antibody, mAb refers to a monoclonal
antibody, Ab-N.sub.3 refers to an azido-functionalized antibody,
Ab-PEG.sub.3-N.sub.3 refers to an azido-functionalized antibody
with a PEG.sub.3 spacer, and ncADC refers to a non-cytotoxic
antibody drug conjugate. For convenience, the Anti Her2-LP(X) and
Anti PRLR-LP(X) nomenclature--within Table 6 and other Tables
herein--where X indicates a particular linker-payload (e.g., LP2 or
LP10, etc.) embraces the presence of a PEG.sub.3 spacer (e.g., from
anti-Her2 antibody-PEG.sub.3-N.sub.3 or anti-PRLR
antibody-PEG.sub.3-N.sub.3), as described herein.
TABLE-US-00008 TABLE 6 List of Antibody,
Antibody-PEG.sub.3-N.sub.3, and LXR Agonist-ncADCs Ab, Ab-N.sub.3,
MS m/z MW DAR or ncADC (ncADC) LP # (LP) (ESI-MS) Anti Her2 mAb
145132 Anti Her2-PEG.sub.3-N.sub.3 145930
NH.sub.2-PEG.sub.3-N.sub.3 218.26 4 Anti Her2-LP2 150880 LP2 1232.7
3.8 Anti Her2-LP3 151830 LP3 1467.8 3.9 Anti Her2-LP4 152175 LP4
1554.8 3.8 Anti Her2-LP5 149925 LP5 990.0 4 Anti Her2-LP6 158153
LP6 3050.3 4 Anti Her2-LP7 157715 LP7 2939.2 3.9 Anti Her2-LP8
156047 LP8 2523.8 3.9 Anti Her2-LP10 157040 LP10 2771.1 4 Anti
Her2-LP11 156602 LP11 2660.0 4 Anti Her2-LP12 157212 LP12 2818.1 4
Anti Her2-LP14 151827 LP14 1469.6 4 Anti PRLR mAb 144579 Anti
PRLR-PEG.sub.3-N.sub.3 145373 NH.sub.2-PEG.sub.3-N.sub.3 218.26 4
Anti PRLR-LP5 149368 LP5 990.0 4 Anti PRLR-LP6 157589 LP6 3050.3 4
Anti PRLR-LP7 157169 LP7 2939.2 3.9 Anti PRLR-LP8 155484 LP8 2523.8
4 Anti PRLR-LP10 156474 LP10 2771.1 4 Anti PRLR-LP11 156052 LP11
2660.0 4 Anti PRLR-LP14 151283 LP14 1469.6 4 isotype control mAb
145430 isotype control-PEG.sub.3-N.sub.3 146235
NH.sub.2-PEG.sub.3-N.sub.3 218.26 4 isotype control-LP2 151176 LP2
1232.7 4 isotype control-LP3 152120 LP3 1467.8 4 isotype
control-LP4 152472 LP4 1554.8 4 isotype control-LP5 150218 LP5
990.0 4 isotype control-LP8 156355 LP8 2523.8 4 isotype
control-LP10 157340 LP10 2771.1 4 isotype control-LP11 156893 LP11
2660.0 3.4 isotype control-LP12 157514 LP12 2818.1 3.9
Example 64
[0835] This example demonstrates methods for characterizing
antibody and non-cytotoxic antibody drug conjugates (ncADC).
[0836] The antibody and ncADC were characterized by SDS-PAGE, SEC,
and MS (ESI). The anti-Her2-LP8 conjugate in Table 6 generated from
the anti-Her2 antibody via its azido-functionalized antibody
(anti-Her2-PEG.sub.3-N.sub.3) was characterized by SDS-PAGE
performed under non-reducing and reducing conditions (FIG. 11), SEC
(FIG. 12), and ESI-MS (FIG. 13), and demonstrated completion of the
ncADC formation.
[0837] SDS-PAGE was used to analyze the integrity and purity of the
ADCs.
[0838] In one method, SDS-PAGE conditions included non-reduced and
reduced samples (2-4 .mu.g) along with BenchMark Pre-Stained
Protein Ladder (Invitrogen, cat #10748-010; L #1671922.) were
loaded per lane in (1.0 mm.times.10 well) Novex 4-20% Tris-Glycine
Gel and were ran at 180 V, 300 mA, for 80 min. An analytic sample
was prepared using Novex Tris-Glycine SDS buffer (2.times.)
(Invitrogen, Cat # LC2676) and the reducing sample was prepared
with SDS sample buffer (2.times.) containing 10%
2-mecaptoethanol.
[0839] In FIG. 11 are shown a representative gel, indicating the
shift of the molecular weights of the antibodies and ncADCs on
SDS-PAGE performed under non-reducing and reducing conditions. The
masses of the heavy chains were increased from the naked antibodies
to the ncADC conjugate. There was no detectable cross-linked
material.
[0840] As shown in FIG. 11, the SDS-PAGE lanes included the
following species based on the following lane labels in Table
7.
TABLE-US-00009 TABLE 7 Lane Sample 1 Standards (Bench Mark 10
.mu.L) 2 Anti Her2 mAb 3 Anti Her2 mAb-NH-PEG.sub.3-N.sub.3 4 Anti
Her2 mAb-LP8 7 Anti Her2 mAb (reduced) 8 Anti Her2
mAb-NH-PEG.sub.3-N.sub.3 (reduced) 9 Anti Her2 mAb-LP8 (reduced) ~2
.mu.g of non-reduced/reduced sample/lane. Novex 4-20% Tris-Glycine
Gel; 1.0 mm .times. 10 well; 180 V, 300 mA, 80 min. BenchMark
Pre-Stained Protein Ladder, Invitrogen, cat #10748-010; L
#1671922.
[0841] ADCs were analyzed for purity by SEC.
[0842] To determine the purity of antibody drug conjugates, SEC was
performed. Analytical SEC experiments were run using a Waters 600
instrument, on a Superdex 200 (1.0.times.30 cm) HR column, at flow
rate of 0.80 mL/min using PBS pH 7.4, and monitored at .lamda.=280
nm using a Waters 2998 PDA. An analytic sample was composed of 200
.mu.L PBS (pH 7.4) with 30-100 .mu.L of test sample. Preparative
SEC purifications were performed using an AKTA instrument from GE
Healthcare, on Superdex 200 PG (2.6.times.60 cm) column, at a flow
rate 2 mL/min eluting with PBS pH 7.4, and monitored at .lamda.=280
nm. The SEC results in FIG. 12 indicated typical retention times
for monomeric mAb and its conjugates and there was no detectable
aggregation or degradation.
[0843] Antibody and ADC were analyzed by intact mass analysis by
LC-ESI-MS.
[0844] Measurement of intact mass for the ncADC samples by
LC-ESI-MS was performed to determine drug-payload distribution
profile and to calculate the average DAR of intact ADC forms. Each
testing sample (20-50 ng, 5 uL) was loaded onto an Acquity UPLC
Protein BEH C4 column (10K psi, 300 .ANG., 1.7 .mu.m, 75
.mu.m.times.100 mm; Cat No. 186003810). After 3 min desalting, the
protein was eluted and mass spectra were acquired by a Waters
Synapt G2-Si mass spectrometer.
[0845] The deconvoluted mass spectra exhibited a predominant peak
for the aglycosylated anti-HER2 antibody with a molecular weight of
145132 Da, and a predominant peak for its azido functionalized
anti-PRLR antibody with a molecular weight of 145930 Da, indicating
a 798 Da increase compared to its aglycosylated parent antibody
(i.e., corresponding to 4 amino-PEG.sub.3-azide conjugations to
each aglycosylated antibody). Also, the predominant peak for
anti-HER2-LP8 conjugate had a molecular weight of 156047 Da,
indicating a 10931 Da increase compared to its aglycosylated parent
antibody (i.e., corresponding to 4 LP8 conjugations to each
aglycosylated antibody). As summarized in Table 6, most
site-specific ADCs in this document have 4DAR.
[0846] For non-site specific antibody drug conjugates, the DAR
values were determined based on the ESI Q-TOF mass analysis. The
ESI Q-TOF mass spectra were deconvoluted to zero charge mass
spectra using a Maximum Entropy algorithm (MassLynx). The resulting
mass spectra demonstrated the distribution of each drug conjugated
antibody. The area percentage of a peak represents the relative
distribution of the particular drug-loaded antibody species. The
average DAR was calculated using the percentage peak area
information and the drug load numbers on the antibody.
[0847] For non-site specific antibody drug conjugates, the DAR
values were determined based on the ESI Q-TOF mass analysis. The
ESI Q-TOF mass spectra were deconvoluted to zero charge mass
spectra using a Maximum Entropy algorithm (MassLynx). The resulting
mass spectra demonstrated the distribution of each drug conjugated
antibody. The area percentage of a peak represents the relative
distribution of the particular drug-loaded antibody species. The
average DAR was calculated using the percentage peak area
information and the drug load numbers on the antibody.
Example 65
[0848] This example demonstrates methods for LanthaScreen TR-FRET
GR Competitive Binding Assay.
[0849] To evaluate the ability of novel LXR agonists to bind to the
LXR alpha and beta receptor, a cell-free binding assay was
performed using a LanthaScreen TR-FRET LXR alpha Coactivator Assay
Kit (ThermoFisher, Cat # PV4655) and LXR beta Coactivator Assay Kit
(ThermoFisher, Cat # PV4658). The assay was performed according to
the manufacturer's instructions. Briefly, a 3-fold serial dilution
of LXR agonists were prepared in 100% DMSO starting at 100 .mu.M
(100.times. of final). Serial dilutions were further diluted
50-fold in nuclear receptor buffer F with 5 mM DTT, and transferred
to a 384-well assay plate. Next, Fluorescein-D22, LXR alpha or beta
LBD-GST, and Tb anti-GST antibody was sequentially added to
384-well assay plate. The plate was then incubated at rt for 2.5
hours while being protected from light. The plate was analyzed on
an Envision Multilabel Plate Reader (PerkinElmer) with excitation
set at 340 nm and emission filters at 520 nm and 486 nm. The FRET
ratio was calculated as 520 nm/486 nm. The IC.sub.50 values were
determined using a four-parameter logistic equation over a 12-point
response curve (GraphPad Prism).
[0850] As shown in Table 8, LXR agonists of the invention bound in
the LXR assay to LXRa with IC.sub.50 values from below 1 nM to
greater than 100 nM and to LXRb with IC.sub.50 values between from
below 1 nM to greater than 100 nM. The reference compounds bound in
the LXR assay to LXRa with IC.sub.50 values less than or equal to
10 nM and to LXRb with IC.sub.50 values between 1 nM and 10 nM.
Under these assay conditions, several of the LXR agonists provided
herein displayed a similar or better IC.sub.50 for binding to LXR
than reference compounds.
[0851] The cell free binding and cell based functional activity of
the compounds in Table 1 are summarized in Table 8. The fold
activation in the cell-based assays (as described in Example 68,
below) was defined based on the maximum activation of the free
payload 9d. Compounds that demonstrated greater than 75% of the
activation of the free payload are termed "full activation".
Compounds that demonstrated from 25% maximal activation to 75%
maximal activation of the free payload are termed "partial
activation". Compounds that demonstrated less than 25% of the
activation of the free payload are termed "no activation".
TABLE-US-00010 TABLE 8 Cell free binding and cell based functional
activity at 48 hours Cell free binding Activation of THP1/LXR-Luc
cells LXR.alpha. LXR.beta. Fold of EC.sub.50 Cpd # IC.sub.50
IC.sub.50 activation (nM) 9a +++ +++ Full activation +++ 9b +++ +++
Full activation +++ 9c ++ +++ Full activation ++ 9d +++ +++ Full
activation ++++ 9e +++ +++ Full activation +++ 9f +++ +++ Full
activation +++ 9h ++++ ++++ Full activation ++++ 9i +++ +++ Partial
activation ++ 9j +++ +++ Full activation ++++ 9k ++ +++ Full
activation +++ 9l ++ ++ Full activation +++ 9m ++ +++ Full
activation +++ 9n ++ +++ Full activation ++++ 9o ++ +++ Full
activation ++++ 9p ++ +++ Full activation +++ 9q +++ +++ Full
activation ++ 9r +++ +++ Full activation ++ 9t + + Partial
activation ++ 9u ++ ++ Partial activation +++ 17b ++ +++ Full
activation ++ 17c + +++ Full activation ++++ 31 +++ +++ Partial
activation ++ GW3965 +++ +++ Full activation + T0901317 ++++ +++
Full activation ++ IC.sub.50: ++++: .gtoreq.1 nM; +++: .gtoreq.10
nM > nM; ++: .gtoreq.100 nM >10 nM; +>100 nM. NT: not
tested. EC.sub.50: ++++: .gtoreq.1 nM; +++: .gtoreq.10 nM >1 nM;
++: .gtoreq.100 nM >10 nM; +: >100 nM. NT: not tested.
Example 66
[0852] To determine the ability of LXR agonists to activate ABCA1
and ABCG1 genes, the mRNA levels of these two genes in
differentiated macrophages was measured. For the assay, THP-1 human
cell line cells were seeded onto 48-well plates at 500,000
cells/well in RPMI 1640 media (Irvine Scientific, #9160) containing
1000 FBS (Gibco, Cat #1043010), 10 .mu.g/mL penicillin-streptomycin
(Gibco, Cat #15140122) in 5% CO.sub.2 at 37.degree. C. Cells were
differentiated into macrophages by treatment with 100 nM Phorbol-12
myristate 13-acetate (Sigma, # P8139), which was added to the media
described above, for 72 hours. Differentiated macrophages were
treated with a serial dilution of LXR agonist compounds and
reference compound T0901317 for a 24-hour period, with a
concentration range between 5.times.10.sup.-7 M to
5.times.10.sup.-17 M. Media from the cells was aspirated and 0.75
mL of TRIzol reagent (Invitrogen, Cat #15596018) was added to
lysate the cells. Chloroform was then used for phase separation.
The aqueous phase, containing total RNA, was purified using
MagMAX.TM.-96 for Microarrays Total RNA Isolation Kit (Ambion, Cat
# AM1830) and reverse-transcribed into cDNA using SuperScript.RTM.
VILO.TM. Master Mix (Invitrogen, Cat #11755050) as per the
manufacturer's instructions. TaqMan.RTM. was performed using Gene
Expression Master Mix, the ABI 7900HT Sequence Detection System
(Applied Biosystems) and the primers and probes indicated below in
Table 9. The GAPDH gene was used as the internal control gene to
normalize any cDNA input differences.
TABLE-US-00011 TABLE 9 Taqman probes and primers Gene Probe
Sequence Forward Primer Reverse Primer ABCA1
CTGACCAATGTGAACAGCTCCAGC ACATGCGACAGGAGGTGATG ATGCCCGCAGA CAATACGA
ABCG1 AGATAATAACCTCACGGAAGCCCAGCG GGACCTGCTGAATGGACATC CCGAGGCAAG
GAGGAGAA GADPH TCAACAGCGACACCCACTCCTC CCAGGTGGTCTCCTCTGACT
GCTTGACAAAG TGGTCGTTGA
[0853] All compounds demonstrated induction of LXR endogenous
effector target genes ABCA1 and ABCG1 in human THP1 macrophages
(FIG. 14). Compounds 9d and 9h showed the highest potency, with
ABCA1 induction EC.sub.50 values that were sub-picomolar, and with
ABCG1 induction EC.sub.50 values that were sub-picomolar. The other
compounds tested showed similar levels of ABCA1 and ABCG1 gene
activation compared to 9d and 9h, but they activated with
nano-molar EC.sub.50 values.
Example 67
[0854] This example demonstrates the generation of bioassay cell
lines for evaluation of the LXR-agonists and their antibody
conjugates.
[0855] A bioassay was developed to assess the activity of LXR
agonists after internalization of an agonist or of a ncADC into
cells and binding to LXR, a nuclear receptor, using a commercially
available LXR reporter (referred to as LXR-Luc) that contains the
firefly luciferase gene under control by minimal CMV promoter and
tandem repeats of the LXR transcriptional response element. For
this assay, a THP1 cell line, which is a human monocytic leukaemia
line, was engineered to express full length human Her2 (expressing
amino acids M1 through V1255 of accession number NP_004439.2). The
subsequent stable cell line was further transduced with a Cignal
LXR Luc Reporter (Qiagen, Cat # CLS-7041L). The resulting stable
cell line is referred to herein as THP1/Her2/LXR-Luc. The Her2 cell
surface expression on THP1/Her2/LXR-Luc cell line was confirmed by
FACS (data not shown).
[0856] Additionally, a THP1 cell line was transduced with a Cignal
LXR Luc Reporter (Qiagen, Cat # CLS-7041L) without the addition of
Her2. The resulting stable cell line is referred to herein as
THP1/LXR-Luc. All of the antibodies used in in the subsequent
bioassays were assessed for their ability to internalize and
release a payload on the bioassay cell line used.
Example 68
[0857] This example assessed the ability of the LXR agonists
provided herein, reference compounds, and anti-Her2 antibody-LXR
ncADC to activate LXR. The samples were tested in the
THP1/LXR-Luc/Her2 bioassay. For the assay, either THP1/LXR-Luc
cells or THP1/LXR-Luc/Her2 cells were seeded onto white 96 well
plates at 30,000 cells/well in media containing RPMI supplemented
with 10% FBS and pencillin/streptomycin (complete media).
Subsequently 3-fold serial dilutions of antibody drug conjugates,
unconjugated antibodies, or free payloads were added to the cells
at final concentration ranging from 100 nM to 0.01 nM. After
48-hour or 72-hour incubation, luciferase activity was determined
after the addition of One-Glo.TM. reagent (Promega, Cat # E6130) to
each well of cells. Relative light units (RLUs) were measured on a
Victor luminometer (PerkinElmer) and the EC.sub.5o values were
determined using a four-parameter logistic equation over a 10-point
dose response curve (GraphPad Prism) (FIG. 15). The EC.sub.50
values of LXR agonists of the invention and reference compounds are
shown in the Table 3. The EC.sub.50 values of the ncADCs and
simultaneously tested LXR agonists are shown in Table 10. The fold
activation is calculated based on the maximum activation of the
free payload 9d. Molecules tested that demonstrated greater than
75% of the activation of the free payload 9d are termed "full
activation". Molecules tested that demonstrated from 25% maximal
activation to 75% maximal activation of the free payload 9d are
termed "partial activation". Molecules tested that demonstrated
less than 25% of the activation of the free payload 9d are termed
"no activation".
[0858] As shown in Table 10, at 48-hour time point, the free
payload, 9d, induced a full activation of THP1/LXR-Luc/Her2 cells
with an EC.sub.50 value of 1.6 nM. Anti-Her2 antibody
site-specifically conjugated with linker payloads containing 9d
stimulated activation of THP1/LXR-Luc/Her2 cells with EC.sub.50
values ranging from 0.51 nM to 0.83 nM (Anti-Her2-LP2, LP3, LP5,
and LP8). Negative isotype control antibodies conjugated with
linker payloads containing 9d did not demonstrate significant
activation, except for the control with LP2, which demonstrated
slight activation at the highest concentrations tested. The free
payload, 9j, induced a full activation of THP1/LXR-Luc/Her2 cells
with an EC.sub.50 value of 0.39 nM. An anti-Her2 antibody
site-specifically conjugated with a linker payload containing 9j
(Anti-Her2-LP4) stimulated activation of THP1/LXR-Luc/Her2 cells
with an EC.sub.50 value of 0.60 nM. A negative isotype control
antibody conjugated with a linker payload containing 9j
demonstrated slight activation at the highest concentrations
tested. The free payload, 9h, induced a full activation of
THP1/LXR-Luc/Her2 cells with an EC.sub.5o value of 0.50 nM. An
anti-Her2 antibody site-specifically conjugated with a linker
payload containing 9h (Anti-Her2-LP12) stimulated activation of
THP1/LXR-Luc/Her2 cells with an EC.sub.50 value of 0.47 nM. A
negative isotype control antibody with a linker payload containing
9h demonstrated slight activation at the highest concentrations
tested.
[0859] As shown in Table 10, at 72-hour time point, the free
payload, 9d, induced a full activation of THP1/LXR-Luc/Her2 cells
with an EC.sub.50 value of 2.8 nM. Anti-Her2 antibody
site-specifically conjugated with linker payloads containing 9d
stimulated activation of THP1/LXR-Luc/Her2 cells with EC.sub.50
values ranging from 0.46 nM to 0.80 nM (Anti-Her2-LP2, LP3, LP5,
and LP8). Negative isotype control antibodies conjugated with
linker payloads containing 9d did not demonstrate significant
activation, except for the control with LP2, which demonstrated
slight activation at the highest concentrations tested. The free
payload, 9j, induced a full activation of THP1/LXR-Luc/Her2 cells
with an EC.sub.50 value of 0.47 pM. An anti-Her2 antibody
site-specifically conjugated with a linker payload containing 9j
(Anti-Her2-LP4) stimulated activation of THP1/LXR-Luc/Her2 cells
with an EC.sub.50 value of 0.55 pM. A negative isotype control
antibody conjugated with a linker payload containing 9j
demonstrated slight activation at the highest concentrations
tested. The free payload, 9h, induced a full activation of
THP1/LXR-Luc/Her2 cells with an EC.sub.5o value of 0.65 nM. An
anti-Her2 antibody site-specifically conjugated with a linker
payload containing 9h (Anti-Her2-LP12) stimulated activation of
THP1/LXR-Luc/Her2 cells with an EC.sub.50 value of 0.45 nM. A
negative isotype control antibody conjugated with a linker payload
containing 9h demonstrated slight activation at the highest
concentrations tested.
TABLE-US-00012 TABLE 10 Activation in THP1/LXR-Luc/Her2 Assay by
LXR agonists and ncADCs 48 hours 72 hours Level of Level of
EC.sub.50 Molecule activation EC.sub.50 activation (nM) Anti
Her2-LP2 Full activation 8.3E-10 Full activation 8.0E-10 Isotype
control-LP2 Partial activation NA Partial activation NA Anti
Her2-LP3 Full activation 5.1E-10 Full activation 4.6E-10 Isotype
control-LP3 No activation NA No activation NA Anti Her2-LP4 Full
activation 6.0E-10 Full activation 5.5E-10 Isotype control-LP4
Partial activation 5.7E-08 Partial activation 3.8E-08 Anti Her2-LP5
Full activation 5.5E-10 Full activation 5.7E-10 Isotype control-LP5
No activation NA No activation NA Anti Her2-LP8 Full activation
6.5E-10 Full activation 7.0E-10 Isotype control-LP8 No activation
NA No activation NA Anti Her2-LP12 Full activation 4.7E-10 Full
activation 4.5E-10 Isotype control-LP12 Partial activation NA
Partial activation NA 9d, payload of LP2, 3, 5, & 8 Full
activation 1.6E-09 Full activation 2.8E-09 9h, payload of LP12 Full
activation 5.0E-10 Full activation 6.5E-10 9j, payload of LP4 Full
activation 3.9E-10 Full activation 4.7E-10 Anti Her2 antibody alone
No activation NA No activation NA NA: not applicable.
Example 69
ADC Conjugation
[0860] This example demonstrates another method for site-specific
conjugation, generally, of a payload to an antibody or
antigen-binding fragment thereof.
[0861] Generated anti-MSR1 antibodies were mutated (N297Q) to
incorporate a transglutaminase site for conjugation with a
therapeutic payload. The site-specific aglycosylated antibodies
containing an N297Q mutation were conjugated with
amine-PEG.sub.3-N.sub.3 to generate the azido-functionalized
antibody conjugates (mAb-N.sub.3), including anti MSR1
Ab-PEG.sub.3-N.sub.3.
[0862] The present example demonstrates a method for making the
conjugates. Aglycosylated antibody with a human IgG1 isotype in
BupH.TM. (pH 7-8) was mixed with .gtoreq.200 molar equivalents of
azido-dPEG.sub.3-amine (MW. 218.26 g/mol). The resulting solution
was mixed with transglutaminase (25 U/mL; 5U MTG per mg of
antibody) resulting in a final concentration of the antibody at
0.5-10 mg/mL, and the solution was then incubated at 37.degree. C.
for 4-24 hours while gently shaking. The reaction was monitored by
SDS-PAGE or ESI-MS. Upon the completion, the excess amine and MTG
were removed by Size Exclusion Chromatography (SEC) to generate the
azido-functionalized antibody (mAb-N3). This product was analyzed
on SDS-PAGE and ESI-MS. The azido-dPEG.sub.3-amine added to two
sites--Q295 and Q297- of the antibody resulting in an 804 Da
increase for the 4DAR aglycosylated antibody-PEG.sub.3-azide
conjugate. The conjugation sites were identified and confirmed at
EEQ.sup.LinkerYQ.sup.LinkerSTYR for the 4DAR azido-functionalized
antibody via peptide sequence mapping of trypsin digested heavy
chains.
[0863] The site-specific aglycosylated antibody drug conjugates
(ADCs) with a human IgG1 or IgG4 containing an N297Q mutation were
prepared by a [2+3] click reaction between the azido-functionalized
antibody (mAb-N.sub.3) with an alkyne containing linker-payload
(LP).
[0864] A site-specific antibody conjugate with linker-payload (LP)
was prepared by incubating mAb-PEG.sub.3-N.sub.3 (1-12 mg/mL) in an
aqueous medium (e.g., PBS, PBS containing 5% glycerol, HBS) with
.gtoreq.6 molar equivalents of an LP dissolved in a suitable
organic solvent, such as DMSO, DMF or DMA (i.e., the reaction
mixture contains 5-20% organic solvent, v/v) at 24.degree. C. to
37.degree. C. for 30 min to 24 hr. The progress of the reaction was
monitored by ESI-MS and the absence of mAb-PEG3-N3 indicated the
completion of the conjugation. The excess amount of the LP and
organic solvent were removed by SEC via elution with PBS, or via
protein A column chromatography via elution with acidic buffer
followed by neutralization with Tris (pH 8.0). The purified
conjugates were analyzed by SEC, SDS-PAGE, and ESI-MS.
[0865] In a specific example, the azido-functionalized antibody (1
mg) in 0.800 mL PBSg (PBS, 5% glycerol, pH 7.4) was treated with
six molar equivalents of DIBAC-PEG.sub.4-D-Lys
(COT-.varies.-CD)-VC-PABC-payload (conc. 10 mg/mL in DMSO) for 2
hours at rt and the excess linker payload (LP) was removed by size
exclusion chromatography (SEC, Superdex 200 HR, GE Healthcare). The
final product was concentrated by ultra-centrifugation and
characterized by UV, SEC, SDS-PAGE and ESI-MS.
Example 70
Characterization of ADCs by LC-ESI-MS
[0866] Measurement of intact mass for the ADC samples by LC-ESI-MS
was performed to determine the drug-payload distribution profile
and to calculate the average DAR. Each testing sample (20-50 ng, 5
uL) was loaded onto an Acquity UPLC Protein BEH C4 column (10K psi,
300 .ANG., 1.7 .mu.m, 75 .mu.m.times.100 mm; Cat No. 186003810).
After 3 min. desalting, the protein was eluted and mass spectra
were acquired by a Waters Synapt G2-Si mass spectrometer. As
summarized in Table 12, most site-specific ADCs have 3.9-4 DAR for
the site specific conjugates.
TABLE-US-00013 TABLE 11 Linker-Payload Properties HPLC HPLC purity
R.sub.t MS (m/z) Highest LP cLogP MF MW (%) (min) 100% m/z peak LP8
-0.38 C.sub.124H.sub.175N.sub.11O.sub.44 2523.76 98 6.45, 841.8
1262.4 6.55 [M/3 + H] [M/2 + H] (B) (30%) LP32 -3.92
C.sub.136H.sub.195N.sub.11O.sub.54 2848.04 96 7.48 955.0 1424.2 (B)
[(M +18)/3] (M/2 + H) 949.5 (30%) (M/3 + H) LP15 7.53
C.sub.72H.sub.100N.sub.10O.sub.13 1313.62 96 8.16 657.5 1313.6 (B)
(M/2 + H) (M + H) (5%) LP13 -1.48
C.sub.138H.sub.193N.sub.15O.sub.49 2846.08 100 6.11, 949.0 1423.3
6.21 (M/3 + H) (M/2 + H) (B) (5%) LP36 6.59
C.sub.115H.sub.160N.sub.16O.sub.28S 2246.66 100 7.24 749.5 1123.8
(B) (M/3 + H) (M/2 + H) (5%) LP39 8.70
C.sub.88H.sub.112N.sub.10O.sub.18 1597.89 95 5.67 799.0 799.0 (B)
(M/2 + H) (M/2 + H) LP311 8.17 C.sub.89H.sub.117N.sub.11O.sub.16
1596.95 95 8.51 798.5 798.5 (B) (M/2 + H) (M/2 + H) LP18 6.49
C.sub.101H.sub.142N.sub.12O.sub.23S 1924.34 97 7.57 642.2 962.5 (B)
(M/3 + H) (M/2 + H) (70%)
TABLE-US-00014 TABLE 12 ADC Properties MW Ab, Ab-N.sub.3, MS m/z
DAR LP # (LP) or ncADC (ncADC) (ESI-MS) H1H27729P H1H27729P-N.sub.3
144166 4 8 2523.8 H1H27729P-LP8 H1H27731P 144620 4
H1H27731P-N.sub.3 8 2523.8 H1H27731P-LP8 H1H27732P 144176 5.7
H1H27732P-N.sub.3 8 2523.8 H1H27732P-LP8 H1H27734P 145110 4.4
H1H27734P-N.sub.3 8 2523.8 H1H27734P-LP8 H1H27736P 145940 4
H1H27736P-N.sub.3 8 2523.8 H1H27736P-LP8 H1H27739P 145251 4
H1H27739P-N.sub.3 8 2523.8 H1H27739P-LP8 H1H27747P 145214 5.3
H1H27747P-N.sub.3 8 2523.8 H1H27747P-LP8 H1H27749P 143441 4
H1H27749P-N.sub.3 8 2523.8 H1H27749P-LP8 H1H17751P 146092 3.8
H1H17751P-N.sub.3 8 2523.8 H1H17751P-LP8 H1H27754P 145477 4.2
H1H27754P-N.sub.3 8 2523.8 H1H27754P-LP8 H1H27756P 145503
H1H27756P-N.sub.3 146310 4 8 2523.8 H1H27756P-LP8 156424 4
H1H17759P2 145126 H1H17759P2-N.sub.3 145930 4 8 2523.8
H1H17759P2-LP8 156046 4 H1H17760P2 145611 H1H17760P2-N.sub.3 146431
4 8 2523.8 H1H17760P-LP8 156533 4 H1H17761P2 145508
H1H17761P2-N.sub.3 146717 6 8 2523.8 H1H17761P2-LP8 161884 159158
5.34 H1H27762P2 144371 H1H27762P2-N.sub.3 145177 4 8 2523.8
H1H27762P2-LP8 155294 4 H1H27766P2 146314 H1H27766P2-N.sub.3 147121
4 8 2523.8 H1H27766P2-LP8 157236 4 H1H27771P2 145966
H1H27771P2-N.sub.3 146774 4 8 2523.8 H1H27771P2-LP8 156890 4
H1H27773P2 145533 H1H27773P2-N.sub.3 146337 4 8 2523.8
H1H27773P2-LP8 156453 4 H1H27778P2 145310 H1H27778P2-N.sub.3 146115
4 8 2523.8 H1H27778P2-LP8 156227 4 H1H21231N H1H21231N-N.sub.3 Lot2
2 8 2523.8 H1H21231N-LP8 Lot4 1.9 H1H21227N H1H21227N-N.sub.3 Lot2
4 8 2523.8 H1H21227N-LP8 Lot3 3.7 H1H21231N H1H21231N-N.sub.3 Lot2
6 8 2523.8 H1H21231N-LP8 Lot3 5.9 H1H21235N 145487
H1H21235N-N.sub.3 146288 4 8 2523.8 H1H21235N-LP8 156390 4.1
H1H25700N 145484 H1H25700N-N.sub.3 146688 6 8 2523.8 H1H25700N-LP8
161873 6 H1H25690N 145157 H1H25690N-N.sub.3 145969 4 8 2523.8
H1H25690N-LP8 156060 4.1 H1H25695N 145736 H1H25695N-N.sub.3 146537
4 8 2523.8 H1H25695N-LP8 156637 3.9 H1H25685N 145380
H1H25685N-N.sub.3 146582 6 8 2523.8 H1H25685N-LP8 161767 5.8
H1H21228N 144830 H1H21228N-N.sub.3 145631 4 8 2523.8 H1H21228N-LP8
155732 4.2 H1H21234N 145790 H1H21234N-N.sub.3 146583 4 8 2523.8
H1H21234N-LP8 156691 4 32 2848.1 H1H21234N-LP32 157983 3.9 15
1313.7 H1H21234N-LP15 151841 3.9 13 2846.2 H1H21234N-LP13 157963
3.9 36 2246.7 H1H21234N-LP36 155570 3.9 39 1597.9 H1H21234N-LP39
152975 3.9 311 1597.0 H1H21234N-LP311 152979 3.9 Fel D1 isotype
control-N297Q isotype control-N297Q-N.sub.3 146251 4 8 2523.8
isotype control-N297Q-LP8 156352 3.9
Example 71
Biacore Surface Plasmon Resonance Derived Binding Kinetics of
Anti-MSR1 Antibody-Drug Conjugates
[0867] The MSR1 antibodies disclosed herein were conjugated to
various liver X receptor (LXR) payloads. This example describes how
equilibrium dissociation constant (K.sub.D) values for human MSR1
reagents binding to human anti-MSR1 antibody-drug conjugates and
their corresponding unconjugated parental antibodies were
determined using a real-time surface plasmon resonance-based
Biacore T200 biosensor.
[0868] All binding studies were performed in 10 mM HEPES, 300 mM
NaCl, 3 mM EDTA, and 0.05% v/v Surfactant Tween-20, pH 7.4 (HBS-ET)
running buffer at 25.degree. C. The Biacore CM4 sensor chip surface
was first derivatized by amine coupling with the goat anti-human
Fc.gamma. specific polyclonal antibody (Jackson ImmunoResearch
Laboratories, Cat # BR-1008-39) to capture anti-MSR1 monoclonal
antibodies. Binding studies were performed on human MSR1
extracellular domain expressed with a N-terminal nonahistidine tag
(His9-hMSR1; R&D Systems, Cat #2708-MS). Different
concentrations of His9-hMSR1 (100 nM-3.7 nM or 30 nM-3.33 nM;
3-fold serial dilution) were first prepared in HBS-ET running
buffer and were injected over anti-human Fc.gamma. captured
anti-MSR1 monoclonal antibody surface for 3 minutes at a flow rate
of 50 .mu.L/minute, while the dissociation of monoclonal antibody
bound MSR1 reagent was monitored for about 8-10 minutes in HBS-ET
running buffer.
[0869] The association rate (k.sub.a) and dissociation rate
(k.sub.d) were determined by fitting the real-time binding
sensorgrams to a 1:1 binding model with mass transport limitation
using Scrubber 2.0c curve-fitting software. Binding dissociation
equilibrium constant (K.sub.D) and dissociative half-life (t1/2)
were calculated from the kinetic rates as:
K D .function. ( M ) = kd ka , and .times. .times. t .times.
.times. 1 .times. / .times. 2 .times. ( min ) = ln .function. ( 2 )
60 * kd ##EQU00001##
[0870] Binding kinetics parameters for His9-hMSR1 binding to
different anti-MSR1 antibody-LXR ADCs and their unconjugated
parental antibodies at 25.degree. C. are shown in Table 13. "LP1"
represents a linker-payload for which the payload structure is
provided in Example 111a.
TABLE-US-00015 TABLE 13 Binding kinetics of His-hMSR1 binding to
MSR1 Antibody-LXR ADCs and Corresponding Unconjugated Antibodies at
25.degree. C. Antibody Captured ka (M.sup.-1 s.sup.-1) kd
(s.sup.-1) K.sub.D (Molar) t1/2 (min) H1H27729P-N297Q 1.05E+05
9.06E-04 8.67E-09 12.8 H1H27729P-N297Q-LP8 5.47E+04 7.18E-04
1.31E-08 16.1 H1H27731P-N297Q 1.17E+05 1.00E-05 8.55E-11 1155.2
H1H27731P-N297Q-LP8 1.28E+05 1.00E-05* 7.80E-11 1155.2
H1H27732P-N297Q 2.20E+05 1.00E-05* 4.50E-11 1155.2
H1H27732P-N297Q-LP8 1.50E+05 1.00E-05* 6.60E-11 1155.2
H1H27734P-N297Q 7.72E+04 5.96E-04 7.72E-09 19.4 H1H27734P-N297Q-LP8
6.93E+04 4.49E-04 6.49E-09 25.7 H1H27736P-N297Q 1.14E+05 1.47E-04
1.29E-09 78.7 H1H27736P-N297Q-LP8 9.59E+04 1.21E-04 1.26E-09 95.5
H1H27739P-N297Q 1.19E+05 5.55E-04 4.68E-09 20.8 H1H27739P-N297Q-LP8
8.88E+04 7.22E-04 8.14E-09 16.0 H1H27747P-N297Q 1.17E+05 2.62E-04
2.24E-09 44.1 H1H27747P-N297Q-LP8 1.36E+05 2.03E-04 1.49E-09 56.9
H1H27749P-N297Q 1.43E+05 1.00E-05* 6.99E-11 1155.2
H1H27749P-N297Q-LP8 1.40E+05 1.00E-05* 7.16E-11 1155.2
H1H27751P-N297Q 2.10E+05 1.75E-04 8.33E-10 66.1 H1H27751P-N297Q-LP8
2.29E+05 1.52E-04 6.64E-10 76.1 H1H27754P-N297Q 2.00E+05 1.00E-05*
4.99E-11 1155.2 H1H27754P-N297Q-LP8 1.77E+05 1.00E-05* 5.64E-11
1155.2 H1H27756P-N297Q 7.21E+04 1.19E-04 1.65E-09 97.4
H1H27756P-N297Q-LP8 6.27E+04 1.10E-04 1.76E-09 104.7
H1H27759P-N297Q 1.03E+05 4.35E-04 4.23E-09 26.6 H1H27759P-N297Q-LP8
1.30E+05 5.95E-04 4.57E-09 19.4 H1H27760P-N297Q 2.31E+05 3.83E-04
1.66E-09 30.2 H1H27760P-N297Q-LP8 2.59E+05 4.34E-04 1.67E-09 26.6
H1H27761P-N297Q 5.95E+05 3.62E-04 6.09E-10 31.9 H1H27761P-N297Q-LP8
2.53E+05 5.11E-04 2.02E-09 22.6 H1H27762P-N297Q 4.05E+05 5.60E-04
1.38E-09 20.6 H1H27762P-N297Q-LP8 4.83E+05 6.23E-04 1.29E-09 18.5
H1H27766P-N297Q 1.72E+05 1.00E-05* 5.83E-11 1155.2
H1H27766P-N297Q-LP8 4.16E+05 2.70E-05 6.49E-11 427.4
H1H27771P-N297Q 3.83E+05 3.55E-04 9.26E-10 32.6 H1H27771P-N297Q-LP8
3.38E+05 4.42E-04 1.31E-09 26.1 H1H27773P-N297Q 5.49E+04 7.52E-04
1.37E-08 15.4 H1H27773P-N297Q-LP8 2.72E+04 9.47E-04 3.48E-08 12.2
H1H27778P-N297Q 1.66E+05 2.71E-04 1.63E-09 42.6 H1H27778P-N297Q-LP8
2.85E+05 2.76E-04 9.70E-10 41.8 H1H21234N-N297Q 2.20E+05 1.00E-05*
4.54E-11 1155.2 H1H21234N-N297Q-LP8 4.90E+05 1.00E-05* 2.04E-11
1155.2 H1xH29273P2 8.20E+04 7.63E-03 9.30E-08 1.5 H1xH29282P2
8.28E+04 3.62E-03 4.37E-08 3.2 H1xH29283P2 1.39E+05 1.85E-03
1.34E-08 6.2 *indicates that no dissociation of His9-hMSR1 was
observed under the current experimental conditions and the k.sub.d
value was manually fixed at 1.00E-05 while fitting the data
.sup.$indicates that no binding was observed under the current
experimental conditions.
[0871] At 25.degree. C., different anti-MSR1 antibody-LXR
conjugates bound to 9.times.His-hMSR1 with K.sub.D values ranging
from less than or equal to 0.6 pM to 34.8 nM, while the
unconjugated parental antibodies bound to 9.times.His-hMSR1 with
K.sub.D values ranging from less than or equal to 0.6 pM to 13.7 nM
as shown in Table 13.
Example 72
Anti-MSR1 Antibody-LXR Conjugates Activate Agonist Binding in a
LXR-Luciferase Reporter Bioassay
[0872] Generation of Assay Cell Line.
[0873] To test the efficacy of anti-MSR1 antibody-LXR conjugates in
vitro, a cell-based LXR responsive luciferase reporter assay was
developed. To generate the assay cell line, a LXR regulated
luciferase reporter gene [Cignal Lenti LXR Reporter (luc) kit
(Qiagen, Cat # CLS-001L)] was transduced into THP1 cells, and cells
were selected for two weeks in puromycin. The lentivirus expresses
the firefly luciferase gene under the control of a minimal CMV
promoter and tandem repeats of the LXR transcriptional response
element. The resulting cell line is referred to as THP1/LXR-Luc
cells.
[0874] Assay Protocol.
[0875] THP1/LXR-Luc cells were seeded onto 96 well plates at 40,000
cells/well in media containing RPMI supplemented with 10% FBS and
pencillin/streptomycin and subsequently differentiated with 200 nM
Phorbol Myristate Acetate (PMA) for 3 days. After the 3-day
differentiation period, three-fold serial dilutions of antibody
drug conjugates, unconjugated antibodies, or free payloads in fresh
media were added to the cells at final concentration ranging from
100 nM to 0.01 nM. Media alone served as a blank control.
Forty-eight hours later, luciferase activity was determined after
the addition of One-Glo.TM. reagent (Promega, Cat # E6130) to each
well. Relative light units (RLUs) were measured on a Victor
luminometer (PerkinElmer) and EC.sub.50 values were determined
using a four-parameter logistic equation over a 10-point dose
response curve (GraphPad Prism). The EC.sub.50 value of each
reagent tested is shown in Table 14. The signal to noise (S/N) was
determined by calculating the ratio of RLU of standard one over RLU
of standard eight for each of the unconjugated anti-MSR1 antibodies
or free payloads. "LP #" represents a linker-payload for which the
corresponding structures are provided elsewhere herein, and "P #"
represents a payload for which the corresponding structures are
provided elsewhere herein.
TABLE-US-00016 TABLE 14 Agonist Activity of Anti-MSR1 Antibody-LXR
Conjugates, Payloads, and Unconjugated Antibodies Molecule tested
EC.sub.50 (M) S/N H1H21231N-N297Q-LP8 8.6E-10 14.5
H1H21227N-N297Q-LP8 8.9E-10 31.0 H1H21231N-N297Q-LP8 1.73E-09 38.6
H1H21234N-N297Q-LP8 3.65E-09 18.4 H1H21234N-N297Q-LP15 6.3E-10 9.0
H1H21234N-N297Q-LP13 9.8E-10 9.6 H1H21234N-N297Q-LP36 1.02E-09 9.2
H1H21234N-N297Q-LP39 1.12E-09 8.3 H1H21234N-N297Q-LP311 8.1E-10
10.0 H1H21234N-N297Q-LP32 8.7E-10 9.1 H1H27729N-N297Q-LP8 1.64E-09
14.5 H1H27731N-N297Q-LP8 1.46E-09 15.5 H1H27732N-N297Q-LP8 8.2E-10
19.1 H1H27734N-N297Q-LP8 5.19E-09 17.8 H1H27736N-N297Q-LP8 1.01E-09
16.4 H1H27739N-N297Q-LP8 1.60E-09 21.0 H1H27747N-N297Q-LP8 4.77E-09
20.6 H1H27749N-N297Q-LP8 1.46E-09 13.1 H1H27751N-N297Q-LP8 1.54E-09
17.9 H1H27754N-N297Q-LP8 1.30E-09 17.3 H1H27756N-N297Q-LP8 1.61E-09
18.6 H1H27759N-N297Q-LP8 5.94E-09 18.9 H1H27760N-N297Q-LP8 6.34E-09
21.5 H1H27761N-N297Q-LP8 5.72E-09 20.7 H1H27762N-N297Q-LP8 7.02E-09
16.4 H1H27766N-N297Q-LP8 1.277E-08 11.3 H1H27771N-N297Q-LP8
2.41E-09 17.3 H1H27773N-N297Q-LP8 >4.05E-08 12.9
H1H27778N-N297Q-LP8 1.51E-09 16.1 H1H21235N-N297Q-LP8 8.3E-10 8.2
H1H25700N-N297Q-LP8 1.13E-09 7.4 H1H25690N-N297Q-LP8 2.5E-10 8.0
H1H25695N-N297Q-LP8 1.87E-09 9.8 H1H25685N-N297Q-LP8 7.8E-10 8.3
Isotype Control-N297Q-LP8 >6.6E-08 2.7 H1H21234N-N297Q No
activation No activation 9d 1.14E-09 15.9 9j 4.6E-10 5.7 9l
2.09E-09 8.9 9o 3.7E-10 8.3
[0876] As shown in Table 14, at the 48-hour time point, all of the
anti-MSR1 antibodies conjugated with LP 8 demonstrated stimulation
of the THP1/Luc cells with EC.sub.50 values ranging from 0.2 nM to
greater than 140.5 nM with S/N values ranging from 7.4 to 38.6. One
exemplary anti-MSR1 antibody-LXR conjugate (H1H21234N-N297Q-LP 8)
demonstrated stimulation of the THP1/Luc cells with an EC.sub.50
value of 3.7 nM and S/N of 18.4. The free payload, 9d, demonstrated
stimulation of the THP1/Luc cells with an average EC.sub.50 of 15.9
nM. The isotype control antibody conjugated with LP 8 (Isotype
control-LP 8) had an average EC.sub.50 value of >66 nM and S/N
of 2.7. Additionally, H1H21234N-N297Q conjugated with additional
LXR agonist linker-payloads (H1H21234N-N297Q-LP 15,
H1H21234N-N297Q-LP 13, H1H21234N-N297Q-LP 36, H1H21234N-N297Q-LP
39, H1H21234N-N297Q-LP 311, and H1H21234N-N297Q-LP 32) tested
demonstrated stimulation of the THP1/Luc cells with EC.sub.50
values ranging from 0.63 nM to greater than 73 nM and S/N ranging
from 1.4 to 10. Additional LXR agonist payloads tested (9j, 9l, and
9o) demonstrated stimulation of the THP1/Luc cells with EC.sub.50
values ranging from 0.37 nM to 2.09 nM and S/N ranging from 5.7 to
8.9. One unconjugated anti-MSR1 antibody (H1H21234N) alone did not
have any impact on stimulation of the THP/Luc cells.
Example 73
Anti-MSR1 Antibody-LXR Conjugates Activate Cholesterol Efflux in
THP-1 Cells
[0877] The ability of anti-MSR1 antibody-LXR conjugates to activate
cholesterol efflux in a human macrophage cell line (THP-1; ATCC
Catalog # TIB-202), was assessed using a fluorescent cholesterol
analog.
[0878] Briefly, THP-1 cells were seeded onto 96-well poly-lysine
coated plates (Corning, Catalog #354640) at 100,000 cells/well in
RPMI 1640 media (Irvine Scientific, Catalog #9160) containing 10%
FBS (Gibco, Catalog #1043010), 10 .mu.g/mL penicillin-streptomycin
(Gibco, Catalog #15140122) and incubated at 5% CO.sub.2 at
37.degree. C. Cells were differentiated into macrophages by
addition of 100 nM Phorbol-12 myristate 13-acetate (Sigma, Catalog
#P 8139) to the media and subjected to further incubation for 96
hours. Differentiated macrophages were then incubated in phenol red
free RPMI 1640 media (Gibco, Catalog #32404-014) containing 25 pM
BODIPY-cholesterol (Avanti Polar Lipids, Catalog #810255P), 0.2%
bovine serum albumin (BSA; Sigma Catalog # A7211), and 10 .mu.g/mL
penicillin-streptomycin for 24 hours, followed by a 24-hour
treatment with serial dilutions of ranging from 1.times.10.sup.7 M
to 5.times.10.sup.-14 M of either free payload, anti-MSR1
antibody-LXR conjugate (H1H21234N-N297Q-LP 8), Isotype control-LXR
conjugate (Isotype control-N297Q-LP 8), and unconjugated anti-MSR1
antibody (H1H21234N) in phenol red free RPMI 1640 media containing
0.2% BSA. Cells were washed with phenol red free RPMI 1640 media
and incubated with 100 .mu.L of acceptor media containing 50
.mu.g/mL high density lipoprotein (Millipore Catalog #437641), 10
.mu.g/mL apolipoprotein A1 (Millipore, Catalog #ALP10) in phenol
red free RPMI 1640 media for 5 hours, after which, the acceptor
media was collected and cells were lysed in 100 .mu.L of RIPA
buffer (Millipore, Catalog #20-188) for 2 hours with gentle
agitation at room temperature. Fluorescence was measured in these
fractions at excitation 482 nm, emission 515 nm in SpectraMax i3
plate reader (Molecular Devices).
[0879] Percentage of BODIPY-cholesterol efflux was calculated using
the following formula: [fluorescence in acceptor
media/(fluorescence in acceptor media+fluorescence in cell
lysate)].times.100. Table 15 provides activated cholesterol efflux
for the tested articles, and FIG. 15 illustrates the data in graph
form.
TABLE-US-00017 TABLE 15 Activation of cholesterol efflux by
antibody- LXR conjugates and comparators Cholesterol Efflux Maximum
activation efflux Molecule tested EC.sub.50 (M) (%) 9d 1.5E-10 36.7
H1H21234N-N297Q-LP8 5.0E-11 36.7 Isotype control-N297Q-LP8
>6.4E-8 30.3 H1H21234N-N297Q N/A 18.7
[0880] As shown in Table 15, after 24 hours, H1H21234N-N297Q-LP 8
conjugate demonstrated the largest amount of cholesterol efflux
with a maximum percent efflux of 36.6% and an EC.sub.50 value of 50
pM. The free payload 9d demonstrated the second largest amount of
cholesterol efflux with a maximum percent efflux of 36.6% and an
EC.sub.50 value of 150 pM. The Isotype control-N297Q-LP 8 conjugate
demonstrated a minimal amount of cholesterol efflux with a maximum
percent efflux of 30.3%. The unconjugated antibody,
H1H21234N-N297Q, did not demonstrated any measurable cholesterol
efflux.
Example 74
In Vivo Effect of Anti-MSR1 Antibody-LXR Conjugates on
Atherosclerosis in a Mouse Model
[0881] The effect of an anti-MSR1 antibody-LXR agonist conjugate,
H1H21234N-N297Q-LP 8, on atherosclerosis development was evaluated
in vivo in mice homozygous for the expression of human MSR1
extracellular domain in place of the mouse MSR1 extracellular
domain and homozygous for deletion of the apoE gene (referred to
herein as Msr1.sup.hu/hu ApoE.sup.-/- mice).
[0882] The Msr1.sup.hu/hu ApoE.sup.-/- mice were pre-bled 6 days
before the start of the experiment after 4-hour fast and were then
placed on an atherogenic western diet (Research Diets, Cat
#106452). The mice were sorted into groups (n=7-9 each) based on
their baseline triglycerides (TG) and low-density lipoprotein
cholesterol (LDL-C) values. An MSR1 antibody (H1H21234N-N297Q) or
MSR1 antibody-LXR agonist conjugate (H1H21234N-N297Q-LP 8) were
administered by weekly subcutaneous injections at 25 mg/kg dose
(based on the antibody concentration) starting on day 0 for 16
weeks. Serum was collected at 4, 8, and 16 weeks of the study after
4-hour fast to evaluate serum lipids using AdviaXPT Chemistry
System (Siemens). Average serum lipid values were calculated for
each time point. Results, expressed as (mean.+-.SEM) are shown in
FIG. 16. FIG. 16 illustrates that administration of the MSR1
antibody-LXR agonist conjugate H1H21234N-N297Q-LP 8 did not have an
effect on serum lipid levels.
[0883] Mice were sacrificed at the end of the study under nonfasted
conditions 6 days after the last injection anti-MSR1 antibody or
MSR1 antibody-LXR agonist ncADC, and their heart and liver were
collected. Hearts were imbedded in Optimal cutting temperature
compound (OCT), and sectioned perpendicular to the axis of the
aorta, starting within the heart and working in the direction of
the aortic arch. Once the aortic root was identified by the
appearance of aortic valve leaflets, serial cross sections (12
.mu.m thick) were taken and mounted on consecutive slides (VWR
International, Cat #16004-406). These sections were stained with
hematoxylin and eosin stain (H&E stain), Oil Red O lipid stain,
and rat-anti-CD68 antibody, (Abcam, Cat # ab201844) to label
macrophages for analysis. An Aperio AT2 slide scanner (Leica
Biosystems, Illinois) was used to scan the slides and to generate
images. For each mouse, the lipid area was measured using HALO
software (Indica Labs, New Mexico) in 7 subsequent cross sections
based on Oil Red O staining, and subsequently the average of total
lesion lipid area per mouse was calculated using these
measurements. All measurements were conducted by an analyst who was
blinded to the treatment groups. Results, expressed as
(mean.+-.SEM) are shown in FIG. 17A. FIG. 17A illustrates that
administration of the MSR1 antibody-LXR agonist conjugate
H1H21234N-N297Q-LP 8 led to reduction in atherosclerotic lesion
area.
[0884] In addition, H&E stained slides were used to calculate
Intima/Media ratio, which represents the normalized value of plaque
size. The internal and external elastic laminas of arterial media
and lumen areas were measured in 7 subsequent cross sections for
each mouse using the H&E stained sections and the average
values were calculated per mouse. Intima/media ratio were
calculated using the equation:
Intima/media ratio=(Internal elastic lamina area-Lumen
area)/(External elastic lamina area-Internal elastic lamina
area)
Results, expressed as (mean.+-.SEM) are shown in FIG. 17B.
[0885] The macrophage content in the sections was measured using
slides stained with rat anti-CD68 antibody. For each mouse,
macrophage positive area was measured using HALO software in at
least 5 subsequent cross sections, and the average of total
macrophage content per mouse was calculated using these
measurements. Results, expressed as (mean.+-.SEM) are shown in FIG.
17C. FIG. 17C illustrates that administration of the MSR1
antibody-LXR agonist conjugate H1H21234N-N297Q-LP 8 led to
reduction in macrophage content.
[0886] Livers collected at sacrifice were used for qRT-PCR and
lipid extraction. One piece of liver from each mouse was placed in
RNAlader (Invitrogen, Cat #AM7023) for RNA extraction and then the
expression of lipogenic genes (Srebf1, Acc, Fasn) to evaluated de
novo lipogenesis was evaluated by qRT-PCR using standard methods.
Results, expressed as (mean.+-.SEM) are shown in FIG. 18. FIG. 18
illustrates that administration of the MSR1 antibody-LXR agonist
conjugate H1H21234N-N297Q-LP 8 has no effect on hepatic
triglyceride or cholesterol level.
[0887] Lipids were extracted from the second piece of liver from
each mouse by Folch's method and solubilized by Carr's method. The
levels of TG, total and free cholesterol were measured using
enzymatic assays for detection (Teco Diagnostics, Cat # T532-480
(TG); Thermo Fisher Scientific, Cat #TR13421 (total cholesterol);
Waco Diagnostics, Cat #993-02501 (free cholesterol)) and normalized
to wet tissue weight. Results, expressed as (mean SEM) are shown in
FIG. 19. FIG. 19 illustrates that administration of the MSR1
antibody-LXR agonist conjugate H1H21234N-N297Q-LP 8 has no effect
on hepatic de novo lipogenesis.
Sequence CWU 1
1
1314PRTArtificial SequenceSyntheticmisc_featureOxygen group
replaces the nitrogen at the N-terminus 1Ala Ala Ala
Ala124PRTArtificial SequenceSyntheticmisc_featureHydroxyl group
replaces the nitrogen at the N-terminus 2Ala Ala Ala
Ala134PRTArtificial SequenceSynthetic 3Ala Ala Ala
Ala149PRTArtificial SequenceSyntheticmisc_feature(3)..(4)Linker
sitemisc_feature(5)..(6)Linker site 4Glu Glu Gln Tyr Gln Ser Thr
Tyr Arg1 5524DNAArtificial SequenceSynthetic 5ctgaccaatg tgaacagctc
cagc 24620DNAArtificial SequenceSynthetic 6acatgcgaca ggaggtgatg
20719DNAArtificial SequenceSynthetic 7atgcccgcag acaatacga
19827DNAArtificial SequenceSynthetic 8agataataac ctcacggaag cccagcg
27920DNAArtificial SequenceSynthetic 9ggacctgctg aatggacatc
201018DNAArtificial SequenceSynthetic 10ccgaggcaag gaggagaa
181122DNAArtificial SequenceSynthetic 11tcaacagcga cacccactcc tc
221220DNAArtificial SequenceSynthetic 12ccaggtggtc tcctctgact
201321DNAArtificial SequenceSynthetic 13gcttgacaaa gtggtcgttg a
21
* * * * *