U.S. patent application number 17/250810 was filed with the patent office on 2022-04-14 for myc-max inhibitor compound therapeutics for cancer treatment, methods and uses associated therewith.
The applicant listed for this patent is THE UNIVERSITY OF BRITISH COLUMBIA. Invention is credited to Fuqiang BAN, Lavinia A. CARABET, Nada LALLOUS, Eric J.J. LEBLANC, Helene MORIN, Paul S. RENNIE, Kriti SINGH, Artem TCHERKASSOV, Anh-Tien TON.
Application Number | 20220112157 17/250810 |
Document ID | / |
Family ID | |
Filed Date | 2022-04-14 |
View All Diagrams
United States Patent
Application |
20220112157 |
Kind Code |
A1 |
TCHERKASSOV; Artem ; et
al. |
April 14, 2022 |
MYC-MAX INHIBITOR COMPOUND THERAPEUTICS FOR CANCER TREATMENT,
METHODS AND USES ASSOCIATED THEREWITH
Abstract
Provided herein are Myc-Max inhibitory compounds having the
structure of Formula (I) and compositions thereof for use in the
treatment of cancer. In particular, the Myc-Max inhibitory
compounds may be useful for the treatment of cancers selected from
one or more of: prostate cancer, breast cancer, colon cancer,
cervical cancer, small-cell lung carcinomas, neuroblastomas,
osteosarcomas, glioblastomas, melanoma and myeloid leukaemia.
##STR00001##
Inventors: |
TCHERKASSOV; Artem;
(Vancouver, CA) ; RENNIE; Paul S.; (Richmond,
CA) ; BAN; Fuqiang; (Markham, CA) ; LEBLANC;
Eric J.J.; (Vancouver, CA) ; CARABET; Lavinia A.;
(Burnaby, CA) ; LALLOUS; Nada; (Vancouver, CA)
; SINGH; Kriti; (Vancouver, CA) ; MORIN;
Helene; (Vancouver, CA) ; TON; Anh-Tien;
(Vancouver, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
THE UNIVERSITY OF BRITISH COLUMBIA |
Vancouver |
|
CA |
|
|
Appl. No.: |
17/250810 |
Filed: |
September 5, 2019 |
PCT Filed: |
September 5, 2019 |
PCT NO: |
PCT/CA2019/051243 |
371 Date: |
March 5, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62727071 |
Sep 5, 2018 |
|
|
|
International
Class: |
C07C 237/22 20060101
C07C237/22; C07C 335/16 20060101 C07C335/16; C07C 275/30 20060101
C07C275/30; C07D 403/12 20060101 C07D403/12; C07C 335/18 20060101
C07C335/18; C07D 405/12 20060101 C07D405/12; C07D 213/61 20060101
C07D213/61; C07D 333/20 20060101 C07D333/20; C07D 231/14 20060101
C07D231/14; C07D 311/16 20060101 C07D311/16; C07D 213/40 20060101
C07D213/40; C07D 413/12 20060101 C07D413/12; C07D 403/06 20060101
C07D403/06; C07D 265/30 20060101 C07D265/30; C07D 307/14 20060101
C07D307/14; C07D 417/12 20060101 C07D417/12; C07C 311/18 20060101
C07C311/18; C07D 265/36 20060101 C07D265/36; C07D 261/08 20060101
C07D261/08; C07D 409/06 20060101 C07D409/06; C07D 277/36 20060101
C07D277/36; C07D 417/06 20060101 C07D417/06; C07D 211/42 20060101
C07D211/42; C07D 249/08 20060101 C07D249/08; C07D 471/04 20060101
C07D471/04; C07D 239/42 20060101 C07D239/42; C07D 241/24 20060101
C07D241/24; C07C 255/66 20060101 C07C255/66 |
Claims
1. A compound, the compound having the structure of Formula I:
##STR00218## wherein, M.sup.1 is selected from: ##STR00219##
M.sup.2 is selected from: ##STR00220## ##STR00221## CH.sub.3 or
NH.sub.2; A.sup.1 is selected from CH.sub.2, CH(CH.sub.3),
CH(CH.sub.2CH.sub.3), CH(CH(CH.sub.3).sub.2), or CHX; A.sup.2 is
CH.sub.2 or CH(CH.sub.3); T.sup.1 is H or CH.sub.3; T2 is H or
CH.sub.3; D.sup.1 is O or S; n.sup.1 is 0-3, wherein if n.sup.1 is
2 or 3, each A.sup.1 may be independently selected from CH.sub.2,
CH(CH.sub.3), CH(CH.sub.2CH.sub.3), CH(CH(CH.sub.3).sub.2), or CHX;
n.sup.2 is 0-1; n.sup.3 is 1 or 2, wherein if n.sup.3 is 2, each
D.sup.1 may be independently selected from O or S; n.sup.4 is 0-3,
wherein if n.sup.4 is 2 or 3, each T.sup.2 may be independently
selected from H or CH.sub.3; n.sup.5 is 0-3, wherein if n.sup.5 is
2 or 3, each A.sup.2 may be independently selected from CH.sub.2,
CH(CH.sub.3), CH(CH.sub.2CH.sub.3), CH(CH(CH.sub.3).sub.2), or CHX;
X is ##STR00222## E.sup.1 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl,
Br, CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00223## E.sup.2 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00224## E.sup.3 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00225## E.sup.4 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2), OCH.sub.2C(CH.sub.3)CH.sub.2)
##STR00226## E.sup.5 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3(CH.sub.2), ##STR00227## E.sup.6 is H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2), OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00228## E.sup.7 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00229## G.sup.1 is H,
OCH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2); L.sup.1 is H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2), OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00230## L.sup.2 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00231## L.sup.3 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00232## L.sup.4 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00233## L.sup.5 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00234## L.sup.6 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00235## L.sup.7 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00236## and provided that when
M.sup.1 is ##STR00237## and G.sup.1 is H, then n.sup.3 is 1;
wherein the compound is for use in the treatment of one or more of
the following: prostate cancer; breast cancer; colon cancer;
cervical cancer; small-cell lung carcinoma; neuroblastomas;
osteosarcoma; glioblastoma; melanoma; and myeloid leukaemia.
2. The compound of claim 1, wherein M.sup.1 is selected from:
##STR00238## and wherein M.sup.2 is selected from: ##STR00239##
CH.sub.3 or NH.sub.2.
3. The compound of claim 1 or 2, wherein A.sup.1 is selected from
CH.sub.2, CH(CH.sub.3) or CH(CH.sub.2CH.sub.3); wherein A.sup.2 is
CH.sub.2 or CH(CH.sub.3); and wherein G.sup.1 is H, OCH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2 or
S(.dbd.O).sub.2(NH.sub.2).
4. The compound of claim 1, 2 or 3, wherein E.sup.1 is H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2), OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00240## E.sup.2 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00241## E.sup.3 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00242## E.sup.4 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00243## E.sup.5 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00244## E.sup.6 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00245## E.sup.7 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00246## L.sup.1 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00247## L.sup.2 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00248## L.sup.3 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00249## L.sup.4 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00250## L.sup.5 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00251## L.sup.6 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00252## and L.sup.7 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00253##
5. The compound of any one of claims 1-4, wherein the compound has
the structure of Formula II: ##STR00254##
6. The compound of any one of claims 1-5, wherein the compound has
the structure of Formula III: ##STR00255##
7. The compound of claim 1, wherein the compounds is selected from
TABLE 3.
8. A compound, the compound having the structure of Formula IV:
##STR00256## wherein, D.sup.2 is O or S; D.sup.3 is O or S; J.sup.1
is H, CH.sub.3, CH.sub.2CH.sub.3, ##STR00257## or is absent (+);
R.sup.1 is ##STR00258## M.sup.3 is selected from: ##STR00259##
E.sup.8 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3;
E.sup.9 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3;
E.sup.10 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3;
E.sup.11 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3;
E.sup.12 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3;
E.sup.13 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3;
E.sup.14 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3;
L.sup.8 is H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00260## L.sup.9 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00261## L.sup.10 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00262## L.sup.11 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00263## L.sup.12 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2), ##STR00264## L.sup.13 is H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3; and L.sup.14 is
H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3; wherein the
compound is for use in the treatment of one or more of the
following: prostate cancer; breast cancer; colon cancer; cervical
cancer; small-cell lung carcinoma; neuroblastomas; osteosarcoma;
glioblastoma; melanoma; and myeloid leukaemia.
9. The compound of claim 8, wherein the compound is selected from
one or more of: ##STR00265##
10. A compound of any one of claims 1-9, for use in the treatment
of cancer.
11. The compound of claim 10, wherein the cancer is selected from
one or more of the following: prostate cancer; breast cancer; colon
cancer; cervical cancer; small-cell lung carcinoma; neuroblastomas;
osteosarcoma; glioblastoma; melanoma; and myeloid leukaemia.
12. A pharmaceutical composition for treating cancer, comprising
compound of any one of claims 1-9 and a pharmaceutically acceptable
carrier.
13. The pharmaceutical composition of claim 12, wherein the cancer
is selected from one or more of the following: prostate cancer;
breast cancer; colon cancer; cervical cancer; small-cell lung
carcinoma; neuroblastomas; osteosarcoma; glioblastoma; melanoma;
and myeloid leukaemia.
14. Use of compound of any one of claims 1-9 for treating
cancer.
15. Use of compound of any one of claims 1-9 in the manufacture of
a medicament for treating cancer.
16. The use of claim 14 or 15, wherein the cancer is selected from
one or more of the following: prostate cancer; breast cancer; colon
cancer; cervical cancer; small-cell lung carcinoma; neuroblastomas;
osteosarcoma; glioblastoma; melanoma; and myeloid leukaemia.
17. A commercial package comprising (a) compound of any one of
claims 1-9 and a pharmaceutically acceptable carrier; and (b)
instructions for the use thereof for treating cancer.
18. A commercial package comprising (a) a pharmaceutical
composition comprising compound of any one of claims 1-9 and a
pharmaceutically acceptable carrier; and (b) instructions for the
use thereof for treating cancer.
19. The commercial package of claim 17 or 18, wherein the cancer is
selected from one or more of the following: prostate cancer; breast
cancer; colon cancer; cervical cancer; small-cell lung carcinoma;
neuroblastomas; osteosarcoma; glioblastoma; melanoma; and myeloid
leukaemia.
20. A compound of any one of Formulas I-IV, provided that the
compound excludes all of the compounds set out in TABLES 3 and
4.
21. A compound having the structure ##STR00266## for use in the
treatment of cancer.
22. The compound of claim 21, wherein the cancer is selected from
one or more of the following: prostate cancer; breast cancer; colon
cancer; cervical cancer; small-cell lung carcinoma; neuroblastomas;
osteosarcoma; glioblastoma; melanoma; and myeloid leukaemia.
23. A pharmaceutical composition for treating cancer, comprising
the compound of claim 21 and a pharmaceutically acceptable
carrier.
24. The pharmaceutical composition of claim 23, wherein the cancer
is selected from one or more of the following: prostate cancer;
breast cancer; colon cancer; cervical cancer; small-cell lung
carcinoma; neuroblastomas; osteosarcoma; glioblastoma; melanoma;
and myeloid leukaemia.
25. Use of compound having the structure ##STR00267## for treating
cancer.
26. Use of compound having the structure ##STR00268## in the
manufacture of a medicament for treating cancer.
27. The use of claim 25 or 26, wherein the cancer is selected from
one or more of the following: prostate cancer; breast cancer; colon
cancer; cervical cancer; small-cell lung carcinoma; neuroblastomas;
osteosarcoma; glioblastoma; melanoma; and myeloid leukaemia.
Description
TECHNICAL FIELD
[0001] The present invention relates to the field of Myc-Max
inhibitors. In particular, the invention relates to Myc-Max
inhibitor compounds for use in the treatment of cancer.
BACKGROUND
[0002] Myc is a transcription factor that regulates growth in
normal cells, but in many cancers over-activity of Myc results in
high rates of growth needed for tumor proliferation and progression
[1, 2]. Myc drives tumorigenesis by transcriptional programming of
a large number of target genes that promote cell growth,
proliferation, metabolism and apoptosis, and block differentiation
[3-7]. Myc is estimated to contribute to most if not all human
cancers, including prostate, breast, colon, cervical cancers,
small-cell lung carcinomas, neuroblastomas, osteosarcomas,
glioblastomas, melanoma, and myeloid leukaemia, most of which are
aggressive and respond poorly to the current therapies [1, 8,
9].
[0003] In prostate cancer (PCa), which is the second leading cause
of cancer-related death in men, the Myc family members--L-Myc,
c-Myc and N-Myc--are implicated in pathogenesis and progression
across the full spectrum of PCa, from localized adenocarcinoma to
the most advanced and treatment-resistant
subtypes--castration-resistant (CRPC) and its neuroendocrine
phenotype (NEPC). Amplifications of Myc family members are the most
frequently observed genomic alterations associated with specific
clinical stages and subtypes of PCa [10-16]. L-Myc is amplified in
.about.27% of localized PCa, in a mutually exclusive manner to
c-Myc [11], whereas c-Myc is commonly amplified in all PCa stages
and subtypes [17]. Notably, c-Myc overexpression antagonizes the
transcriptional activity of the androgen receptor (AR), which is a
driving force in PCa and constitutes the main drug target for
advanced cases of disease [18]. Besides influencing clinically
relevant AR target genes, c-Myc upregulation also affects critical
splicing programs [19] and increases levels of AR-V7--the
constitutively active ligand-independent AR splice variant that
promotes CRPC [20, 21] and is also observed in NEPC [14].
Importantly, N-Myc amplifications induce the NEPC phenotype [14,
15, 22].
[0004] To elicit its oncogenic effects, Myc must form a heterodimer
with its obligate partner Max, which together bind to the DNA and
activate transcription of the target genes [23-26]. Although Myc
could qualify as an ideal cancer target, applying conventional
structure-based drug design approaches is inherently challenging in
drugging Myc. Myc and Max are intrinsically disordered proteins
(IDP), which exist as dynamic ensembles, with no effective pockets
on their surfaces [27-29]. The disordered
basic-helix-loop-helix-leucine zipper (bHLHLZ) domain of the Myc
monomer forms DNA-binding functionalities only via association with
the homologous bHLHLZ domain of Max [23, 30]. Only upon such
heterodimerization does the resulting Myc-Max complex adopt a
stable helical configuration which can bind specific DNA
recognition sequences 5'-CACGTG-3', termed E-boxes, at enhancers
and promoters of target genes, and thereby trigger the recruitment
of chromatin-remodeling complexes and assembly of the
transcriptional machinery to drive the transcriptional program [31,
32]. Myc and Max oligomerize through their helix-loop-helix (HLH)
and leucine zipper (LZ) regions and bind DNA mainly through highly
positively charged basic (b) region and specific residues located
in the HLH region [33, 34].
[0005] Although Myc inactivation may have undesired effects on
normal cells, experimental mouse models of KRAS-driven lung cancer
carrying a conditionally inducible Omomyc construct--a Myc dominant
negative, 93 residue bHLHZ protein fragment with 4 single-point
mutations in the LZ region--established that periodic inhibition is
effective at stopping cancer growth with mild and tolerable side
effects, suggesting a viable therapeutic strategy [35, 36].
[0006] Small molecule inhibition of Myc, a therapeutically
compelling oncogenic transcription factor, has been a challenge for
a long time. Current strategies that directly target Myc in cancer
include inhibitors of Myc-Max protein-protein interactions, such as
10058-F4, 10074-G5, and JY-3-094 [37, 38], or protein-DNA
interactions, such as Mycro3 [39] and KJ-Pyr-9 [40], and inhibitors
of Myc expression with G-quadruplex stabilizers, antisense
oligonucleotides, and siRNA [41, 42]. Indirect approaches have been
reviewed elsewhere [41, 43, 44].
[0007] Compounds 10058-F4, 10074-A4, and 10074-G5 are among the
first identified direct small molecules Myc inhibitors that bind
with mid-micromolar range affinity at 3 independent sites on the
disordered bHLHLZ domain of the Myc (c- and N-Myc) monomer (as
validated by mutagenesis and NMR experiments) [37, 45, 46]. The
efforts to identify them relied on functional screening of finite
libraries unlikely to contain clinically-optimized structures.
Attempts to find more potent and selective analogs have yet to
succeed given the inconsistent behavior of compounds in in vitro
assays [47, 48]. Moreover, these compounds lack proper antitumor
activity in vivo due to rapid metabolism to inactive metabolites,
resulting in low tumoral concentrations insufficient to inhibit
Myc-Max dimerization [49, 50]. Thus, further more effective small
molecule inhibitors of Myc-Max are needed.
SUMMARY
[0008] The present invention is based in part, on the surprising
discovery that the compounds described herein modulate Myc-Max
activity. Specifically, some compounds identified herein, also show
inhibition of Myc-Max in prostate cancer cells.
[0009] In accordance with one embodiment, there is provided a
compound, the compound having the structure of Formula I:
##STR00002##
wherein, M.sup.1 may be selected from:
##STR00003##
M.sup.2 may be selected from:
##STR00004## ##STR00005##
CH.sub.3 or NH.sub.2; A.sup.1 may be selected from CH.sub.2,
CH(CH.sub.3), CH(CH.sub.2CH.sub.3), CH(CH(CH.sub.3).sub.2), or CHX;
A.sup.2 may be CH.sub.2 or CH(CH.sub.3); T may be H or CH.sub.3;
T.sup.2 may be H or CH.sub.3; D.sup.1 may be O or S; n.sup.1 may be
0-3, wherein if n.sup.1 may be 2 or 3, each A.sup.1 may be
independently selected from CH.sub.2, CH(CH.sub.3),
CH(CH.sub.2CH.sub.3), CH(CH(CH.sub.3).sub.2), or CHX; n.sup.2 may
be 0-1; n.sup.3 may be 1 or 2, wherein if n.sup.3 may be 2, each
D.sup.1 may be independently selected from O or S; n.sup.4 may be
0-3, wherein if n.sup.4 may be 2 or 3, each T.sup.2 may be
independently selected from H or CH.sub.3; n.sup.5 may be 0-3,
wherein if n.sup.5 may be 2 or 3, each A.sup.2 may be independently
selected from CH.sub.2, CH(CH.sub.3), CH(CH.sub.2CH.sub.3),
CH(CH(CH.sub.3).sub.2), or CHX;
X may be
##STR00006##
[0010] E.sup.1 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00007##
E.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00008##
E.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00009##
E.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00010##
E.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00011##
E.sup.6 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00012##
E.sup.7 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00013##
G.sup.1 may be H, OCH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2); L.sup.1 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2), OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00014##
L.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00015##
L.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00016##
L.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00017##
L.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00018##
L.sup.6 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00019##
L.sup.7 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00020##
and provided that when M.sup.1 is
##STR00021##
and G.sup.1 is H, then n.sup.3 is 1; and wherein the compound may
be for use in the treatment of one or more of the following:
prostate cancer; breast cancer; colon cancer; cervical cancer;
small-cell lung carcinoma; neuroblastomas; osteosarcoma;
glioblastoma; melanoma; and myeloid leukaemia. Alternatively,
n.sup.2 may be 0-3, wherein if n.sup.2 may be 2 or 3, each T.sup.1
may be independently selected from H or CH.sub.3. M.sup.1 may be
selected from:
##STR00022##
and M.sup.2 may be selected from:
##STR00023##
CH.sub.3 or NH.sub.2. M.sup.1 may be selected from:
##STR00024##
M.sup.1 may be selected from:
##STR00025##
M.sup.1 may be selected from:
##STR00026##
M.sup.1 may be selected from:
##STR00027##
M.sup.1 may be selected from:
##STR00028##
M.sup.1 may be selected from:
##STR00029##
M.sup.1 may be
##STR00030##
[0012] M.sup.2 may be selected from:
##STR00031##
CH.sub.3 or NH.sub.2. M.sup.2 may be selected from:
##STR00032##
CH.sub.3 or NH.sub.2. M.sup.2 may be selected from:
##STR00033##
CH.sub.3 or NH.sub.2. M.sup.2 may be selected from:
##STR00034##
CH.sub.3 or NH.sub.2. M.sup.2 may be selected from:
##STR00035##
CH.sub.3 or NH.sub.2. M.sup.2 may be selected from:
##STR00036##
CH.sub.3 or NH.sub.2. M.sup.2 may be selected from:
##STR00037##
or CH.sub.3. M.sup.2 may be selected from:
##STR00038##
or NH.sub.2. M.sup.2 may be selected from:
##STR00039##
M.sup.2 may be selected from:
##STR00040##
M.sup.2 may be selected from:
##STR00041##
M.sup.2 may be selected from:
##STR00042##
M.sup.2 may be selected from:
##STR00043##
M.sup.2 may be selected from:
##STR00044##
M.sup.2 may be selected from:
##STR00045##
M.sup.2 may be selected from:
##STR00046##
M.sup.2 may be selected from:
##STR00047##
M.sup.2 may be selected from:
##STR00048##
M.sup.2 may be selected from:
##STR00049##
M.sup.2 may be selected from:
##STR00050##
M.sup.2 may be selected from:
##STR00051##
M.sup.2 may be selected from:
##STR00052##
M.sup.2 may be selected from:
##STR00053##
A.sup.1 may be selected from CH.sub.2, CH(CH.sub.3) or
CH(CH.sub.2CH.sub.3). A.sup.2 may be CH.sub.2 or CH(CH.sub.3).
G.sup.1 may be H, OCH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2 or S(.dbd.O).sub.2(NH.sub.2). A.sup.1 may be
selected from CH.sub.2 or CH(CH.sub.3). A.sup.2 may be CH.sub.2.
G.sup.1 may be H, OCH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. A.sup.1 may be selected from CH.sub.2.
A.sup.2 may be CH.sub.2. A.sup.1 may be absent where n.sup.1 is 0.
A.sup.2 may be absent where n.sup.5 is 0. G.sup.1 may be H,
OCH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3 or OCF.sub.3.
G.sup.1 may be H, OCH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br or
CF.sub.3. G.sup.1 may be H, F, Cl, Br or CF.sub.3. G.sup.1 may be H
or S(.dbd.O).sub.2(NH.sub.2). G.sup.1 may be H, OCH.sub.3,
CH.sub.2CH.sub.3 or S(.dbd.O).sub.2(NH.sub.2). G.sup.1 may be H, F,
Cl, Br or S(.dbd.O).sub.2(NH.sub.2). G.sup.1 may be H. E.sup.1 may
be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00054##
E.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00055##
E.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00056##
E.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00057##
E.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00058##
E.sup.6 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00059##
E.sup.7 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00060##
E.sup.1 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). E.sup.2 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
E.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). E.sup.4 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
E.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). E.sup.6 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
E.sup.7 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). E.sup.1 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
E.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. E.sup.3 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
E.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. E.sup.5 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
E.sup.6 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. E.sup.7 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
E.sup.1 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br or
CF.sub.3. E.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br
or CF.sub.3. E.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl,
Br or CF.sub.3. E.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F,
Cl, Br or CF.sub.3. E.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3,
F, Cl, Br or CF.sub.3. E.sup.6 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br or CF.sub.3. E.sup.7 may be H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br or CF.sub.3. E.sup.1 may be
H, F, Cl, Br or CF.sub.3. E.sup.2 may be H, F, Cl, Br or CF.sub.3.
E.sup.3 may be H, F, Cl, Br or CF.sub.3. E.sup.4 may be H, F, Cl,
Br or CF.sub.3. E.sup.5 may be H, F, Cl, Br or CF.sub.3. E.sup.6
may be H, F, Cl, Br or CF.sub.3. E.sup.7 may be H, F, Cl, Br or
CF.sub.3. L.sup.1 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00061##
L.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00062##
L.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00063##
L.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00064##
L.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00065##
L.sup.6 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00066##
L.sup.7 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00067##
L.sup.1 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00068##
L.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00069##
L.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00070##
L.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00071##
L.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00072##
L.sup.6 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00073##
L.sup.7 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00074##
L.sup.1 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.2 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
L.sup.3 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.4 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
L.sup.5 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.6 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
L.sup.7 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.1 may be H, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.2 may be H, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.3 may be H, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.4 may be H, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.5 may be H, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.6 may be H, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.7 may be H, F, Cl, Br,
CF.sub.3, OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.U may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.2 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. L.sup.3 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.4 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. L.sup.5 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.6 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. L.sup.7 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.1 may be H, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.2 may be H, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.3 may be H, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.4 may be H, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.5 may be H, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.6 may be H, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.7 may be H, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.1 may be H, CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or
OCF.sub.2. L.sup.2 may be H, CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3 or OCF.sub.2. L.sup.3 may be H, CH.sub.3, F, Cl, Br,
CF.sub.3, OCF.sub.3 or OCF.sub.2. L.sup.4 may be H, CH.sub.3, F,
Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2. L.sup.5 may be H,
CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2. L.sup.6 may
be H, CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or OCF.sub.2.
L.sup.7 may be H, CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3 or
OCF.sub.2. L.sup.1 may be H, F, Cl, Br or CF.sub.3. L.sup.2 may be
H, F, Cl, Br or CF.sub.3. L.sup.3 may be H, F, Cl, Br or CF.sub.3.
L.sup.4 may be H, F, Cl, Br or CF.sub.3. L.sup.5 may be H, F, Cl,
Br or CF.sub.3. L.sup.6 may be H, F, Cl, Br or CF.sub.3. L.sup.7
may be H, F, Cl, Br or CF.sub.3.
[0013] In accordance with another embodiment, there is provided a
compound of any one of claims 1-4, wherein the compound has the
structure of Formula II:
##STR00075##
[0014] In accordance with another embodiment, there is provided a
compound of any one of claims 1-5, wherein the compound has the
structure of Formula III:
##STR00076##
[0015] The compound may be selected from TABLE 3. The compound may
be one or more of VPC-70063 or VPC-70063. The compound may be one
or more of VPC-70063, VPC-70223; VPC-70215; VPC-70021; VPC-70277;
VPC-70314; VPC-70033; VPC-70084; VPC-70413; VPC-70511; VPC-70514;
VPC-70523; VPC-70524; VPC-70525; VPC-70532; VPC-70498; VPC-70495;
VPC-70489; VPC-70477; VPC-70390; VPC-70393; VPC-70496; VPC-70535;
VPC-70561; VPC-70526; VPC-70529; VPC-70530; VPC-70465; VPC-70527;
VPC-70478; VPC-70501; VPC-70506; VPC-70437; VPC-70458; VPC-70466;
VPC-70387; and VPC-70531.
[0016] In accordance with another embodiment, there is provided a
compound, the compound having the structure of Formula IV:
##STR00077##
wherein, D.sup.2 may be O or S; D.sup.3 may be O or S; J.sup.1 may
be H, CH.sub.3, CH.sub.2CH.sub.3,
##STR00078##
or may be absent (+); R.sup.1 may be
##STR00079##
M.sup.3 may be selected from:
##STR00080##
E.sup.8 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or
CF.sub.3; E.sup.9 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br,
or CF.sub.3; E.sup.10 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl,
Br, or CF.sub.3; E.sup.11 may be H, CH.sub.3, CH.sub.2CH.sub.3, F,
Cl, Br, or CF.sub.3; E.sup.12 may be H, CH.sub.3, CH.sub.2CH.sub.3,
F, Cl, Br, or CF.sub.3; E.sup.13 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3; E.sup.14 may be H,
CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or CF.sub.3; L.sup.8 may be
H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00081##
L.sup.9 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00082##
L.sup.10 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00083##
L.sup.11 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00084##
L.sup.12 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2),
OCH.sub.2C(CH.sub.3)(CH.sub.2),
##STR00085##
L.sup.13 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, or
CF.sub.3; and L.sup.14 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl,
Br, or CF.sub.3; and wherein the compound may be for use in the
treatment of one or more of the following: prostate cancer; breast
cancer; colon cancer; cervical cancer; small-cell lung carcinoma;
neuroblastomas; osteosarcoma; glioblastoma; melanoma; and myeloid
leukaemia.
[0017] M.sup.3 may be selected from:
##STR00086##
M.sup.3 may be selected from:
##STR00087##
M.sup.3 may be selected from:
##STR00088##
M.sup.3 may be selected from:
##STR00089##
M.sup.3 may be selected from:
##STR00090##
M.sup.3 may be selected from:
##STR00091##
M.sup.3 may be selected from:
##STR00092##
M.sup.3 may be selected from:
##STR00093##
M.sup.3 may be selected from:
##STR00094##
[0018] E.sup.8 may be H, CH.sub.3, F, Cl, Br, or CF.sub.3. E.sup.9
may be H, CH.sub.3, F, Cl, Br, or CF.sub.3. E.sup.10 may be H,
CH.sub.3, F, Cl, Br, or CF.sub.3. E.sup.11 may be H, CH.sub.3, F,
Cl, Br, or CF.sub.3. E.sup.12 may be H, CH.sub.3, F, Cl, Br, or
CF.sub.3. E.sup.13 may be H, CH.sub.3, F, Cl, Br, or CF.sub.3.
E.sup.14 may be H, CH.sub.3, F, Cl, Br, or CF.sub.3. L.sup.8 may be
H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3,
OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.9 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
L.sup.10 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.11 may be H, CH.sub.3,
CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3, OCF.sub.3, OCF.sub.2,
S(.dbd.O).sub.2(NH.sub.2) or OCH.sub.2C(CH.sub.3)(CH.sub.2).
L.sup.12 may be H, CH.sub.3, CH.sub.2CH.sub.3, F, Cl, Br, CF.sub.3,
OCF.sub.3, OCF.sub.2, S(.dbd.O).sub.2(NH.sub.2) or
OCH.sub.2C(CH.sub.3)(CH.sub.2). L.sup.13 may be H, CH.sub.3, F, Cl,
Br, or CF.sub.3. L.sup.14 may be H, CH.sub.3, F, Cl, Br, or
CF.sub.3.
[0019] The compound may be selected from one or more of:
##STR00095##
[0020] In a further embodiment there is provided a compound having
the structure
##STR00096##
for use in the treatment of cancer.
[0021] In a further embodiment there is provided a pharmaceutical
composition for treating cancer, including a compound having the
structure
##STR00097##
and a pharmaceutically acceptable carrier.
[0022] In a further embodiment there is provided a use of compound
having the structure
##STR00098##
for treating cancer.
[0023] In a further embodiment there is provided a use of compound
having the structure
##STR00099##
for treating cancer.
[0024] The cancer may be selected from one or more of the
following: prostate cancer; breast cancer; colon cancer; cervical
cancer; small-cell lung carcinoma; neuroblastomas; osteosarcoma;
glioblastoma; melanoma; and myeloid leukaemia.
[0025] In accordance with another embodiment, there is provided a
compound as described herein for use in the treatment of
cancer.
[0026] In accordance with another embodiment, there is provided a
pharmaceutical composition for treating cancer, comprising compound
as described herein and a pharmaceutically acceptable carrier.
[0027] The pharmaceutical composition of claim 12, wherein the
cancer is selected from one or more of the following: prostate
cancer; breast cancer; colon cancer; cervical cancer; small-cell
lung carcinoma; neuroblastomas; osteosarcoma; glioblastoma;
melanoma; and myeloid leukaemia.
[0028] In accordance with another embodiment, there is provided a
use of compound described herein for treating cancer.
[0029] In accordance with another embodiment, there is provided a
use of compound described herein for the manufacture of a
medicament for treating cancer.
[0030] In accordance with another embodiment, there is provided a
commercial package comprising (a) compound as described herein and
a pharmaceutically acceptable carrier; and (b) instructions for the
use thereof for treating cancer.
[0031] In accordance with another embodiment, there is provided a
commercial package comprising (a) a pharmaceutical composition
comprising compound described herein and a pharmaceutically
acceptable carrier; and (b) instructions for the use thereof for
treating cancer.
[0032] In accordance with another embodiment, there is provided a
compound of any one of Formulas I-IV, provided that the compound
excludes all of the compounds set out in TABLES 3 and 4.
[0033] The cancer may be one or more of the following: prostate
cancer; breast cancer; colon cancer; cervical cancer; small-cell
lung carcinoma; neuroblastomas; osteosarcoma; glioblastoma;
melanoma; and myeloid leukaemia. The cancer may be prostate
cancer.
[0034] Alternatively, the compounds of TABLE 5 may be used for
treating cancer, or may be combined with a pharmaceutically
acceptable carrier for the treatment of cancer. The cancer may be
selected from one or more of the following: prostate cancer; breast
cancer; colon cancer; cervical cancer; small-cell lung carcinoma;
neuroblastomas; osteosarcoma; glioblastoma; melanoma; and myeloid
leukaemia.
BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1 shows (A) a the IC.sub.50 of 8.5 .mu.M for VPC-70021
using the Cignal c-Myc kit using a range of concentrations from 24
nM to 50 .mu.M; and (B) the effect of VPC-70021 on growth of LNCaP
cells stimulated with androgen; PC3 cells; HL60 cells and; PC12
cells (Max negative).
[0036] FIG. 2 shows (A) dose response effect of selected hits in
LNCaP PCa cells on the transcriptional activity of c-Myc by using a
c-myc mediated luciferase reporter as compared to literature
inhibitors 10058-F4 and 10074-G5 used as positive controls, with
the data presented as mean f SEM of triplicates and expressed as a
percentage of luciferase activity relative to DMSO control; (B)
inhibition of Myc-Max reduces the levels of AR variant 7 in 22rv1
cells; and (C) the effect of VPC-70063 and VPC-70067 in comparison
with 10058-F4 and 10074-G5 on cell viability of Myc positive
(LNCaP) and Myc negative (HO15.19) cell lines, where the percent of
cell viability is plotted in dose dependent manner. Data points
represent the mean f 95% CI (confidence interval) of triplicates
and expressed as percent of cell viability relative to DMSO
control.
[0037] FIG. 3 shows (A) inhibition of Myc with VPC-70067 and
VPC-70063 resulted in apoptosis of LNCaP cells as indicated by
cleavage of PARP in Western blot; (B) purification of GST-Myc and
His-Max using size exclusion chromatography, where the fraction
highlighted with a black rectangle on the Western blot corresponds
to the fraction used for the binding assay; (C) inhibition of
Myc-Max interaction with the biotinylated E-box quantified by
bilayer interferometry (BLI) in presence of 500 .mu.M of the
studied compounds; (D) dose response inhibition of Myc-Max binding
to DNA in presence of best compound VPC-70063; and (E) mammalian
2-hybrid assay showing the effect of inhibitors on the interaction
between Myc and Max, with data points represent the mean f SEM of
at least three independent experiments. P<0.05 (*), P<0.01
(**) and P<0.001 (***) were considered statistically significant
compared with vehicle control (two-tailed t-test).
DETAILED DESCRIPTION
[0038] The following detailed description will be better understood
when read in conjunction with the appended figures. For the purpose
of illustrating the invention, the figures demonstrate embodiments
of the present invention. However, the invention is not limited to
the precise arrangements, examples, and instrumentalities
shown.
[0039] Any terms not directly defined herein shall be understood to
have the meanings commonly associated with them as understood
within the art of the invention.
[0040] The Myc-Max complex is an attractive target for direct
inhibition. In silico computational drug discovery methods were
used to conduct a virtual screen of more than 6 million purchasable
compounds from the ZINC database (Irwin, J. et al. Abstracts of
Papers Am. Chem. Soc. (2005) 230:U1009) to identify potential
Myc-Max complex binders. The in silico methods included large-scale
docking, in-site rescoring and consensus voting procedures.
[0041] It will be understood by a person of skill that COOH and NR2
may include the corresponding ions, for example carboxylate ions
and ammonium ions, respectively. Alternatively, where the ions are
shown, a person of skill in the art will appreciate that the
counter ion may also be present.
[0042] Those skilled in the art will appreciate that the point of
covalent attachment of the moiety to the compounds as described
herein may be, for example, and without limitation, cleaved under
specified conditions. Specified conditions may include, for
example, and without limitation, in vivo enzymatic or non-enzymatic
means. Cleavage of the moiety may occur, for example, and without
limitation, spontaneously, or it may be catalyzed, induced by
another agent, or a change in a physical parameter or environmental
parameter, for example, an enzyme, light, acid, temperature or pH.
The moiety may be, for example, and without limitation, a
protecting group that acts to mask a functional group, a group that
acts as a substrate for one or more active or passive transport
mechanisms, or a group that acts to impart or enhance a property of
the compound, for example, solubility, bioavailability or
localization.
[0043] In some embodiments, compounds of Formulas I-IV, as
described herein, may be used for systemic treatment of at least
one indication selected from the group consisting of: prostate
cancer, breast cancer, ovarian cancer, endometrial cancer, hair
loss, acne, hirsutism, ovarian cysts, polycystic ovary disease,
precocious puberty and age related macular degeneration.
Alternatively, the compounds of Formulas I-IV may be used for
systemic treatment of at least one indication selected from the
group consisting of: prostate cancer; breast cancer; colon cancer;
cervical cancer; small-cell lung carcinoma; neuroblastomas;
osteosarcoma; glioblastoma; melanoma; and myeloid leukaemia. the In
some embodiments compounds of Formulas I-IV may be used in the
preparation of a medicament or a composition for systemic treatment
of an indication described herein. In some embodiments, methods of
systemically treating any of the indications described herein are
also provided.
[0044] Compounds as described herein may be in the free form or in
the form of a salt thereof. In some embodiment, compounds as
described herein may be in the form of a pharmaceutically
acceptable salt, which are known in the art (Berge S. M. et al., J.
Pharm. Sci. (1977) 66(1):1-19). Pharmaceutically acceptable salt as
used herein includes, for example, salts that have the desired
pharmacological activity of the parent compound (salts which retain
the biological effectiveness and/or properties of the parent
compound and which are not biologically and/or otherwise
undesirable). Compounds as described herein having one or more
functional groups capable of forming a salt may be, for example,
formed as a pharmaceutically acceptable salt. Compounds containing
one or more basic functional groups may be capable of forming a
pharmaceutically acceptable salt with, for example, a
pharmaceutically acceptable organic or inorganic acid.
Pharmaceutically acceptable salts may be derived from, for example,
and without limitation, acetic acid, adipic acid, alginic acid,
aspartic acid, ascorbic acid, benzoic acid, benzenesulfonic acid,
butyric acid, cinnamic acid, citric acid, camphoric acid,
camphorsulfonic acid, cyclopentanepropionic acid, diethylacetic
acid, digluconic acid, dodecylsulfonic acid, ethanesulfonic acid,
formic acid, fumaric acid, glucoheptanoic acid, gluconic acid,
glycerophosphoric acid, glycolic acid, hemisulfonic acid, heptanoic
acid, hexanoic acid, hydrochloric acid, hydrobromic acid, hydriodic
acid, 2-hydroxyethanesulfonic acid, isonicotinic acid, lactic acid,
malic acid, maleic acid, malonic acid, mandelic acid,
methanesulfonic acid, 2-napthalenesulfonic acid,
naphthalenedisulphonic acid, p-toluenesulfonic acid, nicotinic
acid, nitric acid, oxalic acid, pamoic acid, pectinic acid,
3-phenylpropionic acid, phosphoric acid, picric acid, pimelic acid,
pivalic acid, propionic acid, pyruvic acid, salicylic acid,
succinic acid, sulfuric acid, sulfamic acid, tartaric acid,
thiocyanic acid or undecanoic acid. Compounds containing one or
more acidic functional groups may be capable of forming
pharmaceutically acceptable salts with a pharmaceutically
acceptable base, for example, and without limitation, inorganic
bases based on alkaline metals or alkaline earth metals or organic
bases such as primary amine compounds, secondary amine compounds,
tertiary amine compounds, quaternary amine compounds, substituted
amines, naturally occurring substituted amines, cyclic amines or
basic ion-exchange resins. Pharmaceutically acceptable salts may be
derived from, for example, and without limitation, a hydroxide,
carbonate, or bicarbonate of a pharmaceutically acceptable metal
cation such as ammonium, sodium, potassium, lithium, calcium,
magnesium, iron, zinc, copper, manganese or aluminum, ammonia,
benzathine, meglumine, methylamine, dimethylamine, trimethylamine,
ethylamine, diethylamine, triethylamine, isopropylamine,
tripropylamine, tributylamine, ethanolamine, diethanolamine,
2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine,
lysine, arginine, histidine, caffeine, hydrabamine, choline,
betaine, ethylenediamine, glucosamine, glucamine, methylglucamine,
theobromine, purines, piperazine, piperidine, procaine,
N-ethylpiperidine, theobromine, tetramethylammonium compounds,
tetraethylammonium compounds, pyridine, N,N-dimethylaniline,
N-methylpiperidine, morpholine, N-methylmorpholine,
N-ethylmorpholine, dicyclohexylamine, dibenzylamine,
N,N-dibenzylphenethylamine, 1-ephenamine,
N,N'-dibenzylethylenediamine or polyamine resins. In some
embodiments, compounds as described herein may contain both acidic
and basic groups and may be in the form of inner salts or
zwitterions, for example, and without limitation, betaines. Salts
as described herein may be prepared by conventional processes known
to a person skilled in the art, for example, and without
limitation, by reacting the free form with an organic acid or
inorganic acid or base, or by anion exchange or cation exchange
from other salts. Those skilled in the art will appreciate that
preparation of salts may occur in situ during isolation and
purification of the compounds or preparation of salts may occur by
separately reacting an isolated and purified compound.
[0045] In some embodiments, compounds and all different forms
thereof (e.g. free forms, salts, polymorphs, isomeric forms) as
described herein may be in the solvent addition form, for example,
solvates. Solvates contain either stoichiometric or
non-stoichiometric amounts of a solvent in physical association the
compound or salt thereof. The solvent may be, for example, and
without limitation, a pharmaceutically acceptable solvent. For
example, hydrates are formed when the solvent is water or
alcoholates are formed when the solvent is an alcohol.
[0046] In some embodiments, compounds and all different forms
thereof (e.g. free forms, salts, solvates, isomeric forms) as
described herein may include crystalline and amorphous forms, for
example, polymorphs, pseudopolymorphs, conformational polymorphs,
amorphous forms, or a combination thereof. Polymorphs include
different crystal packing arrangements of the same elemental
composition of a compound. Polymorphs usually have different X-ray
diffraction patterns, infrared spectra, melting points, density,
hardness, crystal shape, optical and electrical properties,
stability and/or solubility. Those skilled in the art will
appreciate that various factors including recrystallization
solvent, rate of crystallization and storage temperature may cause
a single crystal form to dominate.
[0047] In some embodiments, compounds and all different forms
thereof (e.g. free forms, salts, solvates, polymorphs) as described
herein include isomers such as geometrical isomers, optical isomers
based on asymmetric carbon, stereoisomers, tautomers, individual
enantiomers, individual diastereomers, racemates, diastereomeric
mixtures and combinations thereof, and are not limited by the
description of the formulas illustrated for the sake of
convenience.
[0048] In some embodiments, pharmaceutical compositions as
described herein may comprise a salt of such a compound, preferably
a pharmaceutically or physiologically acceptable salt.
Pharmaceutical preparations will typically comprise one or more
carriers, excipients or diluents acceptable for the mode of
administration of the preparation, be it by injection, inhalation,
topical administration, lavage, or other modes suitable for the
selected treatment. Suitable carriers, excipients or diluents (used
interchangeably herein) are those known in the art for use in such
modes of administration.
[0049] Suitable pharmaceutical compositions may be formulated by
means known in the art and their mode of administration and dose
determined by the skilled practitioner. For parenteral
administration, a compound may be dissolved in sterile water or
saline or a pharmaceutically acceptable vehicle used for
administration of non water soluble compounds such as those used
for vitamin K. For enteral administration, the compound may be
administered in a tablet, capsule or dissolved in liquid form. The
tablet or capsule may be enteric coated, or in a formulation for
sustained release. Many suitable formulations are known, including,
polymeric or protein microparticles encapsulating a compound to be
released, ointments, pastes, gels, hydrogels, or solutions which
can be used topically or locally to administer a compound. A
sustained release patch or implant may be employed to provide
release over a prolonged period of time. Many techniques known to
one of skill in the art are described in Remington: the Science
& Practice of Pharmacy by Alfonso Gennaro, 20th ed., Lippencott
Williams & Wilkins, (2000). Formulations for parenteral
administration may, for example, contain excipients, polyalkylene
glycols such as polyethylene glycol, oils of vegetable origin, or
hydrogenated naphthalenes. Biocompatible, biodegradable lactide
polymer, lactide/glycolide copolymer, or polyoxyethylene
polyoxypropylene copolymers may be used to control the release of
the compounds. Other potentially useful parenteral delivery systems
for modulatory compounds include ethylene vinyl acetate copolymer
particles, osmotic pumps, implantable infusion systems, and
liposomes. Formulations for inhalation may contain excipients, for
example, lactose, or may be aqueous solutions containing, for
example, polyoxyethylene 9 lauryl ether, glycocholate and
deoxycholate, or may be oily solutions for administration in the
form of nasal drops, or as a gel.
[0050] Compounds or pharmaceutical compositions as described herein
or for use as described herein may be administered by means of a
medical device or appliance such as an implant, graft, prosthesis,
stent, etc. Also, implants may be devised which are intended to
contain and release such compounds or compositions. An example
would be an implant made of a polymeric material adapted to release
the compound over a period of time.
[0051] An "effective amount" of a pharmaceutical composition as
described herein includes a therapeutically effective amount or a
prophylactically effective amount. A "therapeutically effective
amount" refers to an amount effective, at dosages and for periods
of time necessary, to achieve the desired therapeutic result, such
as reduced tumor size, increased life span or increased life
expectancy. A therapeutically effective amount of a compound may
vary according to factors such as the disease state, age, sex, and
weight of the subject, and the ability of the compound to elicit a
desired response in the subject. Dosage regimens may be adjusted to
provide the optimum therapeutic response. A therapeutically
effective amount is also one in which any toxic or detrimental
effects of the compound are outweighed by the therapeutically
beneficial effects. A "prophylactically effective amount" refers to
an amount effective, at dosages and for periods of time necessary,
to achieve the desired prophylactic result, such as smaller tumors,
increased life span, increased life expectancy or prevention of the
progression of prostate cancer to an androgen independent form.
Typically, a prophylactic dose is used in subjects prior to or at
an earlier stage of disease, so that a prophylactically effective
amount may be less than a therapeutically effective amount.
[0052] It is to be noted that dosage values may vary with the
severity of the condition to be alleviated. For any particular
subject, specific dosage regimens may be adjusted over time
according to the individual need and the professional judgment of
the person administering or supervising the administration of the
compositions. Dosage ranges set forth herein are exemplary only and
do not limit the dosage ranges that may be selected by medical
practitioners. The amount of active compound(s) in the composition
may vary according to factors such as the disease state, age, sex,
and weight of the subject. Dosage regimens may be adjusted to
provide the optimum therapeutic response. For example, a single
bolus may be administered, several divided doses may be
administered over time or the dose may be proportionally reduced or
increased as indicated by the exigencies of the therapeutic
situation. It may be advantageous to formulate parenteral
compositions in dosage unit form for ease of administration and
uniformity of dosage.
[0053] In some embodiments, compounds and all different forms
thereof as described herein may be used, for example, and without
limitation, in combination with other treatment methods for at
least one indication selected from the group consisting of:
prostate cancer, breast cancer, ovarian cancer, endometrial cancer,
hair loss, acne, hirsutism, ovarian cysts, polycystic ovary
disease, precocious puberty and age related macular degeneration.
Alternatively, the compounds described herein may be useful for the
treatment of one or more of the following: prostate cancer; breast
cancer; colon cancer; cervical cancer; small-cell lung carcinoma;
neuroblastomas; osteosarcoma; glioblastoma; melanoma; and myeloid
leukaemia. For example, compounds and all their different forms as
described herein may be used as neo-adjuvant (prior), adjunctive
(during), and/or adjuvant (after) therapy with surgery, radiation
(brachytherapy or external beam), or other therapies (for example,
HIFU).
[0054] In general, compounds as described herein should be used
without causing substantial toxicity. Toxicity of the compounds as
described herein can be determined using standard techniques, for
example, by testing in cell cultures or experimental animals and
determining the therapeutic index, i.e., the ratio between the LD50
(the dose lethal to 50% of the population) and the LD100 (the dose
lethal to 100% of the population). In some circumstances however,
such as in severe disease conditions, it may be appropriate to
administer substantial excesses of the compositions. Some compounds
as described herein may be toxic at some concentrations. Titration
studies may be used to determine toxic and non-toxic
concentrations. Toxicity may be evaluated by examining a particular
compound's or composition's specificity across cell lines using PC3
cells as a negative control that do not express AR. Animal studies
may be used to provide an indication if the compound has any
effects on other tissues. Systemic therapy that targets the AR will
not likely cause major problems to other tissues since
anti-androgens and androgen insensitivity syndrome are not
fatal.
[0055] Compounds as described herein may be administered to a
subject. As used herein, a "subject" may be a human, non human
primate, rat, mouse, cow, horse, pig, sheep, goat, dog, cat, etc.
The subject may be suspected of having or at risk for having a
cancer, such as prostate cancer, breast cancer, ovarian cancer or
endometrial cancer, or suspected of having or at risk for having
acne, hirsutism, alopecia, benign prostatic hyperplasia, ovarian
cysts, polycystic ovary disease, precocious puberty, or age related
macular degeneration. Diagnostic methods for various cancers, such
as prostate cancer, breast cancer, ovarian cancer or endometrial
cancer, and diagnostic methods for acne, hirsutism, alopecia,
benign prostatic hyperplasia, ovarian cysts, polycystic ovary
disease, precocious puberty, or age related macular degeneration
and the clinical delineation of cancer, such as prostate cancer,
breast cancer, ovarian cancer or endometrial cancer, diagnoses and
the clinical delineation of acne, hirsutism, alopecia, benign
prostatic hyperplasia, ovarian cysts, polycystic ovary disease,
precocious puberty, or age related macular degeneration are known
to those of ordinary skill in the art.
[0056] Various alternative embodiments and examples are described
herein. These embodiments and examples are illustrative and should
not be construed as limiting the scope of the invention.
Materials and Methods
[0057] Virtual Screening of Potential Myc-Max DBD Inhibitors.
[0058] The published 1.9 .ANG. crystal structure of c-Myc-Max
heterodimer bound to its DNA-recognition sequence (PDB ID:1NKP
[34], chains A, B; waters and DNA excluded) was subjected to the
Site Finder algorithm implemented in MOE [51]. Site Finder is a
geometric method which uses alpha spheres (virtual atoms) to probe
a protein surface for suitable small molecule binding pockets.
Briefly, Site Finder first identifies regions of tight atomic
packing, filters out highly solvent exposed sites, calculates alpha
spheres on sites and classifies them as either hydrophobic or
hydrophilic depending on whether the virtual atom is in a good
hydrogen bonding spot in the receptor, and then produces a
collection of sites based on pruning (alpha spheres corresponding
to inaccessible regions or exposed to solvent are eliminated) and
clustering (by number and chemical type) of alpha spheres. The
sites are then ranked according to their Propensity for Ligand
Binding (PLB) score. The top PDB-ranked pocket was used for
subsequent in silico screening. Virtual screening of the ZINC12
database [53, 54] was performed using structure-based methods
including molecular docking algorithms and pharmacophore screening.
The Glide.TM. program [55, 56], part of Maestro 9.3.TM. suite,
Schrodinger LLC.TM. [57], was used as the starting point to perform
rigid docking of 4.7 million drug-like chemicals. Following
Maestro's standard protein preparation protocol [87, 88], applied
to the Myc-Max X-ray structure, a docking grid was defined as a 20
.ANG. box centered on the residues of predicted Myc-Max DBD binding
site for Glide sampling and scoring of screening compounds. Prior
to docking, each chemical was washed and energy-minimized under the
MMFF94x force field and Born solvation as per ligand preparation
protocol implemented in MOE [51]. Docking was conducted using Glide
standard precision mode with all other settings set to default. The
generated docking poses were ranked by the Glide score, an
interaction energy score that includes hydrogen bonding and
hydrophobic interactions contributions. Potentially weak binders
(Glide score >-5.5 kcal/mol) were discarded. The remaining
top-ranked 12503 remaining compounds were further filtered by
structure-based pharmacophore screening using MOE's tools [51]. A
pharmacophore model of two essential hydrophobic features (1.5
.ANG. diameter each) of the binding site (formed primarily by
Leu917, Ile218, Phe921 and Phe222) was built and used to search for
matching hits in the database of top ranked Glide poses. 1019
pharmacophore-matching hits were then selected for manual
inspection using the 3D visual environment in MOE. 69 compounds
having a good balance of Glide docking score and ligand efficiency
and making favorable interactions with the surrounding side chains
in the pocket were purchased for subsequent experimental
testing.
[0059] Cell Culture and Reagents
[0060] LNCaP and PC3 cells were purchased from the ATCC and grown
in RPMI 1640 supplemented with 10% fetal bovine serum (FBS).
HO15.19 cells were a generous gift from John Sidivy at Brown
University and were cultured in Dulbecco's modified Eagle's medium
DMEM (ATCC 30-2002) supplemented with 10% FBS. 10058-F4 and
10074-G5 were obtained from Sigma.TM.. The UBE2C reporter plasmid
was purchased from GeneCopoeia (product ID #HPRM16429). The Biolux
Gaussia.TM. luciferase assay kit was purchased from New England
Biolab.TM. (#E3300L). PrestoBlue.TM. cell viability reagent was
purchased from Invitrogen.TM. (#A-13262).
[0061] Transfection and Reporter Assays
[0062] Cell transfection was performed using TransIT-2020.TM.
transfection reagents according to the manufacturer's instructions
(Mirus.TM.). LNCaP cells were plated at 10000 cells per well and
treated for 1 day with the indicated concentration of compound. Myc
reporter activity was measured using the Cignal Myc Reporter Assay
Kit.TM. from Qiagen.TM. (#336841) according to the manufacturer's
instructions. For the UBE2C reporter assay, 22rv1 cells were plated
at 10000 cells per well in 96-well plates in RPMI media
supplemented with 5% charcoal-stripped serum (CSS) and treated for
1 day with 1 .mu.M, 10 .mu.M and 25 .mu.M of compound.
[0063] Cell Viability Assays
[0064] LNCaP were plated at 5000 cells per well in RPMI 1640
containing 5% CSS in a 96-well plate, treated with test compounds
(0-25 .mu.M) for 96 hours. Cell density was measured using the
PrestoBlue.TM. assay according to the manufacturer's protocol. The
percentage of cell survival was normalized to the cell density of
control wells treated by vehicle. Viability of Myc-negative HO15.19
cells was done similarly but in DMEM supplemented with 5% CSS.
[0065] c-Myc-Max Purification
[0066] Histidine tagged Max (residues 23-102) and GST tagged Myc
(residues 368-454) were overexpressed in E. coli BL21-DE3 cells.
Cells were co-lyzed in lysis buffer (20 mM Tris pH 8, 500 mM NaCl,
5% glycerol, 10 mM imidazole, 8 mM BME, 2.1 mM PMSF). After
sonication and centrifugation, the complex was first purified by
using a Ni-NTA affinity resin. After overnight dialysis to remove
the imidazole, the protein sample was applied to a size exclusion
chromatography equilibrated with (20 mM Tris pH 8, 150 mM NaCl, 5%
glycerol, 0.2 mM TCEP). Fractions containing equal amount of Myc
and Max on SDS PAGE were collected and used for the binding assay.
The presence of both proteins was validated by Western blot using a
specific antibody of each protein (Max (h2) Sc-8011 and c-Myc
(9E10) Sc-40, Santa Cruz Biotechnology.TM.)
[0067] Biolayer Interferometry Assay
[0068] The direct interaction between biotinylated E-box oligo
(TGAAGCAGACCACGTGGTCGTCTICA) immobilized on a streptavidin
biosensor and a purified Myc-Max complex (0.05 mg/ml) was
quantified by BLI using OctetRED (ForteBio.TM.). The DNA was first
bound to the super-streptavidin sensors over 1000 see at 25.degree.
C. The sensors were next moved into wells containing the reaction
buffer (20 mM Tris pH 8, 150 mM NaCl, 5% glycerol, 0.2 mM TCEP, 5%
dimethylsulfoxide) for measuring the baseline and next into the
Myc-Max complex alone or in presence of the tested inhibitors to
study the association of the complex to the DNA.
[0069] Western Blotting
[0070] After 48 hours of treatment with Myc compounds, LNCaP cells
were lysed, and protein sample preparation followed by Western
blotting were performed. Blots were incubated with primary
antibodies against c-Myc, PARP (Sigma.TM. 084M.sup.4766V), PARP
cleaved-Asp214 (Sigma.TM. SAB4500487) and .beta.-Actin (Sigma.TM.
A2066) overnight at 4.degree. C., followed by appropriate
peroxidase-conjugated secondary antibodies. .beta.-actin served as
an internal control. Visualization of the immunocomplexes was done
by an enhanced chemiluminescence detection system (Millipore.TM.)
followed by exposure to X-ray films.
[0071] Mammalian Two-Hybrid Assay
[0072] Full lengths Myc and Max were cloned in pBIND and pACT
plasmids (CheckMate.TM., Promega.TM.), respectively. PC3 cells in
RPMI 1640 supplemented with 5% FBS were seeded in 96-well plates at
5,000 cells/well. After 24 hours, cells were transfected with 15 ng
of pACT-Max, 19.5 ng of pBIND-Myc, and 13.6 ng of the reporter
plasmid PG5-luciferase. After 24 hours, cells were treated with
various concentrations of the tested inhibitors. Cells were lysed
the next day, and the luminescence signal was measured after adding
50 .mu.L of luciferase assay reagent (Promega.TM.). Each
measurement was done in 4 replicates with biological replicates of
3. Luciferase levels corresponding to Myc-Max interactions were
measured and normalized to a control provided by the commercial kit
to discard non-specific effect due to toxicity or direct luciferase
inhibition.
[0073] Microsomal (Half-Life) Stability
[0074] For the metabolic (half-life) stability assay, microsomes
(MLM) were incubated with 100 .mu.M of test compound at 37.degree.
C. in the presence of the co-factor, NADPH, which initiates the
reaction. For each MLM mix we prepare a series of 4 tubes (t=0,
t=10 min, t=20 min, t=45 min) to monitor the disappearance of test
compounds over a 45 minute time period. The reaction is stopped at
specific time points using 300 .mu.l stopping buffer
(Acetonitrile+0.05% formic acid with internal standard (150 ng/ml
d3T)). Following centrifugation, the supernatant is analyzed on the
LC-MS/MS.
EXAMPLES
Example 1: In Silico Identification of Hit Compounds Targeting the
Myc-Max DBD Site
[0075] The drug-like subset of the ZINC12 molecular database [53,
54], containing more than 6 million purchasable chemicals, was
further reduced to 4.7 million compounds by filtering by
physicochemical properties such as charge, number of rings and
rotatable bonds. The resulting set of 4.7 million structures was
virtually screened against the identified pocket on the Myc-Max
dimer DBD. Glide.TM. (Maestro 9.3.TM. suite, Schrodinger LLC.TM.)
software [55-57] was employed as the primary structure-based
docking technique (with the standard precision mode). The generated
docking poses were then filtered by the Glide.TM. docking score
(binding energy score used to rank docking poses and distinguish
strong binders in their optimal placement in the respective pocket
from compounds that bind weakly) using a -5.5 kcal/mol cutoff. The
top ranked 12503 remaining compounds were further filtered by
structure-based pharmacophore screening using MOE's tools. A
pharmacophore model of two essential hydrophobic features (1.5
.ANG. diameter each) of the binding site (formed primarily by
Leu917, Ile218, Phe921 and Phe222) was built and used to search for
matching hits in the database of top ranked Glide.TM. poses. 1019
pharmacophore-matching hits were then selected for visual
inspection and 116 compounds having a good balance of Glide.TM.
docking score and ligand efficiency (the ratio of binding affinity
over the number of heavy atoms) made additional side-chain or
backbone hydrogen bonds with the charged residues in the site.
Sixty nine (69) compounds were selected for purchase, in particular
those predicted to form hydrogen bonds with the backbone carbonyl
oxygen of Arg215. The purchased compounds were then subjected to
rapid evaluation using a primary screening transcriptional assay as
described below. From the primary cell-based screening 10 hits were
identified (TABLE 1) showing better than 50% inhibition of Myc-Max
transcriptional activity. Hits with more than 70% inhibition were
further investigated for effect on the downstream pathway using
UBE2C reporter assay.
TABLE-US-00001 TABLE 1 Docking scores and activities of hit
compuonds that bind the ordered Myc-Max DBD at the identified site.
Myc- Myc-Max Max/UBE2C Glide transcriptional downstream docking
activity % pathway % Compound score inhibition inhibition ID
Structure (kcal/mol) (25 .mu.M) (25 .mu.M) VPC-70005 ##STR00100##
-5.53 65 n/a VPC-70021 ##STR00101## -5.63 95 73 VPC-70027
##STR00102## -5.69 53 n/a VPC-70033 ##STR00103## -5.77 81 51
VPC-70053 ##STR00104## -5.66 73 50 VPC-70063 ##STR00105## -5.51 106
94 VPC-70064 ##STR00106## -5.59 78 64 VPC-70066 ##STR00107## -5.77
65 n/a VPC-70067 ##STR00108## -5.67 98 71 VPC-70068 ##STR00109##
-5.68 73 58 10058-F4 ##STR00110## n/a 91 70 10074-G5 ##STR00111##
n/a 88 n/a
Example 2: Effects of Hit Compounds on Myc-Max Transcriptional
Activity
[0076] Compounds were subjected to experimental evaluation using
the commercially available transcriptional assay Cignal c-Myc
luciferase reporter assay in LNCaP cells. Compounds 10058-F4 and
10074-G5, known Myc inhibitors from the literature, were used as
positive controls. A transiently transfected Myc-driven luciferase
reporter allowed the monitoring of Myc-regulated signal in LNCaP
upon treatment with the in silico identified compounds. From a
larger number of hits, 10 compounds caused more than 50% reduction
of the Myc-driven luciferase levels at 25 .mu.M (see TABLE 1). A
thorough dose response analysis was performed using LNCaP cells to
evaluate the potency of hit compounds. The compounds inhibit
Myc-Max transcriptional activity with low to mid-micromolar
potency, with the following IC50 values (half-maximal inhibitory
concentration with 95% Confidence Intervals) established as: 22.7
.mu.M [16.6 to 31.2 .mu.M] for VPC-70067 comparable to that of the
control compound 10058-F4 (28.9 .mu.M; [19.7 to 42.5 .mu.M]), and
8.9 .mu.M [6.6 to 11.8 .mu.M] for VPC-70063 (FIG. 2A).
Example 3: Effects of Hit Compounds on Myc-Max Downstream-Regulated
Pathways
[0077] Myc inhibition was recently reported to reduce levels of the
constitutively active androgen receptor splice variant AR-V7 in
22rv1 cells [20]. AR-V7 has been shown to specifically regulate the
expression level of the Ubiquitin Conjugating Enzyme E2C (UBE2C) in
androgen-deprived 22rv1, through the UBE2C promoter [21]. Hence, a
complementary transcriptional screening assay was developed in
house to monitor the expression levels of the AR-V7 isoform in
22rv1 cells by using a plasmid containing a UBE2C promoter linked
to a luciferase reporter. The dose-dependent reduction of
luciferase levels by the identified hits indicates a Myc-related
reduction of AR-V7 level in the cells (see TABLE 1). Compound
VPC-70063 showed the highest reduction of UBE2C promotor activity
suggesting the reduction of V7 levels in 22rv1. The AR-V7 reduction
with the hits was confirmed by Western blot (FIG. 2B).
Example 4: Effects of Hit Compounds on Cell Viability
[0078] The effect of hit compounds on Myc-driven cell proliferation
was evaluated by measuring the cell viability of LNCaP cells after
treatment with increasing concentrations of compounds. Again,
VPC-70063 showed the best inhibition of LNCaP cell proliferation
(IC50=2.5 .mu.M; [95% CI: 2.1-2.8 .mu.M]. To rule out that this
inhibition was due to non-specific cytotoxicity of VPC-70063 we
therefore treated the c-Myc knockout H015.19 cell line (FIG. 2C)
with this compound. The proliferation of the HO15.19 cell line was
slightly affected by VPC-70063, up to a maximum of 40% inhibition
at 25 .mu.M. However, at a VPC-70063 concentration of 3 .mu.M where
70% of LNCaP cells are inhibited there was no significant effect on
the c-Myc knockout cells. VPC-70067, 10058-F4 and 10074-G5 have
IC50 of 11.1 .mu.M [95% CI: 10.6-11.4 .mu.M], 18.31 .mu.M [95% CI:
17.7-18.8 .mu.M] and 8.7 .mu.M [95% CI: 8.3-9.1 PAM], respectively
(FIG. 2C).
Example 5: Mechanism of Action of Hit Compounds
[0079] Apoptosis. Myc inhibition induces cell death by cell cycle
arrest and apoptosis [58]. Cleavage of PARP-1 by caspases is
considered a hallmark of apoptosis and so we measured the ability
of compounds to induce PARP cleavage after treatment. As predicted,
VPC-70063 and VPC-70067 were inducing PARP cleavage suggesting that
the effect of these two compounds were through apoptotic pathways
(FIG. 3A and TABLE 2).
[0080] Direct Binding and disruption of protein-DNA interaction. To
study the direct effect of our hit compounds VPC-70063 and
VPC-70067 on the interaction between Myc-Max heterodimer and the
DNA, we used Bio-Layer Interferometry (BLI, ForteBio.TM.). This
technique is a label-free technology allowing the measurement of
direct interactions between two partners, one immobilized on a
sensor and the other one present in a solution. We applied this
technology to study the disruption of the interaction between a
biotinylated E-box oligo immobilized on a streptavidin biosensor
and a purified Myc-Max complex in presence of our compounds.
Therefore, histidine-tagged Max (residues 23-102) and GST tagged
Myc (residues 368-454) were overexpressed and co-purified. The
fraction containing equal amount of Myc and Max was collected and
used for the binding assay (FIG. 3B). The presence of both proteins
was validated by Western blot using a specific antibody of each
protein. Using BLI, we were able to show that Myc-Max heterodimer
was prevented from interacting with the immobilized DNA in presence
of both VPC-70063 and VPC-70067 similarly to the control 10074-G5
(FIG. 3C and TABLE 2). Additionally, we tested the ability of our
best compound VPC-70063 to disrupt the interaction of MYC/MAX with
DNA in a dose dependent manner. At a concentration below 100 .mu.M,
we did not see any significant effect on the complex dissociation,
but at higher concentration we noticed a dose response decrease of
the MYC/MAX binding to DNA showing that VPC-70063 was able to
disrupt the complex formation (FIG. 3D).
TABLE-US-00002 TABLE 2 Compound Testing Results % inhibition
IC.sub.50 PARP Myc K.O Compound# (uM) effect cells (12 uM) BLI
binding 70511 2 70495 5 70465 10 70127 1 strong 19 weak 70084 20
weak 70021 10 nil 0 average 70388 20 70381 20 70413 15 weak weak
70395 >25 70314 15 70327 >25 70346 >25 70390 9 70219
>25 70277 >25 70223 10 40 70215 20 weak 29 70033 10 nil weak
70053 11 70067 22 good 3 strong 70063 9 strong 35 strong 70005
>25 70068 average
Example 6: Effect of Inhibitors on Myc-Max Interaction Using
Mammalian 2-Hybrid Assay
[0081] The effect of inhibitors of Myc-Max interaction was studied
by using a mammalian two hybrid assay. Full lengths Myc and Max
were cloned in pBIND and pACT plasmids (CheckMate.TM.,
Promega.TM.), respectively. Luciferase levels corresponding to
Myc-Max interactions were measured and normalized to a control
provided by the commercial kit to discard non-specific effect due
to toxicity or direct luciferase inhibition. VPC-70063 showed a
dose response inhibition of the interaction between the two
proteins (FIG. 3E). Unexpectedly, 10074-G5 did not show any effect
on Myc-Max interaction in this assay. As VPC-70063 is more potent
than 10074-G5 in most of the other assays, higher concentrations of
the latter may be needed to see an inhibition of the
interaction.
Example 7: In Silico Binding Mode of VPC-70063
[0082] As described above, compound VPC-70063 was the best
performer in all the cell-based and cell-free assays designed for
this study. The predicted binding pose of VPC-70063
(1-benzyl-3-(3,5-bis(trifluoromethyl)phenyl)thiourea), obtained
using computational modeling methods. The chemical structure of
VPC-70063 is composed of a benzyl ring at one end, a thiourea
linker and a highly hydrophobic 3,5-bis(trifluoromethyl)phenyl
moiety at the other end. Within the binding pocket of the Myc-Max
DBD domain, VPC-70063 is predicted to form 2 hydrogen bonds between
the 2 thiourea amine hydrogens and the backbone carbonyl of Arg215,
as well as a large number of strong hydrophobic interactions formed
by the 3,5-bis(trifluoromethyl)phenyl moiety with the hydrophobic
core of the pocket, including aliphatic and aromatic side-chains of
Leu917, Phe921, and Lys939 of Myc, and Ile218, Phe222, and Arg215
of Max, and those formed by the benzyl ring with aliphatic side
chains of Arg215 and Arg212 of Max. The
3,5-bis(trifluoromethyl)phenyl group of VPC-70063 is matching the
hydrophobic features of the constructed pharmacophore, it is deeply
buried in the hydrophobic core of the Myc-Max DBD pocket being
stabilized via hydrophobic interactions. Furthermore, in the
binding pose, the benzyl ring of VPC-70063 is predicted to overlap
significantly with the DNA backbone. Therefore, it was expected
that VPC-70063, in as much as other hits having similar
interactions, would overcome the binding of DNA to the Myc-Max DBD
site. It is not surprising then, that VPC-70063 blocks the binding
of Myc-Max to DNA as determined by BLI measurements. Further
experiments are required to unequivocally prove the binding mode
and direct disruption of protein-DNA interactions with our current
hits and future derivatives.
[0083] Findings reported in this study prompted us to leverage the
full power of our in silico drug discovery platform that proved
successful in targeting unconventional sites on protein surfaces
and in yielding promising preclinical drug candidates for
previously uncharted targets [59-67]. Consequently, we have
initiated ligand-based similarity searches followed by molecular
docking and consensus scoring computations to identify analogs of
the initial hit compounds. Briefly, three-dimensional similarity
searches were conducted utilizing the ROCS program from OpenEye.TM.
[68, 69] against a large ensemble of conformers consisting of at
most 200 conformers for each of the approximately 9 million entries
of the drug-like purchasable chemical space of the ZINC15 database
[70]. Conformers are generated using Omega2 of OpenEye.TM. [71].
Current hits are used as query molecules. ROCS is a fast
shape-based superposition method, which uses a combination of
global three-dimensional shape overlay and color-based chemical
complementarity in terms of hydrogen-bond donors, hydrogen-bond
acceptors, hydrophobes, anions, cations and rings, to compare the
query to a large collection of molecules and rank the matching
hitlist according to the TanimotoCombo score, a rigorous measure of
shape and color overlap. Molecular docking, using 3 docking
programs differing in their underlying scoring functions and
sampling algorithms: Glide [55, 56], ICM [72] and Hybrid [73, 74],
is employed to position analogs into the Myc-Max DBD. Consensus
voting and filtering using various thresholds is subsequently
performed. The consensus is built based on top-ranking docking
scores (the more negative the stronger the binding affinity; e.g.
Glide score .ltoreq.-5.5 kcal/mol) and calculation, using MOE
scripts [75, 76], of two indicators: root mean square deviation
(RMSD), an atom-based metric reflecting the deviation in atomic
coordinates between poses obtained from the three docking programs,
and predicted pKi, a good indicator of potency. The filtering
thresholds used are: RMSD .ltoreq.3 .ANG. (an RMSD of 0 indicates
perfect superposition; the higher the RMSD the greater the
deviation), and pKi 5 (the larger more potent theoretically). All
high-confidence analogs are subsequently subjected to full
experimental profiling. Quantitative (QSAR) models based on our in
house developed 3D and 4D inductive descriptors [77, 78] are
currently customized for Myc-Max target to serve as an additional
scoring function for accurate activity prediction of analogs and
future derivative series.
[0084] In the longer term and as per our usual practices [79], the
target affinity and drug-like profile of the most promising analogs
will be optimized based on observed structure activity
relationships (SAR) in iterative rounds of in silico modeling,
medicinal chemistry and biological validation, until a lead is
found. In this process, for more elaborate and accurate scoring,
computationally-demanding classical molecular dynamics (MD) and
free energy perturbation MD simulations [80-85] will be executed on
GPU-accelerated clusters. Moreover, the drug-like profile of
promising derivatives will be improved by eliminating toxic
moieties and metabolically labile centers as predicted by
SimulationsPlus ADMET Predictor software [86]. This approach will
allow us to achieve highly potent binding while maintaining the
ligand properties required for safety and biological efficacy.
[0085] In the absence of clinically approved anti-Myc drugs,
targeting the Myc-Max complex represents a critical step towards
creating new therapeutics for lethal CRPC and NEPC. In this study,
we identified a possible druggable site on the DNA-binding domain
(DBD) of the structurally ordered Myc-Max complex and employed a
computer-aided rational drug discovery approach to identify small
molecules that inhibit Myc-Max functionality. A large-scale virtual
screening protocol was utilized to select a set of top-ranked
compounds that were subsequently characterized experimentally. A
number of compounds were identified that inhibit Myc-Max activity
with low to mid-micromolar potency and with no or minimal
cytotoxicity, including VPC-70067, a compound highly similar in
structure, potency and mechanism of action to 10058-F4. In
addition, a novel compound VPC-70063 with a chemically different
scaffold was identified as the best performer in a panel of in
vitro assays as it inhibits Myc-Max transcriptional activity
(IC50=8.9 .mu.M; [95% CI: 6.6 to 11.8 .mu.M]), Myc-Max downstream
functions, levels of the AR-V7 splice variant in CRPC cells, and
cell growth in various PCa cell lines. In addition, VPC-70063
induces apoptosis as expected with a Myc inhibitor. Its specificity
was confirmed by the inhibitory effect on the MYC/MAX association
with DNA and on the cell viability of MYC negative H015.19 where
the inhibition due to some cytotoxicity occurred at much higher
concentrations than the effect on MYC positive LNCaP cells. At the
IC50 value of VPC-70063 (2.5 .mu.M in LNCaP cells), the inhibition
of Myc negative H015.19 cells was .about.7%. This cytoxicity that
is myc independent increased gradually with the increasing
concentrations of the compound to reach 40% at 25 .mu.M of
VPC-70063. It is noteworthy to mention that the literature compound
10074-G5 also showed some cytotoxicity of 37% at 25 .mu.M. Future
work with chemoinformatics optimization will be performed to remove
this undesirable effect from VPC-70063 while keeping its specific
inhibition of Myc-Max complex. As before, our integrative approach
to drug discovery proved successful insofar in discovering novel
Myc-Max inhibitors as promising far-reaching therapeutics for
advanced prostate and other cancers.
[0086] The compounds shown in TABLE 3 below represent those
compounds tested falling under Formula I and having 7000 or greater
Myc-Max inhibitory activity. Similarly, the compounds shown in
TABLE 4 below represent those compounds tested falling under
Formula IV and having 6500 or greater Myc-Max inhibitory activity.
Lastly, the compounds shown in TABLE 5 below represent those
compounds tested and having less than 7000 Myc-Max inhibitory
activity.
TABLE-US-00003 TABLE 3 FORMULA I STRUCTURES Com- % Inhibition pound
# Structure ZINC # 5 .mu.M 10 .mu.M 12.5 .mu.M 25 .mu.M VPC- 70413
##STR00112## ZINC 00025473 9879 114 VPC- 70063 ##STR00113## ZINC
06276840 106 VPC- 70223 ##STR00114## ZINC 0000065 66969 103 VPC-
70511 ##STR00115## ZINC 1514731 108 112 102 VPC- 70514 ##STR00116##
ZINC 3444542 109 110 102 VPC- 70523 ##STR00117## ZINC 20621585 -4
104 102 VPC- 70524 ##STR00118## ZINC 0000069 25983 22 4 102 VPC-
70525 ##STR00119## ZINC 54988299 40 35 102 VPC- 70532 ##STR00120##
ZINC 921272327 101 VPC- 70215 ##STR00121## ZINC 0000467 00600 101
VPC- 70498 ##STR00122## ZINC 763125903 36 106 100 VPC- 70495
##STR00123## ZINC 743008006 107 80 100 VPC- 70489 ##STR00124## ZINC
727282890 38 86 99 VPC- 70477 ##STR00125## ZINC 346751 3 30 99 VPC-
70390 ##STR00126## ZINC 00000913 0116 97 VPC- 70393 ##STR00127##
ZINC 0000090 53472 96 VPC- 70496 ##STR00128## ZINC 0000000 88815 22
95 96 VPC- 70535 ##STR00129## ZINC 745646914 95 VPC- 70561
##STR00130## ZINC 774226807 95 VPC- 70021 ##STR00131## ZINC
12793756 95 VPC- 70277 ##STR00132## ZINC 0000094 19770 95 VPC-
70526 ##STR00133## ZINC 917599593 41 62 94 VPC- 70529 ##STR00134##
ZINC 920075250 14 52 94 VPC- 70530 ##STR00135## ZINC 920997608 94
VPC- 70314 ##STR00136## ZINC 0000087 65174 93 VPC- 70465
##STR00137## ZINC 0000086 83483 51 95 92 VPC- 70527 ##STR00138##
ZINC 48586115 38 43 92 VPC- 70478 ##STR00139## ZINC 792693672 26 65
91 VPC- 70501 ##STR00140## ZINC 790358193 34 37 90 VPC- 70506
##STR00141## ZINC 914870928 73 66 89 VPC- 70437 ##STR00142## ZINC
00000112 1999 24 105 87 VPC- 70458 ##STR00143## ZINC 0000003 02471
42 104 86 VPC- 70466 ##STR00144## ZINC 0000028 81731 1 48 86 VPC-
70387 ##STR00145## ZINC 00001357 4717 82 VPC- 70531 ##STR00146##
ZINC 921269106 0 27 47 81 VPC- 70033 ##STR00147## ZINC 04809037 81
VPC- 70084 ##STR00148## ZINC 07325649 80 VPC- 70483 ##STR00149##
ZINC 726433246 31 38 79 VPC- 70487 ##STR00150## ZINC 726459938 34
42 79 VPC- 70473 ##STR00151## ZINC 00001393 1514 77 VPC- 70388
##STR00152## ZINC 0000090 46072 77 VPC- 70549 ##STR00153## ZINC
730028134 75 VPC- 70468 ##STR00154## ZINC 0000003 07277 9 30 74
VPC- 70381 ##STR00155## ZINC 0000460 56112 74 VPC- 70564
##STR00156## ZINC 792696003 73 VPC- 70554 ##STR00157## ZINC
499670563 71 VPC- 70053 ##STR00158## ZINC 00073052 73 VPC- 70068
##STR00159## ZINC 33002149 73
TABLE-US-00004 TABLE 4 FORMULA IV STRUCTURES Compound % Inhibition
# Structure ZINC # (25 .mu.M) VPC-70067 ##STR00160## ZINC12616868
98 VPC-70064 ##STR00161## ZINC12695008 78 VPC-70005 ##STR00162##
ZINC01211334 65
TABLE-US-00005 TABLE 5 Below 70% Inhibition at 25 .mu.M Compound %
Inhibition # Structure ZINC # 5 .mu.M 10 .mu.M 12.5 .mu.M 25 .mu.M
VPC-70380 ##STR00163## ZINC 00006 4889578 68 VPC-70366 ##STR00164##
ZINC 00004 0135677 60 VPC-70367 ##STR00165## ZINC 00000 6052981 60
VPC-70392 ##STR00166## ZINC 00001 0176407 58 VPC-70389 ##STR00167##
ZINC 00000 9243143 58 VPC-70382 ##STR00168## ZINC 00000 3026309 57
VPC-70386 ##STR00169## ZINC 00000 4065527 55 VPC-70376 ##STR00170##
ZINC 00000 9502950 55 VPC-70395 ##STR00171## ZINC 00021 8276666 56
VPC-70391 ##STR00172## ZINC 00000 9060573 54 VPC-70394 ##STR00173##
ZINC 00000 0214398 54 VPC-70405 ##STR00174## ZINC 00000 2121723 54
VPC-70404 ##STR00175## ZINC 00000 0487571 53 VPC-70384 ##STR00176##
ZINC 00004 6074815 53 VPC-70377 ##STR00177## ZINC 00000 9440450 52
VPC-70379 ##STR00178## ZINC 00003 6145736 52 VPC-70222 ##STR00179##
ZINC 00000 9796412 68 VPC-70219 ##STR00180## ZINC 00000 3335637 67
VPC-70249 ##STR00181## ZINC 00019 3817325 65 VPC-70066 ##STR00182##
ZINC 033135 40 65 VPC-70360 ##STR00183## ZINC 00002 6417951 64
VPC-70361 ##STR00184## ZINC 00001 2905963 61 VPC-70318 ##STR00185##
ZINC 00000 8968624 54 VPC-70343 ##STR00186## ZINC 00001 3460087 54
VPC-70356 ##STR00187## ZINC 00009 6011836 53 VPC-70027 ##STR00188##
ZINC 06975 402 53 VPC-70209 ##STR00189## ZINC 00000 4583705 52
VPC-70146 ##STR00190## ZINC 00000 4648649 52 VPC-70355 ##STR00191##
ZINC 00000 8881483 51 VPC-70345 ##STR00192## ZINC 00001 3236186 51
VPC-70205 ##STR00193## ZINC 00007 0636616 50 VPC-70131 ##STR00194##
ZINC 00001 1834898 50 VPC-70339 ##STR00195## ZINC 00000 2642231 50
VPC-70341 ##STR00196## ZINC 00001 3109284 50 VPC-70340 ##STR00197##
ZINC 00001 4095493 49 VPC-70344 ##STR00198## ZINC 00022 5552803 49
VPC-70358 ##STR00199## ZINC 00001 4185488 48 VPC-70240 ##STR00200##
ZINC 00005 8356756 48 VPC-70267 ##STR00201## ZINC 00009 5401009 47
VPC-70211 ##STR00202## ZINC 00001 4094353 47 VPC-70252 ##STR00203##
ZINC 00005 8282342 45 VPC-70283 ##STR00204## ZINC 00022 0134452 45
VPC-70359 ##STR00205## ZINC 00000 9670218 41 VPC-70158 ##STR00206##
ZINC 00022 5797127 41 VPC-70255 ##STR00207## ZINC 00004 0024098 40
VPC-70216 ##STR00208## ZINC 00000 5754766 40 VPC-70163 ##STR00209##
ZINC 00001 3059960 39 VPC-70266 ##STR00210## ZINC 00009 6413285 38
VPC-70247 ##STR00211## ZINC 00004 4955217 35 VPC-70261 ##STR00212##
ZINC 00009 5426104 35 VPC-70258 ##STR00213## ZINC 97380 35 34
VPC-70236 ##STR00214## ZINC 00000 5273329 32 VPC-70263 ##STR00215##
ZINC 00004 8278811 32
TABLE-US-00006 TABLE 6 Additional Compounds Compound % Inhibition #
Structure ZINC # 5 .mu.M 10 .mu.M 12.5 .mu.M 25 .mu.M VPC-70551
##STR00216## ZINC799750908 91 VPC-70127 ##STR00217## ZINC21285336
106
[0087] Furthermore, VPC-70551 had an IC.sub.50 of 4 .mu.M and a
half-life of 140 minutes.
[0088] Although various embodiments of the invention are disclosed
herein, many adaptations and modifications may be made within the
scope of the invention in accordance with the common general
knowledge of those skilled in this art. Such modifications include
the substitution of known equivalents for any aspect of the
invention in order to achieve the same result in substantially the
same way. Numeric ranges are inclusive of the numbers defining the
range. The word "comprising" is used herein as an open-ended term,
substantially equivalent to the phrase "including, but not limited
to", and the word "comprises" has a corresponding meaning. As used
herein, the singular forms "a", "an" and "the" include plural
referents unless the context clearly dictates otherwise. Thus, for
example, reference to "a thing" includes more than one such thing.
Citation of references herein is not an admission that such
references are prior art to an embodiment of the present invention.
The invention includes all embodiments and variations substantially
as hereinbefore described and with reference to the examples and
drawings.
REFERENCES
[0089] [1] C. V. Dang, MYC on the path to cancer, Cell, 149 (2012)
22-35. [0090] [2] C. V. Dang, MYC, metabolism, cell growth, and
tumorigenesis, Cold Spring Harbor perspectives in medicine, 3
(2013). [0091] [3] C. V. Dang, L. M. Resar, E. Emison, S. Kim, Q.
Li, J. E. Prescott, D. Wonsey, K. Zeller, Function of the c-Myc
oncogenic transcription factor, Experimental cell research, 253
(1999) 63-77. [0092] [4] R. Ponzielli, S. Katz, D. Barsyte-Lovejoy,
L. Z. Penn, Cancer therapeutics: targeting the dark side of Myc,
European journal of cancer, 41 (2005) 2485-2501. [0093] [5] M.
Huang, W. A. Weiss, Neuroblastoma and MYCN, Cold Spring Harbor
perspectives in medicine, 3 (2013) ao14415. [0094] [6] Z. E. Stine,
Z. E. Walton, B. J. Altman, A. L. Hsieh, C. V. Dang, MYC,
Metabolism, and Cancer, Cancer discovery, 5 (2015) 1024-1039.
[0095] [7] S. B. McMahon, MYC and the control of apoptosis, Cold
Spring Harbor perspectives in medicine, 4 (2014) ao14407. [0096]
[8] M. Gabay, Y. Li, D. W. Felsher, MYC activation is a hallmark of
cancer initiation and maintenance, Cold Spring Harbor perspectives
in medicine, 4 (2014). [0097] [9] D. Horiuchi, B. Anderton, A.
Goga, Taking on challenging targets: making MYC druggable, American
Society of Clinical Oncology educational book. American Society of
Clinical Oncology. Meeting, (2014) e497-502. [0098] [10] C. M. Koh,
C. J. Bieberich, C. V. Dang, W. G. Nelson, S. Yegnasubramanian, A.
M. De Marzo, MYC and Prostate Cancer, Genes & cancer, 1 (2010)
617-628. [0099] [11] P. C. Boutros, M. Fraser, N. J. Harding, R. de
Borja, D. Trudel, E. Lalonde, A. Meng, P. H. Hennings-Yeomans, A.
McPherson, V. Y. Sabelnykova, A. Zia, N. S. Fox, J. Livingstone, Y.
J. Shiah, J. Wang, T. A. Beck, C. L. Have, T. Chong, M. Sam, J.
Johns, L. Timms, N. Buchner, A. Wong, J. D. Watson, T. T. Simmons,
C. P'ng, G. Zafarana, F. Nguyen, X. Luo, K. C. Chu, S. D. Prokopec,
J. Sykes, A. Dal Pra, A. Berlin, A. Brown, M. A. Chan-Seng-Yue, F.
Yousif, R. E. Denroche, L. C. Chong, G. M. Chen, E. Jung, C. Fung,
M. H. Starmans, H. Chen, S. K. Govind, J. Hawley, A. D'Costa, M.
Pintilie, D. Waggott, F. Hach, P. Lambin, L. B. Muthuswamy, C.
Cooper, R. Eeles, D. Neal, B. Tetu, C. Sahinalp, L. D. Stein, N.
Fleshner, S. P. Shah, C. C. Collins, T. J. Hudson, J. D. McPherson,
T. van der Kwast, R. G. Bristow, Spatial genomic heterogeneity
within localized, multifocal prostate cancer, Nature genetics, 47
(2015) 736-745. [0100] [12] A. W. Wyatt, M. E. Gleave, Targeting
the adaptive molecular landscape of castration-resistant prostate
cancer, EMBO molecular medicine, 7 (2015) 878-894. [0101] [13] H.
Beltran, S. Tomlins, A. Aparicio, V. Arora, D. Rickman, G. Ayala,
J. Huang, L. True, M. E. Gleave, H. Soule, C. Logothetis, M. A.
Rubin, Aggressive variants of castration-resistant prostate cancer,
Clinical cancer research: an official journal of the American
Association for Cancer Research, 20 (2014) 2846-2850. [0102] [14]
H. Beltran, D. Prandi, J. M. Mosquera, M. Benelli, L. Puca, J.
Cyrta, C. Marotz, E. Giannopoulou, B. V. Chakravarthi, S.
Varambally, S. A. Tomlins, D. M. Nanus, S. T. Tagawa, E. M. Van
Allen, O. Elemento, A. Sboner, L. A. Garraway, M. A. Rubin, F.
Demichelis, Divergent clonal evolution of castration-resistant
neuroendocrine prostate cancer, Nature medicine, 22 (2016) 298-305.
[0103] [15] H. Beltran, D. S. Rickman, K. Park, S. S. Chae, A.
Sboner, T. Y. MacDonald, Y. Wang, K. L. Sheikh, S. Terry, S. T.
Tagawa, R. Dhir, J. B. Nelson, A. de la Taille, Y. Allory, M. B.
Gerstein, S. Perner, K. J. Pienta, A. M. Chinnaiyan, Y. Wang, C. C.
Collins, M. E. Gleave, F. Demichelis, D. M. Nanus, M. A. Rubin,
Molecular characterization of neuroendocrine prostate cancer and
identification of new drug targets, Cancer discovery, 1 (2011)
487-495. [0104] [16] D. Bernard, A. Pourtier-Manzanedo, J. Gil, D.
H. Beach, Myc confers androgen-independent prostate cancer cell
growth, The Journal of clinical investigation, 112 (2003)
1724-1731. [0105] [17] J. H. Kim, S. M. Dhanasekaran, R. Mehra, S.
A. Tomlins, W. Gu, J. Yu, C. Kumar-Sinha, X. Cao, A. Dash, L. Wang,
D. Ghosh, K. Shedden, J. E. Montie, M. A. Rubin, K. J. Pienta, R.
B. Shah, A. M. Chinnaiyan, Integrative analysis of genomic
aberrations associated with prostate cancer progression, Cancer
research, 67 (2007) 8229-8239. [0106] [18] S. J. Barfeld, A.
Urbanucci, H. M. Itkonen, L. Fazli, J. L. Hicks, B. Thiede, P. S.
Rennie, S. Yegnasubramanian, A. M. DeMarzo, I. G. Mills, c-Myc
Antagonises the Transcriptional Activity of the Androgen Receptor
in Prostate Cancer Affecting Key Gene Networks, EBioMedicine, 18
(2017) 83-93. [0107] [19] A. V. Lapuk, S. V. Volik, Y. Wang, C. C.
Collins, The role of mRNA splicing in prostate cancer, Asian
journal of andrology, 16 (2014) 515-521. [0108] [20] N. Nadiminty,
R. Tummala, C. Liu, W. Lou, C. P. Evans, A. C. Gao,
NF-kappaB2/p52:c-Myc:hnRNPA1 Pathway Regulates Expression of
Androgen Receptor Splice Variants and Enzalutamide Sensitivity in
Prostate Cancer, Molecular cancer therapeutics, 14 (2015)
1884-1895. [0109] [21] R. Hu, C. Lu, E. A. Mostaghel, S.
Yegnasubramanian, M. Gurel, C. Tannahill, J. Edwards, W. B. Isaacs,
P. S. Nelson, E. Bluemn, S. R. Plymate, J. Luo, Distinct
transcriptional programs mediated by the ligand-dependent
full-length androgen receptor and its splice variants in
castration-resistant prostate cancer, Cancer research, 72 (2012)
3457-3462. [0110] [22] S. Akamatsu, T. Inoue, O. Ogawa, M. E.
Gleave, Clinical and molecular features of treatment-related
neuroendocrine prostate cancer, International journal of urology:
official journal of the Japanese Urological Association, 25 (2018)
345-351. [0111] [23] E. M. Blackwood, R. N. Eisenman, Max: a
helix-loop-helix zipper protein that forms a sequence-specific
DNA-binding complex with Myc, Science, 251 (1991) 1211-1217. [0112]
[24] G. J. Kato, W. M. Lee, L. L. Chen, C. V. Dang, Max: functional
domains and interaction with c-Myc, Genes & development, 6
(1992) 81-92. [0113] [25] W. D. Thomas, A. Raif, L. Hansford, G.
Marshall, N-myc transcription molecule and oncoprotein, The
international journal of biochemistry & cell biology, 36 (2004)
771-775. [0114] [26] M. Conacci-Sorrell, L. McFerrin, R. N.
Eisenman, An overview of MYC and its interactome, Cold Spring
Harbor perspectives in medicine, 4 (2014) ao14357. [0115] [27] J.
Michel, R. Cuchillo, The impact of small molecule binding on the
energy landscape of the intrinsically disordered protein C-myc,
PloS one, 7 (2012) e41070. [0116] [28] F. Jin, C. Yu, L. Lai, Z.
Liu, Ligand clouds around protein clouds: a scenario of ligand
binding with intrinsically disordered proteins, PLoS computational
biology, 9 (2013) e1003249. [0117] [29] C. Yu, X. Niu, F. Jin, Z.
Liu, C. Jin, L. Lai, Structure-based Inhibitor Design for the
Intrinsically Disordered Protein c-Myc, Scientific reports, 6
(2016) 22298. [0118] [30] B. Luscher, L. G. Larsson, The basic
region/helix-loop-helix/leucine zipper domain of Myc
proto-oncoproteins: function and regulation, Oncogene, 18 (1999)
2955-2966. [0119] [31] A. Sabo, B. Amati, Genome recognition by
MYC, Cold Spring Harbor perspectives in medicine, 4 (2014). [0120]
[32] P. B. Rahl, R. A. Young, MYC and transcription elongation,
Cold Spring Harbor perspectives in medicine, 4 (2014) a020990.
[0121] [33] A. R. Ferre-D'Amare, G. C. Prendergast, E. B. Ziff, S.
K. Burley, Recognition by Max of its cognate DNA through a dimeric
b/HLH/Z domain, Nature, 363 (1993) 38-45. [0122] [34] S. K. Nair,
S. K. Burley, X-ray structures of Myc-Max and Mad-Max recognizing
DNA. Molecular bases of regulation by proto-oncogenic transcription
factors, Cell, 112 (2003) 193-205. [0123] [35] L. Soucek, J.
Whitfield, C. P. Martins, A. J. Finch, D. J. Murphy, N. M. Sodir,
A. N. Karnezis, L. B. Swigart, S. Nasi, G. I. Evan, Modelling Myc
inhibition as a cancer therapy, Nature, 455 (2008) 679-683. [0124]
[36] L. Soucek, J. R. Whitfield, N. M. Sodir, D. Masso-Valles, E.
Serrano, A. N. Karnezis, L. B. Swigart, G. I. Evan, Inhibition of
Myc family proteins eradicates KRas-driven lung cancer in mice,
Genes & development, 27 (2013) 504-513. [0125] [37] X. Yin, C.
Giap, J. S. Lazo, E. V. Prochownik, Low molecular weight inhibitors
of Myc-Max interaction and function, Oncogene, 22 (2003) 6151-6159.
[0126] [38] J. L. Yap, H. Wang, A. Hu, J. Chauhan, K. Y. Jung, R.
B. Gharavi, E. V. Prochownik, S. Fletcher, Pharmacophore
identification of c-Myc inhibitor 10074-G5, Bioorganic &
medicinal chemistry letters, 23 (2013) 370-374. [0127] [39] D.
Stellas, M. Szabolcs, S. Koul, Z. Li, A. Polyzos, C.
Anagnostopoulos, Z. Cournia, C. Tamvakopoulos, A. Klinakis, A.
Efstratiadis, Therapeutic effects of an anti-Myc drug on mouse
pancreatic cancer, Journal of the National Cancer Institute, 106
(2014). [0128] [40] J. R. Hart, A. L. Garner, J. Yu, Y. Ito, M.
Sun, L. Ueno, J. K. Rhee, M. M. Baksh, E. Stefan, M. Hartl, K.
Bister, P. K. Vogt, K. D. Janda, Inhibitor of MYC identified in a
Krohnke pyridine library, Proceedings of the National Academy of
Sciences of the United States of America, 111 (2014) 12556-12561.
[0129] [41] J. R. Whitfield, M. E. Beaulieu, L. Soucek, Strategies
to Inhibit Myc and Their Clinical Applicability, Frontiers in cell
and developmental biology, 5 (2017) 10. [0130] [42] C. M. Koh, A.
Sabo, E. Guccione, Targeting MYC in cancer therapy: RNA processing
offers new opportunities, BioEssays: news and reviews in molecular,
cellular and developmental biology, 38 (2016) 266-275. [0131] [43]
M. R. McKeown, J. E. Bradner, Therapeutic strategies to inhibit
MYC, Cold Spring Harbor perspectives in medicine, 4 (2014). [0132]
[44] D. S. Rickman, J. H. Schulte, M. Eilers, The Expanding World
of N-MYC-Driven Tumors, Cancer discovery, 8 (2018) 150-163. [0133]
[45] A. V. Follis, D. I. Hammoudeh, H. Wang, E. V. Prochownik, S.
J. Metallo, Structural rationale for the coupled binding and
unfolding of the c-Myc oncoprotein by small molecules, Chemistry
& biology, 15 (2008) 1149-1155. [0134] [46] D. I. Hammoudeh, A.
V. Follis, E. V. Prochownik, S. J. Metallo, Multiple independent
binding sites for small-molecule inhibitors on the oncoprotein
c-Myc, Journal of the American Chemical Society, 131 (2009)
7390-7401. [0135] [47] H. Wang, D. I. Hammoudeh, A. V. Follis, B.
E. Reese, J. S. Lazo, S. J. Metallo, E. V. Prochownik, Improved low
molecular weight Myc-Max inhibitors, Molecular cancer therapeutics,
6 (2007) 2399-2408. [0136] [48] H. Wang, J. Chauhan, A. Hu, K.
Pendleton, J. L. Yap, P. E. Sabato, J. W. Jones, M. Perri, J. Yu,
E. Cione, M. A. Kane, S. Fletcher, E. V. Prochownik, Disruption of
Myc-Max heterodimerization with improved cell-penetrating analogs
of the small molecule 10074-G5, Oncotarget, 4 (2013) 936-947.
[0137] [49] J. Guo, R. A. Parise, E. Joseph, M. J. Egorin, J. S.
Lazo, E. V. Prochownik, J. L. Eiseman, Efficacy, pharmacokinetics,
tisssue distribution, and metabolism of the Myc-Max disruptor,
10058-F4 [Z,E]-5-[4-ethylbenzylidine]-2-thioxothiazolidin-4-one, in
mice, Cancer chemotherapy and pharmacology, 63 (2009) 615-625.
[0138] [50] D. M. Clausen, J. Guo, R. A. Parise, J. H. Beumer, M.
J. Egorin, J. S. Lazo, E. V. Prochownik, J. L. Eiseman, In vitro
cytotoxicity and in vivo efficacy, pharmacokinetics, and metabolism
of 10074-G5, a novel small-molecule inhibitor of c-Myc/Max
dimerization, The Journal of pharmacology and experimental
therapeutics, 335 (2010) 715-727. [0139] [51] Molecular Operating
Environment (MOE), 2013.08; Chemical Computing Group ULC, 1010
Sherbooke St. West, Suite #910, Montreal, QC, Canada, H3A 2R7,
2018. [0140] [52] L. A. Jung, A. Gebhardt, W. Koelmel, C. P. Ade,
S. Walz, J. Kuper, B. von Eyss, S. Letschert, C. Redel, L.
d'Artista, A. Biankin, L. Zender, M. Sauer, E. Wolf, G. Evan, C.
Kisker, M. Eilers, OmoMYC blunts promoter invasion by oncogenic MYC
to inhibit gene expression characteristic of MYC-dependent tumors,
Oncogene, 36 (2017) 1911-1924. [0141] [53] J. J. Irwin, B. K.
Shoichet, ZINC--a free database of commercially available compounds
for virtual screening, Journal of chemical information and
modeling, 45 (2005) 177-182. [0142] [54] J. J. Irwin, T. Sterling,
M. M. Mysinger, E. S. Bolstad, R. G. Coleman, ZINC: a free tool to
discover chemistry for biology, Journal of chemical information and
modeling, 52 (2012) 1757-1768. [0143] [55] R. A. Friesner, J. L.
Banks, R. B. Murphy, T. A. Halgren, J. J. Klicic, D. T. Mainz, M.
P. Repasky, E. H. Knoll, M. Shelley, J. K. Perry, D. E. Shaw, P.
Francis, P. S. Shenkin, Glide: a new approach for rapid, accurate
docking and scoring. 1. Method and assessment of docking accuracy,
Journal of medicinal chemistry, 47 (2004) 1739-1749. [0144] [56] T.
A. Halgren, R. B. Murphy, R. A. Friesner, H. S. Beard, L. L. Frye,
W. T. Pollard, J. L. Banks, Glide: a new approach for rapid,
accurate docking and scoring. 2. Enrichment factors in database
screening, Journal of medicinal chemistry, 47 (2004) 1750-1759.
[0145] [57] Schrodinger Release 2018-1: Maestro, Schrodinger, LLC,
New York, N.Y., 2018. [0146] [58] M. J. Huang, Y. C. Cheng, C. R.
Liu, S. Lin, H. E. Liu, A small-molecule c-Myc inhibitor, 10058-F4,
induces cell-cycle arrest, apoptosis, and myeloid differentiation
of human acute myeloid leukemia, Experimental hematology, 34 (2006)
1480-1489. [0147] [59] N. Lallous, K. Dalal, A. Cherkasov, P. S.
Rennie, Targeting alternative sites on the androgen receptor to
treat castration-resistant prostate cancer, International journal
of molecular sciences, 14 (2013) 12496-12519. [0148] [60] P.
Axerio-Cilies, N. A. Lack, M. R. Nayana, K. H. Chan, A. Yeung, E.
Leblanc, E. S. Guns, P. S. Rennie, A. Cherkasov, Inhibitors of
androgen receptor activation function-2 (AF2) site identified
through virtual screening, Journal of medicinal chemistry, 54
(2011) 6197-6205. [0149] [61] N. A. Lack, P. Axerio-Cilies, P.
Tavassoli, F. Q. Han, K. H. Chan, C. Feau, E. LeBlanc, E. T. Guns,
R. K. Guy, P. S. Rennie, A. Cherkasov, Targeting the binding
function 3 (BF3) site of the human androgen receptor through
virtual screening, Journal of medicinal chemistry, 54 (2011)
8563-8573. [0150] [62] R. S. Munuganti, E. Leblanc, P.
Axerio-Cilies, C. Labriere, K. Frewin, K. Singh, M. D. Hassona, N.
A. Lack, H. Li, F. Ban, E. Tomlinson Guns, R. Young, P. S. Rennie,
A. Cherkasov, Targeting the binding function 3 (BF3) site of the
androgen receptor through virtual screening. 2. development of
2-((2-phenoxyethyl)thio)-1H-benzimidazole derivatives, Journal of
medicinal chemistry, 56 (2013) 1136-1148. [0151] [63] R. S.
Munuganti, M. D. Hassona, E. Leblanc, K. Frewin, K. Singh, D. Ma,
F. Ban, M. Hsing, H. Adomat, N. Lallous, C. Andre, J. P. Jonadass,
A. Zoubeidi, R. N. Young, E. T. Guns, P. S. Rennie, A. Cherkasov,
Identification of a potent antiandrogen that targets the BF3 site
of the androgen receptor and inhibits enzalutamide-resistant
prostate cancer, Chemistry & biology, 21 (2014) 1476-1485.
[0152] [64] F. Ban, E. Leblanc, H. Li, R. S. Munuganti, K. Frewin,
P. S. Rennie, A. Cherkasov, Discovery of 1H-indole-2-carboxamides
as novel inhibitors of the androgen receptor binding function 3
(BF3), Journal of medicinal chemistry, 57 (2014) 6867-6872.
[0153] [65] H. Li, M. D. Hassona, N. A. Lack, P. Axerio-Cilies, E.
Leblanc, P. Tavassoli, N. Kanaan, K. Frewin, K. Singh, H. Adomat,
K. J. Bohm, H. Prinz, E. T. Guns, P. S. Rennie, A. Cherkasov,
Characterization of a new class of androgen receptor antagonists
with potential therapeutic application in advanced prostate cancer,
Molecular cancer therapeutics, 12 (2013) 2425-2435. [0154] [66] H.
Li, F. Ban, K. Dalal, E. Leblanc, K. Frewin, D. Ma, H. Adomat, P.
S. Rennie, A. Cherkasov, Discovery of small-molecule inhibitors
selectively targeting the DNA-binding domain of the human androgen
receptor, Journal of medicinal chemistry, 57 (2014) 6458-6467.
[0155] [67] K. Dalal, M. Roshan-Moniri, A. Sharma, H. Li, F. Ban,
M. D. Hassona, M. Hsing, K. Singh, E. LeBlanc, S. Dehm, E. S.
Tomlinson Guns, A. Cherkasov, P. S. Rennie, Selectively targeting
the DNA-binding domain of the androgen receptor as a prospective
therapy for prostate cancer, The Journal of biological chemistry,
289 (2014) 26417-26429. [0156] [68] P. C. Hawkins, A. G. Skillman,
A. Nicholls, Comparison of shape-matching and docking as virtual
screening tools, Journal of medicinal chemistry, 50 (2007) 74-82.
[0157] [69] OpenEye Scientific Software, Santa Fe, N. Mex.
http://www.eyesopen.com (last accessed May, 2018). [0158] [70] T.
Sterling, J. J. Irwin, ZINC 15--Ligand Discovery for Everyone,
Journal of chemical information and modeling, 55 (2015) 2324-2337.
[0159] [71] P. C. Hawkins, A. G. Skillman, G. L. Warren, B. A.
Ellingson, M. T. Stahl, Conformer generation with OMEGA: algorithm
and validation using high quality structures from the Protein
Databank and Cambridge Structural Database, Journal of chemical
information and modeling, 50 (2010) 572-584. [0160] [72] M. A.
Neves, M. Totrov, R. Abagyan, Docking and scoring with ICM: the
benchmarking results and strategies for improvement, Journal of
computer-aided molecular design, 26 (2012) 675-686. [0161] [73] M.
McGann, FRED pose prediction and virtual screening accuracy,
Journal of chemical information and modeling, 51(2011) 578-596.
[0162] [74] M. McGann, FRED and HYBRID docking performance on
standardized datasets, Journal of computer-aided molecular design,
26 (2012) 897-906. [0163] [75] mol_rmsd Calculate RMSD's for
docking results, Scientific Vector Language (SVL) source code
provided by Chemical Computing Group ULC, 1010 Sherbooke St. West,
Suite #910, Montreal, QC, Canada, H3A 2R7, 2018. [0164] [76]
scoring Analysis tool for non-bonded intermolecular interactions:
H-bonds, transition metal, water bridges, hydrophobic, Scientific
Vector Language (SVL) source code provided by Chemical Computing
Group ULC, 1010 Sherbooke St. West, Suite #910, Montreal, QC,
Canada, H3A 2R7, 2018. [0165] [77] A. Cherkasov, E. N. Muratov, D.
Fourches, A. Varnek, Baskin, II, M. Cronin, J. Dearden, P.
Gramatica, Y. C. Martin, R. Todeschini, V. Consonni, V. E. Kuz'min,
R. Cramer, R. Benigni, C. Yang, J. Rathman, L. Terfloth, J.
Gasteiger, A. Richard, A. Tropsha, QSAR modeling: where have you
been? Where are you going to?, Journal of medicinal chemistry, 57
(2014) 4977-5010. [0166] [78] N. Paul, L. A. Carabet, N. Lallous,
T. Yamazaki, M. E. Gleave, P. S. Rennie, A. Cherkasov,
Cheminformatics Modeling of Adverse Drug Responses by Clinically
Relevant Mutants of Human Androgen Receptor, Journal of chemical
information and modeling, 56 (2016) 2507-2516. [0167] [79] F. Ban,
K. Dalal, H. Li, E. LeBlanc, P. S. Rennie, A. Cherkasov, Best
Practices of Computer-Aided Drug Discovery: Lessons Learned from
the Development of a Preclinical Candidate for Prostate Cancer with
a New Mechanism of Action, Journal of chemical information and
modeling, 57 (2017) 1018-1028. [0168] [80] Schrodinger Release
2018-1: FEP+, Schrodinger, New York, N. Y., 2018. [0169] [81] R.
Abel, L. Wang, E. D. Harder, B. J. Berne, R. A. Friesner, Advancing
Drug Discovery through Enhanced Free Energy Calculations, Accounts
of chemical research, 50 (2017) 1625-1632. [0170] [82] B. Kuhn, M.
Tichy, L. Wang, S. Robinson, R. E. Martin, A. Kuglstatter, J. Benz,
M. Giroud, T. Schirmeister, R. Abel, F. Diederich, J. Hert,
Prospective Evaluation of Free Energy Calculations for the
Prioritization of Cathepsin L Inhibitors, Journal of medicinal
chemistry, 60 (2017) 2485-2497. [0171] [83] L. Wang, Y. Deng, Y.
Wu, B. Kim, D. N. LeBard, D. Wandschneider, M. Beachy, R. A.
Friesner, R. Abel, Accurate Modeling of Scaffold Hopping
Transformations in Drug Discovery, Journal of chemical theory and
computation, 13 (2017) 42-54. [0172] [84] E. Harder, W. Damm, J.
Maple, C. Wu, M. Reboul, J. Y. Xiang, L. Wang, D. Lupyan, M. K.
Dahlgren, J. L. Knight, J. W. Kaus, D. S. Cerutti, G. Krilov, W. L.
Jorgensen, R. Abel, R. A. Friesner, OPLS3: A Force Field Providing
Broad Coverage of Drug-like Small Molecules and Proteins, Journal
of chemical theory and computation, 12 (2016) 281-296. [0173] [85]
L. Wang, Y. Wu, Y. Deng, B. Kim, L. Pierce, G. Krilov, D. Lupyan,
S. Robinson, M. K. Dahlgren, J. Greenwood, D. L. Romero, C. Masse,
J. L. Knight, T. Steinbrecher, T. Beuming, W. Damm, E. Harder, W.
Sherman, M. Brewer, R. Wester, M. Murcko, L. Frye, R. Farid, T.
Lin, D. L. Mobley, W. L. Jorgensen, B. J. Berne, R. A. Friesner, R.
Abel, Accurate and reliable prediction of relative ligand binding
potency in prospective drug discovery by way of a modern
free-energy calculation protocol and force field, Journal of the
American Chemical Society, 137 (2015) 2695-2703. [0174] [86] ADMET
Predictor 8.5.
http://www.simulations-plus.com/software/admetpredictor/ (last
accessed May, 2018). [0175] [87] G. M. Sastry, M. Adzhigirey, T.
Day, R. Annabhimoju, W. Sherman, Protein and ligand preparation:
parameters, protocols, and influence on virtual screening
enrichments, Journal of computer-aided molecular design, 27 (2013)
221-234. [0176] [88] Schrodinger Release 2018-1: Schrodinger Suite
2018-1 Protein Preparation Wizard; Epik, Schrodinger, LLC, New
York, N. Y., 2016; Impact, Schrodinger, LLC, New York, N. Y., 2016;
Prime, Schrodinger, LLC, New York, N. Y., 2018.
* * * * *
References