U.S. patent application number 17/509561 was filed with the patent office on 2022-04-07 for methods for preventing titration of bimolecular templated assembly reactions by structurally-determined differential hybridizations.
The applicant listed for this patent is TriBiotica LLC. Invention is credited to Ian Dunn, Matthew Lawler.
Application Number | 20220106597 17/509561 |
Document ID | / |
Family ID | |
Filed Date | 2022-04-07 |
![](/patent/app/20220106597/US20220106597A1-20220407-C00001.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00002.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00003.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00004.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00005.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00006.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00007.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00008.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00009.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00010.png)
![](/patent/app/20220106597/US20220106597A1-20220407-C00011.png)
View All Diagrams
United States Patent
Application |
20220106597 |
Kind Code |
A1 |
Dunn; Ian ; et al. |
April 7, 2022 |
Methods For Preventing Titration Of Bimolecular Templated Assembly
Reactions By Structurally-Determined Differential
Hybridizations
Abstract
The present disclosure provides nucleic acid molecules, and kits
comprising the same, for producing templated assembly products for
a cell.
Inventors: |
Dunn; Ian; (Madison, WI)
; Lawler; Matthew; (Madison, WI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
TriBiotica LLC |
Madison |
WI |
US |
|
|
Appl. No.: |
17/509561 |
Filed: |
October 25, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16462324 |
May 20, 2019 |
11186839 |
|
|
PCT/US2017/062048 |
Nov 16, 2017 |
|
|
|
17509561 |
|
|
|
|
62424607 |
Nov 21, 2016 |
|
|
|
International
Class: |
C12N 15/113 20060101
C12N015/113 |
Claims
1. A nucleic acid molecule comprising: a) a first stem portion
comprising from about 10 to about 20 nucleotide bases; b) an
anti-target loop portion comprising from about 16 to about 40
nucleotide bases and having a first end to which the first stem
portion is linked, wherein the anti-target loop portion is
substantially complementary to a target nucleic acid molecule; c) a
second stem portion comprising from about 10 to about 20 nucleotide
bases linked to a second end of the anti-target loop portion,
wherein the first stem portion is substantially complementary to
the second stem portion; and d) a reactive effector moiety linked
to either the first stem portion or the second stem portion;
wherein the T.sub.m of the anti-target loop portion:target nucleic
acid molecule is greater than the T.sub.m of the first stem
portion:second stem portion; and wherein the reactive effector
moiety is capable of undergoing a chemical reaction with a
corresponding reactive effector moiety.
2. The nucleic acid molecule of claim 1 wherein: the T.sub.m of the
first stem portion:second stem portion subtracted from the T.sub.m
of the anti-target loop portion:target nucleic acid molecule is
from about 10.degree. C. to about 40.degree. C.; and/or the T.sub.m
of the first stem portion:second stem portion is from about
40.degree. C. to about 50.degree. C.; and/or the T.sub.m of the
anti-target loop portion:target nucleic acid molecule is from about
60.degree. C. to about 80.degree. C.; and/or the T.sub.m of the
first stem portion:second stem portion subtracted from the T.sub.m
of the anti-target loop portion:target nucleic acid molecule is
from about 10.degree. C. to about 20.degree. C.
3. The nucleic acid molecule of claim 1 wherein: the first stem
portion comprises from about 12 to about 18 nucleotide bases;
and/or the anti-target loop portion comprises from about 18 to
about 35 nucleotide bases; and/or the second stem portion comprises
from about 12 to about 18 nucleotide bases.
4. The nucleic acid molecule of claim 1 herein the nucleotide bases
of any one or more of the first stem portion, anti-target loop
portion, and second stem portion are selected from the group
consisting of DNA nucleotides, RNA nucleotides,
phosphorothioate-modified nucleotides, 2-O-alkylated RNA
nucleotides, halogenated nucleotides, locked nucleic acid
nucleotides (LNA), peptide nucleic acids (PNA), morpholino nucleic
acid analogues (morpholinos), pseudouridine nucleotides, xanthine
nucleotides, hypoxanthine nucleotides, 2-deoxyinosine nucleotides,
DNA analogs with L-ribose (L-DNA), Xeno nucleic acid (XNA)
analogues, or other nucleic acid analogues capable of base-pair
formation, or artificial nucleic acid analogues with altered
backbones, or any combination thereof.
5. The nucleic acid molecule of claim 1 further comprising a linker
between any one or more of the first stem portion and the
anti-target loop portion, between the anti-target loop portion and
the second stem portion, and between the second stem portion and
the reactive effector moiety.
6. The nucleic acid molecule of claim 1 wherein the reactive
effector moiety is selected from the group consisting of a peptide,
a non-active portion of a peptidomimetic structure, a non-active
portion of a drug, and a bioactive compound.
7. The nucleic acid molecule of claim 1 wherein the reactive
effector moiety further comprises a bio-orthogonal reactive
molecule.
8. The nucleic acid molecule of claim 7 wherein the bio-orthogonal
reactive molecule is selected from the group consisting of an
azide, an alkyne, a cyclooctyne, a nitrone, a norbornene, an
oxanorbornadiene, a phosphine, a dialkyl phosphine, a trialkyl
phosphine, a phosphinothiol, a phosphinophenol, a cyclooctene, a
nitrile oxide, a thioester, a tetrazine, an isonitrile, a
tetrazole, and a quadricyclane, or any derivative thereof.
9. The nucleic acid molecule of claim 1 wherein the anti-target
loop portion further comprises an internal hinge region, wherein
the hinge region comprises one or more nucleotides that are not
complementary to the target nucleic acid molecule.
10. The nucleic acid molecule of claim 9 wherein the hinge region
comprises from about 1 nucleotide to about 6 nucleotides.
11. (canceled)
12. A kit comprising: a first nucleic acid molecule according to
claim 1; and a second nucleic acid molecule comprising from about 6
nucleotide bases to about 20 nucleotide bases, which comprises: a
nucleotide portion that is substantially complementary to the stem
portion of the first nucleic acid molecule that is linked to the
reactive effector moiety; and a reactive effector moiety which can
chemically interact with the reactive effector molecule of the
first nucleic acid molecule; wherein the T.sub.m of the second
nucleic acid molecule:first or second stem portion linked to the
reactive effector moiety is less than or equal to the T.sub.m of
the first stem portion:second stem portion.
13. The kit of claim 12, wherein: the reactive effector moiety of
the second nucleic acid molecule is linked to a bio-orthogonal
reactive molecule; the reactive effector moiety of the first
nucleic acid molecule is linked to a bio-orthogonal reactive
molecule; the bio-orthogonal reactive molecule of the second
nucleic acid molecule can chemically interact with the
bio-orthogonal reactive molecule of the first nucleic acid
molecule.
14. The kit of claim 12 wherein: the T.sub.m of the duplex formed
by the second nucleic acid molecule and the first or second stem
portion linked to the reactive effector moiety subtracted from the
T.sub.m of the first stem portion:second stem portion is from about
0.degree. C. to about 20.degree. C.; and/or the T.sub.m of the
duplex formed by the second nucleic acid molecule and the first or
second stem portion linked to the reactive effector moiety is from
about 30.degree. C. to about 40.degree. C.; and/or the T.sub.m of
the duplex formed by the nucleic acid molecule and the first or
second stem portion linked to the reactive effector moiety
subtracted from the Ina of the first stem portion:second stem
portion is from about 5.degree. C. to about 10.degree. C.
15. The kit of claim 12 wherein the second nucleic acid molecule
comprises from about 8 to about 15 nucleotide bases.
16. The kit of claim 12 wherein: the first nucleic acid molecule
comprises the nucleotide sequence of SEQ ID NO:13, and the second
nucleic acid molecule comprises the nucleotide sequence
5'-AGCTCTCGA GT-3' (SEQ ID NO:15); or the first nucleic acid
molecule comprises the nucleotide sequence of SEQ ID NO:14, and the
second nucleic acid molecule comprises the nucleotide sequence
5'-GACGTCTCGA GT-3' (SEQ ID NO:16).
17. The kit of claim 12 wherein the bio-orthogonal reactive
molecule of the first nucleic acid molecule is hexynyl and the
bio-orthogonal reactive molecule of the second nucleic acid
molecule is azide.
18. A method of producing a templated assembly product for a cell
comprising: contacting a target nucleic acid molecule of the cell
with a first nucleic acid molecule of claim 1; and contacting the
first nucleic acid molecule with a second nucleic acid molecule,
wherein the second nucleic acid molecule comprises: a nucleotide
portion that is substantially complementary to the stem portion of
the first nucleic acid molecule that is linked to the reactive
effector moiety; and a reactive effector moiety which can
chemically interact with the reactive effector molecule of the
first nucleic acid molecule; wherein the T.sub.m of the second
nucleic acid molecule:first or second stem portion linked to the
reactive effector moiety is less than or equal to the T.sub.m of
the first stem portion:second stem portion; resulting in the
combination of the respective reactive effector moieties thereby
producing the templated assembly product.
19. The method of claim 18 wherein: the first nucleic acid molecule
comprises the nucleotide sequence of SEQ ID NO:13, and the second
nucleic acid molecule comprises the nucleotide sequence
5'-AGCTCTCGA GT-3' (SEQ ID NO:15); or the first nucleic acid
molecule comprises the nucleotide sequence of SEQ ID NO:14, and the
second nucleic acid molecule comprises the nucleotide sequence
5'-GACGTCTCGA GT-3' (SEQ ID NO:16).
20. The method of claim 18 wherein the bio-orthogonal reactive
molecule of the first nucleic acid molecule is hexynyl and the
bio-orthogonal reactive molecule of the second nucleic acid
molecule is azide.
Description
FIELD
[0001] The present disclosure is directed, in part, to nucleic acid
molecules, and kits comprising the same, for producing templated
assembly products for a cell.
BACKGROUND
[0002] A goal of drug development is delivering potent
bio-therapeutic interventions to pathogenic cells, such as virus
infected cells, neoplastic cells, cells producing an autoimmune
response, and other dysregulated or dysfunctional cells. Examples
of potent bio-therapeutic interventions capable of combating
pathogenic cells include toxins, pro-apoptotic agents, and
immunotherapy approaches that re-direct immune cells to eliminate
pathogenic cells. Unfortunately, developing these agents is
extremely difficult because of the high risk of toxicity to
adjacent normal cells or the overall health of the patient.
[0003] A method that has emerged to allow delivery of potent
interventions to pathogenic cells while mitigating toxicity to
normal cells is targeting of therapeutics by directing them against
molecular markers specific for pathogenic cells. Targeted
therapeutics have shown extraordinary clinical results in
restricted cases, but are currently limited in their applicability
due to a lack of accessible markers for targeted therapy. It is
extremely difficult, and often impossible, to discover protein
markers for many pathogenic cell types.
[0004] More recently, therapies targeted to nucleic acid targets
specific to pathogenic cells have been developed. Existing nucleic
acid-targeted therapies, such as siRNA, are able to down-modulate
expression of potentially dangerous genes, but do not deliver
potent cytotoxic or cytostatic interventions and thus are not
particularly efficient at eliminating the dangerous cells
themselves.
[0005] Hence, there exists a need to combat the poor efficacy
and/or severe side effects of existing bio-therapeutic
interventions. As described herein, novel structures can be
assembled on cellular nucleic acid templates which define
pathogenic or otherwise undesirable cell classes. Such templated
assembly processes can be used to target the cell types of interest
for destruction. Pairs of modified oligonucleotides carrying
specially tailored and mutually reactive groups can assemble
molecules with predetermined functions following co-annealing in
spatial proximity on a target cellular template. In the
conventional bimolecular approach (i.e., Template Assembly by
Proximity-Enhanced Reactivity (TAPER)), a titration issue emerges
when target templates are present in large amounts, in excess of
levels of oligonucleotides that can practically be obtained
intracellularly. This template titration effect reduces the
functional assembly signal in inverse proportion to the increase in
the template:oligonucleotide ratio. In this application, a means
for circumventing this issue is described, which also has certain
other advantages for the general TAPER process.
SUMMARY
[0006] The present disclosure provides nucleic acid molecules
comprising: a) a first stem portion comprising from about 10 to
about 20 nucleotide bases; b) an anti-target loop portion
comprising from about 16 to about 40 nucleotide bases and having a
first end to which the first stem portion is linked, wherein the
anti-target loop portion is substantially complementary to a target
nucleic acid molecule; c) a second stem portion comprising from
about 10 to about 20 nucleotide bases linked to a second end of the
anti-target loop portion, wherein the first stem portion is
substantially complementary to the second stem portion; and d) a
reactive effector moiety linked to either the first stem portion or
the second stem portion. The T.sub.m of the anti-target loop
portion:target nucleic acid molecule is greater than the T.sub.m of
the first stem portion:second stem portion.
[0007] The present disclosure also provides kits comprising: a) a
first nucleic acid molecule according to any one of claims 1 to 18;
and b) a second nucleic acid molecule comprising from about 6
nucleotide bases to about 20 nucleotide bases, which comprises: i)
a nucleotide portion that is substantially complementary to the
stem portion of the first nucleic acid molecule that is linked to
the reactive effector moiety; and ii) a reactive effector moiety
which can chemically interact with the reactive effector molecule
of the first nucleic acid molecule. The T.sub.m of the second
nucleic acid molecule:first or second stem portion linked to the
reactive effector moiety is less than or equal to the T.sub.m of
the first stem portion:second stem portion.
[0008] The present disclosure also provides methods of producing a
templated assembly product for a cell comprising: a) contacting a
target nucleic acid molecule of the cell with a first nucleic acid
molecule of any one of claims 1 to 18; and b) contacting the first
nucleic acid molecule with a second nucleic acid molecule, wherein
the second nucleic acid molecule comprises: i) a nucleotide portion
that is substantially complementary to the stem portion of the
first nucleic acid molecule that is linked to the reactive effector
moiety; and ii) a reactive effector moiety which can chemically
interact with the reactive effector molecule of the first nucleic
acid molecule; resulting in the combination of the respective
reactive effector moieties thereby producing the templated assembly
product. The T.sub.m of the second nucleic acid molecule:first or
second stem portion linked to the reactive effector moiety is less
than or equal to the T.sub.m of the first stem portion:second stem
portion.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] FIG. 1 shows a representative schematic depiction of how
template titration occurs with excess target mRNA (for example, HPV
DNA target nucleic acid molecule; 5'-TAACT
GTCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGACAAAAAGC-3'; SEQ ID
NO:1) (5'-UAACUGUCAAAAGCCACUGUGUCCUGAAGAAAAGCAAAGACAU
CUGGACAAAAAGC-3' RNA sequence produced therefrom; SEQ ID NO:23) for
bimolecular templated assembly by the TAPER process; curved line
with arrows denotes proximity-induced reaction between the reactive
components of the indicated haplomers (for example 5'-UCCAG
AUGUCUUUGC-3' (SEQ ID NO:2) and 5'-UUUCUUCAGGACACAG-3' (SEQ ID
NO:3)).
[0010] FIG. 2 shows a representative demonstration of template
titration effect with an in vitro model using pyrene
excimer-induced fluorescence (with SEQ ID NO:1, SEQ ID NO:2, and
SEQ ID NO:3, as shown above).
[0011] FIG. 3 (panels A, B, and C) shows a representative
demonstration of template titration with model
oligonucleotide-based click reactions; panel A shows a sequence of
click oligonucleotides (5'-CTTGTCCAGC-alkyne-3' (SEQ ID NO:4); and
5'-azide-TGGACCATCT-3' (SEQ ID NO:5)) and RNA oligonucleotide
template (5'-GAAAUAGAUGGUCCAGCUGGA CAAGCAGAA-3' (SEQ ID NO:6));
panel B shows possible secondary structure with the same RNA
template; panel C shows+/-click reactions with varying ratios of
template to click oligonucleotides; excess template was removed
with NaOH treatments where shown; MU89 melanoma cell RNA
specificity control ratio based on assuming average size of
mammalian mRNA=1500 bases; M=marker lane.
[0012] FIG. 4 shows a representative bimolecular "locked" approach
for circumventing template titration effect.
[0013] FIG. 5 shows a representative schematic depiction of the
operation of a locked haplomer in the presence of excess target
template; the locked haplomer bottle loop sequence hybridizes to
the target more strongly than the self-complementarity that
prevents access by the second effector in the absence of template;
subsequently, the target site for the second effector is rendered
accessible following the target-specific hybridization event.
[0014] FIG. 6 shows a representative use of hybrid nucleic acids
for locked TAPER, consisting of a bottle structure where the
anti-target loop region sequence is composed of normal nucleic
acids (bearing D-ribose), and the stem portion comprising the
reactive effector moiety and its complement are composed of DNA
with L-ribose (L-DNA).
[0015] FIG. 7 shows a representative locked TAPER having an
alternative template architecture, where the template-mediated
first haplomer bottle opening occurs via discontinuous sites
brought into spatial proximity on the exterior of a stem-loop
structure.
[0016] FIG. 8 shows a representative locked TAPER having an
alternative template architecture, where the template-mediated
first haplomer bottle opening occurs via discontinuous sites
brought into spatial proximity in the interior loop of a stem-loop
structure.
[0017] FIG. 9 shows a representative target nucleic acid molecule
sequence (5'-TAACTG
TCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTGGACAAAAAGC-3'; SEQ ID NO:1)
and structures of initial model oligonucleotides (first nucleic
acid molecule is
5'-hexynyl-ACTCGAGACGTCTCTGTCTTTGCTITCTTCAGGACACAGTGGCGAGA
CGTCTCGAGT-3' (SEQ ID NO:7); and second nucleic acid molecule is
5'-TTTGACGTCT CGAGT-azide-3' (SEQ ID NO:8)) designed to examine the
ability of locked constructs to overcome the template titration
effect.
[0018] FIG. 10 shows a representative examination of locked TAPER
model oligonucleotides (see, FIG. 9 sequences) using various
incubation conditions.
[0019] FIG. 11 shows a representative examination of locked TAPER
model oligonucleotides (see, FIG. 9 sequences) using a control
hexynyl oligonucleotide where both self-complementary ends forming
the stem loop are scrambled such that the bottle structure cannot
form, and no hybridization site for the second haplomer is
present.
[0020] FIG. 12 shows a representative examination of locked TAPER
model oligonucleotides (see, FIG. 9 sequences) using a control
hexynyl oligonucleotide where a single stem loop segment is
scrambled such that the bottle structure could not form, while the
hybridization site for the second haplomer is still present.
[0021] FIG. 13 (panels A and B) shows a representative locked TAPER
dose response with HPV oligonucleotide RNA template; panel A shows
plus and minus click reactions from a test series, where varying
amounts of RNA template were used as shown (NT=no template); where
RNA amounts were greater than or equal to a five-fold molar excess
of the haplomers (lanes 9-14), the RNA was removed by alkaline
hydrolysis to avoid its interference with gel migration patterns;
panel B shows samples from the same experiment, but here only the
(+) click reactions are shown for ease of comparison.
[0022] FIG. 14 shows the kinetics of a representative annealing
between target-complementary sequence of a bottle first effector
structure, and the target itself.
[0023] FIG. 15 shows the EBNA1 coding sequence (SEQ ID NO:9),
showing the repeat region between non-repetitive 5' and 3' regions,
and the target specific repetitive sequence within the repeat
region itself.
[0024] FIG. 16 shows sequence and structural arrangements for
representative oligonucleotides (the first nucleic acid molecule is
5'-hexynyl-TTCGACTCGAGACGTCTC
CTTCCTGCCCCTCCTCCTGCTCCGAGACGTCTCGAGT-3' (SEQ ID NO:10); and second
nucleic acid mole is 5'-GACGTCTCGAGTTCTT-azide-3' (SEQ ID NO: 11))
for the locked TAPER using an EBNA1 repeat motif
(5'AGTITGCAGGAGCAGGAGGAGGGGCAGGAGCA GGAG-3'; SEQ ID NO:12).
[0025] FIG. 17 shows a structure of a representative "unlocked"
TAPER EBNA1 repeat-region oligonucleotide
(5'-hexynyl-TTCGACTCGAGACGTCTCCTTCCTGCCCCTCCTCC
TGCTCCGAGACGTCTCGAGT-3'; SEQ ID NO:10) in the presence of specific
target (5'-AGTfGCAGGAGCAGGAGGAGGGGCAGGAGCAGGAG-3'; SEQ ID NO:12)
and hybridized to a second haplomer (5'-GACGTCTCGAGTTCTT-azide-3';
SEQ ID NO: 11).
[0026] FIG. 18 shows results of a representative locked TAPER model
EBNA1 oligonucleotides (see, FIG. 12 sequences) using an
oligonucleotide target.
[0027] FIG. 19 (panels A and B) shows results of a representative
locked TAPER model EBNA1 oligonucleotides (see, FIG. 12 sequences)
using RNA targets; panel A shows gel results from two quantities of
RNA (1.0 and 10.0 .mu.g) extracted from the EBV-bearing
lymphoblastoid cell line EBV-17, along with control RNA from the
non-EBV-bearing melanoma line 453A; panel B shows the same gel as
Panel B, but at a lighter exposure.
DESCRIPTION OF EMBODIMENTS
[0028] Certain exemplary embodiments will now be described to
provide an overall understanding of the principles of the
structure, function, manufacture, and use of the compositions and
methods disclosed herein. One or more examples of these embodiments
are illustrated in the accompanying drawings. Those skilled in the
art will understand that the compositions and methods specifically
described herein and illustrated in the accompanying drawings are
non-limiting exemplary embodiments and that the scope of the
present disclosure is defined solely by the claims. The features
illustrated or described in connection with one exemplary
embodiment may be combined with the features of other embodiments.
Such modifications and variations are intended to be included
within the scope of the present disclosure.
[0029] As used herein, the singular forms "a," "an," and "the"
include plural references unless the content clearly dictates
otherwise. The terms used in this disclosure adhere to standard
definitions generally accepted by those having ordinary skill in
the art. In case any further explanation might be needed, some
terms have been further elucidated below.
[0030] As used herein, the phrases "active effector structure" and
"effector structure" are used interchangeably to refer to the
active portion of a templated assembly product produced upon the
combination of reactive effector moieties that triggers a desired
effect.
[0031] As used herein, the phrase "anti-target loop portion" refers
to a portion of a haplomer that facilitates sequence-specific
binding to a target nucleic acid molecule.
[0032] As used herein, the term "base" refers to a molecule
containing a purine or pyrimidine group, or an artificial analogue,
that forms a binding pair with another corresponding base via
Watson-Crick or Hoogsteen bonding interactions. Bases further
contain groups that facilitate covalently joining multiple bases
together in a polymer, such as an oligomer. Non-limiting examples
include nucleotides, nucleosides, peptide nucleic acid residues, or
morpholino residues.
[0033] As used herein, the terms "bind," "binds," "binding," and
"bound" refer to a stable interaction between two molecules that
are close to one another. The terms include physical interactions,
such as chemical bonds (either directly linked or through
intermediate structures), as well as non-physical interactions and
attractive forces, such as electrostatic attraction, hydrogen
bonding, and van der Waals/dispersion forces.
[0034] As used herein, the phrase "bioconjugation chemistry" refers
to the chemical synthesis strategies and reagents that ligate
common functional groups together under mild conditions,
facilitating the modular construction of multi-moiety
compounds.
[0035] As used herein, the phrase "chemical linker" refers to a
molecule that binds one haplomer to another haplomer or one moiety
to another moiety on different compounds. A linker may be comprised
of branched or unbranched covalently bonded molecular chains.
[0036] As used herein, the phrase "dosage unit form" refers to
physically discrete units suited as unitary dosages for the
subjects to be treated.
[0037] As used herein, the phrase "effector structure-triggered
agent" refers to an exogenously-produced compound or cell capable
of initiating a desired activity upon binding to an effector
structure.
[0038] As used herein, the phrase "effector structure-triggered
agent" refers to an exogenously produced compound or cell capable
of initiating a desired activity upon binding to an effector
structure.
[0039] As used herein, the term "haplomer" refers to the nucleic
acid recognition moiety that binds to a target nucleic acid
template in a sequence-specific manner and participates in product
formation during nucleic acid templated assembly. Also included
herein are "derivatives" or "analogs" such as salts, hydrates,
solvates thereof, or other molecules that have been subjected to
chemical modification and maintain the same biological activity or
lack of biological activity, and/or ability to act as a haplomer,
or function in a manner consistent with a haplomer.
[0040] As used herein, the phrase "non-traceless bio-orthogonal
chemistry" refers to a reaction involving selectively-reactive
moieties in which part or all of the structure of the
selectively-reactive moieties is retained in the product
structure.
[0041] As used herein, the phrase "nucleic acid templated assembly"
refers to the synthesis of a effector structure or structures on a
target nucleic acid molecule, such that the effector structure
formation can be facilitated by haplomers being assembled in
proximity when bound to the target nucleic acid molecule.
[0042] As used herein, the terms "oligomer" and "oligo" refer to a
molecule comprised of multiple units where some or all of the units
are bases capable of forming Watson-Crick or Hoogsteen base-pairing
interactions, allowing sequence-specific binding to nucleic acid
molecules in a duplex or multiplex structure. Non-limiting examples
include, but are not limited to, oligonucleotides, peptide nucleic
acid oligomers, and morpholino oligomers.
[0043] As used herein, the phrase "pathogenic cell" can refer to a
cell that is capable of causing or promoting a diseased or an
abnormal condition, such as a cell infected with a virus, a tumor
cell, and a cell infected with a microbe, or a cell that produces a
molecule that induces or mediates diseases that include, but are
not limited to allergy, anaphylaxis, inflammation and
autoimmunity.
[0044] As used herein, the phrase "pharmaceutically acceptable"
refers to a material that is not biologically or otherwise
unacceptable, that can be incorporated into a composition and
administered to a patient without causing unacceptable biological
effects or interacting in an unacceptable manner with other
components of the composition.
[0045] As used herein, the phrase "pharmaceutically acceptable
salt" means a salt prepared from a base or an acid which is
acceptable for administration to a patient, such as a mammal (e.g.,
salts having acceptable mammalian safety for a given dosage
regime).
[0046] As used herein, the phrase "reactive effector moiety" refers
to a portion of a haplomer that enables formation of effector
structure, such as through a chemical reaction with a corresponding
haplomer, on an adjacent templated assembly. For example, a
reactive effector moiety can react readily with a corresponding
reactive effector moiety, but does not readily react with natural
biomolecules.
[0047] As used herein, the term "salt" can include salts derived
from pharmaceutically acceptable inorganic acids and bases and
salts derived from pharmaceutically acceptable organic acids and
bases and their derivatives and variants thereof.
[0048] As used herein, the term "sample" refers to any system that
haplomers can be administered into, where nucleic acid templated
assembly may occur. Examples of samples include, but are not
limited to, fixed or preserved cells, whole organisms, tissues,
tumors, lysates, or in vitro assay systems.
[0049] As used herein, the phrases "set of corresponding reactants"
or "corresponding haplomers" refer to haplomers that come together
on a single target nucleic acid molecule to take part in a
templated assembly reaction.
[0050] As used herein, the term "superantigen" refers to an antigen
that binds to a broad subset of T cells that express a particular
variable (V) region.
[0051] As used herein, the phrase "target compartment" refers to a
cell, virus, tissue, tumor, lysate, other biological structure,
spatial region, or sample that contains target nucleic acid
molecule(s), or a different amount of target nucleic acid molecules
than a non-target compartment.
[0052] As used herein, the phrases "target nucleic acid sequence"
and "target nucleic acid molecule" are used interchangeably and
refer to a sequence of units or nucleic acids which are intended to
act as a template for nucleic acid templated assembly.
[0053] As used herein, the phrase "templated assembly product,"
refers to the effector structure or structures formed by
interaction, binding or reaction of one or more nucleic acid
haplomers.
[0054] As used herein, the phrase "traceless bio-orthogonal
chemistry" refers to a reaction involving reactive effector
moieties in which a naturally occurring bond, such as an amide, is
formed by elimination of part or all of the reactive effector
moieties from the effector structure thus produced.
[0055] Nucleic acid molecules that are specific to designated cells
of interest (whether these are represented by pathological tumor
cells, abnormal immune cells, or any other cellular types) can be
used as templates for the generation of novel structures (e.g.,
effector structures) by means of proximity-induced enhancement of
molecular interactions (see, for example, PCT Publication No. WO
2014/197547). Such templated products can be designed to trigger
cell death in various ways, or to modulate cellular activities.
Cell-type specific nucleic acids can be sourced from specific
transcribed mRNAs, or via nucleic acid aptamers which can serve to
adapt non-nucleic acid targets for the provision of a defined
template sequence.
[0056] The process by which nucleic acid molecules may permit
templated assembly typically is bimolecular with respect to the
template-complementary effector molecules bearing the relevant
reactive effector moieties. Each functional molecule in these
circumstances is called a "haplomer." While this process is highly
effective under many circumstances, an inherent issue exists with
such assembly systems simply by virtue of their haplomeric
bimolecularity. Since two separate participants are involved, a
molar excess of a target template (irrespective of its source) can
titrate out copies of each haplomer, decreasing the probability
that two haplomers will anneal to the same template (as required
for proximity-induced induction of reactivity). The theoretical
basis of this template-derived titration effect is depicted in FIG.
1. Hence, the conventional bimolecular TAPER process is potentially
restricted by amounts of target template in excess of an optimal
concentration range. In the case of tumors, there are numerous
precedents for over-expression of many transcripts, some of which
act as drivers of tumor proliferation. Consequently, the TAPER
process could be effectively improved against such targets.
[0057] In addition, experimental evidence also suggests that
titration effects can effect templated bimolecular reactions. In
one such approach, pyrene fluorescence was used as a measure of
template-induced molecular proximity. When planar pyrene molecules
are closely juxtaposed on a molecular scale, excimer-based
fluorescent emissions are known to be observable. Covalent
appending of pyrene moieties to 5' and 3' ends of short
oligonucleotides can be used to gauge bimolecular interactions
based on hybridization-induced proximity, as a simple model for
pairs of functional haplomers within the TAPER process. In such
systems, a peak of fluorescent emission is observed when both model
target template and pyrene-labeled complementary oligonucleotide
pairs are at a mutual equimolar ratio, declining thereafter as the
relative template amount rises (see, FIG. 2). In an alternate test
model for template titration, DNA oligonucleotides equipped at
their 5' or 3' ends with mutually-reactive click groups were used
(5'-azide and 3'-linear alkyne), where the click reaction is
catalyzed by univalent copper. Also, the model template in this
scenario was an RNA oligonucleotide, which not only has the
advantage of better representing an actual mRNA target, but also is
readily removable after the click reaction by sodium hydroxide
treatment. The latter feature is important when the products are
analyzed by gel electrophoresis, since large amounts of template
(as when excess template quantities are tested) can interfere with
product band visualization. When the click oligonucleotide pairs
were examined for Cu(I)-catalyzed activity in the presence of the
RNA template, it was observed that the highest amount of product
was seen with greater than 1:1 oligonucleotide:template molar
ratios. However, at higher template levels, formation of product
was almost obliterated (see, FIG. 3). The desire for increased
target nucleic acid template levels for maximal product formation
is interpreted as being due to the potential for significant
secondary structure within the model RNA oligonucleotide target
(see, FIG. 3). Where an equilibrium exists between the folded and
linear (accessible) RNA forms, increased target nucleic acid
template levels concomitantly increase the available amount of
accessible target nucleic acid template. Nevertheless, at very high
target nucleic acid template concentrations, the titration effect
still occurs, and product formation decreases. These observations
reinforce the target nucleic acid template titration effect, while
at the same time showing that prediction of the extent of product
formation impedance simply by target nucleic acid template
concentration alone is not sufficient.
[0058] In general, one solution to the target nucleic acid template
titration effect for TAPER is devised by means of
structurally-determined differential hybridizations. A distinction
in this case from conventional TAPER is that the target nucleic
acid sequence for haplomer binding does not correspond to a
cellular nucleic acid. Here, the haplomer sequences are fixed and
complementary to each other, where the first haplomer is "locked"
by hybridization to a complementary sequence within the same longer
oligonucleotide (see, FIG. 4). An internal anti-target loop portion
sequence within this oligonucleotide structure corresponds to the
target-complementary sequence. The structure comprising the first
haplomer constrained by internal self-hybridization and an
anti-target loop portion sequence that is complementary to the
target nucleic acid molecule sequence is the "first haplomer" or
"first haplomer bottle."
[0059] The present disclosure provides nucleic acid molecules
comprising: a) a first stem portion comprising from about 10 to
about 20 nucleotide bases; b) an anti-target loop portion
comprising from about 16 to about 40 nucleotide bases and having a
first end to which the first stem portion is linked, wherein the
anti-target loop portion is substantially complementary to a target
nucleic acid molecule; c) a second stem portion comprising from
about 10 to about 20 nucleotide bases linked to a second end of the
anti-target loop portion, wherein the first stem portion is
substantially complementary to the second stem portion; and d) a
reactive effector moiety linked to either the first stem portion or
the second stem portion; wherein the T.sub.m of the anti-target
loop portion:target nucleic acid molecule is greater than the
T.sub.m of the first stem portion:second stem portion. A nucleic
acid molecule comprising these features is referred to herein as:
"first nucleic acid molecule", "first haplomer bottle", "first
haplomer" and "bottle haplomer."
[0060] In some embodiments, the first nucleic acid molecule
comprises a first stem portion that comprises from about 10 to
about 20 nucleotide bases. In some embodiments, the first stem
portion comprises from about 12 to about 18 nucleotide bases. In
some embodiments, a reactive effector moiety is linked to the first
stem portion.
[0061] In some embodiments, the first nucleic acid molecule
comprises an anti-target loop portion that comprises from about 16
to about 40 nucleotide bases. In some embodiments, the anti-target
loop portion comprises from about 18 to about 35 nucleotide bases.
The anti-target loop portion has a first end to which the first
stem portion is linked. The anti-target loop portion is
substantially complementary to a target nucleic acid molecule.
[0062] In some embodiments, the anti-target loop portion can
further comprise an internal hinge region, wherein the hinge region
comprises one or more nucleotides that are not complementary to the
target nucleic acid molecule. In some embodiments, the hinge region
comprises from about 1 nucleotide to about 6 nucleotides, from
about 1 nucleotide to about 5 nucleotides, from about 1 nucleotide
to about 4 nucleotides, from about 1 nucleotide to about 3
nucleotides, or 1 or 2 nucleotides.
[0063] The target nucleic acid molecule template (complementary to
the anti-target loop portion of a general first haplomer bottle)
for all locked TAPER embodiments can be comprised of any desired
nucleic acid sequence capable of hybridizing with the specific
anti-loop region portion itself. Any single-stranded nucleic acid
molecule with an accessible sequence is potentially targetable.
These include, but are not limited to, cellular RNAs, mRNA, genomic
or organellar DNA, episomal or plasmid DNA, viral DNA or RNA,
miRNA, rRNA, snRNA, tRNA, short and long non-coding RNAs, and any
artificial sequences used for templating purposes, or any other
biological or artificial nucleic acid sequence. Artificial
sequences include, but are not limited to, aptamers and
macromolecular-nucleic acid conjugates. Aptamer templates are also
included, where these are designed to convert a non-nucleic acid
cellular product into a targetable sequence for any form of TAPER,
including locked TAPER. In some embodiments, the target nucleic
acid molecule hybridization site is kept as short as possible
while: 1) maintaining specificity within a complex transcriptome or
other complex targets; and 2) maintaining the locked TAPER design
guidelines described herein.
[0064] Any cell, virus, tissues, spatial regions, lysate, or other
subcomponent of a sample that contains a target nucleic acid can
provide the target nucleic acid. Target compartments that contain
the target nucleic acid can include, but are not limited to,
pathogenic cells, cancer cells, viruses, host cells infected by a
virus or other pathogen, or cells of the immune system that are
contributing to autoimmunity such as cells of the adaptive or
innate immune systems, transplant rejection, or an allergic
response. In some embodiments, a target nucleic acid can be present
in a virus or cell infected by a virus, but absent in healthy
cells. Some non-limiting examples of virus can include DNA viruses,
RNA viruses, or reverse transcribing viruses. In some embodiments,
a target nucleic acid can be present in a tumor or cancerous cell,
but absent in healthy cells. Some non-limiting examples of cancers
can include those caused by oncoviruses, such as the human
papilloma viruses, Epstein-Barr virus, hepatitis B virus, hepatitis
C virus, human T-lymphotropic viruses, Merkel cell polyoma virus,
and Kaposi's sarcoma-associated herpesvirus. In some embodiments, a
target nucleic acid can be present in an infectious agent or
microbe, or a cell infected by an infectious agent or microbe but
is absent in healthy cells. Some non-limiting examples of
infectious agents or microbes can include viruses, bacteria, fungi,
protists, prions, or eukaryotic parasites.
[0065] The target nucleic acid sequence can also be a fragment,
portion or part of a gene, such as an oncogene, a mutant gene, an
oncoviral gene, a viral nucleic acid sequence, a microbial nucleic
acid sequence, a differentially expressed gene, and a nucleic acid
gene product thereof.
[0066] Examples of cancer-specific target nucleic acids can include
mutant oncogenes, such as mutated ras, HRAS, KRAS, NRAS, BRAF,
EGFR, FLT1, FLT4, KDR, PDGFRA, PDGFRB, ABL1, PDGFB, MYC, CCND1,
CDK2, CDK4, or SRC genes; mutant tumor suppressor genes, such as
TP53, TP63, TP73, MDM1, MDM2, ATM, RB1, RBL1, RBL2, PTEN, APC, DCC,
WT1, IRF1, CDK2AP1, CDKN1A, CDKN1B, CDKN2A, TRIM3, BRCA1, or BRCA2
genes; and genes expressed in cancer cells, where the gene may not
be mutated or genetically altered, but is not expressed in healthy
cells of a sample at the time of administration, such as
carcinoembryonic antigen.
[0067] In some embodiments, the target nucleic acid can be present
in a differential amounts or concentrations in the target
compartments as compared to the non-target compartments. Examples
include, but are not limited to, genes expressed at a different
level in cancer cells than in healthy cells, such as myc,
telomerase, HER2, or cyclin-depedent kinases. In some embodiments,
the target nucleic acid molecule can be a gene that is at least
1.5.times.-fold differentially expressed in the target versus the
non-target compartments. Some examples of these can include, but
are not limited to, genes related to mediating Type I allergic
responses, for which target RNA molecules contain immunoglobulin
epsilon heavy chain sequences; genes expressed in T cell subsets,
such as specific T cell receptors (TCRs) which recognize
self-antigens in the context of particular major histocompatibility
(MHC) proteins like proinsulin-derived peptide and
clonally-specific mRNAs containing .alpha. or .beta.
variable-region sequences, derived from diabetogenic CD8+ T cells;
and cytokines whose production may have adverse outcomes through
exacerbation of inflammatory responses, including but not limited
to TNF-alpha, TNF-beta, IL-1, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12,
IL-15, IL-17, IL-18, IL-21, IL-22, IL-27, IL-31. IFN-gamma, OSM,
and LIF.
[0068] In some embodiments, a target nucleic acid is present in
target compartments and an acceptable subgroup of non-target
compartments, but not in a different or distinct subgroup of
non-target compartments. Some non-limiting examples can include
genes expressed in cancer cells and limited to classes of healthy
cells, such as cancer-testis antigens, survivin, prostate-specific
antigen, carcinoembryonic antigen (CEA), alpha-fetoprotein and
other onco-fetal proteins. Also, many tissues and organs are not
essential to otherwise healthy life in the face of serious disease.
For example, melanocyte antigens, such as Melan-A/MART-1 and gp100
are expressed on many malignant melanomas as well as normal
melanocytes, and therapies that target these antigens can destroy
both tumors and normal melanocytes, resulting in vitiligo, but
major tumor reduction. Likewise, the reproductive organs may be
surgically removed, such as testis, ovary and uterus, as well as
associated organs such as breast and prostate may be targeted when
tumors of these tissues arise, and destruction of normal tissues
within these organs may be a tolerable consequence of therapy.
Furthermore, some cells that produce hormones, such as thyroxine
and insulin can be replaced with the relevant protein, allowing
potential targeting of normal cells that may exist in the presence
of tumors of these origins.
[0069] Target nucleic acid molecules can also include novel
sequences, not previously identified. In some embodiments, a sample
or samples can be evaluated by sequence analysis, such as
next-generation sequencing, whole-transcriptome (RNA-seq) or
whole-genome sequencing, microarray profiling, serial analysis of
gene expression (SAGE), to determine the genetic makeup of the
sample. Target nucleic acid molecules can be identified as those
present in target compartments, but not present in non-target
compartments, or present in differential amounts or concentrations
in target compartments as compared to non-target compartments.
Sequences identified by these methods can then serve as target
nucleic acid molecules.
[0070] In some embodiments, the first nucleic acid molecule
comprises a second stem portion that comprises from about 10 to
about 20 nucleotide bases. In some embodiments, the second stem
portion comprises from about 12 to about 18 nucleotide bases. The
second stem portion is linked to a second end of the anti-target
loop portion. The first stem portion is substantially complementary
to the second stem portion. In some embodiments, a reactive
effector moiety is linked to the second stem portion.
[0071] In some embodiments, the first nucleic acid molecule
comprises the nucleotide sequence
5'-ACTCGAGACGTCTCCTTGTCTTTGCTTTTCTTCAGGACACAGTGGCGA GACGTCTCGAGT-3'
(SEQ ID NO:13) or 5'-ACTCGAGACGTCTCCTTCCTGCCCCTC
CTCCTGCTCCGAGACGTCTCGAGT-3' (SEQ ID NO:14).
[0072] The present disclosure also provides nucleic acid molecules
comprising from about 6 nucleotide bases to about 20 nucleotide
bases, which comprises: a nucleotide portion that is substantially
complementary to the stem portion (either the first stem portion or
the second stem portion) of the first nucleic acid molecule that is
linked to the reactive effector moiety; and a reactive effector
moiety which can chemically interact with the reactive effector
molecule of the first nucleic acid molecule; wherein the T.sub.m of
the second nucleic acid molecule:first or second stem portion
linked to the reactive effector moiety is less than or equal to the
T.sub.m of the first stem portion:second stem portion. A nucleic
acid molecule comprising these features is referred to herein as:
"second nucleic acid molecule" and "second haplomer."
[0073] In some embodiments, the second nucleic acid molecule
comprises from about 6 to about 20 nucleotide bases. In some
embodiments, the second nucleic acid molecule comprises from about
8 to about 15 nucleotide bases.
[0074] In some embodiments, the second nucleic acid molecule
comprises the nucleotide sequence 5'-AGCTCTCGAGT-3' (SEQ ID NO:15),
or 5'-GACGTCTCGAGT-3' (SEQ ID NO:16).
[0075] In some embodiments, the first nucleic acid molecule
comprises the nucleotide sequence of SEQ ID NO:13, and the second
nucleic acid molecule comprises the nucleotide sequence of SEQ ID
NO:15; or the first nucleic acid molecule comprises the nucleotide
sequence of SEQ ID NO:14, and the second nucleic acid molecule
comprises the nucleotide sequence of SEQ ID NO:16.
[0076] For the nucleic acid molecules described herein, the length
of the particular nucleic acid molecule is less important than the
T.sub.m of the duplex formed by the interaction of the nucleic acid
molecule, or portion thereof, with another nucleic acid molecule,
or portion thereof. For example, the T.sub.m of the duplex formed
by the interaction of the anti-target loop portion with the target
nucleic acid molecule (e.g., anti-target loop portion:target
nucleic acid molecule) is greater than the T.sub.m of the duplex
formed by the interaction of the first stem portion of the first
nucleic acid molecule with the second stem portion of the first
nucleic acid molecule (e.g., first stem portion:second stem
portion). In some embodiments, the T.sub.m of the first stem
portion:second stem portion subtracted from the T.sub.m of the
anti-target loop portion:target nucleic acid molecule is from about
10.degree. C. to about 40.degree. C. In some embodiments, the
T.sub.m of the first stem portion:second stem portion subtracted
from the T.sub.m of the anti-target loop portion:target nucleic
acid molecule is from about 10.degree. C. to about 20.degree. C. In
some embodiments, the T.sub.m of the first stem portion:second stem
portion is from about 40.degree. C. to about 50.degree. C. In some
embodiments, the T.sub.m of the anti-target loop portion:target
nucleic acid molecule is from about 60.degree. C. to about
80.degree. C. In some embodiments, the T.sub.m of the duplex formed
by the interaction of the second nucleic acid molecule with either
the first stem portion or the second stem portion, whichever stem
portion is linked to the reactive effector moiety (e.g., second
nucleic acid molecule:first or second stem portion linked to the
reactive effector moiety), is less than or equal to the T.sub.m of
the first stem portion:second stem portion. In some embodiments,
the T.sub.m of the duplex formed by the second nucleic acid
molecule and the first or second stem portion linked to the
reactive effector moiety subtracted from the T.sub.m of the first
stem portion:second stem portion is from about 0.degree. C. to
about 20.degree. C. In some embodiments, the T.sub.m of the duplex
formed by the nucleic acid molecule and the first or second stem
portion linked to the reactive effector moiety subtracted from the
T.sub.m of the first stem portion:second stem portion is from about
5.degree. C. to about 10.degree. C. In some embodiments, the
T.sub.m of the duplex formed by the second nucleic acid molecule
and the first or second stem portion linked to the reactive
effector moiety is from about 30.degree. C. to about 40.degree.
C.
[0077] In addition, translating the T.sub.m information above into
specific lengths of the nucleic acid molecules described herein
also depends on the GC content of each nucleic acid molecule. For
example, the length of a suitable HPV model target nucleic acid
molecule is 30 bases (having a T.sub.m of 70.degree. C.), while
that for the EBV model target nucleic acid molecule is only 21
bases (having a T.sub.m of 69.degree. C.), owing to its greater %
GC.
[0078] This structural arrangement is designed such that in the
absence of target nucleic acid molecule template, the locked first
haplomer bottle (e.g., the first nucleic acid molecule) does not
significantly hybridize to its complementary second haplomer (e.g.,
the second nucleic acid molecule), and thus template-directed
product assembly is not promoted under such conditions. When the
specific target template is present, on the other hand, the first
haplomer bottle is "unlocked" by the formation of a more stable
hybrid between the anti-target loop region of the bottle haplomer
and the target nucleic acid molecule itself (see, FIG. 4). Once
this occurs, the first stem portion of the bottle haplomer that is
linked to the reactive moiety is free to hybridize to the available
second haplomer, with resulting proximity between the mutually
reactive effector moieties on both, and generation of a specific
assembly reaction (see, FIG. 4). It is the exposure of the
accessible first haplomer bottle that renders the process resistant
to the template titration effect, since there is a 1:1
correspondence between the binding of anti-target loop potion to
the corresponding target nucleic acid molecule and generation of
first haplomer accessibility for the second haplomer. This can be
expressed as:
B[L]cH1::H1+T.fwdarw.cH1-T::L-H1 (1)
cH1-T::L-H1+H2.fwdarw.cH1-T::L-H1::H2 (2),
where B[L]cH1::H1 is the first haplomer bottle with the anti-target
loop region (L); T is the target nucleic acid molecule; cH1 is the
complement to the first haplomer sequence H1; T::L-H1 is the
anti-target loop region duplex with the exposed first haplomer
sequence; and H2 is the second haplomer. Since the second haplomer
(H2) can only hybridize to the first haplomer (H1) after the latter
has been exposed through the presence of the specific nucleic acid
molecule template, a template excess cannot have a titration
effect, and indeed is beneficial through shifting equation (1)
further to the right, thus providing more available H1. The
unlocking of a single copy of the first haplomer bottle in the
presence of excess target nucleic acid molecule template is
depicted schematically in FIG. 5. Since the exposed first haplomer
sequence H1 is unique and designed to be absent from the target
expressed genome, spurious hybridization between H1 and an
off-target sequence is minimal. This applies also to the designed
complement to H1, the second haplomer H2.
[0079] As described above, the specificity of the H1::H2
interaction can be enhanced by rendering the hybridization
bio-orthogonal. This can be achieved by, for example, synthesizing
a hybrid first haplomer bottle where the H1 and H1-complementary
(cH1) sequences are comprised of DNA bearing L-ribose, or L-DNA
(see, FIG. 6). Since DNA can only form duplexes between homochiral
complementary single strands, when the H1 sequence is exposed
following hybridization of the (normal) anti-target loop sequence
with cellular target, it follows that H1 can only form a duplex
with a corresponding H2 L-DNA sequence.
[0080] In all locked TAPER embodiments, one can modulate the
hybridization T.sub.m values of each component in line with the
desired differential hybridization effects. Thus, the designed
thermal stabilities of relevant components should be:
T::L>>cH1::H1>H1::H2. It is notable that the sequences of
cH1::H1 and H1::H2 are similar but not identical, in order to
ensure that the sequestration of the H1 haplomer sequence within
the first haplomer bottle is marginally more stable than the H1::H2
inter-haplomer duplex. By this means, mixtures of the first
haplomer bottle and the second haplomer H2 in the absence of target
will favor retention of the cH1::H1 configuration rather than
formation of H1::H2.
[0081] Within a locked TAPER system, when the two haplomers bearing
click chemical groups (e.g., reactive effector moiety linked to a
bio-orthogonal reactive molecule) or other modifications are in
hybridization-mediated spatial proximity (see, FIG. 4), it is by
virtue of their possessing mutual complementarity. This is quite
distinct from conventional TAPER, where the spatial proximity is
achieved by haplomer complementarity to a third-party template
strand. Nevertheless, since the anti-target loop portion of a
locked-TAPER first haplomer bottle hybridizes to a target nucleic
acid molecule sequence in order to expose the recognition site for
the second haplomer, the anti-target loop-target binding itself can
occur via different architectures. These alternative structural
arrangements can include hybridizations to discontinuous sites.
Thus, the target hybridization of the locked TAPER oligonucleotide
schematically depicted in FIG. 7 is achieved with discontinuous
sites brought into spatial proximity in the exterior arms of a stem
loop structure. Alternately, equivalent spatial proximity can be
engendered by hybridization sites juxtaposed within a loop formed
by a template secondary structure (see, FIG. 8). In both of these
embodiments, the regions within the first haplomer loops that
hybridize to discontinuous targets may be separated by an
additional "hinge" sequence of d(T).sub.N, where N is from 1 to
about 6 bases. The provision of such a hinge sequence is designed
to confer flexibility between the two hybridizing segments, and
minimize torsional strain on these regions.
[0082] In these alternative architectures for Locked TAPER, it is
important to maintain the differential rules of hybridization
stabilities for T::L>>cH1::H1>H1::H2 as described above.
Locked TAPER accordingly has the unique feature whereby the TAPER
assembly is always constant through haplomer mutual
complementarity, but target hybridization can assume variable
architectures. In other words, for conventional TAPER, the target
hybridization and assembly-directing hybridizations coincide, but
for locked TAPER they are distinct and separable.
[0083] In these embodiments, locked TAPER affords considerable
advantages compared to conventional TAPER. These advantages
include, for example, evasion of template titration, boosting of
signal strength with high copy-number template, provision of
bio-orthogonal hybridization, and the use of fixed haplomeric
sequences. In the latter case, a single pair of specific haplomers
(bearing bio-orthogonal reactive molecules) can be used for an
indefinite number of targets, where the loop region of first
haplomer bottles can be varied according to the desired target
sequence complement. In addition, solving the template titration
problem enables the targeting of repeat sequence motifs. Where N
copies of a specific motif occurs in M steady-state copies of a
transcript of interest, the total number of theoretically
targetable motifs is N.times.M. In practice, not all such motifs
may be accessible, and the targetable motif number per cell becomes
<N.times.M, owing to secondary structural constraints.
Nevertheless, attempting to target a repeated motif with
conventional TAPER is very likely to suffer restrictions from
template titration, when accessible N.times.M copy number becomes
greater than the molar quantities of each separate haplomer
achievable after delivery into a target cellular environment. No
such restriction exists for locked-TAPER, and indeed, increased
copy number from a repeat motif is an advantage in terms of the
potential increase in read-out product assembly levels. In
addition, the above observation that repeat motifs within a single
transcript may vary in their accessibilities for TAPER purposes may
be another inherent advantage of repeat motifs. In a dynamic
cellular environment, where some single-copy mRNA motifs may have
variable accessibility, multiple repeat motifs may increase the
likelihood of access.
[0084] The locked TAPER process also uses a single segment for the
hybridization that enables specific RNA targeting, in contrast to
conventional TAPER, where two such sequences are used for each
haplomer. Clearly, the length of these segment is a significant
issue in terms of achieving the necessary specificity towards a
target template. In the locked TAPER strategy, the length of the
target-complementary loop sequence can be varied as desired,
subject to the requirement that the Tm of loop::target is >>
the bottle stem T.sub.m. But in specific targeting circumstances,
the length of the target sequence with locked TAPER could achieve
the necessary specificity and still be less than the total sequence
required for conventional bimolecular effector partials. Thus,
targeting by locked TAPER approach may be less demanding than the
conventional TAPER strategy.
[0085] In any of the nucleic acid molecules described herein, or
any portion thereof, the nucleotide bases are selected from the
group consisting of DNA nucleotides, RNA nucleotides,
phosphorothioate-modified nucleotides, 2-O-alkylated RNA
nucleotides, halogenated nucleotides, locked nucleic acid
nucleotides (LNA), peptide nucleic acids (PNA), morpholino nucleic
acid analogues (morpholinos), pseudouridine nucleotides, xanthine
nucleotides, hypoxanthine nucleotides, 2-deoxyinosine nucleotides,
DNA analogs with L-ribose (L-DNA), Xeno nucleic acid (XNA)
analogues, or other nucleic acid analogues capable of base-pair
formation, or artificial nucleic acid analogues with altered
backbones, or any combination or mixture thereof.
[0086] For any of the nucleic acid molecules described herein, the
complementarity with another nucleic acid molecule can be 100%. In
some embodiments, one particular nucleic acid molecule can be
substantially complementary to another nucleic acid molecule. As
used herein, the phrase "substantially complementary" means from 1
to 10 mismatched base positions, from 1 to 9 mismatched base
positions, from 1 to 8 mismatched base positions, from 1 to 7
mismatched base positions, from 1 to 6 mismatched base positions,
from 1 to 5 mismatched base positions, from 1 to 4 mismatched base
positions, from 1 to 3 mismatched base positions, and 1 or 2
mismatched base positions. In some embodiments, it is desirable to
avoid reducing the T.sub.m of the anti-target loop portion:target
nucleic acid molecule by more than 10% via mismatched base
positions. The first haplomer bottle stem is designed with respect
to second haplomer, and its structure is deliberately arranged to
be somewhat more stable than the formation of the second haplomer
duplex.
[0087] Any of the nucleic acid molecules described herein, or any
portion thereof, can further comprise a linker between any one or
more of the first stem portion and the anti-target loop portion,
between the anti-target loop portion and the second stem portion,
and between the second stem portion and the reactive effector
moiety of the first nucleic acid molecule or between the second
nucleic acid molecule and its reactive effector moiety. In some
embodiments, the linker is selected from the group consisting of an
alkyl group, an alkenyl group, an amide, an ester, a thioester, a
ketone, an ether, a thioether, a disulfide, an ethylene glycol, a
cycloalkyl group, a benzyl group, a heterocyclic group, a
maleimidyl group, a hydrazone, a urethane, azoles, an imine, a
haloalkyl, and a carbamate, or any combination thereof.
[0088] Each of the first nucleic acid molecule (e.g., first
haplomer) and the second nucleic acid molecule (e.g., second
haplomer) is linked to a reactive effector moiety. In some
embodiments, the reactive effector moiety is selected from the
group consisting of a peptide, a non-active portion of a
peptidomimetic structure, a non-active portion of a drug, and a
bioactive compound. In some embodiments, the reactive effector
moiety is less than about 20 kDa. In some embodiments, the reactive
effector moiety is less than about 10 kDa.
[0089] The effector structure generated by the processes described
herein (via two reactive effector moieties) is the trigger that
drives a desired action in a sample. Some examples of desired
effector activity can include, but are not limited to, inducing an
immune response, programmed cell death, apoptosis, non-specific or
programmed necrosis, lysis, growth inhibition, inhibition of viral
infection, inhibition of viral replication, inhibition of oncogene
expression, modification of gene expression, inhibition of
microbial infection, and inhibition of microbe replication, as well
as combinations of these biological activities. In some
embodiments, the effector structure can serve as a ligand for an
antibody to induce an immune response at the site of the pathogenic
cells, or to localize antibody-directed therapies, such as an
antibody bearing a therapeutic payload, to the site of the
pathogenic cells. In some embodiments, the effector structure can
modulate expression of a target gene. In some embodiments, the
effector structure can regulate enzyme activity, gene/protein
expression, molecular signaling, and molecular interactions.
[0090] An effector structure is a product of a combination of
reactive effector moieties that produces a desired activity in a
sample. The active effector structure can possess a targeted
activity or an elevated level of activity as compared to either or
both of the reactive effector moieties individually. In some
embodiments, the active effector structure can possess a new or
substantially different activity than the individual reactive
effector moieties, as compared to either or both of the reactive
effector moieties individually.
[0091] A diverse array of effector structures may be produced by
nucleic acid templated assembly. Any active product may serve as an
effector structure as long as such a structure can be produced by
the templated assembly by the reaction of corresponding reactive
effector moieties. Thus, any compound that may be reconstituted
from separate portions (e.g., reactive effector moieties) by
formation of an amide bond, triazole linkage, phosphine oxide
linkage, or other bio-orthogonal ligation products, as described
herein, may serve as an active effector structure. In addition,
such compounds can be assembled on virtually any accessible target
nucleic acid molecule template, thus allowing assembly in a very
diverse set of samples.
[0092] General forms of effector structures include but are not
limited to: Amide-linked Effector Structure created by a
non-traceless bio-orthogonal reaction, such as:
##STR00001##
Triazole-linked effector structure produced by an azide-alkyne
bio-orthogonal reaction, such as:
##STR00002##
Phosphine oxide-linked effector structures produced by
non-traceless Staudinger ligation bio-orthogonal reactions, such
as:
##STR00003##
[0093] Active effector structures can also include proteins,
peptides containing standard or non-standard amino acids,
peptidomimetic structures, and drugs or other bioactive
compounds.
[0094] In some embodiments, effector structures may be liberated
from the other moieties in the templated assembly product by
cleavage of the bonds connecting the effector structure to the
remainder of the product. Cleavage may be achieved by, for example,
hydrolysis of the connecting bonds, or by enzymatic cleavage by
proteins or other compounds endogenous to the sample. Examples of
these cleavable bonds include, but are not limited to, esters,
thioesters, imines, hydrazones, cleavage motifs of cellular
proteases, or substrates of cellular enzymes. Cleavable groups may
be introduced by their incorporation into a haplomer moiety,
linker, or accessory group during synthesis, or may be generated
during the ligation reaction. In some embodiments, post-ligation
cleavage or other in situ chemical modification of the effector
structure may be required for the effector structure to trigger a
desired activity.
[0095] An effector structure may also trigger activity by acting
within a target compartment (for example, within a cell), at the
surface of a target compartment (for example, at the cell surface),
in the vicinity of the target compartment (for example, when the
effector structure is actively exported from the cell, leaks from
the cell, or released upon cell death), or diffuse or be carried to
a distant region of the sample to trigger a response. In some
embodiments, effector structures can be targeted to their active
sites by incorporation of targeting groups in the templated
assembly product. Examples of targeting groups include, but are not
limited to, endoplasmic reticulum transport signals, golgi
apparatus transport signals, nuclear transport signals,
mitochondrial transport signals, ubiquitination motifs, other
proteosome targeting motifs, or glycosylphosphatidylinositol anchor
motifs. Targeting groups may be introduced by their incorporation
into a haplomer moiety, chemical linker, or accessory group during
synthesis, or may be generated during the ligation reaction.
[0096] In some embodiments, the effector structure can be presented
on the surface of a target compartment. In some embodiments, the
effector structure can be presented on the surface of a cell as a
ligand bound to a major histocompatibility complex molecule.
[0097] In some embodiments, the effectors can be endogenous
peptides, and their analogue, or completely synthetic structures
which are targets for effector structure-triggered agents such as
antibodies. Because the availability of target nucleic acid
molecules can limit production of active effectors, it may be
desirable to have effector structures that exert activity when
present at low levels.
[0098] In some embodiments, killing or growth inhibition of target
cells can be induced by direct interaction with cytotoxic,
microbicidal, or virucidal effector structures. Numerous toxic
molecules known in the art can be produced. In some embodiments,
traceless bio-orthogonal reactive chemistry may produce toxic
peptides. Examples of toxic peptides include, but are not limited
to, bee melittin, conotoxins, cathelicidins, defensins, protegrins,
and NK-lysin.
[0099] In some embodiments, killing or growth inhibition of target
cells can be induced by pro-apoptotic effector structures. For
example, effector peptides produced using traceless bio-orthogonal
chemistry include pro-apoptotic peptides, including but not limited
to, prion protein fragment 106-126 (PrP 106-126), Bax-derived
minimum poropeptides associated with the caspase cascade including
Bax 106-134, and pro-apoptotic peptide (KLAKLAK).sub.2.
[0100] In some embodiments, the effector molecule produced can be
thrombogenic, in that it induces activation of various components
of the clotting cascade of proteins, or activation of proteins, or
activation and/or aggregation of platelets, or endothelial damage
that can lead to a biologically active process in which a region
containing pathogenic cells can be selectively thrombosed to limit
the blood supply to a tumor or other pathogenic cell. These types
of effectors can also induce clotting, or prevent clotting, or
prevent platelet activation and aggregation in and around targeted
pathogenic cells.
[0101] In some embodiments, effector structures can mediate killing
or growth inhibition of target cells or viruses by activating
molecules, pathways, or cells associated with the immune system.
Effector structures may engage the innate immune system, the
adaptive immune system, and/or both.
[0102] In some embodiments, effector structures can mediate killing
or growth inhibition of cells or viruses by stimulation of the
innate immune system. In some embodiments, effector structures can
include pathogen-associated molecular patterns (PAMPs),
damage-associated molecular patterns (DAMPs), and synthetic
analogues thereof.
[0103] In some embodiments, the innate immune system can be engaged
by effector structures that activate the complement system. A
non-limiting example of a complement activating effector structures
can be the C3a fragment of complement protein C3.
[0104] In some embodiments, effector structures can be agonists of
formylated peptide receptors. In some embodiments, the formylated
tripeptide formyl-Met-Leu-Phe can be produced using traceless
bio-orthogonal chemistry. A specific example scheme for generating
fMLF peptides using traceless haplomers can include:
##STR00004##
[0105] In some embodiments, small peptide agonists of the
formylated peptide receptor such as the peptide
Trp-Lys-Tyr-Met-Val-(D-Met) (SEQ ID NO:24) can be produced.
[0106] In some embodiments, effector structures with natural or
synthetic ligands of Toll-Like Receptors (TLR) can be produced. In
a non-limiting example, an effector structure can include peptide
fragments of heat shock proteins (hsp) known to be TLR
agonists.
[0107] In some embodiments, traceless bio-orthogonal chemistry may
be used to produce the muramyl dipeptide agonist of the NOD2
receptor to activate an inflammatory response.
[0108] In some embodiments, effector structures can mediate killing
or growth inhibition of cells or viruses by activating molecules or
cells of the adaptive immune system. Unique to the adaptive immune
system, molecules or cells can be engineered to recognize an
extraordinary variety of structures, thus removing the constraint
that the effector structure must be intrinsically active or bind to
an endogenous protein.
[0109] Because of the modularity of the present system, a single
engineered molecule or cell of the adaptive immune system can be
utilized for therapy of any target compartments or target nucleic
acids, since the same effector structure can be produced in the
presence of any target nucleic acid molecule. This is an advantage
over the current state of the art, where new molecules or cells
must be engineered to treat any new target, involving significant
time, difficulty, and cost.
[0110] In some embodiments, an effector structure can be a ligand
for an antibody or antibody fragment (including but not limited to
Fab, Fv, and scFv). Traceless bio-orthogonal approaches can be used
to produce a peptide or other epitope that is bound by an existing
antibody, or an antibody can be developed to recognize an effector
structure created by any selectively reactive or bio-orthogonal
approach.
[0111] For therapeutic intervention in conjunction with haplomers,
manufactured antibodies can be administered as effector
structure-triggered agents. The agent may be administered to a
sample before, during, or after administration of haplomers. An
example includes, but is not limited to, reporter antibodies. In
some embodiments, unmodified antibodies can be utilized to mediate
therapeutic effects. In some embodiments, an effector structure
specific antibody can be manufactured with a payload attached
designed to enhance the therapeutic effect. Examples of therapeutic
antibody payloads include, but are not limited to, cytotoxins,
radioisotopes, radiosensitizers used in conjunction with radiation
therapy, enzymes for the conversion of a co-administered prodrug to
an active drug, or any other antibody-directed therapy.
[0112] In some embodiments, an antibody may be used for detection
of an effector structure in vivo, thus localizing a target
compartment within a subject.
[0113] In some embodiments, effector structures can activate
T-cells. Activation of T-cells can be achieved by an effector
structure binding to a T-cell receptor (TCR). In some embodiments,
an effector structure can be presented on the surface of a target
cell bound to an MHC molecule, facilitating binding of a T-cell
receptor. An effector structure may be bound by MHC class I or MHC
class II molecules. In an exemplary embodiment, an effector
structure is bound by MHC class I molecules. The structure that
binds to the TCR can be a conventional peptide antigen, or a
superantigen that binds to a broad subset of T cells that express a
particular variable (V) region.
[0114] As opposed to a TCR that is selected to interact with
specific antigen, a superantigen can activate a large number of T
cell populations that have receptors capable of binding to
different antigen-MHC complexes, and induce a strong inflammatory
response to set off a cascade of inflammatory mediators. Thus, a
superantigen or superantigen mimetic can be produced as an active
effector structure that can recruit large numbers of T cells to a
pathogenic cell, and lead to destruction or limitation in the
growth of such cells.
[0115] Natural ligands bound to MHC class I molecules are typically
peptides of 8 to 10 amino acids in length, though other lengths are
permissible. Natural ligands bound to MHC class II molecules are
typically peptides of 15 to 24 amino acids in length, though other
lengths are permissible. Effector structures can be produced using
traceless bio-orthogonal chemistry. A peptide that is a known MHC
ligand can be utilized as an effector structure, or a novel peptide
can be produced. Assays for evaluating binding of peptides to MHC
molecules are known in the art, and may be used to evaluate
candidate effector structures for MHC binding.
[0116] MHC molecules are also known to bind non-peptide structures
and peptidomimetics. Non-traceless bio-orthogonal templated
assembly approaches may be utilized to create peptidomimetic
MHC-binding antigens for activation of T-cell receptors. In some
embodiments, the peptidomimetic can be a peptide of 6 to 40 amino
acids or non-standard amino acids, where between 1 to 4 residues
are replaced by a non-traceless bio-orthogonal ligation structure,
such as:
.sup.1.sub.mR-[Bio-orthogonal ligation structure]-R.sup.2.sub.n
where R.sup.1 and R.sup.2 are covalently bonded standard or
non-standard amino acids, m=0 to 40, n=0 to 40, and m+n=2 to 39. In
some embodiments, m+n=3 to 11, producing structures suitable for
binding to MHC class I molecules.
[0117] Examples of effector structures using the MART-1
immunodominant tumor associated antigen as a design scaffold
include, but are not limited to:
[0118] An example of peptidomimetic effector structure based on
Staudinger ligation chemistry is:
##STR00005##
[0119] An example of peptidomimetic effector structure based on
azide-alkyne ligation chemistry is:
##STR00006##
[0120] Example of peptidomimetic effector structure based on
azide-cyclooctyl alkyne ligation chemistry is:
##STR00007##
[0121] Peptidomimetic effector structures may be designed based on
a natural ligand known to bind MHC molecules and activate a T-cell
receptor (as in the examples above.) Alternately, the
peptidomimetic effector structure may be an entirely new structure,
and a new T-cell clone or antibody-TCR chimera (T-body) may be
developed for use as an effector structure-triggered agent. This
approach offers the benefit of using highly non-self,
non-cross-reactive effector structures which may increase activity
while reducing undesired side-effects during therapy.
[0122] In some embodiments, natural peptide or peptidomimetic
MHC-binding effector structures can be utilized in conjunction with
adoptive T-cell therapy, where the adoptive T-cell serves as an
effector structure-triggered agent. An adoptive T cell therapy
provides a patient with exogenous T cells which can accomplish a
therapeutically desirable immunoreaction. However, allogenic T
cells can be potentially problematic either from host rejection, or
the risk of graft-vs.-host disease.
[0123] Recently developed techniques have enabled the use of
autologous T cells for various therapeutic applications, where host
genetic incompatibility is avoided. Clinically relevant T cell
subsets (including clonally-derived cells with specific TCRs) can
be expanded in vitro and returned to autologous patients. Greater
selectivity can be achieved by means of autologous T cells
transfected in vitro with vectors enabling the expression of TCRs
of known specificity against target antigens (such as those known
to be expressed on tumors), or engineered chimeric antigen
receptors with equivalent desired specificities.
[0124] Once an active effector structure has been selected,
appropriate selectively-reactive moieties and reactive effector
moieties can be designed for incorporation into the haplomer(s).
These moieties are designed such that they can reconstitute the
active effector moiety when a templated assembly reaction
occurs.
[0125] In some embodiments, the reactive effector moiety further
comprises a bio-orthogonal reactive molecule. In some embodiments,
the bio-orthogonal reactive molecule is selected from the group
consisting of an azide, an alkyne, a cyclooctyne, a nitrone, a
norbornene, an oxanorbornadiene, a phosphine, a dialkyl phosphine,
a trialkyl phosphine, a phosphinothiol, a phosphinophenol, a
cyclooctene, a nitrile oxide, a thioester, a tetrazine, an
isonitrile, a tetrazole, and a quadricyclane, or any derivative
thereof. In some embodiments, the reactive effector moiety of the
second nucleic acid molecule is linked to a bio-orthogonal reactive
molecule, and the reactive effector moiety of the first nucleic
acid molecule is linked to a bio-orthogonal reactive molecule,
wherein the bio-orthogonal reactive molecule of the second nucleic
acid molecule can chemically interact with the bio-orthogonal
reactive molecule of the first nucleic acid molecule. In some
embodiments, the bio-orthogonal reactive molecule of the first
nucleic acid molecule is hexynyl and the bio-orthogonal reactive
molecule of the second nucleic acid molecule is azide. In some
embodiments, the bio-orthogonal reactive molecule of the first
nucleic acid molecule is azide and the bio-orthogonal reactive
molecule of the second nucleic acid molecule is hexynyl.
[0126] An example of selectively-reactive moiety can include a
bio-orthogonal reactive moiety. The bio-orthogonal reactive moiety
includes those groups that can undergo "click" reactions between
azides and alkynes, traceless or non-traceless Staudinger reactions
between azides and phosphines, and native chemical ligation
reactions between thioesters and thiols. Additionally, the
bio-orthogonal moiety can be any of an azide, a cyclooctyne, a
nitrone, a norbornene, an oxanorbornadiene, a phosphine, a dialkyl
phosphine, a trialkyl phosphine, a phosphinothiol, a
phosphinophenol, a cyclooctene, a nitrile oxide, a thioester, a
tetrazine, an isonitrile, a tetrazole, a quadricyclane, and
derivatives thereof. Selectively reactive moieties of members of a
set of corresponding haplomers are selected such that they will
react with each other to produce an active effector structure.
[0127] Multiple selectively-reactive moieties can be used with the
methods and compositions disclosed herein, some non-limiting
examples include:
Azide-Alkyne "Click Chemistry"
[0128] Click chemistry is highly selective as neither azides nor
alkynes react with common biomolecules under typical conditions.
Azides of the form R--N.sub.3 and terminal alkynes of the form
R--C.ident.CH or internal alkynes of the form R--C.ident.C--R react
readily with each other to produce Huisgen cycloaddition products
in the form of 1,2,3-triazoles.
##STR00008##
[0129] Azide-based haplomers have the substructure: R--N.sub.3,
where R is a chemical linker, nucleic acid recognition moiety (e.g.
a portion of an oligonucleotide that is complementary to another
portion of a nucleic acid molecule), or reactive effector moiety.
Azides and azide derivatives may be readily prepared from
commercially available reagents.
[0130] Azides can also be introduced to a reactive effector moiety
during synthesis of the reactive effector moiety. In some
embodiments, an azide group is introduced into a reactive effector
moiety comprised of a peptide by incorporation of a commercially
available azide-derivatized standard amino acid or amino acid
analogue during synthesis of the reactive effector moiety peptide
using standard peptide synthesis methods. Amino acids may be
derivatized with an azide replacing the .alpha.-amino group,
affording a structure of the form:
##STR00009##
where R is a side chain of a standard amino acid or non-standard
amino acid analogue.
[0131] Commercially available products can introduce azide
functionality as amino acid side chains, resulting in a structure
of the form:
##STR00010##
where A is any atom and its substituents in a side chain of a
standard amino acid or non-standard amino acid analogue.
[0132] An azide may also be introduced into a reactive effector
moiety peptide after synthesis by conversion of an amine group on
the peptide to an azide by diazotransfer methods. Bioconjugate
chemistry can also be used to join commercially available
derivatized azides to chemical linkers, nucleic acid recognition
moieties, or reactive effector moieties that contain suitable
reactive groups.
[0133] Standard alkynes can be incorporated into a haplomer by
methods similar to azide incorporation. Alkyne-functionalized
nucleotide analogues are commercially available, allowing alkyne
groups to be directly incorporated at the time of nucleic acid
recognition moiety synthesis. Similarly, alkyne-deriviatized amino
acid analogues may be incorporated into a reactive effector moiety
by standard peptide synthesis methods. Additionally, diverse
functionalized alkynes compatible with bioconjugate chemistry
approaches may be used to facilitate the incorporation of alkynes
to other moieties through suitable functional or side groups.
Azide-Activated Alkyne "Click Chemistry"
[0134] Standard azide-alkyne chemistry reactions typically require
a catalyst, such as copper(I). Since copper(I) at catalytic
concentrations is toxic to many biological systems, standard
azide-alkyne chemistry reactions have limited uses in living cells.
Copper-free click chemistry systems based on activated alkynes
circumvent toxic catalysts.
[0135] Activated alkynes often take the form of cyclooctynes, where
incorporation into the cyclooctyl group introduces ring strain to
the alkyne.
##STR00011##
[0136] Heteroatoms or substituents may be introduced at various
locations in the cyclooctyl ring, which may alter the reactivity of
the alkyne or afford other alternative chemical properties in the
compound. Various locations on the ring may also serve as
attachment points for linking the cyclooctyne to a nucleic acid
templated assembly moiety or linker. These locations on the ring or
its substituents may optionally be further derivatized with
accessory groups.
[0137] Multiple cyclooctynes are commercially available, including
several derivatized versions suitable for use with standard
bioconjugation chemistry protocols. Commercially available
cyclooctyne derivatized nucleotides can aid in facilitating
convenient incorporation of the reactive effector moiety during
nucleic acid recognition moiety synthesis.
##STR00012##
[0138] Cyclooctyne-azide based bio-orthogonal chemistry may produce
templated assembly products of the general structure:
##STR00013##
[0139] Another example:
##STR00014##
Azide-Phosphine Staudinger Chemistry
[0140] The Staudinger reduction, based on the rapid reaction
between an azide and a phosphine or phosphite with loss of N.sub.2,
also represents a bio-orthogonal reaction. The Staudinger ligation,
in which covalent links are formed between the reactants in a
Staudinger reaction, is suited for use in nucleic acid templated
assembly. Both non-traceless and traceless forms of the Staudinger
ligation allow for a diversity of options in the chemical structure
of products formed in these reactions.
Non-Traceless Staudinger Ligation
[0141] The standard Staudinger ligation is a non-traceless reaction
between an azide and a phenyl-substituted phosphine such as
triphenylphosphine, where an electrophilic trap substituent on the
phosphine, such as a methyl ester, rearranges with the aza-ylide
intermediate of the reaction to produce a ligation product linked
by a phosphine oxide. An example of a Staudinger ligation product
formed by haplomers A and B may have the structure:
##STR00015##
[0142] Phenyl-substituted phosphines carrying electrophilic traps
can also be readily synthesized. Derivatized versions are available
commercially and suitable for incorporation into haplomers:
##STR00016##
Traceless Staudinger Ligation
[0143] In some embodiments, phosphines capable of traceless
Staudinger ligations may be utilized as reactive effector moieties.
In a traceless reaction, the phosphine serves as a leaving group
during rearrangement of the aza-ylide intermediate, creating a
ligation typically in the form of a native amide bond. Compounds
capable of traceless Staudinger ligation generally take the form of
a thioester derivatized phosphine or an ester derivatized
phosphine: An exemplary ester-derivatized phosphine for traceless
Staudinger ligation is:
##STR00017##
An exemplary thioester-derivatized phosphine for traceless
Staudinger ligations is:
##STR00018##
[0144] Chemical linkers or accessory groups may optionally be
appended as substituents to the R groups in the above structures,
providing attachment points for nucleic acid recognition moieties
or for the introduction of additional functionality to the
reactant.
Traceless Phosphinophenol Staudinger Ligation
[0145] Compared to the non-traceless Staudinger phenylphosphine
compounds, the orientation of the electrophilic trap ester on a
traceless phosphinophenol is reversed relative to the phenyl group.
This enables traceless Staudinger ligations to occur in reactions
with azides, generating a native amide bond in the product without
inclusion of the phosphine oxide.
##STR00019##
[0146] The traceless Staudinger ligation may be performed in
aqueous media without organic co-solvents if suitable hydrophilic
groups, such as tertiary amines, are appended to the
phenylphosphine. Weisbrod and Marx describe preparation of
water-soluble phosphinophenol, which may be loaded with a desired
reactive effector moiety containing a carboxylic acid (such as the
C-terminus of a peptide) via the mild Steglich esterification using
a carbodiimide such as dicyclohexylcarbodiimide (DCC) or
N,N'-diisopropylcarbodiimide (DIC) and an ester-activating agent
such as 1-hydroxybenzotriazole (HOBT) (Synlett, 2010, 5, 787-789).
This approach facilitates synthesis of haplomers of the form:
##STR00020##
Water-soluble phosphinophenol-based traceless haplomer
structure.
Traceless Phosphinomethanethiol Staudinger Ligation
[0147] Phosphinomethanethiols represent an alternative to
phosphinophenols for mediating traceless Staudinger ligation
reactions. In general, phosphinomethanethiols possess favorable
reaction kinetics compared with phosphinophenols in mediating
traceless Staudinger reaction. U.S. patent application 2010/0048866
and an article to Tam et al. describe preparation of water-soluble
phosphinomethanethiols of the form:
##STR00021##
(J. Am. Chem. Soc., 2007, 129, 11421-30).
[0148] These compounds may be loaded with a peptide or other
payload, in the form of an activated ester, to form a thioester
suitable for use as a traceless bio-orthogonal reactive group:
##STR00022##
Haplomer structure based on water-soluble phosphinomethanethiol
traceless Staudinger bio-orthogonal chemistry.
Native Chemical Ligation
[0149] Native chemical ligation is a bio-orthogonal approach based
on the reaction between a thioester and a compound bearing a thiol
and an amine. The classic native chemical ligation is between a
peptide bearing a C-terminal thioester and another bearing an
N-terminal cysteine, as seen below:
##STR00023##
[0150] Native chemical ligation may be utilized to mediate
traceless reactions producing a peptide or peptidomimetic
containing an internal cysteine residue, or other thiol-containing
residue if non-standard amino acids are utilized.
[0151] N-terminal cysteines may be incorporated by standard amino
acid synthesis methods. Terminal thioesters may be generated by
several methods known in the art, including condensation of
activated esters with thiols using agents such as
dicyclohexylcarbodiimide (DCC), or introduction during peptide
synthesis via the use of "Safety-Catch" support resins.
Other Selectively Reactive Moieties
[0152] Any suitable bio-orthogonal reaction chemistry may be
utilized for synthesis of haplomers, as long as it efficiently
mediates a reaction in a highly selective manner in complex
biologic environments. A recently developed non-limiting example of
an alternative bio-orthogonal chemistry that may be suitable is
reaction between tetrazine and various alkenes such as norbornene
and trans-cyclooctene, which efficiently mediates bio-orthogonal
reactions in aqueous media.
[0153] Chemical linkers or accessory groups may optionally be
appended as substituents to the above structures, providing
attachment points for nucleic acid recognition moieties or reactive
effector moieties, or for the introduction of additional
functionality to the reactant.
[0154] The configurations involving the reactive effector moieties
depicted in the Examples and Figures could be reversed. In other
words, the reactive effector moiety could be linked to the 3' end
of the first haplomer bottle, as long as the second haplomer
accordingly had its reactive effector moiety linked to its 5' end.
The Examples provided below have the first haplomer bottles with a
5'-linked reactive effector moiety, and the second haplomers with a
3'-lined reactive effector moiety. Likewise, in this system the
reactive effector moieties can be switched around. For example,
instead of using the first haplomer bottle with a 5'-hexynyl and
the second haplomer with a 3'-azide (as in the provided Examples),
the first haplomer bottle could bear the azide, and the second
haplomer the hexynyl group.
[0155] In some embodiments, the portion of the first nucleic acid
molecule that is not linked to a reactive effector moiety can have
additional nucleotide bases that overhang and do not form a part of
the stem structure. In some embodiments, the end of the second
nucleic acid molecule that is not linked to a reactive effector
moiety can have additional nucleotide bases that overhang and do
not form a complementary part of the structure with the stem
portion of the first nucleic acid molecule. In addition, in some
embodiments, the portion of the stem that is linked to the reactive
effector moiety can also have nucleotide bases that are not base
paired with the first stem portion. Such an extension of the stem
with a non-hybridized "arm" places the two reactive effectors at a
greater spatial distance, thus, tending to reduce their mutual
reactivity. So, for a few nucleotide bases (less than 10 or less
than 5), enforced reactivity is still likely to occur, but will
tend to diminish as the non-base paired segment grows in
length.
[0156] In some embodiments, added nucleotide bases can be of
indefinite length, as long as they did not: 1) have significant
homologies with any of the other regions of the locked TAPER
oligonucleotides, and thus tend to cross-hybridize and interfere;
or 2) interfere non-specifically with any other features of the
system. For example, a long appended sequence might reduce
transformation efficiencies of locked TAPER oligonucleotides used
in a therapeutic context. Also, appended sequences should be
designed to avoid spurious hybridizations with other cellular
transcripts. Appended non-homologous sequences of 20-30 nucleotide
bases are suitable. The appended nucleic acid sequences may contain
primer sequences commonly used in the art. Such examples may
include, but are not limited to, M13, T3, T7, SP6, VF2, VR,
modified versions thereof, complementary sequences thereof, and
reverse sequences thereof. In addition, custom primer sequences are
also included. Such primer sequences can be used, for example, the
possible application of chemically-ligated oligonucleotides
spatially elicited (CLOSE) to the locked TAPER strategy, (see, PCT
Publication WO 2016/89958; which is incorporated herein by
reference in its entirety).
[0157] The reactive effector moiety can also be conjugated to other
moieties on a haplomer such that the effector structure produced
may be cleaved from the templated assembly ligation product after
the reaction has occurred. Cleavage may occur via hydrolysis of a
bond, or be catalyzed by enzymes or other molecules within a cell.
Non-limiting examples of cleavage linkages include: esters,
thioesters, imines, hydrazones, cleavage motifs of cellular
proteases, or substrates of cellular enzymes.
[0158] In embodiments in which a traceless bio-orthogonal reactive
group forms a native amide bond in the effector structure, the
reactive effector moiety may include a non-active portion of an
active peptide, or a non-active portion of a non-peptide drug or
endogenous bioactive compound that can be reconstituted via an
amide bond to a corresponding portion.
[0159] In embodiments in which a non-traceless bio-orthogonal
reactive group incorporates a phosphine oxide, triazole, or other
bio-orthogonal ligation residue, reactive effector moieties may
include a non-active portion of a peptidomimetic structure or
non-active portion of a drug or other bioactive compound. In these
embodiments, the ligated residue from the bio-orthogonal reaction
can be integrated into the effector structure.
[0160] Due to the diverse nature of reactive effector moieties,
various methods may be necessary for synthesis. In some
embodiments, peptides are used, and reactive effector moieties may
be synthesized using standard Merrifield solid-phase synthesis.
Synthesis approaches for other reactive effector moieties are
dictated by the specific chemical structure of the particular
moiety.
[0161] The present disclosure also provides kits. In some
embodiments, the kit comprises any one or more of the first nucleic
acid molecules described herein. In some embodiments, the kit
comprises any one or more of the second nucleic acid molecules
described herein.
[0162] The present disclosure also provides methods of producing a
templated assembly product for a cell comprising: a) contacting a
target nucleic acid molecule of the cell with a first nucleic acid
molecule described herein; and contacting the first nucleic acid
molecule with a second nucleic acid molecule, wherein the second
nucleic acid molecule comprises: i) a nucleotide portion that is
substantially complementary to the stem portion of the first
nucleic acid molecule that is linked to the reactive effector
moiety; and ii) a reactive effector moiety which can chemically
interact with the reactive effector molecule of the first nucleic
acid molecule; wherein the T.sub.m of the second nucleic acid
molecule:first or second stem portion linked to the reactive
effector moiety is less than or equal to the T.sub.m of the first
stem portion:second stem portion, thereby resulting in the
combination of the respective reactive effector moieties thereby
producing the templated assembly product.
[0163] In some embodiments, the first nucleic acid molecule
comprises the nucleotide sequence of SEQ ID NO:13, and the second
nucleic acid molecule comprises the nucleotide sequence of SEQ ID
NO:15; or the first nucleic acid molecule comprises the nucleotide
sequence of SEQ ID NO:14, and the second nucleic acid molecule
comprises the nucleotide sequence of SEQ ID NO:16. In some
embodiments, the bio-orthogonal reactive molecule of the first
nucleic acid molecule is hexynyl and the bio-orthogonal reactive
molecule of the second nucleic acid molecule is azide. In some
embodiments, the bio-orthogonal reactive molecule of the first
nucleic acid molecule is azide and the bio-orthogonal reactive
molecule of the second nucleic acid molecule is hexynyl.
[0164] Administration of sets of corresponding haplomers may vary
according to the nature of the sample. In some embodiments, the
haplomers can be dispensed into a sample within a suitable vessel
or chamber. In some embodiments, the sample may be dispensed into a
vessel already containing the haplomers. In some embodiments, the
haplomers can be assembled in in vitro or in situ.
[0165] In some embodiments, the haplomers can be administered for
templated assembly in vivo. To facilitate administration of the
haplomers to samples, prepared haplomers may be administered in any
suitable buffer or formulation, optionally incorporating a suitable
delivery agent, and contacted with the sample. Concentrated forms
of a haplomer may be handled separate from its counterpart
haplomer, as product-generating reactions may occur in the absence
of target nucleic acid molecule template at high concentrations.
Table 1 provides guidelines for maximum acceptable concentrations
of gymnotic (no delivery agent) haplomers comprised of various
reactive effector moieties. If the haplomers are contacted at
concentrations above these thresholds, non-templated background
reactions may occur.
TABLE-US-00001 TABLE 1 Maximum concentrations for contact of
haplomers, above which non-templated reaction levels may occur
Maximum Bioorthogonal Reactive Chemistry Concentration Azide-Alkyne
<50 .mu.M Azide-Phosphine <50 .mu.M Native Chemical Ligation
<1 mM
[0166] Threshold concentrations of other haplomers may be
determined empirically utilizing the templated assembly diagnostic
evaluation assay disclosed.
[0167] In some embodiments, the likelihood of non-templated
reactions may be reduced by administering a set of corresponding
haplomers such that one haplomer is administered first, then a time
delay is observed before the corresponding haplomer is
administered. This time delay may range from one minute to days,
depending on the persistence of the haplomers in the system.
[0168] Certain delivery agents, such as transfection reagents such
as cationic lipids, polyethyleneimine, dextran-based transfectants,
or others known in the art, may cause condensation of the
haplomers. Under these circumstances, haplomers may be prepared
separate from the corresponding reactive haplomers and administered
to the sample separately. Haplomers may also be administered
gymnotically, dissolved in an appropriate buffer without addition
of any additional delivery agent.
[0169] The haplomers may also be administered after formulation
with a suitable delivery agent. A suitable delivery agent may
enhance the stability, bioavailability, biodistribution, cell
permeability, or other desirable pharmacologic property of the
haplomers, or a combination of these properties. Delivery agents
known in the art include, but are not limited to, polycationic
transfection reagents, polyethyleneimine and its derivatives,
DEAE-Dextran, other transfection reagents, salts, ions, buffers,
solubilization agents, various viral vectors, liposomes, targeted
liposomes, nanoparticles, carrier polymers, endosome disruptors,
permeabilization agents, lipids, steroids, surfactants,
dispersants, stabilizers, or any combination thereof.
[0170] Delivery of haplomers to target compartments may also be
enhanced by covalent attachment of accessory groups to haplomers.
Accessory groups that may enhance delivery may include compounds
known to enhance the stability and biodistribution of compounds,
such as polyethylene glycol (PEG); and enhance cell permeability of
haplomers, including, but not limited to, cholesterol derivatives
known in the art, endosome-disrupting agents known in the art, and
cell-penetrating peptides, such as poly-cations such as
poly-arginine or polylysine, peptides derived from the HIV tat
protein, transportan, and peptides derived from the antennapedia
protein (penetratin).
[0171] Administration of effector product-triggered agents, such as
an antibody or other effector product-detecting molecule, or
effector product-detecting cell, may also be included. The
administration can be part of the templated assembly procedure. It
may be administered before, during, or after administration of the
haplomers, and by any method appropriate to the agent. In some
embodiments, the effector structure-triggered agent is administered
prior to administration of the haplomers to facilitate triggering
of activity by effector structures as soon as they are formed and
available for agent binding.
[0172] In some embodiments, multiple sets of corresponding
haplomers may be administered in parallel. These sets of reactants
may bind to multiple hybridization sites on a single target nucleic
acid, or bind to different target nucleic acids, or a combination
thereof. The different sets of haplomers may produce the same
effector structure, thus increasing the level of activity generated
by that effector structure by boosting its production, or the
different sets of haplomers may produce different effector
structures, thus producing multivalent activity in the sample, or a
combination thereof. When multiple sets of haplomers are
administered in parallel, reactive effector moieties from different
sets of haplomers that have the same bio-orthogonal reactive group
(or groups that do not react with each other, if different
bio-orthogonal chemistries are employed for different sets of
haplomers) may be administered together, even at high
concentrations, since they will not be reactive with each other.
For example, if an azide-alkyne bio-orthogonal reactive system is
employed for each set of corresponding haplomers, all of the
azide-containing haplomers may be formulated and administered
together, and all of the alkyne-containing haplomers may be
formulated and administered together after sufficient dilution of
the azides in the sample.
[0173] In some embodiments, the composition administered can
include two or more reactive effector moieties that are each linked
to bio-orthogonal reactive molecules, to produce two or more active
effector structures. Production of two or more active effector
structures can yield two or more effector activities, such as
inducing an immune response, programmed cell death, apoptosis,
necrosis, lysis, growth inhibition, inhibition of viral infection,
inhibition of viral replication, inhibition of oncogene expression,
modification of gene expression, inhibition of microbial infection,
and inhibition of microbe replication, as well as combinations of
these biological activities.
[0174] In some embodiments, the composition administered can
include two or more sets of corresponding haplomers that include
anti-target loop portions capable of binding two or more target
nucleic acid molecules. Two or more target nucleic acid molecules
may be found within the same gene transcript, or alternatively on
distinct and separate transcripts. Two or more sets of
corresponding haplomers recognizing distinct nucleic acid target
molecules within the same cellular transcript may independently
carry the same or distinct reactive effector moieties that react to
form additional copies of the same effector products in a
template-directed manner. The inclusion of two or more reactive
effector moieties can produce two or more active effector
structures to yield two or more effector activities, such as
inducing an immune response, programmed cell death, apoptosis,
non-specific or programmed necrosis, lysis, growth inhibition,
inhibition of viral infection, inhibition of viral replication,
inhibition of oncogene expression, modification of gene expression,
inhibition of microbial infection, and inhibition of microbe
replication, as well as combinations of these biological
activities.
[0175] The abundance of target nucleic acid molecules may also
limit the amount of active effector structure produced by templated
assembly. In some embodiments, there is an average of at least 5
copies of target nucleic acid molecules per target compartment. The
dosage and concentration of the composition administered can take
the availability of the target nucleic acid molecules into
account.
[0176] In some embodiments, methods of delivering a haplomer or
haplomers or a composition comprising one or more haplomers to a
pathogenic cell is disclosed. The methods can include administering
a therapeutically effective amount of a set or multiple sets of
corresponding haplomer compositions to the pathogenic cell, binding
the haplomer compositions to a target nucleic acid molecule, and
generating active effector products. The composition can include
any one or more of the first and/or second nucleic acid molecules
described herein. In some embodiments, the methods can also include
detecting the presence or absence of the target nucleic acid
molecule prior to administering the haplomer composition.
[0177] Pharmaceutical compositions may be administered by one of
the following routes: oral, topical, systemic (e.g. transdermal,
intranasal, or by suppository), or parenteral (e.g. intramuscular,
subcutaneous, or intravenous injection). Compositions may take the
form of tablets, pills, capsules, semisolids, powders, sustained
release formulations, solutions, suspensions, elixirs, aerosols, or
any other appropriate compositions; and comprise at least one
compound in combination with at least one pharmaceutically
acceptable excipient. Suitable excipients are well known to persons
of ordinary skill in the art, and they, and the methods of
formulating the compositions, may be found in such standard
references as Remington: The Science and Practice of Pharmacy. A.
Gennaro, ed., 20th edition, Lippincott. Williams & Wilkins,
Philadelphia, Pa. Suitable liquid carriers, especially for
injectable solutions, include water, aqueous saline solution,
aqueous dextrose solution, and glycols.
[0178] Pharmaceutical compositions suitable for injection may
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersion. In all cases, the
composition should be sterile and should be fluid to the extent
that easy syringeability exists. The composition should be stable
under the conditions of manufacture and storage and should be
preserved against the contaminating action of microorganisms such
as bacteria and fungi. The carrier can be a solvent or dispersion
medium containing, for example, water, ethanol, polyol (for
example, glycerol, propylene glycol, and liquid polyethylene
glycol, and the like), suitable mixtures thereof, and vegetable
oils. The proper fluidity can be maintained, for example, by the
use of a coating such as lecithin, by the maintenance of the
required particle size in the case of dispersion and by the use of
surfactants. Prevention of the action of microorganisms can be
achieved by various antibacterial and antifungal agents. In many
cases, isotonic agents can be included, for example, sugars,
polyalcohols such as mannitol, sorbitol, sodium chloride in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent which
delays absorption, for example, aluminum monostearate and
gelatin.
[0179] Sterile injectable solutions can be prepared by
incorporating the composition containing the haplomers in a
suitable amount in an appropriate solvent with one or a combination
of ingredients enumerated above. Generally, dispersions are
prepared by incorporating the composition into a sterile vehicle
which contains a basic dispersion medium and the required other
ingredients from those enumerated above
[0180] When the composition containing the haplomers is suitably
protected, as described above, the composition can be formulated
for oral administration, for example, with an inert diluent or an
assimilable edible carrier. The composition and other ingredients
can also be enclosed in a hard or soft shell gelatin capsule,
compressed into tablets, or incorporated directly into the
subject's diet. For oral therapeutic administration, the
composition can be incorporated with excipients and used in the
form of ingestible tablets, buccal tablets, troches, capsules,
elixirs, suspensions, syrups, wafers, and the like. The percentage
of the compositions and preparations can, of course, be varied. The
amount of haplomers in such therapeutically useful compositions is
such that a suitable dosage will be obtained.
[0181] It may be advantageous to formulate compositions in dosage
unit form for ease of administration and uniformity of dosage. Each
dosage unit form contains a predetermined quantity of the haplomers
calculated to produce the amount of active effector product in
association with a pharmaceutical carrier. The specification for
the novel dosage unit forms is dependent on the unique
characteristics of the targeted templated assembly composition, and
the particular therapeutic effect to be achieved. Dosages are
determined by reference to the usual dose and manner of
administration of the ingredients.
[0182] The haplomer compositions may comprise pharmaceutically
acceptable carriers, such that the carrier can be incorporated into
the composition and administered to a patient without causing
unacceptable biological effects or interacting in an unacceptable
manner with other components of the composition. Such
pharmaceutically acceptable carriers typically have met the
required standards of toxicological and manufacturing testing, and
include those materials identified as suitable inactive ingredients
by the U.S. Food and Drug Administration.
[0183] The haplomers can also be prepared as pharmaceutically
acceptable salts Such slats can be, for example, a salt prepared
from a base or an acid which is acceptable for administration to a
patient, such as a mammal (e.g., salts having acceptable mammalian
safety for a given dosage regime). However, it is understood that
the salts covered herein are not required to be pharmaceutically
acceptable salts, such as salts of the haplomers that are not
intended for administration to a patient. Pharmaceutically
acceptable salts can be derived from pharmaceutically acceptable
inorganic or organic bases and from pharmaceutically acceptable
inorganic or organic acids. In addition, when a haplomer contains
both a basic moiety, such as an amine, and an acidic moiety such as
a carboxylic acid, zwitterions may be formed and are included
within the term "salt" as used herein. Salts derived from
pharmaceutically acceptable inorganic bases can include ammonium,
calcium, copper, ferric, ferrous, lithium, magnesium, manganic,
manganous, potassium, sodium, and zinc salts, and the like. Salts
derived from pharmaceutically acceptable organic bases can include
salts of primary, secondary and tertiary amines, including
substituted amines, cyclic amines, naturally-occurring amines and
the like, such as arginine, betaine, caffeine, choline,
N,N-dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol,
2-dimethylaminoethanol, ethanolamine, ethylenediamine,
N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine,
histidine, hydrabamine, isopropylamine, lysine, methylglucamine,
morpholine, piperazine, piperadine, polyamine resins, procaine,
purines, theobromine, triethylamine, trimethylamine,
tripropylamine, tromethamine and the like. Salts derived from
pharmaceutically acceptable inorganic acids can include salts of
boric, carbonic, hydrohalic (hydrobromic, hydrochloric,
hydrofluoric or hydroiodic), nitric, phosphoric, sulfamic and
sulfuric acids. Salts derived from pharmaceutically acceptable
organic acids can include salts of aliphatic hydroxyl acids (e.g.,
citric, gluconic, glycolic, lactic, lactobionic, malic, and
tartaric acids), aliphatic monocarboxylic acids (e.g., acetic,
butyric, formic, propionic and trifluoroacetic acids), amino acids
(e.g., aspartic and glutamic acids), aromatic carboxylic acids
(e.g., benzoic, p-chlorobenzoic, diphenylacetic, gentisic,
hippuric, and triphenylacetic acids), aromatic hydroxyl acids
(e.g., o-hydroxybenzoic, p-hydroxybenzoic,
1-hydroxynaphthalene-2-carboxylic and
3-hydroxynaphthalene-2-carboxylic acids), ascorbic, dicarboxylic
acids (e.g., fumaric, maleic, oxalic and succinic acids),
glucoronic, mandelic, mucic, nicotinic, orotic, pamoic,
pantothenic, sulfonic acids (e.g., benzenesulfonic,
camphorsulfonic, edisylic, ethanesulfonic, isethionic,
methanesulfonic, naphthalenesulfonic, naphthalene-1,5-disulfonic,
naphthalene-2,6-disulfonic and p-toluenesulfonic acids), xinafoic
acid, and the like.
[0184] The following representative embodiments are presented:
[0185] Embodiment 1. A nucleic acid molecule comprising: a) a first
stem portion comprising from about 10 to about 20 nucleotide bases;
b) an anti-target loop portion comprising from about 16 to about 40
nucleotide bases and having a first end to which the first stem
portion is linked, wherein the anti-target loop portion is
substantially complementary to a target nucleic acid molecule; c) a
second stem portion comprising from about 10 to about 20 nucleotide
bases linked to a second end of the anti-target loop portion,
wherein the first stem portion is substantially complementary to
the second stem portion; and d) a reactive effector moiety linked
to either the first stem portion or the second stem portion;
wherein the T.sub.m of the anti-target loop portion:target nucleic
acid molecule is greater than the T.sub.m of the first stem
portion:second stem portion.
[0186] Embodiment 2. The nucleic acid molecule of embodiment 1
wherein the T.sub.m of the first stem portion:second stem portion
subtracted from the T.sub.m of the anti-target loop portion:target
nucleic acid molecule is from about 10.degree. C. to about
40.degree. C.
[0187] Embodiment 3. The nucleic acid molecule of embodiment 1 or
embodiment 2 wherein the T.sub.m of the first stem portion:second
stem portion is from about 40.degree. C. to about 50.degree. C.
[0188] Embodiment 4. The nucleic acid molecule of any one of
embodiments 1 to 3 wherein the T.sub.m of the anti-target loop
portion:target nucleic acid molecule is from about 60.degree. C. to
about 80.degree. C.
[0189] Embodiment 5. The nucleic acid molecule of any one of
embodiments 1 to 4 wherein the T.sub.m of the first stem
portion:second stem portion subtracted from the T.sub.m of the
anti-target loop portion:target nucleic acid molecule is from about
10.degree. C. to about 20.degree. C.
[0190] Embodiment 6. The nucleic acid molecule of any one of
embodiments 1 to 5 wherein the first stem portion comprises from
about 12 to about 18 nucleotide bases.
[0191] Embodiment 7. The nucleic acid molecule of any one of
embodiments 1 to 6 wherein the anti-target loop portion comprises
from about 18 to about 35 nucleotide bases.
[0192] Embodiment 8. The nucleic acid molecule of any one of
embodiments 1 to 7 wherein the second stem portion comprises from
about 12 to about 18 nucleotide bases.
[0193] Embodiment 9. The nucleic acid molecule of any one of
embodiments 1 to 8 wherein the nucleotide bases of any one or more
of the first stem portion, anti-target loop portion, and second
stem portion are selected from the group consisting of DNA
nucleotides, RNA nucleotides, phosphorothioate-modified
nucleotides, 2-O-alkylated RNA nucleotides, halogenated
nucleotides, locked nucleic acid nucleotides (LNA), peptide nucleic
acids (PNA), morpholino nucleic acid analogues (morpholinos),
pseudouridine nucleotides, xanthine nucleotides, hypoxanthine
nucleotides, 2-deoxyinosine nucleotides, DNA analogs with L-ribose
(L-DNA), Xeno nucleic acid (XNA) analogues, or other nucleic acid
analogues capable of base-pair formation, or artificial nucleic
acid analogues with altered backbones, or any combination
thereof.
[0194] Embodiment 10. The nucleic acid molecule of any one of
embodiments 1 to 9 further comprising a linker between any one or
more of the first stem portion and the anti-target loop portion,
between the anti-target loop portion and the second stem portion,
and between the second stem portion and the reactive effector
moiety.
[0195] Embodiment 11. The nucleic acid molecule of embodiment 10
wherein the linker is selected from the group consisting of an
alkyl group, an alkenyl group, an amide, an ester, a thioester, a
ketone, an ether, a thioether, a disulfide, an ethylene glycol, a
cycloalkyl group, a benzyl group, a heterocyclic group, a
maleimidyl group, a hydrazone, a urethane, azoles, an imine, a
haloalkyl, and a carbamate, or any combination thereof.
[0196] Embodiment 12. The nucleic acid molecule of any one of
embodiments 1 to 11 wherein the reactive effector moiety is
selected from the group consisting of a peptide, a non-active
portion of a peptidomimetic structure, a non-active portion of a
drug, and a bioactive compound.
[0197] Embodiment 13. The nucleic acid molecule of any one of
embodiments 1 to 12 wherein the reactive effector moiety is less
than 20 kDa.
[0198] Embodiment 14. The nucleic acid molecule of any one of
embodiments 1 to 13 wherein the reactive effector moiety further
comprises a bio-orthogonal reactive molecule.
[0199] Embodiment 15. The nucleic acid molecule of embodiment 14
wherein the bio-orthogonal reactive molecule is selected from the
group consisting of an azide, an alkyne, a cyclooctyne, a nitrone,
a norbornene, an oxanorbornadiene, a phosphine, a dialkyl
phosphine, a trialkyl phosphine, a phosphinothiol, a
phosphinophenol, a cyclooctene, a nitrile oxide, a thioester, a
tetrazine, an isonitrile, a tetrazole, and a quadricyclane, or any
derivative thereof.
[0200] Embodiment 16. The nucleic acid molecule of any one of
embodiments 1 to 15 wherein the anti-target loop portion further
comprises an internal hinge region, wherein the hinge region
comprises one or more nucleotides that are not complementary to the
target nucleic acid molecule.
[0201] Embodiment 17. The nucleic acid molecule of embodiment 16
wherein the hinge region comprises from about 1 nucleotide to about
6 nucleotides.
[0202] Embodiment 18. The nucleic acid molecule of any one of
embodiments 1 to 17 which comprises the nucleotide sequence
5'-ACTCGAGACGTCTCCTTGTCTTTGCTTTTCTTCA GGACACAGTGGCGAGACGTCTCGAGT-3'
(SEQ ID NO:13) or 5'-ACTCGAGACGTCT
CCTTCCTGCCCCTCCTCCTGCTCCGAGACGTCTCGAGT-3' (SEQ ID NO:14).
[0203] Embodiment 19. A kit comprising: a first nucleic acid
molecule according to any one of embodiments 1 to 18; and a second
nucleic acid molecule comprising from about 6 nucleotide bases to
about 20 nucleotide bases, which comprises: a nucleotide portion
that is substantially complementary to the stem portion of the
first nucleic acid molecule that is linked to the reactive effector
moiety; and a reactive effector moiety which can chemically
interact with the reactive effector molecule of the first nucleic
acid molecule; wherein the T.sub.m of the second nucleic acid
molecule:first or second stem portion linked to the reactive
effector moiety is less than or equal to the T.sub.m of the first
stem portion:second stem portion.
[0204] Embodiment 20. The kit of embodiment 19, wherein: the
reactive effector moiety of the second nucleic acid molecule is
linked to a bio-orthogonal reactive molecule; the reactive effector
moiety of the first nucleic acid molecule is linked to a
bio-orthogonal reactive molecule; the bio-orthogonal reactive
molecule of the second nucleic acid molecule can chemically
interact with the bio-orthogonal reactive molecule of the first
nucleic acid molecule.
[0205] Embodiment 21. The kit of embodiment 19 or embodiment 20
wherein the T.sub.m of the duplex formed by the second nucleic acid
molecule and the first or second stem portion linked to the
reactive effector moiety subtracted from the T.sub.m of the first
stem portion:second stem portion is from about 0.degree. C. to
about 20.degree. C.
[0206] Embodiment 22. The kit of any one of embodiments 19 to 21
wherein the T.sub.m of the duplex formed by the second nucleic acid
molecule and the first or second stem portion linked to the
reactive effector moiety is from about 30.degree. C. to about
40.degree. C.
[0207] Embodiment 23. The kit of any one of embodiments 19 to 22
wherein the T.sub.m of the duplex formed by the nucleic acid
molecule and the first or second stem portion linked to the
reactive effector moiety subtracted from the T.sub.m of the first
stem portion:second stem portion is from about 5.degree. C. to
about 10.degree. C.
[0208] Embodiment 24. The kit of any one of embodiments 19 to 23
wherein the second nucleic acid molecule comprises from about 8 to
about 15 nucleotide bases.
[0209] Embodiment 25. The kit of any one of embodiments 19 to 24
wherein: the first nucleic acid molecule comprises the nucleotide
sequence of SEQ ID NO:13, and the second nucleic acid molecule
comprises the nucleotide sequence 5'-AGCTCTCGAGT-3' (SEQ ID NO:15);
or the first nucleic acid molecule comprises the nucleotide
sequence of SEQ ID NO:14, and the second nucleic acid molecule
comprises the nucleotide sequence 5'-GACGTCTCGAGT-3' (SEQ ID
NO:16).
[0210] Embodiment 26. The kit of any one of embodiments 19 to 25
wherein the bio-orthogonal reactive molecule of the first nucleic
acid molecule is hexynyl and the bio-orthogonal reactive molecule
of the second nucleic acid molecule is azide.
[0211] Embodiment 27. A method of producing a templated assembly
product for a cell comprising: contacting a target nucleic acid
molecule of the cell with a first nucleic acid molecule of any one
of embodiments 1 to 18; and contacting the first nucleic acid
molecule with a second nucleic acid molecule, wherein the second
nucleic acid molecule comprises: a nucleotide portion that is
substantially complementary to the stem portion of the first
nucleic acid molecule that is linked to the reactive effector
moiety; and a reactive effector moiety which can chemically
interact with the reactive effector molecule of the first nucleic
acid molecule; wherein the T.sub.m of the second nucleic acid
molecule:first or second stem portion linked to the reactive
effector moiety is less than or equal to the T.sub.m of the first
stem portion:second stem portion; resulting in the combination of
the respective reactive effector moieties thereby producing the
templated assembly product.
[0212] Embodiment 28. The method of embodiment 27 wherein: the
first nucleic acid molecule comprises the nucleotide sequence of
SEQ ID NO:13, and the second nucleic acid molecule comprises the
nucleotide sequence 5'-AGCTCTCGAGT-3' (SEQ ID NO:15); or the first
nucleic acid molecule comprises the nucleotide sequence of SEQ ID
NO:14, and the second nucleic acid molecule comprises the
nucleotide sequence 5'-GACGTCTCGAGT-3' (SEQ ID NO:16).
[0213] Embodiment 29. The method of embodiment 27 or embodiment 28
wherein the bio-orthogonal reactive molecule of the first nucleic
acid molecule is hexynyl and the bio-orthogonal reactive molecule
of the second nucleic acid molecule is azide.
[0214] In order that the subject matter disclosed herein may be
more efficiently understood, examples are provided below. It should
be understood that these examples are for illustrative purposes
only and are not to be construed as limiting the claimed subject
matter in any manner.
EXAMPLES
Example 1: The Locked-Template Assembly by Proximity-Enhanced
Reactivity (TAPER) System with an Oligonucleotide Model Target
[0215] The conditions of these experiments were designed to
demonstrate that only in the presence of specific template (e.g.,
target nucleic acid molecule) would the first nucleic acid molecule
(i.e., haplomer bottle) open and render the first stem portion or
the second stem portion thereof, whichever is linked to the
reactive effector moiety, available for hybridization with the
complementary second nucleic acid molecule (e.g., second
haplomer).
[0216] In initial experiments, the first and second nucleic acid
molecules comprised the bio-orthogonal reactive molecules hexynyl-
and azide-groups appended to their 5' and 3' ends by standard
chemistries. The target nucleic acid molecule selected was a DNA
single-stranded oligonucleotide copy of a segment of HPV E6/E7
transcript (see, FIG. 9). The general experimental plan used
several different incubation conditions with the relevant component
molecules. An initial incubation was performed (using varying times
and temperatures) of the first nucleic acid molecule with or
without the target nucleic acid molecule, followed by a subsequent
incubation with the second nucleic acid molecule. After this, all
samples were split and treated with or without reagents for
catalyzing click reactions between the linear alkyne (hexynyl) and
azide moieties appended to the 5' and 3' ends of the first and
second nucleic acid molecule, respectively.
[0217] The initial incubation was performed at 37.degree. C. in 25
.mu.l of 10 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 50 mM NaCl, and
1 mM dithioerythritol. The HPV DNA target nucleic acid molecule
(oligonucleotide code #34) was present at 4 .mu.M, in a two-fold
molar excess over the first nucleic acid molecule (oligonucleotide
code #249). Before use, the first nucleic acid molecule was
subjected to "pre-self-annealing" to ensure maximal intramolecular
formation of the bottle structure. For this purpose, 1250 pmol of
the first nucleic acid molecule (#249) in 25 .mu.l of 10 mM
Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 50 mM NaCl, and 1 mM
dithioerythritol was subjected to 5 minutes at 80.degree. C.
treatment, followed by rapid chilling at 0.degree. C. for at least
10 minutes. From this, 1 .mu.l (50 pmol) was used for the
experimental tests. When the second nucleic acid molecule was
added, it was at an equimolar concentration with the first nucleic
acid molecule (2 .mu.M). The following incubation conditions were
examined:
[0218] A) HPV target nucleic acid molecule+first nucleic acid
molecule for 2 hours at 37.degree. C.;
[0219] B) First nucleic acid molecule alone, for 2 hours at
37.degree. C.;
[0220] C) HPV target nucleic acid molecule+first nucleic acid
molecule, for 2 hours at 25.degree. C.;
[0221] D) HPV target nucleic acid molecule+first nucleic acid
molecule, heated for 5 minutes at 80.degree. C., followed by slow
cooling to 25.degree. C.; and
[0222] E) HPV target nucleic acid molecule+first nucleic acid
molecule, with no preincubation.
[0223] Following the initial incubation, the second nucleic acid
molecule was added, and all were incubated for an additional hour
at 37.degree. C. All samples were then subjected to +/-click
reactions between the respective bio-orthogonal reactive molecules
in the following manner. Ten (10) .mu.l from each annealing (20
pmol of first and second nucleic acid molecules) were activated for
Cu(I) click catalysis with Tris (3-hydroxypropyltriazolyl methyl)
amine (THPTA), or in equivalent buffer lacking click catalyst. A
premix of the following components was prepared with additions in
the following order: 20 .mu.l of 70 mM THPTA in 0.155 M NaCl; 4
.mu.l of 500 mM Na-ascorbate in 0.155 M NaCl; and 2 .mu.l of 100 mM
CuSO.sub.4 in 0.155 M NaCL. To each of the tubes for the click
reaction, 2.6 .mu.l of this premix was added, such that the final
volume was 50 .mu.l in 1.times. phosphate-buffered saline.
[0224] Tubes were incubated for 30 minutes at 0.degree. C. (on
ice), and then 2 hours at 25.degree. C. At the end of the
incubation period, the tube contents were desalted though Bio-Rad
P6 (in 10 mM Tris pH 7.4, performed according to the manufacturer's
instructions) and precipitated with 20 .mu.g of glycogen (Sigma),
0.3 M sodium acetate, and 3 volumes of ethanol. After
centrifugation, the pellets were washed with 1 ml of 70% ethanol,
dried, and re-dissolved in 4 .mu.l of TE (5 pmol/.mu.l of first and
second nucleic acid molecules). Samples (1 .mu.l) were analyzed on
10% 8 M urea denaturing 10% (19:1) acrylamide gels after
denaturation in 98% formamide at 98.degree. C. for 3 minutes and
immediate transfer to ice.
[0225] Results of this experiment are shown in FIG. 10. No click
product was observed in the absence of the target nucleic acid
molecule (see, B conditions, Lanes 3 and 4), and product was
observed irrespective of whether the incubation temperature was
37.degree. C. or 25.degree. C. (see, A and C conditions, lanes 1,
2, and 5, 6 respectively). The treatment where an initial
high-temperature denaturation step was used served to control for
the role of the bottle structure of the first nucleic acid
molecule, by means of its forcible removal prior to the incubation
with the target nucleic acid molecule. However, this did not
significantly affect the yield of the click product (see, D
conditions, lanes 7 and 8). The requirement for a pre-incubation of
the target nucleic acid molecule and first nucleic acid molecule
with this experimental protocol was tested, and had only a minor
impact on click product formation (see, E conditions, lanes 9,10).
Thus, comparable results were obtained when both the first nucleic
acid molecule, the second nucleic acid molecule, and the target
nucleic acid molecule were mixed together from the commencement of
the incubation period.
[0226] The specificity of the click product formation was probed by
the use of an oligonucleotide version of the initial first nucleic
acid molecule where both the first and second stem portion
sequences were randomly scrambled (code #261), in comparison to the
original (#249) oligonucleotide. Experimental conditions were as
above, except a single combined 30 minute incubation (with no
pre-incubation) was used for all components. Following this
incubation period, samples were subjected to +/-treatment with
agents catalyzing click reactions, as described above (see, Example
1, FIG. 10). Samples were subsequently analyzed on a 10% denaturing
gel with 8 M urea, and stained with SYBR-Gold (Thermofisher).
Results confirmed that for the (#249) first nucleic acid molecule,
click product was only observed in the presence of the target
nucleic acid molecule (see, FIG. 11, lanes 1 vs. 2; 3 vs 4). No
product was observed with the control (#261) template where both of
the stem loops had the same base composition but scrambled
sequences, demonstrating the requirement for specific templating in
the reaction mediated by the click groups.
[0227] A further examination of the locked TAPER system used a
control 5'-hexynyl oligonucleotide where only one of the two
complementary sequences forming the first nucleic acid molecule
stem loop was scrambled (as opposed to the above control where both
such sequences were scrambled). In this additional control
oligonucleotide (code #325), the sequence complementary to the
second nucleic acid molecule was maintained, although no loop
bottle could form. Both the original HPV first nucleic acid
molecule loop bottle (#249) and single-scrambled control (#325)
were subjected to a 2 hour pre-incubation with or without a
two-fold excess of HPV target nucleic acid molecule, followed by an
additional 1 hour incubation with the second nucleic acid molecule
(#250), and then standard+/-click reactions as described above.
Processed samples were examined on 15% 8 M urea gels (see, FIG.
12). These results clearly demonstrated that in the absence of loop
bottle formation (as with the single-scrambled control #325), click
product formation was independent of target nucleic acid molecule,
even though the target-complementary segment was still present. As
before, however, with the first nucleic acid molecule (#249), HPV
target nucleic acid molecule sequence was required before click
product was observed (see, FIG. 12).
[0228] Oligonucleotides used: [0229] 1) HPV first nucleic acid
molecule sequence (#249; 60-mer; annotations from 5'-3': bold=first
nucleic acid molecule sequence (H1); plain CT=additional hinge
sequence; underlined=HPV-target nucleic acid molecule complementary
sequence; small letters=complement to first nucleic acid molecule
sequence (H2)):
TABLE-US-00002 [0229] (SEQ ID NO: 13) 5'
Hexynyl-ACTCGAGACGTCTCCTTGTCTTTGCTTTTCTTCAGGAC
ACAGTGGCgagacgtctcgagt-3'.
[0230] 2) Second nucleic acid molecule (#250; 15-mer, annotations
from 5'-3': TTT=non-specific size extender; bold=second nucleic
acid molecule sequence (H2)):
TABLE-US-00003 [0230] (SEQ ID NO: 8)
5'-TTTGACGTCTCGAGT-azide-3'.
[0231] 3) HPV DNA target nucleic acid molecule (#34; 56-mer):
TABLE-US-00004 [0231] (SEQ ID NO: 1)
5'-TAACTGTCAAAAGCCACTGTGTCCTGAAGAAAAGCAAAGACATCTG
GACAAAAAGC-3'.
[0232] 4) HPV first nucleic acid molecule with double scrambled
stem sequences (#261; 60-mer):
TABLE-US-00005 [0232] (SEQ ID NO: 17)
5'-Hexynyl-GACAGCACCTTCGTCTTGTCTTTGCTTTTCTTCAGGAC
ACAGTGGCGGGCTGCGACAATT.
[0233] 5) HPV first nucleic acid molecule with single scrambled
stem sequence, where the 5' sequence complementary to the second
nucleic acid molecule is maintained (#325; 60-mer):
TABLE-US-00006 [0233] (SEQ ID NO: 18)
5'-Hexynyl-ACTCGAGACGTCTCCTTGTCTTTGCTTTTCTTCAGGAC
ACAGTGGCGGGCTGCGACAATT,
Example 2: Locked TAPER Template Dose-Response with an RNA
Oligonucleotide
[0234] The locked TAPER oligonucleotides used in Example 1 were
examined with an RNA target nucleic acid molecule (code #322,
corresponding to a truncated version of the HPV target nucleic acid
molecule also used in Example 1). Similar conditions as for Example
1 were used with the first nucleic acid molecule (#249) in terms of
quantities (50 pmol; 2 pmol/.mu.l during template and second
nucleic acid molecule hybridizations; 0.4 pmol/.mu.l during click
reactions) and incubation times (2 hour first nucleic acid
molecule/RNA target nucleic acid molecule annealings; 1 hour for
subsequent incubations with the second nucleic acid molecule
(#250)). The RNA target nucleic acid molecule was used in a range
of molar ratios ranging from 0.05:1 (target nucleic acid molecule:
first and second nucleic acid molecule) to 100:1. Where the amount
of RNA target nucleic acid molecule was equal to or greater than
5:1, it was necessary after the +/-click reactions (performed in an
identical manner as for Example 1) to remove the target nucleic
acid molecule prior to gel analysis, to avoid interference with
band patterns. This was readily performed by means of alkaline
hydrolysis, consisting of a treatment of the preparations with 0.2
M NaOH for 20 minutes at 70.degree. C., followed by neutralization
with acetic acid/sodium acetate. All preparations were
precipitated, washed with 70% ethanol, dried, and reconstituted
with 4 .mu.l of TE (10/1.0). Samples (1.0 .mu.l) were run on
denaturing 15% 8 M urea gels. It was observed (see, FIG. 13) that
click products were promoted by the presence of the RNA target
nucleic acid molecule, and were still present even when the target
nucleic acid molecule was in a 100-fold molar excess.
[0235] Oligonucleotide used in addition to #249 and #250 of Example
1: [0236] 6) HPV RNA target nucleic acid molecule (#322;
34-mer):
TABLE-US-00007 [0236] (SEQ ID NO: 19)
5'-AAGCCACUGUGUCCUGAAGAAAAGCAAAGACAUC.
Example 3: Hybridization Kinetics for Locked TAPER Haplomers in the
Presence of Specific Target
[0237] Since the stem-loop in first nucleic acid molecule enforces
a very distinct structural motif compared with a linear
oligonucleotide, it was predicted that first nucleic acid molecule
would show a readily detectable mobility difference in
non-denaturing acrylamide gels relative to unstructured
oligonucleotides of the same size. This was in turn used to examine
the kinetics of hybridization between the anti-target loop region
within the first nucleic acid molecules and specific target nucleic
acid molecules (such hybridization should produce a marked change
in migration behavior in non-denaturing acrylamide gels).
[0238] In 10 .mu.l replicates of the same buffer as used for
Example 1 (10 mM Tris-HCl (pH 7.5), 10 mM MgCl.sub.2, 50 mM NaCl,
and 1 mM dithioerythritol), 50 pmol of the HPV first nucleic acid
molecule (#249) was mixed with 100 pmol of the HPV target nucleic
acid molecule (#34). These tubes were subjected to incubation at
37.degree. C. for 5, 15, 30, 60, and 120 minutes, with a zero-time
point corresponding to mixing of the tube immediately prior to gel
loading. After each time point, the relevant tube was snap frozen
at -80.degree. C. until loading (1 .mu.l of each; 5 pmol and 10
pmol of the HPV first nucleic acid molecule and HPV target nucleic
acid molecule, respectively) on a 10% non-denaturing acrylamide gel
(1.times.TBE). Results are shown in FIG. 14. The HPV first nucleic
acid molecule (#249) alone (see, Lane A) had a markedly accelerated
mobility in comparison to two arbitrary oligonucleotides of the
same lengths (60 bases; see, Lanes 60a and 60b), consistent with
its pronounced secondary structure. Oligonucleotides 60a and 60b
did not have equivalent mobilities, suggesting sequence-specific
mobility effects in the non-denaturing gel, but nevertheless were
easily distinguishable from the HPV first nucleic acid molecule
(#249)). The HPV target nucleic acid molecule alone (#34, see, Lane
B) ran at an approximately similar position as 60a and 60b.
However, hybridization between the HPV first nucleic acid molecule
and HPV target nucleic acid molecule was evidently rapid, with the
bottle band completely removed after 5 minutes incubation.
Concomitant with this, slower-moving forms were observed on the
gel, including discrete bands and unresolved (smeared) material.
(Under the conditions used, even the "time zero" point had reduced
amounts of the unhybridized bottle, and evidence of
slower-migrating products, suggesting that observable hybridization
occurred during sample mixing and transfer to a gel lane). This
confirms that the HPV first nucleic acid molecule exists in a
discrete structural state under normal temperatures, and that
hybridization between the HPV first nucleic acid molecule and HPV
target nucleic acid molecule occurs readily, with concomitant
removal of the "bottle" structure.
[0239] Oligonucleotides used in addition to #249 and #34 of Example
1: [0240] 7) Unrelated 60-mers:
TABLE-US-00008 [0240] 60a (code #11): (SEQ ID NO: 20) 5'
p-CCTTTTTTTAGGAGAAGGAGACTTAGAGGCCATCTCC ACCTCCATAACCCATTTTTTTCC-3';
and 60b (code #71): (SEQ ID NO: 21)
5'-GGAAAAAAATGGGTTATGGAGGTGGAGATGGCCTCTA
AGTCTCCTTCTCCTAAAAAAAGG-3'.
Example 4: Locked-TAPER System with a Cellular RNA Bearing a Repeat
Motif
[0241] An independent examination of the locked TAPER technology
was chosen in the form of a repeat region found in Epstein-Barr
Virus (EBV) transcripts containing a coding sequence for the EBNA1
gene. The ability to target a multiply-repeated motif confers
distinct benefits (some of which are described herein). In this
examination, both a DNA single copy of the repeat region was used
as the target nucleic acid molecule, as well as whole cellular RNA
from an EBV-transformed lymphoblastoid cell line.
[0242] The EBNA1 gene consists of 5' and 3' unique regions, between
which is located a highly repetitive tract (REF). For this
examination, a specific 21-base segment was chosen as the target
nucleic acid molecule, of which there are 14 identifiable copies
within the boundaries of the whole EBNA1 repeat region (see, FIG.
15). An EBNA1-specific first nucleic acid molecule was designed
(see, FIG. 16) with the complement to the 21-base target nucleic
acid molecule as the loop sequence, and with the same nucleic acid
molecule/nucleic acid molecule-complement sequences as for the HPV
first nucleic acid molecule of Example 1. An additional 4-base 5'
sequence was included as a flexible spacer. The structure of the
EBNA1-specific first nucleic acid molecule hybridized with both the
model EBNA1 target nucleic acid molecule and the second nucleic
acid molecule are shown in FIG. 17. The second nucleic acid
molecule sequence complementary to the first nucleic acid molecule
was identical to that used in Example 1; in this case, the second
nucleic acid molecule bears an additional 4-base spacer
sequence.
[0243] Studies were performed with the EBNA1 first nucleic acid
molecule and second nucleic acid molecule with the DNA
oligonucleotide nucleic acid molecule corresponding to the EBNA1
repeat sequence. The EBNA1 first nucleic acid molecule was
initially pre-self-annealed in the same manner as for the first
nucleic acid molecule in Example 1. Samples of the self-annealed
first nucleic acid molecule were then incubated in 10 mM Tris-HCl
(pH 7.5), 10 mM MgCl.sub.2, 50 mM NaCl, and 1 mM dithioerythritol
at a final concentration of 2 .mu.M, along with the DNA target
nucleic acid molecule at both 2-fold and 10-fold excess
concentrations. In addition, a control non-specific DNA
oligonucleotide was used, also at a 10-fold excess concentration.
After a 2 hour incubation at 37.degree. C., the second nucleic acid
molecule was added to a final concentration of 2 .mu.M, and the
incubation continued for a final 1 hour at 37.degree. C. Following
this, 10 .mu.l samples from each examination were subjected to
+/-click reactions in the same manner as for Example 1. Samples (1
.mu.l) were analyzed on 10% 8 M urea denaturing 10% (19:1)
acrylamide gels after denaturation in 98% formamide at 98.degree.
C. for 3 minutes and immediate transfer to ice. Results (see, FIG.
18) showed that in the absence of target nucleic acid molecule, no
click product was observed (see, Lanes 1 and 2). Product was
observed when the specific EBNA1 target nucleic acid molecule
sequence was present (see, Lanes 3-6), but not with the
non-specific control oligonucleotide (see, Lanes 7 and 8). A
sequence-dependent mobility difference was observed for the
EBNA1-specific target nucleic acid molecule and non-specific
control oligonucleotides, despite their being of identical lengths
(35-mers). Moreover, the click product yield was increased with the
greater (10-fold) molar excess of specific target nucleic acid
molecule (see, Lanes 5 and 6) as predicted if the titration effect
was absent. It was notable that with the higher target nucleic acid
molecule level, a faint click product band was observed even in the
absence of Cu(I) catalyst (see, black arrow, Lane 5), indicative of
the increased levels of hexynyl- and azide-linked first and second
nucleic acid molecules brought into proximity via concomitant
increased levels of "open" first nucleic acid molecule.
[0244] The same EBNA1 locked TAPER oligonucleotides were then used
to examine product formation in the presence of cellular RNA
nucleic acid molecules with or without EBV sequences. Whole RNA was
prepared from the lymphoblastoid cell line EBV-17 (origin details;
known to possess EBV genomes and express EBV sequences) and from a
control melanoma cell line (453A) negative for EBV. Incubations
were set up in an identical manner as for the above EBNA1 locked
TAPER examinations with the specific EBNA1 target nucleic acid
molecule (as above), except that all preparations were supplemented
with 30 units of murine RNase inhibitor (New England Biolabs).
Post-incubation+/-click reactions were likewise performed in the
same manner as above. Upon gel analysis and staining as before, it
was shown that click product was detectable with 10 .mu.g (but not
1 .mu.g) of EBV-17 RNA (see, FIG. 19). No product was detectable
with 10 .mu.g control 453A RNA. These results indicate that a
specific repetitive cellular target can be used for successful
locked TAPER.
[0245] Oligonucleotides used: [0246] 8) EBNA1 first nucleic acid
molecule (55-mer; code #283; annotations from 5'-3': TTCG=spacer
tract; bold=first nucleic acid molecule sequence (H1); plain
CT=additional hinge sequence; underlined=HPV-target nucleic acid
molecule complementary sequence; small letters=complement to first
nucleic acid molecule sequence (H2): 5'
Hexynyl-TTCGACTCGAGACGTCTCCTTCCTGCCCCTCCTC CTGCTCCGAGACGTCTCGAGT-3'
(SEQ ID NO:10); [0247] 9) EBNA1 second nucleic acid molecule
(16-mer; code #284; annotations from 5'-3': bold=second nucleic
acid molecule sequence (H2); TCTT=spacer sequence):
TABLE-US-00009 [0247] (SEQ ID NO: 11)
5'-GACGTCTCGAGTTCTT-azide-3';
[0248] 10) EBNA1 repeat region DNA model target nucleic acid
molecule (35-mer; code #282; annotations: bold=DNA copy of repeat
sequence target nucleic acid molecule; remainder=flanking
sequence): 5'-AGTTGCAGGAGCAGGAGGAGGGGCAGGA GCAGGAG-3' (SEQ ID
NO:12); and [0249] 11) Control non-specific oligonucleotide for
EBNA1 (35-mer, code #217):
TABLE-US-00010 [0249] (SEQ ID NO: 22)
5'-GACTAGACGGCCAGGGAGACGAATACATATTCAAT-3'.
[0250] Various modifications of the described subject matter, in
addition to those described herein, will be apparent to those
skilled in the art from the foregoing description. Such
modifications are also intended to fall within the scope of the
appended claims. Each reference (including, but not limited to,
journal articles, U.S. and non-U.S. patents, patent application
publications, international patent application publications, gene
bank accession numbers, and the like) cited in the present
application is incorporated herein by reference in its entirety.
Sequence CWU 1
1
24156DNAartificial sequenceHPV DNA target nucleic acid molecule
1taactgtcaa aagccactgt gtcctgaaga aaagcaaaga catctggaca aaaagc
56215DNAartificial sequencehaplomer 2uccagauguc uuugc
15316DNAartificial sequencehaplomer 3uuucuucagg acacag
16410DNAartificial sequenceclick oligonucleotide 4cttgtccagc
10510DNAartificial sequenceclick oligonucleotide 5tggaccatct
10630DNAartificial sequenceRNA oligonucleotide template 6gaaauagaug
guccagcugg acaagcagaa 30758DNAartificial sequencemodel
oligonucleotide 7actcgagacg tctctgtctt tgcttttctt caggacacag
tggcgagacg tctcgagt 58815DNAartificial sequencemodel
oligonucleotide 8tttgacgtct cgagt 1591926DNAartificial
sequenceEBNA1 coding sequence 9atgtctgacg aggggccagg tacaggacct
ggaaatggcc taggagagaa gggagacaca 60tctggaccag aaggctccgg cggcagtgga
cctcaaagaa gagggggtga taaccatgga 120cgaggacggg gaagaggacg
aggacgagga ggcggaagac caggagcccc gggcggctca 180ggatcagggc
caagacatag agatggtgtc cggagacccc aaaaacgtcc aagttgcatt
240ggctgcaaag ggacccacgg tggaacagga gcaggagcag gagcgggagg
ggcaggagca 300ggaggggcag gagcaggagg aggggcagga gcaggaggag
gggcaggagg ggcaggaggg 360gcaggagggg caggagcagg aggaggggca
ggagcaggag gaggggcagg aggggcagga 420ggggcaggag caggaggagg
ggcaggagca ggaggagggg caggaggggc aggagcagga 480ggaggggcag
gaggggcagg aggggcagga gcaggaggag gggcaggagc aggaggaggg
540gcaggagggg caggagcagg aggaggggca ggaggggcag gaggggcagg
agcaggagga 600ggggcaggag caggaggggc aggaggggca ggaggggcag
gagcaggagg ggcaggagca 660ggaggagggg caggaggggc aggaggggca
ggagcaggag gggcaggagc aggaggggca 720ggagcaggag gggcaggagc
aggaggggca ggaggggcag gagcaggagg ggcaggaggg 780gcaggagcag
gaggggcagg aggggcagga gcaggaggag gggcaggagg ggcaggagca
840ggaggagggg caggaggggc aggagcagga ggggcaggag gggcaggagc
aggaggggca 900ggaggggcag gagcaggagg ggcaggaggg gcaggagcag
gaggaggggc aggagcagga 960ggggcaggag caggaggtgg aggccggggt
cgaggaggca gtggaggccg gggtcgagga 1020ggtagtggag gccggggtcg
aggaggtagt ggaggccgcc ggggtagagg acgtcaaaga 1080gccagggggg
gaagtcgtga aagagccagg gggagaggtc gtggacgtgg agaaaagagg
1140cccaggagtc ccagtagtca gtcatcatca tccgggtctc caccgcgcag
gccccctcca 1200ggtagaaggc catttttcca ccctgtaggg gaagccgatt
attttgaata ccaccaagaa 1260ggtggcccag ctggtgagcc tgacgtgccc
ccgggagcga tagagcaggg ccccgcagat 1320gacccaggag aaggcccaag
cactggaccc cggggtcagg gtgatggagg caggcgcaaa 1380aaaggagggt
ggtttggaaa gcatcgtggt caaggaggtt ccaacccgaa atttgagaac
1440attgcagaag gtttaagagc tctcctggct aggagtcacg tagaaaggac
taccgacgaa 1500ggaacttggg tcgccggtgt gttcgtatat ggaggtagta
agacctccct ttacaaccta 1560aggcgaggaa ctgcccttgc tattccacaa
tgtcgtctta caccattgag tcgtctcccc 1620tttggaatgg cccctggacc
cggcccacaa cctggcccgc taagggagtc cattgtctgt 1680tatttcatgg
tctttttaca aactcatata tttgctgagg ttttgaagga tgcgattaag
1740gaccttgtta tgacaaagcc cgctcctacc tgcaatatca gggtgactgt
gtgcagcttt 1800gacgatggag tagatttgcc tccctggttt ccacctatgg
tggaaggggc tgccgcggag 1860ggtgatgacg gagatgacgg agatgaagga
ggtgatggag atgagggtga ggaagggcag 1920gagtga 19261055DNAartificial
sequencerepresentative oligonucleotide 10ttcgactcga gacgtctcct
tcctgcccct cctcctgctc cgagacgtct cgagt 551116DNAartificial
sequencerepresentative oligonucleotide 11gacgtctcga gttctt
161235DNAartificial sequencespecific target 12agttgcagga gcaggaggag
gggcaggagc aggag 351360DNAartificial sequencefirst nucleic acid
molecule 13actcgagacg tctccttgtc tttgcttttc ttcaggacac agtggcgaga
cgtctcgagt 601451DNAartificial sequencefirst nucleic acid molecule
14actcgagacg tctccttcct gcccctcctc ctgctccgag acgtctcgag t
511511DNAartificial sequencesecond nucleic acid molecule
15agctctcgag t 111612DNAartificial sequencesecond nucleic acid
molecule 16gacgtctcga gt 121760DNAartificial sequenceHPV first
nucleic acid molecule with double scrambled stem sequences
17gacagcacct tcgtcttgtc tttgcttttc ttcaggacac agtggcgggc tgcgacaatt
601860DNAartificial sequenceHPV first nucleic acid molecule with
single scrambled stem sequence 18actcgagacg tctccttgtc tttgcttttc
ttcaggacac agtggcgggc tgcgacaatt 601934DNAartificial sequenceHPV
RNA target nucleic acid molcule 19aagccacugu guccugaaga aaagcaaaga
cauc 342060DNAartificial sequenceUnrelated 60-mer 20ccttttttta
ggagaaggag acttagaggc catctccacc tccataaccc atttttttcc
602160DNAartificial sequenceUnrelated 60-mer 21ggaaaaaaat
gggttatgga ggtggagatg gcctctaagt ctccttctcc taaaaaaagg
602235DNAartificial sequenceControl non-specific oligonucleotide
for EBNA1 22gactagacgg ccagggagac gaatacatat tcaat
352356DNAartificial sequenceHPV DNA target nucleic acid molecule
23uaacugucaa aagccacugu guccugaaga aaagcaaaga caucuggaca aaaagc
562419PRTartificial sequencesmall peptide agonist 24Thr Arg Pro Leu
Tyr Ser Thr Tyr Arg Met Glu Thr Val Ala Leu Asp1 5 10 15Met Glu
Thr
* * * * *