U.S. patent application number 17/548588 was filed with the patent office on 2022-03-31 for methods for controlling seizures by manipulating the levels of microrna-211 (mir-211) in the brain.
The applicant listed for this patent is Uriah BEKENSTEIN. Invention is credited to Uriah BEKENSTEIN, David GREENBERG, Hermona SOREQ.
Application Number | 20220098588 17/548588 |
Document ID | / |
Family ID | |
Filed Date | 2022-03-31 |
United States Patent
Application |
20220098588 |
Kind Code |
A1 |
BEKENSTEIN; Uriah ; et
al. |
March 31, 2022 |
METHODS FOR CONTROLLING SEIZURES BY MANIPULATING THE LEVELS OF
MICRORNA-211 (miR-211) IN THE BRAIN
Abstract
Method for controlling for the appearance of seizures in the
mammalian brain comprising modifying the abundance of a specific
miRNA-miR-211, for uses in preventing seizures and providing a
model system to examine the effect of a drug or a treatment to
seizures.
Inventors: |
BEKENSTEIN; Uriah; (Rehovot,
IL) ; SOREQ; Hermona; (Jerusalem, IL) ;
GREENBERG; David; (Jerusalem, IL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
BEKENSTEIN; Uriah |
Rehovot |
|
IL |
|
|
Appl. No.: |
17/548588 |
Filed: |
December 12, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16365667 |
Mar 26, 2019 |
11225661 |
|
|
17548588 |
|
|
|
|
62640139 |
Mar 8, 2018 |
|
|
|
International
Class: |
C12N 15/113 20060101
C12N015/113; A61P 25/08 20060101 A61P025/08; A01K 67/027 20060101
A01K067/027 |
Claims
1. A method of treating a human or a non-human mammal subject
suffering from: brain injury, concussion, or disruption of the
blood brain barrier the method comprising the step of: (i)
introducing into the brain of said human or non-human subject an
oligonucleotide with the nucleic acid sequence of miR-211
2. The method of claim 1, wherein said introducing into the brain
of said human or non-human subject an oligonucleotide is done by
either: (a) administering a miR-211 oligonucleotide mimetic to the
bloodstream of said human or non-human subject, or (b)
administering a miR-211 oligonucleotide mimetic into--or to the
proximity of--the brain of said human or non-human subject.
3. The method of claim 1, wherein said human or a non-human mammal
subject is suffering from disruption of the blood brain barrier
following physical trauma to the head.
4. The method of claim 1, wherein said human or a non-human mammal
subject suffering from disruption of the blood brain barrier
following neuro-inflammatory or a neuro-infectious Disease or
following Acute Ischemic Stroke.
5. The method of claim 2, wherein said mimetic molecule is selected
from a group consisting of RNA, locked nucleic acid (LNA),
2-0-methyl-blocked, Morpholino and phosphorothioate
oligonucleotides.
5. The method of claim 2, wherein said oligonucleotide is selected
from the group consisting of: SEQ ID No. 1, SEQ ID No. 2, SEQ ID
No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6.
6. The method of claim 2, wherein said introducing into the brain
of said human or non-human subject an oligonucleotide with the
nucleic acid sequence of miR-211 is done by administering a miR-211
oligonucleotide mimetic to the bloodstream of said human or
non-human subject.
7. The method of claim 6, wherein the blood brain-barrier of said
human or non-human subject is compromised or disrupted.
8. A method of Anti-epileptogenic intervention for treating a human
or non-human subject expected to develop epileptogenesis, the
method comprising the step of: (i) introducing into the brain of
said human or non-human subject an oligonucleotide with the nucleic
acid sequence of miR-211, by either: (a) administering a miR-211
oligonucleotide mimetic into--or to the proximity of--the brain of
said human or non-human subject, or (b) administering a miR-211
oligonucleotide mimetic to the bloodstream of said `human or
non-human subject`, wherein the human or non-human subject is
suffering from disruption of the blood brain barrier.
9. The method of claim 8, wherein said introducing into the brain
of said human or non-human subject an oligonucleotide is following
(and within 1 month of) a medical event or condition selected from
the group consisting of: physical trauma to the head, Acute
Ischemic Stroke, status epilepticus, or neuro-inflammatory
disruption of the blood brain barrier.
10. The method of claim 8, wherein introducing into the brain of
said human or non-human subject an oligonucleotide is done by
administering a miR-211 oligonucleotide mimetic to the bloodstream
of said human or non-human subject, and wherein the human or
non-human subject is suffering from disruption of the blood brain
barrier.
11. The method of claim 8, wherein introducing into the brain of
said human or non-human subject an oligonucleotide is done by
administering a miR-211 oligonucleotide mimetic into--or to the
proximity of--the brain of said human or non-human subject.
12. The method of claim 10, wherein said mimetic molecule is
selected from a group consisting of: RNA, locked nucleic acid
(LNA), 2-O-methyl-blocked, Morpholino and phosphorothioate
oligonucleotides.
13. The method of claim 10, wherein said oligonucleotide is
selected from the group consisting of: SEQ ID No. 1, SEQ ID No. 2,
SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6.
14. A method of treating or reducing the likelihood of the
development or occurrence of seizures in an mammal subject,
suffering from a condition characterized by expression changes in
the rain of TGFBR2 pathway genes or of TGF signaling, the method
comprising the step of: (i) introducing into the brain of said
human or non-human subject an oligonucleotide with the nucleic acid
sequence of miR-211, by either: (a) administering a miR-211
oligonucleotide mimetic into--or to the proximity of--the brain of
said human or non-human subject, or (b) administering a miR-211
oligonucleotide mimetic to the bloodstream of said human or
non-human subject, wherein the human or non-human subject is
suffering from disruption of the blood brain barrier.
15. The method of claim 14 wherein said oligonucleotide is selected
from the group consisting of: SEQ ID No. 1, SEQ ID No. 2, SEQ ID
No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6.
Description
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application No. 62/640,139 filed Mar. 8, 2018, the contents of
which is fully incorporated herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates in general to modeling or
treatment of seizures or epilepsy.
[0003] The invention more specifically relates to changing the
expression level or availability of microRNA-211 in the mammalian
brain, such as for treatment of seizures and seizure-related
conditions, as well as for modeling increased susceptibility for
seizures in model organisms.
BACKGROUND OF THE INVENTION
[0004] Epilepsy is a chronic neurological disorder characterized by
the occurrence of unprovoked seizures. Epilepsy affects over 50
million people worldwide, with one third of these cases considered
unsatisfactorily-controlled by current treatments (Pitkanen,
Loscher et al. 2016). With a high lifetime prevalence of about 1%
of the population (Coon, Siegel et al. 2006). Therapeutics for this
prevalent malady is called for.
[0005] MicroRNAs (miRNAS, miRs) are small non-coding RNA molecules,
conserved thought the animal kingdom as well as in plants. In
mammals, miRs regulate the expression levels of most protein coding
genes--orchestrating whole transcriptional pathways (Levy, Khaled
et al. 2010).
[0006] MiR-211 is an intra-genic miRNA located within an intron of
the gene melastatin, in both mice and men. It was acknowledged to
play the tumor suppressor role presumed for melastatin. And is
studied extensively in the context of Melanoma. MiR-211 was also
found to regulate the choice towards apoptosis in cells under ER
stress in check--as in stressed cells PERK induced miR-211
expression, which in turn attenuated stress-dependent expression of
the pro-apoptotic chop/gadd153 transcription factor (Chitnis, Pytel
et al. 2012), and to play a role in neuronal differentiation, with
suggested implications to the biochemistry of Alzheimer's disease
(Fan, et al. 2016).
[0007] We noted (and perused) miR-211 as a candidate in a search
for miRs that may relate to seizures and provide new experimental
evidence and systems that show miR-211 modification in the
mammalian brain effects hyper-synchronization and excitability
reminiscent of brain seizure.
SUMMARY OF INVENTION
[0008] In one aspect, the present invention provides that miR-211
is expected to be potent as a regulator of neuronal functions
relating to seizures. With its location in the 15q13.3 locus
(epilepsy related) we found miR-211 to be of specific interest, and
even more as we found that it in-vitro targets the UTR of
nAChR.alpha.7--a gene in which a gain-of-function mutation results
in nicotine-induced seizures.
[0009] In an additional aspect, the present invention provides that
spontaneous seizures arise in mice with miR-211 dox-controlled
expression, which is confined to the brain--following abrupt
reduction in miR-211 levels.
[0010] The present invention also provides that these seizures
concord with directional gene expression changes of cholinergic
synaptic receptors, and to changes in the level of miR-134. Thus
providing by convergent experimental evidence that modification of
miR-211 levels in the brain effects the susceptibility to
seizures.
[0011] In an additional aspect, the present invention provides that
increased susceptibility to a convulsant is rendered by brain
reduction of miR-211 levels.
[0012] In an additional aspect the present invention provides that
separate transgenic mice model with overexpressed modified
cholinergic receptor the miR-211 is altered alongside seizure
related phenotypes. In an additional aspect, the present invention
provides that in both mice and men miR-211 relates to phenotypes
and Abeta-related pathologies (pertinent to Alzheimer's disease)
and memory impairments.
[0013] Altogether the invention provides that preventing miR-211
reduction in the brain of mammals reduces the threshold for
seizures and seizure related convulsions--pertinent for use in both
therapy as well as in modeling seizure for research.
DETAILED DESCRIPTION OF THE INVENTION
[0014] The present invention is substantially based on the findings
(described below) in humans and mice:
[0015] We noted miR-211 using a "oblique angle" functional
strategy: aiming to find miRNAs which would be both potent to
function in neurons, effect synaptic processes, and are
circumstantially evident in epilepsy models in mice. From >1000
miRs in our analysis we zoned in on three miRs that satisfied these
conditions (see elaboration below) and chose miR-211 for its
unrecognized important "location" in the human genome (the epilepsy
related 15q13.3 locus). We than found that it in-vitro targets the
human UTR of nAChR.alpha.7--a gene in which a gain of function
mutation results in nicotine-induced seizures. We then went to show
predominantly, that miR-211 attenuates hyper-synchronization,
non-convulsive seizure and susceptibility to convulsive seizures.
Moreover to that, miR-211 reduction in the brain lead to
cholinergic-receptor-genes and miR-134 expression changes
regulation of and TGFbetaR-II pathway;
[0016] A yet additional functional similarity between the
functional roles of miR-211 in mice and men was the link to memory
and to Alzhemer's (AD) related pathology--human Brain samples from
patients with AD showed miR-211 over-expression, as did an AD
(APP-MyD88) model mice.
[0017] Our results and claimed invention pertain to interference
with seizures and epilepsy via controlling for the levels of
miR-211.
[0018] Specifically, and in detail: we identified miR-211 as a
putative attenuator of cholinergic-mediated seizures by
intersecting forebrain miR profiles that were Ago-precipitated,
synaptic vesicle target-enriched or differentially expressed under
pilocarpine-induced seizures, and validated TGF.beta.R2 and the
nicotinic anti-inflammatory acetylcholine receptor nAChR.alpha.7 as
murine and human miR-211 targets, respectively. To explore the link
between miR-211 and epilepsy, we engineered dTg-211 mice with
doxycycline-suppressible forebrain overexpression of miR-211. These
mice reacted to doxycycline exposure by spontaneous
electrocorticography-documented non-convulsive seizures,
accompanied by forebrain accumulation of the convulsive
seizures-mediating miR-134. RNA-sequencing demonstrated in
doxycycline-treated dTg-211 cortices over-representation of
synaptic activity, Ca.sup.2+ transmembrane transport, TGF.beta.R-II
signaling and cholinergic synapse pathways. Of note: TGF.beta.R-II
signaling has been linked to lead to epileptogenic prone neuronal
tissue in relation to cholinergic imbalances. Brain injury leads to
the development of an epileptogenic prone neuronal tissue and
recurrent epileptic seizures. Similarly following an acute status
epilepticus (SE) event there is also development of
hyper-excitability and recurrent seizures, and a therapeutic for
these conditions is very much required. Additionally, a cholinergic
dis-regulated mouse model over-expressing a miR-refractory
acetylcholinesterase-R splice variant (Mishra, Friedson et al.
2017) showed a parallel propensity for convulsions, miR-211
decreases and miR-134 elevation, accompanied by deficient capacity
for navigation learning which is reminiscent of that of Alzheimer's
disease patients. Given the above findings, and since cholinergic
signaling can block inflammation via nAChR.alpha.7 blockade of
NFkB-induced production of cytokines, we further profiled both
hippocampal miRs and coding mRNAs in in-house Alzheimer's model
mice with mutated human amyloid plaques and ablated innate immunity
due to MyD88 knockout (Goll, Bekenstein et al. 2014). Notably,
miR-211 levels emerged as conspicuously hyper-expressed in these
mice with shortened life expectancy (<5 months), with many of
its coding targets suppressed, and with massive changes in neuronal
signaling and cholinergic pathways.
[0019] We noted MiR-211 decline induces transcriptome changes of
endothelial, synaptic and cholinergic functions. To explore the
global transcriptional changes following miR-211 suppression, and
test if they relate to specific brain cell types, we compared
dTg-211 brains' transcripts to controls. Specifically, we tested
highly expressed genes characteristic of neurons, astrocytes,
oligodendrocytes and their progenitor cells (OPCs), microglia and
endothelial cells (40) (FIG. 4A, B). None of the cell type marker
groups showed changes in dTg-211 brains compared to controls.
However, comparing dTg-211 transcripts in brains with and without
Dox (FIG. 4C) demonstrated that 19 of 21 endothelial cell markers,
but none of the other cell type markers showed an increase
following Dox administration (P<0.05, perturbation analysis, see
Methods). Thus, miR-211 reaction to Dox appeared to potentiate
endothelial gene expression, predicting functional relevance for
neurovascular unit activities. We also searched for Dox-induced
changes in the expression of cholinergic receptor genes. The
excitatory muscarinic ACh receptor-5 (mAChR5, 31), a positive
effector of cholinergic synaptic transmission was elevated by
4-fold (FIG. 4D). Likewise, the excitatory nAChR.alpha.-1 neuronal
nicotinic receptor and .alpha.-5 nicotinic receptor (Chrna5), the
stress-inducible muscarinic ml receptor and the ionotropic
.alpha.-7 nicotinic receptor (Chrna7), responsible for post- and
presynaptic excitation and blocker of inflammation, were all
elevated. In contrast, the metabotropic muscarinic ACh receptors-4
and -2 (mAChR4, mAChR2) were both two-fold reduced following Dox
administration (FIG. 4D, scheme in FIG. 4E). MAChR4 is located on
both pre- and post-synaptic sites in brain cholinergic synapses,
and exerts inhibitory effects on synaptic firing (44) with a role
in locomotion. Additionally, we noted increases in
butyrylcholinesterase (BChE, supplementary FIG. S4B), which
hydrolyzes ACh in the brain alongside AChE and is elevated in AD
brains. In contrast, we noted decrease of ATCAY/BNIP-H, an
ataxia-related brain-specific scaffold protein, which was recently
found to recruit Choline Acetyltransferase (ChAT) to neurite
terminals, and promote cholinergic signaling (46, 47). Furthermore,
within 4 days following Dox administration, dTg-211 mice presented
4-fold increases in the forebrain levels of miR-134 (FIG. 4F),
known to be causally involved with the induction of convulsive
seizures (10-12, 48). To examine how extra-synaptic cholinergic
imbalance would affect miR-211 expression and the risk of epilepsy,
we employed transgenic AChE-R (TgR) mice over-expressing the
soluble, non-synaptic stress-induced splice variant of AChE from
which the 3'-untranslated region (UTR) which contains the miR
regulatory element (MRE) had been deleted (FIG. 4G, scheme). TgR
mice, which constitutively overexpress AChE-R that catalyzes ACh
breakdown in extra-synaptic sites and show chronic stress
behaviors, are hyper-sensitized to nicotine administration (49).
Intriguingly, these mice also experienced higher susceptibility to
seizures, manifested as larger fraction of mice presenting full
status epilepticus after pilocarpine injection (FIG. 4H). This was
accompanied by shorter latency until status epilepticus was
observed (FIG. 4I, P<0.05), reduced miR-211 expression in the
hippocampus and frontal cortex compared to controls (FIG. 4J), and
overexpression of miR-134 in the prefrontal cortex and hippocampus
(FIG. 4K), possibly in relation to their hypersynchronous state.
Thus, modified cholinergic regulation in TgR mice elevated both
forebrain miR-211 and miR-134 levels and exacerbated susceptibility
to epileptic seizures. We noted that in EEG/ECoG measurements from
mice, the slow hypersynchronous cortical activity is reminiscent
and of several human syndromes manifesting with epilepsy. The
recordings and expression data together with the genetic and
transcriptional information indicates OR suggests that forebrain
miR-211 maintaining OR elevating miR-211 levels in mice and men may
be protective against spontaneous non-convulsive seizures, whereas
its reduction may induce them.
[0020] In summary: We showed the putative role of miR-211 as a
regulator of synaptic functions in the context of synchronous
activity in human and mouse. The murine-related experiments are
summarized below:
[0021] In a 1st mouse model, we explored this possible link between
miR-211 and epilepsy by engineering Tg-mice with
doxycycline-suppressible forebrain miR-211 overexpression.
Doxycycline exposure generated spontaneous seizures, and
RNA-sequencing demonstrated in doxycycline-treated dTg-211 cortices
over-representation of pathways relating to synaptic activity, Ca2+
transmembrane transport, TGF.beta.R-II signaling and cholinergic
synapse pathways.
[0022] In a 2nd mouse model, we related these findings to another
mouse model which over-expresses a miR-refractory
acetylcholinesterase-R splice variant. Expression changes in miRs
as well as phenotypical similarities concord with a cholinergic
link.
[0023] In yet a 3rd mouse model, which relates to the immune
deficiency in AD, miR-211 was very substantially changed.
Importantly, we note transcriptional changes concordant with the
results of the 1st mouse model.
[0024] In conclusion: this work has been based on a set of
different transgenic model mice, human derived samples and cell
cultures, all of which suggest that miR-expression dynamics plays a
key role in hypersynchronous neuronal activity, relating to
epilepsy and cholinergic brain signaling.
[0025] Taken together, our findings demonstrate that in mice,
dynamic miR-211 decreases induce hyper-synchronization, and
non-convulsive seizures, accompanied by expression changes in
cholinergic and TGF.beta.R2 pathways as well as in miR-134.
BRIEF DESCRIPTION OF THE DRAWINGS
[0026] The invention can be understood from these detailed results,
but alternatively articulated as a description of the experimental
results incorporated herein from U.S. Provisional Patent
Application No. 62/640,139.
Result-set No 1: pertaining to identifying MiR-211 as a synaptic
candidate associated with cholinergic signaling-induced seizures.
(a) Three candidate miRs (miR-211, -218, 27a) emerged by
intersecting rodent miRs whose levels modify following exposure to
the cholinergic facilitator pilocarpine (145 miRs, 6); interact
with the RISC complex protein Ago2 in CamKIIa-expressing cells (83
miRs, 26); and target synaptic vesicle transcripts (94 miRs, 80),
predicting involvement in cholinergic-related epileptic seizures.
(b) qRT-PCR-measurements show mmu-miR-211 decline in hippocampal
RNA 24 hrs following exposure to pilocarpine. (c) Human MiR-211, as
well as it's in silico target, nicotinic nAChR.alpha.7 and 5 other
genes localize to a 15q13.3 chromosomal region where heterozygote
deletions entail cognitive impairments with recurrent seizures. (d)
The seed domain of hsa-miR-211-5p shows sequence complementarity
with the inflammation regulating nicotinic nAChR.alpha.7. (e)
Luciferase assay validated direct targeting by miR-211 of
nAChR.alpha.7 in human embryonic kidney cells. Result-set No 2:
dTg-211 mice show spontaneous non-convulsive seizures following
doxycycline-induced reduction of forebrain miR-211 excess. (a)
DTg-211 mice carry the CamK2a promoter, followed by a
trans-activator (tTa) coding sequence and a pTRE-transgene inducing
Doxycycline-suppressible expression of mmu-miR-211 in forebrain
neurons. (b) MiR-211 over-expression in the mouse forebrain but not
cerebellum of is Dox-suppressible. Expression normalized to CamK
controls. (c) Dox-suppressed miR-211 levels reach basal levels
within days. (d) DTg-211 mice were administered Dox before and
after birth, preventing transgene overexpression during
development. ECoG recordings in dTg-211, but not control mice
showed synchronous neuronal cortical activity after Dox-treatment,
parallel to declined miR-211 levels. (e) DTg-211 mice presented
ECoG-recorded seizures exclusively after Dox administration. (f)
ECoG plots showing No. of seizures per day in single dTg-211 mice
and controls (red, blue). Dashed gray line marks initiation of Dox
administration. (g) Representative ECoG recording plot shows a
seizure of a Dox-exposed dTg-211 mouse; corresponding heat-map
shows representative higher power seizure of low frequency
oscillations (.about.5 Hz) at the same time window. (h) Blow-up of
a single event (marked by asterisk in d), presenting an enlarged
section of the seizure activity, with spike and wave form.
Result-set No 3: Dox-treated dTg-211 mice show sustained
susceptibility to PTZ-induced convulsions alongside
TGF.beta.R-associated gene changes in RNA seq. (a) Scheme of
Pentylenetetrazol (PTZ) injection 4-days after 5-day Dox
administration, to examine long-term susceptibility to this
convulsant. See sup FIG. 3a for increased manual convulsions-index
scores in dTg-211 mice. (b) ECoG recording shows larger spikes/min
counts, reflecting seizure-susceptibility in PTZ-exposed dTg-211
mice compared to CamK controls; (c) Number of seizures; (d) Latency
to 1st spike; (e) Number of seizure-events by Neuronal-networks
analysis; and (f) Latency to first seizure. (g) DTg-211 mice
regained miR-211 overexpression after Dox removal, at time of PTZ
test. (h) Luciferase validation tests of miR-211 targeting of the
murine TGF.beta.R-II 3'-UTR but not a control sequence. (i) Reduced
TGF.beta.R-II protein concentration (two fold) in dTg-211 frontal
cortex (ELISA, n=7+7, p<0.001). (j) Increased TGF.beta.R-II mRNA
levels following Dox administration. (k) Fold-change volcano plot
differences for dTg-211 with/without Dox (right pane) compared to
dTg-211/CamK brains (left pane). Dots represent genes, with
positive or negative 2-fold change (orange), passing cutoff
threshold for significance (red), both (green) or unmodified
(black). (1) Empirical Cumulative Distribution Function (ECDF)
plots show differential expression (p-values) following Dox, of
reduced (orange) but not elevated genes (green) in dTg-211 cortices
or in all genes (gray). (m) Cortical genes up-regulated in dTg-211
are reduced (red) following Dox compared to (n) all genes. (o)
Per-gene fold-changes following Dox for TGF.beta.-signaling genes
modified 12 hrs. following status epilepticus. (39) Result-set No
4: MiR-suppression in dTg-211 mice alters cell marker genes and
cholinergic receptors, and cholinergic mouse model show concordant
miR-changes alongside increased seizure susceptibility. (a)
Experimental setup: CamK:Tta mice bred with Tg-pTRE-211 mice
generated dTg-211 mice and littermate CamK-controls.
Illumina-compatible libraries from Frontal cortex-RNA of mice
before or under doxycycline (color-coded squares) were sequenced.
(b) Sustained cell-type marker (40) in dTg brains; (c) Elevated
endothelial marker genes following Dox. (d) Modified muscarinic (M)
and nicotinic (N) cholinergic receptors in Dox-treated dTg-211
brains. (e) Scheme of cholinergic receptors and regulators (shown
in d) in brain cholinergic synapses. Note Dox-induced
downregulation of cholinergic receptors suppressing synaptic
transmission: CHRM2 and CHRM4 (M2 and M4); and upregulation of
facilitators CHRM5 (M5), CHRNA5 and CHRNA7 (.alpha.5 and .alpha.7).
(f) MiR-134 upregulation in dTg-211 mice following Dox
administration parallels the timeframe of seizure induction in this
model. (g) Scheme of the synaptic and non-synaptic AChE transcript
variants, and corresponding protein forms. (h) Mice overexpressing
the non-synaptic cholinergic enzyme AChE-R (TgR(81)) show higher
propensity with (i) shorter latency for status epilepticus event
following Pilocarpine injection, alongside (j) miR-211 reduction
and (k) miR-134 elevation in pre-frontal cortex (PFC) and
hippocampus (Hipp) of TgR mice. Result-set No 5: Protein-protein
interaction network of Dox-induced differentially expressed
synaptic vesicle and cholinergic genes. (a) Protein-protein
interaction-based interconnected network of stringently-defined 134
differentially expressed node genes and overall 427 genes. (b) Fold
changes.+-.SEM of the synaptic vesicle cycle pathway genes within
the network. (c) Fold changes.+-.SEM of the cholinergic synapse
genes within the network. (d-e) Enriched biological process
GO-terms for PPI-networks for genes differentially expressed
following Dox, either down or up. (Fold enrichment, stars denote
significance p-value based on permutation analysis). Result-set No
6: Mmu-miR-211 expressing mice show reduced memory abilities in the
Morris Water Maze, and hsa-miR-211 is overexpressed in AD patient
brains. (a) PANTHER classification of gene ontology shows
Dox-induced enrichment of differentially expressed gene groups,
mainly regulation (Reg.) of neuron-related pathways in the dTg-211
brain transcripts (Asterisk, see methods). (b) Time to reach
platform in the MWM shows reduced learning ability in the 1st and
2nd training days for dTg-211 mice. (c) Search strategy scores
divided by trials and days for individual dTg-211 and CamK mice.
Fewer trials of dTg-211 mice in the last days showed focal or
directed strategy. (c) Loss of preference of the platform quadrant,
reflecting impaired reference memory for dTg-211 compared to CamK
mice in probe trials. (e) Higher miR-211 levels (.about.2-fold) in
post-mortem Alzheimer's entorhinal cortices (72) compared to
non-demented controls, n=7 each, p<0.05, Student's t-test.
Result-set No 7: Scheme depicting the cross of transgenic lines
(MyD88.sup.-/- with B6C3-Tg:APPswe, PSEN1dE9) all from a C57BL6
background to generate MyD88.sup.-/--APP.sub.sw/PS1.DELTA.E9 mice.
As the cholinergic system and Alzheimer's disease (AD)-related
pathologies are long known to be interconnected; AD entails memory
loss and has long been observed to entail perturbed cholinergic
signaling and loss of brain cholinergic cells (ref: Davies and
Maloney 1976). To peer into the possibility that miR regulation,
and specifically that of miR-211 may have a role in the context of
AD and its cholinergic disruption, we utilized samples from triple
transgenic model mice carrying a mutated human amyloid precursor
protein APP gene, a mutated presenilin 1 PS1 gene and an ablated
innate immune system via knockout of the Toll-Like Receptor
(TLR)-related innate immune mediator: The Myeloid Differentiation
Primary Response 88 MyD88 gene (ref). The cumulative augmentation
of these transgenic manipulations served us in modeling the
contribution of AD-related .DELTA..beta. pathology in the absence
of an intact innate immune signaling system. Small RNA sequencing
from these mice noted numerous differentially expressed miRs in the
triple transgenic hippocampi. Of note, alongside Let7-k and
miR-1264, miR-211 was conspicuously upregulated in the hippocampi
of these mice by an order of magnitude. Also, miR-200-a, 3068 and
344-b were all higher in MyD88 null mice than in triple transgenic
mice. These mice, expressing mutant forms of PSN1, APP and MyD88,
can serve to reflect the functional role of the innate immune
system in AD. An important phenotype we noted is the reduced
lifespan and abrupt death of these triple transgenic mice in early
adulthood (Goll, Bekenstein et al. 2014). After 250 days (8 Mo.)
triple transgenic mice were twice as likely to die as controls,
with death rate peeking in 4 months of age. Result-set No 8:
AD-innate-immune model mice show reduced lifespan with exacerbated
death starting at young adulthood. Kaplan-Meier survival curves
showing the cumulative survival probabilities in MyD88-/- (n=47),
APP/PS1 MyD88+/-(n=45) and APP/PS1 MyD88-/- (n=41) over 10 months
(log-rank test p<0.001). Result-set No 9: PCA of miR expression
in MyD88 null mice shows separation between control (black
triangles) and APP-PS1. And A per-miR coefficient of variance shows
higher inter-group variance for many of the expressed miRs than
expected by chance, across expression levels (CPM). Concordantly,
we examined the transcriptional expression profile of both miRs and
mRNAs and the interactions between them in the hippocampus of these
triple mice. Expression of miRs was different between MyD88-/- mice
transgenic for APP-PS1 and control MyD88-/-, as evident from
principal component analysis (PCA) for miR-expression and analysis
of variance. Result-set No 10: MyD88-AD mice show both elevation
and downregulation in MyD88-AD mice. For addressing this question
specifically in the cholinergic context, we examined the expression
of cholinergic receptors. Intriguingly, cholinergic Muscarinic
Receptors 1, 3 and 4 (CHRM1, CHRM3, CHRM4) showed elevation in
MyD-APP mice V.s. MyD88-/- controls; while Cholinergic Muscarinic
Receptor 5 (CHRM5) showed reduction. The relation of these changes
to those observed in dTg-211 mice under the Dox- is of interest,
but will not be elaborated upon. Result-set No 11: Modifications of
miR-211 target genes: MyD88-AD mice show both elevation and
downregulation of expression in the hippocampus of MyD88-AD mice in
respect to MyD88-/- controls. We also observed specific targets of
miR-211 to be modified in the MyD-AD hippocampus (FIG. 7K). These
include Zinc Finger and BTB Domain Containing 7C (ZBTB7C), which is
upregulated in endothelial cells in both in-vitro and in-vivo
models of ischemia and that was (together with ANGPT1) implicated
in the Susceptibility to undergo ischemic injury in response to
cerebral ischemia (Du, Zhou et al. 2015). Of note, dTg-211 mice
following Dox likewise showed a two-fold reduction in ZBTB7C in
respect to both control or no-Dox dTg-211 mice; Ribosomal Protein
S6 Kinase A3 (RPS6KA3) whose impairment causes a non-syndromic form
of mild to moderate mental retardation (Merienne, Jacquot et al.
1999, Field, Tarpey et al. 2006) was also modified. Other changes
were noted in the schizophrenia related Plexin A2 (PLXNA2, Mah,
Nelson et al. 2006) and in the Iron Responsive Element Binding
Protein 2 (IREB2) to which allelic association was suggested for AD
(Coon, Siegel et al. 2006).
Embodiments for the Invention
[0027] Embodiments for the invention comprise inter-related
experimental model systems and methods for limiting or enhancing
the chance for seizures in the mammalian brain.
[0028] In some embodiments model mice expressing oligonucleotides
substantially similar to miR-211 or complements thereof--provide
insight into the epileptic state or provide a backdrop for
discovery of additional agents for therapeutic use. Methods for
limiting or enhancing the chance for seizures in the mammalian
brain by introducing oligonucleotides provide transgenic or viral
expression or delivery by yet additional means to the brain of
oligonucleotides to control and limit reduction in the abundance of
miR-211
Definitions of Terms
[0029] In the present invention, the term "seizure" should be
understood as uncontrolled electrical activity in the brain, which
may produce a physical convulsion, minor physical signs, thought
disturbances, or a combination of symptoms. The type of symptoms
and seizures depend on where the abnormal electrical activity takes
place in the brain, what its cause is, and such factors as the
patient's age and general state of health. Seizures by this
definition can be caused by head injuries, brain tumors, lead
poisoning, mal-development of the brain, genetic and infectious
illnesses, and fevers. Yet in as much as half of the patients with
seizures, no direct cause can yet be found.
[0030] In the present invention, the term "seizure-related
disorder" or "seizure related condition"-should be understood to
mean: both conditions involving tonic-clonic (grand-mal) seizures
and petit mal seizures--these together include brain injury stroke,
CNS infection-associated seizures, brain tumors, traumatic brain
injury, neurodegenerative disorders, and metabolic disorders which
are known to cause seizures.
[0031] In the present invention, the term "epilepsy" pertains to a
central nervous system (neurological) disorder essentially in
humans which brain activity becomes abnormal, causing seizures or
periods of unusual behavior, sensations, and sometimes loss of
awareness. Brain activity phenomena in other mammals may be
described as "epileptic" as per some similarities in recordings in
brain activity.
[0032] In the present invention, the term "Intractable epilepsy"
pertains to a seizure disorder in which a patient's seizures fail
to come under control with treatment. These seizures are sometimes
also called "uncontrolled" or "refractory."
[0033] In the present invention, when addressing "expression" as
"in the brain" it refers to an expression that is unique and
essentially undetectable outside of the Brain of an animal or human
subject.
[0034] In the present invention, the term when addressing
"expression" as "predominantly in the brain" it refers to an
expression in which the fold-increase detectable in the brain of
the said animal or human subject is substantially higher than over
the fold-increase detectable in any other tissue to be examined out
of the brain. Wherein the "substantially higher" old increase is:
fourfold, tenfold, twentyfold or one hundred-fold over the fold
increase in other tissues examined.
[0035] In the present invention the term "oligonucleotides"
pertains to short nucleic acid polymers such as RNA, DNA and
backbone-modified or otherwise modified versions used and known in
the ART: oligonucleotides can be expressed in vivo or in vitro or
alternatively generated by man-designed chemical reactions such as
by Solid-phase synthesis. Chemically the oligonucleotides molecules
described herein may be for example, locked nucleic acid (LNA),
RNA, DNA, 2-O-methyl-blocked, morpholino or phosphorothioate
oligonucleotides. These may take the form of short, (single- or
double-stranded) DNA or RNA molecules, and "oligonucleotides" is
construed to include antisense oligonucleotides (ASO), RNA
interference (RNAi), and aptamer RNAs. An oligo may be considered
as substantially similar if it holds 90%, 93%, 95%, 97%, 99% or
100% similarity to a said sequence. Functionally a person in the
ART of miRNA will most commonly consider of a said sequence to be
substantially similar to a (mature) miRNA if it shares 95%
similarity or 100% similarity allowing (or not) for a single
mismatch along the .about.20 bp alignment.
[0036] In the present invention and as common in the art of cell
biology microRNAs (miRNAs, miRs) are short non-coding RNAs (ncRNAs)
that regulate gene expression at the level of translation, having
features known in the ART.
[0037] Locked nucleic acid (LNA) are modified RNA nucleotide in
which the ribose moiety is modified with an extra bridge connecting
the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the
3'-endo (North) conformation, which is often found in the A-form
duplexes. LNA nucleotides can be mixed with DNA or RNA residues in
the oligonucleotide whenever desired and hybridize with DNA or RNA
according to Watson-Crick base-pairing rules.
[0038] An LNA mimetic OR inhibitor a shorter than 20 bp of
base-paring may functional due to the strong binding of this
nucleic acid species to RNA, and as is known in the ART. LNAs are a
preferred embodiment for administration in the present invention,
such as for mimetic or as an antagomiR, and by diverse means of
delivery as will be specified and as is known in the ART.
[0039] Phosphorothioate are RNA-like nucleic acids with
inter-nucleotide linkages are resistant to nucleases,
phosphorothioate oligonucleotides are also relatively compatible
for use in vivo, since they are may pass more readily to the
interior of the cell via the plasma membrane, when used as
antisense, phosphorothioate may be used to downregulate gene
expression by hybridizing to a target mRNA, or pre-miR. To resist
exonucleases, the oligonucleotide would preferably have
phosphorothioate linkages near both the 5' and 3' ends; and as is
known in the ART.
[0040] Morpholino oligomers (A.K.A. phosphorodiamidate Morpholino
oligomer; PMO), has DNA bases attached to a backbone of
methyl-enemorpholine rings linked through phosphorodiamidate
groups. Morpholinos are classically used to block access to RNAs
such as for knocking down gene function or inhibiting miRs.
[0041] 2'-O-methyl-modified phosphorothioate antisense
oligonucleotides (2-O-methyl-blocked; 2'OMe) is a naturally
occurring post-transcriptional modification of RNA, such as in
tRNAs Oligonucleotides synthesized to contain 2'OMe have increased
Tm for RNA duplexes, and the oligo is protected from
single-stranded endonucleases.
[0042] More globally, in the present invention miRs can be modified
in accordance with the invention using any suitable chemical moiety
including, for example, also boranophosphate, 2'-fluoro, PEG,
terminal inverted-dT base, 2'-fluoro N3-P5'-phosphoramidites, or
combinations thereof. In particular preferred embodiment, the miR
is modified to include LNA (see also Grunweller, et al. (2003) NAR
31:3185-93).
[0043] All of the oligonucleotides described herein for
administration of a synthesized molecule may be provided be the
diverse means known in the ART for experimental and medicinal
use.
[0044] Specifically, delivery to the brain of a subject or model
organism may be done by injection to the brain OR by systemic
injection specifically in conditions in which blood barrier is
interrupted. Encapsulation of the oligonucleotides in liposomes or
alongside nanoparticles and as previously shown and known in the
ART.
[0045] In the present invention an inducer of a molecular
expression system is a small molecule functional in modifying that
system; and such as doxycycline (Dox), and as is known in the
ART.
[0046] In the present invention doxycycline (dox) is a derivative
of tetracycline, a preferred effector for tetracycline
trans-regulation and as is known in the ART of transgenic
systems.
[0047] Tet-Off expression system, comprises a
tetracycline-controlled transactivator protein (tTA) which is
composed of the Tet repressor DNA binding protein (TetR) fused to a
VP16 activator from Herpes Virus, regulating the
tetracycline-responsive promoter element (TRE; and in our case the
miR-211). In the absence of Tc or Dox, tTA binds to the TRE and
activates transcription of the target gene. In the presence of Tc
or Dox, tTA cannot bind to the TRE, and expression from the target
gene remains inactive.
[0048] In the present invention administering is construed as
providing a substance such as by adding it to food or injecting an
organism or patient.
[0049] An externally synthesized oligonucleotide is any
oligonucleotide molecule not synthesized in-vivo per a subject or
animal.
[0050] In the present invention as used herein interchangeably, a
"miRNA gene product," "microRNA," "miR," or "miRNA" may, by
context, refer to the unprocessed or processed RNA transcript from
a miRNA gene, and as indicated by the context. As the miRNA gene
products are not translated into protein, the term "miRNA gene
products" does not include proteins--the term "miR-211" should be
understood to mean the mammalian-conserved intragenic (intronic)
miR. Of note: during miRNA biogenesis a pri-miRNA transcript is
transcribed--this form is cleaved to generate the pre-miRNA. A
70-100 bp form which is found in a stem and loop form.
[0051] As common in the ART, we and others have cloned a miR
sequence to express in a transgenic manner in the form of the
pre-miR. This is preferable for practical reasons. We acknowledge
that the expressed for also leads to and generates some levels of
the "star" form of the miR--that is the complementary portion of
the mature miR which may assume a function, as well as the loop
portion--which is detectable in sequencing. When In the present
invention, the term "miR-211" is used it concerns the functional
miR-211-5p, which has been shown to be the prominent form and
assumes the function of the `gene` and expressed pre-miR is derived
from the prominent form (mmu-miR-211-5p, SEQ ID No. 1,
alternatively hsa-miR-211-5p, SEQ ID No. 2) rather than the pre-miR
or the star form (mmu-pre-miR-211/mmu-miR-211-3p, SEQ ID No. 3/SEQ
ID No. 5 alternatively, in humans: hsa-pre-miR-211/hsa-miR-211-3p,
SEQ ID No.4/SEQ ID No. 6). When the term "miR-211" is used in the
context of a transgene expressed--it concerns the pre-miR form
(such as mmu-pre-miR-211 or hsa-pre-miR-211). When describing
inserting/injecting/administering a synthesized molecule to a
mammal--the term "miR-211" by default concerns the functional
mature mmu-miR-211-5p/hsa-miR-211-5p, and unless otherwise noted.
We find this wording definite; and to substantial extent is
commonly used by persons in the ART.
[0052] Of note: The miRs of the invention and their explicit
sequences thereof are well-known in the art and can be found in the
miRBase Sequence Database and Registry (Kozomara &
Griffiths-Jones (2011) Nucl. Acids Res. 39:D152-7; Griffiths-Jones,
et al. (2008) Nucl. Acids Res. 36:D154-8; and Griffiths-Jones
(2004) Nucl. Acids Res. 32:D109-111.
[0053] In the present invention, the term "reduction" or "decrease"
or "inhibiting expression" should be understood as the reduction in
the relative number of miR molecules (as per a so-called `constant`
or housekeeping molecule constituting a reference)--and as is
normally addressed in the art by quantitative PCR (qPCR) or by high
throughput sequencing.
[0054] In the present invention "mimetic" molecules (or
oligo-mimetics) are chemically modified compounds designed to mimic
the action of naturally occurring molecules; but with alternative
chemistries to the nucleic acid bases.
[0055] The term "inhibition of miR-211 activity" should be
understood as including direct inhibition such as by a molecule
which binds to the miR and directly inhibits its activity (examples
include binding partner, an interfering oligonucleotides molecules,
as described above, and such as, for example, LNA, RNA or
phosphorothioate oligonucleotides.
[0056] Of note: agents suitable for interference of cellular RNAs
include antago-miRs, antisense molecules, small hairpin RNA
molecules (shRNA), small interfering RNA (siRNA) molecules,
microRNA "sponges", decoy oligonucleotides and aptamers.
[0057] Small hairpin RNA (shRNA) molecules are short RNA molecules
having a small hairpin loop in their tertiary structure that may be
employed to silence genes. The design of shRNA molecules capable of
inhibiting miR-211 by binding preferably onto the pre-miR are
apparent to those skilled in the field of shRNA design.
[0058] In the present invention, the term "antagomir" should be
understood to mean a class of chemically engineered
oligonucleotides used to silence endogenous miRs by base paring
with them. More explicitly, an antagomir is a small synthetic oligo
that is complementary to the specific miR target portion such as to
inhibit Ago2 cleavage of the target by the miR.
[0059] Sponge RNAs are small synthetic RNAs that are introduced to
the cell and function like antagomirs yet bind more than one
miR.
[0060] As used herein, "treating" or "treatment" of a disease or
disorder refers to arresting, reducing, ameliorating or delaying
the onset of a disease, disorder, or at least one clinical symptom
or physical parameter of a disease or disorder, which may or may
not be discernible by the patient. In certain embodiments,
"treating" or "treatment" refers to inhibiting or controlling the
disease or disorder, either physically (e.g., stabilization of a
discernible symptom), physiologically (e.g., stabilization of a
physical parameter), or both. As used herein, an "effective amount"
of a miR gene product is an amount sufficient to measurably restore
the self-evident physiological state. Alternatively stated, an
effective amount of a miRNA gene product measurably restores,
reverses or stabilizes neural function to the EEG measured brain
activity expected from an intact subject or animal and in
concordance to the practice and the medical ART. Arguably, one
skilled in the art can determine an effective amount of a miRNA
gene product to be administered to a given subject, by taking into
account factors, such as the size and weight of the subject; health
and sex of the subject; the route of administration based on
previous publications in the field; and whether the nature of
administration: E.g. regional or systemic. In addition, one skilled
in the art can determine an appropriate dosage regimen for the
administration of an isolated miRNA gene product to a given
subject. For example, a miRNA gene product can be administered to
the subject once (e.g., as a single injection or deposition).
Alternatively, a miRNA gene product can be administered multiple
times to a subject. Where a dosage regimen includes multiple
administrations, it is understood that the effective amount of the
miRNA gene product administered to the subject can include the
total amount of gene product administered over the entire dosage
regimen
[0061] In the present invention and as known in the ART various
delivery systems can be used to administer a synthetic oligo for
therapeutic use--by different routes these can include
intra-nasally intradermal, intramuscular, intraperitoneal,
intravenous, subcutaneous, intranasal, epidural, intranasal,
intracerebral, and oral routes. Specifically, this invention is
concerned delivery to the CNS of a mammal--specifically a human,
and also to a model organism such as a rat, mouse OR non-human
primate. Delivery means can thus include injection to brain cavity,
using mini-osmotic pump, as known in the ART, as well as systemic
administration--Intravenous delivery, oral delivery, intramuscular
delivery, intrathecal delivery, and inhaled delivery. Appropriate
methods for achieving these means of delivery are known to those
skilled in the art of drug delivery.
[0062] A genetically modified animal is construed as meaning a
transgenic OR a Genome edited animal, such as by CRISPR-Cas
systems.
[0063] In some embodiments, the miRNA gene product is isolated. As
used herein, an "isolated" miRNA gene product is one that is
synthesized, or altered or removed from the natural state through
human intervention. For example, a synthetic miRNA gene product, or
a miRNA gene product partially or completely separated from the
coexisting materials of its natural state, is considered to be
"isolated." An isolated miRNA gene product can exist in a
substantially-purified form, or can exist in a cell into which the
miRNA gene product has been delivered. Thus, a miRNA gene product
that is deliberately delivered to, or expressed in, a cell is
considered an "isolated" miRNA gene product. A miRNA gene product
produced inside a cell from a miRNA precursor molecule is also
considered to be an "isolated" molecule.
[0064] Isolated miRNA gene products can be obtained using a number
of standard techniques. For example, the miRNA gene products can be
chemically synthesized or recombinantly produced using methods
known in the art. Commercial suppliers of synthetic RNA molecules
or synthesis reagents include, e.g., Dharmacon Research (Lafayette,
Colo.), Pierce Chemical (part of Perbio Science, Rockford, Ill.),
Glen Research (Sterling, Va.), and Cruachem (Glasgow, UK).
[0065] Alternatively, the miRNA gene products can be expressed from
recombinant vectors, either individually or from the same or
different vector. Recombinant vectors include circular or linear
DNA plasmids and typically contain a suitable promoter. Suitable
promoters for expressing RNA from a plasmid include, e.g., the U6
or Hi RNA pol III promoter sequences, or the cytomegalovirus
promoters. Selection of other suitable promoters is within the
skill in the art. The recombinant plasmids of the invention can
also include inducible promoters for expression of the miRNA gene
products in brain cells. The miRNA gene products can also be
expressed from recombinant viral vectors. The RNA expressed from
the recombinant viral vectors can either be isolated from cultured
cell expression systems by standard techniques, or can be expressed
directly in brain cells.
[0066] In the present invention, "seizure-generating-stimuli"
relates to the fact that some seizures such as focal seizures or
seizures generated in a certain region of the brain, may be
initiated in the following pathological causes (ranging from
substance abuse to rhythmic flashing lights) and propagated
throughout the brain. Moreover, stimulation of the brain in a model
organism by stimulant substances has long been used to seizures,
epileptic events and induce epileptogenesis.
[0067] Unless otherwise indicated, all numbers defined above, used
in this specification are to be understood as being modified in all
instances by the term "about". Accordingly, unless indicated to the
contrary, the numerical parameters set forth in this specification
are approximations that may vary by up to plus or minus 10%
depending upon the desired properties to be obtained by the present
invention.
[0068] Units, prefixes and symbols may be denoted in their SI
accepted form. Unless otherwise indicated, nucleic acids are
written left to right in 5' to 3' orientation; amino acid sequences
are written left to right in amino to carboxy-orientation,
respectively. Numeric ranges are inclusive of the numbers defining
the range.
TABLE-US-00001 Sequence Sequence miRbase ID/ ID full name other
database Sequence 1 SEQ ID mmu-miR-211-5p MIMAT0000668
UUCCCUUUGUCAUCCUUUGCCU No. 1 2 SEQ ID hsa-miR-211-5p MIMAT0000268
UUCCCUUUGUCAUCCUUCGCCU No. 2 3 SEQ ID mmu-pre-miR-211 MI0000708
CUGCUUGGACCUGUGACCUGUG No. 3 GGCUUCCCUUUGUCAUCCUUUGC
CUAGGCCUCUGAGUGAGGCAAG GACAGCAAAGGGGGGCUCAGUG GUCACCUCUACUGCAGA 4
SEQ ID hsa-pre-miR-211 MI0000287 UCACCUGGCCAUGUGACUUGUG No. 4
GGCUUCCCUUUGUCAUCCUUCGC CUAGGGCUCUGAGCAGGGCAGG
GACAGCAAAGGGGUGCUCAGUU GUCACUUCCCACAGCACGGAG 5 SEQ ID
mmu-miR-211-3p MIMAT0017059 GCAAGGACAGCAAAGGGGGGC No. 5 6 SEQ ID
hsa-miR-211-3p MIMAT0022694 GCAGGGACAGCAAAGGGGUGC No. 6
[0069] The invention will now be illustrated by the following
non-limiting Examples.
EXAMPLES
Materials and Methods
[0070] Transgenic Mice Generation and Experiments
[0071] We generated pTRE-miR-211 mice by cloning the
pre-mmu-miR-211 sequence into a pTRE-tight vector, followed by
pronuclear injection at The Weizmann Institute of Science Animals
Facility. Mice were held in SPF conditions at The Hebrew
University--an AAALAC International accredited institute. All
procedures, including animal tests were approved by the
institutional ethics committee (Ethics No: NS-16-14729-4), with
concordance to AAALAC International guidelines. Tta-CamKa Strain
(CamK, Calcium/Calmodulin Dependent Protein Kinase II Alpha) was
acquired, backcrossed and crossed and housed as in Supplementary
Methods. DTg mice and CamK littermates were housed together and
administered doxycycline (Dox) in parallel. The cholinergic
muscarinic agonist pilocarpine (Sigma, Israel; 290-340 mg/kg) was
intraperitoneally (i.p.) injected to mice as in (72).
[0072] For genotyping, Tail-tip PCR was used (sequences given in
Supplementary Table S1). B6; CBA-Tg(Camk2a-tTA)1Mmay/J (CamK mice)
were purchased from Jackson Laboratory, Farmington (Jax.RTM. Bar
Harbor, Me). Mice were backcrossed to FVB/N background for three
generations and further crossed to generate double transgenic mice
and littermate controls.
[0073] Behavioral Tests
[0074] Morris Water Maze (MWM):
[0075] Mice were subjected to a Morris water maze (as in Vorhees
and Williams 2006) to assess learning and memory. Briefly, mice
were released to search for a submerged platform in a fiberglass
water tank, 1.2 m in diameter. Water temperature was fixed; and
colored white for opaqueness. Lighting remained fixed, platform
directions were queued with visible marks to allow for allocentric
navigation, and systematic release directions were as in (Vorhees
and Williams 2006). Each mouse was tested in four trials a day for
4 days, followed by a single day of probe trial, in which mice
search for the platform which had been removed. Experiments were
performed blind, using alias numbers per mouse, recorded from a
monochromatic ceiling-fixed video camera and automatic movement
tracing and quantitative data analysis was performed using
EthoVision.RTM. XT (Noldus version 8, Information Technology b.v.,
Wageningen, The Netherlands; Noldus, Spink et al. 2001)
[0076] Luciferase Assay
[0077] MiR-211-5p direct targeting was predicted in-silico and
experimentally assessed using in vitro Luciferase measurement with
the Dual-Luciferase kit (Promega, Madison, Wis.), 48 h after
transfection. Specifically, a 3' untranslated region (3'-UTR)
fragment of human nAChR.alpha.7 OR murine TGF.beta.R-IT transcripts
(both similar in mouse and human), was cloned into a luciferase
reporter vector. Reporter and miR-211 expression vector (Genecopia,
MmiR3291-MR04) were transfected into HEK293-T cells (ATCC,
Manassas, Va.) using polyethylenimine, and luciferase activity
measured and normalized according to manufacturer's
instructions.
[0078] ELISA
[0079] Mice frontal cortices were homogenized in RIPA buffer
containing protease inhibitor (1:200) and centrifuged. Sample
protein content was measured with the Lowry assay (Thermo
Scientific, France). Samples were further diluted 1:3 in PBS and
used for quantifying TGFbR2 by EIAab kit (Cat.: E9935m) as per
manufacturer's instructions.
[0080] ECOG Recordings and Analysis
[0081] Electrocorticography (ECoG) recordings were performed as
previously described (73). Briefly, under deep isoflurane
anesthesia (1-3%) mice were placed in a stereotaxic frame. After
shaving and disinfecting the dorsal aspect of the head, the skull
was exposed by a longitudinal incision. Holes were drilled in
coordinates 3 mm caudal and 2 mm lateral relative to bregma.
Stainless steel screws were fixed to the holes. After placing a
wireless transmitter (Data Science International, St. Paul, Minn.)
with in a pocket formed subcutaneously in the dorsal aspect of the
body, the electrodes were connected to the screws and isolated with
bone cement. Before termination of anesthesia, buprenorphine was
administered (i.p., 0.05 mg/kg). Following recovery, animals were
moved to a behavior room with 12 hr light/dark cycle and had access
to food and water ad libitum. After 4 days of habituation we began
continuous ECoG recording, using a home-made MatLab-based program
that allows reliable unbiased detection of seizures (Bar-Klein et
al. 2014). The results were revised manually and blindly. ECoG
spikes were implemented via the wavelet transform (WT) algorithm
(74) following a band-pass filtration of the ECoG signal between
1-45 Hz. After automated detection and clustering using the MatLab
program, blind human revision was performed to reassure the
results.
[0082] Pentylenetetrazol-Induced Seizures
[0083] Animals were placed individually in Plexiglas boxes and
seizure behavior was observed for 30 min following PTZ injection
(50 mg/kg, s.c.). Seizures intensity was evaluated (as in 75).
Parallel ECoG recording was analyzed as mentioned above.
[0084] RNA samples collection for RT-qPCR and sequencing-compatible
libraries
[0085] Mice were anesthetized with isoflurane prior to cervical
dislocation and their brain regions including frontal cortices were
dissected and collected in liquid nitrogen. For RNA-sequencing, RNA
was extracted by miRNeasy kit (QIAGEN), RNA quality determined with
6000-Nano Bioanalyzer (Agilent, Santa Clara, Calif.), and samples
with RIN values ranged between 8 and 8.9 were used. RNA was
extracted for qRT-PCR validation analysis using TRIzol.RTM. Reagent
(Invitrogen), as reported (see 76). cDNA and PCR as are in
supplementary methods.
[0086] High Throughput RNA Sequencing
[0087] Sequencing-compatible poly A-terminated single-end libraries
were generated using an RNA Library prep kit (NEBNext.RTM.
Multiplex, E7330S, New England Biolabs) following manufacturer's
instructions, with 12 amplification rounds. Libraries were barcoded
and sequenced on a NextSeq Series Sequencing System (The HUJ Center
for Genomic Technologies) using two Illumina chips (Illumina
500.RTM. NextSeq High Output v2 Kit, FC-404-2005, Illumina). Raw
cluster densities for samples ranged between 170-189 K/mm2. Reads
were aligned (90% mapping) to the mouse transcriptome (TopHat2,
77), and expression analysis was performed using the DeSeq (78)
software via R platform (79). Libraries from all tissues were
overall similar in depth, with a similar distribution of transcript
numbers per expression level and tag-wise normalized variance
predictably correlated to expression levels (Supplementary FIG.
S2A, B, C). A 6.2 log-CPM value for PPI thresholding represents
upper 10 percentiles of 18,570 genes in data.
[0088] Bioinformatics, Pathway Analysis and Luciferase Assays
[0089] Cell type marker genes (from 40) were selected as mouse
orthologues name-wise and their levels plotted as fold change,
p-value presented after Bonferroni correction and permutation
analysis used to determine significance per marker. Empirical
Cumulative Distribution Function (ECDF) plots were generated in R
via the stats package (79) after thresholding genes by counts (mean
log(CPM)>1) and sub-setting by significance of differential
expression. PANTHER (Protein ANalysis THrough Evolutionary
Relationships; 51) version 10, Gene Ontology version: 1.2,
annotated 22/6/2016, was used for Gene Ontology (GO) of
differentially expressed genes, for KEGG database (Kyoto
Encyclopedia of Genes and Genomes). See Supplementary methods for
details on luciferase assays and statistics analyses.
[0090] Human Derived Samples
[0091] Postmortem samples of entorhinal cortex from AD and
age-matched controls were obtained from The Netherlands Brain Bank
(NBB) at the Netherlands Institute for Neuroscience, Amsterdam (as
in 72). Samples were collected following a written informed consent
for a brain autopsy by the NBB.
[0092] qPCR
[0093] A qScript Kit (Quanta) was used for Reverse transcription.
Real-time-PCR performed on a CFX-96 machine (Bio-Rad), and
quantification performed using the .DELTA..DELTA.Ct method, with
snoRD47 as a loading control for miRs and .beta.-actin for long
transcripts.
[0094] Statistical Analyses
[0095] Differential expression in sequencing experiments was
derived from adjusted p values in DeSeq (78) on R platform, after
false discovery rate (FDR) correction. For specific genes
presented, fold change and ratio values are shown as mean.+-.SEM.
For cholinergic receptors, t-test was used on normalized count
data. For enrichment of cell type marker genes, p-value was defined
based on permutation analysis. Box and whisker plots show 2nd and
3rd quintiles for box, and 1.5 quantile distances from median for
whiskers, as by convention. Results were considered significant if
P<0.05, P<0.01, P<0.001 (one, two or three asterisks),
after correction for multiple testing when applicable. For ECoG
seizure and spike observations, Mann Whitney test was used.
EXAMPLES
Example 1: Intersecting Publically Available Data to Designate
Candidate miRs to be Used in the Attenuation of Seizure Phenotypes
OR to Model Seizures
[0096] Publically available datasets are deposited in databases
such as GEO. To indicate transcripts, and specifically, miRNAs
which are potent OR may be potent to attenuate OR model seizures
(such as for epilepsy) transcriptional features from publically
available datasets was intersected in a specific manner: namely, to
perform a non-biased search for neuronal miRs regulating synaptic
processes and responding to cholinergic seizure-related cues, we
intersected publicly available transcriptional profiles of miRs
regulating synaptic vesicle transcripts, transcripts
overrepresented in healthy forebrain immune precipitates of
neuronal Argonaut 2 (AGO-IP) and differentially expressed following
pilocarpine injection.
[0097] Three candidate miRs emerged: miR-211, miR-218 and miR-27a.
Intersecting these groups, may also be viewed as representing
predicting involvement in cholinergic-related epileptic seizures as
they include (1) rodent miRs whose levels modify following exposure
to the cholinergic facilitator pilocarpine (145 miRs); interact
with the RISC complex protein Ago2 in CamKIIa-expressing cells (83
miRs); and target synaptic vesicle transcripts (94 miRs).
Example 2: Pilocarpine Model Mice Show Prolonged Changes in miR-211
Flowing Exposure
[0098] Pilocarpine model mice are considered a classic experimental
model for examining seizures, specifically of temporal lobe
epilepsy seizures, and have been addressed also in the ART in the
context of the `transcriptional landscape` of gene expression. In
is considered established in the ART that this cholinergic
muscarinic receptor agonist pilocarpine when injected induces
Status epilepticus (SE) which is followed by its neuropathological
features, such as neuronal death, reactive gliosis, and remodeling
of synaptic circuitry. We noted by qRT-PCR-measurements that
mmu-miR-211 is reduced in hippocampal RNA 24 hrs following exposure
to pilocarpine. Brain derived samples from pilocarpine mice samples
were assayed for expression levels using qPCR after reverse
transcription, as is common in the ART, and the expression of
miR-211-5p in pilocarpine Vs controls samples was reduced post
injection.
Example 3
[0099] Human MiR-211, as well as it's in silico target, nicotinic
nAChR.alpha.7 and 5 other genes localize to a 15q13.3 chromosomal
region where heterozygote deletions entail cognitive impairments
with recurrent seizures. We noted that miR-211 (conserved in
mammals in being an intragenic miR) is located within the TRPM1
calcium channel gene, itself within the 15q13.3 locus where
heterozygote microdeletions (OMIM #612001) associate with mental
retardation and recurrent epileptic seizures. We note that
homozygous deletions associate with severe neurodevelopmental
problems including epileptic encephalopathy. We also observed that
in proximity to the TRPM1 gene and within the 15q13.3 locus is the
nicotinic receptor nAChR.alpha.7 a gain of function mutation in
which results in nicotine-induced seizures. Which was the bases for
further experiments.
Example 4
[0100] miR-target interaction analysis finds human miR-211 to
target the nicotinic receptor nAChR.alpha.7 in human-derived cells:
we followed up an in-silico interaction analysis, which we
performed and predicted the nAChR.alpha.7 to be a miR-targets for
human (has)-miR-211 targets via a 7-mer miR response element (MRE),
we performed an experimental assay/validation:
[0101] human miR-211 was expressed from an expression vector in
cultured human derived cells: namely HEK293 (human embryonic
kidney-) cells and directly downregulated a luciferase expression
construct containing the nAChR.alpha.7 3' UTR, further supporting
both the cholinergic roles of miR-211 in humans, and the
similarity, and tight functional homology, which was the basis of
our next experiments.
Example 5: Expression Cassette of miR-211 Using a Dox-Off
System
[0102] To explore the in-vivo impact of miR-211 decline on
cholinergic signaling and seizure susceptibility, we decided to
utilize a double transgenic "Tet-Off" system, where engineered mice
exclusively express miR-211 from the TRE-insertion in CamK-IIa
expressing cells (which are considered in the ART to preferably
represent expression in forebrain neurons) and only in the absence
of Dox: in order to allowing temporal follow-up of the effects of
introducing and removing over-expression. To these means we
1.sup.st generated a TRE vector for expressing the murine miR-211,
by cloning the pre-mmu-miR-211 sequence into a pTRE-tight
vector.
Example 6: pTRE-miR-211 Transgenic Mice
[0103] Transgenic founder mice with a genomic insertion for the
TRE-vector above generated by pronuclear injection.
[0104] Identification of positive founder lines was by
tissue-derived-sample based PCR. Two founder lines were maintained
for experiment. Founder lines had NO substantial phenotypes.
Example 7
[0105] DTg-211 mice carry the CamK2a promoter, followed by a
trans-activator (tTa) coding sequence and a pTRE-transgene inducing
Doxycycline-suppressible expression of mmu-miR-211 in forebrain
neurons and show MiR-211 over-expression in the forebrain but not
cerebellum--which was Dox-suppressible:
[0106] Progeny double-transgenic mice (dTg-211), (Of TRE-211 and
CamK2a tet line) showed over-expressed miR-211 in forebrain tissues
taken post mortem, but only in the absence of Doxycycline.
[0107] When administered with Dox in drinking water for 6-8 weeks,
dTg-211 mice exhibited normally low forebrain miR-211 expression
levels, indistinguishable from those in control mice In contrast,
Dox withdrawal induced miR-211 accumulation in their frontal
cortex, hippocampus and striatum, but not in the cerebellum,
essentially as reported for other CamK:Tet mouse lines.
Example 8: Transgenic Mice Expressing miR-211 Following a Neuronal
Glial Oligodendrocyte OR Endothelial Promoter
[0108] Transgenic mice expressing the pre-miR-211 (SEQ ID No. X) OR
miR-211-5p (SEQ ID No. Y) Can be generated by cloning these
sequences following a tissue cell-type specific promoters, such as
the CamKII, and as common in the ART. Moreover, using characterized
promoters for that are restricted for each specific brain cell type
(Neuronal, endothelial, oligodendrocytes OR astrocytes: see
Darmanis et al. 2015 and cell type analysis herein) would provide
expression which is substantially cell type-specific in the brain,
albeit require additional experimentation.
Example 9: Transgenic Mice Expressing miR-211 in a Dox-on
Manner
[0109] Transgenic mice expressing the miR-211 sing a Dox-on system
can be performed by a person of skill in the ART, choosing a Dox-on
mouse with brain expression from the publically available strains
(E.g. lists in The Jackson Laboratory). Crossing such mice would
avoid the need to feed animals with Dox prior to experiment, and
would allow the examination of overexpression of a miR-211 sequence
(by expressing a miR-211-5p (Seq ID No YY mouse) OR moR-211 as a
pre-miR, and as in seq ID No. XX mouse) OR a complementary
sequence, OR any sequence which includes the above sequences and
would undergo the biogenesis pathway of miRNAs in a mammalian
cell.
Example 10: DTg-211 Mice have Dox-Suppressible Expression in
Timescale of Days
[0110] When re-administered with Dox, adult (2-month-old) dTg-211
mice showed miR-211 decline to basal levels in the frontal cortex
within 4 days, supporting the applicability of these mice for
evaluating temporal attributes of miR-211 decreases in the
forebrain.
Example 11: Using the DTg-211 Mice with Dox-Suppressible Expression
as a Model System for Examining EEG-Measurable Seizures
[0111] In this experimental scheme: DTg-211 mice were administered
Dox before and after birth, preventing transgene overexpression
during development; and up to age that mice were weaned (3 to 4
weeks after birth). ECoG (EEG) recordings in dTg-211, but not
control mice assessing the synchronous neuronal cortical activity
after Dox-treatment--which is reminiscent of seizures, and parallel
to the decline in miR-211 levels.
Example 12: DTg-211 Mice Presented ECoG-Recorded Seizures
Exclusively after Dox Administration
[0112] To directly test if miR-211 decline affects cortical
neuronal hyper-excitability, we performed electrocorticography
(ECoG) measurements on the mice before and following Dox-mediated
miR-211 reduction: ECoG recordings were initiated and 4-6 days
after, Dox was re-administered, once again reducing the elevated
miR-211 levels. During the subsequent 6 days, ECoG recordings
demonstrated spontaneous non-convulsive seizures in six of eight
dTg-211 mice but in none of nine control CamK mice receiving
similar Dox treatment. Seizures mostly initiated by the 3.sup.rd or
4.sup.th day after Dox administration (FIG. 2F), parallel to the
decline in miR-211 overexpression. Identified seizures showed a
pattern of low frequency (.about.5 Hz) and sharp activity, without
observed motor convulsions.
Example 13: Forebrain miR-211 Suppression Exacerbates Long-Lasting
PTZ-Induced Convulsions
[0113] To further address how miR-211 may effect seizure
susceptibility we treated dTg-211 mice with Dox for 6 days, and
challenged them (and their matched controls) with the
seizure-provoking agent PTZ--5 days after Dox has been removed
(I.e. when the levels of cortical miR-211 are again elevated)
manual convulsions-index scores were elevated in dTg-211 mice,
compared to controls.
Example 14: Forebrain miR-211 Suppression Exacerbated Long-Lasting
PTZ-Induced Seizures
[0114] ECoG recording shows larger spikes/min counts, reflecting
seizure-susceptibility in PTZ-exposed dTg-211 mice compared to CamK
controls. Also parameters such as Number of seizures; Latency from
PTZ injection to 1' spike; and number of seizure-events by
Neuronal-networks analysis; as well as the latency to first seizure
were are suggestive to higher susceptibility and lower threshold
for seizures, in this state.
Example 15: Forebrain miR-211 Suppression Effects TGF-.beta.
Signaling which is Related to Seizures (Via TGFBR2)
[0115] Given the reported role of TGF.beta. signaling in
epileptogenesis, we next examined if the TGF.beta. pathway genes
which change following status epilepticus were modified in the
epilepsy-susceptible dTg-211 mice following Dox. Non-Dox-treated
frontal dTg-211 cortices showed two-fold lower TGFBR2 transcript
levels compared to controls, alongside .about.40% reduced TGFBR2
protein. This finding corresponded to the 3'-UTR of the murine
TGFBR2 gene showing seed sequence complementarity with the mature
mmu-miR-211, and an in-vitro (psi-check luciferase based) assay
showed direct downregulation of the murine TGFBR2 3'-UTR reporter
by mmu-miR-211, validating this miR-target link. Reciprocally,
administration of Dox induced a step-wise 4-fold increase in TGFBR2
mRNA within 4 days.
Example 13: RNA Sequencing from Frontal Cortex Samples of Dox
Treated/Untreated dTg-211 Mice and Controls to Address
Transcriptional Changes
[0116] To explore if TGFBR2 pathway genes are globally changed, we
turned to unbiased RNA-sequencing of dTg-211 cortical tissue RNAs
(without and with Dox suppression of miR-211 overexpression) as
compared to matched control tissues. The cDNA libraries showed
overall similar sequencing depth, reads distribution across
expression level and inter-related tag-wise normalized variance and
expression levels.
[0117] Comparing dTg-211 brains before and after 5 days of Dox
administration showed substantially higher numbers of
differentially expressed genes than comparing naive dTg-211 brains
to CamK-controls, suggesting that Dox-induced suppression of
miR-211 overexpression may entail an extensive physiological
change.
[0118] miR-211 target transcripts (as predicted in silico by the
TagretScan algorithm) showed significant albeit mild increases and
decreases following Dox administration. Such as to suggest that the
bulk of transcriptome changes induced by miR-211 perturbations
occurred in secondarily affected transcripts, and that the
transcriptional footprint of miR-211 reduction was greater than
that of its sustained over-expression.
Example 14: RNA Sequencing from dTg-211 with/without Dox and
Controls Finds Dox Specific Changes in TGFBR2 Related Genes
[0119] Numerous TGF.beta. pathway genes that were modified 12 hr
following status epilepticus (39) were also changed following Dox,
either by up- or down-regulation (FIG. 3O), including the Myc
Proto-Oncogene Protein (MyC), the Chordin (chrd) Inhibitor of DNA
Binding 2, HLH Protein (id2) and SMAD Family Members 1 and 9
(smad1, smad9), suggesting that the Dox-induced release of TGFBR2
from miR-211-mediated suppression impacted forebrain TGF-.beta.
signaling.
Example 15: RNA Sequencing from dTg-211 with/without Dox and
Controls Finds Dox Specific Changes in Cell-Type Marker Genes
[0120] Expressed genes characteristic of neurons, astrocytes,
oligodendrocytes and their progenitor cells (OPCs), microglia and
endothelial cells were described in Darmanis, et al. (2015) none of
the cell type marker groups showed changes in dTg-211 brains
compared to controls. However, comparing dTg-211 transcripts in
brains with and without Dox demonstrated that 19 of 21 endothelial
cell markers (and in contrast, none of the other cell type
gene-marker-groups) showed an increase following Dox administration
(P<0.05, P.sub.val by perturbation analysis, see Methods). Thus,
miR-211 reaction to Dox appeared to potentiate endothelial gene
expression, predicting functional relevance for neurovascular unit
activities.
Example 16: RNA Sequencing from dTg-211 with/without Dox and
Controls Finds Specific and Functionally Directional Expression
Changes in Cholinergic Genes
[0121] The excitatory muscarinic ACh receptor-5 (mAChR5) a positive
effector of cholinergic synaptic transmission was elevated by
4-fold. Likewise, the excitatory nAChR.alpha.-1 neuronal nicotinic
receptor and .alpha.-5 nicotinic receptor (Chrna5) the
stress-inducible muscarinic ml receptor and the ionotropic
.alpha.-7 nicotinic receptor (Chrna7), responsible for post- and
presynaptic excitation and blocker of inflammation, were all
elevated. In contrast, the metabotropic muscarinic ACh receptors-4
and -2 (mAChR4, mAChR2) were both two-fold reduced following Dox
administration. MAChR4 is located on both pre- and post-synaptic
sites in brain cholinergic synapses, and exerts inhibitory effects
on synaptic firing with a role in locomotion. Additionally, we
noted increases in butyrylcholinesterase (BChE) which hydrolyzes
ACh in the brain alongside AChE and is elevated in AD brains. In
contrast, we noted decrease of ATCAY/BNIP-H, an ataxia-related
brain-specific scaffold protein, which was recently found to
recruit Choline Acetyltransferase (ChAT) to neurite terminals, and
promote cholinergic signaling.
[0122] Of note: Dox-induced downregulation of cholinergic receptors
suppressing synaptic transmission: CHRM2 and CHRM4 (M2 and M4); and
upregulation of facilitators CHRM5 (M5), CHRNA5 and CHRNA7
(.alpha.5 and .alpha.7).
Example 16: MiR-134 Upregulation in dTg-211 Mice Following Dox
Administration Paralleled the Timeframe of Seizure Induction
[0123] dTg-211 mice--4 days following Dox administration presented
a 4-fold increases in the forebrain levels of miR-134 as compared
to CamK controls. miR-134 is known to be causally involved with the
induction of convulsive seizures. This timeframe parallels that of
miR-211 expression level changes and the seizure induction in this
model, as described above.
Example 17
[0124] In a second mouse model--mice overexpressing the
non-synaptic cholinergic enzyme AChE-R: the higher propensity and
shorter latency to SE following Pilocarpine injection, was evident
alongside miR-211 reduction and miR-134 elevation.
[0125] To address the set of phenomena we noted in miR-211
expressing mice we decided to examine a second mouse model we and
others have developed in the past: which may provide a wider base
to our conclusions regarding the functions of miR-211; AND concord
with hypothesis regarding the role of extra-synaptic cholinergic
imbalance and feedback affect on miR-211 expression and the risk of
epilepsy.
[0126] This second transgenic mice model comprises mice
transgenically expressing the AChE-R (TgR) this enzyme is the
soluble, non-synaptic stress-induced splice variant of AChE. Also,
in this transgenic model the 3'-untranslated region (UTR) which
contains the miR regulatory element (MRE) had been deleted Of note,
is has been shown that TgR mice, which constitutively overexpress
AChE-R (that catalyzes ACh breakdown in extra-synaptic sites) show
chronic stress behaviors, are hyper-sensitized to nicotine
administration.
[0127] We noted that these mice experienced higher susceptibility
to seizures, manifested as larger fraction of mice presenting full
status epilepticus after pilocarpine injection.
[0128] This was accompanied by shorter latency until status
epilepticus was observed, reduced miR-211 expression in the
hippocampus and frontal cortex compared to controls, and
overexpression of miR-134 in the prefrontal cortex and hippocampus.
Thus, modified cholinergic regulation in TgR mice elevated both
forebrain miR-211 and miR-134 levels and exacerbated susceptibility
to epileptic seizures.
Example 18: Memory Phenotypes in miR-211 Expressing Mice and
Hsa-miR-211 Overexpression in Brains of AD Patient
[0129] In the MWM dTg-211 mice shows reduced learning ability, as
assessed by time to reach platform, in the 1st and 2nd training
days (dTg-211 mice V.s controls). In addition when assessing search
strategy scores--Fewer trials of dTg-211 mice in the last days
showed focal or directed strategy. Loss of preference of the
platform quadrant, is considered to be reflecting an impaired
reference memory for dTg-211 compared to CamK mice in probe
trials.
[0130] We find these observation to concord with the higher miR-211
levels (.about.2-fold) we noted in post-mortem Alzheimer's
entorhinal cortices compared to non-demented controls (n=7 each,
Netherland Brain bank) p<0.05, Student's t-test.
Example 18: Intracranial Injection of a pTRE-miR-211 Vector to a
CamKII Transgenic Mouse to Induce Local miR-211 Modification by
Administering Dox
[0131] To examine local effects of miR-211 overexpression and
subsequent reduction the pTRE-211 plasmid including SEQ ID No. 3
(mmu-pre-miR-211) is performed by methods known in the ART.
Concentrations of vectors and solutions for such an injections are
standard in the ART (see Lowery, R. L., Majewska, A. K.
Intracranial Injection of Adeno-associated Viral Vectors. J. Vis.
Exp. (45), e2140, doi:10.3791/2140 (2010).
Example 19: Intracranial Injection of a miR-211 LNA Mimetic to
Examine for Protection Against Seizures and Change in Seizure
Threshold
[0132] To examine local effects of miR-211 increase an Intracranial
Injection of a miR-211 LNA mimetic is performed by methods known in
the ART. Concentrations of LNA and solutions for such an injections
are standard in the ART (Ernesto Caballero-Garrido et al., Journal
of Neuroscience, 2015).
Example 20: Intracranial Injection of a miR-211 LNA Sponge to
Induce a Reduction in Susceptibility to Seizures
[0133] To examine local effects of miR-211 decrease an intracranial
injection of a miR-211 LNA sponge is performed by methods known in
the ART. (Ernesto Caballero-Garrido et al., Journal of
Neuroscience, 2015).
Example 21: Systemic Injection of a miR-211 LNA Mimetic to Examine
for Protection Against Seizures in a Blood Brain-Barrier
Compromised Animal
[0134] To the potency of miR-211 by systemic injection to a TBI
model animal specifically a blood brain-barrier compromised
animal--systematic injection of a miR-211 LNA mimetic is performed.
Systemic injection and blood brain-barrier compromised animal
models are known in the ART in detail.
Sequence CWU 1
1
6122RNAArtificial SequencemiRNA 1uucccuuugu cauccuuugc cu
22222RNAArtificial SequencemiRNA 2uucccuuugu cauccuucgc cu
223106RNAArtificial SequencemiRNA 3gugcuuggac cugugaccug ug
22ggcuucccuu ugucauccuu ugc 45cuaggccucu gagugaggca ag 67gacagcaaag
gggggcucag ug 89gucaccucua cugcaga 1064110RNAArtificial
SequencemiRNA 4ucaccuggcc augugacuug ug 22ggcuucccuu ugucauccuu cgc
45cuagggcucu gagcagggca gg 67gacagcaaaggggugcucaguu
89gucacuucccacagcacggag 110521RNAArtificial SequencemiRNA
5gcaaggacag caaagggggg c 21621RNAArtificial SequencemiRNA
6gcagggacag caaaggggug c 21
* * * * *