U.S. patent application number 17/474899 was filed with the patent office on 2022-03-24 for methods of detecting analytes.
This patent application is currently assigned to Spatial Transcriptomics AB. The applicant listed for this patent is Spatial Transcriptomics AB. Invention is credited to Jonas Frisen, Joakim Lundeberg, Patrik Stahl.
Application Number | 20220090058 17/474899 |
Document ID | / |
Family ID | 1000005946695 |
Filed Date | 2022-03-24 |
United States Patent
Application |
20220090058 |
Kind Code |
A1 |
Frisen; Jonas ; et
al. |
March 24, 2022 |
Methods of Detecting Analytes
Abstract
Localized detection of RNA in a tissue sample that includes
cells is accomplished on an array. The array include a number of
features on a substrate. Each feature includes a different capture
probe immobilized such that the capture probe has a free 3' end.
Each feature occupies a distinct position on the array and has an
area of less than about 1 mm.sup.2. Each capture probe is a nucleic
acid molecule, which includes a positional domain including a
nucleotide sequence unique to a particular feature, and a capture
domain including a nucleotide sequence complementary to the RNA to
be detected. The capture domain can be at a position 3' of the
positional domain.
Inventors: |
Frisen; Jonas; (Stockholm,
SE) ; Stahl; Patrik; (Stockholm, SE) ;
Lundeberg; Joakim; (Lidingo, SE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Spatial Transcriptomics AB |
Stockholm |
|
SE |
|
|
Assignee: |
Spatial Transcriptomics AB
Stockholm
SE
|
Family ID: |
1000005946695 |
Appl. No.: |
17/474899 |
Filed: |
September 14, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16013654 |
Jun 20, 2018 |
|
|
|
17474899 |
|
|
|
|
14111482 |
Oct 11, 2013 |
10030261 |
|
|
PCT/EP2012/056823 |
Apr 13, 2012 |
|
|
|
16013654 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 15/1065
20130101 |
International
Class: |
C12N 15/10 20060101
C12N015/10 |
Foreign Application Data
Date |
Code |
Application Number |
Apr 13, 2011 |
GB |
1106254.4 |
Claims
1-24. (canceled)
25. A method for determining the location of nucleic acid in a
tissue section, the method comprising: (a) providing an array
comprising a plurality of features on a substrate, wherein a
feature of the plurality of features comprises a plurality of
capture probes immobilized thereon such that a capture probe of the
plurality of capture probes has a free 3' end, the feature
occupying a distinct position on the array, and the capture probe
comprising a nucleic acid molecule having the following domains
oriented 5' to 3': (i) a first sequence comprising a positional
domain comprising a sequence unique to the feature; and (ii) a
second sequence comprising a capture domain comprising a nucleotide
sequence complementary to at least a portion of the nucleic acid to
be detected; (b) placing the tissue section on the array such that
the tissue section covers the feature on the array; (c) hybridizing
the nucleic acid from the tissue section to the capture domain of
the capture probe, such that the nucleic acid is captured by the
capture domain; (d) generating a complementary DNA molecule by
extending the free 3' end of the capture probe using the captured
nucleic acid as a ligation template, such that the generated
complementary DNA molecule comprises a nucleotide sequence
complementary to the positional domain; (e) releasing the generated
complementary DNA molecule, or a portion thereof, or generating and
releasing a second strand complementary to the generated
complementary DNA molecule, or a portion thereof, from the feature
on the array, wherein the generated complementary DNA molecule, or
the portion thereof, comprises the nucleotide sequence of the
positional domain, or the second strand, or the portion thereof,
comprises a sequence complementary to the nucleotide sequence of
the positional domain; and (f) identifying the nucleotide sequence
of the positional domain present in the generated complementary DNA
molecule or a complement thereof, wherein the nucleotide sequence
of the positional domain, or the complement thereof, indicates that
the generated complementary DNA molecule was obtained from nucleic
acid in the tissue section at the distinct position where the
tissue section covered the feature, thereby determining the
location of the nucleic acid in the tissue section.
26. The method of claim 25, wherein step (e) comprises generating
and releasing the second strand, or the portion thereof, from the
feature on the array.
27. The method of claim 26, wherein the releasing of the second
strand, or the portion thereof, from the feature on the array is
performed by denaturation.
28. The method of claim 26, wherein the method further comprises a
step of amplifying the second strand, or the portion thereof,
released from the feature on the array.
29. The method of claim 25, wherein the method further comprises a
step of amplifying the generated complementary DNA molecule to
produce an amplified DNA molecule comprising the nucleotide
sequence of the positional domain, or the complement thereof.
30. The method of claim 29, wherein the step of amplifying the
generated complementary DNA molecule functions as the step of
releasing the generated complementary DNA molecule, or the portion
thereof, or the second strand, or the portion thereof, from the
feature on the array.
31. The method of claim 1, wherein each capture probe consists of a
nucleic acid molecule comprising the following domains oriented 5'
to 3': (i) a cleavage domain; (ii) the first sequence comprising
the positional domain; and (iii) the second sequence comprising the
capture domain, wherein the step of releasing the generated
complementary DNA molecule, or the portion thereof, or the second
strand, or the portion thereof, from the feature on the array
comprises cleaving the cleavage domain.
32. The method of claim 31, wherein the cleavage domain comprises a
sequence that is cleaved by a cleavage enzyme.
33. The method of claim 32, wherein the step of cleaving the
cleavage domain comprises using the cleavage enzyme that recognizes
a nucleotide sequence in the cleavage domain and cleaves the
generated complementary DNA molecule at a position that is 5' to
the positional domain, thereby releasing the generated
complementary DNA molecule, or the portion thereof, or the second
strand, or the portion thereof, from the feature on the array.
34. The method of claim 25, wherein the nucleic acid is RNA.
35. The method of claim 34, wherein the RNA is selected from the
list consisting of: mRNA, tRNA, rRNA, viral RNA, small nuclear RNA
(snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), small
interfering RNA (siRNA), piwi-interacting RNA (piRNA), ribozymal
RNA, antisense RNA, and non-coding RNA.
36. The method of claim 35, wherein the RNA is mRNA and the capture
domain is designed for the selective capture of mRNA.
37. The method of claim 36, wherein the capture domain that is
designed for the selective capture of mRNA hybridizes to the poly-A
tail of mRNA.
38. The method of claim 37, wherein the domain that is designed for
the selective capture of mRNA comprises a poly-T sequence.
39. The method of claim 25, wherein the nucleic acid is genomic
DNA.
40. The method of claim 25, wherein the capture domain comprises a
random hexamer sequence or a random octamer sequence.
41. The method of claim 1, wherein step (f) comprises sequencing
the generated complementary DNA molecule, or the portion thereof,
or the second strand or the portion thereof, released from the
feature on the array.
42. The method of claim 41, wherein the method further comprises:
imaging the tissue section after step (b); and correlating sequence
information obtained in step (f) with an image of the tissue
section.
43. The method of claim 42, wherein the imaging is one or more of:
light field, bright field, dark field, phase contrast, fluorescence
microscopy, reflection, interference, and confocal microscopy.
44. The method of claim 25, wherein the plurality of capture probes
are immobilized on the substrate by a chemical linker.
45. The method of claim 25, wherein the array is a bead array and
the plurality of capture probes are immobilized on beads of the
bead array.
46. The method of claim 25, wherein the method further comprises
staining the tissue section.
47. The method of claim 46, wherein the staining comprises
hematoxylin and eosin staining.
48. The method of claim 25, wherein the array comprises at least
1,000 features.
49. The method of claim 25, wherein the array comprises at least
50,000 features.
50. The method of claim 25, wherein the array comprises at least
100,000 features.
51. The method of claim 25, wherein the tissue section is a fixed
tissue section.
52. The method of 51, wherein the fixed tissue section is a
formalin-fixed paraffin-embedded tissue section.
53. The method of claim 25, wherein the capture probe comprises
deoxynucleotides, ribonucleotides, peptide nucleic acids, or
combinations thereof.
54. The method of claim 25, wherein the capture probe further
comprises an amplification domain positioned 5' to the positional
domain.
Description
SEQUENCE LISTING IN ELECTRONIC FORMAT
[0001] The present application is being filed along with an
Electronic Sequence Listing as an ASCII text file via EFS-Web. The
Electronic Sequence Listing is provided as a file entitled
DEHN53001C2SEQLIST.txt, created and last saved on Jul. 23, 2018,
which is 30,768 bytes in size. The information in the Electronic
Sequence Listing is incorporated herein by reference in its
entirety.
[0002] The present invention relates generally to the localized or
spatial detection of nucleic acid in a tissue sample. The nucleic
acid may be RNA or DNA. Thus, the present invention provides
methods for detecting and/or analysing RNA, e.g. RNA transcripts or
genomic DNA, so as to obtain spatial information about the
localisation, distribution or expression of genes, or indeed about
the localisation or distribution of any genomic variation (not
necessarily in a gene) in a tissue sample, for example in an
individual cell. The present invention thus enables spatial
genomics and spatial transcriptomics.
[0003] More particularly, the present invention relates to a method
for determining and/or analysing a transcriptome or genome and
especially the global transcriptome or genome, of a tissue sample.
In particular the method relates to a quantitative and/or
qualitative method for analysing the distribution, location or
expression of genomic sequences in a tissue sample wherein the
spatial expression or distribution or location pattern within the
tissue sample is retained. Thus, the new method provides a process
for performing "spatial transcriptomics" or "spatial genomics",
which enables the user to determine simultaneously the expression
pattern, or the location/distribution pattern of the genes
expressed or genes or genomic loci present in a tissue sample.
[0004] The invention is particularly based on array technology
coupled with high throughput DNA sequencing technologies, which
allows the nucleic acid molecule (e.g. RNA or DNA molecules) in the
tissue sample, particularly mRNA or DNA, to be captured and
labelled with a positional tag. This step is followed by synthesis
of DNA molecules which are sequenced and analysed to determine
which genes are expressed in any and all parts of the tissue
sample. Advantageously, the individual, separate and specific
transcriptome of each cell in the tissue sample may be obtained at
the same time. Hence, the methods of the invention may be said to
provide highly parallel comprehensive transcriptome signatures from
individual cells within a tissue sample without losing spatial
information within said investigated tissue sample. The invention
also provides an array for performing the method of the invention
and methods for making the arrays of the invention.
[0005] The human body comprises over 100 trillion cells and is
organized into more than 250 different organs and tissues. The
development and organization of complex organs, such as the brain,
are far from understood and there is a need to dissect the
expression of genes expressed in such tissues using quantitative
methods to investigate and determine the genes that control the
development and function of such tissues. The organs are in
themselves a mixture of differentiated cells that enable all bodily
functions, such as nutrient transport, defense etc. to be
coordinated and maintained. Consequently, cell function is
dependent on the position of the cell within a particular tissue
structure and the interactions it shares with other cells within
that tissue, both directly and indirectly. Hence, there is a need
to disentangle how these interactions influence each cell within a
tissue at the transcriptional level.
[0006] Recent findings by deep RNA sequencing have demonstrated
that a majority of the transcripts can be detected in a human cell
line and that a large fraction (75%) of the human protein-coding
genes are expressed in most tissues. Similarly, a detailed study of
1% of the human genome showed that chromosomes are ubiquitously
transcribed and that the majority of all bases are included in
primary transcripts. The transcription machinery can therefore be
described as promiscuous at a global level.
[0007] It is well-known that transcripts are merely a proxy for
protein abundance, because the rates of RNA translation,
degradation etc will influence the amount of protein produced from
any one transcript. In this respect, a recent antibody-based
analysis of human organs and tissues suggests that tissue
specificity is achieved by precise regulation of protein levels in
space and time, and that different tissues in the body acquire
their unique characteristics by controlling not which proteins are
expressed but how much of each is produced.
[0008] However, in subsequent global studies transcriptome and
proteome correlations have been compared demonstrating that the
majority of all genes were shown to be expressed. Interestingly,
there was shown to be a high correlation between changes in RNA and
protein levels for individual gene products which is indicative of
the biological usefulness of studying the transcriptome in
individual cells in the context of the functional role of
proteins.
[0009] Indeed, analysis of the histology and expression pattern in
tissues is a cornerstone in biomedical research and diagnostics.
Histology, utilizing different staining techniques, first
established the basic structural organization of healthy organs and
the changes that take place in common pathologies more than a
century ago. Developments in this field resulted in the possibility
of studying protein distribution by immunohistochemistry and gene
expression by in situ hybridization.
[0010] However, the parallel development of increasingly advanced
histological and gene expression techniques has resulted in the
separation of imaging and transcriptome analysis and, until the
methods of the present invention, there has not been any feasible
method available for global transcriptome analysis with spatial
resolution.
[0011] As an alternative, or in addition, to in situ techniques,
methods have developed for the in vitro analysis of proteins and
nucleic acids, i.e. by extracting molecules from whole tissue
samples, single cell types, or even single cells, and quantifying
specific molecules in said extracts, e.g. by ELISA, qPCR etc.
[0012] Recent developments in the analysis of gene expression have
resulted in the possibility of assessing the complete transcriptome
of tissues using microarrays or RNA sequencing, and such
developments have been instrumental in our understanding of
biological processes and for diagnostics. However, transcriptome
analysis typically is performed on mRNA extracted from whole
tissues (or even whole organisms), and methods for collecting
smaller tissue areas or individual cells for transcriptome analysis
are typically labour intensive, costly and have low precision.
[0013] Hence, the majority of gene expression studies based on
microarrays or next generation sequencing of RNA use a
representative sample containing many cells. Thus the results
represent the average expression levels of the investigated genes.
The separation of cells that are phenotypically different has been
used in some cases together with the global gene expression
platforms (Tang F et al, Nat Protoc, 2010; 5: 516-35; Wang D &
Bodovitz S, Trends Biotechnol. 2010; 28:281-90) and resulted in
very precise information about cell-to-cell variations. However,
high throughput methods to study transcriptional activity with high
resolution in intact tissues have not, until now, been
available.
[0014] Thus, existing techniques for the analysis of gene
expression patterns provide spatial transcriptional information
only for one or a handful of genes at a time or offer
transcriptional information for all of the genes in a sample at the
cost of losing positional information. Hence, it is evident that
methods to determine simultaneously, separately and specifically
the transcriptome of each cell in a sample are required, i.e. to
enable global gene expression analysis in tissue samples that
yields transcriptomic information with spatial resolution, and the
present invention addresses this need.
[0015] The novel approach of the methods and products of the
present invention utilizes now well established array and
sequencing technology to yield transcriptional information for all
of the genes in a sample, whilst retaining the positional
information for each transcript. It will be evident to the person
of skill in the art that this represents a milestone in the life
sciences. The new technology opens a new field of so-called
"spatial transcriptomics", which is likely to have profound
consequences for our understanding of tissue development and tissue
and cellular function in all multicellular organisms. It will be
apparent that such techniques will be particularly useful in our
understanding of the cause and progress of disease states and in
developing effective treatments for such diseases, e.g. cancer. The
methods of the invention will also find uses in the diagnosis of
numerous medical conditions.
[0016] Whilst initially conceived with the aim of transcriptome
analysis in mind, as described in detail below, the principles and
methods of the present invention may be applied also to the
analysis of DNA and hence for genomic analyses also ("spatial
genomics"). Accordingly, at its broadest the invention pertains to
the detection and/or analysis of nucleic acid in general.
[0017] Array technology, particularly microarrays, arose from
research at Stanford University where small amounts of DNA
oligonucleotides were successfully attached to a glass surface in
an ordered arrangement, a so-called "array", and used it to monitor
the transcription of 45 genes (Schena M et al, Science. 1995; 270:
368-9, 371).
[0018] Since then, researchers around the world have published more
than 30,000 papers using microarray technology. Multiple types of
microarray have been developed for various applications, e.g. to
detect single nucleotide polymorphisms (SNPs) or to genotype or
re-sequence mutant genomes, and an important use of microarray
technology has been for the investigation of gene expression.
Indeed, the gene expression microarray was created as a means to
analyze the level of expressed genetic material in a particular
sample, with the real gain being the possibility to compare
expression levels of many genes simultaneously. Several commercial
microarray platforms are available for these types of experiments
but it has also been possible to create custom made gene expression
arrays.
[0019] Whilst the use of microarrays in gene expression studies is
now commonplace, it is evident that new and more comprehensive
so-called "next-generation DNA sequencing" (NGS) technologies are
starting to replace DNA microarrays for many applications, e.g.
in-depth transcriptome analysis.
[0020] The development of NGS technologies for ultra-fast genome
sequencing represents a milestone in the life sciences (Patterson E
et al, Genomics. 2009; 93: 105-11). These new technologies have
dramatically decreased the cost of DNA sequencing and enabled the
determination of the genome of higher organisms at an unprecedented
rate, including those of specific individuals (Wade C M et al
Science. 2009; 326: 865-7; Rubin J et al, Nature 2010; 464:
587-91). The new advances in high-throughput genomics have reshaped
the biological research landscape and in addition to complete
characterization of genomes it is possible also to study the full
transcriptome in a digital and quantitative fashion. The
bioinformatics tools to visualize and integrate these comprehensive
sets of data have also been significantly improved during recent
years.
[0021] However, it has surprisingly been found that a unique
combination of histological, microarray and NGS techniques can
yield comprehensive transcriptional or genomic information from
multiple cells in a tissue sample which information is
characterised by a two-dimensional spatial resolution. Thus, at one
extreme the methods of the present invention can be used to analyse
the expression of a single gene in a single cell in a sample,
whilst retaining the cell within its context in the tissue sample.
At the other extreme, and in a preferred aspect of the invention,
the methods can be used to determine the expression of every gene
in each and every cell, or substantially all cells, in a sample
simultaneously, i.e, the global spatial expression pattern of a
tissue sample. It will be apparent that the methods of the
invention also enable intermediate analyses to be performed.
[0022] In its simplest form, the invention may be illustrated by
the following summary. The invention requires reverse transcription
(RT) primers, which comprise also unique positional tags (domains),
to be arrayed on an object substrate, e.g. a glass slide, to
generate an "array". The unique positional tags correspond to the
location of the RT primers on the array (the features of the
array), Thin tissue sections are placed onto the array and a
reverse transcription reaction is performed in the tissue section
on the object slide. The RT primers, to which the RNA in the tissue
sample binds (or hybridizes), are extended using the bound RNA as a
template to obtain cDNA, which is therefore bound to the surface of
the array. As consequence of the unique positional tags in the RT
primers, each cDNA strand carries information about the position of
the template RNA in the tissue section. The tissue section may be
visualised or imaged, e.g. stained and photographed, before or
after the cDNA synthesis step to enable the positional tag in the
cDNA molecule to be correlated with a position within the tissue
sample. The cDNA is sequenced, which results in a transcriptome
with exact positional information. A schematic of the process is
shown in FIG. 1. The sequence data can then be matched to a
position in the tissue sample, which enables the visualization,
e.g. using a computer, of the sequence data together with the
tissue section, for instance to display the expression pattern of
any gene of interest across the tissue (FIG. 2). Similarly, it
would be possible to mark different areas of the tissue section on
the computer screen and obtain information on differentially
expressed genes between any selected areas of interest. It will be
evident that the methods of the invention result in data that is in
stark contrast to the data obtained using current methods to study
mRNA populations. For example, methods based on in situ
hybridization provide only relative information of single mRNA
transcripts. Thus, the methods of the present invention have clear
advantages over current in situ technologies. The global gene
expression information obtainable from the methods of the invention
also allows co-expression information and quantitative estimates of
transcript abundance. It will be evident that this is a generally
applicable strategy available for the analysis of any tissue in any
species, e.g. animal, plant, fungus.
[0023] As noted above, and described in more detail below, it will
be evident that this basic methodology could readily be extended to
the analysis of genomic DNA, e.g. to identify cells within a tissue
sample that comprise one or more specific mutations. For instance,
the genomic DNA may be fragmented and allowed to hybridise to
primers (equivalent to the RT primers described above), which are
capable of capturing the fragmented DNA (e.g., an adapter with a
sequence that is complementary to the primer may be ligated to the
fragmented DNA or the fragmented DNA may be extended e.g. using an
enzyme to incorporate additional nucleotides at the end of the
sequence, e.g. a poly-A tail, to generate a sequence that is
complementary to the primer) and priming the synthesis of
complementary strands to the capture molecules. The remaining steps
of the analysis may be as described above. Hence, the specific
embodiments of the invention described below in the context of
transcriptome analysis may also be employed in methods of analysing
genomic DNA, where appropriate.
[0024] It will be seen from the above explanation that there is an
immense value in coupling positional information to transcriptome
or genome information. For instance, it enables global gene
expression mapping at high resolution, which will find utility in
numerous applications, including e.g. cancer research and
diagnostics.
[0025] Furthermore, it is evident that the methods described herein
differ significantly from the previously described methods for
analysis of the global transcriptome of a tissue sample and these
differences result in numerous advantages. The present invention is
predicated on the surprising discovery that the use of tissue
sections does not interfere with synthesis of DNA (e.g. cDNA)
primed by primers (e.g. reverse transcription primers) that are
coupled to the surface of an array.
[0026] Thus, in its first and broadest aspect, the present
invention provides a method for localized detection of nucleic acid
in a tissue sample comprising:
[0027] (a) providing an array comprising a substrate on which
multiple species of capture probes are directly or indirectly
immobilized such that each species occupies a distinct position on
the array and is oriented to have a free 3' end to enable said
probe to function as a primer for a primer extension or ligation
reaction, wherein each species of said capture probe comprises a
nucleic acid molecule with 5' to 3':
[0028] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0029] (ii) a capture domain;
[0030] (b) contacting said array with a tissue sample such that the
position of a capture probe on the array may be correlated with a
position in the tissue sample and allowing nucleic acid of the
tissue sample to hybridise to the capture domain in said capture
probes;
[0031] (c) generating DNA molecules from the captured nucleic acid
molecules using said capture probes as extension or ligation
primers, wherein said extended or ligated DNA molecules are tagged
by virtue of the positional domain;
[0032] (d) optionally generating a complementary strand of said
tagged DNA and/or optionally amplifying said tagged DNA;
[0033] (e) releasing at least part of the tagged DNA molecules
and/or their complements or amplicons from the surface of the
array, wherein said part includes the positional domain or a
complement thereof;
[0034] (f) directly or indirectly analysing the sequence of the
released DNA molecules.
[0035] The methods of the invention represent a significant advance
over other methods for spatial transcriptomics known in the art.
For example the methods described herein result in a global and
spatial profile of all transcripts in the tissue sample. Moreover,
the expression of every gene can be quantified for each position or
feature on the array, which enables a multiplicity of analyses to
be performed based on data from a single assay. Thus, the methods
of the present invention make it possible to detect and/or quantify
the spatial expression of all genes in single tissue sample.
Moreover, as the abundance of the transcripts is not visualised
directly, e.g. by fluorescence, akin to a standard microarray, it
is possible to measure the expression of genes in a single sample
simultaneously even wherein said transcripts are present at vastly
different concentrations in the same sample.
[0036] Accordingly, in a second and more particular aspect, the
present invention can be seen to provide a method for determining
and/or analysing a transcriptome of a tissue sample comprising:
[0037] (a) providing an array comprising a substrate on which
multiple species of capture probes are directly or indirectly
immobilized such that each species occupies a distinct position on
the array and is oriented to have a free 3' end to enable said
probe to function as a reverse transcriptase (RT) primer, wherein
each species of said capture probe comprises a nucleic acid
molecule with 5' to 3':
[0038] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0039] (ii) a capture domain;
[0040] (b) contacting said array with a tissue sample such that the
position of a capture probe on the array may be correlated with a
position in the tissue sample and allowing RNA of the tissue sample
to hybridise to the capture domain in said capture probes;
[0041] (c) generating cDNA molecules from the captured RNA
molecules using said capture probes as RT primers, and optionally
amplifying said cDNA molecules;
[0042] (d) releasing at least part of the cDNA molecules and/or
optionally their amplicons from the surface of the array, wherein
said released molecule may be a first strand and/or second strand
cDNA molecule or an amplicon thereof and wherein said part includes
the positional domain or a complement thereof;
[0043] (e) directly or indirectly analysing the sequence of the
released molecules.
[0044] As described in more detail below, any method of nucleic
acid analysis may be used in the analysis step. Typically this may
involve sequencing, but it is not necessary to perform an actual
sequence determination. For example sequence-specific methods of
analysis may be used. For example a sequence-specific amplification
reaction may be performed, for example using primers which are
specific for the positional domain and/or for a specific target
sequence, e.g., a particular target DNA to be detected (i.e.,
corresponding to a particular cDNA/RNA or gene eta). An exemplary
analysis method is a sequence-specific PCR reaction.
[0045] The sequence analysis information obtained in step (e) may
be used to obtain spatial information as to the RNA in the sample.
In other words the sequence analysis information may provide
information as to the location of the RNA in the sample. This
spatial information may be derived from the nature of the sequence
analysis information determined, for example it may reveal the
presence of a particular RNA which may itself be spatially
informative in the context of the tissue sample used, and/or the
spatial information (e.g. spatial localisation) may be derived from
the position of the tissue sample on the array, coupled with the
sequencing information. Thus, the method may involve simply
correlating the sequence analysis information to a position in the
tissue sample e.g. by virtue of the positional tag and its
correlation to a position in the tissue sample. However, as
described above, spatial information may conveniently be obtained
by correlating the sequence analysis data to an image of the tissue
sample and this represents one preferred embodiment of the
invention. Accordingly, in a preferred embodiment the method also
includes a step of:
[0046] (f) correlating said sequence analysis information with an
image of said tissue sample, wherein the tissue sample is imaged
before or after step (c).
[0047] In its broadest sense, the method of the invention may be
used for localized detection of a nucleic acid in a tissue sample.
Thus, in one embodiment, the method of the invention may be used
for determining and/or analysing all of the transcriptome or genome
of a tissue sample e.g. the global transcriptome of a tissue
sample. However, the method is not limited to this and encompasses
determining and/or analysing all or part of the transcriptome or
genome. Thus, the method may involve determining and/or analysing a
part or subset of the transcriptome or genome, e.g. a transcriptome
corresponding to a subset of genes, e.g. a set of particular genes,
for example related to a particular disease or condition, tissue
type etc.
[0048] Viewed from another aspect, the method steps set out above
can be seen as providing a method of obtaining a spatially defined
transcriptome or genome, and in particular the spatially defined
global transcriptome or genome, of a tissue sample.
[0049] Alternatively viewed, the method of the invention may be
seen as a method for localized or spatial detection of nucleic
acid, whether DNA or RNA in a tissue sample, or for localized or
spatial determination and/or analysis of nucleic acid (DNA or RNA)
in a tissue sample. In particular, the method may be used for the
localized or spatial detection or determination and/or analysis of
gene expression or genomic variation in a tissue sample. The
localized/spatial detection/determination/analysis means that the
RNA or DNA may be localized to its native position or location
within a cell or tissue in the tissue sample. Thus for example, the
RNA or DNA may be localized to a cell or group of cells, or type of
cells in the sample, or to particular regions of areas within a
tissue sample. The native location or position of the RNA or DNA
(or in other words, the location or position of the RNA or DNA in
the tissue sample), e.g. an expressed gene or genomic locus, may be
determined.
[0050] The invention can also be seen to provide an array for use
in the methods of the invention comprising a substrate on which
multiple species of capture probes are directly or indirectly
immobilized such that each species occupies a distinct position on
the array and is oriented to have a free 3' end to enable said
probe to function as a reverse transcriptase (RT) primer, wherein
each species of said capture probe comprises a nucleic acid
molecule with 5' to 3':
[0051] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0052] (ii) a capture domain to capture RNA of a tissue sample that
is contacted with said array.
[0053] In a related aspect, the present invention also provides use
of an array, comprising a substrate on which multiple species of
capture probe are directly or indirectly immobilized such that each
species occupies a distinct position on the array and is oriented
to have a free 3' end to enable said probe to function as a reverse
transcriptase (RT) primer, wherein each species of said capture
probe comprises a nucleic acid molecule with 5' to 3':
[0054] (i) a positional domain that corresponds to the position of
the capture probe on the array; and
[0055] (ii) a capture domain;
[0056] to capture RNA of a tissue sample that is contacted with
said array.
[0057] Preferably, said use is for determining and/or analysing a
transcriptome and in particular the global transcriptome, of a
tissue sample and further comprises steps of:
[0058] (a) generating cDNA molecules from the captured RNA
molecules using said capture probes as RT primers and optionally
amplifying said cDNA molecules;
[0059] (b) releasing at least part of the cDNA molecules and/or
optionally their amplicons from the surface of the array, wherein
said released molecule may be a first strand and/or second strand
cDNA molecule or an amplicon thereof and wherein said part includes
the positional domain or a complement thereof;
[0060] (c) directly or indirectly analysing the sequence of the
released molecules; and optionally
[0061] (d) correlating said sequence analysis information with an
image of said tissue sample, wherein the tissue sample is imaged
before or after step (a).
[0062] It will be seen therefore that the array of the present
invention may be used to capture RNA, e.g. mRNA of a tissue sample
that is contacted with said array. The array may also be used for
determining and/or analysing a partial or global transcriptome of a
tissue sample or for obtaining a spatially defined partial or
global transcriptome of a tissue sample. The methods of the
invention may thus be considered as methods of quantifying the
spatial expression of one or more genes in a tissue sample.
Expressed another way, the methods of the present invention may be
used to detect the spatial expression of one or more genes in a
tissue sample. In yet another way, the methods of the present
invention may be used to determine simultaneously the expression of
one or more genes at one or more positions within a tissue sample.
Still further, the methods may be seen as methods for partial or
global transcriptome analysis of a tissue sample with
two-dimensional spatial resolution.
[0063] The RNA may be any RNA molecule which may occur in a cell.
Thus it may be mRNA, tRNA, rRNA, viral RNA, small nuclear RNA
(snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), small
interfering RNA (siRNA), piwi-interacting RNA (piRNA), ribozymal
RNA, antisense RNA or non-coding RNA. Preferably however it is
mRNA.
[0064] Step (c) in the method above (corresponding to step (a) in
the preferred statement of use set out above) of generating cDNA
from the captured RNA will be seen as relating to the synthesis of
the cDNA. This will involve a step of reverse transcription of the
captured RNA, extending the capture probe, which functions as the
RT primer, using the captured RNA as template. Such a step
generates so-called first strand cDNA. As will be described in more
detail below, second strand cDNA synthesis may optionally take
place on the array, or it may take place in a separate step, after
release of first strand cDNA from the array. As also described in
more detail below, in certain embodiments second strand synthesis
may occur in the first step of amplification of a released first
strand cDNA molecule.
[0065] Arrays for use in the context of nucleic acid analysis in
general, and DNA analysis in particular, are discussed and
described below. Specific details and embodiments described herein
in relation to arrays and capture probes for use in the context of
RNA, apply equally (where appropriate) to all such arrays,
including those for use with DNA.
[0066] As used herein the term "multiple" means two or more, or at
least two, e.g. 3, 5, 10, 15, 20, 80, 40, 50, 60, 70, 80, 90, 100,
150, 200, 400, 500, 1000, 2000, 5000, 10,000, or more etc. Thus for
example, the number of capture probes may be any integer in any
range between any two of the aforementioned numbers. It will be
appreciated however that it is envisaged that conventional-type
arrays with many hundreds, thousands, tens of thousands, hundreds
of thousands or even millions of capture probes may be used.
[0067] Thus, the methods outlined herein utilise high density
nucleic acid arrays comprising "capture probes" for capturing and
labelling transcripts from all of the single cells within a tissue
sample e.g. a thin tissue sample slice, or "section". The tissue
samples or sections for analysis are produced in a highly
parallelized fashion, such that the spatial information in the
section is retained. The captured RNA (preferably mRNA) molecules
for each cell, or "transcriptomes", are transcribed into cDNA and
the resultant cDNA molecules are analyzed, for example by high
throughput sequencing. The resultant data may be correlated to
images of the original tissue samples e.g. sections through
so-called barcode sequences (or ID tags, defined herein as
positional domains) incorporated into the arrayed nucleic acid
probes.
[0068] High density nucleic acid arrays or microarrays are a core
component of the spatial transcriptome labelling method described
herein. A microarray is a multiplex technology used in molecular
biology. A typical microarray consists of an arrayed series of
microscopic spots of oligonucleotides (hundreds of thousands of
spots, generally tens of thousands, can be incorporated on a single
array), The distinct position of each nucleic acid
(oligonucleotide) spot (each species of oligonucleotide/nucleic
acid molecule) is known as a "feature" (and hence in the methods
set out above each species of capture probe may be viewed as a
specific feature of the array; each feature occupies a distinct
position on the array), and typically each separate feature
contains in the region of picomoles (10.sup.-'.sup.2 moles) of a
specific DNA sequence (a "species"), which are known as "probes"
(or "reporters"). Typically, these can be a short section of a gene
or other nucleic acid element to which a cDNA or cRNA sample (or
"target") can hybridize under high-stringency hybridization
conditions. However, as described below, the probes of the present
invention differ from the probes of standard microarrays.
[0069] In gene expression microarrays, probe-target hybridization
is usually detected and quantified by detection of visual signal,
e.g. a fluorophore, silver ion, or chemiluminescence-label, which
has been incorporated into all of the targets. The intensity of the
visual signal correlates to the relative abundance of each target
nucleic acid in the sample. Since an array can contain tens of
thousands of probes, a microarray experiment can accomplish many
genetic tests in parallel.
[0070] In standard microarrays, the probes are attached to a solid
surface or substrate by a covalent bond to a chemical matrix, e.g.
epoxy-silane, amino-silane, lysine, polyacrylamide etc. The
substrate typically is a glass, plastic or silicon chip or slide,
although other microarray platforms are known, e.g. microscopic
beads.
[0071] The probes may be attached to the array of the invention by
any suitable means. In a preferred embodiment the probes are
immobilized to the substrate of the array by chemical
immobilization. This may be an interaction between the substrate
(support material) and the probe based on a chemical reaction. Such
a chemical reaction typically does not rely on the input of energy
via heat or light, but can be enhanced by either applying heat,
e.g. a certain optimal temperature for a chemical reaction, or
light of certain wavelength. For example, a chemical immobilization
may take place between functional groups on the substrate and
corresponding functional elements on the probes. Such corresponding
functional elements in the probes may either be an inherent
chemical group of the probe, e.g. a hydroxyl group or be
additionally introduced. An example of such a functional group is
an amine group. Typically, the probe to be immobilized comprises a
functional amine group or is chemically modified in order to
comprise a functional amine group. Means and methods for such a
chemical modification are well known.
[0072] The localization of said functional group within the probe
to be immobilized may be used in order to control and shape the
binding behaviour and/or orientation of the probe, e.g. the
functional group may be placed at the 5' or 3' end of the probe or
within sequence of the probe. A typical substrate for a probe to be
immobilized comprises moieties which are capable of binding to such
probes, e.g. to amine-functionalized nucleic acids. Examples of
such substrates are carboxy, aldehyde or epoxy substrates. Such
materials are known to the person skilled in the art. Functional
groups, which impart a connecting reaction between probes which are
chemically reactive by the introduction of an amine group, and
array substrates are known to the person skilled in the art.
[0073] Alternative substrates on which probes may be immobilized
may have to be chemically activated, e.g. by the activation of
functional groups, available on the array substrate. The term
"activated substrate" relates to a material in which interacting or
reactive chemical functional groups were established or enabled by
chemical modification procedures as known to the person skilled in
the art. For example, a substrate comprising carboxyl groups has to
be activated before use. Furthermore, there are substrates
available that contain functional groups that can react with
specific moieties already present in the nucleic acid probes.
[0074] Alternatively, the probes may be synthesized directly on the
substrate. Suitable methods for such an approach are known to the
person skilled in the art. Examples are manufacture techniques
developed by Agilent Inc., Affymetrix Inc., Roche Nimblegen Inc. or
Flexgen BV. Typically, lasers and a set of mirrors that
specifically activate the spots where nucleotide additions are to
take place are used. Such an approach may provide, for example,
spot sizes (i.e. features) of around 30 .mu.m or larger.
[0075] The substrate therefore may be any suitable substrate known
to the person skilled in the art. The substrate may have any
suitable form or format, e.g. it may be flat, curved, e.g. convexly
or concavely curved towards the area where the interaction between
the tissue sample and the substrate takes place. Particularly
preferred is the where the substrate is a flat, i.e. planar, chip
or slide.
[0076] Typically, the substrate is a solid support and thereby
allows for an accurate and traceable positioning of the probes on
the substrate. An example of a substrate is a solid material or a
substrate comprising functional chemical groups, e.g. amine groups
or amine-functionalized groups. A substrate envisaged by the
present invention is a non-porous substrate. Preferred non-porous
substrates are glass, silicon, poly-L-lysine coated material,
nitrocellulose, polystyrene, cyclic olefin copolymers (COCs),
cyclic olefin polymers (COPS), polypropylene, polyethylene and
polycarbonate.
[0077] Any suitable material known to the person skilled in the art
may be used. Typically, glass or polystyrene is used. Polystyrene
is a hydrophobic material suitable for binding negatively charged
macromolecules because it normally contains few hydrophilic groups.
For nucleic acids immobilized on glass slides, it is furthermore
known that by increasing the hydrophobicity of the glass surface
the nucleic acid immobilization may be increased. Such an
enhancement may permit a relatively more densely packed formation.
In addition to a coating or surface treatment with poly-L-lysine,
the substrate, in particular glass, may be treated by silanation,
e.g. with epoxy-silane or amino-silane or by silynation or by a
treatment with polyacrylamide.
[0078] A number of standard arrays are commercially available and
both the number and size of the features may be varied. In the
present invention, the arrangement of the features may be altered
to correspond to the size and/or density of the cells present in
different tissues or organisms. For instance, animal cells
typically have a cross-section in the region of 1-100 .mu.m,
whereas the cross-section of plant cells typically may range from
1-10000 .mu.m. Hence, Nimblegen.RTM. arrays, which are available
with up to 2.1 million features, or 4.2 million features, and
feature sizes of 13 micrometers, may be preferred for tissue
samples from an animal or fungus, whereas other formats, e.g. with
8.times.130 k features, may be sufficient for plant tissue samples.
Commercial arrays are also available or known for use in the
context of sequence analysis and in particular in the context of
NGS technologies. Such arrays may also be used as the array surface
in the context of the present invention e.g. an Illumina bead
array. In addition to commercially available arrays, which can
themselves be customized, it is possible to make custom or
non-standard "in-house" arrays and methods for generating arrays
are well-established. The methods of the invention may utilise both
standard and non-standard arrays that comprise probes as defined
below.
[0079] The probes on a microarray may be immobilized, i.e. attached
or bound, to the array preferably via the 5' or 3' end, depending
on the chemical matrix of the array. Typically, for commercially
available arrays, the probes are attached via a 3' linkage, thereby
leaving a free 5' end. However, arrays comprising probes attached
to the substrate via a 5' linkage, thereby leaving a free 3' end,
are available and may be synthesized using standard techniques that
are well known in the art and are described elsewhere herein.
[0080] The covalent linkage used to couple a nucleic acid probe to
an array substrate may be viewed as both a direct and indirect
linkage, in that the although the probe is attached by a "direct"
covalent bond, there may be a chemical moiety or linker separating
the "first" nucleotide of the nucleic acid probe from the, e.g.
glass or silicon, substrate i.e. an indirect linkage. For the
purposes of the present invention probes that are immobilized to
the substrate by a covalent bond and/or chemical linker are
generally seen to be immobilized or attached directly to the
substrate.
[0081] As will be described in more detail below, the capture
probes of the invention may be immobilized on, or interact with,
the array directly or indirectly. Thus the capture probes need not
bind directly to the array, but may interact indirectly, for
example by binding to a molecule which itself binds directly or
indirectly to the array (e.g., the capture probe may interact with
(e.g., bind or hybridize to) a binding partner for the capture
probe, i.e. a surface probe, which is itself bound to the array
directly or indirectly). Generally speaking, however, the capture
probe will be, directly or indirectly (by one or more
intermediaries), bound to, or immobilized on, the array.
[0082] The use, method and array of the invention may comprise
probes that are immobilized via their 5' or 3' end. However, when
the capture probe is immobilized directly to the array substrate,
it may be immobilized only such that the 3' end of the capture
probe is free to be extended, e.g. it is immobilized by its 5' end.
The capture probe may be immobilized indirectly, such that it has a
free, i.e. extendible, 3' end.
[0083] By extended or extendible 3' end, it is meant that further
nucleotides may be added to the most 3' nucleotide of the nucleic
acid molecule, e.g. capture probe, to extend the length of the
nucleic acid molecule, i.e. the standard polymerization reaction
utilized to extend nucleic acid molecules, e.g. templated
polymerization catalyzed by a polymerase.
[0084] Thus, in one embodiment, the array comprises probes that are
immobilized directly via their 3' end, so-called surface probes,
which are defined below. Each species of surface probe comprises a
region of complementarity to each species of capture probe, such
that the capture probe may hybridize to the surface probe,
resulting in the capture probe comprising a free extendible 3' end.
In a preferred aspect of the invention, when the array comprises
surface probes, the capture probes are synthesized in situ on the
array.
[0085] The array probes may be made up of ribonucleotides and/or
deoxyribonucleotides as well as synthetic nucleotide residues that
are capable of participating in Watson-Crick type or analogous base
pair interactions. Thus, the nucleic acid domain may be DNA or RNA
or any modification thereof e.g. PNA or other derivatives
containing non-nucleotide backbones. However, in the context of
transcriptome analysis the capture domain of the capture probe must
capable of priming a reverse transcription reaction to generate
cDNA that is complementary to the captured RNA molecules. As
described below in more detail, in the context of genome analysis,
the capture domain of the capture probe must be capable of binding
to the DNA fragments, which may comprise binding to a binding
domain that has been added to the fragmented DNA. In some
embodiments, the capture domain of the capture probe may prime a
DNA extension (polymerase) reaction to generate DNA that is
complementary to the captured DNA molecules, In other embodiments,
the capture domain may template a ligation reaction between the
captured DNA molecules and a surface probe that is directly or
indirectly immobilised on the substrate. In yet other embodiments,
the capture domain may be ligated to one strand of the captured DNA
molecules.
[0086] In a preferred embodiment of the invention at least the
capture domain of the capture probe comprises or consists of
deoxyribonucleotides (dNTPs). In a particularly preferred
embodiment the whole of the capture probe comprises or consists of
deoxyribonucleotides.
[0087] In a preferred embodiment of the invention the capture
probes are immobilized on the substrate of the array directly, i.e.
by their 5' end, resulting in a free extendible 3' end.
[0088] The capture probes of the invention comprise at least two
domains, a capture domain and a positional domain (or a feature
identification tag or domain; the positional domain may
alternatively be defined as an identification (ID) domain or tag,
or as a positional tag). The capture probe may further comprise a
universal domain as defined further below. Where the capture probe
is indirectly attached to the array surface via hybridization to a
surface probe, the capture probe requires a sequence (e.g. a
portion or domain) which is complementary to the surface probe.
Such a complementary sequence may be complementary to a
positional/identification domain and/or a universal domain on the
surface probe. In other words the positional domain and/or
universal domain may constitute the region or portion of the probe
which is complementary to the surface probe. However, the capture
probe may also comprise an additional domain (or region, portion or
sequence) which is complementary to the surface probe. For ease of
synthesis, as described in more detail below, such a surface
probe-complementary region may be provided as part, or as an
extension of the capture domain (such a part or extension not
itself being used for, or capable of, binding to the target nucleic
acid, e.g. RNA).
[0089] The capture domain is typically located at the 3' end of the
capture probe and comprises a free 3' end that can be extended,
e.g. by template dependent polymerization. The capture domain
comprises a nucleotide sequence that is capable of hybridizing to
nucleic acid, e.g. RNA (preferably mRNA) present in the cells of
the tissue sample contact with the array.
[0090] Advantageously, the capture domain may be selected or
designed to bind (or put more generally may be capable of binding)
selectively or specifically to the particular nucleic acid, e.g.
RNA it is desired to detect or analyse. For example the capture
domain may be selected or designed for the selective capture of
mRNA. As is well known in the art, this may be on the basis of
hybridisation to the poly-A tail of mRNA. Thus, in a preferred
embodiment the capture domain comprises a poly-T DNA
oligonucleotide, i.e., a series of consecutive deoxythymidine
residues linked by phosphodiester bonds, which is capable of
hybridizing to the poly-A tail of mRNA. Alternatively, the capture
domain may comprise nucleotides which are functionally or
structurally analogous to poly-T i.e., are capable of binding
selectively to poly-A, for example a poly-U oligonucleotide or an
oligonucleotide comprised of deoxythymidine analogues, wherein said
oligonucleotide retains the functional property of binding to
poly-A. In a particularly preferred embodiment the capture domain,
or more particularly the poly-T element of the capture domain,
comprises at least 10 nucleotides, preferably at least 11, 12, 13,
14, 15, 16, 17, 18, 19 or 20 nucleotides. In a further embodiment,
the capture domain, or more particularly the poly-T element of the
capture domain comprises at least 25, 30 or 35 nucleotides.
[0091] Random sequences may also be used in the capture of nucleic
acid, as is known in the art, e.g. random hexamers or similar
sequences, and hence such random sequences may be used to form all
or a part of the capture domain. For example, random sequences may
be used in conjunction with poly-T (or poly-T analogue etc.)
sequences. Thus where a capture domain comprises a poly-T (or a
"poly-T-like") oligonucleotide, it may also comprise a random
oligonucleotide sequence. This may for example be located 5' or 3'
of the poly-T sequence, e.g. at the 3' end of the capture probe,
but the positioning of such a random sequence is not critical. Such
a construct may facilitate the capturing of the initial part of the
poly-A of mRNA. Alternatively, the capture domain may be an
entirely random sequence. Degenerate capture domains may also be
used, according to principles known in the art.
[0092] The capture domain may be capable of binding selectively to
a desired sub-type or subset of nucleic acid, e.g. RNA, for example
a particular type of RNA such mRNA or rRNA etc. as listed above, or
to a particular subset of a given type of RNA, for example, a
particular mRNA species e.g. corresponding to a particular gene or
group of genes. Such a capture probe may be selected or designed
based on sequence of the RNA it is desired to capture. Thus it may
be a sequence-specific capture probe, specific for a particular RNA
target or group of targets (target group etc). Thus, it may be
based on a particular gene sequence or particular motif sequence or
common/conserved sequence etc., according to principles well known
in the art.
[0093] In embodiments where the capture probe is immobilized on the
substrate of the array indirectly, e.g. via hybridization to a
surface probe, the capture domain may further comprise an upstream
sequence (5' to the sequence that hybridizes to the nucleic acid,
e.g. RNA of the tissue sample) that is capable of hybridizing to 5'
end of the surface probe. Alone, the capture domain of the capture
probe may be seen as a capture domain oligonucleotide, which may be
used in the synthesis of the capture probe in embodiments where the
capture probe is immobilized on the array indirectly.
[0094] The positional domain (feature identification domain or tag)
of the capture probe is located directly or indirectly upstream,
i.e. closer to the 5'' end of the capture probe nucleic acid
molecule, of the capture domain. Preferably the positional domain
is directly adjacent to the capture domain, i.e. there is no
intermediate sequence between the capture domain and the positional
domain. In some embodiments the positional domain forms the 5' end
of the capture probe, which may be immobilized directly or
indirectly on the substrate of the array.
[0095] As discussed above, each feature (distinct position) of the
array comprises a spot of a species of nucleic acid probe, wherein
the positional domain at each feature is unique. Thus, a "species"
of capture probe is defined with reference to its positional
domain; a single species of capture probe will have the same
positional domain. However, it is not required that each member of
a species of capture probe has the same sequence in its entirety.
In particular, since the capture domain may be or may comprise a
random or degenerate sequence, the capture domains of individual
probes within a species may vary. Accordingly, in some embodiments
where the capture domains of the capture probes are the same, each
feature comprises a single probe sequence. However in other
embodiments where the capture probe varies, members of a species of
probe will not have the exact same sequence, although the sequence
of the positional domain of each member in the species will be the
same. What is required is that each feature or position of the
array carries a capture probe of a single species (specifically
each feature or position carries a capture probe which has an
identical positional tag, i.e. there is a single positional domain
at each feature or position). Each species has a different
positional domain which identifies the species. However, each
member of a species, may in some cases, as described in more detail
herein, have a different capture domain, as the capture domain may
be random or degenerate or may have a random or degenerate
component. This means that within a given feature, or position, the
capture domain of the probes may differ.
[0096] Thus in some, but not necessarily in all embodiments, the
nucleotide sequence of any one probe molecule immobilized at a
particular feature is the same as the other probe molecules
immobilized at the same feature, but the nucleotide sequence of the
probes at each feature is different, distinct or distinguishable
from the probes immobilized at every other feature. Preferably each
feature comprises a different species of probe. However, in some
embodiments it may be advantageous for a group of features to
comprise the same species of probe, i.e. effectively to produce a
feature covering an area of the array that is greater than a single
feature, e.g. to lower the resolution of the array. In other
embodiments of the array, the nucleotide sequence of the positional
domain of any one probe molecule immobilized at a particular
feature may be the same as the other probe molecules immobilized at
the same feature but the capture domain may vary. The capture
domain may nonetheless be designed to capture the same type of
molecule, e.g. mRNA in general.
[0097] The positional domain (or tag) of the capture probe
comprises the sequence which is unique to each feature and acts as
a positional or spatial marker (the identification tag). In this
way each region or domain of the tissue sample, e.g. each cell in
the tissue, will be identifiable by spatial resolution across the
array linking the nucleic acid, e.g. RNA (e.g. the transcripts)
from a certain cell to a unique positional domain sequence in the
capture probe. By virtue of the positional domain a capture probe
in the array may be correlated to a position in the tissue sample,
for example it may be correlated to a cell in the sample. Thus, the
positional domain of the capture domain may be seen as a nucleic
acid tag (identification tag).
[0098] Any suitable sequence may be used as the positional domain
in the capture probes of the invention. By a suitable sequence, it
is meant that the positional domain should not interfere with (i.e.
inhibit or distort) the interaction between the RNA of the tissue
sample and the capture domain of the capture probe. For example,
the positional domain should be designed such that nucleic acid
molecules in the tissue sample do not hybridize specifically to the
positional domain. Preferably, the nucleic acid sequence of the
positional domain of the capture probes has less than 80% sequence
identity to the nucleic acid sequences in the tissue sample.
Preferably, the positional domain of the capture probe has less
than 70%, 60%, 50% or less than 40% sequence identity across a
substantial part of the nucleic acids molecules in the tissue
sample. Sequence identity may be determined by any appropriate
method known in the art, e.g. the using BLAST alignment
algorithm.
[0099] In a preferred embodiment the positional domain of each
species of capture probe contains a unique barcode sequence. The
barcode sequences may be generated using random sequence
generation. The randomly generated sequences may be followed by
stringent filtering by mapping to the genomes of all common
reference species and with pre-set Tm intervals, GC content and a
defined distance of difference to the other barcode sequences to
ensure that the barcode sequences will not interfere with the
capture of the nucleic acid, e.g. RNA from the tissue sample and
will be distinguishable from each other without difficulty.
[0100] As mentioned above, and in a preferred embodiment, the
capture probe comprises also a universal domain (or linker domain
or tag). The universal domain of the capture probe is located
directly or indirectly upstream, i.e. closer to the 5' end of the
capture probe nucleic acid molecule, of the positional domain.
Preferably the universal domain is directly adjacent to the
positional domain, i.e. there is no intermediate sequence between
the positional domain and the universal domain. In embodiments
where the capture probe comprises a universal domain, the domain
will form the 5' end of the capture probe, which may be immobilized
directly or indirectly on the substrate of the array.
[0101] The universal domain may be utilized in a number of ways in
the methods and uses of the invention. For example, the methods of
the invention comprise a step of releasing (e.g. removing) at least
part of the synthesised (i.e. extended or ligated) nucleic acid,
e.g. cDNA molecules from the surface of the array. As described
elsewhere herein, this may be achieved in a number of ways, of
which one comprises cleaving the nucleic acid, e.g. cDNA molecule
from the surface of the array. Thus, the universal domain may
itself comprise a cleavage domain, i.e. a sequence that can be
cleaved specifically, either chemically or preferably
enzymatically.
[0102] Thus, the cleavage domain may comprise a sequence that is
recognised by one or more enzymes capable of cleaving a nucleic
acid molecule, i.e. capable of breaking the phosphodiester linkage
between two or more nucleotides. For instance, the cleavage domain
may comprise a restriction endonuclease (restriction enzyme)
recognition sequence. Restriction enzymes cut double-stranded or
single stranded DNA at specific recognition nucleotide sequences
known as restriction sites and suitable enzymes are well known in
the art. For example, it is particularly advantageous to use
rare-cutting restriction enzymes, i.e. enzymes with a long
recognition site (at least 8 base pairs in length), to reduce the
possibility of cleaving elsewhere in the nucleic acid, e.g. cDNA
molecule. In this respect, it will be seen that removing or
releasing at least part of the nucleic acid, e.g. cDNA molecule
requires releasing a part comprising the positional domain of the
nucleic acid, e.g. cDNA and all of the sequence downstream of the
domain, i.e. all of the sequence that is 3' to the positional
domain. Hence, cleavage of the nucleic acid, e.g. cDNA molecule
should take place 5' to the positional domain.
[0103] By way of example, the cleavage domain may comprise a poly-U
sequence which may be cleaved by a mixture of Uracil DNA
glycosylase (UDG) and the DNA glycosylase-lyase Endonuclease VIII,
commercially known as the USER.TM. enzyme.
[0104] A further example of a cleavage domain can be utilised in
embodiments where the capture probe is immobilized to the array
substrate indirectly, i.e. via a surface probe. The cleavage domain
may comprise one or more mismatch nucleotides, i.e. when the
complementary parts of the surface probe and the capture probe are
not 100% complementary. Such a mismatch is recognised, e.g. by the
MutY and T7 endonuclease I enzymes, which results in cleavage of
the nucleic acid molecule at the position of the mismatch.
[0105] In some embodiments of the invention, the positional domain
of the capture probe comprises a cleavage domain, wherein the said
cleavage domain is located at the 5' end of the positional
domain.
[0106] The universal domain may comprise also an amplification
domain. This may be in addition to, or instead of, a cleavage
domain. In some embodiments of the invention, as described
elsewhere herein, it may be advantageous to amplify the nucleic
acid, e.g. cDNA molecules, for example after they have been
released (e.g. removed or cleaved) from the array substrate. It
will be appreciated however, that the initial cycle of
amplification, or indeed any or all further cycles of amplification
may also take place in situ on the array. The amplification domain
comprises a distinct sequence to which an amplification primer may
hybridize. The amplification domain of the universal domain of the
capture probe is preferably identical for each species of capture
probe. Hence a single amplification reaction will be sufficient to
amplify all of the nucleic acid, e.g. cDNA molecules (which may or
may not be released from the array substrate prior to
amplification).
[0107] Any suitable sequence may be used as the amplification
domain in the capture probes of the invention. By a suitable
sequence, it is meant that the amplification domain should not
interfere with (i.e. inhibit or distort) the interaction between
the nucleic acid, e.g. RNA of the tissue sample and the capture
domain of the capture probe. Furthermore, the amplification domain
should comprise a sequence that is not the same or substantially
the same as any sequence in the nucleic acid, e.g. RNA of the
tissue sample, such that the primer used in the amplification
reaction can hybridized only to the amplification domain under the
amplification conditions of the reaction.
[0108] For example, the amplification domain should be designed
such that nucleic acid molecules in the tissue sample do not
hybridize specifically to the amplification domain or the
complementary sequence of the amplification domain. Preferably, the
nucleic acid sequence of the amplification domain of the capture
probes and the complement thereof has less than 80% sequence
identity to the nucleic acid sequences in the tissue sample.
Preferably, the positional domain of the capture probe has less
than 70%, 60%, 50% or less than 40% sequence identity across a
substantial part of the nucleic acid molecules in the tissue
sample. Sequence identity may be determined by any appropriate
method known in the art, e.g. the using BLAST alignment
algorithm.
[0109] Thus, alone, the universal domain of the capture probe may
be seen as a universal domain oligonucleotide, which may be used in
the synthesis of the capture probe in embodiments where the capture
probe is immobilized on the array indirectly.
[0110] In one representative embodiment of the invention only the
positional domain of each species of capture probe is unique.
Hence, the capture domains and universal domains (if present) are
in one embodiment the same for every species of capture probe for
any particular array to ensure that the capture of the nucleic
acid, e.g. RNA from the tissue sample is uniform across the array.
However, as discussed above, in some embodiments the capture
domains may differ by virtue of including random or degenerate
sequences.
[0111] In embodiments where the capture probe is immobilized on the
substrate of the array indirectly, e.g. via hybridisation to a
surface probe, the capture probe may be synthesised on the array as
described below.
[0112] The surface probes are immobilized on the substrate of the
array directly by or at, e.g. their 3' end, Each species of surface
probe is unique to each feature (distinct position) of the array
and is partly complementary to the capture probe, defined
above.
[0113] Hence the surface probe comprises at its 5' end a domain
(complementary capture domain) that is complementary to a part of
the capture domain that does not bind to the nucleic acid, e.g. RNA
of the tissue sample. In other words, it comprises a domain that
can hybridize to at least part of a capture domain oligonucleotide.
The surface probe further comprises a domain (complementary
positional domain or complementary feature identification domain)
that is complementary to the positional domain of the capture
probe. The complementary positional domain is located directly or
indirectly downstream (i.e. at the 3' end) of the complementary
capture domain, i.e. there may be an intermediary or linker
sequence separating the complementary positional domain and the
complementary capture domain. In embodiments where the capture
probe is synthesized on the array surface, the surface probes of
the array always comprise a domain (complementary universal domain)
at the 3' end of the surface probe, i.e. directly or indirectly
downstream of the positional domain, which is complementary to the
universal domain of the capture probe. In other words, it comprises
a domain that can hybridize to at least part of the universal
domain oligonucleotide.
[0114] In some embodiments of the invention the sequence of the
surface probe shows 100% complementarity or sequence identity to
the positional and universal domains and to the part of the capture
domain that does not bind to the nucleic acid, e.g. RNA of the
tissue sample. In other embodiments the sequence of the surface
probe may show less than 100% sequence identity to the domains of
the capture probe, e.g. less than 99%, 98%, 97%, 96%, 95%, 94%,
93%, 92%, 91% or 90%. In a particularly preferred embodiment of the
invention, the complementary universal domain shares less than 100%
sequence identity to the universal domain of the capture probe.
[0115] In one embodiment of the invention, the capture probe is
synthesized or generated on the substrate of the array. In a
representative embodiment (see FIG. 3), the array comprises surface
probes as defined above. Oligonucleotides that correspond to the
capture domain and universal domain of the capture probe are
contacted with the array and allowed to hybridize to the
complementary domains of the surface probes. Excess
oligonucleotides may be removed by washing the array under standard
hybridization conditions. The resultant array comprises partially
single stranded probes, wherein both the 5' and 3' ends of the
surface probe are double stranded and the complementary positional
domain is single stranded. The array may be treated with a
polymerase enzyme to extend the 3' end of the universal domain
oligonucleotide, in a template dependent manner, so as to
synthesize the positional domain of the capture probe. The 3' end
of the synthesized positional domain is then ligated, e.g. using a
ligase enzyme, to the 5' end of the capture domain oligonucleotide
to generate the capture probe. It will be understood in this regard
that the 5' end of the capture domain oligonucleotide is
phosphorylated to enable ligation to take place. As each species of
surface probe comprises a unique complementary positional domain,
each species of capture probe will comprise a unique positional
domain.
[0116] The term "hybridisation" or "hybridises" as used herein
refers to the formation of a duplex between nucleotide sequences
which are sufficiently complementary to form duplexes via
Watson-Crick base pairing. Two nucleotide sequences are
"complementary" to one another when those molecules share base pair
organization homology. "Complementary" nucleotide sequences will
combine with specificity to form a stable duplex under appropriate
hybridization conditions. For instance, two sequences are
complementary when a section of a first sequence can bind to a
section of a second sequence in an anti-parallel sense wherein the
3''-end of each sequence binds to the 5'-end of the other sequence
and each A, T(U), G and C of one sequence is then aligned with a
T(U), A, C and G, respectively, of the other sequence. RNA
sequences can also include complementary G=U or U=G base pairs.
Thus, two sequences need not have perfect homology to be
"complementary" under the invention. Usually two sequences are
sufficiently complementary when at least about 90% (preferably at
least about 95%) of the nucleotides share base pair organization
over a defined length of the molecule. The domains of the capture
and surface probes thus contain a region of complementarity.
Furthermore the capture domain of the capture probe contains a
region of complementarity for the nucleic acid, e.g. RNA
(preferably mRNA) of the tissue sample.
[0117] The capture probe may also be synthesised on the array
substrate using polymerase extension (similarly to as described
above) and a terminal transferase enzyme to add a "tail" which may
constitute the capture domain. This is described further in Example
7 below. The use of terminal transferases to add nucleotide
sequences to the end of an oligonucleotide is known in the art,
e.g. to introduce a homopolymeric tail e.g. a poly-T tail.
Accordingly, in such a synthesis an oligonucleotide that
corresponds to the universal domain of the capture probe may be
contacted with the array and allowed to hybridize to the
complementary domain of the surface probes. Excess oligonucleotides
may be removed by washing the array under standard hybridization
conditions. The resultant array comprises partially single stranded
probes, wherein the 5' ends of the surface probes are double
stranded and the complementary positional domain is single
stranded. The array may be treated with a polymerase enzyme to
extend the 3' end of the universal domain oligonucleotide, in a
template dependent manner, so as to synthesize the positional
domain of the capture probe. The capture domain, e.g. comprising a
poly-T sequence may then be introduced using a terminal transferase
to add a poly-T tail to generate the capture probe.
[0118] The typical array of, and for use in the methods of, the
invention may contain multiple spots, or "features". A feature may
be defined as an area or distinct position on the array substrate
at which a single species of capture probe is immobilized. Hence
each feature will comprise a multiplicity of probe molecules, of
the same species. It will be understood in this context that whilst
it is encompassed that each capture probe of the same species may
have the same sequence, this need not necessarily be the case. Each
species of capture probe will have the same positional domain (i.e.
each member of a species and hence each probe in a feature will be
identically "tagged"), but the sequence of each member of the
feature (species) may differ, because the sequence of a capture
domain may differ. As described above, random or degenerate capture
domains may be used. Thus the capture probes within a feature may
comprise different random or degenerate sequences. The number and
density of the features on the array will determine the resolution
of the array, i.e. the level of detail at which the transcriptome
or genome of the tissue sample can be analysed. Hence, a higher
density of features will typically increase the resolution of the
array.
[0119] As discussed above, the size and number of the features on
the array of the invention will depend on the nature of the tissue
sample and required resolution. Thus, if it is desirable to
determine a transcriptome or genome only for regions of cells
within a tissue sample (or the sample contains large cells) then
the number and/or density of features on the array may be reduced
(i.e. lower than the possible maximum number of features) and/or
the size of the features may be increased (i.e. the area of each
feature may be greater than the smallest possible feature), e.g. an
array comprising few large features. Alternatively, if it is
desirable to determine a transcriptome or genome of individual
cells within a sample, it may be necessary to use the maximum
number of features possible, which would necessitate using the
smallest possible feature size, e.g. an array comprising many small
features.
[0120] Whilst single cell resolution may be a preferred and
advantageous feature of the present invention, it is not essential
to achieve this, and resolution at the cell group level is also of
interest, for example to detect or distinguish a particular cell
type or tissue region, e.g. normal vs tumour cells.
[0121] In representative embodiments of the invention, an array may
contain at least 2, 5, 10, 50, 100, 500, 750, 1000, 1500, 3000,
5000, 10000, 20000, 40000, 50000, 75000, 100000, 150000, 200000,
300000, 400000, 500000, 750000, 800000, 1000000, 1200000, 1500000,
1750000, 2000000, 2100000. 3000000, 3500000, 4000000 or 4200000
features. Whilst 4200000 represents the maximum number of features
presently available on a commercial array, it is envisaged that
arrays with features in excess of this may be prepared and such
arrays are of interest in the present invention. As noted above,
feature size may be decreased and this may allow greater numbers of
features to be accommodated within the same or a similar area. By
way of example. these features may be comprised in an area of less
than about 20 cm.sup.2, 10 cm.sup.2, 5 cm.sup.2, 1 cm.sup.2, 1
mm.sup.2, or 100 .mu.m.sup.2.
[0122] Thus, in some embodiments of the invention the area of each
feature may be from about 1 .mu.m.sup.2, 2 .mu.m.sup.2, 3
.mu.m.sup.2, 4 .mu.m.sup.2, 5 .mu.m.sup.2, 10 .mu.m.sup.2, 12
.mu.m.sup.2, 15 .mu.m.sup.2, 20 .mu.m.sup.2, 50 .mu.m.sup.2, 75
.mu.m.sup.2, 100 .mu.m.sup.2, 150 .mu.m.sup.2, 200 .mu.m.sup.2, 250
.mu.m.sup.2, 300 .mu.m.sup.2, 400 .mu.m.sup.2, or 500
.mu.m.sup.2.
[0123] It will be evident that a tissue sample from any organism
could be used in the methods of the invention, e.g, plant, animal
or fungal. The array of the invention allows the capture of any
nucleic acid, e.g. mRNA molecules, which are present in cells that
are capable of transcription and/or translation. The arrays and
methods of the invention are particularly suitable for isolating
and analysing the transcriptome or genome of cells within a sample,
wherein spatial resolution of the transcriptomes or genomes is
desirable, e.g. where the cells are interconnected or in contact
directly with adjacent cells. However, it will be apparent to a
person of skill in the art that the methods of the invention may
also be useful for the analysis of the transcriptome or genome of
different cells or cell types within a sample even if said cells do
not interact directly, e.g. a blood sample. In other words, the
cells do not need to present in the context of a tissue and can be
applied to the array as single cells (e.g. cells isolated from a
non-fixed tissue). Such single cells, whilst not necessarily fixed
to a certain position in a tissue, are nonetheless applied to a
certain position on the array and can be individually identified.
Thus, in the context of analysing cells that do not interact
directly, or are not present in a tissue context, the spatial
properties of the described methods may be applied to obtaining or
retrieving unique or independent transcriptome or genome
information from individual cells.
[0124] The sample may thus be a harvested or biopsied tissue
sample, or possibly a cultured sample. Representative samples
include clinical samples e.g. whole blood or blood-derived
products, blood cells, tissues, biopsies, or cultured tissues or
cells etc, including cell suspensions. Artificial tissues may for
example be prepared from cell suspension (including for example
blood cells). Cells may be captured in a matrix (for example a gel
matrix e.g. agar, agarose, etc) and may then be sectioned in a
conventional way. Such procedures are known in the art in the
context of immunohistochemistry (see e.g. Andersson et of 2006, J.
Histochem. Cytochem. 54(12): 1413-23. Epub 2006 Sep. 6).
[0125] The mode of tissue preparation and how the resulting sample
is handled may effect the transcriptomic or genomic analysis of the
methods of the invention. Moreover, various tissue samples will
have different physical characteristics and it is well within the
skill of a person in the art to perform the necessary manipulations
to yield a tissue sample for use with the methods of the invention.
However, it is evident from the disclosures herein that any method
of sample preparation may be used to obtain a tissue sample that is
suitable for use in the methods of the invention. For instance any
layer of cells with a thickness of approximately 1 cell or less may
be used in the methods of the invention. In one embodiment, the
thickness of the tissue sample may be less than 0.9, 0.8, 0.7, 0.6,
0.5, 0.4, 0.3, 0.2 or 0.1 of the cross-section of a cell. However,
since as noted above, the present invention is not limited to
single cell resolution and hence it is not a requirement that the
tissue sample has a thickness of one cell diameter or less; thicker
tissue samples may if desired be used. For example cryostat
sections may be used, which may be e.g. 10-20 .mu.m thick.
[0126] The tissue sample may be prepared in any convenient or
desired way and the invention is not restricted to any particular
type of tissue preparation. Fresh, frozen, fixed or unfixed tissues
may be used. Any desired convenient procedure may be used for
fixing or embedding the tissue sample, as described and known in
the art. Thus any known fixatives or embedding materials may be
used.
[0127] As a first representative example of a tissue sample for use
in the invention, the tissue may prepared by deep freezing at
temperature suitable to maintain or preserve the integrity (i.e.
the physical characteristics) of the tissue structure, e.g. less
than -20.degree. C. and preferably less than -25, -30, -40, -50,
-60, -70 or -80.degree. C. The frozen tissue sample may be
sectioned, i.e. thinly sliced, onto the array surface by any
suitable means. For example, the tissue sample may be prepared
using a chilled microtome, a cryostat, set at a temperature
suitable to maintain both the structural integrity of the tissue
sample and the chemical properties of the nucleic acids in the
sample, e.g, to less than -15.degree. C. and preferably less than
-20 or -25.degree. C. Thus, the sample should be treated so as to
minimize the degeneration or degradation of the nucleic acid, e.g.
RNA in the tissue. Such conditions are well-established in the art
and the extent of any degradation may be monitored through nucleic
acid extraction, e.g. total RNA extraction and subsequent quality
analysis at various stages of the preparation of the tissue
sample.
[0128] In a second representative example, the tissue may be
prepared using standard methods of formalin-fixation and
paraffin-embedding (FFPE), which are well-established in the art.
Following fixation of the tissue sample and embedding in a paraffin
or resin block, the tissue samples may sectioned, i.e, thinly
sliced, onto the array. As noted above, other fixatives and/or
embedding materials can be used.
[0129] It will be apparent that the tissue sample section will need
to be treated to remove the embedding material e.g. to
deparaffinize, i.e. to remove the paraffin or resin, from the
sample prior to carrying out the methods of the invention. This may
be achieved by any suitable method and the removal of paraffin or
resin or other material from tissue samples is well established in
the art, e.g. by incubating the sample (on the surface of the
array) in an appropriate solvent e.g. xylene, e.g, twice for 10
minutes, followed by an ethanol rinse, e.g. 99.5% ethanol for 2
minutes, 96% ethanol for 2 minutes, and 70% ethanol for 2
minutes.
[0130] It will be evident to the skilled person that the RNA in
tissue sections prepared using methods of FFPE or other methods of
fixing and embedding is more likely to be partially degraded than
in the case of frozen tissue. However, without wishing to be bound
by any particular theory, it is believed that this may be
advantageous in the methods of the invention. For instance, if the
RNA in the sample is partially degraded the average length of the
RNA polynucleotides will be less and more randomized than a
non-degraded sample. It is postulated therefore that partially
degraded RNA would result in less bias in the various processing
steps, described elsewhere herein, e.g. ligation of adaptors
(amplification domains), amplification of the cDNA molecules and
sequencing thereof.
[0131] Hence, in one embodiment of the invention the tissue sample,
i.e. the section of the tissue sample contacted with the array, is
prepared using FFPE or other methods of fixing and embedding. In
other words the sample may be fixed, e.g. fixed and embedded. In an
alternative embodiment of the invention the tissue sample is
prepared by deep-freezing. In another embodiment a touch imprint of
a tissue may be used, according to procedures known in the art. In
other embodiments an unfixed sample may be used.
[0132] The thickness of the tissue sample section for use in the
methods of the invention may be dependent on the method used to
prepare the sample and the physical characteristics of the tissue.
Thus, any suitable section thickness may be used in the methods of
the invention. In representative embodiments of the invention the
thickness of the tissue sample section will be at least 0.1 .mu.m,
further preferably at least 0.2, 0.3, 0.4, 0.5, 0.7, 1.0, 1.5, 2,
3, 4, 5, 6, 7, 8, 9 or 10 .mu.m. In other embodiments the thickness
of the tissue sample section is at least 10, 12, 13, 14, 15, 20,
30, 40 or 50 .mu.m. However, the thickness is not critical and
these are representative values only. Thicker samples may be used
if desired or convenient e.g. 70 or 100 .mu.m or more. Typically,
the thickness of the tissue sample section is between 1-100 .mu.m,
1-50 .mu.m, 1-30 .mu.m, 1-25 .mu.m, 1-20 .mu.m, 1-15 .mu.m, 1-10
.mu.m, 2-8 .mu.m, 3-7 .mu.m or 4-6 .mu.m, but as mentioned above
thicker samples may be used.
[0133] On contact of the tissue sample section with the array, e.g.
following removal of the embedding material e.g. deparrafinization,
the nucleic acid, e.g. RNA molecules in the tissue sample will bind
to the immobilized capture probes on the array. In some embodiments
it may be advantageous to facilitate the hybridization of the
nucleic acid, e.g. RNA molecules to the capture probes. Typically,
facilitating the hybridization comprises modifying the conditions
under which hybridization occurs. The primary conditions that can
be modified are the time and temperature of the incubation of the
tissue section on the array prior to the reverse transcription
step, which is described elsewhere herein.
[0134] For instance, on contacting the tissue sample section with
the array, the array may be incubated for at least 1 hour to allow
the nucleic acid, e.g. RNA to hybridize to the capture probes.
Preferably the array may be incubated for at least 2, 3, 5, 10, 12,
15, 20, 22 or 24 hours or until the tissue sample section has
dried. The array incubation time is not critical and any convenient
or desired time may be used. Typical array incubations may be up to
72 hours. Thus, the incubation may occur at any suitable
temperature, for instance at room temperature, although in a
preferred embodiment the tissue sample section is incubated on the
array at a temperature of at least 25, 26, 27, 28, 29, 30, 31, 32,
33, 34, 35, 36 or 37.degree. C. Incubation temperatures of up to
55.degree. C. are commonplace in the art. In a particularly
preferred embodiment the tissue sample section is allowed to dry on
the array at 37.degree. C. for 24 hours. Once the tissue sample
section has dried the array may be stored at room temperature
before performing the reverse transcription step. It will be
understood that the if the tissue sample section is allowed to dry
on the surface of the array, it will need to be rehydrated before
further manipulation of the captured nucleic acid can be achieved,
e.g. the step of reverse transcribing the captured RNA.
[0135] Hence, the method of the invention may comprise a further
step of rehydrating the tissue sample after contacting the sample
with the array.
[0136] In some embodiments it may be advantageous to block (e.g.
mask or modify) the capture probes prior to contacting the tissue
sample with the array, particularly when the nucleic acid in the
tissue sample is subject to a process of modification prior to its
capture on the array. Specifically, it may be advantageous to block
or modify the free 3' end of the capture probe. In a particular
embodiment, the nucleic acid in the tissue sample, e.g. fragmented
genomic DNA, may be modified such that it can be captured by the
capture probe. For instance, and as described in more detail below,
an adaptor sequence (comprising a binding domain capable of binding
to the capture domain of the capture probe) may be added to the end
of the nucleic acid, e.g. fragmented genomic DNA. This may be
achieved by, e.g. ligation of an adaptor or extension of the
nucleic acid, e.g. using an enzyme to incorporate additional
nucleotides at the end of the sequence, e.g. a poly-A tail. It is
necessary to block or modify the capture probes, particularly the
free 3' end of the capture probe, prior to contacting the tissue
sample with the array to avoid modification of the capture probes,
e.g. to avoid the addition of a poly-A tail to the free 3' end of
the capture probes. Preferably the incorporation of a blocking
domain may be incorporated into the capture probe when it is
synthesised. However, the blocking domain may be incorporated to
the capture probe after its synthesis.
[0137] In some embodiments the capture probes may be blocked by any
suitable and reversible means that would prevent modification of
the capture domains during the process of modifying the nucleic
acid of the tissue sample, which occurs after the tissue sample has
been contacted with the array. In other words, the capture probes
may be reversibly masked or modified such that the capture domain
of the capture probe does not comprise a free 3' end, i.e. such
that the 3' end is removed or modified, or made inaccessible so
that the capture probe is not susceptible to the process which is
used to modify the nucleic acid of the tissue sample, e.g. ligation
or extension, or the additional nucleotides may be removed to
reveal and/or restore the 3' end of the capture domain of the
capture probe.
[0138] For example, blocking probes may be hybridised to the
capture probes to mask the free 3' end of the capture domain, e.g.
hairpin probes or partially double stranded probes, suitable
examples of which are known in the art. The free 3' end of the
capture domain may be blocked by chemical modification, e.g.
addition of an azidomethyl group as a chemically reversible capping
moiety such that the capture probes do not comprise a free 3' end.
Suitable alternative capping moieties are well known in the art,
e.g. the terminal nucleotide of the capture domain could be a
reversible terminator nucleotide, which could be included in the
capture probe during or after probe synthesis.
[0139] Alternatively or additionally, the capture domain of the
capture probe could be modified so as to allow the removal of any
modifications of the capture probe, e.g. additional nucleotides,
that occur when the nucleic acid molecules of the tissue sample are
modified. For instance, the capture probes may comprise an
additional sequence downstream of the capture domain, i.e. 3' to
capture domain, namely a blocking domain. This could be in the form
of, e.g. a restriction endonuclease recognition sequence or a
sequence of nucleotides cleavable by specific enzyme activities,
e.g. uracil. Following the modification of the nucleic acid of the
tissue sample, the capture probes could be subjected to an
enzymatic cleavage, which would allow the removal of the blocking
domain and any of the additional nucleotides that are added to the
3' end of the capture probe during the modification process. The
removal of the blocking domain would reveal and/or restore the free
3' end of the capture domain of the capture probe. The blocking
domain could be synthesised as part of the capture probe or could
be added to the capture probe in situ (i.e. as a modification of an
existing array), e.g. by ligation of the blocking domain.
[0140] The capture probes may be blocked using any combination of
the blocking mechanisms described above.
[0141] Once the nucleic acid of the tissue sample, e.g. fragmented
genomic DNA, has been modified to enable it to hybridise to the
capture domain of the capture probe, the capture probe must be
unblocked, e.g. by dissociation of the blocking oligonucleotide,
removal of the capping moiety and/or blocking domain.
[0142] In order to correlate the sequence analysis or transcriptome
or genome information obtained from each feature of the array with
the region (i.e. an area or cell) of the tissue sample the tissue
sample is oriented in relation to the features on the array. In
other words, the tissue sample is placed on the array such that the
position of a capture probe on the array may be correlated with a
position in the tissue sample. Thus it may be identified where in
the tissue sample the position of each species of capture probe (or
each feature of the array) corresponds. In other words, it may be
identified to which location in the tissue sample the position of
each species of capture probe corresponds. This may be done by
virtue of positional markers present on the array, as described
below. Conveniently, but not necessarily, the tissue sample may be
imaged following its contact with the array. This may be performed
before or after the nucleic acid of the tissue sample is processed,
e.g. before or after the cDNA generation step of the method, in
particular the step of generating the first strand cDNA by reverse
transcription. In a preferred embodiment the tissue sample is
imaged prior to the release of the captured and synthesised (i.e.
extended or ligated) DNA, e.g. cDNA, from the array. In a
particularly preferred embodiment the tissue is imaged after the
nucleic add of the tissue sample has been processed, e.g. after the
reverse transcription step, and any residual tissue is removed
(e.g. washed) from the array prior to the release of molecules,
e.g, of the cDNA from the array. In some embodiments, the step of
processing the captured nucleic acid, e.g. the reverse
transcription step, may act to remove residual tissue from the
array surface, e.g. when using tissue preparing by deep-freezing.
In such a case, imaging of the tissue sample may take place prior
to the processing step, e.g. the cDNA synthesis step. Generally
speaking, imaging may take place at any time after contacting the
tissue sample with the area, but before any step which degrades or
removes the tissue sample. As noted above, this may depend on the
tissue sample.
[0143] Advantageously, the array may comprise markers to facilitate
the orientation of the tissue sample or the image thereof in
relation to the features of the array. Any suitable means for
marking the array may be used such that they are detectable when
the tissue sample is imaged. For instance, a molecule, e.g. a
fluorescent molecule, that generates a signal, preferably a visible
signal, may be immobilized directly or indirectly on the surface of
the array. Preferably, the array comprises at least two markers in
distinct positions on the surface of the array, further preferably
at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30, 40, 50, 60, 70,
80, 90 or 100 markers. Conveniently several hundred or even several
thousand markers may be used. The markers may be provided in a
pattern, for example make up an outer edge of the array, e.g. an
entire outer row of the features of an array. Other informative
patterns may be used, e.g. lines sectioning the array. This may
facilitate aligning an image of the tissue sample to an array, or
indeed generally in correlating the features of the array to the
tissue sample. Thus, the marker may be an immobilized molecule to
which a signal giving molecule may interact to generate a signal.
In a representative example, the array may comprise a marker
feature, e.g, a nucleic acid probe immobilized on the substrate of
array, to which a labelled nucleic acid may hybridize. For
instance, the labelled nucleic acid molecule, or marker nucleic
acid, may be linked or coupled to a chemical moiety capable of
fluorescing when subjected to light of a specific wavelength (or
range of wavelengths), i.e. excited. Such a marker nucleic acid
molecule may be contacted with the array before, contemporaneously
with or after the tissue sample is stained in order to visualize or
image the tissue sample. However, the marker must be detectable
when the tissue sample is imaged. Thus, in a preferred embodiment
the marker may be detected using the same imaging conditions used
to visualize the tissue sample.
[0144] In a particularly preferred embodiment of the invention, the
array comprises marker features to which a labelled, preferably
fluorescently labelled, marker nucleic acid molecule, e.g.
oligonucleotide, is hybridized.
[0145] The step of imaging the tissue may use any convenient
histological means known in the art, e.g. light, bright field, dark
field, phase contrast, fluorescence, reflection, interference,
confocal microscopy or a combination thereof. Typically the tissue
sample is stained prior to visualization to provide contrast
between the different regions, e.g. cells, of the tissue sample.
The type of stain used will be dependent on the type of tissue and
the region of the cells to be stained. Such staining protocols are
known in the art. In some embodiments more than one stain may be
used to visualize (image) different aspects of the tissue sample,
e.g. different regions of the tissue sample, specific cell
structures (e.g. organelles) or different cell types. In other
embodiments, the tissue sample may be visualized or imaged without
staining the sample, e.g. if the tissue sample contains already
pigments that provide sufficient contrast or if particular forms of
microscopy are used.
[0146] In a preferred embodiment, the tissue sample is visualized
or imaged using fluorescence microscopy.
[0147] The tissue sample, i.e. any residual tissue that remains in
contact with the array substrate following the reverse
transcription step and optionally imaging, if imaging is desired
and was not carried out before reverse transcription, preferably is
removed prior to the step of releasing the cDNA molecules from the
array. Thus, the methods of the invention may comprise a step of
washing the array. Removal of the residual tissue sample may be
performed using any suitable means and will be dependent on the
tissue sample. In the simplest embodiment, the array may be washed
with water. The water may contain various additives, e.g.
surfactants (e.g. detergents), enzymes etc to facilitate to removal
of the tissue. In some embodiments, the array is washed with a
solution comprising a proteinase enzyme (and suitable buffer) e.g.
proteinase K. In other embodiments, the solution may comprise also
or alternatively cellulase, hemicelluase or chitinase enzymes, e.g.
if the tissue sample is from a plant or fungal source. In further
embodiments, the temperature of the solution used to wash the array
may be, e.g. at least 30.degree. C., preferably at least 35, 40,
45, 50 or 55.degree. C. It will be evident that the wash solution
should minimize the disruption of the immobilized nucleic acid
molecules. For instance, in some embodiments the nucleic acid
molecules may be immobilized on the substrate of the array
indirectly, e.g. via hybridization of the capture probe and the RNA
and/or the capture probe and the surface probe, thus the wash step
should not interfere with the interaction between the molecules
immobilized on the array, i.e. should not cause the nucleic acid
molecules to be denatured.
[0148] Following the step of contacting the array with a tissue
sample, under conditions sufficient to allow hybridization to occur
between the nucleic acid, e.g. RNA (preferably mRNA), of the tissue
sample to the capture probes, the step of securing (acquiring) the
hybridized nucleic acid takes place. Securing or acquiring the
captured nucleic acid involves a covalent attachment of a
complementary strand of the hybridized nucleic acid to the capture
probe (i.e. via a nucleotide bond, a phosphodiester bond between
juxtaposed 3'-hydroxyl and 5-phosphate termini of two immediately
adjacent nucleotides), thereby tagging or marking the captured
nucleic acid with the positional domain specific to the feature on
which the nucleic acid is captured.
[0149] In some embodiments, securing the hybridized nucleic acid,
e.g. a single stranded nucleic acid, may involve extending the
capture probe to produce a copy of the captured nucleic acid, e.g.
generating cDNA from the captured (hybridized) RNA. It will be
understood that this refers to the synthesis of a complementary
strand of the hybridized nucleic acid, e.g. generating cDNA based
on the captured RNA template (the RNA hybridized to the capture
domain of the capture probe). Thus, in an initial step of extending
the capture probe, e.g. the cDNA generation, the captured
(hybridized) nucleic acid, e.g. RNA acts as a template for the
extension, e.g. reverse transcription, step. In other embodiments,
as described below, securing the hybridized nucleic acid, e.g.
partially double stranded DNA, may involve covalently coupling the
hybridized nucleic acid, e.g. fragmented DNA, to the capture probe,
e.g. ligating to the capture probe the complementary strand of the
nucleic acid hybridized to the capture probe, in a ligation
reaction.
[0150] Reverse transcription concerns the step of synthesizing cDNA
(complementary or copy DNA) from RNA, preferably mRNA (messenger
RNA), by reverse transcriptase. Thus cDNA can be considered to be a
copy of the RNA present in a cell at the time at which the tissue
sample was taken, i.e. it represents all or some of the genes that
were expressed in said cell at the time of isolation.
[0151] The capture probe, specifically the capture domain of the
capture probe, acts as a primer for producing the complementary
strand of the nucleic acid hybridized to the capture probe, e.g. a
primer for reverse transcription. Hence, the nucleic acid, e.g.
cDNA, molecules generated by the extension reaction, e.g. reverse
transcription reaction, incorporate the sequence of the capture
probe, i.e. the extension reaction, e.g. reverse transcription
reaction, may be seen as a way of labelling indirectly the nucleic
acid, e.g. transcripts, of the tissue sample that are in contact
with each feature of the array. As mentioned above, each species of
capture probe comprises a positional domain (feature identification
tag) that represents a unique sequence for each feature of the
array, Thus, all of the nucleic acid, e.g. cDNA, molecules
synthesized at a specific feature will comprise the same nucleic
acid "tag".
[0152] The nucleic acid, e.g. cDNA, molecules synthesized at each
feature of the array may represent the genome of, or genes
expressed from, the region or area of the tissue sample in contact
with that feature, e.g. a tissue or cell type or group or sub-group
thereof, and may further represent genes expressed under specific
conditions, e.g. at a particular time, in a specific environment,
at a stage of development or in response to stimulus etc. Hence,
the cDNA at any single feature may represent the genes expressed in
a single cell, or if the feature is in contact with the sample at a
cell junction, the cDNA may represent the genes expressed in more
than one cell. Similarly, if a single cell is in contact with
multiple features, then each feature may represent a proportion of
the genes expressed in said cell. Similarly, in embodiments in
which the captured nucleic acid is DNA, any single feature may be
representative of the genome of a single cell or more than one
cell. Alternatively, the genome of a single cell may be represented
by multiple features.
[0153] The step of extending the capture probe, e.g. reverse
transcription, may be performed using any suitable enzymes and
protocol of which many exist in the art, as described in detail
below. However, it will be evident that it is not necessary to
provide a primer for the synthesis of the first nucleic acid, e.g.
cDNA, strand because the capture domain of the capture probe acts
as the primer, e.g. reverse transcription primer.
[0154] Preferably, in the context of the present invention the
secured nucleic acid (i.e. the nucleic acid covalently attached to
the capture probe), e.g. cDNA is treated to comprise double
stranded DNA. However, in some embodiments, the captured DNA may
already comprise double stranded DNA, e.g. where partially double
stranded fragmented DNA is ligated to the capture probe. Treatment
of the captured nucleic acid to produce double stranded DNA may be
achieved in a single reaction to generate only a second DNA, e.g.
cDNA, strand, i.e. to produce double stranded DNA molecules without
increasing the number of double stranded DNA molecules, or in an
amplification reaction to generate multiple copies of the second
strand, which may be in the form of single stranded DNA (e.g.
linear amplification) or double stranded DNA, e.g. cDNA (e.g.
exponential amplification).
[0155] The step of second strand DNA, e.g. cDNA, synthesis may take
place in situ on the array, either as a discrete step of second
strand synthesis, for example using random primers as described in
more detail below, or in the initial step of an amplification
reaction. Alternatively, the first strand DNA, e.g. cDNA (the
strand comprising, i.e. incorporating, the capture probe) may be
released from the array and second strand synthesis, whether as a
discrete step or in an amplification reaction may occur
subsequently, e.g. in a reaction carried out in solution.
[0156] Where second strand synthesis takes place on the array (i.e.
in situ) the method may include an optional step of removing the
captured nucleic acid, e.g. RNA before the second strand synthesis,
for example using an RNA digesting enzyme (RNase) e.g. RNase H.
Procedures for this are well known and described in the art.
However, this is generally not necessary, and in most cases the RNA
degrades naturally. Removal of the tissue sample from the array
will generally remove the RNA from the array. RNase H can be used
if desired to increase the robustness of RNA removal.
[0157] For instance, in tissue samples that comprise large amounts
of RNA, the step of generating the double stranded cDNA may yield a
sufficient amount of cDNA that it may be sequenced directly
(following release from the array). In this case, second strand
cDNA synthesis may be achieved by any means known in the art and as
described below. The second strand synthesis reaction may be
performed on the array directly, i.e, whilst the cDNA is
immobilized on the array, or preferably after the cDNA has been
released from the array substrate, as described below.
[0158] In other embodiments it will be necessary to enhance, i.e.
amplify, the amount of secured nucleic acid, e.g. synthesized cDNA
to yield quantities that are sufficient for DNA sequencing. In this
embodiment, the first strand of the secured nucleic acid, e.g. cDNA
molecules, which comprise also the capture probe of the features of
the array, acts as a template for the amplification reaction, e.g.
a polymerase chain reaction. The first reaction product of the
amplification will be a second strand of DNA, e.g. cDNA, which
itself will act as a template for further cycles of the
amplification reaction.
[0159] In either of the above described embodiments, the second
strand of DNA, e.g. cDNA, will comprise a complement of the capture
probe. If the capture probe comprises a universal domain, and
particularly an amplification domain within the universal domain,
then this may be used for the subsequent amplification of the DNA,
e.g. cDNA, e.g. the amplification reaction may comprise a primer
with the same sequence as the amplification domain, i.e. a primer
that is complementary (i.e. hybridizes) to the complement of the
amplification domain. In view of the fact that the amplification
domain is upstream of the positional domain of the capture probe
(in the secured nucleic acid, e.g. the first cDNA strand), the
complement of the positional domain will be incorporated in the
second strand of the DNA, e.g. cDNA molecules.
[0160] In embodiments where the second strand of DNA, e.g. cDNA is
generated in a single reaction, the second strand synthesis may be
achieved by any suitable means. For instance, the first strand
cDNA, preferably, but not necessarily, released from the array
substrate, may be incubated with random primers, e.g. hexamer
primers, and a DNA polymerase, preferably a strand displacement
polymerase, e.g. klenow (exo), under conditions sufficient for
templated DNA synthesis to occur. This process will yield double
stranded cDNA molecules of varying lengths and is unlikely to yield
full-length cDNA molecules, i.e. cDNA molecules that correspond to
entire mRNA from which they were synthesized. The random primers
will hybridise to the first strand cDNA molecules at a random
position, i.e. within the sequence rather than at the end of the
sequence.
[0161] If it is desirable to generate full-length DNA, e.g. cDNA,
molecules, i.e, molecules that correspond to the whole of the
captured nucleic acid, e.g. RNA molecule (if the nucleic acid, e.g.
RNA, was partially degraded in the tissue sample then the captured
nucleic acid, e.g. RNA, molecules will not be "full-length"
transcripts or the same length as the initial fragments of genomic
DNA), then the 3' end of the secured nucleic acid, e.g. first stand
cDNA, molecules may be modified. For example, a linker or adaptor
may be ligated to the 3' end of the cDNA molecules. This may be
achieved using single stranded ligation enzymes such as T4 RNA
ligase or Circligase.TM. (Epicentre Biotechnologies).
[0162] Alternatively, a helper probe (a partially double stranded
DNA molecule capable of hybridising to the 3' end of the first
strand cDNA molecule), may be ligated to the 3' end of the secured
nucleic acid, e.g. first strand cDNA, molecule using a double
stranded ligation enzyme such as T4 DNA ligase, Other enzymes
appropriate for the ligation step are known in the art and include,
e.g. Tth DNA ligase, Taq DNA ligase, Thermococcus sp. (strain
9.degree. N) DNA ligase (9.degree. N.TM. DNA ligase, New England
Biolabs), and Ampligase.TM. (Epicentre Biotechnologies). The helper
probe comprises also a specific sequence from which the second
strand DNA, e.g. cDNA, synthesis may be primed using a primer that
is complementary to the part of the helper probe that is ligated to
the secured nucleic acid, e.g. first cDNA strand. A further
alternative comprises the use of a terminal transferase active
enzyme to incorporate a polynucleotide tail, e.g. a poly-A tail, at
the 3' end of the secured nucleic acid, e.g, first strand of cDNA,
molecules. The second strand synthesis may be primed using a poly-T
primer, which may also comprise a specific amplification domain for
further amplification. Other methods for generating "full-length"
double stranded DNA, e.g. cDNA, molecules (or maximal length second
strand synthesis) are well-established in the art.
[0163] In some embodiments, second strand synthesis may use a
method of template switching, e.g. using the SMART.TM. technology
from Clontech.RTM.. SMART (Switching Mechanism at 5' End of RNA
Template) technology is well established in the art and is based
that the discovery that reverse transcriptase enzymes, e.g.
Superscript.RTM. II (Invitrogen), are capable of adding a few
nucleotides at the 3' end of an extended cDNA molecule, i.e. to
produce a DNA/RNA hybrid with a single stranded DNA overhang at the
3' end. The DNA overhang may provide a target sequence to which an
oligonucleotide probe can hybridise to provide an additional
template for further extension of the cDNA molecule,
Advantageously, the oligonucleotide probe that hybridises to the
cDNA overhang contains an amplification domain sequence, the
complement of which is incorporated into the synthesised first
strand cDNA product. Primers containing the amplification domain
sequence, which will hybridise to the complementary amplification
domain sequence incorporated into the cDNA first strand, can be
added to the reaction mix to prime second strand synthesis using a
suitable polymerase enzyme and the cDNA first strand as a template.
This method avoids the need to ligate adaptors to the 3' end of the
cDNA first strand. Whilst template switching was originally
developed for full-length mRNAs, which have a 5' cap structure, it
has since been demonstrated to work equally well with truncated
mRNAs without the cap structure. Thus, template switching may be
used in the methods of the invention to generate full length and/or
partial or truncated cDNA molecules. Thus, in a preferred
embodiment of the invention, the second strand synthesis may
utilise, or be achieved by, template switching. In a particularly
preferred embodiment, the template switching reaction, i.e. the
further extension of the cDNA first strand to incorporate the
complementary amplification domain, is performed in situ (whilst
the capture probe is still attached, directly or indirectly, to the
array). Preferably, the second strand synthesis reaction is also
performed in situ.
[0164] In embodiments where it may be necessary or advantageous to
enhance, enrich or amplify the DNA, e.g. cDNA molecules,
amplification domains may be incorporated in the DNA, e.g. cDNA
molecules. As discussed above, a first amplification domain may be
incorporated into the secured nucleic acid molecules, e.g. the
first strand of the cDNA molecules, when the capture probe
comprises a universal domain comprising an amplification domain. In
these embodiments, the second strand synthesis may incorporate a
second amplification domain. For example, the primers used to
generate the second strand cDNA, e.g. random hexamer primers,
poly-T primer, the primer that is complementary to the helper
probe, may comprise at their 5' end an amplification domain, i.e, a
nucleotide sequence to which an amplification primer may hybridize.
Thus, the resultant double stranded DNA may comprise an
amplification domain at or towards each 5' end of the double
stranded DNA, e.g. cDNA molecules. These amplification domains may
be used as targets for primers used in an amplification reaction,
e.g. PCR. Alternatively, the linker or adaptor which is ligated to
the 3' end of the secured nucleic acid molecules, e.g. first strand
cDNA molecules, may comprise a second universal domain comprising a
second amplification domain. Similarly, a second amplification
domain may be incorporated into the first strand cDNA molecules by
template switching.
[0165] In embodiments where the capture probe does not comprise a
universal domain, particularly comprising an amplification domain,
the second strand of the cDNA molecules may be synthesised in
accordance with the above description. The resultant double
stranded DNA molecules may be modified to incorporate an
amplification domain at the 5' end of the first DNA, e.g. cDNA
strand (a first amplification domain) and, if not incorporated in
the second strand DNA, e.g. cDNA synthesis step, at the 5' end of
the second DNA, e.g. cDNA strand (a second amplification domain).
Such amplification domains may be incorporated, e.g. by ligating
double stranded adaptors to the ends of the DNA, e.g. cDNA
molecules. Enzymes appropriate for the ligation step are known in
the art and include, e.g. Tth DNA ligase, Taq DNA ligase,
Thermococcus sp. (strain 9.degree. N) DNA ligase (9.degree. N.TM.
DNA ligase, New England Biolabs), Ampligase.TM. (Epicentre
Biotechnologies) and T4 DNA ligase. In a preferred embodiment the
first and second amplification domains comprise different
sequences.
[0166] From the above, it is therefore apparent that universal
domains, which may comprise an amplification domain, may be added
to the secured (i.e. extended or ligated) DNA molecules, for
example to the cDNA molecules, or their complements (e.g. second
strand) by various methods and techniques and combinations of such
techniques known in the art e.g. by use of primers which include
such a domain, ligation of adaptors, use of terminal transferase
enzymes and/or by template switching methods. As is clear from the
discussion herein, such domains may be added before or after
release of the DNA molecules from the array.
[0167] It will be apparent from the above description that all of
the DNA, e.g. cDNA molecules from a single array that have been
synthesized by the methods of the invention may all comprise the
same first and second amplification domains. Consequently, a single
amplification reaction, e.g. PCR, may be sufficient to amplify all
of the DNA, e.g, cDNA molecules. Thus in a preferred embodiment,
the method of the invention may comprise a step of amplifying the
DNA, e.g. cDNA molecules. In one embodiment the amplification step
is performed after the release of the DNA, e.g. cDNA molecules from
the substrate of the array. In other embodiments amplification may
be performed on the array (i.e. in situ on the array). It is known
in the art that amplification reactions may be carried out on
arrays and on-chip thermocyclers exist for carrying out such
reactions. Thus, in one embodiment arrays which are known in the
art as sequencing platforms or for use in any form of sequence
analysis (e.g. in or by next generation sequencing technologies)
may be used as the basis of the arrays of the present invention
(e.g. lumina bead arrays etc.)
[0168] For the synthesis of the second strand of DNA, e.g, cDNA it
is preferable to use a strand displacement polymerase (e.g. 029 DNA
polymerase, Bst (exo.sup.-) DNA polymerase, klenow (exo.sup.-) DNA
polymerase) if the cDNA released from the substrate of the array
comprises a partially double stranded nucleic acid molecule. For
instance, the released nucleic acids will be at least partially
double stranded (e.g. DNA:DNA, DNA:RNA or DNA:DNA/RNA hybrid) in
embodiments where the capture probe is immobilized indirectly on
the substrate of the array via a surface probe and the step of
releasing the DNA, e.g. cDNA molecules comprises a cleavage step.
The strand displacement polymerase is necessary to ensure that the
second cDNA strand synthesis incorporates the complement of the
positional domain (feature identification domain) into the second
DNA, e.g. cDNA strand.
[0169] It will be evident that the step of releasing at least part
of the DNA, e.g. cDNA molecules or their amplicons from the surface
or substrate of the array may be achieved using a number of
methods. The primary aim of the release step is to yield molecules
into which the positional domain of the capture probe (or its
complement) is incorporated (or included), such that the DNA, e.g.
cDNA molecules or their amplicons are "tagged" according to their
feature (or position) on the array. The release step thus removes
DNA, e.g. cDNA molecules or amplicons thereof from the array, which
DNA, e.g. cDNA molecules or amplicons include the positional domain
or its complement (by virtue of it having been incorporated into
the secured nucleic acid, e.g. the first strand cDNA by, e.g.
extension of the capture probe, and optionally copied in the second
strand DNA if second strand synthesis takes place on the array, or
copied into amplicons if amplification takes place on the array).
Hence, in order to yield sequence analysis data that can be
correlated with the various regions in the tissue sample it is
essential that the released molecules comprise the positional
domain of the capture probe (or its complement).
[0170] Since the released molecule may be a first and/or second
strand DNA, e.g. cDNA molecule or amplicon, and since the capture
probe may be immobilised indirectly on the array, it will be
understood that whilst the release step may comprise a step of
cleaving a DNA, e.g. cDNA molecule from the array, the release step
does not require a step of nucleic acid cleavage; a DNA, e.g. cDNA
molecule or an amplicon may simply be released by denaturing a
double-stranded molecule, for example releasing the second cDNA
strand from the first cDNA strand, or releasing an amplicon from
its template or releasing the first strand cDNA molecule (i.e. the
extended capture probe) from a surface probe. Accordingly, a DNA,
e.g, cDNA molecule may be released from the array by nucleic acid
cleavage and/or by denaturation (e.g by heating to denature a
double-stranded molecule). Where amplification is carried out in
situ on the array, this will of course encompass releasing
amplicons by denaturation in the cycling reaction.
[0171] In some embodiments, the DNA, e.g. cDNA molecules are
released by enzymatic cleavage of a cleavage domain, which may be
located in the universal domain or positional domain of the capture
probe. As mentioned above, the cleavage domain must be located
upstream (at the 5' end) of the positional domain, such that the
released DNA, e.g. cDNA molecules comprise the positional
(identification) domain. Suitable enzymes for nucleic acid cleavage
include restriction endonucleases, e.g. Rsal. Other enzymes, e.g. a
mixture of Uracil DNA glycosylase (UDG) and the DNA
glycosylase-lyase Endonuclease VIII (USER.TM. enzyme) or a
combination of the MutY and T7 endonuclease I enzymes, are
preferred embodiments of the methods of the invention.
[0172] In an alternative embodiment, the DNA, e.g. cDNA molecules
may be released from the surface or substrate of the array by
physical means. For instance, in embodiments where the capture
probe is indirectly immobilized on the substrate of the array, e.g.
via hybridization to the surface probe, it may be sufficient to
disrupt the interaction between the nucleic acid molecules. Methods
for disrupting the interaction between nucleic acid molecules, e.g.
denaturing double stranded nucleic acid molecules, are well known
in the art. A straightforward method for releasing the DNA, e.g.
cDNA molecules (i.e. of stripping the array of the synthesized DNA,
e.g. cDNA molecules) is to use a solution that interferes with the
hydrogen bonds of the double stranded molecules. In a preferred
embodiment of the invention, the DNA, e.g. cDNA molecules may be
released by applying heated water, e.g. water or buffer of at least
85.degree. C., preferably at least 90, 91, 92, 93, 94, 95, 96, 97,
98, 99.degree. C. As an alternative or addition to the use of a
temperature sufficient to disrupt the hydrogen bonding, the
solution may comprise salts, surfactants etc. that may further
destabilize the interaction between the nucleic acid molecules,
resulting in the release of the DNA, e.g. cDNA molecules.
[0173] It will be understood that the application of a high
temperature solution, e.g. 90-99.degree. C. water may be sufficient
to disrupt a covalent bond used to immobilize the capture probe or
surface probe to the array substrate. Hence, in a preferred
embodiment, the DNA, e.g. cDNA molecules may be released by
applying hot water to the array to disrupt covalently immobilized
capture or surface probes.
[0174] It is implicit that the released DNA, e.g. cDNA molecules
(the solution comprising the released DNA, e.g. cDNA molecules) are
collected for further manipulation, e.g. second strand synthesis
and/or amplification. Nevertheless, the method of the invention may
be seen to comprise a step of collecting or recovering the released
DNA, e.g. cDNA molecules. As noted above, in the context of in situ
amplification the released molecules may include amplicons of the
secured nucleic acid, e.g. cDNA.
[0175] In embodiments of methods of the invention; it may be
desirable to remove any unextended or unligated capture probes.
This may be, for example, after the step of releasing DNA molecules
from the array. Any desired or convenient method may be used for
such removal including, for example, use of an enzyme to degrade
the unextended or unligated probes, e.g. exonuclease.
[0176] The DNA, e.g. cDNA molecules, or amplicons, that have been
released from the array, which may have been modified as discussed
above, are analysed to investigate (e.g. determine their sequence,
although as noted above actual sequence determination is not
required--any method of analysing the sequence may be used). Thus,
any method of nucleic acid analysis may be used. The step of
sequence analysis may identify the positional domain and hence
allow the analysed molecule to be localized to a position in the
tissue sample. Similarly, the nature or identity of the analysed
molecule may be determined. In this way the nucleic acid, e.g. RNA
at given position in the array, and hence in the tissue sample may
be determined. Hence the analysis step may include or use any
method which identifies the analysed molecule (and hence the
"target" molecule) and its positional domain. Generally such a
method will be a sequence-specific method. For example, the method
may use sequence-specific primers or probes, particularly primers
or probes specific for the positional domain and/or for a specific
nucleic acid molecule to be detected or analysed e.g. a DNA
molecule corresponding to a nucleic acid, e.g. RNA or cDNA molecule
to be detected. Typically in such a method sequence-specific
amplification primers e.g. PCR primers may be used.
[0177] In some embodiments it may be desirable to analyse a subset
or family of target related molecules, e.g. all of the sequences
that encode a particular group of proteins which share sequence
similarity and/or conserved domains, e.g. a family of receptors.
Hence, the amplification and/or analysis methods described herein
may use degenerate or gene family specific primers or probes that
hybridise to a subset of the captured nucleic acids or nucleic
acids derived therefrom, e.g. amplicons. In a particularly
preferred embodiment, the amplification and/or analysis methods may
utilise a universal primer (i.e. a primer common to all of the
captured sequences) in combination with a degenerate or gene family
specific primer specific for a subset of target molecules.
[0178] Thus in one embodiment, amplification-based, especially
PCR-based methods of sequence analysis are used.
[0179] However, the steps of modifying and/or amplifying the
released DNA, e.g. cDNA molecules may introduce additional
components into the sample, e.g. enzymes, primers, nucleotides etc.
Hence, the methods of the invention may further comprise a step of
purifying the sample comprising the released DNA, e.g. cDNA
molecules or amplicons prior to the sequence analysis, e.g. to
remove oligonucleotide primers, nucleotides, salts etc that may
interfere with the sequencing reactions. Any suitable method of
purifying the DNA, e.g. cDNA molecules may be used.
[0180] As noted above, sequence analysis of the released DNA
molecules may be direct or indirect. Thus the sequence analysis
substrate (which may be viewed as the molecule which is subjected
to the sequence analysis step or process) may directly be the
molecule which is released from the array or it may be a molecule
which is derived therefrom. Thus, for example in the context of
sequence analysis step which involves a sequencing reaction, the
sequencing template may be the molecule which is released from the
array or it may be a molecule derived therefrom. For example, a
first and/or second strand DNA, e.g. cDNA molecule released from
the array may be directly subjected to sequence analysis (e.g.
sequencing), i.e. may directly take part in the sequence analysis
reaction or process (e.g. the sequencing reaction or sequencing
process, or be the molecule which is sequenced or otherwise
identified). In the context of in situ amplification the released
molecule may be an amplicon. Alternatively, the released molecule
may be subjected to a step of second strand synthesis or
amplification before sequence analysis (e.g. sequencing or
identification by other means). The sequence analysis substrate
(e.g. template) may thus be an amplicon or a second strand of a
molecule which is directly released from the array.
[0181] Both strands of a double stranded molecule may be subjected
to sequence analysis (e.g. sequenced) but the invention is not
limited to this and single stranded molecules (e.g. cDNA) may be
analysed (e.g. sequenced). For example various sequencing
technologies may be used for single molecule sequencing, e.g. the
Helicos or Pacbio technologies, or nanopore sequencing technologies
which are being developed. Thus, in one embodiment the first strand
of DNA, e.g. cDNA may be subjected to sequencing. The first strand
DNA, e.g. cDNA may need to be modified at the 3' end to enable
single molecule sequencing. This may be done by procedures
analogous to those for handling the second DNA, e.g, cDNA strand.
Such procedures are known in the art.
[0182] In a preferred aspect of the invention the sequence analysis
will identify or reveal a portion of captured nucleic acid, e.g.
RNA sequence and the sequence of the positional domain. The
sequence of the positional domain (or tag) will identify the
feature to which the nucleic acid, e.g. mRNA molecule was captured.
The sequence of the captured nucleic acid, e.g. RNA molecule may be
compared with a sequence database of the organism from which the
sample originated to determine the gene to which it corresponds. By
determining which region (e.g. cell) of the tissue sample was in
contact with the feature, it is possible to determine which region
of the tissue sample was expressing said gene (or contained the
gene, e.g, in the case of spatial genomics). This analysis may be
achieved for all of the DNA, e.g. cDNA molecules generated by the
methods of the invention, yielding a spatial transcriptome or
genome of the tissue sample.
[0183] By way of a representative example, sequencing data may be
analysed to sort the sequences into specific species of capture
probe, i.e, according to the sequence of the positional domain.
This may be achieved by, e.g. using the FastX toolkit FASTQ Barcode
splitter tool to sort the sequences into individual files for the
respective capture probe positional domain (tag) sequences. The
sequences of each species, i.e. from each feature, may be analyzed
to determine the identity of the transcripts. For instance, the
sequences may be identified using e.g. Blastn software, to compare
the sequences to one or more genome databases, preferably the
database for the organism from which the tissue sample was
obtained. The identity of the database sequence with the greatest
similarity to the sequence generated by the methods of the
invention will be assigned to said sequence. In general, only hits
with a certainty of at least 1e.sup.-6, preferably 1e.sup.-7,
1e.sup.-8, or 1e.sup.-9 will be considered to have been
successfully identified.
[0184] It will be apparent that any nucleic acid sequencing method
may be utilised in the methods of the invention. However, the
so-called "next generation sequencing" techniques will find
particular utility in the present invention. High-throughput
sequencing is particularly useful in the methods of the invention
because it enables a large number of nucleic acids to be partially
sequenced in a very short period of time. In view of the recent
explosion in the number of fully or partially sequenced genomes, it
is not essential to sequence the full length of the generated DNA,
e.g. cDNA molecules to determine the gene to which each molecule
corresponds. For example, the first 100 nucleotides from each end
of the DNA, e.g. cDNA molecules should be sufficient to identify
both the feature to which the nucleic acid, e.g. mRNA was captured
(i.e. its location on the array) and the gene expressed. The
sequence reaction from the "capture probe end" of the DNA, e.g.
cDNA molecules yields the sequence of the positional domain and at
least about 20 bases, preferably 30 or 40 bases of transcript
specific sequence data. The sequence reaction from the "non-capture
probe end" may yield at least about 70 bases, preferably 80, 90, or
100 bases of transcript specific sequence data.
[0185] As a representative example, the sequencing reaction may be
based on reversible dye-terminators, such as used in the
Illumina.TM. technology. For example, DNA molecules are first
attached to primers on, e.g. a glass or silicon slide and amplified
so that local clonal colonies are formed (bridge amplification).
Four types of ddNTPs are added, and non-incorporated nucleotides
are washed away. Unlike pyrosequencing, the DNA can only be
extended one nucleotide at a time. A camera takes images of the
fluorescently labelled nucleotides then the dye along with the
terminal 3' blocker is chemically removed from the DNA, allowing a
next cycle. This may be repeated until the required sequence data
is obtained. Using this technology, thousands of nucleic acids may
be sequenced simultaneously on a single slide.
[0186] Other high-throughput sequencing techniques may be equally
suitable for the methods of the invention, e.g. pyrosequencing. In
this method the DNA is amplified inside water droplets in an oil
solution (emulsion PCR), with each droplet containing a single DNA
template attached to a single primer-coated bead that then forms a
clonal colony. The sequencing machine contains many
picolitre-volume wells each containing a single bead and sequencing
enzymes. Pyrosequencing uses luciferase to generate light for
detection of the individual nucleotides added to the nascent DNA
and the combined data are used to generate sequence read-outs.
[0187] An example of a technology in development is based on the
detection of hydrogen ions that are released during the
polymerisation of DNA. A microwell containing a template DNA strand
to be sequenced is flooded with a single type of nucleotide. If the
introduced nucleotide is complementary to the leading template
nucleotide it is incorporated into the growing complementary
strand. This causes the release of a hydrogen ion that triggers a
hypersensitive ion sensor, which indicates that a reaction has
occurred. If homopolymer repeats are present in the template
sequence multiple nucleotides will be incorporated in a single
cycle. This leads to a corresponding number of released hydrogen
ions and a proportionally higher electronic signal.
[0188] Thus, it is clear that future sequencing formats are slowly
being made available, and with shorter run times as one of the main
features of those platforms it will be evident that other
sequencing technologies will be useful in the methods of the
invention.
[0189] An essential feature of the present invention, as described
above, is a step of securing a complementary strand of the captured
nucleic acid molecules to the capture probe, e.g. reverse
transcribing the captured RNA molecules. The reverse transcription
reaction is well known in the art and in representative reverse
transcription reactions, the reaction mixture includes a reverse
transcriptase, dNTPs and a suitable buffer. The reaction mixture
may comprise other components, e.g. RNase inhibitor(s). The primers
and template are the capture domain of the capture probe and the
captured RNA molecules are described above. In the subject methods,
each dNTP will typically be present in an amount ranging from about
10 to 5000 .mu.M, usually from about 20 to 1000 .mu.M. It will be
evident that an equivalent reaction may be performed to generate a
complementary strand of a captured DNA molecule, using an enzyme
with DNA polymerase activity. Reactions of this type are well known
in the art and are described in more detail below.
[0190] The desired reverse transcriptase activity may be provided
by one or more distinct enzymes, wherein suitable examples are:
M-MLV, MuLV, AMV, HIV, ArrayScript.TM. MultiScribe.TM.,
ThermoScript.TM., and SuperScript.RTM. I, II, and III enzymes.
[0191] The reverse transcriptase reaction may be carried out at any
suitable temperature, which will be dependent on the properties of
the enzyme. Typically, reverse transcriptase reactions are
performed between 37-55.degree. C., although temperatures outside
of this range may also be appropriate. The reaction time may be as
little as 1, 2, 3, 4 or 5 minutes or as much as 48 hours. Typically
the reaction will be carried out for between 5-120 minutes,
preferably 5-60, 5-45 or 5-30 minutes or 1-10 or 1-5 minutes
according to choice. The reaction time is not critical and any
desired reaction time may be used.
[0192] As indicated above, certain embodiments of the methods
include an amplification step, where the copy number of generated
DNA, e.g. cDNA molecules is increased, e.g., in order to enrich the
sample to obtain a better representation of the nucleic acids, e.g.
transcripts captured from the tissue sample. The amplification may
be linear or exponential, as desired, where representative
amplification protocols of interest include, but are not limited
to: polymerase chain reaction (PCR); isothermal amplification,
etc.
[0193] The polymerase chain reaction (PCR) is well known in the
art, being described in U.S. Pat. Nos. 4,683,202; 4,683,195;
4,800,159; 4,965,188 and 5,512,462, the disclosures of which are
herein incorporated by reference. In representative PCR
amplification reactions, the reaction mixture that includes the
above released DNA, e.g. cDNA molecules from the array, which are
combined with one or more primers that are employed in the primer
extension reaction, e.g., the PCR primers that hybridize to the
first and/or second amplification domains (such as forward and
reverse primers employed in geometric (or exponential)
amplification or a single primer employed in a linear
amplification). The oligonucleotide primers with which the released
DNA, e.g. cDNA molecules (hereinafter referred to as template DNA
for convenience) is contacted will be of sufficient length to
provide for hybridization to complementary template DNA under
annealing conditions (described in greater detail below). The
length of the primers will depend on the length of the
amplification domains, but will generally be at least 10 bp in
length, usually at least 15 bp in length and more usually at least
16 bp in length and may be as long as 30 bp in length or longer,
where the length of the primers will generally range from 18 to 50
bp in length, usually from about 20 to 35 bp in length. The
template DNA may be contacted with a single primer or a set of two
primers (forward and reverse primers), depending on whether primer
extension, linear or exponential amplification of the template DNA
is desired.
[0194] In addition to the above components, the reaction mixture
produced in the subject methods typically includes a polymerase and
deoxyribonucleoside triphosphates (dNTPs), The desired polymerase
activity may be provided by one or more distinct polymerase
enzymes. In many embodiments, the reaction mixture includes at
least a Family A polymerase, where representative Family A
polymerases of interest include, but are not limited to: Thermus
aquaticus polymerases, including the naturally occurring polymerase
(Taq) and derivatives and homologues thereof, such as Klentaq (as
described in Barnes et al, Proc. Natl. Acad. Sci USA (1994)
91:2216-2220); Thermus thermophilus polymerases, including the
naturally occurring polymerase (Tth) and derivatives and homologues
thereof, and the like. In certain embodiments where the
amplification reaction that is carried out is a high fidelity
reaction, the reaction mixture may further include a polymerase
enzyme having 3'-5' exonuclease activity, e.g., as may be provided
by a Family B polymerase, where Family B polymerases of interest
include, but are not limited to: Thermococcus litoralis DNA
polymerase (Vent) as described in Perler et al., Proc. Natl. Acad.
Sci. USA (1992) 89:5577-5581: Pyrococcus species GB-D (Deep Vent);
Pyrococcus furiosus DNA polymerase (Pfu) as described in Lundberg
et al., Gene (1991) 108:1-6, Pyrococcus woesei (Pfu) and the like.
Where the reaction mixture includes both a Family A and Family B
polymerase, the Family A polymerase may be present in the reaction
mixture in an amount greater than the Family B polymerase, where
the difference in activity will usually be at least 10-fold, and
more usually at least about 100-fold, Usually the reaction mixture
will include four different types of dNTPs corresponding to the
four naturally occurring bases present, i.e. dATP, dTTP, dCTP and
dGTP. In the subject methods, each dNTP will typically be present
in an amount ranging from about 10 to 5000 .mu.M, usually from
about 20 to 1000 .mu.M.
[0195] The reaction mixtures prepared in the reverse transcriptase
and/or amplification steps of the subject methods may further
include an aqueous buffer medium that includes a source of
monovalent ions, a source of divalent cations and a buffering
agent. Any convenient source of monovalent ions, such as KCl,
K-acetate, NH.sub.4-acetate, K-glutamate, NH.sub.4Cl, ammonium
sulphate, and the like may be employed. The divalent cation may be
magnesium, manganese, zinc and the like, where the cation will
typically be magnesium. Any convenient source of magnesium cation
may be employed, including MgCl.sub.2, Mg-acetate, and the like.
The amount of Mg.sup.2+ present in the buffer may range from 0.5 to
10 mM, but will preferably range from about 3 to 6 mM, and will
ideally be at about 5 mM. Representative buffering agents or salts
that may be present in the buffer include Tris, Tricine, HEPES,
MOPS and the like, where the amount of buffering agent will
typically range from about 5 to 150 mM, usually from about 10 to
100 mM, and more usually from about 20 to 50 mM, where in certain
preferred embodiments the buffering agent will be present in an
amount sufficient to provide a pH ranging from about 6.0 to 9.5,
where most preferred is pH 7.3 at 72.degree. C. Other agents which
may be present in the buffer medium include chelating agents, such
as EDTA, EGTA and the like.
[0196] In preparing the reverse transcriptase, DNA extension or
amplification reaction mixture of the steps of the subject methods,
the various constituent components may be combined in any
convenient order. For example, in the amplification reaction the
buffer may be combined with primer, polymerase and then template
DNA, or all of the various constituent components may be combined
at the same time to produce the reaction mixture.
[0197] As discussed above, a preferred embodiment of the invention
the DNA, e.g. cDNA molecules may be modified by the addition of
amplification domains to the ends of the nucleic acid molecules,
which may involve a ligation reaction. A ligation reaction is also
required for the in situ synthesis of the capture probe on the
array, when the capture probe is immobilized indirectly on the
array surface.
[0198] As is known in the art, ligases catalyze the formation of a
phosphodiester bond between juxtaposed 3'-hydroxyl and 5'-phosphate
termini of two immediately adjacent nucleic acids. Any convenient
ligase may be employed, where representative ligases of interest
include, but are not limited to: Temperature sensitive and
thermostable ligases. Temperature sensitive ligases include, but
are not limited to, bacteriophage T4 DNA ligase, bacteriophage T7
ligase, and E. coli ligase. Thermostable ligases include, but are
not limited to, Taq ligase, Tth ligase, and Pfu ligase.
Thermostable ligase may be obtained from thermophilic or
hyperthermophilic organisms, including but not limited to,
prokaryotic, eukaryotic, or archael organisms. Certain RNA ligases
may also be employed in the methods of the invention.
[0199] In this ligation step, a suitable ligase and any reagents
that are necessary and/or desirable are combined with the reaction
mixture and maintained under conditions sufficient for ligation of
the relevant oligonucleotides to occur. Ligation reaction
conditions are well known to those of skill in the art. During
ligation, the reaction mixture in certain embodiments may be
maintained at a temperature ranging from about 4.degree. C. to
about 50.degree. C., such as from about 20.degree. C. to about
37.degree. C. for a period of time ranging from about 5 seconds to
about 16 hours, such as from about 1 minute to about 1 hour. In yet
other embodiments, the reaction mixture may be maintained at a
temperature ranging from about 35.degree. C. to about 45.degree.
C., such as from about 37.degree. C. to about 42.degree. C., e.g.,
at or about 38.degree. C., 39.degree. C., 40.degree. C. or
41.degree. C., for a period of time ranging from about 5 seconds to
about 16 hours, such as from about 1 minute to about 1 hour,
including from about 2 minutes to about 8 hours. In a
representative embodiment, the ligation reaction mixture includes
50 mM Tris pH7.5, 10 mM MgCl.sub.2, 10 mM DTT, 1 mM ATP, 25 mg/ml
BSA, 0.25 units/ml RNase inhibitor, and T4 DNA ligase at 0.125
units/ml. In yet another representative embodiment; 2.125 mM
magnesium ion, 0.2 units/ml RNase inhibitor; and 0.125 units/ml DNA
ligase are employed. The amount of adaptor in the reaction will be
dependent on the concentration of the DNA, e.g, cDNA in the sample
and will generally be present at between 10-100 times the molar
amount of DNA, e.g. cDNA.
[0200] By way of a representative example the method of the
invention may comprise the following steps:
[0201] (a) contacting an array with a tissue sample, wherein the
array comprises a substrate on which multiple species of capture
probes are directly or indirectly immobilized such that each
species occupies a distinct position on the array and is oriented
to have a free 3' end to enable said probe to function as a reverse
transcriptase (RT) primer, wherein each species of said capture
probe comprises a nucleic acid molecule with 5' to 3':
[0202] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0203] (ii) a capture domain;
[0204] such that RNA of the tissue sample hybridises to said
capture probes;
[0205] (b) imaging the tissue sample on the array;
[0206] (c) reverse transcribing the captured mRNA molecules to
generate cDNA molecules;
[0207] (d) washing the array to remove residual tissue;
[0208] (e) releasing at least part of the cDNA molecules from the
surface of the array;
[0209] (f) performing second strand cDNA synthesis on the released
cDNA molecules;
[0210] and
[0211] (g) analysing the sequence of (e.g. sequencing) the cDNA
molecules.
[0212] By way of an alternative representative example the method
of the invention may comprise the following steps:
[0213] (a) contacting an array with a tissue sample, wherein the
array comprises a substrate on which at least two species of
capture probes are directly or indirectly immobilized such that
each species occupies a distinct position on the array and is
oriented to have a free 3' end to enable said probe to function as
a reverse transcriptase (RT) primer, wherein each species of said
capture probe comprises a nucleic acid molecule with 5' to 3':
[0214] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0215] (ii) a capture domain;
[0216] such that RNA of the tissue sample hybridises to said
capture probes;
[0217] (b) optionally rehydrating the tissue sample;
[0218] (c) reverse transcribing the captured mRNA molecules to
generate first strand cDNA molecules and optionally synthesising
second strand cDNA molecules;
[0219] (d) imaging the tissue sample on the array;
[0220] (e) washing the array to remove residual tissue;
[0221] (f) releasing at least part of the cDNA molecules from the
surface of the array;
[0222] (g) amplifying the released cDNA molecules;
[0223] and
[0224] (h) analysing the sequence of (e.g. sequencing) the
amplified cDNA molecules.
[0225] By way of yet a further representative example the method of
the invention may comprise the following steps:
[0226] (a) contacting an array with a tissue sample, wherein the
array comprises a substrate on which multiple species of capture
probes are directly or indirectly immobilized such that each
species occupies a distinct position on the array and is oriented
to have a free 3' end to enable said probe to function as a reverse
transcriptase (RT) primer, wherein each species of said capture
probe comprises a nucleic acid molecule with 5' to 3': [0227] (i) a
positional domain that corresponds to the position of the capture
probe on the array, and [0228] (ii) a capture domain;
[0229] such that RNA of the tissue sample hybridises to said
capture probes;
[0230] (b) optionally imaging the tissue sample on the array;
[0231] (c) reverse transcribing the captured mRNA molecules to
generate cDNA molecules;
[0232] (d) optionally imaging the tissue sample on the array if not
already performed as step (b):
[0233] (e) washing the array to remove residual tissue;
[0234] (f) releasing at least part of the cDNA molecules from the
surface of the array;
[0235] (g) performing second strand cDNA synthesis on the released
cDNA molecules;
[0236] (h) amplifying the double stranded cDNA molecules;
[0237] (i) optionally purifying the cDNA molecules to remove
components that may interfere with the sequencing reaction;
[0238] and
[0239] (j) analysing the sequence of (e.g. sequencing) the
amplified cDNA molecules.
[0240] The present invention includes any suitable combination of
the steps in the above described methods. It will be understood
that the invention also encompasses variations of these methods,
for example where amplification is performed in situ on the array.
Also encompassed are methods which omit the imaging step.
[0241] The invention may also be seen to include a method for
making or producing an array (i) for use in capturing mRNA from a
tissue sample that is contacted with said array; or (ii) for use in
determining and/or analysing a (e.g. the partial or global)
transcriptome of a tissue sample, said method comprising
immobilizing, directly or indirectly, multiple species of capture
probe to an array substrate, wherein each species of said capture
probe comprises a nucleic acid molecule with 5' to 3': [0242] (i) a
positional domain that corresponds to the position of the capture
probe on the array; and [0243] (ii) a capture domain.
[0244] The method of producing an array of the invention may be
further defined such that each species of capture probe is
immobilized as a feature on the array.
[0245] The method of immobilizing the capture probes on the array
may be achieved using any suitable means as described herein. Where
the capture probes are immobilized on the array indirectly the
capture probe may be synthesized on the array. Said method may
comprise any one or more of the following steps:
[0246] (a) immobilizing directly or indirectly multiple surface
probes to an array substrate, wherein the surface probes comprise:
[0247] (i) a domain capable of hybridizing to part of the capture
domain oligonucleotide (a part not involved in capturing the
nucleic acid, e.g. RNA); [0248] (ii) a complementary positional
domain; and [0249] (iii) a complementary universal domain;
[0250] (b) hybridizing to the surface probes immobilized on the
array capture domain oligonucleotides and universal domain
oligonucleotides;
[0251] (c) extending the universal domain oligonucleotides, by
templated polymerisation, to generate the positional domain of the
capture probe; and
[0252] (d) ligating the positional domain to the capture domain
oligonucleotide to produce the capture oligonucleotide.
[0253] Ligation in step (d) may occur simultaneously with extension
in step (c). Thus it need not be carried out in a separate step,
although this is course encompassed if desired.
[0254] The features of the array produced by the above method of
producing the array of the invention, may be further defined in
accordance with the above description.
[0255] Although the invention is described above with reference to
detection or analysis of RNA, and transcriptome analysis or
detection, it will be appreciated that the principles described can
be applied analogously to the detection or analysis of DNA in cells
and to genomic studies. Thus, more broadly viewed, the invention
can be seen as being generally applicable to the detection of
nucleic acids in general and in a further more particular aspect,
as providing methods for the analysis or detection of DNA. Spatial
information may be valuable also in a genomics context i.e.
detection and/or analysis of a DNA molecule with spatial
resolution. This may be achieved by genomic tagging according to
the present invention. Such localized or spatial detection methods
may be useful for example in the context of studying genomic
variations in different cells or regions of a tissue, for example
comparing normal and diseased cells or tissues (e.g. normal vs
tumour cells or tissues) or in studying genomic changes in disease
progression etc. For example, tumour tissues may comprise a
heterogeneous population of cells which may differ in the genomic
variants they contain (e.g. mutations and/or other genetic
aberrations, for example chromosomal rearrangements, chromosomal
amplifications/deletions/insertions etc.). The detection of genomic
variations, or different genomic loci, in different cells in a
localized way may be useful in such a context, e.g. to study the
spatial distribution of genomic variations. A principal utility of
such a method would be in tumour analysis. In the context of the
present invention, an array may be prepared which is designed, for
example, to capture the genome of an entire cell on one feature.
Different cells in the tissue sample may thus be compared. Of
course the invention is not limited to such a design and other
variations may be possible, wherein the DNA is detected in a
localized way and the position of the DNA captured on the array is
correlated to a position or location in the tissue sample.
[0256] Accordingly, in a more general aspect, the present invention
can be seen to provide a method for localized detection of nucleic
acid in a tissue sample comprising:
[0257] (a) providing an array comprising a substrate on which
multiple species of capture probes are directly or indirectly
immobilized such that each species occupies a distinct position on
the array and is oriented to have a free 3' end to enable said
probe to function as a primer for a primer extension or ligation
reaction, wherein each species of said capture probe comprises a
nucleic acid molecule with 5' to 3':
[0258] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0259] (ii) a capture domain;
[0260] (b) contacting said array with a tissue sample such that the
position of a capture probe on the array may be correlated with a
position in the tissue sample and allowing nucleic acid of the
tissue sample to hybridise to the capture domain in said capture
probes;
[0261] (c) generating DNA molecules from the captured nucleic acid
molecules using said capture probes as extension or ligation
primers, wherein said extended or ligated DNA molecules are tagged
by virtue of the positional domain;
[0262] (d) optionally generating a complementary strand of said
tagged DNA and/or optionally amplifying said tagged DNA;
[0263] (e) releasing at least part of the tagged DNA molecules
and/or their complements or amplicons from the surface of the
array, wherein said part includes the positional domain or a
complement thereof;
[0264] (f) directly or indirectly analysing the sequence of (e.g.
sequencing) the released DNA molecules.
[0265] As described in more detail above, any method of nucleic
acid analysis may be used in the analysis step. Typically this may
involve sequencing, but it is not necessary to perform an actual
sequence determination. For example sequence-specific methods of
analysis may be used. For example a sequence-specific amplification
reaction may be performed, for example using primers which are
specific for the positional domain and/or for a specific target
sequence, e.g. a particular target DNA to be detected (i.e.
corresponding to a particular cDNA/RNA or gene or gene variant or
genomic locus or genomic variant etc.). An exemplary analysis
method is a sequence-specific PCR reaction.
[0266] The sequence analysis (e.g. sequencing) information obtained
in step (f) may be used to obtain spatial information as to the
nucleic acid in the sample. In other words the sequence analysis
information may provide information as to the location of the
nucleic acid in the sample. This spatial information may be derived
from the nature of the sequence analysis information obtained e.g.
from a sequence determined or identified, for example it may reveal
the presence of a particular nucleic acid molecule which may itself
be spatially informative in the context of the tissue sample used,
and/or the spatial information (e.g. spatial localisation) may be
derived from the position of the tissue sample on the array,
coupled with the sequence analysis information. However, as
described above, spatial information may conveniently be obtained
by correlating the sequence analysis data to an image of the tissue
sample and this represents one preferred embodiment of the
invention.
[0267] Accordingly, in a preferred embodiment the method also
includes a step of: (g) correlating said sequence analysis
information with an image of said tissue sample, wherein the tissue
sample is imaged before or after step (c).
[0268] The primer extension reaction referred to in step (a) may be
defined as a polymerase-catalysed extension reaction and acts to
acquire a complementary strand of the captured nucleic acid
molecule that is covalently attached to the capture probe, i.e. by
synthesising the complementary strand utilising the capture probe
as a primer and the captured nucleic acid as a template. In other
words it may be any primer extension reaction carried out by any
polymerase enzyme. The nucleic acid may be RNA or it may be DNA.
Accordingly the polymerase may be any polymerase. It may be a
reverse transcriptase or it may be a DNA polymerase. The ligation
reaction may be carried out by any ligase and acts to secure the
complementary strand of the captured nucleic acid molecule to the
capture probe, i.e. wherein the captured nucleic acid molecule
(hybridised to the capture probe) is partially double stranded and
the complementary strand is ligated to the capture probe.
[0269] One preferred embodiment of such a method is the method
described above for the determination and/or analysis of a
transcriptome, or for the detection of RNA, In alternative
preferred embodiment the detected nucleic acid molecule is DNA. In
such an embodiment the invention provides a method for localized
detection of DNA in a tissue sample comprising:
[0270] (a) providing an array comprising a substrate on which
multiple species of capture probes are directly or indirectly
immobilized such that each species occupies a distinct position on
the array and is oriented to have a free 3' end to enable said
probe to function as a primer for a primer extension or ligation
reaction, wherein each species of said capture probe comprises a
nucleic acid molecule with 5' to 3':
[0271] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0272] (ii) a capture domain;
[0273] (b) contacting said array with a tissue sample such that the
position of a capture probe on the array may be correlated with a
position in the tissue sample and allowing DNA of the tissue sample
to hybridise to the capture domain in said capture probes;
[0274] (c) fragmenting DNA in said tissue sample, wherein said
fragmentation is carried out before, during or after contacting the
array with the tissue sample in step (b);
[0275] (d) extending said capture probes in a primer extension
reaction using the captured DNA fragments as templates to generate
extended DNA molecules, or ligating the captured DNA fragments to
the capture probes in a ligation reaction to generate ligated DNA
molecules, wherein said extended or ligated DNA molecules are
tagged by virtue of the positional domain;
[0276] (e) optionally generating a complementary strand of said
tagged DNA and/or optionally amplifying said tagged DNA;
[0277] (f) releasing at least part of the tagged DNA molecules
and/or their complements and/or amplicons from the surface of the
array, wherein said part includes the positional domain or a
complement thereof;
[0278] (g) directly or indirectly analysing the sequence of the
released DNA molecules.
[0279] The method may further include a step of:
[0280] (h) correlating said sequence analysis information with an
image of said tissue sample, wherein the tissue sample is imaged
before or after step (d).
[0281] In the context of spatial genomics, where the target nucleic
acid is DNA the inclusion of imaging and image correlation steps
may in some circumstances be preferred.
[0282] In embodiments in which DNA is captured, the DNA may be any
DNA molecule which may occur in a cell. Thus it may be genomic,
i.e. nuclear, DNA, mitochondrial DNA or plastid DNA, e.g.
chloroplast DNA. In a preferred embodiment, the DNA is genomic
DNA.
[0283] It will be understood that where fragmentation is carried
out after the contacting in step (b), i.e. after the tissue sample
is placed on the array, fragmentation occurs before the DNA is
hybridised to the capture domain. In other words the DNA fragments
are hybridised (or more particularly, allowed to hybridise) to the
capture domain in said capture probes.
[0284] Advantageously; but not necessarily; in a particular
embodiment of this aspect of the invention, the DNA fragments of
the tissue sample may be provided with a binding domain to enable
or facilitate their capture by the capture probes on the array.
Accordingly, the binding domain is capable of hybridising to the
capture domain of the capture probe. Such a binding domain may thus
be regarded as a complement of the capture domain (i.e. it may be
viewed as a complementary capture domain); although absolute
complementarity between the capture and binding domains is not
required, merely that the binding domain is sufficiently
complementary to allow a productive hybridisation to take place,
i.e. that the DNA fragments in the tissue sample are able to
hybridise to the capture domain of the capture probes. Provision of
such a binding domain may ensure that DNA in the sample does not
bind to the capture probes until after the fragmentation step. The
binding domain may be provided to the DNA fragments by procedures
well known in the art, for example by ligation of adaptor or linker
sequences which may contain the binding domain. For example a
linker sequence with a protruding end may be used. The binding
domain may be present in the single-stranded portion of such a
linker, such that following ligation of the linker to the DNA
fragments, the single-stranded portion containing the binding
domain is available for hybridisation to the capture domain of the
capture probes. Alternatively and in a preferred embodiment, the
binding domain may be introduced by using a terminal transferase
enzyme to introduce a polynucleotide tail e.g. a homopolymeric tail
such as a poly-A domain. This may be carried out using a procedure
analogous to that described above for introducing a universal
domain in the context of the RNA methods. Thus, in advantageous
embodiments a common binding domain may be introduced. In other
words, a binding domain which is common to all the DNA fragments
and which may be used to achieve the capture of the fragments on
the array.
[0285] Where a tailing reaction is carried out to introduce a
(common) binding domain, the capture probes on the array may be
protected from the tailing reaction, i.e, the capture probes may be
blocked or masked as described above. This may be achieved for
example by hybridising a blocking oligonucleotide to the capture
probe e.g. to the protruding end (e.g. single stranded portion) of
the capture probe. Where the capture domain comprises a poly-T
sequence for example, such a blocking oligonucleotide may be a
poly-A oligonucleotide. The blocking oligonucleotide may have a
blocked 3' end (i.e. an end incapable of being extended, or
tailed). The capture probes may also be protected, i.e. blocked, by
chemical and/or enzymatic modifications, as described in detail
above.
[0286] Where the binding domain is provided by ligation of a linker
as described above, it will be understood that rather than
extending the capture probe to generate a complementary copy of the
captured DNA fragment which comprises the positional tag of the
capture probe primer, the DNA fragment may be ligated to the 3' end
of the capture probe. As noted above ligation requires that the 5'
end to be ligated is phosphorylated. Accordingly, in one
embodiment, the 5' end of the added linker, namely the end which is
to be ligated to the capture probe (i.e. the non-protruding end of
the linker added to the DNA fragments) will be phosphorylated. In
such a ligation embodiment, it will accordingly be seen that a
linker may be ligated to double stranded DNA fragments, said linker
having a single stranded protruding 3' end which contains the
binding domain. Upon contact with the array, the protruding end
hybridises to the capture domain of the capture probes. This
hybridisation brings the 3' end of the capture probe into
juxtaposition for ligation to the 5' (non-protruding) end of the
added linker. The capture probe, and hence the positional domain,
is thus incorporated into the captured DNA fragment by this
ligation. Such an embodiment is shown schematically in FIG. 21.
[0287] Thus, the method of this aspect of the invention may in a
more particular embodiment comprise:
[0288] (a) providing an array comprising a substrate on which
multiple species of capture probes are directly or indirectly
immobilized such that each species occupies a distinct position on
the array and is oriented to have a free 3' end to enable said
probe to function as a primer for a primer extension or ligation
reaction, wherein each species of said capture probe comprises a
nucleic acid molecule with 5' to 3': [0289] (i) a positional domain
that corresponds to the position of the capture probe on the array,
and [0290] (ii) a capture domain;
[0291] (b) contacting said array with a tissue sample such that the
position of a capture probe on the array may be correlated with a
position in the tissue sample;
[0292] (c) fragmenting DNA in said tissue sample, wherein said
fragmentation is carried out before, during or after contacting the
array with the tissue sample in step (b);
[0293] (d) providing said DNA fragments with a binding domain which
is capable of hybridising to said capture domain;
[0294] (e) allowing said DNA fragments to hybridise to the capture
domain in said capture probes;
[0295] (f) extending said capture probes in a primer extension
reaction using the captured DNA fragments as templates to generate
extended DNA molecules, or ligating the captured DNA fragments to
the capture probes in a ligation reaction to generate ligated DNA
molecules, wherein said extended or ligated DNA molecules are
tagged by virtue of the positional domain;
[0296] (g) optionally generating a complementary strand of said
tagged DNA and/or optionally amplifying the tagged DNA;
[0297] (h) releasing at least part of the tagged DNA molecules
and/or their complements and/or amplicons from the surface of the
array, wherein said part includes the positional domain or a
complement thereof;
[0298] (i) directly or indirectly analysing the sequence of the
released DNA molecules.
[0299] The method may optionally include a further step of
[0300] (j) correlating said sequence analysis information with an
image of said tissue sample, wherein the tissue sample is imaged
before or after step (f).
[0301] In the methods of nucleic acid or DNA detection set out
above, the optional step of generating a complementary copy of the
tagged nucleic acid/DNA or of amplifying the tagged DNA, may
involve the use of a strand displacing polymerase enzyme, according
to the principles explained above in the context of the
RNA/transcriptome analysis/detection methods. Suitable strand
displacing polymerases are discussed above. This is to ensure that
the positional domain is copied into the complementary copy or
amplicon. This will particularly be the case where the capture
probe is immobilized on the array by hybridisation to a surface
probe.
[0302] However, the use of a strand displacing polymerase in this
step is not essential. For example a non-strand displacing
polymerase may be used together with ligation of an oligonucleotide
which hybridises to the positional domain. Such a procedure is
analogous to that described above for the synthesis of capture
probes on the array.
[0303] In one embodiment, the method of the invention may be used
for determining and/or analysing all of the genome of a tissue
sample e.g. the global genome of a tissue sample. However, the
method is not limited to this and encompasses determining and/or
analysing all or part of the genome. Thus, the method may involve
determining and/or analysing a part or subset of the genome, e.g. a
partial genome corresponding to a subset or group of genes or of
chromosomes, e.g, a set of particular genes or chromosomes or a
particular region or part of the genome, for example related to a
particular disease or condition, tissue type etc. Thus, the method
may be used to detect or analyse genomic sequences or genomic loci
from tumour tissue as compared to normal tissue, or even within
different types of cell in a tissue sample. The presence or
absence, or the distribution or location of different genomic
variants or loci in different cells, groups of cells, tissues or
parts or types of tissue may be examined.
[0304] Viewed from another aspect, the method steps set out above
can be seen as providing a method of obtaining spatial information
regarding the nucleic acids, e.g. genomic sequences, variants or
loci of a tissue sample. Put another way, the methods of the
invention may be used for the labelling (or tagging) of genomes,
particularly individual or spatially distributed genomes.
[0305] Alternatively viewed, the method of the invention may be
seen as a method for spatial detection of DNA in a tissue sample,
or a method for detecting DNA with spatial resolution, or for
localized or spatial determination and/or analysis of DNA in a
tissue sample. In particular, the method may be used for the
localized or spatial detection or determination and/or analysis of
genes or genomic sequences or genomic variants or loci (e.g.
distribution of genomic variants or loci) in a tissue sample. The
localized/spatial detection/determination/analysis means that the
DNA may be localized to its native position or location within a
cell or tissue in the tissue sample. Thus for example, the DNA may
be localized to a cell or group of cells, or type of cells in the
sample, or to particular regions of areas within a tissue sample.
The native location or position of the DNA (or in other words, the
location or position of the DNA in the tissue sample), e.g. a
genomic variant or locus, may be determined.
[0306] It will be seen therefore that the array of the present
invention may be used to capture nucleic acid, e.g. DNA of a tissue
sample that is contacted with said array. The array may also be
used for determining and/or analysing a partial or global genome of
a tissue sample or for obtaining a spatially defined partial or
global genome of a tissue sample. The methods of the invention may
thus be considered as methods of quantifying the spatial
distribution of one or more genomic sequences (or variants or loci)
in a tissue sample. Expressed another way, the methods of the
present invention may be used to detect the spatial distribution of
one or more genomic sequences or genomic variants or genomic lad in
a tissue sample. In yet another way, the methods of the present
invention may be used to determine simultaneously the location or
distribution of one or more genomic sequences or genomic variants
or genomic loci at one or more positions within a tissue sample.
Still further, the methods may be seen as methods for partial or
global analysis of the nucleic acid e.g. DNA of a tissue sample
with spatial resolution e.g. two-dimensional spatial
resolution.
[0307] The invention can also be seen to provide an array for use
in the methods of the invention comprising a substrate on which
multiple species of capture probes are directly or indirectly
immobilized such that each species occupies a distinct position on
the array and is oriented to have a free 3' end to enable said
probe to function as an extension or ligation primer, wherein each
species of said capture probe comprises a nucleic acid molecule
with 5' to 3':
[0308] (i) a positional domain that corresponds to the position of
the capture probe on the array, and
[0309] (ii) a capture domain to capture nucleic acid of a tissue
sample that is contacted with said array.
[0310] In one aspect the nucleic acid molecule to be captured is
DNA. The capture domain may be specific to a particular DNA to be
detected, or to a particular class or group of DNAs, e.g, by virtue
of specific hybridisation to a specific sequence of motif in the
target DNA e.g. a conserved sequence, by analogy to the methods
described in the context of RNA detection above. Alternatively the
DNA to be captured may be provided with a binding domain, e.g. a
common binding domain as described above, which binding domain may
be recognised by the capture domain of the capture probes. Thus, as
noted above, the binding domain may for example be a homopolymeric
sequence e.g. poly-A. Again such a binding domain may be provided
according to or analogously to the principles and methods described
above in relation to the methods for RNA/transcriptome analysis or
detection. In such a case, the capture domain may be complementary
to the binding domain introduced into the DNA molecules of the
tissue sample.
[0311] As also described in the RNA context above, the capture
domain may be a random or degenerate sequence. Thus, DNA may be
captured non-specifically by binding to a random or degenerate
capture domain or to a capture domain which comprises at least
partially a random or degenerate sequence.
[0312] In a related aspect, the present invention also provides use
of an array, comprising a substrate on which multiple species of
capture probe are directly or indirectly immobilized such that each
species occupies a distinct position on the array and is oriented
to have a free 3' end to enable said probe to function as a primer
for a primer extension or ligation reaction, wherein each species
of said capture probe comprises a nucleic acid molecule with 5' to
3':
[0313] (i) a positional domain that corresponds to the position of
the capture probe on the array; and
[0314] (ii) a capture domain;
[0315] to capture nucleic acid, e.g. DNA or RNA, of a tissue sample
that is contacted with said array.
[0316] Preferably, said use is for localized detection of nucleic
acid in a tissue sample and further comprises steps of:
[0317] (a) generating DNA molecules from the captured nucleic acid
molecules using said capture probes as extension or ligation
primers, wherein said extended or ligated molecules are tagged by
virtue of the positional domain;
[0318] (b) optionally generating a complementary strand of said
tagged nucleic acid and/or amplifying said tagged nucleic acid;
[0319] (c) releasing at least part of the tagged DNA molecules
and/or their complements or amplicons from the surface of the
array, wherein said part includes the positional domain or a
complement thereof;
[0320] (d) directly or indirectly analysing the sequence of the
released DNA molecules; and optionally
[0321] (e) correlating said sequence analysis information with an
image of said tissue sample, wherein the tissue sample is imaged
before or after step (a).
[0322] The step of fragmenting DNA in a tissue sample may be
carried out using any desired procedure known in the art. Thus
physical methods of fragmentation may be used e.g. sonication or
ultrasound treatment. Chemical methods are also known. Enzymatic
methods of fragmentation may also be used, e.g. with endonucleases,
for example restriction enzymes. Again methods and enzymes for this
are well known in the art. Fragmentation may be done before during
or after preparing the tissue sample for placing on an array, e.g.
preparing a tissue section. Conveniently, fragmentation may be
achieved in the step of fixing tissue. Thus for example, formalin
fixation will result in fragmentation of DNA. Other fixatives may
produce similar results.
[0323] In terms of the detail of preparing and using the arrays in
these aspects of the invention, it will understood that the
description and detail given above in the context of RNA methods
applies analogously to the more general nucleic acid detection and
DNA detection methods set out herein. Thus, all aspects and details
discussed above apply analogously. For example, the discussion of
reverse transcriptase primers and reactions etc may be applied
analogously to any aspect of the extension primers, polymerase
reactions etc. referred to above. Likewise, references and to first
and second strand cDNA synthesis may be applied analogously to the
tagged DNA molecule and its complement. Methods of sequence
analysis as discussed above may be used.
[0324] By way of example, the capture domain may be as described
for the capture probes above. A poly-T or poly-T-containing capture
domain may be used for example where the DNA fragments are provided
with a binding domain comprising a poly-A sequence.
[0325] The capture probes/tagged DNA molecules (i.e. the tagged
extended or ligated molecules) may be provided with universal
domains as described above, e.g. for amplification and/or
cleavage.
[0326] The invention will be further described with reference to
the following non-limiting Examples with reference to the following
drawings in which:
[0327] FIG. 1 shows the overall concept using arrayed "barcoded"
oligo-dT probes to capture mRNA from tissue sections for
transcriptome analysis.
[0328] FIG. 2 shows the a schematic for the visualization of
transcript abundance for corresponding tissue sections.
[0329] FIG. 3 shows 3' to 5' surface probe composition and
synthesis of 5' to 3' oriented capture probes that are indirectly
immobilized at the array surface.
[0330] FIG. 4 shows a bar chart demonstrating the efficiency of
enzymatic cleavage (USER or Rsal) from in-house manufactured arrays
and by 99.degree. C. water from Agilent manufactured arrays, as
measured by hybridization of fluorescently labelled probes to the
array surface after probe release.
[0331] FIG. 5 shows a fluorescent image captured after 99.degree.
C. water mediated release of DNA surface probes from commercial
arrays manufactured by Agilent. A fluorescent detection probe was
hybridized after hot water treatment. Top array is an untreated
control.
[0332] FIG. 6 shows a fixated mouse brain tissue section on top of
the transcriptome capture array post cDNA synthesis and treated
with cytoplasmic (top) and nucleic stains (middle), respectively,
and merged image showing both stains (bottom).
[0333] FIG. 7 shows a table that lists the reads sorted for their
origin across the low density in-house manufactured DNA-capture
array as seen in the schematic representation.
[0334] FIG. 8 shows a FFPE mouse brain tissue with nucleic and Map2
specific stains using a barcoded microarray.
[0335] FIG. 9 shows FFPE mouse brain olfactory bulb with nucleic
stain (white) and visible morphology.
[0336] FIG. 10 shows FFPE mouse brain olfactory bulb (approx
2.times.2 mm) with nucleic stain (white), overlaid with theoretical
spotting pattern for low resolution array.
[0337] FIG. 11 shows FFPE mouse brain olfactory bulb (approx
2.times.2 mm) with nucleic stain (white), overlaid with theoretical
spotting pattern for medium-high resolution array.
[0338] FIG. 12 shows FFPE mouse brain olfactory bulb zoomed in on
glomerular area (top right of FIG. 9).
[0339] FIG. 13 shows the resulting product from a USER release
using a random hexamer primer (R6) coupled to the B_handle (B_R6)
during amplification; product as depicted on a bioanalyzer.
[0340] FIG. 14 shows the resulting product from a USER release
using a random octamer primer (R8) coupled to the B_handle (B_R8)
during amplification; product as depicted on a bioanalyzer.
[0341] FIG. 15 shows the results of an experiment performed on FFPE
brain tissue covering the whole array, ID5 (left) and ID20 (right)
amplified with ID specific and gene specific primers (B2M exon 4)
after synthesis and release of cDNA from surface; ID5 and ID20
amplified.
[0342] FIG. 16 shows a schematic illustration of the principle of
the method described in Example 4, i.e. use of microarrays with
immobilized DNA oligos (capture probes) carrying spatial labeling
tag sequences (positional domains). Each feature of oligos of the
microarray carries a 1) a unique labeling tag (positional domain)
and 2) a capture sequence (capture domain).
[0343] FIG. 17 shows the results of the spatial genomics protocol
described in Example 5 carried out with genomic DNA prefragmented
to mean size of 200 bp. Internal products amplified on array
labeled and synthesized DNA, The detected peak is of expected
size.
[0344] FIG. 18 shows the results of the spatial genomics protocol
described in Example 5 carried out with genomic DNA prefragmented
to mean size of 700 bp. Internal products amplified on array
labeled and synthesized DNA. The detected peak is of expected
size.
[0345] FIG. 19 shows the results of the spatial genomics protocol
described in Example 5 carried out with genomic DNA prefragmented
to mean size of 200 bp. Products amplified with one internal primer
and one universal sequence contained in the surface oligo.
Amplification carried out on array labeled and synthesized DNA. The
expected product is a smear given that the random fragmentation and
terminal transferase labeling of genomic DNA will generate a very
diverse sample pool.
[0346] FIG. 20 shows the results of the spatial genomics protocol
described in Example 5 carried out with genomic DNA prefragmented
to mean size of 700 bp. Products amplified with one internal primer
and one universal sequence contained in the surface oligo.
Amplification carried out on array labeled and synthesized DNA. The
expected product is a smear given that the random fragmentation and
terminal transferase labeling of genomic DNA will generate a very
diverse sample pool.
[0347] FIG. 21 shows a schematic illustration of the ligation of a
linker to a DNA fragment to introduce a binding domain for
hybridisation to a poly-T capture domain, and subsequent ligation
to the capture probe,
[0348] FIG. 22 shows the composition of 5' to 3' oriented capture
probes used on high-density capture arrays.
[0349] FIG. 23 shows the frame of the high-density arrays, which is
used to orientate the tissue sample, visualized by hybridization of
fluorescent marker probes.
[0350] FIG. 24 shows capture probes cleaved and non-cleaved from
high-density array, wherein the frame probes are not cleaved since
they do not contain uracil bases. Capture probes were labelled with
fluorophores coupled to poly-A oligonucleotides.
[0351] FIG. 25 shows a bioanalyzer image of a prepared sequencing
library with transcripts captured from mouse olfactory bulb.
[0352] FIG. 26 shows a Matlab visualization of captured transcripts
from total RNA extracted from mouse olfactory bulb.
[0353] FIG. 27 shows Olfr (olfactory receptor) transcripts as
visualized across the capture array using Matlab visualization
after capture from mouse olfactory bulb tissue.
[0354] FIG. 28 shows a pattern of printing for in-house 41-ID-tag
microarrays.
[0355] FIG. 29 shows a spatial genomics library generated from a
A431 specific translocation after capture of poly-A tailed genomic
fragments on capture array.
[0356] FIG. 30 shows the detection of A431 specific translocation
after capture of spiked 10% and 50% poly-A tailed A431 genomic
fragments into poly-A tailed U2OS genomic fragments on capture
array.
[0357] FIG. 31 shows a Matlab visualization of captured ID-tagged
transcripts from mouse olfactory bulb tissue on 41-ID-tag in-house
arrays overlaid with the tissue image. For clarity, the specific
features on which particular genes were identified have been
circled.
EXAMPLE
Preparation of the Array
[0358] The following experiments demonstrate how oligonucleotide
probes may be attached to an array substrate by either the 5' or 3'
end to yield an array with capture probes capable of hybridizing to
mRNA.
Preparation of In-House Printed Microarray with 5' to 3' Oriented
Probes
[0359] 20 RNA-capture oligonucleotides with individual tag
sequences (Tag 1-20, Table 1 were spotted on glass slides to
function as capture probes. The probes were synthesized with a
5'-terminus amino linker with a C6 spacer. All probes where
synthesized by Sigma-Aldrich (St. Louis, Mo., USA). The RNA-capture
probes were suspended at a concentration of 20 .mu.M in 150 mM
sodium phosphate, pH 8.5 and were spotted using a Nanoplotter
NP2.1/E (Gesim, Grosserkmannsdorf, Germany) onto CodeLink.TM.
Activated microarray slides (7.5 cm.times.2.5 cm; Surmodics, Eden
Prairie, Minn., USA). After printing, surface blocking was
performed according to the manufacturers instructions. The probes
were printed in 16 identical arrays on the slide, and each array
contained a pre-defined printing pattern. The 16 sub-arrays were
separated during hybridization by a 16-pad mask (ChipClip.TM.
Schleicher & Schuell BioScience, Keene, N.H., USA).
TABLE-US-00001 TABLE 1 Name Sequence 5' mod 3' mod Length Sequences
for free 3' capture probes TAP-ID1
UUAAGTACAAATCTCGACTGCCACTCTGAACCTTCTCCTTCTCCTTCACCTTTTTTTTTTTTTTTT-
TTTTVN Amino-C6 72 (SEQ ID NO: 1) Enzymatic recog UUAAGTACAA (SEQ
ID NO: 2) 10 Universal amp handle P ATCTCGACTGCCACTCTGAA (SEQ ID
NO: 3) 20 ID1 CCTTCTCCTTCTCCTTCACC (SEQ ID NO: 4) 20 Capture
sequence TTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 5) 22 ID1
CCTTCTCCTTCTCCTTCACC (SEQ ID NO: 6) 20 ID2 CCTTGCTGCTTCTCCTCCTC
(SEQ ID NO: 7) 20 ID3 ACCTCCTCCGCCTCCTCCTC (SEQ ID NO: 8) 20 ID4
GAGACATACCACCAAGAGAC (SEQ ID NO: 9) 20 ID5 GTCCTCTATTCCGTCACCAT
(SEQ ID NO: 10) 20 ID6 GACTGAGCTCGAACATATGG (SEQ ID NO: 11) 20 ID7
TGGAGGATTGACACAGAACG (SEQ ID NO: 12) 20 ID8 CCAGCCTCTCCATTACATCG
(SEQ ID NO: 13) 20 ID9 AAGATCTACCAGCCAGCCAG (SEQ ID NO: 14) 20 ID10
CGAACTTCCACTGTCTCCTC (SEQ ID NO: 15) 20 ID11 TTGCGCCTTCTCCAATACAC
(SEQ ID NO: 16) 20 ID12 CTCTTCTTAGCATGCCACCT (SEQ ID NO: 17) 20
ID13 ACCACTTCTGCATTACCTCC (SEQ 1D NO: 18) 20 ID14
ACAGCCTCCTCTTCTTCCTT (SEQ ID NO: 19) 20 ID15 AATCCTCTCCTTGCCAGTTC
(SEQ ID NO: 20) 20 ID16 GATGCCTCCACCTGTAGAAC (SEQ ID NO: 21) 20
ID17 GAAGGAATGGAGGATATCGC (SEQ ID NO: 22) 20 ID18
GATCCAAGGACCATCGACTG (SEQ ID NO: 23) 20 ID19 CCACTGGAACCTGACAACCG
(SEQ ID NO: 24) 20 ID20 CTGCTTCTTCCTGGAACTCA (SEQ ID NO: 25) 20
Sequences for free 5 surface probes and on-chip free 3' capture
probe synthesis Free 5' surface probe-A
GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCATATCGGACAGATCGGAAGAGCGTAGTGTAG
Amino C7 66 (SEQ ID NO: 26) Free 5' surface probe-U
GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCATATCGGACGGCTGCTGGTAAATAGAGATCA
Amino C7 66 (SEQ ID NO: 27) Nick GCG 3 LP' TTCAGAGTGGCAGTCGAGATCAC
(SEQ ID NO: 28) 23 ID' GCGGCAATCATATCGGAC (SEQ ID NO: 29) 18 A' 22
bp MutY mismatch AGATCGGAAGAGCGTAGTGTAG (SEQ ID NO: 30) 22 U' 22 bp
MutY mismatch GGCTGCTGGTAAATAGAGATCA (SEQ ID NO: 31) Hybridized
sequences for capture probe synthesis Illumina amp handle A
AACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 32) 33 Universa ampl
handle U AAGTGTGGAAAGTTGATCGCTATTTACCAGCAGCC (SEQ ID NO: 33) 35
Capture_LP_Poly-dTVN GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTTTTTTTTTVN
(SEQ ID NO: 34) Phosphorylated 45 Capture_LP_Poly-d24T
GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTTTTTTTTTTTTT (SEQ ID NO: 35)
Phosphorylated 47 Additional secondary universal amplification
handles Illumina amp handle B AGACGTGTGCTCTTCCGATCT (SEQ ID NO: 36)
21 Universal amp handle X ACGTCTGTGAATAGCCGCAT (SEQ ID NO: 37) 20
B_R6 handle (or X) AGACGTGTGCTCTTCCGATCTNNNNNNNN (SEQ ID NO: 38)
27(26) B_R8 handle (or X) AGACGTGTGCTCTTCCGATCTNNNNNNNNNN (SEQ ID
NO: 39) 29(28) B_polyTVN (or X)
AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 40) 43(42)
B_poly24T (or X) AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTTTT (SEQ
ID NO: 41) 45(44) Amplification handle to incorporate A handle into
P handle products A_P handle
ACACTCTTTCCCTACACGACGCTCTTCCGATCTATCTCGACTGCCACTCTGAA (SEQ ID NO:
42) 53
[0360] Preparation of In-House Printed Microarray with 3' to 5'
Oriented Probes and Synthesis of 5' to 3' Oriented Capture
Probes
[0361] Printing of surface probe oligonucleotides was performed as
in the case with 5' to 3' oriented probes above, with an amino-07
linker at the 3' end, as shown in Table 1.
[0362] To hybridize primers for capture probe synthesis,
hybridization solution containing 4.times.SSC and 0.1% SDS, 2 .mu.M
extension primer (the universal domain oligonucleotide) and 2 .mu.M
thread joining primer (the capture domain oligonucleotide) was
incubated for 4 min at 50.degree. C. Meanwhile the in-house array
was attached to a ChipClip (Whatman). The array was subsequently
incubated at 50.degree. C. for 30 min at 300 rpm shake with 50
.mu.L of hybridization solution per well.
[0363] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake; 2) 0.2.times.SSC
for 1 min at 300 rpm shake; and 3) 0.1.times.SSC for 1 min at 300
rpm shake. The array was then spun dry and placed back in the
ChipClip.
[0364] For extension and ligation reaction (to generate the
positional domain of the capture probe) 50 .mu.L of enzyme mix
containing 10.times.Ampligase buffer, 2.5 U AmpliTaq DNA Polymerase
Stoffel Fragment (Applied Biosystems), 10 U Ampligase (Epicentre
Biotechnologies), dNTPs 2 mM each (Fermentas) and water, was
pipetted to each well. The array was subsequently incubated at
55.degree. C. for 30 min. After incubation the array was washed
according to the previously described array washing method but the
first step has the duration of 10 min instead of 6 min.
[0365] The method is depicted in FIG. 3.
[0366] Tissue Preparation
[0367] The following experiments demonstrate how tissue sample
sections may be prepared for use in the methods of the
invention.
[0368] Preparation of Fresh Frozen Tissue and Sectioning onto
Capture Probe Arrays
[0369] Fresh non-fixed mouse brain tissue was trimmed if necessary
and frozen down in -40.degree. C. cold isopentane and subsequently
mounted for sectioning with a cryostat at 10 .mu.m. A slice of
tissue was applied onto each capture probe array to be used.
[0370] Preparation of Formalin-Fixed Paraffin-Embedded (FFPE)
Tissue
[0371] Mouse brain tissue was fixed in 4.degree./s formalin at
4.degree. C. for 24 h. After that it was incubated as follows:
3.times. incubation in 70% ethanol for 1 hour; 1.times. incubation
in 80% ethanol for 1 hour; 1.times. incubation in 96% ethanol for 1
hour; 3.times. incubation in 100% ethanol for 1 hour; and 2.times.
incubation in xylene at room temperature for 1 h.
[0372] The dehydrated samples were then incubated in liquid low
melting paraffin 52-54.degree. C. for up to 3 hours, during which
the paraffin was changed once to wash out residual xylene. Finished
tissue blocks were then stored at RT. Sections were then cut at 4
.mu.m in paraffin with a microtome onto each capture probe array to
be used.
[0373] The sections were dried at 37.degree. C. on the array slides
for 24 hours and stored at RT.
[0374] Deparaffinization of FFPE Tissue
[0375] Formalin fixed paraffinized mouse brain 10 .mu.m sections
attached to CodeLink slides were deparaffinised in xylene twice
for: 10 min, 99.5% ethanol for 2 min; 96% ethanol for 2 min; 70%
ethanol for 2 min; and were then air dried.
[0376] cDNA Synthesis The following experiments demonstrate that
mRNA captured on the array from the tissue sample sections may be
used as template for cDNA synthesis.
[0377] cDNA Synthesis on Chip
[0378] A 16 well mask and Chip Clip slide holder from Whatman was
attached to a CodeLink slide. The SuperScript.TM.III One-step
RT-PCR System with Platinum.RTM.Taq DNA Polymerase from Invitrogen
was used when performing the cDNA synthesis. For each reaction 25
.mu.l 2.times. reaction mix (SuperScript.TM.III One-step RT-PCR
System with Platinum.RTM.Tag DNA Polymerase, Invitrogen), 22.5
.mu.l H.sub.2O and 0.5 .mu.l 100.times.BSA were mixed and heated to
50.degree. C. SuperScript III/Platinum Taq enzyme mix was added to
the reaction mix, 2 .mu.l per reaction, and 50 .mu.l of the
reaction mix was added to each well on the chip. The chip was
incubated at 50.degree. C. for 30 min (Thermomixer Comfort,
Eppendorf).
[0379] The reaction mix was removed from the wells and the slide
was washed with: 2.times.SSC, 0.1% SDS at 50.degree. C. for 10 min;
0.2.times.SSC at room temperature for 1 min; and 0.1.times.SSC at
room temperature for 1 min. The chip was then spin dried.
[0380] In the case of FFPE tissue sections, the sections could now
be stained and visualized before removal of the tissue, see below
section on visualization.
[0381] Visualization
[0382] Hybridization of Fluorescent Marker Probes Prior to
Staining
[0383] Prior to tissue application fluorescent marker probes were
hybridized to features comprising marker oligonucleotides printed
on the capture probe array. The fluorescent marker probes aid in
the orientation of the resulting image after tissue visualization,
making it possible to combine the image with the resulting
expression profiles for individual capture probe "tag" (positional
domain) sequences obtained after sequencing. To hybridize
fluorescent probes a hybridization solution containing 4.times.SSC
and 0.1% SDS, 2 .mu.M detection probe (P) was incubated for 4 min
at 50.degree. C. Meanwhile the in-house array was attached to a
ChipClip (Whatman). The array was subsequently incubated at
50.degree. C. for 30 min at 300 rpm shake with 504 of hybridization
solution per well.
[0384] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.3SC for 1 min at 300
rpm shake. The array was then spun dry.
[0385] General Histological Staining of FFPE Tissue Sections Prior
to or Post cDNA Synthesis
[0386] FFPE tissue sections immobilized on capture probe arrays
were washed and rehydrated after deparaffinization prior to cDNA
synthesis as described previously, or washed after cDNA synthesis
as described previously. They are then treated as follows: incubate
for 3 minutes in Hematoxylin; rinse with deionized water; incubate
5 minutes in tap water; rapidly dip 8 to 12 times in acid ethanol;
rinse 2.times.1 minute in tap water; rinse 2 minutes in deionized
water; incubate 30 seconds in Eosin; wash 3.times.5 minutes in 95%
ethanol; wash 3.times.5 minutes in 100% ethanol; wash 3.times.10
minutes in xylene (can be done overnight); place coverslip on
slides using DPX; dry slides in the hood overnight.
[0387] General Immunohistochemistry Staining of a Target Protein in
FFPE Tissue Sections Prior to or Post cDNA Synthesis
[0388] FFPE tissue sections immobilized on capture probe arrays
were washed and rehydrated after deparaffinization prior to cDNA
synthesis as described previously, or washed after cDNA synthesis
as described previously. They were then treated as follows without
being allowed to dry during the whole staining process; sections
were incubated with primary antibody (dilute primary antibody in
blocking solution comprising 1.times.Tris Buffered Saline (50 mM
Tris. 150 mM NaCl, pH 7.6), 4% donkey serum and 0.1% triton-x) in a
wet chamber overnight at RT; rinse three times with 1.times.TBS;
incubate section with matching secondary antibody conjugated to a
fluorochrome (FITC, Cy3 or Cy5) in a wet chamber at RT for 1 hour.
Rinse 3.times. with 1.times.TBS, remove as much as possible of TBS
and mount section with ProLong Gold+DAPI (Invitrogen) and analyze
with fluorescence microscope and matching filter sets.
[0389] Removal of Residual Tissue
[0390] Frozen Tissue
[0391] For fresh frozen mouse brain tissue the washing step
directly following cDNA synthesis was enough to remove the tissue
completely.
[0392] FFPE Tissue
[0393] The slides with attached formalin fixed paraffinized mouse
brain tissue sections were attached to ChipClip slide holders and
16 well masks (Whatman). For each 150 .mu.l Proteinase K Digest
Buffer from the RNeasy FFPE kit (Qiagen), 10 .mu.l Proteinase K
Solution (Qiagen) was added. 50 .mu.l of the final mixture was
added to each well and the slide was incubated at 56.degree. C. for
30 min.
[0394] Capture Probe (cDNA) Release
[0395] Capture Probe Release with Uracil Cleaving USER Enzyme
Mixture in PCR Buffer (Covalently Attached Probes)
[0396] A 16 well mask and CodeLink slide was attached to the
ChipClip holder (Whatman). 50 .mu.l of a mixture containing
1.times. FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl2
(Roche), 200 .mu.M dNTPs (New England Biolabs) and 0.1 U/1 .mu.l
USER Enzyme (New England Biolabs) was heated to 37.degree. C. and
was added to each well and incubated at 37.degree. C. for 30 min
with mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer
comfort; Eppendorf). The reaction mixture containing the released
cDNA and probes was then recovered from the wells with a
pipette.
[0397] Capture Probe Release with Uracil Cleaving USER Enzyme
Mixture in TdT (Terminal Transferase) Buffer (Covalently Attached
Probes)
[0398] 50 .mu.l of a mixture containing: 1.times. TdT buffer (20 mM
Tris-acetate (pH 7.9), 50 mM Potassium Acetate and 10 mM Magnesium
Acetate) (New England Biolabs, www.neb.com); 0.1 .mu.g/.mu.l BSA
(New England Biolabs); and 0.1 U/.mu.l USER Enzyme (New England
Biolabs) was heated to 37.degree. C. and was added to each well and
incubated at 37.degree. C. for 30 min with mixing (3 seconds at 300
rpm, 6 seconds at rest) (Thermomixer comfort; Eppendorf). The
reaction mixture containing the released cDNA and probes was then
recovered from the wells with a pipette.
[0399] Capture Probe Release with Boiling Hot Water (Covalently
Attached Probes)
[0400] A 16 well mask and CodeLink slide was attached to the
ChipClip holder (Whatman). 50 .mu.l of 99.degree. C. water was
pipetted into each well. The 99.degree. C. water was allowed to
react for 30 minutes. The reaction mixture containing the released
cDNA and probes was then recovered from the wells with a
pipette.
[0401] Capture Probe Release with Heated PCR Buffer (Hybridized In
Situ Synthesized Capture Probes, i.e. Capture Probes Hybridized to
Surface Probes)
[0402] 50 .mu.l of a mixture containing: 1.times. TdT buffer (20 mM
Tris-acetate (pH 7.9). 50 mM Potassium Acetate and 10 nM Magnesium
Acetate) (New England Biolabs, www.neb.com); 0.1 .mu.g/.mu.l BSA
(New England Biolabs); and 0.1 U/.mu.l USER Enzyme (New England
Biolabs) was preheated to 95.degree. C. The mixture was then added
to each well and incubated for 5 minutes at 95.degree. C. with
mixing (3 seconds at 300 rpm, 6 seconds at rest) (Thermomixer
comfort; Eppendorf). The reaction mixture containing the released
probes was then recovered from the wells.
[0403] Capture Probe Release with Heated TdT (Terminal Transferase)
Buffer (Hybridized in Situ Synthesized Capture Probes, i.e. Capture
Probes Hybridized to Surface Probes)
[0404] 50 .mu.l of a mixture containing: 1.times. TdT buffer (20 mM
Tris-acetate (pH 7.9). 50 mM Potassium Acetate and 10 mM Magnesium
Acetate) (New England Biolabs, www.neb.com); 0.1 .mu.g/.mu.l BSA
(New England Biolabs); and 0.1 U/.mu.l USER Enzyme (New England
Biolabs) was preheated to 95c'O. The mixture was then added to each
well and incubated for 5 minutes at 95.degree. C. with mixing (3
seconds at 300 rpm, 6 seconds at rest) (Thermomixer comfort;
Eppendorf). The reaction mixture containing the released probes was
then recovered from the wells.
[0405] The efficacy of treating the array with the USER enzyme and
water heated to 99'C can be seen in FIG. 3. Enzymatic cleavage
using the USER enzyme and the Rsal enzyme was performed using the
"in-house" arrays described above (FIG. 4). Hot water mediated
release of DNA surface probes was performed using commercial arrays
manufactured by Agilent (see FIG. 5).
[0406] Probe Collection and Linker Introduction
[0407] The experiments demonstrate that first strand cDNA released
from the array surface may be modified to produce double stranded
DNA and subsequently amplified.
[0408] Whole Transcriptome Amplification by the Picoplex Whole
Genome Amplification Kit (Capture Probe Sequences Including
Positional Domain (Tag) Sequences not Retained at the Edge of the
Resulting dsDNA)
[0409] Capture probes were released with uracil cleaving USER
enzyme mixture in PCR buffer (covalently attached capture probes)
or with heated PCR buffer (hybridized in situ synthesized capture
probes, i.e. capture probes hybridized to surface probes).
[0410] The released cDNA was amplified using the Picoplex (Rubicon
Genomics) random primer whole genome amplification method, which
was carried out according to manufacturers instructions.
[0411] Whole Transcriptome Amplification by dA Tailing with
Terminal Transferase (TdT) (Capture Probe Sequences Including
Positional Domain (Tag) Sequences Retained at the End of the
Resulting dsDNA)
[0412] Capture probes were released with uracil cleaving USER
enzyme mixture in TdT (terminal transferase) buffer (covalently
attached capture probes) or with heated TdT (terminal transferase)
buffer (hybridized in situ synthesized capture probes, i.e. capture
probes hybridized to surface probes).
[0413] 38 .mu.l of cleavage mixture was placed in a clean 0.2 ml
PCR tube. The mixture contained: 1.times. TdT buffer (20 mM
Tris-acetate (pH 7,9), 50 mM Potassium Acetate and 10 mM Magnesium
Acetate) (New England Biolabs, www.neb.com), 0.1 .mu.g/.mu.l BSA
(New England Biolabs); 0.1 U/.mu.l USER Enzyme (New England
Biolabs) (not for heated release); released cDNA (extended from
surface probes); and released surface probes. To the PCR tube; 0.5
.mu.l RNase H (5 U/.mu.l, final concentration of 0.06 U/.mu.l), 1
.mu.l TdT (20 U/.mu.l, final concentration of 0.5 U/.mu.l), and 0.5
.mu.l dATPs (100 mM, final concentration of 1.25 mM), were added.
For dA tailing; the tube was incubated in a thermocycler (Applied
Biosystems) at 37.degree. C. for 15 min followed by an inactivation
of TdT at 70.degree. C. for 10 min. After dA tailing, a PCR master
mix was prepared. The mix contained: 1.times. Faststart HiFi PCR
Buffer (pH 8.3) with 1.8 mM MgCl.sub.2 (Roche); 0.2 mM of each dNTP
(Fermentas); 0.2 .mu.M of each primer, A (complementary to the
amplification domain of the capture probe) and B_(dT)24 (Eurofins
MWG Operon) (complementary to the poly-A tail to be added to the 3'
end of the first cDNA strand); and 0.1 U/.mu.l Faststart HiFi DNA
polymerase (Roche). 23 .mu.l of PCR Master mix was placed into nine
clean 0.2 ml PCR tubes. 2 .mu.l of dA tailing mixture were added to
eight of the tubes, while 2 .mu.l water (RNase/DNase free) was
added to the last tube (negative control). PCR amplification was
carried out with the following program: Hot start at 95.degree. C.
for 2 minutes, second strand synthesis at 50.degree. C. for 2
minutes and 72.degree. C. for 3 minutes, amplification with 30 PCR
cycles at 95.degree. C. for 30 seconds. 65.degree. C. for 1
minutes, 72.degree. C. for 3 minutes, and a final extension at
72.degree. C. for 10 minutes.
[0414] Post-Reaction Cleanup and Analysis
[0415] Four amplification products were pooled together and were
processed through a Qiaquick PCR purification column (Qiagen) and
eluted into 36 .mu.l EB (10 mM Tris-C1, pH 8.5). The product was
analyzed on a Bioanalyzer (Agilent). A DNA 1000 kit was used
according to manufacturers instructions.
[0416] Sequencing
[0417] Lumina Sequencing
[0418] dsDNA library for Illumine sequencing using sample indexing
was carried out according to manufacturers instructions. Sequencing
was carried out on an HiSeq2000 platform (Illumine).
[0419] Bioinformatics
[0420] Obtaining Digital Transcriptomic Information from Sequencing
Data from Whole Transcriptome Libraries Amplified Using the dA
Tailing Terminal Transferase Approach
[0421] The sequencing data was sorted through the FastX toolkit
FASTQ Barcode splitter tool into individual files for the
respective capture probe positional domain (tag) sequences.
Individually tagged sequencing data was then analyzed through
mapping to the mouse genome with the Tophat mapping tool. The
resulting SAM file was processed for transcript counts through the
HTseq-count software.
[0422] Obtaining Digital Transcriptomic Information from Sequencing
Data from Whole Transcriptome Libraries Amplified Using the
Picoplex Whole Genome Amplification Kit Approach
[0423] The sequencing data was converted from FASTQ format to FASTA
format using the FastX toolkit FASTQ-to-FASTA converter. The
sequencing reads was aligned to the capture probe positional domain
(tag) sequences using Blastn and the reads with hits better than
1e.sup.-6 to one of tag sequences were sorted out to individual
files for each tag sequence respectively. The file of tag sequence
reads was then aligned using Blastn to the mouse transcriptome, and
hits were collected.
[0424] Combining Visualization Data and Expression Profiles
[0425] The expression profiles for individual capture probe
positional domain (tag) sequences are combined with the spatial
information obtained from the tissue sections through staining.
Thereby the transcriptomic data from the cellular compartments of
the tissue section can be analyzed in a directly comparative
fashion, with the availability to distinguish distinct expression
features for different cellular subtypes in a given structural
context
Example 2
[0426] FIGS. 8 to 12 show successful visualisation of stained FFPE
mouse brain tissue (olfactory bulb) sections on top of a bar-coded
transcriptome capture array, according to the general procedure
described in Example 1. As compared with the experiment with fresh
frozen tissue in Example 1, FIG. 8 shows better morphology with the
FFPE tissue. FIGS. 9 and 10 show how tissue may be positioned on
different types of probe density arrays.
Example 3
[0427] Whole Transcriptome Amplification by Random Primer Second
Strand Synthesis Followed by Universal Handle Amplification
(Capture Probe Sequences Including Tag Sequences Retained at the
End of the Resulting dsDNA)
[0428] Following capture probe release with uracil cleaving USER
enzyme mixture in PCR buffer (covalently attached probes)
OR
[0429] Following capture probe release with heated FOR buffer
(hybridized in situ synthesized capture probes)
1 .mu.l RNase H (5 U/.mu.l) was added to each of two tubes, final
concentration of 0.12 U/.mu.l, containing 40 .mu.l 1.times.
Faststart HiFi PCR Buffer (pH 8.3) with 1.8 mM MgCl.sub.2 (Roche,
www.roche-applied-science.com), 0.2 mM of each dNTP (Fermentas,
www.fermentas.com), 0.1 .mu.g/.mu.l BSA (New England Biolabs,
www.neb.com), 0.1 U/.mu.l USER Enzyme (New England Biolabs),
released cDNA (extended from surface probes) and released surface
probes. The tubes were incubated at 37.degree. C. for 30 min
followed by 70.degree. C. for 20 min in a thermo cycler (Applied
Biosystems, www.appliedbiosystems.com). 1 .mu.l Klenow Fragment (3'
to 5' exo minus) (Illumina, www.illumina.com) and 1 .mu.l handle
coupled random primer (10 .mu.M) (Eurofins MWG Operon,
www.eurofinsdna.com) was added to the two tubes (B_R8 (octamer) to
one of the tubes and B_R6 (hexamer) to the other tube), final
concentration of 0.23 .mu.M. The two tubes were incubated at
15.degree. C. for 15 min, 25.degree. C. for 15 min, 37.degree. C.
for 15 min and finally 75.degree. C. for 20 min in a thermo cycler
(Applied Biosystems). After the incubation, 1 .mu.l of each primer,
AP and B (10 .mu.M) (Eurofins MWG Operon), was added to both tubes,
final concentration of 0.22 .mu.M each. 1 .mu.l Faststart HiFi DNA
polymerase (5 U/.mu.l) (Roche) was also added to both tubes, final
concentration of 0.11 U/.mu.l. PCR amplification were carried out
in a thermo cycler (Applied Biosystems) with the following program:
Hot start at 94.degree. C. for 2 min, followed by 50 cycles at
94.degree. C. for 15 seconds. 55.degree. C. for 30 seconds,
68.degree. C. for 1 minute, and a final extension at 68'C for 5
minutes. After the amplification, 40 .mu.l from each of the two
tubes were purified with Qiaquick PCR purification columns (Qiagen,
www.qiagen.com) and eluted into 30 .mu.l EB (10 mM Tris-Cl, pH
8.5). The Purified products were analyzed with a Bioanalyzer
(Agilent, www.home.agilent.com), DNA 7500 kit were used. The
results are shown in FIGS. 13 and 14.
[0430] This Example demonstrates the use of random hexamer and
random octamer second strand synthesis, followed by amplification
to generate the population from the released cDNA molecules.
Example 4
[0431] Amplification of ID-Specific and Gene Specific Products
after cDNA Synthesis and Probe Collection
[0432] Following capture probe release with uracil cleaving USER
enzyme mixture in PCR buffer (covalently attached probes).
[0433] The cleaved cDNA was amplified in final reaction volumes of
10 .mu.l. 7 .mu.l cleaved template, 1 .mu.l ID-specific forward
primer (2 .mu.M), 1 .mu.l gene-specific reverse primer (2 .mu.M)
and 1 .mu.l FastStart High Fidelity Enzyme Blend in 1.4.times.
FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 to
give a final reaction of 10 .mu.l with 1.times. FastStart High
Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 and 1 U FastStart
High Fidelity Enzyme Blend. PCR amplification were carried out in a
thereto cycler (Applied Biosystems) with the following program: Hot
start at 94.degree. C. for 2 min, followed by 50 cycles at
94.degree. C. for 15 seconds, 55.degree. C. for 30 seconds,
68.degree. C. for 1 minute, and a final extension at 68.degree. C.
for 5 minutes.
[0434] Primer sequences, resulting in a product of approximately
250 bp,
TABLE-US-00002 Beta-2 microglobulin (B2M) primer (SEQ ID NO: 43)
5'-TGGGGGTGAGAATTGCTAAG-3' ID-1 primer (SEQ ID NO: 44)
5'-CCTTCTCCTTCTCCTTCACC-3' ID-5 primer (SEQ ID NO: 45)
5'-GTCCTCTATTCCGTCACCAT-3' ID-20 primer (SEQ ID NO: 46)
5'-CTGCTTCTTCCTGGAACTCA-3'
[0435] The results are shown in FIG. 15. This shows successful
amplification of ID-specific and gene-specific products using two
different ID primers (i.e. specific for ID tags positioned at
different locations on the microarray and the same gene specific
primer from a brain tissue covering all the probes. Accordingly
this experiment establishes that products may be identified by an
ID tag-specific or target nucleic acid specific amplification
reaction. It is further established that different ID tags may be
distinguished. A second experiment, with tissue covering only half
of the ID probes (i.e. capture probes) on the array resulted in a
positive result (PCR product) for spots that were covered with
tissue.
Example 5
[0436] Spatial Genomics
[0437] Background. The method has as its purpose to capture DNA
molecules from a tissue sample with retained spatial resolution,
making it possible to determine from what part of the tissue a
particular DNA fragment stems.
[0438] Method. The principle of the method is to use microarrays
with immobilized DNA oligos (capture probes) carrying spatial
labeling tag sequences (positional domains). Each feature of oligos
of the microarray carries a 1) a unique labeling tag (positional
domain) and 2) a capture sequence (capture domain). Keeping track
of where which labeling tag is geographically placed on the array
surface makes it possible to extract positional information in two
dimensions from each labeling tag. Fragmented genomic DNA is added
to the microarray, for instance through the addition of a thin
section of FFPE treated tissue. The genomic DNA in this tissue
section is pre-fragmented due to the fixation treatment.
[0439] Once the tissue slice has been placed on the array, a
universal tailing reaction is carried out through the use of a
terminal transferase enzyme. The tailing reaction adds polydA tails
to the protruding 3' ends of the genomic DNA fragments in the
tissue. The oligos on the surface are blocked from tailing by
terminal transferase through a hybridized and 3' blocked polydA
probe.
[0440] Following the terminal transferase tailing, the genomic DNA
fragments are able to hybridize to the spatially tagged oligos in
their vicinity through the polydA tail meeting the polydT capture
sequence on the surface oligos. After hybridization is completed a
strand displacing polymerase such as Klenow exo- can use the oligo
on the surface as a primer for creation of a new DNA strand
complementary to the hybridized genomic DNA fragment. The new DNA
strand will now also contain the positional information of the
surface oligo's labeling tag.
[0441] As a last step the newly generated labeled DNA strands are
cleaved from the surface through either enzymatic means,
denaturation or physical means. The strands are then collected and
can be subjected to downstream amplification of the entire set of
strands through introduction of universal handles, amplification of
specific amplicons, and/or sequencing.
[0442] FIG. 16 is a schematic illustration of this process.
[0443] Materials and Methods
[0444] Preparation of In-House Printed Microarray with 6' to 3'
Oriented Probes
[0445] 20 DNA-capture oligos with individual tag sequences (Table
1) were spotted on glass slides to function as capture probes. The
probes were synthesized with a 5'-terminus amino linker with a 06
spacer. All probes where synthesized by Sigma-Aldrich (St. Louis,
Mo., USA). The DNA-capture probes were suspended at a concentration
of 20 .mu.M in 150 mM sodium phosphate, pH 8.5 and were spotted
using a Nanoplotter NP2.1/E (Gesim, Grosserkmannsdorf, Germany)
onto CodeLink.TM. Activated microarray slides (7.5 cm.times.2.5 cm;
Surmodics, Eden Prairie, Minn., USA). After printing, surface
blocking was performed according to the manufacturer's
instructions. The probes were printed in 16 identical arrays on the
slide, and each array contained a pre-defined printing pattern. The
16 sub-arrays were separated during hybridization by a 16-pad mask
(ChipClip.TM. Schleicher & Schnell BioScience, Keene, N.H.,
USA).
[0446] Preparation of In-House Printed Microarray with 3' to 5'
Oriented Probes and Synthesis of 5' to 3' Oriented Capture
Probes
[0447] Printing of oligos was performed as in the case with 5' to
3' oriented probes above. To hybridize primers for capture probe
synthesis hybridization solution containing 4.times.SSC and 0.1%
SDS, 2 .mu.M extension primer (A_primer) and 2 .mu.M thread joining
primer (p_poly_dT) was incubated for 4 min at 50.degree. C.
Meanwhile the in-house array was attached to a ChipClip (Whatman).
The array was subsequently incubated at 50.degree. C. for 30 min at
300 rpm shake with 50 LL of hybridization solution per well.
[0448] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps; 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.3SC for 1 min at 300
rpm shake. The array was then spun dry and placed back in the
ChipClip.
[0449] For extension and ligation 50 LL of enzyme mix containing
10.times.Ampligase buffer, 2.5 U AmpliTaq DNA Polymerase Stoffel
Fragment (Applied Biosystems), 10 U Ampligase (Epicentre
Biotechnologies), dNTPs 2 mM each (Fermentas) and water, is
pipetted to each well. The array is subsequently incubated at
55.degree. C. for 30 min. After incubation the array is washed
according to previously described array washing method but the
first step has the duration of 10 min instead of 6 min.
[0450] Hybridization of polydA Probe for Protection of Surface
Oligo Capture Sequences from dA Tailing
[0451] To hybridize a 3'-biotin blocked polydA probe for protection
of the surface oligo capture sequences a hybridization solution
containing 4.times.SSC and 0.1% SDS, 2 .mu.M 3'bio-polydA was
incubated for 4 min at 50.degree. C. Meanwhile the in-house array
was attached to a ChipClip (Whatman). The array was subsequently
incubated at 50.degree. C. for 30 min at 300 rpm shake with 50
.mu.L of hybridization solution per well.
[0452] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.SSC for 1 min at 300
rpm shake. The array was then spun dry and placed back in the
ChipClip.
[0453] Preparation of Formalin-Fixed Paraffin-Embedded (FFPE)
Tissue
[0454] Mouse brain tissue was fixed in 4% formalin at 4.degree. C.
for 24 h. After that it was incubated as follows: 3.times.
incubation in 70% ethanol for 1 hour, 1.times. incubation in 80%
ethanol for 1 hour, 1.times. incubation in 96% ethanol for 1 hour,
3.times. incubation in 100% ethanol for 1 hour, 2.times. incubation
in xylene at room temperature for 1 h.
[0455] The dehydrated samples were then incubated in liquid low
melting paraffin 52-54.degree. C. for up to 3 hours, during which
the paraffin in changed once to wash out residual xylene. Finished
tissue blocks were then stored at RT. Sections were then cut at 4
.mu.m in paraffin with a microtome onto each capture probe array to
be used.
[0456] The sections are dried at 37.degree. C. on the array slides
for 24 hours and store at RT.
[0457] Deparaffinization of FFPE Tissue
[0458] Formalin fixed paraffinized mouse brain 10 .mu.m sections
attached to CodeLink slides were deparaffinised in xylene twice for
10 min, 99.5% ethanol for 2 min, 96% ethanol for 2 min, 70% ethanol
for 2 min and were then air dried.
[0459] Universal Tailing of genomic DNA
[0460] For dA tailing a 50 .mu.l reaction mixture containing
1.times. TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium
Acetate and 10 mM Magnesium Acetate) (New England Biolabs,
www.neb.com), 0.1 .mu.g/.mu.l BSA (New England Biolabs), 1 .mu.l
TdT (20 U/.mu.l) and 0.5 .mu.l dATPs (100 mM) was prepared. The
mixture was added to the array surface and the array was incubated
in a thermo cycler (Applied Biosystems) at 37.degree. C. for 15 min
followed by an inactivation of TdT at 70.degree. C. for 10 min.
After this the temperature was lowered to 59.degree. C. again to
allow for hybridization of dA tailed genomic fragments to the
surface oligo capture sequences.
[0461] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.SSC for 1 min at 300
rpm shake. The array was then spun dry.
[0462] Extension of Labeled DNA
[0463] A 50 .mu.l reaction mixture containing 50 .mu.l of a mixture
containing 1.times. Klenow buffer, 200 .mu.M dNTPs (New England
Biolabs) and 1 .mu.l Klenow Fragment (3' to 5' exo minus) and was
heated to 37.degree. C. and was added to each well and incubated at
37.degree. C. for 30 min with mixing (3 s. 300 rpm, 6 s. rest)
(Thermomixer comfort; Eppendorf).
[0464] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.SSC for 1 min at 300
rpm shake. The array was then spun dry.
[0465] Removal of Residual Tissue
[0466] The slides with attached formalin fixed paraffinized mouse
brain tissue sections were attached to ChipClip slide holders and
16 well masks (Whatman). For each 150 .mu.l Proteinase K Digest
Buffer from the RNeasy FFPE kit (Qiagen) 10 .mu.l Proteinase K
Solution (Qiagen) was added. 50 .mu.l of the final mixture was
added to each well and the slide was incubated at 56.degree. C. for
30 min.
[0467] Capture Probe Release with Uracil Cleaving USER Enzyme
Mixture in PCR Buffer (Covalently Attached Probes)
[0468] A 16 well mask and CodeLink slide was attached to the
ChipClip holder (Whatman). 50 .mu.l of a mixture containing
1.times. FastStart High Fidelity Reaction Buffer with 1.8 mM
MgCl.sub.2 (Roche), 200 .mu.M dNTPs (New England Biolabs) and 0.1
U/1 .mu.l USER Enzyme (New England Biolabs) was heated to
37.degree. C. and was added to each well and incubated at
37.degree. C. for 30 min with mixing (3 s. 300 rpm, 6 s. rest)
(Thermomixer comfort; Eppendorf). The reaction mixture containing
the released cDNA and probes was then recovered from the wells with
a pipette.
[0469] Amplification of ID-Specific and Gene Specific Products
after Synthesis of Labelled DNA and Probe Collection
[0470] Following capture probe release with uracil cleaving USER
enzyme mixture in PCR buffer (covalently attached probes).
[0471] The cleaved DNA was amplified in final reaction volumes of
10 .mu.l. 7 .mu.l cleaved template, 1 .mu.l ID-specific forward
primer (2 .mu.M), 1 .mu.l gene-specific reverse primer (2 .mu.M)
and 1 .mu.l FastStart High Fidelity Enzyme Blend in 1.4.times.
FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 to
give a final reaction of 10 .mu.l with 1.times. FastStart High
Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2 and 1 U FastStart
High Fidelity Enzyme Blend. PCR amplification were carried out in a
thermo cycler (Applied Biosystems) with the following program: Hot
start at 94.degree. C. for 2 min, followed by 50 cycles at
94.degree. C. for 15 seconds, 55.degree. C. for 30 seconds,
68.degree. C. for 1 minute, and a final extension at 68.degree. C.
for 5 minutes.
[0472] Whole Genome Amplification by Random Primer Second Strand
Synthesis Followed by Universal Handle Amplification (Capture Probe
Sequences Including Tag Sequences Retained at the End of the
Resulting dsDNA)
[0473] Following capture probe release with uracil cleaving USER
enzyme mixture in PCR buffer (covalently attached probes).
[0474] A reaction mixture containing 40 .mu.l 1.times. Faststart
HiFi PCR Buffer (pH 8.3) with 1.8 mM MgCl.sub.2 (Roche,
www.roche-applied-science.com), 0.2 mM of each dNTP (Fermentas,
www.fermentas.com), 0.1 .mu.g/.mu.l A BSA (New England Biolabs,
www.neb.com), 0.1 U/.mu.l USER Enzyme (New England Biolabs),
released DNA (extended from surface probes) and released surface
probes. The tubes were incubated at 37.degree. C. for 30 min
followed by 70.degree. C. for 20 min in a thermo cycler (Applied
Biosystems, www.appliedbiosystems.com). 1 .mu.l Klenow Fragment (3'
to 5' exo minus) (Illumina, www.illumina.com) and 1 .mu.l handle
coupled random primer (10 .mu.M) (Eurofins MWG Operon,
www.eurofinsdna.com) was added to the tube. The tube was incubated
at 15.degree. C. for 15 min, 25.degree. C. for 15 min, 37.degree.
C. for 15 min and finally 75.degree. C. for 20 min in a thermo
cycler (Applied Biosystems). After the incubation, I l of each
primer, A_P and B (10 .mu.M) (Eurofins MWG Operon), was added to
the tube. 1 .mu.l Faststart HiFi DNA polymerase (5 U/.mu.l) (Roche)
was also added to the tube. PCR amplification were carried out in a
thermo cycler (Applied Biosystems) with the following program: Hot
start at 94.degree. C. for 2 min, followed by 50 cycles at
94.degree. C. for 15 seconds, 55.degree. C. for 30 seconds,
68.degree. C. for 1 minute, and a final extension at 68.degree. C.
for 5 minutes. After the amplification, 400 from the tube was
purified with Qiaquick PCR purification columns (Qiagen,
www.qiagen.com) and eluted into 30 .mu.l EB (10 mM Tris-CL, pH
8.5), The Purified product was analyzed with a Bioanalyzer
(Agilent, www.home.agilent.com), DNA 7500 kit were used,
[0475] Visualization
[0476] Hybridization of Fluorescent Marker Probes Prior to
Staining
[0477] Prior to tissue application fluorescent marker probes are
hybridized to designated marker sequences printed on the capture
probe array. The fluorescent marker probes aid in the orientation
of the resulting image after tissue visualization, making it
possible to combine the image with the resulting expression
profiles for individual capture probe tag sequences obtained after
sequencing. To hybridize fluorescent probes a hybridization
solution containing 4.times.SSC and 0.1% SDS, 2 .mu.l detection
probe (P) was incubated for 4 min at 50.degree. C. Meanwhile the
in-house array was attached to a ChipClip (Whatman). The array was
subsequently incubated at 50.degree. C. for 30 min at 300 rpm shake
with 50 .mu.L of hybridization solution per well.
[0478] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.3SC for 1 min at 300
rpm shake. The array was then spun dry.
[0479] General Histological Staining of FFPE Tissue Sections Prior
to or Post Synthesis of Labeled DNA
[0480] FFPE tissue sections immobilized on capture probe arrays are
washed and rehydrated after deparaffinization prior to synthesis of
labeled as described previously, or washed after synthesis of
labeled DNA as described previously. They are then treated as
follows: incubate for 3 minutes in Hematoxylin, rinse with
deionized water, incubate 5 minutes in tap water, rapidly dip 8 to
12 times in acid ethanol, rinse 2.times.1 minute in tap water,
rinse 2 minutes in deionized water, incubate 30 seconds in Eosin,
wash 3.times.5 minutes in 95% ethanol, wash 3.times.5 minutes in
100% ethanol, wash 3.times.10 minutes in xylene (can be done
overnight), place coverslip on slides using DPX, dry slides in the
hood overnight.
[0481] General Immunohistochemistry Staining of a Target Protein in
FFPE Tissue Sections Prior to or Post Synthesis of Labeled DNA
[0482] FFPE tissue sections immobilized on capture probe arrays are
washed and rehydrated after deparaffinization prior to synthesis of
labeled DNA as described previously, or washed after synthesis of
labeled DNA as described previously. They are then treated as
follows without being let to dry during the whole staining process:
Dilute primary antibody in blocking solution (1.times.TBS (Tris
Buffered Saline (50 mM Tris, 150 mM NaCl, pH 7.6), 4% donkey serum,
0:1% triton-x), incubate sections with primary antibody in a wet
chamber overnight at RT, rinse 3.times. with 1.times.TBS, incubate
section with matching secondary antibody conjugated to a
fluorochrome (FITC, Cy3 or Cy5) in a wet chamber at RT for 1 h,
Rinse 3.times. with 1.times.TBS, remove as much as possible of TBS
and mount section with ProLong Gold+DAPI (Invitrogen) and analyze
with fluorescence microscope and matching filter sets.
Example 6
[0483] This experiment was conducted following the principles of
Example 5, but using fragmented genomic DNA on the array rather
than tissue. The genomic DNA was pre-fragmented to a mean size of
200 bp and 700 bp respectively. This experiment shows that the
principle works. Fragmented genomic DNA is very similar to FFPE
tissue.
[0484] Amplification of Internal Gene Specific Products after
Synthesis of Labelled DNA and Probe Collection
[0485] Following capture probe release with uracil cleaving USER
enzyme mixture in PCR buffer (covalently attached probes)
containing 1.times. FastStart High Fidelity Reaction Buffer with
1.8 mM MgCl.sub.2 (Roche), 200 .mu.M dNTPs (New England Biolabs)
and 0.1 U/1 .mu.l USER Enzyme (New England Biolabs).
[0486] The cleaved DNA was amplified in a final reaction volume of
50 .mu.l. To 47 .mu.l cleaved template was added 1 .mu.l
ID-specific forward primer (10 .mu.M), 1 .mu.l gene-specific
reverse primer (10 .mu.M) and 1 .mu.l FastStart High Fidelity
Enzyme Blend. PCR amplification were carried out in a thereto
cycler (Applied Biosystems) with the following program: Hot start
at 94.degree. C. for 2 min, followed by 50 cycles at 94.degree. C.
for 15 seconds, 55.degree. C. for 30 seconds, 68.degree. C. for 1
minute, and a final extension at 68.degree. C. for 5 minutes.
[0487] Amplification of Label-Specific and Gene Specific Products
after Synthesis of Labelled DNA and Probe Collection
[0488] Following capture probe release with uracil cleaving USER
enzyme mixture in PCR buffer (covalently attached probes)
containing 1.times. FastStart High Fidelity Reaction Buffer with
1.8 mM MgCl.sub.2 (Roche), 200 .mu.M dNTPs (New England Biolabs)
and 0.1 U/1 .mu.l USER Enzyme (New England Biolabs).
[0489] The cleaved DNA was amplified in a final reaction volume of
50 .mu.l. To 47 .mu.l cleaved template was added 1 .mu.l
label-specific forward primer (10 .mu.M), 1 .mu.l gene-specific
reverse primer (10 .mu.M) and 1 .mu.l FastStart High Fidelity
Enzyme Blend. PCR amplification were carried out in a thereto
cycler (Applied Biosystems) with the following program: Hot start
at 94.degree. C. for 2 min, followed by 50 cycles at 94.degree. C.
for 15 seconds, 55.degree. C. for 30 seconds, 68.degree. C. for 1
minute, and a final extension at 68.degree. C. for 5 minutes.
TABLE-US-00003 Forward-Genomic DNA Human Primer (SEQ ID NO: 47)
5'-GACTGCTCTTTTCACCCATC-3' Reverse-Genomic DNA Human Primer (SEQ ID
NO: 48) 5'-GGAGCTGCTGGTGCAGGG-3' P-label specific primer (SEQ ID
NO: 49) 5'-ATCTCGACTGCCACTCTGAA-3'
[0490] The results are shown in FIGS. 17 to 20. The Figures show
internal products amplified on the array--the detected peaks in
FIGS. 17 and 18 are of the expected size. This thus demonstrates
that genomic DNA may be captured and amplified. In FIGS. 19 and 20,
the expected product is a smear given that the random fragmentation
and terminal transferase labeling of genomic DNA will generate a
very diverse sample pool.
Example 7
[0491] Alternative Synthesis of 5' to 3' Oriented Capture Probes
Using Polymerase Extension and Terminal Transferase Tailing
[0492] To hybridize primers for capture probe synthesis
hybridization solution containing 4.times.SSC and 0.1% SDS and 2
.mu.M extension primer (A_primer) was incubated for 4 min at
50.degree. C. Meanwhile the in-house array (see Example 1) was
attached to a ChipClip (Whatman). The array was subsequently
incubated at 50.degree. C. for 30 min at 300 rpm shake with 50
.mu.L of hybridization solution per well.
[0493] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.SSC for 1 min at 300
rpm shake. The array was then spun dry and placed back in the
ChipClip.
[0494] 1 .mu.l Klenow Fragment (3' to 5' exo minus) (Illumina,
www.illumina.com) together with 10.times. Klenow buffer, dNTPs 2 mM
each (Fermentas) and water, was mixed into a 50 .mu.l reaction and
was pipetted into each well.
[0495] The array was incubated at 15.degree. C. for 15 min,
25.degree. C. for 15 min, 37.degree. C. for 15 min and finally
75.degree. C. for 20 min in an Eppendorf Thermomixer.
[0496] After incubation, the array was removed from the ChipClip
and washed with the 3 following steps: 1) 50.degree. C. 2.times.SSC
solution with 0.1% SDS for 6 min at 300 rpm shake, 2) 0.2.times.SSC
for 1 min at 300 rpm shake and 3) 0.1.times.SSC for 1 min at 300
rpm shake. The array was then spun dry and placed back in the
ChipClip.
[0497] For dT tailing a 50 .mu.l reaction mixture containing
1.times. TdT buffer (20 mM Tris-acetate (pH 7.9), 50 mM Potassium
Acetate and 10 mM Magnesium Acetate) (New England Biolabs,
www.neb.com), 0.1 .mu.g/.mu.l BSA (New England Biolabs), 0.5 .mu.l
RNase H (5 U/.mu.l) TdT (20 U/.mu.l) and 0.5 .mu.l dTTPs (100 mM)
was prepared. The mixture was added to the array surface and the
array was incubated in a thermo cycler (Applied Biosystems) at
37.degree. C. for 15 min followed by an inactivation of TdT at
70.degree. C. for 10 min.
Example 8
[0498] Spatial Transcriptomics Using 5' to 3' High Probe Density
Arrays and Formalin-Fixed Frozen (FF-Frozen) Tissue with USER
System Cleavage and Amplification Via Terminal Transferase
[0499] Array Preparation
[0500] Pre-fabricated high-density microarrays chips were ordered
from Roche-Nimblegen (Madison, Wis., USA). Each capture probe array
contained 135,000 features of which 132,640 features carried a
capture probe comprising a unique ID-tag sequence (positional
domain) and a capture region (capture domain). Each feature was
13.times.13 .mu.m in size. The capture probes were composed 5' to
3' of a universal domain containing five dUTP bases (a cleavage
domain) and a general amplification domain, an ID tag (positional
domain) and a capture region (capture domain) (FIG. 22 and Table
2). Each array was also fitted with a frame of marker probes (FIG.
23) carrying a generic 30 bp sequence (Table 2) to enable
hybridization of fluorescent probes to help with orientation during
array visualization.
[0501] Tissue Preparation--Preparation of Formalin-Fixed Frozen
Tissue
[0502] The animal (mouse) was perfused with 50 ml PBS and 100 ml 4%
formalin solution. After excision of the olfactory bulb, the tissue
was put into a 4% formalin bath for post-fixation for 24 hrs. The
tissue was then sucrose treated in 30% sucrose dissolved in PBS for
24 hrs to stabilize morphology and to remove excess formalin. The
tissue was frozen at a controlled rate down to -40.degree. C. and
kept at -26.degree. C. between experiments. Similar preparation of
tissue postfixed for 3 his or without post-fixation was carried out
for a parallel specimen. Perfusion with 2% formalin without
post-fixation was also used successfully. Similarly the sucrose
treatment step could be omitted. The tissue was mounted into a
cryostat for sectioning at 10 .mu.m. A slice of tissue was applied
onto each capture probe array to be used. Optionally for better
tissue adherence, the array chip was placed at 50.degree. C. for 15
minutes.
[0503] Optional Control--Total RNA Preparation from Sectioned
Tissue
[0504] Total RNA was extracted from a single tissue section (10
.mu.m) using the RNeasy FFPE kit (Qiagen) according to
manufacturers instructions. The total RNA obtained from the tissue
section was used in control experiments for a comparison with
experiments in which the RNA was captured on the array directly
from the tissue section. Accordingly, in the case where totalRNA
was applied to the array the staining, visualization and
degradation of tissue steps were omitted.
[0505] On-Chip Reactions
[0506] The hybridization of marker probe to the frame probes,
reverse transcription, nuclear staining, tissue digestion and probe
cleavage reactions were all performed in a 16 well silicone gasket
(Arraylt, Sunnyvale, Calif., USA) with a reaction volume of 50
.mu.l per well. To prevent evaporation, the cassettes were covered
with plate sealers (In Vitro AB, Stockholm, Sweden).
[0507] Optional--Tissue Permeabilization Prior to cDNA
Synthesis
[0508] For permeabilization using Proteinase K, proteinase K
(Qiagen, Hilden, Germany) was diluted to 1 .mu.g/ml in PBS. The
solution was added to the wells and the slide incubated at room
temperature for 5 minutes, followed by a gradual increase to
80.degree. C. over 10 minutes. The slide was washed briefly in PBS
before the reverse transcription reaction.
[0509] Alternatively for permeabilization using microwaves, after
tissue attachment, the slide was placed at the bottom of a glass
jar containing 50 ml 0.2.times.SSC (Sigma-Aldrich) and was heated
in a microwave oven for 1 minute at 800 W. Directly after microwave
treatment the slide was placed onto a paper tissue and was dried
for 30 minutes in a chamber protected from unnecessary air
exposure. After drying, the slide was briefly dipped in water
(RNase/DNase free) and finally spin-dried by a centrifuge before
cDNA synthesis was initiated.
[0510] cDNA Synthesis
[0511] For the reverse transcription reaction the Superscript III
One-Step RT-PCR System with Platinum Taq (Life
Technologies/Invitrogen, Carlsbad, Calif., USA) was used. Reverse
transcription reactions contained 1.times. reaction mix, 1.times.
BSA (New England Biolabs, Ipswich, Mass., USA) and 2 .mu.l
SuperScript III RT/Platinum Taq mix in a final volume of 50 .mu.l.
This solution was heated to 50.degree. C. before application to the
tissue sections and the reaction was performed at 50.degree. C. for
30 minutes. The reverse transcription solution was subsequently
removed from the wells and the slide was allowed to air dry for 2
hours.
[0512] Tissue Visualization
[0513] After cDNA synthesis, nuclear staining and hybridization of
the marker probe to the frame probes (probes attached to the array
substrate to enable orientation of the tissue sample on the array)
was done simultaneously. A solution with DAPI at a concentration of
300 nM and marker probe at a concentration of 170 nM in PBS was
prepared. This solution was added to the wells and the slide was
incubated at room temperature for 5 minutes, followed by brief
washing in PBS and spin drying.
[0514] Alternatively the marker probe was hybridized to the frame
probes prior to placing the tissue on the array. The marker probe
was then diluted to 170 nM in hybridization buffer (4.times.SSC,
0.1% SDS). This solution was heated to 50.degree. C. before
application to the chip and the hybridization was performed at
50.degree. C. for 30 minutes at 300 rpm. After hybridization, the
slide was washed in 2.times.SSC, 0.1% SDS at 50.degree. C. and 300
rpm for 10 minutes, 0.2.times.SSC at 300 rpm for 1 minute and
0.1.times.SSC at 300 rpm for 1 minute. In that case the staining
solution after cDNA synthesis only contained the nuclear DAPI stain
diluted to 300 nM in PBS. The solution was applied to the wells and
the slide was incubated at room temperature for 5 minutes, followed
by brief washing in PBS and spin drying.
[0515] The sections were microscopically examined with a Zeiss Axis
Imager Z2 and processed with MetaSystems software.
[0516] Tissue Removal
[0517] The tissue sections were digested using Proteinase K diluted
to 1.25 .mu.l/.mu.l in PKD buffer from the RNeasy FFPE Kit (both
from Qiagen) at 56.degree. C. for 30 minutes with an interval mix
at 300 rpm for 3 seconds, then 6 seconds rest. The slide was
subsequently washed in 2.times.SSC, 0.1% SDS at 50.degree. C. and
300 rpm for 10 minutes, 0.2.times.SSC at 300 rpm for 1 minute and
0.1.times.SSC at 300 rpm for 1 minute.
[0518] Probe Release
[0519] The 16-well Hybridization Cassette with silicone gasket
(Arraylt) was preheated to 37.degree. C. and attached to the
Nimblegen slide. A volume of 500 of cleavage mixture preheated to
37.degree. C., consisting of Lysis buffer at an unknown
concentration (Takara), 0.1 U/.mu.l USER Enzyme (NEB) and 0.1
.mu.g/.mu.l BSA was added to each of wells containing surface
immobilized cDNA. After removal of bubbles the slide was sealed and
incubated at 37.degree. C. for 30 minutes in a Thermomixer comfort
with cycled shaking at 300 rpm for 3 seconds with 6 seconds rest in
between. After the incubation 450 cleavage mixture was collected
from each of the used wells and placed into 0.2 ml PCR tubes (FIG.
24).
[0520] Library Preparation
[0521] Exonuclease Treatment
[0522] After cooling the solutions on ice for 2 minutes,
Exonuclease I (NEB) was added, to remove unextended cDNA probes, to
a final volume of 46.20 and a final concentration of 0.52 U/.mu.l.
The tubes were incubated in a thermo cycler (Applied Biosystems) at
37.degree. C. for 30 minutes followed by inactivation of the
exonuclease at 80.degree. C. for 25 minutes.
[0523] dA-Tailing by Terminal Transferase
[0524] After the exonuclease step, 450 polyA-tailing mixture,
according to manufacturers instructions consisting of TdT Buffer
(Takara), 3 mM dATP (Takara) and manufacturers TdT Enzyme mix (TdT
and RNase H) (Takara), was added to each of the samples. The
mixtures were incubated in a thermocycler at 37.degree. C. for 15
minutes followed by inactivation of TdT at 70.degree. C. for 10
minutes.
[0525] Second-Strand Synthesis and PCR-Amplification
[0526] After dA-tailing, 23 .mu.l PCR master mix was placed into
four new 0.2 ml PCR tubes per sample, to each tube 2 .mu.l sample
was added as a template. The final PCRs consisted of 1.times. Ex
Taq buffer (Takara), 200 .mu.M of each dNTP (Takara), 600 nM
A_primer (MWG), 600 nM B_dT20VN_primer (MWG) and 0.025 U/0 Ex Taq
polymerase (Takara)(Table 2). A second cDNA strand was created by
running one cycle in a thermocycler at 95.degree. C. for 3 minutes,
50.degree. C. for 2 minutes and 72.degree. C. for 3 minutes. Then
the samples were amplified by running 20 cycles (for library
preparation) or 30 cycles (to confirm the presence of cDNA) at
95.degree. C. for 30 seconds, 67.degree. C. for 1 minute and
72.degree. C. for 3 minutes, followed by a final extension at
72.degree. C. for 10 minutes.
[0527] Library Cleanup
[0528] After amplification, the four PCRs (100 .mu.l) were mixed
with 5000 binding buffer (Qiagen) and placed in a Qiaquick PCR
purification column (Qiagen) and spun for 1 minute at
17,900.times.g in order to bind the amplified cDNA to the membrane.
The membrane was then washed with wash buffer (Qiagen) containing
ethanol and finally eluted into 50 .mu.l of 10 mM Tris-Cl, pH
8.5.
[0529] The purified and concentrated sample was further purified
and concentrated by CA-purification (purification by
superparamagnetic beads conjugated to carboxylic acid) with an MBS
robot (Magnetic Biosolutions). A final PEG concentration of 10% was
used in order to remove fragments below 150-200 bp. The amplified
cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min
and were then eluted into 150 of 10 mM Tris-Cl, pH 8.5.
[0530] Library Quality Analysis
[0531] Samples amplified for 30 cycles were analyzed with an
Agilent Bioanalyzer (Agilent) in order to confirm the presence of
an amplified cDNA library, the DNA High Sensitivity kit or DNA 1000
kit were used depending on the amount of material.
[0532] Sequencing Library Preparation
[0533] Library Indexing
[0534] Samples amplified for 20 cycles were used further to prepare
sequencing libraries. An index PCR master mix was prepared for each
sample and 23 .mu.l was placed into six 0.2 ml tubes. 2 .mu.l of
the amplified and purified cDNA was added to each of the six PCRs
as template making the PCRs containing 1.times. Phusion master mix
(Fermentas), 500 nM InPE1.0 (Illumina), 500 nM Index 1-12
(Illumina), and 0.4 nM InPE2.0 (Illumina). The samples were
amplified in a thermocycler for 18 cycles at 98.degree. C. for 30
seconds, 65.degree. C. for 30 seconds and 72.degree. C. for 1
minute, followed by a final extension at 72.degree. C. for 5
minutes.
[0535] Sequencing Library Cleanup
[0536] After amplification, the six PCRs (150 .mu.l) were mixed
with 750 .mu.l binding buffer and placed in a Qiaquick PCR
purification column and spun for 1 minute at 17,900.times.g in
order to bind the amplified cDNA to the membrane (because of the
large sample volume (900 .mu.l), the sample was split in two (each
450 .mu.l) and was bound in two separate steps). The membrane was
then washed with wash buffer containing ethanol and finally eluted
into 50 .mu.l of 10 mM Tris-Cl, pH 8.5.
[0537] The purified and concentrated sample was further purified
and concentrated by CA-purification with an MBS robot. A final PEG
concentration of 7.8% was used in order to remove fragments below
300-350 bp. The amplified cDNA was allowed to bind to the CA-beads
for 10 min and were then eluted into 15 .mu.l of 10 mM Tris-Cl, pH
8.5. Samples were analyzed with an Agilent Bioanalyzer in order to
confirm the presence and size of the finished libraries, the DNA
High Sensitivity kit or DNA 1000 kit were used according to
manufacturers instructions depending on the amount of material
(FIG. 25).
[0538] Sequencing
[0539] The libraries were sequenced on the Illumina Hiseq2000 or
Miseq depending on desired data throughput according to
manufacturers instructions. Optionally for read 2, a custom
sequencing primer B_r2 was used to avoid sequencing through the
homopolyrneric stretch of 20 T.
[0540] Data Analysis
[0541] Read 1 was trimmed 42 bases at 5' end. Read 2 was trimmed 25
bases at 5' end (optionally no bases were trimmed from read 2 if
the custom primer was used). The reads were then mapped with bowtie
to the repeat masked Mus musculus 9 genome assembly and the output
was formatted in the SAM file format. Mapped reads were extracted
and annotated with UCSC refGene gene annotations. Indexes were
retrieved with `indexFinder` (an inhouse software for index
retrieval). A mango DB database was then created containing
information about all caught transcripts and their respective index
position on the chip.
[0542] A matlab implementation was connected to the database and
allowed for spatial visualization and analysis of the data (FIG.
26).
[0543] Optionally the data visualization was overlaid with the
microscopic image using the fluorescently labelled frame probes for
exact alignment and enabling spatial transcriptomic data
extraction.
Example 9
[0544] Spatial Transcriptomics Using 3' to 5' High Probe Density
Arrays and FFPE Tissue with MutY System Cleavage and Amplification
Via TdT
[0545] Array Preparation
[0546] Pre-fabricated high-density microarrays chips were ordered
from Roche-Nimblegen (Madison, Wis., USA). Each used capture probe
array contained 72 k features out of which 66,022 contained a
unique ID-tag complementary sequence. Each feature was 16.times.16
.mu.m in size. The capture probes were composed 3' to 5' in the
same way as the probes used for the in-house printed 3' to 5'
arrays with the exception to 3 additional bases being added to the
upper (P') general handle of the probe to make it a long version of
P', LP' (Table 2). Each array was also fitted with a frame of
probes carrying a generic 30 bp sequence to enable hybridization of
fluorescent probes to help with orientation during array
visualization.
[0547] Synthesis of 5' to 3' Oriented Capture Probes
[0548] The synthesis of 5' to 3' oriented capture probes on the
high-density arrays was carried out as in the case with in-house
printed arrays, with the exception that the extension and ligation
steps were carried out at 55.degree. C. for 15 mins followed by
72.degree. C. for 15 mins. The A-handle probe (Table 2) included an
NG mismatch to allow for subsequent release of probes through the
MutY enzymatic system described below. The P-probe was replaced by
a longer LP version to match the longer probes on the surface.
[0549] Preparation of Formalin-Fixed Paraffin-Embedded Tissue and
Deparaffinization
[0550] This was carried out as described above in the in-house
protocol.
[0551] cDNA Synthesis and Staining
[0552] cDNA synthesis and staining was carried out as in the
protocol for 5' to 3' oriented high-density Nimblegen arrays with
the exception that biotin labeled dCTPs and dATPs were added to the
cDNA synthesis together with the four regular dNTPs (each was
present at 25.times. times more than the biotin labeled ones).
[0553] Tissue Removal
[0554] Tissue removal was carried out in the same way as in the
protocol for 5' to 3' oriented high-density Nimblegen arrays
described in Example 8.
[0555] Probe Cleavage by MutY
[0556] A 16-well Incubation chamber with silicone gasket (ArrayIT)
was preheated to 37.degree. C. and attached to the Codelink slide.
A volume of 50 .mu.l of cleavage mixture preheated to 37.degree.
C., consisting of 1.times. Endonucelase VIII Buffer (NEB), 10
U/.mu.l MutY (Trevigen), 10 U/.mu.l Endonucelase VIII (NEB), 0.1
.mu.g/.mu.l BSA was added to each of wells containing surface
immobilized cDNA. After removal of bubbles the slide was sealed and
incubated at 37.degree. C. for 30 minutes in a Thermomixer comfort
with cycled shaking at 300 rpm for 3 seconds with 6 seconds rest in
between. After the incubation, the plate sealer was removed and 40
.mu.l cleavage mixture was collected from each of the used wells
and placed into a FOR plate.
[0557] Library Preparation
[0558] Biotin-Streptavidin Mediated Library Cleanup
[0559] To remove unextended cDNA probes and to change buffer, the
samples were purified by binding the biotin labeled cDNA to
streptavidin coated C1-beads (Invitrogen) and washing the beads
with 0.1M NaOH (made fresh). The purification was carried out with
an MBS robot (Magnetic Biosolutions), the biotin labelled cDNA was
allowed to bind to the Cl-beads for 10 min and was then eluted into
20 .mu.l of water by heating the bead-water solution to 80.degree.
C. to break the biotin-streptavidin binding.
[0560] dA-Tailing by Terminal Transferase
[0561] After the purification step, 18 .mu.l of each sample was
placed into new 0.2 ml PCR tubes and mixed with 22 .mu.l of a
polyA-tailing master mix leading to a 40 .mu.l reaction mixture
according to manufacturers instructions consisting of lysis buffer
(Takara, Cellamp Whole Transcriptome Amplification kit), TdT Buffer
(Takara), 1.5 mM dATP (Takara) and TdT Enzyme mix (TdT and RNase H)
(Takara). The mixtures were incubated in a thermocycler at
37.degree. C. for 15 minutes followed by inactivation of TdT at
70.degree. C. for 10 minutes.
[0562] Second-Strand Synthesis and FOR-Amplification
[0563] After dA-tailing, 23 .mu.l PCR master mix was placed into
four new 0.2 ml PCR tubes per sample, to each tube 2 .mu.l sample
was added as a template. The final PCRs consisted of 1.times. Ex
Taq buffer (Takara), 200 .mu.M of each dNTP (Takara), 600 nM
A_primer (MWG), 600 nM B_dT20VN_primer (MWG) and 0.025 U/.mu.l Ex
Taq polymerase (Takara). A second cDNA strand was created by
running one cycle in a thermo cycler at 95.degree. C. for 3
minutes, 50.degree. C. for 2 minutes and 72.degree. C. for 3
minutes. Then the samples were amplified by running 20 cycles (for
library preparation) or 30 cycles (to confirm the presence of cDNA)
at 95.degree. C. for 30 seconds, 67.degree. C. for 1 minute and
72.degree. C. for 3 minutes, followed by a final extension at
72.degree. C. for 10 minutes.
[0564] Library Cleanup
[0565] After amplification, the four PCRs (100 .mu.l) were mixed
with 500 .mu.l binding buffer (Qiagen) and placed in a Qiaquick PCR
purification column (Qiagen) and spun for 1 minute at
17,900.times.g in order to bind the amplified cDNA to the membrane.
The membrane was then washed with wash buffer (Qiagen) containing
ethanol and finally eluted into 50 .mu.l of 10 mM Tris-HCl, pH
8.5.
[0566] The purified and concentrated sample was further purified
and concentrated by CA-purification (purification by
superparamagnetic beads conjugated to carboxylic acid) with an MBS
robot (Magnetic Biosolutions). A final PEG concentration of 10% was
used in order to remove fragments below 150-200 bp. The amplified
cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min
and were then eluted into 15 .mu.l of 10 mM Tris-HCl, pH 8.5.
[0567] Second PCR-Amplification
[0568] The final PCRs consisted of 1.times. Ex Taq buffer (Takara),
200 .mu.M of each dNTP (Takara), 600 nM A_primer (MWG), 600 nM
B_primer (MWG) and 0.025 U/.mu.l Ex Taq polymerase (Takara). The
samples were heated to 95.degree. C. for 3 minutes, and then
amplified by running 10 cycles at 95.degree. C. for 30 seconds,
65.degree. C. for 1 minute and 72.degree. C. for 3 minutes,
followed by a final extension at 72.degree. C. for 10 minutes.
[0569] Second Library Cleanup
[0570] After amplification, the four PCRs (100 .mu.l) were mixed
with 500 .mu.l binding buffer (Qiagen) and placed in a Qiaquick PCR
purification column (Qiagen) and spun for 1 minute at
17,900.times.g in order to bind the amplified cDNA to the membrane.
The membrane was then washed with wash buffer (Qiagen) containing
ethanol and finally eluted into 50 .mu.l of 10 mM Tris-Cl, pH
8.5.
[0571] The purified and concentrated sample was further purified
and concentrated by CA-purification (purification by
super-paramagnetic beads conjugated to carboxylic acid) with an MBS
robot (Magnetic Biosolutions). A final PEG concentration of 10% was
used in order to remove fragments below 150-200 bp. The amplified
cDNA was allowed to bind to the CA-beads (Invitrogen) for 10 min
and were then eluted into 15 .mu.l of 10 mM Tris-HCl, pH 8.5.
[0572] Sequencing Library Preparation
[0573] Library Indexing
[0574] Samples amplified for 20 cycles were used further to prepare
sequencing libraries. An index PCR master mix was prepared for each
sample and 23 .mu.l was placed into six 0.2 ml tubes. 2 .mu.l of
the amplified and purified cDNA was added to each of the six PCRs
as template making the PCRs containing 1.times. Phusion master mix
(Fermentas), 500 nM InPE1.0 (Illumine), 500 nM Index 1-12
(Illumina), and 0.4 nM InPE2.0 (Illumine). The samples were
amplified in a thermo cycler for 18 cycles at 98.degree. C. for 30
seconds, 65.degree. C. for 30 seconds and 72.degree. C. for 1
minute, followed by a final extension at 72.degree. C. for 5
minutes.
[0575] Sequencing Library Cleanup
[0576] After amplification, the samples was purified and
concentrated by CA-purification with an MBS robot. A final PEG
concentration of 7.8% was used in order to remove fragments below
300-350 bp. The amplified cDNA was allowed to bind to the CA-beads
for 10 min and were then eluted into 15 .mu.l of 10 mM Tris-HCl, pH
8.5.
[0577] 10 .mu.l of the amplified and purified samples were placed
on a Caliper XT chip and fragments between 480 bp and 720 bp were
cut out with the Caliper XT (Caliper). Samples were analyzed with
an Agilent Bioanalyzer in order to confirm the presence and size of
the finished libraries, the DNA High Sensitivity kit was used.
[0578] Sequencing and Data Analysis
[0579] Sequencing and Bioinformatic was carried out in the same way
as in the protocol for 5' to 3' oriented high-density Nimblegen
arrays described in Example 8. However, in the data analysis, read
1 was not used in the mapping of transcripts. Specific Olfr
transcripts could be sorted out using the Matlab visualization tool
(FIG. 27).
Example 10
[0580] Spatial Transcriptomics Using in House Printed 41-Tag
Microarray with 5' to 3' Oriented Probes and Formalin-Fixed Frozen
(FF-Frozen) Tissue with Permeabilization Through ProteinaseK or
Microwaving with USER System Cleavage and Amplification Via TdT
[0581] Array Preparation
[0582] In-house arrays were printed as previously described but
with a pattern of 41 unique ID-tag probes with the same composition
as the probes in the 5' to 3' oriented high-density array in
Example 8 (FIG. 28).
[0583] All other steps were carried out in the same way as in the
protocol described in Example 8.
Example 11
[0584] Alternative Method for Performing the cDNA Synthesis
Step
[0585] cDNA synthesis on chip as described above can also be
combined with template switching to create a second strand by
adding a template switching primer to the cDNA synthesis reaction
(Table 2). The second amplification domain is introduced by
coupling it to terminal bases added by the reverse transcriptase at
the 3' end of the first cDNA strand, and primes the synthesis of
the second strand. The library can be readily amplified directly
after release of the double-stranded complex from the array
surface.
Example 12
[0586] Spatial Genomics Using in House Printed 41-Tag Microarray
with 5' to 3' Oriented Probes and Fragmented Poly-A Tailed gDNA
with USER System Cleavage and Amplification Via TdT-Tailing or
Translocation Specific Primers
[0587] Array Preparation
[0588] In-house arrays were printed using Codelink slides
(Surmodics) as previously described but with a pattern of 41 unique
ID-tag probes with the same composition as the probes in the 5' to
3' oriented high-density in Example 8.
[0589] Total DNA Preparation from Cells
[0590] DNA Fragmentation
[0591] Genomic DNA (gDNA) was extracted by DNeasy kit (Qiagen)
according to the manufacturers instructions from A431 and U2OS cell
lines. The DNA was fragmented to 500 bp on a Covaris sonicator
(Covaris) according to manufacturer's instructions.
[0592] The sample was purified and concentrated by CA-purification
(purification by super-paramagnetic beads conjugated to carboxylic
acid) with an MBS robot (Magnetic Biosolutions). A final PEG
concentration of 10% was used in order to remove fragments below
150-200 bp. The fragmented DNA was allowed to bind to the CA-beads
(Invitrogen) for 10 min and were then eluted into 15 .mu.l of 10 mM
Tris-HCl, pH 8.5.
[0593] Optional Control--Spiking of Different Cell Lines
[0594] Through spiking of A431 DNA into U2OS DNA different levels
of capture sensitivity can be measured, such as from spiking of 1%,
10% or 50% of A431 DNA.
[0595] dA-Tailing by Terminal Transferase
[0596] A 45 .mu.l polyA-tailing mixture, according to
manufacturer's instructions consisting of TdT Buffer (Takara), 3 mM
dATP (Takara) and TdT Enzyme mix (TdT and RNase H) (Takara), was
added to 0.5 .mu.g of fragmented DNA. The mixtures were incubated
in a thermocycler at 37.degree. C. for 30 minutes followed by
inactivation of TdT at 80.degree. C. for 20 minutes. The dA-tailed
fragments were then cleaned through a Qiaquick (Qiagen) column
according to manufacturer's instructions and the concentration was
measured using the Qubit system (Invitrogen) according to
manufacturer's instructions.
[0597] On-Chip Experiments
[0598] The hybridization, second strand synthesis and cleavage
reactions were performed on chip in a 16 well silicone gasket
(Arraylt, Sunnyvale, Calif., USA). To prevent evaporation, the
cassettes were covered with plate sealers (In Vitro AB, Stockholm,
Sweden).
[0599] Hybridization
[0600] 117 ng of DNA was deposited onto a well on a prewarmed array
(56.degree. C.) in a total volume of 45 .mu.l consisting of
1.times. NEB buffer (New England Biolabs) and 1.times. BSA. The
mixture was incubated for 30 mins at 50.degree. C. in a Thermomixer
Comfort (Eppendorf) fitted with an MTP block at 300 rpm shake.
[0601] Second Strand Synthesis
[0602] Without removing the hybridization mixture, 150 of a Kienow
extension reaction mixture consisting of 1.times. NEB buffer 1.5
.mu.l Klenow polymerase, and 3.75 .mu.l dNTPs (2 mM each) was added
to the well. The reaction mixture was incubated in a Thermomixer
Comport (Eppendorf) 37.degree. C. for 30 mins without shaking.
[0603] The slide was subsequently washed in 2.times.SSC, 0.1% SDS
at 50.degree. C. and 300 rpm for 10 minutes, 0.2.times.SSC at 300
rpm for 1 minute and 0.1.times.SSC at 300 rpm for 1 minute.
[0604] Probe Release
[0605] A volume of 50 .mu.l of a mixture containing 1.times.
FastStart High Fidelity Reaction Buffer with 1.8 mM MgCl.sub.2
(Roche), 200 .mu.M dNTPs (New England Biolabs), 1.times. BSA and
0.1 U/.mu.l USER Enzyme (New England Biolabs) was heated to
37.degree. C. and was added to each well and incubated at
37.degree. C. for 30 min with mixing (3 seconds at 300 rpm, 6
seconds at rest) (Thermomixer comfort; Eppendorf). The reaction
mixture containing the released DNA which was then recovered from
the wells with a pipette.
[0606] Library Preparation
[0607] Amplification Reaction Amplification was carried out in 10
.mu.l reactions consisting of 7.5 .mu.l released sample, 1 .mu.l of
each primer and 0.5 .mu.l enzyme (Roche, FastStart HiFi PCR
system). The reaction was cycled as 94.degree. C. for 2 mins, one
cycle of 94.degree. C. 15 sec, 55.degree. C. for 2 mins, 72.degree.
C. for 2 mins, 30 cycles of 94.degree. C. for 15 secs, 65.degree.
C. for 30 secs, 72.degree. C. for 90 secs, and a final elongation
at 72.degree. C. for 5 mins.
[0608] In the preparation of a library for sequencing the two
primers consisted of the surface probe A-handle and either of a
specific translocation primer (for A431) or a specific SNP primer
coupled to the B-handle (Table 2).
[0609] Library Cleanup
[0610] The purified and concentrated sample was further purified
and concentrated by CA-purification (purification by
superparamagnetic beads conjugated to carboxylic acid) with an MBS
robot (Magnetic Biosolutions). A final PEG concentration of 10% was
used in order to remove fragments below 150-200 bp. The amplified
DNA was allowed to bind to the CA-beads (Invitrogen) for 10 min and
was then eluted into 150 of 10 mM Tris-HCl, pH 8.5.
[0611] Library Quality Analysis
[0612] Samples were analyzed with an Agilent Bioanalyzer (Agilent)
in order to confirm the presence of an amplified DNA library, the
DNA High Sensitivity kit or DNA 1000 kit were used depending on the
amount of material.
[0613] Library Indexing
[0614] Samples amplified for 20 cycles were used further to prepare
sequencing libraries. An index PCR master mix was prepared for each
sample and 23 .mu.l was placed into six 0.2 ml tubes. 2 .mu.l of
the amplified and purified cDNA was added to each of the six PCRs
as template making the PCRs containing 1.times. Phusion master mix
(Fermentas), 500 nM InPE1.0 (Illumina), 500 nM Index 1-12
(Illumina), and 0.4 nM InPE2.0 (Illumina). The samples were
amplified in a thereto cycler for 18 cycles at 98.degree. C. for 30
seconds. 65.degree. C. for 30 seconds and 72.degree. C. for 1
minute, followed by a final extension at 72.degree. C. for 5
minutes.
[0615] Sequencing Library Cleanup
[0616] The purified and concentrated sample was further purified
and concentrated by CA-purification with an MBS robot. A final PEG
concentration of 7.8% was used in order to remove fragments below
300-350 bp. The amplified DNA was allowed to bind to the CA-beads
for 10 min and were then eluted into 15 .mu.l of 10 mM Tris-Cl, pH
8.5. Samples were analyzed with an Agilent Bioanalyzer in order to
confirm the presence and size of the finished libraries, the DNA
High Sensitivity kit or DNA 1000 kit were used according to
manufacturers instructions depending on the amount of material
(FIG. 29).
[0617] Sequencing
[0618] Sequencing was carried out in the same way as in the
protocol for 5' to 3' oriented high-density Nimblegen arrays
described in Example 8.
[0619] Data Analysis
[0620] Data analysis was carried out to determine the sensitivity
of capture of the arrayed ID-capture probes. Read 2 was sorted
based on its content of either of the translocation or SNP primers.
These reads were then sorted per their ID contained in Read 1.
[0621] Optional Control--Direct Amplification of Cell-Line Specific
Translocations
[0622] This was used to measure the capture sensitivity of spiked
cell lines directly by PCR. The forward and reverse primers (Table
2) for the A431 translocations were used to try and detect the
presence of the translocation in the second strand copied and
released material (FIG. 30).
TABLE-US-00004 TABLE 2 Oligos used for spatial transcriptomics and
spatial genomics Example 8 Nimblegen 5' to 3' arrays with free 3'
end Array probes 5' to 3' Probe1 (SEQ ID NO: 50)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGTCCGATATGATTGCCGCTTTTTTTTTTTTTTTTT-
TTTVN Probe2 (SEQ ID NO: 51)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATGAGCCGGGTTCATCTTTTTTTTTTTTTTTTTTT-
TTTVN Probe3 (SEQ ID NO: 52)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTGAGGCACTCTGTTGGGATTTTTTTTTTTTTTTTT-
TTTVN Probe4 (SEQ ID NO: 53)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATGATTAGTCGCCATTCGTTTTTTTTTTTTTTTTT-
TTTVN Probe5 (SEQ ID NO: 54)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTACTTGAGGGTAGATGTTTTTTTTTTTTTTTTTTTT-
TTTVN Probe6 (SEQ ID NO: 55)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATGGCCAATACTGTTATCTTTTTTTTTTTTTTTTT-
TTTVN Probe7 (SEQ ID NO: 56)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCGCTACCCTGATTCGACCTTTTTTTTTTTTTTTTT-
TTTVN Probe8 (SEQ ID NO: 57)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCCACTTTCGCCGTAGTTTTTTTTTTTTTTTTTT-
TTTVN Probe9 (SEQ ID NO: 58)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTAGCAACTTTGAGCAAGATTTTTTTTTTTTTTTTTT-
TTTVN Probe10 (SEQ ID NO: 59)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGCCAATTCGGAATTCCGGTTTTTTTTTTTTTTTTT-
TTTVN Probe11 (SEQ ID NO: 60)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGCCCAAGGTAATACATTTTTTTTTTTTTTTTTT-
TTTVN Probe12 (SEQ ID NO: 61)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGCATTTCCTATTCGAGTTTTTTTTTTTTTTTTT-
TTTVN Probe13 (SEQ ID NO: 62)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGCTAAATCTAACCGCCTTTTTTTTTTTTTTTTT-
TTTVN Probe14 (SEQ ID NO: 63)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGGAATTAAATTCTGATGGTTTTTTTTTTTTTTTTT-
TTTVN Probe15 (SEQ ID NO: 64)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCATTACATAGGTGCTAAGTTTTTTTTTTTTTTTTT-
TTTVN Probe16 (SEQ ID NO: 65)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATTGACTTGCGCTCGCACTTTTTTTTTTTTTTTTT-
TTTVN Probe17 (SEQ ID NO: 66)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTATAGTATCTCCCAAGTTCTTTTTTTTTTTTTTTTT-
TTTVN Probe18 (SEQ ID NO: 67)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGCGCCTGTAATCCGCATTTTTTTTTTTTTTTTT-
TTTVN Probe19 (SEQ ID NO: 68)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTGCGCCACTCTTTAGGTAGTTTTTTTTTTTTTTTTT-
TTTVN Probe20 (SEQ ID NO: 69)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTATGCAAGTGATTGGCTTTTTTTTTTTTTTTTTTT-
TTTVN Probe21 (SEQ ID NO: 70)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCCAAGCCACGTTTATACGTTTTTTTTTTTTTTTTT-
TTTVN Probe22 (SEQ ID NO: 71)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTACCTGATTGCTGTATAACTTTTTTTTTTTTTTTTT-
TTTVN Probe23 (SEQ ID NO: 72)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCAGCGCATCTATCCTCTATTTTTTTTTTTTTTTTT-
TTTVN Probe24 (SEQ ID NO: 73)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTTCCACGCGTAGGACTAGTTTTTTTTTTTTTTTTTT-
TTTVN Probe25 (SEQ ID NO: 74)
UUUUUACACTCTTTCCCTACACGACGCTCTTCCGATCTCGACTAAGTATGTAGCGCTTTTTTTTTTTTTTTTT-
TTTVN Frame probe AAATTTCGTCTGCTATCGCGCTTCTGTACC Layout1 (SEQ ID
NO: 75) Fluorescent marker probe GGTACAGAAGCGCGATAGCAG-Cy3 PS_1
(SEQ ID NO: 76) Second strand synthesis and first PCR Amplification
handles A_primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 77)
B_dt20VN_primer (SEQ ID NO: 78)
AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTVN Custom sequencing
primer B_r2 (SEQ ID NO: 79) TCA GAC GTG TGC TCT TCC GAT CTT TTT TTT
TTT TTT TTT TTT T Example 9 Nimblegen 3' to 5' arrays with free 5'
end Array probes 5' to 3' Probe1 (SEQ ID NO: 80)
GCGTTCAGAGTGGCAGTCGAGATCACGCGGCAATCATATCGGACAGATCGGAAGAGCGTAGTGTAG
Probe2 (SEQ ID NO: 81)
GCGTTCAGAGTGGCAGTCGAGATCACAAGATGAACCCGGCTCATAGATCGGAAGAGCGTAGTGTAG
Probe3 (SEQ ID NO: 82)
GCGTTCAGAGTGGCAGTCGAGATCACTCCCAACAGAGTGCCTCAAGATCGGAAGAGCGTAGTGTAG
Probe4 (SEQ ID NO: 83)
GCGTTCAGAGTGGCAGTCGAGATCACCGAATGGCGACTAATCATAGATCGGAAGAGCGTAGTGTAG
Probe5 (SEQ ID NO: 84)
GCGTTCAGAGTGGCAGTCGAGATCACAAACATCTACCCTCAAGTAGATCGGAAGAGCGTAGTGTAG
Probe6 (SEQ ID NO: 85)
GCGTTCAGAGTGGCAGTCGAGATCACGATAACAGTATTGGCCATAGATCGGAAGAGCGTAGTGTAG
Probe7 (SEQ ID NO: 86)
GCGTTCAGAGTGGCAGTCGAGATCACGGTCGAATCAGGGTAGCGAGATCGGAAGAGCGTAGTGTAG
Probe8 (SEQ ID NO: 87)
GCGTTCAGAGTGGCAGTCGAGATCACACTACGGCGAAAGTGGGCAGATCGGAAGAGCGTAGTGTAG
Probe9 (SEQ ID NO: 88)
GCGTTCAGAGTGGCAGTCGAGATCACATCTTGCTCAAAGTTGCTAGATCGGAAGAGCGTAGTGTAG
Probe10 (SEQ ID NO: 89)
GCGTTCAGAGTGGCAGTCGAGATCACCCGGAATTCCGAATTGGCAGATCGGAAGAGCGTAGTGTAG
Probe11 (SEQ ID NO: 90)
GCGTTCAGAGTGGCAGTCGAGATCACATGTATTACCTTGGGCGAAGATCGGAAGAGCGTAGTGTAG
Probe12 (SEQ ID NO: 91)
GCGTICAGAGTGGCAGTCGAGATCACCTCGAATAGGAAATGCGAAGATCGGAAGAGCGTAGTGTAG
Probe13 (SEQ ID NO: 92)
GCGTTCAGAGTGGCAGTCGAGATCACGGCGGTTAGATTTAGCAAAGATCGGAAGAGCGTAGTGTAG
Probe14 (SEQ ID NO: 93)
GCGTTCAGAGTGGCAGTCGAGATCACCCATCAGAATTTAATTCCAGATCGGAAGAGCGTAGTGTAG
Probe15 (SEQ ID NO: 94)
GCGTTCAGAGTGGCAGTCGAGATCACCTTAGCACCTATGTAATGAGATCGGAAGAGCGTAGTGTAG
Probe16 (SEQ ID NO: 95)
GCGTTCAGAGTGGCAGTCGAGATCACGTGCGAGCGCAAGTCAATAGATCGGAAGAGCGTAGTGTAG
Probe17 (SEQ ID NO: 96)
GCGTTCAGAGTGGCAGTCGAGATCACGAACTTGGGAGATACTATAGATCGGAAGAGCGTAGTGTAG
Probe18 (SEQ ID NO: 97)
GCGTTCAGAGTGGCAGTCGAGATCACTGCGGATTACAGGCGCACAGATCGGAAGAGCGTAGTGTAG
Probe19 (SEQ ID NO: 98)
GCGTTCAGAGTGGCAGTCGAGATCACCTACCTAAAGAGTGGCGCAGATCGGAAGAGCGTAGTGTAG
Probe20 (SEQ ID NO: 99)
GCGTTCAGAGTGGCAGTCGAGATCACAAGCCAATCACTTGCATAAGATCGGAAGAGCGTAGTGTAG
Probe21 (SEQ ID NO: 100)
GCGTTCAGAGTGGCAGTCGAGATCACCGTATAAACGTGGCTTGGAGATCGGAAGAGCGTAGTGTAG
Probe22 (SEQ ID NO: 101)
GCGTTCAGAGTGGCAGTCGAGATCACGTTATACAGCAATCAGGTAGATCGGAAGAGCGTAGTGTAG
Probe23 (SEQ ID NO: 102)
GCGTTCAGAGTGGCAGTCGAGATCACTAGAGGATAGATGCGCTGAGATCGGAAGAGCGTAGTGTAG
Probe24 (SEQ ID NO: 103)
GCGTTCAGAGTGGCAGTCGAGATCACACTAGTCCTACGCGTGGAAGATCGGAAGAGCGTAGTGTAG
Probe25 (SEQ ID NO: 104)
GCGTTCAGAGTGGCAGTCGAGATCACGCGCTACATACTTAGTCGAGATCGGAAGAGCGTAGTGTAG
Frame probe AAATTTCGTCTGCTATCGCGCTTCTGTACC Layout1 (SEQ ID NO: 105)
Capture probe GTGATCTCGACTGCCACTCTGAATTTTTTTTTTTTTTTTTTTTVN
LP_Poly-dTVN (SEQ ID NO: 106) Amplification handle probe
ACACTCTTTCCCTACACGACGCTCTTCCGATCT A-handle (SEQ ID NO: 107) Second
strand synthesis and first PCR arnp ification handles A_primer
ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 108) B_dt20VN primer
AGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTVN (SEQ ID NO: 109) Second
PCR A_primer (SEQ ID NO: 110) ACACTCTTTCCCTACACGACGCTCTTCCGATCT
B_primer (SEQ ID NO: 111) GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Example 11 Template switching Templateswitch_longB
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATTGrGrG (SEQ ID NO: 112) Example
12 Spatial genomics ACACTCTTTCCCTACACGACGCTCTTCCGATCT A_primer (SEQ
ID NO: 113) B_A431_Chr2 + 2_FW_A
AGACGTGTGCTCTTCCGATCTTGGCTGCCTGAGGCAATG (SEQ ID NO: 114)
B_A431_Chr2 + 2_RE_A AGACGTGTGCTCTTCCGATCTCTCGCTAACAAGCAGAGAGAAC
(SEQ ID NO: 115) B_A431_Chr3_+ 7_FW_B
AGACGTGTGCTCTTCCGATCTTGAGAACAAGGGGGAAGAG (SEQ ID NO: 116)
B_A431_Chr3_+ 7_RE_B AGACGTGTGCTCTTCCGATCTCGGTGAAACAAGCAGGTAAC (SEQ
ID NO: 117) B_NT_1_FW (SEQ ID NO: 118)
AGACGTGTGCTCTTCCGATCTCATTCCCACACTCATCACAC B_NT_1_RE (SEQ ID NO:
119) AGACGTGTGCTCTTCCGATCTTCACACTGGAGAAAGACCC
B_NT_2_FW (SEQ ID NO: 120)
AGACGTGTGCTCTTCCGATCTGGGGTTCAGAGTGATTTTTCAG B_NT_2_RE (SEQ ID NO:
121) AGACGTGTGCTCTTCCGATCTTCCGTTTTCTTTCAGTGCC
Sequence CWU 1
1
121172DNAArtificial SequenceTAP-ID1misc_feature(1)..(1)5'-terminus
amino linker with a C6 spacermisc_feature(72)..(72)n is a, c, g, t
or u 1uuaagtacaa atctcgactg ccactctgaa ccttctcctt ctccttcacc
tttttttttt 60tttttttttt vn 72210DNAArtificial SequenceEnzymatic
recognition sequence 2uuaagtacaa 10320DNAArtificial
SequenceUniversal amplification handle P 3atctcgactg ccactctgaa
20420DNAArtificial sequenceSynthetic oligonucleotide 4ccttctcctt
ctccttcacc 20522DNAArtificial sequenceCapture
sequencemisc_feature(22)..(22)n is a, c, g, or t 5tttttttttt
tttttttttt vn 22620DNAArtificial sequenceSynthetic oligonucleotide
6ccttctcctt ctccttcacc 20720DNAArtificial sequenceSynthetic
oligonucleotide 7ccttgctgct tctcctcctc 20820DNAArtificial
sequenceSynthetic oligonucleotide 8acctcctccg cctcctcctc
20920DNAArtificial sequenceSynthetic oligonucleotide 9gagacatacc
accaagagac 201020DNAArtificial sequenceSynthetic oligonucleotide
10gtcctctatt ccgtcaccat 201120DNAArtificial sequenceSynthetic
oligonucleotide 11gactgagctc gaacatatgg 201220DNAArtificial
sequenceSynthetic oligonucleotide 12tggaggattg acacagaacg
201320DNAArtificial sequenceSynthetic oligonucleotide 13ccagcctctc
cattacatcg 201420DNAArtificial sequenceSynthetic oligonucleotide
14aagatctacc agccagccag 201520DNAArtificial sequenceSynthetic
oligonucleotide 15cgaacttcca ctgtctcctc 201620DNAArtificial
sequenceSynthetic oligonucleotide 16ttgcgccttc tccaatacac
201720DNAArtificial sequenceSynthetic oligonucleotide 17ctcttcttag
catgccacct 201820DNAArtificial sequenceSynthetic oligonucleotide
18accacttctg cattacctcc 201920DNAArtificial sequenceSynthetic
oligonucleotide 19acagcctcct cttcttcctt 202020DNAArtificial
sequenceSynthetic oligonucleotide 20aatcctctcc ttgccagttc
202120DNAArtificial sequenceSynthetic oligonucleotide 21gatgcctcca
cctgtagaac 202220DNAArtificial sequenceSynthetic oligonucleotide
22gaaggaatgg aggatatcgc 202320DNAArtificial sequenceSynthetic
oligonucleotide 23gatccaagga ccatcgactg 202420DNAArtificial
sequenceSynthetic oligonucleotide 24ccactggaac ctgacaaccg
202520DNAArtificial sequenceSynthetic oligonucleotide 25ctgcttcttc
ctggaactca 202666DNAArtificial sequenceFree 5' surface probe -
Amisc_feature(66)..(66)3'-terminus amino linker with a C7 spacer
26gcgttcagag tggcagtcga gatcacgcgg caatcatatc ggacagatcg gaagagcgta
60gtgtag 662766DNAArtificial sequenceFree 5' surface probe -
Umisc_feature(66)..(66)3'-terminus amino linker with a C7 spacer
27gcgttcagag tggcagtcga gatcacgcgg caatcatatc ggacggctgc tggtaaatag
60agatca 662823DNAArtificial sequenceLP' 28ttcagagtgg cagtcgagat
cac 232918DNAArtificial sequenceID' 29gcggcaatca tatcggac
183022DNAArtificial sequenceA' 22bp MutY mismatch 30agatcggaag
agcgtagtgt ag 223122DNAArtificial sequenceU' 22bp MutY mismatch
31ggctgctggt aaatagagat ca 223233DNAArtificial sequenceIllumina
amplification handle A 32acactctttc cctacacgac gctcttccga tct
333335DNAArtificial sequenceUniversal amplification handle U
33aagtgtggaa agttgatcgc tatttaccag cagcc 353445DNAArtificial
sequenceCapture LP
Poly-dTVNmisc_feature(1)..(1)Phosphorylatedmisc_feature(45)..(45)n
is a, c, g, or t 34gtgatctcga ctgccactct gaattttttt tttttttttt
tttvn 453547DNAArtificial sequenceCapture LP
Poly-d24Tmisc_feature(1)..(1)Phosphorylated 35gtgatctcga ctgccactct
gaattttttt tttttttttt ttttttt 473621DNAArtificial sequenceIllumina
amplification handle B 36agacgtgtgc tcttccgatc t
213720DNAArtificial sequenceUniversal amplification handle X
37acgtctgtga atagccgcat 203829DNAArtificial sequenceB R6 handle (or
X)misc_feature(22)..(29)n is a, c, g, or t 38agacgtgtgc tcttccgatc
tnnnnnnnn 293931DNAArtificial sequenceB R8 handle (or
X)misc_feature(22)..(31)n is a, c, g, or t 39agacgtgtgc tcttccgatc
tnnnnnnnnn n 314043DNAArtificial sequenceB polyTVN (or
X)misc_feature(43)..(43)n is a, c, g, or t 40agacgtgtgc tcttccgatc
tttttttttt tttttttttt tvn 434145DNAArtificial sequenceB poly24T (or
X) 41agacgtgtgc tcttccgatc tttttttttt tttttttttt ttttt
454253DNAArtificial sequenceA P handle 42acactctttc cctacacgac
gctcttccga tctatctcga ctgccactct gaa 534320DNAArtificial
sequenceBeta-2 microglobulin (B2M) primer 43tgggggtgag aattgctaag
204420DNAArtificial sequenceID-1 primer 44ccttctcctt ctccttcacc
204520DNAArtificial sequenceID-5 primer 45gtcctctatt ccgtcaccat
204620DNAArtificial sequenceID-20 primer 46ctgcttcttc ctggaactca
204720DNAArtificial sequenceForward - Genomic DNA Human primer
47gactgctctt ttcacccatc 204818DNAArtificial sequenceReverse -
Genomic DNA Human primer 48ggagctgctg gtgcaggg 184920DNAArtificial
sequenceP - label specific primer 49atctcgactg ccactctgaa
205078DNAArtificial sequenceProbe 1misc_feature(78)..(78)n is a, c,
g, t or u 50uuuuuacact ctttccctac acgacgctct tccgatctgt ccgatatgat
tgccgctttt 60tttttttttt ttttttvn 785178DNAArtificial sequenceProbe
2misc_feature(78)..(78)n is a, c, g, t or u 51uuuuuacact ctttccctac
acgacgctct tccgatctat gagccgggtt catctttttt 60tttttttttt ttttttvn
785278DNAArtificial sequenceProbe 3misc_feature(78)..(78)n is a, c,
g, t or u 52uuuuuacact ctttccctac acgacgctct tccgatcttg aggcactctg
ttgggatttt 60tttttttttt ttttttvn 785378DNAArtificial sequenceProbe
4misc_feature(78)..(78)n is a, c, g, t or u 53uuuuuacact ctttccctac
acgacgctct tccgatctat gattagtcgc cattcgtttt 60tttttttttt ttttttvn
785478DNAArtificial sequenceProbe 5misc_feature(78)..(78)n is a, c,
g, t or u 54uuuuuacact ctttccctac acgacgctct tccgatctac ttgagggtag
atgttttttt 60tttttttttt ttttttvn 785578DNAArtificial sequenceProbe
6misc_feature(78)..(78)n is a, c, g, t or u 55uuuuuacact ctttccctac
acgacgctct tccgatctat ggccaatact gttatctttt 60tttttttttt ttttttvn
785678DNAArtificial sequenceProbe 7misc_feature(78)..(78)n is a, c,
g, t or u 56uuuuuacact ctttccctac acgacgctct tccgatctcg ctaccctgat
tcgacctttt 60tttttttttt ttttttvn 785778DNAArtificial sequenceProbe
8misc_feature(78)..(78)n is a, c, g, t or u 57uuuuuacact ctttccctac
acgacgctct tccgatctgc ccactttcgc cgtagttttt 60tttttttttt ttttttvn
785878DNAArtificial sequenceProbe 9misc_feature(78)..(78)n is a, c,
g, t or u 58uuuuuacact ctttccctac acgacgctct tccgatctag caactttgag
caagattttt 60tttttttttt ttttttvn 785978DNAArtificial sequenceProbe
10misc_feature(78)..(78)n is a, c, g, t or u 59uuuuuacact
ctttccctac acgacgctct tccgatctgc caattcggaa ttccggtttt 60tttttttttt
ttttttvn 786078DNAArtificial sequenceProbe
11misc_feature(78)..(78)n is a, c, g, t or u 60uuuuuacact
ctttccctac acgacgctct tccgatcttc gcccaaggta atacattttt 60tttttttttt
ttttttvn 786178DNAArtificial sequenceProbe
12misc_feature(78)..(78)n is a, c, g, t or u 61uuuuuacact
ctttccctac acgacgctct tccgatcttc gcatttccta ttcgagtttt 60tttttttttt
ttttttvn 786278DNAArtificial sequenceProbe
13misc_feature(78)..(78)n is a, c, g, t or u 62uuuuuacact
ctttccctac acgacgctct tccgatcttt gctaaatcta accgcctttt 60tttttttttt
ttttttvn 786378DNAArtificial sequenceProbe
14misc_feature(78)..(78)n is a, c, g, t or u 63uuuuuacact
ctttccctac acgacgctct tccgatctgg aattaaattc tgatggtttt 60tttttttttt
ttttttvn 786478DNAArtificial sequenceProbe
15misc_feature(78)..(78)n is a, c, g, t or u 64uuuuuacact
ctttccctac acgacgctct tccgatctca ttacataggt gctaagtttt 60tttttttttt
ttttttvn 786578DNAArtificial sequenceProbe
16misc_feature(78)..(78)n is a, c, g, t or u 65uuuuuacact
ctttccctac acgacgctct tccgatctat tgacttgcgc tcgcactttt 60tttttttttt
ttttttvn 786678DNAArtificial sequenceProbe
17misc_feature(78)..(78)n is a, c, g, t or u 66uuuuuacact
ctttccctac acgacgctct tccgatctat agtatctccc aagttctttt 60tttttttttt
ttttttvn 786778DNAArtificial sequenceProbe
18misc_feature(78)..(78)n is a, c, g, t or u 67uuuuuacact
ctttccctac acgacgctct tccgatctgt gcgcctgtaa tccgcatttt 60tttttttttt
ttttttvn 786878DNAArtificial sequenceProbe
19misc_feature(78)..(78)n is a, c, g, t or u 68uuuuuacact
ctttccctac acgacgctct tccgatctgc gccactcttt aggtagtttt 60tttttttttt
ttttttvn 786978DNAArtificial sequenceProbe
20misc_feature(78)..(78)n is a, c, g, t or u 69uuuuuacact
ctttccctac acgacgctct tccgatctta tgcaagtgat tggctttttt 60tttttttttt
ttttttvn 787078DNAArtificial sequenceProbe
21misc_feature(78)..(78)n is a, c, g, t or u 70uuuuuacact
ctttccctac acgacgctct tccgatctcc aagccacgtt tatacgtttt 60tttttttttt
ttttttvn 787178DNAArtificial sequenceProbe
22misc_feature(78)..(78)n is a, c, g, t or u 71uuuuuacact
ctttccctac acgacgctct tccgatctac ctgattgctg tataactttt 60tttttttttt
ttttttvn 787278DNAArtificial sequenceProbe
23misc_feature(78)..(78)n is a, c, g, t or u 72uuuuuacact
ctttccctac acgacgctct tccgatctca gcgcatctat cctctatttt 60tttttttttt
ttttttvn 787378DNAArtificial sequenceProbe
24misc_feature(78)..(78)n is a, c, g, t or u 73uuuuuacact
ctttccctac acgacgctct tccgatcttc cacgcgtagg actagttttt 60tttttttttt
ttttttvn 787478DNAArtificial sequenceProbe
25misc_feature(78)..(78)n is a, c, g, t or u 74uuuuuacact
ctttccctac acgacgctct tccgatctcg actaagtatg tagcgctttt 60tttttttttt
ttttttvn 787530DNAArtificial sequenceFrame probe - Layout 1
75aaatttcgtc tgctatcgcg cttctgtacc 307621DNAArtificial
sequenceFluorescent marker probe PS 1misc_feature(21)..(21)Coupled
to cyanine 3 fluorescent dye 76ggtacagaag cgcgatagca g
217733DNAArtificial sequenceSecond strand synthesis and first PCR
amplification handle - A primer 77acactctttc cctacacgac gctcttccga
tct 337843DNAArtificial sequenceSecond strand synthesis and first
PCR amplification handle - B dt20VN primermisc_feature(43)..(43)n
is a, c, g, or t 78agacgtgtgc tcttccgatc tttttttttt tttttttttt tvn
437943DNAArtificial sequenceCustom sequencing primer B r2
79tcagacgtgt gctcttccga tctttttttt tttttttttt ttt
438066DNAArtificial sequenceProbe 1 80gcgttcagag tggcagtcga
gatcacgcgg caatcatatc ggacagatcg gaagagcgta 60gtgtag
668166DNAArtificial sequenceProbe 2 81gcgttcagag tggcagtcga
gatcacaaga tgaacccggc tcatagatcg gaagagcgta 60gtgtag
668266DNAArtificial sequenceProbe 3 82gcgttcagag tggcagtcga
gatcactccc aacagagtgc ctcaagatcg gaagagcgta 60gtgtag
668366DNAArtificial sequenceProbe 4 83gcgttcagag tggcagtcga
gatcaccgaa tggcgactaa tcatagatcg gaagagcgta 60gtgtag
668466DNAArtificial sequenceProbe 5 84gcgttcagag tggcagtcga
gatcacaaac atctaccctc aagtagatcg gaagagcgta 60gtgtag
668566DNAArtificial sequenceProbe 6 85gcgttcagag tggcagtcga
gatcacgata acagtattgg ccatagatcg gaagagcgta 60gtgtag
668666DNAArtificial sequenceProbe 7 86gcgttcagag tggcagtcga
gatcacggtc gaatcagggt agcgagatcg gaagagcgta 60gtgtag
668766DNAArtificial sequenceProbe 8 87gcgttcagag tggcagtcga
gatcacacta cggcgaaagt gggcagatcg gaagagcgta 60gtgtag
668866DNAArtificial sequenceProbe 9 88gcgttcagag tggcagtcga
gatcacatct tgctcaaagt tgctagatcg gaagagcgta 60gtgtag
668966DNAArtificial sequenceProbe 10 89gcgttcagag tggcagtcga
gatcacccgg aattccgaat tggcagatcg gaagagcgta 60gtgtag
669066DNAArtificial sequenceProbe 11 90gcgttcagag tggcagtcga
gatcacatgt attaccttgg gcgaagatcg gaagagcgta 60gtgtag
669166DNAArtificial sequenceProbe 12 91gcgttcagag tggcagtcga
gatcacctcg aataggaaat gcgaagatcg gaagagcgta 60gtgtag
669266DNAArtificial sequenceProbe 13 92gcgttcagag tggcagtcga
gatcacggcg gttagattta gcaaagatcg gaagagcgta 60gtgtag
669366DNAArtificial sequenceProbe 14 93gcgttcagag tggcagtcga
gatcacccat cagaatttaa ttccagatcg gaagagcgta 60gtgtag
669466DNAArtificial sequenceProbe 15 94gcgttcagag tggcagtcga
gatcacctta gcacctatgt aatgagatcg gaagagcgta 60gtgtag
669566DNAArtificial sequenceProbe 16 95gcgttcagag tggcagtcga
gatcacgtgc gagcgcaagt caatagatcg gaagagcgta 60gtgtag
669666DNAArtificial sequenceProbe 17 96gcgttcagag tggcagtcga
gatcacgaac ttgggagata ctatagatcg gaagagcgta 60gtgtag
669766DNAArtificial sequenceProbe 18 97gcgttcagag tggcagtcga
gatcactgcg gattacaggc gcacagatcg gaagagcgta 60gtgtag
669866DNAArtificial sequenceProbe 19 98gcgttcagag tggcagtcga
gatcacctac ctaaagagtg gcgcagatcg gaagagcgta 60gtgtag
669966DNAArtificial sequenceProbe 20 99gcgttcagag tggcagtcga
gatcacaagc caatcacttg cataagatcg gaagagcgta 60gtgtag
6610066DNAArtificial sequenceProbe 21 100gcgttcagag tggcagtcga
gatcaccgta taaacgtggc ttggagatcg gaagagcgta 60gtgtag
6610166DNAArtificial sequenceProbe 22 101gcgttcagag tggcagtcga
gatcacgtta tacagcaatc aggtagatcg gaagagcgta 60gtgtag
6610266DNAArtificial sequenceProbe 23 102gcgttcagag tggcagtcga
gatcactaga ggatagatgc gctgagatcg gaagagcgta 60gtgtag
6610366DNAArtificial sequenceProbe 24 103gcgttcagag tggcagtcga
gatcacacta
gtcctacgcg tggaagatcg gaagagcgta 60gtgtag 6610466DNAArtificial
sequenceProbe 25 104gcgttcagag tggcagtcga gatcacgcgc tacatactta
gtcgagatcg gaagagcgta 60gtgtag 6610530DNAArtificial sequenceFrame
probe - layout 1 105aaatttcgtc tgctatcgcg cttctgtacc
3010645DNAArtificial sequenceCapture probe - LP
poly-dTVNmisc_feature(45)..(45)n is a, c, g, or t 106gtgatctcga
ctgccactct gaattttttt tttttttttt tttvn 4510733DNAArtificial
sequenceAmplification handle probe A-handle 107acactctttc
cctacacgac gctcttccga tct 3310833DNAArtificial sequenceSecond
strand synthesis and first PCR amplification handle - A primer
108acactctttc cctacacgac gctcttccga tct 3310943DNAArtificial
sequenceSecond strand synthesis and first PCR amplification handle
- B dt20VN primermisc_feature(43)..(43)n is a, c, g, or t
109agacgtgtgc tcttccgatc tttttttttt tttttttttt tvn
4311033DNAArtificial sequenceSecond PCR - A primer 110acactctttc
cctacacgac gctcttccga tct 3311134DNAArtificial sequenceSecond PCR -
B primer 111gtgactggag ttcagacgtg tgctcttccg atct
3411239DNAArtificial sequenceTemplate Switching primer -
longBmisc_feature(37)..(39)Ribonucleotides 112gtgactggag ttcagacgtg
tgctcttccg atctatggg 3911333DNAArtificial sequenceSpatial genomics
- A primer 113acactctttc cctacacgac gctcttccga tct
3311439DNAArtificial sequenceSpatial genomics - B A431 Chr2+2 FW A
114agacgtgtgc tcttccgatc ttggctgcct gaggcaatg 3911543DNAArtificial
sequenceSpatial genomics - B A431 Chr2+2 RE A 115agacgtgtgc
tcttccgatc tctcgctaac aagcagagag aac 4311640DNAArtificial
sequenceSpatial genomics - B A431 Chr3+7 FW B 116agacgtgtgc
tcttccgatc ttgagaacaa gggggaagag 4011741DNAArtificial
sequenceSpatial genomics - B A431 Chr3+7 RE B 117agacgtgtgc
tcttccgatc tcggtgaaac aagcaggtaa c 4111841DNAArtificial
sequenceSpatial genomics - B NT 1 FW 118agacgtgtgc tcttccgatc
tcattcccac actcatcaca c 4111940DNAArtificial sequenceSpatial
genomics - B NT 1 RE 119agacgtgtgc tcttccgatc ttcacactgg agaaagaccc
4012043DNAArtificial sequenceSpatial genomics - B NT 2 FW
120agacgtgtgc tcttccgatc tggggttcag agtgattttt cag
4312140DNAArtificial sequenceSpatial genomics - B NT 2 RE
121agacgtgtgc tcttccgatc ttccgttttc tttcagtgcc 40
* * * * *
References