U.S. patent application number 17/532756 was filed with the patent office on 2022-03-10 for methods and compositions using rna interference and antisense oligonucleotides for inhibition of kras.
The applicant listed for this patent is The University of North Carolina at Chapel Hill. Invention is credited to Salma H. Azam, Chad Pecot.
Application Number | 20220073923 17/532756 |
Document ID | / |
Family ID | |
Filed Date | 2022-03-10 |
United States Patent
Application |
20220073923 |
Kind Code |
A1 |
Pecot; Chad ; et
al. |
March 10, 2022 |
METHODS AND COMPOSITIONS USING RNA INTERFERENCE AND ANTISENSE
OLIGONUCLEOTIDES FOR INHIBITION OF KRAS
Abstract
The invention relates to the inhibition of expression of mutant
KRAS sequences using RNA interference, antisense oligonucleotides,
and chemically-modified oligonucleotides.
Inventors: |
Pecot; Chad; (Pittsboro,
NC) ; Azam; Salma H.; (Cary, NC) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
The University of North Carolina at Chapel Hill |
Chapel Hill |
NC |
US |
|
|
Appl. No.: |
17/532756 |
Filed: |
November 22, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16842404 |
Apr 7, 2020 |
11180759 |
|
|
17532756 |
|
|
|
|
16070600 |
Jul 17, 2018 |
10619159 |
|
|
PCT/US2017/014013 |
Jan 19, 2017 |
|
|
|
16842404 |
|
|
|
|
62280458 |
Jan 19, 2016 |
|
|
|
International
Class: |
C12N 15/113 20060101
C12N015/113; A61P 35/00 20060101 A61P035/00 |
Claims
1. An antisense oligonucleotide targeted to a synthetic human KRAS
mRNA that encodes the missense mutations G12C, G12D, and G13D,
wherein the antisense oligonucleotide is 16-25 nucleotides in
length and comprises the sequence TABLE-US-00013 (SEQ ID NO: 114)
TCTTGCCTACGTCATA.
2. (canceled)
3. The antisense oligonucleotide of claim 1, consisting of the
sequence CACTCTTGCCTACGTCATAA (SEQ ID NO:115) or
GCACTCTTGCCTACGTCATA (SEO ID NO: 116).
4. (canceled)
5. The antisense oligonucleotide of claim 1, wherein the antisense
oligonucleotide comprises at least one phosphorothioate linkage,
optionally all phosphorothioate linkages.
6. (canceled)
7. The antisense oligonucleotide of claim 1, wherein the antisense
oligonucleotide comprises at least one modified nucleotide at or
near the 5' end and/or the 3' end, optionally at least three
modified nucleotides at each of the 5' end and the 3' end.
8. (canceled)
9. The antisense oligonucleotide of claim 7, wherein the modified
nucleotide is a 2'-O-methoxyethyl (2'-MOE)-modified nucleotide.
10. The antisense oligonucleotide of claim 9, wherein the antisense
oligonucleotide comprises at least three 2'-MOE-modified
nucleotides at each of the 5' end and/or the 3' end.
11. The antisense oligonucleotide of claim 10, wherein the
antisense oligonucleotide consists of a sequence selected from:
TABLE-US-00014 a) (SEQ ID NO: 68)
C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A*A; or b) (SEQ ID NO: 69)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A;
wherein * indicates a phosphorothioate linkage and bold indicates a
2'-MOE-modified nucleotide.
12. The antisense oligonucleotide of claim 7, wherein at least one
modified nucleotide is a locked nucleic acid.
13. An antisense oligonucleotide targeted to a naturally-occurring
human KRAS mRNA encoding a mutation selected from G12C, G12D, G12V,
and G13D, wherein the antisense oligonucleotide is 16-25
nucleotides in length and comprises a sequence selected from: a)
TCTTGCCTACGCCACA (SEQ ID NO:117) targeted to a human KRAS mRNA
encoding a G12C mutation; b) TCTTGCCTACGCCATC (SEQ ID NO:118)
targeted to a human KRAS mRNA encoding a G12D mutation; c)
TCTTGCCTACGCCAAC (SEQ ID NO:119) targeted to a human KRAS mRNA
encoding a G12V mutation; d) TCTTGCCTACGTCACC (SEQ ID NO:120)
targeted to a human KRAS mRNA encoding a G13D mutation; or e) a
sequence at least 90% identical to any one of a) to d); wherein the
antisense oligonucleotide comprises at least one non-naturally
occurring chemical modification.
14. (canceled)
15. The antisense oligonucleotide of claim 13, wherein the
antisense oligonucleotide consists of a sequence selected from: a)
GCACTCTTGCCTACGCCACA (SEQ ID NO:117) targeted to a human KRAS mRNA
encoding a G12C mutation; b) GCACTCTTGCCTACGCCATC (SEQ ID NO:118)
targeted to a human KRAS mRNA encoding a G12D mutation; c)
GCACTCTTGCCTACGCCAAC (SEQ ID NO:119) targeted to a human KRAS mRNA
encoding a G12V mutation; or d) GCACTCTTGCCTACGTCACC (SEQ ID
NO:120) targeted to a human KRAS mRNA encoding a G13D mutation.
16. The antisense oligonucleotide of claim 13, wherein the
antisense oligonucleotide comprises at least one phosphorothioate
linkage, optionally all phosphorothioate linkages.
17. (canceled)
18. The antisense oligonucleotide of claim 13, wherein the
antisense oligonucleotide comprises at least one modified
nucleotide at or near the 5' end and/or the 3' end, optionally at
least the modified nucleotides at each of the 5' end and the 3'
end.
19. (canceled)
20. The antisense oligonucleotide of claim 18, wherein the modified
nucleotide is a 2'-MOE-modified nucleotide.
21. The antisense oligonucleotide of claim 20, wherein the
antisense oligonucleotide comprises at least three 2'-MOE-modified
nucleotides at each of the 5' end and/or the 3' end.
22. The antisense oligonucleotide of claim 21, wherein the
antisense oligonucleotide consists of a sequence selected from:
TABLE-US-00015 a) (SEQ ID NO: 70)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*C*A; b) (SEQ ID NO: 71)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*T*C; c) (SEQ ID NO: 72)
G*C*A*C*T*C*T*T*G*C*C*T*A*C'G*C*C*A*A*C; or d) (SEQ ID NO: 73)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*C*C;
wherein * indicates a phosphorothioate linkage and bold indicates a
2'-MOE-modified nucleotide.
23. The antisense oligonucleotide of claim 18, wherein at least one
modified nucleotide is a locked nucleic acid.
24. The antisense oligonucleotide of claim 23, wherein the
antisense oligonucleotide consists of a sequence selected from:
TABLE-US-00016 a) (SEQ ID NO: 74)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*C*+A; b) (SEQ ID NO: 75)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*+T*C; c) (SEQ ID NO: 76)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*+A*C; or d) (SEQ ID NO: 77)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*+T*C*A*C*C;
wherein * indicates a phosphorothioate linkage, bold indicates a
2'-methoxymethyl-modified nucleotide, and + indicates the following
nucleotide is a locked nucleic acid.
25. (canceled)
26. A nucleic acid molecule encoding the antisense oligonucleotide
of claim 13.
27-38. (canceled)
39. A composition comprising the antisense oligonucleotide of claim
13.
40. A composition comprising two or more of the antisense
oligonucleotide of claim 13, in any combination, wherein the two or
more antisense oligonucleotides each comprise a different
sequence.
41-42. (canceled)
43. A pharmaceutical composition comprising the antisense
oligonucleotide of claim 13 and a pharmaceutically acceptable
carrier.
44. (canceled)
45. A method of treating cancer in a subject in need thereof,
wherein the cancer comprises a mutant human KRAS gene comprising
one or more of the missense mutations G12C, G12D, G12V, and G13D,
the method comprising delivering to the subject the antisense
oligonucleotide of claim 13, thereby treating cancer in the
subject.
46. (canceled)
Description
STATEMENT OF PRIORITY
[0001] This application is a divisional of and claims priority to
U.S. application Ser. No. 16/842,404, filed Apr. 7, 2020, now U.S.
Pat. No. 11,180,759, which is a continuation-in-part of U.S.
application Ser. No. 16/070,600, filed Jul. 17, 2018, now U.S. Pat.
No. 10,619,159, which is a 35 U.S.C. .sctn. 371 national phase
application of PCT Application PCT/US2017/014013 filed Jan. 19,
2017, which claims the benefit of U.S. Provisional Application Ser.
No. 62/280,458, filed Jan. 19, 2016, the entire contents of each of
which are incorporated by reference herein in its entirety.
STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING
[0002] A Sequence Listing in ASCII text format, submitted under 37
C.F.R. .sctn. 1.821, entitled 5470-773IPDV_ST25.txt, 59,648 bytes
in size, generated on Nov. 18, 2021 and filed via EFS-Web, is
provided in lieu of a paper copy. This Sequence Listing is hereby
incorporated by reference into the specification for its
disclosures.
FIELD OF THE INVENTION
[0003] The invention relates to the inhibition of expression of
mutant KRAS sequences using RNA interference, antisense
oligonucleotides, and chemically-modified oligonucleotides.
BACKGROUND OF THE INVENTION
[0004] Since its discovery in 1982, the RAS family of genes has
been characterized as an important class of proto-oncogenes (Cox et
al., Nat. Rev. Drug Discov. 13:828 (2014)). Through three decades
of extensive research, mutational activation of certain RAS genes
(KRAS, NRAS, and HRAS) has been implicated in nearly one-third of
all cancers (Pecot et al., Mol. Cancer Ther. 13:2876 (2014)). In
particular, KRAS mutations are observed most frequently, both
exclusively and in conjunction with the other RAS isoforms (Cox et
al., Nat. Rev. Drug Discov. 13:828 (2014)). Yet in spite of efforts
to develop inhibitors for this highly prevalent mutation, no strong
therapeutic candidates have emerged, thus earning the KRAS gene its
reputation as an elusively "undruggable" target.
[0005] The RAS genes encode a family of small GTPases that act upon
downstream effector proteins to promote cell survival, growth, and
proliferation (Khosravi-Far et al., Cancer Metastasis Rev. 13:67
(1994)). Proper function of the RAS proteins relies upon activation
via a guanine nucleotide exchange factor (GEF) to its active,
GTP-bound form as well as membrane association of the RAS-GTP
complex, both of which have been proposed as targets for KRAS
inhibition. However, due to low efficacy and target specificity of
previously proposed therapeutic agents in directly inhibiting KRAS,
current measures to target the KRAS pathway focus predominantly on
inhibition of downstream effector proteins (Cox et al., Nat. Rev.
Drug Discov. 13:828 (2014)). Nevertheless, despite challenges in
developing a small molecule to directly down-regulate gene
activity, KRAS remains a therapeutically relevant target due to its
prevalence as a driving mutation in human cancers.
[0006] Advances in RNA interference (RNAi) suggest its potential as
an effective means of knocking down KRAS expression. RNAi therapy
uses the interaction of an exogenous small interfering RNA (siRNA)
and endogenous enzymatic machinery, termed an RNA-induced silencing
complex (RISC), to selectively silence specific genes at the mRNA
level (Pecot et al., Nat. Rev. Cancer 11:59 (2011)). A recent study
has revealed the efficacy of RNAi as a well-tolerated therapy for
inducing metastatic regression in human cancer patients (Tabernero
et al., Cancer Discov. 3:406 (2013)). In addition, using
nanoliposomes we have recently verified the efficacy of siRNA
delivery for knockdown of human KRAS in various lung and colon
cancer models, both in vitro and in vivo (Pecot et al., Mol. Cancer
Ther. 13:2876 (2014)).
[0007] However, there remains a lack of target-specificity for
mutant KRAS over the wild-type (WT) allele. Despite the oncogenic
properties of the mutant allele, WT KRAS is necessary for proper
response to extra-cellular inputs that promote viability in
non-cancerous cells (Khosravi-Far et al., Cancer Metastasis Rev.
13:67 (1994)). As such, there is a need for inhibitors that target
mutant KRAS while sparing WT KRAS.
[0008] Accordingly, the present invention overcomes the
deficiencies in the art by providing compositions and methods using
RNA interference for specific inhibition of mutant KRAS
sequences.
SUMMARY OF THE INVENTION
[0009] The present invention is based on the identification of RNA
molecules that inhibit expression of mutant KRAS sequences while
sparing expression of WT KRAS. Accordingly, one aspect of the
invention relates to a double stranded RNA molecule comprising an
antisense strand and a sense strand, wherein the nucleotide
sequence of the antisense strand is complementary to a region of
the nucleotide sequence of a synthetic human KRAS gene that
contains the missense mutations G12C, G12D, and G13D or the
missense mutations G12C, G12V, and G13D, the region consisting
essentially of about 18 to about 25 consecutive nucleotides;
wherein the double stranded RNA molecule inhibits expression of a
mutant human KRAS gene comprising one or more of the missense
mutations G12C, G12D, G12V, and G13D and minimally inhibits
expression of wild-type human KRAS.
[0010] Another aspect of the invention relates to a composition,
e.g., a pharmaceutical composition, comprising one or more of the
RNA molecules of the invention.
[0011] A further aspect of the invention relates to a method of
inhibiting expression of a mutant human KRAS gene comprising one or
more of the missense mutations G12C, G12D, G12V, and G13D in a
cell, the method comprising contacting the cell with the RNA
molecule of the invention, thereby inhibiting expression of the
mutant human KRAS gene in the cell.
[0012] An additional aspect of the invention relates to a method of
treating cancer in a subject in need thereof, wherein the cancer
comprises a mutant human KRAS gene comprising one or more of the
missense mutations G12C, G12D, G12V, and G13D, the method
comprising delivering to the subject the RNA molecule of the
invention, thereby treating cancer in the subject.
[0013] Another aspect of the invention relates to the use of the
RNA molecules of the invention to inhibit expression of a mutant
human KRAS gene comprising one or more of the missense mutations
G12C, G12D, G12V. and G13D in a cell and to treat cancer in a
subject in need thereof, wherein the cancer comprises a mutant
human KRAS gene comprising one or more of the missense mutations
G12C, G12D, G12V, and G13D.
[0014] A further aspect of the invention relates to an antisense
oligonucleotide targeted to a synthetic human KRAS mRNA that
encodes the missense mutations G12C, G12D, and G13D, wherein the
antisense oligonucleotide is 16-25 nucleotides in length and
comprises the sequence TCTTGCCTACGTCATA (SEQ ID NO:114).
[0015] An additional aspect of the invention relates to an
antisense oligonucleotide targeted to a naturally-occurring human
KRAS mRNA encoding a mutation selected from G12C, G12D, G12V, and
G13D, wherein the antisense oligonucleotide is 16-25 nucleotides in
length and comprises a sequence selected from:
[0016] a) TCTTGCCTACGCCACA (SEQ ID NO:117) targeted to a human KRAS
mRNA encoding a G12C mutation;
[0017] b) TCTTGCCTACGCCATC (SEQ ID NO:118) targeted to a human KRAS
mRNA encoding a G12D mutation;
[0018] c) TCTTGCCTACGCCAAC (SEQ ID NO:119) targeted to a human KRAS
mRNA encoding a G12V mutation:
[0019] d) TCTTGCCTACGTCACC (SEQ ID NO:120) targeted to a human KRAS
mRNA encoding a G13D mutation; or
[0020] e) a sequence at least 90% identical to any one of a) to d)
wherein the antisense oligonucleotide comprises at least one
non-naturally occurring chemical modification.
[0021] Another aspect of the invention relates to a siRNA molecule
targeted to a naturally-occurring human KRAS mRNA encoding a
mutation selected from G12C, G12D, G12V. and G13D, wherein the
siRNA molecule comprises at least one chemical modification, and
wherein the siRNA molecule comprises one of the following pairs of
sequences: sense strand of SEQ ID NO:128 and antisense strand of
SEQ ID NO:129; [0022] sense strand of SEQ ID NO:130 and antisense
strand of SEQ ID NO:131; [0023] sense strand of SEQ ID NO:132 and
antisense strand of SEQ ID NO:133; [0024] sense strand of SEQ ID
NO:134 and antisense strand of SEQ ID NO:135; [0025] sense strand
of SEQ ID NO:136 and antisense strand of SEQ ID NO:137; [0026]
sense strand of SEQ ID NO:138 and antisense strand of SEQ ID
NO:139; [0027] sense strand of SEQ ID NO:140 and antisense strand
of SEQ ID NO:141; [0028] sense strand of SEQ ID NO:142 and
antisense strand of SEQ ID NO:143; [0029] sense strand of SEQ ID
NO:144 and antisense strand of SEQ ID NO:145; [0030] sense strand
of SEQ ID NO:146 and antisense strand of SEQ ID NO:147; [0031]
sense strand of SEQ ID NO:148 and antisense strand of SEQ ID
NO:149; [0032] sense strand of SEQ ID NO:150 and antisense strand
of SEQ ID NO:151; [0033] sense strand of SEQ ID NO:152 and
antisense strand of SEQ ID NO:153; [0034] sense strand of SEQ ID
NO:154 and antisense strand of SEQ ID NO:155; [0035] sense strand
of SEQ ID NO:156 and antisense strand of SEQ ID NO:157; or [0036]
sense strand of SEQ ID NO:158 and antisense strand of SEQ ID
NO:159; or a sequence at least 90% identical thereto.
[0037] An additional aspect of the invention relates to an siRNA
molecule targeted to human KRAS mRNA, wherein the sense strand of
the siRNA comprises the sequence of SEQ ID NO:50 or SEQ ID NO:51,
and wherein the siRNA comprises at least one non-naturally
occurring chemical modification.
[0038] Another aspect of the invention relates to a composition,
e.g., a pharmaceutical composition, comprising one or more of the
antisense oligonucleotides or siRNAs molecules of the
invention.
[0039] A further aspect of the invention relates to a method of
inhibiting expression of a mutant human KRAS gene comprising one or
more of the missense mutations G12C, G12D, G12V, and G13D in a
cell, the method comprising contacting the cell with the antisense
oligonucleotides or siRNAs molecules of the invention, thereby
inhibiting expression of the mutant human KRAS gene in the
cell.
[0040] An additional aspect of the invention relates to a method of
treating cancer in a subject in need thereof, wherein the cancer
comprises a mutant human KRAS gene comprising one or more of the
missense mutations G12C, G12D, G12V, and G13D, the method
comprising delivering to the subject the antisense oligonucleotides
or siRNAs molecules of the invention, thereby treating cancer in
the subject.
[0041] Another aspect of the invention relates to the use of the
antisense oligonucleotides or siRNAs molecules of the invention to
inhibit expression of a mutant human KRAS gene comprising one or
more of the missense mutations G12C, G12D, G12V, and G13D in a cell
and to treat cancer in a subject in need thereof, wherein the
cancer comprises a mutant human KRAS gene comprising one or more of
the missense mutations G12C, G12D, G12V, and G13D.
[0042] These and other aspects of the invention are set forth in
more detail in the description of the invention below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0043] FIG. 1 shows KRAS siRNA sequences (SEQ ID NOS:40-51). TMS
siRNA sequences were designed to bind the G domain of the human
KRAS gene at codons 12 and 13 and target three point mutations
(each indicated with an asterisk). Underlining indicates the
remaining base pairs targeted by the siRNA (sense). Sequences for
G12C and G12D siRNAs were obtained from Fleming et al., Mol. Cancer
Res. 3:413 (2005). Positive control siRNAs (Seq2 and Seq3) were
obtained from Pecot et al., Mol. Cancer Ther. 13:2876 (2014) and
targeted a downstream coding region of the KRAS mRNA.
[0044] FIGS. 2A-2B show KRAS expression levels with mutant-specific
(MS) and control siRNAs. NIH 3T3 cells infected with human WT,
G12C, G12D, G12V, or G13D KRAS were reverse transfected with either
(A) MS siRNA sequences (12CD113D_1, 12CD113D_2, 12CD13D_3,
12CD13D_4, 12CV13D_1, and 12CV13D_2) or (B) control mutant-specific
siRNA or non-specific sequences.
[0045] FIG. 3 shows the testing of custom KRAS siRNA sequences
12CD13D_1 and 12CD13D_4 in a KRAS G12D mutant lung cancer cell
line.
[0046] FIG. 4 shows the library of siRNA sequences (SEQ ID
NOS:45-51) used for testing all possible siRNA sequence
permutations between the custom siRNA sequences.
[0047] FIG. 5 shows the relative expression of wild-type and mutant
KRAS mRNAs in 3T3 cells.
[0048] FIG. 6 shows a schematic of the antisense oligonucleotide
screen against the synthetic KRAS gene (SEQ ID NOS:52 and 53).
[0049] FIG. 7 shows the ability of 16 antisense oligonucleotides to
inhibit mutant KRAS expression in A431 cells. The A431 cells have
been genetically-engineered to have the KRAS wild-type allele
removed and individual A431 clones were created to express the
human KRAS mutant alleles, either KRAS G12C, KRAS G12D, KRAS G12V,
or KRAS G13D (as shown); thus controlling for gymnotic delivery
mechanisms, oligonucleotide trafficking and RNAse H silencing
activity.
[0050] FIG. 8 shows the ability of 6 antisense oligonucleotides to
inhibit mutant KRAS expression in genetically-engineered A431 cells
at different concentrations.
[0051] FIG. 9 shows the ability of chemically-modified ASO16
antisense oligonucleotides to inhibit mutant KRAS expression in
genetically-engineered A431 cells.
[0052] FIG. 10 shows the activity of fully modified siRNAs targeted
to the KRAS G12C mutation in genetically-engineered A431 cells
expressing KRAS G12C.
[0053] FIG. 11 shows the activity of fully modified siRNAs targeted
to the KRAS G12C mutation in genetically-engineered A431 cells
expressing KRAS G12C.
[0054] FIG. 12 shows the activity of fully modified siRNAs targeted
to the KRAS G12D mutation in genetically-engineered A431 cells
expressing KRAS G12D.
[0055] FIG. 13 shows the activity of fully modified siRNAs targeted
to the KRAS G12D mutation in genetically-engineered A431 cells
expressing KRAS G12D.
[0056] FIG. 14 shows the activity of fully modified siRNAs targeted
to the KRAS G12V mutation in genetically-engineered A431 cells
expressing KRAS G12V.
[0057] FIG. 15 shows the activity of fully modified siRNAs targeted
to the KRAS G12V mutation in genetically-engineered A431 cells
expressing KRAS G12V.
[0058] FIG. 16 shows the activity of fully modified siRNAs targeted
to the KRAS G13D mutation in genetically-engineered A431 cells
expressing KRAS G13D.
[0059] FIG. 17 shows the activity of fully modified siRNAs targeted
to the KRAS G13D mutation in genetically-engineered A431 cells
expressing KRAS G13D.
[0060] FIG. 18 shows the activity of fully modified siRNAs targeted
to KRAS in HCT116 (KRAS G13D mutant) and LU65 (KRAS G12C mutant)
cells.
DETAILED DESCRIPTION OF THE INVENTION
[0061] The present invention will now be described in more detail
with reference to the accompanying drawings, in which preferred
embodiments of the invention are shown. This invention may,
however, be embodied in different forms and should not be construed
as limited to the embodiments set forth herein. Rather, these
embodiments are provided so that this disclosure will be thorough
and complete, and will fully convey the scope of the invention to
those skilled in the art.
[0062] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. The
terminology used in the description of the invention herein is for
the purpose of describing particular embodiments only and is not
intended to be limiting of the invention. All publications, patent
applications, patents, patent publications and other references
cited herein are incorporated by reference in their entireties for
the teachings relevant to the sentence and/or paragraph in which
the reference is presented.
[0063] Nucleotide sequences are presented herein by single strand
only, in the 5' to 3' direction, from left to right, unless
specifically indicated otherwise. Nucleotides and amino acids are
represented herein in the manner recommended by the IUPAC-IUB
Biochemical Nomenclature Commission, or (for amino acids) by either
the one-letter code, or the three letter code, both in accordance
with 37 C.F.R. .sctn. 1.822 and established usage.
[0064] Except as otherwise indicated, standard methods known to
those skilled in the art may be used for cloning genes, amplifying
and detecting nucleic acids, and the like. Such techniques are
known to those skilled in the art. See, e.g., Sambrook et al.,
Molecular Cloning: A Laboratory Manual 2nd Ed. (Cold Spring Harbor,
N.Y., 1989); Ausubel et al. Current Protocols in Molecular Biology
(Green Publishing Associates, Inc. and John Wiley & Sons, Inc.,
New York).
[0065] Unless the context indicates otherwise, it is specifically
intended that the various features of the invention described
herein can be used in any combination.
[0066] Moreover, the present invention also contemplates that in
some embodiments of the invention, any feature or combination of
features set forth herein can be excluded or omitted.
[0067] To illustrate, if the specification states that a complex
comprises components A, B and C, it is specifically intended that
any of A, B or C, or a combination thereof, can be omitted and
disclaimed singularly or in any combination.
Definitions
[0068] As used in the description of the invention and the appended
claims, the singular forms "a," "an," and "the" are intended to
include the plural forms as well, unless the context clearly
indicates otherwise.
[0069] Also as used herein, "and/or" refers to and encompasses any
and all possible combinations of one or more of the associated
listed items, as well as the lack of combinations when interpreted
in the alternative ("or").
[0070] The term "about," as used herein when referring to a
measurable value such as an amount of polypeptide, dose, time,
temperature, enzymatic activity or other biological activity and
the like, is meant to encompass variations of .+-.20%, .+-.10%,
.+-.5%, .+-.1%, .+-.0.5%, or even .+-.0.1% of the specified
amount.
[0071] As used herein, the transitional phrase "consisting
essentially of" (and grammatical variants) is to be interpreted as
encompassing the recited materials or steps and those that do not
materially affect the basic and novel characteristic(s) of the
claimed invention. Thus, the term "consisting essentially of" as
used herein should not be interpreted as equivalent to
"comprising."
[0072] The term "consists essentially of" (and grammatical
variants), as applied to a polynucleotide sequence of this
invention, means a polynucleotide that consists of both the recited
sequence (e.g., SEQ ID NO) and a total of ten or less (e.g., 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides on the 5' and/or
3' ends of the recited sequence such that the function of the
polynucleotide is not materially altered. The total of ten or less
additional nucleotides includes the total number of additional
nucleotides on both ends added together.
[0073] The term "materially altered," as applied to polynucleotides
of the invention, refers to an increase or decrease in ability to
inhibit expression of a target mRNA of at least about 50% or more
as compared to the expression level of a polynucleotide consisting
of the recited sequence.
[0074] The term "enhance" or "increase" refers to an increase in
the specified parameter of at least about 1.25-fold, 1.5-fold.
2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold,
twelve-fold, or even fifteen-fold.
[0075] The term "inhibit" or "reduce" or grammatical variations
thereof as used herein refers to a decrease or diminishment in the
specified level or activity of at least about 15%, 25%, 35%. 40%,
50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments,
the inhibition or reduction results in little or essentially no
detectible activity (at most, an insignificant amount, e.g., less
than about 10% or even 5%).
[0076] A "therapeutically effective" amount as used herein is an
amount that provides some improvement or benefit to the subject.
Alternatively stated, a "therapeutically effective" amount is an
amount that will provide some alleviation, mitigation, or decrease
in at least one clinical symptom in the subject (e.g., in the case
of cancer, reduction in tumor burden, prevention of further tumor
growth, prevention of metastasis, or increase in survival time).
Those skilled in the art will appreciate that the therapeutic
effects need not be complete or curative, as long as some benefit
is provided to the subject.
[0077] By the terms "treat," "treating," or "treatment of." it is
intended that the severity of the subject's condition is reduced or
at least partially improved or modified and that some alleviation,
mitigation or decrease in at least one clinical symptom is
achieved.
[0078] "Prevent" or "preventing" or "prevention" refer to
prevention or delay of the onset of the disorder and/or a decrease
in the severity of the disorder in a subject relative to the
severity that would develop in the absence of the methods of the
invention. The prevention can be complete, e.g., the total absence
of cancer in a subject. The prevention can also be partial, such
that the occurrence or severity of cancer in a subject is less than
that which would have occurred without the present invention.
[0079] As used herein, "nucleic acid," "nucleotide sequence," and
"polynucleotide" are used interchangeably and encompass both RNA
and DNA, including cDNA, genomic DNA, mRNA, synthetic (e.g.,
chemically synthesized) DNA or RNA and chimeras of RNA and DNA. The
term polynucleotide, nucleotide sequence, or nucleic acid refers to
a chain of nucleotides without regard to length of the chain. The
nucleic acid can be double-stranded or single-stranded. Where
single-stranded, the nucleic acid can be a sense strand or an
antisense strand. The nucleic acid can be synthesized using
oligonucleotide analogs or derivatives (e.g., inosine or
phosphorothioate nucleotides). Such oligonucleotides can be used,
for example, to prepare nucleic acids that have altered
base-pairing abilities or increased resistance to nucleases. The
present invention further provides a nucleic acid that is the
complement (which can be either a full complement or a partial
complement) of a nucleic acid, nucleotide sequence, or
polynucleotide of this invention. When dsRNA is produced
synthetically, less common bases, such as inosine,
5-methylcytosine, 6-methyladenine, hypoxanthine and others can also
be used for antisense, dsRNA, and ribozyme pairing. For example,
polynucleotides that contain C-5 propyne analogues of uridine and
cytidine have been shown to bind RNA with high affinity and to be
potent antisense inhibitors of gene expression. Other
modifications, such as modification to the phosphodiester backbone,
or the 2'-hydroxy in the ribose sugar group of the RNA can also be
made.
[0080] An "isolated polynucleotide" is a nucleotide sequence (e.g.,
DNA or RNA) that is not immediately contiguous with nucleotide
sequences with which it is immediately contiguous (one on the 5'
end and one on the 3' end) in the naturally occurring genome of the
organism from which it is derived. Thus, in one embodiment, an
isolated nucleic acid includes some or all of the 5' non-coding
(e.g., promoter) sequences that are immediately contiguous to a
coding sequence. The term therefore includes, for example, a
recombinant DNA that is incorporated into a vector, into an
autonomously replicating plasmid or virus, or into the genomic DNA
of a prokaryote or eukaryote, or which exists as a separate
molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or
restriction endonuclease treatment), independent of other
sequences. It also includes a recombinant DNA that is part of a
hybrid nucleic acid encoding an additional polypeptide or peptide
sequence. An isolated polynucleotide that includes a gene is not a
fragment of a chromosome that includes such gene, but rather
includes the coding region and regulatory regions associated with
the gene, but no additional genes naturally found on the
chromosome.
[0081] The term "isolated" can refer to a nucleic acid, nucleotide
sequence or polypeptide that is substantially free of cellular
material, viral material, and/or culture medium (when produced by
recombinant DNA techniques), or chemical precursors or other
chemicals (when chemically synthesized). Moreover, an "isolated
fragment" is a fragment of a nucleic acid, nucleotide sequence or
polypeptide that is not naturally occurring as a fragment and would
not be found in the natural state. "Isolated" does not mean that
the preparation is technically pure (homogeneous), but it is
sufficiently pure to provide the polypeptide or nucleic acid in a
form in which it can be used for the intended purpose.
[0082] An "isolated cell" refers to a cell that is separated from
other components with which it is normally associated in its
natural state. For example, an isolated cell can be a cell in
culture medium and/or a cell in a pharmaceutically acceptable
carrier of this invention. Thus, an isolated cell can be delivered
to and/or introduced into a subject. In some embodiments, an
isolated cell can be a cell that is removed from a subject and
manipulated as described herein ex vivo and then returned to the
subject.
[0083] The term "fragment," as applied to a polynucleotide, will be
understood to mean a nucleotide sequence of reduced length relative
to a reference nucleic acid or nucleotide sequence and comprising,
consisting essentially of, and/or consisting of a nucleotide
sequence of contiguous nucleotides identical or almost identical
(e.g., 90%, 92%, 95%, 98%, 99% identical) to the reference nucleic
acid or nucleotide sequence. Such a nucleic acid fragment according
to the invention may be, where appropriate, included in a larger
polynucleotide of which it is a constituent. In some embodiments,
such fragments can comprise, consist essentially of, and/or consist
of oligonucleotides having a length of at least about 8, 10, 12,
15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or more
consecutive nucleotides of a nucleic acid or nucleotide sequence
according to the invention.
[0084] The term "fragment," as applied to a polypeptide, will be
understood to mean an amino acid sequence of reduced length
relative to a reference polypeptide or amino acid sequence and
comprising, consisting essentially of, and/or consisting of an
amino acid sequence of contiguous amino acids identical or almost
identical (e.g., 90%, 92%, 95%, 98%, 99% identical) to the
reference polypeptide or amino acid sequence. Such a polypeptide
fragment according to the invention may be, where appropriate,
included in a larger polypeptide of which it is a constituent. In
some embodiments, such fragments can comprise, consist essentially
of, and/or consist of peptides having a length of at least about 4,
6, 8, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, or
more consecutive amino acids of a polypeptide or amino acid
sequence according to the invention.
[0085] A "vector" is any nucleic acid molecule for the cloning of
and/or transfer of a nucleic acid into a cell. A vector may be a
replicon to which another nucleotide sequence may be attached to
allow for replication of the attached nucleotide sequence. A
"replicon" can be any genetic element (e.g., plasmid, phage,
cosmid, chromosome, viral genome) that functions as an autonomous
unit of nucleic acid replication in vivo, i.e., capable of
replication under its own control. The term "vector" includes both
viral and nonviral (e.g., plasmid) nucleic acid molecules for
introducing a nucleic acid into a cell in vitro, ex vivo, and/or in
vivo. A large number of vectors known in the art may be used to
manipulate nucleic acids, incorporate response elements and
promoters into genes, etc. For example, the insertion of the
nucleic acid fragments corresponding to response elements and
promoters into a suitable vector can be accomplished by ligating
the appropriate nucleic acid fragments into a chosen vector that
has complementary cohesive termini. Alternatively, the ends of the
nucleic acid molecules may be enzymatically modified or any site
may be produced by ligating nucleotide sequences (linkers) to the
nucleic acid termini. Such vectors may be engineered to contain
sequences encoding selectable markers that provide for the
selection of cells that contain the vector and/or have incorporated
the nucleic acid of the vector into the cellular genome. Such
markers allow identification and/or selection of host cells that
incorporate and express the proteins encoded by the marker. A
"recombinant" vector refers to a viral or non-viral vector that
comprises one or more heterologous nucleotide sequences (i.e.,
transgenes), e.g., two, three, four, five or more heterologous
nucleotide sequences.
[0086] Viral vectors have been used in a wide variety of gene
delivery applications in cells, as well as living animal subjects.
Viral vectors that can be used include, but are not limited to,
retrovirus, lentivirus, adeno-associated virus, poxvirus,
alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr
virus, and/or adenovirus vectors. Non-viral vectors include, but
are not limited to, plasmids, liposomes, electrically charged
lipids (cytofectins), nucleic acid-protein complexes, and
biopolymers. In addition to a nucleic acid of interest, a vector
may also comprise one or more regulatory regions, and/or selectable
markers useful in selecting, measuring, and monitoring nucleic acid
transfer results (delivery to specific tissues, duration of
expression, etc.).
[0087] Vectors may be introduced into the desired cells by methods
known in the art, e.g., transfection, electroporation,
microinjection, transduction, cell fusion, DEAE dextran, calcium
phosphate precipitation, lipofection (lysosome fusion), use of a
gene gun, or a nucleic acid vector transporter (see, e.g., Wu et
al., J. Biol. Chem. 267:963 (1992); Wu et al., J. Biol. Chem.
263:14621 (1988); and Hartmut et al., Canadian Patent Application
No. 2,012,311, filed Mar. 15, 1990).
[0088] In some embodiments, a polynucleotide of this invention can
be delivered to a cell in vivo by lipofection. Synthetic cationic
lipids designed to limit the difficulties and dangers encountered
with liposome-mediated transfection can be used to prepare
liposomes for in vivo transfection of a nucleotide sequence of this
invention (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413
(1987); Mackey, et al., Proc. Natl. Acad. Sc. U.S.A. 85:8027
(1988); and Ulmer et al., Science 259:1745 (1993)). The use of
cationic lipids may promote encapsulation of negatively charged
nucleic acids, and also promote fusion with negatively charged cell
membranes (Feigner et al., Science 337:387 (1989)). Particularly
useful lipid compounds and compositions for transfer of nucleic
acids are described in International Patent Publications WO95/18863
and WO96/17823, and in U.S. Pat. No. 5,459,127. The use of
lipofection to introduce exogenous nucleotide sequences into
specific organs in vhvo has certain practical advantages. Molecular
targeting of liposomes to specific cells represents one area of
benefit. It is clear that directing transfection to particular cell
types would be particularly preferred in a tissue with cellular
heterogeneity, such as pancreas, liver, kidney, and the brain.
Lipids may be chemically coupled to other molecules for the purpose
of targeting (Mackey, et al., 1988, supra). Targeted peptides,
e.g., hormones or neurotransmitters, and proteins such as
antibodies, or non-peptide molecules can be coupled to liposomes
chemically.
[0089] In various embodiments, other molecules can be used for
facilitating delivery of a nucleic acid in vivo, such as a cationic
oligopeptide (e.g., WO95/21931), peptides derived from nucleic acid
binding proteins (e.g., WO96/25508), and/or a cationic polymer
(e.g., WO95/21931).
[0090] It is also possible to introduce a vector in vivo as naked
nucleic acid (see U.S. Pat. Nos. 5,693,622, 5,589,466 and
5,580,859). Receptor-mediated nucleic acid delivery approaches can
also be used (Curiel el al., Hum. Gene Ther. 3:147 (1992); Wu et
al., J. Biol. Chem. 262:4429 (1987)).
[0091] As used herein, the terms "protein" and "polypeptide" are
used interchangeably and encompass both peptides and proteins,
unless indicated otherwise.
[0092] A "fusion protein" is a polypeptide produced when two
heterologous nucleotide sequences or fragments thereof coding for
two (or more) different polypeptides not found fused together in
nature are fused together in the correct translational reading
frame. Illustrative fusion polypeptides include fusions of a
polypeptide of the invention (or a fragment thereof) to all or a
portion of glutathione-S-transferase, maltose-binding protein, or a
reporter protein (e.g., Green Fluorescent Protein, P-glucuronidase,
pi-galactosidase, luciferase, etc.), hemagglutinin, c-myc, FLAG
epitope, etc.
[0093] By the term "express" or "expression" of a polynucleotide
coding sequence, it is meant that the sequence is transcribed, and
optionally, translated. Typically, according to the present
invention, expression of a coding sequence of the invention will
result in production of the polypeptide of the invention. The
entire expressed polypeptide or fragment can also function in
intact cells without purification.
[0094] As used herein, the term "gene" refers to a nucleic acid
molecule capable of being used to produce mRNA, antisense RNA,
miRNA, and the like. Genes may or may not be capable of being used
to produce a functional protein. Genes can include both coding and
non-coding regions (e.g., introns, regulatory elements, promoters,
enhancers, termination sequences and 5' and 3' untranslated
regions). A gene may be "isolated" by which is meant a nucleic acid
that is substantially or essentially free from components normally
found in association with the nucleic acid in its natural state.
Such components include other cellular material, culture medium
from recombinant production, and/or various chemicals used in
chemically synthesizing the nucleic acid.
[0095] As used herein, "complementary" polynucleotides are those
that are capable of base pairing according to the standard
Watson-Crick complementarity rules. Specifically, purines will base
pair with pyrimidines to form a combination of guanine paired with
cytosine (G:C) and adenine paired with either thymine (A:T) in the
case of DNA, or adenine paired with uracil (A:U) in the case of
RNA. For example, the sequence "A-G-T" binds to the complementary
sequence "T-C-A." It is understood that two polynucleotides may
hybridize to each other even if they are not completely
complementary to each other, provided that each has at least one
region that is substantially complementary to the other.
[0096] The terms "complementary" or "complementarity," as used
herein, refer to the natural binding of polynucleotides under
permissive salt and temperature conditions by base-pairing.
Complementarity between two single-stranded molecules may be
"partial," in which only some of the nucleotides bind, or it may be
complete when total complementarity exists between the single
stranded molecules. The degree of complementarity between nucleic
acid strands has significant effects on the efficiency and strength
of hybridization between nucleic acid strands.
[0097] As used herein, the terms "substantially complementary" or
"partially complementary" mean that two nucleic acid sequences are
complementary at least about 50%, 60%, 70%, 80% or 90% of their
nucleotides. In some embodiments, the two nucleic acid sequences
can be complementary at least at 85%, 90%, 95%, 96%, 97%, 98%, 99%
or more of their nucleotides. The terms "substantially
complementary" and "partially complementary" can also mean that two
nucleic acid sequences can hybridize under high stringency
conditions and such conditions are well known in the art.
[0098] As used herein, "heterologous" refers to a nucleic acid
sequence that either originates from another species or is from the
same species or organism but is modified from either its original
form or the form primarily expressed in the cell. Thus, a
nucleotide sequence derived from an organism or species different
from that of the cell into which the nucleotide sequence is
introduced, is heterologous with respect to that cell and the
cell's descendants. In addition, a heterologous nucleotide sequence
includes a nucleotide sequence derived from and inserted into the
same natural, original cell type, but which is present in a
non-natural state, e.g., a different copy number, and/or under the
control of different regulatory sequences than that found in
nature.
[0099] As used herein, the terms "contacting," "introducing" and
"administering" are used interchangeably, and refer to a process by
which dsRNA of the present invention or a nucleic acid molecule
encoding a dsRNA of this invention is delivered to a cell, in order
to inhibit or alter or modify expression of a target gene. The
dsRNA may be administered in a number of ways, including, but not
limited to, direct introduction into a cell (i.e., intracellularly)
and/or extracellular introduction into a cavity, interstitial
space, or into the circulation of the organism.
[0100] "Introducing" in the context of a cell or organism means
presenting the nucleic acid molecule to the organism and/or cell in
such a manner that the nucleic acid molecule gains access to the
interior of a cell. Where more than one nucleic acid molecule is to
be introduced these nucleic acid molecules can be assembled as part
of a single polynucleotide or nucleic acid construct, or as
separate polynucleotide or nucleic acid constructs, and can be
located on the same or different nucleic acid constructs.
Accordingly, these polynucleotides can be introduced into cells in
a single transformation event or in separate transformation events.
Thus, the term "transformation" as used herein refers to the
introduction of a heterologous nucleic acid into a cell.
Transformation of a cell may be stable or transient.
[0101] "Transient transformation" in the context of a
polynucleotide means that a polynucleotide is introduced into the
cell and does not integrate into the genome of the cell.
[0102] By "stably introducing" or "stably introduced" in the
context of a polynucleotide introduced into a cell, it is intended
that the introduced polynucleotide is stably incorporated into the
genome of the cell, and thus the cell is stably transformed with
the polynucleotide.
[0103] "Stable transformation" or "stably transformed" as used
herein means that a nucleic acid molecule is introduced into a cell
and integrates into the genome of the cell. As such, the integrated
nucleic acid molecule is capable of being inherited by the progeny
thereof, more particularly, by the progeny of multiple successive
generations. "Genome" as used herein includes the nuclear and
mitochondrial genome, and therefore includes integration of the
nucleic acid into, for example, the mitochondrial genome. Stable
transformation as used herein can also refer to a transgene that is
maintained extrachromasomally, for example, as a
minichromosome.
[0104] Transient transformation may be detected by, for example, an
enzyme-linked immunosorbent assay (ELISA) or Western blot, which
can detect the presence of a peptide or polypeptide encoded by one
or more transgene introduced into an organism. Stable
transformation of a cell can be detected by, for example, a
Southern blot hybridization assay of genomic DNA of the cell with
nucleic acid sequences which specifically hybridize with a
nucleotide sequence of a transgene introduced into an organism.
Stable transformation of a cell can be detected by, for example, a
Northern blot hybridization assay of RNA of the cell with nucleic
acid sequences which specifically hybridize with a nucleotide
sequence of a transgene introduced into an organism. Stable
transformation of a cell can also be detected by, e.g., a
polymerase chain reaction (PCR) or other amplification reactions as
are well known in the art, employing specific primer sequences that
hybridize with target sequence(s) of a transgene, resulting in
amplification of the transgene sequence, which can be detected
according to standard methods Transformation can also be detected
by direct sequencing and/or hybridization protocols well known in
the art.
[0105] Embodiments of the invention are directed to expression
cassettes designed to express the nucleic acids of the present
invention. As used herein, "expression cassette" means a nucleic
acid molecule having at least a control sequence operably linked to
a nucleotide sequence of interest. In this manner, for example,
promoters in operable interaction with the nucleotide sequences for
the siRNAs of the invention are provided in expression cassettes
for expression in an organism or cell.
[0106] As used herein, the term "promoter" refers to a region of a
nucleotide sequence that incorporates the necessary signals for the
efficient expression of a coding sequence. This may include
sequences to which an RNA polymerase binds, but is not limited to
such sequences and can include regions to which other regulatory
proteins bind together with regions involved in the control of
protein translation and can also include coding sequences.
[0107] Furthermore, a "promoter" of this invention is a promoter
capable of initiating transcription in a cell of an organism. Such
promoters include those that drive expression of a nucleotide
sequence constitutively, those that drive expression when induced,
and those that drive expression in a tissue- or
developmentally-specific manner, as these various types of
promoters are known in the art.
[0108] For purposes of the invention, the regulatory regions (i.e.,
promoters, transcriptional regulatory regions, and translational
termination regions) can be native/analogous to the organism or
cell and/or the regulatory regions can be native/analogous to the
other regulatory regions. Alternatively, the regulatory regions may
be heterologous to the organism or cell and/or to each other (i.e.,
the regulatory regions). Thus, for example, a promoter can be
heterologous when it is operably linked to a polynucleotide from a
species different from the species from which the polynucleotide
was derived. Alternatively, a promoter can also be heterologous to
a selected nucleotide sequence if the promoter is from the
same/analogous species from which the polynucleotide is derived,
but one or both (i.e., promoter and polynucleotide) are
substantially modified from their original form and/or genomic
locus, or the promoter is not the native promoter for the operably
linked polynucleotide.
[0109] The choice of promoters to be used depends upon several
factors, including, but not limited to, cell- or tissue-specific
expression, desired expression level, efficiency, inducibility and
selectability. For example, where expression in a specific tissue
or organ is desired, a tissue-specific promoter can be used. In
contrast, where expression in response to a stimulus is desired, an
inducible promoter can be used. Where continuous expression is
desired throughout the cells of an organism, a constitutive
promoter can be used. It is a routine matter for one of skill in
the art to modulate the expression of a nucleotide sequence by
appropriately selecting and positioning promoters and other
regulatory regions relative to that sequence.
[0110] In addition to the promoters described above, the expression
cassette also can include other regulatory sequences. As used
herein, "regulatory sequences" means nucleotide sequences located
upstream (5' non-coding sequences), within or downstream (3
non-coding sequences) of a coding sequence, and which influence the
transcription, RNA processing or stability, or translation of the
associated coding sequence. Regulatory sequences include, but are
not limited to, enhancers, introns, translation leader sequences
and polyadenylation signal sequences.
[0111] The expression cassette also can optionally include a
transcriptional and/or translational termination region (i.e.,
termination region) that is functional in the organism. A variety
of transcriptional terminators are available for use in expression
cassettes and are responsible for the termination of transcription
beyond the transgene and correct mRNA polyadenylation. The
termination region may be native to the transcriptional initiation
region, may be native to the operably linked nucleotide sequence of
interest, may be native to the host, or may be derived from another
source (i.e., foreign or heterologous to the promoter, the
nucleotide sequence of interest, the host, or any combination
thereof).
[0112] A signal sequence can be operably linked to nucleic acids of
the present invention to direct the nucleotide sequence into a
cellular compartment. In this manner, the expression cassette will
comprise a nucleotide sequence encoding the siRNA operably linked
to a nucleic acid sequence for the signal sequence. The signal
sequence may be operably linked at the N- or C- terminus of the
siRNA.
[0113] Regardless of the type of regulatory sequence(s) used, they
can be operably linked to the nucleotide sequence of the siRNA. As
used herein, "operably linked" means that elements of a nucleic
acid construct such as an expression cassette are configured so as
to perform their usual function. Thus, regulatory or control
sequences (e.g., promoters) operably linked to a nucleotide
sequence of interest are capable of effecting expression of the
nucleotide sequence of interest. The control sequences need not be
contiguous with the nucleotide sequence of interest, so long as
they function to direct the expression thereof.
[0114] Thus, for example, intervening untranslated, yet
transcribed, sequences can be present between a promoter and a
coding sequence, and the promoter sequence can still be considered
"operably linked" to the coding sequence. A nucleotide sequence of
the present invention (i.e., a siRNA) can be operably linked to a
regulatory sequence, thereby allowing its expression in a cell
and/or subject.
[0115] The expression cassette also can include a nucleotide
sequence for a selectable marker, which can be used to select a
transformed organism or cell. As used herein, "selectable marker"
means a nucleic acid that when expressed imparts a distinct
phenotype to the organism or cell expressing the marker and thus
allows such transformed organisms or cells to be distinguished from
those that do not have the marker. Such a nucleic acid may encode
either a selectable or screenable marker, depending on whether the
marker confers a trait that can be selected for by chemical means,
such as by using a selective agent (e.g., an antibiotic or the
like), or on whether the marker is simply a trait that one can
identify through observation or testing, such as by screening. Of
course, many examples of suitable selectable markers are known in
the art and can be used in the expression cassettes described
herein.
[0116] In some embodiments of the present invention, the expression
cassette can comprise an expression control sequence operatively
linked to a nucleotide sequence that is a template for one or both
strands of the dsRNA. In further embodiments, a promoter can flank
either end of the template nucleotide sequence, wherein the
promoters drive expression of each individual DNA strand, thereby
generating two complementary (or substantially complementary) RNAs
that hybridize and form the dsRNA. In alternative embodiments, the
nucleotide sequence is transcribed into both strands of the dsRNA
on one transcription unit, wherein the sense strand is transcribed
from the 5' end of the transcription unit and the antisense strand
is transcribed from the 3' end, wherein the two strands are
separated by about 3 to about 500 basepairs, and wherein after
transcription, the RNA transcript folds on itself to form a short
hairpin RNA (shRNA) molecule.
[0117] As used herein "sequence identity" refers to the extent to
which two optimally aligned polynucleotide or polypeptide sequences
are invariant throughout a window of alignment of components, e.g.,
nucleotides or amino acids. "Identity" can be readily calculated by
known methods including, but not limited to, those described in:
Computational Molecular Biology (Lesk A. M., ed.) Oxford University
Press. New York (1988); Biocomputing: Informatics and Genome
Projects (Smith. D. W., ed.) Academic Press, New York (1993);
Computer Analysis of Sequence Data, Part 1 (Griffin, A. M., and
Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence
Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press
(1987); and Sequence Analysis Primer (Gribskov, M. and Devereux,
J., eds.) Stockton Press, New York (1991).
[0118] As used herein, the term "substantially identical" or
"corresponding to" means that two nucleic acid sequences have at
least 60%, 70%, 80% or 90% sequence identity. In some embodiments,
the two nucleic acid sequences can have at least 85%, 90%, 95%,
96%, 97%, 98%, 99% or 100% of sequence identity.
[0119] An "identity fraction" for aligned segments of a test
sequence and a reference sequence is the number of identical
components which are shared by the two aligned sequences divided by
the total number of components in reference sequence segment, i.e.,
the entire reference sequence or a smaller defined part of the
reference sequence.
[0120] As used herein, the term "percent sequence identity" or
"percent identity" refers to the percentage of identical
nucleotides in a linear polynucleotide sequence of a reference
("query") polynucleotide molecule (or its complementary strand) as
compared to a test ("subject") polynucleotide molecule (or its
complementary strand) when the two sequences are optimally aligned
(with appropriate nucleotide insertions, deletions, or gaps
totaling less than 20 percent of the reference sequence over the
window of comparison). In some embodiments, "percent identity" can
refer to the percentage of identical amino acids in an amino acid
sequence.
[0121] Optimal alignment of sequences for aligning a comparison
window are well known to those skilled in the art and may be
conducted by tools such as the local homology algorithm of Smith
and Waterman, the homology alignment algorithm of Needleman and
Wunsch, the search for similarity method of Pearson and Lipman, and
optionally by computerized implementations of these algorithms such
as GAP, BESTFIT, FASTA, and TFASTA available as part of the
GCG.RTM. Wisconsin Package.RTM. (Accelrys Inc., Burlington, Mass.).
Percent sequence identity is represented as the identity fraction
multiplied by 100.
[0122] The comparison of one or more polynucleotide sequences may
be to a full-length polynucleotide sequence or a portion thereof,
or to a longer polynucleotide sequence. For purposes of this
invention "percent identity" may also be determined using BLASTX
version 2.0 for translated nucleotide sequences and BLASTN version
2.0 for polynucleotide sequences.
[0123] The percent of sequence identity can be determined using the
"Best Fit" or "Gap" program of the Sequence Analysis Software
Package.TM. (Version 10: Genetics Computer Group, Inc., Madison,
Wis.). "Gap" utilizes the algorithm of Needleman and Wunsch
(Needleman and Wunsch, J Mol. Biol. 48:443-453, 1970) to find the
alignment of two sequences that maximizes the number of matches and
minimizes the number of gaps. "BestFit" performs an optimal
alignment of the best segment of similarity between two sequences
and inserts gaps to maximize the number of matches using the local
homology algorithm of Smith and Waterman (Smith and Waterman, Adv.
Appl. Math., 2:482-489, 1981, Smith et al., Nucleic Acids Res.
11:2205-2220, 1983).
[0124] Useful methods for determining sequence identity are also
disclosed in Guide to Huge Computers (Martin J. Bishop, ed.,
Academic Press, San Diego (1994)), and Carillo, H., and Lipton, D.,
(Applied Math 48:1073(1988)). More particularly, preferred computer
programs for determining sequence identity include but are not
limited to the Basic Local Alignment Search Tool (BLAST) programs
which are publicly available from National Center Biotechnology
Information (NCBI) at the National Library of Medicine, National
Institute of Health, Bethesda, Md. 20894; see BLAST Manual,
Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol.
215:403-410 (1990)); version 2.0 or higher of BLAST programs allows
the introduction of gaps (deletions and insertions) into
alignments; for peptide sequence BLASTX can be used to determine
sequence identity; and, for polynucleotide sequence BLASTN can be
used to determine sequence identity.
[0125] As used herein, "RNAi" or "RNA interference" refers to the
process of sequence-specific post-transcriptional gene silencing,
mediated by double-stranded RNA (dsRNA). As used herein, "dsRNA"
refers to RNA that is partially or completely double stranded.
Double stranded RNA is also referred to as small interfering RNA
(siRNA), small interfering nucleic acid (siNA), microRNA (miRNA),
and the like. In the RNAi process, dsRNA comprising a first
(antisense) strand that is complementary to a portion of a target
gene and a second (sense) strand that is fully or partially
complementary to the first antisense strand is introduced into an
organism. After introduction into the organism, the target
gene-specific dsRNA is processed into relatively small fragments
(siRNAs) and can subsequently become distributed throughout the
organism, leading to a loss-of-function mutation having a phenotype
that, over the period of a generation, may come to closely resemble
the phenotype arising from a complete or partial deletion of the
target gene.
[0126] MicroRNAs (miRNAs) are non-protein coding RNAs, generally of
between about 18 to about 25 nucleotides in length. These miRNAs
direct cleavage in trans of target transcripts, negatively
regulating the expression of genes involved in various regulation
and development pathways (Bartel, Cell, 116:281-297 (2004); Zhang
et al. Dev. Biol. 289:3-16 (2006)). As such, miRNAs have been shown
to be involved in different aspects of growth and development as
well as in signal transduction and protein degradation. Since the
first miRNAs were discovered in plants (Reinhart et al. Genes Dev
16:1616-1626 (2002), Park et al. Curr. Biol. 12:1484-1495 (2002))
many hundreds have been identified. Many microRNA genes (MIR genes)
have been identified and made publicly available in a database
(miRBase; microrna.sanger.ac.uk/sequences), miRNAs are also
described in U.S. Patent Publications 2005/0120415 and
2005/144669A1, the entire contents of which are incorporated by
reference herein.
[0127] Genes encoding miRNAs yield primary miRNAs (termed a
"pri-miRNA") of 70 to 300 bp in length that can form imperfect
stem-loop structures. A single pri-miRNA may contain from one to
several miRNA precursors. In animals, pri-miRNAs are processed in
the nucleus into shorter hairpin RNAs of about 65 nt (pre-miRNAs)
by the RNaseIII enzyme Drosha and its cofactor DGCR8/Pasha. The
pre-miRNA is then exported to the cytoplasm, where it is further
processed by another RNaseIII enzyme, Dicer, releasing a
miRNA/miRNA* duplex of about 22 nt in size. Many reviews on
microRNA biogenesis and function are available, for example, see,
Bartel Cell 116:281-297 (2004), Murchison et al. Curr. Opin. Cell
Biol. 16:223-229 (2004), Dugas et al. Curr. Opin. Plant Biol.
7:512-520 (2004) and Kim Nature Rev. Mol. Cell Biol. 6:376-385
(2005).
RNA Molecules
[0128] The present invention is based on the identification of RNA
molecules that inhibit expression of mutant KRAS sequences while
sparing expression of WT KRAS. Accordingly, one aspect of the
invention relates to a double stranded RNA molecule comprising an
antisense strand and a sense strand, wherein the nucleotide
sequence of the antisense strand is complementary to a region of
the nucleotide sequence of a synthetic human KRAS gene that
contains the missense mutations G12C, G12D, and G13D or the
missense mutations G12C, G12V, and G13D, the region consisting
essentially of about 18 to about 25 consecutive nucleotides;
wherein the double stranded RNA molecule inhibits expression of a
mutant human KRAS gene comprising one or more of the missense
mutations G12C. G12D, G12V, and G13D and minimally inhibits
expression of wild-type human KRAS. The region of the KRAS gene
targeted by the RNA molecule comprises the nucleotides encoding
residues 12 and 13. The RNA molecules provide decreased expression
of mutant KRAS in a cell as compared to a wild-type variety of the
cell (e.g., a control cell or nontransformed cell). In some
embodiments, expression of mutant KRAS is inhibited by at least
about 50%, e.g., at least about 50%, 60%, 70%, 80%, 90%, 95%, or
more.
[0129] A human KRAS gene containing the missense mutations G12C,
G12D, and G13D or the missense mutations G12C, G12V, and G13D does
not exist in nature. Examples of a region of such artificial gene
sequences include SEQ ID NOS:37 and 38, with the mutations relative
to the corresponding WT KRAS sequence (SEQ ID NO:39)
underlined.
TABLE-US-00001 SEQ ID NO: 37
ACTGAATATAAACTTGTGGTAGTTGGAGCTTATGACGTAGGCAAGAGTGC CTTGACGATACAG
SEQ ID NO: 38 ACTGAATATAAACTTGTGGTAGTTGGAGCTTTTGACGTAGGCAAGAGTGC
CTTGACGATACAG SEQ ID NO: 39
ACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGC
CTTGACGATACAG
[0130] The double stranded RNA molecule can comprise, consist
essentially of, or consist of about 18 to about 25 nucleotides
(e.g., 18, 19, 20, 21, 22, 23, 24, or 25 or any range therein).
Additional nucleotides can be added at the 3' end, the 5' end or
both the 3' and 5' ends to facilitate manipulation of the RNA
molecule but that do not materially affect the basic
characteristics or function of the double stranded RNA molecule in
RNA interference (RNAi). Additionally, one or two nucleotides can
be deleted from one or both ends of any of the sequences disclosed
herein that do not materially affect the basic characteristics or
function of the double stranded RNA molecule in RNAi. The term
"materially affect" as used herein refers to a change in the
ability to inhibit expression of the protein encoded by the mRNA
(e.g., WT KRAS) by no more than about 50%, e.g., no more than about
50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or less. Such
additional nucleotides can be nucleotides that extend the
complementarity of the antisense strand along the target sequence
and/or such nucleotides can be nucleotides that facilitate
manipulation of the RNA molecule or a nucleic acid molecule
encoding the RNA molecule, as would be known to one of skill in the
art. For example, a TT overhang at the 3' end may be present, which
is used to stabilize the siRNA duplex and does not affect the
specificity of the siRNA.
[0131] The dsRNA of the invention may optionally comprise a single
stranded overhang at either or both ends. The double-stranded
structure may be formed by a single self-complementary RNA strand
(i.e., forming a hairpin loop) or two complementary RNA strands.
RNA duplex formation may be initiated either inside or outside the
cell. When the dsRNA of the invention forms a hairpin loop, it may
optionally comprise an intron and/or a nucleotide spacer, which is
a stretch of nucleotides between the complementary RNA strands, to
stabilize the hairpin sequence in cells. The RNA may be introduced
in an amount that allows delivery of at least one copy per cell.
Higher doses of double-stranded material may yield more effective
inhibition.
[0132] In particular embodiments, the present invention provides
double stranded RNA containing a nucleotide sequence that is fully
complementary to a region of the target gene for inhibition.
However, it is to be understood that 100% complementarity between
the antisense strand of the double stranded RNA molecule and the
target sequence is not required to practice the present invention.
Thus, sequence variations that might be expected due to genetic
mutation, strain polymorphism, or evolutionary divergence can be
tolerated. RNA sequences with insertions, deletions, and single
point mutations relative to the target sequence may also be
effective for inhibition.
[0133] In certain embodiments, the nucleotide sequence of the
antisense strand contains at least 3 mismatches with the nucleotide
sequence of wild-type human KRAS such that the RNA molecule does
not target WT KRAS and only minimally inhibits expression of WT
KRAS. As used herein, "minimally inhibits expression" means that
expression of the protein encoded by the mRNA (e.g., WT KRAS) is
inhibited by no more than about 50%, e.g., no more than about 50%,
45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or less.
[0134] In certain embodiments, the nucleotide sequence of the
antisense strand contains no more than 2 mismatches with the
nucleotide sequence of a mutant human KRAS gene comprising one or
more of the missense mutations G12C, G12D, G12V, and G13D. In some
embodiments, the nucleotide sequence of the antisense strand
contains at least 3 mismatches with the nucleotide sequence of
wild-type human KRAS and contains no more than 2 mismatches with
the nucleotide sequence of a mutant human KRAS gene comprising one
or more of the missense mutations G12C. G12D, G12V, and G3D.
[0135] In some embodiments, the nucleotide sequence of the sense
strand comprises a nucleotide sequence that is at least about 80%
identical to the nucleotide sequence of any of SEQ ID NOS:1-9,
e.g., at least about 80%, 85%. 90%, 91%, 92%, 93%, 94%, 95%, 96%.
97%, 98%, 99%, or more identical to the nucleotide sequence of any
of SEQ ID NOS:1-9.
[0136] In some embodiments, the nucleotide sequence of the sense
strand comprises, consists essentially of, or consist of the
nucleotide sequence of any of SEQ ID NOS:1-9.
TABLE-US-00002 SEQ ID NO: 1 GAGCUUAUGACGUAGGCAA SEQ ID NO: 2
AGUUGGAGCUUAUGACGUA SEQ ID NO: 3 GGUAGUUGGAGCUUAUGAC SEQ ID NO: 4
GUAGUUGGAGCUUAUGACG SEQ ID NO: 5 UAGUUGGAGCUUAUGACGU SEQ ID NO: 6
GUUGGAGCUUAUGACGUAG SEQ ID NO: 7 UUGGAGCUUAUGACGUAGG SEQ ID NO: 8
UGGAGCUUAUGACGUAGGC SEQ ID NO: 9 GGAGCUUAUGACGUAGGCA
[0137] In some embodiments, the nucleotide sequence of the
antisense strand comprises a nucleotide sequence that is at least
about 80% identical to the nucleotide sequence of any of SEQ ID
NOS:19-27, e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99%, or more identical to the nucleotide
sequence of any of SEQ ID NOS: 19-27. In some embodiments, the
nucleotide sequence of the antisense strand comprises, consists
essentially of, or consist of the nucleotide sequence of any of SEQ
ID NOS: 19-27.
TABLE-US-00003 SEQ ID NO: 19 UUGCCUACGUCAUAAGCUC SEQ ID NO: 20
UACGUCAUAAGCUCCAACU SEQ ID NO: 21 GUCAUAAGCUCCAACUACC SEQ ID NO: 22
CGUCAUAAGCUCCAACUAC SEQ ID NO: 23 ACGUCAUAAGCUCCAACUA SEQ ID NO: 24
CUACGUCAUAAGCUCCAAC SEQ ID NO: 25 CCUACGUCAUAAGCUCCAA SEQ ID NO: 26
GCCUACGUCAUAAGCUCCA SEQ ID NO: 27 UGCCUACGUCAUAAGCUCC
[0138] In some embodiments, one or both of the sense strand and the
antisense strand comprises a TT overhang at the 3' end. Thus, in
some embodiments, the sense strand comprises a nucleotide sequence
that is at least about 80% identical to the nucleotide sequence of
any of SEQ ID NOS:10-18, e.g., at least about 80%, 85%, 900%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more identical to the
nucleotide sequence of any of SEQ ID NOS: 10-18. In some
embodiments, the nucleotide sequence of the sense strand comprises,
consists essentially of, or consist of the nucleotide sequence of
any of SEQ ID NOS: 10-18.
TABLE-US-00004 SEQ ID NO: 10 GAGCUUAUGACGUAGGCAAdTdT SEQ ID NO: 11
AGUUGGAGCUUAUGACGUAdTdT SEQ ID NO: 12 GGUAGUUGGAGCUUAUGACdTdT SEQ
ID NO: 13 GUAGUUGGAGCUUAUGACGdTdT SEQ ID NO: 14
UAGUUGGAGCUUAUGACGUdTdT SEQ ID NO: 15 GULTGGAGCUUAUGACGUAGdTdT SEQ
ID NO: 16 UUGGAGCUUAUGACGUAGGdTdT SEQ ID NO: 17
UGGAGCUUAUGACGUAGGCdTdT SEQ ID NO: 18 GGAGCUUAUGACGUAGGCAdTdT
[0139] In some embodiments, the nucleotide sequence of the
antisense strand comprise a nucleotide sequence that is at least
about 80% identical to the nucleotide sequence of any of SEQ ID
NOS:28-36. e.g., at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%.
95%, 96%, 97%, 98%, 99%, or more identical to the nucleotide
sequence of any of SEQ ID NOS: 28-36. In some embodiments, the
nucleotide sequence of the antisense strand comprises, consists
essentially of, or consist of the nucleotide sequence of any of SEQ
ID NOS: 28-36.
TABLE-US-00005 SEQ ID NO: 28 UUGCCUACGUCAUAAGCUCdTdT SEQ ID NO: 29
UACGUCAUAAGCUCCAACUdTdT SEQ ID NO: 30 GUCAUAAGCUCCAACUACCdTdT SEQ
ID NO: 31 CGUCAUAAGCUCCAACUACdTdT SEQ ID NO: 32
ACGUCAUAAGCUCCAACUAdTdT SEQ ID NO: 33 CUACGUCAUAAGCUCCAACdTdT SEQ
ID NO: 34 CCUACGUCAUAAGCUCCAAdTdT SEQ ID NO: 35
GCCUACGUCAUAAGCUCCAdTdT SEQ ID NO: 36 UGCCUACGUCAUAAGCUCCdTdT
[0140] In some embodiments of this invention, the sense strand of
the double stranded RNA molecule can be fully complementary to the
antisense strand or the sense strand can be substantially
complementary or partially complementary to the antisense strand.
By substantially or partially complementary is meant that the sense
strand and the antisense strand can be mismatched at about 1, 2, 3,
4, 5, 6, 7, 8, 9, or 10 nucleotide pairings. Such mismatches can be
introduced into the sense strand sequence, e.g., near the 3' end,
to enhance processing of the double stranded RNA molecule by Dicer,
to duplicate a pattern of mismatches in a siRNA molecule inserted
into a chimeric nucleic acid molecule or artificial microRNA
precursor molecule of this invention, and the like, as would be
known to one of skill in the art. Such modification will weaken the
base pairing at one end of the duplex and generate strand
asymmetry, therefore enhancing the chance of the antisense strand,
instead of the sense strand, being processed and silencing the
intended gene (Geng and Ding "Double-mismatched siRNAs enhance
selective gene silencing of a mutant ALS-causing Allele1" Acta
Pharmacol. Sin. 29:211-216 (2008); Schwarz et al. "Asymmetry in the
assembly of the RNAi enzyme complex" Cell 115:199-208 (2003)).
[0141] The double stranded RNA molecule of the invention may be in
the form of any type of RNA interference molecule known in the art.
In some embodiments, the double stranded RNA molecule is a small
interfering RNA (siRNA) molecule. In other embodiments, the double
stranded RNA molecule is a short hairpin RNA (shRNA) molecule. In
other embodiments, the double stranded RNA molecule is part of a
microRNA precursor molecule.
Antisense Oligonucleotides
[0142] One aspect of the invention relates to an antisense
oligonucleotide (ASO) targeted to a synthetic human KRAS mRNA that
encodes the missense mutations G12C, G12D. and G13D, wherein the
ASO is 16-25 nucleotides in length and comprises or consists
essentially of the sequence TCTTGCCTACGTCATA (SEQ ID NO:114). In
some embodiments, the ASO is 16, 17, 18, 19, 20, 21, 22, 23, 24, or
25 nucleotides in length or any range therein. In some embodiments,
the ASO is 20,21, or 22 nucleotides in length. In some embodiments,
the ASO is 20 nucleotides in length. In certain embodiments, at
least 80% of the unspecified nucleotides in the ASO are
complementary to a wild-type human KRAS gene, e.g., at least 80%,
85%, 90%, 91%. 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In
certain embodiments, at least 80% of the unspecified nucleotides in
the ASO are complementary to a mutant human KRAS gene, e.g., at
least 80%. 85%. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99%. In certain embodiments, the ASO is 17-25 nucleotides in length
and comprises or consists essentially of the sequence
CTCTTGCCTACGTCATA (SEQ ID NO:121), 18-25 nucleotides in length and
ACTCTTGCCTACGTCATA (SEQ ID NO:122), or 19-25 nucleotides in length
and CACTCTTGCCTACGTCATA (SEQ ID NO:123).
[0143] In some embodiments, the ASO comprises, consists essentially
of, or consists of the sequence CACTCTTGCCTACGTCATAA (SEQ ID
NO:115) or a sequence at least 90% identical thereto, e.g., at
least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
identical. In some embodiments, the ASO comprises, consists
essentially of or consists of the sequence GCACTCTTGCCTACGTCATA
(SEQ ID NO:116) or a sequence at least 90% identical thereto, e.g.,
at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
identical.
[0144] The ASO may be comprised of deoxyribonucleotides,
ribonucleotides, or a combination thereof.
[0145] In some embodiments, the ASO comprises at least one
non-naturally occurring chemical modification. In certain
embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, or 19 of the nucleotide linkages are chemically
modified. In some embodiments, the ASO comprises at least one
phosphorothioate linkage. In some embodiments, the ASO comprises 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19
phosphorothioate linkages. In some embodiments, the ASO comprises
all phosphorothioate linkages.
[0146] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotides are
chemically modified. In some embodiments, the ASO comprises at
least one modified nucleotide at or near the 5' end and/or the 3'
end, e.g., within 5 nucleotides of 5' end and/or the 3' end, e.g.,
at least 1, 2, 3, 4, or 5 modified nucleotides. In some
embodiments, the ASO comprises at least 3 modified nucleotides at
each of the 5' end and the 3' end, e.g., at least 4 or at least 5.
In some embodiments, at least one of the modified nucleotides is a
2'-O-methoxyethyl (2'-MOE)-modified nucleotide. In some
embodiments, all of the modified nucleotides is a 2'-MOE-modified
nucleotide. In some embodiments, the ASO comprises at least 3
2'-MOE-modified nucleotides at each of the 5' end and/or the 3'
end, e.g., at least 4 or at least 5.
[0147] In some embodiments, the ASO comprises, consists essentially
of, or consists of a sequence selected from:
TABLE-US-00006 a) (SEQ ID NO: 68)
C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A*A; or b) (SEQ ID NO: 69)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A;
wherein * indicates a phosphorothioate linkage and bold indicates a
2'-MOE-modified nucleotide. In some embodiments, the ASO comprises,
consists essentially of, or consists of a sequence at least 90%
identical to one of SEQ ID NO:68 and SEQ ID NO:69, e.g., at least
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
[0148] Another aspect of the invention relates to an ASO targeted
to a naturally-occurring human KRAS mRNA encoding a mutation
selected from G12C, G12D, G12V, and G13D, wherein the ASO is 16-25
nucleotides in length and comprises or consists essentially of a
sequence selected from: [0149] a) TCTTGCCTACGCCACA (SEQ ID NO:117)
targeted to a human KRAS mRNA encoding a G12C mutation; [0150] b)
TCTTGCCTACGCCATC (SEQ ID NO:118) targeted to a human KRAS mRNA
encoding a G12D mutation; [0151] c) TCTTGCCTACGCCAAC (SEQ ID
NO:119) targeted to a human KRAS mRNA encoding a G12V mutation;
[0152] d) TCTTGCCTACGTCACC (SEQ ID NO:120) targeted to a human KRAS
mRNA encoding a G13D mutation; or [0153] e) a sequence at least 90%
identical to any one of a) to d); wherein the antisense
oligonucleotide comprises at least one non-naturally occurring
chemical modification.
[0154] In some embodiments, the ASO is at least 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or 99% identical to one of SEQ ID
NOS:117-120.
[0155] In some embodiments, the ASO is 16, 17, 18, 19, 20, 21, 22,
23, 24, or 25 nucleotides in length or any range therein. In some
embodiments, the ASO is 20, 21, or 22 nucleotides in length. In
some embodiments, the ASO is 20 nucleotides in length. In certain
embodiments, at least 80% of the unspecified nucleotides in the ASO
are complementary to a wild-type human KRAS gene, e.g., at least
80%, 85%, 90.degree. %, 91%, 92%, 93%, 94%, 95%, 96%, 97%. 98%, or
99%. In certain embodiments, at least 80% of the unspecified
nucleotides in the ASO are complementary to a mutant human KRAS
gene, e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%, 98%, or 99%. In certain embodiments, the ASO is 17-25
nucleotides in length and comprises an additional nucleotide C at
the 5' end of the sequence of one of SEQ ID NOS:117-120. In certain
embodiments, the ASO is 18-25 nucleotides in length and comprises
additional nucleotides AC at the 5' end of the sequence of one of
SEQ ID NOS:117-120. In certain embodiments, the ASO is 19-25
nucleotides in length and comprises additional nucleotides CAC at
the 5' end of the sequence of one of SEQ ID NOS:117-120. In certain
embodiments, the ASO is 20-25 nucleotides in length and comprises
additional nucleotides GCAC at the 5' end of the sequence of one of
SEQ ID NOS:117-120.
[0156] In some embodiments, the antisense oligonucleotide consists
of a sequence selected from: [0157] a) GCACTCTTGCCTACGCCACA (SEQ ID
NO:124) targeted to a human KRAS mRNA encoding a G12C mutation;
[0158] b) GCACTCTTGCCTACGCCATC (SEQ ID NO:125) targeted to a human
KRAS mRNA encoding a G12D mutation; [0159] c) GCACTCTTGCCTACGCCAAC
(SEQ ID NO:126) targeted to a human KRAS mRNA encoding a G12V
mutation; or [0160] d) GCACTCTTGCCTACGTCACC (SEQ ID NO:127)
targeted to a human KRAS mRNA encoding a G13D mutation.
[0161] The ASO may be comprised of deoxyribonucleotides,
ribonucleotides, or a combination thereof.
[0162] In some embodiments, the ASO comprises at least one
non-naturally occurring chemical modification. In certain
embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, or 19 of the nucleotide linkages are chemically
modified. In some embodiments, the ASO comprises at least one
phosphorothioate linkage. In some embodiments, the ASO comprises 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19
phosphorothioate linkages. In some embodiments, the ASO comprises
all phosphorothioate linkages.
[0163] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotides are
chemically modified. In some embodiments, the ASO comprises at
least one modified nucleotide at or near the 5' end and/or the 3'
end, e.g., within 5 nucleotides of 5' end and/or the 3' end, e.g.,
at least 1, 2, 3, 4, or 5 modified nucleotides. In some
embodiments, the ASO comprises at least five modified nucleotides
at each of the 5' end and the 3' end. In some embodiments, at least
one of the modified nucleotides is a 2'-MOE-modified nucleotide. In
some embodiments, all of the modified nucleotides is a
2'-MOE-modified nucleotide. In some embodiments, the ASO comprises
at least 3 2'-MOE-modified nucleotides at each of the 5' end and/or
the 3' end, e.g., at least 4 or at least 5.
[0164] In certain embodiments, the ASO consists of a sequence
selected from:
TABLE-US-00007 a) (SEQ ID NO: 70)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*C*A; b) (SEQ ID NO: 71)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*T*C; c) (SEQ ID NO: 72)
G*C*A*C*T*C*T*T*G*C*C*T*A*C'G*C*C*A*A*C; or d) (SEQ ID NO: 73)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*C*C;
wherein * indicates a phosphorothioate linkage and bold indicates a
2'-MOE-modified nucleotide. In some embodiments, the ASO comprises,
consists essentially of, or consists of a sequence at least 90%
identical to one of SEQ ID NOS:70-73, e.g., at least 90%, 91%, 92%,
93%, 94%. 95%, 96%, 97%, 98%, or 99% identical.
[0165] In some embodiments, at least one modified nucleotide is a
locked nucleic acid nucleotide, e.g., at least 1, 2, 3, 4, or 5
modified nucleotides. The lock nucleic acid may be, without
limitation, a methylene bridge connecting the 2' oxygen and 4'
carbon on the ribose to lock the ribose in the 3'-endo (North)
conformation.
[0166] In certain embodiments, the ASO consists of a sequence
selected from:
TABLE-US-00008 a) (SEQ ID NO: 74)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*C*+A; b) (SEQ ID NO: 75)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*+T*C; c) (SEQ ID NO: 76)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*+A*C; or d) (SEQ ID NO: 77)
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*+T*C*A*C*C;
wherein * indicates a phosphorothioate linkage, bold indicates a
2'-methoxymethyl-modified nucleotide, and + indicates the following
nucleotide is a locked nucleic acid. In some embodiments, the ASO
comprises, consists essentially of, or consists of a sequence at
least 90% identical to one of SEQ ID NOS:74-76, e.g., at least 90%,
91%. 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical.
Chemically-Modified siRNAs
[0167] One aspect of the invention relates to a siRNA molecule
targeted to a naturally-occurring human KRAS mRNA encoding a
mutation selected from G12C, G12D, G12V, and G13D, wherein the
siRNA comprises as least one chemical modification. In some
embodiments, the siRNA molecule is fully chemically modified. The
term "fully chemically-modified" means that every nucleotide in the
siRNA contains a chemical modification. In some embodiments, each
nucleotide in the siRNA molecule is modified with a 2'-O-methyl
group or a 2'-fluoro group.
[0168] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotide
linkages in the siRNA are chemically modified. In some embodiments,
the siRNA comprises at least one phosphorothioate linkage. In some
embodiments, the siRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, or 19 phosphorothioate linkages. In
some embodiments, the siRNA comprises all phosphorothioate
linkages.
[0169] In certain embodiments, the siRNA molecule comprising at
least one chemical modification comprises a sense strand and an
antisense strand, wherein the siRNA molecule comprises one of the
following pairs of sequences: [0170] sense strand of SEQ ID NO:128
and antisense strand of SEQ ID NO:129; [0171] sense strand of SEQ
ID NO:130 and antisense strand of SEQ ID NO:131; [0172] sense
strand of SEQ ID NO:132 and antisense strand of SEQ ID NO:133;
[0173] sense strand of SEQ ID NO:134 and antisense strand of SEQ ID
NO:135; [0174] sense strand of SEQ ID NO:136 and antisense strand
of SEQ ID NO:137; [0175] sense strand of SEQ ID NO:138 and
antisense strand of SEQ ID NO:139; [0176] sense strand of SEQ ID
NO:140 and antisense strand of SEQ ID NO:141; [0177] sense strand
of SEQ ID NO:142 and antisense strand of SEQ ID NO:143; [0178]
sense strand of SEQ ID NO:144 and antisense strand of SEQ ID
NO:145; [0179] sense strand of SEQ ID NO:146 and antisense strand
of SEQ ID NO:147; [0180] sense strand of SEQ ID NO:148 and
antisense strand of SEQ ID NO:149; [0181] sense strand of SEQ ID
NO:150 and antisense strand of SEQ ID NO:151; [0182] sense strand
of SEQ ID NO:152 and antisense strand of SEQ ID NO:153; [0183]
sense strand of SEQ ID NO:154 and antisense strand of SEQ ID
NO:155; [0184] sense strand of SEQ ID NO:156 and antisense strand
of SEQ ID NO:157; or [0185] sense strand of SEQ ID NO:158 and
antisense strand of SEQ ID NO:159.
[0186] In some embodiments, the siRNA comprises, consists
essentially of, or consists of a sequence at least 90% identical to
one of SEQ ID NOS:128-159, e.g., at least 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, or 99% identical.
TABLE-US-00009 TABLE 1 Fully modified siRNA sequences Strand
Sequence (5'-3') SEQ ID NO S GAGCUUGUGGCGUAGGCAAGA 128 AS
UUGCCUACGCCACAAGCUCCA 129 S GAGCUGAUGGCGUAGGCAAGA 130 AS
UUGCCUACGCCAUCAGCUCCA 131 S GAGCUGGUGACGUAGGCAAGA 132 AS
UUGCCUACGUCACCAGCUCCA 133 S AGUUGGAGCUUGUGGCGUAGG 134 AS
UACGCCACAAGCUCCAACUAC 135 S AGUUGGAGCUGAUGGCGUAGG 136 AS
UACGCCAUCAGCUCCAACUAC 137 S AGUUGGAGCUGGUGACGUAGG 138 AS
UACGUCACCAGCUCCAACUAC 139 S GGUAGUUGGAGCUGGUGACGU 140 AS
GUCACCAGCUCCAACUACCAC 141 S AGUUGGAGCUGUUGGCGUAGG 142 AS
UACGCCAACAGCUCCAACUAC 143 S GAGCUGUUGGCGUAGGCAAGA 144 AS
UUGCCUACGCCAACAGCUCCA 145 S GAGCUGAUGGCGUAGGCAAGA 146 AS
UUGCCUACGCCAUCAGCUCCA 147 S GAGCUGGUGACGUAGGCAAGA 148 AS
UUGCCUACGUCACCAGCUCCA 149 S AGUUGGAGCUUGUGGCGUAGG 150 AS
UACGCCACAAGCUCCAACUAC 151 S AGUUGGAGCUGAUGGCGUAGG 152 AS
UACGCCAUCAGCUCCAACUAC 153 S AGUUGGAGCUGGUGACGUAGG 154 AS
UACGUCACCAGCUCCAACUAC 155 S AGUUGGAGCUGUUGGCGUAGG 156 AS
UACGCCAACAGCUCCAACUAC 157 S GAGCUGUUGGCGUAGGCAAGA 158 AS
UUGCCUACGCCAACAGCACCA 159 S-sense strand AS-antisense strand
[0187] In certain embodiments, the siRNA molecule is fully
chemically modified and comprises a sense strand and an antisense
strand, wherein the siRNA molecule comprises one of the following
pairs of sequences: [0188] sense strand of SEQ ID NO:78 and
antisense strand of SEQ IDI NO:79; [0189] sense strand of SEQ ID
NO:80 and antisense strand of SEQ ID NO:81; [0190] sense strand of
SEQ ID NO:82 and antisense strand of SEQ ID NO:83; [0191] sense
strand of SEQ ID NO:84 and antisense strand of SEQ ID NO:85; [0192]
sense strand of SEQ ID NO:86 and antisense strand of SEQ ID NO:87;
[0193] sense strand of SEQ ID NO:88 and antisense strand of SEQ ID
NO:89; [0194] sense strand of SEQ ID NO:90 and antisense strand of
SEQ ID NO:91; [0195] sense strand of SEQ ID NO:92 and antisense
strand of SEQ IDI NO:93; [0196] sense strand of SEQ ID NO:94 and
antisense strand of SEQ ID NO:95; [0197] sense strand of SEQ ID
NO:96 and antisense strand of SEQ ID NO:97; [0198] sense strand of
SEQ ID NO:98 and antisense strand of SEQ ID NO:99; [0199] sense
strand of SEQ ID NO:100 and antisense strand of SEQ ID NO:101;
[0200] sense strand of SEQ ID NO:102 and antisense strand of SEQ ID
NO:103; [0201] sense strand of SEQ ID NO:104 and antisense strand
of SEQ ID NO:105; [0202] sense strand of SEQ ID) NO:106 and
antisense strand of SEQ ID NO:107; or [0203] sense strand of SEQ
ID) NO:108 and antisense strand of SEQ ID NO:109.
[0204] In some embodiments, the siRNA comprises, consists
essentially of, or consists of a sequence at least 90% identical to
one of SEQ ID NOS:78-109, e.g., at least 90%/e, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, or 99% identical.
[0205] Another aspect of the invention relates to an siRNA molecule
targeted to human KRAS mRNA, wherein the sense strand of the siRNA
comprises, consists essentially of, or consists of the sequence of
SEQ ID NO:50 or SEQ ID NO:51, and wherein the siRNA comprises at
least one non-naturally occurring chemical modification. In some
embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the
nucleotides in the siRNA are chemically modified. In some
embodiments, the siRNA is fully chemically-modified. In some
embodiments, each nucleotide in the siRNA molecule is modified with
a 2'-O-methyl group or a 2'-fluoro group.
[0206] In certain embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 of the nucleotide
linkages in the siRNA are chemically modified. In some embodiments,
the siRNA comprises at least one phosphorothioate linkage. In some
embodiments, the siRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, or 19 phosphorothioate linkages. In
some embodiments, the siRNA comprises all phosphorothioate
linkages.
[0207] In certain embodiments, the fully chemically-modified siRNA
molecule comprises a sense strand and an antisense strand, wherein
the siRNA molecule comprises one of the following pairs of
sequences: [0208] sense strand of SEQ ID NO:110 and antisense
strand of SEQ ID NO:111; or [0209] sense strand of SEQ ID NO:112
and antisense strand of SEQ ID NO:113.
[0210] In some embodiments, the siRNA comprises, consists
essentially of, or consists of a sequence at least 90% identical to
one of SEQ ID NOS:110-113, e.g., at least 90%, 91%, 92%, 93%. 94%,
95%, 96%, 97%, 98%, or 99% identical.
[0211] The double stranded RNA molecule, ASO, or
chemically-modified siRNA molecule may be constructed using
chemical synthesis and enzymatic ligation reactions by procedures
known in the art. For example, a double stranded RNA, ASO, or
chemically-modified siRNA molecule may be chemically synthesized
using naturally occurring nucleotides or various modified
nucleotides designed to increase the biological stability of the
molecules or to increase the physical stability of the duplex
formed between the double stranded RNA, ASO, or chemically-modified
siRNA molecule and target nucleotide sequences, e.g.,
phosphorothioate derivatives and acridine substituted nucleotides
can be used. Examples of modified nucleotides which can be used to
generate the double stranded RNA, ASO, or chemically-modified siRNA
molecule include, but are not limited to, 5-fluorouracil,
5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomet-hyluracil, dihydrouracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine,
1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine.
5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,
5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester,
uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil,
3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine. Alternatively, the double stranded RNA or ASO
can be produced using an expression vector into which a nucleic
acid encoding the double stranded RNA or ASO has been cloned.
[0212] The double stranded RNA, ASO, or chemically-modified siRNA
molecule can further include nucleotide sequences wherein at least
one, or all, of the internucleotide bridging phosphate residues are
modified phosphates, such as methyl phosphonates, methyl
phosphonothioates, phosphoromorpholidates, phosphoropiperazidates
and phosphoramidates. For example, every one or every other one of
the internucleotide bridging phosphate residues can be modified as
described. In another non-limiting example, the double stranded
RNA, ASO, or chemically-modified siRNA molecule is a nucleotide
sequence in which at least one, or all, of the nucleotides contain
a 2' lower alkyl moiety (e.g., C.sub.1-C.sub.4, linear or branched,
saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl,
propyl. 1-propenyl, 2-propenyl, and isopropyl). In another example,
one or more of the nucleotides may be a 2'-fluoro nucleotide, a
2-O-methyl nucleotide, or a locked nucleic acid nucleotide. For
example, every one or every other one of the nucleotides can be
modified as described. See also, Furdon et al., Nucleic Acids Res.
17:9193 (1989); Agrawal el al., Proc. Natl. Acad. Sci. USA 87:1401
(1990); Baker et al., Nucleic Acids Res. 18:3537 (1990); Sproat et
al., Nucleic Acids Res. 17:3373 (1989); Walder and Walder, Proc.
Natl. Acad. Sd. USA 85:5011 (1988); incorporated by reference
herein in their entireties for their teaching of methods of making
polynucleotide molecules, including those containing modified
nucleotide bases).
[0213] The invention further relates to a nucleic acid construct
comprising the RNA molecule or ASO of the invention. The invention
further relates to a nucleic acid construct encoding the RNA
molecule or ASO of the invention and a nucleic acid construct
comprising the nucleic acid molecule encoding the RNA molecule or
ASO. In each of these embodiments, the nucleic acid construct may
be a vector or a plasmid, e.g., an expression vector.
[0214] Another aspect of the invention relates to a composition
comprising the RNA molecule, ASO, chemically-modified siRNA
molecule, or nucleic acid construct of the invention and another
component, e.g., a suitable carrier. In some embodiments, the
composition comprises two or more of the RNA molecules, ASOs,
chemically-modified siRNA molecules, or nucleic acid constructs of
the invention, wherein the two or more RNA molecules, ASO, or
chemically-modified siRNA molecule each comprise a different
antisense strand. In certain embodiments, the two or more RNA
molecules are present on the same nucleic acid construct, on
different nucleic acid constructs or any combination thereof.
[0215] In some embodiments, the composition is a pharmaceutical
composition comprising the RNA molecule(s), ASO(s),
chemically-modified siRNA molecule(s), or nucleic acid construct(s)
of the invention and a pharmaceutically acceptable carrier.
[0216] It is understood that the compositions of this invention can
comprise, consist essentially of, or consist of any of the RNA
molecules, ASOs, chemically-modified siRNA molecules, and nucleic
acid constructs in any combination and in any ratio relative to one
another. Furthermore, by "two or more" is meant 2, 3, 4, 5, 6, 7,
8, 9, 10, etc., up to a total number of RNA molecules, ASOs,
chemically-modified siRNA molecules, and nucleic acid constructs of
this invention. In some embodiments, the compositions comprise,
consist essentially of or consist of the RNA molecules of SEQ ID
NO:1 and SEQ ID NO:3.
[0217] In some aspects of the invention, the composition or
pharmaceutical composition further comprises additional components
that enhance the delivery of the RNA molecule(s), ASO(s),
chemically-modified siRNA molecule(s), or nucleic acid construct(s)
of the invention to a subject, e.g., by enhancing the stability of
the RNA molecule(s), ASO(s), chemically-modified siRNA molecule(s),
or nucleic acid construct(s). In some embodiments, the additional
component may be a particle, e.g., a microparticle or nanoparticle.
In some embodiments, the particle is a lipid particle, e.g., a
liposome, e.g., a microliposome or a nanoliposome. The liposome,
microliposome, or nanoliposome may contain any components known in
the art to be suitable for preparing liposomes. In some
embodiments, the liposome comprises
1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC). Liposomes may
be prepared by methods known in the art, e.g., as described in
Pecot et al., Mol. Cancer Ther. 13:2876 (2014), incorporated by
reference herein in its entirety. In some embodiments, the RNA
molecule is formed into a stable nucleic acid lipid particle
(SNALP), e.g., using particles such as those provided by Arbutus
Biopharma (Doylestown, Pa.). In certain embodiments, the lipid
particle comprises, consists essentially of, or consists of
cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).
PEG-cDMA or PEG-cDSA, and
1,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane (DLinDMA) (see Judge
et al., J. Clin. Invest. 119:661 (2009)). In some embodiments, the
lipid particle comprises two or more of the RNA molecules, ASOs, or
chemically-modified siRNA molecules of the invention. e.g., the RNA
molecules of SEQ ID NO:1 and SEQ ID NO:3. In some embodiments, the
additional component is a targeted delivery moiety to which the RNA
molecule(s), ASO(s), chemically-modified siRNA molecule(s), or
nucleic acid construct(s) or covalently or noncovalently
conjugated, e.g., ligands, aptamers, or monoclonal antibodies.
[0218] The present invention encompasses cells comprising the RNA
molecules and/or nucleic acid constructs of the invention. Thus, in
some embodiments, the present invention provides a transformed cell
comprising a RNA molecule and/or a nucleic acid construct and/or a
composition of this invention, wherein the transformed cell has
reduced expression of mutant KRAS as compared to a control
cell.
Methods
[0219] Various methods are provided herein, employing the nucleic
acid molecules, nucleic acid constructs, and/or compositions of
this invention. Thus, in one aspect, the present invention provides
a method of inhibiting expression of a mutant human KRAS gene
comprising one or more of the missense mutations G12C, G12D, G12V,
and G13D in a cell, the method comprising contacting the cell with
the RNA molecule, ASO, chemically-modified siRNA molecule, nucleic
acid construct, composition, and/or pharmaceutical composition of
the invention, thereby inhibiting expression of the mutant human
KRAS gene in the cell.
[0220] Also provided herein is a method of treating cancer in a
subject in need thereof, wherein the cancer comprises a mutant
human KRAS gene comprising one or more of the missense mutations
G12C, G12D, G12V, and G13D, the method comprising delivering to the
subject the RNA molecule, ASO, chemically-modified siRNA molecule,
nucleic acid construct, composition, and/or pharmaceutical
composition of the invention, thereby treating cancer in the
subject. A cancer comprising a mutant human KRAS gene comprising
one or more of the missense mutations G12C, G12D, G12V, and G13D is
a cancer, e.g., a tumor in which one or more cells express the
mutant KRAS gene.
[0221] In one embodiment of each of these aspects, the subject may
be one that has been diagnosed with cancer. In another embodiment,
the subject may be one that is at risk of developing cancer (e.g.,
predisposed due to hereditary factors, smoking, viral infection,
exposure to chemicals, etc.). In a further embodiment, the subject
may be one that has been identified as carrying a mutant KRAS gene
and has or has not been diagnosed with cancer.
[0222] The double stranded RNA, ASO, or chemically-modified siRNA
molecule of the invention can be delivered directly into a cell by
any method known in the art, e.g., by transfection or
microinjection, e.g., as part of a composition comprising lipid
particles. In other embodiments, the double stranded RNA or ASO can
be delivered to a subject in the form of polynucleotides encoding
the RNA or ASO to produce expression of the double stranded RNA or
ASO within the cells of the subject. Those skilled in the art will
appreciate that the isolated polynucleotides encoding the RNAs or
ASOs of the invention will typically be associated with appropriate
expression control sequences, e.g., transcription/translation
control signals and polyadenylation signals.
[0223] It will further be appreciated that a variety of
promoter/enhancer elements can be used depending on the level and
tissue-specific expression desired. The promoter can be
constitutive or inducible, depending on the pattern of expression
desired. The promoter can be native or foreign and can be a natural
or a synthetic sequence. By foreign, it is intended that the
transcriptional initiation region is not found in the wild-type
host into which the transcriptional initiation region is
introduced. The promoter is chosen so that it will function in the
target cell(s) of interest.
[0224] To illustrate, the RNA or ASO coding sequence can be
operatively associated with a cytomegalovirus (CMV) major
immediate-early promoter, an albumin promoter, an Elongation Factor
1-.alpha. (EF1-.alpha.) promoter, a P.gamma.K promoter, a MFG
promoter, or a Rous sarcoma virus promoter.
[0225] Inducible promoter/enhancer elements include
hormone-inducible and metal-inducible elements, and other promoters
regulated by exogenously supplied compounds, including without
limitation, the zinc-inducible metallothionein (MT) promoter; the
dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV)
promoter; the T7 polymerase promoter system (see WO 98/10088); the
ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA
93:3346 (1996)); the tetracycline-repressible system (Gossen et
al., Proc. Natl. Acad. Sci. USA 89:5547 (1992)); the
tetracycline-inducible system (Gossen et al., Science 268:1766
(1995); see also Harvey et al., Curr. Opin. Chem. Biol. 2:512
(1998)); the RU486-inducible system (Wang et al., Nat. Biotech.
15:239 (1997); Wang et al., Gene Ther., 4:432(1997)); and the
rapamycin-inducible system (Magari et al., J. Clin. Invest.
100:2865 (1997)).
[0226] Other tissue-specific promoters or regulatory promoters
include, but are not limited to, promoters that typically confer
tissue-specificity in neurons. These include, but are not limited
to, promoters for synapsin 1, tubulin .alpha.1, platelet-derived
growth factor B-chain, tyrosine hydroxylase, neuron-specific
enolase, and neurofilaments. Skeletal muscle cell promoters
include, but are not limited to, promoters for .beta.-actin, Pitx3,
creatine kinase, and myosin light chain. Cardiac muscle cell
promoters include, but are not limited to, promoters for cardiac
actin, cardiac troponin T, troponin C, myosin light chain-2, and
.alpha.-myosin heavy chain. Islet (beta) cell promoters include,
but are not limited to, glucokinase, gastrin, insulin, and islet
amyloid polypeptide.
[0227] Moreover, specific initiation signals are generally required
for efficient translation of inserted RNA or ASO coding sequences.
These translational control sequences, which can include the ATG
initiation codon and adjacent sequences, can be of a variety of
origins, both natural and synthetic.
[0228] The isolated nucleic acid encoding the double stranded RNA
or ASO can be incorporated into an expression vector. Expression
vectors compatible with various host cells are well known in the
art and contain suitable elements for transcription and translation
of nucleic acids. Typically, an expression vector contains an
"expression cassette," which includes, in the 5' to 3' direction, a
promoter, a coding sequence encoding a double stranded RNA
operatively associated with the promoter, and, optionally, a
termination sequence including a stop signal for RNA polymerase and
a polyadenylation signal for polyadenylase.
[0229] Non-limiting examples of animal and mammalian promoters
known in the art include, but are not limited to, the SV40 early
(SV40e) promoter region, the promoter contained in the 3' long
terminal repeat (LTR) of Rous sarcoma virus (RSV), the promoters of
the ElA or major late promoter (MLP) genes of adenoviruses (Ad),
the cytomegalovirus (CMV) early promoter, the herpes simplex virus
(HSV) thymidine kinase (TK) promoter, baculovirus IE1 promoter,
elongation factor 1 alpha (EF1) promoter, phosphoglycerate kinase
(PGK) promoter, ubiquitin (Ubc) promoter, an albumin promoter, the
regulatory sequences of the mouse metallothionein-L promoter and
transcriptional control regions, the ubiquitous promoters (HPRT,
vimentin, .alpha.-actin, tubulin and the like), the promoters of
the intermediate filaments (desmin, neurofilaments, keratin, GFAP,
and the like), the promoters of therapeutic genes (of the MDR, CFTR
or factor VIII type, and the like), and pathogenesis and/or
disease-related promoters. In addition, any of these expression
sequences of this invention can be modified by addition of enhancer
and/or regulatory sequences and the like.
[0230] Enhancers that may be used in embodiments of the invention
include but are not limited to: an SV40 enhancer, a cytomegalovirus
(CMV) enhancer, an elongation factor I (EF1) enhancer, yeast
enhancers, viral gene enhancers, and the like.
[0231] Termination control regions, i.e., terminator or
polyadenylation sequences, may be derived from various genes native
to the preferred hosts. In some embodiments of the invention, the
termination control region may comprise or be derived from a
synthetic sequence, a synthetic polyadenylation signal, an SV40
late polyadenylation signal, an SV40 polyadenylation signal, a
bovine growth hormone (BGH) polyadenylation signal, viral
terminator sequences, or the like.
[0232] It will be apparent to those skilled in the art that any
suitable vector can be used to deliver the polynucleotide to a cell
or subject. The vector can be delivered to cells in vivo. In other
embodiments, the vector can be delivered to cells ex vivo, and then
cells containing the vector are delivered to the subject. The
choice of delivery vector can be made based on a number of factors
known in the art, including age and species of the target host, in
vitro versus in vivo delivery, level and persistence of expression
desired, intended purpose (e.g., for therapy or screening), the
target cell or organ, route of delivery, size of the isolated
polynucleotide, safety concerns, and the like.
[0233] Suitable vectors include, but are not limited to, plasmid
vectors, viral vectors (e.g., retrovirus, alphavirus; vaccinia
virus; adenovirus, adeno-associated virus and other parvoviruses,
lentivirus, poxvirus, or herpes simplex virus), lipid vectors,
poly-lysine vectors, synthetic polyamino polymer vectors, and the
like.
[0234] Any viral vector that is known in the art can be used in the
present invention. Protocols for producing recombinant viral
vectors and for using viral vectors for nucleic acid delivery can
be found in Ausubel et al., Current Protocols in Molecular Biology
(Green Publishing Associates, Inc. and John Wiley & Sons. Inc.,
New York) and other standard laboratory manuals (e.g., Vectors for
Gene Therapy. In: Current Protocols in Human Genetics. John Wiley
and Sons, Inc.: 1997).
[0235] Non-viral transfer methods can also be employed. Many
non-viral methods of nucleic acid transfer rely on normal
mechanisms used by mammalian cells for the uptake and intracellular
transport of macromolecules. In particular embodiments, non-viral
nucleic acid delivery systems rely on endocytic pathways for the
uptake of the nucleic acid molecule by the targeted cell. Exemplary
nucleic acid delivery systems of this type include liposomal
derived systems, poly-lysine conjugates, and artificial viral
envelopes.
[0236] In particular embodiments, plasmid vectors are used in the
practice of the present invention. For example, naked plasmids can
be introduced into muscle cells by injection into the tissue.
Expression can extend over many months, although the number of
positive cells is typically low (Wolff et al., Science 247:247
(1989)). Cationic lipids have been demonstrated to aid in
introduction of nucleic acids into some cells in culture (Felgner
and Ringold, Nature 337:387 (1989)). Injection of cationic lipid
plasmid DNA complexes into the circulation of mice has been shown
to result in expression of the DNA in lung (Brigham et al., Am. J.
Med. Sci. 298:278 (1989)). One advantage of plasmid DNA is that it
can be introduced into non-replicating cells.
[0237] In a representative embodiment, a nucleic acid molecule
(e.g., a plasmid) can be entrapped in a lipid particle bearing
positive charges on its surface and, optionally, tagged with
antibodies against cell surface antigens of the target tissue
(Mizuno et al., No Shinkei Geka 20:547 (1992); PCT publication WO
91/06309; Japanese patent application 1047381; and European patent
publication EP-A-43075).
[0238] Liposomes that consist of amphiphilic cationic molecules are
useful as non-viral vectors for nucleic acid delivery in vitro and
in vivo (reviewed in Crystal, Science 270:404 (1995); Blaese et
al., Cancer Gene Ther. 2:291 (1995); Behr et al., Bioconjugate
Chem. 5:382 (1994); Remy et al., Bioconjugate Chem. 5:647 (1994);
and Gao et al., Gene Therapy 2:710 (1995)). The positively charged
liposomes are believed to complex with negatively charged nucleic
acids via electrostatic interactions to form lipid:nucleic acid
complexes. The lipid:nucleic acid complexes have several advantages
as nucleic acid transfer vectors. Unlike viral vectors, the
lipid:nucleic acid complexes can be used to transfer expression
cassettes of essentially unlimited size. Since the complexes lack
proteins, they can evoke fewer immunogenic and inflammatory
responses. Moreover, they cannot replicate or recombine to form an
infectious agent and have low integration frequency. A number of
publications have demonstrated that amphiphilic cationic lipids can
mediate nucleic acid delivery in vivo and in vitro (Feigner et al.,
Proc. Natl. Acad. Sci. USA 84:7413 (1987); Loeffler et al., Meth.
Enzymol. 217:599 (1993); Feigner et al., J. Biol. Chem. 269-2550
(1994)).
[0239] Several groups have reported the use of amphiphilic cationic
lipid-nucleic acid complexes for in vivo transfection both in
animals and in humans (reviewed in Gao et al., Gene Therapy 2:710
(1995); Zhu et al., Science 261:209 (1993); and Thierry et al.,
Proc. Natl. Acad. Sci. USA 92:9742 (1995)). U.S. Pat. No. 6,410,049
describes a method of preparing cationic lipid-nucleic acid
complexes that have a prolonged shelf life.
[0240] Nuclear localization signals can also be used to enhance the
targeting of the double stranded RNA or expression vector into the
proximity of the nucleus and/or its entry into the nucleus. Such
nuclear localization signals can be a protein or a peptide such as
the SV40 large Tag NLS or the nucleoplasmin NLS. These nuclear
localization signals interact with a variety of nuclear transport
factors such as the NLS receptor (karyopherin alpha) which then
interacts with karyopherin beta.
[0241] Expression vectors can be designed for expression of
stranded RNA or ASOs in prokaryotic or eukaryotic cells. For
example, stranded RNA or ASOs can be expressed in bacterial cells
such as E. coli, insect cells (e.g., the baculovirus expression
system), yeast cells, plant cells or mammalian cells. Some suitable
host cells are discussed further in Goeddel, Gene Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego,
Calif. (1990). Examples of bacterial vectors include, but are not
limited to, pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript,
psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A
(Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, and pRIT5
(Pharmacia). Examples of vectors for expression in the yeast S.
cerevisiae include pYepSecl (Baldari et al., EMBO J. 6:229 (1987)),
pMFa (Kurjan and Herskowitz, Cell 30:933 (1982)), pJRY88 (Schultz
et al., Gene 54:113 (1987)), and pYES2 (Invitrogen Corporation, San
Diego, Calif.). Non-limiting examples of baculovirus vectors
available for expression of nucleic acids to produce proteins in
cultured insect cells (e.g., Sf 9 cells) include the pAc series
(Smith et al., Mol. Cell. Biol. 3:2156(1983)) and the pVL series
(Lucklow and Summers Virology 170:31 (1989)).
[0242] Examples of mammalian expression vectors include pWLNEO,
pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, PBPV, pMSG, PSVL
(Pharmacia), pCDM8 (Seed, Nature 329:840 (1987)) and pMT2PC
(Kaufman et al., EMBO J. 6:187 (1987)). When used in mammalian
cells, the expression vector's control functions are often provided
by viral regulatory elements. For example, commonly used promoters
are derived from polyoma, adenovirus 2, cytomegalovirus and Simian
Virus 40.
[0243] Viral vectors have been used in a wide variety of gene
delivery applications in cells, as well as living animal subjects.
Viral vectors that can be used include, but are not limited to,
retrovirus, lentivirus, adeno-associated virus, poxvirus,
alphavirus, baculovirus, vaccinia virus, herpes virus, Epstein-Barr
virus, adenovirus, geminivirus, and caulimoviruses vectors.
Non-limiting examples of non-viral vectors include plasmids,
liposomes, electrically charged lipids (cytofectins), nucleic
acid-protein complexes, and biopolymers. In addition to a nucleic
acid of interest, a vector may also comprise one or more regulatory
regions, and/or selectable markers useful in selecting, measuring,
and monitoring nucleic acid transfer results (delivery to specific
tissues, duration of expression, etc.).
[0244] In addition to the regulatory control sequences discussed
above, the recombinant expression vector can contain additional
nucleotide sequences. For example, the recombinant expression
vector can encode a selectable marker gene to identify host cells
that have incorporated the vector.
[0245] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" refer
to a variety of art-recognized techniques for introducing foreign
nucleic acids (e.g., DNA and RNA) into a host cell, including, but
are not limited to, calcium phosphate or calcium chloride
co-precipitation, DEAE-dextran-mediated transfection, lipofection,
electroporation, microinjection, DNA-loaded liposomes,
lipofectamine-DNA complexes, cell sonication, gene bombardment
using high velocity microprojectiles, and viral-mediated
transfection. Suitable methods for transforming or transfecting
host cells can be found in Sambrook et al., Molecular Cloning: A
Laboratory Manual 2nd Ed. (Cold Spring Harbor, N.Y., 1989), and
other laboratory manuals.
[0246] If stable integration is desired, often only a small
fraction of cells (in particular, mammalian cells) integrate the
foreign DNA into their genome. In order to identify and select
integrants, a nucleic acid that encodes a selectable marker (e.g.,
resistance to antibiotics) can be introduced into the host cells
along with the nucleic acid of interest. Preferred selectable
markers include those that confer resistance to drugs, such as
G418, hygromycin and methotrexate. Nucleic acids encoding a
selectable marker can be introduced into a host cell on the same
vector as that comprising the nucleic acid of interest or can be
introduced on a separate vector. Cells stably transfected with the
introduced nucleic acid can be identified by drug selection (e.g.,
cells that have incorporated the selectable marker gene will
survive, while the other cells die).
[0247] In one embodiment, the double stranded RNA, ASO, or
chemically-modified siRNA molecule of the invention is administered
directly to the subject. Generally, the compounds of the invention
will be suspended in a pharmaceutically-acceptable carrier (e.g.,
physiological saline) and administered orally, topically, or by
intravenous infusion, or injected subcutaneously, intramuscularly,
intracranially, intrathecally, intraperitoneally, intrarectally,
intravaginally, intranasally, intragastrically, intratracheally, or
intrapulmonarily. They are preferably delivered directly to the
site of the disease or disorder, such as the lung, intestine, or
pancreas. The dosage required depends on the choice of the route of
administration; the nature of the formulation; the nature of the
patient's illness; the subject's size, weight, surface area, age,
and sex; other drugs being administered; and the judgment of the
attending physician. Suitable dosages are in the range of
0.01-100.0 .mu.g/kg. Wide variations in the needed dosage are to be
expected in view of the differing efficiencies of various routes of
administration. For example, oral administration would be expected
to require higher dosages than administration by i.v. injection
(e.g., 2-, 3-, 4-, 6-. 8-, 10-; 20-, 50-, 100-, 150-, or more
fold). Variations in these dosage levels can be adjusted using
standard empirical routines for optimization as is well understood
in the art. Administrations can be single or multiple.
Encapsulation of the inhibitor in a suitable delivery vehicle
(e.g., polymeric microparticles or implantable devices) may
increase the efficiency of delivery, particularly for oral
delivery.
[0248] According to certain embodiments, the double stranded RNA,
ASO, or chemically-modified siRNA molecule can be targeted to
specific cells or tissues in vivo. Targeting delivery vehicles,
including liposomes and viral vector systems are known in the at.
For example, a liposome can be directed to a particular target cell
or tissue by using a targeting agent, such as an antibody, soluble
receptor or ligand, incorporated with the liposome, to target a
particular cell or tissue to which the targeting molecule can bind.
Targeting liposomes are described, for example, in Ho et al.,
Biochemistry 25:5500 (1986); Ho et al., J. Biol. Chem. 262:13979
(1987); Ho et al., J. Biol. Chem. 262:13973 (1987); and U.S. Pat.
No. 4,957,735 to Huang et al., each of which is incorporated herein
by reference in its entirety). Enveloped viral vectors can be
modified to deliver a nucleic acid molecule to a target cell by
modifying or substituting an envelope protein such that the virus
infects a specific cell type. In adenoviral vectors, the gene
encoding the attachment fibers can be modified to encode a protein
domain that binds to a cell-specific receptor. Herpesvirus vectors
naturally target the cells of the central and peripheral nervous
system. Alternatively, the route of administration can be used to
target a specific cell or tissue. For example, intracoronary
administration of an adenoviral vector has been shown to be
effective for the delivery of a gene to cardiac myocytes (Maurice
et al., J. Clin. Invest. 104:21 (1999)). Intravenous delivery of
cholesterol-containing cationic liposomes has been shown to
preferentially target pulmonary tissues (Liu et al., Nature
Biotechnol. 15:167 (1997)), and effectively mediate transfer and
expression of genes in vivo. Other examples of successful targeted
in vivo delivery of nucleic acid molecules are known in the art.
Finally, a recombinant nucleic acid molecule can be selectively
(i.e., preferentially, substantially exclusively) expressed in a
target cell by selecting a transcription control sequence, and
preferably, a promoter, which is selectively induced in the target
cell and remains substantially inactive in non-target cells.
[0249] The double stranded RNA, ASO, or chemically-modified siRNA
molecule of the present invention can optionally be delivered in
conjunction with other therapeutic agents. The additional
therapeutic agents can be delivered concurrently with the double
stranded RNA, ASO, or chemically-modified siRNA molecule of the
invention. As used herein, the word "concurrently" means
sufficiently close in time to produce a combined effect (that is,
concurrently can be simultaneously, or it can be two or more events
occurring within a short time period before or after each other).
In one embodiment, the double stranded RNA, ASO, or
chemically-modified siRNA molecule of the invention are
administered in conjunction with agents useful for treating cancer,
such as: 1) vinca alkaloids (e.g., vinblastine, vincristine); 2)
epipodophyllotoxins (e.g., etoposide and teniposide); 3)
antibiotics (e.g., dactinomycin (actinomycin D), daunorubicin
(daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin
(mithramycin), and mitomycin (mitomycin C)); 4) enzymes (e.g.,
L-asparaginase); 5) biological response modifiers (e.g.,
interferon-alfa); 6) platinum coordinating complexes (e.g.,
cisplatin and carboplatin); 7) anthracenediones (e.g.,
mitoxantrone); 8) substituted ureas (e.g., hydroxyurea); 9)
methylhydrazine derivatives (e.g., procarbazine (N-methylhydrazine;
MIH)); 10) adrenocortical suppressants (e.g., mitotane (o,p'-DDD)
and aminoglutethimide); 11) adrenocorticosteroids (e.g.,
prednisone); 12) progestins (e.g., hydroxyprogesterone caproate,
medroxyprogesterone acetate, and megestrol acetate); 13) estrogens
(e.g., diethylstilbestrol and ethinyl estradiol); 14) antiestrogens
(e.g., tamoxifen); 15) androgens (e.g., testosterone propionate and
fluoxymesterone); 16) antiandrogens (e.g., flutamide); and 17)
gonadotropin-releasing hormone analogs (e.g., leuprolide). In
another embodiment, the compounds of the invention are administered
in conjunction with anti-angiogenesis agents, such as antibodies to
VEGF (e.g., bevacizumab (AVASTIN), ranibizumab (LUCENTIS)) and
other promoters of angiogenesis (e.g., bFGF, angiopoietin-1),
antibodies to alpha-v/beta-3 vascular integrin (e.g., VITAXIN),
angiostatin, endostatin, dalteparin, ABT-510, CNGRC peptide TNF
alpha conjugate, cyclophosphamide, combretastatin A4 phosphate,
dimethylxanthenone acetic acid, docetaxel, lenalidomide,
enzastaurin, paclitaxel, paclitaxel albumin-stabilized nanoparticle
formulation (Abraxane), soy isoflavone (Genistein), tamoxifen
citrate, thalidomide, ADH-1 (EXHERIN), AG-013736, AMG-706, AZD2171,
sorafenib tosylate, BMS-582664, CHIR-265, pazopanib, PI-88,
vatalanib, everolimus, suramin, sunitinib malate, XL184, ZD6474,
ATN-161, cilenigtide, and celecoxib, or any combination
thereof.
[0250] The term "cancer," as used herein, refers to any benign or
malignant abnormal growth of cells. Examples include, without
limitation, breast cancer, prostate cancer, lymphoma, skin cancer,
pancreatic cancer, colon cancer, melanoma, malignant melanoma,
ovarian cancer, brain cancer, primary brain carcinoma, head-neck
cancer, glioma, glioblastoma, liver cancer, bladder cancer,
non-small cell lung cancer, head or neck carcinoma, breast
carcinoma, ovarian carcinoma, lung carcinoma, small-cell lung
carcinoma, Wilmis' tumor, cervical carcinoma, testicular carcinoma,
bladder carcinoma, pancreatic carcinoma, stomach carcinoma, colon
carcinoma, prostatic carcinoma, genitourinary carcinoma, thyroid
carcinoma, esophageal carcinoma, myeloma, multiple myeloma, adrenal
carcinoma, renal cell carcinoma, endometrial carcinoma, adrenal
cortex carcinoma, malignant pancreatic insulinoma, malignant
carcinoid carcinoma, choriocarcinoma, mycosis fungoides, malignant
hypercalcemia, cervical hyperplasia, leukemia, acute lymphocytic
leukemia, chronic lymphocytic leukemia, acute myelogenous leukemia,
chronic myelogenous leukemia, chronic granulocytic leukemia, acute
granulocytic leukemia, hairy cell leukemia, neuroblastoma,
rhabdomyosarcoma, Kaposi's sarcoma, polycythemia vera, essential
thrombocytosis, Hodgkin's disease, non-Hodgkin's lymphoma,
soft-tissue sarcoma, osteogenic sarcoma, primary macroglobulinemia,
and retinoblastoma. In some embodiments, the cancer is selected
from the group of tumor-forming cancers.
Pharmaceutical Compositions
[0251] As a further aspect, the invention provides pharmaceutical
formulations and methods of administering the same to achieve any
of the therapeutic effects (e.g., treatment of cancer) discussed
above. The pharmaceutical formulation may comprise any of the
reagents discussed above in a pharmaceutically acceptable
carrier.
[0252] By "pharmaceutically acceptable" it is meant a material that
is not biologically or otherwise undesirable, i.e., the material
can be administered to a subject without causing any undesirable
biological effects such as toxicity.
[0253] The formulations of the invention can optionally comprise
medicinal agents, pharmaceutical agents, carriers, adjuvants,
dispersing agents, diluents, and the like.
[0254] The double stranded RNA, ASO, chemically-modified siRNA
molecule, or nucleic acid construct of the invention can be
formulated for administration in a pharmaceutical carrier in
accordance with known techniques. See, e.g., Remington, The Science
And Practice of Pharmacy (9.sup.th Ed. 1995). In the manufacture of
a pharmaceutical formulation according to the invention, the double
stranded RNA, ASO, or chemically-modified siRNA molecule (including
the physiologically acceptable salts thereof) is typically admixed
with, inter alia, an acceptable carrier. The carrier can be a solid
or a liquid, or both, and is preferably formulated with the double
stranded RNA, ASO, or chemically-modified siRNA molecule as a
unit-dose formulation, for example, a tablet, which can contain
from 0.01 or 0.5% to 95% or 99% by weight of the double stranded
RNA, ASO, or chemically-modified siRNA molecule. One or more double
stranded RNAs, ASOs, or chemically-modified siRNA molecules can be
incorporated in the formulations of the invention, which can be
prepared by any of the well-known techniques of pharmacy.
[0255] A further aspect of the invention is a method of treating
subjects in vivo, comprising administering to a subject a
pharmaceutical composition comprising a double stranded RNA, ASO,
or chemically-modified siRNA molecule of the invention in a
pharmaceutically acceptable carrier, wherein the pharmaceutical
composition is administered in a therapeutically effective amount.
Administration of the double stranded RNA, ASO, or
chemically-modified siRNA molecule of the present invention to a
human subject or an animal in need thereof can be by any means
known in the art for administering compounds.
[0256] Non-limiting examples of formulations of the invention
include those suitable for oral, rectal, buccal (e.g.,
sub-lingual), vaginal, parenteral (e.g., subcutaneous,
intramuscular including skeletal muscle, cardiac muscle, diaphragm
muscle and smooth muscle, intradermal, intravenous,
intraperitoneal), topical (i.e., both skin and mucosal surfaces,
including airway surfaces), intranasal, transdermal,
intraarticular, intracranial, intrathecal, and inhalation
administration, administration to the liver by intraportal
delivery, as well as direct organ injection (e.g., into the liver,
into a limb, into the brain or spinal cord for delivery to the
central nervous system, into the pancreas, or into a tumor or the
tissue surrounding a tumor).
[0257] The most suitable route in any given case will depend on the
nature and severity of the condition being treated and on the
nature of the particular compound which is being used. In some
embodiments, it may be desirable to deliver the formulation locally
to avoid any side effects associated with systemic administration.
For example, local administration can be accomplished by direct
injection at the desired treatment site, by introduction
intravenously at a site near a desired treatment site (e.g., into a
vessel that feeds a treatment site). In some embodiments, the
formulation can be delivered locally to ischemic tissue. In certain
embodiments, the formulation can be a slow release formulation,
e.g., in the form of a slow release depot.
[0258] For injection, the carrier will typically be a liquid, such
as sterile pyrogen-free water, pyrogen-free phosphate-buffered
saline solution, bacteriostatic water, or Cremophor EL[R](BASF,
Parsippany, N.J.). For other methods of administration, the carrier
can be either solid or liquid.
[0259] For oral administration, the compound can be administered in
solid dosage forms, such as capsules, tablets, and powders, or in
liquid dosage forms, such as elixirs, syrups, and suspensions.
Compounds can be encapsulated in gelatin capsules together with
inactive ingredients and powdered carriers, such as glucose,
lactose, sucrose, mannitol, starch, cellulose or cellulose
derivatives, magnesium stearate, stearic acid, sodium saccharin,
talcum, magnesium carbonate and the like. Examples of additional
inactive ingredients that can be added to provide desirable color,
taste, stability, buffering capacity, dispersion or other known
desirable features are red iron oxide, silica gel, sodium lauryl
sulfate, titanium dioxide, edible white ink and the like. Similar
diluents can be used to make compressed tablets. Both tablets and
capsules can be manufactured as sustained release products to
provide for continuous release of medication over a period of
hours. Compressed tablets can be sugar coated or film coated to
mask any unpleasant taste and protect the tablet from the
atmosphere, or enteric-coated for selective disintegration in the
gastrointestinal tract. Liquid dosage forms for oral administration
can contain coloring and flavoring to increase patient
acceptance.
[0260] Formulations suitable for buccal (sub-lingual)
administration include lozenges comprising the compound in a
flavored base, usually sucrose and acacia or tragacanth; and
pastilles comprising the compound in an inert base such as gelatin
and glycerin or sucrose and acacia.
[0261] Formulations of the present invention suitable for
parenteral administration comprise sterile aqueous and non-aqueous
injection solutions of the compound, which preparations are
preferably isotonic with the blood of the intended recipient. These
preparations can contain anti-oxidants, buffers, bacteriostats and
solutes which render the formulation isotonic with the blood of the
intended recipient. Aqueous and non-aqueous sterile suspensions can
include suspending agents and thickening agents. The formulations
can be presented in unit/dose or multi-dose containers, for example
sealed ampoules and vials, and can be stored in a freeze-dried
(lyophilized) condition requiring only the addition of the sterile
liquid carrier, for example, saline or water-for-injection
immediately prior to use.
[0262] Extemporaneous injection solutions and suspensions can be
prepared from sterile powders, granules and tablets of the kind
previously described. For example, in one aspect of the present
invention, there is provided an injectable, stable, sterile
composition comprising a compound of the invention, in a unit
dosage form in a sealed container. The compound or salt is provided
in the form of a lyophilizate which is capable of being
reconstituted with a suitable pharmaceutically acceptable carrier
to form a liquid composition suitable for injection thereof into a
subject. The unit dosage form typically comprises from about 10 ng
to about 10 grams of the compound or salt. When the compound or
salt is substantially water-insoluble, a sufficient amount of
emulsifying agent which is pharmaceutically acceptable can be
employed in sufficient quantity to emulsify the compound or salt in
an aqueous carrier. One such useful emulsifying agent is
phosphatidyl choline.
[0263] Formulations suitable for rectal administration are
preferably presented as unit dose suppositories. These can be
prepared by admixing the compound with one or more conventional
solid carriers, for example, cocoa butter, and then shaping the
resulting mixture.
[0264] Formulations suitable for topical application to the skin
preferably take the form of an ointment, cream, lotion, paste, gel,
spray, aerosol, or oil. Carriers which can be used include
petroleum jelly, lanoline, polyethylene glycols, alcohols,
transdermal enhancers, and combinations of two or more thereof.
[0265] Formulations suitable for transdermal administration can be
presented as discrete patches adapted to remain in intimate contact
with the epidermis of the recipient for a prolonged period of time.
Formulations suitable for transdermal administration can also be
delivered by iontophoresis (see, for example, Tyle, Pharm. Res.
3:318 (1986)) and typically take the form of an optionally buffered
aqueous solution of the compound. Suitable formulations comprise
citrate or bis\tris buffer (pH 6) or ethanol/water and contain from
0.1 to 0.2M of the compound.
[0266] The compound can alternatively be formulated for nasal
administration or otherwise administered to the lungs of a subject
by any suitable means, e.g., administered by an aerosol suspension
of respirable particles comprising the compound, which the subject
inhales. The respirable particles can be liquid or solid. The term
"aerosol" includes any gas-borne suspended phase, which is capable
of being inhaled into the bronchioles or nasal passages.
Specifically, aerosol includes a gas-borne suspension of droplets,
as can be produced in a metered dose inhaler or nebulizer, or in a
mist sprayer. Aerosol also includes a dry powder composition
suspended in air or other carrier gas, which can be delivered by
insufflation from an inhaler device, for example. See Ganderton
& Jones, Drug Delivery to the Respiratory Tract, Ellis Horwood
(1987); Gonda (1990) Critical Reviews in Therapeutic Drug Carrier
Systems 6:273-313; and Raeburn et al., J. Pharmacol. Toxicol. Meth.
27:143 (1992).
[0267] Aerosols of liquid particles comprising the compound can be
produced by any suitable means, such as with a pressure-driven
aerosol nebulizer or an ultrasonic nebulizer, as is known to those
of skill in the art. See, e.g., U.S. Pat. No. 4,501,729. Aerosols
of solid particles comprising the compound can likewise be produced
with any solid particulate medicament aerosol generator, by
techniques known in the pharmaceutical art.
[0268] Alternatively, one can administer the compound in a local
rather than systemic manner, for example, in a depot or
sustained-release formulation.
[0269] Further, the present invention provides liposomal
formulations of the compounds disclosed herein and salts thereof.
The technology for forming liposomal suspensions is well known in
the art. When the compound or salt thereof is an aqueous-soluble
salt, using conventional liposome technology, the same can be
incorporated into lipid vesicles. In such an instance, due to the
water solubility of the compound or salt, the compound or salt will
be substantially entrained within the hydrophilic center or core of
the liposomes. The lipid layer employed can be of any conventional
composition and can either contain cholesterol or can be
cholesterol-free. When the compound or salt of interest is
water-insoluble, again employing conventional liposome formation
technology, the salt can be substantially entrained within the
hydrophobic lipid bilayer which forms the structure of the
liposome. In either instance, the liposomes which are produced can
be reduced in size, as through the use of standard sonication and
homogenization techniques.
[0270] The liposomal formulations containing the compounds
disclosed herein or salts thereof, can be lyophilized to produce a
lyophilizate which can be reconstituted with a pharmaceutically
acceptable carrier, such as water, to regenerate a liposomal
suspension.
[0271] In the case of water-insoluble compounds, a pharmaceutical
composition can be prepared containing the water-insoluble
compound, such as for example, in an aqueous base emulsion. In such
an instance, the composition will contain a sufficient amount of
pharmaceutically acceptable emulsifying agent to emulsify the
desired amount of the compound. Particularly useful emulsifying
agents include phosphatidyl cholines and lecithin.
[0272] In particular embodiments, the compound is administered to
the subject in a therapeutically effective amount, as that term is
defined above. Dosages of pharmaceutically active compounds can be
determined by methods known in the art, see. e.g., Remington's
Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.). The
therapeutically effective dosage of any specific compound will vary
somewhat from compound to compound, and patient to patient, and
will depend upon the condition of the patient and the route of
delivery. As a general proposition, a dosage from about 0.001 to
about 50 mg/kg will have therapeutic efficacy, with all weights
being calculated based upon the weight of the compound, including
the cases where a salt is employed. Toxicity concerns at the higher
level can restrict intravenous dosages to a lower level such as up
to about 10 mg/kg, with all weights being calculated based upon the
weight of the compound, including the cases where a salt is
employed. A dosage from about 10 mg/kg to about 50 mg/kg can be
employed for oral administration. Typically, a dosage from about
0.5 mg/kg to 5 mg/kg can be employed for intramuscular injection.
Particular dosages are about 1 .mu.mol/kg to 50 .mu.mol/kg, and
more particularly to about 22 .mu.mol/kg and to 33 .mu.mol/kg of
the compound for intravenous or oral administration,
respectively.
[0273] In particular embodiments of the invention, more than one
administration (e.g., two, three, four, or more administrations)
can be employed over a variety of time intervals (e.g., hourly,
daily, weekly, monthly, etc.) to achieve therapeutic effects.
[0274] The present invention finds use in veterinary and medical
applications. Suitable subjects include both avians and mammals,
with mammals being preferred. The term "avian" as used herein
includes, but is not limited to, chickens, ducks, geese, quail,
turkeys, and pheasants. The term "mammal" as used herein includes,
but is not limited to, humans, bovines, ovines, caprines, equines,
felines, canines, lagomorphs, etc. Human subjects include neonates,
infants, juveniles, and adults. In other embodiments, the subject
is an animal model of cancer. In certain embodiments, the subject
has or is at risk for cancer.
[0275] The following examples are not intended to limit the scope
of the claims to the invention, but are rather intended to be
exemplary of certain embodiments. Any variations in the exemplified
methods that occur to the skilled artisan are intended to fall
within the scope of the present invention. As will be understood by
one skilled in the art, there are several embodiments and elements
for each aspect of the claimed invention, and all combinations of
different elements are hereby anticipated, so the specific
combinations exemplified herein are not to be construed as
limitations in the scope of the invention as claimed. If specific
elements are removed or added to the group of elements available in
a combination, then the group of elements is to be construed as
having incorporated such a change.
Example 1
Mutant KRAS-Specific siRNAs
[0276] Methods: Novel mutant-specific siRNAs (MS siRNAs) were
designed based on previous literature that suggests a 3-mismatch
tolerance threshold for 19-nucleotide siRNA efficacy (Naito et al.,
Nucleic Acids Res. 32:W124 (2004)). With two or fewer mismatches
between the sequence and the target gene, the siRNA is able to
successfully bind and knock-down expression of the gene of
interest; however, at and above the 3 mismatch threshold, the siRNA
fails to recognize the target, thus allowing for expression of the
encoded protein. Custom MS siRNAs were generated using open source
softwares provided by Sigma Aldrich, Life Technologies and
Dharmacon to be antisense to an artificial, hyper-mutated version
of the WT KRAS gene which never actually occurs in nature, with
exactly 3 point mutations corresponding to each of the most
commonly occurring KRAS mutants (G12C, G12D or G12V, and G13D).
Thirty flanking nucleotides were included upstream and downstream
of these sites in the artificial, hyper-mutated mRNA input (FIG.
1). Of note, siRNA sequences were designed to target two different
artificial mRNA sequences; one that simultaneously contained
specific missense mutations in codons 12 (G12C and G12D) and 13
(G13D), and another that simultaneously contained specific missense
mutations in codons 12 (G12C and G12V) and 13 (G13D) (FIG. 1). The
resultant sequence is thus antisense with 3 mismatch errors to WT
KRAS but only 2 mismatch errors to each of the 3 mutant KRAS
alleles. Consequently, it was hypothesized that these MS siRNAs
will optimize the task of targeting mutant KRAS while sparing the
WT KRAS allele since the sequence is below the 3 mismatch threshold
for the former and above for the latter. In addition, by
introducing one mutation from each of 3 different prevalent KRAS
mutants in the custom sequence design, the resultant siRNA has the
added potential benefit of simultaneously targeting several KRAS
mutants rather than one.
[0277] Constructs containing the WT, G12C, G12D, G12V. or G13D KRAS
gene inserted into pBABE-puro retroviral expression vectors were
prepared. To expand the vector constructs, plasmids were added to
high efficiency competent E. coli cells and incubated in S.O.C.
media on a shaker at 37.degree. C. Cells were then plated on
ampicillin agarose plates and incubated at 37.degree. C. overnight.
Liquid cultures were prepared by picking and placing bacterial
colonies from the overnight plates into LB broth with 1 .mu.l/ml
carbocyclin and incubating overnight on a shaker at 37.degree. C.
Liquid cultures were performed in triplicate. Plasmid DNA from the
resultant turbid cultures was purified using a QIAprep Spin
Miniprep Kit (Qiagen). Successful plasmid expansion was confirmed
via restriction enzyme digest using BamHI and HindIII and gel
electrophoresis. Undigested plasmids from the Miniprep were further
expanded in LB Broth with 0.1 .mu.l/mil carbocyclin and then
purified using a QIAprep Spin Maxiprep Kit (Qiagen).
[0278] To produce retrovirus containing the pBABE-puro-KRAS
plasmids, 9.times.10.sup.6 HEK 293T cells were seeded onto 6 cm
cell culture plates in 293T media (DMEM with 10% FBS and 1%
penicillin-streptomycin) and incubated at 37.degree. C., 5%
CO.sub.2. After 24 hours, plasmid DNA mixtures were prepared for
each pBABE-puro-KRAS plasmid by creating a mixture of 0.01
.mu.g/.mu.l plasmid construct and 0.01 .mu.g/.mu.l PCL10A pack
vector plasmid to OptiMEM media. In addition, a L2K mixture was
prepared by adding 0.05 .mu.g/.mu.l Lipofectamine 2000 (Thermo
Fisher Scientific) in OptiMEM media and incubating at room
temperature for 5 minutes. The L2K mixture was then combined 1:1
with each plasmid DNA mixture and incubated at room temperature for
20 minutes. Media was removed from the incubated cells, then 2 ml
of 293T media was added to each well along with 250 .mu.l of the
plasmid DNA/L2K mixture. After another 24 hours, the plasmid
DNA/L2K media was replaced with 293T media. After another 24 hours,
the resultant viral media was collected from the wells and replaced
with fresh 293T media. Virus media was stored overnight on ice at
4.degree. C. After another 24 hours, media was collected again from
the wells and added to the previously stored virus. The mixture was
centrifuged at room temperature, then the supernatant was
collected. This process was repeated using mCherry and 293T media
instead of plasmid construct to produce mCherry and empty vector
virus, respectively.
[0279] To infect cells with KRAS plasmid, NIH 3T3 cells were
harvested and seeded at 100,000 per well in 6 well plates in
complete media (DMEM with 10% Colorado calf serum and 1%
pen/strep). After 4-6 hours and once the cells attached, the media
was aspirated and 2 ml of complete media with 10 .mu.l/ml polybrene
along with 250 .mu.l of viral media (WT, G12C, G12D, G12V, G13D,
mCherry, and empty vector) or complete media (negative controls)
were added to each well. Cells were centrifuged at 1500 g for 60
minutes at 30.degree. C., then incubated overnight at 37.degree. C.
After 24 hours, wells were aspirated and complete media was added
to each well. After another 24 hours, wells were aspirated and
complete media with 2 .mu.g/ml puromycin was added. Media was
replaced with puromycin media every 24 hours until no living cells
remained in the negative control wells. Successful infection was
further verified using mCherry expression.
[0280] RNAi knockdown was induced in KRAS-infected NIH 3T3 cells
plated at a density of 60,000 cells per 500 .mu.l complete media
per well in 24 well plates. Sequences for the scrambled control
siRNA, as well as positive controls (Seq #2 and #3, G12C and G12D
siRNAs) previously found to potently silence wild-type and mutant
KRAS were used as indicated in FIG. 1 (Fleming et al., Mol. Cancer
Res. 3:413 (2005); Pecot et al., Mol. Cancer Ther. 13:2876 (2014)).
Cells were incubated in 5:1 mixture of complete media and
serum-free media, along with 20 nM siRNA (Sigma Aldrich) and
Lipofectamine(R) RNAiMAX transfection reagent (Thermo Fisher
Scientific, 2:1 ratio of transfection reagent to siRNA by volume)
for 5 hours at 37.degree. C. in 5% CO.sub.2. Media was removed, and
cells were incubated in complete media only for another 19 hours
before RNA was collected and purified using a QIAprep Spin Miniprep
Kit.
[0281] Purified RNA from siRNA treatments was quantified using a
spectrophotometer, then reverse transcribed to cDNA using an
iScript.TM. cDNA Synthesis Kit (Bio-Rad). To quantify relative
expression levels of KRAS, RT-PCR reactions were performed by
monitoring real-time changes in fluorescent intensity of SYBR green
on the StepOnePlus.TM. Real-Time PCR System (Thermo Fisher
Scientific). Each sample was run in triple replicate. The
StepOnePlus.TM. was also used to obtain RQ values using the
.DELTA..DELTA.CT analysis to calculate .DELTA.Ct values by
comparing cycle threshold (Ct values) of KRAS to those of the
target reference gene. 18s, then compare .DELTA.Ct values for each
siRNA to those of the NC siRNA. Error bars represent 1 standard
deviation. Data represents the result of one trial of two
biological replicates for WT and G12D and two trials of two
biological replicates for G12C, G12V, and G13D. Reverse
transfection experiments were performed in duplicate for each siRNA
for each cell line.
[0282] Results: To test the efficacy of mutant-specific KRAS
silencing in vitro, a panel of candidate MS KRAS siRNA sequences
was tested for their ability to knock-down KRAS expression in both
WT and target mutant KRAS-expressing cells. The 12CD13D_1 sequence
was observed to exhibit a sparing of WT KRAS expression (only 4%
knock-down compared to negative control siRNA) while knocking down
G12C (50%), G12D (82%), and G13D mutant KRAS (66%) (FIG. 2A). The
sequence was also unexpectedly noted to knock down G12V expression
(58%). Additionally, 12CD13D_2 and 12CD13D_4 were also found to
exhibit WT sparing and mutant knockdown. However, the former
appeared to exhibit less WT sparing than 12CD13D_1 and the latter
less KRAS knockdown in all cell lines (FIG. 2A). The remaining
sequences exhibited either low potency against mutant KRAS, high
KRAS knockdown in the WT KRAS cell line, or both (FIG. 2A).
[0283] In addition, G12C- and G12D-specific siRNA sequences
(Fleming et al., Mol. Cancer Res. 3:413 (2005)) were tested in
order to compare the efficacy of MS siRNA sequences against those
previously demonstrated to exhibit target-specificity. However, the
mutant-specificity of these sequences was not confirmed, and the
sequences did not exhibit the expected preferential knockdown of
G12C and G12D mutant KRAS, respectively, over the WT or other
mutant alleles (FIG. 2B).
[0284] KRAS siRNA sequences 12CD13D_1 and 12CD13D_4 were tested in
a KRAS G12D mutant lung cancer cell line. Using a control siRNA
(Scr) and two previously validated KRAS siRNAs (Seq #2 and #3), it
was demonstrated that customized, mutant specific KRAS siRNA
sequences 12CD13D_1 and 12CD13D_4 are highly effective at silencing
KRAS protein expression (FIG. 3).
[0285] Testing all possible siRNA sequence permutations between our
custom siRNA sequences. In order to verify the best possible custom
KRAS siRNA sequences (leading sequences being 12CD13D_1 and
12CD3D_4), a library of sequences (12CD13D_A thru 12CD13D_F) were
tested that incrementally move downstream between 12CD13D_1 and
12CD13D_4 (FIG. 4).
[0286] Following stable transduction of 3T3 cells with either
wild-type (WT) or mutant G12C, G12D, G12V and G13D human KRAS
sequences, the cells were transfected with KRAS siRNA sequences
listed in FIG. 5. Twenty-four hours after transfection, cells were
lysed, RNA collected and cDNA was made. Quantitative qPCR was
performed for KRAS using 18s as a house-keeping gene. It was found
that the leading 12CD13D_1 and 12CD13D_4 custom sequences were
still the best overall at silencing mutant KRAS, while the other
possible KRAS siRNA sequences ("A" thru "F") were less potent
overall at silencing the different KRAS mRNA sequences. On this
experiment the custom KRAS siRNA 12CD13D_4 sequence was best at
sparing the WV sequence.
[0287] Discussion: Although numerous efforts have been made to
target mutant KRAS, no direct inhibitors are currently in clinical
use. Moreover, most current small-molecule cancer therapeutics
exhibit low target specificity, resulting in adverse toxicity in
non-cancerous cells (Pecot et al., Nat. Rev. Cancer 11:59 (2011)).
Despite current headways in inhibiting downstream effectors in the
KRAS signaling pathway, KRAS remains an elusive target for drug
development (Cox et al., Nat. Rev. Drug Discov. 13:828 (2014)). As
such, this study investigated the efficacy of novel MS siRNA as a
means of selectively inhibiting expression of mutant KRAS.
[0288] Based on these preliminary findings, the 12CD13D_1 and
12CD13D_2 siRNA sequences were chosen as lead candidates for
further investigation as therapeutic agents because of their high
mutant-specificity and potency. To a lesser extent, 12CD13D_4 is
also a promising candidate; however, its low efficiency in knocking
down KRAS expression in mutant targets suggests that it may not be
effective as a clinically relevant therapeutic agent. By contrast,
the G12C- and G12D-specific siRNA do not appear to exhibit any sort
of sparing of the WT KRAS allele.
[0289] In addition, the low specificity of both sequences designed
to target the G12V rather than the G12D point mutation suggests a
greater tolerance for WT KRAS in G12V-targeting sequences.
[0290] These preliminary findings collectively suggest the
viability of novel MS siRNAs as a mutant-specific vehicle for
silencing oncogenic KRAS. With its potential as an effective
payload with mutant KRAS specificity, novel mutant-specific siRNAs
present a promising avenue of pursuit for drugging the formerly
"undruggable."
Example 2
Antisense Oligonucleotides Targeted to Synthetic Mutant KRAS
[0291] A series of antisense oligonucleotide (ASO) sequences were
created that target a mutant KRAS of the invention comprising the
mutations G12C, G12D and G13D (SEQ ID NO:53) relative to the
wild-type KRAS sequence (SEQ ID NO:52) (FIG. 6 and Table 2). In
FIG. 6, the black bars represent nucleotides that have a
2'-methoxy-ethyl (MOE) modification, while the gray regions
represent the "Gapmer" that is composed of DNA. The schematic is
not to scale and the black bars are composed of 5 flanking
MOE-modified nucleotides on each side while there is a 10
nucleotide Gapmer. The ASOs incorporate phosphorothioate linkages
(PS, designated by a "*") between all nucleotides, a 10-nt Gapmer
(underlined), and 5 flanking 2'-MOE (methoxy-ethyl) modifications
(bold). The ASOs were tested to identify single-stranded RNA and/or
DNA sequences that maintain the ability to silence several KRAS
mutations.
TABLE-US-00010 TABLE 2 ASO sequences SEQ ASO ID Number Sequence NO
1 T*C*A*T*A*A*G*C*T*C*C*A*A*C*T*A*C*C*A*C 54 2
G*T*C*A*T*A*A*G*C*T*C*C*A*A*C*T*A*C*C*A 55 3
C*G*T*C*A*T*A*A*G*C*T*C*C*A*A*C*T*A*C*C 56 4
A*C*G*T*C*A*T*A*A*G*C*T*C*C*A*A*C*T*A*C 57 5
T*A*C*G*T*C*A*T*A*A*G*C*T*C*C*A*A*C*T*A 58 6
C*T*A*C*G*T*C*A*T*A*A*G*C*T*C*C*A*A*C*T 59 7
C*C*T*A*C*G*T*C*A*T*A*A*G*C*T*C*C*A*A*C 60 8
G*C*C*T*A*C*G*T*C*A*T*A*A*G*C*T*C*C*A*A 61 9
T*G*C*C*T*A*C*G*T*C*A*T*A*A*G*C*T*C*C*A 62 10
T*T*G*C*C*T*A*C*G*T*C*A*T*A*A*G*C*T*C*C 63 11
C*T*T*G*C*C*T*A*C*G*T*C*A*T*A*A*G*C*T*C 64 12
T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A*A*G*C*T 65 13
C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A*A*G*C 66 14
A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A*A*G 67 15
C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A*A 68 16
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A 69
[0292] Four separate A431 cell lines were engineered to remove
expression of wild-type KRAS and express one of the mutations G12C,
G12D, G13D, or G12V. Each cell line was treated with free ASOs at
1.1 .mu.M for 48 hours, and qPCR was run. The results are shown in
FIG. 7. While several of the ASOs were demonstrated to silence one
or more of the mutations, it was found that ASO15 and ASO16 were
very potent at silencing all 4 of the most common KRAS
mutations.
[0293] Some of the top hits were re-evaluated, and again ASO15 and
ASO16 were found to potently silence all 4 of the KRAS mutations in
a dose-responsive manner (FIG. 8). Cells were treated with free
ASOs at 1.1 .mu.M and 10 .mu.M for 48 hours, then qPCR was run for
mutant KRAS.
Example 3
Modified ASO16 Sequences
[0294] Starting with the potent ASO16, modified versions were
prepared to identify ASOs with increased mutation specificity by
targeting the ASO to mutations that exist in nature, e.g., single
mutations (G12C, G12D, G12V, or G13D). Modifications included base
substitutions and the use of locked nucleic acids. The modified
sequences are shown in Table 3. The ASOs incorporates
phosphorothioate linkages (PS, designated by a "*") between all
nucleotides, a 10-nt Gapmer (underlined), and 5 flanking 2'-MOE
(methoxy-ethyl) modifications (bold). The last four sequences use a
single locked nucleic acid (LNA, denoted by "+" before the base) in
place of an MOE to increase melting temperatures at specific sites.
The LNA consists of a methylene bridge connecting the 2' and 4'
carbons.
TABLE-US-00011 TABLE 3 Modified ASO16 sequences ASO Number Sequence
SEQ ID NO 16 G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*T*A 69 ASO16-G12C
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*C*A 70 ASO16-G12D
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*T*C 71 ASO16-G12V
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*A*C 77 ASO16-G13D
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*T*C*A*C*C 73 ASO16-
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*C*+A 74 G12C-LNA ASO16-
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*+T*C 75 G12D-LNA ASO16-
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*C*C*A*+A*C 76 G12V-LNA ASO16-
G*C*A*C*T*C*T*T*G*C*C*T*A*C*G*+T*C*A*C*C 77 G13D-LNA
[0295] The ASOs were tested on the A431 cell lines as described
above. The results are shown in FIG. 9. Improved potency for each
KRAS mutation was found for: 1) G12C using ASO16-G12C and
ASO-G12C-LNA, 2) G12D using ASO16-G12D and ASO16-G12D-LNA, 3) G12V
using ASO16-G12V and ASO16-G12V-LNA and 4) G13D using ASO16-G13D
and ASO16-G13D-LNA. These results indicate that the increased
mutation specificity of these ASO sequences led to increased
potency.
Example 4
Fully Modified siRNA Sequences
[0296] Several of the ASOs targeted to single KRAS mutations
described in Example 3 were converted to siRNA molecules in an
effort to identify sequences that maximize the reduction of
expression of mutated sequences while sparing the wild-type KRAS
sequence.
[0297] These siRNAs were then fully modified (FM) to minimize
nuclease degradation and immune stimulation. While these types of
modifications often attenuate the silencing activity of siRNAs, the
inventors have developed several fully modified siRNA sequences
that retain all or nearly all of their silencing activity compared
to unmodified siRNAs.
[0298] Table 4 lists the fully modified siRNA sequences that were
prepared.
[0299] Each of the siRNAs was tested in A431 cells engineered to
either express WT or the targeted KRAS mutation. For mutant
expressing A431 cells, the WT allele was deleted via CRISPR, so the
expression shown is only reflective of the mutant mRNA. Cells were
transfected with a low dose (20 nM) of negative control (NC) or the
FM KRAS siRNAs and qPCR for KRAS expression was run on RNA isolated
24 hours later.
[0300] For siRNAs targeting the G12C mutation, it was found that
D1-G12C-FM and 12-G12C-FM were both able to reduce mutant KRAS G12C
while spare the wild-type expression (FIG. 10). Notably, not all of
the siRNAs were equivalent in suppressing G12C KRAS or sparing
wild-type KRAS. As shown in FIG. 11, it was found that some
(hatched bars) mutant-specific (MS) iterations of the `parent` D1,
D2, and D4 sequences were more potent (panel 1). It was found that
several of the MS sequences more potently reduced the mutant over
WT sequences (see D1-G12C, D2-G12C, D4-G12C), unlike a pan-KRAS Seq
2 (panel 2). Finally, it was found that FM iterations of these MS
sequences showed retained silencing activity on mutant KRAS over WT
KRAS expression (e.g., D2-G12C-FM-F) (panel 3).
TABLE-US-00012 TABLE 4 Fully modified siRNA sequences Name Strand
Sequence (5'-3') SEQ ID NO D1-G12C-FM S
[mG]*[mA]*[mG][mC][mU][mU][2flG][mU][2flG][2flG][2flC][mG][mU][mA][mG][mG-
][mC][mA][mA][mG][mA] 78 AS
[mU]*[2flU]*[mG][mC][mC][2flU][mA][mC][mG][mC][mC][mA][mC][2flA][mA][2-
flG][mC][mU][mC]*[mC]*[mA] 79 D1-G12D-FM S
[mG]*[mA]*[mG][mC][mU][mG][2flA][mU][2flG][2flG][2flC][mG][mU][mA][mG][mG-
][mC][mA][mA][mG][mA] 80 AS
[mU]*[2flU]*[mG][mC][mC][2flU][mA][mC][mG][mC][mC][mA][mU][2flC][mA][2-
flG][mC][mU][mC]*[mC]*[mA] 81 D1-G13D-FM S
[mG]*[mA]*[mG][mC][mU][mG][2flG][mU][2flG][2flA][2flC][mG][mU][mA][mG][mG-
][mC][mA][mA][mG][mA] 82 AS
[mU]*[2flU]*[mG][mC][mC][2flU][mA][mC][mG][mU][mC][mA][mU][2flC][mA][2-
flG][mC][mU][mC]*[mC]*[mA] 83 D2-G12C-FM S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flU][mG][mU][mG][mG][mC-
][mG][mU][mA][mG][mG] 84 AS
[mU]*[2flA]*[mC][mG][mC][2flC][mA][mC][mA][mA][mG][mC][mU][2flC][mC][2-
flA][mA][mC][mU]*[mA]*[mC] 85 D2-G12D-FM S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flG][mA][mU][mG][mG][mC-
][mG][mU][mA][mG][mG] 86 AS
[mU]*[2flA]*[mC][mG][mC][2flC][mA][mU][mC][mA][mG][mC][mU][2flC][mC][2-
flA][mA][mC][mU]*[mA]*[mC] 87 D2-G13D-FM S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flG][mG][mU][mG][mA][mC-
][mG][mU][mA][mG][mG] 88 AS
[mU]*[2flA]*[mC][mG][mU][2flC][mA][mC][mC][mA][mG][mC][mU][2flC][mC][2-
flA][mA][mC][mU]*[mA]*[mC] 89 D4-G13D-FM S
[mG]*[mG]*[mU][mA][mG][mU][2flU][mG][2flG][2flA][2flG][mC][mU][mG][mG][mU-
][mG][mA][mC][mG][mU] 90 AS
[mG]*[2flU]*[mC][mA][mC][2flC][mA][mG][mC][mU][mC][mC][mA][2flA][mC][2-
flU][mA][mC][mC]*[mA]*[mC] 91 D1-G12V-FM S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flG][mU][mU][mG][mG][mC-
][mG][mU][mA][mG][mG] 92 AS
[mG]*[2flU]*[mC][mA][mC][2flC][mA][mG][mC][mU][mC][mC][mA][2flA][mC][2-
flU][mA][mC][mC]*[mA]*[mC] 96 D2-G12V-FM S
[mG]*[mA]*[mG][mC][mU][mG][2flU][mU][2flG][2flG][2flC][mG][mU][mA][mG][mG-
][mC][mA][mA][mG][mA] 94 AS
[mU]*[2flU]*[mG][mC][mC][2flU][mA][mC][mG][mC][mC][mA][mA][2flC][mA][2-
flG][mC][mU][mC]*[mC]*[mA] 95 D1-G12D-FM-F S
[mG]*[mA]*[mG][mC][mU][mG][2flA][mU][2flG][2flG][2flC][mG][mU][mA][mG][mG-
][mC][mA][mA][mG][mA] 96 AS
[mU]*[2flU]*[mG][mC][mC][2flU][mA][mC][mG][mC][mC][mA][2flU][2flC][mA]-
[2flG][mC][mU][mC]*[mC]*[mA] 97 D1-G13D-FM-F S
[mG]*[mA]*[mG][mC][mU][mG][2flG][mU][2flG][2flA][2flC][mG][mU][mA][mG][mG-
][mC][mA][mA][mG][mA] 98 AS
[mU]*[2flU]*[mG][mC][mC][2flU][mA][mC][mG][2flU][mC][mA][mC][2flC][mA]-
[2flG][mC][mU][mC]*[mC]*[mA] 99 D2-G12C-DM-F S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flU][mG][mU][mG][mG][mC-
][mG][mU][mA][mG][mG] 100 AS
[mU]*[2flA]*[mC][mG][mC][2flC][mA][mC][2flA][mA][mG][mC][mU][2flC][mC]-
[2flA][mA][mC][mU]*[mA]*[mC] 101 D2-G12D-FM-F S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flG][mA][mU][mG][mG][mC-
][mG][mU][mA][mG][mG] 102 AS
[mU]*[2flA]*[mC][mG][mC][2flC][mA][2flU][mC][mA][mG][mC][mU][2flC][mC]-
[2flA][mA][mC][mU]*[mA]*[mC] 103 D2-G13D-FM-F S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flG][mG][mU][mG][mA][mC-
][mG][mU][mA][mG][mG] 104 AS
[mU]*[2flA]*[mC][mG][2flU][2flC][mA][mC][mC][mA][mG][mC][mU][2flC][mC]-
[2flA][mA][mC][mU]*[mA]*[mC] 105 D1-G12V-FM-F S
[mA]*[mG]*[mU][mU][mG][mG][2flA][mG][2flC][2flU][2flG][mG][mU][mG][mA][mC-
][mG][mU][mA][mG][mG] 106 AS
[mU]*[2flA]*[mC][mG][mC][2flC][mA][2flA][mC][mA][mG][mC][mU][2flC][mC]-
[2flA][mA][mC][mU]*[mA]*[mC] 107 D2-G12V-FM-F S
[mG]*[mA]*[mG][mC][mU][mG][2flU][mU][2flG][2flG][2flC][mG][mU][mA][mG][mG-
][mC][mA][mA][mG][mA] 108 AS
[mU]*[2flU]*[mG][mC][mC][2flU][mA][mC][mG][mC][mC][mA][2flA][2flC][mA]-
[2flG][mC][mA][mC]*[mC]*[mA] 109 Seq2-FM S
[mG]*[mU]*[mC][mU][mC][mU][2flU][mG][2flG][2flA][2flU][mA][mU][m-
U][mC][mU][mC][mG][mA] 110 AS
[mU]*[2flC]*[mG][mA][mG][2flA][mA][mU][mA][mU][mC][mC][mA][2flA][mG][2-
flA][mG][mA][mC]*[mA]*[mG] 111 Seq3-FM S
[mC]*[mA]*[mG][mC][mU][mA][2flA][mU][2flU][2flC][2flA][mG][mA][m-
A][mU][mC][mA][mU][mU] 112 AS
[mA]*[2flA]*[mU][mG][mA][2flU][mU][mC][mU][mG][mA][mA][mU][2flU][mA][2-
flG][mC][mU][mG]*[mU]*[mA] 113 S-sense strand AS-antisense strand
m-2'-O-methyl on sugar moieties 2fl-2'-fluoro on sugar moieties
*-phosphorothioate in between nucleotides
[0301] For siRNAs targeting the G12D mutation, it was found that
D1-G12D-FM, D2-G12D-FM and D2-G12D-FM-F were all able to reduce
mutant KRAS G12D (FIG. 12). D1-G12D-FM and D2-G12D-FM were also
able to spare WT expression (FIG. 12). Notably, not all of the
siRNAs were equivalent in suppressing G12D KRAS or sparing
wild-type KRAS. As shown in FIG. 13, it was found that some
(hatched bars) mutant-specific (MS) iterations of the `parent` D1,
D2 and D4 sequences were more potent (panel 1). It was found that
several of the MS sequences more potently reduced the mutant over
WT sequences (see D1-G12D), unlike a pan-KRAS Seq 2 (panel 2).
Finally, it was found that FM iterations of these MS sequences
showed retained silencing activity on mutant KRAS over WT KRAS
expression (e.g., D1-G12D-FM and D2-G12D-FM) (panel 3).
[0302] For siRNAs targeting the G12V mutation, it was found that
V1-G12V-FM and V2-G12D-FM were able to reduce mutant KRAS G12V
while also able to spare WT expression (FIG. 14). Notably, not all
of the siRNAs were equivalent in suppressing G12D KRAS or sparing
wild-type KRAS. As shown in FIG. 15, it was found that some
(hatched bars) mutant-specific (MS) iterations of the `parent` D1,
D2 and D4 sequences were more potent (panel 1). It was found that
several of the MS sequences more potently reduced the mutant over
WT sequences (see D2-G12V), unlike a pan-KRAS Seq2 (panel 2).
Finally, it was found that FM iterations of these MS sequences
showed retained silencing activity on mutant KRAS over WT KRAS
expression (e.g., D1-G12V-FM and D2-G12V-FM) (panel 3).
[0303] For siRNAs targeting the G13D mutation, it was found that
D2-G13D-FM and D2-G13D-FM-F were able to reduce mutant KRAS G12D
(FIG. 16). D2-G12D-FM-F was also able to spare WT expression (FIG.
16). Notably, not all of the siRNAs were equivalent in suppressing
G12D KRAS or sparing wild-type KRAS. As shown in FIG. 17, it was
found that some (hatched bars) mutant-specific (MS) iterations of
the `parent` D1, D2 and D4 sequences were more potent (panel 1). It
was found that several of the MS sequences more potently reduced
the mutant over WT sequences (see D1-G13D and D4-G13D), unlike a
pan-KRAS Seq 2 (panel 2). Finally, it was found that FM iterations
of these MS sequences showed retained silencing activity on mutant
KRAS over WT KRAS expression (e.g., D2-G13D-FM and D2-G13D-FM-F)
(panel 3).
Example 5
Additional Fully Modified siRNA Sequences
[0304] siRNAs comprising the sequence of SEQ ID NO:50 or SEQ ID
NO:51 were used as positive controls in the experiments described
in Example 1. Fully modified versions of these siRNAs were prepared
to test their specificity and potency. The sequences of the FM
siRNAs are shown in Table 4. The HCT116 (colon cancer, KRAS G13D)
and LU65 (lung cancer, KRAS G12C) cell lines were transfected with
20 nM of either unmodified Seq2 or Seq3, or fully chemically
modified (FM) Seq2-FM or Seq3-FM siRNA sequences. Both Seq2-FM and
Seq3-FM surprisingly maintained full silencing of KRAS activity,
especially at 48 hours post-treatment (FIG. 18).
[0305] All publications, patents, and patent applications are
herein incorporated by reference to the same extent as if each
individual publication, patent, or patent application was
specifically and individually indicated to be incorporated by
reference.
[0306] Although the foregoing invention has been described in some
detail by way of illustration and example for purposes of clarity
of understanding, it will be obvious that certain changes and
modifications may be practiced within the scope of the list of the
foregoing embodiments and the appended claims.
Sequence CWU 1
1
159119RNAArtificialsiRNA sequence 1gagcuuauga cguaggcaa
19219RNAArtificialsiRNA sequence 2aguuggagcu uaugacgua
19319RNAArtificialsiRNA sequence 3gguaguugga gcuuaugac
19419RNAArtificialsiRNA sequence 4guaguuggag cuuaugacg
19519RNAArtificialsiRNA sequence 5uaguuggagc uuaugacgu
19619RNAArtificialsiRNA sequence 6guuggagcuu augacguag
19719RNAArtificialsiRNA sequence 7uuggagcuua ugacguagg
19819RNAArtificialsiRNA sequence 8uggagcuuau gacguaggc
19919RNAArtificialsiRNA sequence 9ggagcuuaug acguaggca
191021RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
10gagcuuauga cguaggcaan n 211121RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 11aguuggagcu uaugacguan n
211221RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
12gguaguugga gcuuaugacn n 211321RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 13guaguuggag cuuaugacgn n
211421RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
14uaguuggagc uuaugacgun n 211521RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 15guuggagcuu augacguagn n
211621RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
16uuggagcuua ugacguaggn n 211721RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 17uggagcuuau gacguaggcn n
211821RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
18ggagcuuaug acguaggcan n 211919RNAArtificialsiRNA sequence
19uugccuacgu cauaagcuc 192019RNAArtificialsiRNA sequence
20uacgucauaa gcuccaacu 192119RNAArtificialsiRNA sequence
21gucauaagcu ccaacuacc 192219RNAArtificialsiRNA sequence
22cgucauaagc uccaacuac 192319RNAArtificialsiRNA sequence
23acgucauaag cuccaacua 192419RNAArtificialsiRNA sequence
24cuacgucaua agcuccaac 192519RNAArtificialsiRNA sequence
25ccuacgucau aagcuccaa 192619RNAArtificialsiRNA sequence
26gccuacguca uaagcucca 192719RNAArtificialsiRNA sequence
27ugccuacguc auaagcucc 192821RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 28uugccuacgu cauaagcucn n
212921RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
29uacgucauaa gcuccaacun n 213021RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 30gucauaagcu ccaacuaccn n
213121RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
31cgucauaagc uccaacuacn n 213221RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 32acgucauaag cuccaacuan n
213321RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
33cuacgucaua agcuccaacn n 213421RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 34ccuacgucau aagcuccaan n
213521RNAArtificialsiRNA sequencemisc_feature(20)..(21)n is dT
35gccuacguca uaagcuccan n 213621RNAArtificialsiRNA
sequencemisc_feature(20)..(21)n is dT 36ugccuacguc auaagcuccn n
213763DNAArtificialMutated human KRAS gene sequence 37actgaatata
aacttgtggt agttggagct tatgacgtag gcaagagtgc cttgacgata 60cag
633863DNAArtificialMutated human KRAS gene sequence 38actgaatata
aacttgtggt agttggagct tttgacgtag gcaagagtgc cttgacgata 60cag
633963DNAArtificialMutated human KRAS gene sequence 39actgaatata
aacttgtggt agttggagct ggtggcgtag gcaagagtgc cttgacgata 60cag
634063DNAHomo sapiens 40actgaatata aacttgtggt agttggagct ggtggcgtag
gcaagagtgc cttgacgata 60cag 634163DNAArtificialMutated human KRAS
gene sequence 41actgaatata aacttgtggt agttggagct tgtggcgtag
gcaagagtgc cttgacgata 60cag 634263DNAArtificialMutated human KRAS
gene sequence 42actgaatata aacttgtggt agttggagct gatggcgtag
gcaagagtgc cttgacgata 60cag 634363DNAArtificialMutated human KRAS
gene sequence 43actgaatata aacttgtggt agttggagct gttggcgtag
gcaagagtgc cttgacgata 60cag 634463DNAArtificialMutated human KRAS
gene sequence 44actgaatata aacttgtggt agttggagct ggtgacgtag
gcaagagtgc cttgacgata 60cag 634563RNAArtificialMutated siRNA target
sequencemisc_feature(22)..(40)G12C siRNA target sequence
45acugaauaua aacuuguggu aguuggagcu uguggcguag gcaagagugc cuugacgaua
60cag 634663RNAArtificialMutated siRNA target
sequencemisc_feature(22)..(40)G12D siRNA target sequence
46acugaauaua aacuuguggu aguuggagcu gauggcguag gcaagagugc cuugacgaua
60cag 634763RNAArtificialMutated siRNA target
sequencemisc_feature(18)..(36)12CD13D_4 siRNA target
sequencemisc_feature(19)..(37)12CD13D_A target
sequencemisc_feature(20)..(38)12CD13D_B target
sequencemisc_feature(21)..(39)12CD13D_2 siRNA target
sequencemisc_feature(22)..(40)12CD13D_C target
sequencemisc_feature(23)..(41)12CD13D_D target
sequencemisc_feature(24)..(42)12CD13D_E target
sequencemisc_feature(25)..(43)12CD13D_F target
sequencemisc_feature(26)..(44)12CD13D_1 siRNA target
sequencemisc_feature(28)..(46)12CD13D_3 siRNA target sequence
47acugaauaua aacuuguggu aguuggagcu uaugacguag gcaagagugc cuugacgaua
60cag 634863RNAArtificialMutated siRNA target
sequencemisc_feature(21)..(39)12CV13D_1 siRNA target
sequencemisc_feature(26)..(44)12CV13D_2 siRNA target sequence
48acugaauaua aacuuguggu aguuggagcu uuugacguag gcaagagugc cuugacgaua
60cag 634919RNAArtificialNegative control siRNA sequence
49uucuccgaac gugucacgu 195019RNAArtificialPositive control siRNA
sequence 50gucucuugga uauucucga 195119RNAArtificialPositive control
siRNA sequence 51cagcuaauuc agaaucauu 195241RNAHomo sapiens
52cuugugguag uuggagcugg uggcguaggc aagagugccu u
415341RNAArtificialsynthetic mutant KRAS 53cuugugguag uuggagcuua
ugacguaggc aagagugccu u 415420DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 54tcataagctc caactaccac 205520DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 55gtcataagct ccaactacca 205620DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 56cgtcataagc tccaactacc 205720DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(6)..(20)2'-methoxyethyl group on each
nucleotide 57acgtcataag ctccaactac 205820DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 58tacgtcataa gctccaacta 205920DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 59ctacgtcata agctccaact 206020DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 60cctacgtcat aagctccaac 206120DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 61gcctacgtca taagctccaa 206220DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 62tgcctacgtc ataagctcca 206320DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 63ttgcctacgt cataagctcc 206420DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 64cttgcctacg tcataagctc 206520DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 65tcttgcctac gtcataagct 206620DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 66ctcttgccta cgtcataagc 206720DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 67actcttgcct acgtcataag 206820DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 68cactcttgcc tacgtcataa 206920DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 69gcactcttgc ctacgtcata 207020DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 70gcactcttgc ctacgccaca 207120DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 71gcactcttgc ctacgccatc 207220DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 72gcactcttgc ctacgccaac 207320DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(20)2'-methoxyethyl group on each
nucleotide 73gcactcttgc ctacgtcacc 207420DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(19)2'-methoxyethyl group on each
nucleotidemisc_feature(20)..(20)2', 4' methylene bridge
74gcactcttgc ctacgccaca 207520DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(18)2'-methoxyethyl group on each
nucleotidemisc_feature(19)..(19)2', 4' methylene
bridgemisc_feature(20)..(20)2'-methoxyethyl group 75gcactcttgc
ctacgccatc 207620DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(18)2'-methoxyethyl group on each
nucleotidemisc_feature(19)..(19)2', 4' methylene
bridgemisc_feature(20)..(20)2'-methoxyethyl group 76gcactcttgc
ctacgccaac 207720DNAArtificialantisense
oligonucleotidemisc_feature(1)..(5)2'-methoxyethyl group on each
nucleotidemisc_feature(16)..(16)2', 4' methylene
bridgemisc_feature(17)..(20)2'-methoxyethyl group on each
nucleotide 77gcactcttgc ctacgtcacc 207821RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 78gagcuugugg cguaggcaag a 217921RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
79uugccuacgc cacaagcucc a 218021RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 80gagcugaugg cguaggcaag a 218121RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
81uugccuacgc caucagcucc a 218221RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 82gagcugguga cguaggcaag a 218321RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
83uugccuacgu caccagcucc a 218421RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 84aguuggagcu uguggcguag g 218521RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
85uacgccacaa gcuccaacua c 218621RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2-O-methyl group on each nucleotide
86aguuggagcu gauggcguag g 218721RNAArtificialsiRNA antisense
strandmisc_feature(1)..(1)2-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2-O-methyl group on each nucleotide
87uacgccauca gcuccaacua c 218821RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2-O-methyl group on each nucleotide
88aguuggagcu ggugacguag g 218921RNAArtificialsiRNA antisense
strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
89uacgucacca gcuccaacua c 219021RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 90gguaguugga gcuggugacg u 219121RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
91gucaccagcu ccaacuacca c 219221RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 92aguuggagcu guuggcguag g 219321RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
93uacgccaaca gcuccaacua c 219421RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 94gagcuguugg cguaggcaag a 219521RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
95uugccuacgc caacagcucc a 219621RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 96gagcugaugg cguaggcaag a 219721RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(12)2'-O-methyl group on each
nucleotidemisc_feature(13)..(14)2'-fluoro group on each
nucleotidemisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
97uugccuacgc caucagcucc a 219821RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 98gagcugguga cguaggcaag a 219921RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(9)2'-O-methyl group on each
nucleotidemisc_feature(10)..(10)2'-fluoro
groupmisc_feature(11)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
99uugccuacgu caccagcucc a 2110021RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 100aguuggagcu uguggcguag g 2110121RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(8)2'-O-methyl group on each
nucleotidemisc_feature(9)..(9)2'-fluoro
groupmisc_feature(10)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
101uacgccacaa gcuccaacua c 2110221RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 102aguuggagcu gauggcguag g 2110321RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(7)2'-O-methyl
groupmisc_feature(8)..(8)2'-fluoro
groupmisc_feature(9)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
103uacgccauca gcuccaacua c 2110421RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 104aguuggagcu ggugacguag g 2110521RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(4)2'-O-methyl group on each
nucleotidemisc_feature(5)..(6)2'-fluoro group on each
nucleotidemisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
105uacgucacca gcuccaacua c 2110621RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 106aguuggagcu guuggcguag g 2110721RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(7)2'-O-methyl
groupmisc_feature(8)..(8)2'-fluoro
groupmisc_feature(9)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
107uacgccaaca gcuccaacua c 2110821RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(21)2'-O-methyl group on each
nucleotide 108gagcuguugg cguaggcaag a 2110921RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(12)2'-O-methyl group on each
nucleotidemisc_feature(13)..(14)2'-fluoro group on each
nucleotidemisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
109uugccuacgc caacagcacc a 2111019RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(19)2'-O-methyl group on each
nucleotide 110gucucuugga uauucucga 1911121RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
111ucgagaauau ccaagagaca g 2111219RNAArtificialsiRNA sense
strandmisc_feature(1)..(6)2'-O-methyl group on each
nucleotidemisc_feature(7)..(7)2'-fluoro
groupmisc_feature(8)..(8)2'-O-methyl
groupmisc_feature(9)..(11)2'-fluoro group on each
nucleotidemisc_feature(12)..(19)2'-O-methyl group on each
nucleotide 112cagcuaauuc agaaucauu 1911321RNAArtificialsiRNA
antisense strandmisc_feature(1)..(1)2'-O-methyl
groupmisc_feature(2)..(2)2'-fluoro
groupmisc_feature(3)..(5)2'-O-methyl group on each
nucleotidemisc_feature(6)..(6)2'-fluoro
groupmisc_feature(7)..(13)2'-O-methyl group on each
nucleotidemisc_feature(14)..(14)2'-fluoro
groupmisc_feature(15)..(15)2'-O-methyl
groupmisc_feature(16)..(16)2'-fluoro
groupmisc_feature(17)..(21)2'-O-methyl group on each nucleotide
113aaugauucug aauuagcugu a 2111416DNAArtificialantisense
oligonucleotide 114tcttgcctac gtcata 1611520DNAArtificialantisense
oligonucleotide 115cactcttgcc tacgtcataa
2011620DNAArtificialantisense oligonucleotide 116gcactcttgc
ctacgtcata 2011716DNAArtificialantisense oligonucleotide
117tcttgcctac gccaca 1611816DNAArtificialantisense oligonucleotide
118tcttgcctac gccatc 1611916DNAArtificialantisense oligonucleotide
119tcttgcctac gccaac 1612016DNAArtificialantisense oligonucleotide
120tcttgcctac gtcacc 1612117DNAArtificialantisense oligonucleotide
121ctcttgccta cgtcata 1712218DNAArtificialantisense oligonucleotide
122actcttgcct acgtcata 1812319DNAArtificialantisense
oligonucleotide 123cactcttgcc tacgtcata
1912420DNAArtificialantisense oligonucleotide 124gcactcttgc
ctacgccaca 2012520DNAArtificialantisense oligonucleotide
125gcactcttgc ctacgccatc 2012620DNAArtificialantisense
oligonucleotide 126gcactcttgc ctacgccaac
2012720DNAArtificialantisense oligonucleotide 127gcactcttgc
ctacgtcacc 2012821RNAArtificialsiRNA sense strand 128gagcuugugg
cguaggcaag a 2112921RNAArtificialsiRNA antisense strand
129uugccuacgc cacaagcucc a 2113021RNAArtificialsiRNA sense strand
130gagcugaugg cguaggcaag a 2113121RNAArtificialsiRNA antisense
strand 131uugccuacgc caucagcucc a 2113221RNAArtificialsiRNA sense
strand 132gagcugguga cguaggcaag a 2113321RNAArtificialsiRNA
antisense strand 133uugccuacgu caccagcucc a
2113421RNAArtificialsiRNA sense strand 134aguuggagcu uguggcguag g
2113521RNAArtificialsiRNA antisense strand 135uacgccacaa gcuccaacua
c 2113621RNAArtificialsiRNA sense strand 136aguuggagcu gauggcguag g
2113721RNAArtificialsiRNA antisense strand 137uacgccauca gcuccaacua
c 2113821RNAArtificialsiRNA sense strand 138aguuggagcu ggugacguag g
2113921RNAArtificialsiRNA antisense strand 139uacgucacca gcuccaacua
c 2114021RNAArtificialsiRNA sense strand 140gguaguugga gcuggugacg u
2114121RNAArtificialsiRNA antisense strand 141gucaccagcu ccaacuacca
c 2114221RNAArtificialsiRNA sense strand 142aguuggagcu guuggcguag g
2114321RNAArtificialsiRNA antisense strand 143uacgccaaca gcuccaacua
c 2114421RNAArtificialsiRNA sense strand 144gagcuguugg cguaggcaag a
2114521RNAArtificialsiRNA antisense strand 145uugccuacgc caacagcucc
a 2114621RNAArtificialsiRNA sense strand 146gagcugaugg cguaggcaag a
2114721RNAArtificialsiRNA antisense strand 147uugccuacgc caucagcucc
a 2114821RNAArtificialsiRNA sense strand 148gagcugguga cguaggcaag a
2114921RNAArtificialsiRNA antisense strand 149uugccuacgu caccagcucc
a 2115021RNAArtificialsiRNA sense strand 150aguuggagcu uguggcguag g
2115121RNAArtificialsiRNA antisense strand 151uacgccacaa gcuccaacua
c 2115221RNAArtificialsiRNA sense strand 152aguuggagcu gauggcguag g
2115321RNAArtificialsiRNA antisense strand 153uacgccauca gcuccaacua
c 2115421RNAArtificialsiRNA sense strand 154aguuggagcu ggugacguag g
2115521RNAArtificialsiRNA antisense strand 155uacgucacca gcuccaacua
c 2115621RNAArtificialsiRNA sense strand 156aguuggagcu guuggcguag g
2115721RNAArtificialsiRNA antisense strand 157uacgccaaca gcuccaacua
c 2115821RNAArtificialsiRNA sense strand 158gagcuguugg cguaggcaag a
2115921RNAArtificialsiRNA antisense strand 159uugccuacgc caacagcacc
a 21
* * * * *