U.S. patent application number 17/526885 was filed with the patent office on 2022-03-03 for methods relating to pluripotent cells.
The applicant listed for this patent is VCell Therapeutics, Inc.. Invention is credited to Koji Kojima, Charles A. Vacanti.
Application Number | 20220064593 17/526885 |
Document ID | / |
Family ID | |
Filed Date | 2022-03-03 |
United States Patent
Application |
20220064593 |
Kind Code |
A1 |
Vacanti; Charles A. ; et
al. |
March 3, 2022 |
METHODS RELATING TO PLURIPOTENT CELLS
Abstract
The technology described herein relates to methods, assays, and
compositions relating to causing a cell to assume a more
pluripotent state, e.g. without introducing foreign genetic
material.
Inventors: |
Vacanti; Charles A.;
(Hanover, MD) ; Kojima; Koji; (Hanover,
MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
VCell Therapeutics, Inc. |
Hanover |
MD |
US |
|
|
Appl. No.: |
17/526885 |
Filed: |
November 15, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15269077 |
Sep 19, 2016 |
|
|
|
17526885 |
|
|
|
|
PCT/US15/21418 |
Mar 19, 2015 |
|
|
|
15269077 |
|
|
|
|
61955358 |
Mar 19, 2014 |
|
|
|
61955362 |
Mar 19, 2014 |
|
|
|
62043042 |
Aug 28, 2014 |
|
|
|
International
Class: |
C12N 5/074 20060101
C12N005/074 |
Claims
1. Isolated cells expressing one or more markers of pluripotency
formed by treating non-embryonic, non-transformed normal
differentiated mammalian somatic cells with an effective amount of
chemical stress comprising ATP to a concentration of between 20
.mu.M and 200 mM, alone or in combination with a mechanical stress
to increase the levels of stress inducible genes in an amount and
for a time effective to increase the number of cells expressing one
or more markers of pluripotency, wherein the cells are at a pH of
between 3.0 and 6.8, without introduction of an exogenous gene, a
transcript, a protein, a nuclear component or cytoplasm, or without
cell fusion, wherein the one or more pluripotency markers are
selected from the group consisting of Oct4, SSEA, Nanog and Sox2,
thereby increasing the number of cells expressing the markers of
pluripotency, wherein the cells are in tissue specific cell culture
media.
2. The cells of claim 1, wherein the cell population is formed by
the method further comprising exposure to mechanical stress
disrupting pores resulting in loss of between about 40% and about
90% of the cytoplasm or the mitochondria from the cell, in addition
to chemical stress.
3. The cells of claim 1, wherein the mechanical disruption is
achieved by trituration of the cells.
4. The cells of claim 1, wherein the stress is mechanical
disruption of the pores of the cell membrane in the presence of ATP
and exposure to a pH between 4.6 and 6.
5. The cells of claim 4 wherein the pH is between 5 and 5.7.
6. The cells of claim 1 wherein the ATP is in a concentration
between one and 15 mM.
7. The cells of claim 1 wherein the cells are cultured in culture
media for culturing embryonic neural stem cells.
8. The cells of claim 1 wherein the cells are cultured in culture
media for culturing skin cells.
9. The cells of claim 1 wherein the cells are cultured in culture
media for culturing liver cells.
10. The cells of claim 1 wherein the cells are cultured in culture
media for culturing muscle cells.
11. The cells of claim 1 wherein the cells are cultured in culture
media for culturing lung cells.
12. The cells of claim 1 wherein the cells are cultured in culture
media for culturing mesoderm cells.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 15/269,077, filed Sep. 19, 2016, which is a continuation under
35 U.S.C. 371 of PCT Application No. PCT/US2015/021418, filed Mar.
19, 2015, which claims priority to and benefit under 35 U.S.C.
.sctn. 119(e) of U.S. Provisional Application Nos. 61/955,358,
filed Mar. 19, 2014, 61/955,362, filed Mar. 19, 2014, and
62/043,042, filed Aug. 28, 2014, the contents of each of which are
incorporated herein by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0002] The Sequence Listing submitted Sep. 24, 2015, as a text file
named "VAC_110_CON_DIV_Sequence_Listing.txt," created on Sep. 15,
2016, and having a size of 19,376 bytes is hereby incorporated by
reference.
TECHNICAL FIELD
[0003] The technology described herein relates to the production of
pluripotent cells.
BACKGROUND
[0004] Current methods of obtaining pluripotent cells rely
primarily upon tissues of limited availability (e.g. embryonic
tissue or cord blood) or the addition of reprogramming factors
(Hanna, J. et al. Cell 2008 133, 250-264; Hockemeyer, D. et al.
Cell stem cell 2008 3, 346-353; Kim, D. et al. Cell stem cell 2009
4, 472-476; Kim, J. B. Nature 2009 461, 649-643; Okabe, M. et al.
Blood 2009 114, 1764-1767), which involves introduction of
exogenous nucleic acids. Methods of readily producing stem cells,
particularly autologous stem cells, without the complications
introduced by the addition of exogenous reprogramming factors,
would accelerate research into cellular differentiation and the
development of stem-cell based therapies. While it is hypothesized
that damage to cells as a result of exposure to irritants, such as
burns, chemical injury, trauma and radiation, may alter normal
somatic cells to become cancer cells, there is no direct evidence
that healthy adult somatic cells can be converted to other states
without the specific manipulation of reprogramming factors.
[0005] Previously, researchers have reported finding "adult stem
cells" in adult tissues (Reynolds, B. A. & Weiss, S. Science
1992 255, 1707-1710; Megeney, L. A. et al., Genes & development
1996 10, 1173-1183; Caplan, A. I. Journal of orthopaedic research
1991 9, 641-650; Lavker, R. M. & Sun, T. T. The Journal of
investigative dermatology 1983 81, 121s-127s). Such reports remain
controversial. For example, researchers looking for cells
expressing the stem cell marker Oct4 failed to find Oct4-expressing
cells in adult bone marrow in normal homeostasis, (Lengner, C. J.
et al. Cell Cycle 2008 7, 725-728; Berg, J. S. & Goodell, M. A.
Cell stem cell 2007 1, 359-360), while others report the ability to
isolate Oct4-expressing cells from different adult tissues (Jiang,
Y. et al. Nature 2010 418, 41-49; D'Ippolito, G. et al. Journal of
cell science 2004 117, 2971-2981; Johnson, J. et al. Cell 2005 122,
303-315; Kucia, M. et al. Leukemia 2006 20, 857-869; Kuroda, Y. et
al. PNAS 2011 107, 8639-8643; Obokata, H. et al. Tissue
engineering. 2011 Part A 17, 607-615; Rahnemai-Azar, A. et al.
Cytotherapy 2011 13, 179-192; Huang, Y. et al. Transplantation 2010
89, 677-685; Zuba-Surma, E. K. et al. Journal of cellular and
molecular medicine 2011 15, 1319-1328; Paczkowska, E. et al. Annals
of transplantation 2011 16, 59-71). It has been hypothesized that
these cells represent either a population of adult stem cells or
are merely an artifact of the techniques being used. In either
case, they remain rare and do not represent an adequate source of
pluripotent cells for research and therapeutic purposes.
SUMMARY
[0006] Described herein are improved methods for generating
pluripotent cells, e.g. STAP cells which provide increased
efficiency, yield, and/or quality as compared to the methods
disclosed in International Patent Publication WO 2013/163296 and
Obokata et al. Nature 2014 505:641-647; each of which is
incorporated by reference herein. Also described herein are methods
and uses relating to cells generated by the present methods.
BRIEF DESCRIPTION OF THE DRAWINGS
[0007] FIGS. 1A-1D depict Oct4 expressing cell generation from CD45
positive somatic cells. FIG. 1A depicts Oct4-GFP expression of
stress treated cells. Stress-treated cells express Oct4-GFP, while
untreated controls did not. Magnification of an Oct4-expressing
colony is shown in the upper right in the stress-treated group.
Scale bar indicates 100 .mu.m. FIG. 1B depicts population analysis
of stress-treated cells and non-stress treated control. A GFP
expressing cell population is observed only in the stress treated
group at day 5. FIG. 1C depicts cell-size analysis of CD 45
positive cells before and after the stress treatment at day 7. FIG.
1D depicts chronological change of CD45 positive cells after the
stress treatment.
[0008] FIGS. 2A-2B depict characterization of animal callus cells
(ACCs). FIG. 2A depicts chronological gene expression change of
pluripotent marker genes. The messenger RNA levels were normalized
to GAPDH. (n=3, the average+S.D.) FIG. 2B depicts methylation
analysis of Oct4 and Nanog promoter genes.
[0009] FIGS. 3A-3D depict cellular modifications after stress
treatment. FIG. 3A depicts relative gene expression of stress
defense genes during the ACCs generation phase. Samples were
collected at day 3 and day 7 and compared with CD45 positive cells.
(n=3, the average+S.D.) FIG. 3 B depicts total cellular ATP
measurement. (n=3, the average+S.D.) FIG. 3C depicts ROS
measurement. Error bars indicate SD. FIG. 3D depicts relative gene
expression of mtDNA replication factors. (n=3, the
average+S.D.)
[0010] FIGS. 4A-4B depict chimera mouse generation from ACCs. FIG.
4A depicts a scheme of chimera mouse generation. Panel (i)
demonstrates that ACs were dissociated into single cells with
trypsin or (panel ii) ACs were cut into small pieces then injected
into blastocysts. FIG. 4B depicts chimera contribution analysis.
Tissues from 9 pups were analyzed by FACS.
[0011] FIGS. 5A-5C experiments with ACC-generating conditions. FIG.
5A demonstrates that CD45 positive cells were exposed to various
stresses and Oct4-GFP expression was analyzed by FACS. Percentage
of Oct4-GFP expressing cells in survived cells after stress
treatment. (n=3, the average+S.D.) FIG. 5B depicts the
determination of pH condition. CD45 positive cells were exposed to
different pH solutions. At 3 days after stress treatment, Oct4-GFP
expression was analyzed by FACS. FIG. 5C depicts the determination
of culture condition. Stress treated cells were cultured in various
mediums. The number of GFP-expressing ACs was counted at day 14.
(n=3, the average+S.D.)
[0012] FIGS. 6A-6B depict ACCs generation from CD45 positive cells
derived from ICR mice. FIG. 6A depicts chronological change of CD45
positive cells after stress treatment. The expression of E-cadherin
and SSEA-1 was analyzed by FACS. FIG. 6B demonstrates that Oct4
gene expression of E-Cadherin/SSEA1 double positive cells was
confirmed by RT-PCR. (n=3, the average+S.D.)
[0013] FIGS. 7A-7B depict ACC generation from various tissues
derived from GOF mice. FIG. 7A depicts the ratio of Oct4-GFP
expressing cells after stress treatment. Somatic cells were
isolated from various tissues, and exposed to various stresses.
Oct4-GFP expression was analyzed by FACS. FIG. 7B depicts embryonic
gene expression of ACCs derived from various tissues. Gene
expressions were normalized by GAPDH. (n=3, the average+S.D.)
[0014] FIG. 8 depicts relative gene expression of stress defense
genes during the first 7 days. After stress treatment, cells were
collected at day 1, 3 and 7, and gene expression was compared with
native CD45 positive cells. Graphs entitled Hspb1, Hspa9a, Hspa1a,
and Hspa1b indicate the gene expressions of heat shock proteins.
Graph entitled Ercc4 indicates DNA repair gene expression. Graphs
entitled Hif3a, Txnip, Sod2, Tgr, Gsta3, Gpx2, Gpx3, and Gpx4
indicate the gene expression of redox genes. Y-axis indicates
relative folds of expression.
[0015] FIG. 9 depicts differentiation of ACCs. The graph depicts a
chimera contribution analysis. Chimera fetuses generated with ACCs
derived from various somatic cells were analyzed by FACS. Graph
shows the average of 5 chimera fetuses at E13.5 to 15.5.
[0016] FIG. 10 demonstrates that stress treatment caused
reprogramming to somatic cells via Mesenchymal-Epithelial
Transition (MET). The expression of MET-related genes is shown in
native cells, and in cells 3 and 7 days after stress treatment was
begun. The y-axis shows % expression, normalized to the level in
the sample with the expression level for that gene.
[0017] FIG. 11 depicts FACS analysis of cell populations before and
after stress. GFP expression was evident, indicating generation of
pluripotent cells, in post-stressed cell populations from each
tested tissue type.
[0018] FIG. 12A depicts: Mechanical hyperalgesia, indicated by the
drop in paw withdrawal threshold after capsaicin injection, is
reduced in rats treated with intrathecal SSP-SAP. Subsequent graphs
show the response at 10 min post-capsaicin, when the largest
difference occurs. FIG. 12B: Five weeks after spinal stem cells
were implanted the capsaicin-induced hyperalgesia is restored.
[0019] FIG. 13A depicts tactile and FIG. 13B depicts thermal
responses after capsaicin injections into the paw in rats first
injected i.t. with SSP-SAP, that greatly reduces the hyperalgesic
state (cf. FIGS. 12A and 12B), and then treated with stem cells,
lumbar i.t. injection. "Naive Response" shows the hyperalgesic
response to capsaicin before any manipulations. "BL1" is the
baseline response before a capsaicin injection in rats that had
been treated 2 weeks previously with either SSP-SAP or the inactive
Blank-SAP. "BL2" is the baseline response, without capsaicin
injection, 1-2 days after the Stem cell delivery. Note the ability
of the stem cell implant to return the hyperalgesic response of
SSP-SAP-treated rats to that of Naive rats and of Blank-SAP-treated
controls.
[0020] FIGS. 14A and 14B demonstrate that the potency of a specific
antagonist of the NK1-R is increased in rats where capsaicin
sensitivity has been restored by stem cell implants. The IC50 of
L-733,060 is .about.0.3 mM (30 uL i.t. injection) for both modes of
hyperalgesia in naive rats (O, .quadrature.; FIG. 14A; and in those
rats that received Blank-SAP followed by stem cells, not shown),
whereas in the stem cell-restored rats (FIG. 14B) the IC50 is
.about.30 uM for tactile hyperalgesia (.box-solid.) and .about.5 uM
for thermal hyperalgesia (.circle-solid.).
DETAILED DESCRIPTION
[0021] Aspects of the technology described herein relate to the
production or generation of pluripotent cells from cells. The
aspects of the technology described herein are based upon the
inventors' discovery that stress can induce the production of
pluripotent stem cells from cells without the need to introduce an
exogenous gene, a transcript, a protein, a nuclear component or
cytoplasm to the cell, or without the need of cell fusion. In some
embodiments, the stress induces a reduction in the amount of
cytoplasm and/or mitochondria in a cell; triggering a
dedifferentiation process and resulting in pluripotent cells. In
some embodiments, the stress causes a disruption of the cell
membrane, e.g. in at least 10% of the cells exposed to the stress.
These pluripotent cells are characterized by one or more of, the
ability to differentiate into each of the three germ layers (in
vitro and/or in vivo), the generation of teratoma-like cell masses
in vivo, and the ability to generate viable embryos and/or chimeric
mice.
[0022] Described herein are experiments demonstrating that
treatment of cells with certain environmental stresses, including,
but not limited to stresses which reduce the amount of cytoplasm
and/or mitochondria in the cell, can reduce mitochondrial activity,
demethylate regions of the genome associated with
dedifferentiation, cause the cells to display markers of known
dedifferentiation pathways. Accordingly, in some embodiments,
provided herein are methods of generating pluripotent cells from
cells, the methods comprising removing at least about 40% of the
cytoplasm and/or mitochondria from a cell, and selecting
pluripotency or cells exhibiting pluripotency markers, wherein the
cell is not present in a tissue. Also described herein are other
stress treatments that can generate pluripotent cells from
cells.
[0023] For convenience, certain terms employed herein, in the
specification, examples and appended claims are collected here.
Unless stated otherwise, or implicit from context, the following
terms and phrases include the meanings provided below. Unless
explicitly stated otherwise, or apparent from context, the terms
and phrases below do not exclude the meaning that the term or
phrase has acquired in the art to which it pertains. The
definitions are provided to aid in describing particular
embodiments, and are not intended to limit the claimed invention,
because the scope of the invention is limited only by the claims.
Unless otherwise defined, all technical and scientific terms used
herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
[0024] As used herein the term "comprising" or "comprises" is used
in reference to compositions, methods, and respective component(s)
thereof, that are essential to the method or composition, yet open
to the inclusion of unspecified elements, whether essential or
not.
[0025] As used herein the term "consisting essentially of" refers
to those elements required for a given embodiment. The term permits
the presence of elements that do not materially affect the basic
and novel or functional characteristic(s) of that embodiment.
[0026] The term "consisting of" refers to compositions, methods,
and respective components thereof as described herein, which are
exclusive of any element not recited in that description of the
embodiment.
[0027] As used in this specification and the appended claims, the
singular forms "a," "an," and "the" include plural references
unless the context clearly dictates otherwise. Thus for example,
references to "the method" includes one or more methods, and/or
steps of the type described herein and/or which will become
apparent to those persons skilled in the art upon reading this
disclosure and so forth. Similarly, the word "or" is intended to
include "and" unless the context clearly indicates otherwise.
Although methods and materials similar or equivalent to those
described herein can be used in the practice or testing of this
disclosure, suitable methods and materials are described below. The
abbreviation, "e.g." is derived from the Latin exempli gratia, and
is used herein to indicate a non-limiting example. Thus, the
abbreviation "e.g." is synonymous with the term "for example."
[0028] Definitions of common terms in cell biology and molecular
biology can be found in "The Merck Manual of Diagnosis and
Therapy", 19th Edition, published by Merck Research Laboratories,
2006 (ISBN 0-911910-19-0); Robert S. Porter et al. (eds.), and The
Encyclopedia of Molecular Biology, published by Blackwell Science
Ltd., 1994 (ISBN 0-632-02182-9). Definitions of common terms in
molecular biology can also be found in Benjamin Lewin, Genes X,
published by Jones & Bartlett Publishing, 2009 (ISBN-10:
0763766321); Kendrew et al. (eds.), Molecular Biology and
Biotechnology: a Comprehensive Desk Reference, published by VCH
Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols
in Protein Sciences 2009, Wiley Intersciences, Coligan et al.,
eds.
[0029] Unless otherwise stated, the present invention was performed
using standard procedures, as described, for example in Sambrook et
al., Molecular Cloning: A Laboratory Manual (3 ed.), Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2001);
Davis et al., Basic Methods in Molecular Biology, Elsevier Science
Publishing, Inc., New York, USA (1995); Current Protocols in Cell
Biology (CPCB) (Juan S. Bonifacino et. al. ed., John Wiley and
Sons, Inc.), and Culture of Animal Cells: A Manual of Basic
Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th edition
(2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol.
57, Jennie P. Mather and David Barnes editors, Academic Press, 1st
edition, 1998) which are all incorporated by reference herein in
their entireties.
[0030] The terms "decrease," "reduce," "reduced", and "reduction"
are all used herein generally to mean a decrease by a statistically
significant amount relative to a reference. However, for avoidance
of doubt, "reduce," "reduction", or "decrease" typically means a
decrease by at least 10% as compared to the absence of a given
treatment and can include, for example, a decrease by at least
about 20%, at least about 25%, at least about 30%, at least about
35%, at least about 40%, at least about 45%, at least about 50%, at
least about 55%, at least about 60%, at least about 65%, at least
about 70%, at least about 75%, at least about 80%, at least about
85%, at least about 90%, at least about 95%, at least about 98%, at
least about 99%, up to and including, for example, the complete
absence of the given entity or parameter as compared to the absence
of a given treatment, or any decrease between 10-99% as compared to
the absence of a given treatment.
[0031] The terms "increased", "increase", or "enhance" are all used
herein to generally mean an increase by a statically significant
amount; for the avoidance of any doubt, the terms "increased",
"increase", or "enhance" means an increase of at least 10% as
compared to a reference level, for example an increase of at least
about 20%, or at least about 30%, or at least about 40%, or at
least about 50%, or at least about 60%, or at least about 70%, or
at least about 80%, or at least about 90% or up to and including a
100% increase or any increase between 10-100% as compared to a
reference level, or at least about a 2-fold, or at least about a
3-fold, or at least about a 4-fold, or at least about a 5-fold or
at least about a 10-fold increase, or any increase between 2-fold
and 10-fold or greater as compared to a reference level.
[0032] As used herein, the terms "treat," "treatment," "treating,"
or "amelioration" when used in reference to a disease, disorder or
medical condition, refer to therapeutic treatments for a condition,
wherein the object is to reverse, alleviate, ameliorate, inhibit,
slow down or stop the progression or severity of a symptom or
condition. The term "treating" includes reducing or alleviating at
least one adverse effect or symptom of a condition. Treatment is
generally "effective" if one or more symptoms or clinical markers
are reduced. Alternatively, treatment is "effective" if the
progression of a condition is reduced or halted. That is,
"treatment" includes not just the improvement of symptoms or
markers, but also a cessation or at least slowing of progress or
worsening of symptoms that would be expected in the absence of
treatment. Beneficial or desired clinical results include, but are
not limited to, alleviation of one or more symptom(s), diminishment
of extent of the deficit, stabilized (i.e., not worsening) state of
health, delay or slowing of the disease progression, and
amelioration or palliation of symptoms. Treatment can also include
the subject surviving beyond when mortality would be expected
statistically.
[0033] As used herein, the term "administering," refers to the
placement of a pluripotent cell produced according to the methods
described herein and/or the at least partially differentiated
progeny of such a pluripotent cell into a subject by a method or
route which results in at least partial localization of the cells
at a desired site. A pharmaceutical composition comprising a
pluripotent cell produced according to the methods described herein
and/or the at least partially differentiated progeny of such a
pluripotent cell can be administered by any appropriate route which
results in an effective treatment in the subject.
[0034] As used herein, a "subject" means a human or animal Usually
the animal is a vertebrate such as a primate, rodent, domestic
animal or game animal. Primates, for example, include chimpanzees,
cynomolgous monkeys, spider monkeys, and macaques, e.g., Rhesus
monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits
and hamsters. Domestic and game animals include cows, horses, pigs,
deer, bison, buffalo, feline species, e.g., domestic cat, canine
species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu,
ostrich, and fish, e.g., trout, catfish and salmon. Patient or
subject includes any subset of the foregoing, e.g., all of the
above. In certain embodiments, the subject is a mammal, e.g., a
primate, e.g., a human.
[0035] Preferably, the subject is a mammal. The mammal can be a
human, non-human primate, mouse, rat, dog, cat, horse, or cow, but
is not limited to these examples. Mammals other than humans can be
advantageously used as subjects that represent animal models of a
disease associated with a deficiency, malfunction, and/or failure
of a given cell or tissue or a deficiency, malfunction, or failure
of a stem cell compartment. In addition, the methods described
herein can be used to treat domesticated animals and/or pets. A
subject can be male or female. A subject can be one who has been
previously diagnosed with or identified as suffering from or having
a deficiency, malfunction, and/or failure of a cell type, tissue,
or stem cell compartment or one or more diseases or conditions
associated with such a condition, and optionally, but need not have
already undergone treatment for such a condition. A subject can
also be one who has been diagnosed with or identified as suffering
from a condition including a deficiency, malfunction, and/or
failure of a cell type or tissue or of a stem cell compartment, but
who shows improvements in known risk factors as a result of
receiving one or more treatments for such a condition.
Alternatively, a subject can also be one who has not been
previously diagnosed as having such a condition. For example, a
subject can be one who exhibits one or more risk factors for such a
condition or a subject who does not exhibit risk factors for such
conditions.
[0036] As used herein, the term "select", when used in reference to
a cell or population of cells, refers to choosing, separating,
segregating, and/or selectively propagating one or more cells
having a desired characteristic. The term "select" as used herein
does not necessarily imply that cells without the desired
characteristic are unable to propagate in the provided
conditions.
[0037] As used herein, "maintain" refers to continuing the
viability of a cell or population of cells. A maintained population
will have a number of metabolically active cells. The number of
these cells can be roughly stable over a period of at least one day
or can grow.
[0038] As used herein, a "detectable level" refers to a level of a
substance or activity in a sample that allows the amount of the
substance or activity to be distinguished from a reference level,
e.g. the level of substance or activity in a cell that has not been
exposed to a stress. In some embodiments, a detectable level can be
a level at least 10% greater than a reference level, e.g. 10%
greater, 20% greater, 50% greater, 100% greater, 200% greater, or
300% or greater.
[0039] The term "statistically significant" or "significantly"
refers to statistical significance and generally means a two
standard deviation (2SD) difference above or below a reference,
e.g. a concentration or abundance of a marker, e.g. a stem cell
marker or differentiation marker. The term refers to statistical
evidence that there is a difference. It is defined as the
probability of making a decision to reject the null hypothesis when
the null hypothesis is actually true. The decision is often made
using the p-value.
[0040] Other than in the operating examples, or where otherwise
indicated, all numbers expressing quantities of ingredients or
reaction conditions used herein should be understood as modified in
all instances by the term "about." The term "about" when used in
connection with percentages can mean.+-.1%.
[0041] Other terms are defined herein within the description of the
various aspects of the technology described herein.
[0042] The aspects of the technology described herein relate to
methods of generating a pluripotent cell from a cell as well as
uses and methods of using those pluripotent cells. In contrast with
existing methods of generating pluripotent cells (i.e. induced
pluripotent stem cells or iPS cells) which rely upon increasing the
expression of reprogramming factors, for example, by introducing
nucleic acid constructs encoding one or more reprogramming factors
(e.g. Oct4), the methods described herein subject the cells to a
stress but do not require introduction of foreign reprogramming
actors.
[0043] In some embodiments, the stress reduces the volume of the
cell's cytoplasm and/or the number of the cell's mitochondria. The
reduction of the volume of the cell's cytoplasm or the number of
the cell's mitochondria induces a stress response during which the
cell acquires at least pluripotent capabilities. In one aspect,
described herein is a method to generate a pluripotent cell,
comprising removing at least about 40% of the cytoplasm from a
cell, and selecting cells exhibiting pluripotency, wherein the cell
is not present in a tissue. In one aspect, the invention as
described herein relates to a method to generate a pluripotent
cell, comprising removing at least about 40% of the mitochondria
from a cell, and selecting cells exhibiting pluripotency, wherein
the cell is not present in a tissue.
[0044] The cells used in the methods, assays, and compositions
described herein can be any type of cell, e.g. an adult cell, an
embryonic cell, a differentiated cell, a stem cell, a progenitor
cell, and/or a somatic cell. A cell can be described by
combinations of the terms described above, e.g. a cell can be an
embryonic stem cell or a differentiated somatic cell. The cell used
in the methods, assays, and compositions described herein can be
obtained from a subject. In some embodiments, the cell is a
mammalian cell. In some embodiments, the cell is a human cell. In
some embodiments, the cell is an adult cell. In some embodiments,
the cell is a neonatal cell. In some embodiments, the cell is a
fetal cell. In some embodiments, the cell is an amniotic cell. In
some embodiments, the cell is a cord blood cell.
[0045] "Adult" refers to tissues and cells derived from or within
an animal subject at any time after birth. "Embryonic" refers to
tissues and cells derived from or within an animal subject at any
time prior to birth.
[0046] As used herein, the term "somatic cell" refers to any cell
other than a germ cell, a cell present in or obtained from a
pre-implantation embryo, or a cell resulting from proliferation of
such a cell in vitro. Stated another way, a somatic cell refers to
any cells forming the body of an organism, as opposed to germline
cells. In mammals, germline cells (also known as "gametes") are the
spermatozoa and ova which fuse during fertilization to produce a
cell called a zygote, from which the entire mammalian embryo
develops. Every other cell type in the mammalian body--apart from
the sperm and ova, the cells from which they are made (gametocytes)
and undifferentiated stem cells--is a somatic cell: internal
organs, skin, bones, blood, and connective tissue are all made up
of somatic cells. In some embodiments the somatic cell is a
"non-embryonic somatic cell," by which is meant a somatic cell that
is not present in or obtained from an embryo and does not result
from proliferation of such a cell in vitro. In some embodiments the
somatic cell is an "adult somatic cell," by which is meant a cell
that is present in or obtained from an organism other than an
embryo or a fetus or results from proliferation of such a cell in
vitro. It is noted that adult and neonatal or embryonic cells can
be distinguished by structural differences, e.g. epigenetic
organization such as methylation patterns. In some embodiments, the
somatic cell is a mammalian somatic cell. In some embodiments, the
somatic cell is a human somatic cell. In some embodiments, the
somatic cell is an adult somatic cell. In some embodiments, the
somatic cell is a neonatal somatic cell.
[0047] As used herein, a "differentiated cell" refers to a cell
that is more specialized in its fate or function than at a previous
point in its development, and includes both cells that are
terminally differentiated and cells that, although not terminally
differentiated, are more specialized than at a previous point in
their development. The development of a cell from an uncommitted
cell (for example, a stem cell), to a cell with an increasing
degree of commitment to a particular differentiated cell type, and
finally to a terminally differentiated cell is known as progressive
differentiation or progressive commitment. In the context of cell
ontogeny, the adjective "differentiated", or "differentiating" is a
relative term. A "differentiated cell" is a cell that has
progressed further down the developmental pathway than the cell it
is being compared with. Thus, stem cells can differentiate to
lineage-restricted precursor cells (such as a mesodermal stem
cell), which in turn can differentiate into other types of
precursor cells further down the pathway (such as an cardiomyocyte
precursor), and then to an end-stage differentiated cell, which
plays a characteristic role in a certain tissue type, and may or
may not retain the capacity to proliferate further.
[0048] As used herein, the term "stem cell" refers to a cell in an
undifferentiated or partially differentiated state that has the
property of self-renewal and has the developmental potential to
naturally differentiate into a more differentiated cell type,
without a specific implied meaning regarding developmental
potential (i.e., totipotent, pluripotent, multipotent, etc.). By
self-renewal is meant that a stem cell is capable of proliferation
and giving rise to more such stem cells, while maintaining its
developmental potential. Accordingly, the term "stem cell" refers
to any subset of cells that have the developmental potential, under
particular circumstances, to differentiate to a more specialized or
differentiated phenotype, and which retain the capacity, under
certain circumstances, to proliferate without substantially
differentiating. The term "somatic stem cell" is used herein to
refer to any stem cell derived from non-embryonic tissue, including
fetal, juvenile, and adult tissue. Natural somatic stem cells have
been isolated from a wide variety of adult tissues including blood,
bone marrow, brain, olfactory epithelium, skin, pancreas, skeletal
muscle, and cardiac muscle. Exemplary naturally occurring somatic
stem cells include, but are not limited to, mesenchymal stem cells
and hematopoietic stem cells. In some embodiments, the stem or
progenitor cells can be embryonic stem cells. As used herein,
"embryonic stem cells" refers to stem cells derived from tissue
formed after fertilization but before the end of gestation,
including pre-embryonic tissue (such as, for example, a
blastocyst), embryonic tissue, or fetal tissue taken any time
during gestation, typically but not necessarily before
approximately 10-12 weeks gestation. Most frequently, embryonic
stem cells are totipotent cells derived from the early embryo or
blastocyst. Embryonic stem cells can be obtained directly from
suitable tissue, including, but not limited to human tissue, or
from established embryonic cell lines. In one embodiment, embryonic
stem cells are obtained as described by Thomson et al. (U.S. Pat.
Nos. 5,843,780 and 6,200,806; Science 282:1145, 1998; Curr. Top.
Dev. Biol. 38:133 ff, 1998; Proc. Natl. Acad. Sci. U.S.A. 92:7844,
1995 which are incorporated by reference herein in their
entirety).
[0049] Exemplary stem cells include embryonic stem cells, adult
stem cells, pluripotent stem cells, neural stem cells, liver stem
cells, muscle stem cells, muscle precursor stem cells, endothelial
progenitor cells, bone marrow stem cells, chondrogenic stem cells,
lymphoid stem cells, mesenchymal stem cells, hematopoietic stem
cells, central nervous system stem cells, peripheral nervous system
stem cells, and the like. Descriptions of stem cells, including
method for isolating and culturing them, may be found in, among
other places, Embryonic Stem Cells, Methods and Protocols, Turksen,
ed., Humana Press, 2002; Weisman et al., Annu. Rev. Cell. Dev.
Biol. 17:387 403; Pittinger et al., Science, 284:143 47, 1999;
Animal Cell Culture, Masters, ed., Oxford University Press, 2000;
Jackson et al., PNAS 96(25):14482 86, 1999; Zuk et al., Tissue
Engineering, 7:211 228, 2001 ("Zuk et al."); Atala et al.,
particularly Chapters 33 41; and U.S. Pat. Nos. 5,559,022,
5,672,346 and 5,827,735. Descriptions of stromal cells, including
methods for isolating them, may be found in, among other places,
Prockop, Science, 276:71 74, 1997; Theise et al., Hepatology,
31:235 40, 2000; Current Protocols in Cell Biology, Bonifacino et
al., eds., John Wiley & Sons, 2000 (including updates through
March, 2002); and U.S. Pat. No. 4,963,489.
[0050] As used herein, "progenitor cells" refers to cells in an
undifferentiated or partially differentiated state and that have
the developmental potential to differentiate into at least one more
differentiated phenotype, without a specific implied meaning
regarding developmental potential (i.e., totipotent, pluripotent,
multipotent, etc.) and that does not have the property of
self-renewal. Accordingly, the term "progenitor cell" refers to any
subset of cells that have the developmental potential, under
particular circumstances, to differentiate to a more specialized or
differentiated phenotype. In some embodiments, the stem or
progenitor cells are pluripotent stem cells. In some embodiments,
the stem or progenitor cells are totipotent stem cells.
[0051] The term "totipotent" refers to a stem cell that can give
rise to any tissue or cell type in the body. "Pluripotent" stem
cells can give rise to any type of cell in the body except germ
line cells. Stem cells that can give rise to a smaller or limited
number of different cell types are generally termed "multipotent."
Thus, totipotent cells differentiate into pluripotent cells that
can give rise to most, but not all, of the tissues necessary for
fetal development. Pluripotent cells undergo further
differentiation into multipotent cells that are committed to give
rise to cells that have a particular function. For example,
multipotent hematopoietic stem cells give rise to the red blood
cells, white blood cells and platelets in the blood.
[0052] The term "pluripotent" as used herein refers to a cell with
the capacity, under different conditions, to differentiate to cell
types characteristic of all three germ cell layers (i.e., endoderm
(e.g., gut tissue), mesoderm (e.g., blood, muscle, and vessels),
and ectoderm (e.g., skin and nerve)). Pluripotent cells are
characterized primarily by their ability to differentiate to all
three germ layers, using, for example, a nude mouse teratoma
formation assay. Pluripotency is also evidenced by the expression
of embryonic stem (ES) cell markers, although the preferred test
for pluripotency is the demonstration of the capacity to
differentiate into cells of each of the three germ layers.
[0053] The "ACC" and "STAP" cells described in the Examples herein,
are non-limiting examples of pluripotent cells. The "STAP stem
cells" are non-limiting examples of pluripotent stem cells. The
term pluripotent cell and the term pluripotent stem cell may be
used herein interchangeably because both cells can be used suitably
for the purpose of the present invention.
[0054] The term "pluripotency" or a "pluripotent state" as used
herein refers to a cell with the ability to differentiate into all
three embryonic germ layers: endoderm (gut tissue), mesoderm
(including blood, muscle, and vessels), and ectoderm (such as skin
and nerve).
[0055] The term "multipotent" when used in reference to a
"multipotent cell" refers to a cell that is able to differentiate
into some but not all of the cells derived from all three germ
layers. Thus, a multipotent cell is a partially differentiated
cell. Multipotent cells are well known in the art, and non-limiting
examples of multipotent cells can include adult stem cells, such as
for example, hematopoietic stem cells and neural stem cells.
Multipotent means a stem cell may form many types of cells in a
given lineage, but not cells of other lineages. For example, a
multipotent blood stem cell can form the many different types of
blood cells (red, white, platelets, etc.), but it cannot form
neurons. The term "multipotency" refers to a cell with the degree
of developmental versatility that is less than totipotent and
pluripotent.
[0056] The term "totipotency" refers to a cell with the degree of
differentiation describing a capacity to make all of the cells in
the adult body as well as the extra-embryonic tissues including the
placenta. The fertilized egg (zygote) is totipotent as are the
early cleaved cells (blastomeres)
[0057] The cell used in the methods described herein can be a cell
which is not present in a tissue. As used herein, a "tissue" refers
to an organized biomaterial (e.g. a group, layer, or aggregation)
of similarly specialized cells united in the performance of at
least one particular function. When cells are removed from an
organized superstructure, or otherwise separated from an organized
superstructure which exists in vivo, they are no longer present in
a tissue. For example, when a blood sample is separated into two or
more non-identical fractions, or a spleen is minced and
mechanically-dissociated with Pasteur pipettes, the cells are no
longer present in a tissue. In some embodiments, cells which are
not present in a tissue are isolated cells. The term "isolated" as
used herein in reference to cells refers to a cell that is
mechanically or physically separated from another group of cells
with which they are normally associated in vivo. Methods for
isolating one or more cells from another group of cells are well
known in the art. See, e.g., Culture of Animal Cells: a manual of
basic techniques (3rd edition), 1994, R. I. Freshney (ed.),
Wiley-Liss, Inc.; Cells: a laboratory manual (vol. 1), 1998, D. L.
Spector, R. D. Goldman, L. A. Leinwand (eds.), Cold Spring Harbor
Laboratory Press; Animal Cells: culture and media, 1994, D. C.
Darling, S. J. Morgan, John Wiley and Sons, Ltd. Optionally the
isolated cell has been cultured in vitro, e.g., in the presence of
other cells.
[0058] In some embodiments, a cell, while not present in a tissue,
is present in a population of cells. In some embodiments, the
population of cells is a population of cells. As used herein, a
"population of cells" refers to a group of at least 2 cells, e.g. 2
cells, 3 cells, 4 cells, 10 cells, 100 cells, 1000 cells, 10,000
cells, 100,000 cells or any value in between, or more cells.
Optionally, a population of cells can be cells which have a common
origin, e.g. they can be descended from the same parental cell,
they can be clonal, they can be isolated from or descended from
cells isolated from the same tissue, or they can be isolated from
or descended from cells isolated from the same tissue sample. A
population of cells can comprise 1 or more cell types, e.g. 1 cell
type, 2 cell types, 3 cell types, 4 cell types or more cell types.
A population of cells can be heterogeneous or homogeneous. A
population of cells can be substantially homogeneous if it
comprises at least 90% of the same cell type, e.g. 90%, 92%, 95%,
98%, 99%, or more of the cells in the population are of the same
cell type. A population of cells can be heterogeneous if less than
90% of the cells present in the population are of the same cell
type.
[0059] In some embodiments, the methods described herein can relate
to making a non-pluripotent cell (e.g. a differentiated cell)
assume a pluripotent phenotype. In some embodiments, generating a
pluripotent cell can include generating a cell with a more
pluripotent phenotype, i.e. causing a cell to assume a phenotype
which has broader differentiation potential. By way of non-limiting
example, very small embryonic-like cells (VSEL) cells can be
unipotent instead of pluripotent, and/or be limited in their
ability to differentiate into certain differentiated cell types
(possibly due the epigenetic state of VSELs more closely resembling
differentiated cells than embryonic stem cells). In accordance with
the methods described herein, a unipotent cell and/or cell with
limited differentiation ability can be caused to assume a more
pluripotent phenotype. A more pluripotent phenotype can be a
phenotype that is able to differentiate into a greater number of
differentiated cell types e.g. of two unipotent cells, the one that
can differentiate into a greater number of differentiated cell
types of that lineage is more pluripotent and/or a pluripotent cell
is more pluripotent than a unipotent cell.
[0060] The methods of generating a pluripotent cell (or more
pluripotent cell) described herein can comprise, for example,
removing part of the cytoplasm from a cell and/or removing
mitochondria from a cell. In some embodiments, the removal of part
of the cytoplasm or mitochondria from a cell removes partial
epigenetic control of the cell. In some embodiments, at least about
40% of the cytoplasm is removed, e.g. at least about 40%, at least
about 50%, at least about 60%, at least about 70%, at least about
80%, at least about 90% or more of the cytoplasm of a cell is
removed. In some embodiments, between 60% and 80% of the cytoplasm
of a cell is removed. In some embodiments, at least about 40% of
the mitochondria are removed, e.g. at least about 40%, at least
about 50%, at least about 60%, at least about 70%, at least about
80%, at least about 90% or more of the mitochondria of a cell are
removed. In some embodiments, between 50% and 90% of the
mitochondria of a cell are removed.
[0061] The method of subjecting the cell to stress and/or removing
part of the cytoplasm or mitochondria from a cell can be any
environmental stimulus that will cause pores and/or ruptures in the
membrane of a cell below the threshold of lethality. The stress may
comprise unphysiological stress in tissue or cell culture.
Non-limiting examples of suitable environmental stimuli include
trauma, mechanical stimuli, chemical exposure, ultrasonic
stimulation, oxygen-deprivation, nutrient-deprivation, radiation,
exposure to extreme temperatures, dissociation, trituration,
physical stress, hyper osmosis, hypo osmosis, membrane damage,
toxin, extreme ion concentration, active oxygen, UV exposure,
strong visible light, deprivation of essential nutrition, or
unphysiologically acidic environment. In some embodiments, one
environmental stimulus can be applied to a cell. In some
embodiments, multiple environmental stimuli can be applied to a
cell, e.g. 2 stimuli, 3 stimuli, 4 stimuli or more stimuli can be
applied. Multiple environmental stimuli can be applied concurrently
or separately.
[0062] In some embodiments, the stress can be a stress that will
cause membrane disruption in at least 10% of the cells exposed to
the stress. As used herein, "membrane disruption" refers to
compromising, rupturing, or disrupting a membrane such that pores
or gaps form, sufficient to release a detectable amount of
organelles and/or cellular material, including but not limited to
mitochondria and DNA into the extracellular environment. Methods of
detecting the release of cellular material, e.g. mitochondria are
known in the art and described elsewhere herein. The released
cellular material can be free or encapsulated or surrounded by
membranes.
[0063] The stress can cause membrane disruption in at least 10% of
the cells exposed to the stress, e.g. 10% or more, 20% or more, 30%
or more, 40% or more 50% or more, 60% or more, 70% or more, 80% or
more, or 90% or more. In some embodiments, the cells exposed to the
stress can be cells of the same type and characteristics as the
cells to be made more pluripotent as described herein, e.g. the
stress suitable for one type of cell may not be suitable for
another type of cell.
[0064] The length of time for which the cells are exposed to stress
can vary depending upon the stimulus being used. For example, when
using low nutrition conditions to stress cells according to the
methods described herein, the cells can be cultured under low
nutrition conditions for 1 week or more, e.g. 1 week, 2 weeks, or 3
weeks or longer. In some embodiments, the cells are cultured under
low nutrition conditions for about 3 weeks. In another non-limiting
example, cells exposed to low pH or hypoxic conditions according to
the methods described herein can be exposed for minutes or long,
e.g. including for several hours, e.g. for at least 2 minutes, for
at least 5 minutes, for at least 20 minutes, for at least 1 hour,
for at least 2 hours, for at least 6 hours or longer.
[0065] Mechanical stimuli that induce the generation of pluripotent
cells can include any form of contact of a substance or surface
with the cell membrane which will mechanically disrupt the
integrity of the membrane. Mechanical stimulus can comprise
exposing the cell to shear stress and/or high pressure. An
exemplary form of mechanical stimulus is trituration. Trituration
is a process of grinding and/or abrading the surface of a particle
via friction. A non-limiting example of a process for trituration
of a cell is to cause the cell to pass through a device wherein the
device has an aperture smaller than the size of the cell. For
example, a cell can be caused, by vacuum pressure and/or the flow
of a fluid, to pass through a pipette in which at least part of the
interior space of the pipette has a diameter smaller than the
diameter of the cell. In some embodiments, the cell is passed
through at least one device with a smaller aperture than the size
of the cell. In some embodiments, the cell is passed through
several devices having progressively smaller apertures. In some
embodiments, cells can be triturated for 5 or more minutes, e.g. 5
minutes, 10 minutes, 20 minutes, 30 minutes, or 60 minutes. In some
embodiments, the cells can be triturated by passing them through a
Pasteur pipette with an internal diameter of 50 .mu.m. In some
embodiments, the cells can be triturated by passing them through a
Pasteur pipette with an internal diameter of 50 .mu.m for 20
minutes.
[0066] Other methods of applying stress necessary to induce cells
to generate pluripotent cells include, for example, exposure to
certain chemicals, or physico-chemical conditions (e.g. high or low
pH, osmotic shock, temperature extremes, oxygen deprivation, etc.).
Treatments of this kind and others that induce the generation of
pluripotent cells are discussed further below. Chemical exposure
can include, for example, any combination of pH, osmotic pressure,
and/or pore-forming compounds that disrupt or compromise the
integrity of the cell membrane. By way of non-limiting example, the
cells can be exposed to unphysiologically acidic environment or low
pH, streptolysin O, or distilled water (i.e. osmotic shock).
[0067] Low pH can include a pH lower than 6.8, e.g. 6.7, 6.5, 6.3,
6.0, 5.8, 5.4, 5.0, 4.5, 4.0, or lower. In some embodiments, the
low pH is from about 3.0 to about 6.0. In some embodiments, the low
pH is from about 4.5 to about 6.0. In some embodiments, the low pH
is from 5.4 to 5.8. In some embodiments, the low pH is from 5.4 to
5.6. In some embodiments, the low pH is about 5.6. In some
embodiments, the low pH is about 5.7. In some embodiments, the low
pH is about 5.5. In some embodiments, the cells can be exposed to
low pH conditions for up to several days, e.g. for 6 days or less,
for 4 days or less, for 3 days or less, for 2 days or less, for 1
day or less, for 12 hours or less, for 6 hours or less, for 3 hours
or less, for 2 hours or less, for 1 hour or less, for 30 minutes or
less, for 20 minutes or less, or less than 10 minutes. In some
embodiments, the cells can be exposed to a pH from 5.4 to 5.6 for 3
days or less. In some embodiments, the cells can be exposed to a pH
of from about 5.6 to 6.8 for 3 days or less. In some embodiments,
the cells can be exposed of a pH of from about 5.6 to 6.8 for 1
hour or less. In some embodiments, the cells can be exposed of a pH
of from about 5.6 to 6.8 for about 30 minutes. In some embodiments,
the cells can be exposed of a pH of from about 5.6 to 6.8 for about
20 minutes. In some embodiments, the cells can be exposed to a pH
of from about 5.6 to 5.8 for 3 days or less. In some embodiments,
the cells can be exposed of a pH of from about 5.6 to 5.8 for 1
hour or less. In some embodiments, the cells can be exposed of a pH
of from about 5.6 to 5.8 for about 30 minutes. In some embodiments,
the cells can be exposed of a pH of from about 5.6 to 5.8 for about
20 minutes.
[0068] In some embodiments, cells can be exposed to ATP to induce
the generation of pluripotent cells. In some embodiments, cells can
be exposed to ATP at concentrations from about 20 .mu.M to about
200 mM. In some embodiments, cells can be exposed to ATP at
concentrations from about 200 .mu.M to about 20 mM. In some
embodiments, cells can be exposed to ATP at concentrations of about
2.4 mM. In some embodiments, cell can be exposed to ATP diluted in
HBSS. In some embodiments, cells can be exposed to ATP for 1 minute
or longer, e.g. at least 1 minute, at least 2 minutes, at least 5
minutes, at least 15 minutes, at least 30 minutes, at least 45
minutes, at least 1 hour or longer. In some embodiments, the cells
can be exposed to ATP for from about 5 minutes to about 30 minutes.
In some embodiments, the cells can be exposed to ATP for about 15
minutes. In some embodiments, the cells can be exposed to about 2.4
mM ATP for about 15 minutes.
[0069] In some embodiments, cells can be exposed to CaCl.sub.2 to
induce the generation of pluripotent cells. In some embodiments,
cells can be exposed to CaCl.sub.2 at concentrations from about 20
.mu.M to about 200 mM. In some embodiments, cells can be exposed to
CaCl.sub.2 at concentrations from about 200 .mu.M to about 20 mM.
In some embodiments, cells can be exposed to CaCl.sub.2 at
concentrations of about 2 mM. In some embodiments, cells can be
exposed to CaCl.sub.2 diluted in HBSS. In some embodiments, cells
can be exposed to CaCl.sub.2 for 1 day or longer, e.g. at least 1
day, at least 2 days, at least 1 week, at least 2 weeks, at least 3
weeks or longer. In some embodiments, the cells can be exposed to
CaCl.sub.2 for from about 1 week to 3 weeks. In some embodiments,
the cells can be exposed to CaCl.sub.2 for about 2 weeks. In some
embodiments, the cells can be exposed to about 2 mM CaCl.sub.2 for
about 2 weeks. In some embodiments, the cells can be exposed to
about 2 mM CaCl.sub.2 for about 1 week.
[0070] Examples of pore-forming compounds include streptolysin O
(SLO), saponin, digitonin, filipin, Ae I. cytolysin of sea anemone,
aerolysin, amatoxin, amoebapore, amoebapore homolog from Entamoeba
dispar, brevinin-1E, brevinin-2E, barbatolysin, cytolysin of
Enterococcus faecalis, delta hemolysin, diphtheria toxin, El Tor
for cytolysin of Vibrio cholerae, equinatoxin, enterotoxin of
Aeromonas hydrophila, esculentin, granulysin, haemolysin of Vibrio
parahaemolyticus, intermedilysin of Streptococcus intermedins, the
lentivirus lytic peptide, leukotoxin of Actinobacillus
actinomycetemcomitans, magainin, melittin, membrane-associated
lymphotoxin, Met-enkephalin, neokyotorphin, neokyotorphin fragment
1, neokyotorphin fragment 2, neokyotorphin fragment 3,
neokyotorphin fragment 4, NKlysin, paradaxin, alpha cytolysin of
Staphylococcus aureus, alpha cytolysin of Clostridium septicum,
Bacillus thuringiensis toxin, colicin complement, defensin,
histolysis, listeriolysin, magainin, melittin, pneumolysin, yeast
killer toxin, valinomycin, Peterson's crown ethers, perforin,
perfringolysin O, theta-toxin of Clostridium perfringens,
phallolysin, phallotoxin, and other molecules, such as those
described in Regen et al, Biochem Biophys Res Commun 1989
159:566-571; which is incorporated herein by reference in its
entirety. Methods of purifying or synthesizing pore-forming
compounds are well known to one of ordinary skill in the art.
Further, pore-forming compounds are commercially available, e.g.
streptolysin O (Cat No. S5265; Sigma-Aldrich; St. Louis, Mo.). By
way of non-limiting example, cells can be exposed to SLO for about
5 minutes or more, e.g. at least 5 minutes, at least 10 minutes, at
least 20 minutes, at least 30 minutes, at least 45 minutes, at
least 1 hour, at least 2 hours, at least 3 hours, or longer. In
some embodiments, cells are exposed to SLO for from about 30
minutes to 2 hours. In some embodiments, cells are exposed to SLO
for about 50 minutes. By way of non-limiting example, cells can be
exposed to SLO at concentrations of from about 10 ng/mL to 1 mg/mL.
In some embodiments, cells can be exposed to SLO at concentrations
of from about 1 .mu.g/mL to 100 .mu.g/mL. In some embodiments,
cells can be exposed to SLO at about 10 .mu.g/mL. In some
embodiments, cells can be exposed to SLO at about 10 .mu.g/mL for
about 50 minutes.
[0071] Oxygen-deprivation conditions that induce the generation of
pluripotent cells can include culturing cells under reduced oxygen
conditions, e.g. culturing cells in 10% oxygen or less. In some
embodiments, the cells are cultured under 5% oxygen or less. The
length of culturing under reduced oxygen conditions can be 1 hour
or longer, e.g. 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3
weeks, 1 month, 2 months or longer. In some embodiments, the cells
can be cultured under reduced oxygen conditions for from 1 week to
1 month. In some embodiments, the cells can be cultured under
reduced oxygen conditions for about 3 weeks.
[0072] Nutrient-deprivation conditions that induce the generation
of pluripotent cells can include the lack of any factor or nutrient
that is beneficial to cell growth. In some embodiments,
nutrient-deprivation conditions comprise culturing the cells in
basal culture medium, e.g. F12 or DMEM without further supplements
such as FBS or growth factors. The length of culturing in
nutrient-deprivation conditions can be 1 hour or longer, e.g. 1
hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 1 month, 2
months or longer. In some embodiments, the cells can be cultured
under nutrient-deprivation conditions for from 1 week to 1 month.
In some embodiments, the cells can be cultured under
nutrient-deprivation conditions for about 2 weeks. In some
embodiments, the cells can be cultured under nutrient-deprivation
conditions for about 3 weeks. In some embodiments,
nutrient-deprivation conditions can include conditions with no
growth factors or conditions with less than 50% of a standard
concentration of one or more growth factors for a given cell
type.
[0073] Exposure to extreme temperatures that induces the generation
of pluripotent cells can include exposure to either low
temperatures or high temperatures. For a mammalian cell, an extreme
low temperature can be a temperature below 35.degree. C., e.g.
34.degree. C., 33.degree. C., 32.degree. C., 31.degree. C., or
lower. In some embodiments, an extreme low temperature can be a
temperature below freezing. Freezing of cells can cause membrane
perforations by ice crystals and provides an avenue for reducing
cytoplasm. For a mammalian cell, an extreme high temperature can be
a temperature above 42.degree. C., e.g. 43.degree. C., 44.degree.
C., 45.degree. C., 46.degree. C. or higher. In some embodiments,
the extreme high temperature can be a temperature of about
85.degree. C. or higher. The length of culturing under extreme
temperatures can be 20 minutes or longer, e.g. 20 minutes, 30
minutes, 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks,
1 month, 2 months or longer. Clearly, the higher the temperature,
the shorter the exposure that will generally be tolerated to permit
the generation of pluripotent cells.
[0074] Further examples of stresses that can be used in the methods
described herein include, but are not limited to, ultrasonic
stimulation and radiation treatment.
[0075] In some embodiments, after being exposed to a stress, the
cells can be cultured prior to selection according to the methods
described below herein. The cells can be cultured for at least 1
hour prior to selection, e.g. the stressful stimulus is removed and
the cells are cultured for at least 1 hour, at least 2 hours, at
least 6 hours, at least 12 hours, at least 1 day, at least 2 days,
at least 7 days or longer prior to selecting as described herein.
By way of non-limiting example, cells can be exposed to SLO for
about 50 minutes and then cultured in culture medium without SLO
for about 7 days prior to selection. In some embodiments, the
culture medium used to culture the cells prior to selection does
not contain differentiation factors or promote differentiation. In
some embodiments, the culture medium is one suitable for the
culture of stem cells and/or pluripotent cells. Examples of such
media are described below herein.
[0076] In some embodiments, the amount of cytoplasm in a cell is
reduced. The reduction of cytoplasm in a cell can be determined by
monitoring the size of the cell. Methods of determining cell size
are well known to one of ordinary skill in the art and include, by
way of non-limiting example, cytofluorimetric analysis. In brief,
single cells are stained with propidium iodide filtered and
measured, for example, on a DAKO GALAXY.TM. (DAKO) analyzer using
FLOMAX.TM. software. Cytofluorimetric analysis can then be
performed to establish cell size. Microbeads of predefined sizes
are re-suspended in isotonic phosphate saline (pH 7.2) and used as
a standard for which to compare size of cells contained in spheres
using cytofluorimetric analysis. Both cells and beads are analyzed
using the same instrument setting (forward scatter, representing
cell and bead size, and side scatter, representing cellular
granularity). Cell size can be calculated on a curve employing bead
size on the x-axis and forward scatter values on the y-axis.
[0077] In some embodiments, the amount of mitochondria in a cell is
reduced. Methods of determining the number of mitochondria in a
cell are well known to one of ordinary skill in the art and include
staining with a mitochondria-specific dye and counting the number
of mitochondria visible per cell when viewed under a microscope.
Mitochondria-specific dyes are commercially available, e.g.
MITOTRACKER.TM. (Cat No M7512 Invitrogen; Grand Island, N.Y.). In
some embodiments, the number of mitochondria or the intensity of
the signal from mitochondria-specific dyes can be decreased by at
least 40% following treatment with the methods described above
herein. In some embodiments, cells are selected in which the number
of mitochondria or the intensity of the signal from
mitochondria-specific dyes decreased by at least 40% following
treatment with the methods described above herein.
[0078] The amount of mitochondria and/or membrane disruption can
also be detected by measuring redox activity in the extracellular
environment. As mitochondria are released into the extracellular
environment by the stress described herein, the level of ROS in the
extracellular environment can increase and can be used to measure
the effectiveness of a given stress.
[0079] In some embodiments of any of the aspects described herein,
the cell can be subjected to a stress while in the presence of LIF
(leukemia inhibitory factor).
[0080] In some aspects, after removing a portion of the cytoplasm
and/or mitochondria of a cell, the method further comprises
selecting cells exhibiting pluripotency. Pluripotent cells can be
selected by selecting cells which display markers, phenotypes, or
functions of pluripotent cells. Selecting cells can comprise
isolating and propagating cells displaying the desired
characteristics or culturing a population of cells with unknown
characteristics under conditions such that cells with the desired
characteristic(s) will survive and/or propagate at a higher rate
than those cells not having the desired characteristic(s).
Non-limiting examples of markers and characteristics of pluripotent
cells are described herein below. In some embodiments, selecting
the cells for pluripotency comprises, at least in part, selecting
cells which express Oct4. In some embodiments, selecting the cells
for pluripotency comprises, at least in part, selecting cells which
express Nanog. In some embodiments, selecting the cells for
pluripotency comprises, at least in part, selecting cells which
express Oct4, Nanog, E-cadherin, and/or SSEA. In some embodiments,
pluripotent cells can be selected by selecting cells expressing
SSEA-1 and E-cadherin using antibodies specific for those markers
and FACS. In some embodiments cells can be selected on the basis of
size using FACS or other cell sorting devices as known in the art
and/or described herein. Cells can also be selected by their
inability to adhere to culture dishes.
[0081] Cells can also be selected on the basis of smaller size
after being subjected to stress. That is, stressed cells that
progress to pluripotency are smaller than their non-pluripotent
somatic precursors. In some embodiments, cells with a diameter of
less than 8 .mu.m are selected, e.g. cells with a diameter of 8
.mu.m or less, 7 .mu.m or less, 6 .mu.m or less, 5 .mu.m or less,
or smaller. Cells can be selected on the basis of size after being
cultured for a brief period (e.g. several minutes to several days)
or after being allowed to rest following the stress treatment. In
some embodiments, the cells can be selected on the basis of size
immediately following the stress treatment. Cells can be selected
on the basis of size by any method known in the art, e.g. the use
of a filter or by FACS.
[0082] In some embodiments of the methods described herein, a
pluripotent cell generated according to the methods described
herein can be cultured to permit propagation of that pluripotent
cell (i.e. propagation of a stem cell). In some embodiments, a
pluripotent cell generated according to the methods described
herein can be maintained in vitro. In one aspect, the technology
described herein relates to a composition comprising a pluripotent
cell and/or the at least partially differentiated progeny thereof.
In some embodiments, the pluripotent cell and/or the at least
partially differentiated progeny thereof can be maintained in
vitro, e.g. as a cell line. Cell lines can be used to screen for
and/or test candidate agents, e.g. therapeutic agents for a given
disease and/or agents that modulate stem cells, as described below
herein. In some embodiments, the pluripotent cell and/or the at
least partially differentiated progeny thereof can be derived from
a cell obtained from a subject with a disease, e.g. a disease
associated with the failure of a naturally occurring cell or tissue
type or a naturally occurring pluripotent and/or multipotent cell
(as described herein below), and/or a disease involving cells which
have genetic mutations, e.g. cancer. The compositions described
herein, can be used, e.g. in disease modeling, drug discovery,
diagnostics, and individualized therapy.
[0083] Conditions suitable for the propagation and or maintaining
of stem and/or pluripotent cells are known in the art. Propagation
of stem cells permits expansion of cell numbers without
substantially inducing or permitting differentiation. By way of
non-limiting example, conditions suitable for propagation of
pluripotent cells include plating cells at 1.times.10.sup.6
cells/cm.sup.2 in F12/DMEM (1:1, v/v) supplemented with 2% B27, 20
ng/mL basic fibroblast growth factor, and 10 ng/mL epidermal growth
factor. About 50% of the medium can be replaced every 2-3 days for
the duration of the culture. In some embodiments, the conditions
suitable for the propagation of stem and/or pluripotent cells
comprise culturing the cells in B27-LIF (i.e. serum-free medium
containing LIF (1.times.10.sup.3 units/mL, Chemicon; Cat No:
ESG1107 EMD Millipore, Billerica, Mass.) and B27 supplement (Cat
No: 0080085-SA; Invitrogen; Grand Island, N.Y.) as described in
Hitoshi, S. et al. Genes & development 2004 18, 1806-1811;
which is incorporated by reference herein in its entirety. Other
media suitable for culturing the cells described herein are
described in the Examples herein. e.g. ES establishment culture
medium, 2i, 3i and ACTH, ES culture condition, ES-LIF, embryonic
neural stem cell culture condition, and EpiSCs culture condition.
In some embodiments, conditions for the propagation or maintenance
of pluripotent cells can include culture the cells in the presence
of LIF (leukemia inhibitory factor).
[0084] During propagation, the pluripotent cell generated according
to the methods described herein will continue to express the same
pluripotent stem cell marker(s). Non-limiting examples of
pluripotent stem cell markers include SSEA-1, SSEA-2, SSEA-3,
SSEA-4 (collectively referred to herein as SSEA), AP, E-cadherin
antigen, Oct4, Nanog, Ecat1, Rex1, Zfp296, GDF3, Dppa3, Dppa4,
Dppa5, Sox2, Esrrb, Dnmt3b, Dnmt31, Utf1, Tcl1, Bat1, Fgf4, Neo,
Cripto, Cdx2, and Slc2a3. Methods of determining if a cell is
expressing a pluripotent stem cell marker are well known to one of
ordinary skill in the art and include, for example, RT-PCR, the use
of reporter gene constructs (e.g. expression of the Oct4-GFP
construct described herein coupled with FACS or fluorescence
microscopy), and FACS or fluorescence microscopy using antibodies
specific for cell surface markers of interest.
[0085] Pluripotent cell markers also include elongated telomeres,
as compared to cells. Telomere length can be determined, for
example, by isolating genomic DNA, digesting the gDNA with
restriction enzymes such as Hinf1 and Rsa1, and detecting telomeres
with a telomere length assay reagent. Such reagents are known in
the art and are commercially available, e.g. the TELOTAGGG.TM.
TELOMERE LENGTH ASSAY kit (Cat No. 12209136001 Roche; Indianapolis,
Ind.).
[0086] In some embodiments, a cell treated according to the methods
described herein can be altered to more closely resemble the
epigenetic state of an embryonic stem cell than it did prior to
being treated in accordance with the disclosed methods. The
epigenetic state of a cell refers to the chemical marking of the
genome as opposed to changes in the nucleotide sequence of the
genome. Epigenetic marks can include DNA methylation (imprints) as
well as methylation and acetylation of proteins associated with
DNA, such as histones. The term `DNA methylation` refers to the
addition of a methyl (CH.sub.3) group to a specific base in the
DNA. In mammals, methylation occurs almost exclusively at the 5
position on a cytosine when this is followed by a guanine (CpG). In
some embodiments, the epigenetic state can comprise epigenetic
methylation patterns, e.g. DNA methylation patterns. Assays for
determining the presence and location of epigenetic markings are
known in the art, and can include bisulfite sequencing. Briefly,
DNA is treated with the CpGenome.TM. DNA Modification Kit
(Chemicon, Temecula, Calif.) and regions of interest (e.g. the
Nanog and Oct4 genes) are amplified and sequenced.
[0087] Some aspects of the technology described herein relate to
assays using a pluripotent stem cell produced by the methods
described herein. For example, a pluripotent stem cell produced by
the methods described herein can be used to screen and/or identify
agents which modulate the viability, differentiation, or
propagation of pluripotent stem cells. Such assays can comprise
contacting a pluripotent cell produced according to the methods
described herein with a candidate agent and determining whether the
viability, differentiation and/or propagation of the pluripotent
cell contacted with the candidate agent varies from the viability,
differentiation and/or propagation of a pluripotent cell not
contacted with the candidate agent. In some embodiments, an agent
can increase the viability, differentiation, and/or propagation of
the pluripotent stem cell. In some embodiments, an agent can
decrease the viability, differentiation, and/or propagation of the
pluripotent stem cell. In some embodiments, the pluripotent stem
cell can be contacted with multiple candidate agents, e.g. to
determine synergistic or antagonistic effects or to screen
candidate agents in pools.
[0088] A candidate agent is identified as an agent that modulates
the viability of a pluripotent cell produced if the number of
pluripotent cells which are viable, i.e. alive is higher or lower
in the presence of the candidate agent relative to its absence.
Methods of determining the viability of a cell are well known in
the art and include, by way of non-limiting example determining the
number of viable cells at least two time points, by detecting the
strength of a signal from a live cell marker, or the number or
proportion of cells stained by a live cell marker. Live cell
markers are available commercially, e.g. PRESTO BLUE.TM. (Cat No
A-13261; Life Technologies; Grand Island, N.Y.). A candidate agent
is identified as an agent that modulates the propagation of a
pluripotent cell produced if the rate of propagation of the
pluripotent cell is altered, i.e. the number of progeny cells
produced in a given time is higher or lower in the presence of the
candidate agent. Methods of determining the rate of propagation of
a cell are known in the art and include, by way of non-limiting
example, determining an increase in live cell number over time.
[0089] A candidate agent is identified as an agent that modulates
the differentiation of a pluripotent cell if the rate or character
of the differentiation of the pluripotent cell is higher or lower
in the presence of the candidate agent. Methods of determining the
rate or character of differentiation of a cell are known in the art
and include, by way of non-limiting example, detecting markers or
morphology of a particular lineage and comparing the number of
cells and/or the rate of appearance of cells with such markers or
morphology in the population contacted with a candidate agent to a
population not contacted with the candidate agent. Markers and
morphological characteristics of various cell fate lineages and
mature cell types are known in the art. By way of non-limiting
example, mesodermal cells are distinguished from pluripotent cells
by the expression of actin, myosin, and desmin Chondrocytes can be
distinguished from their precursor cell types by staining with
safranin-O and or FASTGREEN.TM. dyes (Fisher; Pittsburgh, Pa.;
F99). Osteocytes can be distinguished from their precursor cell
types by staining with Alizarin Red S (Sigma; St. Louis, Mo.: Cat
No A5533).
[0090] In some embodiments, a candidate agent can be an potential
inhibitor of tumor stem cells, e.g. the methods described herein
can be used to create pluripotent cells from mature tumor cells,
and used to screen for agents which inhibit the creation and/or
viability of tumor cells. The methods described herein can also be
used to screen for agents which kill mature tumor cells but which
do not promote the development and/or survival of tumor stem
cells.
[0091] In some embodiments, the pluripotent cells are contacted
with one or more candidate agents and cultured under conditions
which promote differentiation to a particular cell lineage or
mature cell type. Conditions suitable for differentiation are known
in the art. By way of non-limiting example, conditions suitable for
differentiation to the mesoderm lineage include DMEM supplemented
with 20% fetal calf serum (FCS), with the medium exchanged every 3
days. By way of further non-limiting example, conditions suitable
for differentiation to the neural lineage include plating cells on
ornithin-coated chamber slides in F12/DMEM (1:1, v/v) supplemented
2% B27, 10% FCS, 10 ng/mL bFGF, and 20 ng/m LEGF. The medium can be
exchanged every 3 days.
[0092] As used herein, a "candidate agent" refers to any entity
which is normally not present or not present at the levels being
administered to a cell, tissue or subject. A candidate agent can be
selected from a group comprising: chemicals; small organic or
inorganic molecules; nucleic acid sequences; nucleic acid
analogues; proteins; peptides; aptamers; peptidomimetic, peptide
derivative, peptide analogs, antibodies; intrabodies; biological
macromolecules, extracts made from biological materials such as
bacteria, plants, fungi, or animal cells or tissues; naturally
occurring or synthetic compositions or functional fragments
thereof. In some embodiments, the candidate agent is any chemical
entity or moiety, including without limitation synthetic and
naturally-occurring non-proteinaceous entities. In certain
embodiments the candidate agent is a small molecule having a
chemical moiety. For example, chemical moieties include
unsubstituted or substituted alkyl, aromatic, or heterocyclyl
moieties including macrolides, leptomycins and related natural
products or analogues thereof. Candidate agents can be known to
have a desired activity and/or property, or can be selected from a
library of diverse compounds.
[0093] Candidate agents can be screened for their ability to
modulate the viability, propagation, and/or differentiation of a
pluripotent cell. In one embodiment, candidate agents are screened
using the assays for viability, differentiation, and/or propagation
described above and in the Examples herein.
[0094] Generally, compounds can be tested at any concentration that
can modulate cellular function, gene expression or protein activity
relative to a control over an appropriate time period. In some
embodiments, compounds are tested at concentrations in the range of
about 0.1 nM to about 1000 mM. In one embodiment, the compound is
tested in the range of about 0.1 .mu.M to about 20 .mu.M, about 0.1
.mu.M to about 10 .mu.M, or about 0.1 .mu.M to about 5 .mu.M.
[0095] Depending upon the particular embodiment being practiced,
the candidate or test agents can be provided free in solution, or
can be attached to a carrier, or a solid support, e.g., beads. A
number of suitable solid supports can be employed for
immobilization of the test agents. Examples of suitable solid
supports include agarose, cellulose, dextran (commercially
available as, e.g., Sephadex, Sepharose) carboxymethyl cellulose,
polystyrene, polyethylene glycol (PEG), filter paper,
nitrocellulose, ion exchange resins, plastic films,
polyaminemethylvinylether maleic acid copolymer, glass beads, amino
acid copolymer, ethylene-maleic acid copolymer, nylon, silk, etc.
Additionally, for the methods described herein, test agents can be
screened individually, or in groups or pools. Group screening is
particularly useful where hit rates for effective test agents are
expected to be low, such that one would not expect more than one
positive result for a given group.
[0096] Methods for developing small molecule, polymeric and genome
based libraries are described, for example, in Ding, et al. J Am.
Chem. Soc. 124: 1594-1596 (2002) and Lynn, et al., J. Am. Chem.
Soc. 123: 8155-8156 (2001). Commercially available compound
libraries can be obtained from, e.g., ArQule (Woburn, Mass.),
Invitrogen (Carlsbad, Calif.), Ryan Scientific (Mt. Pleasant,
S.C.), and Enzo Life Sciences (Farmingdale, N.Y.). These libraries
can be screened for the ability of members to modulate the
viability, propagation, and/or differentiation of pluripotent stem
cells. The candidate agents can be naturally occurring proteins or
their fragments. Such candidate agents can be obtained from a
natural source, e.g., a cell or tissue lysate. Libraries of
polypeptide agents can also be prepared, e.g., from a cDNA library
commercially available or generated with routine methods. The
candidate agents can also be peptides, e.g., peptides of from about
5 to about 30 amino acids, with from about 5 to about 20 amino
acids being preferred and from about 7 to about 15 being
particularly preferred. The peptides can be digests of naturally
occurring proteins, random peptides, or "biased" random peptides.
In some methods, the candidate agents are polypeptides or proteins.
Peptide libraries, e.g. combinatorial libraries of peptides or
other compounds can be fully randomized, with no sequence
preferences or constants at any position. Alternatively, the
library can be biased, i.e., some positions within the sequence are
either held constant, or are selected from a limited number of
possibilities. For example, in some cases, the nucleotides or amino
acid residues are randomized within a defined class, for example,
of hydrophobic amino acids, hydrophilic residues, sterically biased
(either small or large) residues, towards the creation of
cysteines, for cross-linking, prolines for SH-3 domains, serines,
threonines, tyrosines or histidines for phosphorylation sites, or
to purines.
[0097] The candidate agents can also be nucleic acids. Nucleic acid
candidate agents can be naturally occurring nucleic acids, random
nucleic acids, or "biased" random nucleic acids. For example,
digests of prokaryotic or eukaryotic genomes can be similarly used
as described above for proteins.
[0098] In some embodiments, the candidate agent that is screened
and identified to modulate viability, propagation and/or
differentiation of a pluripotent cell according to the methods
described herein, can increase viability, propagation and/or
differentiation of a pluripotent cell by at least 5%, preferably at
least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1-fold,
1.1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold,
50-fold, 100-fold or more relative to an untreated control. In some
embodiments, the candidate agent that is screened and identified to
modulate viability, propagation and/or differentiation of a
pluripotent cell according to the methods described herein, can
decrease viability, propagation and/or differentiation of a
pluripotent cell by at least 5%, preferably at least 10%, 20%, 30%,
40%, 50%, 50%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or more, up to and
including complete reduction (i.e., zero viability, growth,
propagation, or differentiation) relative to an untreated
control.
[0099] In some embodiments, the candidate agent functions directly
in the form in which it is administered. Alternatively, the
candidate agent can be modified or utilized intracellularly to
produce a form that modulates the desired activity, e.g.
introduction of a nucleic acid sequence into a cell and its
transcription resulting in the production of an inhibitor or
activator of gene expression or protein activity within the
cell.
[0100] It is contemplated that the methods and compositions
described herein can be used, e.g. in the development of cancer
vaccines. Generating at least partially differentiated progeny of
pluripotent tumor cells obtained as described herein (e.g. by
treating a mature tumor cell in accordance with the methods
described herein) can provide a diverse and changing antigen
profile which can permit the development of more powerful APC
(antigen presenting cells)-based cancer vaccines.
[0101] In some embodiments, the methods described herein relate to
increasing the transformation efficiency of a cell. Stressing
cells, e.g., inducing pluripotency as described herein can make the
cells more receptive to methods of genetic modification including
but not limited to transgene insertion, viral vectors, and/or zinc
finger endonucleases. It is contemplated that the methods described
herein can permit cells to be modified to a genetically receptive
state such that naked DNA could be used to transform the resulting
pluripotent cells.
[0102] Some aspects of the technology described herein relate to
methods of cell therapy comprising administering a pluripotent
cell, produced by the methods described herein, or the at least
partially differentiated progeny of such a cell to a subject in
need of cell therapy. In some embodiments, a therapeutically
effective amount of pluripotent cells or the at least partially
differentiated progeny of the pluripotent cell is provided. In some
embodiments, the pluripotent cells and/or their progeny are
autologous. In some embodiments, the pluripotent cells and/or their
progeny are allogeneic. In some embodiments, the pluripotent cells
and/or their progeny are autologous. In some embodiments, the
pluripotent cells and/or their progeny are HLA-matched allogeneic.
In some embodiments, the pluripotent cells and/or their progeny are
syngeneic. In some embodiments, the pluripotent cells and/or their
progeny are xenogenic. In some embodiments, the cell therapy can be
autologous therapy, e.g. a cell from a subject can be used to
generate a pluripotent cell according to the methods described
herein and the pluripotent cell and/or at least partially
differentiated progeny of that pluripotent cell can be administered
to the subject. As used herein, a "subject in need of cell therapy"
refers to a subject diagnosed as having, or at risk of having or
developing a disease associated with the failure of a naturally
occurring cell or tissue type or a naturally occurring pluripotent
and/or multipotent cell (e.g. stem cell).
[0103] In some embodiments, the methods described herein can be
used to treat genetic disorders, e.g. Tay-Sachs or hemophilia, e.g.
by administering allogeneic pluripotent cells and/or their progeny
obtained as described herein.
[0104] In one aspect, described herein is a method of preparing a
cell or tissue that is compatible with cell therapy to be
administered to a subject, comprising: generating a pluripotent
cell (or more pluripotent cell) from a cell according to the
methods described herein, wherein the cell is an autologous cell or
HLA-matched allogeneic cell. In some embodiments, the pluripotent
cell (or more pluripotent cell) can be differentiated along a
pre-defined cell lineage prior to administering the cell or tissue
to the subject.
[0105] Pluripotent cells, e.g. pluripotent stem cells, generated
according to the methods described herein can be used in cancer
therapy. For example, high dose chemotherapy plus hematopoietic
stem cell transplantation to regenerate the bone marrow
hematopoietic system can benefit from the use of pluripotent cells
generated as described herein.
[0106] Non-limiting examples of diseases associated with the
failure of a naturally occurring cell or tissue type or a naturally
occurring pluripotent and/or multipotent cell include aplastic
anemia, Fanconi anemia, and paroxysmal nocturnal hemoglobinuria
(PNH). Others include, for example: acute leukemias, including
acute lymphoblastic leukemia (ALL), acute myelogenous leukemia
(AML), acute biphenotypic leukemia and acute undifferentiated
leukemia; chronic leukemias, including chronic myelogenous leukemia
(CML), chronic lymphocytic leukemia (CLL), juvenile chronic
myelogenous leukemia (JCML) and juvenile myelomonocytic leukemia
(JMML); myeloproliferative disorders, including acute
myelofibrosis, angiogenic myeloid metaplasia (myelofibrosis),
polycythemia vera and essential thrombocythemia; lysosomal storage
diseases, including mucopolysaccharidoses (MPS), Hurler's syndrome
(MPS-IH), Scheie syndrome (MPS-IS), Hunter's syndrome (MPS-II),
Sanfilippo syndrome (MPS-III), Morquio syndrome (MPS-IV),
Maroteaux-Lamy Syndrome (MPS-VI), Sly syndrome, beta-glucuronidase
deficiency (MPS-VII), adrenoleukodystrophy, mucolipidosis II
(I-cell Disease), Krabbe disease, Gaucher's disease, Niemann-Pick
disease, Wolman disease and metachromatic leukodystrophy;
histiocytic disorders, including familial erythrophagocytic
lymphohistiocytosis, histiocytosis-X and hemophagocytosis;
phagocyte disorders, including Chediak-Higashi syndrome, chronic
granulomatous disease, neutrophil actin deficiency and reticular
dysgenesis; inherited platelet abnormalities, including
amegakaryocytosis/congenital thrombocytopenia; plasma cell
disorders, including multiple myeloma, plasma cell leukemia, and
Waldenstrom's macroglobulinemia. Other malignancies treatable with
stem cell therapies include but are not limited to breast cancer,
Ewing sarcoma, neuroblastoma and renal cell carcinoma, among
others. Also treatable with stem cell therapy are: lung disorders,
including COPD and bronchial asthma; congenital immune disorders,
including ataxia-telangiectasia, Kostmann syndrome, leukocyte
adhesion deficiency, DiGeorge syndrome, bare lymphocyte syndrome,
Omenn's syndrome, severe combined immunodeficiency (SCID), SCID
with adenosine deaminase deficiency, absence of T & B cells
SCID, absence of T cells, normal B cell SCID, common variable
immunodeficiency and X-linked lymphoproliferative disorder; other
inherited disorders, including Lesch-Nyhan syndrome, cartilage-hair
hypoplasia, Glanzmann thrombasthenia, and osteopetrosis;
neurological conditions, including acute and chronic stroke,
traumatic brain injury, cerebral palsy, multiple sclerosis,
amyotrophic lateral sclerosis and epilepsy; cardiac conditions,
including atherosclerosis, congestive heart failure and myocardial
infarction; metabolic disorders, including diabetes; and ocular
disorders including macular degeneration and optic atrophy. Such
diseases or disorders can be treated either by administration of
pluripotent cells themselves, permitting in vivo differentiation to
the desired cell type with or without the administration of agents
to promote the desired differentiation, and/or by administering
pluripotent cells differentiated to, or at least partially
differentiated towards the desired cell type in vitro. Methods of
diagnosing such conditions are well known to medical practitioners
of ordinary skill in the art. In some embodiments, the subject can
be one who was treated with radiation therapy or other therapies
which have ablated a population of cells or stem cells, e.g. the
subject can be a subject with cancer whose bone marrow has been
ablated by radiation therapy.
[0107] In some embodiments, pluripotent cells are administered to
the subject. In some embodiments, an at least partially
differentiated cell is administered to the subject. In some
embodiments, the method of cell therapy can further comprise
differentiating the pluripotent cell along a pre-defined cell
lineage prior to administering the cell. Methods of differentiating
stem cells along desired cell lineages are known in the art and
examples are described herein.
[0108] In some embodiments, a composition comprising a pluripotent
cell obtained according to the methods described herein or an at
least partially differentiated cell which is the progeny of the
pluripotent cell is administered to the subject.
[0109] In some embodiments, a composition comprising a pluripotent
cell obtained according to the methods described herein, or an at
least partially differentiated cell which is the progeny of the
pluripotent cell, can optionally further comprise G-CSF, GM-CSF
and/or M-CSF and/or can be administered to a subject who has or
will be administered G-CSF, GM-CSF and/or M-CSF in a separate
composition. Administration of G-CSF, GM-CSF and/or M-CSF can, e.g.
induce a state of inflammation favorable to organ regeneration and
removal of tissue debris, waste and buildup.
[0110] In some embodiments, administration of the pluripotent cells
and/or their at least partially differentiated progeny can occur
within a relatively short period of time following production of
the pluripotent cell in culture according to the methods described
herein (e.g. 1, 2, 5, 10, 24 or 48 hours after production). In some
embodiments, administration of the at least partially
differentiated progeny can occur within a relatively short period
of time following differentiation of the pluripotent cell in
culture according to the methods described herein (e.g. 1, 2, 5,
10, 24 or 48 hours after production). In some embodiments, the
pluripotent cells and/or their at least partially differentiated
progeny can be cryogenically preserved prior to administration.
[0111] In some aspects, the technology described herein relates to
a composition comprising a pluripotent cell generated according to
the methods described herein and/or the at least partially
differentiated progeny of the pluripotent cell. In some
embodiments, a pharmaceutical composition comprises a pluripotent
cell generated according to the methods described herein and/or the
at least partially differentiated progeny of the pluripotent cell,
and optionally a pharmaceutically acceptable carrier. The
compositions can further comprise at least one pharmaceutically
acceptable excipient.
[0112] The pharmaceutical composition can include suitable
excipients, or stabilizers, and can be, for example, solutions,
suspensions, gels, or emulsions. Typically, the composition will
contain from about 0.01 to 99 percent, preferably from about 5 to
95 percent of cells, together with the carrier. The cells, when
combined with pharmaceutically or physiologically acceptable
carriers, excipients, or stabilizer, can be administered
parenterally, subcutaneously, by implantation or by injection. For
most therapeutic purposes, the cells can be administered via
injection as a solution or suspension in liquid form. The term
"pharmaceutically acceptable carrier" refers to a carrier for
administration of the pluripotent cell generated according to the
methods described herein and/or the at least partially
differentiated progeny of the pluripotent cell. Such carriers
include, but are not limited to, saline, buffered saline, dextrose,
water, glycerol, and combinations thereof. Each carrier must be
"acceptable" in the sense of being compatible with the other
ingredients of the formulation, for example the carrier does not
decrease the impact of the agent on the subject. In other words, a
carrier is pharmaceutically inert and compatible with live
cells.
[0113] Suitable formulations also include aqueous and non-aqueous
sterile injection solutions which can contain anti-oxidants,
buffers, bacteriostats, bactericidal antibiotics and solutes which
render the formulation isotonic with the bodily fluids of the
intended recipient. Aqueous and non-aqueous sterile suspensions can
include suspending agents and thickening agents. The formulations
can be presented in unit-dose or multi-dose containers.
[0114] Examples of parenteral dosage forms include, but are not
limited to, solutions ready for injection, suspensions ready for
injection, and emulsions. Parenteral dosage forms can be prepared,
e.g., using bioresorbable scaffold materials to hold pluripotent
cells generated according to the methods described herein and/or
the at least partially differentiated progeny of the pluripotent
cell.
[0115] The term `epigenetic modification` refers to the chemical
marking of the genome. Epigenetic marks can include DNA methylation
(imprints) as well as methylation and acetylation of proteins
associated with DNA, such as histones. Parent-of-origin-specific
gene expression (either from the maternal or paternal chromosome)
is often observed in mammals and is due to epigenetic
modifications. In the parental germlines, epigenetic modification
can lead to stable gene silencing or activation.
[0116] As used herein, the term "administer" or "transplant" refers
to the placement of cells into a subject by a method or route which
results in at least partial localization of the cells at a desired
site such that a desired effect is produced.
[0117] The pluripotent stem cells described herein, and/or their at
least partially differentiated progeny, can be administered in any
manner found appropriate by a clinician and can include local
administration, e.g. by injection of a suspension of cells or, for
example, by implantation of a preparation of cells deposited or
grown on or within an implantable scaffold or support. Implantable
scaffolds can include any of a number of degradable or resorbable
polymers, or, for example, a silk scaffold, among others. Suitable
routes for administration of a pharmaceutical composition
comprising pluripotent stem cells described herein, and/or their at
least partially differentiated progeny include but are not limited
to local administration, e.g. intraperitoneal, parenteral,
intracavity or subcutaneous administration. The phrases "parenteral
administration" and "administered parenterally" as used herein,
refer to modes of administration other than enteral and topical
administration, usually by injection, and includes, without
limitation, intraperitoneal, intradermal, subcutaneous injection
and infusion. Administration can involve the use of needles,
catheters and syringes suitable for injection, or surgical
implantation. The use of a combination of delivery means and sites
of delivery are contemplated to achieve the desired clinical
effect.
[0118] The term `epigenetic modification` refers to the chemical
marking of the genome. Epigenetic marks can include DNA methylation
(imprints) as well as methylation and acetylation of proteins
associated with DNA, such as histones. Parent-of-origin-specific
gene expression (either from the maternal or paternal chromosome)
is often observed in mammals and is due to epigenetic
modifications. In the parental germline, epigenetic modification
can lead to stable gene silencing or activation.
[0119] In one embodiment, a therapeutically effective amount of
pluripotent stem cells described herein, and/or their at least
partially differentiated progeny is administered to a subject. A
"therapeutically effective amount" is an amount of pluripotent stem
cells described herein, and/or their at least partially
differentiated progeny, sufficient to produce a measurable
improvement in a symptom or marker of the condition being treated.
Actual dosage levels of cells in a therapeutic composition can be
varied so as to administer an amount of the cells that is effective
to achieve the desired therapeutic response for a particular
subject. The selected dosage level will depend upon a variety of
factors including, but not limited to, the activity of the
therapeutic composition, formulation, the route of administration,
combination with other drugs or treatments, severity of the
condition being treated, the physical condition of the subject,
prior medical history of the subject being treated and the
experience and judgment of the clinician or practitioner
administering the therapy. Generally, the dose and administration
scheduled should be sufficient to result in slowing, and preferably
inhibiting progression of the condition and also preferably causing
a decrease in one or more symptoms or markers of the condition.
Determination and adjustment of a therapeutically effective dose,
as well as evaluation of when and how to make such adjustments, are
known to those of ordinary skill in the art of medicine.
[0120] The dosage of pluripotent stem cells described herein,
and/or their at least partially differentiated progeny administered
according to the methods described herein can be determined by a
physician and adjusted, as necessary, to suit observed effects of
the treatment. With respect to duration and frequency of treatment,
it is typical for skilled clinicians to monitor subjects in order
to determine when the treatment is providing therapeutic benefit,
and to determine whether to administer another dose of cells,
increase or decrease dosage, discontinue treatment, resume
treatment, or make other alteration to the treatment regimen. Where
cells administered are expected to engraft and survive for medium
to long term, repeat dosages can be necessary. However,
administration can be repeated as necessary and as tolerated by the
subject. The dosage should not be so large as to cause substantial
adverse side effects. The dosage can also be adjusted by the
individual physician in the event of any complication. Typically,
however, the dosage can range from 100 to 1.times.10.sup.9
pluripotent stem cells as described herein, and/or their at least
partially differentiated progeny for an adult human, e.g. 100 to
10,000 cells, 1,000 to 100,000 cells, 10,000 to 1,000,000 cells, or
1,000,000 to 1.times.10.sup.9 cells. Effective doses can be
extrapolated from dose-response curves derived from, for example,
animal model test bioassays or systems.
[0121] Therapeutic compositions comprising pluripotent stem cells
described herein, and/or their at least partially differentiated
progeny prepared as described herein are optionally tested in one
or more appropriate in vitro and/or in vivo animal models of
disease, such as a SCID mouse model, to confirm efficacy, evaluate
in vivo growth of the transplanted cells, and to estimate dosages,
according to methods well known in the art. In particular, dosages
can be initially determined by activity, stability or other
suitable measures of treatment vs. non-treatment (e.g., comparison
of treated vs. untreated animal models), in a relevant assay. In
determining the effective amount of pluripotent stem cells
described herein, and/or their at least partially differentiated
progeny, the physician evaluates, among other criteria, the growth
and volume of the transplanted cells and progression of the
condition being treated. The dosage can vary with the dosage form
employed and the route of administration utilized.
[0122] With respect to the therapeutic methods described herein, it
is not intended that the administration of pluripotent stem cells
described herein, and/or their at least partially differentiated
progeny be limited to a particular mode of administration, dosage,
or frequency of dosing. All modes of administration are
contemplated, including intramuscular, intravenous,
intraperitoneal, intravesicular, intraarticular, intralesional,
subcutaneous, or any other route sufficient to provide a dose
adequate to treat the condition being treated.
[0123] In some embodiments, the methods described herein can be
used to generate pluripotent cells in vivo, e.g. a cell present in
a subject can be subjected to a stress as described herein such
that acquires a pluripotent phenotype. Methods of applying the
stresses described herein to cells in vivo are readily apparent,
e.g. mild acid solutions can be introduced to a tissue via
injection and/or direct application, temperatures can be altered by
probes which can heat or cool the surrounding tissue or via the use
of non-invasive methods, e.g. focus beam radiation. In vivo
modulation of pluripotency can be used to, e.g. increase tissue
regeneration or wound healing. Non-limiting examples can include
the injection of a mild acid into an arthritic knee joint to induce
knee joint cells (e.g. synovial or cartilage cells) to assume a
pluripotent phenotype and generate new tissues. A further
non-limiting example can include the treatment of a subject with a
stroke or central nervous system injury (e.g. spinal cord injury).
After inflammation has resolved, the cells adjacent to the injured
area can be treated with a stress as described herein, generating
pluripotent cells that can repopulate the damaged tissue and/or
regenerate or repair the damaged tissue.
[0124] In a further non-limiting example, changes in epigenetic
status (e.g. by treatment with a demethylase) can cause non-insulin
secreting cells (e.g. alpha glugagon cells of the pancreas) to
convert to insulin-secreting cells (e.g. beta cells). Accordingly,
treating a non-insulin secreting cell (e.g. an alpha glugagon cell
of the pancreas) in accordance with the methods described herein
can result in the cell becoming an insulin-secreting cell, e.g. a
beta-like cell, either in vivo or in vitro.
[0125] Further, it is contemplated that the pluripotent cells
described herein can fuse with other cells (i.e. "recipient
cells"), e.g. cells not treated according to the methods described
herein, non-pluripotent cells, mature cells, malignant cells,
and/or damaged cells. The fusion of the cells can result in an
increased level of cellular repair enzyme expression and/or
activity in the recipient cell as compared to prior to the fusion.
This can increase the health and/or function of the recipient cell,
e.g. by increasing repair of cellular damage, mutations, and/or
modification of the epigenetic status of the recipient cell.
[0126] In some embodiments, by increasing the pluripotency of cells
in vivo, the epigenetic markers (e.g. DNA methylation,
demethylation, and/or hydroxymethylation status) of those cells can
be modulated. Modulation of epigenetic markers has been implicated
in, e.g. malignancy, arthritis, autoimmune disease, aging, etc and
the treatment of such epigenetically-linked conditions in
accordance with the methods described herein is contemplated.
[0127] In some embodiments, multiple tissues can be treated in vivo
at the same time, e.g. a mildly acidic state could be induced in
multiple organs, e.g. successively or in synchrony (e.g. brain,
heart, liver, lung, and/or thyroid) to treat widespread damage or
aging.
[0128] It is further contemplated that the in vivo treatment of
cells as described herein can be combined with the administration
of pluripotent cells and/or the at least partially differentiated
progeny thereof which have been produced as described herein.
[0129] It is contemplated herein that the methods described herein
can be used to treat, e.g. a fetus or embryo in utero.
[0130] Efficacy of treatment can be assessed, for example by
measuring a marker, indicator, symptom or incidence of, the
condition being treated as described herein or any other measurable
parameter appropriate, e.g. number of pluripotent cell progeny. It
is well within the ability of one skilled in the art to monitor
efficacy of treatment or prevention by measuring any one of such
parameters, or any combination of parameters.
[0131] Effective treatment is evident when there is a statistically
significant improvement in one or more markers, indicators, or
symptoms of the condition being treated, or by a failure to worsen
or to develop symptoms where they would otherwise be anticipated.
As an example, a favorable change of at least about 10% in a
measurable parameter of a condition, and preferably at least about
20%, about 30%, about 40%, about 50% or more can be indicative of
effective treatment. Efficacy for pluripotent cells generated
according to the methods described herein and/or the at least
partially differentiated progeny of the pluripotent cell can also
be judged using an experimental animal model known in the art for a
condition described herein. When using an experimental animal
model, efficacy of treatment is evidenced when a statistically
significant change in a marker is observed, e.g. the number of
hematopoietic cells present in a mouse following bone marrow
ablation and treatment with pluripotent cells as described
herein.
[0132] In one aspect, described herein is a method of producing a
pluripotent cell capable of differentiating into a placental cell,
the method comprising culturing a pluripotent cell obtained
according to the methods described herein in the presence of FGF4.
In some embodiments, the pluripotent cell is capable of
differentiating into an embryonic stem cell. In some embodiments,
the concentration of FGF4 is from about 1 nM to about 1 uM. In some
embodiments, the concentration of FGF4 is from 1 nM to 1 uM. In
some embodiments, the concentration of FGF4 is from about 5 nM to
about 500 nM. In some embodiments, the concentration of FGF4 is
from about 10 nM to about 100 nM.
[0133] In some aspects, the technology described herein relates to
a system for generating a pluripotent cell from a cell, comprising
removing a portion of the cytoplasm and/or mitochondria from the
cell.
[0134] A system for generating a pluripotent cell from a cell,
according to the methods described herein, can comprise a container
in which the cells are subjected to stress. The container can be
suitable for culture of somatic and/or pluripotent cells, as for
example, when cells are cultured for days or longer under low
oxygen conditions in order to reduce the amount of cytoplasm and/or
mitochondria according to the methods described herein.
Alternatively, the container can be suitable for stressing the
cells, but not for culturing the cells, as for example, when cells
are triturated in a device having a narrow aperture for a limited
period, e.g. less than 1 hour. A container can be, for example, a
vessel, a tube, a microfluidics device, a pipette, a bioreactor, or
a cell culture dish. A container can be maintained in an
environment that provides conditions suitable for the culture of
somatic and/or pluripotent cells (e.g. contained within an
incubator) or in an environment that provides conditions which will
cause environmental stress on the cell (e.g. contained within an
incubator providing a low oxygen content environment). A container
can be configured to provide 1 or more of the environmental
stresses described above herein, e.g. 1 stress, 2 stresses, 3
stresses, or more. Containers suitable for manipulation and/or
culturing somatic and/or pluripotent cells are well known to one of
ordinary skill in the art and are available commercially (e.g. Cat
No CLS430597 Sigma-Aldrich; St. Louis, Mo.). In some embodiments,
the container is a microfluidics device. In some embodiments, the
container is a cell culture dish, flask, or plate.
[0135] In some embodiments, the system can further comprise a means
for selecting pluripotent cells, e.g. the system can comprise a
FACS system which can select cells expressing a pluripotency marker
(e.g. Oct4-GFP) or select by size as described above herein.
Methods and devices for selection of cells are well known to one of
ordinary skill in the art and are available commercially, e.g. BD
FACSARIA SORP.TM. coupled with BD LSRII.TM. and BD FACSDIVA.TM.
Software (Cat No. 643629) produced by BD Biosciences; Franklin
Lakes, N.J.
[0136] In some embodiments, cells which are not present in a tissue
are provided to the system. In some embodiments, tissues are
provided to the system and the system further comprises a means of
isolating one or more types of cells. By way of non-limiting
example, the system can comprise a tissue homogenizer. Tissue
homogenizers and methods of using them are known in the art and are
commercially available (e.g. FASTH21.TM., Cat No. 21-82041 Omni
International; Kennesaw, Ga.). Alternatively, the system can
comprise a centrifuge to process blood or fluid samples.
[0137] In some embodiments, the system can be automated. Methods of
automating cell isolation, cell culture, and selection devices are
known in the art and are commercially available. For example, the
FASTH21.TM. Tissue Homogenizer (Cat No. 21-82041 Omni
International; Kennesaw, Ga.) and the BD FACSARIA SORP.TM..
[0138] In some embodiments, the system can be sterile, e.g. it can
be operated in a sterile environment or the system can be operated
as a closed, sterile system.
[0139] In one aspect, described herein is a method of increasing
the self-renewal ability of a pluripotent cell, the method
comprising culturing the cell in the presence of
adrenocorticotropic hormone (ACTH), 2i or 3i medium. As used
herein, "self-renewal ability" refers to the length of time a cell
can be cultured and passaged in vitro, e.g. the number of passages
a cell and it's progeny can be subjected to and continue to produce
viable cells. The cell which is caused to have an increased
self-renewal ability according to the method described herein can
be, e.g. a totipotent cell and/or a cell generated by exposing it
to stress as described elsewhere herein.
[0140] In some embodiments, culturing in the presence of ACTH can
comprise culturing the cell in a cell medium comprising from about
0.1 .mu.M to about 1,000 .mu.M, e.g. from about 0.1 .mu.M to about
100 .mu.M, from about 0.1 .mu.M to about 10 .mu.M, or about 10
.mu.M. In some embodiments, culturing the cell in the presence of
ACTH can comprise culturing the cell in LIF medium comprising ACTH.
LIF, ACTH, 2i and 3i are commercially available and well known in
the art, e.g. ACTH can be purchased from Sigma-Aldrich (Cat No.
A0673; St. Louis, Mo.) and LIF media can be purchased from
Millipore (e.g. Cat Nos ESG1107; Billerica, Mass.), and 3i can be
purchased from Stem Cells Inc. (e.g. as "iSTEM Stem Cell Culture
Medium, Cat No. SCS-SF-ES-01; Newark, Calif.).
[0141] In some embodiments, the culturing step can proceed for at
least 3 days, e.g. at least 3 days, at least 4 days, at least 5
days, at least 6 days, at least 7 days, or longer. After the
culturing step, the cells can be maintained under conditions
suitable for maintaining pluripotent cells as described elsewhere
herein.
[0142] In some embodiments, after the culturing step, the cell can
express a detectable and/or increased level of a stem cell marker.
Stem cell markers and methods of detecting them are described
elsewhere herein. In some embodiments, the stem cell marker can be
selected from the group consisting of Oct3/4; Nanog; Rex1; Klf4;
Sox2; Klf2; Esrr-beta; Tbx3; and Klf5.
[0143] In one aspect, provided herein are methods for generating
pluripotent or STAP cells that is an improvement over the preceding
methods, e.g. provides increased efficiency, quality and/or
yield.
[0144] In one embodiment, provided herein is a method for
generating pluripotent or STAP cells from, e.g., a cell suspension
and/or tissue culture conditions.
[0145] As a first step, the initial (e.g. starting material) cell
in suspension can be pelleted and/or removed from solution. As but
one example, the cell can be pelleted by centrifugation in a
centrifuge tube for from about 800 rpm to about 1600 rpm for from
about 1 minute to about 20 minutes. As but one example, the cell
can be pelleted by centrifugation in a centrifuge tube for about
1200 rpm for 5 minutes. In some embodiments, the cell in suspension
can be contacted with digestive enzyme such as trypsin prior to
being pelleted and/or removed from solution. As but one example,
Trypsin-EDTA, at from about 0.01% to about 0.5% (Gibco: 25300-054)
can be added to a tissue culture dish containing cells, for from
about 1 to about 20 minutes, to release adherent cells to be added
to a centrifuge tube. As but one example, Trypsin-EDTA, 0M5%
(Gibco: 25300-054) can be added to a tissue culture dish containing
cells, for from about 3-5 minutes, to release adherent cells to be
added to a centrifuge tube. In embodiments comprising
centrifugation, the supernatant can be aspirated down to the cell
pellet following centrifugation.
[0146] In some embodiments, the first step is performed on a
population of at least 1 million viable cells. In some embodiments,
the first step is performed on a population of at least 5 million
viable cells. In some embodiments, the first step is performed on a
population of at least 10 million viable cells.
[0147] As a second step, the cells can be resuspended in
physicological saline, e.g., HBSS (Hanks Balanced Saline Solution)
(e.g., HBSS Ca.sup.+Mg.sup.+ Free: Gibco 14170-112), In some
embodiments, the cell can be resuspended at a concentration of from
about 1.times.10.sup.3 cells/mL to about 1.times.10.sup.9
cells/mL.
[0148] In some embodiments, the cell can be resuspended at a
concentration of from about 1.times.10.sup.5 cells/mL to about
1.times.10.sup.7 cells/mL. In some embodiments, the cell can be
resuspended at a concentration of about 1.times.10.sup.6 cells/mL.
In some embodiments, the cells can be resuspended in a 50 nit tube.
In some embodiments, the cells can be resuspended in 2-3 mL HBSS in
a 50 nit tube.
[0149] As a third step, the cell, in suspension/solution, can be
triturated, e.g. passed through an aperture, opening, and/or lumen
sufficiently small to generate, e.g. shear stresses. In exemplary
embodiments described below herein, the aperture, opening, and/or
lumen is comprised by a glass pipette having an opening of a size
as described below herein. Trituration can be accomplished by a
number of alternative means, Non-limiting examples can include
apertures, lumens, or channels in a microfluidics device, a
cell-handling device having a pump and tubing, passing a cell
suspension through a grate or filter, causing a cell suspension to
flow past barriers or particles, and the like. One of skill in the
art can empirically determine the appropriate pressures, flow
rates, shear stress, etc. for different trituration systems based
upon the present disclosure. Further discussion of fluid stresses
and calculations relevant to such stresses can be found in, e.g.,
Fournier "Basic Transport Phenomena in Biomedical Engineering"
Taylor & Francis, 1999; which is incorporated by reference
herein in its entirety.
[0150] In some embodiments, the trituration can last for from about
10 minutes to about 2 hours, e.g. from about 20 minutes to about 1
hours, or about 30 minutes. In some embodiments, the trituration
can last for at least 10 minutes, e.g. 10 minutes or more, 20
minutes or more, 30 minutes or more, 40 minutes or more, 50 minutes
or more, or 60 minutes or more. In some embodiments, the
trituration can continue until the suspension can be easily
triturated through the opening or lumen. In some embodiments, the
trituration in the last aperture or lumen can be continued until
the suspension passes easily through the aperture or lumen. In some
embodiments, the trituration in each aperture or lumen can be
continued until the suspension passes easily through that aperture
or lumen.
[0151] In some embodiments, the trituration can comprise
trituration through a series of openings or lumens, e.g. a series
of progressively smaller openings or lumens. In some embodiments,
the series of openings or lumens comprises at least 2 openings or
lumens, e.g, 2, 3, 4, 5, 10, 20, 50, or more openings or lumens. In
some embodiments, one or more of the openings or lumens can be
pre-coated, e.g. with HBSS or water.
[0152] As but an exemplary embodiment, the cells can be triturated
through multiple, e.g., three openings or lumens. In some
embodiments, the first opening or lumen can have an internal
diameter of from about 0.5 mm to about 2.0 mm. In some embodiments,
the first opening or lumen can have an internal diameter of from
about 0.7 mm to about 1.5 mm. In some embodiments, the first
opening or lumen can have an internal diameter of about 1.1 mm. In
some embodiments, the trituration through the first aperture or
lumen can be performed for from about 1 minute to about 10 minutes.
In some embodiments, the trituration through the first aperture or
lumen can be performed for about 5 minutes. As but an exemplary
embodiment, the first opening or lumen is comprised by a standard
9'' glass pipette (e.g., Fisher brand 9'' Disposable Pasteur
Pipettes: 13-678-20D) and the cell suspension can be triturated in
and out of the pipette for 5 minutes with a fair amount of force to
dissociate cell aggregates and any associated debris.
[0153] In some embodiments, the last two apertures or lumens in the
series can have internal diameters of from about 90 to about 200
microns and from about 25 microns to about 90 microns. In some
embodiments, the last two apertures or lumens in the series can
have internal diameters of from about 100 to about 150 microns and
from about 50 microns to about 70 microns. In some embodiments, the
trituration can comprise about 5 to about 20 minutes of trituration
through the second to last aperture or lumen and about 5 to about
20 minutes of trituration in the last aperture or lumen. In some
embodiments, the trituration can comprises about 10 minutes of
trituration through the second to last aperture or lumen and about
15 minutes of trituration in the last aperture or lumen.
[0154] As but an exemplary embodiment, the last two openings or
lumens can be comprised by pipettes modified as follows: Make two
fire polished pipettes with very small orifices as follows: Heat
the standard 9'' glass pipette over, e.g., a Bunsen burner and then
pull and stretch the distal (melting) end of the pipette, until the
lumen collapses and the tip breaks off, leaving a closed, pointed
glass tip. Wait until the pipette cools, and then break off the
closed distal tip until a very small lumen is now identifiable.
Repeat this process with the second pipette, but break the tip off
a little more proximally, creating a slightly larger distal lumen.
The larger lumen should be about 100-150 microns in diameter, while
the other pipette should have a smaller lumen of about 50-70
microns. The cell suspension can be triturated through the pipette
with the larger lumen for 10 minutes. This can be followed with
trituration through the pipette having the smaller lumen (50-70
microns) for an additional 15 minutes. Continue to triturate the
suspension until it passes easily up and down the fire polished
pipette of the smaller bore. Each pipette can be precoated with
media. Also, during trituration, aspirating air and creating
bubbles or foam in the cell suspension is to be avoided.
[0155] In some embodiments, trituration can be performed at a rate
of from about 1 to about 200 cycles per minute, e.g. the entire
suspension is passed through an aperture, lumen, or opening 1 to
100 times per minute. In some embodiments, trituration can be
performed at a rate of from about 10 to about 60 cycles per minute.
In some embodiments trituration can be performed at a rate of about
40 cycles per minute. In some embodiments, wherein a pipette is
used for trituration, the suspension can be passed out of and back
into the pipette about 20 times per minute.
[0156] In a next step, the triturated cells can be isolated from
the suspension. In some embodiments, about 0 to 50 volumes of HBSS
can be added to the triturated suspension and the suspension
centrifuged at from about 800-1600 rpm for from about 1 minute to
about 30 minutes and then the supernatant aspirated. In some
embodiments, about 9 volumes of HBSS can be added to the triturated
suspension and the suspension centrifuged at about 1200 rpm for
about 5 minutes and then the supernatant aspirated.
[0157] In a next step, the cells can be resuspended in HBSS, with
the resulting suspension having a pH of from about 5.0 to about
6.0. In some embodiments, the resulting suspension can have a pH of
from about 5.4 to about 5.8. In some embodiments, the resulting
suspension can have a pH of from about 5.6 to about 5.7. In some
embodiments, the resulting suspension can have a pH of about 5.6.
In some embodiments, the HBSS solution prior to admixture with the
cells can have a pH of from about 5.0 to about 5.7. In some
embodiments, the HBSS solution prior to admixture with the cells
can have a pH of from about 5.3 to about 5.6. In some embodiments,
the HBSS solution prior to admixture with the cells can have a pH
of about 5.4. In some embodiments, the cells can be resuspended at
a concentration of from about 2.times.10.sup.4 cells/mL to about
2.times.10.sup.8 cells/mL. In some embodiments, the cells can be
resuspended at a concentration of about 2.times.10.sup.6.
[0158] As but an exemplary example the resuspension step of the
preceding paragraph can be performed as follows: when making the
solution acidic, mildly pipette it using a 5 ml pipette for 10
seconds immediately after adding the acid to the Hanks Solution.
HBSS has a very weak buffering capacity, so any solution
transferred from the supernatant of the previous suspension will
affect the pH of the HBSS drastically. The instructions below will
show how to create HBSS with the optimum pH of 5.6-5.7 for STAP
cell generation according to this experimental embodiment. First,
titrate the pH of pre-chilled HBSS (at 4 degrees C.) with 12N HCl
to a pH of 5.6. This is done by slowly adding 11.6 ul of 12 N HCl
to 50 ml of HBSS. After confirming this pH, sterilize the solution
by filtering through a 0.2 micron syringe filter or bottle top
filter of, into a new sterile container for storage. Please
confirm, for example, the final pH of 5.6-5.7 through an initial
test experiment with an appropriate number of cells. Because the pH
of the HBSS is so important, the pH of the solution be checked,
re-titrated and re-sterilized prior to each use.
[0159] In a next step, the cells in the HBSS suspension can be
incubated at about their in vivo temperature. For example,
mammalian cells can be incubated at about 37.degree. C. In some
embodiments, the incubation can be for from about 5 minutes to
about 3 hours. In some embodiments, the incubation can be for from
about 10 minutes to about 1 hour. In some embodiments, the
incubation can be for from about 15 minutes to about 40 minutes. In
some embodiments, the incubation can be for about 25 minutes.
[0160] In a next step, the cells are isolated from the acidic HBSS
solution. As but one example, the cells can be pelleted by
centrifugation in a centrifuge tube for from about 800 rpm to about
1600 rpm for from about 1 minute to about 20 minutes. As but one
example, the cells can be pelleted by centrifugation in a
centrifuge tube for about 1200 rpm for 5 minutes. In some
embodiments, the supernatant can then be aspirated.
[0161] In a next step, the cells can be resuspended in media
suitable for maintaining and/or selecting a pluripotent cell. In
some embodiments, the media is sphere media. As used herein,
"sphere media refers to DMEM/F12 with 1% Antibiotic and 2% B27
Gibco 12587-010. In some embodiments, the media can further
comprise growth factors, e.g., b-FGF (20 ng/ml), EGF (20 ng/ml),
heparin (0.2%, Stem Cell Technologies 07980). These factors are
tailored to the type of cell used. For example, In some
embodiments, LIF (1000U) can be added if the cells are murine). In
some embodiments, supplements such as bFGF, EGF and heparin may not
be necessary.) In some embodiments, the cells can be resuspended in
media at a concentration of 10.sup.5 cells/cc.
[0162] In a next step, the cells can be cultured and/or maintained,
e.g. cultured at 37.degree. C. with 5% CO.sub.2. In some
embodiments, the cells can be agitated during culturing/maintaining
to prevent adherence to a cell culture container. In some
embodiments, the cells can be gently pipetted using, for example, a
5 ml pipette, twice/day for 2 minutes, for the first week, to
discourage them from attaching to the bottom of the dishes. In some
embodiments, this can promote good sphere formation. In some
embodiments, sphere media, optionally containing supplements, can
be added every other day. For example, add 1 ml/day to a 10 cm
culture dish, or 0.5 ml/day to a 6 cm dish.
[0163] In a second embodiment, provided herein is a method for
generating pluripotent or STAP cells from, e.g., a soft tissue that
may comprise red blood cells (RBCs). Such tissues can include, but
are not limited to the liver, spleen, and lung.
[0164] In a first step, the soft tissue, (e.g. an excised, washed,
sterile organ tissue) is mechanically sliced, minced scraped,
and/or macerated. In some embodiments, this step can be performed
in the presence of digestive enzymes and/or enzymes that degrade
the ECM. In some embodiments, the enzyme can be collagenase. It is
contemplated herein that different types of collagenase or enzymes
are better for digestion of different organ tissues, based upon the
components of that tissue's ECM and connective tissues. One of
skill in the art can readily determine appropriate enzymes for each
tissue type. In some embodiments, the tissue is spleen and no
enzyme is necessary. As but an exemplary example, the tissue can be
minced and scraped for from about 1 minute to about 30 minutes
using scalpels and/or scissors to increase surface area that is
exposed to the collagenase, until the tissue appears to become
gelatinous in consistency. As but an exemplary example, the tissue
can be minced and scraped for from about 10 minutes using scalpels
and/or scissors. In some embodiments, additional enzyme can be
added and the tissue incubated with the enzyme, optionally with
agitation. As but one example, the tissue can be kept in an
incubator/shaker for 30 minutes at 37'C at 90 RPM. In some
embodiments, the tissue can be diluted in HBSS after enzyme
exposure and/or mechanical disruption.
[0165] In a next step, the cell, in suspension, can be triturated,
e.g. passed through an opening or lumen sufficiently small to
generate, e.g. shear stresses. In some embodiments, the trituration
can last for from about 10 minutes to about 2 hours, e.g. from
about 20 minutes to about 1 hours, or about 30 minutes. In some
embodiments, the trituration can last for at least 10 minutes, e.g.
10 minutes or more, 20 minutes or more, 30 minutes or more, 40
minutes or more, 50 minutes or more, or 60 minutes or more. In some
embodiments, the trituration can continue until the suspension can
be easily triturated through the opening or lumen. In some
embodiments, the trituration in the last aperture or lumen can be
continued until the suspension passes easily through the aperture
or lumen. In some embodiments, the trituration in each aperture or
lumen can be continued until the suspension passes easily through
that aperture or lumen.
[0166] In some embodiments, the trituration can comprise
trituration through a series of openings or lumens, e.g. a series
of progressively smaller openings or lumens. In some embodiments,
the series of openings or lumens comprises at least 2 openings or
lumens, e.g. 2, 3, 4, 5, 10, 20, 50, or more openings or lumens. In
some embodiments, one or more of the openings or lumens can be
pre-coated, e.g. with HBSS or water.
[0167] As but an exemplary embodiment, the cells can be triturated
through three openings or lumens. In some embodiments, the first
opening or lumen can have an internal diameter of from about 0.5 mm
to about 2.0 mm. In some embodiments, the first opening or lumen
can have an internal diameter of from about 0.7 mm to about 1.5 mm.
In some embodiments, the first opening or lumen can have an
internal diameter of about 1.1 mm. In some embodiments, the
trituration through the first aperture or lumen can be performed
for from about 1 minute to about 10 minutes. In some embodiments,
the trituration through the first aperture or lumen can be
performed for about 5 minutes. As but an exemplary embodiment, the
first opening or lumen is comprised by a standard 9'' glass pipette
(e.g., Fisher brand 9'' Disposable Pasteur Pipettes: 13-678-20D)
and the cell suspension can be triturated in and out of the pipette
for 5 minutes with a fair amount of force to dissociate cell
aggregates and any associated debris.
[0168] In some embodiments, the last two apertures or lumens in the
series can have internal diameters of from about 90 to about 200
microns and from about 25 microns to about 90 microns. In some
embodiments, the last two apertures or lumens in the series can
have internal diameters of from about 100 to about 150 microns and
from about 50 microns to about 70 microns. In some embodiments, the
trituration can comprise about 5 to about 20 minutes of trituration
through the second to last aperture or lumen and about 5 to about
20 minutes of trituration in the last aperture or lumen. In some
embodiments, the trituration can comprises about 10 minutes of
trituration through the second to last aperture or lumen and about
15 minutes of trituration in the last aperture or lumen.
[0169] As but an exemplary embodiment, the last two openings or
lumens can be comprised by pipettes modified as follows: Make two
fire polished pipettes with very small orifices as follows: Heat
the standard 9'' glass pipette over a Bunsen burner and then pull
and stretch the distal (melting) end of the pipette, until the
lumen collapses and the tip breaks off, leaving a closed, pointed
glass tip. Wait until the pipette cools, and then break off the
closed distal tip until a very small lumen is now identifiable.
Repeat this process with the second pipette, but break the tip off
a little more proximally, creating a slightly larger distal lumen.
The larger lumen should be about 100-150 microns in diameter, while
the other pipette should have a smaller lumen of about 50-70
microns. The cell suspension can be triturated through the pipette
with the larger lumen for 10 minutes. This can be followed with
trituration through the pipette having the smaller lumen (50-70
microns) for an additional 15 minutes. Continue to triturate the
suspension until it passes easily up and down the fire polished
pipette of the smaller bore. Each pipette can be precoated with
media. Also, during trituration, aspirating air and creating
bubbles or foam in the cell suspension is to be avoided.
[0170] In some embodiments, trituration can be performed at a rate
of from about 1 to about 200 cycles per minute, e.g. the entire
suspension is passed through an aperture, lumen, or opening 1 to
100 times per minute. In some embodiments, trituration can be
performed at a rate of from about 10 to about 60 cycles per minute.
In some embodiments trituration can be performed at a rate of about
40 cycles per minute. In some embodiments, wherein a pipette is
used for trituration, the suspension can be passed out of and back
into the pipette about 20 times per minute.
[0171] In a next step, the non-RBC triturated cells can be isolated
from red blood. In some embodiments, about 0 to 50 volumes of HBSS
can be added to the triturated suspension and then 0.1 to 20
volumes of an RBC-isolating solution added. One of skill in the art
is aware of solutions for isolating RBCs, e.g. lympholyte or beads
with RBC-specific antibodies.
[0172] As but an exemplary embodiment, after trituration is
completed add HBSS can be added to the cells, then 1 volume of
Lympholyte can be to the bottom of the tube to create a good
bilayer. In some embodiments, mixing of the two solutions should be
avoided. This mixture can be centrifuged at 1000 g for 10 min.
Rotate the tube 180.RTM. and recentrifuge at 1000 g for an
additional 10 min. This will cause the erythrocytes to form a
pellet at the bottom of the tube. Using a standard 9'' glass
pipette aspirate the cell suspensions layer between HBSS and
Lympholyte is removed and placed in a new 50 ml tube. HSBB can be
added to the suspension to a total volume of 20 ml of HBSS and then
the suspension mixed by pipetting via a 5 ml pipette for 1
minutes.
[0173] In a next step, the cells are isolated from the HBSS
solution. As but one example, the cells can be pelleted by
centrifugation in a centrifuge tube for from about 800 rpm to about
1600 rpm for from about 1 minute to about 20 minutes. As but one
example, the cells can be pelleted by centrifugation in a
centrifuge tube for about 1200 rpm for 5 minutes. In some
embodiments, the In a next step, the cells can be resuspended in
HBSS, with the resulting suspension having a pH of from about 5.0
to about 6.0. In some embodiments, the resulting suspension can
have a pH of from about 5.4 to about 5.8. In some embodiments, the
resulting suspension can have a pH of from about 5.6 to about 5.7.
In some embodiments, the resulting suspension can have a pH of
about 5.6. In some embodiments, the HBSS solution prior to
admixture with the cells can have a pH of from about 5.0 to about
5.7. In some embodiments, the HBSS solution prior to admixture with
the cells can have a pH of from about 5.3 to about 5.6. In some
embodiments, the HBSS solution prior to admixture with the cells
can have a pH of about 5.4. In some embodiments, the cells can be
resuspended at a concentration of from about 2.times.10.sup.4
cells/mL to about 2.times.10.sup.8 cells/mL. In some embodiments,
the cells can be resuspended at a concentration of about
2.times.10.sup.6.
[0174] As but an exemplary example the resuspension step of the
preceding paragraph can be performed as follows: when making the
solution acidic, mildly pipette it using a 5 ml pipette for 10
seconds immediately after adding the acid to the Hanks Solution.
HBSS has a very weak buffering capacity, so any solution
transferred from the supernatant of the previous suspension will
affect the pH of the HBSS drastically. The instructions below will
show how to create HBSS with the optimum pH of 5.6-5.7 for STAP
cell generation according to this experimental embodiment. First,
titrate the pH of pre-chilled HBSS (at 4 degrees C.) with 12N HCl
to a pH of 5.6. This is done by slowly adding 11.6 ul of 12 N HCl
to 50 ml of HBSS. After confirming this pH, sterilize the solution
by filtering through a 0.2 micron syringe filter or bottle top
filter of, into a new sterile container for storage. Please confirm
the final pH of 5.6-5.7 through an initial test experiment with an
appropriate number of cells. Because the pH of the HBSS is so
important, the pH of the solution be checked, re-titrated and
re-sterilized prior to each use.
[0175] In a next step, the cells in the HBSS suspension can be
incubated at about their in vivo temperature. For example,
mammalian cells can be incubated at about 37.degree. C. In some
embodiments, the incubation can be for from about 5 minutes to
about 3 hours. In some embodiments, the incubation can be for from
about 10 minutes to about 1 hour. In some embodiments, the
incubation can be for from about 15 minutes to about 40 minutes. In
some embodiments, the incubation can be for about 25 minutes.
[0176] In a next step, the cells are isolated from the acidic HBSS
solution. As but one example, the cells can be pelleted by
centrifugation in a centrifuge tube for from about 800 rpm to about
1600 rpm for from about 1 minute to about 20 minutes. As but one
example, the cells can be pelleted by centrifugation in a
centrifuge tube for about 1200 rpm for 5 minutes. In some
embodiments, the supernatant can then be aspirated.
[0177] In a next step, the cells can be resuspended in media
suitable for maintaining and/or selecting a pluripotent cell. In
some embodiments, the media is sphere media. As used herein,
"sphere media refers to DMEM/F12 with 1% Antibiotic and 2% B27
Gibco 12587-010. In some embodiments, the media can further
comprise growth factors, e.g., b-FGF (20 ng/ml), EGF (20 ng/ml),
heparin (0.2%, Stem Cell Technologies 07980). In some embodiments,
LIF (1000U) can be added if the cells are murine). In some
embodiments, supplements such as bFGF, EGF and heparin may not be
necessary.) In some embodiments, the cells can be resuspended in
media at a concentration of 10.sup.5 cells/cc.
[0178] In a next step, the cells can be cultured and/or maintained,
e.g. at 37.degree. C. with 5% CO.sub.2. In some embodiments, the
cells can be agitated during culturing/maintaining to prevent
adherence to a cell culture container. In some embodiments, the
cells can be gently pipetted using a 5 ml pipette, twice/day for 2
minutes, for the first week, to discourage them from attaching to
the bottom of the dishes. In some embodiments, this can promote
good sphere formation. In some embodiments, sphere media,
optionally containing supplements, can be added every other day.
For example, add 1 ml/day to a 10 cm culture dish, or 0.5 ml/day to
a 6 cm dish.
[0179] In one aspect, described herein is a method of treating
neurological damage in a vertebrate, the method comprising
administering to the vertebrate pluripotent (including "more
pluripotent" cells as described herein) cells or STAP cells as
described herein to a vertebrate in need of treatment for
neurological damage. In some embodiments the cells administered are
cells generated by the improved methods described herein, e.g. the
methods of the two immediately foregoing aspects and/or Example 5.
In some embodiments, the cells can be administered in a scaffold,
hydrogel, or delayed-release formulation. In some embodiments, the
cells can be autologous to the vertebrate. In some embodiments, the
cells are generated from neurological tissue. In some embodiments,
the vertebrate is in need of treatment for neurotoxin exposure,
acute neurological injury, chronic neurological injury, and/or a
degenerative neurological disease. In some embodiments, the
neurological damage can comprise damage to the spinal cord, nerves,
and/or brain. In some embodiments, the vertebrate can be a rodent,
e.g. a mouse or rat. In some embodiments, the vertebrate can be a
canine, a feline, a dog, a cat, a domesticated animal, a horse, or
a primate, e.g. a human. In some embodiments, the method can
comprise repeated administrations, e.g. 2 or more, 3 or more, 4 or
more or more administrations. In some embodiment, the cells can be
administered to the site of the damage, e.g. surgically implanted
and/or injected.
[0180] In one aspect, provided herein is a kit comprising a pipette
having an opening of from about 90 to about 200 microns in diameter
and/or a pipette having an opening of from about 25 microns to
about 90 microns in diameter. In some embodiments the first pipette
has an opening of from about 100 to about 150 microns in diameter
and the second pipette has an opening of from about 50 microns to
about 70 microns in diameter.
[0181] In some embodiments, the kit can further comprise an
additional pipette having an opening of from about 0.5 mm to about
2.0 mm in diameter. In some embodiments, the pipette can have an
opening of from about 0.7 mm to about 1.5 mm in diameter. In some
embodiments, the pipette can have an opening of about 1.1 mm
diameter.
[0182] In some embodiments, kits can alternatively be provided with
devices having apertures and/or lumens of the diameters described
above for pipettes, e.g. microfluidics devices having channels with
apertures or lumens with the described internal diameters.
[0183] In some embodiments, the kit can further comprise HBSS. In
some embodiments, the HBSS can have a pH of from about 5.0 to about
5.7. In some embodiments, the HBSS can have a pH of from about 5.3
to about 5.6. In some embodiments, the HBSS can have a pH of about
5.4. In some embodiments, the kit can further comprise acid for
titrating the pH of the HBSS. In some embodiments, the acid is HCl.
In some embodiments, the kit can further comprise sphere media, and
optionally, growth factors.
[0184] A kit is any manufacture (e.g., a package or container)
comprising at least one multi-electrode array according to the
various embodiments herein, the manufacture being promoted,
distributed, or sold as a unit for performing the methods or assays
described herein. The kits described herein include reagents and/or
components that permit the generation, culture and/or selection of
pluripotent cells. The kits described herein can optionally
comprise additional components useful for performing the methods
and assays described herein. Such reagents can include, e.g. cell
culture media, growth factors, differentiation factors, buffer
solutions, labels, imaging reagents, and the like. Such ingredients
are known to the person skilled in the art and may vary depending
on the particular cells and methods or assay to be carried out.
Additionally, the kit may comprise an instruction leaflet and/or
may provide information as to the relevance of the obtained
results.
[0185] The description of embodiments of the disclosure is not
intended to be exhaustive or to limit the disclosure to the precise
form disclosed. While specific embodiments of, and examples for,
the disclosure are described herein for illustrative purposes,
various equivalent modifications are possible within the scope of
the disclosure, as those skilled in the relevant art will
recognize. For example, while method steps or functions are
presented in a given order, alternative embodiments may perform
functions in a different order, or functions may be performed
substantially concurrently. The teachings of the disclosure
provided herein can be applied to other procedures or methods as
appropriate. The various embodiments described herein can be
combined to provide further embodiments. Aspects of the disclosure
can be modified, if necessary, to employ the compositions,
functions and concepts of the above references and application to
provide yet further embodiments of the disclosure. These and other
changes can be made to the disclosure in light of the detailed
description.
[0186] Specific elements of any of the foregoing embodiments can be
combined or substituted for elements in other embodiments.
Furthermore, while advantages associated with certain embodiments
of the disclosure have been described in the context of these
embodiments, other embodiments may also exhibit such advantages,
and not all embodiments need necessarily exhibit such advantages to
fall within the scope of the disclosure.
[0187] All patents and other publications identified are expressly
incorporated herein by reference for the purpose of describing and
disclosing, for example, the methodologies described in such
publications that might be used in connection with the present
invention. These publications are provided solely for their
disclosure prior to the filing date of the present application.
Nothing in this regard should be construed as an admission that the
inventors are not entitled to antedate such disclosure by virtue of
prior invention or for any other reason. All statements as to the
date or representation as to the contents of these documents is
based on the information available to the applicants and does not
constitute any admission as to the correctness of the dates or
contents of these documents.
[0188] This invention is further illustrated by the following
examples which should not be construed as limiting.
EXAMPLES
Example 1
[0189] All organisms possess a primitive survival instinct. When
plants are subjected to significant external stresses they activate
a mechanism to survive that causes dedifferentiation of cells and
enables regeneration of the injured area or the entire organism.
While such mechanisms appear to be essential for lower organisms to
survive extreme environmental changes, they have yet to be
documented in mammals.
[0190] The inventors hypothesized that physical stress may cause
mature mammalian cells to revert to a stem cell state, similar to
that seen in plants and lower organisms. To examine this
hypothesis, mature cells procured from seven adult somatic tissues
were studied. To first focus on which physical stresses might be
most effective in altering mature cells to revert to a less mature
state, CD45 positive lymphocytes harvested from Oct4-GFP mice were
studied. Cells from these mice provide a readout of reversion to a
stem cell phenotype when the stem cell specific Oct4 promoter is
activated. The mature, fully differentiated cells were exposed to
several significant external stimuli.
[0191] For example, CD45 positive lymphocytes were exposed to low
pH solution to provide a strong chemical stress. Within 3 days of
exposure, GFP expressing cells were observed, and within 5 days,
spherical colonies composed of GFP expressing cells were observed.
Cells generated in this manner are referred to in this Example as
Stress Altered Stem Cells (SASCs or SACs). SACs can also be
referred to as rejuvenated stem cells (RSCs) or animal callus cells
(ACCs). SACs expressed several markers normally associated with
embryonic stem cells. SACs exhibited a differentiation potency
equivalent to ES cells, contributed to the generation of chimera
mice and were capable of generating whole fetuses when injected
into 4N blastocysts. Cells generated in this manner initially
showed low mitochondrial activity and other conditions normally
associated with the induction of cell based injury defense
mechanisms. They then exhibited demethylation of the Oct4 and Nanog
gene promoters. The reprogramming of stress altered cells appeared
to be induced via mesenchymal-epithelial transition. The findings
are consistent with descriptions of cells contained in the plant
callus, in response to injury (external stimuli). A plant callus is
formed from a stress induced conversion of cells to pluripotent
plant stem cells, capable of forming clonal bodies. Such a
spherical colony, generated from mature fully differentiated
somatic mammalian cells in response to significant external
stimuli, is referred to herein as an Animal Callus, and to the
stress altered cells contained in such a colony or callus, as
"Animal Callus Cells" (ACCs) or SACs.
[0192] Thus, significant physical and chemical stresses caused
normal mature adult cells to be reprogrammed to pluripotent stem
cells capable of embryogenesis. While not wishing to be bound by
theory, the mechanism of reprogramming appears to include the
induction of a cellular survival and repair process normally seen
in response to injury. It is demonstrated herein that mammalian
cells possess a survival mechanism very similar to that of plants,
to revert to reprogrammed state in response to significant
stressful external stimuli.
[0193] Various types of cells have reportedly been reprogrammed to
a pluripotent stem cell state through induction or forced
expression of specific genes.sup.1-5. It is also believed that
damage to cells as a result of exposure to irritants, such as
burns, chemical injury, trauma and radiation, may alter normal
cells to become cancer cells.
[0194] Introduction
[0195] All organisms appear to have a common instinct to survive
injury related to stressful stimuli by adapting themselves to the
environment and regenerating their bodies. In plants, ontogenesis
is observed not only in zygotes but also in fully differentiated
cells and immature pollen. In vertebrates, newts are capable of
regenerating several anatomical structures and organs, including
their limbs.sup.1. Of particular note is that the remarkable
regenerative capacity demonstrated by both plants and newts is
induced by external stimuli, which cause cellular dedifferentiation
of previously fully differentiated somatic cells. While billions of
years have passed from the earliest form of life, and different
organisms have evolved in unique ways, this survival instinct may
be inherited from a common ancestor to modern-era organisms.
Although terminally differentiated mammalian cells are normally
believed to be incapable of reversing the differentiation process,
mammals may retain a previously unappreciated program to escape
death in response to drastic environmental changes.
[0196] The plant callus, a mass of proliferating cells formed in
response to external stimuli, such as wounding, which can be
stimulated in culture by the plant hormones.sup.2. The callus
contains reprogrammed somatic cells, referred to as callus cells,
each of which is capable of clonally regenerating the entire body.
Callus cells are not inherent in plants, but are generated from
somatic cells in response to external stimuli. Although recent
studies demonstrated that mammalian somatic cells can be
reprogrammed by exogenous processes, such as gene
induction.sup.3-7, reprogramming of mammalian somatic cells in
response to external physical and or chemical stimuli, in a manner
that parallels plants, has not been reported. Interestingly, it is
believed that extreme external stimuli, such as exposure to
irritants, including burns, chemical injury, trauma and radiation,
may alter normal somatic cells to become cancer cells. Such
experiences seem to indicate that external stimuli will result in
mammalian cellular change.
[0197] In this study, it was hypothesized that mammalian cells
retain a mechanism to survive exposure to significant external
stress, in the same manner as plants. This report presents evidence
that application of significant physical and chemical stimuli can
cause reprogramming of mature, fully differentiated mammalian
somatic cells, procured from various tissues, and that such stress
altered cells are capable of forming an animal callus containing
"animal callus cells", which can regenerate the clonal body.
[0198] Results
[0199] Significant physical and chemical stimuli applied to mature
somatic cells. Since the embryonic transcription factor Oct4 is
thought to be crucial in regulation of the pluripotent status of
cells, the initial strategy was to identify which external stimuli
most efficiently altered mature cells to become reprogrammed to
express Oct4. CD45 positive hematopoietic lineage cells were first
studied in order to avoid contamination with undifferentiated
cells. CD45 positive cells harvested from spleens procured from
Oct4-GFP (GOF) mice.sup.8, were exposed to various significant
physical and chemical stimuli. The exposures included: osmotic
pressure treatment, treatment with significant mechanical
trituration, exposure to low pH, application of cell membrane
damage using streptolysin O (SLO), exposure to under nutrition and
exposure to hypoxia and high Ca.sup.2+ concentration. Next, GFP
expressing cells were identified, sorted and collected using FACS.
Gene expression of Oct4 was confirmed by R-T PCR. Exposure to each
of the applied stimuli resulted in reprogramming of the mature
cells to express GFP to some degree (FIG. 5A). Exposure of the
mature cells to the chemical stress of low pH and the physical
stress of significant mechanical trituration appeared to be the
most effective treatments in altering mature cells to express Oct4.
To determine the optimal pH for inducing conversion to Oct4
expressing cells, CD45 positive cells were exposed to solutions of
varying acidity, from pH 4.0 to pH 6.8. At 3 days after exposure to
an acidic solution, GFP expression of cells was analyzed using
FACS. An acid solution with a pH 5.4-5.6 most efficiently altered
cells to express GFP (FIG. 5B). Consequently, exposure to low pH
was focused upon as the stress treatment of choice for the
remainder of the study.
[0200] The optimum culture conditions for maintaining stress
altered Oct4 expressing cells were then determined. Several
previously described culture media, including: ES establishment
culture medium, 3i.sup.9 and ACTH.sup.10, ES culture condition,
ES-LIF.sup.11, embryonic neural stem cell culture condition,
B27-LIF.sup.12, and EpiSCs culture condition.sup.13, were studied.
Cells were plated into each medium, and GFP expressed colonies were
counted (FIG. 5C). The medium B27-LIF appeared to be the most
effective in generating GFP expressing spherical colonies.
Therefore B27-LIF medium was utilized for culture of the treated
cells.
[0201] Stress treated CD45 positive cells were cultured in B27-LIF
medium, and within 5 days, GFP expressing spherical colonies were
observed while no GFP expressing colonies were observed in the
untreated control (FIG. 1A). Spherical colonies grew to
approximately 70 .mu.m in diameter over the first 7 days, and
spherical colonies could be maintained for another 7 days in that
culture condition. The configuration of the colonies was slightly
baroque, appearing more similar in shape to the callus seen in
botany, rather than spheres. A cell colony generated by stress
treatment was therefore referred to as an Animal Callus (AC).
Cultured cells were dissociated and population analysis was then
performed using FACS. The analysis revealed that the application of
certain significant stimuli resulted in the generation of stress
altered cells, now referred to as Animal Callus Cells (ACCs), that
did not previously exist in the CD45 positive cell populations
(FIG. 1B). The phenotypic change of CD45 positive cells as a result
stress treatment was observed at the single cell level. While CD45
positive cells did not express GFP, ACCs expressed GFP associated
with a diminished expression of CD45 (data not shown). Examination
of single cells revealed that the cell size of treated cells
appeared smaller than untreated cells. Therefore, cell size of ACCs
population was analyzed by FACS. The cell size of ACCs was quite
small, with 80% of cells being less than 8 .mu.m in diameter (FIG.
1C).
[0202] To examine chronological phenotypic change associated with
CD45 diminution and Oct4 expression, stress treated CD45 positive
cells were analyzed at day 1, day 3 and day 7. At day 1, most of
cells still expressed CD45, but not Oct4. At day 3, marker
expression transitioned to reveal CD45 negative cells or CD45
negative/Oct4positive (dim) cells. At day 7, CD45 expression
disappeared, and Oct4 expressing cells were observed (FIG. 1D).
Notably, during the first 7 days of culture, the number of PI
positive cells (dead cells) gradually increased (Data not shown),
which suggested that the stress treatment and the culture condition
gradually changed the character of cells and selected for
successfully altered cells, which expressed Oct4.
[0203] Characterization of ACCs. To confirm the reprogramming of
somatic cells as a result of exposure to external stimuli, early
embryogenesis marker gene expression of ACCs was investigated. As a
positive control of early embryogenesis, ES cells were utilized in
following experiments. Marker expression and DNA methylation was
characterized as follows: Immunofluorescence staining at day 7,
showed that spherical colonies containing ACCs, uniformly expressed
pluripotent cell markers, E-cadherin antigen, Nanog, SSEA-1,
PCAM-1, and AP, and were positive for Oct4-GFP (data not shown).
Gene expression analysis showed that ACCs and ES cells, but not
primary CD45 positive cells, expressed comparable levels of Oct4,
Nanog, Sox2, Ecat1, Esg1, Dax1, Fgf5, Klf4 and Rex1 genes (FIG.
2A). Gene expression of ES specific genes in ACCs reached a peak at
day 7 (FIG. 2A). Bisulfite sequencing was performed to determine
the methylation status of Oct4 and Nanog gene promoters in ACCs.
Native lymphocytes and cultured lymphocyte control samples
displayed extensive methylation at both promoters, whereas ACCs
showed widespread demethylation of these regions similar to that
seen in ES cells (FIG. 2B). Thus, it is demonstrated that mammalian
somatic cells were reprogrammed by external stress.
[0204] To confirm that the Oct4 gene expression resulted from
stress treatment of mature cells not only in GOF mice but also in
wild type mice, CD45 positive lymphocytes were harvested from
spleens procured from ICR mice. The lymphocytes were then exposed
to the stress treatment and chronologically analyzed until day 7
using FACS. A SSEA-1 positive/E-cadherin positive cell population
was seen in the stress treated group, while SSEA-1/E-cadherin
expression was not observed in the non-stress treated control group
(FIG. 6A). Those double positive cells expressed Oct4 gene
expression, which was confirmed by R-T PCR (FIG. 6B). These results
demonstrated that as a result of the stress treatment, ACCs, Oct4
positive and pluripotent marker expressing cells, were generated
from CD45 positive cells irrespective of mouse strain.
[0205] These results imply that the mature fully differentiated
adult somatic cells reverted to "sternness" as a result of the
stress treatment.
[0206] To assess the sternness of ACCs, their self-renewal potency
and their differentiation potency were examined. To study their
self-renewal potency, ACCs colonies derived from previously mature
CD45 positive lymphocytes were dissociated into single cells, and
plated into 96 well plates, with one cell per well in an effort to
generate clonally derived populations. Ten days after plating,
spherical colonies were seen in 4 of the 96 wells. The dividing
time of ACCs varied from well to well. Some divided in 12-16 h and
others divided in 30-34 h. ACCs were passaged at least 5 times,
with continued expression of Oct4 observed. Consequently, ACCs
demonstrated a potential for self-renewal, and the potential to
differentiate into cells from all three germ layers in vitro.
[0207] ACs derived from mature GOF lymphocytes were again
dissociated into single cells, sorted to contain only a population
of cells that expressed GFP and then cultured in differentiation
media. At 14-21 days after plating, cells expressed the ectoderm
marker, .beta.III-tubulin and GFAP, the mesoderm marker,
.alpha.-smooth muscle actin, and the endoderm marker,
.alpha.-fetoprotein and Cytokeratin 7 (data not shown). Thus, ACCs
differentiated into cells representative of the three germ layers
in vitro.
[0208] Stress alteration of mature somatic cells procured from
various adult tissues. To examine whether ACCs could be generated
not only mature lymphocytes but also other types of somatic cells,
brain, skin, muscle, fat, bone marrow, lung and liver were
harvested from Oct4-GFP (GOF) mice. Cells were isolated from the
tissue samples, dissociated into single cells, and treated with
different physical and or chemical stress conditions. The
efficiency of the process to alter the cells differed as a function
of both the source of cells and the stress condition(s) to which
the cells were exposed (FIG. 7A). The ability of stress to alter
mature cells to express Oct4, differed depending on the derivation
of cells, but stress was able to alter cells to express Oct4 to
some degree in mature cells derived from all three germ layers
(FIG. 7A). ACC colonies derived from any mature tissue expressed
pluripotent markers, E-cadherin, Nanog, PCAM-1 and AP (data not
shown), and ES specific marker genes (FIG. 7B). Significant
physical and chemical stresses altered mature somatic cells to
revert to a stem cell state, despite of the source of tissues and
derivation of the germ layers.
[0209] Cellular modification in the initial phase of ACCs
generation. These results demonstrate that strong physical and
chemical stimuli result in reprogramming of somatic cells. Stress
treated lymphocytes were observed to form an AC within 5 days. It
was hypothesized that drastic change of molecular events occurred
as a result of the stress exposure. Studies were therefore focused
on the initial phase of the reprogramming, which was the during the
first 7 days after the exposure to the stimuli.
[0210] Because ACCs survived after the significant stress exposure,
it was speculated that survival mechanisms normally turned on to
repair cellular damage were induced during the ACCs generation.
First the expression of a number of candidate genes involved in
cellular response to stress and DNA repair was compared in in
native CD45 positive cells and stress-treated CD45 positive cells
at day 1, day 3 and day 7. Cellular response gene expression was
already observed at day 1, and those genes were up-regulated over 7
days when the mixtures of ACC generating cells and other cells were
analyzed (FIG. 8). Because the up-regulation of cellular response
genes was correlated with ACCs generation, ACCs at day 3 and day 7
were sorted, and gene expression was analyzed. With the exception
of Hif3a, all candidate genes were up-regulated to various degrees
during the ACCs generation (FIG. 3A). Four heat shock genes and one
DNA repair gene were found to be up-regulated during the ACCs
generation. Furthermore, seven of the up-regulated genes are known
to be directly involved in the regulation of the cellular redox
state. These results suggested that the self-repair or self-defense
potency was induced during the ACCs generation.
[0211] Since ACCs exhibited the up-regulation of cellular redox
associated genes, the mitochondrial function of ACCs was next
examined. Mitochondria are organelles responsible for production of
the vast majority of ATP via the redox reaction using oxygen within
eukaryotic cells. GFP expression of ACC spherical colonies
gradually diminished from peripheral located cells after 7 days
when colonies were cultured without passage. ACCs contained at day
10 contained GFP expressing central cells and non-GFP
differentiated peripheral cells (data not shown). Mitochondrial
morphology was evaluated in ACCs and differentiated cells by
staining with a mitochondrial-specific dye, MitoTracker Red. ACC
mitochondria were observed as peri-nuclear clusters that appear
punctate and globular while differentiated cell contained many
mitochondria which were filamentous and wide-spread in cytoplasm.
ATP production of ACCs was less than that in native CD45 positive
cells (FIG. 3B). Also, reactive oxygen species (ROS) production of
ACCs was less than in native CD45 positive cells (FIG. 3C). Finally
the key factors involved in mtDNA replication were assessed; which
are mitochondrial transcription factor A (Tfam), the
mitochondrial-specific DNA polymerase gamma (Polg) and its
accessory unit (Polg2). The gene expression of Tfam, Polg, and
Polg2 in ACCs was lower than those in differentiated cells (FIG.
3D). Consequently, ACCs contained small numbers of mitochondria and
ACCs' mitochondrial activity was lower than differentiated cells.
These results implied that ACCs acquired a metabolic system
distinct from differentiated cells to survive after the severe
stress response.
[0212] Developmental potential of ACCs. Finally, it was assessed
whether ACCs possessed a developmental potential similar to that of
plant callus cells. As an initial test for developmental potency,
ACCs implanted subcutaneously in immunodeficient (SCID) mice were
studied. Six weeks after transplantation, ACCs generated tissues
representing all three germ layers (data not shown).
[0213] ACCs differentiated into cells representative of all three
germ layers in vivo and in vitro. Therefore, the chimera
contribution potency of ACCs was assessed. ACCs for use in chimera
generation studies were prepared using CD45 positive cells derived
from F1 GFP (C57BL/6GFP.times.DBA/2 or 129/SvGFP.times.C57BL/6GFP)
or GOF. Because gene expression analysis had revealed that at day
7, ACCs expressed the highest level of pluripotent marker genes,
day 7 ACCs were utilized for the chimera mouse generation study.
Initially, conventional methods for chimera generation were
utilized. ACs were dissociated into single cells via treatment with
trypsin. The ACCs were then injected into blastocysts (FIG. 4A).
Using this approach, the chimera contribution of dissociated ACCs
was quite low (Table 1). Therefore ACCs without prior trypsin
treatment, which often causes cellular damage, were injected into
blastocysts. ACs were cut into small clusters using a micro-knife
under the microscopy. Small clusters of ACs were then injected into
blastocysts (FIG. 4A). Using this approach, the chimera
contribution of ACCs dramatically increased (data not shown).
Chimera mice generated with ACCs grew up healthy (data not shown)
and germ line transmission has been observed. The chimera
contribution rate of each tissue was analyzed by FACS. The results
showed that ACCs derived from lymphocytes contributed to all tissue
(FIG. 4B).
[0214] As demonstrated above, ACCs can be generated from various
cells derived from all three germ layers (FIG. 7A-7B). In order to
examine whether ACCs derived from various tissues had different
differentiation tendencies, ACCs were generated from various
tissues derived from F1GFP mice, and injected into ICR blastocysts.
Then, using FACS, the contribution ratio of each tissue in the
generated chimera mice was analyzed. It was found that ACCs derived
from any tissue contributed to chimeric mouse generation (FIG. 9).
In addition, the contribution ratio to skin, brain, muscle, fat,
liver and lung was analyzed in chimera mice generated using ACCs
derived from various tissues. ACCs derived from any tissue
contributed to generate tissues representative of all three germ
layers, and no differentiation tendency was observed (FIG. 9).
[0215] The generation of mice by tetraploid complementation, which
involves injection of pluripotent cells in 4N host blastocysts,
represents the most rigorous test for developmental potency because
the resulting embryos are derived only from injected donor
cells.sup.16 ACCs were generated from lymphocytes derived from
DBA.times.B6GFP F1 mice or 129/SvGFP.times.B6GFP F1. ACCs resulted
in the generation of (mid) late-gastration `all ACC embryos` after
injection into 4N blastocysts (data not shown). Genotyping analysis
demonstrated that `all ACC embryos` had specific genes of strain
which was utilized to generate ACCs. Thus, ACCs possessed the
potential to generate a clonal body just like plant callus
cells.
[0216] Discussion
[0217] Mammalian somatic cells exhibit the ability for animal
callus (AC) formation as a result of exposure to significant
external stimuli, in a fashion very similar to plants. The cells
contained in these calli (animal callus cells, ACCs) have the
ability to generate chimeric mice and to generate new embryos fully
consisting of only cells generated from ACCs. The results described
herein demonstrate that mammalian somatic cells regain the ability
to differentiate into any of the three germ layers by external
stimuli. This implies that somatic cells have a greater plasticity
than previously believed. Furthermore, this study demonstrates the
potential of somatic cell reprogramming without gene induction or
the introduction of foreign proteins, and offers new insight into
the potential of adult stem cells; representing a significant
milestone in the elucidation of stem cell biology.
[0218] Materials and Methods
[0219] Tissue harvesting and Cell culture. For mature lymphocytes
isolation, spleens derived from GOF mice or ICR mice were minced by
scissors and mechanically-dissociated with pasture pipettes.
Dissociated spleens were strain through a cell strainer (BD
Biosciences, San Jose). Collected cells were re-suspended in DMEM
medium and added the same volume of lympholyte (CEDARLANE.RTM.,
Ontario, Canada), then centrifuged at 1000 g for 15 min.
Lymphocytes layer was taken out and attained with CD45 antibody
(ab25603, abcam, Cambridge, Mass.). CD45 positive cells were sorted
by FACS Aria (BD Biosciences). Then, CD45 positive cells were
treated with stress treatment (pH5.5 solution for 15 min) and
plated into B27 medium supplemented with 1000U LIF (Sigma) and 10
ng/ml FGF 2 (Sigma).
[0220] Exposure to external stimuli--stress treatment. To give a
mechanical stress to mature cells, pasture pipette were heated and
then stretched to create lumens approximately 50 microns in
diameters, and then broken. Mature somatic cells were then
triturated through these pipettes for 20 mM, and cultured for 7
days. To provide a hypoxic stimulus to mature cells, cells were
cultured in a 5% oxygen incubator for 3 weeks. An under nutrition
stimulus was provided to mature cells, by culturing the cells in a
basic culture medium for 3 weeks. To expose the mature cells to a
physiological stress, they were treated with low pH (pH5.5)
solution, and cultured for 7 days. Also, cells were given more
serious damage. To create pores in mature cell membranes, cells
were treated with SLO (Streptolysin 0).
[0221] SLO-treated cells were incubated in HBSS containing 10
.mu.g/mL SLO at 37.degree. C. for 50 min and then cultured in
culture medium without SLO for 7 days. Cells exposed to
under-nutrition stress were cultured in basal medium for 2 to 3
weeks. Cells exposed to "ATP" stress were incubated in HBSS
containing 2.4 mM ATP at 37.degree. C. for 15 mM and then cultured
in culture medium for 7 days. Cells exposed to "Ca" stress were
cultured in culture medium containing 2 mM CaCl.sub.2 for 2
weeks.
[0222] Bisulfite sequence. For cells procured from GOF mice were
dissociated into single cells. GFP positive cells collected using
by FACS Aria. Genome DNA was extracted from ACCs and studied.
Bisulfite treatment of DNA was done using the CpGenome DNA
Modification Kit (Chemicon, Temecula, Calif.,
http://www.chemicon.com) following the manufacturer's instructions.
The resulting modified DNA was amplified by nested polymerase chain
reaction PCR using two forward (F) primers and one reverse (R)
primer: Oct4 (F1, GTTGTTTTGTTTTGGTTTTGGATAT (SEQ ID NO: 1; F2,
ATGGGTTGAAATATTGGGTTTATTTA (SEQ ID NO: 2);
R,CCACCCTCTAACCTTAACCTCTAAC (SEQ ID NO: 3)). And Nanog (F1,
GAGGATGTTTTTTAAGTTTTTTTT (SEQ ID NO:4); F2,
AATGTTTATGGTGGATTTTGTAGGT (SEQ ID NO: 5); R,
CCCACACTCATATCAATATAATAAC (SEQ ID NO:6)). PCR was done using TaKaRa
Ex Taq Hot Start Version (RR030A). DNA sequencing was performed
using M13 primer with the assistance of GRAS (The Genome Resource
and Analysis Unit).
[0223] Immunohistochemistry. Cultured cells were fixed with 4%
parafolmaldehyde and permeabilized with 0.1% Triton X-100/PBS prior
blocking with 1% BSA solution (Life Technology, Tokyo, Japan).
Secondary antibodies were goat anti-mouse or -rabbit coupled to
Alexa-488 or -594 (Invitrogen). Cell nuclei were visualized with
DAPI (Sigma). Slides were mounted with SlowFade Gold antifade
reagent (Invitrogen).
[0224] Fluorescence-Activated Cell Sorting and Flow Cytometry.
Cells were prepared according to standard protocols and suspended
in 0.1% BSA/PBS on ice prior to FACS. PI (BD Biosciences) was used
to exclude dead cells. Cells were sorted on a BD FACSAria SORP and
analyzed on a BD LSRII with BD FACSDiva Software (BD
Biosciences).
[0225] RNA Preparation and RT-PCR Analysis. RNA was isolated with
the RNeasy Micro kit (QIAGEN). Reverse transcription was performed
with the SupeSACript III First Strand Synthesis kit (Invitrogen).
SYBR Green Mix I (Roche Diagnostics) was used for amplification,
and samples were run on a Lightcycler-II Instrument (Roche
Diagnostics).
[0226] Animal Studies. For tumorigenicity studies, cells suspended
in 100 ml PBS were injected subcutaneously in the flanks of
age-matched immunodeficient SCID mice. Mice were sacrificed and
necropsied after 6 weeks.
[0227] ATP and ROS Assay. Intercellular ATP level was measured by
the ATP Bioluminescence Assay Kit HS II (Roche) according to
supplier's protocol. The luminescence intensity was measured by
using a Gelomax 96 Microplate Luminometer (Promega, Madison, Wis.)
and the luminescence readings were normalized by cell count. For
measurement of ROS levels, cells were incubated in a medium contain
2 .mu.M dihydroethidium (Molecular Probes) at 37.degree. C. in dark
for 15 minutes. Cells were then washed with PBS and suspended in
PBS containing 0.5% BSA. The fluorescence intensity of 30000 cells
was recorded with the help of a BD Biosciences LSR II (BD
Bioscience, Spark, Md.).
[0228] Chimera mice generation and analyses. Production of Diploid
and Tetraploid Chimeras. Diploid embryos were obtained from ICR
strain females mated with ICR males and tetraploid embryos were
obtained from BDF1 strain females mated with BDF1 males. Tetraploid
embryos were produced by the electrofusion of 2-cell
embryos.sup.17. In this study, because trypsin treatment caused low
chimerism, ACCs spherical colonies were cut into small pieces using
a micro-knife under the microscopy, then small clusters of ACCs
were injected into day 4.5 blastocyst by large pipette. Next day,
the chimeric blastocysts were transferred into day 2.5
pseudopregnant females.
REFERENCES
[0229] 1. Brockes, J. P. & Kumar, A. Plasticity and
reprogramming of differentiated cells in amphibian regeneration.
Nature reviews. Molecular cell biology 3, 566-574,
doi:10.1038/nrm881 (2002). [0230] 2. Sinnott, J. J. & Burklund,
C. W. The treatment of carotid insufficiency. The Nebraska state
medical journal 45, 357-359 (1960). [0231] 3. Hanna, J. et al.
Direct reprogramming of terminally differentiated mature B
lymphocytes to pluripotency. Cell 133, 250-264,
doi:10.1016/j.cell.2008.03.028 (2008). [0232] 4. Hockemeyer, D. et
al. A drug-inducible system for direct reprogramming of human
somatic cells to pluripotency. Cell stem cell 3, 346-353,
doi:10.1016/j.stem.2008.08.014 (2008). [0233] 5. Kim, D. et al.
Generation of human induced pluripotent stem cells by direct
delivery of reprogramming proteins. Cell stem cell 4, 472-476,
doi:10.1016/j.stem.2009.05.005 (2009). [0234] 6. Kim, J. B. et al.
Direct reprogramming of human neural stem cells by OCT4. Nature
461, 649-643, doi:10.1038/nature08436 (2009). [0235] 7. Okabe, M.
et al. Definitive proof for direct reprogramming of hematopoietic
cells to pluripotency. Blood 114, 1764-1767,
doi:10.1182/blood-2009-02-203695 (2009). [0236] 8. Ohbo, K. et al.
Identification and characterization of stem cells in prepubertal
spermatogenesis in mice small star, filled. Developmental biology
258, 209-225 (2003). [0237] 9. Ying, Q. L. et al. The ground state
of embryonic stem cell self-renewal. Nature 453, 519-523,
doi:10.1038/nature06968 (2008). [0238] 10. Ogawa, K., Matsui, H.,
Ohtsuka, S. & Niwa, H. A novel mechanism for regulating clonal
propagation of mouse ES cells. Genes to cells: devoted to molecular
& cellular mechanisms 9, 471-477,
doi:10.1111/j.1356-9597.2004.00736.x (2004). [0239] 11. Gough, N.
M. et al. LIF: a molecule with divergent actions on myeloid
leukaemic cells and embryonic stem cells. Reproduction, fertility,
and development 1, 281-288 (1989). [0240] 12. Hitoshi, S. et al.
Primitive neural stem cells from the mammalian epiblast
differentiate to definitive neural stem cells under the control of
Notch signaling. Genes & development 18, 1806-1811,
doi:10.1101/gad.1208404 (2004). [0241] 13. Tesar, P. J. et al. New
cell lines from mouse epiblast share defining features with human
embryonic stem cells. Nature 448, 196-199, doi:10.1038/nature05972
(2007). [0242] 14. Saretzki, G., Armstrong, L., Leake, A., Lako, M.
& von Zglinicki, T. Stress defense in murine embryonic stem
cells is superior to that of various differentiated murine cells.
Stem Cells 22, 962-971, doi:10.1634/stemcells.22-6-962 (2004).
[0243] 15. Mitalipova, M. M. et al. Preserving the genetic
integrity of human embryonic stem cells. Nature biotechnology 23,
19-20, doi:10.1038/nbt0105-19 (2005). [0244] 16. Nagy, A., Rossant,
J., Nagy, R., Abramow-Newerly, W. & Roder, J. C. Derivation of
completely cell culture-derived mice from early-passage embryonic
stem cells. Proceedings of the National Academy of Sciences of the
United States of America 90, 8424-8428 (1993). [0245] 17. Nagy, A.
et al. Embryonic stem cells alone are able to support fetal
development in the mouse. Development 110, 815-821 (1990).
TABLE-US-00001 [0245] TABLE 1 Generation of chimera mice from ACCs
No. of No. of chimeric Culture fertilized mice obtained Mouse Cell
preparation period of embryos No. High strain for injection SACs
injected offspring Total contribution** BDF1 Single 7 day 40 32 1 0
BDF1 Cluster 7 day 58 48* 16 4 129B6F1 Cluster 7 day 98 64 20 6 GOF
Cluster 7 day 73 35 24 2 GOF Cluster 10 day 35 20 4 0 *All fetuses
were collected at 13.5 dpc to 15.5 dpc and the contribution rate of
ACCs into each organs was examined by FACS **The contribution of
SACs into each chimera was scored as high (>50% of the coat
color of GFP expression)
TABLE-US-00002 TABLE 2 Primer sequences. The middle column
contains, from top to bottom, SEQ ID NOs: 7-39 and the right hand
column contains, from top to bottom, SEQ ID NOs: 40-72. Gene 5'
Primer 3' Primer Txni gtcatccttgatctgcccct gagacgacctgctacacctg
Bmi1 ggtacttacgatgcccagca tccctacctgactgcttacg Prdx2
ccctgaatatccctctgct tatgtctgctcgtacccctt Hspb1 agatggctacatctctcggt
tcagacctcggttcatcttc Hif3a cactctggacttggagatgc
cttggaccttcgaaggacga Hspa1b cttgtcgttggtgatggtga
tcaaagcgcagaccacctcg Hspa9a gttgaagcagttaatatggc
gcatgtcgtccgcagtaact Ercc4 agatgagaccaacctggacc
tcgacttcgtcttgttcggt Hpas1a aggtggagatcatcgccaac
tctacctgttccgcgtctag Gapdh cgttgaatttgccgtgagtg
tggtgaaggtcggtgtgaac Gpx2 attgccaagtcgttctacga gtaggacagaaacggatgga
Sod2 aggtcgcttacagattgctg gtgtcgatcgttcttcact Tgr
gtctctttagaaaagtgtga attgcagctgcaaatccctg Gsta tacagctttcttcctggcca
tacgattcacggaccgtgcc Pdha2 atgtcagccttgtggaaatt
aacgataactgatccctggg Gpx3 gtctgacagaccaataccat cagttctacctgtaggacag
Gpx4 aacggctgcgtggtgaagcg cctccttccaggtctccgga Polg
ggacctcccttagagaggga agcatgccagccagagtcact Pol2
acagtgccttcaggttagtc actccaatctgagcaagacc Tfam gcatacaaagaagctgtgag
gttatatgctgaacgaggtc Oct4 tctttccaccaggcccccgg
tgcgggcggacatggggagat ct cc Ecat1 tgtggggccctgaaaggcga
atgggccgccatacgacgac gctgagat gctcaact Esg1 gaagtctggttccttggcag
actcgatacactggcctagc gatg Nanog caggtgtttgagggtagctc
cggttcatcatggtacagtc ERas actgcccctcatcagactgc cactgccttgtactcgggta
tact gctg Gdf3 gttccaacctgtgcctcgcg agcgaggcatggagagagcg tctt
gagcag Fgf4 cgtggtgagcatcttcggag ccttcttggtccgcccgttc tgg tta Rex1
acgagtggcagtttcttctt tatgactcacttccaggggg ggga cact Cripto
atggacgcaactgtgaacat ctttgaggtcctggtccatc gatgttcgca acgtgaccat
Dax1 tgctgcggtccaggccatca gggcactgttcagttcagcg agag gatc Sox2
tagagctagactccgggcga ttgccttaaacaagaccacg tga aaa Klf4
gcgaactcacacaggcgaga tcgcttcctcttcctccgac aacc aca Fgf5
gctgtgtctcaggggattgt cactctcggcctgtcttttc
TABLE-US-00003 TABLE 3 Percent of cells demonstrating pluripotent
phenotype after 1 week of stress treatment. Treatments are shown in
the first column and the tissue of origin of the somatic cells is
shown in the second row. Numbers are percentages. 1 week-old Bone
Marrow Brain Lung Muscle Fat Fibroblast Control 0 0 0 0 0 0 Hypoxia
2 3 3.2 2.8 1.6 1.2 Trituration 19.5 20.5 19.8 20.6 18.4 9.5 SLO
13.2 10.3 18.4 20.5 32.8 15.2 undernutrition 2 3.4 1.8 4.5 2.4 1.5
ATP 12.3 15.4 9.8 68.4 79.6 25.10 Ca 1.2 0.8 1.3 1.5 2.7 3.5
Example 2
[0246] Without wishing to be bound by theory, the methods described
herein are contemplated to be activating a process related to
apoptosis, or controlled cell death. Mild injury to cells can
induce the activation of repair genes. Severe injury to cells can
activate a previously undefined survival mechanism. It is
contemplated that when cells are exposed to a significant stress,
such as the stresses described herein, the cellular components
(e.g. mitochondria, vesicles, nuclei, ribosomes, endoplasmic
reticulum, exosomes, endosomes, cell membranes, mitochondria,
lysosomes, ATP, proteins, enzymes, carbohydrates, lipids, etc) are
released from the damaged cells into a "cellieu." Data described
herein indicate that this "cellieu" can be capable of
reconstituting and/or promoting the survival of cells. It is
additionally contemplated, without wishing to be bound by theory,
that mitochondria (and other organelles) are able to direct the
reconstitution of the cells. Because of the small size, simplicity,
ability to direct cell differentiation, and prokaryotic-like
nature, mitochondria may survive stresses that prove lethal to the
parent cell. Mitochondria can be released from the cell free,
encapsulated in a membrane, and/or bound to other cellular
components.
[0247] Alternatively, without wishing to be bound by theory, the
nuclei can remain intact, encapsulated in a cell membrane which can
comprise some mitochondria. These damaged cells with very little
cytoplasm and very few organelles, which have lost the epigenetic
control of the nucleus, can then interact and possibly fuse with
organelles that have been extruded. This provides cells with the
subcellular components necessary for growth and replication but the
cells have lost epigenetic control, and therefore a more primitive
(e.g. more pluripotent) state is induced.
Example 3: Protocol for Generating STAP Cells from Mature Somatic
Cells
[0248] Described herein is an improved protocol for generating STAP
cells, regardless of the cells type being studied. The protocol
below is an improvement over the methods described in our Jan. 31,
2014 article published in Nature (Obokata et. Al., Stimulus
triggered fate conversion of somatic cells into pluripotency.
Nature 505. 641-647, 2014) and provides, e.g. increased efficiency
and yield. The protocol is extremely simple, but will vary
slightly, if starting with tissue rather than a cell suspension. It
also will vary depending upon the cell type or tissue with is used
as a starting material.
[0249] In some embodiment, do not skip any steps. In some
embodiments, triturate the cell suspension for a minimum of 30
minutes, until the suspension can be easily triturated up and down
the reduced bore pipettes of the smallest orifices. The protocol is
first described when starting with a suspension of cells, and then
describe additional steps necessary when starting with a soft
tissue.
[0250] Generating STAP Cells when Starting with a Suspension of
Mature Somatic Cells:
A1. Live somatic cells should be suspended in a centrifuge tube,
and then centrifuged at 1200 rpm for 5 minutes. Note: Trypsin-EDTA,
0.05% (Gibco: 25300-054) can be added to the tissue culture dish
containing cells, for 3-5 minutes, to release adherent cells to be
added to the centrifuge tube. A2. Aspirate the supernatant down to
the cell pellet. A3. Resuspend the resulting pellet a concentration
of 1.times.10.sup.6 cells/ml in of Hanks Balanced Saline Solution
(HBSS Ca.sup.+Mg.sup.+ Free: Gibco 14170-112) in 50 ml tube. For
example, the pellet can be resuspended in 2-3 mL HBSS in a 50 mL
tube. A4. Precoat a standard 9'' glass pipette with media (so the
cells do no stick to the pipette--an exemplary pipette is the
Fisher brand 9'' Disposable Pasteur Pipettes: 13-678-20D).
Triturate the cell suspension in and out of the pipette for 5
minutes to dissociate cell aggregates and any associated debris.
This can be done with a fair amount of force. A5. As a final step
in the trituration process, make two fire polished pipettes with
very small orifices as follows: [0251] Heat the standard 9'' glass
pipette over a Bunsen burner and then pull and stretch the distal
(melting) end of the pipette, until the lumen collapses and the tip
breaks off, leaving a closed, pointed glass tip. Wait until the
pipette cools, and then break off the closed distal tip until a
very small lumen is now identifiable. Repeat this process with the
second pipette, but break the tip off a little more proximally,
creating a slightly larger distal lumen. The larger lumen should be
about 100-150 microns in diameter, while the other pipette should
have a smaller lumen of about 50-70 microns. Now triturate the cell
suspension through the pipette with the larger lumen for 10
minutes. Follow this with trituration through the pipette having
the smaller lumen (50-70 microns) for an additional 15 minutes.
Continue to triturate the suspension until it passes easily up and
down the fire polished pipette of the smaller bore. Precoat each
pipette with media. Also, during trituration, aspirating air and
creating bubbles or foam in the cell suspension is to be avoided.
A6. Add HSBB to the suspension to a total volume of 20 ml,
centrifuge at 1200 rpm for 5 minutes and then aspirate the
supernatant. A7. Resuspend the cells in HBSS at a pH of 5.4, at
cell concentration of 2.times.10.sup.6 cells/ml, then place in an
incubator at 37'C for 25 minutes. The pH of the HBSS will increase
with the addition of the cell suspension, so an HBSS solution of
lower than the desired final pH of 5.6 can be used. [0252] When
making the solution acidic, mildly pipette it using a 5 ml pipette
for 10 seconds immediately after adding the acid to the Hanks
Solution. HBSS has a very weak buffering capacity, so any solution
transferred from the supernatant of the previous suspension will
affect the pH of the HBSS drastically. The instructions below will
show how to create HBSS with the optimum pH of 5.6-5.7 for STAP
cell generation according to this experimental embodiment. First,
titrate the pH of pre-chilled HBSS (at 4 degrees C.) with 12N HCl
to a pH of 5.6. This is done by slowly adding 11.6 ul of 12 N HCl
to 50 ml of HBSS. After confirming this pH, sterilize the solution
by filtering through a 0.2 micron syringe filter or bottle top
filter of, into a new sterile container for storage. Please confirm
the final pH of 5.6-5.7 through an initial test experiment with an
appropriate number of cells. Because the pH of the HBSS is so
important, the pH of the solution be checked, re-titrated and
re-sterilized prior to each use. A8. After 25 minutes in the acid
bath, centrifuge the suspension at 1200 rpm for 5 minutes. A9.
Aspirate the supernatant and resuspend the resulting pellet in 5 ml
of what is termed herein "sphere media" (DMEM/F12 with 1%
Antibiotic and 2% B27 Gibco 12587-010) and place at a concentration
of 10.sup.5 cells/cc, within a non-adherent tissue culture dish in
the presence of the following supplements: b-FGF (20 ng/ml), EGF
(20 ng/ml), heparin (0.2%, Stem Cell Technologies 07980). LIF
(1000U) should be added if the cells are murine). In some
embodiments, supplements such as bFGF, EGF and heparin may not be
necessary. After the cells are placed in tissue culture dishes,
they can be gently pipetted using a 5 ml pipette, twice/day for 2
minutes, for the first week, to discourage them from attaching to
the bottom of the dishes. In some embodiment, this can promote good
sphere formation. Add sphere media containing the supplements
described every other day. (Add 1 ml/day to a 10 cm culture dish,
or 0.5 ml/day to a 6 cm dish)
[0253] B. Generating STAP Cells when Starting with Soft Tissues
that Contain Many RBCs.
B1. Place the excised, washed sterile organ tissue into an 60 mm
petri dish containing 50 ul of collagenase. (The spleen may not
need to be exposed to any digestive enzymes.) It is contemplated
herein that different types of collagenase or enzymes are better
for digestion of different organ tissues. B2. Mince and scrape the
tissue for 10 minutes using scalpels and scissors to increase
surface area that is exposed to the collagenase, until the tissue
appears to become gelatinous in consistency. B3. Add an additional
450 ul of collagenase to the dish and place in an incubator/shaker
for 30 minutes at 37'C at 90 RPM. B4. Add 1.5 ml of HBSS to the
dish (yielding a total volume of 2.0 ml) and then aspirate the
entire contents via a 5 ml pipette and place into a 50 ml tube. B5.
Now proceed to triturate as previously described above (step A4-5)
when starting with mature somatic cells. B6. After trituration is
completed (through step A5 when using a culture dish of mature
somatic cells), add 3 ml of HBSS, yielding a volume of 5 ml, to the
15 ml tube and then slowly add 5 ml of Lympholyte to the bottom of
the tube to create a good bilayer. In some embodiments, mixing of
the two solutions should be avoided. B7. Centrifuge this tube at
1000 g for 10 min. Rotate the tube 180.degree. and recentrifuge at
1000 g for an additional 10 min. This will cause the erythrocytes
to form a pellet at the bottom of the tube. B8. Using a standard
9'' glass pipette aspirate the cell suspensions layer between HBSS
and Lympholyte and place in a new 50 ml tube. B9. Add HSBB to the
suspension to a total volume of 20 ml of HBSS and then thoroughly
mix the suspension by pipetting via a 5 ml pipette for 1 minutes.
B10. Centrifuge the solution at 1,200 rpm for 5 minutes and
aspirate the supernatant. B11. For the next steps see A7-9 as
described in this Example.
Example 4: The Restoration by Adult STAP Stem Cells of Normal
Hyperalgesic Responses Diminished by the Chemical Ablation of NK-1
Expressing Neurons in the Rat Spinal Cord
[0254] Spinal cord injury presents with a complex of often chronic
neurological sensory abnormalities, including numbness,
paraesthesias and pain. Understanding the mechanisms underlying any
one of these, and developing effective therapeutics is complicated
by the broad pathological changes resulting from these traumatic
injuries. Described herein is a very specific cytological injury in
the spinal cord to produce a limited but well-defined sensory
deficit which has then been reversed by implanting stressed adult
stem cells (altered by the Stimulus-Triggered Acquisition of
Pluripotency, STAP).
[0255] The highly specific cytotoxin SSP-SAP (20 uL, 1 uM) was
injected into the intrathecal (i.t.) space of the male rat spinal
cord in order to ablate a large majority of the neurokinin-1
receptor (NK1R)-expressing neurons. Two to 3 weeks later the
normally robust hyperalgesic responses to injection of capsaicin
(10 uL, 0.1%) in the plantar hindpaw, consisting of mechanical
hyperalgesia to stimulation by von Frey filaments and thermal
hyperalgesia appearing as a shortening of the latency of withdrawal
to a radiant heat source, were almost absent. Subsequent i.t.
injection of the STAP stem cells, either as a suspension of
individual cells or as spherical aggregates of cells, led to a slow
restoration, over the next 1-2 weeks, of capsaicin-induced
mechanical and thermal hyperalgesia. The restored response had the
same amplitude and time-course as the native, pre-ablation
response, and was fully inhibited by i.t. injection of the NK-1R
antagonist L-733,060 (at 300 uM). Immunocytochemistry of the lumbar
spinal cord from rats with restored hyperalgesic functions revealed
staining of NK-1R throughout the dorsal horn. It thus appears that
STAP stem cells can restore normal function after specific spinal
neuronal loss and present a model for a therapeutic approach to
spinal cord injury.
[0256] Adult male S-D rats were first handled for 4-5 days to
familiarize them with the test arena, to minimize stress-induced
analgesia, and to obtain Naive and initial Baseline behavioral
data. Tactile responsiveness was determined by probing the plantar
surface of one hindpaw with a 15 g von Frey filament (VFH), 10
times every 3 secs. Baseline sensitivity, with no treatments and no
capsaicin equaled .about.1-2 paw withdrawals per 10 probes. Thermal
sensitivity was indicated by the latency for paw withdrawal from a
radiant heat source (Hargreaves method: cutoff time set at 18
sec.). Baseline latency .about.16 sec. Before any intrathecal
injections, the Naive rats' responses to capsaicin injection into
the hindpaw were determined to be: Tactile: 6 withdrawals/10 VFH
probes, and Thermal: 6 sec latency.
[0257] Intrathecal injections were made via a sacral approach,
using a 30 g needle, and delivering either SSP-SAP (modified
Substance P-saporin conjugate), which eliminates most
NK!-R-expressing spinal neurons (Mantyh et al.) or its inactive
congener, Blank-SAP (nonsense peptide conjugated to saporin).
[0258] Several weeks later, when the acute hyper-responsiveness due
to capsaicin had been abolished in SSP-SAP-treated animals (but not
Blank-SAP-treated ones), Stimulus Triggered Activation of
Pluripotency (STAP) stem cells were injected into the same region
of the lumbar spinal cord where SAP conjugates had been
injected.
[0259] Responses to tactile and thermal stimulation after capsaicin
injection were followed for another 5 weeks, at which time the rats
were anesthetized with pentobarbital (75 mg/kg i.p.) and
cardio-perfused with cold saline, then 4% paraformaldehyde. Spinal
cords were sectioned at 50 um thickness and stained with anti-NK1-R
and anti-neuron primary antibodies: [Rabbit ant-NK-1R (lot
#011M4819, Sigma-Aldrich St. Louis, Mo.) 1:5000 (2.3 .mu.g/ml) and
Mouse anti-NeuN (lot #LV1825845, Millipore Billerica, Mass.) 1:500
(2 .mu.g/ml), dissolved in PBS with 1% NDS and 0.3% Triton X-100],
then washed extensively and incubated in the correlate 2.degree.
Abs [Donkey anti-Rabbit Alexa Fluor 555 (lot #819572) and Donkey
anti-Mouse Alexa Fluor 488 (lot #1113537) (Invitrogen, Grand
Island, N.Y., USA), both 1:1000 (2 .mu.g/ml) and were dissolved
with 1% NDS and 0.3% Triton X-100 in PBS] before viewing in a
fluorescence microscope.
[0260] Total numbers of NK-1 and Neu-N immunopositive cell bodies
per tissue section were counted for superficial (I and II) and deep
(III-V) laminae from each of the experimental groups (n=3/group).
Results are expressed as mean percentages of surviving neurons in
superficial and deep laminae in rats that received SSP-SAP (or
vehicle) with or without stem cell treatment.
[0261] Mechanical hyperalgesia, indicated by the drop in paw
withdrawal threshold after capsaicin injection, is reduced in rats
treated with intrathecal SSP-SAP (FIGS. 12A and 12B). Five weeks
after spinal stem cells were implanted the capsaicin-induced
hyperalgesia is restored. Stem cell implant returned the
hyperalgesic response of SSP-SAP-treated rats to that of Naive rats
and of Blank-SAP-treated controls (FIGS. 13A and 13B). The potency
of a specific antagonist of the NK1-R is increased in rats where
capsaicin sensitivity has been restored by stem cell implants
(FIGS. 14A and 14B).
[0262] SSP-SAP is highly effective in ablating NK1R-expressing
neurons in the spinal cord and, thusly, of virtually abolishing the
early hyperalgesic responses to the capsaicin injected into the
hind paw. Delivery of STAP stem cells restores the "normal"
hyperalgesic tactile and thermal responses to capsaicin in SSP-SAP
treated rats. In rats that experienced no change in hyperalgesic
responsiveness due to the injection of Blank-SAP, the delivery of
STAP stem cells had no effect on the responses to capsaicin. The
normalization of the hyperalgesic responses by STAP stem cells was
accompanied by a return of NK1R-IR in the spinal cord. The potency
of an antagonist of NK1R for inhibition of capsaicin hyperalgesia
was enhanced 10-60 times in STAP stem cell restored rats over its
potency in Naive rats or in rats that received Blank-SAP. Without
wishing to be bound by theory, it is contemplated that this might
occur from a change in the affinity of the antagonist for the NK1R
induced by the STAP stem cells or in a difference in the coupling
of NK1R into the overall scheme for hyperalgesic responses in the
restored rats.
[0263] Example 5: Described Herein is a Protocol with Improved
Results in Creating pluripotent STAP stem cells from mature somatic
cells, not dependent on the source of cells. The protocol has been
revised to reflect improved techniques. This protocol utilizes a
combination of individual stresses and approaches that are more
effective in achieving the desired end result; that is, creation of
pluripotent STAP
[0264] Without wishing to be bound by theory, is contemplated
herein that in some protocols described herein, ATP was utilized as
an energy source to improve the viability of the cells and spheres
generated. The addition of ATP resulted in better sphere formation
and was associated with a marked decrease in the pH of the solution
to which the mature cells were exposed. Further exploration of the
utility of a low pH solution containing ATP in generating STAP
cells indicates that while pH alone resulted in the generation of
STAP cells, the use of a low pH solution containing ATP,
dramatically increased the efficacy of this conversion. When this
solution is used in combination with mechanical trituration of
mature cells, the results were even more profound. Consequently,
described herein is a protocol which incorporates these findings to
increase the efficacy of generating STAP cells.
[0265] The described protocol is efficient for generating STAP
cells, regardless of the cell type being studied. In some
embodiments, trituration of the mature cell suspension in the low
pH, ATP enhanced solution proceeds for a minimum of 30 minutes,
e.g., until the suspension can be easily triturated up and down the
reduced bore pipettes of the smallest orifices. First described is
a protocol for use when starting with a suspension of cells, and
then additional steps necessary when starting with a soft tissue
are described.
[0266] A. Generating STAP Cells when Starting with a Suspension of
Mature Somatic Cells:
[0267] A1. Make a low pH HBSS solution containing ACT as follows
and then set aside for use in step A4. Make a stock solution of
ATP, 200 mM, to add to HBSS by adding 110.22 mg of ATP powder
(Adenosine 5' Triphosphate Disodium Salt Hydrate--Sigma A2383) to
each 1 mL of water (MilliQ water). The pH of this solution is about
3.0.
[0268] Place 5 mL of HBSS (with phenol red) [Life Technologies,
14170-161] into a 15 mL tube. Place a clean pH sensor into the
HBSS. Titrate in the ACT stock solution, drop by drop, into the
HBSS until the desired pH of, e.g., 5.0 is obtained. Mix the
solution regularly to ensure that the measurement is accurate.
[0269] In some embodiments, the concentration of ATP in the
resulting solution of HBSS and ATP is from about 0.5 mg/cc to about
100 mg/cc. In some embodiments, the concentration of ATP in the
resulting solution of HBSS and ATP is from about 0.5 mg/cc to about
20 mg/cc. In some embodiments, the concentration of ATP in the
resulting solution of HBSS and ATP is from about 0.5 mg/cc to about
10 mg/cc. In some embodiments, the concentration of ATP in the
resulting solution of HBSS and ATP is from about 1.0 mg/cc to about
7 mg/cc. In some embodiments, the concentration of ATP in the
resulting solution of HBSS and ATP is from about 1.5 mg/cc to about
5 mg/cc. In some embodiments, the concentration of ATP in the
resulting solution of HBSS and ATP is from about 1 mM to about 150
mM. In some embodiments, the concentration of ATP in the resulting
solution of HBSS and ATP is from about 1 mM to about 50 mM. In some
embodiments, the concentration of ATP in the resulting solution of
HBSS and ATP is from about 1 mM to about 15 mM. In some
embodiments, the concentration of ATP in the resulting solution of
HBSS and ATP is from about 2.0 mM to about 10 mM. In some
embodiments, the concentration of ATP in the resulting solution of
HBSS and ATP is from about 2.7 mM to about 9 mM.
[0270] In some embodiments, the concentration of ATP in the
resulting solution of HBSS and ATP is at least about 0.5 mg/cc. In
some embodiments, the concentration of ATP in the resulting
solution of HBSS and ATP is at least about 1.0 mg/cc. In some
embodiments, the concentration of ATP in the resulting solution of
HBSS and ATP is at least about 1.5 mg/cc. In some embodiments, the
concentration of ATP in the resulting solution of HBSS and ATP is
at least about 1 mM. In some embodiments, the concentration of ATP
in the resulting solution of HBSS and ATP is at least about 2.0 mM.
In some embodiments, the concentration of ATP in the resulting
solution of HBSS and ATP is at least about 2.7 mM.
[0271] In some embodiments, higher concentrations of ATP can be
achieved by buffering the solution at and/or around the desired pH.
In some embodiments, the desired pH is at least 5.0. In some
embodiments, the desired pH is at least about 5.0. In some
embodiments, the desired pH is about 5.0. In some embodiments, the
desired pH is at from about 4.0 to about 6.5. In some embodiments,
the desired pH is at from about 5.0 to about 5.7.
[0272] A2. Add the live somatic cells to be treated, as a cell
suspension to a centrifuge tube, and then centrifuge at 1200 rpm
for 5 minutes. In some embodiments, 0.05% (Gibco: 25300-054) can be
added to the tissue culture dish containing cells, for 3-5 minutes,
to release adherent cells to be added to the centrifuge tube.
[0273] A3. Aspirate the supernatant down to the cell pellet
[0274] A4. Resuspend the resulting pellet at a concentration of
1.times.106 cells/ml in the low pH, Hanks Balanced Saline Solution
with ATP, (made above in Step 1A) in a 50 ml tube. In some
embodiments, a volume of 2-3 ml of the cell suspension in a 50 ml
tube can be used.
[0275] A5. Precoat a standard 9'' glass pipette with media (so the
cells do not stick to the pipette--e.g., Fisher brand 9''
Disposable Pasteur Pipettes: 13-678-20D). Triturate the cell
suspension in and out of the pipette for 5 minutes to dissociate
cell aggregates and any associated debris. This can be done with a
fair amount of force.
[0276] A6. As a final step in the trituration process, make two
fire polished pipettes with very small orifices as follows: Heat
the standard 9'' glass pipette over a Bunsen burner and then pull
and stretch the distal (melting) end of the pipette, until the
lumen collapses and the tip breaks off, leaving a closed, pointed
glass tip. Wait until the pipette cools, and then break off the
closed distal tip until a very small lumen is now identifiable.
Repeat this process with the second pipette, but break the tip off
a little more proximally, creating a slightly larger distal lumen.
The larger lumen should be about 100-150 microns in diameter, while
the other pipette should have a smaller lumen of about 50-70
microns. Now triturate the cell suspension through the pipette with
the larger lumen for 10 minutes. Follow this with trituration
through the pipette having the smaller lumen (50-70 microns) for an
additional 15 minutes. Continue to triturate the suspension until
it passes easily up and down the fire polished pipette of the
smaller bore. Again, remember to precoat each pipette with media.
Also, during trituration, try to avoid aspirating air and creating
bubbles or foam in the cell suspension.
[0277] A7. Add normal HBSS (containing no ATP) to the suspension to
a total volume of 20 ml, centrifuge at 1200 rpm for 5 minutes and
then aspirate the supernatant.
[0278] A8. Resuspend the resulting pellet in 5 ml of what we term
"sphere media" (DMEM/F12 with 1% Antibiotic and 2% B27 Gibco
12587-010) and place at a concentration of 105 cells/ml, within a
non-adherent tissue culture dish in the presence of the following
supplements: b-FGF (20 ng/ml), EGF (20 ng/ml), heparin (0.2%, Stem
Cell Technologies 07980). LIF (1000U) should be added if the cells
are murine). In some embodiments, supplements such as bFGF, EGF and
heparin may not be necessary. After the cells are placed in tissue
culture dishes, they should be gently pipetted using a 5 ml
pipette, twice/day for 2 minutes, for the first week, to discourage
them from attaching to the bottom of the dishes. This is important
to generate good sphere formation. Add sphere media containing the
supplements described every other day. (Add 1 ml/day to a 10 cm
culture dish, or 0.5 ml/day to a 6 cm dish.)
[0279] B. Generating S'L'AP Cells when Starting with Soft Tissues
that Contain Many RBCs.
[0280] B1. Place the excised, washed sterile organ tissue into an
60 mm petri dish containing 50-500 .mu.l of collagenase, depending
on the size of the tissue. Add a sufficient volume of the
collagenase to wet the entire tissue. Different types of
collagenase or other enzymes are better for digestion of different
organ tissues. (The spleen may not need to be exposed to any
digestive enzymes.)
[0281] B2. Mince and scrape the tissue for 10 minutes using
scalpels and scissors to increase surface area that is exposed to
the collagenase, until the tissue appears to become gelatinous in
consistency.
[0282] It is specifically contemplated herein that in this
embodiment of the method, or any embodiment of the method described
herein, that the scraping of the tissue can be performed with a
flat edged blade and/or surface, e.g., a number 11 scalpel as
opposed to a curved surgical blade. Alternatively, in any
embodiment described herein, application of high frequency sound
waves can be substituted for scraping and/or combined (either
simultaneously or sequentially) in order to disrupt the tissue.
High frequency sound waves can, e.g., disrupt membranes, punch
holes in tissue and/or membranes, and/or cause membrane leakiness.
High frequency sound waves are also amenable being scaled up. One
of skill in the art is familiar with methods for applied high
frequency sound waves to tissues, e.g., commercial sonicators are
available (e.g. The Qsonica Q55 Sonicator, Cat. No. UX-04712-52
available from Cole-Palmer; Vernon Hills, Ill.).
[0283] B3. Add additional collagenase to the dish to make the total
volume=0.5 ml, and place in an incubator/shaker for 30 minutes at
37.degree. C. at 90 rpm.
[0284] B4. Add 1.5 ml of the low pH HBSS/ATP solution to the dish
(yielding a total volume of 2.0 ml) and then aspirate the entire
contents via a 5 ml pipette and place into a 50 ml tube.
[0285] B5. Now proceed to triturate as previously described above
(step A4-5) when starting with mature somatic cells.
[0286] B6. After trituration is completed (through step A5 when
using a culture dish of mature somatic cells), add 3 ml of HBSS,
yielding a volume of 5 ml, to the 15 ml tube and then slowly add 5
ml of Lympholyte to the bottom of the tube to create a good
bilayer. The solution should be added as described to create a
bilayer and avoid mixing of the two solutions.
[0287] B7. Centrifuge this tube at 1000 g for 10 min. Rotate the
tube 180.degree. and recentrifuge at 1000 g for an additional 10
min. This will cause the erythrocytes to form a pellet at the
bottom of the tube.
[0288] B8. Using a standard 9'' glass pipette, aspirate the cell
suspensions layer between HBSS and Lympholyte and place in a new 50
ml tube.
[0289] B9. Add HBSS to the suspension to a total volume of 20 ml of
HBSS and then thoroughly mix the suspension by pipetting via a 5 ml
pipette for 1 minute.
[0290] B10. Centrifuge the solution at 1,200 rpm for 5 minutes and
aspirate the supernatant.
[0291] B11. For the next steps see A6-8.
Sequence CWU 1
1
84125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1gttgttttgt tttggttttg gatat 25226DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2atgggttgaa atattgggtt tattta 26325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
3ccaccctcta accttaacct ctaac 25424DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 4gaggatgttt tttaagtttt tttt
24525DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5aatgtttatg gtggattttg taggt 25625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
6cccacactca tatcaatata ataac 25720DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 7gtcatccttg atctgcccct
20820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 8ggtacttacg atgcccagca 20919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
9ccctgaatat ccctctgct 191020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 10agatggctac atctctcggt
201120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11cactctggac ttggagatgc 201220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
12cttgtcgttg gtgatggtga 201320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 13gttgaagcag ttaatatggc
201420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14agatgagacc aacctggacc 201520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15aggtggagat catcgccaac 201620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 16cgttgaattt gccgtgagtg
201720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17attgccaagt cgttctacga 201820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18aggtcgctta cagattgctg 201920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 19gtctctttag aaaagtgtga
202020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20tacagctttc ttcctggcca 202120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21atgtcagcct tgtggaaatt 202220DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 22gtctgacaga ccaataccat
202320DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 23aacggctgcg tggtgaagcg 202420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24ggacctccct tagagaggga 202520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 25acagtgcctt caggttagtc
202620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 26gcatacaaag aagctgtgag 202722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
27tctttccacc aggcccccgg ct 222828DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 28tgtggggccc tgaaaggcga
gctgagat 282924DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 29gaagtctggt tccttggcag gatg
243020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 30caggtgtttg agggtagctc 203124DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
31actgcccctc atcagactgc tact 243224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
32gttccaacct gtgcctcgcg tctt 243323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33cgtggtgagc atcttcggag tgg 233424DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 34acgagtggca gtttcttctt
ggga 243530DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 35atggacgcaa ctgtgaacat gatgttcgca
303624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 36tgctgcggtc caggccatca agag 243723DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
37tagagctaga ctccgggcga tga 233824DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 38gcgaactcac acaggcgaga
aacc 243920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 39gctgtgtctc aggggattgt 204020DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
40gagacgacct gctacacctg 204120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 41tccctacctg actgcttacg
204220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 42tatgtctgct cgtacccctt 204320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
43tcagacctcg gttcatcttc 204420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 44cttggacctt cgaaggacga
204520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 45tcaaagcgca gaccacctcg 204620DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
46gcatgtcgtc cgcagtaact 204720DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 47tcgacttcgt cttgttcggt
204820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 48tctacctgtt ccgcgtctag 204920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
49tggtgaaggt cggtgtgaac 205020DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 50gtaggacaga aacggatgga
205119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 51gtgtcgatcg ttcttcact 195220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
52attgcagctg caaatccctg 205320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 53tacgattcac ggaccgtgcc
205420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 54aacgataact gatccctggg 205520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
55cagttctacc tgtaggacag 205620DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 56cctccttcca ggtctccgga
205721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 57agcatgccag ccagagtcac t 215820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
58actccaatct gagcaagacc 205920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 59gttatatgct gaacgaggtc
206023DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 60tgcgggcgga catggggaga tcc 236128DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
61atgggccgcc atacgacgac gctcaact 286220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
62actcgataca ctggcctagc 206320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 63cggttcatca tggtacagtc
206424DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 64cactgccttg tactcgggta gctg 246526DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
65agcgaggcat ggagagagcg gagcag 266623DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
66ccttcttggt ccgcccgttc tta 236724DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 67tatgactcac ttccaggggg
cact 246830DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 68ctttgaggtc ctggtccatc acgtgaccat
306924DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 69gggcactgtt cagttcagcg gatc 247023DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
70ttgccttaaa caagaccacg aaa 237123DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 71tcgcttcctc ttcctccgac aca
237220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 72cactctcggc ctgtcttttc 207325DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
73gttgttttgt tttggttttg gatat 257426DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
74atgggttgaa atattgggtt tattta 267525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
75ccaccctcta accttaacct ctaac 257624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
76gaggatgttt tttaagtttt tttt 247725DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
77aatgtttatg gtggattttg taggt 257825DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
78cccacactca tatcaatata ataac 257920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
79gcacctgtgg ggaagaaact 208025DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 80tgagagctgt ctcctactat cgatt
258121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 81agaactggga ccactccagt g 218224DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
82ttcaccctct ccactgacag atct 248324DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
83ctaggccaca gaattgaaag atct 248425DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
84gtaggtggaa attctagcat catcc 25
* * * * *
References