U.S. patent application number 17/368699 was filed with the patent office on 2022-02-03 for amplification with primers of limited nucleotide composition.
The applicant listed for this patent is ATILA BIOSYSTEMS INCORPORATED. Invention is credited to Xin Chen, Youxiang Wang, Zhijie Yang.
Application Number | 20220033891 17/368699 |
Document ID | / |
Family ID | |
Filed Date | 2022-02-03 |
United States Patent
Application |
20220033891 |
Kind Code |
A1 |
Wang; Youxiang ; et
al. |
February 3, 2022 |
AMPLIFICATION WITH PRIMERS OF LIMITED NUCLEOTIDE COMPOSITION
Abstract
The invention provides methods of amplification from a single
primer or a pair of forward and reverse primers of limited
nucleotide composition. Limited nucleotide composition means that
the primers are underrepresented in at least one nucleotide type.
Such primers have much reduced capacity to prime from each other or
to extend initiated by mispriming from other than at their intended
primer binding sites in a target nucleic acid.
Inventors: |
Wang; Youxiang; (Mountain
View, CA) ; Yang; Zhijie; (Mountain View, CA)
; Chen; Xin; (Mountain View, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
ATILA BIOSYSTEMS INCORPORATED |
PALO ALTO |
CA |
US |
|
|
Appl. No.: |
17/368699 |
Filed: |
July 6, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15569080 |
Oct 24, 2017 |
11091799 |
|
|
PCT/US16/29054 |
Apr 22, 2016 |
|
|
|
17368699 |
|
|
|
|
62152756 |
Apr 24, 2015 |
|
|
|
International
Class: |
C12Q 1/6848 20060101
C12Q001/6848 |
Claims
1. A method of amplifying a segment of a target nucleic acid
comprising: contacting a sample comprising a target nucleic acid
with forward and reverse primers; and conducting an amplification
reaction wherein an amplified segment of the target nucleic acid is
formed by extension of the forward and reverse primers with the
target nucleic acid serving as a template; wherein the primers are
underrepresented in one or more of the four standard nucleotide
types, the underrepresented nucleotide type(s) being the same in
the primers, and the amplified segment is the predominant
amplification product formed from by extension of the forward
and/or reverse primers.
2. The method of claim 1 wherein the target nucleic acid has a
strand comprising a complement of a forward primer binding site and
a reverse primer binding site.
3. The method of claim 1 wherein the target nucleic acid has a
strand comprising a forward primer binding site and a reverse
primer binding site.
4. The method of claim 1, wherein the amplified segment constitutes
at least 99% of all amplification products formed by extension of
the forward and reverse primers.
5. The method of claim 1, wherein the forward and reverse primers
have greater complementarity to the forward and reverse primer
bindings sites than to any other pair of primer binding sites
supporting amplification in the sample.
6. The method of claim 1, wherein the forward and reverse primers
have one and only one of the four standard nucleotide types
underrepresented.
7. The method of claim 1, wherein the forward primer binding site
and the reverse primer binding site are underrepresented in the
complement of the underrepresented nucleotide type in the forward
and reverse primers.
8. The method of claim 1, wherein the forward and reverse primers
have no more than two units of the underrepresented nucleotide type
and the forward primer binding site and the reverse primer binding
site have no more than four units of the complement of the
underrepresented nucleotide type.
9. The method of claim 1, wherein the forward and reverse primers
have no more than one unit of the underrepresented nucleotide type
and the forward primer binding site and the reverse primer binding
site have no more than two units of the complement of the
underrepresented nucleotide type.
10. The method of claim 1, wherein the underrepresented nucleotide
type(s) in the forward and reverse primers do not occupy the 3'
positions of the forward and reverse primers.
11. The method of claim 1, wherein the forward and reverse primers
consist of the three nucleotides other than the underrepresented
nucleotide type and the forward primer binding site and the reverse
primer binding site consist of the three nucleotides other than the
complement of the underrepresent nucleotide in the forward and
reverse primers.
12. The method of any of claim 1, wherein the forward and reverse
primer has one unit of underrepresented nucleotide at the 5'
end.
13. The method of claim 1, wherein the forward and reverse primers
have two of the standard four-nucleotide-types
underrepresented.
14. The method of claim 13, wherein the forward primer binding site
and the reverse primer binding site are underrepresented in the
complements of the underrepresented nucleotide types in the forward
and reverse primers.
15. The method of claim 1, wherein the complement of the forward
primer binding site and the reverse primer binding site are
contiguous.
16. The method of claim 1, wherein the complement of the forward
primer binding site and the reverse primer binding site are
separated by a region excluding the underrepresented nucleotide
type in the forward and reverse primers and its complement
17. The method of claim 1, wherein the complement of the forward
primer binding site and the reverse primer binding site are
separated by a region including the underrepresented nucleotide in
the forward and reverse primers or its complement or both.
18. The method of claim 1, wherein the 3' nucleotide of the forward
and/or reverse primers is the complement of the underrepresented
nucleotide in the forward and reverse primers.
19. The method of claim 1, wherein the 3' nucleotide of the forward
and/or reverse primers is C or G.
20. The method of claim 1, wherein the forward and/or reverse
primer contains an unnatural nucleotide, which is inosine, isoC,
isoG, 7-deaza-2'-deoxyguanosine, or 7-deaza-2'-deoxyadenosine.
21-84. (canceled)
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] The present application is a continuation of U.S. patent
application Ser. No. 15/569,080 filed Oct. 24, 2017, which is a US
national stage of PCT/US2016/029054 filed Apr. 22, 2016, which
claims the benefit of U.S. 62/152,756 filed Apr. 24, 2015, each
incorporated by reference in its entirety for all purposes.
REFERENCE TO A SEQUENCE LISTING
[0002] This application includes an electronic sequence listing in
a file named 558381SEQLST.txt, created on Jul. 6, 2021 and
containing 23,599 bytes, which is hereby incorporated by reference
in its entirety for all purposes.
BACKGROUND
[0003] PCR amplification was invented by Kary Mullis in 1983
(Mullis, 1987 U.S. Pat. No. 4,683,202; Saiki et al., 1985, Science
(New York, N.Y.), 230(4732), 1350-1354), for which he later won the
Nobel Prize. Since then, various primer-based template dependent
nucleic acid amplification methods have been described including
the strand displacement assay (George T. Walker, Little, &
Nadeau, 1993, U.S. Pat. No. 5,270,184; George T. Walker, 1995, U.S.
Pat. No. 5,455,166; G. T. Walker et al., 1992, Nucleic Acids
Research, 20(7), 1691-1696, 1992, Proceedings of the National
Academy of Sciences of the United States of America, 89(1),
392-396) and the transcription-based amplification systems,
including the methods described in U.S. Pat. Nos. 5,437,990;
5,409,818; and 5,399,491; the transcription amplification system
(TSA) (Kwoh et al., 1989, Proceedings of the National Academy of
Sciences of the United States of America, 86(4), 1173-1177; Kacian
& Fultz, 1995, U.S. Pat. No. 5,480,784; Kacian & Fultz,
1996, U.S. Pat. No. 5,399,491); and self-sustained sequence
replication (3SR) (Fahy, Gingeras, Guatelli, Kwoh, & Whitfield,
1992, WO 92/08800; Guatelli et al., 1990, Proceedings of the
National Academy of Sciences of the United States of America,
87(5), 1874-1878); ligation chain reaction (sometimes referred to
as oligonucleotide ligase amplification OLA) (Laffler, Carrino,
& Marshall, 1993, Annales De Biologie Clinique, 51(9),
821-826); cycling probe technology (CPT) (Duck, Alvarado-Urbina,
Burdick, & Collier, 1990a, BioTechniques, 9(2), 142-148),
rolling circle amplification (RCA) (Fire & Xu, 1995,
Proceedings of the National Academy of Sciences, 92(10), 4641-4645;
Lizardi, 1998, U.S. Pat. No. 5,854,033), nucleic acid sequence
based amplification (NASBA) (Compton, 1991, Nature, 350(6313),
91-92, Malek, Davey, Henderson, & Sooknanan, 1992), invasive
cleavage technology, Helicase dependent amplification (HDA) (Kong,
Vincent, & Xu, 2004, US 2004-0058378 A1; Kong, Vincent, &
Xu, 2007 US pat. US2007/0254304 A1), Exponential amplification
(EXPAR) (Van Ness, Van Ness, & Galas, 2003, Proceedings of the
National Academy of Sciences of the United States of America,
100(8), 4504-4509), Hybridization chain reaction (HCR)(R. M. Dirks
& Pierce, 2004, Proceedings of the National Academy of Sciences
of the United States of America, 101(43), 15275-15278, R. Dirks
& Pierce, 2012, U.S. Pat. No. 8,105,778), and catalyzed hairpin
assembly (CHA) (Li, Ellington, & Chen, 2011, Nucleic Acids
Research, 39(16), e110). All of the above references are
incorporated herein by reference. Although the nucleic acid
amplification technique has been widely adopted, it is not without
drawbacks limiting its accuracy and sensitivity. The intended
amplification product usually results from extension from a pair
forward and reverse primers binding to their perfectly
complementary primer binding sites. But unintended amplification
products can arise from the primers duplexing and each serving as a
template for extension of the other (primer-dimer) or from primers
priming from secondary (unintended) primer binding sites having
varying degrees of mismatch by conventional Watson-Crick pairing
rules. In consequence, the intended amplification product is
synthesized together with various unintended or background
products. The presence of these unintended or background products
becomes more significant as the initial concentration of the
intended target in the sample is decreased or as the number of
cycles of PCR increases (see FIGS. 2 and 3 comparing conventional
primers with limited composition of primers of the invention) or
when more than one pair of primers is used as in multiplex
amplification. In consequence, the sensitivity of detection is
limited as is the range of cycles over which a linear increase in
signal of a desired amplification product can be detected.
[0004] Non-specific amplification can be reduced by reducing the
formation of primer extension products prior to the start of the
reaction. In one method, referred to as a "hot-start" protocol, one
or more critical reagents are withheld from the reaction mixture
until the temperature is raised sufficiently to provide the
necessary hybridization specificity. Manual hot-start methods, in
which the reaction tubes are opened after the initial high
temperature incubation step and the missing reagents are added, are
labor intensive and increase the risk of contamination of the
reaction mixture. Alternatively, a heat sensitive material, such as
wax, can be used to separate or sequester reaction components, as
described in (Bloch, Raymond, & Read, 1995 U.S. Pat. No.
5,411,876), incorporated herein by reference, and (Chou, Russell,
Birch, Raymond, & Bloch, 1992, Nucleic Acids Research, 20(7),
1717-1723), incorporated herein by reference. In these methods, a
high temperature pre-reaction incubation melts the heat sensitive
material, thereby allowing the reagents to mix.
[0005] Another method of reducing the formation of primer extension
products prior to the start of the reaction relies on the
heat-reversible inactivation of the DNA polymerase. Birch, Laird,
& Zoccoli, 1997 U.S. Pat. No. 5,677,152; Birch, Laird, &
Zoccoli, 1998 U.S. Pat. No. 5,773,258, both incorporated herein by
reference, describe DNA polymerases reversibly modified by the
covalent attachment of a modifier group. Incubation of the
inactivated DNA polymerase at high temperature results in cleavage
of the modifier-enzyme bond, thereby reactivating the enzyme.
[0006] Non-covalent reversible inhibition of a DNA polymerase by
DNA polymerase-specific antibodies is described in Scalice,
Sharkey, Christy Jr., Esders, & Daiss, 1994, U.S. Pat. No.
5,338,671, incorporated herein by reference.
[0007] Non-specific amplification also can be reduced by
enzymatically degrading extension products formed prior to the
start of the reaction using the methods describe in Gelfand, Kwok,
& Sninsky, 1995, U.S. Pat. No. 5,418,149, which is incorporated
herein by reference. The degradation of newly-synthesized extension
products is achieved by incorporating into the reaction mixture
dUTP and UNG, and incubating the reaction mixture at 45-60.degree.
C. prior to carrying out the amplification reaction. Primer
extension results in the formation of uracil-containing DNA, which
is degraded by UNG under the pre-amplification conditions. A
disadvantage of this method is that the degradation of extension
product competes with the formation of extension product and the
elimination of non-specific primer extension product may be less
complete. An advantage of this method is that uracil-containing DNA
introduced into the reaction mixture as a contamination from a
previous reaction is also degraded and, thus, the method also
reduces the problem of contamination of a PCR by the amplified
nucleic acid from previous reactions.
[0008] Another method of reducing the formation of primer extension
products prior to the start of the reaction relies on the use of
primers modified at or near the 3' end by the addition of a moiety
to an exocyclic amine, as described in Will, 1999, U.S. Pat. No.
6,001,611, incorporated herein by reference.
[0009] Despite efforts to reduce non-specific amplification, most
methods are focused on reducing false positive products from primer
extension at low temperature. Few methods address the problem of
false positive products from primer interaction at high temperature
after amplification cycle get started, which is described herein as
transient interaction from primers during amplification process.
This problem increases as more and more primers are multiplexed in
amplification reactions to achieve high-throughput results.
Transient interaction forms when internal segments of primers
hybridize with each other within one primer or between primers. The
hybridizations can be consecutive base pairs following Watson-Crick
pairing rules, or base pairs mixed with Watson-Crick pairing
(perfect match) and non-Watson-Crick pairing (mismatch or
mispairing). DNA mismatch formation in solution has been reviewed
by Seela & Budow, 2008, Molecular bioSystems, 4(3), 232-245.
Among eight possible mismatches, GG, GT, and GA pairs are most
stable. Although mismatch base pairs are less stable than
Watson-Crick pairs and stability is influenced by base context of
sequences, the problem is particularly serious as more and more
primers are multiplexed in amplification reactions to achieve
high-throughput results which results in extreme sequence
diversity. In theory, mismatches close to 3' terminal of primers
dramatically influence primer extension efficiency. While this is
true, Kwok et al., 1990, Nucleic Acids Research, 18(4), 999-1005
and Stadhouders et al., 2010, The Journal of Molecular Diagnostics:
JMD, 12(1), 109-117 showed that 3' end mismatches had from minor to
severe effect; however, none eliminated primer extension. When
mismatches are located at #2 position of 3' end of primers, only AA
GA pairs had a strong detrimental effect on primer extensions.
Collectively, DNA duplexes with mismatches form through transient
interactions during both pre-amplification and amplification.
Dynamic pairing (perfect matches or mismatches) of 3' nucleotides
of primers with a template initiate primer extension resulting in
unintended amplification products.
SUMMARY
[0010] Primer-primer interaction and non-specific amplification
have been fundamental problems in all amplification methods. To
address this fundamental issue, a novel primer or probe design
method has been discovered that can substantially suppress the
primer dimer and unwanted side reaction amplification products. The
invention provides a method of amplifying a segment of a target
nucleic acid comprising: contacting a sample comprising a target
nucleic acid with forward and reverse primers; conducting an
amplification reaction wherein an amplified segment of the target
nucleic acid is formed by extension of the forward and reverse
primers with the target nucleic acid serving as a template; wherein
the primers are underrepresented in one or more of the four
standard nucleotide types, the underrepresented nucleotide type(s)
being the same in the primers, and the amplified segment is the
predominant amplification product formed from by extension of the
forward and/or reverse primers.
[0011] The invention further provides a method of amplifying a
target nucleic acid comprising contacting a target nucleic acid
with primers having a 3' hybridization segment which randomly
varies among primers linked to a 5' artificial segment, which is
the same in different primers and, wherein the 5' artificial
segment consists of only three types of nucleotide except that the
5' nucleotide can be the underrepresented nucleotide; and the 3'
segment consists of the same three types of nucleotides except that
up to 20% of its units can be the fourth nucleotide type at
positions except the 3' end.
[0012] The invention further provides a method of amplifying a
target nucleic acid comprising contacting a target nucleic with
random primers consisting of the four nucleotide types A, T, C and
I (Inosine).
[0013] The invention further provides a method of extending a
segment of a target nucleic acid comprising contacting a sample
comprising a target nucleic acid with a primer; conducting an
extension reaction wherein an extended segment of the target
nucleic acid is formed by extension of the primer; wherein the
primer is underrepresented in one or more of the four standard
nucleotide types, and the extended segment is the predominant
extension product formed from extension of the primer.
[0014] In the disclosed invention, the target to be detected can
contain a particular region wherein the primer or probe
hybridization or binding region contains three types of nucleotides
only. In such a situation, the composition of the primer or probe
would also have three types of nucleotides only: ATC, ATG, ACG, and
TCG. The missing nucleotide is called an underrepresented
nucleotide. The underrepresented nucleotide can be one type of
nucleotide, or two types of nucleotides or three types of
nucleotides in a primer or probe. As an example of composition of
the primer or probe has ATC only, the underrepresented nucleotide
is G. The primer contains three types of nucleotides with option
which the 3' nucleotide is complementary with the underrepresented
nucleotide. For instance, for the ATC primer, the 3' end nucleotide
is C that is complementary with the underrepresented nucleotide G.
This three nucleotide-type primer or probe does not form primer
dimer to produce false positive products because the 3' end of the
primer or probe is always mismatched and cannot be extended. These
kinds of primers or probes are called underrepresented primers or
probes. The primer binding site is called an underrepresented
binding site. In a template amplification system, suitable reagents
are included to extend the underrepresented primer with a target
nucleic acid as template. In a signal amplification system,
suitable reagents are included to allow an underrepresented probe
to hybridize with target to generate detection signal.
[0015] In a situation of exponential amplification such as PCR, two
primers are needed. One or both primers can be underrepresented
primers. In the situation of both forward and reverse primers are
underrepresented primers, a target nucleic acid to be detected can
have a region contains three segments: the forwarded primer binding
segment, reverse primer binding segment, and the segment between
two primers binding sites. Both primer binding segments contains
the same three nucleotide types. The segment between two primers
binding sites contains zero nucleotides or nucleotides that do not
have underrepresented nucleotide and complementary nucleotides of
underrepresented nucleotide. In such a situation, PCR amplification
needs three types of deoxyribonucleotide triphosphates only. These
kinds of forward and reverse underrepresented primer do not use
each other as template to form primer dimer products. In addition,
unwanted amplification products from both forward and reverse
underrepresented primer mis-hybridization are terminated because
the system does not have fourth nucleotides. Software is designed
to search for the region in the target suitable for such
amplification.
[0016] In another embodiment, the above mentioned amplification
system may include dideoxynucleotide triphosphate(s) complementary
to the underrepresented nucleotide(s) in primers. Any unwanted
extension product from both forward and reverse primers is
terminated by incorporation of the dideoxynucleotide.
[0017] In another embodiment, in which an underrepresented primer
binding segment in the target cannot be found, the underrepresented
primer may contains limited number of underrepresented nucleotides,
such as one or two or three, no more than 20% of the primer length.
Primers contain one or two or three underrepresented nucleotides
can dramatically reduce the primer-primer interaction, while
increasing primer-template hybridization efficiency. When a limited
number of underrepresented nucleotides are included in the primer,
the reaction system needs to include a set of all four types of
deoxynucleotides triphosphate for amplification.
[0018] In another embodiment, when a limited number of
underrepresented nucleotides is included in the underrepresented
primer, a reduced amount of deoxynucleotide triphosphates
complementary to the underrepresented nucleotide(s) may be used in
the amplification system. The reduced amount can be 99% to 0.001%
relative to the regular amount of deoxynucleotide triphosphates in
the amplification system.
[0019] In another embodiment, wherein an underrepresented primer
binding segment in the target cannot be found, the primers may have
limited number of mismatch base pairs to exclude at least one or
all underrepresented nucleotides in the underrepresented
primers.
[0020] In another embodiment, when an underrepresented primer
hybridizes to a primer binding segment with a limited number of
mismatch base pairs, many approaches can be used to enhance
underrepresented primer hybridization efficiency. For instance, a
mismatch binding reagent can be included in the amplification
system to improve underrepresented primer hybridization efficiency.
For instance, primer hybridization efficiency with C-C mismatch can
be enhanced by including a silver ion, a rhodium complex, a
2-amino-7-methyl-1,8-naphthyridine derivative, and so forth.
[0021] In another embodiment, an underrepresented primer can be
used to amplify any segment of target while regular set of all four
types of deoxynucleotide triphosphates are included in the
amplification system.
[0022] In another embodiment, the 5' end of the underrepresented
primers are the underrepresented nucleotides to inhibit any
produced primer dimer products to be further used as primer to
produce concatemer primer dimer.
[0023] In another embodiment, the primer consists of a 3' segment
with limited nucleotide composition, a 5' segment with regular four
types of nucleotide composition, and a linker between two segments
with artificial sequences of same limited nucleotide composition as
the 3' segment.
[0024] In another embodiment, the linker described above can form a
hairpin structure.
[0025] In another embodiment, the underrepresented primer need a
junction probe to co-hybridize with target to form a three way
junction structure to facilitate underrepresented primer binding to
its binding site.
[0026] In another embodiment, the underrepresented primers have
artificial sequences tailed on their 5' end.
[0027] In another embodiment, when the underrepresented primers
have artificial sequences in the 5' segment, the artificial
sequences may include sequences that will interact with specific
enzymes or form particular chemical recognition structures before
or after the synthesis of the complementary strand of the primer.
Optionally, the forward or reverse primer is linked to an enzyme
recognition segment. For instance, for nicking amplification, the
artificial sequences will include restriction enzyme recognition
sequences, which can be a nuclease recognition site. For
transcription amplification such as TMA (transcription mediated
amplification), the artificial sequences will include promoter
sequences. The 5' end sequence may form G-quadruplex structure to
recognize specific ligand, and so forth. The artificial sequences
may also include barcode.
[0028] In another embodiment, the underrepresented primer is a
degenerate primer mixture. In another embodiment, the
underrepresented primer is a random primer mixture. All
oligonucleotides in the mixture are underrepresented in the same
nucleotide type(s). In some embodiments, the primer has more than
1%, but no more than 20% underrepresented nucleotides. In some
embodiments, the degenerate primer or random primer has a 5' tail
with an artificial sequence.
[0029] In another embodiment, when target sequences are from
organisms of a variety of species or genotypes, or a mixture of
more than one alleles, a primer with underrepresented nucleotide(s)
can contain degenerate bases at certain positions to match
different sequence variations and the amplification may include a
combination of an underrepresented primer and a degenerate primer.
The concentration ratio of the underrepresented primer and the
degenerate primer can be varied.
[0030] In another embodiment, the underrepresented primer is
provided with a helper primer to facilitate target hybridization
and amplification. The helper primer binds to the same primer
binding site as the underrepresented primer with fewer number of
mismatches. The helper primer is provided in low concentration
(e.g., .ltoreq.0.01%, 0.1%, 0.5%, 1%, 2%, 5%, 10%, or 50% of the
concentration of the underrepresented primer).
[0031] In another embodiment, when more than one underrepresented
primers or probes are needed. The primers or probes may bind to
opposite or the same strands of template. For three ways junction
signal amplification, two probes will hybridize to the same stand.
For PCR amplification, forward and reverse underrepresented primers
will hybridize to opposite stands.
[0032] In another embodiment, after the underrepresented primer or
probe hybridizes with a target nucleic acid, an extension reaction
to amplify the target may be linear amplification or exponential
amplification and the amplification condition may be isothermal or
temperature cycling.
[0033] In another embodiment, when one or more than one primers or
probes are used in a reaction system, not all the primers or probes
needs to be underrepresented primers. For instance in LAMP
amplification, four primers are needed. BIP or FIP or both BIP and
FIP can be underrepresented primer. But the other primers are not
necessary to be underrepresented primers.
[0034] In another embodiment, when one underrepresented probe is
needed, such as padlock probe, 3' end segment or 5' end segment or
both 3' end segment and 5' end segment of the probe can have the
same type of underrepresented nucleotides. The linker between 3'
end and 5' end can be any artificial sequences.
[0035] In another embodiment, in high multiplex amplification
systems, multiple pairs of underrepresented primers are needed. In
some embodiments, the multiple pairs of underrepresented primers
have one or more than one kind of universal sequence at the 5' end.
The 5' end universal sequences can be any artificial sequences. In
multiplex amplification, the amplification targets may be from the
same gene, or different genes, or from the same sample or different
samples.
[0036] In another embodiment, the underrepresented primer or probe
may have unnatural nucleotides such as inosine, 5' nitroindole,
7-deaza-2'-deoxyadenosine, 7-deaza-2'-deoxyguanosine, IsoC, or
isoG. The underrepresented primer or probe may also be PNA, LNA,
and so forth. In some embodiments, inclusion of the above unnatural
nucleotides in the primer increases its Tm and hybridization
efficiency to template.
[0037] In another embodiment, the underrepresented primer is
attached at its 5' end by an oligonucleotide segment that can form
a stem loop structure. The 5' terminal base of the segment is the
complement to the underrepresented nucleotide. When two such
primers are used in PCR amplification with three types of
deoxynucleotide triphosphates included in the amplification system,
the amplified product can be ligated to form a circular product
with ligase. In another embodiment, when only one primer has the 5'
stem loop structure, the amplification product is ligated to form a
hairpin structure.
[0038] In another embodiment, the underrepresented primer contains
an underrepresented nucleotide internally. When the deoxynucleotide
triphosphate complementary to the underrepresented nucleotide is
not included in the reaction, the extension will stop at the
internal underrepresented nucleotide of the primer and the
amplification product will contain a designed stick end. The
designed stick end may be ligated with any kinds of adapters for
downstream application.
[0039] In another embodiment, one, two, or three types of dNTPs are
provided in the underrepresented primer reaction.
[0040] In another embodiment, deoxyinosine triphosphate, and/or
7-deaza-2''-deoxyguanosine 5''-triphosphate, and/or
7-deaza-2''-deoxyadenosine 5''-triphosphate is provided in the
amplification reaction.
[0041] In another embodiment, four types of dNTPs are provided, but
one, two, or three types of dNTPs are at different concentrations
for underrepresented primer extension reaction.
[0042] In another embodiment, one, two, or three types of
nucleotide triphosphate monomers are provided in the
underrepresented primer extension reaction.
[0043] In another embodiment, unnatural nucleotide triphosphate
monomers are provided in the underrepresented primer extension
reaction.
[0044] In another embodiment, when more than one underrepresented
primers are used, primers may be provided in different
concentrations in reactions. For instance, one primer in higher
concentration will carry out asymmetric amplification.
[0045] In another embodiment, the underrepresented primers or
probes may be coated or attached to a surface such as beads or
glass surfaces. For amplification reaction, either forward primer
or reverse primer or both forward and reverse primer may be
attached to a surface.
[0046] In another embodiment, for multiplex amplification with
multiple pairs of underrepresented primers, the amplification
products may be detected with microarray, sequencing, beads, or as
nanoparticles. One of a pair underrepresented primers is grafted to
a surface in conjunction with free primers in solution. These
methods allow the simultaneous amplification and attachment of a
PCR product onto the surface. Optionally both primers may be
grafted to a surface for amplification. The pattern of how
underrepresented primers or probes attach to a surface may be coded
or non-coded, or randomly distributed.
[0047] In another embodiment, amplification is detected with
fluorescent intercalating dyes, fluorescent probes, detection label
tags, mass tags, electrophoresis, magnetic tags, or melting curve
analysis.
[0048] In another embodiment, one underrepresented primer is linked
at its 5' end to an artificial oligonucleotide whose melting
temperature is different from an amplification product primed from
that primer. The amplification reaction is monitored based on a
transition from the melting peak of the artificial oligonucleotide
to that of the amplification product. Such a format can be
multiplex by linking different primers to different artificial
oligonucleotides having different melting temperatures. In another
embodiment, underrepresented primers are attached on their 5' end
by artificial sequences which can form a stem-loop structure with a
melting temperature different from the melting temperatures of
amplicons. In some embodiments, melting curve analysis is measured
from presence of a double-stranded intercalating dye. In another
embodiment, a fluorophore and a quencher are attached to the 5' end
artificial sequences. In another embodiment, the fluorophore and
the quencher are attached to the complementary sequence of the 5'
end artificial sequences. In another embodiment, the fluorophore
and the quencher are attached to the 5' end artificial sequence and
the complementary sequences of the 5' end artificial sequences
separately. In another embodiment, the 5' end artificial sequences
of the underrepresented primer can form a stem-loop structure.
[0049] In some embodiments, in a multiplex reaction,
underrepresented primers are attached at their 5' ends to more than
one types of artificial sequence. One or more than one type of
complementary sequences of the 5' end artificial sequences are
included in the reaction. In some embodiments, different
complementary sequences of the 5' end artificial sequences are
attached with different fluorophore and quencher. In another
embodiment, multiple 5' end artificial sequences on the
underrepresented primers can form double strands with a common
complementary sequences of the 5' end artificial sequences. But the
5' end artificial sequences are different by only one or more than
one mutations. The disappearance of a melt peak indicates its
corresponding target is present.
[0050] In another embodiment, an oligonucleotide labeled with a
fluorophore and a quencher is provided in the template
amplification reaction. The oligonucleotide is complementary to a
segment on the amplicon. During melt curve analysis after
amplification reaction, the oligonucleotide dissociate from bound
amplicon and a melt peak at its Tm indicates the presence of
template. In some embodiments, multiple oligonucleotides with
different Tm are provided in the reaction. In some embodiments, the
segment on amplicon that hybridizes with the oligonucleotide
contains mutations to alter the Tm. In some embodiments, multiple
oligonucleotides labeled with different fluorophores are included
in the reaction, melt curve analysis is done in multiple channels
to increase multiplicity.
[0051] In another embodiment, one underrepresented primer is
attached on its 5' end by a fluorophore labeled artificial
sequence. An oligonucleotide labeled with a quencher is also
provided in the reaction. The quencher oligonucleotide hybridizes
with the underrepresented primer and the fluorescence is quenched.
On template amplification, the underrepresented primer participates
in primer extension and becomes a double-stranded amplicon. The
quencher oligonucleotide dissociates from the primer and
fluorescence is released.
[0052] In another embodiment, one underrepresented primer is linked
on its 5' end to an artificial sequence that has an
underrepresented nucleotide on its 3' end. An oligonucleotide
labeled with a fluorophore and a quencher is also provided in the
reaction. The oligonucleotide hybridizes with the artificial
sequence on primer and the hybridization region covers the
underrepresented nucleotide. During amplification, 5' nuclease
activity of DNA polymerase digests the oligonucleotide separating
the fluorophore and quencher and releases fluorescence. Extensions
terminate at the underrepresented nucleotide and the digested
oligonucleotide dissociates from its binding region allowing
another intact oligonucleotide to hybridize. The process repeats
and signal is amplified.
[0053] In another embodiment, for multiplex amplification with
multiple pairs of underrepresented primers, a universal tail with
artificial sequence is attached to the 5' end of underrepresented
primers. A universal detection probe is also provided in the
reaction, which consists of double-stranded DNA with a 3' overhang
segment. The universal probe is labeled with a fluorophore on one
strand and a quencher on the other strand so that in
double-stranded form the probe is non-fluorescent. The 3' overhang
segment contains the same sequence as the universal tail on
underrepresented primers. The synthesized sequence complementary to
the universal tail hybridizes with the 3' overhang segment of the
universal probe and extension results in separation of the double
strands of the universal probe and releasing of fluorescence. In
some embodiments, more than one types of the universal tail and
universal probe are provided in reaction for multiplex detection.
In some embodiments, the universal probe is a molecular beacon with
3' overhang. In another embodiment, a fluorophore is attached to
the underrepresented primers and double strand intercalating
quencher chemical is provided in the reaction. During exponential
amplification, the liquid quencher intercalates to the amplified
double strands products to quench fluorescent tag for real time
detection. The liquid quencher is a non-fluorescent chemical that
interacts with double strands DNA and quenches proximity
fluorescent tag.
[0054] In another embodiment, a fluorophore is attached to the
underrepresented primers which generates enhanced fluorescence when
the attached primer extends to form a double strand (light-up
probe).
[0055] In another embodiment, a fluorophore is attached to the
underrepresented primers and one type of dNTP is labeled with a
different fluorophore. Real time fluorescence is detected by FRET.
In some embodiments, fluorophore labeled ddNTP is provided.
[0056] In another embodiment, an oligonucleotide template can be
attached to an analyte. For instance, the analyte may be a protein
or an antibody. Amplification of oligonucleotide template with
underrepresented primers indicate the presence of the analyte. In
some embodiments, underrepresented primers or probes are attached
to an analyte. Amplification with the underrepresented primers or
probes indicates the presence or absence of the analyte.
[0057] In another embodiment, the current invention is used for
mutation detection. Such mutations include nucleotide insertions,
deletions, rearrangements, transitions, transversions,
polymorphisms, and substitutions.
[0058] In another embodiment, the current invention provides a kit
for use in sequencing, re-sequencing, gene expression monitoring,
genetic diversity profiling, diagnosis, screening, whole genome
sequencing, whole genome polymorphism discovery and scoring,
transcriptome analysis, or any other applications involving the
amplification or detection of nucleic acids or the sequencing. This
kit can comprise any of the underrepresented primers or primer
pairs or probes described herein and necessary reagents for
specific applications.
[0059] In another embodiment, the invention provides an apparatus
for carrying out the methods of the invention. Such apparatus can
perform for example a sample process, underrepresented primers or
probes mixing, reagent mixing, amplification and signal
detection.
BRIEF DESCRIPTION OF THE DRAWINGS
[0060] FIG. 1 shows a target nucleic acid and exemplary three
nucleotide primers and primer binding sites. The upper portion of
the figure shows one strand of the target nucleic acid containing
the complement of the forward primer binding site (ATC nucleotides)
contiguous with the reverse primer binding site (ATG site). The
lower portion shows the primers bound to their respective binding
sites on opposing strands. Amplification can proceed in the
presence of dTTP, dATP, and dGTP (and other typical PCR components)
but dCTP is not required because there are no G nucleotides in the
strands of the target nucleic acid being amplified. Sequences in
the lower portion of FIG. 1 are, from top to bottom, SEQ ID NO:115,
SEQ ID NO:116 (depicted 3' to 5'), SEQ ID NO:117, and SEQ ID NO:118
(depicted 3' to 5').
[0061] FIGS. 2A, B compare transient primer interaction of
conventional four-nucleotide-type primers (A) and three-nucleotide
primers (B).
[0062] FIGS. 3A, B compare amplification product from primer dimer
amplification of three nucleotide primers (A) with conventional
four-nucleotide-type primers (B).
[0063] FIGS. 4A-B shows real time PCR of human genomic DNA (A) with
three nucleotide-type primers and three dNTPs compared with a no
template control (B).
[0064] FIG. 5 shows a template in which primer binding sites show
three mismatches (forward primer) or two mismatches (reverse
primer) to primers of three nucleotide-type composition. Sequences
in FIG. 5 are, from top to bottom, SEQ ID NO:116 (depicted 3' to
5'), SEQ ID NO:119, SEQ ID NO:120 (depicted 3' to 5'), SEQ ID
NO:117, SEQ ID NO:117, SEQ ID NO:120 (depicted 3' to 5'), SEQ ID
NO:119, and SEQ ID NO:116 (depicted 3' to 5').
[0065] FIG. 6 shows examples of mismatch binding reagents.
Sequences in FIG. 6 are, from top to bottom, SEQ ID NO:116
(depicted 3' to 5'), SEQ ID NO:119, SEQ ID NO:120 (depicted 3' to
5'), and SEQ ID NO:117.
[0066] FIG. 7 shows amplification of a template in which three
nucleotide-type primer binding sites are separated by a segment
including all four-nucleotide-types. Amplification is performed in
the presence of all four-nucleotide-types mononucleotide
triphosphates.
[0067] FIGS. 8A-C show fluorescence over time (A, B) and gel
electrophoresis (C) from amplification with three nucleotide-type
primers and all four dNTPs.
[0068] FIG. 9 compares primer dimer between three nucleotide
primers and four nucleotide primers.
[0069] FIGS. 10A-D shows PCR with primers containing 1 or 2 units
of the underrepresented nucleotide (G). The sequence on the left
side is SEQ ID NO:121, and the sequence on the right side is SEQ ID
NO:122.
[0070] FIGS. 11A-C show amplification with mononucleotide
triphosphate which is the complement of underrepresented nucleotide
present at reduced amount compared with other nucleotide
triphosphates types (A), absent (B) and in the absence of template
(C).
[0071] FIG. 12 shows amplification with the mononucleotide
triphosphate which is the complement of the underrepresented
nucleotide in the primers supplied as a ddNTP.
[0072] FIGS. 13A, B show multiplex detection of multiple templates
with melting curve analysis.
[0073] FIG. 14 shows linking of a three nucleotide-type primer too
short to prime amplification by itself to a toe hold segment.
[0074] FIG. 15 shows an alternative toe hold format.
[0075] FIG. 16A-C shows use of a three way junction when a three
nucleotide primer is too short to support amplification by itself.
FIG. 16A shows a template to be amplified. In FIG. 16B, the
four-nucleotide-type 5' region (sequence 4) of the 3 way junction
helper hybridizes to template. In FIG. 16C, forward primer
extension product hybridizes to reverse primer and generates full
length products.
[0076] FIGS. 17A-B and 18A-B show alternative three-way junction
formats.
[0077] FIG. 19 shows multiplex amplification and detection in which
a three-nucleotide-type primer is linked at its 5' end to an
artificial segment linked to a fluorophore.
[0078] FIGS. 20A, B show florescence over time for template
amplification (A) and no template control (B).
[0079] FIGS. 21A, B shows fluorescence over time for template
amplification (A) and no template control (B).
[0080] FIG. 22 shows asymmetric PCR with an excess of reverse
primer.
[0081] FIG. 23 shows a Taqman.RTM. probe format.
[0082] FIG. 24 shows a molecular beacon format.
[0083] FIG. 25 multiplex amplification and detection using a three
nucleotide-type primer with a universal fluorescent tail and
quencher.
[0084] FIG. 26 Amplification and detection of sticky end
products.
[0085] FIG. 27 amplification and detection of circular
products.
[0086] FIG. 28 whole genome amplification with three
nucleotide-type primers.
[0087] FIG. 29 Use of three nucleotide primers in combination with
nicking amplification or transcription mediated amplification.
[0088] FIG. 30 Use of three nucleotide-type primers for LAMP
amplification or Recombinase Polymerase Amplification.
[0089] FIGS. 31A, B, C: Isothermal amplification by nicking
mechanism, transcription mediated amplification or rolling circle
amplification.
[0090] FIGS. 32A and B show immunoPCR in which a target nucleic
acid is attached to an analyte via one or more antibodies.
[0091] FIG. 33 shows an amplification reaction in which a primer is
labelled with a first fluorophore and a nucleotide triphosphate
used in amplification is labelled with a second fluorophore. Energy
transfer between the fluorophores in the amplification product
generates a signal.
[0092] FIG. 34 shows an amplification reaction which a primer is
labelled with a fluorophore and a nucleotide triphosphate used in
amplification is labelled with a quencher. The signal from
fluorophore is quenched as the amplification product is formed
generating a signal.
[0093] FIG. 35 shows an amplification reaction in which a primer is
labelled with a fluorophore and a DNA intercalating agent is
introduced into the amplification mix. Intercalation of the agent
into the amplification product quenches the signal from the
fluorophore as the amplification product is formed.
[0094] FIG. 36 shows an amplification reaction in which a primer is
labelled with a light up fluorophore. Such a fluorophore has no
signal in the primer, but when the primer is incorporated into am
amplification product, the fluorophore intercalates into the
amplification product and generates a signal.
[0095] FIG. 37 shows a multiplex amplification reaction with
double-stranded tailed underrepresented primers and a detection
method with melt curve analysis.
[0096] FIGS. 38A-E shows a multiplex amplification reaction with
special tailed underrepresented primers and their partially
complementary strand, and a detection method with the 5' Flap
activity of DNA polymerase. FIG. 38A shows the primer and a
complementary oligonucleotide labelled with a fluorophore and
quencher. FIG. 38B shows extension. FIG. 38C shows cleavage of the
fluorophore from its oligonucleotide by 5' Flap endonuclease
activity generating a fluorescent signal. FIGS. 38D and E show
extension and cleavage of another template.
[0097] FIGS. 39A, B show a method of monitoring an amplification
reaction in which one of the primers is linked to an artificial
oligonucleotide tail in an amplification reaction including an
oligonucleotide complementary to the tail labeled with a
fluorophore and quencher. Before amplification (A), the quencher
and fluorophore and quencher are in proximity and the signal is
low. After amplification (B), the labeled oligonucleotide
hybridizes with the complementary primer tail separating the
quencher and fluorophore and increasing the signal.
[0098] FIGS. 40A, B show a method of monitoring an amplification
reaction in which one of the primers is linked to an artificial
oligonucleotide tail including a quencher and fluorophore. Before
amplification (A), the quencher and fluorophore are proximate in
space so the signal is low. After amplification (B), the
fluorophore and quencher are further separated by duplexing of the
artificial oligonucleotide to a complementary strand and the
fluorescent signal is increased.
DEFINITIONS
[0099] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood in the art
to which the invention pertains. The following definitions
supplement those in the art and are directed to the current
application and are not to be imputed to any related or unrelated
case, e.g., to any commonly owned patent or application. Although
any methods and materials similar or equivalent to those described
herein can be used in the practice for testing of the present
invention, the preferred materials and methods are described
herein. Accordingly, the terminology used herein is for the purpose
of describing particular embodiments only, and is not intended to
be limiting. The term "a" or "an" entity refers to one or more of
that entity; for example, "a nucleic acid," represents one or more
nucleic acids. Therefore, the terms "a" (or "an"), "one or more,"
and "at least one" can be used interchangeably herein.
[0100] Nucleic acids include DNA and RNA and DNA-RNA chimeras can
be double-stranded or single-stranded. DNA can be genomic, cDNA, or
synthetic. RNA can be mRNA, tRNA, rRNA, hnRNA among others. The
term "nucleic acid" encompasses any physical string of monomer
units that can be corresponded to a string of nucleotides,
including a polymer of nucleotides (e.g., a typical DNA or RNA
polymer), peptide nucleic acid (PNA), modified oligonucleotides
(e.g., oligonucleotides comprising bases that are not typical to
biological RNA or DNA in solution, such as 2'-O-methylated
oligonucleotides), and the like. A nucleic acid can be e.g.,
single-stranded or double-stranded.
[0101] The four conventional nucleotide bases are A, T/U, C and G
with T being present in DNA and U in RNA. The nucleotides found in
targets are usually natural nucleotides (deoxyribonucleotides or
ribonucleotides). Such is also the case is nucleotides forming
primers.
[0102] Complementarity of nucleic acid strands means that the
strands form a stabile duplex due to hydrogen bonding between their
nucleobase groups. The complementary bases are in DNA, A with T and
C with G, and, in RNA, C with G, and U with A. Nucleotides in
respective strands are complementarity when they form one of these
(Watson-Crick pairings) when the strands are maximally aligned.
Nucleotides are mismatched when they do not form a complementarity
pair when their respective strands are maximally aligned.
Complementarity of strands can be perfect or substantial. Perfect
complementarity between two strands means that the two strands can
form a duplex in which every base in the duplex is bonded to a
complementary base by Watson-Crick pairing. Substantial
complementary means most but not necessarily all bases in strands
form Watson-Crick pairs to form a stable hybrid complex in set of
hybridization conditions (e.g., salt concentration and
temperature). For example, some primers can duplex with a primer
binding site notwithstanding up to 1, 2 or 3 positions of mismatch,
provided such mismatches are not at the 3' end and preferably not
proximate thereto (e.g., within 4 nucleotides). Such conditions can
be predicted by using the sequences and standard mathematical
calculations to predict the Tm of hybridized strands, or by
empirical determination of Tm by using routine methods. Tm refers
to the temperature at which a population of hybridization complexes
formed between two nucleic acid strands are 50% denatured. At a
temperature below the Tm, formation of a hybridization complex is
favored, whereas at a temperature above the Tm, melting or
separation of the strands in the hybridization complex is favored.
Tm may be estimated for a nucleic acid having a known G+C content
in an aqueous 1 M NaCl solution by using, e.g., Tm=81.5+0.41(%
G+C)-675/N-% mismatch, where N=total number of bases.
[0103] A mismatch means that a nucleotide in one strand of nucleic
acid does not or cannot pair through Watson-Crick base pairing with
a nucleotide in an opposing complementary nucleic acid strand.
Examples of mismatches are but not limited to AA, AG, AC, GG, CC,
TT, TG, TC, UU, UG, UC, and UT base pairs. Mismatches can happen
between DNA and DNA molecules, DNA and RNA molecules, RNA and RNA
molecules, and among other natural or artificial nucleic acid
analogs.
[0104] Mismatch binding reagents or agents are any molecules or any
modification in underrepresented primers that can stabilize the
underrepresented primer hybridization with underrepresented primer
binding sites through chemical interaction or physical interaction.
Modification of underrepresented primers may be modified in any
way, as long as a given modification is compatible with the desired
function of a given underrepresented primers as can be easily
determined. Modifications include base modifications, sugar
modifications or backbone modifications. Some small molecules can
bind to mismatched bases through hydrogen bonds presumably
complementary to those in the unpaired base and stabilize the
duplex with a high base selectivity. Metal ions have been shown to
interact with nucleic acids for their structure formation and
folding. Ono A., Togashi H. (Ono & Togashi, 2004, Angewandte
Chemie (International Ed. in English), 43(33), 4300-4302) showed
that addition of mercury ion in solution increases the Tm DNA
duplex with T-T mismatch by 5.degree. C. Torigoe H., Okamoto I. et
al. (Torigoe et al., 2012, Biochimie, 94(11), 2431-2440) showed
that silver ion selectively bind and stabilize C-C mismatch. A
series of rhodium complexes capable of high-selectivity mismatch
site recognition has been designed and synthesized by Cordier C.,
Pierre V. C. et al. (Cordier, Pierre, & Barton, 2007, Journal
of the American Chemical Society, 129(40), 12287-12295). Nakatani
K., Sando S., et al. (Nakatani, Sando, Kumasawa, Kikuchi, &
Saito, 2001, Journal of the American Chemical Society, 123(50),
12650-12657) have developed a series of naphthyridine based small
molecules to selectively recognize mismatched DNA.
[0105] Hybridization or annealing conditions include chemical
components and their concentrations (e.g., salts, chelating agents,
formamide) of an aqueous or organic solution containing the nucleic
acids, and the temperature of the mixture in which one nucleic acid
strand bonds to a second nucleic acid strand by complementary
strand interactions to produce a hybridization complex.
[0106] A sample is a composition in which one or more target
nucleic acids of interest may be present, including patient
samples, plant or animal materials, waste materials, materials for
forensic analysis, environmental samples, Circulation tumor cell
(CTC), cell free DNA, liquid biopsy, and the like. Samples include
any tissue, cell, or extract derived from a living or dead organism
which may contain a target nucleic acid, e.g., peripheral blood,
bone marrow, plasma, serum, biopsy tissue including lymph nodes,
respiratory tissue or exudates, gastrointestinal tissue, urine,
feces, semen, or other body fluids. Samples of particular interest
are tissue samples (including body fluids) from a human or an
animal having or suspected of having a disease or condition,
particularly infection by a virus. Other samples of interest
include industrial samples, such as for water testing, food
testing, contamination control, and the like. Sample components may
include target and non-target nucleic acids, and other materials
such as salts, acids, bases, detergents, proteins, carbohydrates,
lipids and other organic or inorganic materials. A sample may or
may not be subject of processing to purify a target nucleic acid
before amplification. Further processing can treatment with a
detergent or denaturant to release nucleic acids from cells or
viruses, removal or inactivation of non-nucleic acid components and
concentration of nucleic acids.
[0107] A target nucleic acid refers to a nucleic acid molecule or
population of related nucleic acid molecules that is or may be
present within a sample. A target nucleic acid includes a segment
to be amplified defined by primer binding sites. The segment can be
the entire nucleic acid or any segment thereof of length amenable
to amplification. For example, a target nucleic acid can be an
entire chromosome, gene or cDNA, and a target segment can be for
example, only 40-500 of these nucleotides. A target segment can
present on any strand (sense or anti-sense) of the structure. A
target nucleic acid can be RNA (e.g., viral RNA, micro RNA, mRNA,
cRNA, rRNA, hnRNA or DNA (genomic or cDNA) among others.
[0108] The target nucleic acid can be from a pathogenic
microorganism, such as a virus, bacteria or fungus, or can be
endogenous to a patient. Viral nucleic acids (e.g., genomic, mRNA)
form a useful target for analyses of viral sequences. Some examples
of viruses that can be detected include HIV, hepatitis (A, B, or
C), herpes virus (e.g., VZV, HSV-1, HAV-6, HSV-II, CMV, and Epstein
Barr virus), adenovirus, XMRV, influenza virus, flaviviruses,
echovirus, rhinovirus, coxsackie virus, cornovirus, respiratory
syncytial virus, mumps virus, rotavirus, measles virus, rubella
virus, parvovirus, vaccinia virus, HTLV virus, dengue virus,
MLV-related Virus, papillomavirus, molluscum virus, poliovirus,
rabies virus, JC virus and arboviral encephalitis virus. Examples
of such bacteria include Chlamydia, rickettsial bacteria,
mycobacteria, staphylococci, treptocci, pneumonococci, meningococci
and conococci, Klebsiella, Proteus, Serratia, Pseudomonas,
Legionella, diphtheria, Salmonella, bacilli, cholera, tetanus,
botulism, anthrax, plague, leptospirosis, Lymes disease bacteria,
streptococci, or Neisseria. rRNA is a particularly useful target
nucleic acid for typing bacteria. Detection of human or animal
genes is useful for detecting presence or susceptibility to
disease. Examples of genes that can be the subject of detection
include cancer gene fusions, BRACA-1 or BRAC-2, p53, CFTR,
cytochromes P450), for genotyping (e.g., forensic identification,
paternity testing, heterozygous carrier of a gene that acts when
homozygous, HLA typing), determining drug efficacy on an individual
(e.g., companion diagnostics) and other uses.
[0109] An underrepresented nucleotide type is one present in no
more than 20% of positions in a primer or primer binding site, or
both primer and primer binding site. Typically a primer has
nucleotide composition of, A, G, C, T or, A, G, C, U. A primer may
include unnatural nucleotide, such as Iso C and IsoG, deaza G or
deaza A. These are scored the same way as corresponding standard
nucleotides in determining the number or percentage of
underrepresented nucleotides. An analog corresponds with a natural
nucleotide if it has the same relative pairing affinity with other
natural nucleotides. Thus deaza G or inosine are analogs of G
because they pair more strongly with C than any of the other
natural nucleotides. As an example, if G is an underrepresented
nucleotide type, to determine a percentage of the underrepresented
nucleotide type in a primer, deaza G is included in the numerator
(as well as the denominator) and deaza A only in the denominator.
Thus, the percentage of underrepresented nucleotide in a primer
containing one G, one deaza G and 20 nucleotides total is 10%.
Typically an underrepresented nucleotide type is present in 0, 1 or
2 units at internal positions and optionally one at the 5' terminal
position in each primer and 0, 1, 2, 3 or 4 units in each primer
binding sites, and in 0 units in an artificial sequence. Ideally
one and only unit of the underrepresented nucleotide type is at the
5' terminal position. If one and only one of the
four-nucleotide-types is underrepresented it is the least
represented (including null representation) of the four standard
nucleotide types. If the primer contains a degenerate position, the
position is counted as being an underrepresented nucleotide type
position (i.e., in the numerator as well as the denominator) if the
degeneracy includes the underrepresented nucleotide type and in the
denominator only otherwise. A nucleotide analog having no
preference among binding to the natural nucleotide types is treated
the same as a degenerate position. A primer containing
underrepresented nucleotide type(s) is called an underrepresented
primer. A probe containing underrepresented nucleotide type(s)
called underrepresented probe.
[0110] The term "dNTP" generally refers to an individual or
combination of deoxynucleotides containing a phosphate, sugar and
organic base in the triphosphate form, that provide precursors
required by a DNA polymerase for DNA synthesis. A dNTP mixture may
include each of the naturally occurring deoxynucleotides (i.e.,
adenine (A), guanine (G), cytosine (C), uracil (U), and Thymine
(T)). In some embodiments, each of the naturally occurring
deoxynucleotides may be replaced or supplemented with a synthetic
analog; such as inosine, isoG, IsoC, deaza G, deaza A, and so
forth. When nucleotides are underrepresented in a primer or a
probe, the nucleotides are called underrepresented nucleotides. The
underrepresented nucleotides can be included in a reaction system
as the form of deoxynucleotides or dideoxynucleotides or
ribonucleotides. Their complements are called complementary
nucleotides of underrepresented nucleotides. The term "ddNTP"
generally refers to an individual or combination of
dideoxynucleotides containing a phosphate, sugar and organic base
in the triphosphate form, that provide precursors required by a DNA
polymerase for DNA synthesis. A ddNTP mixture may include each of
the naturally occurring dideoxynucleotides (i.e., adenine (A),
guanine (G), cytosine (C), uracil (U), and Thymine (T)). In some
embodiments, each of the naturally occurring dideoxynucleotides may
be replaced or supplemented with a synthetic analog; such as
inosine, isoG, IsoC, deazaG, deaza A, and so forth. The term "NTP"
generally refers to an individual or combination of Ribonucleotides
containing a phosphate, sugar and organic base in the triphosphate
form, that provide precursors required by a RNA polymerase for RNA
synthesis. A NTP mixture may include each of the naturally
occurring Ribonucleotides (i.e., adenine (A), guanine (G), cytosine
(C), uracil (U)). In some embodiments, each of the naturally
occurring Ribonucleotides may be replaced or supplemented with a
synthetic analog; such as inosine, isoG, IsoC, deazaG, deaza A, and
so forth.
[0111] A primer binding site or probe binding site is
interchangeable with underrepresented primer binding site or
underrepresented probe binding site in this invention. A primer
binding site is a complete or partial site in a target nucleic acid
to which a primer hybridizes. A partial site can be supplemented by
provision of toehold and junction sequences, which also contain
partial primer binding sites. A partial binding site from a toehold
or junction sequence can combine with a partial primer binding site
on a target nucleic acid to form a complete primer binding
site.
[0112] The term primer or probe is interchangeable with
underrepresented primer or underrepresented probe in this
invention. A primer or a probe is an oligonucleotide complementary
to primer or probe binding site contributed in whole or part by a
target nucleic acid. A primer or a probe can be linked at its 5'
end to another nucleic acid (sometimes referred to as a tail), not
found in or complementary to the target nucleic acid. A 5' tail can
have an artificial sequence. For a primer or probe exactly
complementary to a primer or a probe binding site, the demarcation
between primer or probe and tail is readily apparent in that the
tail starts with the first noncomplementary nucleotide encountered
moving from the 3' end of the primer or probe. For a primer
substantially complementary to a primer binding site, the last
nucleotide of the primer is the last nucleotide complementary to
the primer binding site encountered moving away from the 3' end of
the primer that contributes to primer binding to the target nucleic
acid (i.e., primer with this 5' nucleotide has higher TM for the
target nucleic acid than a primer without the 5' nucleotide).
Complementarity or not between nucleotides in the primer and
priming binding site is determined by Watson-Crick pairing or not
on maximum alignment of the respective sequences.
[0113] A primer or a probe is an oligonucleotide. The term
"oligonucleotide" encompasses a singular "oligonucleotide" as well
as plural "oligonucleotides," and refers to any polymer of two or
more of nucleotides, nucleosides, nucleobases or related compounds
used as a reagent in the amplification methods of the present
invention, as well as subsequent detection methods. The
oligonucleotide may be DNA and/or RNA and/or analogs thereof and/or
DNA RNA chimeric. The term oligonucleotide does not denote any
particular function to the reagent, rather, it is used generically
to cover all such reagents described herein. An oligonucleotide may
serve various different functions, e.g., it may function as a
primer if it is capable of hybridizing to a complementary strand
and can further be extended in the presence of a nucleic acid
polymerase, it may provide a promoter if it contains a sequence
recognized by an RNA polymerase and allows for transcription, it
may contain detection reagents for signal generation/amplification,
and it may function to prevent hybridization or impede primer
extension if appropriately situated and/or modified. Specific
oligonucleotides of the present invention are described in more
detail below. As used herein, an oligonucleotide can be virtually
any length, limited only by its specific function in the
amplification reaction or in detecting an amplification product of
the amplification reaction. Oligonucleotides of a defined sequence
and chemical structure may be produced by conventional techniques,
such as by chemical or biochemical synthesis, and by in vitro or in
vivo expression from recombinant nucleic acid molecules, e.g.
bacterial or viral vectors. As intended by this disclosure, an
oligonucleotide does not consist solely of wild-type chromosomal
DNA or the in vivo transcription products thereof. Oligonucleotides
may be modified in any way, as long as a given modification is
compatible with the desired function of a given oligonucleotide as
can be easily determined. Modifications include base modifications,
sugar modifications or backbone modifications. Base modifications
include, but are not limited to the use of the following bases in
addition to adenine, cytidine, guanosine, thymine and uracil: C-5
propyne, 2-amino adenine, 5-methyl cytidine, inosine, and dP and dK
bases. The sugar groups of the nucleoside subunits may be ribose
deoxyribose and analogs thereof, including, for example,
ribonucleosides having 2'-O-methyl (2'-O-ME) substitution to the
ribofuranosyl moiety. See "Method for Amplifying Target Nucleic
Acids Using Modified Primers," (Becker, Majlessi, & Brentano,
2000, U.S. Pat. No. 6,130,038). Other sugar modifications include,
but are not limited to 2)-amino, 2''-fluoro,
(L)-alpha-threofuranosyl, and pentopuranosyl modifications. The
nucleoside subunits may be joined by linkages such as
phosphodiester linkages, modified linkages or by non-nucleotide
moieties which do not prevent hybridization of the oligonucleotide
to its complementary target nucleic acid sequence. Modified
linkages include those linkages in which a standard phosphodiester
linkage is replaced with a different linkage, such as a
phosphorothioate linkage or a methylphosphonate linkage. The
nucleobase subunits may be joined, for example, by replacing the
natural deoxyribose phosphate backbone of DNA with a pseudo peptide
backbone, such as a 2-aminoethylglycine backbone which couples the
nucleobase subunits by means of a carboxymethyl linker to the
central secondary amine. (DNA analogs having a pseudo peptide
backbone are commonly referred to as "peptide nucleic acids" or
"PNA" and are disclosed by Nielsen et al., "Peptide Nucleic Acids,"
(Nielsen, Buchardt, Egholm, & Berg, 1996, U.S. Pat. No.
5,539,082). Other linkage modifications include, but are not
limited to, morpholino bonds. Non-limiting examples of
oligonucleotides or oligomers contemplated by the present invention
include nucleic acid analogs containing bicyclic and tricyclic
nucleoside and nucleotide analogs (LNAs). See Imanishi et al.,
"Bicyclonucleoside and Oligonucleotide Analogues," (Imanishi &
Obika, 2001, U.S. Pat. No. 6,268,490); and Wengel et al.,
"Oligonucleotide Analogues," (Wengel & Nielsen, 2003, U.S. Pat.
No. 6,670,461). Any nucleic acid analog is contemplated by the
present invention provided the modified oligonucleotide can perform
its intended function, e.g., hybridize to a target nucleic acid
under stringent hybridization conditions or amplification
conditions, or interact with a DNA or RNA polymerase, thereby
initiating extension or transcription. In the case of detection
probes, the modified oligonucleotides must also be capable of
preferentially hybridizing to the target nucleic acid under
stringent hybridization conditions. The 3'-terminus of an
oligonucleotide (or other nucleic acid) can be blocked in a variety
of ways using a blocking moiety, as described below. A "blocked"
oligonucleotide is not efficiently extended by the addition of
nucleotides to its 3'-terminus, by a DNA- or RNA-dependent DNA
polymerase, to produce a complementary strand of DNA. As such, a
"blocked" oligonucleotide cannot be a "primer."
[0114] The term "degenerate primer" refers to a mixture of similar
primers with differing bases at the varying positions (Mitsuhashi,
J. Clin. Lab. Anal., 10(5): 285 93 (1996); von Eggeling et al.,
Cell. Mol. Biol., 41(5):653 70 (1995); (Zhang et al., Proc. Natl.
Acad. Sci. USA, 89:5847 5851 (1992); Telenius et al., Genomics,
13(3):718 25 (1992)). Such primers can include inosine, as inosine
is able to base pair with adenosine, cytosine, guanine or
thymidine. Degenerate primers allow annealing to and amplification
of a variety of target sequences that can be related. Degenerate
primers that anneal to target DNA can function as a priming site
for further amplification. A degenerate region is a region of a
primer that varies, while the rest of the primer can remain the
same. Degenerate primers (or regions) denote more than one primer
and can be random. A random primer (or regions) denotes that the
sequence is not selected, and it can be degenerate but does not
have to be. In some embodiments, the 3' target specific regions
have a Tm of between about 5.degree. C. and 50.degree. C. In some
embodiments, a 15-mer has a Tm of less than about 60.degree. C.
[0115] A primer "3' segment or 3' binding region or 3' binding site
or 3' hybridization region" is able to bind to a genomic sequence
occurring in a genome at a particular frequency. In some
embodiments, this frequency is between about 0.01% and 2.0%, such
as, between about 0.05% and 0.1% or between about 0.1% and 0.5%. In
some embodiments, the length of the "binding site" of a primer
depends mainly on the averaged lengths of the predicted PCR
products based on bioinformatic calculations. The definition
includes, without limitation, a "binding region" of between about 4
and 12 bases in length. In more particular embodiments, the length
of the 3' binding region can be, for example, between about 4 and
20 bases, or between about 8 and 15 bases. Binding regions having a
Tm of between about 10.degree. C. and 60.degree. C. are included
within the definition. The term, "primer binding segment," when
used herein refers to a primer of specified sequence.
[0116] The term "random or random region" refers to a region of an
oligonucleotide primer that is able to anneal to unspecified sites
in a group of target sequences, such as in a genome. The term
"random primer" as used herein refers to a primer that may include
a 3' segment target specific binding region and a 5' segment
artificial sequence. The "random region" facilitates binding of the
primer to target DNA and binding of the polymerase enzyme used in
PCR amplification to the duplex formed between the primer and
target DNA. The random region nucleotides can be degenerate or
non-specific, promiscuous nucleobases or nucleobase analogs. The
length of the "random region" of the oligonucleotide primer, among
other things, depends on the length of the specific region. In
certain embodiments, without limitation, the "random region" is
between about 2 and 15 bases in length, between about 4 and 12
bases in length or between about 4 and 6 bases in length. In
another embodiment, the specific and random regions combined will
be about 9 bases in length, e.g., if the specific region has 4
bases, the random region will have 5 bases.
[0117] In some embodiments, the primer 3' segment comprises both a
specific region and a random region or degenerate region. In other
embodiments, the 3' segment includes a specific region, and a
random region or a degenerate region. In other embodiments, the 3'
segment of the target primer only includes a specific region, a
random region, or a degenerate region. Of course, known regions
(sequences that are known) can also be used or part of the options
disclosed herein.
[0118] A polymerase is an enzyme that can perform template directed
extension of a primer hybridized to the template. It can be a DNA
polymerase, an RNA polymerase or a reverse transcriptase. Examples
of DNA polymerases include: E. coli DNA polymerase I, Taq DNA
polymerase, S. pneumoniae DNA polymerase I, TfI DNA polymerase, D.
radiodurans DNA polymerase I, Tth DNA polymerase, Tth XL DNA
polymerase, M. tuberculosis DNA polymerase I, M.
thermoautotrophicum DNA polymerase I, Herpes simplex-1 DNA
polymerase, T4 DNA polymerase, thermosequenase or a wild-type or
modified T7 DNA polymerase, 029 Polymerase, Bst Polymerase, Vent
Polymerase, 9.degree. Nm Polymerase, Klenow fragment of DNA
Polymerase I. Examples of reverse transcriptase: AMV Reverse
Transcriptase, MMLV Reverse Transcriptase, HIV Reverse
Transcriptase. Examples of RNA polymerases include: T7 RNA
polymerase or SP6 RNA polymerase, bacterial RNA polymerases and
eukaryotic RNA polymerases.
[0119] Amplification refers to either producing an additional copy
or copies of all or a segment of a target nucleic acid by
template-directed primer extension (target amplification) or
amplifying detection signal for qualitatively/quantitatively
measurement (signal amplification) or both. Amplification can be
performed under temperature cycled or isothermal conditions or
combined. Amplification can be linear or exponential.
[0120] Many well-known methods of nucleic acid target amplification
require thermocycling to alternately denature double-stranded
nucleic acids and hybridize primers; however, other well-known
methods of nucleic acid amplification are isothermal. The
polymerase chain reaction, commonly referred to as PCR (Mullis,
1987 U.S. Pat. No. 4,683,202; Saiki et al., 1985, Science (New
York, N.Y.), 230(4732), 1350-1354), uses multiple cycles of
denaturation, annealing of primer pairs to opposite strands, and
primer extension to exponentially increase copy numbers of the
target sequence. In a variation called RT-PCR, reverse
transcriptase (RT) is used to make a complementary DNA (cDNA) from
mRNA, and the cDNA is then amplified by PCR to produce multiple
copies of DNA (Gelfand et al., "Reverse Transcription with
Thermostable DNA Polymerases--High Temperature Reverse
Transcription," (Gelfand, 1994, U.S. Pat. No. 5,322,770; Gelfand
& Myers, 1994, U.S. Pat. No. 5,310,652). Another method of
amplifying nucleic acid is called the LCR method (ligase chain
reaction, Laffler, Carrino, & Marshall, 1993, Annales De
Biologie Clinique, 51(9), 821-826). LCR (Laffler et al., 1993,
Annales De Biologie Clinique, 51(9), 821-826) is based on the
reaction in which two adjacent probes are hybridized with a target
sequence and ligated to each other by a ligase. The two probes
could not be ligated in the absence of the target nucleotide
sequence, and thus the presence of the ligated product is
indicative of the target nucleotide sequence. The LCR method also
requires control of temperature for separation of a complementary
chain from a template. Another method is strand displacement
amplification (George T. Walker, Little, & Nadeau, 1993, U.S.
Pat. No. 5,270,184; George T. Walker, 1995, U.S. Pat. No.
5,455,166; G. T. Walker et al., 1992, Nucleic Acids Research,
20(7), 1691-1696, 1992, Proceedings of the National Academy of
Sciences of the United States of America, 89(1), 392-396), commonly
referred to as SDA, which uses cycles of annealing pairs of primer
sequences to opposite strands of a target sequence, primer
extension in the presence of a dNTP to produce a duplex
hemiphosphorothioated primer extension product,
endonuclease-mediated nicking of a hemimodified restriction
endonuclease recognition site, and polymerase-mediated primer
extension from the 3' end of the nick to displace an existing
strand and produce a strand for the next round of primer annealing,
nicking and strand displacement, resulting in geometric
amplification of product. Thermophilic SDA (tSDA) uses thermophilic
endonucleases and polymerases at higher temperatures in essentially
the same method (Frailer, Spargo, Van, Walker, & Wright, 2002,
European Pat. No. 0 684 315). Other amplification methods include:
nucleic acid sequence based amplification (Compton, 1991, Nature,
350(6313), 91-92, Malek, Davey, Henderson, & Sooknanan, 1992),
commonly referred to as NASBA; one that uses an RNA replicase to
amplify the probe molecule itself (Lizardi, Guerra, Lomeli,
Tussie-Luna, & Russell Kramer, 1988, Nature Biotechnology,
6(10), 1197-1202), commonly referred to as 013 replicase; a
transcription-based amplification method (Kwoh et al., 1989,
Proceedings of the National Academy of Sciences of the United
States of America, 86(4), 1173-1177); self-sustained sequence
replication (3SR), (Guatelli et al., 1990, Proceedings of the
National Academy of Sciences of the United States of America,
87(5), 1874-1878; Landgren (1993) Trends in Genetics 9, 199-202;
and Lee, H. et al., NUCLEIC ACID AMPLIFICATION TECHNOLOGIES
(1997)); and, transcription-mediated amplification (Kwoh et al.,
1989, Proceedings of the National Academy of Sciences of the United
States of America, 86(4), 1173-1177; Kacian & Fultz, 1995, U.S.
Pat. No. 5,480,784; Kacian & Fultz, 1996, U.S. Pat. No.
5,399,491), commonly referred to as TMA. For further discussion of
known amplification methods see Persing, David H., 1993, "In Vitro
Nucleic Acid Amplification Techniques" in Diagnostic Medical
Microbiology: Principles and Applications (Persing et al., Eds.),
pp. 51-87 (American Society for Microbiology, Washington, D.C.).
Other illustrative amplification methods suitable for use in
accordance with the present invention also include rolling circle
amplification (RCA) (Fire & Xu, 1995, Proceedings of the
National Academy of Sciences, 92(10), 4641-4645; Lizardi, 1998,
U.S. Pat. No. 5,854,033); Nucleic Acid Amplification Using Nicking
Agents (Van Ness, Galas, & Van Ness, 2006, U.S. Pat. No.
7,112,423); Nicking and Extension Amplification Reaction (NEAR)
(Maples et al., 2009, US 2009-0017453 A1); Helicase Dependent
Amplification (HDA) (Kong, Vincent, & Xu, 2004, US 2004-0058378
A1; Kong, Vincent, & Xu, 2007 US pat. US2007/0254304 A1); and
Loop-Mediated Isothermal Amplification (LAMP) (Notomi & Hase,
2002, U.S. Pat. No. 6,410,278), and Quadruplex priming
amplification (Analyst, 2014, 139, 1644-1652). Expar amplification
(PNAS Apr. 15, 2003 100, 4504-4509). Cross priming amplification
(Sci Rep. 2012; 2: 246). SMAP amplification (Nature Methods April
2007; 4(3):257-62). Multiple displacement amplification (MDA,
Proceedings of the National Academy of Sciences 2005, 102 (48):
17332-6.), Recombinase Polymerase Amplification (Journal of
Clinical Virology 54 (4): 308-12). Single primer isothermal
amplification (SPIA) (clinical chemistry, 2005 vol. 51 no. 10
1973-1981).
[0121] Another aspect of amplification is signal amplification.
When a sufficient amount of nucleic acids to be detected is
available, there are advantages to detecting that sequence
directly, instead of making more copies of that target, (e.g., as
in PCR and LCR). Traditional methods of direct detection including
Northern and Southern blotting and RNase protection assays usually
require the use of radioactivity and are not amenable to
automation. Other techniques have sought to eliminate the use of
radioactivity and/or improve the sensitivity in automatable
formats. The cycling probe reaction (CPR) (Duck, Alvarado-Urbina,
Burdick, & Collier, 1990b, BioTechniques, 9(2), 142-148), uses
a long chimeric oligonucleotide in which a central portion is made
of RNA while the two termini are made of DNA. Hybridization of the
probe to a target DNA and exposure to a thermostable RNase H causes
the RNA portion to be digested. This destabilizes the remaining DNA
portions of the duplex, releasing the remainder of the probe from
the target DNA and allowing another probe molecule to repeat the
process. Branched DNA (bDNA), described by Urdea et al., 1987,
Gene, 61(3), 253-264, involves oligonucleotides with branched
structures that allow each individual oligonucleotide to carry 35
to 40 labels (e.g., alkaline phosphatase enzymes). While this
enhances the signal from a hybridization event, signal from
non-specific binding is similarly increased. Other signal
amplification include: Invasive Cleavage of Nucleic Acids (Prudent,
Hall, Lyamichev, Brow, & Dahlberg, 2006, U.S. Pat. No.
7,011,944); Hybridization Chain Reaction (HCR) (R. M. Dirks &
Pierce, 2004, Proceedings of the National Academy of Sciences of
the United States of America, 101(43), 15275-15278, R. Dirks &
Pierce, 2012, U.S. Pat. No. 8,105,778) and G-quadruplex
DNAzyme-based colorimetric detection. CHA amplification (J. Am.
Chem. Soc., 2013, 135 (20), pp 7430-7433). SMART signal
amplification (Biotechniques 2002 March; 32(3):604-6, 608-11.)
[0122] Amplification products can be detected qualitatively (i.e.,
positive signal relative to control) or quantitatively (signal
intensity related to absolute or relative amount of analyte giving
rise to amplification product). Detection can include but does not
require further analysis, such as sequencing of an amplification
product. The methods provided by the invention may also include
directly detecting a particular nucleic acid in a capture reaction
product or amplification reaction product, such as a particular
target amplicon or set of amplicons. Accordingly, mixtures of the
invention can comprise specialized probe sets including
TAQMAN.RTM., which uses a hydrolyzable probe containing detectable
reporter and quencher moieties, which can be released by a DNA
polymerase with 5T->3' exonuclease activity (Livak, Flood, &
Marmaro, 1996, U.S. Pat. No. 5,538,848); molecular beacon, which
uses a hairpin probe with reporter and quenching moieties at
opposite termini (Tyagi, Kramer, & Lizardi, 1999, U.S. Pat. No.
5,925,517); Fluorescence resonance energy transfer (FRET) primers,
which use a pair of adjacent primers with fluorescent donor and
acceptor moieties, respectively (Wittwer, Ririe, & Rasmussen,
2001, U.S. Pat. No. 6,174,670); and LIGHTUP.TM., a single short
probe which fluoresces only when bound to the target (Kubista &
Svanvik, 2001, U.S. Pat. No. 6,329,144). Similarly, SCORPION.TM.
(Whitcombe, Theaker, Gibson, & Little, 2001, U.S. Pat. No.
6,326,145) and SIMPLEPROBES.TM. (Wittwer et al., 2003, U.S. Pat.
No. 6,635,427) use single reporter/dye probes. Amplicon-detecting
probes can be designed according to the particular detection
modality used, and as discussed in the above-referenced patents.
Other detection methods include: gel electrophoresis, mass
spectrometry, or capillary electrophoresis, melting curve, nucleic
acid-based fluorescent chelating dye such as SYBR.TM. green, or
detection of amplification products using a fluorescent label and a
soluble quencher (Will, Gupta, & Geyer, 2014, U.S. Pat. No.
8,658,366).
[0123] The term "multiplex amplification" refers to the
amplification of more than one nucleic acid of interest. For
example, it can refer to the amplification of multiple sequences
from the same sample or the amplification of one of several
sequences in a sample as discussed, for example, in George T.
Walker, Nadeau, & Little, 1995 U.S. Pat. No. 5,422,252; and
George T. Walker, Nadeau, Spears, et al., 1995, U.S. Pat. No.
5,470,723, which provide examples of multiplex strand displacement
amplification. The term also refers to the amplification of one or
more sequences present in multiple samples either simultaneously or
in step-wise fashion.
[0124] Real-time amplification refers to an amplification reaction
for which the amount of reaction product, i.e. amplicon, is
monitored as the reaction proceeds. Forms of real-time
amplification differ mainly in the detection mechanisms used for
monitoring the reaction products. Detection methods are reviewed in
Mackay, Arden, & Nitsche, 2002, Nucleic Acids Research, 30(6),
1292-1305, which is incorporated herein by reference.
[0125] The term "detection label" refers to any atom or molecule
which can be used to provide or aid to provide, a detectable
(preferably quantifiable) signal, and can be attached to a nucleic
acid or protein. Labels may provide signals detectable by
fluorescence, radioactivity, colorimetry, gravimetry, magnetism,
enzymatic activity and the like. Detection labels can be
incorporated in a variety of ways: (1) the primers comprise the
label(s), for example, attached to the base, a ribose, a phosphate,
or analogous structures in a nucleic acid analog; (2) nucleotides
triphosphates are modified at either the base or the ribose (or to
analogous structures in a nucleic acid analog) with the label(s);
the label-modified nucleotides are then incorporated into a newly
synthesized strand by an extension enzyme such as a polymerase; (3)
modified nucleotides are used that comprise a functional group that
can be used (post-enzymatic reaction) to add a detectable label;
(4) modified primers are used that comprise a functional group that
can be used to add a detectable label in a similar manner; (5) a
label probe that is directly labeled and hybridizes to a portion of
the amplicon can be used; (6) a label that can be incorporated into
amplified products; (7) a label that can react with byproducts of
amplification reaction.
[0126] The terms "thermally cycling," "thermal cycling", "thermal
cycles" or "thermal cycle" refer to repeated cycles of temperature
changes from a total denaturing temperature, to an annealing (or
hybridizing) temperature, to an extension temperature and back to
the total denaturing temperature. The terms also refer to repeated
cycles of a denaturing temperature and an extension temperature,
where the annealing and extension temperatures are combined into
one temperature. A totally denaturing temperature unwinds all
double-stranded fragments into single strands. An annealing
temperature allows a primer to hybridize or anneal to the
complementary sequence of a separated strand of a nucleic acid
template. The extension temperature allows the synthesis of a
nascent DNA strand of the amplicon.
[0127] The term "reaction mixture", "amplification mixture" or "PCR
mixture" refers to a mixture of components necessary to amplify at
least one amplicon from nucleic acid templates. The mixture may
comprise nucleotides (dNTPs), a thermostable polymerase, primers,
and a plurality of nucleic acid templates. The mixture may further
comprise a Tris buffer, a monovalent salt, and Mg'. The
concentration of each component is well known in the art and can be
further optimized.
[0128] The terms "amplified product" or "amplicon" refer to a
fragment of DNA amplified by a polymerase using a pair of primers
in an amplification method such as PCR.
[0129] "Fluorophore" refers to a moiety that absorbs light energy
at a defined excitation wavelength and emits light energy at a
different defined wavelength.
[0130] A "quencher" includes any moiety that is capable of
absorbing the energy of an excited fluorescent label when it is
located in close proximity to the fluorescent label and is capable
of dissipating that energy. A quencher can be a fluorescent
quencher or a non-fluorescent quencher, which is also referred to
as a dark quencher. The fluorophores listed above can play a
quencher role if brought into proximity to another fluorophore,
wherein either FRET quenching or contact quenching can occur. It is
preferred that a dark quencher which does not emit any visible
light is used. Examples of dark quenchers include, but are not
limited to, DABCYL (4-(4'-dimethylaminophenylazo) benzoic acid)
succinimidyl ester, diarylrhodamine carboxylic acid, succinimidyl
ester (QSY.TM.-7), and 4',5'-dinitrofluorescein carboxylic acid,
succinirnidyl ester (QSY.TM.-33), quencherl, or "Black hole
quenchers" (BHQ.TM.-1, BHQ.TM.2 and BHQ.TM.-3), nucleotide analogs,
nucleotide G residues, nanoparticles, and gold particles.
[0131] The term "mutation" refers to one or more nucleotides in a
target nucleic acid sequence that differ from a prototypical form
of the target nucleic acid designated wildtype. The sequence
designated wildtype is the most common allelic form of a sequence,
the first discovered form of the sequence, and/or a form of the
sequence associated with a normal (non-diseased phenotype). Single
nucleotide polymorphisms (SNPs) are one form of mutation.
[0132] The term "surface" refers to any solid surface to which
nucleic acids can be covalently attached, such as for example latex
beads, dextran beads, polystyrene, polypropylene surface,
polyacrylamide gel, gold surfaces, glass surfaces and silicon
wafers. Preferably the solid support is a glass surface.
[0133] The term "attached to surface" as used herein refers to any
chemical or non-chemical attachment method including
chemically-modifiable functional groups. "Attachment" relates to
immobilization of nucleic acid on solid supports by either a
covalent attachment or via irreversible passive adsorption or via
affinity between molecules (for example, immobilization on an
avidin-coated surface by biotinylated molecules). The attachment
must be of sufficient strength that it cannot be removed by washing
with water or aqueous buffer under DNA-denaturing conditions.
[0134] A sticky end is a single-stranded end of a nucleic acid
adjacent a double-stranded segment of the nucleic acid. Nucleic
acids with stick ends with complementary sequences can anneal via
the sticky ends and undergo ligation to one another.
[0135] An artificial sequence is a sequence lacking complementarity
to or at least not intended to have complementarity to a naturally
occurring target nucleic acid known or suspected may be present in
a sample. Artificial sequences can serve as linkers joining
segments hybridizing to a target nucleic acid, or as tails for
labelling primers, among other purposes.
DETAILED DESCRIPTION
I. General
[0136] The invention provides methods of amplification from a
single primer or a pair of forward and reverse primers of limited
nucleotide composition. Limited nucleotide composition means that
the primers are underrepresented in at least one nucleotide type.
Such primers have much reduced capacity to prime from each other or
to extend initiated by mispriming from other than at their intended
primer binding sites in a target nucleic acid. The use of such
primers for target-specific amplification requires identification
of primer binding sites in a target nucleic acid that support
primer binding and amplification. In some target nucleic acids,
primer binding sites having complete complementarity to primers of
limited nucleotide composition can be identified. More often,
segments of limited nucleotide composition in target nucleic acids
are too short by themselves to serves as primer binding sites.
However, such sites can be adapted to undergo amplification with
primers of limited nucleotide composition by a variety of
techniques described below including the use of ancillary toehold
or junction oligonucleotide, primer with mismatch hybridization to
primer binding site, mismatch stabilizing agents and presence of
limited numbers of the underrepresented nucleotide in the primers.
The disclosed invention includes methods that can improve
underrepresented primer hybridization efficiency to
underrepresented primer binding site. The present methods can be
used in a variety of amplification formats, such as PCR, TMA,
ligase chain reaction, NEAR, LAMP, RPA, EXPAR, and so forth and
with a variety of detection formats. The methods can also be
multiplexed for detection of multiple target nucleic acids
simultaneously.
II. Primer Design
[0137] a. Basic Principles
[0138] The present method start with a basic concept of a limited
nucleotide composition of primers in which one or more nucleotide
type(s) is underrepresented (e.g., A, T, C and no G) and then
selects the best primer binding sites within a target nucleic acid
for pairing with primers of that composition (e.g., A, T and G).
Depending on the primer binding sites selected, the nucleotide
composition of the primers may then be further adjusted (e.g., by
allowing a limited number units of an underrepresented nucleotide)
to improve complementarity with to the primer binding sites.
[0139] A preferred primer design is that one and only one of the
four standard nucleotide types is underrepresented in both the
forward and reverse primers. In other words, such primers can
consist of A, T/U and C with G underrepresented, A, T/U, G with C
underrepresented, A, G and C with T underrepresented or T, G and C
with A underrepresented. The underrepresented nucleotide type is
preferably G or C. If the underrepresented nucleotide type is
present at all in a primer, it is preferably at position(s) other
than the 3' nucleotide, most preferably as the 5' nucleotide or a
5' tail nucleotide linked to the 5' nucleotide of the primer.
Inclusion of a 5' underrepresented nucleotide increases the melting
temperature (TM) of primer binding without significantly increasing
in unintended amplification products.
[0140] The 3' nucleotide of a primer is preferably occupied by the
complement of the underrepresented nucleotide type. For example, if
the underrepresented nucleotide type is G, then the 3' nucleotide
is preferably C and vice versa. The terminal C or G inhibits primer
dimer extension because there is no complementary base on the
primers for it to pair with. The elimination or underrepresentation
of one nucleotide type substantially limits the number of
nucleotides than can form Watson-Crick pairs between the primers or
between primers and mismatched primer binding sites. Correct base
paring of the 3' nucleotide of a primer is of greatest importance
in its ability to support template dependent extension. Use of the
complement of the underrepresented nucleotide type at this position
substantially reduces primer dimer and primer mismatch
extension.
[0141] Other features of primer design are similar to conventional
primers. A primer has a sequence complementary to its primer
binding site. Some primers are at least 15, 20, 25, 30, 35 or 40
nucleotides long. Some primers are no more than 25, 30, 40, 50 or
75 nucleotides long. Primers can have any permutation of these
lower and upper lengths, e.g., from 15-50 of 20-30 or 30-40
nucleotides. The melting temperature of a primer to its primer
binding site can be for example 45-80 C or preferably 55-65 C. By
convention, for primers binding to opposite strands, one of which
is the coding strand, the forward primer is complementary to the
noncoding strand so the extended product is the coding strand, and
the reverse primer to the coding strand so the extended product is
the noncoding strand. For target nucleic acids not having coding
and noncoding strands, designation of forward and reverse primer is
arbitrary. Such is also the case when forward and reverse primers
bind to primer binding sites on the same strand. Primers can have
5' tails not complementary to a target nucleic acid. Such tails can
be used for attaching fluorophore or quenchers, or can contain
identification codes, or can link discontinuous segments of primer
complementary to its target nucleic acid.
[0142] Amplification conditions are usually similar to conventional
primers in terms of buffers, Mg.sup.2+, enzymes, temperatures and
so forth. Conventional amplification is performed with all four
standard nucleotide types present as dNTP monomers. Amplification
with primers of limited nucleotide composition can be so performed,
but can also be performed with the complements of the
underrepresented nucleotide type(s) absent or present at reduced
concentration or provided as ddNTP(s), as further described
below.
[0143] Usually but not invariably forward and reverse primers bind
to opposite strands of a target nucleic acid. Thus, one strand of a
target nucleic acid contains for example, the complement of the
forward primer binding site and the reverse primer binding site,
and the other strand contains the forward primer binding site and
complement of the reverse primer binding site. In some formats,
forward and reverse primer binding sites are on the same strand.
For example, linked forward and reverse primers can bind to binding
sites on the same strand and amplify by a rolling circle mechanism.
Some pairs of three way junction primers can also bind to sites on
the same nucleic acid strand, such that one primer serves as a
template for the other.
[0144] The search for suitable primer binding sites in a target
nucleic acid is informed by the principles of primer design in that
the primer binding sites should be complementary to the primers.
For example, for use with primers that are underrepresented in a
single nucleotide type, one can search a target nucleic acid for a
forward primer binding site and a reverse primer binding site that
are underrepresented in the complement of the nucleotide type
underrepresented in the primers. Preferably, a forward primer
binding site and a reverse primer binding site are identified in
which the complement of the underrepresented nucleotide type is
absent. However, if such sites cannot be found, other primer
binding sites can be still be used, preferably those in which the
number of units of the complement of the underrepresented
nucleotide type is minimized. Often, the complement of the
underrepresented nucleotide type in the primers is itself
underrepresented in the primer binding sites, but this is not
essential. Some forward and reverse primer binding sites each have
no more than 4, 3, 2 or 1 units of the complement of the nucleotide
underrepresented in the primers.
[0145] For ATC primers, software can be used to look for contiguous
or proximate ATC and ATG regions representing the complement of the
forward primer binding site and reverse primer binding site
respectively. To use ATG primers, software can look for ATG and ATC
regions for the complement of the forward primer binding site and
the reverse primer binding site respectively. To use CGA primers,
software can look for CGA and CGT regions representing the
complement of the forward primer binding site and the reverse
primer binding site respectively. To use CGT primers, software can
look for CGT and CGA regions for the complement of the forward
primer binding site and the reverse primer binding site
respectively.
[0146] The complement of the forward primer binding site (or the
forward primer binding site itself if on the same strand as the
reverse primer) and the reverse primer binding site can be
contiguous with one another or separated by intervening nucleotides
in a strand of the target nucleic acid. The intervening
nucleotides, if any, may exclude the underrepresented nucleotide in
the primers and its complement, or may include one or both of these
nucleotides and either of the other two of the four standard
nucleotide types. If non-contiguous, the complement of the forward
primer binding site (or the forward primer binding site itself) and
reverse primer binding site should be close enough together to
prime extension compatible with the amplification technique (e.g.,
no more than 100, 500, 1000, or 10000 nucleotides).
[0147] FIG. 1 shows a simple representation of the method in which
the forward and reverse primers each consist of A, T and C
nucleotides, with a C nucleotide at the 3' positions. In other
words G is the underrepresented nucleotide type. The reverse primer
binding site consists of A, T and G (the complement of the C, and
underrepresented in the primers). The complement of the forward
primer binding site shown consists of A, T and C, implying that the
forward primer binding site (like the reverse primer binding site)
consists of A, T and G. The forward and reverse primers are
perfectly complementary to the forward and reverse primer binding
sites, respectively. The complement of the forward primer binding
site and the reverse primer binding sites are contiguous. An
amplification product can form when a reaction is supplied with the
three nucleotide triphosphate monomers complementary to the
three-nucleotide-types in the forward and reverse primers, A, T and
G. Primer dimer formation and mispriming are inhibited as described
because few bases can pair between primers and or between a primer
and a mismatched primer binding site. But even if the primers could
sufficiently bind to unintended primer binding sites sufficient to
initiate extension, no amplification product would form because the
omitted nucleotide triphosphate monomer in the amplification mix
brings amplification to a stop whenever the extended chain need to
incorporate a C.
[0148] Alternatively, the primer binding sites can be noncontiguous
and separated by a region including all four of the standard
nucleotides, as shown in FIG. 7. In such a case, amplification is
performed with all four of the standard nucleotide triphosphate
monomers.
[0149] b. Mismatches Between Primer Binding Sites and Primers
[0150] FIG. 5 shows a more typical situation in which a search of a
target nucleic acids for forward and reverse primer binding sites
showed no suitable pair of forward and reverse prime binding sites
having complete complementarity to primers consisting of A, T, C
nucleotides (i.e., no primer binding sites in which the
underrepresented nucleotide type is entirely absent). The longest
ATC region contains 7 nucleotides (CATCCTC) and the longest ATG
region (CGATTGGTATG) contains 12 nucleotides. These regions are not
long enough to use as primers because their Tm's are too low. In
such cases, primers mismatched with the primer binding sites can be
used. In FIG. 5 the forward primer binding site has three units of
C and the reverse primer binding site has two units of C aligned
with C-nucleotides in the primers. Accordingly when such primers
and primer binding sites are hybridized with one another there are
three mismatch positions between forward primer and its binding
site and two mismatches between the reverse primer and its binding
site. Nevertheless hybridization and extension can still occur
albeit with reduced efficiency. Hybridization and extension can be
increased if the reaction mix is supplied with a mismatch
stabilizing agent. Mismatch binding or stabilizing agent are any
molecules or any modification in underrepresented primers that can
stabilize the underrepresented primer hybridization with
underrepresented primer binding sites through chemical interaction
or physical interaction (se FIG. 6). Modification of
underrepresented primers may be modified in any way, as long as a
given modification is compatible with the desired function of a
given underrepresented primers as can be easily determined.
Modifications include base modifications, sugar modifications or
backbone modifications, such as PNA, LNA, or 2' Fluorine 2'
methyloxy. Rhodium metalloinsertors as examples of mismatch
stabilizing agents are described by Ernst et al. J. Am. Chem. Soc.
131, 2359-2366 (2009). Chemicals such as rhodium metalloinsertors
can specifically bind DNA mismatches and have a binding constant of
2.0.times.10.sup.7M.sup.-1 at a CC mismatch. Binding of rhodium
metalloinsertors can increase the melting temperature of
double-stranded DNA including a mismatch by 18.7.degree. C.
Therefore such mismatch binding reagents can be added to
three-nucleotide-type primer PCR reactions to specifically
stabilize mismatches and increase PCR efficiency. As well as C-C
mismatches, T-C or A-C mismatches can be stabilized by such
reagents among other possibilities. Even with such stabilizing
agents, mismatched primers may hybridize to a template with
slightly reduced efficiency but amplification can proceed.
[0151] c. Inclusion of a Few Units of Underrepresented
Nucleotide
[0152] Alternatively or additionally to using a mismatch
stabilizing agent, the number of mismatches can be reduced by
introducing a limited number of units of the underrepresented
nucleotide type (typically up to 2 internal position) at positions
in a primer that reduce the number of mismatches with its primer
binding site. An underrepresented nucleotide can also be used at
the 5' position of the primer or in a tail immediately 5' to the 5'
end of the primer. For example, with the primers and primer binding
sites shown in FIG. 5, introduction of two G's into each of the
forward and reverse primers reduces the mismatches to one in the
case of the forward primer and none in the case of the reverse
primer.
[0153] The choice whether to use a mismatch stabilizing agent or to
include one or more units of the underrepresented nucleotide type
in the primers depends on the number of mismatch positions between
hypothetical forward and reverse primers completely lacking the
underrepresented nucleotide types and their respective binding
sites. If there are more than two mismatches between such a primer
and its binding site or a mismatch occurs close (e.g., within 4
nucleotides) to the 3' end of a primer, it is preferred to
eliminate one or more mismatches by inclusion of one or more
underrepresented nucleotides in the primer.
[0154] In the case of ATC primers, instead of introducing G into
the underrepresented primer, one or more unnatural bases can be
introduced as alternative as long as the unnatural bases can help
to reduce primer dimer interaction comparing to conventional ATGC
primers. An example of the unnatural bases is inosine. Introducing
G increases the hybridization efficiency of primer to its binding
site, but also increases inter- and intra-primer interactions
because CG pairs are present now. Inosine on the other hand
maintains the hybridization efficiency of primer to its binding
site with the help of flanking bases pairs. But a single or a few
of C and I pairs between or within primers make little contribution
to binding and do no result in substantial primer dimer formation.
Preferably such primers consist of a 3' segment that contains only
A, T, and C to minimize the mismatch effect on primer extension
efficiency, and a 5' segment including only any number of inosine
residues (e.g., 1-10)
[0155] In situations in which the primer binding sites are not
perfectly matched with primers in which an underrepresented
nucleotide type is entirely absent, the amplification can still
occur without the complement of the underrepresented nucleotide
type in the primers being supplied as a nucleotide triphosphate
monomer, but proceeds more efficiently if this nucleotide type is
supplied. This nucleotide type can however by supplied at reduced
concentration compared with the others of the standard four
nucleotides (e.g., <10.times., <100.times. or <1000.times.
each of the other nucleotide triphosphate monomers), or can be
supplied as a dideoxy NTP. Extension resulting from mispriming is
terminated by the dideoxy NTP. Use of either strategy (reducing
nucleotide concentration or use of ddNTP) decreases unintended
amplification products from mispriming or primer dimers. The
primers with inosine substitutions require dCTP in the reaction for
efficient extension on the inosine bases. The dCTP however can be
supplied at reduced concentration compared with the other types of
nucleotide triphosphate monomers.
[0156] When target sequences are from organisms of a variety of
species or genotypes, the template is a mixture of more than one
allele. Primer with underrepresented nucleotide can contain
degenerate bases at certain positions to match different sequence
variations.
[0157] Underrepresented primers with mismatches or inosine
substitutions can be used in combination with the conventional
primers of their original sequences (i.e. no mismatches or inosine
substitutions) in amplification reactions. However, a conventional
primer should have reduced concentrations, between 0.1% to 50% of
an underrepresented primer's concentration. The conventional
primers hybridize to their binding sites more efficiently than the
underrepresented primers and their extension products provide the
underrepresented primers with more templates. The types of dNTP
which are complement of the underrepresented nucleotide are
provided at reduced concentrations as mentioned above or are
completely omitted depending on the composition of the
underrepresented primers. Such combination of conventional and
underrepresented primers facilitates the amplification from
underrepresented primers and maintains the low primer-primer
interactions.
[0158] d. Toe Hold Primers
[0159] FIG. 14 shows a situation in which a search of a target
nucleic acid for suitable primer binding sites shows a suitable
reverse primer binding site and a potential forward primer binding
site, which has limited nucleotide composition (e.g., one
nucleotide type is absent), but is too short by itself to support
primer binding. In this situation, a forward primer is designed in
which a primer segment with an underrepresented nucleotide type is
linked at its 5' end to a nucleic acid segment of artificial
sequence (i.e., not complementary to the target nucleic acid)
having the same underrepresented nucleotide, which is itself linked
at its 5' end to a second primer segment in which all four
nucleotides are represented, which is complementary to the target
nucleic acid. Such a primer can hybridize to the target nucleic
acid with the segment of artificial sequence forming a loop flanked
by the two primer segments hybridized to the target nucleic acid.
Because the second primer segment helps the first primer segment
form a duplex the target nucleic acid despite the first primer
segment itself being too short to form a stabile duplex, the second
primer segment can be referred to as a toehold primer. Such primers
can be amplified in an amplification mix in which the complement of
the underrepresented nucleotide type is not supplied as a
nucleotide triphosphate monomer or in which all four standard
nucleotide triphosphate monomers are supplied. Either or both
primers can be supplied with toehold sequences and artificial
sequences as described. In a further variation instead of the
artificial sequence forming just a loop when the first and second
primer segments are hybridized to the target nucleic acid as shown
in FIG. 14, the artificial sequence can form a stem loop structure
shown in FIG. 15. The 3' end of the linker region is the complement
to the 3' end of the 5' priming region. The primer forms a hairpin
structure which stabilizes its hybridization with the template and
increases its amplification efficiency.
[0160] In another format, a single primer binding site can use two
kinds of primers for amplification simultaneously. One primer is
called helper in which the 3' primer segment with underrepresented
nucleotide is directly linked with the 5' primer segment that is
similar to conventional primer. The helper can hybridize with
target with sufficient efficiency to initiate amplification due to
help from conventional primer segment. For detection of multiple
alleles, the 5' primer segment can contain degenerate bases. The
other primer is underrepresented primer and very similar to the
helper primer by simply changing the fourth nucleotides in its 5'
segment with complement of underrepresented nucleotide type. The
helper is provided in limited amount to minimize unintended
amplification, while sufficient to initiate amplification. The
second primer is provided in regular concentration to carry on the
amplification.
[0161] e. Three Way Junction Primers
[0162] The type of situation shown in FIG. 14 in which one or both
of the primer binding sites with an underrepresented nucleotide
type is too short to support primer binding can alternatively be
addressed by the use of three way junction sequences as shown in
FIGS. 16A-C. Here a primer segment with an underrepresented
nucleotide type (1) is linked at its 5' end to an artificial
segment of the same underrepresented nucleotide type (2). This
primer is then held in place on the target nucleic acid with a
junction primer comprising a target binding site (4) and the
complement of the artificial segment (3). The target binding site
of the junction primer includes all four standard nucleotides. The
junction primer can be used at reduced concentration (copy number)
relative to the limited nucleotide composition primer. Either or
both of the forward and reverse primer can be replaced by three way
junction sequences.
[0163] FIG. 17 shows an alternative format for three way junction
probes. In this format a primer segment with an underrepresented
nucleotide type (2) is linked at its 3' end to an artificial
segment underrepresented in the same nucleotide typed (1). A
junction probe is supplied having a target binding segment (3)
linked at its 5' end to an artificial segment (4) having an
underrepresented nucleotide that is the complement of the
nucleotide underrepresented in the primer segment (2). The two
artificial segments (1) and (4) are complementary to one another
but of unequal lengths such that the shorter artificial segment (1
can extend using the longer artificial segment as a template. The
reverse primer is designed using an analogous approach. The
extension products from the forward and reverse primers are of
complementary sequence and can serve as a template for extension of
the other resulting in an amplification product.
[0164] FIG. 31B shows a similar arrangement in which a primer
segment with an underrepresented nucleotide type is linked at its
3' end to a nucleic acid having the complement of a promoter
sequence. A junction probe is supplied having a target binding
segment with an underrepresented nucleotide linked at its 5' end to
a nucleic acid having the promoter sequence, which is in turn
linked at its 5' end to a nucleic acid with an artificial sequence.
The promoter can initiate transcription to generate a transcript of
the artificial sequence linked to the promoter indicating presence
of the target nucleic acid.
[0165] FIG. 31A shows a similar arrangement to FIG. 31B but in
which as an alternative to a promoter the junction probe can be
linked through a nucleic acid with a restriction site to the
nucleic acid with an artificial sequence. Such an arrangement
supports nicking amplification. Oligonucleotide1 (left) consists of
a 3' artificial segment with restriction site linked to a 5'
segment, which is a three-nucleotide-type primer. Oligonucleotide2
(right) consists of a 5' artificial three-nucleotide-type sequence
linked to a 3' segment which is three-nucleotide-type primer, and a
linker segment complementary to the 3' sequence of
oligonucleotide1. Oligonucleotides1 and 2 form a three way junction
structure with the template. Oligonucleotide1 extends and forms
full restriction site. A nicking enzyme nicks and releases extended
product. Nicking and extension repeat in later cycles.
[0166] FIGS. 18A, B shows a variation on the format of FIG. 17 in
which the forward primer is as described in FIG. 17 but the reverse
primer is an artificial universal primer having the same
underrepresented nucleotide type as the forward primer. The forward
primer is specific to target sequence and the universal primer
remains same for different targets. In FIG. 18A, the three
nucleotide-type region (sequence 2) of primer 1 hybridizes to a
template. The 3' end of primer 1 (sequence 1) hybridizes to the
three nucleotide-type region (sequence 4) and extends sequence 5.
Extension product of the forward primer can serve as a template for
extension of the universal primer generating an amplification
product (FIG. 18B).
[0167] f. Rolling Circle Formats
[0168] FIG. 31C shows forward and reverse primers linked by a
nucleic acid of artificial sequence. Both the forward and reverse
primers and the artificial sequence have an underrepresented
nucleotide type. The forward and reverse primers bind to binding
sites on the same strand of a nucleic acid target and the nick is
filled with ligase. After ligation, free primers are digested to
leave only ligated circular products. The ligated product can be
amplified by rolling circle replication.
[0169] g. Detection Formats
[0170] The above methods are compatible with a variety of detection
formats. In one format, one or more of the nucleotide triphosphate
monomers used for amplification is labeled, so that detection label
gets incorporated into an amplification product with the labeled
monomer. Differentiation of amplification product from any
unincorporated labeled monomer allows detection of the
amplification signal. In another format, either or both of the
forward and reverse underrepresented primers is linked to a
detection label. Differentiation of amplification product from any
unincorporated labeled primer allows detection of the amplification
signal. The detection label may be attached at any position of the
primer. In another format, either or both of the forward and
reverse underrepresented primers are linked to an enzyme
recognition segment (e.g., a promoter recognized by a polymerase).
In another format, both the nucleotide triphosphate monomers and
either or both of the forward and reverse underrepresented
nucleotide primers used for amplification are labeled.
Differentiation of amplification product from any unincorporated
labeled primer and or nucleotide triphosphate monomers allows
detection of the amplification signal. In another format, special
reagents or chemicals are included in the amplification mixture
such as SYBR.TM. allows to monitor the amplification. In another
format, a side product such pyrophosphate allows detection of the
amplification reaction. In another format, the amplification
product is detected based on mass, size, temperature, electricity,
radiation, color, absorption, reflection, speed, and so forth. In
another format, either or both of the forward and reverse
underrepresented primers or portion of the underrepresented primers
are labeled with fluorophores. Quenching chemicals can be provided
in the amplification reaction such as new methylene blue,
7-deaza-2'-deoxyguanosine-5'-triphosphate, or
7-deaza-2'-deoxyadenosine-5'-triphosphate. The quenching chemicals
specifically incorporate into amplification products and quench the
fluorescence signal, whereas they have no effect on free
fluorophore labeled primers.
[0171] In a variation, the artificial segment is initially
hybridized to a complementary oligonucleotide linked to a quencher,
which quenches the fluorescence from the fluorescent label. The
complementary oligonucleotide with the quencher becomes detached in
performing the amplification, so that a fluorescent signal emerges
as the amplification proceeds. FIG. 19 shows, primer 1 at left is
labelled with F1. Primer 2 at right is labeled with F2. Such an
amplification product can be detected in real time without removal
of unincorporated fluorescently labelled primer. Optionally, such a
detection format can be performed with an excess of the unlabeled
primer (reverse primer as shown in FIG. 20) to improve probe
detection efficiency. Such a detection format can be multiplexed
for simultaneous detection of multiple targets.
[0172] FIG. 25A shows the composition of primers used an exemplary
method. One of the three nucleotide-type primers is tailed at its
5' end with universal artificial three nucleotide sequences. A 5'
end fluorophore labelled probe consists of a 3' sequence which is
the same as the artificial sequence of a primer and a 5' detection
probe. A 3' end quencher labelled probe complementary to the 5'
detection probe is also provided Fluorescence is quenched when no
amplification occurs.
[0173] FIG. 25B shows multiple primer pairs with the same 5'
artificial tail used to detect multiple targets. A reverse primer
extends to the artificial tail sequence and generates the
complementary sequence to the artificial tail. The newly generated
reverse primer extended on its 3' end hybridizes to the
fluorescence labeled probe and extends to replace the quencher
labeled probe. This ends with free fluorescence to be detected.
Different fluorophore labelled probes and primer tail sequences can
be used for multicolor detection.
[0174] In another detection format (Taqman.RTM. format) shown in
FIG. 23, one of the primers can be linked at its 5' end to an
artificial segment having the same underrepresent nucleotide(s) as
the primer to which it is linked. Such a primer is supplied with a
complementary oligonucleotide having a fluorescent label at one end
and a quencher at the other. When reverse primer extension meets
the quencher oligonucleotide, 5' exonuclease activity of the
polymerase digests the Taqman.RTM. probe and separates the
fluorophore and quencher giving rise to a fluorescent signal. Such
a signal can be detected without removal of unused primer allowing
real time detection.
[0175] FIGS. 38A-E show another detection format using a 5' Flap
endonuclease activity of Taq DNA polymerase. FIG. 38A shows the
primer structure. One of the primers is linked at its 5' end to an
artificial segment having the same underrepresented nucleotide(s)
as the primer to which it is linked. A single nucleotide "G" serves
as a linker between the primer and the artificial segment. A
complementary oligonucleotide having a fluorophore labeled at one
end and a quencher labeled internally is supplied at equal or
excess amount. The 3' segment of the complementary oligonucleotide
hybridizes to the artificial segment of the primer and the 5'
segment is not complementary to the primer sequence. FIG. 38B shows
that the primer has generated primer extension product and a
reverse primer binds to the product and extends. FIG. 38C C shows
that when reverse primer extension meets the junction of
hybridization between the artificial segment and the complement
oligonucleotide, 5' Flap endonuclease activity of the DNA
polymerase cleaves the complement oligonucleotides and separates
the fluorophore and quencher resulting in fluorescence signal. The
extension of reverse primer stops at the "G" because dCTP is not
provided in the reaction. Another complement oligonucleotide can
now bind to the artificial segment on the primer (FIG. 38D) and is
cleaved to release fluorescence signal (FIG. 38E). The process
repeats and fluorescence signal is amplified.
[0176] FIGS. 39A, B show a real-time detection format amenable to
multiplexing using a fluorophore quencher labeled oligo. FIG. 39A
shows primer structure. One of the primers is linked at its 5' end
to an artificial segment having the same underrepresented
nucleotide(s) as the primer to which it is linked. A fluorophore
and a quencher labeled oligonucleotide that has the same sequence
as the artificial segment is also provided in amplification
reaction. In its single strand form, the fluorophore and quencher
are in proximity and the fluorescence is quenched. FIG. 39B shows
that during the target amplification, reverse primer extensions
generate the complementary sequence of the artificial tail. FQ
labeled oligonucleotide, which has the same sequence as the
artificial tail can hybridize to the synthesized complementary
sequence. The fluorophore and quencher are no longer in proximity
and fluorescence is released. This reaction can be facilitated by
asymmetric reaction in which reverse primer is in excess amount so
that single strands of the complementary sequence are available for
the FQ oligonucleotide to hybridize.
[0177] FIG. 40A, B show a further real time detection format
amenable to multiplexing. FIG. 40A shows the primer structure. One
or both of the primers is linked at its 5' end to an artificial
segment having the same underrepresented nucleotide(s) as the
primer to which it is linked. A fluorophore and a quencher is
attached to the artificial segment and at least one of the label is
internal to the artificial segment. In the single strand form, the
fluorophore and quencher are in proximity and the fluorescence is
quenched. FIG. 40B shows that during the target amplification, the
artificial segment becomes double-stranded. The fluorophore and
quencher are no longer in proximity and fluorescence is
released.
[0178] FIG. 24 shows a further detection format (molecular beacon).
One or both of the primers is again linked at its 5' end to an
artificial segment which has the same underrepresented
nucleotide(s) as the primer to which it is linked. The
amplification is performed in the presence of a molecular beacon
probe which has a hairpin stem structure with a fluorophore and
quencher at the ends of the hairpin and the loop sequence
complementary to the complement of the artificial segment linked to
the primer. When an amplification product is formed the loop
segment of the molecular beacon hybridizes to the artificial
segment, separating the fluorophore and quencher generating a
fluorescent signal. This signal can be detected in real time
without removal of unincorporated molecular beacon.
[0179] All of the formats involving labeled primers or primers
having linked artificial sequences that hybridize with labelled
oligonucleotides can readily be multiplexed by using different
fluorescent labels and different artificial sequence for each
target to be detected. When multiplex amplifications are performed
with multiple primers or primer pairs, the underrepresented
nucleotide type(s) are usually the same in all primers present in
the multiplex. For example, all primers can have an
underrepresented G, or an underrepresented C.
[0180] Amplification products can also be detected by melt curve
analysis (changes in absorption with temperature), mass
spectrometry, gel electrophoresis, or capillary electrophoresis
among other techniques.
[0181] The disclosed methods greatly reduce primer dimer formation
and non-specific amplifications, thereby allowing use of
double-stranded intercalating dyes to detect amplicons, which is
very cost effective compared to the usage of fluorophore labeled
oligonucleotides. These methods can be adapted to use melt curve
analysis to differentiate between different amplicons based on
their Tm. The presence and absence of a melt peak at a certain
temperature determines the presence and absence of its
corresponding amplicon. Preferably, 3 or 4 or 5 or 6 amplicons can
be differentiated by their Tm ranging from 65.degree. C. to
95.degree. C. However, due to the nature of a regular amplicon, its
Tm cannot be in the lower Tm range (i.e. 40.degree. C.-65.degree.
C.). An artificial tail sequence with a Tm in the lower Tm range
(40.degree. C.-65.degree. C.) is attached to the 5' end of one or
more than one underrepresented primers (FIG. 37). One strand of the
artificial tail sequence can have the same underrepresented
nucleotide type(s) as the primer to which it is linked. Different
underrepresented primers can have the same artificial tail or
different artificial tails with different Tm. The complementary
sequences of the artificial tails are also provided in the reaction
so that they can form double strands. If the primer does not
participate in the PCR reaction, it remains unchanged in the
solution. After PCR, the double-stranded tail remains and shows a
melt peak at its Tm during melting curve analysis. However, if the
primer participate in PCR reactions, its extended products serve as
templates for other primers to hybridize and extend, and becomes
part of double strand amplicon. The double-stranded tail detaches
and its corresponding melting peak in the low Tm range (40.degree.
C.-65.degree. C.) disappears. Thus, as amplification proceeds there
is a transition from the melting peak of primer tail(s) to that of
amplification products incorporating such primers. Preferably, 3 or
4 or 5 or 6 types of the artificial tails with different Tm can be
introduced to different underrepresented primers. The disappearance
of one melting peak indicates the presence of the corresponding
target. This method greatly increases multiplicity of the reaction
with only one type of double-stranded intercalating dye. Instead of
an artificial tail and a complementary strand, stem-loop structures
can also be used to attach the underrepresented primers.
[0182] Combination of multi-channel fluorescence detection and Tm
differentiation enables even higher multiplicity. A series of the
artificial sequences with different Tm can be labeled with a
fluorophore and their complementary sequences are labeled with a
quencher. A second series of the artificial sequences can be
labeled with another fluorophore and their complementary sequences
labeled with another quencher. When the two series of sequences are
attached to the 5' end of different underrepresented primers, the
disappearance of a melting peak after amplification reaction in a
fluorescence channel indicates the presence of corresponding
target. The fluorophore and quencher can also be both labeled on
the complementary sequences so that its fluorescence is at minimum
level in single strand form and increases when it hybridizes to the
artificial tails on the underrepresented primers. When stem-loop
structures are used to attach underrepresented primers, fluorophore
and quencher are labeled on the two ends of the stem-loop
structures, in another word, one of the fluorophore and quencher is
internally labeled on the primer. The Tm differences between double
strands/stem-loops can be introduced by using different sequences
or by using mismatch bases in one strand.
[0183] In another format of multi-channel melt curve analysis, an
underrepresented primer is tailed on its 5' end by an artificial
sequence. A fluorophore and quencher labeled oligonucleotide with
the same sequence as the artificial tail is also provided. The
complementary sequence of the artificial tail (or the fluorophore
and quencher labeled oligo) is synthesized if the underrepresented
primer participates in the reaction. During melt curve analysis
after amplification reaction, the fluorophore and quencher labeled
oligonucleotide hybridizes to the complementary sequence and
dissociates when the temperature reaches its Tm. The
oligonucleotide has a higher fluorescence signal when it duplexes
with its complementary strand than the signal when it is in single
strand form. Therefore a melt peak is observed. Preferably 2 or 3
or 4 or 5 or 6 melt peaks can be resolved in a temperature range in
one fluorophore channel. The method can detect more targets in
multi-channel format. The difference in Tm can be introduced by
sequences with different base composition, sequences with different
length, sequences with mismatches to its complementary strand, and
the like.
[0184] The disclosed methods can be used to detect analytes other
than nucleic acids, for instance, proteins or antibodies. An
oligonucleotide template can be attached to an analyte. After
separating the unbound oligonucleotide template, amplification of
the oligonucleotide template with underrepresented primers
indicates the presence of the analyte. Alternatively,
underrepresented primers or probes can be attached to an analyte.
The detection of the underrepresented primers or probes indicates
the presence or absence of the analyte. For instance, after
proximity ligation of underrepresented primers or probes attached
to the analyte, detection of the ligated products indicates the
presence or absence of the analyte.
[0185] FIGS. 32A and B show exemplary formats for immunoPCR in
which the primers have one or more underrepresented nucleotide
type(s). In FIG. 32A, antigens coated to solid surface are detected
with antibodies attached by oligonucleotide which serve as realtime
PCR template. Realtime PCR signal indicates the presence of
antigen. The oligonucleotide can also be attached to secondary
antibodies which bind primary antibodies. The assay can also be
used in sandwich immunoassays. In FIG. 32B, antibodies specific to
different epitopes on an antigen or multiple antibodies are
attached to different oligonucleotides. When the antibodies bind
antigen, oligonucleotides 1 and 2 are ligated with help of helper
oligonucleotides. The ligation product serves as realtime PCR
template for detection of antigens. Such assay can also be used for
protein-protein interaction detection, where each protein binds
with a specific antibody that is attached with an oligonucleotide.
Protein-protein interactions result in proximity ligation of two
oligonucleotides when then serves as realtime PCR template for
detection.
[0186] FIG. 33 shows realtime PCR detection with energy transfer
between fluorophores.
[0187] Primer 1 (or both primers) with underrepresented nucleotide
type(s) is labeled with fluorophore 1 on its 5' end. For example,
as shown in the figure, primer 1 is labeled on its 5' A. In PCR
reaction, fluorophore 2 labeled dTTP is incorporated into product.
Excitation of fluorophore 2 results in energy transfer from
fluorophore 2 to fluorophore 1. Fluorophore 1 is then excited and
signal is detected.
[0188] FIG. 34 shows realtime PCR detection with a chemically
modified dNTP. One or more primers with underrepresented
nucleotides are labeled with fluorophores. One or more types of
dNTPs are labeled with a double-stranded DNA intercalating
chemical, or are modified such as deaza dGTP or deaza dATP. The
labeled or modified dNTP intercalate into PCR product and
fluorescence from primer is quenched. Signal drop indicates the
presence of template. In another embodiment, modified dNTP can be
used to selectively detect the signal from double-stranded DNA
intercalating dyes. For example, deaza-G or deaza-A will quench
SYBR.TM. Green signal in its proximity, therefore a regular PCR
product that contains evenly distributed deaza-Gs is not detected
by SYBR.TM. Green. The underrepresented primers can have artificial
sequences at their 5' ends that don't contain complementary bases
to the modified deoxynucleotide triphosphates. The synthesized
complementary sequences of the artificial sequences in the 5' end
will not contain the modified dNTP that will quench intercalating
dye. For example when ATC primer is tailed on its 5' end by
artificial sequence that contains no C, the PCR amplification
products include two segments: a segment that contains deaza-G and
a segment that contains no deaza-G. The intercalating dye SYBR.TM.
Green fluorescence will be quenched by the deaza-G in the first
segment and the SYBR.TM. Green fluorescence in the second segment
will not be quenched.
[0189] FIG. 35 shows realtime PCR detection with energy transfer
between fluorophore and DNA intercalating chemicals. One or more
primers with underrepresented nucleotides are labeled with
fluorophore. A dsDNA intercalating chemical is added into PCR
reaction. The chemical can be a fluorescence quencher which results
in fluorescence signal drop when template is present. The chemical
can also serve as energy transfer donor which excites the
fluorophore on primers when template is present.
[0190] FIG. 36 shows realtime PCR detection with a Lightup.RTM.
fluorophore. One or more primers with underrepresented nucleotides
are labeled with a Lightup.RTM. fluorophore. The fluorophore has no
fluorescence when the primers are in single strand form. In PCR
reaction, primers hybridize to templates and extend to form a
double strand. The fluorophore then intercalates into the
double-stranded DNA and fluorescence is detected.
[0191] For multiplex amplification with multiple pairs of
underrepresented primers or probes, the amplification products may
be detected with microarray, or sequences, or beads or nanobars.
One of a pair underrepresented primers is grafted to a surface in
conjunction with free primers in solution. These methods allow the
simultaneous amplification and attachment of a PCR product onto the
surface (Oroskar et al., 1996, Clinical Chemistry, 42(9),
1547-1555). Optionally both primers may be grafted to a surface for
amplification. The underrepresented primers or probes attached to a
surface may be coded or non-coded, or randomly distributed.
[0192] WO96/04404 (Mosaic Technologies, Inc. et al) discloses a
method of detection of a target nucleic acid in a sample which
potentially contains the target nucleic acid. The method involves
the induction of a PCR based amplification of the target nucleic
acid only when the target nucleic acid is present in the sample
being tested. For the amplification of the target sequence, both
primers are attached to a solid support, which results in the
amplified target nucleic acid sequences also being attached to the
solid support. The amplification technique disclosed in this
document is sometimes referred to as the "bridge amplification"
technique with the both forward and reverse underrepresented
primers are attached on a support. In this technique the two
underrepresented primers are, as for conventional PCR, specifically
designed so that they flank the particular target DNA sequence to
be amplified. Thus, if the particular target nucleic acid is
present in the sample, the target nucleic acid can hybridize to the
underrepresented primers and be amplified by PCR. The first step in
this PCR amplification process is the hybridization of the target
nucleic acid to the first specific underrepresented primer attached
to the support ("primer 1"). A first amplification product, which
is complementary to the target nucleic acid, is then formed by
extension of the primer 1sequence. On subjecting the support to
denaturation conditions the target nucleic acid is released and can
then participate in further hybridization reactions with other
primer 1 sequences which may be attached to the support. The first
amplification product which is attached to the support, may then
hybridize with the second specific underrepresented primer ("primer
2") attached to the support and a second amplification product
comprising a nucleic acid sequence complementary to the first
amplification product can be formed by extension of the primer 2
sequence and is also attached to the support. Thus, the target
nucleic acid and the first and second amplification products are
capable of participating in a plurality of hybridization and
extension processes, limited only by the initial presence of the
target nucleic acid and the number of primer 1 and primer 2
sequences initially present and the result is a number of copies of
the target sequence attached to the surface.
[0193] Amplification products are only formed if the target nucleic
acid is present. Therefore, monitoring the support for the presence
or absence of one or more amplification products is indicative of
the presence or absence of a specific target sequence.
[0194] The Mosaic technique can be used to achieve an amount of
multiplexing in that several different target nucleic acid
sequences can be amplified simultaneously by arraying different
sets of first and second underrepresented primers as disclosed
herein specific for each different target nucleic acid sequence, on
different regions of the solid support.
[0195] h. Amplification of Products with a Sticky End
[0196] Conventionally a PCR product with a sticky end is produced
with restriction sites tailed primers followed by restriction
enzyme digestion, or the addition of an extra adenine on 3' end by
the adenine transferase activity of Taq polymerase. Although the
first approach gives desirable results, it requires extra steps, is
time consuming, and is not always suitable to downstream
applications. The second approach only produces short overhangs
which have low efficiency for ligations. Disclosed in this
invention as shown in FIG. 26, the underrepresented primers are
linked at their 5' end with an artificial sequence and an
underrepresented nucleotides located between the 5' end artificial
sequence and the underrepresented primers. Depending on
application, one or both underrepresented primers can be tailed
with artificial sequences. When provided with only 3 nucleotide
triphosphate monomers omitting the complement of the
underrepresented nucleotide, primer extensions stops at the
position of the underrepresented nucleotide in the primer.
Amplification results in products with 5' overhang on one side or
both sides. The free choice of sequence and length of the
artificial tail allows various applications, such as cloning,
hybridization with single strand DNA on solid surface, ligation
with adapters, and so forth.
[0197] i. Smrt.TM.-Bell Primers for a Circular Amplification
Product
[0198] The methods can also be performed with primers linked to
hairpin loops forming bell-shaped primers useful for generating
circular products for next generation sequencing as shown in FIGS.
26 and 27. Forward and reverse primers with an underrepresented
nucleotide type are each linked at the 5' end to one arm of a
hairpin primer (which can have any nucleotide composition). The 5'
most nucleotide of the primer is the complement of the
underrepresented nucleotide. The two primers hybridize to
contiguous binding sites on the target nucleic acid or binding
sites that are non-contiguous but free of the underrepresented
nucleotide type. Both primers are extended in an amplification mix
lacking the complement of the underrepresented nucleotide.
Extension stops when the nucleotide triphosphate of complement of
the underrepresented nucleotide is needed to incorporate. The
extended strands of two primers hybridize with each other leaving a
circular structure with nicks between the 3' end of one primer and
the 5' of the other primer. The nicks are sealed with ligase
generating a circular product, which can serve as a template for
SMRT.TM. Bell sequencing. The process is shown in more detail in
FIGS. 27A-C. FIG. 27A shows a first primer includes a target
binding region A with an underrepresented nucleotide linked to a
hairpin with complementary stem regions C which is also a target
binding region and C' and a loop E 3' of which is a target binding
region. The reverse primer has a target binding region B with an
underrepresented nucleotide type linked to hairpin loop with
segments D which is also a target binding region and D' forming the
stem and a loop F 3' of which is a target binding region. In this
configuration segments A, C and part of E in the forward primer
bind to the template as to segments B, D and part of F in the
reverse primer. FIG. 27B shows both primers anneal to templates.
The ACE sequences of primer 1 hybridize to the A'C'E' sequences of
templates and extend B' sequence. BDF sequences of primer 2
hybridize to B'D'F; sequences of templates and extend A' sequence.
Extension stops when the non-provided nucleotide is needed. FIG.
27C shows the two extension products from step B form hairpin
structures and hybridize to each other at the A'B or AB' regions.
The nicks at arrows are ligated. A circular product is generated.
Non-circular oligonucleotides in the system can be digested with
exonuclease. Alternatively, the underrepresented primer may have a
stem loop structure at 5' end segment. When both such kinds of
underrepresented primers are used in amplification using non-strand
displacement polymerase in the amplification system, the amplified
product can be ligated to form a circular product with ligase.
Non-circular oligonucleotides in the system can be digested with an
exonuclease. The stem loop sequence at 5' end segment may be the
same or different for both underrepresented primers. The ligated
circular products can be cut with different chemicals or enzymes to
linearize the circular products for downstream application. The
disclosed invention methods can be used for second generation
sequence library preparation.
[0199] i. Primers Underrepresented in More than One Nucleotide
Type
[0200] The strategy and principles for primers with a single
underrepresented nucleotide type can be applied to primers or with
two or even three underrepresented nucleotides can be applied to
primers (or in other words consisting entirely or primarily of a
single nucleotide). Use of primers underrepresented in a single
nucleotide has wider applicability in natural target nucleic acids
because binding sites for such primers occur at statistically
greater frequency. However, some forms of amplification, such as
immune-PCR, amplify nucleic acids of artificial sequences. Such
artificial sequences can be designed to be amplified with primers
with two or even three underrepresented nucleotide type as with one
underrepresented nucleotide type.
[0201] In primers underrepresented in two nucleotide types, the two
underrepresented nucleotide types should not be complementary to
one another. In others words, the underrepresented nucleotide types
can be A with C, A with G, T/U with C or T/U with G. This leaves
primers consisting entirely or primarily of the same two
noncomplementary nucleotide types. Such primers have reduced
ability to support primer-dimer or primer-mismatch extension.
Primers have three nucleotides underrepresented or in other words,
consisting entirely or substantially of a single nucleotide type
also have reduced ability to support primer dimer or mismatched
primer extension. Primer binding sites are selected by analogous
principles to those described above, and primer sequences can be
adjusted to accommodate a small number of underrepresented
nucleotide(s) if necessary. Toehold and junction primer strategies
can also be used. Amplification with such primers is performed at
least with the complements of the nucleotides not underrepresented
in the primers, and optionally, with the complements of the
underrepresented nucleotide(s) as well, which as noted can be
supplied in reduced concentration or as dideoxy nucleotides.
[0202] j. Amplification Methods
[0203] The strategy and principles described above can be
incorporated into any amplification method involving
template-directed extension from single or paired primers. The
polymerase chain reaction is one implementation including
optionally RT-PCR. PCR is characterized by temperature cycling to
permit primer annealing, primer extension and denaturation of an
extended strand from its template.
[0204] Transcription mediated amplification (TMA) is an alternative
isothermal form in which one or both of the primers is linked to a
promoter at its 5' end, usually a T7 promoter, as shown in FIG.
29B. FIG. 29B shows two three nucleotide-type primers tailed with
promoter sequences for an RNA polymerase. Once the double-stranded
promoter is formed, the RNA polymerase starts transcription
amplification. The amplification product is single stranded RNA
molecules. TMA can also be coupled to reverse transcription.
[0205] Another isothermal amplification format amenable to use with
primers of the invention is the nicking amplification reaction
(NEAR). NEAR exponentially amplifies DNA at a constant temperature
using a polymerase and nicking enzyme. The primers for nicking
amplification are linked to artificial segments at their 5' ends,
the 5' segments containing a cleavage site for the nicking enzyme
(as shown in FIG. 29A). In the first cycle both primers hybridize
to a template and extend. In the next cycle, both primers can
hybridizes to the first cycle products and extend to generate the
full nicking site on the artificial tail. Once a nicking site is
formed, nicking enzyme nicks and releases one strand. Extension and
nicking repeat in the next cycle.
[0206] Another isothermal amplification procedure amenable to use
with primers of the invention is loop mediated isothermal
amplification or (LAMP). LAMP uses one or more primers having
underrepresented nucleotides in accordance with the invention.
(FIG. 30, left panel). In LAMP, the target sequence is amplified at
a constant temperature of 60-65.degree. C. using either two or
three sets of primers and a polymerase with high strand
displacement activity in addition to a replication activity.
Typically, 4 different primers are used to identify 6 distinct
regions on the target gene, which adds highly to the specificity.
An additional pair of "loop primers" can further accelerate the
reaction.
[0207] Another isothermal amplification format is Recombinase
Polymerase Amplification (RPA) is a single tube, isothermal
alternative to the Polymerase Chain Reaction (PCR) (FIG. 30 right).
The RPA process employs three core enzymes--a recombinase, a
single-stranded DNA-binding protein (SSB) and strand-displacing
polymerase. Recombinases are capable of pairing oligonucleotide
primers with homologous sequence in duplex DNA. SSB bind to
displaced strands of DNA and prevent the primers from being
displaced. Finally, the strand displacing polymerase begins DNA
synthesis where the primer has bound to the target DNA. By using
two opposing primers, much like PCR, if the target sequence is
indeed present, an exponential DNA amplification reaction is
initiated. The two primers can both be primers with
underrepresented nucleotide types as described above.
[0208] Still other amplification format in which primers of the
invention can be used include strand displacement assay,
transcription-based amplification systems, self-sustained sequence
replication (3SR), a ligation chain reaction (sometimes referred to
as oligonucleotide ligase amplification OLA), cycling probe
technology (CPT), rolling circle amplification (RCA), nucleic acid
sequence bases amplification (NASBA), invasive cleavage technology,
Helicase dependent amplification (HDA), Exponential amplification
(EXPAR), Hybridization chain reaction (HCR), and catalyzed hairpin
assembly (CHA).
[0209] Another amplification format is immune-PCR in which an
analyte is linked to a nucleic acid (which can have an artificial
sequence) and the analyte is detected by amplification of the
nucleic acid. Such amplification can be performed with a primer
pair with underrepresented nucleotide types (e.g., completely
absent) complementary to primer binding sites underrepresented in
the complements of the underrepresented nucleotide(s).
[0210] The above methods amplify a specific predetermined target
nucleic acid or segment thereof determined by the selected primers
and their complementary primer binding sites (in other words,
target-specific amplification). The amplification product from a
pair of primers binding to its intended primer binding sites
predominates over any or all other amplification products primed
from the same primer pair either by primer dimer binding or
mispriming on the target sequence. Optionally, the amplified
segment constitutes at least 99% of all amplification products
formed by extension of the forward and reverse primers. Preferably
the amplification product from primers binding to their intended
primer binding sites is present in at least 10, 50, 100 or 1000
fold excess (by moles, mass or copy number) of any or all other
amplification products primed from the primer pair. In some
methods, a single pair of primers is used in amplification. In
other methods, multiple primer pairs are used in a multiplex
amplification. The number of primer pairs can be for example 2-50
or more, preferably 5-25 or 10-20, or at least 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20. When multiple
primer pairs are used the intended amplification product of each
primer pair from binding of the primer pair to its intended primer
binding sites is present in at least 10, 50, 100 or 1000 fold
excess (by moles, mass or copy number) to any or all other
amplification products primed by that primer pair. Except in the
random priming format described below, primers used in the methods
are not random primers in which most or all primer positions are
occupied by random or degenerate selections of nucleotides varying
among primers. Rather each primer pair is designed to hybridize to
specific primer binding sites in a target nucleic acid, and
typically different primer pairs are unrelated from each other as
required by the different primer binding sites in target nucleic
acids being detected. For example, one primer pair can be designed
to bind to primer binding sites on a target nucleic acid in one
pathogen and a second primer pair to primer binding sites on a
different target nucleic acid in a different pathogen. Except by
coincidence the different target nucleic acids and consequently
primer binding sites and primers are unrelated to one another.
III. Random Priming with Degenerate Primers
[0211] The invention further provides methods of random priming
amplification with degenerate underrepresented primers-called
underrepresented degenerate primers. Such methods employ primers
with a 3' hybridization segment which randomly varies among primers
(as shown in FIG. 28) linked to a 5' artificial segment, which is
the same in different primers. The 5' artificial segment consists
of only three types of nucleotide with the possible exception of an
underrepresented nucleotide at the 5' end and the 3' hybridization
segment consists of the same three types of nucleotides. In another
embodiment, the 3' segment also consists of the same three types of
nucleotides except that it can also include limited number of units
of the fourth nucleotide type at positions except at the 3' end.
The limited number of units of the fourth nucleotide type (G)
present in the 3' random segment are more than 1%, but less than
20%. Usually no more than 1, 2 or 3 such nucleotides are present in
the 3' random segment. Including limited number of units of the
underrepresented nucleotide type in the 3' segment significantly
increases the diversity of random primers without significantly
increasing unintended random primer interactions. In another
embodiment, underrepresented degenerate primers may include
unnatural nucleotides, such as inosine, nitroindole, as long as
unnatural nucleotides included in the underrepresented primers may
help to reduce primer interaction comparing to traditional A, T, G,
C primers. The unnatural nucleotides can be included in the 5'
artificial segment or in the 3' random hybridization segment, or
included in both 5' artificial segment and 3' random hybridization
segment. An example of the 3' hybridization segment consists of A,
T, C and a fourth unnatural nucleotide inosine can be included in
random position. In such case, the 3' random hybridization segment
consists of A, T, C and I four nucleotides. In another embodiment,
the unnatural nucleotides can be included also as underrepresented
in the degenerated underrepresented primers. An example of A, T, C
degenerate underrepresented primers can include inosine with the
amount between 0.1% and 25%. The disclosed invention may include
one or two step amplifications: an initial amplification performed
with each of the four nucleotide triphosphate monomers generates
primary amplification products flanked by the 5' artificial segment
and its complement. A secondary amplification is then performed
with primers with 3' segment which is complementary to the
complement of the 5' artificial segment of the random primers. Such
methods are particularly useful for amplifying large regions of
DNA, such as BACS, YACS, whole chromosomes or whole genomes or
single cell amplification. Amplified product can be detected by
addition of SYBR.TM. green or by fluorescence labeled probes among
other methods. Primers used in secondary amplification can have 5'
tails for other applications such as sequencing library
preparation, single cell amplification among others. Amplification
can be by PCR or isothermal methods disclosed herein.
IV. Extension Reactions
[0212] The principles of primer design discussed above can also be
used for primers used for extension reactions, such as single-base
extension in which a primer hybridizes adjacent to but not spanning
a mutation, such as a SNP, or allele specific extension in which a
primer hybridizes across a site of mutation. In reactions involving
extension from a single primer, primer-primer dimerization is not a
concern but mismatched binding of a primer to a target nucleic acid
(or non-target nucleic acid) is a concern, and primer-dimer
problems can also arise in multiplex extension.
V. Mutation Detection
[0213] The present invention may be used for detecting a mutation
in target nucleic acids indicative of genomic instability. For
example, methods of mutation detection are useful to detect and/or
to identify mutations or other alterations associated with
diseases, such as cancer and other pathological genetic conditions,
disorders or syndromes. Such mutations include nucleotide
insertions, deletions, rearrangements, transitions, translations,
tranversions, polymorphisms, and substitutions. More specifically,
mutations can include single nucleotide polymorphisms (SNP's). The
present invention can be used to identify the presence or absence
of mutations. Generally, mutations can include any change in the
target nucleic acid, such as a loss of heterozygosity or other
indicia of genomic instability.
[0214] Generally, methods for detecting a mutation in a target
nucleic acid include hybridization-based assay or exposing a target
nucleic acid template suspected to contain a mutation to an
underrepresented primer that is capable of hybridizing to a known
region proximate to the suspected mutation. The underrepresented
primer is extended and one or more complementary nucleotides are
hybridized through the site suspected to contain the mutation. The
presence or absence of a mutation is determined by analyzing the
nucleotides that are incorporated or not incorporated into the
underrepresented primer. In one format, one or more
underrepresented primers contain 7-deaza-2'-deoxyguanosine and/or
7-deaza-2'-deoxyadenosine at 3' end. The unnatural nucleotides at
3' end further inhibit or facilitate amplification on templates to
detect mutations.
[0215] Many mutation detection methods reported in literature can
use current invention to improve detection accuracy. For instance,
SNPs detection is performed using two main methods, the traditional
and high throughput methods. The traditional gel-based approach
uses standard molecular techniques, such as amplification
refractory mutation system (ARMS), restriction digests and various
forms of gel electrophoresis (e.g., RFLP), denaturing gradient gel
electrophoresis (DGGE) and single-strand conformation polymorphism
(SSCP). High throughput methods include allele discrimination
methods (Allele-Specific Hybridization, Allele-Specific
Single-BasePrimer Extension), Padlock probe, Molecular inversion
probe (MIP), High-throughput assay chemistry (Flap endonuclease
discrimination, Oligonucleotide ligation), DNA arrays,
pyrosequencing, second generation sequencing, and light cycler.
VI. Computer Implementation
[0216] Selection of primer binding sites and primers can be
performed by computer-implemented analysis of a target nucleic acid
in a computer programmed by non-transitory computer readable
storage media. The sequence of a target nucleic acid (one or both
strands) is received in a computer. The computer also stores or
receives by user input desired nucleotide compositions of primers
(e.g., A, T, C). The computer is then programmed to search the
target sequence to identify forward and reverse primer binding
sites within a distance of one another compatible with
amplification that most closely correspond to the primer
composition. If the primer composition is A, T, C, then forward and
reverse primer binding sites should most closely correspond to A, T
and G. The computer can identify forward and reverse primer binding
sites on opposite strands or can identify a complement of the
forward primer binding sites and reverse primer binding site on the
same strand and calculate the forward primer binding site from its
complement. The computer can then provide output of candidate pairs
of primer binding sites, which may differ to varying degrees with
the ideal composition sought. The computer can also show primer
designs that hybridize to each of the primer binding site pairs.
Multiple primer designs can be shown for the same primer binding
site pair with different numbers of units of the underrepresented
nucleotide and different numbers of mismatches.
[0217] A computer system can include a bus which interconnects
major subsystems such as a central processor, a system memory, an
input/output controller, an external device such as a printer via a
parallel port, a display screen via a display adapter, a serial
port, a keyboard, a fixed disk drive, and an internet connection.
Many other devices can be connected such as a scanner via I/O
controller, a mouse connected to serial port or a network
interface. Many other devices or subsystems may be connected in a
similar manner. Also, it is not necessary for all of the devices to
be present to practice the present invention, as discussed below.
The devices and subsystems may be interconnected in different ways.
Source code to implement the present invention may be operably
disposed in system memory or stored on storage media such as a
fixed disk, compact disk or the like. The computer system can be a
mainframe, PC, table or cell phone among other possibilities.
VII. Method and Kits for Application
[0218] Any of the disclosed primers and probes can be incorporated
into kits. Such a kit preferably includes at least one primer pair
and preferably at least 5, 20 or 20 primer pairs. The primer pairs
in a kit are preferably capable of use in the same multiplex
reaction meaning that they have compatible melting temperatures as
well as the same underrepresented nucleotide type(s). Any other
reagents disclosed as being used with such primers and probes can
be included in such kits including NTPs for inclusion in
amplification reactions, mismatch stabilizing agents, fluorophores
or other labels. Kits can also include instructions detailing how
to use the kit in any of the disclosed methods.
[0219] The disclosed invention provides kits for the detection and
identification of microorganisms, e.g., pathogens infecting
mammals. Thus, the invention can be used, e.g., to identify the
particular strain of a virus that is infecting a human subject,
e.g., the particular strain of human immunodeficiency virus, or
papilloma virus (HPV), among others. Strains of microorganisms
often differ from each other in a few nucleotides, whereas the
remaining of their genomes is identical. Thus, probes can be made
to recognize the conserved regions and to identify the particular
variable nucleotide(s).
[0220] For example, a wide variety of infectious diseases can be
detected by the process of the present invention. Typically, these
are caused by bacterial, viral, parasite, and fungal infectious
agents. The resistance of various infectious agents to drugs can
also be determined using the present invention.
[0221] The present invention is also useful for detection of drug
resistance by infectious agents. For example, vancomycin-resistant
Enterococcus faecium, methicillin-resistant Staphylococcus aureus,
penicillin-resistant Streptococcus pneumoniae, multi-drug resistant
Mycobacterium tuberculosis, and AZT-resistant human
immunodeficiency virus can all be identified with the present
invention.
[0222] Genetic diseases can also be detected by the process of the
present invention. This can be carried out by prenatal or
post-natal screening for chromosomal and genetic aberrations or for
genetic diseases. Examples of detectable genetic diseases include:
21 hydroxylase deficiency, cystic fibrosis, Fragile X Syndrome,
Turner Syndrome, Duchenne Muscular Dystrophy, Down Syndrome or
other trisomies, heart disease, single gene diseases, HLA typing,
phenylketonuria, sickle cell anemia. Tay-Sachs Disease,
thalassemia, Klinefelter Syndrome, Huntington Disease, autoimmune
diseases, lipidosis, obesity defects, hemophilia, inborn errors of
metabolism, and diabetes.
[0223] Cancers which can be detected by the process of the present
invention generally involve oncogenes, tumor suppressor genes, or
genes involved in DNA amplification, replication, recombination, or
repair. Examples of these include: BRCA1 gene, p53 gene, APC gene,
Her2/Neu amplification, Bcr/AB1, K-ras gene, and human
papillomavirus Types 16 and 18. Various aspects of the present
invention can be used to identify amplifications, large deletions
as well as point mutations and small deletions/insertions of the
above genes in the following common human cancers: leukemia, colon
cancer, breast cancer, lung cancer, prostate cancer, brain tumors,
central nervous system tumors, bladder tumors, melanomas, liver
cancer, osteosarcoma and other bone cancers, testicular and ovarian
carcinomas, head and neck tumors, and cervical neoplasms.
[0224] In the area of environmental monitoring, the present
invention can be used for detection, identification, and monitoring
of pathogenic and indigenous microorganisms in natural and
engineered ecosystems and microcosms such as in municipal waste
water purification systems and water reservoirs or in polluted
areas undergoing bioremediation. It is also possible to detect
plasmids containing genes that can metabolize xenobiotics, to
monitor specific target microorganisms in population dynamic
studies, or either to detect, identify, or monitor genetically
modified microorganisms in the environment and in industrial
plants.
[0225] The present invention can be used for sequencing library
preparation for NGS, single cell amplification and detection such
as RNA-seq, prenatal detection such as down syndrome, and so
forth.
[0226] The present invention can also be used in a variety of
forensic areas, including for human identification for military
personnel and criminal investigation, paternity testing and family
relation analysis, HLA compatibility typing, Short Tandom Repeats
(STR) and screening blood, sperm, or transplantation organs for
contamination.
[0227] In the food and feed industry, the present invention has a
wide variety of applications. For example, it can be used for
identification and characterization of production organisms such as
yeast for production of beer, wine, cheese, yogurt, bread, and so
forth. Another area of use is with regard to quality control and
certification of products and processes (e.g., livestock,
pasteurization, and meat processing) for contaminants. Other uses
include the characterization of plants, bulbs, and seeds for
breeding purposes, identification of the presence of plant-specific
pathogens, and detection and identification of veterinary
infections and in animal breeding programs.
[0228] Although the invention has been described in detail for
purposes of clarity of understanding, certain modifications may be
practiced within the scope of the appended claims. All publications
including accession numbers, websites and the like, and patent
documents cited in this application are hereby incorporated by
reference in their entirety for all purposes to the same extent as
if each were so individually denoted. To the extent difference
version of a sequence, website or other reference may be present at
different times, the version associated with the reference at the
effective filing date is meant. The effective filing date means the
earliest priority date at which the accession number at issue is
disclosed. Unless otherwise apparent from the context any element,
embodiment, step, feature or aspect of the invention can be
performed in combination with any other.
EXAMPLES
Examples 1 and 2: Transient Interactions in Conventional Primers
and Three Nucleotides Primers
[0229] Although primer dimer formation is not fully understood, it
is clear that primer interaction is responsible for unintended
amplification products. In theory, with the help of computation,
conventional four nucleotides primers can be very carefully
designed to avoid secondary structures and primer-primer
interactions. Such computations work well for single pair of
primers but less so for multiplexes.
[0230] We designed a set of four nucleotide primers (regular primer
1-32) by theoretical computation. In multiplex with 32 primers, we
found extremely high level of primer-primer interactions. A set of
three-nucleotide-type primers with random sequences was also
multiplexed. Primer interactions were much lower in the
three-nucleotide-type primer multiplex.
[0231] We used SYBR.TM. Green to detect any primer-primer
interaction formed in the reaction. A 25 ul reaction contained 10
mM Tris-HCl (pH8.3), 50 mM KCl (1:10 dilution of AmpliTaq.TM. Gold
PCR buffer II, Life Technologies), 2 mM MgCl2(1:12.5 dilution of 25
mM stock MgCl2 solution, Life Technologies), 0.2 mM each
dNTP(1:12.5 diluted from 2.5 mM each dNTPs solution, which was
prepared from 100 mM stock dNTP solutions, Life Technologies), and
1.times. SYBR.TM. green 11(1:100 dilution from 100.times. stock
solution, which was prepared from 10000.times. stock solution,
Sigma-Aldrich). Thirty-two four-nucleotide-type primers or
three-nucleotide-type primers (IDTDNA) were added to final
concentrations of 2.6 uM, 5.2 uM, 13 uM, 26 uM, 39 uM, and 52 uM.
The reactions were heated to 95 C for 2 min, and cooled to 65 C for
signal detection.
[0232] FIG. 2A shows four-nucleotide-type primer interactions. When
no primers were present (0 uM), the fluorescence signal was zero.
2.6 uM shows a fluorescence signal at ca. 100k. 5.2 uM shows a
fluorescence signal at ca. 150k-180k. 13.1 uM shows a fluorescence
signal at ca. 250k-300k. 26 uM and 39 uM show fluorescence signal
at ca. 300k-350k.
[0233] FIG. 2B shows three-nucleotide-type primer interactions. 2.6
uM, 5.2 uM, and 13 uM concentrations of primers only showed minimal
fluorescence level of less than 10k. 26 uM, 39 uM, and 52 uM
concentrations showed gradually increase fluorescence from ca.
12.5k to ca. 25k.
Example 3: Four Nucleotide and Three Nucleotide Primer Dimer
Formation in PCR Reactions
[0234] As shown in example 2, primer-primer interactions are at
extremely high level for four-nucleotide-type primers and are at
very low level for three-nucleotide-type primers. Therefore, in PCR
reactions, three-nucleotide-type primers should have a much lower
primer-dimer formation. We multiplexed the same sets of primers
used in previous example in PCR reactions.
[0235] For three nucleotide primers, a 25 ul PCR reaction contained
10 mM Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM
dTTP, 0.2 mM dGTP, 1.times.SYBR.TM. green II, and 1.875 u of
AmpliTaq.TM. Gold DNA polymerase (Life Technologies). For four
nucleotide primers, 0.2 mM dCTP is also added. Both three
nucleotides primers and regular four nucleotides primers are added
to a total concentration of 2.6 uM. PCR cycling was carried out on
StepOne.TM. Real-Time PCR System. Cycling conditions were as
following: 95.degree. C. 10 minutes, 10 cycles of (95.degree. C. 15
seconds, 60.degree. C. 30 seconds), and 50 cycles of (95.degree. C.
15 seconds, 65.degree. C. 30 seconds). Both reactions were repeated
for 48 times.
[0236] FIG. 3A shows three-nucleotide-type primer dimer formation.
Only 2 of 48 repeats had primer dimer at 50 and 55 cycles. FIG. 3B
shows four-nucleotide-type primer dimer formation. All 48 reactions
consistently had primer dimers before 30 cycles.
Example 4: Real Time PCR Reaction with Three-Nucleotide-Type
Primers and Three-Nucleotide-Type dNTPs
[0237] Three-nucleotide-type primers with mismatches were designed
to detect human genomic DNA.
[0238] A 25 ul PCR reaction contained 100 ng human genomic DNA
(NEB), 10 mM Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP,
0.2 mM dTTP, 0.2 mM dGTP, 1x SYBR.TM. green II, 0.8 mM each primer
(Hemo2F, Hemo2R), 1.25 u of AmpliTaq.TM. Gold DNA polymerase. A
no-template control reaction contained no human genomic DNA. PCR
cycling was carried out on StepOne.TM. Real-Time PCR System (Life
Technologies). Cycling conditions were as following: 95.degree. C.
10 minutes, 60 cycles of (95.degree. C. 15 seconds, 60.degree. C.
15 seconds). The fluorescence signal was recorded at annealing
step.
[0239] FIG. 4A shows fluorescence over time for PCR reaction with
human genomic DNA as a template. FIG. 4B shows fluorescence over
time for PCR reaction of a no template control.
[0240] 100 ng human genomic DNA was readily detected with
three-nucleotide-type primer real time PCR. When no template was
present, no primer dimers formed.
Example 5: Real Time PCR and End Point Detection with
Three-Nucleotide-Type Primers and 4 Nucleotides dNTPs
[0241] In this example, three-nucleotide-type primers were used in
the same way as conventional four-nucleotide-type primers would be.
Two sets of primers were tested for detection of HPV11. HPV11-1F
and HPV11-1R had no mismatches, HPV11MM1F had mismatches at
position 12 and 18, and HPV11MM1R had mismatches at position 11 and
22.
[0242] The HPV template was diluted to 10.sup.5 (1 pg), 10.sup.4
(100 fg), 10.sup.3 (10 fg), 10.sup.2 (0.1 fg), 10.sup.1 (0.01 fg)
copies/ul. A 25 ul PCR reaction contained 1 ul template, 10 mM
Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM each dATP, dTTP,
and dGTP, 1.times.SYBR.TM. green II, 0.8 mM each primer, 1.25 u of
AmpliTaq.TM. Gold DNA polymerase. PCR cycling was carried out on
StepOne.TM. Real-Time PCR System. Cycling conditions were as
following: 95.degree. C. 10 minutes, 60 cycles of (95.degree. C. 15
seconds, 60.degree. C. 15 seconds). Fluorescence signal was
recorded at annealing step. After 60 cycles, 6.times.DNA loading
dye was added and 10 ul samples were loaded onto 0.8% agarose
gel.
[0243] FIGS. 8A, B show fluorescence over time for all templates
including H.sub.2O for a no template control. As few as 10 copies
of HPV template could be readily detected, whereas the no template
control had no amplification over 60 cycles. FIG. 8C shows a gel
electrophoresis image of amplification products. All templates were
amplified with correct size products regardless of presence of
mismatch in primer sequences.
Example 6: Three-Nucleotide-Type Primer with 5' G
[0244] The hybridization region of three-nucleotide-type primers on
template is usually flanked by a C on its 3' end. Otherwise when it
is an A T or G, more bases could be included in the primer
consistent with the limited composition. In this example, we
designed a three-nucleotide-type primer with a G on its 5' end to
match with the 3' C on template. Such primers have higher Tm and
improved hybridization efficiency.
[0245] Addition of a G on the 5' end potentially enables pairing of
C of same primer or different primer. However, such a pairing has
no effect on primer dimer formation because no extension can occur
on the 5' end. In some extreme cases, when primer dimers form, the
unintended extension product ends with a C on its 3' end as other
primers. The 3' C prevents further extension when this product
interacts with other primers because the 3' C cannot pair with any
other bases on the primers.
Example 7: Mismatch Binding Reagents Stabilize Primer Template
Hybridization
[0246] Amplifications can be performed with primers with
mismatches. When more mismatches are introduced into primers,
primer-template hybridization is less efficient. In this example,
mismatch binding reagents are added into reaction to stabilize
primer-template hybridization and increase amplification
efficiency.
[0247] To test the effect of mismatch binding reagent on
primer-template hybridization, pairs of synthetic oligonucleotides
with various degrees of mismatches are mixed with mismatch binding
reagent. Typically oligonucleotides are provided at 0.1-1 uM in the
presence of 10 mM Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM
dATP, 0.2 mM dTTP, 0.2 mM dGTP, 1.times.SYBR.TM. green II. Mismatch
binding reagent is provided in 0.times., 0.001.times., 0.01.times.,
0.1.times., or 1.times. concentration of the oligos. Melting curve
analysis is conducted as following condition: mixture is heated to
95.degree. C. for 1 minute to completely denature two oligos;
mixture is then cooled slowly down to desired temperature modified
according to theoretical melting temperature of the two oligos,
e.g. 10-20 degrees below the melting temperature of one
oligonucleotide assuming no mismatch; mixture is then heated by
0.1-0.3.degree. C. per step, fluorescence signal is collected each
step. Melting curves of oligonucleotides with various degree of
mismatch and various amount of mismatch binding reagent are plotted
and melting temperatures are calculated. The mismatch binding
reagent that increases melting temperature of oligonucleotides with
mismatch are selected to use in amplification.
[0248] A 25 ul amplification reaction contains templates, 10 mM
Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP,
0.2 mM dGTP, 1.times.SYBR.TM. green II, and 1.25 u of AmpliTaq.TM.
Gold DNA polymerase. Three-nucleotide primers are added typically
to a concentration of 100 nm, 200 nM, 400 nM, or 800 nM. Mismatch
binding reagents are added in the reaction to a concentration
typically at a ratio to the concentration of primers of 1:1000,
1:100, 1:10, 1:1 10:1, 100:1, 1000:1. PCR cycling conditions are as
following: 95.degree. C. 10 minutes, 10 cycles of (95.degree. C. 15
seconds, 60.degree. C. 30 seconds), and 50 cycles of (95.degree. C.
15 seconds, 65.degree. C. 30 seconds).
Example 8: Comparison of Primer Dimer Formation Between Three
Nucleotide Primers and Four Nucleotide Primers
[0249] We have compared primer dimer formation between three
nucleotide primer with three nucleotide dNTPs and four nucleotide
primer with four nucleotide dNTPs. In this example, we compared
primer dimer formation for one more situation, three nucleotide
primers with four nucleotide dNTPs. The three-nucleotide-type
primers were designed to amplify human genomic sequences targeting
Hemoglobin (Hemo1F, Hemo1R, Hemo2F, Hemo2R), PPIA (PPIAF and
PPIAR), GAPDH (GAPDHF, GAPDHR), and YWHZ (YWHZ1F, YWHZ1R, YWHZ2F,
YWHZ2R). The four-nucleotide-type primers (regular 1-12) were
designed for HPV detection, but were used here to compare with
three nucleotide primers. All reactions contained 12 oligos.
[0250] A 25 ul PCR reaction contained 10 mM Tris-HCl (pH8.3), 50 mM
KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dGTP,
1.times.SYBR.TM. green II, and 1.875 u of AmpliTaq.TM. Gold DNA
polymerase. In the reactions with 4 dNTPs, 0.2 mM dCTP is added.
Both three-nucleotide-type primers and regular four-nucleotide-type
primers were added to a total concentration of 2.62 uM. PCR cycling
was carried out on StepOne.TM. Real-Time PCR System. Cycling
conditions were as following: 95.degree. C. 10 minutes, 10 cycles
of (95.degree. C. 15 seconds, 60.degree. C. 30 seconds), and 50
cycles of (95.degree. C. 15 seconds, 65.degree. C. 30 seconds). No
template was present. After conducting PCR, the mix was run on 1.5%
agarose gel. Any detectable products would be the result of
amplification from primer dimer formation.
[0251] FIG. 9 shows the agarose gel image. Lane 1 is a DNA ladder.
Lane 2 is three-nucleotide-type primers with three nucleotide
dNTPs. Lane 3 is three-nucleotide-type primers with four nucleotide
dNTPs. Lane 4 is four-nucleotide-type primers with four nucleotide
dNTPs. Both reactions with three-nucleotide-type primers did not
have any visible products, whereas four nucleotides primers formed
primer dimers in the absence of template.
Example 9: PCR with Constrained Primers with 1 or 2
Underrepresented Nucleotides
[0252] Certain templates are not suitable to design three
nucleotide-type primers. For example, a primer may be unsuitable
when a mismatch is very close to the 3' end of one or both primers,
or when many mismatches have to be present. In such case,
constrained primers with 1 or 2 underrepresented nucleotides can be
used. These primers can still have mismatches with template if
necessary, but have no more than 2 underrepresented nucleotides to
minimize primer-primer interactions.
[0253] Two sets of primers were designed for human genomic sequence
targeting atm and csf1r. ATM_F and ATM_R each contains 1 G and 2
mismatches. CSF1R_F and CSF1R_R each contains 2 Gs. The expected
product sizes are 301 bp and 232 bp. A 25 ul PCR reaction contained
10 ng human genomic DNA, 10 mM Tris-HCl (pH8.3), 50 mM KCl, 2 mM
MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dGTP, 0.2 mM dCTP,
1.times.SYBR.TM. green II, 400 nM each primer, and 1.25 u of
AmpliTaq.TM. Gold DNA polymerase. PCR cycling was carried out on
StepOne.TM. Real-Time PCR System. Cycling conditions were as
following: 95.degree. C. 10 minutes, 10 cycles of (95.degree. C. 15
seconds, 60.degree. C. 30 seconds, 72.degree. C. 30 seconds), and
35 cycles of (95.degree. C. 15 seconds, 65.degree. C. 30 seconds,
72.degree. C. 30 seconds). PCR products were run on 1.5% agarose
gel.
[0254] FIG. 10A shows an agarose gel image. Lane 1 is DNA ladder.
Lane 2 is atm PCR product. Lane 3 is csf1r PCR product.
[0255] No template control reactions were conducted to compare
primer dimer formation of constrained primers and regular four
nucleotide primers. A 25 ul PCR reaction contained 10 mM Tris-HCl
(pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM
dGTP, 0.2 mM dCTP, 1.times.SYBR.TM. green II, and 1.875 u of
AmpliTaq.TM. Gold DNA polymerase. Both constrained primers
(ATC-1G-1 to ATC-1G-10, ATC-2G-1 to ATC-2G-10) and regular four
nucleotides primers (regular 1-10) were multiplexed with 10
oligonucleotides and added to a total concentration of 50 uM. PCR
cycling was carried out on StepOne.TM. Real-Time PCR System.
Cycling conditions were as following: 95.degree. C. 10 minutes, 10
cycles of (95.degree. C. 15 seconds, 60.degree. C. 30 seconds), and
50 cycles of (95.degree. C. 15 seconds, 65.degree. C. 30 seconds).
Fluorescence signal was collected at the annealing step.
[0256] FIG. 10B shows fluorescence over time for constrained
primers with 1G (underrepresented nucleotide). FIG. 10C shows
fluorescence over time for constrained primers with 2Gs. FIG. 7D
shows fluorescence over time for regular four-nucleotide-type
primers. Both constrained primers reduced primer dimer formation
and false positive amplification was undetectable until 40 cycles.
The regular four nucleotides primers had strong primer-primer
interactions and false positive amplification consistently appeared
at about 25 cycles.
Example 10: Toehold Primer
[0257] When certain target sequences need to be amplified and no
three-nucleotide-type sequence of sufficient length is available
for the target, a toehold primer can be used. Both 5' segment and
3' segment of the toehold primers can bind to target sequence,
therefore primer-template hybridization is with higher efficiency
than the efficiency of the short three-nucleotide-type primer.
Three-nucleotide-type artificial linker then serves as template for
extension and provide sufficient primer-template binding length for
later cycles. With omission of one type of nucleotide triphosphate
monomers, the four-nucleotide-type nature of the 5' segment of
toehold primer doesn't significantly increase unintended
amplification. Toehold primers can also be provided in low
concentrations to further lower the chance of unintended
amplification.
[0258] A 25 ul PCR reaction contains templates, 10 mM Tris-HCl
(pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM
dGTP, 1.times.SYBR.TM. green II, and 1.25 u of AmpliTaq.TM. Gold
DNA polymerase. Three-nucleotide primers are added typically to a
concentration of 100 nM, 200 nM, 400 nM, or 800 nM. The toehold
primers are added typically to a concentration of 1 nM, 10 nM, 100
nM, 200 nM, 400 nM, 800 nM. PCR cycling conditions are as
following: 95.degree. C. 10 minutes, 10 cycles of (95.degree. C. 15
seconds, 60.degree. C. 30 seconds), and 50 cycles of (95.degree. C.
15 seconds, 65.degree. C. 30 seconds).
Example 11: Three Way Junction Format for Three Nucleotide
Primer
[0259] FIG. 16A shows a template to be amplified. In FIG. 16B, the
four-nucleotide-type 5' region (sequence 4) of the 3 way junction
helper hybridizes to template. The forward primer (sequence 1)
hybridizes to the template next to the hybridization region of
sequence 4. The artificial segments linked to the 5' end of forward
primer (sequence 2) and the 3' end of 3 way junction helper
(sequence 3) are complementary to each other and hybridize together
to stabilize the full structure and initiate polymerase extension.
On the other strand, a reverse primer hybridizes and extend in the
three nucleotide region where sequence 1 hybridizes. In FIG. 16C,
forward primer extension product hybridizes to reverse primer and
generates full length products. A three way junction format can be
applied to both primers.
[0260] A 25 ul PCR reaction contains templates, 10 mM Tris-HCl
(pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM
dGTP, 1.times.SYBR.TM. green II, and 1.25 u of AmpliTaq.TM. Gold
DNA polymerase. Three-nucleotide primers are added typically to a
concentration of 100 nM, 200 nM, 400 nM, or 800 nM. The three way
junction helpers are added typically to a concentration of 1 nM, 10
nM, 100 nM, 200 nM, 400 nM, 800 nM. PCR conditions are as
following: 95.degree. C. 10 minutes, 10 cycles of (95.degree. C. 15
seconds, 60.degree. C. 30 seconds), and 50 cycles of (95.degree. C.
15 seconds, 65.degree. C. 30 seconds).
Example 12: Three Nucleotide Mismatch Primer or Constrained Primer
PCR with Limited Amount of One of Four Nucleotide Monophosphate
[0261] When three-nucleotide-type primers with G absent and with at
least one mismatch are used for amplification with three nucleotide
monophosphates, primer extension stops when dCTP is required. The
intermediate products will hybridize to each other or hybridize to
primers to extend to full products. When dCTP is provided in
limited amount, incorporation of dCTP in primer extension generates
more template, therefore will generate more intermediate products
for three nucleotides primer PCR, which increases PCR efficiency.
Constrained primers preferably contain no more than 2 Gs. When
template permits, dCTP is provided in a limited amount so that it
is sufficient for PCR extension; however it still limits the
formation of primer dimer or non-specific amplification with
template.
[0262] A set of primers are designed for HPV containing 1Gin
forward primer and 2Gs (11-1G-F, 11-2G-R) in reverse primer. A 25
ul PCR reaction contained 1 pg HPV11 DNA, 10 mM Tris-HCl (pH8.3),
50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dGTP,
4.times.SYBR.TM. green II, 400 nM each primer, and 1.875 u of
AmpliTaq.TM. Gold DNA polymerase. In the reactions with dCTP, dCTP
was added at 1 uM (1/200 of regular amount). PCR cycling was
carried out on StepOne.TM. Real-Time PCR System. Cycling conditions
were as following: 95.degree. C. 10 minutes, 10 cycles of
(95.degree. C. 15 seconds, 60.degree. C. 30 seconds), and 50 cycles
of (95.degree. C. 15 seconds, 65.degree. C. 30 seconds).
Fluorescence signal was collected at the annealing step.
[0263] FIG. 11A shows fluorescence over time for constrained primer
PCR with 1 uM dCTP. FIG. 11B shows fluorescence over time for
constrained primer PCR with no dCTP. FIG. 11C shows fluorescence
over time for constrained primer and no template control with 1 uM
dCTP. As low as 1 uM dCTP is sufficient for amplification with
constrained primers. When no dCTP is provided, primer extension
stops when dCTP is required. Therefore only short double-strand
products are formed, giving a delayed amplification curve and low
amplification signal. In the no template control, with 1 uM dCTP,
no primer dimer formed in 60 cycles.
Example 13: Reducing Non-Specific Amplification in Multiplex PCR
with Three-Nucleotide-Type Primers by Adding Fourth Nucleotide
Monophosphate as ddNTP
[0264] Three-nucleotide-type primers can also reduce non-specific
template amplification because primers cannot extend long sequences
without dCTP at non-specific priming site. When ddCTP is provided
in a PCR reaction, any time non-specific primer extension meets a G
on the template, ddCTP is incorporated and prevents this product
from further extension. However, specific three nucleotide primer
PCR does not incorporate ddCTP, and is therefore not affected by
addition of ddCTP. We designed three nucleotide primers for HPV56
detection in patient cervical samples. Human genomic DNA is always
present in patient samples at high amount. Occasionally HPV56
primers can react with human genomic DNA and have non-specific
amplification when no HPV56 DNA is present. When ddCTP is added in
the reaction at 0.2 mM, non-specific amplification rate is reduced
to an undetectable level.
[0265] A 25 ul PCR reaction contained 100 ng human genomic DNA
template, 10 mM Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM
dATP, 0.2 mM dTTP, 0.2 mM dGTP, 1x SYBR.TM. green II, 400 nM each
HPV56 and human YWHZ primers, and 1.875 u of AmpliTaq.TM. Gold DNA
polymerase. For ddCTP reactions, 0.2 mM ddCTP is added. PCR cycling
was carried out on StepOne.TM. Real-Time PCR System. Cycling
conditions were as following: 95.degree. C. 10 minutes, 10 cycles
of (95.degree. C. 15 seconds, 60.degree. C. 30 seconds), and 50
cycles of (95.degree. C. 15 seconds, 65.degree. C. 30 seconds).
[0266] Both HPV56 primers (56MM1F, 56MM1R) and human YWHZ primers
(YWHZF1Tmtail, YWHZR1Tmtail) were used in the PCR reaction. The
reaction with ddCTP was repeated so that we have a non-specifically
amplified product. The reaction without ddCTP was repeated and no
non-specific amplification was observed. FIG. 12 shows a gel image.
Lane 1 is DNA ladder. Lane 2 shows YWHZ product at 116 bp and a
non-specific HPV56 primer product at 81 bp when ddCTP is not
provided. Lane 3 shows only YWHZ product is present when ddCTP is
provided.
Example 14: Multiplex Detection of Multi-Templates with Melt Curve
Analysis
[0267] As shown in example 13, we designed three-nucleotide-type
HPV primers to detect HPV in patient samples and human YWHZ primers
as internal control. When we use DNA intercalating dye SYBR.TM.
green as signal detecting reagents, HPV and internal control were
both detected with same dye. To differentiate the two types of
reaction, the primers were modified so that PCR products of HPV and
internal control have different Tm, and were separated with melting
curve analysis. A negative control was performed with only human
genomic DNA as template.
[0268] A 25 ul PCR reaction contained 10 pg HPV56 DNA template, 10
ng human genomic DNA template, 10 mM Tris-HCl (pH8.3), 50 mM KCl, 2
mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dGTP, 1.times.SYBR.TM.
green II, and 1.875 u of AmpliTaq.TM. Gold DNA polymerase. Primer
concentrations are 100 nM each primer. In negative sample, no HPV56
DNA is added. PCR cycling was carried out on StepOne.TM. Real-Time
PCR System. Cycling conditions were as following: 95.degree. C. 10
minutes, 10 cycles of (95.degree. C. 15 seconds, 60.degree. C. 30
seconds), and 50 cycles of (95.degree. C. 15 seconds, 65.degree. C.
30 seconds). Fluorescence signal was recorded at annealing step and
melt curve analysis was performed at the end of cycling
program.
[0269] FIG. 13A shows two well-resolved melt curves peaks generated
at 72.47.degree. C. and 79.86.degree. C. corresponding to HPV56 and
human YWHZ products. In contrast, in FIG. 13B, negative controls
did not show a 72.47.degree. C. melt curve peak indicating that no
HPV56 was present.
Example 16: Real Time PCR Detection with Fluorescence Labeled Three
Nucleotides Primer
[0270] In addition to SYBR.TM. green based detection, we also
tested fluorescence based detection with three nucleotides primers.
Fluorescence labeled primers enable high multiplex and enable
multiple channel detection in single tube reaction. We added an
artificial three nucleotide tail to human YWHZ primers and labeled
the tail with FAM fluorophore at 5' end, and a quencher labeled
probe which is complementary to the artificial tail. We carefully
designed the tail/probe sequence with lower Tm than those of
primers so that extension can happen at a higher annealing
temperature to ensure full extension to tailed region, before
quenchers hybridize to free fluorescence primers at a lower
temperature for signal detection. The assay can be facilitated with
asymmetric primer concentration in the PCR reaction where reverse
primer is provided in excess amount to preferentially generate
strands that are detected by fluorescence labeled primer (FIG. 22).
Because signal generation relies on reveres primer extension,
excess amount of reverse primer enhances the signal and thereby the
efficiency of the reaction.
[0271] A 25 ul PCR reaction contained 10 ng human genomic DNA
template, 10 mM Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM
dATP, 0.2 mM dTTP, 0.2 mM dGTP, 1.25 u of AmpliTaq' Gold DNA
polymerase, 100 nM fluorescence labeled primer, 100 nM
BHQ.TM.-probe, and 100 nM reverse primer. PCR cycling was carried
out on StepOne.TM. Real-Time PCR System. Cycling conditions were as
following: 95.degree. C. 10 minutes, 60 cycles of (95.degree. C. 15
seconds, 60.degree. C. 30 seconds, 50.degree. C. 30 seconds, and
50.degree. C. 15 seconds). Fluorescence signal was recorded in the
second 50.degree. C. step.
[0272] FIG. 20A shows fluorescence over time for template
amplification. FIG. 20B shows fluorescence over time for no
template control reaction. 10 ng human genomic DNA is well detected
with the FAM labeled primer. No amplification product from primer
dimers was observed in the control.
Example 17: Multiplex PCR with Universal Fluorescence Labeled
Primer
[0273] The directly fluorescence labeled primers from last example
enable high level of multiplexing and multi-channel signal
detection. However, individual labeling of primers is not cost
efficient. In this example, we designed a fluorescence labeled
universal primer which can detect multi products from multiplex
reaction. In addition to regular three nucleotides PCR primers, we
introduced a universal three nucleotide tail to the 5' end of each
primer. In the reaction, a universal primer that has the same
sequence as the primer tail is included. The universal primer was
also tailed with a double-stranded sequence in which one strand is
three nucleotide sequence and is labeled with a fluorophore and the
complementary strand is labeled with a quencher. We used YWHZ
primers to design the assay. We employed asymmetric PCR to
preferentially generate strands that is detected by the universal
primer. We demonstrated that the fluorescence labeled universal
primer can be combined with three nucleotide multiplex PCR reaction
to efficiently amplify multiple target sequences.
[0274] A 25 ul PCR reaction contained 100 ng human genomic DNA, 10
mM Tris-HCl (pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM
dTTP, 0.2 mM dGTP, 1.25 u of AmpliTaq.TM. Gold DNA polymerase, 100
nM fluorescence labeled universal primer, 100 nM BHQ.TM.-probe, 100
nM tailed YWHZ forward primer and 400 nM YWHZ reverse primer. PCR
cycling was carried out on BioRad CFX96 real time PCR machine.
Cycling conditions were as following: 95.degree. C. 10 minutes, 60
cycles of (95.degree. C. 15 seconds, 60.degree. C. 30 seconds,
50.degree. C. 30 seconds, and 50.degree. C. 15 seconds).
Fluorescence signal was recorded second 50.degree. C. step.
[0275] FIG. 21A shows fluorescence over time for template
amplification. FIG. 21B shows fluorescence over time for no
template control reaction. 100 ng human genomic DNA was readily
detected with the FAM labeled universal primer. No amplification
product from primer dimer formation was detected in the no template
control.
Example 18: Taqman.RTM. Probe Format
[0276] Instead of labeling fluorescence on primer, in this format,
fluorescence is labeled on probe as Taqman.RTM. probe format. When
reverse primer extend to the Taqman.RTM. probe, 5' exo activity of
DNA polymerase digest the probe, releasing free fluorescence to be
detected.
[0277] In this example, three nucleotide primers are tailed with
universal artificial sequences. In PCR reaction, a Taqman.RTM.
format probe is provides. The probe is complementary to the
universal artificial sequence and labeled with a fluorophore and a
quencher. PCR is conducted with one primer as said format or both
primers as said format. When primer extension meet the Taqman.RTM.
probe, 5' exo nuclease activity of DNA polymerase digests the probe
and separates the fluorophore with quencher generating fluorescence
signal.
[0278] A 25 ul PCR reaction contains templates, 10 mM Tris-HCl
(pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM
dGTP, and 1.25 u of AmpliTaq.TM. Gold DNA polymerase.
Three-nucleotide primers are added typically to a concentration of
100 nM, 200 nM, 400 nM, or 800 nM. The Taqman.RTM. probe is added
typically at concentrations of 100 nM, 200 nM, 400 nM. PCR cycling
conditions are as following: 95.degree. C. 10 minutes, 60 cycles of
(95.degree. C. 15 seconds, 60.degree. C. 30 seconds, 72.degree. C.
60 seconds).
Example 19: Molecular Beacon Format
[0279] Fluorophore labeled molecular beacon is provided in
reaction. Forward primer is tailed with a three nucleotides
artificial sequence which contain same sequence as the molecular
beacon. When reverse primer extend to the artificial sequence and
generate its complement sequence. Molecular beacon hybridize to the
sequence, fluorescence is no longer quenched and is detected.
[0280] In this example, three nucleotide primers are tailed with
universal artificial sequences. In PCR reaction, a molecular beacon
format probe is provides. The probe has hairpin structure and is
labeled with a fluorophore and a quencher. As free probe, it
remains hairpin structure and fluorophore is quenched. Its loop
sequence is same as the universal artificial sequence. When PCR is
conducted, primer extensions generate complementary sequence of the
universal artificial sequence. Probe now hybridizes to the
complementary sequence and is no longer the hairpin structure. This
causes separation of fluorophore and quencher, generating
fluorescence signal.
[0281] A 25 ul PCR reaction contains templates, 10 mM Tris-HCl
(pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM
dGTP, and 1.25 u of AmpliTaq.TM. Gold DNA polymerase.
Three-nucleotide primers are added typically to a concentration of
100 nM, 200 nM, 400 nM, or 800 nM. The molecular beacon probe are
added typically at concentrations of 100 nM, 200 nM, 400 nM. PCR
cycling conditions are as following: 95.degree. C. 10 minutes, 60
cycles of (95.degree. C. 15 seconds, 60.degree. C. 30 seconds,
72.degree. C. 60 seconds).
Example 20: Whole Genome Amplification
[0282] Constrained random three nucleotide primers containing one
underrepresented nucleotide are tailed with artificial sequences.
These random primers are used to amplify whole genomic DNA. PCR
products is further amplified with universal primers, which are
same sequences as the artificial sequences of random primers. The
amplified products can be used for sequencing.
[0283] In contrast to PCR technology which is carried out with
temperature cycles, three-nucleotide-type primers are also used in
isothermal amplification which is carried out at a constant
temperature and does not require a thermal cycler. Amplified
product can be detected with addition of SYBR.TM. green or
fluorescence labeled probes. Typically isothermal amplification is
carried out with strand displacement DNA polymerase.
[0284] A 25 ul PCR reaction contains templates, 10 mM Tris-HCl
(pH8.3), 50 mM KCl, 2 mM MgCl2, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM
dGTP, 1.times.SYBR.TM. green II, and 2.5 u of AmpliTaq.TM. Gold DNA
polymerase. Random primers are added typically to a concentration
of 100 nM, 200 nM, 400 nM, 800 nM, 1 uM, 2 uM, 5 uM, or 10 uM. PCR
cycling conditions are as following: 95.degree. C. 10 minutes, 60
cycles of (95.degree. C. 15 seconds, 60.degree. C. 30 seconds,
72.degree. C. 60 seconds). In secondary PCR reaction, products from
previous reaction are diluted 1:10, 1:100, 1:1000, or 1:10000, and
1 ul of dilution is added as template. Universal primers are
typically used at a concentration of 100 nM, 200 nM, 400 nM, or 800
nM. Other reagents are provided as a similar manner. For isothermal
reaction, amplification is incubated at 60.degree. C. for desired
duration.
Example 21: Isothermal Amplification
[0285] Four types of isothermal amplification are shown in this
example: Loop mediated isothermal amplification (LAMP), nicking
enzyme amplification reaction (NEAR), transcription mediated
amplification (TMA), rolling circle amplification (RCA), Helicase
dependent amplification (HDA), Exponential amplification (EXPAR),
Hybridization chain reaction (HCR), catalyzed hairpin assembly
(CHA).
[0286] LAMP is typically performed in a total 25-100 ul reaction
mixture containing 0.1-0.8 mM each of FIP and BIP, 0-0.2 mM each of
the kick primers, 0.1-0.4 mM each of loop primers, 0.8-1.6 mM
dNTPs, 0.25-1M betaine, 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 2-4 mM MgSO.sub.4, 0.1% Triton.TM. X-100,
4-8 units of the Bst DNA polymerase large fragment (New England
Biolabs) and the specified amounts of double-stranded target DNA.
The mixture is incubated at 60.degree. C. and analyzed in real
time. The amplification is detected with SYBR.TM. green or
fluorescence labeled probes.
[0287] NEAR is typically performed in a total 10-100 ul reaction
mixture containing template, 45.7 mM Tris, 13.9 mM KCl, 10 mM
(NH4)2SO4, 50 mM NaCl, 0.5 mM DTT, 15 mM MgCl2, 0.1% Triton.TM.
X-100, 0.008 mM EDTA, 6 ug/mL BSA, 3.9% glycerol, 0.1-0.3 U/uL
nicking enzyme, 0.1-0.4 U/uL strand displacement enzyme, 0.1-0.8 uM
each primer. The mixture is incubated at 54-60.degree. C. and the
amplification is detected with fluorescence labeled probes.
[0288] TMA is typically performed in a total volume of 25-100 ul
reaction mixture containing 2 mM each dNTP, 8 mM each rNTP, 80 mM
Tris-HCl pH 7.5 at 25.degree. C., 50 mM MgCl2, 35 mM KCl, 10% (w/v)
polyvinylpyrrolidone and 0.1-1 uM primer with promoter sequence and
reverse primer. Reaction mixture is incubated at 60.degree. C. for
10 min under oil to allow denaturation of the RNA. The mixture was
then cooled to 42.degree. C. for 5 min before adding enzyme mix
containing MMLV reverse transcriptase (2000 units/assay) and T7 RNA
polymerase (2000 units/assay) in 8 mM Hepes pH 7.5, 50 mM
N-acetyl-L-cysteine, 0.04 mM zinc acetate, 80 mM trehalose, 140 mM
Tris-HCl pH 8.0 at 25.degree. C., 70 mM KCl, 1 mM EDTA, 0.01% (w/v)
phenol red, 10% (v/v) Triton.TM. X-100 and 20% (v/v) glycerol) and
incubation continued for a further 60 min at 42.degree. C.
[0289] RCA amplification reaction is typically performed in a 50 ul
mixture containing template, 8 U Bst DNA polymerase (New England
Biolabs), 100-800 nM of each RCA primer, and 400 .mu.M dNTP mix.
The mixture is incubated at 65.degree. C. for 60 min and cooled at
10.degree. C.
[0290] Amplification products are detected with SYBR.TM. green or
fluorescence labeled probes and can be used in other
applications.
[0291] HDA amplification reaction is typically performed in a 50
.mu.l reaction containing the following reagents: 1.times.HDA
Buffer (360 mM Tris-Acetate (pH7.5), 250 mM KOAC, 100 mM DTT, 1
mg/ml BSA, and 50 mM Magnesium Acetate), template, 0.1-0.8 .mu.M
each primer, 0.4 mM.mu.l dNTPs, 4 mM ATP, DNA polymerase, helicase,
and T4 gp32. Amplification reaction is performed without initial
denaturation (e.g. reagents are added as described above), or with
initial denaturation and annealing (e.g. DNA polymerase and
helicase are added after initial step is done). The reaction is
incubated for one hour at 37.degree. C. Amplification products are
detected with SYBR.TM. green or fluorescence labeled probes. The
EXPAR amplification reaction is typically performed at 60.degree.
C. Reaction contains 85 mM KCl, 25 mM Tris-HCl (pH 8.8, 25.degree.
C.), 2.0 mM MgSO4, 5 mM MgCl2, 10 mM (NH4)2SO4, 0.1% (vol:vol)
Triton.TM. X-100, 0.5mMDTT, nicking enzyme, Vent exo-polymerase,
400 uM dNTPs, 10 ug/ml BSA, template, and primers. Amplification
products are detected with SYBR.TM. green or fluorescence labeled
probes.
[0292] HCR reaction is typically performed in 4-50 uL containing
1.times.HBN buffer (150 mM Na2HPO4 and 1.5 M NaCl, pH 6.8), 1.0 uM
each of hairpin H1 and H2, and 0.1-1 uM initiator. The reaction is
conducted with the following conditions: boiling in a water bath
for 5 min followed by gradually cooling down to room temperature
for 1 h.
[0293] CHA reaction is typically performed in 5-50 uL mixture
containing 10-1000 nM each hairpin H1 and H2, 50-1000 nM reporter
duplex (fluorophore labeled oligo: quencher labeled oligo=1:2,
1.times.TNaK buffer (20 mM Tris, pH 7.5; 140 mM NaCl; 5 mM KCl). H1
and H2 were separately refolded (90.degree. C. for 1 min, followed
by cooling to room temperature at 0.1.degree. C./s) in TNaK Buffer
immediately before use. Following addition of target oligo,
reaction is incubated at 37.degree. C. for fluorescence
detection.
TABLE-US-00001 Sequence Listing SEQ. ID NO: Regular primer 1
gtccattgcaggtttactgt 1 gcagcattcgagtgctggag cagatgtt Regular primer
2 gtgaaggtacaaatgaggag 2 gggcgatattgtgtcccctg tatgtttttcc Regular
primer 3 gtggtgttacaagtgtgaca 3 acaggttaggaccggccaga tggacaa
Regular primer 4 agttcgtttatgtgtcaaca 4 gtacagcacaggtagggcac
acaatattcactg Regular primer 5 cggtaccccctcgaagtcgt 5
ttgtccataccaaagcctgc tccgt Regular primer 6 acaaccccaccaagcgagtg 6
cgacccggtctttgtttgtg cagtcag Regular primer 7 ctaccagctgcagtgtgttg
7 ttacacgggatgaaccacag cgtca Regular primer 8 tagaagcctcacgggatact
8 ctgcgggtttgcagttgcac accacg Regular primer 9 tcctagtgagtccataaaca
9 gctgctgctgcagctggtag tagaagcc Regular primer 10
gtgcaactgcaaaccagtaa 10 cctgctgcctgtactagaaa ccatccgtt Regular
primer 11 accgtggacttagatccgtc 11 tccacatgcaggaggcagca agga Regular
primer 12 agtgggcacaaaaaagcaaa 12 acgacgctgagtctctgcag cttccacttc
Regular primer 13 ctccactgctttccactgcc 13 agttgcgtgttacagaattg
aagctccgt Regular primer 14 ccttcgcgttgtacagcaga 14
tgttagtccatcgccgttgc tagt Regular primer 15 gccgtaatgtgctatcacaa 15
ctgtgaggccagatggacaa gcagaacaa Regular primer 16
gcattcatagcactgcgacg 16 gaccttctatagccgtgcac agccgg Regular primer
17 ggtctacttcatcctcatcc 17 tcatcctataccacaaactg agattgacctgc
Regular primer 18 agccacagcaagctagacgg 18 gacgagccaactgcaccaac
gactc Regular primer 19 caactgcaccacaaacttac 19
actgacagcggccacagcaa gctaga Regular primer 20 acattcagagtaccaaagag
20 gacctgcgcgcagagtgggc acgttac Regular primer 21
ccgtccaagcctatttcatc 21 ctcgtctatttacatcctga accaactgacct Regular
primer 22 atggacaagcacaaccggcc 22 acagctactgttgatacaca aacgaaccgtg
Regular primer 23 atggtgtttattgctgtgca 23 cagctagacaaccgacgtac
gaaccct Regular primer 24 tggatgaccctgaaggtaca 24
aacgggctcctgttcttcgt tctattaccgc Regular primer 25
accgtggtgccacaagtgta 25 acgggccagatggacaagca caac Regular primer 26
caacagtacaacaaccgacg 26 tacgaactgtttattgctgt gcacagctagg Regular
primer 27 ctcgcgctctgcctgtacac 27 atgcaacagatacaggttca gactt
Regular primer 28 gcacaggccttgtttaatgt 28 gcaggatctatactgcaccc
aaactttcgtt Regular primer 29 ccataagcagctgttgtacc 29
acacgtgtgagttggtggtg cagttg Regular primer 30 aacgtgcccactctgcgcac
30 cacaacatcccatcccctcc Regular primer 31 caactgcaccaccaactcac 31
acttacaacagcaagctaga caagctgaac Regular primer 32
ccaaagaggagctacgtgtg 32 gtacaacccattgcagttat ttagatgatgcgc
ATCrandom1 aatacctcctcactctcacc 33 caatttctcccccaacaccc ATCrandom2
acaccacacataatttcacc 34 tctctatctcccacccccac ATCrandom3
tcccctccctttactcccat 35 ttcaccttaaccttcccaac ATCrandom4
ccataaactactcccatatc 36 ttcccattccccttcctccc ATCrandom5
aactaccatccttctctaca 37 tcctctccaaatctcccccc ATCrandom6
cacaccataccatcccactc 38 ccatttactttctacccctc ATCrandom7
tcctatccccccttccatat 39 caccccctatccccttcacc ATCrandom8
accactcttcctcacaacat 40 atccttcctccacccacacc ATCrandom9
aaccccctacaaaatcccca 41 ccaccaaccccatctacacc ATCrandom10
ccaccaccaactataacttc 42 attcctctcacttccctccc ATCrandom11
accccttaaaacccacctac 43 tccatacctcccctcaaccc ATCrandom12
atcccccatacccaatctct 44 atcctatcacaccaaccacc ATCrandom13
acacctaattaccctctcca 45 accttactccctcattcccc ATCrandom14
cttacacactcttccatcct 46 ccctctaaaccacctctctc ATCrandom15
ccccattttaacccctcccc 47 aaacaacacctacaactccc ATCrandom16
cccactacatctttcccttc 48 tactcctacctactcccatc ATCrandom17
aacctccacctaccattcct 49 cccacaactcacacaccctc ATCrandom18
ctttataccccaaaccatat 50 cctttaccccttccctcccc ATCrandom19
ctcctccattcaccttccac 51 ctcttttcaaacccaacacc ATCrandom20
aatccccaccaaaccatcta 52 ctatcattccctccatcccc ATCrandom21
aattaaacttcctccaccct 53 tccttccaaccaccccacac ATCrandom22
taactcaactaatttcttac 54 cttccacctcccccccctcc ATCrandom23
tacccctacccacaccccct 55 caactaaaccatacactaac ATCrandom24
ccctcattttctcaaacaca 56 accctctcctcactctcccc ATCrandom25
ctatacccatccctaaacac 57 atcaactccaccctcttccc ATCrandom26
tcccaatcctatctcacact 58 ccttctccacccccccaacc ATCrandom27
tctccctactaactaaccat 59 cctcccctccaaaccacttc ATCrandom28
ctaccccctctactactact 60 cacaccccccactaacttac ATCrandom29
cccatacatcaaactctcat 61 tatcccctccacccccaccc ATCrandom30
ttcaccccccaaaccatccc 62 ttccctctcactccctcctc ATCrandom31
atattaacacccttctccct 63 cacatccccacttccttccc ATCrandom32
acaacaacacctccccctaa 64 accaaccaacccctcctaac Hemo2F
aatttctattaaaccttcct 65 ttcttccctaactccaacta ctaaac Hemo2R
cacaatccacatcctcaacc 66 cccttcataatatccccc HPV11-1F
cttatcttacctccacacct 67 aataccctttcacaatc HPV11-1R
ccaccatacccaccactatt 68 ttctacatcatc HPV11MM1F tacaatcaacaacatcctca
69 ctcacaattacaac HPV11MM1R taaacaaccacacaaacaac 70 catctatcaccatc
Hemo1F cccttcatcttttctttccc 71 cttcttttc
Hemo1R ccctcttacttctccccttc 72 ctatcacatcaacttaacc PPIAF
ctcttactctaccatttccc 73 ttctatttaacccttctatt c PPIAR
ccaaatctccaaccttcaaa 74 ctttaaacccaacttcaaac GAPDHF
ccatcaataaactaccctct 75 cctcaaccacttacttctcc tctcttattc GAPDHR
ccaccttccctcccctctcc 76 cccacaccc YWHZF1 ccctttccttactttctcat 77
caaatcattccaacaacc YWHZR1 tttctcaattccacatacca 78 atttctaatccc
YWHZF2 tctttccatctcccatcatc 79 ccctctcttcctccccaccc YWHZR2
tttctaatcaatccccccct 80 ctcccacaaaaaataccaac tcatttttttc ATM_F
cttattcccaaggcctttaa 81 actgttcacctcac ATM_R catatactgaagatcacacc
82 caagctttccatcc CSF1R _F ctccctgtcgtcaactcctc 83 CSF1R_R
ccctcccaccctcaggacta 84 taccaatc ATC-1G-1 aatacctcctcactctcacc 85
caatttctcccccaagaccc ATC-1G-2 acaccacacataatttcacc 86
tctctatctcccaccccgac ATC-1G-3 tcccctccctttactcccat 87
ttcaccttaacgttcccaac ATC-1G-4 ccataaactactcccatatc 88
ttcccattcccgttcctccc ATC-1G-5 aactaccatccttctctaca 89
tcctctccaaatctgccccc ATC-1G-6 cacaccataccatcccactc 90
ccatttagtttctacccctc ATC-1G-7 tcctatccccccttccatat 91
caccccctatccccttcagc ATC-1G-8 accactcttcctcacaacat 92
atccttcctccagccacacc ATC-1G-9 aaccccctacaaaatccgca 93
ccaccaaccccatctacacc ATC-1G-10 ccaccaccaactataacttc 94
attcctgtcacttccctccc ATC-2G-1 aatacctcctcactctcacc 95
caatttctcccccaagaccc ATC-2G-2 acaccacacataatttcacc 96
tctctatctcccagcccgac ATC-2G-3 tcccctccctttactcccat 97
ttcaccttaacgttccgaac ATC-2G-4 ccataaactactcccatatc 98
ttcccattcccgttcctgcc ATC-2G-5 aactaccatccttctctaca 99
tcctctccaaatctggcccc ATC-2G-6 cacaccataccatcccactc 100
ccatttagtttctacgcctc ATC-2G-7 tcctatccccccttccatat 101
caccccctatccccttgagc ATC-2G-8 accactcttcctcacaacat 102
atccttcgtccagccacacc ATC-2G-9 aaccccctacaaaatccgca 103
ccaccagccccatctacacc ATC-2G-10 ccaccaccaactataacttc 104
attcctgtcacttgcctccc 11-1G-F ccctttacatttccaaatcc 105 attcccctttgac
11-2G-R catctcatagttcatatact 106 gcattcccatttc 56MM1F
attactctctcactaaccac 107 aataccaaaacaaacattcc c 56MM1R
ccaaccctaccctaaatacc 108 ctatattcatatccactaac YWHZF1Tmtail
accacacacccacaccacca 109 cccacacccctttccttact ttctcatcaaatcattccaa
caacc YWHZR1Tmtail cccttcctctcctctccctc 110 tcaactttctcaattccaca
taccaatttctaatccc YWHZF1tailed F FAMacctccaccctccccct 111
ttccttactttctcatcaaa tcattccaacaacc YWHZF1universal
accacacacccacaccacca 112 tailed cccacccctttccttacttt
ctcatcaaatcattccaaca acc UP F FAMacctccaccctccacca 113
cacacccacaccaccaccca c QuencherProbe ggagggtggaggtBHQ.TM. 114
Sequence CWU 1
1
122148DNAArtificial sequenceSynthesized 1gtccattgca ggtttactgt
gcagcattcg agtgctggag cagatgtt 48251DNAArtificial
sequenceSynthesized 2gtgaaggtac aaatgaggag gggcgatatt gtgtcccctg
tatgtttttc c 51347DNAArtificial sequenceSynthesized 3gtggtgttac
aagtgtgaca acaggttagg accggccaga tggacaa 47453DNAArtificial
sequenceSynthesized 4agttcgttta tgtgtcaaca gtacagcaca ggtagggcac
acaatattca ctg 53545DNAArtificial sequenceSynthesized 5cggtaccccc
tcgaagtcgt ttgtccatac caaagcctgc tccgt 45647DNAArtificial
sequenceSynthesized 6acaaccccac caagcgagtg cgacccggtc tttgtttgtg
cagtcag 47745DNAArtificial sequenceSynthesized 7ctaccagctg
cagtgtgttg ttacacggga tgaaccacag cgtca 45846DNAArtificial
sequenceSynthesized 8tagaagcctc acgggatact ctgcgggttt gcagttgcac
accacg 46948DNAArtificial sequenceSynthesized 9tcctagtgag
tccataaaca gctgctgctg cagctggtag tagaagcc 481049DNAArtificial
sequenceSynthesized 10gtgcaactgc aaaccagtaa cctgctgcct gtactagaaa
ccatccgtt 491144DNAArtificial sequenceSynthesized 11accgtggact
tagatccgtc tccacatgca ggaggcagca agga 441250DNAArtificial
sequenceSynthesized 12agtgggcaca aaaaagcaaa acgacgctga gtctctgcag
cttccacttc 501349DNAArtificial sequenceSynthesized 13ctccactgct
ttccactgcc agttgcgtgt tacagaattg aagctccgt 491444DNAArtificial
sequenceSynthesized 14ccttcgcgtt gtacagcaga tgttagtcca tcgccgttgc
tagt 441549DNAArtificial sequenceSynthesized 15gccgtaatgt
gctatcacaa ctgtgaggcc agatggacaa gcagaacaa 491646DNAArtificial
sequenceSynthesized 16gcattcatag cactgcgacg gaccttctat agccgtgcac
agccgg 461752DNAArtificial sequenceSynthesized 17ggtctacttc
atcctcatcc tcatcctata ccacaaactg agattgacct gc 521845DNAArtificial
sequenceSynthesized 18agccacagca agctagacgg gacgagccaa ctgcaccaac
gactc 451946DNAArtificial sequenceSynthesized 19caactgcacc
acaaacttac actgacagcg gccacagcaa gctaga 462047DNAArtificial
sequenceSynthesized 20acattcagag taccaaagag gacctgcgcg cagagtgggc
acgttac 472152DNAArtificial sequenceSynthesized 21ccgtccaagc
ctatttcatc ctcgtctatt tacatcctga accaactgac ct 522251DNAArtificial
sequenceSynthesized 22atggacaagc acaaccggcc acagctactg ttgatacaca
aacgaaccgt g 512347DNAArtificial sequenceSynthesized 23atggtgttta
ttgctgtgca cagctagaca accgacgtac gaaccct 472451DNAArtificial
sequenceSynthesized 24tggatgaccc tgaaggtaca aacgggctcc tgttcttcgt
tctattaccg c 512544DNAArtificial sequenceSynthesized 25accgtggtgc
cacaagtgta acgggccaga tggacaagca caac 442651DNAArtificial
sequenceSynthesized 26caacagtaca acaaccgacg tacgaactgt ttattgctgt
gcacagctag g 512745DNAArtificial sequenceSynthesized 27ctcgcgctct
gcctgtacac atgcaacaga tacaggttca gactt 452851DNAArtificial
sequenceSynthesized 28gcacaggcct tgtttaatgt gcaggatcta tactgcaccc
aaactttcgt t 512946DNAArtificial sequenceSynthesized 29ccataagcag
ctgttgtacc acacgtgtga gttggtggtg cagttg 463040DNAArtificial
sequenceSynthesized 30aacgtgccca ctctgcgcac cacaacatcc catcccctcc
403150DNAArtificial sequenceSynthesized 31caactgcacc accaactcac
acttacaaca gcaagctaga caagctgaac 503253DNAArtificial
sequenceSynthesized 32ccaaagagga gctacgtgtg gtacaaccca ttgcagttat
ttagatgatg cgc 533340DNAArtificial sequenceSynthesized 33aatacctcct
cactctcacc caatttctcc cccaacaccc 403440DNAArtificial
sequenceSynthesized 34acaccacaca taatttcacc tctctatctc ccacccccac
403540DNAArtificial sequenceSynthesized 35tcccctccct ttactcccat
ttcaccttaa ccttcccaac 403640DNAArtificial sequenceSynthesized
36ccataaacta ctcccatatc ttcccattcc ccttcctccc 403740DNAArtificial
sequenceSynthesized 37aactaccatc cttctctaca tcctctccaa atctcccccc
403840DNAArtificial sequenceSynthesized 38cacaccatac catcccactc
ccatttactt tctacccctc 403940DNAArtificial sequenceSynthesized
39tcctatcccc ccttccatat caccccctat ccccttcacc 404040DNAArtificial
sequenceSynthesized 40accactcttc ctcacaacat atccttcctc cacccacacc
404140DNAArtificial sequenceSynthesized 41aaccccctac aaaatcccca
ccaccaaccc catctacacc 404240DNAArtificial sequenceSynthesized
42ccaccaccaa ctataacttc attcctctca cttccctccc 404340DNAArtificial
sequenceSynthesized 43accccttaaa acccacctac tccatacctc ccctcaaccc
404440DNAArtificial sequenceSynthesized 44atcccccata cccaatctct
atcctatcac accaaccacc 404540DNAArtificial sequenceSynthesized
45acacctaatt accctctcca accttactcc ctcattcccc 404640DNAArtificial
sequenceSynthesized 46cttacacact cttccatcct ccctctaaac cacctctctc
404740DNAArtificial sequenceSynthesized 47ccccatttta acccctcccc
aaacaacacc tacaactccc 404840DNAArtificial sequenceSynthesized
48cccactacat ctttcccttc tactcctacc tactcccatc 404940DNAArtificial
sequenceSynthesized 49aacctccacc taccattcct cccacaactc acacaccctc
405040DNAArtificial sequenceSynthesized 50ctttataccc caaaccatat
cctttacccc ttccctcccc 405140DNAArtificial sequenceSynthesized
51ctcctccatt caccttccac ctcttttcaa acccaacacc 405240DNAArtificial
sequenceSynthesized 52aatccccacc aaaccatcta ctatcattcc ctccatcccc
405340DNAArtificial sequenceSynthesized 53aattaaactt cctccaccct
tccttccaac caccccacac 405440DNAArtificial sequenceSynthesized
54taactcaact aatttcttac cttccacctc ccccccctcc 405540DNAArtificial
sequenceSynthesized 55tacccctacc cacaccccct caactaaacc atacactaac
405640DNAArtificial sequenceSynthesized 56ccctcatttt ctcaaacaca
accctctcct cactctcccc 405740DNAArtificial sequenceSynthesized
57ctatacccat ccctaaacac atcaactcca ccctcttccc 405840DNAArtificial
sequenceSynthesized 58tcccaatcct atctcacact ccttctccac ccccccaacc
405940DNAArtificial sequenceSynthesized 59tctccctact aactaaccat
cctcccctcc aaaccacttc 406040DNAArtificial sequenceSynthesized
60ctaccccctc tactactact cacacccccc actaacttac 406140DNAArtificial
sequenceSynthesized 61cccatacatc aaactctcat tatcccctcc acccccaccc
406240DNAArtificial sequenceSynthesized 62ttcacccccc aaaccatccc
ttccctctca ctccctcctc 406340DNAArtificial sequenceSynthesized
63atattaacac ccttctccct cacatcccca cttccttccc 406440DNAArtificial
sequenceSynthesized 64acaacaacac ctccccctaa accaaccaac ccctcctaac
406546DNAArtificial sequenceSynthesized 65aatttctatt aaaccttcct
ttcttcccta actccaacta ctaaac 466638DNAArtificial
sequenceSynthesized 66cacaatccac atcctcaacc cccttcataa tatccccc
386737DNAArtificial sequenceSynthesized 67cttatcttac ctccacacct
aatacccttt cacaatc 376832DNAArtificial sequenceSynthesized
68ccaccatacc caccactatt ttctacatca tc 326934DNAArtificial
sequenceSynthesized 69tacaatcaac aacatcctca ctcacaatta caac
347034DNAArtificial sequenceSynthesized 70taaacaacca cacaaacaac
catctatcac catc 347129DNAArtificial sequenceSynthesized
71cccttcatct tttctttccc cttcttttc 297239DNAArtificial
sequenceSynthesized 72ccctcttact tctccccttc ctatcacatc aacttaacc
397341DNAArtificial sequenceSynthesized 73ctcttactct accatttccc
ttctatttaa cccttctatt c 417440DNAArtificial sequenceSynthesized
74ccaaatctcc aaccttcaaa ctttaaaccc aacttcaaac 407550DNAArtificial
sequenceSynthesized 75ccatcaataa actaccctct cctcaaccac ttacttctcc
tctcttattc 507629DNAArtificial sequenceSynthesized 76ccaccttccc
tcccctctcc cccacaccc 297738DNAArtificial sequenceSynthesized
77ccctttcctt actttctcat caaatcattc caacaacc 387832DNAArtificial
sequenceSynthesized 78tttctcaatt ccacatacca atttctaatc cc
327940DNAArtificial sequenceSynthesized 79tctttccatc tcccatcatc
ccctctcttc ctccccaccc 408051DNAArtificial sequenceSynthesized
80tttctaatca atccccccct ctcccacaaa aaataccaac tcattttttt c
518134DNAArtificial sequenceSynthesized 81cttattccca aggcctttaa
actgttcacc tcac 348234DNAArtificial sequenceSynthesized
82catatactga agatcacacc caagctttcc atcc 348320DNAArtificial
sequenceSynthesized 83ctccctgtcg tcaactcctc 208428DNAArtificial
sequenceSynthesized 84ccctcccacc ctcaggacta taccaatc
288540DNAArtificial sequenceSynthesized 85aatacctcct cactctcacc
caatttctcc cccaagaccc 408640DNAArtificial sequenceSynthesized
86acaccacaca taatttcacc tctctatctc ccaccccgac 408740DNAArtificial
sequenceSynthesized 87tcccctccct ttactcccat ttcaccttaa cgttcccaac
408840DNAArtificial sequenceSynthesized 88ccataaacta ctcccatatc
ttcccattcc cgttcctccc 408940DNAArtificial sequenceSynthesized
89aactaccatc cttctctaca tcctctccaa atctgccccc 409040DNAArtificial
sequenceSynthesized 90cacaccatac catcccactc ccatttagtt tctacccctc
409140DNAArtificial sequenceSynthesized 91tcctatcccc ccttccatat
caccccctat ccccttcagc 409240DNAArtificial sequenceSynthesized
92accactcttc ctcacaacat atccttcctc cagccacacc 409340DNAArtificial
sequenceSynthesized 93aaccccctac aaaatccgca ccaccaaccc catctacacc
409440DNAArtificial sequenceSynthesized 94ccaccaccaa ctataacttc
attcctgtca cttccctccc 409540DNAArtificial sequenceSynthesized
95aatacctcct cactctcacc caatttctcc cccaagaccc 409640DNAArtificial
sequenceSynthesized 96acaccacaca taatttcacc tctctatctc ccagcccgac
409740DNAArtificial sequenceSynthesized 97tcccctccct ttactcccat
ttcaccttaa cgttccgaac 409840DNAArtificial sequenceSynthesized
98ccataaacta ctcccatatc ttcccattcc cgttcctgcc 409940DNAArtificial
sequenceSynthesized 99aactaccatc cttctctaca tcctctccaa atctggcccc
4010040DNAArtificial sequenceSynthesized 100cacaccatac catcccactc
ccatttagtt tctacgcctc 4010140DNAArtificial sequenceSynthesized
101tcctatcccc ccttccatat caccccctat ccccttgagc 4010240DNAArtificial
sequenceSynthesized 102accactcttc ctcacaacat atccttcgtc cagccacacc
4010340DNAArtificial sequenceSynthesized 103aaccccctac aaaatccgca
ccaccagccc catctacacc 4010440DNAArtificial sequenceSynthesized
104ccaccaccaa ctataacttc attcctgtca cttgcctccc 4010533DNAArtificial
sequenceSynthesized 105ccctttacat ttccaaatcc attccccttt gac
3310633DNAArtificial sequenceSynthesized 106catctcatag ttcatatact
gcattcccat ttc 3310741DNAArtificial sequenceSynthesized
107attactctct cactaaccac aataccaaaa caaacattcc c
4110840DNAArtificial sequenceSynthesized 108ccaaccctac cctaaatacc
ctatattcat atccactaac 4010965DNAArtificial sequenceSynthesized
109accacacacc cacaccacca cccacacccc tttccttact ttctcatcaa
atcattccaa 60caacc 6511057DNAArtificial sequenceSynthesized
110cccttcctct cctctccctc tcaactttct caattccaca taccaatttc taatccc
5711151DNAArtificial sequenceSynthesizedmisc_feature(1)..(1)FAM
fluorophore 111acctccaccc tccccctttc cttactttct catcaaatca
ttccaacaac c 5111263DNAArtificial sequenceSynthesized 112accacacacc
cacaccacca cccacccctt tccttacttt ctcatcaaat cattccaaca 60acc
6311338DNAArtificial sequenceSynthesizedmisc_feature(1)..(1)FAM
fluorophore 113acctccaccc tccaccacac acccacacca ccacccac
3811413DNAArtificial sequenceSynthesizedmisc_feature(13)..(13)Black
hole quencher BHQ 114ggagggtgga ggt 1311567DNAArtificial
sequenceSynthesized 115ctccataccc actatcaatc atatcaccat cctcggattg
gtattggagg ttattaataa 60tggtgga 6711633DNAArtificial
sequenceSynthesized 116tccaccatta ttaataacct ccaataccaa tcc
3311734DNAArtificial sequenceSynthesized 117ctccataccc actatcaatc
atatcaccat cctc 3411867DNAArtificial sequenceSynthesized
118tccaccatta ttaataacct ccaataccaa tccgaggatg gtgatatgat
tgatagtggg 60tatggag 6711967DNAArtificial sequenceSynthesized
119ctccataccc agtatcaatg atatcagcat cctcggattg gtattgcagg
ttattaataa 60tcgtgga 6712067DNAArtificial sequenceSynthesized
120tccacgatta ttaataacct gcaataccaa tccgaggatg ctgatatcat
tgatactggg 60tatggag 6712133DNAArtificial sequenceSynthesized
121cctaaccata acgtccaata attattacca cct 3312233DNAArtificial
sequenceSynthesized 122cctaaccata acgtccaata attattagca cct 33
* * * * *