U.S. patent application number 17/272203 was filed with the patent office on 2022-02-03 for adeno-associated viral vectors for the treatment of best disease.
This patent application is currently assigned to University of Florida Research Foundation, Incorporated. The applicant listed for this patent is University of Florida Research Foundation, Incorporated. Invention is credited to William W. Hauswirth, Cristhian J. Ildefonso, Alfred S. Lewin, Brianna M. Young.
Application Number | 20220033826 17/272203 |
Document ID | / |
Family ID | |
Filed Date | 2022-02-03 |
United States Patent
Application |
20220033826 |
Kind Code |
A1 |
Hauswirth; William W. ; et
al. |
February 3, 2022 |
ADENO-ASSOCIATED VIRAL VECTORS FOR THE TREATMENT OF BEST
DISEASE
Abstract
Aspects of the disclosure relate to methods and compositions
useful for treating bestrophinopathies, such as Best Disease.
Inventors: |
Hauswirth; William W.;
(Gainesville, FL) ; Lewin; Alfred S.;
(Gainesville, FL) ; Ildefonso; Cristhian J.;
(Gainesville, FL) ; Young; Brianna M.; (Ocklawaha,
FL) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
University of Florida Research Foundation, Incorporated |
Gainesville |
FL |
US |
|
|
Assignee: |
University of Florida Research
Foundation, Incorporated
Gainesville
FL
|
Appl. No.: |
17/272203 |
Filed: |
August 30, 2019 |
PCT Filed: |
August 30, 2019 |
PCT NO: |
PCT/US2019/049163 |
371 Date: |
February 26, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62754530 |
Nov 1, 2018 |
|
|
|
62749622 |
Oct 23, 2018 |
|
|
|
62726184 |
Aug 31, 2018 |
|
|
|
International
Class: |
C12N 15/113 20060101
C12N015/113; C12N 15/86 20060101 C12N015/86; C12N 7/00 20060101
C12N007/00; C07K 14/705 20060101 C07K014/705; A61K 48/00 20060101
A61K048/00 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The invention was made with government support under Grant
No. EY021721 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1. A short hairpin RNA (shRNA) comprising: a) a sense strand
comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO:
2) and an antisense strand comprising the nucleotide sequence
ACACUGUGAAGCUUUGACG (SEQ ID NO: 3); and b) a loop.
2. The shRNA of claim 1, wherein the loop comprises the nucleotide
sequence UUCAAGAGA (SEQ ID NO: 7).
3. The shRNA of claim 1, wherein the shRNA comprises the nucleotide
sequence CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG (SEQ ID
NO: 1).
4. A vector encoding the shRNA of claim 1.
5. The vector of claim 4 further comprising a recombinant
bestrophin (BEST1) coding sequence that does not contain a sequence
targeted by the shRNA.
6. The vector of claim 5, wherein the recombinant BEST1 coding
sequence is codon-optimized for expression in a human cell.
7. The vector of claim 5, wherein the recombinant BEST1 coding
sequence comprises a nucleotide sequence that is at least 90%
identical to the nucleotide sequence of SEQ ID NO: 9.
8. The vector of claim 7, wherein the recombinant BEST1 coding
sequence comprises the nucleotide sequence of SEQ ID NO: 9.
9. A vector encoding an shRNA of claim 1 and a recombinant BEST1
sequence comprising a nucleotide sequence that is at least 90%
identical to the nucleotide sequence of SEQ ID NO: 11.
10. The vector of claim 9, wherein the vector comprises the
nucleotide sequence of SEQ ID NO: 11.
11. The vector of claim 4, wherein the vector is a plasmid or a
viral vector.
12. (canceled)
13. The vector of claim 11, wherein the viral vector is a
recombinant adeno-associated viral (rAAV) vector.
14. The vector of claim 13, wherein the rAAV vector is
self-complementary.
15. A recombinant adeno-associated viral (rAAV) particle comprising
the rAAV vector of claim 13.
16. The rAAV particle of claim 15, wherein the rAAV viral particle
is an AAV serotype 2 (AAV2) viral particle.
17. A composition comprising the rAAV particle of claim 15 and a
pharmaceutically acceptable carrier.
18. A method of modulating BEST1 expression in a subject, the
method comprising administering to the subject the composition of
claim 17.
19. A method of treating Best Disease in a subject, the method
comprising administering to the subject the composition of claim
17.
20. The method of claim 19, wherein the subject is a human
subject.
21-24. (canceled)
25. A method of treating an autosomal recessive bestrophinopathy
(ARB) in a human subject, the method comprising administering to
the subject the composition of claim 17.
26-31. (canceled)
32. An shRNA that comprises a nucleotide sequence that differs from
the nucleotide sequence of SEQ ID NO: 1
(CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG) by 1 or 2
nucleotides.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a national stage filing under 35 U.S.C.
.sctn. 371 of International Application, PCT/US2019/049163 filed
Aug. 30, 2019, which claims the benefit of the filing dates of U.S.
Provisional Application No. 62/726,184 filed Aug. 31, 2018, U.S.
Provisional Application No. 62/749,622 filed Oct. 23, 2018, and
U.S. Provisional Application No. 62/754,530, filed Nov. 1, 2018,
the entire contents of each of which are incorporated by
reference.
REFERENCE TO A SEQUENCE LISTING SUBMITTED AS A TEXT FILE VIA
EFS-WEB
[0003] The instant application contains a Sequence Listing which
has been submitted in ASCII format via EFS-Web and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Sep. 8, 2021, is named U119670061US03-SUBSEQ-EPG and is 8,056
bytes in size.
BACKGROUND
[0004] Mutations in the BEST1 gene (also called VMD2) cause several
forms of retinal degeneration including Best vitelliform macular
dystrophy, also known as Best Disease. (Best Disease may also be
referred to as Best macular dystrophy, vitelline dystrophy, and
vitelliform macular dystrophy.) Bestrophinopathies are caused by
more than 200 different mutations in the human BEST1 gene that
encodes a protein (bestrophin, or BEST1) that functions as a
calcium-dependent chloride channel associated with basolateral
membrane of the retinal pigment epithelium. In bestrophinopathies,
defective fluid transport across the RPE damages the interaction
between the RPE and photoreceptor cells. This damage leads to
detachment of the retina from its supporting layer and accumulation
of oxidized proteolipid (lipofuscin) within the RPE and subretinal
space. Eventually, photoreceptors die, primarily in the macular
region, which is responsible for central vision. In humans, BEST1
mutations are usually autosomal dominant, meaning that one
defective copy leads to disease regardless of the presence of a
normal (wild type) gene inherited from the other parent. However,
autosomal recessive bestrophinopathies (ARBs) have also been
reported.
[0005] Best Disease, a rare disease, is a slowly progressive
macular dystrophy with onset generally in childhood and sometimes
in later teenage years. Affected individuals initially have normal
vision followed by decreased central visual acuity and
metamorphopsia. Individuals retain normal peripheral vision and
dark adaptation. Individuals develop a mass on the macula that
resembles an egg yolk. This mass eventually breaks up and spreads
throughout the macula, leading to a reduction in central vision.
Best Disease may be diagnosed based on family history or
ophthalmologic examination, e.g., fundus appearance or
electrooculogram (EOG).
[0006] Inherited retinal degenerations (IRDs) encompass a large
group of blinding conditions that are molecularly heterogeneous and
pathophysiologically distinct. The genetic defect often acts
primarily on rod or cone photoreceptors (PRs), or both, and the
specific defect may involve phototransduction, ciliary transport,
morphogenesis, neurotransmission, or others. Less common are
primary defects involving the retinal pigment epithelium (RPE),
although they have received increased attention due to high-profile
clinical trials.
[0007] The most common IRD due to a primary RPE defect is caused by
mutations in BEST1, encoding a transmembrane protein associated
with the basolateral portion of the RPE. BEST1 (bestrophin) is a
multifunctional channel protein responsible for mediating
transepithelial ion transport, regulation of intracellular calcium
signaling and RPE cell volume, and modulation of the homeostatic
milieu in the subretinal space. In eukaryotic cells, BEST1 forms a
stable homopentamer with four transmembrane helices, cytosolic N
and C termini, and a continuous central pore sensitive to
calcium-dependent control of chloride permeation.
[0008] In humans, BEST1 mutations result in a wide spectrum of IRDs
collectively grouped as bestrophinopathies that often involve
pathognomonic macular lesions. Retinal regions away from the
lesions tend to appear grossly normal, despite the existence of a
retina-wide electrophysiological defect in the EOG, which reflects
an abnormality in the standing potential of the eye.
Naturally-occurring biallelic mutations in the canine BEST1 gene
(cBEST1) cause canine IRD with distinct phenotypic similarities to
both the dominant and recessive forms of human bestrophinopathies,
including the salient predilection of subretinal lesions to the
canine fovea-like area.
[0009] Proper anatomical apposition and a sustained interaction
between RPE apical microvilli (MV) and PR outer segments (OSs) are
considered crucial for normal vision. Both the ionic composition
and volume regulation of the subretinal space are essential for
maintaining the accurate molecular proximity of this complex and
homeostasis of the RPE-PR interface. In vitro and ex vivo studies
have long shown that genetic mutations, metabolic perturbations, as
well as light stimuli alter the ionic composition of the subretinal
space and physiological responses of the RPE and/or PRs. More
recently, in vivo studies of outer retinal microanatomy in health
and disease and its response to light have become increasingly
informative with modern retinal imaging modalities.
[0010] Mutations in the BEST1 gene cause detachment of the retina
and degeneration of photoreceptor (PR) cells due to a primary
channelopathy in the neighboring retinal pigment epithelium (RPE)
cells. The pathophysiology of the interaction between RPE and PR
cells preceding the formation of retinal detachment remains not
well-understood.
SUMMARY OF THE INVENTION
[0011] Aspects of the disclosure relate to compositions for
treating bestrophinopathies (e.g., Best vitelliform macular
dystrophy) in a subject (e.g., in a human). Aspects of the
disclosure are designed to suppress the expression of endogenous
BEST1 mRNA (e.g., both the mutated and the normal copy). In some
embodiments, the expression is suppressed using RNA interference.
In some embodiments, the endogenous BEST1 mRNA is simultaneously
replaced with normal BEST1 mRNA to produce only normal protein. In
some embodiments, adeno-associated virus (AAV) is used to deliver
an intronless copy of the BEST1 gene plus a gene for a small
hairpin RNA (shRNA) that leads to the production of a small
interfering RNA (siRNA).
[0012] In some embodiments, one or both alleles of the BEST1 gene
of a subject (e.g., a human) are silenced by administering a short
hairpin RNA (shRNA) molecule to a subject (e.g., to a subject
having Best Disease, for example to a human having Best Disease).
In some embodiments, a replacement BEST1 coding sequence also is
administered to the subject to provide a functional bestrophin
protein, e.g., to restore photoreceptor function to the subject. In
some embodiments, the replacement BEST1 coding sequence has one or
more nucleotide substitutions relative to the endogenous gene
allele(s) that render the replacement gene resistant to the effects
of the interfering RNA. In some embodiments, the replacement BEST1
coding sequence is a human BEST1 coding sequence (e.g., a wild-type
human BEST1 coding sequence) that includes one or more (e.g., 1, 2,
3, 4, 5, or more) substitutions to render the gene resistant to
degradation mediated by the shRNA. In some embodiments, the
replacement BEST1 coding sequence includes one or more silent
mutations (base changes in the third position of codons) in the
target site to render the gene "de-targeted" to degradation
mediated by the shRNA.
[0013] In some aspects, the disclosure provides a short hairpin RNA
(shRNA) comprising a sense strand comprising the nucleotide
sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2), an antisense strand
comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:
3), and a loop. In some embodiments, the loop comprises the
nucleotide sequence UUCAAGAGA (SEQ ID NO: 7).
[0014] In some aspects, the disclosure provides a short hairpin RNA
(shRNA) comprising a sense strand comprising the nucleotide
sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO: 6), an antisense strand
comprising the nucleotide sequence AAGAACUCGCCAUAUAGCAGC (SEQ ID
NO: 5), and a loop. In some embodiments, the loop comprises the
nucleotide sequence CUCGAG (SEQ ID NO: 8).
[0015] In some embodiments, the disclosure provides a short hairpin
RNA (shRNA) that comprises an antisense strand comprising the
nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).
[0016] In some aspects, the disclosure provides a vector comprising
a genetic sequence encoding the shRNAs described in the preceding
paragraphs.
[0017] In some aspects, the disclosure provides a vector that
further comprises a recombinant functional (e.g., wild-type) BEST1
coding sequence that does not contain a sequence targeted by the
shRNA. In some aspects, the vector further comprises a recombinant
functional BEST1 coding sequence that is codon-optimized for
expression in a human cell.
[0018] In some aspects, the disclosure provides a vector that
comprises a recombinant BEST1 coding sequence that comprises a
nucleotide sequence that is at least 90% identical to the
nucleotide sequence of SEQ ID NO: 9. In some aspects, the
disclosure provides a vector that comprises a recombinant BEST1
coding sequence that comprises a nucleotide sequence that is at
least 90% identical to the nucleotide sequence of SEQ ID NO:
10.
[0019] In some aspects, the disclosure provides a vector that is a
plasmid or a viral vector. In some aspects, the viral vector is a
recombinant adeno-associated viral (rAAV) vector. In some aspects,
the rAAV vector is self-complementary.
[0020] In some aspects, the disclosure provides a rAAV viral
particle that is an AAV serotype 2 viral particle.
[0021] In some aspects, the disclosure provides a composition
comprising a vector or rAAV particle and a pharmaceutically
acceptable carrier.
[0022] In some aspects, the disclosure provides a method of
modulating BEST1 expression in a subject, the method comprising
administering to the subject, such as a human subject, a
composition comprising a vector or rAAV particle and a
pharmaceutically acceptable carrier. In some aspects, the
disclosure provides a method of treating bestrophinopathies (e.g.,
Best Disease and ARB) in a subject, the method comprising
administering a composition.
[0023] In some embodiments, a vector encoding a functional BEST1
sequence is provided to supplement or correct (e.g., at least
partially) cellular BEST1 function without knocking down endogenous
BEST1 gene expression. In some embodiments, the BEST1 sequence is
codon-optimized.
[0024] In some embodiments, a vector encoding a functional BEST1
sequence is provided to supplement or correct (e.g., at least
partially) cellular BEST1 function and an shRNA sequence is
provided to knock down endogenous BEST1 gene expression. In some
embodiments, endogenous Best1 expression is knocked down using
shRNA. In some embodiments, the BEST1 sequence is codon-optimized.
In some embodiments, the BEST1 sequence is modified to be resistant
to the shRNA. In some embodiments, the BEST1 and shRNA sequences
are encoded on the same AAV vector.
[0025] In some aspects, the disclosure provides a composition for
use in treating Best Disease and a composition for use in the
manufacture of a medicament to treat Best Disease. In some aspects,
the disclosure provides a composition comprising a vector or rAAV
particle, wherein the vector encodes a functional BEST1 sequence,
for use in treating ARB, and a composition for use in the
manufacture of a medicament to treat ARB.
[0026] These and other aspects are described in the following
drawings, examples, and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] The following drawings form part of the present
specification and are included to further demonstrate certain
aspects of the present disclosure, which can be better understood
by reference to one or more of these drawings in combination with
the detailed description of specific embodiments presented herein.
It is to be understood that the data illustrated in the drawings in
no way limit the scope of the disclosure.
[0028] FIGS. 1A-1D show retina-wide pathology of RPE apical
microvillar projections associated with BEST1 mutations in canines.
FIGS. 1A and 1B show confocal images illustrating the molecular
pathology of cBest (R25*/R25*; 89 wk) (FIG. 1B) compared with
wild-type (FIG. 1A) (42 wk). Retinal cryosections were
immunolabeled with anti-EZRIN and human cone arrestin and combined
with peanut agglutinin lectin and DAPI labels. FIG. 1C shows
representative photomicrographs of 6-wk-old canine wild-type and
cBest-mutant (R25*/P463fs) retinas immunolabeled with anti-BEST1
and anti-SLC16A1. White arrowheads point to a subset of cone-MV.
FIG. 1D shows quantification of cone-MV numbers across the retina
between cBest-mutant and age-matched control eyes. The y axis
represents the average number of cone-MV per square millimeter for
each color-coded retinal region examined. Abbreviations: H&E,
he-matoxylin & eosin staining; PRL, photoreceptor IS/OS layer;
i, inferior; N, nasal; S, superior; T, temporal.
[0029] FIGS. 2A-2F show light-mediated changes in the outer retinal
structure in wild-type and cBest (R25*/P463fs) mutants. FIG. 2A
shows cross-sectional imaging along the horizontal meridian through
the central area centralis (fovea-like area) in a 15-wk-old normal
(WT) dog and an 11-wk-old cBest (R25*/P463fs) with less and more
light adaptation (LA). Thin white arrows indicate the
superotemporal location of the OCT. FIG. 2B shows longitudinal
reflectivity profiles (LRPs) (average of 85 single LRPs) at
3.degree. nasal from the fovea-like area (T, temporal retina) and
nasal edge of the optic nerve head (N, nasal retina) in WT dogs (12
eyes, age 15 to 17 wk) compared with cBest-treated dogs (6 eyes,
age 11 wk) with less and more LA. Arrowheads indicate IS/OS and
RPE/T peaks; single and double arrows mark the additional
hyporeflective layer in cBest. FIG. 2C shows the distance between
IS/OS and RPE/T peaks in WT and cBest eyes under two LA conditions.
Symbols with error bars represent mean (.+-.2 SD) distance for each
group of eyes at both locations. FIG. 2D is a schematic description
of the dark and light adaptation protocol. Animals were
dark-adapted (D/A) overnight and OCT imaging was performed. Then,
five increasing light exposures (L1 through L5) were used. FIG. 2D
also shows magnified views of the OCT scans in cBest with
overlapping LRPs after overnight dark adaptation (left) and after
the maximum light exposure (right). FIG. 2E shows in a different
subset of cBest eyes (n=3; colored traces), results of using an
abbreviated protocol involving only L4 and L5 exposures. FIG. 2F
shows spatial topography of IS/OS-to-RPE/T distance in mean WT
compared with two representative cBest eyes [panels; EM356-OS:
297-wk-old cmr1/cmr3 (R25*/P463fs); LH30-OD: 12-wk-old cmr3
(P463fs/P463fs)].
[0030] FIGS. 3A-3D show BEST1 gene augmentation therapy results in
sustained reversal of foveomacular lesions and restoration of
RPE-PR interface structure in cBest mutants. FIG. 3A shows the
natural history of the central subretinal detachment documented by
in vivo imaging in the right eye of cBest dog (EM356-OD;
R25*/P463fs) at three time points. The insets show
auto-fluorescence and OCT images. FIG. 3B shows fundus images taken
before (at 52 wk of age) and after subretinal injection with
AAV2-cBEST1 (1.5.times.10.sup.10 vg/mL) was performed in the eye
shown in FIG. 3A. The subretinal bleb area is denoted by the dashed
circle. Images acquired at 43 and 245 wk post-injection document
sustained reversal of the central lesion and fully reattached
retina within the treated area. Middle and right insets show
autofluorescence and OCT images. FIGS. 3C and 3D show the
restoration of RPE-photoreceptor interface structure post
AAV-hBEST1 treatment in the cBest (R25*/R25*) model in comparison
with control. Bleb boundaries are marked by dashed circles; the
locations of corresponding OCT scans cut through the subretinal
lesions before injection or through the matching locations mapped
post-injection are marked by horizontal lines; retinotomy sites are
indicated by arrowheads.
[0031] FIGS. 4A-4F show reversal of microdetachments across retinal
regions after subretinal gene therapy in cBest-mutant dogs [owl
(R25*/R25*), cmr1/cmr3 (R25*/P463fs), or cmr3 (P463fs/P463fs)]
subretinally injected with BSS or AAV-hBEST1. FIG. 4A shows maps of
IS/OS-RPE/T distance topography in cBest-mutant dogs [owl
(R25*/R25*), cmr1/cmr3 (R25*/P463fs), or cmr3 (P463fs/P463fs)]
subretinally injected with BSS or AAV-hBEST1. Treatment boundaries
are based on fundus photographs of the bleb taken at the time of
the injection (dotted lines) and, if visible, demarcations apparent
at the time of imaging (dashed lines). All eyes are shown as
equivalent right eyes with optic nerve and major blood vessels
(black), tapetum boundary (white), and fovea-like region (white
ellipse) overlaid for ease of comparison. FIG. 4B shows the
IS/OS-RPE/T distance difference from WT at the superior and
inferior retinal locations in cBest eyes within the treated bleb
(Tx; filled symbols) and untreated outside bleb (Ctrl; open
symbols) regions. Dashed lines delimit the 95th percentile of
normal variability. Topographies of the IS/OS-RPE/T distance are
shown pre- (Left) and posttreatment (Right). FIGS. 4C and 4E depict
grayscale maps of the difference between each cBest eye and mean WT
control. White represents gross retinal detachments. FIGS. 4D and
4F show measurements of the colocalized difference of IS/OS-RPE/T
distance between WT and cBest pre- (PreTx) and post treatment (Tx)
for the eyes shown in FIGS. 4C and 4E, respectively.
[0032] FIGS. 5A-5G show retinotopic phenotype in two human subjects
with ARB. FIG. 5A shows RPE health across the retinas of two ARB
patients, P1 and P2, imaged with short-wavelength
reduced-illuminance autofluorescence imaging (SW-RAFI), taking
advantage of the natural RPE fluorophore lipofuscin. White arrows
depict the location of the perimetric profiles and OCT scans;
rectangles show the regions of interest shown in other panels; and
black arrowheads demarcate disease-to-health transition in the
nasal midperipheral retina. FIG. 5B shows perimetric light
sensitivity of rods in dark-adapted (upper) and cones in
light-adapted (lower) eyes measured across the horizontal meridian.
Grey regions represent normal sensitivity except for the
physiological blindspot corresponding to the optic nerve (ONH).
FIG. 5C shows retinal cross-section with OCT along the horizontal
meridian crossing the fovea. FIGS. 5D and 5E show detail of outer
retinal lamination in patients compared with normal at the two
regions of interest at the parapapillary retina (FIG. 5D) and
midperipheral nasal retina (FIG. 5E). Color indicates interface
near COS tips and interface near ROS tips and RPE apical processes,
and brick indicates interface near the RPE and Bruch's membrane.
FIGS. 5F and 5G show dark-adaptation kinetics measured in P1 at the
parapapillary locus (FIG. 5F) and in P2 at the nasal midperipheral
locus (FIG. 5G). Time 0 refers to the end of adaptation light.
[0033] FIGS. 6A-6D show RPE-PR interdigitation zone in canine
models of CNGB3-associated achromatopsia (ACHM3). FIGS. 6A and 6B
show representative fluorescence microscopy images of 6-wk-old
CNGB3-D262N-mutant (FIG. 6A) and CNGB3-null (FIG. 6B;
CNGB3.sup.-/-) retinas demonstrating normal expression of BEST1
limited to the basolateral plasma membrane of RPE cells, and
SLC16A1, a marker labeling RPE apical processes. Arrows point to a
subset of cone-associated RPE apical microvilli (c-MV). FIGS. 6A
and 6B also show anti-CNGB3 and anti-EZRIN colabeling, with an
age-matched wild-type retina shown for reference. FIGS. 6C and 6D
show immunohistochemical evaluation of the RPE-PR interface in
CNGB3-mutant retinas from 85-wk-old (FIG. 6C) and 57-wk-old (FIG.
6D) affected dogs. RPE apical aspect and its microvillar extensions
were immunolabeled with EZRIN, and a subset of c-MV is denoted by
arrows. Abbreviations: ACHM3, achromatopsia type 3; cCNGB3, canine
CNGB3 gene; c-MV, cone-associated RPE apical microvilli; CNGB3,
cyclic nucleotide-gated channel beta 3 protein; hCAR, human cone
arrestin; SLC16A1, solute carrier family 16 member 1.
[0034] FIG. 7 shows recovery of light-mediated microdetachments.
Two cBest-affected (R25*/P463fs) eyes [ages 43 (Right) and 52
(Left) wk] were dark-adapted overnight and imaged similar to
results shown in FIG. 2A.
[0035] FIGS. 8A-8B show hyperthick ONL at retinal regions with
microdetachment, and its correction with gene therapy, in cBest
eyes. FIG. 8A shows that uninjected cBest eyes (shown in FIGS.
2A-2F and 4A-4F as IS/OS-RPE/T thickness maps) demonstrate
hyperthick ONL corresponding to large regions of retinal
microdetachment, and localized thinning of the ONL above gross
lesions and near the fovea-like region in some eyes. FIG. 8B shows
that treated cBest eyes (shown in FIGS. 4A-4F as IS/OS-RPE/T
thickness maps) demonstrate normal ONL thickness in the AAV-treated
regions surrounded by hyperthick, normal, or thinned ONL within
untreated regions. OD, right eye; OS, left eye.
[0036] FIGS. 9A-9F show evolution of a focal macular lesion in a
cBest-affected (R25*/P463fs) dog (EM356-OS). FIG. 9A shows that the
discrete separation of photoreceptor layer from the underlying RPE
progressed to form a larger subretinal macrodetachment (vitelliform
lesion) evident en face and FIG. 9B shows the corresponding OCT
scan at 23 wk of age. FIG. 9C shows the first signs of
hyper-autofluorescent material accumulating within the subretinal
lesion were observed 8 wk later (31 wk; early pseudohypopyon
lesion). FIG. 9D shows that at 66 wk of age, a typical
pseudohypopyon appearance is documented, followed by
vitelliruptive-like lesions at 172 and 297 wk of age with
dispersion of the autofluorescent material (Insets, close-ups).
FIGS. 9E and 9F show that significant thinning of the ONL is
apparent by OCT scan. Darkened lines demarcate the position of the
corresponding SD-OCT scans.
[0037] FIG. 10 shows Retinal preservation after AAV-hBEST1
treatment in three cBest models [cmr1 (R25*/R25*), cmr1/cmr3
(R25*/P463fs), and cmr3 (P463fs/P463fs)] in comparison with the
wild-type control and cBest untreated eyes.
[0038] FIGS. 11A-11D show dose-response effects of BEST1 transgene
expression on RPE cytoskeleton rescue in a cBest (R25*/P463fs)
retina. FIG. 11A shows a cross-sectional overview from the surgical
bleb area (left), through the adjacent penumbral region (middle),
and toward the contiguous extent outside of the injection zone
(right). FIG. 11B shows the remarkable extension of RPE apical
projections within the treated region with augmented BEST1; FIG.
11C shows the presence of vestigial microvilli and rod-MV in the
bleb penumbra associated with patchy distribution of BEST1 (weak
signals within individual RPE cells) and RPE-PR microdetachment;
FIG. 11D shows the formation of subretinal lesions in the absence
of both BEST1 expression and RPE apical processes outside of the
treatment zone.
[0039] FIGS. 12A-12B shows interocular symmetry of rod and cone
function ARB patients P1 (FIG. 12A) and P2 (FIG. 12B). Rod (RSL)
and cone sensitivity loss (CSL) maps of both eyes of two patients
with ARB.
[0040] FIG. 13 shows a map of 6262-bp plasmid, pTR-VMD2-hBest,
human Bestrophin.
[0041] FIG. 14 shows a map of 6222-bp plasmid, pTR-VMD2-cBest,
canine Bestrophin.
[0042] FIG. 15 shows a map of 6209-bp plasmid,
pTR-SB-VMD2-HBest1-shRNA05, which contains resistant Best1.
[0043] FIG. 16 shows a map of 6145-bp plasmid,
pTR-SB-VMD2-DTBest1-shRNA744, which contains de-targeted Best1.
[0044] FIG. 17 shows that the VMD2 promoter works well in cell
culture. HEK293T cells were transfected with plasmids expressing
GFP or Best1 using the Chicken beta actin promoter (CBA) or the
VMD2 promoter. Protein lysates were separated on polyacrylamide
gels and expression of bestrophin (Best1) was detected by Western
Blot and normalized to the expression of beta-tubulin to show even
loading of the gel.
[0045] FIGS. 18A-18B show that Best1 specific-siRNA is functional.
The band intensities shown in the Western blot (FIG. 18A) and
quantified in a bar graph (FIG. 18B) indicate that the transfection
of HEK293T stably expressing BEST1 led to a 75% reduction in
Bestrophin (Best1) protein.
[0046] FIGS. 19A-19B show that Best1 shRNA is active: HEK293T-BEST1
cells were transfected with 4 .mu.g of the indicated plasmid.
[0047] FIG. 20 shows the detargeting of Best1. Silent mutations
(base changes in the third position of codons) were used to remove
an siRNA target site from Best1 mRNA. The example disclosed is for
shRNA744. SEQ ID NOs: 15-17 correspond to the sequences from top to
bottom: wild-type BEST1 target site; the (complementary) shRNA744
target site, and de-targeted DTBEST1 siRNA target site.
DETAILED DESCRIPTION
[0048] Aspects of the application provide methods and compositions
that are useful for treating Best Disease in a subject (e.g., in a
human subject having Best Disease).
[0049] In some embodiments, the disclosure provides methods and
compositions for delivering a functional bestrophin protein to
subjects having one or more mutant BEST1 genes. In some
embodiments, a recombinant BEST1 gene (e.g., a coding sequence, for
example a cDNA or open reading frame) is provided on a viral vector
(e.g., an rAAV vector). In some embodiments, expression of one or
both alleles of the endogenous BEST1 gene are also knocked down.
For example, in some embodiments an siRNA (e.g., an shRNA) is
delivered to a subject along with a recombinant BEST1 gene. In some
embodiments, a viral vector (e.g., an rAAV vector) encodes both a
recombinant BEST1 gene and one or more siRNAs that target the
endogenous BEST1 gene. In some embodiments, the recombinant BEST1
gene is modified to comprise one or more nucleotide substitutions
that make it resistant to targeting by the one or more siRNAs. In
some embodiments, the recombinant BEST1 gene is codon optimized
(e.g., for expression in a subject, for example in a human
subject).
[0050] In some embodiments, the disclosure provides a short hairpin
RNA (shRNA) comprising a sense strand comprising the nucleotide
sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2), an antisense strand
comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO:
3), and a loop. In some embodiments, the loop comprises the
nucleotide sequence UUCAAGAGA (SEQ ID NO: 7)
[0051] In other embodiments, the disclosure provides a short
hairpin RNA (shRNA) comprising a sense strand comprising the
nucleotide sequence GCUGCUAUAUGGCGAGUUCUU (SEQ ID NO: 6), an
antisense strand comprising the nucleotide sequence
AAGAACUCGCCAUAUAGCAGC (SEQ ID NO: 5), and a loop. In some
embodiments, the loop comprises the nucleotide sequence CUCGAG (SEQ
ID NO: 8).
[0052] In some embodiments, the disclosure provides a short hairpin
RNA (shRNA) that comprises an antisense strand comprising the
nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3).
[0053] In some embodiments, the shRNA can be delivered using a
vector as an shRNA driven by a promoter (e.g., a human H1 RNA
promoter). In some embodiments, this vector is a plasmid. In some
embodiments, the vector is a viral vector, such as an
adeno-associated virus (AAV) vector. In some embodiments, the
vector is a double-stranded or self-complementary AAV vector. In
some embodiments, the vector sequence encoding the shRNA comprises
a BEST1 sequence.
[0054] Accordingly, in some embodiments an shRNA can be encoded on
a DNA vector (e.g., a viral vector) by a nucleic acid having a
sequence of
TABLE-US-00001 (SEQ ID NO: 18) CCGTCAAAGCTTCACAGTGTTTCAA
GAGAACACTGTGAAGCTTTGACG,
where the loop sequence is underlined. In some embodiments, a
different loop sequence is substituted for the loop sequence shown
in SEQ ID NO: 7.
[0055] Also, in some embodiments, an shRNA can be encoded on a DNA
vector (e.g., a viral vector) by a nucleic acid having a sequence
of
TABLE-US-00002 (SEQ ID NO: 19) GCTGCTATATGGCGAGTTCTTCTCG
AGAAGAACTCGCCATATAGCAGC,
where the loop sequence is underlined. In some embodiments, a
different loop sequence is substituted for the loop sequence shown
in SEQ ID NO: 8.
[0056] In some embodiments, the same vector comprises a coding
sequence that encodes normal (e.g., wild-type) Best1 protein but is
resistant to the action of the shRNA expressed by the vector.
[0057] In some embodiments, the BEST1 coding sequence comprises a
sequence that is at least 90%, at least 91%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least 99%, or 100% identical to SEQ ID NO: 9.
[0058] In some embodiments, the BEST1 coding sequence comprises a
sequence that is at least 90%, at least 91%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least 99%, or 100% identical to SEQ ID NO: 10. In
some embodiments, the BEST1 coding sequence comprises a sequence
that is at least 90%, at least 91%, at least 92%, at least 93%, at
least 94%, at least 95%, at least 96%, at least 97%, at least 98%,
at least 99%, or 100% identical to SEQ ID NO: 11.
[0059] In some embodiments, the BEST1 coding sequence comprises a
sequence that is at least 90%, at least 91%, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least 99%, or 100% identical to SEQ ID NO: 15.
TABLE-US-00003 The 1757-bp wild-type BEST1 sequence is defined as
follows (SEQ ID NO: 9): ATGACCATCACTTACACAAGCCAAGTGGCTAATGC
CCGCTTAGGCTCCTTCTCCCGCCTGCTGCTGTGCT
GGCGGGGCAGCATCTACAAGCTGCTATATGGCGAG
TTCTTAATCTTCCTGCTCTGCTACTACATCATCCG
CTTTATTTATAGGCTGGCCCTCACGGAAGAACAAC
AGCTGATGTTTGAGAAACTGACTCTGTATTGCGAC
AGNTACATCCAGCTCATCCCCATTTCCTTCGTGCT
GGGCTTCTACGTGACGCTGGTCGTGACCCGCTGGT
GGAACCAGTACGAGAACCTGCCGTGGCCCGACCGC
CTCATGAGCCTGGTGTCGGGCTTCGTCGAAGGCAA
GGACGAGCAAGGCCGGCTGCTGCGGCGCACGCTCA
TCCGCTACGCCAACCTGGGCAACGTGCTCATCCTG
CGCAGCGTCAGCACCGCAGTCTACAAGCGCTTCCC
CAGCGCCCAGCACCTGGTGCAAGCAGGCTTTATGA
CTCCGGCAGAACACAAGCAGTTGGAGAAACTGAGC
CTACCACACAACATGTTCTGGGTGCCCTGGGTGTG
GTTTGCCAACCTGTCAATGAAGGCGTGGCTTGGAG
GTCGAATCCGGGACCCTATCCTGCTCCAGAGCCTG
CTGAACGAGATGAACACCTTGCGTACTCAGTGTGG
ACACCTGTATGCCTACGACTGGATTAGTATCCCAC
TGGTGTATACACAGGTGGTGACTGTGGCGGTGTAC
AGCTTCTTCCTGACTTGTCTAGTTGGGCGGCAGTT
TCTGAACCCAGCCAAGGCCTACCCTGGCCATGAGC
TGGACCTCGTTGTGCCCGTCTTCACGTTCCTGCAG
TTCTTCTTCTATGTTGGCTGGCTGAAGGTGGCAGA
GCAGCTCATCAACCCCTTTGGAGAGGATGATGATG
ATTTTGAGACCAACTGGATTGTCGACAGGAATTTG
CAGGTGTCCCTGTTGGCTGTGGATGAGATGCACCA
GGACCTGCCTCGGATGGAGCCGGACATGTACTGGA
ATAAGCCCGAGCCACAGCCCCCCTACACAGCTGCT
TCCGCCCAGTTCCGTCGAGCCTCCTTTATGGGCTC
CACCTTCAACATCAGCCTGAACAAAGAGGAGATGG
AGTTCCAGCCCAATCAGGAGGACGAGGAGGATGCT
CACGCTGGCATCATTGGCCGCTTCCTAGGCCTGCA
GTCCCATGATCACCATCCTCCCAGGGCAAACTCAA
GGACCAAACTACTGTGGCCCAAGAGGGAATCCCTT
CTCCACGAGGGCCTGCCCAAAAACCACAAGGCAGC
CAAACAGAACGTTAGGGGCCAGGAAGACAACAAGG
CCTGGAAGCTTAAGGCTGTGGACGCCTTCAAGTCT
GCCCCACTGTATCAGAGGCCAGGCTACTACAGTGC
CCCACAGACNCCCCTCAGCCCCACTCCCATGTTCT
TCCCCCTAGAACCATCAGCGCCGTCAAAGCTTCAC
AGTGTCACAGGCATAGACACCAAAGACAAAAGCTT
AAAGACTGTGAGTTCTGGGGCCAAGAAAAGTTTTG
AATTGCTCTCAGAGAGCGATGGGGCCTTGATGGAG
CACCCAGAAGTATCTCAAGTGAGGAGGAAAACTGT
GGAGTTTAACCTGACGGATATGCCAGAGATCCCCG
AAAATCACCTCAAAGAACCTTTGGAACAATCACCA
ACCAACATACACACTACACTCAAAGATCACATGGA
TCCTTATTGGGCCTTGGAAAACAGGGATGAAGCAC ATTCCTAA
[0060] In some embodiments, the BEST1 coding sequence comprises
includes a short de-targeted sequence that corresponds a region of
the wild-type BEST1 gene. An exemplary de-targeted sequence that
may be used with a vector sequence encoding an shRNA744 sequence is
defined as follows (SEQ ID NO: 10): CTACTGTACGGAGAATTTCT.
[0061] Other nucleotide substitutions can be made to de-target the
BEST1 sequence. For example, in some embodiments, the de-targeted
sequence is located in a different position on the BEST1 coding
sequence and corresponds to a different region of the wild-type
BEST1 gene. An exemplary de-targeted sequence that may be used with
a vector sequence encoding an shRNA05 sequence and is defined as
follows (SEQ ID NO: 11): CCAGCAAGCTGCACAGCGT.
[0062] In some embodiments, an shRNA (e.g., shRNA05) encoded by a
nucleic acid comprising the sequence of SEQ ID NO: 1 (and/or the
complement thereof) is transcribed in a host cell (e.g., in a
subject, for example in a human subject) treated with the vector.
In some embodiments, two or more different shRNAs (e.g., having
different start sites and/or termination sites, for example
differing from shRNA05 by one or two additional or fewer
nucleotides) are transcribed in a host cell.
[0063] In some embodiments, the BEST1 coding sequence is driven by
a promoter (e.g., a human opsin proximal promoter). In some
embodiments, the promoter comprises a sequence that is at least
80%, at least 85%, at least 90%, at least 91%, at least 92%, at
least 93%, at least 94%, at least 95%, at least 96%, at least 97%,
at least 98%, at least 99%, or 100% identical to SEQ ID NO: 12
below.
[0064] In some embodiments, the promoter driving shRNA expression
comprises a sequence that is at least 90%, at least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID
NO: 13 below. In some embodiments, the promoter driving shRNA
expression comprises a sequence that is at least 90%, at least 91%,
at least 92%, at least 93%, at least 94%, at least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100% identical to
SEQ ID NO: 14 below.
[0065] The sequences of the exemplary promoters are as follows:
TABLE-US-00004 VMD2 promoter, 623 bp fragment (SEQ ID NO: 12)
AATTCTGTCATTTTACTAGGGTGATGAAATTCCCA
AGCAACACCATCCTTTTCAGATAAGGGCACTGAGG
CTGAGAGAGGAGCTGAAACCTACCCGGCGTCACCA
CACACAGGTGGCAAGGCTGGGACCAGAAACCAGGA
CTGTTGACTGCAGCCCGGTATTCATTCTTTCCATA
GCCCACAGGGCTGTCAAAGACCCCAGGGCCTAGTC
AGAGGCTCCTCCTTCCTGGAGAGTTCCTGGCACAG
AAGTTGAAGCTCAGCACAGCCCCCTAACCCCCAAC
TCTCTCTGCAAGGCCTCAGGGGTCAGAACACTGGT
GGAGCAGATCCTTTAGCCTCTGGATTTTAGGGCCA
TGGTAGAGGGGGTGTTGCCCTAAATTCCAGCCCTG
GTCTCAGCCCAACACCCTCCAAGAAGAAATTAGAG
GGGCCATGGCCAGGCTGTGCTAGCCGTTGCTTCTG
AGCAGATTACAAGAAGGGACCAAGACAAGGACTCC
TTTGTGGAGGTCCTGGCTTAGGGAGTCAAGTGACG
GCGGCTCAGCACTCACGTGGGCAGTGCCAGCCTCT
AAGAGTGGGCAGGGGCACTGGCCACAGAGTCCCAG GGAGTCCCACCAGCCTAGTCGCCAGACC H1
promoter (SEQ ID NO: 13) TAAAACGACGGCCAGTGAATTCATATTTGCATGTC
GCTATGTGTTCTGGGAAATCACCATAAACGTGAAA
TGTCTTTGGATTTGGGAATCTTATAAGTTCTGTAT GAGACCACT U6 promoter (SEQ ID
NO: 14) GAGGGCCTATTTCCCATGATTCCTTCATATTTGCA
TATACGATACAAGGCTGTTAGAGAGATAATTGGAA
TTAATTTGACTGTAAACACAAAGATATTAGTACAA
AATACGTGACGTAGAAAGTAATAATTTCTTGGGTA
GTTTGCAGTTTTAAAATTATGTTTTAAAATGGACT
ATCATATGCTTACCGTAACTTGAAAGTATTTCGAT
TTCTTGGCTTTATATATCTTGTGGAAAGGAC
[0066] In some embodiments, the BEST1 coding sequence is in a
vector, such as an AAV vector or plasmid.
[0067] In some embodiments, the vector as described herein
comprises a sequence that is at least 80%, at least 85%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least 96%, at least 97%, at least 98%, at least 99%,
or 100% identical to a de-targeted BEST1 sequence, SEQ ID NO:
10.
[0068] In some embodiments, a vector encoding a functional BEST1
sequence is provided to supplement or correct (e.g., at least
partially) cellular BEST1 function without knocking down endogenous
BEST1 gene expression. In some embodiments, the BEST1 sequence is
codon-optimized.
[0069] In some embodiments, a vector encoding a functional BEST1
sequence and an shRNA sequence is provided to supplement or correct
(e.g., at least partially) cellular BEST1 function and knock down
endogenous BEST1 gene expression. In some embodiments, endogenous
Best1 expression is knocked down using shRNA. In some embodiments,
the BEST1 sequence is codon-optimized. In some embodiments, the
BEST1 sequence is modified to be resistant to the shRNA. In some
embodiments, the BEST1 and shRNA sequences are encoded on the same
AAV vector.
[0070] In some embodiments, the disclosure provides a method of
modulating BEST1 expression in a subject, the method comprising
administering to the subject, such as a human subject, a
composition comprising a vector or rAAV particle and a
pharmaceutically acceptable carrier. In some aspects, the
disclosure provides a method of treating bestrophinopathies (e.g.,
Best Disease and ARB) in a subject, the method comprising
administering a composition.
[0071] In some embodiments, the disclosure provides a composition
for use in treating Best Disease and a composition for use in the
manufacture of a medicament to treat Best Disease. In some aspects,
the disclosure provides a composition comprising a vector or rAAV
particle, wherein the vector encodes a functional BEST1 sequence,
for use in treating ARB and a composition for use in the
manufacture of a medicament to treat ARB.
[0072] Aspects of the disclosure relate to recombinant
adeno-associated virus (rAAV) particles for delivery of an rAAV
vector as described herein (e.g., encoding an shRNA and/or a
replacement BEST1) into various tissues, organs, and/or cells. In
some embodiments, the rAAV particles comprise a capsid protein as
described herein, e.g., an AAV2 capsid protein. In some
embodiments, the vector contained within the rAAV particle encodes
an RNA of interest (e.g., an shRNA comprising the sequence of SEQ
ID NO: 1) and comprises a replacement BEST1 coding sequence (e.g.,
comprising the sequence of SEQ ID NO: 10).
[0073] Recombinant AAV (rAAV) vectors contained within an rAAV
particle may comprise at a minimum (a) one or more heterologous
nucleic acid regions (e.g., encoding an shRNA and/or a Best1
protein) and (b) one or more regions comprising inverted terminal
repeat (ITR) sequences (e.g., wild-type ITR sequences or engineered
ITR sequences) flanking the one or more heterologous nucleic acid
regions (or transgenes). In some embodiments, the heterologous
nucleic acid region encodes an RNA of interest (e.g., an shRNA
comprising the sequence of SEQ ID NO: 3) and comprises a
replacement BEST1 coding sequence (e.g., comprising the sequence of
SEQ ID NO: 10). In some embodiments, the rAAV vector is between 4
kb and 5 kb in size (e.g., 4.2 to 4.7 kb in size). This rAAV vector
may be encapsidated by a viral capsid, such as an AAV2 capsid. In
some embodiments, the rAAV vector is single-stranded. In some
embodiments, the rAAV vector is double-stranded. In some
embodiments, a double-stranded rAAV vector may be, for example, a
self-complementary vector that contains a region of the vector that
is complementary to another region of the vector, initiating the
formation of the double-strandedness of the vector.
[0074] As disclosed herein, analysis of Best1 structure with
targeted mutations has shown that loss of retinal pigment
epithelium apical microvilli and resulting microdetachment of the
retina represent the earliest features of canine
bestrophinopathies. Retinal light exposure expands, and dark
adaptation contracts, the microdetachments. Subretinal
adeno-associated virus-based gene therapy corrects both the
vitelliform lesions and the light-modulated microdetachments.
[0075] Studies of molecular pathology in the canine BEST1 disease
model revealed retina-wide abnormalities at the RPE-PR interface
associated with defects in the RPE microvillar ensheathment and a
cone PR-associated insoluble interphotoreceptor matrix. In vivo
imaging demonstrated a retina-wide RPE-PR microdetachment, which
contracted with dark adaptation and expanded upon exposure to a
moderate intensity of light.
[0076] Subretinal BEST1 gene augmentation therapy using
adeno-associated virus 2 reversed not only clinically detectable
subretinal lesions but also the diffuse microdetachments.
Immunohistochemical analyses showed correction of the structural
alterations at the RPE-PR interface in areas with BEST1 transgene
expression. Successful treatment effects were demonstrated in three
different canine BEST1 genotypes with vector titers in the
0.1.times.10.sup.11 to 5.times.10.sup.11 vector genomes per mL
range. Patients with biallelic BEST1 mutations exhibited large
regions of retinal lamination defects, severe PR sensitivity loss,
and slowing of the retinoid cycle. Human translation of canine
BEST1 gene therapy success in reversal of macro- and
microdetachments through restoration of cytoarchitecture at the
RPE-PR interface has promise to result in improved visual function
and prevent disease progression in patients affected with
bestrophinopathies.
[0077] As further disclosed herein, it was discovered that
adeno-associated virus (AAV)2-mediated BEST1 gene augmentation
corrects this primary subclinical defect as well as the
disease.
[0078] The rAAV particle may be of any AAV serotype, including any
derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2/1,
2/5, 2/8, or 2/9). As used herein, the serotype of an rAAV particle
refers to the serotype of the capsid proteins. In some embodiments,
the rAAV particle is AAV2. Non-limiting examples of derivatives and
pseudotypes include rAAV2/1, rAAV2/5, rAAV2/8, rAAV2/9, AAV2-AAV3
hybrid, AAVrh.10, AAVhu.14, AAV3a/3b, AAVrh32.33, AAV-HSC15,
AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8,
AAV-HSC15/17, AAVM41, AAV9.45, AAV6(Y445F/Y731F), AAV2.5T,
AAV-HAE1/2, AAV clone 32/83, AAVShH10, AAV2 (Y->F), AAV8
(Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes
and derivatives/pseudotypes, and methods of producing such
derivatives/pseudotypes are known in the art (see, e.g., Mol Ther.
2012 April; 20(4):699-708. doi: 10.1038/mt.2011.287. Epub 2012 Jan.
24. The AAV vector toolkit: poised at the clinical crossroads.
Asokan Al, Schaffer D V, Samulski R J.). In some embodiments, the
rAAV particle is a pseudotyped rAAV particle, which comprises (a) a
nucleic acid vector comprising ITRs from one serotype (e.g., AAV2)
and (b) a capsid comprised of capsid proteins derived from another
serotype (e.g., AAV5). Methods for producing and using pseudotyped
rAAV vectors are known in the art (see, e.g., Duan et al., J.
Virol., 75:7662-7671, 2001; Halbert et al., J. Virol.,
74:1524-1532, 2000; Zolotukhin et al., Methods, 28:158-167, 2002;
and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001).
[0079] Methods of producing rAAV particles and rAAV vectors are
also known in the art and commercially available (see, e.g.,
Zolotukhin et al. Production and purification of serotype 1, 2, and
5 recombinant adeno-associated viral vectors. Methods 28 (2002)
158-167; and U.S. Patent Publication Nos. US 2007/0015238 and US
2012/0322861, which are incorporated herein by reference; and
plasmids and kits available from ATCC and Cell Biolabs, Inc.). For
example, a plasmid containing the rAAV vector may be combined with
one or more helper plasmids, e.g., that contain a rep gene (e.g.,
encoding Rep78, Rep68, Rep52 and Rep40) and a cap gene (e.g.,
encoding VP1, VP2, and VP3, including a modified VP3 region as
described herein), and transfected into a producer cell line such
that the rAAV particle can be packaged and subsequently
purified.
[0080] In some embodiments, the one or more helper plasmids include
a first helper plasmid comprising a rep gene and a cap gene (e.g.,
encoding a rAAV capsid protein as described herein) and a second
helper plasmid comprising a E1a gene, a E1b gene, a E4 gene, a E2a
gene, and a VA gene. In some embodiments, the rep gene is a rep
gene derived from AAV2 and the cap gene is derived from AAV2 and
may include modifications to the gene in order to produce the
modified capsid protein described herein. Helper plasmids, and
methods of making such plasmids, are known in the art and
commercially available (see, e.g., pDM, pDG, pDP1rs, pDP2rs,
pDP3rs, pDP4rs, pDP5rs, pDP6rs, pDG (R484E/R585E), and pDP8.ape
plasmids from PlasmidFactory, Bielefeld, Germany; other products
and services available from Vector Biolabs, Philadelphia, Pa.;
Cellbiolabs, San Diego, Calif.; Agilent Technologies, Santa Clara,
Ca; and Addgene, Cambridge, Mass.; pxx6; Grimm et al. (1998), Novel
Tools for Production and Purification of Recombinant
Adenoassociated Virus Vectors, Human Gene Therapy, Vol. 9,
2745-2760; Kern, A. et al. (2003), Identification of a
Heparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids,
Journal of Virology, Vol. 77, 11072-11081.; Grimm et al. (2003),
Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based
Production of Adeno-associated Virus Vectors of Serotypes 1 to 6,
Molecular Therapy, Vol. 7, 839-850; Kronenberg et al. (2005), A
Conformational Change in the Adeno-Associated Virus Type 2 Capsid
Leads to the Exposure of Hidden VP1 N Termini, Journal of Virology,
Vol. 79, 5296-5303; and Moullier, P. and Snyder, R. O. (2008),
International efforts for recombinant adeno-associated viral vector
reference standards, Molecular Therapy, Vol. 16, 1185-1188).
[0081] An exemplary, non-limiting, rAAV particle production method
is described next. One or more helper plasmids are produced or
obtained, which comprise rep and cap ORFs for the desired AAV
serotype and the adenoviral VA, E2A (DBP), and E4 genes under the
transcriptional control of their native promoters. The cap ORF may
also comprise one or more modifications to produce a modified
capsid protein as described herein. HEK293 cells (available from
ATCC.RTM.) are transfected via CaPO4-mediated transfection, lipids
or polymeric molecules such as Polyethylenimine (PEI) with the
helper plasmid(s) and a plasmid containing a heterologous nucleic
acid vector described herein (e.g. a plasmid containing a
heterologous nucleic acid comprising wild-type or mutant cBEST1 or
hBEST1 gene shown in FIG. 13, 14, 15 or 16). The HEK293 cells are
then incubated for at least 60 hours to allow for rAAV particle
production. Alternatively, in another example Sf9-based producer
stable cell lines are infected with a single recombinant
baculovirus containing the nucleic acid vector. As a further
alternative, in another example HEK293 or BHK cell lines are
infected with a HSV containing the nucleic acid vector and
optionally one or more helper HSVs containing rep and cap ORFs as
described herein and the adenoviral VA, E2A (DBP), and E4 genes
under the transcriptional control of their native promoters. The
HEK293, BHK, or Sf9 cells are then incubated for at least 60 hours
to allow for rAAV particle production. The rAAV particles can then
be purified using any method known the art or described herein,
e.g., by iodixanol step gradient, CsCl gradient, chromatography, or
polyethylene glycol (PEG) precipitation.
[0082] The disclosure also contemplates host cells that comprise an
shRNA, a vector, or an rAAV particle as described herein. Such host
cells include mammalian host cells, with human host cells being
preferred, and may be isolated, e.g., in cell or tissue culture. In
some embodiments, the host cell is a cell of the eye.
[0083] In some aspects, the disclosure provides formulations of one
or more rAAV-based compositions disclosed herein in
pharmaceutically acceptable solutions for administration to a cell
or an animal, either alone or in combination with one or more other
modalities of therapy, and in particular, for therapy of human
cells, tissues, and diseases affecting man.
[0084] Accordingly, in some embodiments, a composition is provided
which comprises an shRNA, a vector, or an rAAV particle as
described herein and optionally a pharmaceutically acceptable
carrier. In some embodiments, the compositions described herein can
be administered to a subject in need of treatment. In some
embodiments, the subject has or is suspected of having one or more
conditions, diseases, or disorders of the brain and/or eye (e.g.,
Best Disease). In some embodiments, the subject has or is suspected
of having one or more of the conditions, diseases, and disorders
disclosed herein (e.g., Best Disease). In some embodiments, the
subject has one or more endogenous mutant BEST1 alleles (e.g.,
associated with or that cause a disease or disorder of the eye or
retina). In some embodiments, the subject has at least one
autosomal dominant mutant BEST1 allele (e.g., that causes Best
Disease). In some embodiments, the subject is a human. In some
embodiments, the subject is a non-human primate. Non-limiting
examples of non-human primate subjects include macaques (e.g.,
cynomolgus or rhesus macaques), marmosets, tamarins, spider
monkeys, owl monkeys, vervet monkeys, squirrel monkeys, baboons,
gorillas, chimpanzees, and orangutans. Other exemplary subjects
include domesticated animals such as dogs and cats; livestock such
as horses, cattle, pigs, sheep, goats, and chickens; and other
animals such as mice, rats, guinea pigs, and hamsters.
[0085] In some embodiments, the dose of rAAV particles administered
to a cell or a subject may be on the order ranging from 10.sup.6 to
10.sup.14 particles/mL or 10.sup.3 to 10.sup.15 particles/mL, or
any values therebetween for either range, such as for example,
about 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, 10.sup.11,
10.sup.12, 10.sup.13, or 10.sup.14 particles/mL. In one embodiment,
rAAV particles of higher than 10.sup.13 particles/mL are be
administered. In some embodiments, the dose of rAAV particles
administered to a subject may be on the order ranging from 10.sup.6
to 10.sup.14 vector genomes (vgs)/mL or 10.sup.3 to 10.sup.15
vgs/mL, or any values therebetween for either range, such as for
example, about 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10,
10.sup.11, 10.sup.12, 10.sup.13, or 10.sup.14 vgs/mL. In one
embodiment, rAAV particles of higher than 10.sup.13 vgs/mL are be
administered. The rAAV particles can be administered as a single
dose, or divided into two or more administrations as may be
required to achieve therapy of the particular disease or disorder
being treated. In some embodiments, 0.0001 mL to 10 mLs (e.g.,
0.0001 mL, 0.001 mL, 0.01 mL, 0.1 mL, 1 mL, 10 mLs) are delivered
to a subject in a dose.
[0086] In some embodiments, rAAV particle titers range from
1.times.10.sup.10 to 5.times.10.sup.13 vg/ml. In some embodiments,
rAAV particle titers can be about 1.times.10.sup.10,
2.5.times.10.sup.10, 5.times.10.sup.10, 1.times.10.sup.11,
2.times.10.sup.11, 2.5.times.10.sup.11, 5.times.10.sup.11,
1.times.10.sup.12, 2.5.times.10.sup.12, 5.times.10.sup.12,
1.times.10.sup.13, 2.5.times.10.sup.13, or 5.times.10.sup.13 vg/mL.
In some embodiments, particle titers are less than
1.times.10.sup.10 vg/mL. In some embodiments, rAAV particle titers
are greater than 1.times.10.sup.15 vg/mL. In some embodiments, rAAV
particle titers are greater than 5.times.10.sup.13 vgs/mL. In
particular embodiments, rAAV particle titers are about
2.times.10.sup.11 or 2.5.times.10.sup.11. In some embodiments, rAAV
particles are administered via methods further described herein
(e.g., subretinally or intravitreally).
[0087] The rAAV particles can be administered as a single dose, or
divided into two or more administrations as may be required to
achieve therapy of the particular disease or disorder being
treated. In some embodiments, from 1 to 500 microliters of a
composition (e.g., comprising an rAAV particle) described in this
application is administered to one or both eyes of a subject. For
example, in some embodiments, about 1, about 10, about 50, about
100, about 200, about 300, about 400, or about 500 microliters can
be administered to each eye. However, it should be appreciated that
smaller or larger volumes could be administered in some
embodiments.
[0088] If desired, rAAV particle or nucleic acid vectors may be
administered in combination with other agents as well, such as,
e.g., proteins or polypeptides or various pharmaceutically-active
agents, including one or more systemic or topical administrations
of therapeutic polypeptides, biologically active fragments, or
variants thereof. In fact, there is virtually no limit to other
components that may also be included, given that the additional
agents do not cause a significant adverse effect upon contact with
the target cells or host tissues. The rAAV particles may thus be
delivered along with various other agents as required in the
particular instance. Such compositions may be purified from host
cells or other biological sources, or alternatively may be
chemically synthesized as described herein.
[0089] In other aspects, the disclosure provides formulations of
one or more of the plasmids encoding an shRNA as disclosed herein
in pharmaceutically acceptable solutions for administration to a
cell or an animal, either alone or in combination with one or more
other modalities of therapy, and in particular, for therapy of
human cells, tissues, and diseases affecting man. The disclosure
also provides methods of administration of plasmids encoding an
shRNA as disclosed herein. Exemplary methods comprised methods of
administration of plasmids to mammals, e.g. humans.
[0090] In some embodiments, the disclosed plasmid formulations for
administration to mammals (e.g., humans) comprise DNA plasmid
vector in phosphate buffered saline (PBS). The concentration of the
vector may be between 1 mg/ml and 3 mg/ml. In certain embodiments,
the concentration is about 2 mg/ml. In other embodiments, the
concentration is about 1.6 mg/ml, about 1.7 mg/ml, about 1.75
mg/ml, about 1.8 mg/ml, about 1.85 mg/ml, about 1.9 mg/ml, about
1.95 mg/ml, about 2.05 mg/ml, about 2.1 mg/ml, or about 2.15
mg/ml.
[0091] Formulation of pharmaceutically-acceptable excipients and
carrier solutions is well-known to those of skill in the art, as is
the development of suitable dosing and treatment regimens for using
the particular compositions described herein in a variety of
treatment regimens, including e.g., oral, parenteral, intravenous,
intranasal, intra-articular, and intramuscular administration and
formulation.
[0092] Typically, these formulations may contain at least about
0.1% of the therapeutic agent (e.g., rAAV particle or plasmid) or
more, although the percentage of the active ingredient(s) may, of
course, be varied and may conveniently be between about 1 or 2% and
about 70% or 80% or more of the weight or volume of the total
formulation. Naturally, the amount of therapeutic agent(s) (e.g.,
rAAV particle) in each therapeutically-useful composition may be
prepared in such a way that a suitable dosage will be obtained in
any given unit dose of the compound. Factors such as solubility,
bioavailability, biological half-life, route of administration,
product shelf life, as well as other pharmacological considerations
will be contemplated by one skilled in the art of preparing such
pharmaceutical formulations, and as such, a variety of dosages and
treatment regimens may be desirable.
[0093] In certain circumstances it will be desirable to deliver an
shRNA, a vector, or an rAAV particle as described herein in
suitably formulated pharmaceutical compositions disclosed herein,
either subcutaneously, intraocularly, intravitreally, parenterally,
subcutaneously, intravenously, intracerebro-ventricularly,
intramuscularly, intrathecally, orally, intraperitoneally, by oral
or nasal inhalation, or by direct injection to one or more cells,
tissues, or organs by direct injection.
[0094] The pharmaceutical forms of compositions (e.g., comprising
an shRNA, a vector, or an rAAV particle as described herein)
suitable for injectable use include sterile aqueous solutions or
dispersions. In some embodiments, the form is sterile and fluid to
the extent that easy syringability exists. In some embodiments, the
form is stable under the conditions of manufacture and storage and
is preserved against the contaminating action of microorganisms,
such as bacteria and fungi. The carrier can be a solvent or
dispersion medium containing, for example, water, saline, ethanol,
polyol (e.g., glycerol, propylene glycol, and liquid polyethylene
glycol, and the like), suitable mixtures thereof, and/or vegetable
oils. Proper fluidity may be maintained, for example, by the use of
a coating, such as lecithin, by the maintenance of the required
particle size in the case of dispersion and by the use of
surfactants.
[0095] The term "carrier" refers to a diluent, adjuvant, excipient,
or vehicle with which the shRNA, vector, or rAAV particle as
described herein is administered. Such pharmaceutical carriers can
be sterile liquids, such as water and oils, including those of
petroleum oil such as mineral oil, vegetable oil such as peanut
oil, soybean oil, and sesame oil, animal oil, or oil of synthetic
origin. Saline solutions and aqueous dextrose and glycerol
solutions can also be employed as liquid carriers.
[0096] The compositions of the present disclosure can be delivered
to the eye through a variety of routes. They may be delivered
intraocularly, by topical application to the eye or by intraocular
injection into, for example the vitreous (intravitreal injection)
or subretinal (subretinal injection) inter-photoreceptor space. In
some embodiments, they are delivered to rod photoreceptor cells.
Alternatively, they may be delivered locally by insertion or
injection into the tissue surrounding the eye. They may be
delivered systemically through an oral route or by subcutaneous,
intravenous or intramuscular injection. Alternatively, they may be
delivered by means of a catheter or by means of an implant, wherein
such an implant is made of a porous, non-porous or gelatinous
material, including membranes such as silastic membranes or fibers,
biodegradable polymers, or proteinaceous material. They can be
administered prior to the onset of the condition, to prevent its
occurrence, for example, during surgery on the eye, or immediately
after the onset of the pathological condition or during the
occurrence of an acute or protracted condition.
[0097] For administration of an injectable aqueous solution, for
example, the solution may be suitably buffered, if necessary, and
the liquid diluent first rendered isotonic with sufficient saline
or glucose. These particular aqueous solutions are especially
suitable for intravenous, intramuscular, intravitreal, subcutaneous
and intraperitoneal administration. In this connection, a sterile
aqueous medium that can be employed will be known to those of skill
in the art in light of the present disclosure. For example, one
dosage may be dissolved in 1 ml of isotonic NaCl solution and
either added to 1000 ml of hypodermoclysis fluid or injected at the
proposed site of infusion, (see for example, "Remington's
Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and
1570-1580). Some variation in dosage will necessarily occur
depending on the condition of the subject being treated. The person
responsible for administration will, in any event, determine the
appropriate dose for the individual subject. Moreover, for human
administration, preparations should meet sterility, pyrogenicity,
and the general safety and purity standards as required by, e.g.,
FDA Office of Biologics standards.
[0098] Sterile injectable solutions may be prepared by
incorporating an shRNA, a vector, or an rAAV particle as described
herein in the required amount in the appropriate solvent with
several of the other ingredients enumerated above, as required,
followed by filtered sterilization. Generally, dispersions are
prepared by incorporating the various sterilized active ingredients
into a sterile vehicle which contains the basic dispersion medium
and the required other ingredients from those enumerated above. In
the case of sterile powders for the preparation of sterile
injectable solutions, the preferred methods of preparation are
vacuum-drying and freeze-drying techniques which yield a powder of
the active ingredient plus any additional desired ingredient from a
previously sterile-filtered solution thereof.
[0099] The amount of composition (e.g., comprising an shRNA, a
vector, or an rAAV particle as described herein) and time of
administration of such composition will be within the purview of
the skilled artisan having benefit of the present teachings. It is
likely, however, that the administration of
therapeutically-effective amounts of the disclosed compositions may
be achieved by a single administration, such as for example, a
single injection of sufficient numbers of rAAV particles to provide
therapeutic benefit to the patient undergoing such treatment.
Alternatively, in some circumstances, it may be desirable to
provide multiple, or successive administrations of the composition,
either over a relatively short, or a relatively prolonged period of
time, as may be determined by the medical practitioner overseeing
the administration of such compositions.
[0100] In some embodiments, rod cells remain structurally intact
and/or viable upon silencing of cellular BEST1 gene expression. In
some embodiments, rod cells in which cellular BEST1 gene expression
is silenced may have shortened outer segments which would normally
contain BEST1. In some embodiments, the length of the outer
segments can be maintained or restored (e.g., partially or
completely) using the exogenously added (hardened) BEST1 gene, the
expression of which is resistant to silencing using the
compositions described in this application.
[0101] To "treat" a disease as the term is used herein, means to
reduce the frequency or severity of at least one sign or symptom of
a disease or disorder experienced by a subject (e.g., Best
Disease). The compositions described above are typically
administered to a subject in an effective amount, that is, an
amount capable of producing a desirable result. The desirable
result will depend upon the active agent being administered. For
example, an effective amount of a rAAV particle may be an amount of
the particle that is capable of transferring a heterologous nucleic
acid to a host organ, tissue, or cell.
[0102] Toxicity and efficacy of the compositions utilized in
methods of the disclosure can be determined by standard
pharmaceutical procedures, using either cells in culture or
experimental animals to determine the LD50 (the dose lethal to 50%
of the population). The dose ratio between toxicity and efficacy
the therapeutic index and it can be expressed as the ratio
LD50/ED50. Those compositions that exhibit large therapeutic
indices are preferred. While those that exhibit toxic side effects
may be used, care should be taken to design a delivery system that
minimizes the potential damage of such side effects. The dosage of
compositions as described herein lies generally within a range that
includes an ED50 with little or no toxicity. The dosage may vary
within this range depending upon the dosage form employed and the
route of administration utilized.
[0103] Without further elaboration, it is believed that one skilled
in the art can, based on the above description, utilize the present
disclosure to its fullest extent. The following specific
embodiments are, therefore, to be construed as merely illustrative,
and not limitative of the remainder of the disclosure in any way
whatsoever. All publications cited herein are incorporated by
reference for the purposes or subject matter referenced herein.
EXAMPLES
Example 1
Early Retina-Wide Pathology at the RPE-PR Interface.
[0104] To understand the pathophysiology behind the impaired RPE-PR
interaction, cBest retinas with clinically obvious disease were
evaluated. The key features of RPE apical membrane responsible for
direct interaction with PR OS s were examined by
immunohistochemistry (IHC) against EZRIN, a membrane-cytoskeleton
linker protein essential for formation of RPE apical MV, and
combined with human cone arrestin (hCAR) and peanut agglutinin
lectin (PNA) labeling to distinguish the cone PR matrix-specific
interface. Confocal microscopy and analysis of 3D reconstruction
images from the wild-type (WT) retina exposed a complex sheet-like
structure of both inherent constituents of RPE apical membrane:
cone- and rod-associated MV. Cone-MV (also known as RPE apical cone
sheath) were more pronounced than rod-MV, and formed a highly
organized wrapping that tethered individual cone outer segments
(COSs) to the RPE apical surface (FIG. 1A). In the subretinal
space, this intercellular complex was further encased with an
equally intricate cone-specific insoluble extracellular matrix
sheath (cone-IPM) detected by selective binding of PNA lectin (FIG.
1A). In diseased cBest retinas, however, such complex extracellular
compartmentalization of COSs was lost, and the dearth of
microvillar ensheathment was accompanied by hypertrophied RPE cells
overloaded with lipofuscin granules and compromised insoluble
cone-IPM (FIG. 1B). These observations were confirmed in three
distinct cBEST1 genotypes (R25*/R25*, P463fs/P463fs, and
R25*/P463fs) examined across both the tapetal and nontapetal
portions of the retina in 22 eyes after disease onset (age range 45
to 270 wk).
[0105] To evaluate the possibility that the structural cone-MV
abnormalities are secondary to cone dysfunction and disease, the
RPE-COS interaction in a different canine IRD model was examined: a
primary cone photoreceptor channelopathy, CNGB3-associated
achromatopsia. The RPE-COS complex was first examined at 6 wk of
age; CNGB3-mutant retinas, harboring either a missense or locus
deletion mutation, showed no apparent irregularities at the RPE-PR
interface, and the proper localization of RPE apical markers was
associated with specific anti-BEST1 labeling (FIGS. 6A and 6B).
Double immunostaining demonstrated specific distribution of EZRIN
along cone-MV interdigitating with hCAR-positive yet CNGB3-negative
COSs. As a consequence of CNGB3 channel subunit dysfunction in
older (ages 57 and 85 wk) mutant retinas, which undergo a gradual
cone PR degeneration, it was found that the microvillar
ensheathment of the RPE apical domain still remained largely intact
(FIGS. 6C and 6D).
[0106] The findings in CNGB3-mutant retinas suggested that the
structural alterations associated with cone-MV ensheathment in
cBest were not secondary to a cone defect but specific to the RPE
channelopathy triggered by mutations in BEST1. The 6-week time
point, which is well before clinical disease onset and near the end
of postnatal retinal differentiation in dogs, was the focus of
these experiments (FIGS. 1C and 1D). In contrast to the age-matched
WT control, the lack of specific basolateral BEST1 immunolabeling
in the cBest RPE was associated with a rather smooth apical surface
and clearly underdeveloped (vestigial) apical microvilli (FIG. 1C,
arrowheads). Quantification of the spatial density of cone-MV and
the length of cone- and rod-MV was performed on deconvolved 3D
Z-stack projection images at four retinal locations (FIG. 1D).
Significant differences (P<0.0001) in the mean number of cone-MV
were found between cBest and WT in each retinal region examined
(FIG. 1D). Even though the cone photoreceptor numbers were
comparable to controls, the cone-MV in cBest were much fewer in
number, sparsely distributed, and consistently appeared shorter and
much finer than those in controls regardless of the topographical
location. In control (WT) eyes, the average length of cone-MV was
17.4 (.+-.0.25) .mu.m in the tapetal superotemporal quadrant and
12.3 (.+-.0.23) .mu.m in the inferior nontapetal retina, whereas
the length of rod-MV was 6.7 (.+-.0.11) .mu.m and 5.3 (.+-.0.27)
.mu.m in the tapetal and nontapetal portions of the retina,
respectively. In cBest, however, the average length of rare cone-MV
extensions identified was substantially reduced (6.0.+-.0.31 and
6.5.+-.0.74 .mu.m in the central tapetal and nontapetal inferior
parts, respectively). A quantitative assessment of the minute
rod-MV in cBest was beyond the limits of optical resolution.
cBEST1-Mutant Eyes have Retina-Wide Microdetachments that Expand
with Light Exposure.
[0107] To determine in vivo correlates of the early RPE-PR
interface abnormalities detected by IHC, noninvasive imaging with
optical coherence tomography (OCT) was used to evaluate cBest eyes
at young ages, well before ophthalmoscopic lesions are detectable.
Qualitatively, central retinas of all evaluated eyes showed an
additional hyposcattering layer in the outer retina located distal
to the outer nuclear layer (ONL) that was not detectable in WT eyes
(FIG. 2A, arrow and double arrow). Unexpectedly, the hyposcattering
layer was variable with repeated recordings in the same eye within
a single experimental session. Further analyses uncovered that the
width of the hyposcattering layer was greater in scans obtained
toward the end of an imaging session, when the retina would have
been exposed to greater retinal irradiance due to intervening
autofluorescence imaging performed with bright short-wavelength
lights (FIG. 2A, double arrow, more LA). The width of the
hyposcattering layer was less in scans obtained early in the
imaging session before autofluorescence imaging was performed (FIG.
2A, arrow, less LA).
[0108] Quantitative studies were performed by obtaining
longitudinal reflectivity profiles and making measurements both at
nasal and temporal retinal locations. WT eyes (n=12, ages 15 to 17
wk) showed outer retinal hyperscattering peaks at the outer
plexiform layer (OPL) and the external limiting membrane (ELM)
defining the intervening hyposcattering layer as the ONL (FIG. 2B).
Distal to the ELM was a hyperscattering peak corresponding to the
junction between inner and outer segments of photoreceptors
(IS/OS), a major peak originating near the RPE-tapetum interface
(RPE/T), and an intervening minor hyperscattering peak
corresponding to photoreceptor OS tips, which was often difficult
to resolve (FIG. 2B). An abnormal hyposcattering layer (FIG. 2B,
arrows) was detectable in cBest eyes (n=6, age 11 wk) with less
light exposure. With greater light exposure, the hyposcattering
layer became deeper and more distinct (FIG. 2B, double arrows);
both nasal and temporal retinal locations showed the same effect.
The distance between the IS/OS and RPE/T peaks (FIGS. 2A and 2B,
arrowheads) was measured. In WT eyes, the distance was 41.3
(.+-.4.5) .mu.m, whereas in cBest eyes this distance was
significantly greater (P<0.001) at 46.8 (.+-.6.7) .mu.m and 45.2
(.+-.6.8) .mu.m (less light exposure) and 55.8 (.+-.10.5) .mu.m and
53.5 (.+-.6.3) .mu.m (more light exposure) for nasal and temporal
retinal regions, respectively (FIG. 2C).
[0109] Two types of experiments were performed to better understand
the thickness of the hyposcattering layer as a function of light
exposure. In the main experiment (WT, n=12, age 15 to 17 wk; cBest,
n=3, age 13 wk), eyes were dark-adapted overnight and then
sequential imaging was performed in the dark over a 2-h period with
five intervening brief 488-nm light exposures of incrementally
greater intensity ranging from very dim lights to moderate lights
produced by standard clinical ophthalmic equipment (FIG. 2D). In a
shorter experimental protocol, only the highest two light exposures
were used in different eyes (cBest, n=3, age 13 wk). After
overnight dark adaptation, IS/OS-RPE/T distance was 40.0 (.+-.4.5)
.mu.m in WT eyes, whereas it was 47.1 (.+-.4.8) .mu.m in cBest
(FIG. 2E); the difference was statistically significant
(P<0.001). Increasingly brighter light exposures resulted in
monotonic expansion of the IS/OS-RPE/T distance in cBest eyes,
reaching an apparent plateau of 59.4 (.+-.8.7) .mu.m (FIG. 2E). In
WT eyes, the effect of the light exposure was either negligible or
small, with the IS/OS-RPE/T distance reaching a plateau of 40.9
(.+-.4.3) .mu.m. Thus, exposure to light appeared to cause an acute
retinal microdetachment of up to 18.4 (.+-.8.7) .mu.m in cBest eyes
within minutes at an age preceding any detectable ophthalmoscopic
findings. The light-mediated microdetachment disappeared over a
time span of less than 24 h (FIG. 7).
[0110] In preparation for localized gene therapy, retinotopic
distribution of light-driven microdetachments was evaluated in
fully light-adapted cBest and WT eyes (FIG. 2F). The mean
IS/OS-RPE/T distance across WT eyes (n=4, age 104 wk) was
relatively homogeneous across superior and inferior retinal areas,
with a clear boundary corresponding to the transition between
tapetal and pigmented (nontapetal) retina. Greater distance in the
tapetal retina of WT eyes was likely due to differences in the
dominant contributors to the hyperscattering peak (tapetum in the
tapetal retina versus pigmented RPE). In a cBest eye (R25*/P463fs)
at age 297 wk, there was a relatively diffuse retina-wide
microdetachment in addition to grossly obvious retinal detachment
at the fovea-like region (FIG. 2F, demarcated with darker color).
In a younger cBest eye (P463fs/P463fs) at age 12 wk, there was a
distinct band of greater microdetachment along the visual streak
and surrounding the optic nerve head even though no ophthalmoscopic
abnormalities were evident. Difference maps between mutant eyes and
mean WT demonstrated the spatial distribution of the extent of
microdetachments (FIG. 2F, Right).
[0111] To assess the potential adverse consequences on
photoreceptors, ONL thickness was topographically mapped across the
retinal areas with microdetachments (FIGS. 8A and 8B). The
microdetachments did not result in thinning of the ONL that would
be expected from photoreceptor degeneration. Instead, there was a
tendency for the ONL in cBest to be homogeneously thicker than WT;
hyperthick regions typically included the central-superior tapetal
retina, but could also extend into the inferior nontapetal retina
(FIG. 8A). Of importance, the hyperthick regions of the ONL, when
examined microscopically, had numbers of PR nuclei that were
comparable to controls. This suggests an expansion of internuclear
spacing as the likely cause of hyperthick ONL observed by
imaging.
Natural History of Canine Bestrophinopathy.
[0112] As a prerequisite to assessing gene therapy outcomes, the
natural history of cBest was determined from a group of 18 dogs [12
male (M) and 6 female (F); age range 6 to 297 wk] (Table 1). cBest
dogs were serially monitored by ophthalmoscopy and noninvasive
imaging to detect the onset of earliest disease and understand
disease progression. Based on the systematic in vivo imaging, the
first disease signs were detected as early as 11 wk of age (mean
age of 15 wk) as a subtle focal retinal elevation of the canine
fovea-like regions (FIG. 9A). This discrete separation of
photoreceptor layer from the underlying RPE progressed to form a
larger subretinal macrodetachment (vitelliform lesion) evident en
face and on the corresponding OCT scan at 23 wk of age (FIG. 9B).
This discrete RPE-PR detachment on cross-sectional imaging, yet
unnoticeable on en face imaging, was found to be consistent among
cBest eyes examined (n=34), regardless of genotype. From the
subclinical stage, the disease progressed to form a macrodetachment
(vitelliform stage) limited to the canine fovea and surrounded by
microdetachment (FIG. 3A, Left panel). The primary lesion gradually
evolved to manifest as a characteristic bullous detachment within
the area centralis that encompassed the fovea-like region (FIG. 3A,
Middle and Right panels and FIGS. 9B-9D). The presence of
distinctive hyperautofluorescence was evident in the inferior part
of the lesion (FIG. 3A, Middle Inset panels; pseudohypopyon stage).
The advanced disease stages involved a partial resorption and
dispersion of the hyperautofluorescent material within the central
lesion, associated with significant thinning of ONL (FIGS. 9E and
9F).
[0113] In each case followed by serial imaging (Table 1), cBest
manifested bilaterally and nearly always presented a remarkable
symmetry, albeit with a variable rate of progression (FIG. 3A and
FIGS. 9A-9F). The gross retinal detachments, ophthalmoscopically
visible in both eyes, either remained limited to the central retina
or became more extensive with extracentral lesions scattered
throughout, still with a strong predilection to the central
cone-rich areas and associated with hyperthick ONL.
TABLE-US-00005 TABLE 1 Summary of AAV-BEST1-treated and control
eyes used in the study. AAV titer Last cBEST1 Age, inj., Volume
examination, Dog ID Sex status Eye Treatment wk vg/mL inj., .mu.L
wk p.i. Outcome EM356 M R25*/ OD AAV- 52 1.5E+10 50 245 Reversal
P463fs cBEST1 OS UnTx 245 Progression EM385 M R25*/ OD BSS 39 50
105 Progression R25* OS AAV- 39 1.5E+11 60 105 Reversal cBEST1 EMC1
F R25*/ OD AAV- 27 2.0E+11 110 156 Reversal R25* hBEST1 OS BSS 27
110 156 Progression EMC3 F R25*/ OD BSS 27 110 103 Progression R25*
OS AAV- 27 2.0E+11 120 103 Reversal hBEST1 EML4 M R25*/ OD BSS 58
150 79 Progression P463fs OS AAV- 58 2.5E+11 95 79 Reversal hBEST1
EML6 F R25*/ OD AAV- 43 2.0E+11 100 51 Reversal P463fs hBEST1 OS
BSS 43 110 51 Progression EML9 M R25*/ OD AAV- 69 5.0E+11 65 54
Reversal P463fs hBEST1 OS BSS 69 70 54 Progression EML13 F R25*/ OD
UnTx 52 Progression P463fs OS AAV- 45 1.5E+11 100 52 Reversal
hBEST1 EML22 R25*/ OD AAV- 27 3.5E+11 100 39 Reversal P463fs hBEST1
OS AAV- 27 3.5E+11 100 39 Reversal hBEST1 LH15 P463fs/ OD AAV- 65
2.5E+11 180 207 Reversal P463fs hBEST1 OS AAV- 65 2.5E+11 50 207
Reversal hBEST1 LH21 P463fs/ OD BSS 27 50 207 Progression P463fs OS
AAV- 27 2.5E+11 50 207 Reversal hBEST1 LH30 P463fs/ OD AAV- 31
2.5E+11 110 13 Reversal P463fs hBEST1 OS AAV- 31 2.5E+11 110 13
Reversal hBEST1 AS277 M WT OU UnTx 6 control EML24 M R25*/ OU UnTx
6 P463fs control EML21 M R25*/ OU UnTx 13 P463fs control EML23 F
R25*/ OU UnTx 13 P463fs control N306 M WT OU UnTx 15 control N307 F
WT OU UnTx 15 control N308 F WT OU UnTx 15 control N300 M WT OU
UnTx 17 control N301 M WT OU UnTx 17 control N302 F WT OU UnTx 17
control CCAN M WT OU UnTx 37 control CCGS M WT OU UnTx 37 control
LH14 M WT OU UnTx 42 control EML31 M R25*/ OD UnTx 43 P463fs
control EML27 M R25*/ OD UnTx 52 P463fs control EM346 M R25*/ OS
UnTx 89 R25* control N284 F WT OS UnTx 145 control N269 F WT OS
UnTx 199 control Key: BSS, balanced salt solution; cBEST1, canine
transgene; hBEST1, human transgene; Inj., injected; OD, right eye;
OS, left eye; OU, bilateral; p.i., postinjection; UnTx, untreated;
vg, vector genomes; WT, wild type. cBEST1 mutations: R25*/R25*,
p.Arg25Ter-homozygote; P463fs/P463fs, p.Pro463fs-homozygote;
R25*/P463fs, p.Arg25Ter/p.Pro463fs-compound heterozygous.
Subretinal BEST1 Gene Augmentation Therapy Stably Corrects
Disease.
[0114] To evaluate proof of concept for AAV2-mediated subretinal
gene augmentation therapy, 22 cBest eyes were injected [vector
titers in the 0.1 to 5.times.10.sup.11 vector genomes (vg) per mL
range or balanced salt solution (BSS) control] at 27 to 69 wk
(Table 1) with a canine (cBEST1) or human (hBEST1) transgene driven
by the human VMD2 promoter. Maps of exemplary AAV vectors
comprising hBEST1 and cBEST1 heterologous nucleic acids used to
make the disclosed rAAV particles are shown in FIGS. 13 and 14,
respectively. cBest dogs exhibiting different stages of focal or
multifocal retinal detachments were either injected unilaterally
with AAV leaving the fellow eye uninjected, or with AAV in one eye
and control (BSS) injection in the contralateral eye; three cases
manifesting multifocal disease were injected bilaterally with AAV
targeting the superotemporal quadrant, while the retinal areas
outside of the surgical bleb served as an internal control (Table
1).
[0115] A representative result is shown from a compound
heterozygous (R25*/P463fs) dog displaying advanced central retinal
detachment in the right eye (EM356-OD) (FIG. 3A) that underwent
subretinal injection with cBEST1 at the age of 52 wk (FIG. 3B, Left
panel), while the fellow eye was not injected (EM356-OS) (FIGS.
9A-9F). Both eyes were monitored clinically and by in vivo imaging.
Disease reversal was first apparent in the injected eye at 4 wk
postinjection (p.i.) and retained a sustained effect long-term, as
illustrated at 43 and 245 wk p.i. (FIG. 3B). In this and other
cases with advanced disease that presented extensive accumulation
of autofluorescent material within the subretinal macrodetachments
(n=13 eyes), hyperautofluorescent signals were still detectable for
several months post AAV injection but gradually faded over time
(FIG. 3B, Inset panels). Based on noninvasive imaging, both the
focal as well as extracentral lesions within the AAV-BEST1-treated
regions resolved 4 to 12 wk p.i., and localized retinal
reattachments remained stable thereafter (Table 1). There was no
evidence of inflammatory responses in any of the AAV-treated eyes,
and the longitudinal in vivo evaluations did not reveal adverse
effects on the RPE or neural retina.
[0116] AAV-mediated treatment with the hBEST1 also resulted in
lesion reversal and long-term disease correction (n=13 eyes).
Representative in vivo imaging results and MC evaluations (FIGS. 3C
and 3D) from a cBest dog (R25*/R25*) showed that the early
bilateral lesions present before treatment disappeared after the
study eye (EMC3-OS) was treated with AAV-hBEST1 (2.times.10.sup.11
vg/mL) (FIG. 3D), while the lesion in the contralateral control eye
(EMC3-OD) injected with BSS continued to enlarge (FIG. 3C). Based
on funduscopic examination, in the illustrated example as well as
in all other cases the transient retinal detachment associated with
vector or BSS delivery resolved within 24 to 48 h p.i.; however,
the retinal lesions injected with BSS reappeared as early as 1 wk
p.i., and progressed along the natural disease course (FIG. 3C).
This was in sharp contrast to the AAV-treated eyes, where both the
early as well as more advanced lesions resolved within the first 6
wk after hBEST1 gene therapy, and the treated areas thereafter
remained disease-free (FIG. 3D). Ophthalmological examinations and
IHC assessments using RPE- and PR-specific markers showed no
adverse effects on the retina up to 207 wk p.i. (FIGS. 3, 10 and
11). Of particular importance, the assessments of the retinal
preservation p.i. revealed a remarkable restoration of retinal
architecture at the RPE-PR interface, including extension of
cone-MV and actin cytoskeleton rescue, corresponding to the
vector-treated bleb area with either the canine or human BEST1
transgenes (FIGS. 3C and 3D, Lower panel and FIGS. 10 and 11). No
differences in the clinical picture or response to the AAV-BEST1
treatment were observed between genders.
[0117] Retinas were preserved after AAV-hBEST1 treatment in three
cBest models [cmr1 (R25*/R25*), cmr1/cmr3 (R25*/P463fs), and cmr3
(P463fs/P463fs)] in comparison with the wild-type control and cBest
untreated eyes. cBest eyes were injected with AAV-hBEST1
(2.times.10.sup.11 vg/mL) at 27 wk (cmr1), 45 wk (cmr1/cmr3), or 63
wk (cmr3) of age, and evaluated by IHC at 103 wk, 51 wk, or 207 wk
p.i., respectively (FIG. 10). No apparent abnormalities within the
treated areas were detected up to 207 wk p.i. Note the RPE apical
extensions projecting into subretinal space in all treated eyes
(EZRIN). The untreated cBest control (Far Right panel) shows lack
of RPE apical microvilli, RPE hypertrophy (EZRIN, RPE65), and
accumulation of lipofuscin granules within the RPE monolayer along
with autofluorescent deposits in the subretinal space.
[0118] Representative confocal photomicrographs are shown in FIG.
11A depicting a cBest (R25*/P463fs) retina 79 weeks post AAV-hBEST1
injection (2.5.times.10.sup.11 vg/mL) and double-labeled with BEST1
(RPE, darker color) and SLC16A1 (RPE, lighter color). A
cross-sectional overview from the surgical bleb area (FIG. 11B),
through the adjacent penumbral region (FIG. 11C), and toward the
contiguous extent outside of the injection zone (FIG. 11D) is shown
in FIGS. 11B-11D. A direct correlation between the degree of
restoration of the RPE-PR interface structure and BEST1 transgene
expression was observed as highlighted in the magnified images. A
remarkable extension of RPE apical projections within the treated
region with augmented BEST1 was observed (FIG. 11B); presence of
vestigial microvilli [c-MV (lighter arrowheads) and rod-MV (darker
arrowheads)] in the bleb penumbra associated with patchy
distribution of BEST1 (weak red signals within individual RPE
cells) and RPE-PR microdetachment (FIG. 11C); formation of
subretinal lesions in the absence of both BEST1 expression and RPE
apical processes outside of the treatment zone (FIG. 11D).
Scalloped and unelaborated RPE apical surface and massive
intracellular deposits appeared as granular aggregates within cBest
mutant RPE (FIG. 11A, upper panel, Non-injected; FIG. 11D,
close-up). In the zone of detachment, cellular debris creeping into
subretinal space (asterisks) corresponds to the Muller glia, and
reflect retinal remodeling in response to stress. [Scale bars, 100
.mu.m (Upper) and 10 .mu.m (FIGS. 11A-11D).]
Correction of Light-Modulated Microdetachments with Gene
Therapy.
[0119] To understand the consequences of BEST1 gene augmentation
therapy on retinal regions without ophthalmoscopically detectable
retinal detachments, IS/OS-RPE/T distance was measured
topographically within and outside subretinal blebs, A
representative result with a control subretinal BSS injection at
age 69 wk in a cBest (R25*/P463fs) dog showed homogeneous
microdetachment covering all the imaged retina at age 87 wk (FIG.
4A). The average microdetachment extent (IS/OS-RPE/T distance of
the BSS-injected mutant dog subtracted from colocalized
measurements performed in WT eyes) was 11.6 .mu.m in the superior
retina and 16.7 .mu.m in the inferior retina (FIG. 4B), consistent
with uninjected cBest eyes. Subretinal AAV gene therapy, on the
other hand, resulted in substantial reduction of the IS/OS-RPE/T
distance in treated regions. EMC3-OS, EML4-OS, and LH21-OS
demonstrate results in three genotypes treated with gene therapy
using the human BEST1 transgene with titers of
.about.2.times.10.sup.11 vg/mL (FIG. 4A and Table 1). In each case,
there was significant reduction of the IS/OS-RPE/T distance in the
treated bleb. Notably, gross retinal detachments (darker color)
were only detectable outside the treatment region (FIG. 4A).
Quantitative measurements showed complete amelioration of the
microdetachments, with the IS/OS-RPE/T distance returning to WT
levels both in superior and inferior retinal regions treated with
subretinal gene therapy (FIG. 4B, filled symbols) but not in
retinal regions away from the treatment bleb (FIG. 4B, unfilled
symbols).
[0120] The region of efficacy with subretinal gene therapy is often
shown to extend beyond the bleb formed at the time of the surgery
to include a penumbral region. In cBest dogs with successful gene
therapy, there was also a penumbral region but it appeared to be
qualitatively larger than typically encountered previously (FIG.
4A). In some of the most extreme examples, pretreatment maps of
retina-wide microdetachment were found to be necessary to
demonstrate the extent of penumbral expansion. EML9-OD, for
example, at age 29 wk showed a retina-wide microdetachment that was
most extreme along the visual streak and included several regions
with gross retinal detachments (FIG. 4C). Gene therapy was
performed at 69 wk. At 87 wk, microdetachments across the whole
retina imaged as well as the majority of the gross retinal
detachments had disappeared (FIG. 4C), and quantitative measures
showed a normal or thinner IS/OS-RPE/T distance in superior and
inferior retinal locations (FIG. 4D). Importantly, IS/OS-RPE/T
distance showed substantial improvements at retinal locations
corresponding to the bleb formed at the time of the injection as
well as in nasal retinal control regions in the same eye. This
extreme example of penumbral expansion is likely explained by
greater diffusion of the vector via the microdetachment in cBest
eyes that resulted in the transduction of the RPE at sites
substantially more distant than the initial bleb. A more typical
example with a delimited penumbral expansion is illustrated for
comparison. EML13-OS at age 37 wk showed microdetachments
retina-wide that were especially prominent in the temporal retina
and along the visual streak; there were also several gross retinal
detachments along the visual streak (FIG. 4E). Gene therapy was
performed at 45 wk. At 81 wk of age, both superior and inferior
retina temporal to the optic nerve was lacking micro- and
macrodetachments, whereas the untreated nasal retina had retained
the microdetachments as well as formed a large number of
macrodetachments (FIG. 4E). Quantitative results confirmed the
treatment effect (FIG. 4F), which did not reach the nasal retina,
unlike EML9-OD.
[0121] To understand the potential consequences of gene therapy on
retinal degeneration, ONL thickness was mapped across treated eyes
(FIG. 8B). Treated retinal regions showing disappearance of
microdetachments tended to also correspond to normal ONL thickness,
whereas untreated regions retaining microdetachments tended to show
hyperthick or normal, or in some regions, thinned ONL (FIG. 8B). In
summary, AAV-mediated gene augmentation therapy in canine
bestrophinopathies appears to promote a sustained reversal of gross
retinal detachments, reestablishment of a close contact between RPE
and PRs, and return of ONL thickness to normal values.
Human Autosomal Recessive Bestrophinopathies: Structure and
Function.
[0122] To facilitate clinical translation of successful gene
therapy in BEST1-mutant dogs, studies were performed to better
understand the human pathophysiology of autosomal recessive
bestrophinopathies (ARBs) and to gain insight into the distribution
of retina-wide disease beyond the gross ophthalmoscopically
detectable lesions previously described. Data are shown (FIGS.
5A-5G) from two patients: P1 was a 39-y-old woman with a best
corrected visual acuity of 20/100 carrying biallelic BEST1
mutations (c.341T>C/c.400C>G), whereas P2 was a 36-y-old man
with 20/60 acuity also carrying biallelic mutations
(c.95T>C/c.102C>T) in BEST1. In both patients, mutant alleles
segregated with clinically unaffected parents. Ultrawide imaging of
RPE health taking advantage of the natural autofluorescence of
lipofuscin granules they contain showed widespread and extensive
abnormalities consisting of regions of relative hyper- or
hypoautofluorescence and local heterogeneity. Of note, there was a
distinct transition zone (FIG. 5A, arrowheads) in the nasal
midperipheral retina demarcating the healthier nasal peripheral
retina.
[0123] Rod and cone function was sampled at high density along the
horizontal meridian to better understand the topography of vision
loss and its correspondence to retinal structural abnormalities.
Both patients demonstrated a deep (>3 log) loss of rod-mediated
sensitivity centrally in long-term dark-adapted eyes; there was
relative preservation of rod function in the temporal field (nasal
retina) in both patients and the parapapillary area in one patient
(FIG. 5B, Upper panel). Surprisingly, cone-mediated function in
light-adapted eyes demonstrated only a moderate loss (<1 log) or
normal or near-normal results (FIG. 5B, Lower panel). Rod and cone
function sampled across the full extent of the visual field
corroborated and extended these findings and showed strong
interocular symmetry (FIGS. 12A and 12B). Rod (RSL) and cone
sensitivity loss (CSL) maps of both eyes of two patients with ARB.
Large and symmetric central areas of severe RSL were surrounded by
relatively retained function in the temporal field. Cone function
is relatively less affected and CSL is relatively uniform across
the visual fields. Physiological blind spot is shown as black
square at 12.degree. in the temporal field.
[0124] Cross-sectional imaging with OCT was performed to evaluate
the retinal lamination abnormalities along the horizontal meridian
crossing the fovea (FIG. 5C). There was not a consistent
light-exposure history at the time of OCT imaging. Both patients
showed a significant loss of ONL and abnormalities at the level of
photoreceptor IS/OS in the outer retina across most of the central
retina. P2, in addition, showed intraretinal cystic spaces and the
detachment of the central retina from the RPE, likely due to
accumulation of subretinal fluid. The retinal lamination showed
relative normalization in the parapapillary region (FIG. 5C,
dark-colored rectangles) and beyond the nasal midperipheral
transition (FIG. 5C, light-colored rectangles). Analyses of the two
regions of interest showed detectable but abnormally thinned ONL,
and detectable IS/OS and cone outer segment tip (COST) with low
peak signal in both patients (FIGS. 5D and 5E). In P1, the
distances from the ELM to IS/OS and IS/OS to COST were comparable
to normal. There appeared to be a hyposcattering layer distal to
COST, and the RPE appeared hyperthick (FIG. 5D, Middle panel). In
P2, ELM to IS/OS appeared shorter than normal, whereas
IS/OS-to-COST distance was comparable to normal. COST-to-ROST/RPE
distance appeared greater than normal with an intervening
indistinct hyposcattering layer; the RPE appeared to be comparable
in thickness to normal (FIG. 5D, Right panel). Analysis of the
outer retina in the nasal midperipheral region in P1 showed
ELM-to-IS/OS, IS/OS-to-COST, and COST-to-ROST/RPE distances greater
than normal and RPE thickness which was comparable to normal (FIG.
5E, Middle panel). P2 features appeared intermediate between P1 and
normal (FIG. 5E, Right panel).
[0125] To understand the implications of structural abnormalities
at the level of the outer retina and RPE for the kinetics of
retinoid transfer between these cellular layers, dark-adaptation
testing was performed. At the parapapillary location shown in FIG.
5D, dark-adapted thresholds of P1 were rod-mediated but 1.3 log
unit-elevated (FIG. 5F). By 22.5 min following a light exposure,
the P1 results had remained cone-mediated on a plateau whereas
normal was already within 1 log unit of the final dark-adapted
threshold. By 50 min, P1 rod results were still 1 log-elevated
whereas normal recovery was complete (FIG. 5F). At the
midperipheral nasal retinal location shown in FIG. 5E, dark-adapted
thresholds of P2 were rod-mediated and -0.5 log unit-elevated
compared with normal (FIG. 5G). By 14.5 min following a light
exposure, there was first evidence of rod function which was only
incrementally slower than the 11-min cone-rod break in normal. The
rate of rod recovery was similar to normal (FIG. 5G). In summary,
rod dark-adaptation kinetics of P1 at the parapapillary locus
showed an extremely slow time course, whereas dark-adaptation
kinetics of rod function of P2 at the midperipheral locus was
closer to normal (FIGS. 5F and 5G).
[0126] The RPE has a key role in maintaining the metabolically
active environment of the subretinal space. Due to the dynamic
relationship with adjacent retinal layers, mutations in
RPE-specific genes often adversely affect the neighboring sensory
neurons, leading to loss of visual function and PR degeneration.
Mutations in BEST1 are known to disrupt transepithelial ion and
fluid transport in response to abnormal levels of intracellular
calcium. Abnormal RPE calcium signaling is also thought to lead to
dysregulation of other pathways through altered expression and
interactions of Ca.sup.2+-sensitive proteins. Based on findings in
cBest, one such protein is EZRIN, a membrane-cytoskeleton linker
essential for the formation and proper maturation of RPE apical MV.
It has been demonstrated that the activation of EZRIN's
membrane-F-actin cross-linking function occurs directly in response
to Ca.sup.2+ transients, and Ezrin-KO mice exhibit a substantial
decrease in elaboration of RPE MV. The apparent underdevelopment of
RPE apical MV found in the BEST1-mutant RPE is consistent with
these findings. Furthermore, comparative IHC assessments with other
IRD models demonstrated that these major structural alterations
associated with microvillar ensheathment are specific to the
primary RPE channelopathy triggered by BEST1 mutations, and not
secondary to cone dysfunction and degeneration.
[0127] The structural components of RPE apical processes are very
different from those of nonmotile intestinal microvilli. The
presence of contractile proteins (such as myosin) in the RPE apical
microvilli, and also molecules typically found at the sites of cell
attachments, suggests that the RPE actively adheres to, and exerts
tension on, the neural retina. The dearth of a proper microvillar
ensheathment at the RPE-PR interface in cBest, and thus an absence
of physical and electrostatic support by these projections to the
PR OS, would be expected to weaken the adhesive forces and lead to
separation of the RPE-PR complex retina-wide. The microdetachment
of the PR layer from the underlying RPE found in cBest at the
earliest stages of disease would be consistent with this process.
Moreover, the presence of contractile elements in the RPE apical
projections and the fact that they have evolved from cells in which
pigment migration occurred indicate that MV are capable of active
contraction while interdigitating with PR OS, and are destined to
facilitate circadian phagocytic activity. A single RPE cell can
accommodate about 30 to 50 PRs, depending on the retinal location
and packing density; the elaborate network of microvilli allows
each RPE cell to handle such a high metabolic load on a daily
basis. Insights from proteomic profiling support this argument.
There is an enriched fraction of retinoid-processing proteins
expressed along the RPE apical MV, together with a number of
channel proteins and transporters (e.g., Na.sup.+/K.sup.+ ATPase)
central to the efficient transport of water, ions, and metabolites
between the RPE and PR OS. Considering the topographic differences
in the size of RPE cells and taking into account the density and
length of MV quantified in this study, MV extensions expand the
functional surface of a single RPE cell by 20- to 30-fold in the
central retina, which is consistent with earlier estimates. This
number is even higher (.about.50-fold) for the small RPE cells in
the macular region that adapted to a higher turnover rate of shed
POS while facing the most densely packed PRs. Such dramatic
reduction in a total apical surface area in BEST1-mutant RPE will
lead to a chronic delay in processing of metabolites, and arrest
the abilities of the RPE to maintain both the proper cell volume as
well as chemical composition and physiological pH levels in the
subretinal space. Since these factors are essential for retinal
adhesion, any limitation in the RPE transporting system will alter
the balance of hydrostatic forces and result in decreased
osmoelastic properties of the RPE-PR complex with subsequent
separation from the neuroretina. Indeed, the primary serous
detachment in human and canine bestrophinopathy is first evident in
the fovea, the central area of highest metabolic activity. The
absence of high-reaching RPE apical processes, which in the
structurally intact retina tightly wrap COS up to the ellipsoids,
would explain the predilection of this cone-rich structure for its
primary detachment in bestrophinopathies. There would be almost
exclusive reliance on the frictional interactions with the MV. This
is consistent with observations in cBest, documenting formation of
the focal previtelliform lesions within the canine fovea-like area
of the area centralis, and also the susceptibility of other central
cone-rich areas (like visual streak) to subretinal detachment.
[0128] The major expansion of microdetachments in cBest upon
exposure to dim and moderate light intensities was an unexpected
result. In normal eyes, light exposure is known to change molecular
composition of the subretinal space. There is also evidence that
measurable structural changes occur in the normal outer retina with
light exposure, such as changes in outer segment length, hydration
of the subretinal space, increased actin staining along RPE apical
MV, and phototropism of outer segments. However, all of the normal
changes are substantially smaller than those measured in cBest. For
example, normal human eyes showed changes of .about.1 .mu.m, and
normal mouse eyes showed changes of .about.4 .mu.m in the outer
retina, compared with .about.18-.mu.m expansion of the subretinal
space driven by light in cBest. Human ARB has only recently been
recognized and the literature on the earliest disease stages is
limited. The recessive cBest disease appears to have phenotypic
similarities to both dominant and recessive bestrophinopathies in
humans. In patients with Best disease (BVMD), there has been some
controversy regarding the structural features of retinal regions
surrounding vitelliform or later-stage lesions, or retinas in the
previtelliform stage of disease. Some studies have demonstrated
minor abnormalities at the level of the RPE-PR interface, whereas
results from others support no detectable structural defects.
Contributing to this controversy could be genotype, the resolution
of different methodological approaches used, or light history
preceding the imaging. Indeed, light-dependent outer retinal
changes have been described in BVMD using methods such as those
disclosed herein; still, the magnitude of the changes in patients
was smaller (.about.2 .mu.m) than in cBest. In general, however,
the abnormal response of the affected retina to light stimuli could
be related to the markedly reduced light peak/dark trough ratio in
the electrooculogram, a finding consistent in all, even
presymptomatic, Best Disease patients.
[0129] Of importance, both the micro- and macrodetachments in cBest
had adverse effects on photoreceptor health: Regions of
microdetachment tended to correspond to hyperthick ONL, whereas
large lesions with gross macrodetachment showed thinning of ONL.
Smaller lesions with macrodetachment could not be assessed with the
sampling methods used here. ONL contains the nuclei of all rods and
cones, and classic studies in animal models and human eye donors
have generally shown thinning of the ONL with disease progression.
Less well known are some of the earliest stages of retinal disease
showing ONL thickening, which has only become measurable with the
advancement of in vivo imaging methods. Human studies have
previously demonstrated such ONL thickening in early stages of
retinal diseases. There has also been evidence in animal studies of
ONL thickening associated with retinal stress. The hyperthick
regions of ONL mapped in cBest when examined microscopically showed
the number of PR nuclei to be comparable to control, suggesting a
greater internuclear spacing within the ONL, likely corresponding
to a level of retinal stress that is below the apoptosis threshold.
Gross retinal detachments, on the other hand, may cause greater
retinal stress and progressive degeneration.
[0130] To prevent the photoreceptor and vision loss associated with
BEST1 mutations, subretinal gene augmentation therapy directed to
retinal areas with macro- and microdetachments was performed.
Results showed that AAV-mediated BEST1 gene augmentation is safe,
reverses the clinically obvious lesions, ameliorates the diffuse
microdetachments, and results in normalization of hyperthick ONL.
Furthermore, gene therapy was successful in three distinct BEST1
genotypes with both focal and multifocal presentations, and
confirmed long-term durability of the treatment effect. At the
molecular level, the ability of the canine as well as the human
BEST1 transgene to correct the apposition of the RPE-PR complex and
restore the cytoarchitecture of this critical interface was
confirmed. This study suggests that early as well as more advanced
stages of autosomal recessive disease are sensible to approach with
this therapy. Further studies utilizing human inducible pluripotent
stem cell (hiPSC)-derived RPE models derived from patients
harboring autosomal Best1 mutations will determine whether the gene
augmentation approach would also be beneficial for BVMD
patients.
[0131] To facilitate the clinical translation of successful gene
augmentation therapy, ARB patients were studied to gain insight
into their retina-wide disease. Consistent with most, but not all,
previous descriptions, retinal disease in ARB patients extended
well beyond the macula into the midperiphery. Retinotopic mapping
of en face and cross-sectional imaging and rod and cone function
demonstrated the existence of a distinct transition from disease to
health in the midperipheral retina, a feature not previously
emphasized. Within the diseased region, severe abnormalities in
retinal structure were associated with severe loss of rod function;
unexpectedly, cone function was relatively retained. Rod
dysfunction within the central retina was also associated with
extreme slowing of the retinoid cycle, whereas the healthier
periphery showed near-normal recycling of the retinoids. There are
at least two retinoid cycles that provide the 11-cis-retinal
chromophore to photoreceptor pigments. The canonical retinoid cycle
functions in the RPE to produce chromophore for rod and cone PRs.
The retinal retinoid cycle, on the other hand, is thought to
regenerate chromophore within the retina for the specific use of
cones. The abnormal RPE-PR interface in Best disease would most
likely affect the chromophore delivery from the canonical RPE
retinoid cycle; the retinal retinoid cycle may be relatively
unaffected, thus explaining the greater retention of cone
function.
[0132] In summary, as disclosed herein, new molecular contributors
to the pathophysiology of bestrophinopathies at the RPE-PR
interface were surprisingly uncovered. The earliest expression of
disease was discovered--a diffuse microdetachment potentiated by
light exposure that was easily detectable by in vivo imaging.
AAV-mediated BEST1 augmentation gene therapy reversed both the
grossly obvious lesions and microdetachments, and restored the
cytoarchitecture of the RPE-PR interface. Evaluation of ARB
patients showed retinotopic distribution and properties of
structural and functional defects beyond that expected from PR
degeneration. Such visual dysfunction may be expected to improve
upon successful application of BEST1 gene augmentation therapy to
patients affected with bestrophinopathies.
Example 2
[0133] The vector technology of Example 2 was designed to suppress
the expression of endogenous BEST1 mRNA (both the mutated and the
normal copy) using RNA interference. These vectors simultaneously
replace the endogenous BEST1 mRNA with normal BEST1 mRNA to produce
only normal protein. The technology uses adeno-associated virus to
deliver an intronless copy of the BEST1 gene plus a gene for a
small hairpin RNA (shRNA) that leads to the production of a small
interfering RNA (siRNA). The BEST1 gene has been rendered resistant
to the siRNA because of silent mutations in its reading frame. Two
shRNAs, and therefore two modified human BEST1 genes, were
designed. Both BEST1 genes are driven by a 623 bp fragment of the
human VMD2 promoter. The BEST1 cDNA is preceded by a synthetic
intron and followed by a poly adenylation sequence, both derived
from the SV40 virus. In one case, shRNA05 is driven by the RNA
polymerase III (pol III) H1 promoter, and in the other, shRNA744 it
is driven by the pol III U6 promoter. A sequence of six thymidines,
serves as a termination sequence for each shRNA. To identify these
active shRNAs, nine potential siRNA or shRNA sequences were
screened.
[0134] The genetic sequences encoding the shRNAs are as
follows:
TABLE-US-00006 shRNA05 (SEQ ID NO: 1) CGUCAAAGCUUCACAGUGU UUCAAGAGA
ACACUGUGAAGCUUUGACG shRNA05 shRNA05 sense Loop anti-sense (SEQ ID
NO: 2) (SEQ ID NO: 7) (SEQ ID NO: 3) shRNA744 (SEQ ID NO: 4)
AAGAACUCGCCAUAUAGCAGC CUCGAG GCUGCUAUAUGGCGAGUUCUU shRNA744
antisense Loop shRNA744 sense (SEQ ID NO: 5) (SEQ ID NO: 8) (SEQ ID
NO: 6)
[0135] Maps of exemplary AAV vectors comprising heterologous
nucleic acids encoding shRNA05 and shRNA744 as well as a hBEST1
gene that includes a de-targeted sequence (e.g., one of SEQ ID NOs:
10 or 11), which are used to produce the disclosed rAAV particles,
are shown in FIGS. 15 and 16, respectively. Both sequences are
driven by a VMD2 promoter.
[0136] In some embodiments, disclosure provides an shRNA05 sense
strand that comprises a sense strand comprising the nucleotide
sequence of SEQ ID NO: 2, plus an additional nucleotide immediately
prior to the first cytosine of this sequence. In certain
embodiments, this additional nucleotide comprises a cytosine
(C).
[0137] In some embodiments, the disclosure provides an shRNA05 that
comprises an antisense strand comprising the nucleotide sequence of
SEQ ID NO: 3.
[0138] An exemplary genetic sequence corresponding to the region of
the vector encoding the pol III H1 promoter, shRNA05, and
termination sequence is as follows:
TABLE-US-00007 (SEQ ID NO: 20) TAAAACGACGGCCAGTGAATTCATATTTGCATGTC
GCTATGTGTTCTGGGAAATCACCATAAACGTGAAA
TGTCTTTGGATTTGGGAATCTTATAAGTTCTGTAT
GAGACCACTcggatccCGTCAAAGCTTCACAGTGT
TTCAAGAGAACACTGTGAAGCTTTGACGTTTTTT.
This sequence further includes a BamHI endonuclease site (ggatcc)
to facilitate screening and ensure that the start site of the
shRNA05 would be positioned 25 nucleotides downstream of the H1
promoter TATA box (TATAA). Accordingly, in some embodiments, an
shRNA (e.g., shRNA05) encoded by a nucleic acid comprising this
sequence (and/or the complement thereof) is transcribed in a host
cell (e.g., in a subject, for example in a human subject, treated
with the vector). In some embodiments, two or more different shRNAs
(e.g., having different start sites and/or termination sites, for
example differing from shRNA05 by one or two additional or fewer
nucleotides) are transcribed in a host cell.
[0139] FIG. 17 shows that the VMD2 promoter works well in cell
culture. HEK293T cells were transfected with plasmids expressing
GFP or Best1 using the Chicken beta actin promoter (CBA) or the
VMD2 promoter. Protein lysates were separated on polyacrylamide
gels and expression of bestrophin (Best1) was detected by Western
Blot and normalized to the expression of beta-tubulin to show even
loading of the gel. FIGS. 18A and 18B shows that Best1-specific
siRNA is functional. Transfection of HEK293T stably expressing
BEST1 led to a 75% reduction in Bestrophin (Best1) protein. 20 nM
siRNA was employed can cells were analyzed 48 hours after
transfection. Western blot (FIG. 18A), Knock-down of BEST1 was
compared by standardization of band intensity between Best1 and
Tubulin (Best1/Tubulin) (FIG. 18B). FIGS. 19A and 19B show Best1
shRNA is active: HEK293T-BEST1 cells were transfected with 4 .mu.g
of the indicated plasmid. Cells were harvested 48 hrs after
transfection. Expression of BEST1 was determined by Western Blot
(FIG. 19A). Knock-down of BEST1 was compared by standardization of
band intensity between Best1 and Tubulin (Best1/Tubulin) (FIG.
19B). FIG. 20 shows de-targeting of Best1. Silent mutations (base
changes in the third position of codons) were used to remove an
siRNA target site from Best1 mRNA. The example disclosed is for
shRNA744. SEQ ID NOs: 15-17 correspond to the sequences from top to
bottom.
Materials and Methods
Canine BEST1 Models and In Vivo Retinal Imaging.
[0140] cBest-mutant dogs (n=18) of both sexes (12 M and 6 F)
harboring either homozygous (c.73C>T) (p.R25*/R25*) or
(c.1388delC) (p.P463fs/P463fs) or biallelic (c.73C>T/1388delC)
(p.R25*/P463fs) mutations in cBEST1 (GB*NM 001097545) were
included. For ease of annotating the multipanel figures, the three
genotypes, respectively, are referred to as cmr1, cmr3, and
cmr1/cmr3. The study was conducted in comparison with control
cross-bred dogs (n=12; 7 M and 5 F) (Table 1). All animals were
bred and maintained at the Retinal Disease Studies Facility (RDSF).
The studies were carried out in strict accordance with the
recommendations in the Guide for the Care and Use of Laboratory
Animals of the NIH and in compliance with the Association for
Research in Vision and Ophthalmology Statement for the Use of
Animals in Ophthalmic and Vision Research. The protocols were
approved by the Institutional Animal Care and Use Committee of the
University of Pennsylvania (IACUC nos. 804956 and 803422). En face
and retinal cross-sectional imaging was performed with the dogs
under general anesthesia as previously described.
Human Subjects.
[0141] Light-adapted and two-color dark-adapted function was
measured at 2.degree. intervals across the central visual field
(central 60.degree. along horizontal and vertical meridians) and at
12.degree. intervals throughout the visual field. Photoreceptor
mediation under dark-adapted conditions was determined by the
sensitivity difference between 500- and 650-nm stimuli.
Dark-adaptation kinetics was evaluated similar to techniques
previously described (92-94) using an LED-based dark adaptometer
(Roland Consult) and a short-duration (30 s) moderate light
exposure from a clinical short-wavelength autofluorescence imaging
device (25% laser output; Spectralis HRA; Heidelberg Engineering).
Optical coherence tomography (OCT) was used to analyze laminar
architecture across the retina. Retinal cross-sections were
recorded with a spectral-domain (SD) OCT system (RTVue-100;
Optovue). Postacquisition data analysis was performed with custom
programs (MATLAB 7.5; MathWorks). Recording and analysis techniques
have been previously described (30, 31, 94). Longitudinal
reflectivity profiles (LRPs) were used to identify retinal
features. A confocal scanning laser ophthalmoscope (Spectralis HRA;
Heidelberg Engineering) was used to record en face images and
estimate RPE health with short-wavelength reduced-illuminance
autofluorescence imaging (SW-RAFI) as previously described (95).
All images were acquired with the high-speed mode
(30.degree..times.30.degree. square field or 50.degree. circular
field).
Canine BEST1 Models and in Vivo Retinal Imaging.
[0142] Overlapping en face images of reflectivity with
near-infrared illumination (820 nm) were obtained (Spectralis
HRA+OCT) with 30.degree.- and 55.degree.-diameter lenses to
delineate fundus features such as the optic nerve, retinal blood
vessels, boundaries of injection blebs, retinotomy sites, and other
local changes. Custom programs (MATLAB 7.5; MathWorks) were used to
digitally stitch individual photos into a retina-wide panorama.
Short-wavelength autofluorescence and reflectance imaging was used
to outline the boundary of the tapetum and pigmented RPE.
Spectraldomain optical coherence tomography (SD-OCT) was performed
with overlapping (30.degree..times.25.degree.) raster scans across
large regions of the retina. Postacquisition processing of OCT data
was performed with custom programs (MATLAB 7.5). For retina-wide
topographic analysis, integrated backscatter intensity of each
raster scan was used to position its precise location and
orientation relative to the retinal features visible on the
retinawide mosaic formed by near-infrared reflectance (NIR) images.
Individual LRPs forming all registered raster scans were allotted
to regularly spaced bins (1.degree..times.1.degree.) in a
rectangular coordinate system centered at the optic nerve; LRPs in
each bin were aligned and averaged. Intraretinal peaks and
boundaries corresponding to the OPL, ELM, IS/OS, and RPE/T were
segmented using both intensity and slope information of backscatter
signal along each LRP. Topographic maps of ONL thickness were
generated from the OPL-to-ELM distance, and maps of IS/OSto-RPE/T
thickness were generated from the distance between these peaks. For
all topographic results, locations of blood vessels, optic nerve
head, bleb, tapetum boundaries, and fovea-like area (24) were
overlaid for reference. First, maps from WT dogs were registered by
the centers of the optic nerve head and rotated to bring the
fovea-like areas in congruence, and a map of mean WT topography was
derived. The fovea-like area of cBest mutant dogs was determined by
superimposing a WT template onto mutant eyes by alignment of the
optic nerve head, major superior blood vessels, and boundary of the
tapetum. Next, cBEST1-mutant maps were registered to the WT map by
the center of the optic nerve and estimated fovea-like area, and
difference maps were derived. Difference maps were sampled within
and outside treatment blebs for each eye. The relation between
exposure to light and changes to outer retinal structure was
evaluated by two approaches. In a subset of eyes, cross-sectional
OCT imaging was performed early in each experimental session
followed initially by autofluorescence imaging with a bright
short-wavelength light followed subsequently by further OCT
imaging. OCT records obtained early in such sessions were
considered to be from retinas exposed to less light compared with
records obtained late, although the exact light exposure could not
be quantified. In another subset of eight eyes, OCT recordings were
performed after overnight dark adaptation, and serially in a dark
room following short intervals of short-wavelength light exposure
from a cSLO. In three of the eyes, five increasingly greater light
exposures were used: L1: laser, 20%; duration, 60 s; L2: laser,
25%; duration, 30 s; L3: laser, 50%; duration, 30 s; L4: laser,
100%; duration, 30 s; L5: laser, 100%; duration, 300 s. In three
eyes, only L4 and L5 were used. In two additional eyes, only L5 was
used to follow the recovery of light-mediated microdetachment over
a 24-h period. The standard (100%) laser setting is estimated to
correspond to a human retinal irradiance of 330 .mu.Wcm-2 at 488-nm
wavelength (98). In both approaches, the areas selected for
analysis were based on near-infrared imaging of the fundus with the
cSLO before the start of the study, and excluded areas where overt
clinically visible macrodetachments were located.
Subretinal Injections and Postoperative Procedures.
[0143] Subretinal injections of recombinant AAV2/2 delivering
either the cBEST1 or hBEST1 transgene under control of the human
VMD2 promoter (46) were performed under general anesthesia
following previously published procedures (46, 82, 97). Vector
production and validation have been detailed previously (46).
Injection volumes ranging from 50 to 180 .mu.L of the viral vector
solution (titer range of 0.1 to 5.times.10.sup.11 vg/mL) (Table 1)
were delivered subretinally using a custom-modified RetinaJect
subretinal injector (SurModics) (97) under direct visualization
with an operating microscope via a transvitreal approach without
vitrectomy. An anterior chamber paracentesis was performed
immediately after injection to prevent increase in intraocular
pressure. Directly after injection, formation of a subretinal bleb
was documented by fundus photography (RetCam Shuttle; Clarity
Medical Systems). In all cases, the surgical bleb flattened and the
retina reattached within 24 to 48 h p.i. Ophthalmic examinations,
including biomicroscopy, indirect ophthalmoscopy, and fundus
photography, were conducted on a regular basis (24 h, 48 h, and 5 d
p.i., and then weekly for the first 2 mo followed by a monthly eye
examination thereafter) throughout the injection-end point
evaluation time interval. Postoperative management was performed as
described previously (46).
Histological and Immunohistochemical Evaluations.
[0144] Ocular tissues for ex vivo analyses were collected as
previously described (24, 99). All efforts were made to improve
animal welfare and minimize discomfort. For all ex vivo
assessments, cBest and control (WT) eyes were fixed in 4%
paraformaldehyde, embedded in optimal cutting temperature media,
and processed as reported previously (99). Histological assessments
were made using standard hematoxylin/eosin (H&E) staining, and
all immunohistochemical experiments were performed on
10-.mu.m-thick cryosections following established protocols (46,
99). Briefly, retinal cryosections were permeabilized with
1.times.PBS/0.25% Triton X-100, blocked for 1 h at room
temperature, and incubated overnight with a primary antibody (Table
2). For multicolor labeling, primary antibodies were combined with
Alexa Fluor 488 phalloidin (Thermo Fisher Scientific) or PNA-AF647
(L32460; Molecular Probes), followed by incubation with a
corresponding secondary antibody (Alexa Fluor) for 1 h. The slides
were examined by epifluorescence or transmitted light microscopy
(Axioplan; Carl Zeiss Meditec), and digital images were collected
with a Spot 4.0 camera (Diagnostic Instruments).
TABLE-US-00008 TABLE 2 List of primary antibodies used for
immunohistochemical assessments. Antibody Dilution Source Mouse
monoclonal anti-BEST1 1:400 Ab2182; Abcam Mouse monoclonal
anti-EZRIN 1:400 Ab4069; Abcam Mouse monoclonal anti-RPE65 1:500
NB100-355; Novus Biologicals Mouse monoclonal anti-BEST1 .sup.
1:1,000 MAB5316; Millipore Rabbit polyclonal anti-hCAR 1:10,000
Courtesy of C. M. Craft, University of Southern California, Los
Angeles Rabbit polyclonal anti- 1:100 AB5405; Millipore RED/GREEN
OPSIN Rabbit polyclonal anti- .sup. 1:5,000 AB5407; Millipore BLUE
OPSIN Rabbit polyclonal anti- 1:500 Courtesy of N. J. SLC16A1
Philp, Thomas Jefferson University, Philadelphia Chicken polyclonal
anti- 1:500 Michigan State CNGB3 University
Confocal Microscopy and Image Analysis.
[0145] Confocal images were acquired on a TCS-SP5 confocal
microscope system (Leica Microsystems) or an A1R laser scanning
confocal microscope (Nikon Instruments). To obtain counts of
cone-associated MV (cone-MV), two adjacent fields, each region of
interest (ROI) 155 .mu.m long, were imaged 4 mm from the optic
nerve head in 10 retinal sections per retinal quadrant (temporal,
superior, inferior, and nasal) (n=80 ROIs per eye) in both eyes
from 6-wkold cBest (R25*/P463fs) and an age-matched WT control.
Image stacks were acquired at 0.25-.mu.m Z-steps and deconvolved
with Huygens deconvolution software version 17.04 (Scientific
Volume Imaging). All deconvolved images were rendered in the Leica
LAS X 3D rendering module, where the cone-MV were counted manually.
The length of both cone- and rod-MV was assessed within the Leica
LAS X software from maximum projection images. Data were analyzed
in Microsoft Excel and quantified using Prism software version 7
(GraphPad).
REFERENCES
[0146] 1. Bramall A N, Wright A F, Jacobson S G, McInnes R R (2010)
The genomic, biochemical, and cellular responses of the retina in
inherited photoreceptor degenerations and prospects for the
treatment of these disorders. Annu Rev Neurosci 33:441-472. [0147]
2. Veleri S, et al. (2015) Biology and therapy of inherited retinal
degenerative disease: Insights from mouse models. Dis Model Mech
8:109-129. [0148] 3. Cideciyan A V (2010) Leber congenital
amaurosis due to RPE65 mutations and its treatment with gene
therapy. Prog Retin Eye Res 29:398-427. [0149] 4. Ghazi N G, et al.
(2016) Treatment of retinitis pigmentosa due to MERTK mutations by
ocular subretinal injection of adeno-associated virus gene vector:
Results of a phase I trial. Hum Genet 135:327-343. [0150] 5.
Russell S, et al. (2017) Efficacy and safety of voretigene
neparvovec (AAV2-hRPE65v2) in patients with RPE65-mediated
inherited retinal dystrophy: A randomised, controlled, open-label,
phase 3 trial. Lancet 390:849-860. [0151] 6. Best F (1905) Uber
eine hereditare Maculaaffektion. Z Augenheilkd 13:199-212. [0152]
7. Petrukhin K, et al. (1998) Identification of the gene
responsible for Best macular dystrophy. Nat Genet 19:241-247.
[0153] 8. Boon C J, et al. (2009) The spectrum of ocular phenotypes
caused by mutations in the BEST1 gene. Prog Retin Eye Res
28:187-205. [0154] 9. Marmorstein A D, et al. (2000) Bestrophin,
the product of the Best vitelliform macular dystrophy gene (VMD2),
localizes to the basolateral plasma membrane of the retinal pigment
epithelium. Proc Natl Acad Sci USA 97:12758-12763. [0155] 10. Sun
H, Tsunenari T, Yau K W, Nathans J (2002) The vitelliform macular
dystrophy protein defines a new family of chloride channels. Proc
Natl Acad Sci USA 99: 4008-4013. [0156] 11. Neussert R, Muller C,
Milenkovic V M, Strauss O (2010) The presence of bestrophin1
modulates the Ca2+ recruitment from Ca2+ stores in the ER. Pflugers
Arch 460: 163-175. [0157] 12. Hartzell H C, Qu Z, Yu K, Xiao Q,
Chien L T (2008) Molecular physiology of bestrophins:
Multifunctional membrane proteins linked to Best disease and other
retinopathies. Physiol Rev 88:639-672. [0158] 13. Strau O, Muller
C, Reichhart N, Tamm E R, Gomez N M (2014) The role of bestrophin1
in intracellular Ca(2+) signaling. Adv Exp Med Biol 801:113-119.
[0159] 14. Fischmeister R, Hartzell H C (2005) Volume sensitivity
of the bestrophin family of chloride channels. J Physiol
562:477-491. [0160] 15. Milenkovic A, et al. (2015) Bestrophin 1 is
indispensable for volume regulation in human retinal pigment
epithelium cells. Proc Natl Acad Sci USA 112:E2630-E2639. [0161]
16. Mullins R F, Kuehn M H, Faidley E A, Syed N A, Stone E M (2007)
Differential macular and peripheral expression of bestrophin in
human eyes and its implication for Best disease. Invest Ophthalmol
Vis Sci 48:3372-3380. [0162] 17. Guziewicz K E, et al. (2017)
Bestrophinopathy: An RPE-photoreceptor interface disease. Prog
Retin Eye Res 58:70-88. [0163] 18. Kane Dickson V, Pedi L, Long S B
(2014) Structure and insights into the function of a
Ca(2+)-activated Cl(-) channel. Nature 516:213-218. [0164] 19. Yang
T, et al. (2014) Structure and selectivity in bestrophin ion
channels. Science 346: 355-359. [0165] 20. Vaisey G, Miller A N,
Long S B (2016) Distinct regions that control ion selectivity and
calcium-dependent activation in the bestrophin ion channel. Proc
Natl Acad Sci USA 113:E7399-E7408. [0166] 21. Deutman A F (1969)
Electro-oculography in families with vitelliform dystrophy of the
fovea. Detection of the carrier state. Arch Ophthalmol 81:305-316.
[0167] 22. Arden G B, Constable P A (2006) The electro-oculogram.
Prog Retin Eye Res 25: 207-248. [0168] 23. Guziewicz K E, et al.
(2007) Bestrophin gene mutations cause canine multifocal
retinopathy: A novel animal model for best disease. Invest
Ophthalmol Vis Sci 48: 1959-1967. [0169] 24. Beltran W A, et al.
(2014) Canine retina has a primate fovea-like bouquet of cone
photoreceptors which is affected by inherited macular
degenerations. PLoS One 9: e90390. [0170] 25. Hageman G S, Johnson
L V (1991) The photoreceptor-retinal pigment epithelium interface.
Principles and Practise of Clinical Electrophysiology of Vision,
eds Heckenlively J R, Arden G B (Mosby-Year Book, St. Louis), pp
53-68. [0171] 26. Strauss O (2005) The retinal pigment epithelium
in visual function. Physiol Rev 85: 845-881. [0172] 27. Huang B,
Karwoski C J (1992) Light-evoked expansion of subretinal space
volume in the retina of the frog. J Neurosci 12:4243-4252. [0173]
28. Putting B J, Zweypfenning R C, Vrensen G F, Oosterhuis J A, van
Best J A (1992) Bloodretinal barrier dysfunction at the pigment
epithelium induced by blue light. Invest Ophthalmol Vis Sci
33:3385-3393. [0174] 29. Li J D, Govardovskii V I, Steinberg R H
(1994) Light-dependent hydration of the space surrounding
photoreceptors in the cat retina. Vis Neurosci 11:743-752. [0175]
30. Huang Y, et al. (1998) Relation of optical coherence tomography
to microanatomy in normal and rd chickens. Invest Ophthalmol Vis
Sci 39:2405-2416. [0176] 31. Pianta M J, et al. (2003) In vivo
micropathology of Best macular dystrophy with optical coherence
tomography. Exp Eye Res 76:203-211. [0177] 32. Cideciyan A V, et
al. (2005) In vivo dynamics of retinal injury and repair in the
rhodopsin mutant dog model of human retinitis pigmentosa. Proc Natl
Acad Sci USA 102: 5233-5238. [0178] 33. Bizheva K, et al. (2006)
Optophysiology: Depth-resolved probing of retinal physiology with
functional ultrahigh-resolution optical coherence tomography. Proc
Natl Acad Sci USA 103:5066-5071. [0179] 34. Kay C N, et al. (2012)
Three-dimensional distribution of the vitelliform lesion,
photoreceptors, and retinal pigment epithelium in the macula of
patients with best vitelliform macular dystrophy. Arch Ophthalmol
130:357-364. [0180] 35. Bissig D, Berkowitz B A (2012)
Light-dependent changes in outer retinal water diffusion in rats in
vivo. Mol Vis 18:2561. [0181] 36. Abramoff M D, et al. (2013) Human
photoreceptor outer segments shorten during light adaptation.
Invest Ophthalmol Vis Sci 54:3721-3728. [0182] 37. Li Y, Fariss R
N, Qian J W, Cohen E D, Qian H (2016) Light-induced thickening of
photoreceptor outer segment layer detected by ultra-high resolution
OCT imaging. Invest Ophthalmol Vis Sci 57:OCT105-OCT111. [0183] 38.
Lu Y, Wang B, Pepperberg D R, Yao X (2016) Stimulus-evoked outer
segment changes occur before the hyperpolarization of retinal
photoreceptors. Biomed Opt Express 8: 38-47. [0184] 39. Zhang P, et
al. (2017) In vivo optophysiology reveals that G-protein activation
triggers osmotic swelling and increased light scattering of rod
photoreceptors. Proc Natl Acad Sci USA 114:E2937-E2946. [0185] 40.
Lu C D, et al. (2017) Photoreceptor layer thickness changes during
dark adaptation observed with ultrahigh-resolution optical
coherence tomography. Invest Ophthalmol Vis Sci 58:4632-4643.
[0186] 41. Steinberg R H (1985) Interactions between the retinal
pigment epithelium and the neural retina. Doc Ophthalmol
60:327-346. [0187] 42. Mieziewska K (1996) The interphotoreceptor
matrix, a space in sight. Microsc Res Tech 35:463-471. [0188] 43.
Sidjanin D J, et al. (2002) Canine CNGB3 mutations establish cone
degeneration as orthologous to the human achromatopsia locus ACHM3.
Hum Mol Genet 11: 1823-1833. [0189] 44. Komaromy A M, et al. (2013)
Transient photoreceptor deconstruction by CNTF enhances
rAAV-mediated cone functional rescue in late stage
CNGB3-achromatopsia. Mol Ther 21:1131-1141. [0190] 45. Acland G M,
Aguirre G D (1987) Retinal degenerations in the dog: IV. Early
retinal degeneration (erd) in Norwegian elkhounds. Exp Eye Res
44:491-521. [0191] 46. Guziewicz K E, et al. (2013) Recombinant
AAV-mediated BEST1 transfer to the retinal pigment epithelium:
Analysis of serotype-dependent retinal effects. PLoS One 8: e75666.
[0192] 47. Bruewer A R, et al. (2013) Evaluation of lateral spread
of transgene expression following subretinal AAV-mediated gene
delivery in dogs. PLoS One 8:e60218. [0193] 48. Beltran W A, et al.
(2017) Optimization of retinal gene therapy for X-linked retinitis
pigmentosa due to RPGR mutations. Mol Ther 25:1866-1880. [0194] 49.
Sparrow J R, Hicks D, Hamel C P (2010) The retinal pigment
epithelium in health and disease. Curr Mol Med 10:802-823. [0195]
50. Jacobson S G, et al. (2008) Photoreceptor layer topography in
children with Leber congenital amaurosis caused by RPE65 mutations.
Invest Ophthalmol Vis Sci 49: 4573-4577. [0196] 51. Charbel Issa P,
et al. (2009) Characterisation of severe rod-cone dystrophy in a
consanguineous family with a splice site mutation in the MERTK
gene. Br J Ophthalmol 93:920-925. [0197] 52. Meunier I, et al.
(2016) A dominant mutation in MAPKAPK3, an actor of p38 signaling
pathway, causes a new retinal dystrophy involving Bruch's membrane
and retinal pigment epithelium. Hum Mol Genet 25:916-926. [0198]
53. Singh R, et al. (2013) iPS cell modeling of Best disease:
Insights into the pathophysiology of an inherited macular
degeneration. Hum Mol Genet 22:593-607. [0199] 54. Bonilha V L,
Finnemann S C, Rodriguez-Boulan E (1999) Ezrin promotes
morphogenesis of apical microvilli and basal infoldings in retinal
pigment epithelium. J Cell Biol 147: 1533-1548. [0200] 55.
Koltzscher M, Neumann C, Konig S, Gerke V (2003) Ca2+-dependent
binding and activation of dormant Ezrin by dimeric S100P. Mol Biol
Cell 14:2372-2384. [0201] 56. Bonilha V L, et al. (2006) The
retinal pigment epithelium apical microvilli and retinal function.
Adv Exp Med Biol 572:519-524. [0202] 57. Bonilha V L, Rayborn M E,
Saotome I, McClatchey A I, Hollyfield J G (2006) Microvilli defects
in retinas of ezrin knockout mice. Exp Eye Res 82:720-729. [0203]
58. Philp N J, Nachmias V T (1985) Components of the cytoskeleton
in the retinal pigmented epithelium of the chick. J Cell Biol
101:358-362. [0204] 59. Bonilha V L, et al. (2004) Proteomic
characterization of isolated retinal pigment epithelium microvilli.
Mol Cell Proteomics 3:1119-1127. [0205] 60. Gao H, Hollyfield J G
(1992) Aging of the human retina. Differential loss of neurons and
retinal pigment epithelial cells. Invest Ophthalmol Vis Sci
33:1-17. [0206] 61. Kiser P D, Golczak M, Palczewski K (2014)
Chemistry of the retinoid (visual) cycle. Chem Rev 114:194-232.
[0207] 62. Miller S S, Steinberg R H (1977) Passive ionic
properties of frog retinal pigment epithelium. J Membr Biol
36:337-372. [0208] 63. Volland S, Esteve-Rudd J, Hoo J, Yee C,
Williams D S (2015) A comparison of some organizational
characteristics of the mouse central retina and the human macula.
PLoS One 10:e0125631. [0209] 64. Cuenca N, Ortuno-Lizaran I,
Pinilla I (Oct. 13, 2017) Cellular characterization of optical
coherence tomography and outer retinal bands using specific
immunohistochemistry markers and clinical implications.
Ophthalmology, 10.1016/j.ophtha.2017.09.016. [0210] 65. Uehara F,
Matthes M T, Yasumura D, LaVail M M (1990) Light-evoked changes in
the interphotoreceptor matrix. Science 248:1633-1636. [0211] 66.
Jonnal R S, Kocaoglu O P, Wang Q, Lee S, Miller D T (2012)
Phase-sensitive imaging of the outer retina using optical coherence
tomography and adaptive optics. Biomed Opt Express 3:104-124.
[0212] 67. Hillmann D, et al. (2016) In vivo optical imaging of
physiological responses to photostimulation in human
photoreceptors. Proc Natl Acad Sci USA 113:13138-13143. [0213] 68.
Bialek S, Miller S S (1994) K+ and Cl- transport mechanisms in
bovine pigment epithelium that could modulate subretinal space
volume and composition. J Physiol 475: 401-417. [0214] 69. Lu R,
Levy A M, Zhang Q, Pittler S J, Yao X (2013) Dynamic near-infrared
imaging reveals transient phototropic change in retinal rod
photoreceptors. J Biomed Opt 18: 106013. [0215] 70. Querques G, et
al. (2011) The spectrum of subclinical Best vitelliform macular
dystrophy in subjects with mutations in BEST1 gene. Invest
Ophthalmol Vis Sci 52: 4678-4684. [0216] 71. Qian C X, et al.
(2017) Optical coherence tomography examination of the retinal
pigment epithelium in Best vitelliform macular dystrophy.
Ophthalmology 124: 456-463. [0217] 72. Kay D B, et al. (2013) Outer
retinal structure in best vitelliform macular dystrophy. JAMA
Ophthalmol 131:1207-1215. [0218] 73. Arora R, et al. (2016)
Unilateral BEST1-associated retinopathy. Am J Ophthalmol 169:
24-32. [0219] 74. Scoles D, et al. (2017) Photoreceptor inner
segment morphology in Best vitelliform macular dystrophy. Retina
37:741-748. [0220] 75. Abramoff M D, Mullins R F, Stone E M (2014)
Outer segment length in different Best disease genotypes. JAMA
Ophthalmol 132:1152-1153. [0221] 76. Faktorovich E G, Steinberg R
H, Yasumura D, Matthes M T, LaVail M M (1990) Photoreceptor
degeneration in inherited retinal dystrophy delayed by basic
fibroblast growth factor. Nature 347:83-86. [0222] 77. Milam A H,
Li Z Y, Fariss R N (1998) Histopathology of the human retina in
retinitis pigmentosa. Prog Retin Eye Res 17:175-205. [0223] 78.
Jacobson S G, et al. (2006) Remodeling of the human retina in
choroideremia: Rab escort protein 1 (REP-1) mutations. Invest
Ophthalmol Vis Sci 47:4113-4120. [0224] 79. Jacobson S G, Cideciyan
A V (2010) Treatment possibilities for retinitis pigmentosa. N Engl
J Med 363:1669-1671. [0225] 80. Cideciyan A V, et al. (2011) Cone
photoreceptors are the main targets for gene therapy of NPHP5
(IQCB1) or NPHP6 (CEP290) blindness: Generation of an all-cone
Nphp6 hypomorph mouse that mimics the human retinal ciliopathy. Hum
Mol Genet 20:1411-1423. [0226] 81. Sadigh S, et al. (2013) Abnormal
thickening as well as thinning of the photoreceptor layer in
intermediate age-related macular degeneration. Invest Ophthalmol
Vis Sci 54: 1603-1612. [0227] 82. Beltran W A, et al. (2015)
Successful arrest of photoreceptor and vision loss expands the
therapeutic window of retinal gene therapy to later stages of
disease. Proc Natl Acad Sci USA 112:E5844-E5853. [0228] 83. Johnson
A A, et al. (2017) Bestrophin 1 and retinal disease. Prog Retin Eye
Res 58: 45-69. [0229] 84. Schatz P, Klar J, Andreasson S, Ponjavic
V, Dahl N (2006) Variant phenotype of Best vitelliform macular
dystrophy associated with compound heterozygous mutations in VMD2.
Ophthalmic Genet 27:51-56. [0230] 85. Burgess R, et al. (2008)
Biallelic mutation of BEST1 causes a distinct retinopathy in
humans. Am J Hum Genet 82:19-31. [0231] 86. Kinnick T R, et al.
(2011) Autosomal recessive vitelliform macular dystrophy in a large
cohort of vitelliform macular dystrophy patients. Retina
31:581-595. [0232] 87. Bitner H, et al. (2011) A homozygous
frameshift mutation in BEST1 causes the classical form of Best
disease in an autosomal recessive mode. Invest Ophthalmol Vis Sci
52: 5332-5338. [0233] 88. Boon C J, et al. (2013) Autosomal
recessive bestrophinopathy: Differential diagnosis and treatment
options. Ophthalmology 120:809-820. [0234] 89. Lamb T D, Pugh E N,
Jr (2004) Dark adaptation and the retinoid cycle of vision. Prog
Retin Eye Res 23:307-380.
[0235] 90. Wang J S, Kefalov V J (2011) The cone-specific visual
cycle. Prog Retin Eye Res 30: 115-128. [0236] 91. Kaylor J J, et
al. (2013) Identification of DES1 as a vitamin A isomerase in
Muller glial cells of the retina. Nat Chem Biol 9:30-36. [0237] 92.
Cideciyan A V, Pugh E N, Jr, Lamb T D, Huang Y, Jacobson S G (1997)
Rod plateau during dark adaptation in Sorsby's fundus dystrophy and
vitamin A deficiency. Invest Ophthalmol Vis Sci 38:1786-1794.
[0238] 93. Cideciyan A V, et al. (2000) Rod and cone visual cycle
consequences of a null mutation in the 11-cis-retinol dehydrogenase
gene in man. Vis Neurosci 17:667-678. [0239] 94. Cideciyan A V, et
al. (2013) Human cone visual pigment deletions spare sufficient
photoreceptors to warrant gene therapy. Hum Gene Ther 24:993-1006.
[0240] 95. Cideciyan A V, et al. (2007) Reduced-illuminance
autofluorescence imaging in ABCA4-associated retinal degenerations.
J Opt Soc Am A Opt Image Sci Vis 24:1457-1467. [0241] 96. National
Research Council (2011) Guide for the Care and Use of Laboratory
Animals (Natl Acad Press, Washington, D.C.), 8th Ed. [0242] 97.
Komaromy A M, Varner S E, de Juan E, Acland G M, Aguirre G D (2006)
Application of a new subretinal injection device in the dog. Cell
Transplant 15:511-519. [0243] 98. Delori F, et al. (2011)
Quantitative measurements of autofluorescence with the scanning
laser ophthalmoscope. Invest Ophthalmol Vis Sci 52:9379-9390.
[0244] 99. Beltran W A, Hammond P, Acland G M, Aguirre G D (2006) A
frameshift mutation in RPGR exon ORF15 causes photoreceptor
degeneration and inner retina remodeling in a model of X-linked
retinitis pigmentosa. Invest Ophthalmol Vis Sci 47:1669-1681.
Other Embodiments
[0245] All of the features disclosed in this specification may be
combined in any combination. Each feature disclosed in this
specification may be replaced by an alternative feature serving the
same, equivalent, or similar purpose. Thus, unless expressly stated
otherwise, each feature disclosed is only an example of a generic
series of equivalent or similar features.
[0246] From the above description, one skilled in the art can
easily ascertain the essential characteristics of the present
disclosure, and without departing from the spirit and scope
thereof, can make various changes and modifications of the
disclosure to adapt it to various usages and conditions. Thus,
other embodiments are also within the claims.
EQUIVALENTS
[0247] While several inventive embodiments have been described and
illustrated herein, those of ordinary skill in the art will readily
envision a variety of other means and/or structures for performing
the function and/or obtaining the results and/or one or more of the
advantages described herein, and each of such variations and/or
modifications is deemed to be within the scope of the inventive
embodiments described herein. More generally, those skilled in the
art will readily appreciate that all parameters, dimensions,
materials, and configurations described herein are meant to be
exemplary and that the actual parameters, dimensions, materials,
and/or configurations will depend upon the specific application or
applications for which the inventive teachings is/are used. Those
skilled in the art will recognize, or be able to ascertain using no
more than routine experimentation, many equivalents to the specific
inventive embodiments described herein. It is, therefore, to be
understood that the foregoing embodiments are presented by way of
example only and that, within the scope of the appended claims and
equivalents thereto, inventive embodiments may be practiced
otherwise than as specifically described and claimed. Inventive
embodiments of the present disclosure are directed to each
individual feature, system, article, material, kit, and/or method
described herein. In addition, any combination of two or more such
features, systems, articles, materials, kits, and/or methods, if
such features, systems, articles, materials, kits, and/or methods
are not mutually inconsistent, is included within the inventive
scope of the present disclosure.
[0248] All definitions, as defined and used herein, should be
understood to control over dictionary definitions, definitions in
documents incorporated by reference, and/or ordinary meanings of
the defined terms.
[0249] All references, patents and patent applications disclosed
herein are incorporated by reference with respect to the subject
matter for which each is cited, which in some cases may encompass
the entirety of the document.
[0250] The indefinite articles "a" and "an," as used herein in the
specification and in the claims, unless clearly indicated to the
contrary, should be understood to mean "at least one."
[0251] The phrase "and/or," as used herein in the specification and
in the claims, should be understood to mean "either or both" of the
elements so conjoined, i.e., elements that are conjunctively
present in some cases and disjunctively present in other cases.
Multiple elements listed with "and/or" should be construed in the
same fashion, i.e., "one or more" of the elements so conjoined.
Other elements may optionally be present other than the elements
specifically identified by the "and/or" clause, whether related or
unrelated to those elements specifically identified. Thus, as a
non-limiting example, a reference to "A and/or B", when used in
conjunction with open-ended language such as "comprising" can
refer, in one embodiment, to A only (optionally including elements
other than B); in another embodiment, to B only (optionally
including elements other than A); in yet another embodiment, to
both A and B (optionally including other elements); etc.
[0252] As used herein in the specification and in the claims, "or"
should be understood to have the same meaning as "and/or" as
defined above. For example, when separating items in a list, "or"
or "and/or" shall be interpreted as being inclusive, i.e., the
inclusion of at least one, but also including more than one, of a
number or list of elements, and, optionally, additional unlisted
items. Only terms clearly indicated to the contrary, such as "only
one of" or "exactly one of," or, when used in the claims,
"consisting of," will refer to the inclusion of exactly one element
of a number or list of elements. In general, the term "or" as used
herein shall only be interpreted as indicating exclusive
alternatives (i.e., "one or the other but not both") when preceded
by terms of exclusivity, such as "either," "one of," "only one of,"
or "exactly one of." "Consisting essentially of," when used in the
claims, shall have its ordinary meaning as used in the field of
patent law.
[0253] As used herein in the specification and in the claims, the
phrase "at least one," in reference to a list of one or more
elements, should be understood to mean at least one element
selected from any one or more of the elements in the list of
elements, but not necessarily including at least one of each and
every element specifically listed within the list of elements and
not excluding any combinations of elements in the list of elements.
This definition also allows that elements may optionally be present
other than the elements specifically identified within the list of
elements to which the phrase "at least one" refers, whether related
or unrelated to those elements specifically identified. Thus, as a
non-limiting example, "at least one of A and B" (or, equivalently,
"at least one of A or B," or, equivalently "at least one of A
and/or B") can refer, in one embodiment, to at least one,
optionally including more than one, A, with no B present (and
optionally including elements other than B); in another embodiment,
to at least one, optionally including more than one, B, with no A
present (and optionally including elements other than A); in yet
another embodiment, to at least one, optionally including more than
one, A, and at least one, optionally including more than one, B
(and optionally including other elements); etc.
[0254] It should also be understood that, unless clearly indicated
to the contrary, in any methods claimed herein that include more
than one step or act, the order of the steps or acts of the method
is not necessarily limited to the order in which the steps or acts
of the method are recited.
[0255] In the claims, as well as in the specification above, all
transitional phrases such as "comprising," "including," "carrying,"
"having," "containing," "involving," "holding," "composed of," and
the like are to be understood to be open-ended, i.e., to mean
including but not limited to. Only the transitional phrases
"consisting of" and "consisting essentially of" shall be closed or
semi-closed transitional phrases, respectively, as set forth in the
United States Patent Office Manual of Patent Examining Procedures,
Section 2111.03. It should be appreciated that embodiments
described in this document using an open-ended transitional phrase
(e.g., "comprising") are also contemplated, in alternative
embodiments, as "consisting of" and "consisting essentially of" the
feature described by the open-ended transitional phrase. For
example, if the disclosure describes "a composition comprising A
and B", the disclosure also contemplates the alternative
embodiments "a composition consisting of A and B" and "a
composition consisting essentially of A and B".
Sequence CWU 1
1
20148RNAArtificial SequenceSynthetic Polynucleotide 1ccgucaaagc
uucacagugu uucaagagaa cacugugaag cuuugacg 48219RNAArtificial
SequenceSynthetic Polynucleotide 2cgucaaagcu ucacagugu
19319RNAArtificial SequenceSynthetic Polynucleotide 3acacugugaa
gcuuugacg 19448RNAArtificial SequenceSynthetic Polynucleotide
4aagaacucgc cauauagcag ccucgaggcu gcuauauggc gaguucuu
48521RNAArtificial SequenceSynthetic Polynucleotide 5aagaacucgc
cauauagcag c 21621RNAArtificial SequenceSynthetic Polynucleotide
6gcugcuauau ggcgaguucu u 2179RNAArtificial SequenceSynthetic
Polynucleotide 7uucaagaga 986RNAArtificial SequenceSynthetic
Polynucleotide 8cucgag 691758DNAHomo
sapiensmisc_feature(213)..(213)n is a, c, g, or
tmisc_feature(1410)..(1410)n is a, c, g, or t 9atgaccatca
cttacacaag ccaagtggct aatgcccgct taggctcctt ctcccgcctg 60ctgctgtgct
ggcggggcag catctacaag ctgctatatg gcgagttctt aatcttcctg
120ctctgctact acatcatccg ctttatttat aggctggccc tcacggaaga
acaacagctg 180atgtttgaga aactgactct gtattgcgac agntacatcc
agctcatccc catttccttc 240gtgctgggct tctacgtgac gctggtcgtg
acccgctggt ggaaccagta cgagaacctg 300ccgtggcccg accgcctcat
gagcctggtg tcgggcttcg tcgaaggcaa ggacgagcaa 360ggccggctgc
tgcggcgcac gctcatccgc tacgccaacc tgggcaacgt gctcatcctg
420cgcagcgtca gcaccgcagt ctacaagcgc ttccccagcg cccagcacct
ggtgcaagca 480ggctttatga ctccggcaga acacaagcag ttggagaaac
tgagcctacc acacaacatg 540ttctgggtgc cctgggtgtg gtttgccaac
ctgtcaatga aggcgtggct tggaggtcga 600atccgggacc ctatcctgct
ccagagcctg ctgaacgaga tgaacacctt gcgtactcag 660tgtggacacc
tgtatgccta cgactggatt agtatcccac tggtgtatac acaggtggtg
720actgtggcgg tgtacagctt cttcctgact tgtctagttg ggcggcagtt
tctgaaccca 780gccaaggcct accctggcca tgagctggac ctcgttgtgc
ccgtcttcac gttcctgcag 840ttcttcttct atgttggctg gctgaaggtg
gcagagcagc tcatcaaccc ctttggagag 900gatgatgatg attttgagac
caactggatt gtcgacagga atttgcaggt gtccctgttg 960gctgtggatg
agatgcacca ggacctgcct cggatggagc cggacatgta ctggaataag
1020cccgagccac agccccccta cacagctgct tccgcccagt tccgtcgagc
ctcctttatg 1080ggctccacct tcaacatcag cctgaacaaa gaggagatgg
agttccagcc caatcaggag 1140gacgaggagg atgctcacgc tggcatcatt
ggccgcttcc taggcctgca gtcccatgat 1200caccatcctc ccagggcaaa
ctcaaggacc aaactactgt ggcccaagag ggaatccctt 1260ctccacgagg
gcctgcccaa aaaccacaag gcagccaaac agaacgttag gggccaggaa
1320gacaacaagg cctggaagct taaggctgtg gacgccttca agtctgcccc
actgtatcag 1380aggccaggct actacagtgc cccacagacn cccctcagcc
ccactcccat gttcttcccc 1440ctagaaccat cagcgccgtc aaagcttcac
agtgtcacag gcatagacac caaagacaaa 1500agcttaaaga ctgtgagttc
tggggccaag aaaagttttg aattgctctc agagagcgat 1560ggggccttga
tggagcaccc agaagtatct caagtgagga ggaaaactgt ggagtttaac
1620ctgacggata tgccagagat ccccgaaaat cacctcaaag aacctttgga
acaatcacca 1680accaacatac acactacact caaagatcac atggatcctt
attgggcctt ggaaaacagg 1740gatgaagcac attcctaa 17581020DNAArtificial
SequenceSynthetic Polynucleotide 10ctactgtacg gagaatttct
201119DNAArtificial SequenceSynthetic Polynucleotide 11ccagcaagct
gcacagcgt 1912623DNAArtificial SequenceSynthetic Polynucleotide
12aattctgtca ttttactagg gtgatgaaat tcccaagcaa caccatcctt ttcagataag
60ggcactgagg ctgagagagg agctgaaacc tacccggcgt caccacacac aggtggcaag
120gctgggacca gaaaccagga ctgttgactg cagcccggta ttcattcttt
ccatagccca 180cagggctgtc aaagacccca gggcctagtc agaggctcct
ccttcctgga gagttcctgg 240cacagaagtt gaagctcagc acagccccct
aacccccaac tctctctgca aggcctcagg 300ggtcagaaca ctggtggagc
agatccttta gcctctggat tttagggcca tggtagaggg 360ggtgttgccc
taaattccag ccctggtctc agcccaacac cctccaagaa gaaattagag
420gggccatggc caggctgtgc tagccgttgc ttctgagcag attacaagaa
gggaccaaga 480caaggactcc tttgtggagg tcctggctta gggagtcaag
tgacggcggc tcagcactca 540cgtgggcagt gccagcctct aagagtgggc
aggggcactg gccacagagt cccagggagt 600cccaccagcc tagtcgccag acc
62313114DNAArtificial SequenceSynthetic Polynucleotide 13taaaacgacg
gccagtgaat tcatatttgc atgtcgctat gtgttctggg aaatcaccat 60aaacgtgaaa
tgtctttgga tttgggaatc ttataagttc tgtatgagac cact
11414241DNAArtificial SequenceSynthetic Polynucleotide 14gagggcctat
ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60ataattggaa
ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga
120aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat
ggactatcat 180atgcttaccg taacttgaaa gtatttcgat ttcttggctt
tatatatctt gtggaaagga 240c 2411524DNAHomo sapiens 15aagctgctat
atggcgagtt ctta 241621DNAArtificial SequenceSynthetic
Polynucleotide 16cgacgatata ccgctcaaga a 211724DNAArtificial
SequenceSynthetic Polynucleotide 17aagctgctgt acggcgagtt cctg
241848DNAArtificial SequenceSynthetic Polynucleotide 18ccgtcaaagc
ttcacagtgt ttcaagagaa cactgtgaag ctttgacg 481948DNAArtificial
SequenceSynthetic Polynucleotide 19gctgctatat ggcgagttct tctcgagaag
aactcgccat atagcagc 4820174DNAArtificial SequenceSynthetic
Polynucleotide 20taaaacgacg gccagtgaat tcatatttgc atgtcgctat
gtgttctggg aaatcaccat 60aaacgtgaaa tgtctttgga tttgggaatc ttataagttc
tgtatgagac cactcggatc 120ccgtcaaagc ttcacagtgt ttcaagagaa
cactgtgaag ctttgacgtt tttt 174
* * * * *