U.S. patent application number 17/149484 was filed with the patent office on 2022-01-27 for hepatitis b core protein modulators.
The applicant listed for this patent is Assembly Biosciences, Inc.. Invention is credited to Lee D. Arnold, Lynne Bannen, Mark G. Bures, Simon Nicolas Haydar, Leping Li, Hans Maag, William W. Turner.
Application Number | 20220023311 17/149484 |
Document ID | / |
Family ID | |
Filed Date | 2022-01-27 |
United States Patent
Application |
20220023311 |
Kind Code |
A1 |
Turner; William W. ; et
al. |
January 27, 2022 |
HEPATITIS B CORE PROTEIN MODULATORS
Abstract
The present disclosure provides, in part, compounds having
allosteric effector properties against Hepatitis B virus Cp. Also
provided herein are methods of treating viral infections, such as
hepatitis B, comprising administering to a patient in need thereof
a disclosed compound of formula: ##STR00001##
Inventors: |
Turner; William W.;
(Bloomington, IN) ; Arnold; Lee D.; (Bloomington,
IN) ; Li; Leping; (Carmel, IN) ; Bures; Mark
G.; (Carmel, IN) ; Haydar; Simon Nicolas;
(South San Francisco, CA) ; Maag; Hans; (Kleires
Wiesental, DE) ; Bannen; Lynne; (Carmel, IN) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Assembly Biosciences, Inc. |
South San Francisco |
CA |
US |
|
|
Appl. No.: |
17/149484 |
Filed: |
January 14, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16333788 |
Mar 15, 2019 |
10987360 |
|
|
PCT/US1207/051605 |
Sep 14, 2017 |
|
|
|
17149484 |
|
|
|
|
62395114 |
Sep 15, 2016 |
|
|
|
62395118 |
Sep 15, 2016 |
|
|
|
62395126 |
Sep 15, 2016 |
|
|
|
62395132 |
Sep 15, 2016 |
|
|
|
International
Class: |
A61K 31/554 20060101
A61K031/554; A61P 31/20 20060101 A61P031/20; A61K 31/426 20060101
A61K031/426; A61K 31/427 20060101 A61K031/427; A61K 31/454 20060101
A61K031/454; C07D 277/28 20060101 C07D277/28; C07D 281/14 20060101
C07D281/14; C07D 417/04 20060101 C07D417/04; C07D 513/04 20060101
C07D513/04; C07D 417/12 20060101 C07D417/12; C07D 487/04 20060101
C07D487/04 |
Claims
1. A compound ##STR00168## or a pharmaceutically acceptable salt
thereof.
2.-11. (canceled)
12. A pharmaceutically acceptable composition comprising a compound
of claim 1, or a pharmaceutically acceptable salt thereof, and a
pharmaceutically acceptable excipient.
13. A method of treating a hepatitis B infection in a patient in
need thereof, comprising administering an effective amount of a
compound of claim 1, or a pharmaceutically acceptable salt
thereof.
14. A method of treating a hepatitis B infection in a patient in
need thereof, comprising administering a first compound selected
from a compound of claim 1, or a pharmaceutically acceptable salt
thereof, and optionally administering one or more additional
compounds.
15. A method of treating a hepatitis B infection in a patient in
need thereof, comprising administering an amount of a compound of
claim 1, or a pharmaceutically acceptable salt thereof, and
administering another HBV capsid assembly promoter.
16. A method of treating a hepatitis B infection in a patient in
need thereof, comprising administering a first compound selected
from claim 1, or a pharmaceutically acceptable salt thereof, and
one or more other HBV agents each selected from the group
consisting of HBV capsid assembly promoters, HBF viral polymerase
interfering nucleosides, viral entry inhibitors, HBsAg secretion
inhibitors, disruptors of nucleocapsid formation, cccDNA formation
inhibitors, antiviral core protein mutant, HBc directed
transbodies, RNAi targeting HBV RNA, immunostimulants, TLR-7/9
agonists, cyclophilin inhibitors, HBV vaccines, SMAC mimetics,
epigenetic modulators, kinase inhibitors, and STING agonists.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of and priority to U.S.
Application Ser. No. 62/395,126 filed Sep. 15, 2016, U.S.
Application Ser. No. 62/395,114 filed Sep. 15, 2016, U.S.
Application Ser. No. 62/395,132 filed Sep. 15, 2016, and U.S.
Application Ser. No. 62/395,118 filed Sep. 15, 2016, each of which
is hereby incorporated by reference in its entirety.
BACKGROUND
[0002] Hepatitis B (HBV) causes viral Hepatitis that can further
lead to chronic liver disease and increase the risk of liver
cirrhosis and liver cancer (hepatocellular carcinoma). Worldwide,
about 2 billion people have been infected with HBV, around 360
million people are chronically infected, and every year HBV
infection causes more than one half million deaths (2009; WHO,
2009). HBV can be spread by body fluids: from mother to child, by
sex, and via blood products. Children born to HBV-positive mothers
may also be infected, unless vaccinated at birth.
[0003] The virus particle is composed of a lipid envelope studded
with surface protein (HBsAg) that surrounds the viral core. The
core is composed of a protein shell, or capsid, built of 120 core
protein (Cp) dimers, which in turn contains the relaxed circular
DNA (rcDNA) viral genome as well as viral and host proteins. In an
infected cell, the genome is found as a covalently closed circular
DNA (cccDNA) in the host cell nucleus. The cccDNA is the template
for viral RNAs and thus viral proteins. In the cytoplasm, Cp
assembles around a complex of full-length viral RNA (the so-called
pregenomic RNA or pgRNA and viral polymerase (P). After assembly, P
reverse transcribes the pgRNA to rcDNA within the confines of the
capsid to generate the DNA-filled viral core. For convenience, we
divide the assembly process at the point of capsid assembly and
pgRNA-packaging. Steps preceding this event are "upstream"; steps
following RNA-packaging are "downstream".
[0004] At present, chronic HBV is primarily treated with
nucleos(t)ide analogs (e.g. entecavir) that suppress the virus
while the patient remains on treatment but do not eliminate the
infection, even after many years of treatment. Once a patient
starts taking nucleotide analogs most must continue taking them or
risk the possibility of a life threatening immune response to viral
rebound. Further, nucleos(t)ide therapy may lead to the emergence
of antiviral drug resistance (Deres and Rubsamen-Waigmann, 1999;
Tennant et al., 1998; Zhang et al., 2003) and--in rare
patients--adverse events have been reported (Ayoub and Keeffe,
2011).
[0005] The only FDA approved alternative to nucleos(t)ide analogs
is treatment with interferon .alpha. or pegylated interferon
.alpha.. Unfortunately, the adverse event incidence and profile of
interferon .alpha. can result in poor tolerability, and many
patients are unable to complete therapy. Moreover, only a small
percentage of patients are considered appropriate for interferon
therapy, as only a small subset of patients are likely to have a
sustained clinical response to a course of interferon therapy. As a
result, interferon based therapies are used in only a small
percentage of all diagnosed patients who elect for treatment.
[0006] Thus, current HBV treatments can range from palliative to
watchful waiting. Nucleos(t)ide analogs suppress virus production,
treating the symptom, but leave the infection intact. Interferon
.alpha. has severe side effects and less tolerability among
patients and is successful as a finite treatment strategy in only a
small minority of patients. There is a clear on-going need for more
effective treatments for HBV infections.
SUMMARY
[0007] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00002##
[0008] wherein
[0009] R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9,
R.sup.10, R.sup.m, R.sup.m', R.sup.77, R.sup.78, R.sup.C, R.sup.Z,
L, and Y are defined herein. Also provided herein are
pharmaceutical compositions of these compounds and methods of
treating viral infections, such as hepatitis B, comprising
administering to a patient a disclosed compound.
[0010] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00003##
[0011] wherein
[0012] R.sup.1, R.sup.8, R.sup.9, R.sup.10, R.sup.m, R.sup.m',
R.sup.78, R.sup.79, R.sup.C, R.sup.Z, Z, and Y are defined herein.
Also provided herein are pharmaceutical compositions of these
compounds and methods of treating viral infections, such as
hepatitis B, comprising administering to a patient a disclosed
compound.
[0013] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00004##
[0014] wherein
[0015] R.sup.4, R.sup.5, R.sup.7, R.sup.8, R.sup.9, R.sup.10,
R.sup.m, R.sup.m', R.sup.78, R.sup.79, R.sup.C, R.sup.Z, and Y are
defined herein. Also provided herein are pharmaceutical
compositions of these compounds and methods of treating viral
infections, such as hepatitis B, comprising administering to a
patient a disclosed compound.
[0016] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00005##
[0017] wherein
R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9, R.sup.10,
R.sup.m, R.sup.m', R.sup.78, R.sup.79, R.sup.C, R.sup.Z, and Y are
defined herein. Also provided herein are pharmaceutical
compositions of these compounds and methods of treating viral
infections, such as hepatitis B, comprising administering to a
patient a disclosed compound.
[0018] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00006##
[0019] wherein
[0020] R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9,
R.sup.10, R.sup.m, R.sup.m', R.sup.58, R.sup.59, R.sup.78,
R.sup.79, R.sup.Z, and Y are defined herein. Also provided herein
are pharmaceutical compositions of these compounds and methods of
treating viral infections, such as hepatitis B, comprising
administering to a patient a disclosed compound.
[0021] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00007##
[0022] wherein
[0023] R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9,
R.sup.10, R.sup.m, R.sup.m', R.sup.78, R.sup.79, R.sup.80, R.sup.Z,
and Y are defined herein. Also provided herein are pharmaceutical
compositions of these compounds and methods of treating viral
infections, such as hepatitis B, comprising administering to a
patient a disclosed compound.
[0024] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00008##
[0025] wherein
[0026] R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9,
R.sup.10, R.sup.m, R.sup.m', R.sup.Z, A, B, and Y are defined
herein. Also provided herein are pharmaceutical compositions of
these compounds and methods of treating viral infections, such as
hepatitis B, comprising administering to a patient a disclosed
compound.
[0027] Provided herein are compounds that can have properties such
as those described below, where the compounds in some embodiments
may be represented by:
##STR00009##
[0028] wherein
[0029] R.sup.1, R.sup.2, R.sup.2b, R.sup.3, R.sup.8, R.sup.9,
R.sup.10, R.sup.m, R.sup.m', R.sup.78, R.sup.79, R.sup.Z and p are
defined herein. Also provided herein are pharmaceutical
compositions of these compounds and methods of treating viral
infections, such as hepatitis B, comprising administering to a
patient a disclosed compound.
[0030] For example, the present disclosure is directed in part to
compounds having allosteric effector properties against Hepatitis B
virus Cp, a protein found as a dimer, a multimer, and as the
protein shell of the HBV core. Without being bound by theory,
disclosed compounds may ultimately target multimerization of viral
core proteins, which is central to HBV infection, where the core
protein multimerizes into shell, or capsid, and/or disclosed
compounds may for example, ultimately target interaction of viral
core proteins with other macromolecules, such as host or viral
nucleic acid, host proteins, or other viral proteins. For example,
disclosed compounds may be considered in some embodiments
CpAM--core protein allosteric modifiers. CpAM interaction with core
protein can allosterically favor an assembly-active form of Cp
dimer and lead to viral capsid assembly at an inappropriate time or
place or lead to non-standard intersubunit interactions, all
resulting in defective capsids. CpAMs may additionally or
alternatively affect steps of "upstream" of capsid assembly by
altering the concentrations or nature of Cp available as dimer as
compared to capsid or other multimeric forms. Disclosed compounds
or CpAMs may, in some embodiments, noticeably affect functions
upstream of viral assembly such as modulation of cccDNA
transcription, RNA stability and/or protein-protein
interactions.
DETAILED DESCRIPTION
[0031] The features and other details of the disclosure will now be
more particularly described. Before further description of the
present invention, certain terms employed in the specification,
examples and appended claims are collected here. These definitions
should be read in light of the remainder of the disclosure and as
understood by a person of skill in the art. Unless defined
otherwise, all technical and scientific terms used herein have the
same meaning as commonly understood by a person of ordinary skill
in the art.
Definitions
[0032] As intended herein, the terms "a" and "an" include singular
as well as plural references unless the context clearly dictates
otherwise. For example, the term "an assembly effector" can include
one or more such effectors.
[0033] The term "alkyl" as used herein refers to a saturated
straight or branched hydrocarbon. Exemplary alkyl groups include,
but are not limited to, straight or branched hydrocarbons of 1-6,
1-4, or 1-3 carbon atoms, referred to herein as C.sub.1-6alkyl,
C.sub.1-4alkyl, and C.sub.1-3alkyl, respectively. Exemplary alkyl
groups include, but are not limited to, methyl, ethyl, propyl,
isopropyl, 2-methyl-1-butyl, 3-methyl-2-butyl, 2-methyl-1-pentyl,
3-methyl-1-pentyl, 4-methyl-1-pentyl, 2-methyl-2-pentyl,
3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-1-butyl,
3,3-dimethyl-1-butyl, 2-ethyl-1-butyl, butyl, isobutyl, t-butyl,
pentyl, isopentyl, neopentyl, and hexyl.
[0034] The term "alkenyl" as used herein refers to an unsaturated
straight or branched hydrocarbon having at least one carbon-carbon
double bond. Exemplary alkenyl groups include, but are not limited
to, a straight or branched group of 2-6 or 3-4 carbon atoms,
referred to herein as C.sub.2-6alkenyl, and C.sub.3-4alkenyl,
respectively. Exemplary alkenyl groups include, but are not limited
to, vinyl, allyl, butenyl, and pentenyl.
[0035] The term "alkoxy" as used herein refers to a straight or
branched alkyl group attached to oxygen (alkyl-O--). Exemplary
alkoxy groups include, but are not limited to, alkoxy groups of 1-6
or 2-6 carbon atoms, referred to herein as C.sub.1-6alkoxy, and
C.sub.2-6alkoxy, respectively. Exemplary alkoxy groups include, but
are not limited to methoxy, ethoxy, and isopropoxy.
[0036] The term "alkynyl" as used herein refers to an unsaturated
straight or branched hydrocarbon having at least one carbon-carbon
triple bond. Exemplary alkynyl groups include, but are not limited
to, straight or branched groups of 2-6, or 3-6 carbon atoms,
referred to herein as C.sub.2-6alkynyl, and C.sub.3-6alkynyl,
respectively. Exemplary alkynyl groups include, but are not limited
to, ethynyl, propynyl, butynyl, pentynyl, hexynyl, and
methylpropynyl.
[0037] The terms "cycloalkyl" or a "carbocyclic group" as used
herein refers to a saturated or partially unsaturated hydrocarbon
group of, for example, 3-6, or 4-6 carbons, referred to herein as
C.sub.3-6cycloalkyl or C.sub.4-6cycloalkyl, respectively. Exemplary
cycloalkyl groups include, but are not limited to, cyclohexyl,
cyclopentyl, cyclopentenyl, cyclobutyl or cyclopropyl.
[0038] The terms "halo" or "halogen" as used herein refer to F, Cl,
Br, or I.
[0039] The terms "heteroaryl" or "heteroaromatic group" as used
herein refers to a monocyclic aromatic 5-6 membered ring system
containing one or more heteroatoms, for example one to three
heteroatoms, such as nitrogen, oxygen, and sulfur. Where possible,
said heteroaryl ring may be linked to the adjacent radical though
carbon or nitrogen. Examples of heteroaryl rings include but are
not limited to furan, thiophene, pyrrole, thiazole, oxazole,
isothiazole, isoxazole, imidazole, pyrazole, triazole, pyridine or
pyrimidine.
[0040] The terms "heterocyclyl" or "heterocyclic group" are
art-recognized and refer to saturated or partially unsaturated 4-7
membered ring structures, whose ring structures include one to
three heteroatoms, such as nitrogen, oxygen, and sulfur. Where
possible, heterocyclyl rings may be linked to the adjacent radical
through carbon or nitrogen. Examples of heterocyclyl groups
include, but are not limited to, pyrrolidine, piperidine,
morpholine, thiomorpholine, piperazine, oxetane, azetidine,
tetrahydrofuran or dihydrofuran.
[0041] The terms "hydroxy" and "hydroxyl" as used herein refers to
the radical --OH.
[0042] "Treatment" as used herein includes the alleviation,
prevention, reversal, amelioration or control of a pathology,
disease, disorder, process, condition or event, including viral
infection. In this context, the term "treatment" is further to be
understood as embracing the use of a drug to inhibit, block,
reverse, restrict or control progression of viral infection.
[0043] As used herein, the term "pharmaceutical composition" refers
to compositions of matter comprising at least one pharmaceutical
compound and optionally a pharmaceutically acceptable carrier.
[0044] As used herein, the term "pharmaceutical compound" or "drug"
refers to a free compound, its therapeutically suitable salts,
solvates such as hydrates, specific crystal forms of the compound
or its salts, or therapeutically suitable prodrugs of the
compound.
[0045] Pharmaceutically or pharmacologically acceptable" include
molecular entities and compositions that do not produce an adverse,
allergic or other untoward reaction when administered to an animal,
or a human, as appropriate. For human administration, preparations
should meet sterility, pyrogenicity, and general safety and purity
standards as required by FDA Office of Biologics standards.
[0046] The term "pharmaceutically acceptable carrier" or
"pharmaceutically acceptable excipient" as used herein refers to
any and all solvents, dispersion media, coatings, isotonic and
absorption delaying agents, and the like, that are compatible with
pharmaceutical administration. The use of such media and agents for
pharmaceutically active substances is well known in the art. The
compositions may also contain other active compounds providing
supplemental, additional, or enhanced therapeutic functions.
[0047] The compounds of the disclosure may contain one or more
chiral centers and, therefore, exist as stereoisomers. The term
"stereoisomers" when used herein consist of all enantiomers or
diastereomers. These compounds may be designated by the symbols
"(+)," "(-)," "R" or "S," depending on the configuration of
substituents around the stereogenic carbon atom, but the skilled
artisan will recognize that a structure may denote a chiral center
implicitly. The present invention encompasses various stereoisomers
of these compounds and mixtures thereof. Mixtures of enantiomers or
diastereomers may be designated "(.+-.)" in nomenclature, but the
skilled artisan will recognize that a structure may denote a chiral
center implicitly.
[0048] The compounds of the disclosure may contain one or more
double bonds and, therefore, exist as geometric isomers resulting
from the arrangement of substituents around a carbon-carbon double
bond. The symbol denotes a bond that may be a single, double or
triple bond as described herein. Substituents around a
carbon-carbon double bond are designated as being in the "Z" or "E"
configuration wherein the terms "Z" and "E" are used in accordance
with IUPAC standards. Unless otherwise specified, structures
depicting double bonds encompass both the "E" and "Z" isomers.
Substituents around a carbon-carbon double bond alternatively can
be referred to as "cis" or "trans," where "cis" represents
substituents on the same side of the double bond and "trans"
represents substituents on opposite sides of the double bond.
[0049] Compounds of the disclosure may contain a carbocyclic or
heterocyclic ring and therefore, exist as geometric isomers
resulting from the arrangement of substituents around the ring. The
arrangement of substituents around a carbocyclic or heterocyclic
ring are designated as being in the "Z" or "E" configuration
wherein the terms "Z" and "E" are used in accordance with IUPAC
standards. Unless otherwise specified, structures depicting
carbocyclic or heterocyclic rings encompass both "Z" and "E"
isomers. Substituents around a carbocyclic or heterocyclic ring may
also be referred to as "cis" or "trans", where the term "cis"
represents substituents on the same side of the plane of the ring
and the term "trans" represents substituents on opposite sides of
the plane of the ring. Mixtures of compounds wherein the
substituents are disposed on both the same and opposite sides of
plane of the ring are designated "cis/trans."
[0050] Individual enantiomers and diastereomers of compounds of the
present invention can be prepared synthetically from commercially
available starting materials that contain asymmetric or stereogenic
centers, or by preparation of racemic mixtures followed by
resolution methods well known to those of ordinary skill in the
art. These methods of resolution are exemplified by (1) attachment
of a mixture of enantiomers to a chiral auxiliary, separation of
the resulting mixture of diastereomers by recrystallization or
chromatography and liberation of the optically pure product from
the auxiliary, (2) salt formation employing an optically active
resolving agent, (3) direct separation of the mixture of optical
enantiomers on chiral liquid chromatographic columns or (4) kinetic
resolution using stereoselective chemical or enzymatic reagents.
Racemic mixtures can also be resolved into their component
enantiomers by well-known methods, such as chiral-phase liquid
chromatography or crystallizing the compound in a chiral solvent.
Stereoselective syntheses, a chemical or enzymatic reaction in
which a single reactant forms an unequal mixture of stereoisomers
during the creation of a new stereocenter or during the
transformation of a pre-existing one, are well known in the art.
Stereoselective syntheses encompass both enantio- and
diastereoselective transformations, and may involve the use of
chiral auxiliaries. For examples, see Carreira and Kvaerno,
Classics in Stereoselective Synthesis, Wiley-VCH: Weinheim,
2009.
[0051] The compounds disclosed herein can exist in solvated as well
as unsolvated forms with pharmaceutically acceptable solvents such
as water, ethanol, and the like, and it is intended that the
invention embrace both solvated and unsolvated forms. In one
embodiment, the compound is amorphous. In one embodiment, the
compound is a single polymorph. In another embodiment, the compound
is a mixture of polymorphs. In another embodiment, the compound is
in a crystalline form.
[0052] The invention also embraces isotopically labeled compounds
of the invention which are identical to those recited herein,
except that one or more atoms are replaced by an atom having an
atomic mass or mass number different from the atomic mass or mass
number usually found in nature. Examples of isotopes that can be
incorporated into compounds of the invention include isotopes of
hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine
and chlorine, such as .sup.2H, .sup.3H, .sup.13C, .sup.14C,
.sup.15N, .sup.18O, .sup.17O, .sup.31P, .sup.32S, .sup.18F, and
.sup.36Cl, respectively. For example, a compound of the invention
may have one or more H atom replaced with deuterium.
[0053] Certain isotopically-labeled disclosed compounds (e.g.,
those labeled with .sup.3H and .sup.14C) are useful in compound
and/or substrate tissue distribution assays. Tritiated (i.e.,
.sup.3H) and carbon-14 (i.e., .sup.14C) isotopes are particularly
preferred for their ease of preparation and detectability. Further,
substitution with heavier isotopes such as deuterium (i.e.,
.sup.2H) may afford certain therapeutic advantages resulting from
greater metabolic stability (e.g., increased in vivo half-life or
reduced dosage requirements) and hence may be preferred in some
circumstances. Isotopically labeled compounds of the invention can
generally be prepared by following procedures analogous to those
disclosed in the examples herein by substituting an isotopically
labeled reagent for a non-isotopically labeled reagent.
[0054] The term "therapeutically suitable salt," refers to salts or
zwitterions of pharmaceutical compounds which are water or
oil-soluble or dispersible, suitable for treatment of disorders and
effective for their intended use. The salts may be prepared, for
instance, during the final isolation and purification of the
compounds or separately by reacting an amino group of the compounds
with a suitable acid. For example, a compound may be dissolved in a
suitable solvent, such as but not limited to methanol and water,
and treated with at least one equivalent of an acid, for instance
hydrochloric acid. The resulting salt may precipitate out and be
isolated by filtration and dried under reduced pressure.
Alternatively, the solvent and excess acid may be removed under
reduced pressure to provide the salt. Representative salts include
acetate, adipate, alginate, citrate, aspartate, benzoate,
benzenesulfonate, bisulfate, butyrate, camphorate,
camphorsulfonate, digluconate, glycerophosphate, hemisulfate,
heptanoate, hexanoate, formate, isethionate, fumarate, lactate,
maleate, methanesulfonate, naphthylenesulfonate, nicotinate,
oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate,
picrate, oxalate, maleate, pivalate, propionate, succinate,
tartrate, trichloroacetate, trifluoroacetate, glutamate,
para-toluenesulfonate, undecanoate, hydrochloric, hydrobromic,
sulfuric, phosphoric, and the like. The amino groups of a compound
may also be quaternized with alkyl chlorides, bromides, and iodides
such as methyl, ethyl, propyl, isopropyl, butyl, lauryl, myristyl,
stearyl, and the like.
[0055] Basic addition salts may be prepared, for instance, during
the final isolation and purification of pharmaceutical compounds by
reaction of a carboxyl group with a suitable base such as the
hydroxide, carbonate, or bicarbonate of a metal cation such as
lithium, sodium, potassium, calcium, magnesium, or aluminum, or an
organic primary, secondary, or tertiary amine. Quaternary amine
salts may derived, for example, from methylamine, dimethylamine,
trimethylamine, triethylamine, diethylamine, ethylamine,
tributylamine, pyridine, N,N-dimethylaniline, N-methylpiperidine,
N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine,
N,N-dibenzylphenethylamine, 1-ephenamine, and
N,N'-dibenzylethylenediamine, ethylenediamine, ethanolamine,
diethanolamine, piperidine, piperazine, and the like.
[0056] The term "therapeutically suitable prodrug," refers to those
prodrugs or zwitterions which are suitable for use in contact with
the tissues of subjects and are effective for their intended use.
The term "prodrug" refers to compounds that are transformed in vivo
to a pharmaceutical compound, for example, by hydrolysis in blood.
The term "prodrug," refers to compounds that contain, but are not
limited to, substituents known as "therapeutically suitable
esters." The term "therapeutically suitable ester," refers to
alkoxycarbonyl groups appended to the parent molecule on an
available carbon atom. More specifically, a "therapeutically
suitable ester," refers to alkoxycarbonyl groups appended to the
parent molecule on one or more available aryl, cycloalkyl and/or
heterocycle groups. Compounds containing therapeutically suitable
esters are an example, but are not intended to limit the scope of
compounds considered to be prodrugs. Examples of prodrug ester
groups include pivaloyloxymethyl, acetoxymethyl, phthalidyl,
indanyl and methoxymethyl, as well as other such groups known in
the art. Other examples of prodrug ester groups are found in T.
Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14
of the A.C.S. Symposium Series, and in Edward B. Roche, ed.,
Bioreversible Carriers in Drug Design, American Pharmaceutical
Association and Pergamon Press, 1987, both of which are
incorporated herein by reference.
[0057] The terms "pharmaceutically effective amount" and "effective
amount", as used herein, refer to an amount of a pharmaceutical
formulation that will elicit the desired therapeutic effect or
response when administered in accordance with the desired treatment
regimen. US2011/0144086 describes the use of some
diabenzothiazepine molecules (DBTs) as anti-malarial "inhibitors of
the plasmodial surface anion channel." However, no study of DBT
molecules as anti-virals has yet been reported.
[0058] In one Aspect, provided herein are compounds represented by
Formula I:
##STR00010##
[0059] wherein [0060] Y is selected from the group consisting of
S(O).sub.y, C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is
0, 1, or 2; [0061] L is a bond or a C.sub.1-3alkylene (optionally
substituted with one, two or three substituents each independently
selected from the group consisting of halogen, C.sub.1-6alkyl,
C.sub.1-6halolalkyl, and hydroxyl); [0062] R.sup.11, for each
occurrence, is selected from the group consisting of H, halogen,
and C.sub.1-6alkyl (optionally substituted with one, two, or three
halogens); [0063] R.sub.Y is selected from the group consisting of
H, methyl, ethyl, propyl, propenyl, butyl, phenyl and benzyl,
wherein R.sub.Y when not H may be optionally substituted by
hydroxyl; [0064] R.sup.Z is selected from the group consisting of
H, methyl, ethyl, propyl, phenyl and benzyl; [0065] R.sup.m' and
R.sup.m are each independently selected from the group consisting
of H, C.sub.1-6alkyl (optionally substituted by one, two or three
substituents each independently selected from halogen and
hydroxyl), and C.sub.2-6alkenyl (optionally substituted by one, two
or three substituents each independently selected from halogen and
hydroxyl); [0066] R.sup.c is selected from the group consisting of
H, C.sub.1-6alkyl and C.sub.2-6alkenyl; [0067] R.sup.77 is selected
from the group consisting of H, halogen, cyano, and C.sub.1-6alkyl;
[0068] R.sup.78 is a C.sub.3-7cycloalkyl (optionally substituted
with 1, 2 or 3 substituents each independently selected from the
group consisting of R.sup.73); [0069] R.sup.73 is selected
independently for each occurrence from the group consisting of
halogen, hydroxyl, nitro, cyano, CHO, oxo, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, carboxy, oxo, NR'R'', --C(O)--C.sub.1-6alkyl,
C.sub.3-6cycloalkyl, --NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl,
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl,
X.sup.2--R.sup.79; and X.sup.2--C.sub.1-6alkylene-R.sup.79; [0070]
X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), O, --C(O)-- and NR'; [0071] R.sup.79 is
selected independently for each occurrence from the group
consisting of H, hydroxyl, halogen, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, heterocycle (optionally substituted by
one or more substituents selected from the group consisting of
halogen, NR'R', --C(O)--O--C.sub.1-6alkyl, carboxy and
C.sub.1-6alkyl), --C(O)--NR'R'', --C(.dbd.NH)--NR'R'', heteroaryl,
phenyl (optionally substituted by one or more substituents selected
from the group consisting of halogen, NR'R', --C(O)--O--C.sub.1-6
alkyl, carboxy, C.sub.1-6alkoxy, and C.sub.1-6 alkyl),
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6 alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2); [0072] R'
is selected, independently for each occurrence, from H, methyl,
ethyl, cyclopropyl, cyclobutyl, and propyl; [0073] R'' is selected,
independently for each occurrence, from H, methyl, ethyl, propyl,
(optionally substituted by hydroxyl), butyl (optionally substituted
by hydroxyl), --C(O)-- methyl and --C(O)-ethyl, or R' and R'' taken
together with the nitrogen to which they are attached may form a
4-7 membered heterocycle optionally substituted by one, two or more
substituents selected from the group consisting of halogen,
hydroxyl, NH.sub.2, --C(O)--O--C.sub.1-3alkyl,
--C(O)--C.sub.1-3alkyl, carboxy, oxo, and C.sub.1-3alkyl; [0074]
each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8,
R.sup.9, and R.sup.10 is independently selected for each occurrence
from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.1-6alkoxy, C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen,
hydroxyl, nitro, cyano, and NR'R''; and [0075] wherein for each
occurrence, C.sub.1-6alkyl, C.sub.2-6alkenyl or C.sub.2-6alkynyl
may be optionally substituted with one, two, three or more
substituents selected from the group consisting of halogen,
hydroxyl, nitro, cyano, carboxy, C.sub.3-6cycloalkyl,
C.sub.2-4alkenyl, C.sub.2-4alkynyl, C.sub.1-3alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
NR'--C(O)--C.sub.1-3alkyl, NR'--C(O)--O--C.sub.1-3alkyl, and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.1-3alkyl, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkylene may be
optionally substituted by a substituent selected from the group
consisting of C.sub.3-6cycloalkyl, hydroxyl, cyano, and halogen;
and pharmaceutically acceptable salts thereof.
[0076] For example, in some embodiments of the compound of Formula
I: Y is S(O).sub.y, NH, or O. In some embodiments, Y is S(O).sub.y.
In some embodiments, y is 1 or 2. In some embodiments, y is 2.
[0077] For example, in some embodiments of the compound of Formula
I: each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8,
R.sup.9, and R.sup.10 is independently selected for each occurrence
from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.1-6haloalkyl, and halogen. In some embodiments, R.sup.7 is
selected from H and F. In some embodiments, R.sup.6 is selected
from H and F. In some embodiments, R.sup.5 is selected from H and
F. In some embodiments R.sup.10 is selected from the group
consisting of H, methyl and F. In some embodiments, each of
R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9, R.sup.10, and
R.sup.11 is H.
[0078] For example, in some embodiments of the compound of Formula
I: R.sup.m' and R.sup.m are each H. In some embodiments R.sup.C is
H. In some embodiments, R.sup.Z is H. In some embodiments L is a
bond or CH.sub.2. In some embodiments L is CH.sub.2. In some
embodiments L is a bond.
[0079] For example, in some embodiments of the compound of Formula
I: R.sup.78 is cyclohexyl or cyclopentyl, wherein each R.sup.78 is
optionally substituted with 1, 2 or 3 substituents each
independently selected from the group consisting of R.sup.73.
[0080] For example, in some embodiments of the compound of Formula
I: R.sup.73 is selected independently for each occurrence from the
group consisting of halogen, hydroxyl, nitro, cyano, CHO, oxo,
C.sub.1-6alkyl, --C(O)--O--C.sub.1-6alkyl,
--C(O)--NR'--C.sub.1-6alkyl, --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6 alkynyl, C.sub.1-6 alkoxy, carboxy,
oxo, NR'R'', --C(O)--C.sub.1-6alkyl, --NR'--C(O)--C.sub.1-6 alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
C(O)--NR'--C.sub.1-6alkyl, and
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl;
wherein for each occurrence, C.sub.1-6alkyl, C.sub.2-6alkenyl or
C.sub.2-6alkynyl may be optionally substituted with one, two, three
or more substituents selected from the group consisting of halogen,
hydroxyl, nitro, cyano, carboxy, C.sub.3-6cycloalkyl,
C.sub.1-3alkoxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-2alkyl (where w
is 0, 1 or 2), NR'--C(O)--C.sub.1-3alkyl, and S(O).sub.w--NR'R''
(where w is 0, 1 or 2); C.sub.1-6alkoxy may be optionally
substituted with one, two, three or more substituents selected from
the group consisting of halogen, hydroxyl, nitro, cyano, carboxy,
NR'R'', --NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
and S(O).sub.w--NR'R'' (where w is 0, 1 or 2).
[0081] For example, in some embodiments of the compound of Formula
I: R.sup.73 is selected independently for each occurrence from the
group consisting of halogen, hydroxyl, cyano, CHO, oxo,
C.sub.1-6alkyl, --C(O)--O--C.sub.1-6 alkyl,
--C(O)--NR'--C.sub.1-6alkyl, C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6 alkoxy, carboxy, oxo, NR'R'', --C(O)--C.sub.1-6alkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6 alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl, and
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl;
wherein for each occurrence, C.sub.1-6alkyl, C.sub.2-6alkenyl or
C.sub.2-6alkynyl may be optionally substituted with one substituent
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.3-6cycloalkyl, C.sub.1-3alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
NR'--C(O)--C.sub.1-3alkyl, NR'--C(O)--O--C.sub.1-3alkyl, and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-2alkyl (where w
is 0, 1 or 2), and S(O).sub.w--NR'R'' (where w is 0, 1 or 2).
[0082] For example, in some embodiments of the compound of Formula
I: R.sup.73 is selected independently for each occurrence from the
group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy,
C.sub.1-6alkyl, C.sub.1-6haloalkyl, C.sub.1-6alkoxy, and
C.sub.1-6haloalkoxy; wherein C.sub.1-6alkyl and C.sub.1-6alkoxy
groups are not further substituted. In some embodiments R.sup.73 is
selected independently for each occurrence from the group
consisting of H, halogen, methyl, and trifluoromethyl.
[0083] In another aspect, provided herein are compounds represented
by Formula II:
##STR00011##
wherein
[0084] Y is S(O).sub.y;
[0085] y is 0, 1 or 2
[0086] n is 0 or 1;
[0087] R.sup.77 is selected from the group consisting of H,
halogen, cyano, and C.sub.1-6alkyl;
[0088] R.sup.78 is a C.sub.3-7cycloalkyl (optionally substituted
with 1, 2 or 3 substituents each independently selected from the
group consisting of R.sup.73);
[0089] R.sup.73 is selected independently for each occurrence from
the group consisting of halogen, hydroxyl, nitro, cyano, CHO, oxo,
C.sub.1-6alkyl, --C(O)--O--C.sub.1-6alkyl,
--C(O)--NR'--C.sub.1-6alkyl, --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy, oxo,
NR'R'', --C(O)--C.sub.1-6alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O)--C.sub.1-6alkyl (where w is 0, 1 or 2), --S(O).sub.w--NR'R''
(where w is 0, 1 or 2), --NR'--S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), C(O)--NR'--C.sub.1-6alkyl, C(O)--C.sub.1-3
alkylene-NR'--C(O)--O--C.sub.1-6alkyl, X.sup.2--R.sup.79; and
X.sup.2--C.sub.1-6 alkylene-R.sup.79;
[0090] X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), O, --C(O)-- and NR';
[0091] R.sup.79 is selected independently for each occurrence from
the group consisting of H, hydroxyl, halogen, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, heterocycle (optionally substituted by
one or more substituents selected from the group consisting of
halogen, NR'R', --C(O)--O--C.sub.1-6alkyl, carboxy and
C.sub.1-6alkyl), --C(O)--NR'R'', --C(.dbd.NH)--NR'R'', heteroaryl,
phenyl (optionally substituted by one or more substituents selected
from the group consisting of halogen, NR'R',
--C(O)--O--C.sub.1-6alkyl, carboxy, C.sub.1-6alkoxy, and
C.sub.1-6alkyl), C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
C.sub.3-6cycloalkyl, --NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0092] R' is selected, independently for each occurrence, from H,
methyl, ethyl, cyclopropyl, cyclobutyl, and propyl;
[0093] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl, (optionally substituted by hydroxyl), butyl
(optionally substituted by hydroxyl), --C(O)-methyl and
--C(O)-ethyl, or R' and R'' taken together with the nitrogen to
which they are attached may form a 4-7 membered heterocycle
optionally substituted by one, two or more substituents selected
from the group consisting of halogen, hydroxyl, NH.sub.2,
--C(O)--O--C.sub.1-3alkyl, --C(O)--C.sub.1-3alkyl, carboxy, oxo,
and C.sub.1-3alkyl;
[0094] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.1-6alkoxy, C.sub.1-6alkynyl, C.sub.2-6alkenyl, halogen,
hydroxyl, nitro, cyano, and NR'R''; and
[0095] wherein for each occurrence, C.sub.1-6alkyl,
C.sub.2-6alkenyl or C.sub.2-6alkynyl may be optionally substituted
with one, two, three or more substituents selected from the group
consisting of halogen, hydroxyl, nitro, cyano, carboxy,
C.sub.3-6cycloalkyl, C.sub.2-4alkenyl, C.sub.2-4alkynyl,
C.sub.1-3alkoxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-2alkyl (where w
is 0, 1 or 2), NR'--C(O)--C.sub.1-3alkyl,
NR'--C(O)--O--C.sub.1-3alkyl, and S(O).sub.w--NR'R'' (where w is 0,
1 or 2); C.sub.1-6alkoxy may be optionally substituted with one,
two, three or more substituents selected from the group consisting
of halogen, hydroxyl, nitro, cyano, carboxy, C.sub.1-3alkyl,
NR'R'', --NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
and S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkylene
may be optionally substituted by a substituent selected from the
group consisting of C.sub.3-6cycloalkyl, hydroxyl, cyano, and
halogen;
[0096] and pharmaceutically acceptable salts thereof.
[0097] For example, in some embodiments of the compound of Formula
II:
[0098] R.sup.78 is cyclohexyl or cyclopentyl, wherein each R.sup.78
is optionally substituted with 1, 2 or 3 substituents each
independently selected from the group consisting of R.sup.73;
[0099] R.sup.73 is selected independently for each occurrence from
the group consisting of halogen, hydroxyl, nitro, cyano, CHO, oxo,
C.sub.1-6alkyl, --C(O)--O--C.sub.1-6alkyl,
--C(O)--NR'--C.sub.1-6alkyl, --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy, oxo,
NR'R'', --C(O)--C.sub.1-6alkyl, --NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl, and
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl;
[0100] wherein for each occurrence, C.sub.1-6alkyl,
C.sub.2-6alkenyl or C.sub.2-6alkynyl may be optionally substituted
with one, two, three or more substituents selected from the group
consisting of halogen, hydroxyl, nitro, cyano, carboxy,
C.sub.3-6cycloalkyl, C.sub.1-3alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
NR'--C(O)--C.sub.1-3alkyl, NR'--C(O)--O--C.sub.1-3alkyl, and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-2alkyl (where w
is 0, 1 or 2), and S(O).sub.w--NR'R'' (where w is 0, 1 or 2).
[0101] In another aspect, provided herein are compounds represented
by Formula III:
##STR00012##
[0102] wherein [0103] represents a single or double bond; [0104] Y
is selected from the group consisting of, C.dbd.O,
C(R.sup.11).sub.2, S(O).sub.y, NR.sub.Y and O wherein y is 0, 1, or
2; [0105] Z is CR.sup.2 or N when is a double bond; [0106] Z is
CR.sup.2R.sup.2 or NR.sup.3 when is a single bond;
[0107] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, proprene, butyl, phenyl and benzyl; or R.sub.Y taken
together with R.sup.2 and the nitrogen and carbon which they are
respectively attached form a fused 4-7 membered heterocycle;
[0108] R.sup.1 and R.sup.2 are independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R';
[0109] R.sup.3 is selected from the group consisting of H, methyl,
ethyl, propyl, proprene, butyl or R.sup.3 taken together with
R.sup.1 and the nitrogen and carbon which they are respectively
attached form a fused 4-7 membered heterocycle;
[0110] R.sup.8, R.sup.9, and R.sup.10 are independently selected
for each occurrence from the group consisting of hydrogen,
C.sub.1-6alkyl, C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen,
hydroxyl, nitro, cyano, and NR'R';
[0111] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0112] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H, C.sub.1-6alkyl (optionally substituted
by one, two or three substituents each independently selected from
halogen and hydroxyl), and C.sub.2-6alkenyl (optionally substituted
by one, two or three substituents each independently selected from
halogen and hydroxyl);
[0113] R.sup.c is selected from the group consisting of H,
C.sub.1-6alkyl and C.sub.2-6alkenyl;
[0114] R.sup.78 is selected from the group consisting of H, cyano,
CHO, CF.sub.3, C.sub.1-6alkyl, carboxy, --C(O)--O--C.sub.1-6alkyl;
--NR'R''; phenyl (optionally substituted with one, two, three or
four substituents each independently selected from the group
consisting of R.sup.73); benzyl (optionally substituted with one or
more substituents each independently selected from the group
consisting of R.sup.73), 4-7 membered heterocycle (optionally
substituted with one or more substituents each independently
selected from the group consisting of R.sup.73); 5-6 membered
monocyclic heteroaryl (optionally substituted with one or more
substituents each independently selected from the group consisting
of R.sup.73); 9-10 membered bicyclic heteroaryl (optionally
substituted with one or more substituents each independently
selected from the group consisting of R.sup.73) and
X.sup.2--C.sub.0-6alkylene-R.sup.79;
[0115] X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), 0, --C(O)-- and NR';
[0116] R.sup.79 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6 alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6 alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0117] R.sup.73 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, oxo, C.sub.1-6 alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6
alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl, NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl,
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl, and
X.sup.2--C.sub.0-6alkylene-R.sup.79;
[0118] R' is selected, independently for each occurrence, from H,
methyl, ethyl, cyclopropyl, cyclobutyl, and propyl;
[0119] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl (optionally substituted by hydroxyl), butyl
(optionally substituted by hydroxyl), --C(O)-methyl and
--C(O)-ethyl, or R' and R'' taken together with the nitrogen to
which they are attached may form a 4-6 membered heterocycle
optionally substituted by one or more substituents selected from
the group consisting of halogen, NH.sub.2,
--C(O)--O--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkyl, carboxy and
C.sub.1-6alkyl;
[0120] R.sup.11, for each occurrence, is selected from the group
consisting of H, halogen, and C.sub.1-6alkyl (optionally
substituted with one, two, or three halogens);
[0121] wherein for each occurrence, C.sub.1-6alkyl,
C.sub.2-6alkenyl or C.sub.2-6alkynyl may be optionally substituted
with one, two, three or more substituents selected from the group
consisting of halogen, hydroxyl, nitro, cyano, C.sub.3-6cycloalkyl,
C.sub.2-4alkenyl, C.sub.2-4alkynyl, C.sub.1-3alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
NR'--C(O)--C.sub.1-3 alkyl, NR'--C(O)--O--C.sub.1-3 alkyl, and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.1-3alkyl, --NR'--S(O).sub.w--C.sub.1-2alkyl
(where w is 0, 1 or 2), and S(O).sub.w--NR'R''; C.sub.1-6alkylene
may be optionally substituted by a substituent selected from the
group consisting of C.sub.3-6cycloalkyl, hydroxyl, cyano, and
halogen;
[0122] and pharmaceutically acceptable salts thereof.
[0123] In one embodiment, the compound of Formula III may be
represented by Formula IV:
##STR00013##
[0124] where for example the substituents are described above.
[0125] In another embodiment, the compound of Formula III may be
represented by Formula V:
##STR00014##
[0126] where for example the substituents are described above.
[0127] In another embodiment, the compound of Formula III may be
represented by Formula VI:
##STR00015##
[0128] wherein n is 0 or 1, and the remaining substituents are
described above.
[0129] For example, in some embodiments of the compound of Formula
III, IV, V or VI: Y is selected from the group consisting of S,
S(O).sub.2, NR.sub.Y and O.
[0130] For example, in some embodiments of the compound of Formula
III, IV, V or VI: R.sup.8 R.sup.9, and R.sup.10 are each
independently selected for each occurrence from the group
consisting of hydrogen, methyl, trifluoromethyl, and halogen; In
some embodiments, each of R.sup.8, R.sup.9, and R.sup.10 is
hydrogen.
[0131] For example, in some embodiments of the compound of Formula
III, IV, V and VI: R.sup.C is H. In some embodiments R.sup.Z is H.
In some embodiments R.sup.m' and R.sup.m are each H.
[0132] For example, in some embodiments of the compound of Formula
III, IV, V and VI:
[0133] R.sup.78 is selected from the group consisting of cyano,
CHO, CF.sub.3, C.sub.1-6alkyl, carboxy, --C(O)--O--C.sub.1-6alkyl,
--NR'R'', phenyl (optionally substituted with one, two, three or
four substituents each independently selected from the group
consisting of R.sup.73), and 5-6 membered monocyclic heteroaryl
(optionally substituted with one or more substituents each
independently selected from the group consisting of R.sup.73);
[0134] R.sup.79 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0135] R.sup.73 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, oxo, C.sub.1-6alkyl,
--C(O).sub.wO--C.sub.1-6 alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl, NR'--C(O)--C.sub.1-6 alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl,
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl, and
X.sup.2--C.sub.0-6alkylene-R.sup.79; and
[0136] X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), 0, --C(O)-- and NR'.
[0137] For example, in some embodiments of the compound of Formula
III, IV, V or VI: R.sup.79 selected from the group consisting of H,
methyl, halogen, and trifluoromethyl.
[0138] In another aspect, provided herein are compounds represented
by Formula VII:
##STR00016##
[0139] wherein
[0140] Y is selected from the group consisting of S(O).sub.y,
C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is 0, 1, or
2;
[0141] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, proprene, butyl, phenyl and benzyl;
[0142] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0143] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H, C.sub.1-6alkyl (optionally substituted
by one, two or three substituents each independently selected from
halogen and hydroxyl), and C.sub.2-6alkenyl (optionally substituted
by one, two or three substituents each independently selected from
halogen and hydroxyl);
[0144] R.sup.c is selected from the group consisting of H,
C.sub.1-6alkyl and C.sub.2-6alkenyl;
[0145] R.sup.78 is selected from the group consisting of H, cyano,
CHO, C.sub.1-6alkyl, carboxy, --C(O)--O--C.sub.1-6alkyl; --NR'R'';
phenyl (optionally substituted with one, two, three or four
substituents each independently selected from the group consisting
of R.sup.73); benzyl (optionally substituted with one or more
substituents each independently selected from the group consisting
of R.sup.73), 4-7 membered heterocycle (optionally substituted with
one or more substituents each independently selected from the group
consisting of R.sup.73); 5-6 membered monocyclic heteroaryl
(optionally substituted with one or more substituents each
independently selected from the group consisting of R.sup.73); 9-10
membered bicyclic heteroaryl (optionally substituted with one or
more substituents each independently selected from the group
consisting of R.sup.73) and
X.sup.2--C.sub.0-6alkylene-R.sup.79;
[0146] X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), 0, --C(O)-- and NR';
[0147] R.sup.79 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6 alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6 alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6 alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0148] R.sup.73 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, oxo, C.sub.1-6 alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6
alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl, NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O)--C.sub.1-6alkyl (where w is 0,
1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl,
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl, and
X.sup.2--C.sub.0-6alkylene-R.sup.79;
[0149] R' is selected, independently for each occurrence, from H,
methyl, ethyl, cyclopropyl, cyclobutyl, and propyl;
[0150] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl (optionally substituted by hydroxyl), butyl
(optionally substituted by hydroxyl), --C(O)-methyl and
--C(O)-ethyl, or R' and R'' taken together with the nitrogen to
which they are attached may form a 4-6 membered heterocycle
optionally substituted by one or more substituents selected from
the group consisting of halogen, NH.sub.2,
--C(O)--O--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkyl, carboxy and
C.sub.1-6alkyl;
[0151] R.sup.11, for each occurrence, is selected from the group
consisting of H, halogen, and C.sub.1-6alkyl (optionally
substituted with one, two, or three halogens);
[0152] each of moieties R.sup.4, R.sup.5, R.sup.7, R.sup.8,
R.sup.9, and R.sup.10 is independently selected for each occurrence
from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R''; and
[0153] wherein for each occurrence, C.sub.1-6alkyl,
C.sub.2-6alkenyl or C.sub.2-6alkynyl may be optionally substituted
with one, two, three or more substituents selected from the group
consisting of halogen, hydroxyl, nitro, cyano, C.sub.3-6cycloalkyl,
C.sub.2-4alkenyl, C.sub.2-4alkynyl, C.sub.1-3alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
NR'--C(O)--C.sub.1-3alkyl, NR'--C(O)--O--C.sub.1-3alkyl, and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.1-3alkyl, --NR'--S(O).sub.w--C.sub.1-2alkyl
(where w is 0, 1 or 2), and S(O).sub.w--NR'R''; C.sub.1-6alkylene
may be optionally substituted by a substituent selected from the
group consisting of C.sub.3-6cycloalkyl, hydroxyl, cyano, and
halogen;
[0154] and pharmaceutically acceptable salts thereof.
[0155] For example, in some embodiments of the compound of Formula
VII: Y is selected from the group consisting of S, S(O).sub.2,
NR.sub.Y, and O.
[0156] For example, in some embodiments of the compound of Formula
VII: each of moieties R.sup.4, R.sup.5, R.sup.7, R.sup.8, R.sup.9,
and R.sup.10 is independently selected for each occurrence from the
group consisting of hydrogen, halogen, methyl, and trifluoromethyl.
In some embodiments, each of moieties R.sup.4, R.sup.5, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is H.
[0157] For example, in some embodiments of the compound of Formula
VII: R.sup.C is H. In some embodiments R.sup.Z is H. In some
embodiments R.sup.m' and R.sup.m are each H.
[0158] For example, in some embodiments of the compound of Formula
VII:
[0159] R.sup.78 is selected from the group consisting of cyano,
CHO, CF.sub.3, C.sub.1-6alkyl, carboxy, --C(O)--O--C.sub.1-6alkyl;
--NR'R''; phenyl (optionally substituted with one, two, three or
four substituents each independently selected from the group
consisting of R.sup.73); and 5-6 membered monocyclic heteroaryl
(optionally substituted with one or more substituents each
independently selected from the group consisting of R.sup.73);
[0160] R.sup.79 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0161] R.sup.73 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, oxo, C.sub.1-6 alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6
alkoxy, carboxy, NR' R'', --C(O)--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl, NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl,
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl, and
X.sup.2--C.sub.0-6alkylene-R.sup.79; and
[0162] X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), 0, --C(O)-- and NR'.
[0163] For example, in some embodiments of the compound of Formula
VII: R.sup.79 is selected from the group consisting of H, methyl,
halogen, and trifluoromethyl.
[0164] In another aspect, provided herein are compounds represented
by Formula VIII:
##STR00017##
[0165] wherein
[0166] Y is selected from the group consisting of S(O).sub.y,
C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is 0, 1, or
2;
[0167] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, proprene, butyl, phenyl and benzyl;
[0168] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0169] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H, C.sub.1-6alkyl (optionally substituted
by one, two or three substituents each independently selected from
halogen and hydroxyl), and C.sub.2-6alkenyl (optionally substituted
by one, two or three substituents each independently selected from
halogen and hydroxyl);
[0170] R.sup.c is selected from the group consisting of H,
C.sub.1-6alkyl and C.sub.2-6alkenyl;
[0171] R.sup.78 is selected from the group consisting of H, cyano,
CHO, C.sub.1-6alkyl, carboxy, --C(O)--O--C.sub.1-6alkyl; --NR'R'';
phenyl (optionally substituted with one, two, three or four
substituents each independently selected from the group consisting
of R.sup.73); benzyl (optionally substituted with one or more
substituents each independently selected from the group consisting
of R.sup.73), 4-7 membered heterocycle (optionally substituted with
one or more substituents each independently selected from the group
consisting of R.sup.73); 5-6 membered monocyclic heteroaryl
(optionally substituted with one or more substituents each
independently selected from the group consisting of R.sup.73); 9-10
membered bicyclic heteroaryl (optionally substituted with one or
more substituents each independently selected from the group
consisting of R.sup.73) and
X.sup.2--C.sub.0-6alkylene-R.sup.79;
[0172] X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), O, --C(O)-- and NR';
[0173] R.sup.79 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6 alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0174] R.sup.73 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, oxo, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl, NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl,
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl, and
X.sup.2--C.sub.0-6alkylene-R.sup.79;
[0175] R' is selected, independently for each occurrence, from H,
methyl, ethyl, cyclopropyl, cyclobutyl, and propyl;
[0176] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl (optionally substituted by hydroxyl), butyl
(optionally substituted by hydroxyl), --C(O)-methyl and
--C(O)-ethyl, or R' and R'' taken together with the nitrogen to
which they are attached may form a 4-6 membered heterocycle
optionally substituted by one or more substituents selected from
the group consisting of halogen, NH.sub.2,
--C(O)--O--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkyl, carboxy and
C.sub.1-6alkyl;
[0177] R.sup.11, for each occurrence, is selected from the group
consisting of H, halogen, and C.sub.1-6alkyl (optionally
substituted with one, two, or three halogens);
[0178] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R''; and
[0179] wherein for each occurrence, C.sub.1-6alkyl,
C.sub.2-6alkenyl or C.sub.2-6alkynyl may be optionally substituted
with one, two, three or more substituents selected from the group
consisting of halogen, hydroxyl, nitro, cyano, C.sub.3-6cycloalkyl,
C.sub.2-4alkenyl, C.sub.2-4alkynyl, C.sub.1-3alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2),
NR'--C(O)--C.sub.1-3alkyl, and S(O).sub.wNR'R'' (where w is 0, 1 or
2); C.sub.1-6alkoxy may be optionally substituted with one, two,
three or more substituents selected from the group consisting of
halogen, hydroxyl, nitro, cyano, carboxy, C.sub.1-3alkyl,
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R''; C.sub.1-6alkylene may be optionally substituted
by a substituent selected from the group consisting of
C.sub.3-6cycloalkyl, hydroxyl, cyano, and halogen;
[0180] and pharmaceutically acceptable salts thereof.
[0181] For example, in some embodiments of the compound of Formula
VIII: Y is selected from the group consisting of S, S(O).sub.2,
NR.sub.Y, and O.
[0182] For example, in some embodiments of the compound of Formula
VIII: each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8,
R.sup.9, and R.sup.10 is independently selected for each occurrence
from the group consisting of hydrogen, halogen, methyl, and
trifluoromethyl. In some embodiments, each of moieties R.sup.4,
R.sup.5, R.sup.6, R.sup.7, R.sup.8, R.sup.9, and R.sup.10 is H.
[0183] For example, in some embodiments of the compound of Formula
VIII: R.sup.C is H. In some embodiments R.sup.Z is H. In some
embodiments R.sup.m' and R.sup.m are each H.
[0184] For example, in some embodiments of the compound of Formula
VIII:
[0185] R.sup.78 is selected from the group consisting of cyano,
CHO, CF.sub.3, C.sub.1-6alkyl, carboxy, --C(O)--O--C.sub.1-6alkyl;
--NR'R''; phenyl (optionally substituted with one, two, three or
four substituents each independently selected from the group
consisting of R.sup.73); and 5-6 membered monocyclic heteroaryl
(optionally substituted with one or more substituents each
independently selected from the group consisting of R.sup.73);
[0186] R.sup.79 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO. C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0187] R.sup.73 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, oxo, C.sub.1-6 alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6
alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl, NR'--C(O)--C.sub.1-6alkyl,
NR'--C(O)--O--C.sub.1-6alkyl, --S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6 alkyl, C(O)--C.sub.1-3
alkylene-NR'--C(O)--O--C.sub.1-6alkyl, and
X.sup.2--C.sub.0-6alkylene-R.sup.79; and
[0188] X.sup.2 is selected from the group consisting of S(O).sub.w
(wherein w is 0, 1, or 2), O, --C(O)-- and NR'.
[0189] For example, in some embodiments of the compound of Formula
VIII: R.sup.79 is selected from the group consisting of H, methyl,
halogen, and trifluoromethyl.
[0190] In another aspect, provided herein are compounds represented
by Formula IX:
##STR00018##
[0191] wherein
[0192] Y is selected from the group consisting of S(O).sub.y,
C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is 0, 1, or
2;
[0193] R.sup.11 is H or C.sub.1-6alkyl,
[0194] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0195] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0196] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H and C.sub.1-6alkyl (optionally
substituted by one, two or three substituents each independently
selected from halogen and hydroxyl);
[0197] each of R.sup.58, R.sup.59, R.sup.78, and R.sup.79 is
selected independently for each occurrence from the group
consisting of H, halogen, hydroxyl, nitro, cyano, CHO,
C.sub.1-6alkyl, --C(O)--O--C.sub.1-6alkyl, heterocycle (optionally
substituted by halogen or NR'R'), --C(O)--NR'R'',
--C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkoxy,
C.sub.3-6cycloalkyl, --S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1
or 2), and --S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0198] R' is selected, independently for each occurrence, from H,
methyl, ethyl, and propyl;
[0199] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl, butyl, --C(O)-methyl and --C(O)-ethyl, or R'
and R'' taken together with the nitrogen to which they are attached
may form a 4-6 membered heterocycle;
[0200] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R'';
[0201] wherein for each occurrence, C.sub.1-6alkyl may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, CHO, carboxy, C.sub.2-6alkynyl, C.sub.1-6alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--NR'--S(O).sub.w (where w is 0, 1 or 2), and S(O).sub.w--NR'R''
(where w is 0, 1 or 2); C.sub.1-6alkoxy may be optionally
substituted with one, two, three or more substituents selected from
the group consisting of halogen, hydroxyl, nitro, cyano, carboxy,
C.sub.1-6alkyl, NR'R'', --NR'--S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), and S(O).sub.w--NR'R'' (where w is 0, 1 or 2); and
pharmaceutically acceptable salts thereof.
[0202] For example, in some embodiments of the compound of Formula
IX: Y is S(O).sub.y. In some embodiments y is 1 or 2. In some
embodiments y is 2. In some embodiments R.sup.m' and R.sup.m are
each H. In some embodiments R.sup.Z is H.
[0203] For example, in some embodiments of the compound of Formula
IX: each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7, R.sup.8,
R.sup.9, and R.sup.10 is independently selected for each occurrence
from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.1-6haloalkyl, and halogen. In some embodiments R.sup.7 is
selected from H and F. In some embodiments R.sup.6 is selected from
H and F. In some embodiments R.sup.5 is selected from H and F. In
some embodiments R.sup.10 is selected from the group consisting of
H, methyl, and F. In some embodiments each of R.sup.4, R.sup.5,
R.sup.6, R.sup.7, R.sup.8, R.sup.9, R.sup.10, and R.sup.11 is
H.
[0204] For example, in some embodiments of the compound of Formula
IX: each of R.sup.58, R.sup.59, R.sup.78, and R.sup.79 is selected
independently for each occurrence from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6alkyl,
C.sub.1-6alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
--C(O)--C.sub.1-6alkoxy, C.sub.3-6cycloalkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2); wherein for each
occurrence, C.sub.1-6alkyl may be optionally substituted with one
substituent selected independently for each occurrence from the
group consisting of halogen, hydroxyl, nitro, cyano, CHO, carboxy,
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, NR'R'',
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one substituent selected independently
for each occurrence from the group consisting of halogen, hydroxyl,
nitro, cyano, carboxy, C.sub.1-6alkyl, NR'R'',
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2).
[0205] For example, in some embodiments of the compound of Formula
IX: each of R.sup.58, R.sup.59, R.sup.78, and R.sup.79 is selected
independently for each occurrence from the group consisting of H,
halogen, hydroxyl, nitro, cyano, carboxy, C.sub.1-6alkyl,
C.sub.1-6haloalkyl, C.sub.1-6alkoxy, and C.sub.1-6haloalkoxy;
wherein C.sub.1-6alkyl and C.sub.1-6alkoxy groups are not further
substituted. In some embodiments each of R.sup.58, R.sup.59,
R.sup.78, and R.sup.79 is selected independently for each
occurrence from the group consisting of H, halogen, methyl, and
trifluoromethyl.
[0206] For example, in some embodiments of the compound of Formula
IX: each of R.sup.78 and R.sup.79 is H. In some embodiments each of
R.sup.58, R.sup.59, R.sup.78, and R.sup.79 is H.
[0207] In another aspect, provided herein are compounds represented
by Formula X:
##STR00019##
[0208] wherein
[0209] Y is S(O).sub.y;
[0210] each of R.sup.58 and R.sup.59 is selected independently for
each occurrence from the group consisting of H, halogen, hydroxyl,
nitro, cyano, CHO, C.sub.1-6alkyl, --C(O)--O--C.sub.1-6alkyl,
--C(O)--NR'R'', --C(.dbd.NH)--NR'R'', C.sub.2-6alkenyl,
C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy, NR'R'',
--C(O)--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkoxy,
C.sub.3-6cycloalkyl, --S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1
or 2), and --S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0211] R' is selected, independently for each occurrence, from H,
methyl, ethyl, and propyl;
[0212] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl, butyl, --C(O)-methyl and --C(O)-ethyl, or R'
and R'' taken together with the nitrogen to which they are attached
may form a 4-6 membered heterocycle;
[0213] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R'';
[0214] wherein for each occurrence, C.sub.1-6alkyl may be
optionally substituted with one substituent selected independently
at each occurrence from the group consisting of halogen, hydroxyl,
nitro, cyano, carboxy, CHO, C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, NR'R'', (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one substituent selected independently
for each occurrence from the group consisting of halogen, hydroxyl,
nitro, cyano, CHO, carboxy, C.sub.1-6alkyl, NR'R'',
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0215] and pharmaceutically acceptable salts thereof.
[0216] For example, in some embodiments of the compound of Formula
X: each of R.sup.58 and R.sup.59 is H.
[0217] In another aspect, provided herein are compounds represented
by Formula XI
##STR00020##
[0218] wherein
[0219] Y is selected from the group consisting of S(O).sub.y,
C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is 0, 1, or
2;
[0220] R.sup.11 is H or C.sub.1-6alkyl,
[0221] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0222] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0223] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H and C.sub.1-6alkyl (optionally
substituted by one, two or three substituents each independently
selected from halogen and hydroxyl);
[0224] R.sup.80 is a pyridyl, optionally substituted by one to
three substituents R.sup.58;
[0225] each of R.sup.58, R.sup.78 and R.sup.79 is selected
independently for each occurrence from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, heterocycle (optionally substituted by
halogen or NR'R'), --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkoxy,
C.sub.3-6cycloalkyl, --S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1
or 2), and --S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0226] R' is selected, independently for each occurrence, from H,
methyl, ethyl, and propyl;
[0227] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl, butyl, --C(O)-methyl and --C(O)-ethyl, or R'
and R'' taken together with the nitrogen to which they are attached
may form a 4-6 membered heterocycle;
[0228] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R'';
[0229] wherein for each occurrence, C.sub.1-6alkyl may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, CHO, carboxy, C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --NR'--S(O).sub.w (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.1-6alkyl, NR'R'',
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0230] and pharmaceutically acceptable salts thereof.
[0231] For example, in some embodiments of the compound of Formula
XI: R.sup.80 is 2-pyridyl, optionally substituted by one to three
substituents independently selected from R.sup.58.
[0232] In another aspect, provided herein are compounds represented
by Formula XII:
##STR00021##
[0233] wherein
[0234] Y is selected from the group consisting of S(O).sub.y,
C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is 0, 1, or
2;
[0235] R.sup.11 is H or C.sub.1-6alkyl,
[0236] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0237] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0238] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H and C.sub.1-6alkyl (optionally
substituted by one, two or three substituents each independently
selected from halogen and hydroxyl);
[0239] A is a 1,2,3 triazole, substituted with one substituent
R.sup.79;
[0240] B is a thiazole (substituted by one substituent R.sup.58 and
one substituent R.sup.59), or a pyridyl (optionally substituted by
one to three substituents R.sup.59);
[0241] each of R.sup.58, R.sup.59, and R.sup.79 is selected
independently for each occurrence from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO. C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, heterocycle (optionally substituted by
halogen or NR'R'), --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkoxy,
C.sub.3-6cycloalkyl, --S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1
or 2), and --S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0242] R' is selected, independently for each occurrence, from H,
methyl, ethyl, and propyl;
[0243] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl, butyl, --C(O)-methyl and --C(O)-ethyl, or R'
and R'' taken together with the nitrogen to which they are attached
may form a 4-6 membered heterocycle;
[0244] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R'';
[0245] wherein for each occurrence, C.sub.1-6alkyl may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, CHO, carboxy, C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --NR'--S(O).sub.w (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.1-6alkyl, NR'R'',
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); and pharmaceutically
acceptable salts thereof.
[0246] For example, in some embodiments of the compound of Formula
XII: A is selected from the group consisting of
##STR00022##
[0247] In another aspect, provided herein are compounds represented
by Formula XIII:
##STR00023##
[0248] wherein
[0249] Y is selected from the group consisting of S(O).sub.y,
C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is 0, 1, or
2;
[0250] R.sup.11 is H or C.sub.1-6alkyl,
[0251] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0252] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0253] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H and C.sub.1-6alkyl (optionally
substituted by one, two or three substituents each independently
selected from halogen and hydroxyl);
[0254] each of R.sup.58, R.sup.59, and R.sup.79 is selected
independently for each occurrence from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, heterocycle (optionally substituted by
halogen or NR'R'), --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkoxy,
C.sub.3-6cycloalkyl, --S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1
or 2), and --S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0255] R' is selected, independently for each occurrence, from H,
methyl, ethyl, and propyl;
[0256] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl, butyl, --C(O)-methyl and --C(O)-ethyl, or R'
and R'' taken together with the nitrogen to which they are attached
may form a 4-6 membered heterocycle;
[0257] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R'';
[0258] wherein for each occurrence, C.sub.1-6alkyl may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, CHO, carboxy, C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --NR'--S(O).sub.w (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.1-6 alkyl, NR'R'', (where w is 0, 1 or 2),
and S(O).sub.w--NR'R'' (where w is 0, 1 or 2); and pharmaceutically
acceptable salts thereof.
[0259] In another aspect, provided herein are compounds represented
by Formula XIV:
##STR00024##
[0260] wherein
[0261] Y is selected from the group consisting of S(O).sub.y,
C.dbd.O, C(R.sup.11).sub.2, NR.sub.Y and O wherein y is 0, 1, or
2;
[0262] R.sup.11 is H or C.sub.1-6alkyl,
[0263] R.sub.Y is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0264] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0265] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H and C.sub.1-6alkyl (optionally
substituted by one, two or three substituents each independently
selected from halogen and hydroxyl);
[0266] each of R.sup.58, R.sup.59, and R.sup.79 is selected
independently for each occurrence from the group consisting of H,
halogen, hydroxyl, nitro, cyano, CHO. C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, heterocycle (optionally substituted by
halogen or NR'R'), --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6 alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, --C(O)--C.sub.1-6alkoxy,
C.sub.1-6cycloalkyl, --S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1
or 2), and --S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0267] R' is selected, independently for each occurrence, from H,
methyl, ethyl, and propyl;
[0268] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl, butyl, --C(O)-methyl and --C(O)-ethyl, or R'
and R'' taken together with the nitrogen to which they are attached
may form a 4-6 membered heterocycle;
[0269] each of moieties R.sup.4, R.sup.5, R.sup.6, R.sup.7,
R.sup.8, R.sup.9, and R.sup.10 is independently selected for each
occurrence from the group consisting of hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen, hydroxyl, nitro,
cyano, and NR'R'';
[0270] wherein for each occurrence, C.sub.1-6alkyl may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, CHO, carboxy, C.sub.2-6alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-6alkyl (where w
is 0, 1 or 2), --NR'--S(O).sub.w (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkoxy may be
optionally substituted with one, two, three or more substituents
selected from the group consisting of halogen, hydroxyl, nitro,
cyano, carboxy, C.sub.1-6alkyl, NR'R'',
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2);
[0271] and pharmaceutically acceptable salts thereof.
[0272] In another aspect, provided herein are compounds represented
by Formula XV:
##STR00025##
[0273] wherein [0274] represents a single or double bond;
[0275] p is 0 or 1;
[0276] R.sup.1, R.sup.2 and R.sup.2b are each independently
selected for each occurrence from the group consisting of hydrogen,
C.sub.1-6alkyl, C.sub.2-6alkynyl, C.sub.2-6alkenyl,
C.sub.3-6cycloalkyl, halogen, hydroxyl, nitro, cyano, and
NR'R';
[0277] or when is a double bond R.sup.2b is absent;
[0278] or when p is 0 and a single bond, R.sup.1 is selected from
the group consisting of hydrogen, C.sub.1-6alkyl, C.sub.2-6alkynyl,
C.sub.2-6alkenyl, C.sub.3-6cycloalkyl, halogen, hydroxyl, nitro,
cyano, NR'R', and oxo; and R.sup.2 and R.sup.2b are each selected
independently at each occurrence from hydrogen, C.sub.1-6alkyl,
C.sub.2-6alkynyl, C.sub.2-6alkenyl, and C.sub.3-6cycloalkyl; or
R.sup.2 and R.sup.2b including the carbon to which they are
attached are joined to form a spiro fused cycloalkyl ring of 3 to 7
carbons;
[0279] R.sup.3 is selected from the group consisting of H, methyl,
ethyl, propyl, proprene, butyl;
[0280] R.sup.8, R.sup.9, and R.sup.10 are each independently
selected for each occurrence from the group consisting of hydrogen,
C.sub.1-6alkyl, C.sub.2-6alkynyl, C.sub.2-6alkenyl, halogen,
hydroxyl, nitro, cyano, and NR'R';
[0281] R.sup.Z is selected from the group consisting of H, methyl,
ethyl, propyl, phenyl and benzyl;
[0282] R.sup.m' and R.sup.m are each independently selected from
the group consisting of H, C.sub.1-6alkyl (optionally substituted
by one, two or three substituents each independently selected from
halogen and hydroxyl), C.sub.2-6alkenyl (optionally substituted by
one, two or three substituents each independently selected from
halogen and hydroxyl), NR'R'', and hydroxyl;
[0283] R.sup.78 is selected from the group consisting of H,
halogen, cyano, CF.sub.3, C.sub.1-6alkyl, carboxy,
--C(O)--O--C.sub.1-6alkyl; --NR'R'', phenyl (optionally substituted
with one, two, three or four substituents each independently
selected from the group consisting of R.sup.73), benzyl (optionally
substituted with one or more substituents each independently
selected from the group consisting of R.sup.73), 4-7 membered
heterocycle (optionally substituted with one or more substituents
each independently selected from the group consisting of R.sup.73),
4-7 membered monocyclic heteroaryl (optionally substituted with one
or more substituents each independently selected from the group
consisting of R.sup.73), and 9-10 membered bicyclic heteroaryl
(optionally substituted with one or more substituents each
independently selected from the group consisting of R.sup.73);
[0284] R.sup.79 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'R'', --C(.dbd.NH)--NR'R'',
C.sub.2-6alkenyl, C.sub.2-6alkynyl, C.sub.1-6alkoxy, carboxy,
NR'R'', --C(O)--C.sub.1-6alkyl, C.sub.3-6cycloalkyl,
--NR'--C(O)--C.sub.1-6alkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2), and
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2);
[0285] R.sup.73 is selected from the group consisting of H,
halogen, hydroxyl, nitro, cyano, oxo, C.sub.1-6alkyl,
--C(O)--O--C.sub.1-6alkyl, --C(O)--NR'--C.sub.1-6alkyl,
--C(.dbd.NH)--NR' R'', C.sub.2-6 alkenyl, C.sub.2-6alkynyl,
C.sub.1-6alkoxy, carboxy, NR'R'', --C(O)--C.sub.1-6alkyl,
--C.sub.3-6cycloalkyl, NR'--C(O)--O--C.sub.1-6alkyl,
--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
--S(O).sub.w--NR'R'' (where w is 0, 1 or 2),
--NR'--S(O).sub.w--C.sub.1-6alkyl (where w is 0, 1 or 2),
C(O)--NR'--C.sub.1-6alkyl, and
C(O)--C.sub.1-3alkylene-NR'--C(O)--O--C.sub.1-6alkyl;
[0286] R' is selected, independently for each occurrence, from H,
methyl, ethyl, cyclopropyl, cyclobutyl, and propyl;
[0287] R'' is selected, independently for each occurrence, from H,
methyl, ethyl, propyl (optionally substituted by hydroxyl), butyl
(optionally substituted by hydroxyl), --C(O)-methyl and
--C(O)-ethyl, or R' and R'' taken together with the nitrogen to
which they are attached may form a 4-6 membered heterocycle
optionally substituted by one or more substituents selected from
the group consisting of halogen, NH.sub.2,
--C(O)--O--C.sub.1-6alkyl, carboxy and C.sub.1-6alkyl;
[0288] wherein for each occurrence, C.sub.1-6alkyl,
C.sub.2-6alkenyl or C.sub.1-6alkynyl may be optionally substituted
with one, two, three or more substituents selected from the group
consisting of halogen, hydroxyl, nitro, cyano, carboxy,
C.sub.3-6cycloalkyl, C.sub.2-4alkenyl, C.sub.2-4alkynyl,
C.sub.1-3alkoxy, NR'R'', --NR'--S(O).sub.w--C.sub.1-2alkyl (where w
is 0, 1 or 2), NR'--C(O)--C.sub.1-3alkyl,
NR'--C(O)--O--C.sub.1-3alkyl, --NR'--S(O).sub.w, and
S(O).sub.w--NR'R'', or with one substituent which is a monocyclic
4-6 membered heterocycle in which 1-3 ring atoms are each
independently selected from the group consisting of N, O, and S;
C.sub.1-6alkoxy may be optionally substituted with one, two, three
or more substituents selected from the group consisting of halogen,
hydroxyl, nitro, cyano, carboxy, C.sub.1-3alkyl, NR'R'',
--NR'--S(O).sub.w--C.sub.1-2alkyl (where w is 0, 1 or 2), and
S(O).sub.w--NR'R'' (where w is 0, 1 or 2); C.sub.1-6alkylene may be
optionally substituted by a substituent selected from the group
consisting of C.sub.3-6cycloalkyl, hydroxyl, cyano, and
halogen;
[0289] and pharmaceutically acceptable salts thereof.
[0290] In some embodiments, a compound of Formula XV is represented
by Formula XVI:
##STR00026##
[0291] where for example the substituents are described above.
[0292] In some embodiments, a compound of Formula XV is represented
by Formula XVII:
##STR00027##
[0293] where for example the substituents are described above.
[0294] In some embodiments, a compound of Formula XV is represented
by Formula IXVIII:
##STR00028##
[0295] where for example the substituents are described above.
[0296] For example, in some embodiments of the compound of Formula
XV, XVI, XVII, or XVIII: each of R.sup.8, R.sup.9, and R.sup.10 is
independently selected for each occurrence from the group
consisting of hydrogen, methyl, trifluoromethyl, and halogen. In
some embodiments, each of R.sup.8, R.sup.9, and R.sup.10 is
hydrogen.
[0297] For example, in some embodiments of the compound of Formula
XV, XVI, XVII, or XVIII: R.sup.3 is hydrogen; R.sup.Z is hydrogen;
and/or R.sup.m and R.sup.m' are each hydrogen.
[0298] For example, in some embodiments of the compound of Formula
XV, XVI, XVII, or XVIII: R.sup.79 selected from the group
consisting of hydrogen, methyl, trifloromethyl, and halogen. In
some embodiments, R.sup.79 is hydrogen.
[0299] For example, in some embodiments of the compound of Formula
XV, XVI, XVII, or XVIII: R.sup.78 is selected from the group
consisting of hydrogen, halogen, cyano, CF.sub.3, C.sub.1-6alkyl,
carboxy, --C(O)--O--C.sub.1-6alkyl, --NR'R'', and phenyl
(optionally substituted with one, two, three or four substituents
each independently selected from the group consisting of
R.sup.73).
[0300] For example, in some embodiments of the compound of Formula
XVI or XVII: R.sup.1 and R.sup.2 are each independently selected
for each occurrence from the group consisting of hydrogen,
C.sub.1-6alkyl, C.sub.1-6haloalkyl, C.sub.3-6cycloalkyl, and
halogen, wherein each C.sub.1-6alkyl may be optionally substituted
with one substituent which is selected from the group consisting of
C.sub.3-6cycloalkyl and monocyclic 4-6 membered heterocycle in
which 1-3 ring atoms are each independently selected from the group
consisting of N, O, and S.
[0301] For example, in some embodiments of the compound of Formula
XVIII: R.sup.2 and R.sup.2b are independently selected at each
occurrence from C.sub.1-6alkyl, C.sub.2-6alkynyl, C.sub.2-6alkenyl,
and C.sub.3-6cycloalkyl; or R.sup.2 and R.sup.2b including the
carbon to which they are attached are joined to form a spiro fused
cycloalkyl ring of 3 to 7 carbons.
[0302] The present disclosure also provides a compound selected
from any one of Tables 1-6, or a pharmaceutically acceptable salt
thereof.
[0303] The present disclosure also provides a pharmaceutically
acceptable composition comprising: a compound of any one of
Formulas I to XVIII, or a pharmaceutically acceptable salt thereof,
and a pharmaceutically acceptable excipient.
[0304] The present disclosure also provides a pharmaceutically
acceptable composition comprising: a disclosed compound, or a
pharmaceutically acceptable salt thereof, and a pharmaceutically
acceptable excipient.
[0305] In a further aspect, a method for treating a hepatitis B
infection in a patient in need thereof is provided, comprising:
administering to a subject or patient an effective amount of a
disclosed compound, and/or administering a first disclosed compound
and optionally, an additional, different disclosed compound(s). In
another embodiment, the method comprises: administering to a
subject or patient a therapeutically effective amount of a
pharmaceutical composition comprising a disclosed compound, or two
or more disclosed compounds. In another embodiment, the method
comprises: administering to a subject or patient a therapeutically
effective amount of a pharmaceutical composition comprising a
disclosed compound. In another embodiment, the method comprises:
administering to a subject or patient a therapeutically effective
amount of a pharmaceutical composition comprising a compound of any
one of Formulas I to XIII.
[0306] For use in accordance with this aspect, the appropriate
dosage is expected to vary depending on, for example, the
particular compound employed, the mode of administration, and the
nature and severity of the infection to be treated as well as the
specific infection to be treated and is within the purview of the
treating physician. Usually, an indicated administration dose may
be in the range between about 0.1 to about 1000 .mu.g/kg body
weight. In some cases, the administration dose of the compound may
be less than 400 .mu.g/kg body weight. In other cases, the
administration dose may be less than 200 .mu.g/kg body weight. In
yet other cases, the administration dose may be in the range
between about 0.1 to about 100 .mu.g/kg body weight. The dose may
be conveniently administered once daily, or in divided doses up to,
for example, four times a day or in sustained release form.
[0307] A compound may be administered by any conventional route, in
particular: enterally, topically, orally, nasally, e.g. in the form
of tablets or capsules, via suppositories, or parenterally, e.g. in
the form of injectable solutions or suspensions, for intravenous,
intra-muscular, sub-cutaneous, or intra-peritoneal injection.
Suitable formulations and pharmaceutical compositions will include
those formulated in a conventional manner using one or more
physiologically acceptable carriers or excipients, and any of those
known and commercially available and currently employed in the
clinical setting. Thus, the compounds may be formulated for oral,
buccal, topical, parenteral, rectal or transdermal administration
or in a form suitable for administration by inhalation or
insufflation (either orally or nasally).
[0308] For oral administration, pharmaceutical compositions may
take the form of, for example, tablets or capsules prepared by
conventional means with pharmaceutically acceptable excipients such
as binding agents (e.g. pregelatinised maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g. lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e.g. magnesium stearate, talc or silica);
disintegrants (e.g. potato starch or sodium starch glycollate); or
welting agents (e.g. sodium lauryl sulphate). Tablets may be coated
by methods well known in the art. Liquid preparations for oral
administration may take the form of, for example, solutions, syrups
or suspensions, or they may be presented as a dry product for
constitution with water or other suitable vehicle before use. Such
liquid preparations may be prepared by conventional means with
pharmaceutically acceptable additives such as suspending agents
(e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible
fats); emulsifying agents (e.g. lecithin or acacia); non-aqueous
vehicles (e.g. almond oil, oily esters, ethyl alcohol or
fractionated vegetable oils); and preservatives (e.g. methyl or
propyl-p-hydroxybenzoates or sorbic acid). Preparations may also
contain buffer salts, flavoring, coloring and sweetening agents as
appropriate.
[0309] Preparations for oral administration may also be suitably
formulated to give controlled-release or sustained release of the
active compound(s) over an extended period. For buccal
administration the compositions may take the form of tablets or
lozenges formulated in a conventional manner known to the skilled
artisan.
[0310] A disclosed compound may also be formulated for parenteral
administration by injection e.g. by bolus injection or continuous
infusion. Formulations for injection may be presented in unit
dosage form e.g. in ampoules or in multi-dose containers, with an
added preservative. The compositions may take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles,
and may contain additives such as suspending, stabilizing and/or
dispersing agents. Alternatively, the compound may be in powder
form for constitution with a suitable vehicle, e.g. sterile
pyrogen-free water, before use. Compounds may also be formulated
for rectal administration as suppositories or retention enemas,
e.g. containing conventional suppository bases such as cocoa butter
or other glycerides.
[0311] In some cases, a disclosed compound may be administered as
part of a combination therapy in conjunction with one or more
antivirals. Example antivirals include nucleoside analogs,
interferon .alpha., and other assembly effectors, for instance
heteroaryldihydropyrimidines (HAPs) such as methyl
4-(2-chloro-4-fluorophenyl)-6-methyl-2-(pyridin-2-yl)-1,4-dihyd-
ropyrimidine-5-carboxylate (HAP-1). For example, provided herein is
a method of treating patient suffering from hepatitis B comprising:
administering to a subject a first amount of a disclosed compound
and a second amount of an antiviral, or other anti HBV agent, for
example a second amount of a second compound selected from the
group consisting of: another HBV caspid assembly promoter (such as
certain compounds disclosed herein or for example, GLS4, BAY
41-4109, AT-130, DVR-23 (e.g., as depicted below),
##STR00029##
NVR 3-778, NVR1221 (by code); and N890 (as depicted below):
##STR00030##
other CpAMs such as those disclosed in the following patent
applications hereby incorporated by reference: WO2014037480.
WO2014184328, WO2013006394, WO2014089296, WO2014106019,
WO2013102655, WO2014184350, WO2014184365, WO2014161888,
WO2014131847, WO2014033176, WO2014033167, and WO2014033170;
Nucleoside analogs interfering with viral polymerase, such as
entecavir (Baraclude), Lamivudine, (Epivir-HBV), Telbivudine
(Tyzeka, Sebivo), Adefovir dipivoxil (Hepsera), Tenofovir (Viread),
Tenofovir alafenamide fumarate (TAF), prodrugs of tenofavir (e.g.
AGX-1009), L-FMAU (Clevudine), LB80380 (Besifovir) and:
##STR00031##
viral entry inhibitors such as Myrcludex B and related lipopeptide
derivatives; HBsAg secretion inhibitors such as REP 9AC' and
related nucleic acid-based amphipathic polymers, HBF-0529
(PBHBV-001), PBHBV-2-15 as depicted below:
##STR00032##
and BM601 as depicted below:
##STR00033##
disruptors of nucleocapsid formation or integrity such as
NZ-4/W28F:
##STR00034##
cccDNA formation inhibitors: such as BSBI-25, CCC-0346, CCC-0975
(as depicted below):
##STR00035##
HBc directed transbodies such as those described in Wang Y, et al,
Transbody against hepatitis B virus core protein inhibits hepatitis
B virus replication in vitro, Int. Immunopharmacol (2014), located
at //dx.doi.org/10.1016/j.intimp.2015.01.028; antiviral core
protein mutant (such as Cp183-V124W and related mutations as
described in WO/2013/010069, WO2014/074906 each incorporated by
reference); inhibitors of HBx-interactions such as RNAi, antisense
and nucleic acid based polymers targeting HBV RNA; e.g., RNAi (for
example ALN-HBV, ARC-520, TKM-HBV, ddRNAi), antisense (ISIS-HBV),
or nucleic acid based polymer: (REP 2139-Ca); immunostimulants such
as Interferon alpha 2a (Roferon), Intron A (interferon alpha 2b),
Pegasys (peginterferon alpha 2a), Pegylated IFN 2b, IFN lambda 1a
and PEG IFN lambda 1a, Wellferon. Roferon, Infergen, lymphotoxin
beta agonists such as CBE11 and BS1); Non-Interferon Immune
enhancers such as Thymosin alpha-1 (Zadaxin) and Interleukin-7
(CYT107); TLR-7/9 agonists such as GS-9620, CYT003, Resiquimod;
Cyclophilin Inhibitors such as NVP018; OCB-030; SCY-635;
Alisporivir; NIM811 and related cyclosporine analogs; vaccines such
as GS-4774, TG1050, Core antigen vaccine; SMAC mimetics such as
birinapant and other IAP-antagonists; Epigenetic modulators such as
KMT inhibitors (EZH1/2, G9a, SETD7, Suv39 inhibitors), PRMT
inhibitors, HDAC inhibitors, SIRT agonists, HAT inhibitors, WD
antagonists (e.g. OICR-9429), PARP inhibitors, APE inhibitors, DNMT
inhibitors, LSD1 inhibitors, JMJD HDM inhibitors, and Bromodomain
antagonists; kinase inhibitors such as TKB1 antagonists, PLK1
inhibitors, SRPK inhibitors, CDK2 inhibitors, ATM & ATR kinase
inhibitors; STING Agonists; Ribavirin; N-acetyl cysteine; NOV-205
(BAM205); Nitazoxanide (Alinia). Tizoxanide; SB 9200 Small Molecule
Nucleic Acid Hybrid (SMNH); DV-601; Arbidol; FXR agonists (such as
GW 4064 and Fexaramin); antibodies, therapeutic proteins, gene
therapy, and biologics directed against viral components or
interacting host proteins.
[0312] In some embodiments, the disclosure provides a method of
treating a hepatitis B infection in a patient in need thereof,
comprising administering a first compound selected from any one of
the disclosed compounds, and one or more other HBV agents each
selected from the group consisting of HBV capsid assembly
promoters, HBF viral polymerase interfering nucleosides, viral
entry inhibitors, HBsAg secretion inhibitors, disruptors of
nucleocapsid formation, cccDNA formation inhibitors, antiviral core
protein mutant, HBc directed transbodies, RNAi targeting HBV RNA,
immunostimulants, TLR-7/9 agonists, cyclophilin inhibitors, HBV
vaccines, SMAC mimetics, epigenetic modulators, kinase inhibitors,
and STING agonists. In some embodiments, the disclosure provides a
method of treating a hepatitis B infection in a patient in need
thereof, comprising administering an amount of a disclosed
compound, and administering another HBV capsid assembly
promoter.
[0313] In some embodiments, the first and second amounts together
comprise a pharmaceutically effective amount. The first amount, the
second amount, or both may be the same, more, or less than
effective amounts of each compound administered as monotherapies.
Therapeutically effective amounts of a disclosed compound and
antiviral may be co-administered to the subject, i.e., administered
to the subject simultaneously or separately, in any given order and
by the same or different routes of administration. In some
instances, it may be advantageous to initiate administration of a
disclosed compound first, for example one or more days or weeks
prior to initiation of administration of the antiviral. Moreover,
additional drugs may be given in conjunction with the above
combination therapy.
[0314] In another embodiment, a disclosed compound may be
conjugated (e.g., covalently bound directly or through molecular
linker to a free carbon, nitrogen (e.g. an amino group), or oxygen
(e.g. an active ester) of a disclosed compound), with a detection
moiety, e.g. a fluorophore moiety (such a moiety may for example
re-emit a certain light frequency upon binding to a virus and/or
upon photon excitation. Contemplated fluorophores include
AlexaFluor.RTM. 488 (Invitrogen) and BODIPY FL (Invitrogen), as
well as fluorescein, rhodamine, cyanine, indocarbocyanine,
anthraquinones, fluorescent proteins, aminocoumarin,
methoxycoumarin, hydroxycoumarin, Cy2, Cy3, and the like. Such
disclosed compounds conjugated to a detection moiety may be used in
e.g. a method for detecting HBV or biological pathways of HBV
infection, e.g., in vitro or in vivo; and/or methods of assessing
new compounds for biological activity.
EXAMPLES
[0315] The compounds of Groups I-IV described herein can be
prepared in a number of ways based on the teachings contained
herein and synthetic procedures known in the art. In the
description of the synthetic methods described below, it is to be
understood that all proposed reaction conditions, including choice
of solvent, reaction atmosphere, reaction temperature, duration of
the experiment and workup procedures, can be chosen to be the
conditions standard for that reaction, unless otherwise indicated.
It is understood by one skilled in the art of organic synthesis
that the functionality present on various portions of the molecule
should be compatible with the reagents and reactions proposed.
Substituents not compatible with the reaction conditions will be
apparent to one skilled in the art, and alternate methods are
therefore indicated. The starting materials for the examples are
either commercially available or are readily prepared by standard
methods from known materials. At least some of the compounds
identified as "intermediates" herein are contemplated as compounds
of the invention.
Compounds of Group I:
Example 1: Synthesis of 11-oxo-10, 11-dihydrodibenzo[b,f]
[1,4]thiazepine-8-carboxylic acid 5, 5-dioxide (9)
##STR00036##
[0316] Synthesis of methyl 4-((2-(methoxycarbonyl) phenyl)
thio)-3-nitrobenzoate (3)
##STR00037##
[0318] To a stirred solution of methyl 4-fluoro-3-nitrobenzoate 2
(30 g, 150.67 mmol) in DMF (300 mL) under inert atmosphere were
added cesium carbonate (58.76 g, 180.8 mmol) and methyl
2-mercaptobenzoate 1 (22.6 mL, 165.47 mmol) at RT; heated to
55-60.degree. C. and stirred for 2 h. The reaction was monitored by
TLC; after completion of the reaction, the reaction mixture was
diluted with water (1500 mL) and the precipitated solid was
filtered to obtain the crude. The crude was washed with water (500
mL), hexane (200 mL) and dried in vacuo to afford compound 3 (48.8
g, 93%) as yellow solid. TLC: 20% EtOAc/hexanes (R.sub.f: 0.4);
.sup.1H NMR (CDCl.sub.3, 400 MHz): .delta. 8.85 (s, 1H), 7.99-7.92
(m, 2H), 7.66-7.56 (m, 3H), 6.93 (d, J=8.6 Hz, 1H), 3.94 (s, 3H),
3.79 (s, 3H).
Synthesis of methyl 3-amino-4-((2-(methoxycarbonyl) phenyl) thio)
benzoate (4)
##STR00038##
[0320] To a stirred solution of compound 3 (48 g, 138.32 mmol) in
MeOH (1000 mL) under inert atmosphere was added 10% Pd/C (20 g,
wet) at RT under hydrogen atmosphere in an autoclave (100 psi
pressure) and stirred for 24 h. The reaction was monitored by TLC;
after completion of the reaction, the reaction mixture was filtered
through celite, washed with 50% MeOH/CH.sub.2Cl.sub.2 (500 mL). The
filtrate was removed in vacuo to obtain the crude which as
triturated with diethyl ether (200 mL), washed with hexane (200 mL)
and dried in vacuo to afford compound 4 (40 g, 91%) as yellow
solid. TLC: 10% EtOAc/hexanes (R.sub.f: 0.3); .sup.1H NMR
(DMSO-d.sub.6, 400 MHz): .delta. 7.95 (dd, J=7.8, 1.4 Hz, 1H),
7.48-7.35 (m, 3H), 7.23 (td, J=7.5, 1.1 Hz, 1H), 7.15 (dd, J=8.0,
1.8 Hz, 1H), 6.66 (dd, J=8.2, 0.8 Hz, 1H), 5.67 (br s, 2H), 3.88
(s, 3H), 3.84 (s, 3H).
Synthesis of 3-amino-4-((2-carboxyphenyl) thio) benzoic acid
(5)
##STR00039##
[0322] To a stirred solution of compound 4 (40 g, 126.18 mmol) in
THF:H.sub.2O (5:1, 400 mL) was added lithium hydroxide monohydrate
(26 g, 619.0 mmol) at 0.degree. C.; warmed to RT and stirred for 48
h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The pH of the
residue was acidified with 2 N HCl to .about.2. The precipitated
solid was filtered and dried in vacuo to afford compound 5 (34.6 g,
95%) as an off-white solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.1);
.sup.1H NMR (DMSO-d.sub.6, 500 MHz): .delta. 13.00 (br s, 2H), 7.93
(dd, J=7.7, 1.0 Hz, 1H), 7.42 (s, 1H), 7.40-7.31 (m, 2H), 7.18 (t,
J=7.4 Hz, 1H), 7.13 (dd, J=8.0, 1.6 Hz, 1H), 6.61 (d, J=7.8 Hz,
1H), 5.55 (br s, 2H).
Synthesis of 11-oxo-10, 11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxylic acid (6)
##STR00040##
[0324] To a stirred solution of compound 5 (31 g, 107.26 mmol) in
THF (600 mL) under inert atmosphere was added CDI (86.88 g, 536.29
mmol) at 0.degree. C.; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was acidified with 2 N HCl to pH.about.4. The
obtained solid was filtered and further dried by using toluene
(2.times.200 mL) to afford compound 6 (26 g, 90%) as white solid.
TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.3); .sup.1H NMR
(DMSO-d.sub.6, 400 MHz): .delta. 13.22 (br s, 1H), 10.81 (s, 1H),
7.78 (s, 1H), 7.72-7.64 (m, 3H), 7.57-7.44 (m, 3H).
Synthesis of methyl 11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxylate (7)
##STR00041##
[0326] To a stirred solution of 6 (500 mg, 1.84 mmol) in
MeOH:CH.sub.2Cl.sub.2 (1:1, 20 mL) under argon atmosphere was added
CH.sub.2N.sub.2 (in situ prepared using N-nitrosomethyl urea (0.95
g, 9.2 mmol)+KOH (0.51 g, 9.22 mmol) at 0.degree. C.; warmed to RT
and stirred for 1 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 20% EtOAc/hexanes to afford compound 7 (450
mg, 86%) as white solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.5);
.sup.1H-NMR (DMSO-d.sub.6, 500 MHz): .delta. 10.82 (s, 1H), 7.82
(s, 1H), 7.75-7.69 (m, 3H), 7.58-7.63 (m, 3H), 3.82 (s, 3H).
Synthesis of methyl 11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxylate 5, 5-dioxide (8)
##STR00042##
[0328] To a stirred solution of 7 (5 g, 17.54 mmol) in acetic acid
(25 mL) was added 30% aqueous hydrogen peroxide (100 mL) at
0.degree. C.; warmed to 50.degree. C. and stirred for 72 h. The
reaction was monitored by TLC; after completion of the reaction,
the obtained solid was filtered, washed with water (100 mL), 10%
EtOAc/hexanes (100 mL) and dried in vacuo to afford compound 8 (3.5
g, 64%) as white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2 (R.sub.f:
0.3); .sup.1H NMR (DMSO-d.sub.6, 500 MHz): .delta. 11.58 (s, 1H),
8.09 (d, J=8.4 Hz, 1H), 8.01-7.95 (m, 3H), 7.93-7.83 (m, 3H), 3.88
(s, 3H);
Synthesis of 11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxylic acid 5, 5-dioxide (9)
##STR00043##
[0330] To a stirred solution of compound 8 (3.5 g, 11.04 mmol) in a
mixture of THF:MeOH:H.sub.2O (2:2:1, 25 mL) was added lithium
hydroxide monohydrate (1.3 g, 33.12 mmol) portion wise for 10 min
at 0.degree. C.; warmed to RT and stirred for 3 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo. The residue was diluted with water (20 mL)
and acidified with 1 N HCl to pH.about.2. The obtained solid was
filtered, washed with isopropyl alcohol (15 mL) and dried in vacuo
to obtain compound 9 (2.8 g, 84%) as white solid. TLC: 5%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.1); .sup.1H NMR (DMSO-d.sub.6,
400 MHz): .delta. 13.65 (br s, 1H), 11.55 (s, 1H), 8.07 (d, J=8.3
Hz, 1H), 8.03-7.82 (m, 6H).
Example 2: Synthesis of tert-butyl 4-(5-(aminomethyl) thiazol-2-yl)
piperidine-1-carboxylate (18)
##STR00044##
[0331] Synthesis of tert-butyl 4-(5-(((tert-butyldimethylsilyl)
oxy) methyl) thiazol-2-yl)-4-hydroxypiperidine-1-carboxylate
(12)
[0332] To a stirring solution 5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazole 10 (5 g, 21.83 mmol) in dry THF (100 mL) under
inert atmosphere was added n-butyl lithium (1.6 M solution in
hexane, 22.0 mL, 1.2 mmol) dropwise for 15 min at -78.degree. C.
and stirred for 2 h. To this was added tert-butyl
4-oxopiperidine-1-carboxylate 11 (4.8 g, 24.01 mmol) at -78.degree.
C. and stirred at the same temperature for 2 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was quenched with saturated ammonium chloride (20 mL) and
extracted with EtOAc (2.times.100 mL). The combined organic
extracts were dried over sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel column chromatography using 20-30% EtOAc/hexanes to afford
compound 12 (7 g, 75%) as yellow liquid. TLC: 30% EtOAc/hexanes
(R.sub.f: 0.5); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta. 7.54
(s, 1H), 4.84 (s, 2H), 3.83-3.77 (m, 2H), 3.19-3.00 (m, 1H),
1.94-1.85 (m, 2H), 1.70-1.65 (m, 2H), 1.41 (s, 9H), 1.35-1.21 (m,
2H), 0.87 (s, 9H), 0.08 (s, 6H); LC-MS: 87.69%; 429.2 (M+1).sup.+;
(column; Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT
3.20 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2
mL/min).
Synthesis of tert-butyl 4-(5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazol-2-yl)-4-(((methylthio) carbonothioyl) oxy)
piperidine-1-carboxylate (13)
[0333] To a stirring solution of compound 12 (6 g, 14.02 mmol) in
THF (50 mL) under argon atmosphere was added sodium hydride (60%,
1.29 g, 28.04 mmol) portion wise for 10 min at 0.degree. C. and
stirred for 20 min. To this was added carbon disulfide (2.13 g,
28.04 mmol) at 0.degree. C. and stirred for 1 h, followed by
addition of MeI (4.03 mL, 28.04 mmol) stirred at the same
temperature for 1 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was quenched with
ice-cold water (50 mL) and extracted with EtOAc (2.times.150 mL).
The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to crude compound 13 (12 g) as
yellow solid. Which was carried forward for next step without
further purification. TLC: 30% EtOAc/hexanes (R.sub.f: 0.2).
Synthesis of mixture of tert-butyl 4-(5-(((tert-butyldimethylsilyl)
oxy) methyl) thiazol-2-yl) piperidine-1-carboxylate (14)
[0334] To a stirring solution of compound 13 (6 g, crude) in
Toluene (100 mL) under argon atmosphere were added tributylstannane
(9.52 mL, 75.77 mmol), AIBN (379 mg, 2.31 mmol) at 0.degree. C.;
heated to reflux and stirred for 16 h. The reaction was monitored
by TLC; after completion of the reaction, the volatiles were
concentrated in vacuo. The residue was diluted with EtOAc (150 mL),
washed with saturated potassium fluoride solution (100 mL), brine
(100 mL). The organic extract was dried over sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
was purified through silica gel column chromatography using 5%
EtOAc/hexanes to afford mixture of compound 14 (1 g) as yellow
sticky solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.4); LC-MS: 75.86%;
413.4 (M+1).sup.+; (Column; X-select CSH C-18 (150.times.4.6 mm,
3.5 .mu.m); RT 5.66 min. 2.5 mM NH.sub.4OAc: ACN, 0.8 ml/min).
Synthesis of Mixture of tert-butyl 4-(5-(hydroxymethyl)
thiazol-2-yl) piperidine-1-carboxylate (15)
[0335] To a stirring solution of compound 14 (1 g, 2.42 mmol) in
THF (30 mL) under inert atmosphere was added cesium fluoride (735
mg, 4.84 mmol), tetrabutylammonium fluoride (1.0 M solution in THF,
1.20 mL, 1.21 mmol) at 0.degree. C.; warmed to RT and stirred for 2
h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was quenched with ice-cold water (75
mL) and extracted with EtOAc (2.times.50 mL). The combined organic
extracts were washed with brine (75 mL) and dried over sodium
sulfate, filtered and concentrated in vacuo to obtain the crude.
The crude was purified through silica gel column chromatography
using 3% MeOH/CH.sub.2Cl.sub.2 to afford crude compound 15 (500 mg)
as off-white sticky solid. TLC: 30% EtOAc/hexanes (R.sub.f:
0.4).
Synthesis of tert-butyl 4-(5-(((methylsulfonyl) oxy) methyl)
thiazol-2-yl) piperidine-1-carboxylate (16)
[0336] To a stirring solution of compound 15 (500 mg, 1.67 mmol) in
CH.sub.2Cl.sub.2 (30 mL) under inert atmosphere were added triethyl
amine (1.2 mL, 8.39 mmol), methanesulfonyl chloride (0.25 mL, 3.35
mmol) at 0.degree. C.; warmed to RT and stirred for 4 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was diluted with CH.sub.2Cl.sub.2 (75 mL)
washed with water (2.times.50 mL), brine (75 mL). The organic
extract was dried over sodium sulfate, filtered and concentrated in
vacuo to afford crude compound 16 (500 mg) as a pale-yellow syrup.
TLC: 30% EtOAc/(R.sub.f: 0.5).
Synthesis of tert-butyl 4-(5-(azidomethyl) thiazol-2-yl)
piperidine-1-carboxylate (17)
[0337] To a stirring solution of compound 16 (500 mg, mixture of
compounds) in DMF (10 mL) under inert atmosphere was added sodium
azide (259 mg, 3.99 mmol) at RT and stirred for 16 h. The reaction
was monitored by TLC; after completion, the reaction mixture was
diluted with water EtOAc (200 mL) and washed with water (100 mL)
and brine (75 mL). The combined organic extract was dried over
sodium sulphate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel column
chromatography using 20-30% EtOAc/hexanes to afford compound 17
(300 mg) as off-white sticky solid. TLC: 30% EtOAc/hexanes
(R.sub.f: 0.4); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta. 7.70
(s, 1H), 4.70 (s, 2H), 4.01-3.96 (m, 2H), 3.24-3.13 (m, 1H),
2.95-2.84 (m, 2H), 2.04-1.98 (m, 2H), 1.60-1.46 (m, 2H), 1.40 (s,
9H).
Synthesis of tert-butyl 4-(5-(aminomethyl) thiazol-2-yl)
piperidine-1-carboxylate (18)
[0338] To a stirring solution of compound 17 (300 mg, 0.92 mmol) in
MeOH (20 mL) under inert atmosphere was added 10% Pd/C (300 mg, 50%
wet) at RT and stirred under hydrogen atmosphere (balloon pressure)
for 16 h. The reaction was monitored by TLC; after completion of
the reaction, the reaction mixture was filtered through celite,
eluted with 10% MeOH/CH.sub.2Cl.sub.2 and the filtrate was
concentrated in vacuo to obtain the crude. The crude was purified
through silica gel column chromatography using 2-10%
MeOH/CH.sub.2Cl.sub.2 to afford compound 18 (200 mg, crude) as an
off-white sticky solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.42;
LC-MS: 63.48%; 298.0 (M+1).sup.+; (column; Ascentis Express C18,
(50.times.3.0 mm, 2.7 .mu.m); RT 1.64 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Example 3: Synthesis of (2-(3, 3-dimethylcyclopentyl) thiazol-5-yl)
methanamine hydrochloride (27)
##STR00045## ##STR00046##
[0339] Synthesis of 3, 3-dimethylcyclopentan-1-one (20)
[0340] To a stirring solution of copper iodide (12 g, 62.5 mmol) in
ether (200 mL) was added methyl lithium (65 mL, 104.1 mmol)
dropwise for 1 h at 0.degree. C. under inert atmosphere. The
reaction mixture was stirred at 0.degree. C. for 2 h.
[0341] To a stirring solution of 3-methylcyclopent-2-en-1-one 19 (5
g, 52 mmol) in ether (50 mL) was added the above reaction mixture
drop wise at 0.degree. C. under inert atmosphere. The reaction
mixture was stirred at 0.degree. C. for 2 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was poured in to sodium sulphate hydrate (50 mL) and
stirred for 30 min. The reaction mixture was filtered through
celite. The filtrate was dried over sodium sulphate and
concentrated in vacuo to obtain the crude. The crude was purified
through column chromatography using 2-3% EtOAc/Hexane to afford
compound 20 (1.2 g, 20%) as a colorless liquid. .sup.1H NMR (500
MHz, DMSO-d.sub.6): .delta. 2.23 (t, J=7.8 Hz, 2H), 1.99 (s, 2H),
1.71 (t, J=7.8 Hz, 2H), 1.05 (s, 6H).
Synthesis of 1-(5-(((tert-butyldimethylsilyl) oxy) methyl)
thiazol-2-yl)-3, 3-dimethylcyclopentan-1-ol (21)
[0342] To a stirring solution 5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazole 10 (2.04 g, 8.92 mmol) in dry THF (5 mL) under
inert atmosphere was added n-butyl lithium (1.6 M solution in
hexane, 6.4 mL, 10.25 mmol) dropwise for 10 min at -78.degree. C.
and stirred for 1 h. To this was added compound 20 (500 mg, 4.46
mmol) in THF (5 mL) at -78.degree. C. and stirred at the same
temperature for 16 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was quenched with
saturated ammonium chloride solution (25 mL) and extracted with
EtOAc (2.times.100 mL). The combined organic extracts were dried
over sodium sulfate, filtered and concentrated in vacuo to obtain
the crude. The crude was purified through silica gel column
chromatography using 5% EtOAc/hexanes to afford compound 21 (300
mg, 65%) as colorless liquid. TLC: 10% EtOAc/hexanes (R.sub.f:
0.6)(eluted trice); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta.
7.52 (s, 1H), 5.84 (s, 1H), 4.82 (s, 2H), 2.24-2.16 (m, 1H),
2.05-2.01 (m, 1H), 1.95-1.85 (m, 1H), 1.81-1.70 (m, 2H), 1.59-1.51
(m, 1H), 1.15 (s, 3H), 1.06 (s, 3H), 0.87 (s, 9H), 0.07 (s, 6H);
LC-MS: 94.08%; 342.1 (M+1).sup.+ (column; Ascentis Express C-18,
(50.times.3.0 mm, 2.7 .mu.m); RT 3.22 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of 5-(((tert-butyldimethylsilyl) oxy) methyl)-2-(3,
3-dimethylcyclopent-1-en-1-yl) thiazole (22)
[0343] To a stirring solution of compound 21 (100 mg, 0.30 mmol) in
CH.sub.2Cl.sub.2 (10 mL) under inert atmosphere were added triethyl
amine (0.40 mL, 2.92 mmol), methane sulfonyl chloride (0.11 mL,
1.46 mmol) at 0.degree. C.; stirred RT for 3 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was quenched with water (20 mL) and extracted with
CH.sub.2Cl.sub.2 (2.times.20 mL). The combined organic extracts
were washed with sodium bicarbonate solution (20 mL), brine (20 mL)
dried over sodium sulfate, filtered and concentrated in vacuo to
obtain the crude compound 22 (100 mg) as brown liquid. TLC: 10%
EtOAc/Hexane (R.sub.f: 0.7); .sup.1H NMR (500 MHz, DMSO-d.sub.6):
.delta. 7.61 (s, 1H), 6.26 (s, 1H), 4.86 (s, 2H), 2.81-2.73 (m,
2H), 1.80-1.71 (m, 2H), 1.12 (s, 6H), 0.87 (s, 9H), 0.08 (s, 6H);
LC-MS: 88.39%; 324.2 (M+1).sup.+; (column; Ascentis Express C-18,
(50.times.3.0 mm, 2.7 .mu.m); RT 3.78 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of 5-(((tert-butyldimethylsilyl) oxy) methyl)-2-(3,
3-dimethylcyclopentyl) thiazole (23)
[0344] To a stirring solution of compound 22 (100 mg, 0.30 mmol) in
methanol (10 mL) was added 10% Pd/C (50% wet, 50 mg) at RT under
inert atmosphere. The reaction mixture was stirred under hydrogen
atmosphere (balloon pressure) at RT for 24 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was filtered through a pad of celite and the celite bed was
washed with 5% MeOH/CH.sub.2Cl.sub.2 (20 mL). The filtrate was
concentrated in vacuo to obtain the crude. The crude was purified
through column chromatography using 5% EtOAc/hexanes to afford
compound 23 (20 mg, 15%) as colorless liquid. TLC: 20%
EtOAc/hexanes (R.sub.f: 0.7); .sup.1H NMR (500 MHz, DMSO-d.sub.6):
.delta. 7.49 (s, 1H), 4.83 (s, 2H), 3.63-3.51 (m, 1H), 2.25-2.11
(m, 1H), 1.93-1.85 (m, 2H), 1.66-1.44 (m, 3H), 1.06 (s, 3H), 1.03
(s, 3H), 0.86 (s, 9H), 0.06 (s, 6H); LC-MS: 80.96%; 326.1
(M+1).sup.+; (column; Ascentis Express C-18, (50.times.3.0 mm, 2.7
.mu.m); RT 3.72 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 mL/min).
Synthesis of (2-(3, 3-dimethylcyclopentyl) thiazol-5-yl) methanol
(24)
[0345] To a stirred solution of compound 23 (70 mg, 0.21 mmol) in
THF (10 mL) under argon atmosphere was added TBAF (0.6 mL, 0.64
mmol), at 0.degree. C.; stirred at RT for 2 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was diluted with water (20 mL) and extracted with EtOAc
(2.times.20 mL). The combined organic layer was washed with water
and dried over sodium sulfate, filtered and concentrated in vacuo
to obtain the crude. The crude was purified through silica gel
column chromatography using 30% EtOAc/Hexane to afford compound 24
(50 mg, 90%) as colorless liquid. TLC: 20% EtOAc/Hexane (R.sub.f:
0.1); .sup.1H NMR (500 MHz, DMSO-d.sub.6): .delta. 7.44 (s, 1H),
5.41 (t, J=5.8 Hz, 1H), 4.59 (d, J=5.8 Hz, 2H), 3.59-3.52 (m, 1H),
2.23-2.06 (m, 1H), 1.93-1.77 (m, 2H), 1.64-1.41 (m, 3H), 1.05 (s,
3H), 1.02 (s, 3H); LC-MS: 98.22%; 326.1 (M+1).sup.+; (column;
Ascentis Express C-18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.06 min.
0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of 5-(chloromethyl)-2-(3, 3-dimethylcyclopentyl) thiazole
(25)
[0346] To a stirring solution of compound 24 (600 mg, 2.84 mmol) in
CH.sub.2Cl.sub.2 (5 mL) under inert atmosphere were added triethyl
amine (1.19 mL, 8.53 mmol), methanesulfonyl chloride (0.33 mL, 4.26
mmol) at 0.degree. C.; stirred at 0.degree. C. for 2 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was quenched with water (30 mL) and extracted
with CH.sub.2Cl.sub.2 (2.times.30 mL). The combined organic
extracts were washed with sodium bicarbonate solution (20 mL),
brine (30 mL) dried over sodium sulfate, filtered and concentrated
in vacuo to obtain the crude compound 25 (500 mg, 82%) as white
solid. This crude material was taken to next step without further
purification. TLC: 30% EtOAc/Hexane (R.sub.f: 0.2); .sup.1H NMR
(500 MHz, DMSO-d.sub.6): .delta. 7.65 (s, 1H), 5.02 (s, 2H),
3.64-3.50 (m, 1H), 2.22-2.09 (m, 1H), 1.92-1.77 (m, 2H), 1.65-1.37
(m, 3H), 1.04 (s, 3H), 1.01 (s, 3H); LC-MS: 77.70%; 230
(M+1).sup.+; (column; Ascentis Express C-18, (50.times.3.0 mm, 2.7
.mu.m); RT 2.93 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 ml/min).
Synthesis of 5 5-(azidomethyl)-2-(3, 3-dimethylcyclopentyl)
thiazole (26)
[0347] To a stirring solution of compound 25 (500 mg, 1.73 mmol) in
DMF (5 mL) under inert atmosphere was added sodium azide (225 mg,
3.46 mmol) at 0.degree. C.; warmed to RT and stirred for 3 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was diluted with water (20 mL) and extracted
with EtOAc (2.times.20 mL). The combined organic extracts were
dried over sodium sulphate, filtered and concentrated in vacuo to
obtain crude compound 26 (500 mg) as an off-white solid. This crude
material was taken to next step without further purification. TLC:
30% EtOAc/hexanes (R.sub.f: 0.3); .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 7.65 (s, 1H), 4.68 (s, 2H), 3.72-3.51 (m,
1H), 2.28-2.13 (m, 1H), 1.95-1.84 (m, 2H), 1.67-1.43 (m, 3H), 1.06
(s, 3H), 1.04 (s, 3H); LC-MS: 88.96%; 237.1 (M+1).sup.+; (column;
Ascentis Express C-18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.90 min.
0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of (2-(3, 3-dimethylcyclopentyl) thiazol-5-yl)
methanamine (27)
[0348] To a stirring solution of compound 26 (500 mg, 2.11 mmol) in
THF:H.sub.2O (4:1, 10 mL) was added triphenyl phosphine (667 mg,
2.54 mmol) at 0.degree. C.; warmed to RT and stirred for 2 h. The
reaction was monitored by TLC; after completion of the reaction;
the volatiles were removed in vacuo to obtain the crude amine (450
mg crude).
[0349] To the above crude amine (450 mg) in 4 N HCl in 1, 4-dioxane
(10 mL) under inert atmosphere was stirred at RT for 1 h. The
reaction was monitored by TLC; after completion of the reaction,
the volatiles were removed in vacuo. The crude washed with
triturated with EtOAc (2.times.5 mL) and dried in vacuo to afford
compound 27 (200 mg, as HCl salt, 45%) as a white solid. TLC: 30%
EtOAc/Hexane (R.sub.f: 0.2); .sup.1H NMR (500 MHz, DMSO-d.sub.6):
.delta. 8.40 (br s, 3H), 7.66 (s, 1H), 4.21 (s, 2H), 3.61-3.56 (m,
1H), 2.20-2.15 (m, 1H), 1.93-1.89 (m, 1H), 1.84-1.80 (m, 1H),
1.61-1.44 (m, 3H), 1.03 (s, 3H), 1.00 (s, 3H); LC-MS: 94.57%; 211.2
(M+1).sup.+; column; Kinetex EVO C-18 (50.times.3.0 mm, 2.6 .mu.m);
RT 2.75 min. 2.5 mM NH.sub.4OAc: ACN, 0.8 mL/min).
Example 4: Synthesis of (2-(morpholinomethyl) thiazol-5-yl)
methanamine (34)
##STR00047##
[0350] Synthesis of 4-((5-(((tert-butyldimethylsilyl) oxy) methyl)
thiazol-2-yl) methyl) morpholine (30)
[0351] To a stirring solution of compound 28 (2 g, 7.78 mmol) in 1,
2-dichloroethane (20 mL) under inert atmosphere were added
morpholine 29 (812 mg, 9.33 mmol) and sodium triacetoxyborohydride
(3.3 g, 15.56 mmol) at 0.degree. C.; warmed to RT and stirred for
16 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was quenched with ice-cold water
(100 mL) and extracted with CH.sub.2Cl.sub.2 (2.times.100 mL). The
combined organic extracts were dried over sodium sulfate, filtered
and concentrated in vacuo to obtain the crude. The crude was
purified through silica gel column chromatography using 10-50%
EtOAc/hexanes to afford compound 30 (1.3 g, 51%) as colorless thick
syrup. TLC: 30% EtOAc/hexanes (R.sub.f: 0.1); .sup.1H NMR
(DMSO-d.sub.6, 500 MHz): .delta. 7.54 (s, 1H), 4.85 (s, 2H), 3.76
(s, 2H), 3.62-3.53 (m, 4H), 2.49-2.45 (m, 4H), 0.86 (s, 9H), 0.07
(s, 6H); LC-MS: 94.28%; 329.0 (M+1).sup.+; (column; Ascentis
Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.06 min. 0.025% Aq.
TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of (2-(morpholinomethyl) thiazol-5-yl) methanol (31)
[0352] To a stirring solution of compound 30 (1.3 g, 3.96 mmol) in
THF (30 mL) under inert atmosphere was added tetrabutylammonium
fluoride (1.0 M solution in THF, 3.96 mL, 5.94 mmol) at 0.degree.
C.; warmed to RT and stirred for 2 h. The reaction was monitored by
TLC; after completion of the reaction, the reaction mixture was
quenched with water (100 mL) and extracted with EtOAc (2.times.100
mL). The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
was purified through silica gel flash column chromatography using
10-50% EtOAc/hexanes to afford compound 31 (700 mg, 82%) as thick
syrup. TLC: 50% EtOAc/hexanes (R.sub.f: 0.1); .sup.1H-NMR
(DMSO-d.sub.6, 400 MHz): .delta. 7.51 (s, 1H), 5.48 (t, J=5.7 Hz,
1H), 4.63 (dd, J=5.6, 0.8 Hz, 2H), 3.76 (s, 2H), 3.61-3.57 (m, 4H),
2.49-2.45 (m, 4H); LC-MS: 98.60%; 215.0 (M+1).sup.+; (column;
Kinetex EVO C-18 (50.times.3.0 mm, 2.6 .mu.m); RT 0.94 min. 2.5 mM
Aq. NH.sub.4OOCH+5% ACN:ACN+5% 2.5 mM Aq.NH.sub.4OOCH, 0.8
mL/min).
Synthesis of 4-((5-(chloromethyl) thiazol-2-yl) methyl) morpholine
(32)
[0353] To a stirring solution of compound 31 (700 mg, 3.25 mmol) in
CH.sub.2Cl.sub.2 (20 mL) under inert atmosphere were added triethyl
amine (1.38 mL, 9.74 mmol) at 0.degree. C. and stirred for 10 min.
To this was added methanesulfonyl chloride (0.3 mL, 3.90 mmol) at
0.degree. C.; warmed to RT and stirred for 2 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was quenched with saturated NaHCO.sub.3 solution (50 mL)
and extracted with EtOAc (2.times.100 mL). The combined organic
extracts were dried over sodium sulfate, filtered and concentrated
in vacuo to afford crude compound 32 (700 mg, 93%) as a pale brown
liquid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.4); LC-MS: 89.79%; 232.9
(M+1).sup.+; (column; Ascentis Express C-18, (50.times.3.0 mm, 2.7
.mu.m); RT 0.58 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 mL/min).
Synthesis of 4-((5-(azidomethyl) thiazol-2-yl) methyl) morpholine
(33)
[0354] To a stirring solution of compound 32 (700 mg, 3.01 mmol) in
DMF (20 mL) under inert atmosphere was added sodium azide (580 mg,
9.05 mmol) at 0.degree. C.; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC and LC-MS; after completion of the
reaction, the reaction mixture was diluted with ice-cold water (100
mL) and extracted with EtOAc (2.times.100 mL). The combined organic
extracts were dried over sodium sulphate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel flash column chromatography using 10-30% EtOAc/hexanes to
afford compound 33 (400 mg, 70%) as colorless thick syrup. TLC: 30%
EtOAc/hexanes (R.sub.f: 0.5); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz):
.delta. 7.70 (s, 1H), 4.70 (s, 2H), 3.80 (s, 2H), 3.62-3.58 (m,
4H), 2.51-2.49 (m, 4H).
Synthesis of (2-(morpholinomethyl) thiazol-5-yl) methanamine
(34)
[0355] To a stirring solution of compound 33 (400 mg, 1.67 mmol) in
THF:H.sub.2O (4:1, 10 mL) was added triphenyl phosphine (877 mg,
3.34 mmol) at RT and stirred for 16 h. The reaction was monitored
by TLC and LC-MS; after completion of the reaction, the reaction
mixture was quenched with water (100 mL) and extracted with EtOAc
(2.times.100 mL). The combined organic extracts were dried over
sodium sulphate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel flash column
chromatography using 4-5% MeOH/CH.sub.2Cl.sub.2 to afford compound
34 (200 mg, 56%) as colorless thick syrup. TLC: 10%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2); .sup.1H-NMR (DMSO-d.sub.6,
400 MHz): .delta. 7.48 (s, 1H), 3.90 (s, 2H), 3.74 (s, 2H),
3.63-3.56 (m, 4H), 2.97-2.72 (m, 2H), 2.48-2.45 (m, 4H); LC-MS:
99.68%; 213.9 (M+1).sup.+; (Column; X-select CSH C-18
(150.times.4.6 mm, 3.5 .mu.m); RT 1.31 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.0 mL/min).
Example 5: Compound Preparation
[0356] Acid 9 was synthesized as mentioned above and converted to
final products with prepared amines employing typical procedures A
and the results are captured in the Table 1:
##STR00048##
Typical Procedure A:
[0357] To a stirred solution of compound 9 (100 mg, 0.36 mmol) in
DMF (5 mL) under inert atmosphere were added EDCI.HCl (105 mg, 0.55
mmol), HOBt (75 mg, 0.55 mmol), compound 18 (73 mg) and
diisopropylethylamine (0.1 mL, 1.10 mmol) at 0.degree. C. warmed to
RT and stirred for 16 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo to
obtain the crude. The crude was either directly dried in vacuo or
triturated or purified through silica gel column chromatography to
afford the desired compound.
TABLE-US-00001 TABLE 1 Synthesis of compounds from various acids
and various amines Procedure, Com- Inter- Rx. Mass pound mediate,
Yield Spec. Mass Spec. No. Structure amine (%) Found Calculated
.sup.1H-NMR 926-A ##STR00049## A.sup.a, 9, 18 36 581.1 (M +
1).sup.+ 582.16 for C.sub.28H.sub.30N.sub.4O.sub.6S.sub.2 .sup.1H
NMR ((400 MHz, DMSO-d.sub.6): .delta. 11.51 (s, 1H), 9.38 (t, J =
5.8 Hz, 1H), 8.05 (d, J = 8.3 Hz, 1H), 7.98 (dt, J = 7.5, 1.3 Hz,
2H), 7.93-7.82 (m, 3H), 7.79 (dd, J = 18.3, 1.5 Hz, 1H), 7.57 (s,
1H), 4.60 (d, J = 5.5 Hz, 2H), 3.98-3.93 (m, 2H), 3.16-3.06 (m,
1H), 2.95-2.78 (m, 2H), 1.99-1.93 (m, 2H), 1.55-1.42 (m, 2H), 1.39
(s, 9H); 927 ##STR00050## A, 9, 34 40 499.0 (M + 1).sup.+ 498.10
for C.sub.23H.sub.22N.sub.4O.sub.5S2 .sup.1H-NMR (400 MHz,
DMSO-d.sub.6): .delta. 11.51 (s, 1H), 9.39 (t, J = 5.6 Hz, 1H),
8.05 (br d, J = 8.2 Hz, 1H), 7.98 (t, J = 7.0 Hz, 2H), 7.93-7.77
(m, 4H), 7.57 (s, 1H), 4.61 (br d, J = 4.9 Hz, 2H), 3.73 (s, 2H),
3.59-3.54 (m, 4H), 2.47-2.43 (m, 4H); 979 ##STR00051## A, 9, 27 62
496.1 (M + 1).sup.+ 495.13 for C25H25N3O4S2 .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 11.51 (s, 1H), 9.37 (t, J = 5.7 Hz, 1H),
8.05 (d, J = 8.2 Hz, 1H), 8.00-7.96 (m, 2H), 7.92-7.72 (m, 4H),
7.52 (s, 1H), 4.59 (d, J = 5.6 Hz, 2H), 3.58-3.46 (m, 1H),
2.23-2.06 (m, 1H), 1.94-1.73 (m, 2H), 1.66-1.40 (m, 3H), 1.04 (s,
3H), 1.01 (s, 3H); A.sup.a: EDCI (2 equiv), HOBt (2 equiv), DIPEA
(5 equiv);
Example 6: Synthesis of 884
##STR00052## ##STR00053##
[0358] Synthesis of methyl 4-((tert-butoxycarbonyl) amino)
cyclohexane-1-carboxylate (44)
[0359] To a stirring solution of 4-((tert-butoxycarbonyl) amino)
cyclohexane-1-carboxylic acid 43 (5 g, 19.45 mmol) in MeOH (25 mL)
under inert atmosphere was added diazomethane in diethyl ether
(freshly prepared by addition of N-nitrosomethyl urea (10 g, 97.25
mmol) to 50% KOH solution (100 mL) and diethylether (200 mL) at
0.degree. C.) at 0.degree. C.; warmed to RT and stirred for 4 h.
The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo to afford compound 44
(2 g, crude) as pale yellow solid. TLC: 30% EtOAc/hexanes (R.sub.f:
0.5); .sup.1H NMR (DMSO-d.sub.6, 400 MHz): .delta. 6.72 (br s, 1H),
3.59 (s, 3H), 2.51-2.45 (m, 2H), 1.93-1.81 (m, 2H), 1.62-1.47 (m,
4H), 1.45-1.33 (m, 11H).
Synthesis of tert-butyl (4-formylcyclohexyl) carbamate (45)
[0360] To a stirring solution of compound 44 (7 g, 25.88 mmol) in
dry THF (100 mL) under argon atmosphere was added
diisobutylaluminium hydride (1 M sol. in Toluene, 38.75 mL, 38.75
mmol) dropwise for 15 min at -78.degree. C. and stirred at the same
temperature for 2 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was quenched with
MeOH (10 mL) at -78.degree. C. and stirred for 30 min and added
saturated sodium potassium tartrate solution (50 mL) for 1 h. The
organic layer was separated and the aqueous layer was extracted
with diethyl ether (2.times.100 mL). The combined organic extracts
were dried over sodium sulfate, filtered and concentrated in vacuo
to obtain the crude. The crude was purified through silica gel
column chromatography using 20% EtOAc/hexanes to afford compound 45
(4 g, 64%) as colorless liquid. TLC: 30% EtOAc/hexanes (R.sub.f:
0.5).
Synthesis of tert-butyl (4-((5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazol-2-yl) (hydroxy) methyl) cyclohexyl) carbamate
(35)
[0361] To a stirring solution of 5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazole 10 (4 g, 17.47 mmol) in dry THF (100 mL) under
inert atmosphere was added n-butyl lithium (1.6 M solution in
hexane, 17.46 mL, 20.96 mmol) dropwise for 10 min at -78.degree. C.
and stirred for 1 h. To this was added tert-butyl
(4-formylcyclohexyl) carbamate 45 (4.63 mL, 20.96 mmol) at
-78.degree. C. and stirred at the same temperature for 2 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was quenched with saturated ammonium chloride
solution (30 mL) and extracted with EtOAc (2.times.100 mL). The
combined organic extracts were dried over sodium sulfate, filtered
and concentrated in vacuo to obtain the crude. The crude was
purified through silicagel column chromatography to afford compound
35 (3.5 g, 45%) as a pale-yellow liquid. TLC: 30% EtOAc/hexanes
(R.sub.f: 0.4); LC-MS: 75.02%, 21.60%; 457.0 (M+1).sup.+; (column;
Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.97, 3.15
min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of tert-butyl (4-((5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazol-2-yl)(((methylthio) carbonothioyl) oxy) methyl)
cyclohexyl) carbamate (36)
[0362] To a stirring solution of tert-butyl
(4-((5-(((tert-butyldimethylsilyl) oxy) methyl) thiazol-2-yl)
(hydroxy) methyl) cyclohexyl) carbamate 35 (3.5 g, 76.75 mmol) in
THF (50 mL) under argon atmosphere was added sodium hydride (60%,
614 mg, 15.35 mmol) portion wise for 10 min at 0.degree. C. and
stirred for 1 min. To this was added carbon disulfide (1.17 g,
15.35 mmol) at 0.degree. C. and stirred for 1 h, followed by
addition of methyl iodide (0.94 mL, 15.35 mmol) stirred at the same
temperature for 1 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was quenched with
ice-cold water (30 mL) and extracted with EtOAc (2.times.100 mL).
The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to crude compound 36 (5 g) as
yellow solid. This was carried forward for next step without
further purification. TLC: 30% EtOAc/hexanes (R.sub.f: 0.6).
Synthesis of text-butyl (4-((5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazol-2-yl) methyl) cyclohexyl) carbamate (37)
[0363] To a stirring solution of tert-butyl
(4-((5-(((tert-butyldimethylsilyl) oxy) methyl)
thiazol-2-yl)(((methylthio) carbonothioyl) oxy) methyl) cyclohexyl)
carbamate 36 (5 g, 9.16 mmol) in Toluene (100 mL) under argon
atmosphere were added tributylstannane (8.0 g, 27.47 mmol), AIBN
(751 mg, 4.58 mmol) at 0.degree. C.; heated to reflux and stirred
for 16 h. The reaction was monitored by TLC; after completion of
the reaction, the volatiles were concentrated in vacuo. The residue
was diluted with EtOAc (75 mL), washed with saturated potassium
fluoride solution (50 mL), brine (50 mL). The organic extract was
dried over sodium sulfate, filtered and concentrated in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 10-20% EtOAc/hexanes to afford crude compound
37 (3.5 g) as yellow sticky solid. TLC: 30% EtOAc/hexanes (R.sub.f:
0.4); LC-MS: 74.83%; 441.2 (M+1).sup.+; (column; Ascentis Express
C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.97, 3.15 min. 0.025% Aq.
TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of tert-butyl (4-((5-(hydroxymethyl) thiazol-2-yl)
methyl) cyclohexyl) carbamate (38)
[0364] To a stirring solution of compound 37 (3.5 g, 7.96 mmol) in
THF (100 mL) under inert atmosphere was added cesium fluoride (3.6
g, 23.86 mmol), tetrabutylammonium fluoride (1.0 M solution in THF,
3.98 mL, 3.98 mmol) at 0.degree. C.; warmed to RT and stirred for 1
h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was diluted with EtOAc (2.times.50
mL) washed with water (75 mL). The combined organic extracts were
dried over sodium sulfate, filtered and concentrated in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 2-10% EtOAc/hexanes and further purified by
preparative HPLC purification to afford compound 38 (1.1 g, 69%) as
pale yellow solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.2); .sup.1H
NMR (DMSO-d.sub.6, 500 MHz): .delta. 7.47 (s, 1H), 6.70 (d, J=6.9
Hz, 1H), 5.44 (t, J=5.7 Hz, 1H), 4.61 (dd, J=5.6, 0.9 Hz, 2H),
3.50-3.40 (m, 1H), 2.85 (d, J=7.5 Hz, 2H), 1.87-1.75 (m, 1H),
1.59-1.40 (m, 8H), 1.38 (s, 9H); LC-MS: 99.52%; 327.0 (M+1).sup.+;
(column; Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT
2.06 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2
mL/min).
Synthesis of tert-butyl (4-((5-(chloromethyl) thiazol-2-yl) methyl)
cyclohexyl) carbamate (39)
[0365] To a stirring solution of compound 38 (1 g, 3.06 mmol) in
CH.sub.2Cl.sub.2 (50 mL) under inert atmosphere were added triethyl
amine (2.20 mL, 15.33 mmol), methanesulfonyl chloride (1.2 mL,
15.33 mmol) at 0.degree. C.; warmed to RT and stirred for 4 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was quenched with ice-cold water (75 mL) and
extracted with CH.sub.2Cl.sub.2 (2.times.75 mL). The combined
organic extracts were dried over sodium sulfate, filtered and
concentrated in vacuo to afford crude compound 39 (800 mg) as
colorless liquid. The crude was carried forward for next step
without further purification. TLC: 50% EtOAc/hexanes (R.sub.f:
0.6); LC-MS: 61.63%; 345.0 (M+1).sup.+; (column; Ascentis Express
C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.72 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of tert-butyl (4-((5-(azidomethyl) thiazol-2-yl) methyl)
cyclohexyl) carbamate (40)
[0366] To a stirring solution of compound 39 (1 g, 2.47 mmol) in
DMF (20 mL) under inert atmosphere was added sodium azide (483 mg,
7.42 mmol) at RT and stirred for 16 h. The reaction was monitored
by TLC; after completion of the reaction, the reaction mixture was
diluted with ice-cold water (100 mL) and extracted with EtOAc
(2.times.75 mL). The combined organic extracts were dried over
sodium sulphate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel column
chromatography using 10-20% EtOAc/hexanes to afford compound 40
(300 mg, 30% over 2 steps) as an off-white sticky solid. TLC: 70%
EtOAc/hexanes (R.sub.f: 0.4); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz):
.delta. 7.66 (s, 1H), 6.73-6.67 (m, 1H), 4.68 (s, 2H), 3.50-3.41
(m, 1H), 2.94-2.89 (m, 2H), 1.86-1.85 (m 1H), 1.56-1.42 (m, 8H),
1.38 (s, 9H); LC-MS: 99.61%; 352.0 (M+1).sup.+; (column; Ascentis
Express C-18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.69 min 0.025% Aq.
TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of tert-butyl (4-((5-(aminomethyl) thiazol-2-yl) methyl)
cyclohexyl) carbamate (41)
[0367] To a stirring solution of compound 40 (300 mg, 0.90 mmol) in
MeOH (25 mL) under inert atmosphere was added 10% Pd/C (50 mg, 50%
wet) at RT and stirred under hydrogen atmosphere (balloon pressure)
at RT and stirred for 16 h. The reaction was monitored by TLC;
[0368] after completion of the reaction, the reaction mixture was
filtered through celite and eluted with 10% MeOH/CH.sub.2Cl.sub.2
(2.times.50 mL). The filtrate was concentrated in vacuo to afford
crude compound 41 (250 mg) as pale yellow solid. TLC: 30%
EtOAc/hexanes (R.sub.f: 0.1); .sup.1H NMR (DMSO-d.sub.6, 400 MHz):
.delta. 7.45 (s, 1H), 6.70 (d, J=5.9 Hz, 1H), 3.89 (s, 1.5H), 3.82
(s, 0.5H), 3.51-3.38 (m, 1H), 2.84-2.82 (m, 2H), 1.85-1.82 (m, 1H),
1.60-1.41 (m, 8H), 1.38 (s, 9H); LC-MS: 97.36%; 326.1 (M+1).sup.+;
(column; Ascentis Express C-18, (50.times.3.0 mm, 2.7 .mu.m); RT
1.74 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2
mL/min).
Synthesis of tert-butyl (4-((5-((5, 5-dioxido-11-oxo-10,
11-dihydrodibenzo [b,f] [1, 4] thiazepine-8-carboxamido) methyl)
thiazol-2-yl) methyl) cyclohexyl) carbamate (42)
[0369] To a stirring solution of compound 9 (200 mg, 0.66 mmol) in
DMF (20 mL) under inert atmosphere were added EDCI.HCl (252 mg,
1.32 mmol), HOBt (178 mg, 1.32 mmol), diisopropylethylamine (0.61
mL, 3.30 mmol) and compound 41 (214 mg, 0.66 mmol) at 0.degree. C.;
warmed to RT and stirred for 16 h. The reaction was monitored by
TLC; after completion of the reaction, the reaction mixture was
diluted with water (50 mL) and extracted with EtOAc (2.times.50
mL). The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
was purified through silicagel column chromatography using 2-5%
MeOH/CH.sub.2Cl.sub.2 to afford compound 42 (200 mg, 49%) as an
off-white solid. TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.5);
.sup.1H NMR (DMSO-d.sub.6, 400 MHz): 11.50 (br s, 1H), 9.37 (t.
J=5.8 Hz, 1H), 8.05 (d, J=8.3 Hz, 1H), 7.98 (td, J=7.3, 1.3 Hz,
2H), 7.93-7.82 (m, 3H), 7.79 (dd, J=8.3, 1.5 Hz, 1H), 7.53 (s, 1H),
6.68 (d, J=6.1 Hz, 1H), 4.59 (d, J=5.6 Hz, 2H), 3.49-3.38 (m, 1H),
2.84-2.80 (m, 2H), 1.86-1.75 (m, 1H), 1.58-1.34 (m, 13H), 1.32-1.20
(m, 2H), 0.89-0.79 (m, 2H); LC-MS: 97.29%; 610.1 (M+1).sup.+;
(column; Kinetex EVOC-18 (50.times.3.0 mm, 2.6 .mu.m); RT 2.98 min.
2.5 mM Aq. NH4OOCH+5% ACN:ACN+5% 2.5 mM Aq.NH.sub.4OOCH, 0.8
mL/min).
Synthesis of N-((2-((4-aminocyclohexyl) methyl) thiazol-5-yl)
methyl)-11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide hydrochloride (884)
[0370] To a stirring solution of compound 42 (50 mg, 0.08) in
CH.sub.2Cl.sub.2 (5 mL) under inert atmosphere was added 4 N HCl in
1, 4-dioxane (5 mL) at 0.degree. C.; warmed to RT and stirred for 3
h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The crude was
triturated with 10% MeOH/CH.sub.2Cl.sub.2 (5 mL) and dried in vacuo
to afford 884 (35 mg, HCl salt) as an off-white solid. TLC: 10%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.1); .sup.1H-NMR (DMSO-d.sub.6,
500 MHz): .delta. 11.52 (s, 1H), 9.42 (t, J=5.8 Hz, 1H), 8.05 (d,
J=8.3 Hz, 1H), 8.02-7.95 (m, 2H), 7.93-7.77 (m, 6H), 7.56 (s, 1H),
4.60 (d, J=5.6 Hz, 2H), 3.21-3.09 (m, 1H), 2.88 (d, J=7.7 Hz, 2H),
1.98-1.84 (m, 1H), 1.64 (q, J=5.7 Hz, 3H), 1.56-1.39 (m, 4H);
LC-MS: 98.03%; 511.1 (M+1).sup.+; (column; Ascentis Express C-18.
(50.times.3.0 mm, 2.7 .mu.m); RT 1.71 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity): 94.88%;
(column; X select CSH C-18 (150.times.4.6 mm, 3.5 .mu.m); RT 5.43
min. 0.05% TFA+5% ACN:ACN+5% 0.05% TFA; 1.0 mL/min,
Diluent:ACN:water).
Example 7: Synthesis of 818
##STR00054## ##STR00055##
[0371] Synthesis of 8-(5-(((tert-butyldimethylsilyl) oxy) methyl)
thiazol-2-yl)-1, 4-dioxaspiro [4.5] decan-8-ol (47)
[0372] To a stirring solution 5-(((tert-butyldimethylsilyl) oxy)
methyl) thiazole 10 (11 g, 0.048 mmol) in dry THF (100 mL) under
inert atmosphere was added n-butyl lithium (1.6 M solution in
hexane, 72.0 mL, 0.072 mmol) dropwise for 10 min at -78.degree. C.
and stirred for 1 h. To this was added 1, 4-dioxaspiro [4.5]
decan-8-one 46 (1.35 mL, 17.43 mmol) at -78.degree. C. and stirred
at the same temperature for 2 h. The reaction was monitored by TLC;
after completion of the reaction, the reaction mixture was quenched
with ice-cold water (10 mL) and extracted with EtOAc (2.times.100
mL). The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
was purified through silica gel column chromatography using 7-10%
EtOAc/hexanes to afford compound 47 (12 g, 65%) as colorless
liquid. TLC: 50% EtOAc/hexanes (R.sub.f: 0.2); LC-MS: 93.94%; 386.0
(M+1).sup.+; (column; Ascentis Express C18, (50.times.3.0 mm, 2.7
.mu.m); RT 2.84 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 mL/min).
Synthesis of O-(8-(5-(((tert-butyldimethylsilyl) oxy) methyl)
thiazol-2-yl)-1, 4-dioxaspiro [4.5] decan-8-yl) S-methyl
carbonodithioate (48)
[0373] To a stirring solution of compound 47 (12 g, 31.16 mmol) in
THF (150 mL) under argon atmosphere was added sodium hydride (60%,
2.49 g, 62.33 mmol) portion wise for 20 min at 0.degree. C. and
stirred for 20 min. To this was added carbon disulfide (4.74 g,
62.33 mmol) at 0.degree. C. and stirred for 1 h, followed by
addition of MeI (1.28 mL, 62.33 mmol) and stirred at the same
temperature for 1 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was quenched with
ice-cold water (10 mL) and extracted with EtOAc (2.times.250 mL).
The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to crude compound 48 (12 g) as a
colorless syrup. TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2).
Synthesis of Mixture of 5-(((tert-butyldimethylsilyl) oxy)
methyl)-2-(1, 4-dioxaspiro [4.5] dec-7-en-8-yl) thiazole (49) and
5-(((tert-butyldimethylsilyl) oxy) methyl)-2-(1, 4-dioxaspiro [4.5]
decan-8-yl) thiazole (49A)
[0374] To a stirring solution of compound 48 (12 g, 25.26 mmol) in
Toluene (20 mL) under argon atmosphere were added tributylstannane
(22.05 g, 75.77 mmol), AIBN (828 mg, 5.04 mmol) at RT; heated to
110.degree. C. for and stirred for 16 h. The reaction was monitored
by TLC; after completion of the reaction, the volatiles were
removed in vacuo. The residue was diluted with EtOAc (150 mL)
washed with saturated potassium fluoride solution (100 mL). The
organic extract was dried over sodium sulfate, filtered and
concentrated in vacuo to obtain the crude. The crude was purified
through silica gel flash column chromatography using 10%
EtOAc/hexanes to afford mixture of compound 49 & 49A (3.5 g, as
thick syrup. TLC: 30% EtOAc/hexanes (R.sub.f: 0.4); .sup.1H NMR
(DMSO-d.sub.6, 500 MHz): .delta. 7.69-7.49 (m, 1H), 6.46-6.42 (m,
1H), 4.85 (s, 2H), 3.91 (s, 4H), 2.65-2.60 (m, 2H), 2.52-2.48 (m,
2H), 2.44-2.36 (m, 2H), 1.80 (t, J=6.6 Hz, 2H), 0.87 (s, 9H), 0.07
(s, 6H);
Synthesis of mixture of (2-(1, 4-dioxaspiro [4.5] decan-8-yl)
thiazol-5-yl) methanol (50) and (2-(1, 4-dioxaspiro [4.5]
dec-7-en-8-yl) thiazol-5-yl) methanol (50A)
[0375] To a stirring solution of compound 49 & 49A (3.5 g,
mixture of compounds) in THF (30 mL) under inert atmosphere was
added tetrabutylammonium fluoride (1.0 M solution in THF, 14.30 mL,
14.30 mmol) at 0.degree. C. and stirred at the same temperature for
1 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was quenched with ice-cold water
(100 mL) and extracted with EtOAc (2.times.100 mL). The combined
organic extracts were washed with saturated NaHCO.sub.3 solution
(75 mL), water (50 mL), brine (100 mL) and dried over sodium
sulfate, filtered and concentrated in vacuo to obtain the crude.
The crude was purified through silica gel column chromatography
using 3% MeOH/CH.sub.2Cl.sub.2 to afford compound 50 & 50A (2.4
g) as thick syrup. TLC: 10% EtOAc/hexanes (R.sub.f: 0.1); LC-MS:
35.91%; 256.0 (M+1).sup.+ (50A), 61.18%; 254.0 (M+1).sup.+ (50);
(column; Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT
1.46 min. 1.56 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 mL/min).
Synthesis of Mixture of 5-(chloromethyl)-2-(1,4-dioxaspiro [4.5]
dec-7-en-8-yl) thiazole (51) and 5-(chloromethyl)-2-(1,
4-dioxaspiro [4.5] decan-8-yl) thiazole (51A)
[0376] To a stirring solution of compound 50 & 50A (2.4 g, 9.44
mmol) in CH.sub.2Cl.sub.2 (30 mL) under inert atmosphere were added
triethyl amine (4.08 mL, 28.26 mmol), methanesulfonyl chloride
(1.29 mg, 11.31 mmol) at 0.degree. C.; warmed to RT and stirred for
2 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was quenched with ice-cold water (50
mL) and extracted with CH.sub.2Cl.sub.2 (2.times.75 mL), washed
with water (75 mL), brine (75 mL). The combined organic extracts
were dried over sodium sulfate, filtered and concentrated in vacuo
to afford mixture of compound 51 and 51A (2.5 g) as a pale-yellow
liquid. TLC: 30% EtOAc/(R.sub.f: 0.4); LC-MS (Agilent 6310 Ion
trap): 24.48%; 274.1 (M+1).sup.+ (51A), 29.02%; 272.1 (M+1).sup.+
(51); (column; X-select CSH C-18 (50.times.3.0 mm, 2.5 .mu.m); RT
3.8 min, 3.86 min. 2.5 mM NH.sub.4OAc (Aq): ACN; 0.8 mL/min).
Synthesis of Mixture of 5-(azidomethyl)-2-(1, 4-dioxaspiro [4.5]
dec-7-en-8-yl) thiazole (52) and 5-(azidomethyl)-2-(1, 4-dioxaspiro
[4.5] decan-8-yl) thiazole (52A)
[0377] To a stirring solution of compound 51 and 51A (2.5 g,
mixture of compounds) in DMF (20 mL) under inert atmosphere was
added sodium azide (1.75 g, 27.34 mmol) at 0.degree. C.; warmed to
RT and stirred for 16 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was diluted with
water (100 mL) and extracted with EtOAc (2.times.100 mL). The
combined organic extracts were washed with water (75 mL) and brine
(75 mL). The combined organic extracts were dried over sodium
sulphate, filtered and concentrated in vacuo to obtain the crude.
The crude was purified through silica gel column chromatography
using 3% MeOH/CH.sub.2Cl.sub.2 to afford compound 52 and 52A (1.5
g) as colorless thick syrup. TLC: 5% MeOH/CH.sub.2Cl.sub.2
(R.sub.f: 0.5); LC-MS (Agilent 6310 Ion trap): 24.90%; 281.2
(M+1).sup.+ (52A), 55.47%; 279.2 (M+1).sup.+ (52); (column;
X-select CSH C-18 (50.times.3.0 mm, 2.5 .mu.m); RT 3.8 min, 3.86
min. 2.5 mM NH.sub.4OAc (Aq): ACN; 0.8 mL/min).
Synthesis of (2-(1, 4-dioxaspiro [4.5] decan-8-yl) thiazol-5-yl)
methanamine (53)
[0378] To a stirring solution of compound 52 and 52A (1.5 g, crude)
in MeOH (50 mL) under inert atmosphere was added 10% Pd/C (1 g, 50%
wet) at RT and stirred under hydrogen atmosphere (balloon pressure)
at RT for 20 h. The reaction was monitored by TLC; after completion
of the reaction, the reaction mixture was filtered through celite
and washed with MeOH (50 mL). The filtrate was concentrated in
vacuo to obtain the crude. The crude was purified through basic
alumina column chromatography using 3% MeOH/CH.sub.2Cl.sub.2 to
afford compound 53 (600 mg) as colorless thick syrup. TLC: 5%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2); LC-MS (Agilent 6310 Ion
trap): 66.98%; 255.1 (M+1).sup.+ (column; X-select CSH C-18
(50.times.3.0 mm, 2.5 .mu.m); RT 2.1 min, 3.86 min. 2.5 mM
NH.sub.4OAc (Aq): ACN; 0.8 mL/min).
Synthesis of N-((2-(1, 4-dioxaspiro [4.5] decan-8-yl) thiazol-5-yl)
methyl)-11-oxo-10, 11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide (54)
[0379] To a stirring solution of compound 9 (200 mg, 0.66 mmol) in
DMF (10 mL) under inert atmosphere were added HOBt (133.6 mg, 0.99
mmol), EDCI.HCl (189.1 mg, 0.99 mmol), diisopropylethylamine (0.59
mL, 3.30 mmol) and compound 53 (201 mg, 0.79 mmol) at 0.degree. C.,
warmed to RT and stirred for 16 h. The reaction was monitored by
TLC; after completion of the reaction, the reaction mixture was
diluted with water (50 mL) and extracted with EtOAc (2.times.50
mL). The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
was purified through silicagel (100-200 mesh) column chromatography
using 3% MeOH/CH.sub.2Cl.sub.2 to afford compound 54 (150 mg, 42%)
as an off-white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2 (R.sub.f:
0.5); .sup.1H NMR (DMSO-d.sub.6, 400 MHz): .delta.1.50 (s, 1H),
9.37 (t, J=5.7 Hz, 1H), 8.05 (d, J=8.2 Hz, 1H), 7.98 (td, J=7.5,
1.4 Hz, 2H), 7.93-7.82 (m, 3H), 7.79 (dd, J=8.3, 1.5 Hz, 1H), 7.55
(s, 1H), 4.60 (d, J=5.6 Hz, 2H), 3.86 (s, 4H), 3.05-2.93 (m, 1H),
2.02-1.93 (m, 2H), 1.76-1.52 (m, 6H); LC-MS: 93.76%; 540.0
(M+1).sup.+; (column; Ascentis Express C18, (50.times.3.0 mm, 2.7
.mu.m); RT 2.10 min 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 mL/min).
Synthesis of 11-oxo-N-((2-(4-oxocyclohexyl) thiazol-5-yl)
methyl)-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide (818)
[0380] To a stirring solution of compound 54 (200 mg, 0.37 mmol) in
MeOH (10 mL) was added 6 N HCl (10 mL) at 0.degree. C.; warmed to
RT and stirred for 16 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo.
The residue was diluted with water (10 mL) and basified with
NaHCO.sub.3 (500 mg) and extracted with 10% MeOH/CH.sub.2Cl.sub.2
(2.times.50 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated in vacuo to obtain the
crude, which was triturated with diethyl ether (5 mL), n-pentane
(10 mL), 10% MeOH/CH.sub.2Cl.sub.2 ( ) to obtain the solid. This
was further purified by precipitation in N-methyl
pyrrolidinone:H.sub.2O (0.5:10 mL). The solid obtained was filtered
and dried in vacuo to afford 818 (170 mg, 93%) as an off-white
solid. TLC: 40% EtOAc/hexanes (R.sub.f: 0.1); .sup.1H NMR
(DMSO-d.sub.6, 400 MHz): .delta. 11.52 (br s, 1H), 9.40 (t, J=5.7
Hz, 1H), 8.05 (d, J=8.2 Hz, 1H), 8.01-7.95 (m, 2H), 7.93-7.83 (m,
3H), 7.79 (dd, J=8.3, 1.6 Hz, 1H), 7.59 (s, 1H), 4.61 (d, J=5.6 Hz,
2H), 3.49-3.41 (m, 1H), 2.59-2.52 (m, 2H), 2.34-2.24 (m, 4H),
1.96-1.84 (m, 2H); LC-MS: 93.83%; 496.0 (M+1).sup.+; (column;
Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT 1.97 min.
0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min). HPLC
(purity): 94.80%; (column; X select CSH C-18 (150.times.4.6 mm, 3.5
.mu.m); RT 7.25 min. 0.05% TFA+5% ACN:ACN+5% 0.05% TFA; 1.0 mL/min,
Diluent:ACN:water).
Example 8: Synthesis of 924
##STR00056##
[0381] Synthesis of N-((2-(4-hydroxycyclohexyl) thiazol-5-yl)
methyl)-11-oxo-10, 11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide (924)
[0382] To a stirring solution of 818 (280 mg, 0.56 mmol) in MeOH
(10 mL) under argon atmosphere was added sodium borohydride (64 mg,
1.69 mmol) portion wise for 5 min at 0.degree. C.; warmed to RT and
stirred for 16 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was diluted with
ice-cold water (50 mL) and the volatiles were removed in vacuo to
obtain the crude, which was purified by preparative HPLC
purification to afford 924 (50 mg, 18%) as an off-white solid. TLC:
40% EtOAc/hexanes (R.sub.f: 0.2); .sup.1H-NMR (DMSO-d.sub.6, 400
MHz): .delta. 11.50 (s, 1H), 9.37 (br t, J=5.7 Hz, 1H), 8.04 (d,
J=8.2 Hz, 1H), 7.98 (td, J=7.3, 1.1 Hz, 2H), 7.93-7.82 (m, 3H),
7.79 (dd, J=8.2, 1.4 Hz, 1H), 7.53 (s, 1H), 4.59 (br d, J=5.5 Hz,
3H), 3.47-3.35 (m, 1H), 2.86-2.77 (m, 1H), 2.07-1.77 (m, 4H),
1.50-1.40 (m, 2H), 1.31-1.21 (m, 2H); LC-MS: 96.34%; 498.0
(M+1).sup.+; (column; Ascentis Express C-18, (50.times.3.0 mm, 2.7
.mu.m); RT 1.87 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 ml/min); HPLC (purity): 93.67%; (column; X select CSH C-18
(150.times.4.6 mm, 3.5 .mu.m); RT 6.48 min. 0.05% TFA+5% ACN:ACN+5%
0.05% TFA; 1.0 mL/min, Diluent:DMSO:ACN:water).
Example 9: Synthesis of 1034
##STR00057##
[0383] Synthesis of 11-oxo-N-((2-(piperidin-4-yl) thiazol-5-yl)
methyl)-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide hydrochloride (926)
[0384] To a stirring solution of 926-A (50 mg, 0.08 mmol) in
CH.sub.2Cl.sub.2 (10 mL) under inert atmosphere was added 4 N HCl
in 1, 4-dioxane (0.5 mL) at 0.degree. C.; warmed to RT and stirred
for 4 h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The crude was
triturated with diethyl ether (2.times.10 mL) and dried in vacuo to
afford 926 (160 mg, HCl salt) as an off-white solid. TLC: 40%
EtOAc/hexanes (R.sub.f: 0.1); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz):
.delta. 11.52 (s, 1H), 9.43 (t, J=5.6 Hz, 1H), 8.75-8.62 (m, 1H),
8.53-8.41 (m, 1H), 8.05 (d, J=8.3 Hz, 1H), 8.01-7.95 (m, 2H), 7.91
(td, J=7.5, 1.5 Hz, 1H), 7.88-7.83 (m, 2H), 7.80 (dd, J=8.3, 1.6
Hz, 1H), 7.61 (s, 1H), 4.61 (d, J=5.8 Hz, 2H), 3.326-3.28 (m, 3H),
3.07-2.93 (m, 2H), 2.16-2.10 (m, 2H), 1.91-1.77 (m, 2H); LC-MS:
98.13%; 483.1 (M+1).sup.+; (column; Ascentis Express C18,
(50.times.3.0 mm, 2.7 .mu.m); RT 1.62 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min). HPLC (purity): 97.44%;
(column; X select CSH C-18 (150.times.4.6 mm, 3.5 .mu.m); RT 5.25
min. 0.05% TFA+5% ACN:ACN+5% 0.05% TFA; 1.0 mL/min,
Diluent:DMSO:ACN:water).
Synthesis of tert-butyl (S)-(1-(4-(5-((5, 5-dioxido-11-oxo-10,
11-dihydrodibenzo [b, f] [1, 4] thiazepine-8-carboxamido) methyl)
thiazol-2-yl) piperidin-1-yl)-1-oxopropan-2-yl) carbamate (56)
[0385] To a stirring solution of 926 (40 mg, 0.083 mmol) in DMF (50
mL) under inert atmosphere were added EDCI.HCl (63 mg, 0.33 mmol),
HOBt (32 mg, 0.16 mmol), diisopropyl ethyl amine (0.15 mL, 0.83
mmol) and (tert-butoxycarbonyl)-L-alanine 55 (32 mg, 0.16 mmol) at
0.degree. C.; warmed to RT and stirred for 16 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was diluted with water (30 mL) and extracted with EtOAc
(2.times.50 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel column
chromatography using 5-10% MeOH/CH.sub.2Cl.sub.2 to afford compound
56 (33 mg, 30%) as an off-white solid. TLC: 10%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.4); LC-MS: 90.73%; 554.1
(M+1).sup.+ (Des-Boc); (column; Kinetex EVO C-18 (50.times.3.0 mm,
2.6 .mu.m); RT 2.54 min. 2.5 mM Aq. NH.sub.4OOCH+5% ACN:ACN+5% 2.5
mM Aq.NH.sub.4OOCH, 0.8 mL/min).
Synthesis of N-((2-(1-(L-alanyl) piperidin-4-yl) thiazol-5-yl)
methyl)-11-oxo-10, 11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide hydrochloride (1034)
[0386] To a stirring solution of compound 56 (30 mg, 0.04 mmol) in
CH.sub.2Cl.sub.2 (5 mL) under inert atmosphere was added 4 N HCl in
1, 4-dioxane (0.2 mL) at 0.degree. C.; warmed to RT and stirred for
4 h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The crude was
triturated with EtOAc (2.times.10 mL), added water (1 mL) and
lyophilized for 12 h to afford 1034 (30 mg, HCl salt) as an
off-white solid. TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.1);
.sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta. 11.52 (s, 1H), 9.43
(t, J=5.8 Hz, 1H), 8.05 (d, J=8.3 Hz, 4H), 8.02-7.95 (m, 2H),
7.93-7.82 (m, 3H), 7.80 (dd, J=8.3, 1.4 Hz, 1H), 7.59 (s, 1H), 4.60
(d, J=5.4 Hz, 2H), 4.45-4.32 (m, 2H), 3.97-3.80 (m, 1H), 3.32-3.17
(m, 2H), 2.92-2.75 (m, 1H), 2.14-1.98 (m, 2H), 1.72-1.40 (m, 2H),
1.30 (br d, J=6.7 Hz, 3H); LC-MS: 94.36%; 554.1 (M+1).sup.+;
(column; Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT
1.71 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
HPLC (purity): 93.40%; (column; X select CSH C-18 (150.times.4.6
mm, 3.5 .mu.m); RT 5.30 min. 0.05% TFA+5% ACN:ACN+5% 0.05% TFA; 1.0
mL/min, Diluent:DMSO:ACN:water).
Example 10: Synthesis of 1035-A
##STR00058##
[0387] Synthesis of text-butyl (2-(4-(5-((5, 5-dioxido-11-oxo-10,
11-dihydrodibenzo [b, f] [1, 4] thiazepine-8-carboxamido) methyl)
thiazol-2-yl) piperidin-1-yl)-2-oxoethyl) (methyl) carbamate
(1035-A)
[0388] To a stirring solution of 926 (100 mg, 0.19 mmol) in DMF (20
mL) under inert atmosphere were added EDCI.HCl (110 mg, 0.57 mmol),
HOBt (78 mg, 0.57 mmol), diisopropyl ethyl amine (0.27 mL, 1.44
mmol) and N-(tert-butoxycarbonyl)-N-methylglycine (55 mg, 0.28
mmol) at 0.degree. C.; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was diluted with water (100 mL) and extracted
with EtOAc (2.times.75 mL). The combined organic extracts were
dried over sodium sulfate, filtered and concentrated in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 2-3% MeOH/CH.sub.2Cl.sub.2 to afford compound
1035-A (80 mg, 46%) as an off-white solid. TLC: 10%
MeOH/CH.sub.2Cl.sub.2(R.sub.f: 0.5); .sup.1H NMR (DMSO-d.sub.6, 400
MHz): .delta. 11.51 (s, 1H), 9.39 (t, J=5.7 Hz, 1H), 8.05 (d, J=8.2
Hz, 1H), 8.01-7.95 (m, 2H), 7.93-7.82 (m, 3H), 7.79 (dd, J=1.5, 8.2
Hz, 1H), 7.58 (s, 1H), 4.60 (br d, J=5.3 Hz, 2H), 4.35-4.33 (m,
1H), 4.14-3.73 (m, 3H), 3.27-3.06 (m, 2H), 2.79-2.74 (m, 4H),
2.12-1.90 (m, 2H), 1.68-1.43 (m, 2H), 1.41, 1.23 (s, 9H); LC-MS:
98.48%; 554.1 (M+1).sup.+ (Des-Boc); (column; Ascentis Express C18,
(50.times.3.0 mm, 2.7 .mu.m); RT 2.16 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min). HPLC (purity): 97.86%;
(column; X select CSH C-18 (150.times.4.6 mm, 3.5 .mu.m); RT 5.30
min. 0.05% TFA+5% ACN:ACN+5% 0.05% TFA; 1.0 mL/min,
Diluent:ACN:water).
Example 11: Synthesis of 980-A
##STR00059##
[0389] Synthesis of 3-bromocyclopent-2-en-1-one (62)
[0390] To a stirring solution of cyclopentane-1, 3-dione 61 (5 g,
51.02 mmol) in chloroform (150 mL) was added phosphorous tribromide
(9.6 mL, 102.04 mmol) at 0.degree. C. under inert atmosphere. The
reaction mixture was heated to 80.degree. C. and stirred for 5 h.
The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was poured into ice cold water (150
mL) and extracted with CH.sub.2Cl.sub.2 (2.times.150 mL). The
combined organic extracts were dried over sodium sulfate, filtered
and concentrated in vacuo (below 30.degree. C.) to afford compound
62 (2.5 g) as an off white solid. This crude material was taken to
next step without further purification. TLC: 10% EtOAc/hexanes
(R.sub.1: 0.8); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 6.57
(t, J=1.8 Hz, 1H), 2.99-2.97 (m, 2H), 2.48-2.46 (m, 2H); LC-MS
(Agilent 6310 Ion trap): 97.41%; 161.2 (M.sup.++1); (column;
Kinetex EVO C-18 (50.times.3.0 mm, 2.6 .mu.m); RT 1.30 min. 0.05%
Aq. TFA:ACN, 0.8 mL/min).
Synthesis of 3-(4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl)
cyclopent-2-en-1-one (63)
[0391] To a stirring solution of compound 62 (2.5 g, crude) in
1,4-dioxane (100 mL) were added Bis(pinacolato) diboron (4 g, 15.62
mmol) and potassium acetate (3.06 g, 31.25 mmol) in a sealed tube
at RT and purged under argon for 30 min. Then Pd(dppf)Cl.sub.2
(1.14 g, 1.56 mmol) was added at RT. The reaction mixture was
heated to 100.degree. C. and stirred for 16 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was filtered through a pad of celite and the celite bed was
washed with 5% MeOH/CH.sub.2Cl.sub.2 (50 mL). The filtrate was
concentrated in vacuo to afford compound 63 (3.2 g) as black syrup.
This crude material was taken to next step without further
purification. TLC: 20% EtOAc/hexanes (R.sub.f: 0.3).
Synthesis of text-butyl ((2-(3-oxocyclopent-1-en-1-yl)
thiazol-5-yl) methyl) carbamate (58)
[0392] To a stirring solution of tert-butyl ((2-chlorothiazol-5-yl)
methyl) carbamate 57 (1 g, 4.02 mmol) in a mixture of
dimethoxyethane/water (4:1, 40 mL) were added compound 63 (2.5 g,
crude) and sodium carbonate (1.49 g, 14.11 mmol) in a sealed tube
at RT and purged under argon for 30 min. Then Pd(dppf)Cl.sub.2 (295
mg, 0.4 mmol) was added at RT. The reaction mixture was heated to
120.degree. C. and stirred for 16 h. The reaction was monitored by
TLC; after completion of the reaction, the volatiles were removed
in vacuo to obtain the crude. The crude was purified through column
chromatography using 30% EtOAc/hexanes to afford compound 58 (600
mg, 51%) as an off white solid. TLC: 40% EtOAc/hexanes (R.sub.f:
0.3); LC-MS: 81.51%; 294.9 (M+1).sup.+; (column; Kinetex EVO C-18
(50.times.3.0 mm, 2.6 .mu.m); RT 2.27 min. 2.5 mM NH.sub.4OOCH in
water+5% ACN:ACN+5% 2.5 mM NH.sub.4OOCH in water, 0.8 mL/min).
Synthesis of tert-butyl ((2-(3-oxocyclopentyl) thiazol-5-yl)
methyl) carbamate (59)
[0393] To a stirring solution of compound 58 (600 mg, 2.04 mmol) in
methanol (20 mL) was added 10% Pd/C (50% wet, 200 mg) at RT under
inert atmosphere. The reaction mixture was stirred under hydrogen
atmosphere (balloon pressure) at RT for 16 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was filtered through a pad of celite and the celite bed was
washed with 5% MeOH/CH.sub.2Cl.sub.2 (50 mL). The filtrate was
concentrated in vacuo to obtain the crude. The crude was purified
through column chromatography using 20% EtOAc/hexanes to afford
compound 59 as a mixture of homo coupled and product (250 mg) as
white solid. TLC: 40% EtOAc/hexanes (R.sub.f: 0.4); LC-MS: 43.29%;
296.9 (M+1).sup.+; (column; Kinetex EVO C-18 (50.times.3.0 mm, 2.6
.mu.m); RT 2.28 min. 2.5 mM NH.sub.4OOCH in water+5% ACN:ACN+5% 2.5
mM NH.sub.4OOCH in water, 0.8 mL/min).
Synthesis of 3-(5-(aminomethyl) thiazol-2-yl) cyclopentan-1-one
hydrochloride (60)
[0394] To a stirring solution of compound 59 (250 mg, 0.84 mmol) in
CH.sub.2Cl.sub.2 (5 mL) was added 4 N HCl in 1, 4-dioxane (2.5 mL)
at 0.degree. C. under inert atmosphere. The reaction mixture was
gradually warmed to RT and stirred for 2 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo to obtain the crude. The crude was washed
with diethylether (2.times.5 mL) and dried in vacuo to afford
compound 60 as a mixture of de-Boc homo coupled and product (185
mg, HCl salt) as white solid. TLC: 70% EtOAc/hexane (R.sub.f: 0.1);
LC-MS: 80.26%; 197.0 (M+1).sup.+; (column; Kinetex EVO C-18
(50.times.3.0 mm, 2.6 um); RT 0.70 mM. 2.5 mM NH.sub.4OOCH in
water+5% ACN:ACN+5% 2.5 mM NH.sub.4OOCH in water, 0.8 mL/min).
Synthesis of 11-oxo-N-((2-(3-oxocyclopentyl) thiazol-5-yl)
methyl)-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide (980-A)
[0395] To a stirring solution of 11-oxo-10, 11-dihydrodibenzo [b,
f] [1, 4] thiazepine-8-carboxylic acid 5, 5-dioxide 9 (150 mg, 0.49
mmol) in DMF (8 mL) were added compound 60 (173 mg, 0.74 mmol),
EDCI.HCl (142 mg, 0.74 mmol), HOBt (100 mg, 0.74 mmol) followed by
diisopropylethylamine (0.46 mL, 2.47 mmol) at 0.degree. C. under
inert atmosphere. The reaction mixture was gradually warmed to RT
and stirred for 16 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was poured into
ice cold water (100 mL) and extracted with EtOAc (2.times.100 mL).
The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo. The crude was purified through
column chromatography using 3% MeOH/CH.sub.2Cl.sub.2 followed by
washings with EtOAc (2.times.10 mL) to afford 980-A (75 mg, 31%) as
white solid. TLC: 7% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.6); .sup.1H
NMR (400 MHz, DMSO-d.sub.6): .delta. 11.52 (s, 1H), 9.41 (t, J=5.5
Hz, 1H), 8.05 (d, J=8.2 Hz, 1H), 8.00-7.95 (m, 2H), 7.93-7.83 (m,
3H), 7.79 (d, J=8.2 Hz, 1H), 7.59 (s, 1H), 4.61 (d, J=5.8 Hz, 2H),
3.85-3.75 (m, 1H), 2.64-2.56 (m, 1H), 2.46-2.32 (m, 2H), 2.28-2.22
(m, 2H), 2.07-1.96 (m, 1H); LC-MS: 95.89%; 482.1 (M+1).sup.+;
(column; Kinetex EVO C-18 (50.times.3.0 mm, 2.6 um); RT 2.19 min.
2.5 mM NH.sub.4OOCH in water+5% ACN:ACN+5% 2.5 mM NH.sub.4OOCH in
water, 0.8 mL/min); HPLC (purity): 97.27%; (column; X-Select
CSH-C-18 (150.times.4.6 mm, 3.5 .mu.m); RT 8.63 min. 5 mM
NH.sub.4OAc:ACN; 1.0 mL/min. Diluent:ACN:H.sub.2O).
Example 12: Synthesis of 980-B
##STR00060##
[0396] Synthesis of 5-(azidomethyl)-2-chlorothiazole (65)
[0397] To a stirred solution of 2-chloro-5-(chloromethyl) thiazole
64 (10 g, 59.52 mmol) in EtOH (150 mL) under argon atmosphere was
added sodium azide (5.8 g, 89.23 mmol) at RT and heated to reflux
for 4 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was filtered, washed with EtOAc (100
mL) and the filtrate was concentrated in vacuo to obtain the crude.
The crude was purified through silica gel flash column
chromatography using 5% EtOAc/hexanes to afford compound 65 (10 g,
97%) as a pale-yellow oil. TLC: 10% EtOAc/hexanes (R.sub.f: 0.5);
LC-MS: 99.33%; 174.7 (M+1).sup.+; (column; Ascentis Express C18,
(50.times.3.0 mm, 2.7 .mu.m); RT 2.28 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of (2-chlorothiazol-5-yl) methanamine (66)
[0398] To a stirred solution of compound 65 (10 g, 57.47 mmol) in
THF:H.sub.2O (15:1, 160 mL) was added triphenyl phosphine (15.05 g,
57.45 mmol) portion wise for 15 min at RT and stirred for 3 h. The
reaction was monitored by TLC; after completion of the reaction,
the volatiles were removed in vacuo. The residue was diluted with
EtOAc (3.times.100 mL). The combined organic extracts were dried
over sodium sulfate, filtered and concentrated in vacuo to obtain
the crude compound 66 (10 g) as an off-white solid; which was
carried forward for next step without further purification. TLC:
10% EtOAc/hexanes (R.sub.f: 0.2). LC-MS: 21.47%+7.59%; 149.0
(M+1).sup.+; (column; X-select CSH C-18 (50.times.3.0 mm, 2.5
.mu.m); RT 0.73 min & 0.82 mM. 2.5 mM NH.sub.4OOCH (Aq).sup.+5%
ACN:ACN+5% 2.5 mM NH.sub.4OOCH (Aq); 0.8 mL/min).
Synthesis of N-((2-chlorothiazol-5-yl) methyl)-11-oxo-10,
11-dihydrodibenzo [b, f] [1, 4] thiazepine-8-carboxamide 5,
5-dioxide (67)
[0399] To a stirred solution of compound 9 (600 mg, 1.65 mmol) in
DMF (15 mL) under inert atmosphere were added compound 66 (362 mg,
1.98 mmol), EDCI.HCl (597 mg, 3.30 mmol), HOBt (445 mg, 3.30 mmol)
and diisopropylethylamine (1.5 mL, 8.25 mmol) at 0.degree. C.;
warmed to RT and stirred for 16 h. The reaction was monitored by
TLC; after completion of the reaction, the reaction mixture was
diluted with water (100 mL) and extracted with EtOAc (2.times.100
mL). The combined organic extracts were dried over sodium sulphate,
filtered and concentrated in vacuo to obtain the crude. The crude
was triturated with EtOAc (10 mL), diethyl ether (10 mL), n-hexane
(20 mL) and dried in vacuo to afford compound 67 (700 mg, 82%) as
an off-white solid. TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.4);
.sup.1H-NMR (DMSO-d.sub.6 400 MHz): .delta. 11.51 (br s, 1H), 9.48
(t, J=5.5 Hz, 1H), 8.06 (d, J=8.3 Hz, 1H), 7.98 (td, J=7.4, 1.1 Hz,
2H), 7.93-7.83 (m, 3H), 7.79 (dd, J=8.3, 1.5 Hz, 1H), 7.61 (s, 1H),
4.59 (d, J=5.5 Hz, 2H).
Synthesis of 11-oxo-N-((2-(3-oxocyclopent-1-en-1-yl) thiazol-5-yl)
methyl)-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide (69)
[0400] To a stirring solution of N-((2-chlorothiazol-5-yl)
methyl)-11-oxo-10,11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide 67 (500 mg, 1.15 mmol) in a
mixture of dimethoxyethane/water (4:1, 20 mL) were added 3-(4, 4,
5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) cyclopent-2-en-1-one 68
(720 mg, 3.46 mmol) and sodium carbonate (428 mg, 4.03 mmol) in a
sealed tube at RT and purged under argon for 30 min. Then
Pd(dppf)Cl.sub.2 (84 mg, 0.11 mmol) was added at RT. The reaction
mixture was heated to 120.degree. C. and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the volatiles were removed in vacuo to obtain the crude. The crude
was purified through column chromatography using 3%
MeOH/CH.sub.2Cl.sub.2 followed by washings with EtOAc (2.times.10
mL) to afford compound 69 (150 mg, 27%) as white solid. TLC: 5%
MeOH/CH.sub.2Cl.sub.2 (R.sub.1: 0.4); .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 11.53 (s, 1H), 9.53 (t, J=5.6 Hz, 1H), 8.06
(d, J=8.3 Hz, 1H), 8.01-7.95 (m, 3H), 7.90 (td, J=7.4, 1.4 Hz, 1H),
7.88-7.79 (m, 3H), 6.67 (t, J=1.8 Hz, 1H), 4.73 (d, J=5.6 Hz, 2H),
3.05-3.02 (m, 2H), 2.48-2.46 (m, 2H); LC-MS: 91.36%; 480.1
(M+1).sup.+; (column; Kinetex EVO C-18 (50.times.3.0 mm, 2.6 um);
RT 2.18 min. 2.5 mM NH.sub.4OOCH in water+5% ACN:ACN+5% 2.5 mM
NH.sub.4OOCH in water, 0.8 mL/min).
Synthesis of N-((2-(3, 3-dimethoxycyclopentyl) thiazol-5-yl)
methyl)-11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide (980-B)
[0401] To a stirring solution of compound 69 (150 mg, 0.31 mmol) in
methanol (10 mL) and DMF (0.5 mL) was added 10% Pd/C (50% wet, 50
mg) at RT under inert atmosphere. The reaction mixture was stirred
under hydrogen atmosphere (balloon pressure) at RT for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was filtered through a pad of celite and the
celite bed was washed with 5% MeOH/CH.sub.2Cl.sub.2 (20 mL). The
filtrate was concentrated in vacuo to obtain the crude. The crude
was purified through preparative HPLC to afford 980-B (15 mg, 9%)
as white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.6);
.sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.50 (br s, 1H), 9.38
(t, J=5.7 Hz, 1H), 8.05 (d, J=8.2 Hz, 1H), 7.98 (td, J=7.3, 1.1 Hz,
2H), 7.93-7.77 (m, 4H), 7.54 (s, 1H), 4.59 (d, J=5.6 Hz, 2H),
3.52-3.41 (m, 1H), 3.10 (s, 3H), 3.09 (s, 3H), 2.35-2.25 (m, 1H),
2.13-2.05 (m, 1H), 1.95-1.71 (m, 4H); LC-MS: 92.54%; 526.2
(M-1).sup.-; (column; Kinetex EVO C-18 (50.times.3.0 mm, 2.6 um);
RT 2.52 min. 2.5 mM Aq. NH.sub.4OOCH in water+5% ACN:ACN+5% 2.5 mM
NH.sub.4OOCH in water, 0.8 mL/min); HPLC (purity): 95.61%; (column;
X-Select CSH-C-18 (150.times.4.6 mm, 3.5 .mu.m); RT 9.29 min. 5 mM
NH.sub.4OAc ACN; 1.0 mL/min, Diluent:DMSO:ACN H.sub.2O).
Compounds of Group II:
Example 1: Synthesis of 5-oxo-5, 6-dihydrobenzo [b] pyrido [4, 3-f]
[1, 4] thiazepine-8-carboxylic acid (10): A Common Intermediate
##STR00061##
[0402] Synthesis of methyl 3-bromoisonicotinate (2)
##STR00062##
[0404] To a stirred solution of 3-bromoisonicotinic acid 1 (2 g,
9.90 mmol) in MeOH:THF (2:1, 30 mL) under argon atmosphere was
added CH.sub.2N.sub.2 (2 g, 49.50 mmol) at 0.degree. C.; warmed to
RT and stirred for 1 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 20% EtOAc/hexanes to afford compound 2 (1.4 g,
66%) as brown oil. TLC: 20% EtOAc/hexanes (R.sub.f: 0.7);
.sup.1H-NMR (CDCl.sub.3, 400 MHz): .delta. 8.87 (s, 1H), 8.62 (d,
J=7.2 Hz, 1H), 7.63 (d, J=5.6 Hz, 1H), 3.97 (s, 3H).
Synthesis of methyl 3-((4-methoxybenzyl) thio) isonicotinate
(4)
##STR00063##
[0406] To a stirred solution of compound 2 (1.4 g, 6.48 mmol) in 1,
4-dioxane (72 mL) under argon atmosphere were added
(4-methoxyphenyl) methanethiol 3 (1 g, 6.48 mmol),
Pd.sub.2(dba).sub.3 (148 mg, 0.16 mmol), Xantphos (187 mg, 0.32
mmol), cesium carbonate (4.2 g, 12.90 mmol) at RT; heated to
100.degree. C. and stirred for 6 h. The reaction was monitored by
TLC; after completion of the reaction, the volatiles were removed
in vacuo. The residue was diluted with water (25 mL) and extracted
with ELOAc (2.times.30 mL). The combined organic extracts were
dried over sodium sulfate, filtered and concentrated in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 20% EtOAc/hexanes to afford compound 4 (750
mg, 40%) as yellow solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.3);
.sup.1H-NMR (CDCl.sub.3, 500 MHz): .delta. 8.64 (s, 1H), 8.46 (d,
J=5.0 Hz, 1H), 7.80 (d, J=5.0 Hz, 1H), 7.31 (d, J=9.0 Hz, 2H), 6.85
(d, J=9.0 Hz, 2H), 4.22 (s, 2H), 3.95 (s, 3H), 3.79 (s, 3H).
Synthesis of methyl 3-mercaptoisonicotinate (5)
##STR00064##
[0408] A stirred solution of compound 4 (750 mg, 2.59 mmol) in
trifluoro acetic acid (15 mL) under argon atmosphere at RT was
heated to 80.degree. C. and stirred for 12 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo to obtain the crude compound 5 (440 mg) which
was carried to the next step without further purification. TLC: 30%
EtOAc/hexanes (R.sub.f: 0.4); .sup.1H-NMR (CDCl.sub.3, 400 MHz):
.delta. 8.99 (s, 1H), 8.59 (d, J=6.0 Hz, 1H), 8.24 (d, J=6.0 Hz,
1H), 4.13 (s, 1H), 4.06 (s, 3H).
Synthesis of methyl 3-((4-(methoxycarbonyl)-2-nitrophenyl) thio)
isonicotinate (7)
##STR00065##
[0410] To a stirred solution of methyl 4-fluoro-3-nitrobenzoate 6
(30 mg, 0.15 mmol) in DMF (1.5 mL) under argon atmosphere were
added compound 5 (28 mg, 0.16 mmol), cesium carbonate (54 mg, 0.16
mmol) at RT; heated to 60.degree. C. and stirred for 4 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was diluted with water (15 mL) and extracted
with CH.sub.2Cl.sub.2 (2.times.15 mL). The combined organic
extracts were dried over sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel column chromatography using 25% EtOAc/hexanes to afford
compound 7 (15 mg, 29%) as yellow solid. TLC: 30% EtOAc/hexanes
(R.sub.f: 0.3); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta. 8.90
(t, J=6.8 Hz, 2H), 8.65 (s, 1H), 8.04 (d, J=8.8 Hz, 1H), 7.89 (s,
1H), 7.07 (d, J=8.4 Hz, 1H), 3.89 (s, 3H), 3.74 (s, 3H).
Synthesis of 3-((4-carboxy-2-nitrophenyl) thio) isonicotinic acid
(8)
##STR00066##
[0412] To a stirred solution of compound 7 (175 mg, 0.50 mmol) in
THF (6 mL) under argon atmosphere was added lithium hydroxide
monohydrate (127 mg, 3.01 mmol) in water (2 mL) at RT; heated to
80.degree. C. and stirred for 4 h. The reaction was monitored by
TLC; after completion of the reaction, the volatiles were removed
in vacuo to obtain the crude. The crude was neutralized with 2 N
HCl to pH.about.7; the obtained solid was filtered, washed with 10%
EtOAc/hexanes and dried in vacuo to afford compound 8 (140 mg, 87%)
as yellow solid. TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2);
.sup.1H-NMR (DMSO-d.sub.6, 500 MHz): .delta. 13.63 (br s, 2H), 8.81
(d, J=5.0 Hz, 1H), 8.77 (s, 1H), 8.60 (s, 1H), 8.01 (d, J=9.0 Hz,
1H), 7.80 (d, J=5.0 Hz, 1H), 7.05 (d, J=9.0 Hz, 1H).
Synthesis of 3-((2-amino-4-carboxyphenyl) thio) isonicotinic acid
(9)
##STR00067##
[0414] To a stirred solution of compound 8 (140 mg, 0.43 mmol) in
MeOH (10 mL) under argon atmosphere was added 10% Pd/C (70 mg) at
RT and stirred under hydrogen atmosphere (balloon pressure) for 7
h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was filtered through celite and the
filtrate was evaporated in vacuo to obtain the crude compound 9
which was carried to the next step without further purification.
TLC: 20% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.3); .sup.1H-NMR
(DMSO-d.sub.6, 500 MHz): .delta. 12.91 (br s, 2H), 8.76 (d, J=5.0
Hz, 1H), 8.39 (d, J=5.0 Hz, 1H), 7.80-7.69 (m, 2H), 7.43 (d, J=9.0
Hz, 2H), 7.15-7.04 (m, 2H).
Synthesis of 5-oxo-5, 6-dihydrobenzo [b] pyrido [4, 3-f] [1, 4]
thiazepine-8-carboxylic acid (10)
##STR00068##
[0416] To a stirred solution of compound 9 (40 mg, 0.13 mmol) in
THF (4 mL) under argon atmosphere was added CDI (67 mg, 0.41 mmol)
at RT and stirred for 16 h. The reaction was monitored by TLC;
after completion of the reaction, the volatiles were removed in
vacuo. The residue was diluted with water (20 mL) and pH was
adjusted with 2 N HCl to 6. The obtained solid was filtered, washed
with 20% EtOAc/hexanes and dried in vacuo to obtain compound 10 (16
mg, 43%) as pale yellow solid. TLC: 20% EtOAc/hexanes (R.sub.f:
0.4); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta.13.43 (br s, 1H),
11.08 (s, 1H), 8.73 (s, 1H), 8.66 (d, J=4.8 Hz, 1H), 7.79-7.57 (m,
4H).
Example 2: Synthesis of 5-oxo-5, 6-dihydrobenzo [b] pyrido [4, 3-f]
[1, 4] thiazepine-8-carboxylic acid 11, 11-dioxide (11): A Common
Intermediate
##STR00069##
##STR00070##
[0418] To a stirring solution of 5-oxo-5, 6-dihydrobenzo [b] pyrido
[4, 3-f] [1, 4] thiazepine-8-carboxylic acid 10 (500 mg, 1.83 mmol)
in 1, 2 dichloro ethane:CH.sub.3CN:H.sub.2O (1:1:2, 20 mL) were
added sodium metaperiodate (1.17 g, 5.49 mmol), ruthenium chloride
(20.6 mg, 0.091 mmol) at RT and stirred for 6 h. The reaction was
monitored by TLC; after completion, the volatiles were removed in
vacuo. The precipitated solid was filtered, washed with water (50
mL), n-hexane (20 mL) and dried in vacuo to afford compound 11 (340
mg, 61%) as an off-white solid. TLC: 15% MeOH/CH.sub.2Cl.sub.2
(R.sub.f: 0.2); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta.13.72
(br s, 1H), 11.79 (s, 1H), 9.14 (s, 1H), 9.11 (d, J=5.0 Hz, 1H),
8.12 (d, J=8.3 Hz, 1H), 7.97-7.91 (m, 3H); LC-MS: 98.91%; 304.9
(M+1).sup.+; (column; Ascentis Express C18, (50.times.3.0 mm, 2.7
.mu.m); RT 1.61 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 mL/min).
Example 3: Synthesis of
7-methyl-5-oxo-5,6-dihydrobenzo[b]pyrido[4,3-f][1,4]thiazepine-8-carboxyl-
ic acid 11,11-dioxide (19): A Common Intermediate
##STR00071##
[0419] Synthesis of 1-Bromo-4-fluoro-2-methyl-3-nitrobenzene
(13)
##STR00072##
[0421] To a stirred solution of compound 12 (25 g, 161.2 mmol) in
TFA:conc. H.sub.2SO.sub.4 (150 mL:75 mL) at 0.degree. C., under
argon atmosphere, NBS (43 g, 241.9 mmol) was added portion wise and
stirred at RT for 3 h. The progress of the reaction was monitored
by TLC. After completion, the reaction mixture was poured in to ice
cold water (700 mL); the precipitated solid was collected by
filtration and washed with water. The residue was purified by
silica gel column chromatography using 2% EtOAc/hexane to afford
the title compound 13 (21 g, 56%) as a light yellow solid. TLC: 10%
EtOAc/hexane (R.sub.f: 0.6); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 7.89-7.86 (m, 1H), 7.48 (t, J=9.6 Hz, 1H), 2.36 (s,
3H).
Synthesis of Methyl
3-((4-bromo-3-methyl-2-nitrophenyl)thio)isonicotinate (14)
##STR00073##
[0423] To a stirred solution of compound 5 (6.2 g, 36.6 mmol) and
compound 13 (8.54 g, 36.6 mmol) in DMF (70 mL) CS.sub.2CO.sub.3 (12
g, 36.6 mmol) was added and stirred at 60.degree. C. for 12 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mixture was poured on ice; the obtained solid was
filtered and dried in vacuo. The crude compound was purified by
silica gel column chromatography using 10% EtOAc/hexane to afford
compound 14 (6 g, 58.47%) as a light yellow solid. TLC: 30%
EtOAc/Hexane (R.sub.f: 0.3); .sup.1H-NMR (400 MHz, DMSO-d.sub.6):
.delta. 8.52 (d, J=5.2 Hz, 1H), 8.08 (s, 1H), 7.98 (d, J=8.4 Hz,
1H), 7.81 (d, J=5.2 Hz, 1H), 7.71 (d, J=8.8 Hz, 1H), 3.89 (s, 3H),
2.36 (s, 3H); LCMS Observed: 282.95 (M+1).sup.+.
Synthesis of Methyl
3-((4-bromo-3-methyl-2-nitrophenyl)sulfonyl)isonicotinate (15)
##STR00074##
[0425] To a stirred solution of compound 14 (1.5 g, 3.93 mmol) in
1, 2 dichloro ethane:CH.sub.3CN:H.sub.2O (1:1:2, 40 mL) at
0.degree. C., sodium metaperiodate (2.5 g, 11.78 mmol) was added
and stirred for 10 min. To this solution, ruthenium trichloride
hydrate (0.04 g, 0.196 mmol) was added at 0.degree. C. The
resulting reaction mixture was stirred at RT for 12 h. The progress
of the reaction was monitored by TLC. After completion; the
reaction mixture was filtered through a pad of celite. The filtrate
was concentrated in vacuo. The crude compound was purified by
silica gel column chromatography using 15% EtOAc/hexane to afford
compound 15 (1 g, 63%) as a white solid. TLC: 50% EtOAc/Hexane
(R.sub.f: 0.3); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta.
9.13-9.11 (m, 2H), 8.20 (d, J=8.4 Hz, 1H), 7.87-7.85 (m, 2H), 3.84
(s, 3H), 2.33 (s, 3H); LCMS Observed (m/z): 416.95 (M+3).sup.+.
Synthesis of Methyl 3-((2-amino-4-bromo-3-methylphenyl)sulfonyl)
isonicotinate (16)
##STR00075##
[0427] To a stirred solution of compound 15 (5.4 g, 13.04 mmol) in
THF:H.sub.2O (3:1, 80 mL) mixture, iron powder (2.19 g, 39.13 mmol)
and NH.sub.4Cl (2.09 g, 39.13 mmol) was added and stirred at
70.degree. C. for 6 h. The progress of the reaction was monitored
by TLC. After completion, the reaction mixture was filtered through
a pad of celite. The filtrate was concentrated in vacuo. The
residue was diluted with water (100 mL) and extracted with ethyl
acetate (2.times.100 mL). The combined organic layers were dried
over anhydrous sodium sulfate, filtered and concentrated in vacuo
to obtain the crude. The crude was purified through silica gel
column chromatography using 20% EtOAc/hexane to afford compound 16
(4.8 g, 96%) as a white solid. TLC: 40% EtOAc/Hexane (R.sub.f:
0.5); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 9.32 (s, 1H),
8.99 (d, J=4.8 Hz, 1H), 7.74 (d, J=5.2 Hz, 1H), 7.47 (d, J=8.8 Hz,
1H), 7.04 (d, J=8.0 Hz, 1H), 6.21 (s, 2H), 3.89 (s, 3H), 2.22 (s,
3H); LCMS Observed (m/z): 384.95 (M+1).sup.+.
Synthesis of
8-Bromo-7-methylbenzo[b]pyrido[4,3-f][1,4]thiazepin-5(6H)-one
11,11-dioxide (17)
##STR00076##
[0429] To a stirred solution of compound 16 (4.8 g, 12.5 mmol) in
THF:H.sub.2O (3:1, 100 mL), LiOH (1.57 g, 37.5 mmol) was added and
stirred at 80.degree. C. for 6 h. The progress of the reaction was
monitored by TLC. After completion, the volatiles were removed in
vacuo. The crude was neutralized with 1 N HCl to pH.about.7; the
obtained solid was filtered and dried in vacuo to afford title
compound 17 (4.2 g, 95.67%) as a brown solid. TLC: 40% EtOAc/hexane
(R.sub.f: 0.4); The crude compound was used as such for the next
step without further purification. .sup.1H-NMR (400 MHz,
DMSO-d.sub.6): .delta. 11.26 (s, 1H), 9.08-9.05 (m, 2H), 7.88 (d,
J=4.8 Hz, 1H), 7.78 (s, 2H), 2.47 (s, 3H); LCMS Observed (m/z):
354.95 (M+3).sup.+.
Synthesis of Methyl
7-methyl-5-oxo-5,6-dihydrobenzo[b]pyrido[4,3-f][1,4]
thiazepine-8-carboxylate 11,11-dioxide (18)
##STR00077##
[0431] To a stirred solution of compound 17 (2.1 g, 5.96 mmol) in
MeOH (50 mL) under argon atmosphere in autoclave, sodium acetate
(1.46 g, 17.89 mmol) and dppf (0.33 g, 0.596 mmol) was added and
purged with argon for 30 min. To this solution, Pd(OAc).sub.2 (0.13
g, 0.596 mmol) was added and again purged with carbon monoxide. The
resulting reaction mixture was heated in autoclave at 100.degree.
C. for 150 psi pressure for 6 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mixture was
filtered through a pad of celite and filtrate was concentrated in
vacuo. The residue was diluted with water (100 mL) and extracted
with ethyl acetate (2.times.100 mL). The combined organic layers
were dried over anhydrous sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel column chromatography using 10% EtOAc/hexane to afford compound
18 (0.8 g, 40.4%) as a white solid. TLC: 50% EtOAc/hexane (R.sub.f:
0.3); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.15 (s, 1H),
9.08-9.06 (m, 2H), 7.97 (d, J=8.4 Hz, 1H), 7.90 (d, J=5.2 Hz, 1H),
7.72 (d, J=8.4 Hz, 1H), 3.86 (s, 3H), 2.46 (s, 3H); LCMS Observed
(m/z): 333 (M+1).sup.+.
Synthesis of
7-Methyl-5-oxo-5,6-dihydrobenzo[b]pyrido[4,3-f][1,4]thiazepine-8-carboxyl-
ic acid 11,11-dioxide (19)
##STR00078##
[0433] To a stirred solution of compound 18 (0.8 g, 2.41 mmol) in
THF:H.sub.2O (3:1, 10 mL), LiOH (0.303 g, 7.22 mmol) was added and
stirred at RT for 4 h. The progress of the reaction was monitored
by TLC. After completion, the volatiles were removed in vacuo. The
crude was acidified with 2 N HCl to pH.about.6; the obtained solid
was filtered and dried in vacuo to afford title compound 19 (0.75
g, 98%) as a white solid. TLC: 50% EtOAc/hexane (R.sub.f: 0.2); The
crude compound was used as such for the next step without further
purification. .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 13.20
(bs, 1H), 11.12 (s, 1H), 9.09-9.07 (m, 2H), 7.95-7.89 (m, 2H), 7.70
(d, J=8.0 Hz, 1H), 2.47 (s, 3H); LCMS Observed (m/z): 318.95
(M+1).sup.+.
Example 4: Synthesis of
2,3-dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]thiazepine-7-carboxylic
acid (27): A Common Intermediate
##STR00079##
[0434] Synthesis of 2-Methyl-3-oxobutanoic acid (21)
##STR00080##
[0436] A mixture of compound 20 (6 g, 41.66 mmol) and 1N NaOH (60
mL) was stirred at RT for 3 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mixture was
acidified with 6 N H.sub.2SO.sub.4 to pH.about.6 and extracted with
10% MeOH/DCM (3.times.100 mL). The combined organic layers were
dried over anhydrous sodium sulfate, filtered and concentrated in
vacuo to afford the title compound 21 (1.8 g, 37.26%) as an
off-white solid. TLC: 40% EtOAc/hexane (R.sub.f: 0.2, stain in
PMA); The crude compound was used as such for the next step without
further purification.
Synthesis of Methyl 4-((4-methoxybenzyl)thio)-3-nitrobenzoate
(23)
##STR00081##
[0438] To a stirred solution of compound 22 (20 g, 93.02 mmol) in
DMF (200 mL), Cs.sub.2CO.sub.3 (45.36 g, 139.5 mmol) and
(4-methoxyphenyl)methanethiol 3 (14.32 g, 93.02 mmol) were added.
The resulting reaction mixture was stirred at 60.degree. C. for 2
h. The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was diluted with ice cold water
(500 mL); the precipitated solid was collected by filtration;
washed with hexane and dried in vacuo to obtain title compound 23
(20 g, 64.57%) as an off-white solid TLC: 40% EtOAc/hexane
(R.sub.f: 0.3); The crude compound was used as such for the next
step without further purification. .sup.1H-NMR (400 MHz,
DMSO-d.sub.6): .delta. 8.62 (s, 1H), 8.15 (d, J=8.8 Hz, 1H), 7.88
(d, J=8.8 Hz, 1H), 7.38 (d, J=8.8 Hz, 2H), 6.91 (d, J=8.8 Hz, 2H),
4.38 (s, 2H), 3.90 (s, 3H), 3.74 (s, 3H).
Synthesis of Methyl 3-amino-4-((4-methoxybenzyl)thio)benzoate
(24)
##STR00082##
[0440] To a stirred solution of compound 23 (20 g, 60 mmol) in AcOH
(200 mL), iron powder (13.45 g, 240 mmol) was added and stirred at
90.degree. C. for 2 h. The progress of the reaction was monitored
by TLC. After completion, the reaction mixture was filtered through
a pad of celite. The filtrate was concentrated in vacuo. The
residue was diluted with sat. NaHCO.sub.3 solution and extracted
with ethyl acetate (3.times.500 mL). The combined organic extracts
were dried over sodium sulfate, filtered and concentrated in vacuo
to afford the title compound 24 (13.5 g, 74.21%) an off-white solid
TLC: 30% EtOAc/hexane (R.sub.f: 0.4); The crude compound was used
as such for the next step without further purification .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 7.96 (s, 1H), 7.71 (d, J=8.4 Hz,
1H), 7.53 (d, J=8.4 Hz, 1H), 7.31 (d, J=8.4 Hz, 2H), 6.87 (d, J=8.4
Hz, 2H), 4.22 (s, 2H), 3.83 (s, 3H), 3.73 (s, 3H).
Synthesis of Methyl
4-((4-methoxybenzyl)thio)-3-(2-methyl-3-oxobutanamido) benzoate
(25)
##STR00083##
[0442] To a stirred solution of compound 24 (1 g, 3.30 mmol) and
compound 21 (2 g, 17.39 mmol) in THF (10 mL) under argon
atmosphere, T.sub.3P (2 g, 6.60 mmol) and DIPEA (1.27 g, 9.90 mmol)
were added and stirred at RT for 16 h. The progress of the reaction
was monitored by TLC. After completion, the reaction mixture was
diluted with water (100 mL) and extracted with ethyl acetate
(3.times.100 mL). The combined organic extracts were dried over
sodium sulfate and dried in vacuo to afford the crude compound. The
crude compound was purified by silica gel column chromatography
using 15% EtOAc/hexane to afford the title compound 25 (0.8 g,
60.6%) as an off-white solid TLC: 40% EtOAc/hexane (R.sub.f: 0.3);
.sup.1H NMR (400 MHz, DMSO-d.sub.6) 9.81 (s, 1H), 7.93 (s, 1H),
7.74 (d, J=8.4 Hz, 1H), 7.56 (d, J=8.0 Hz, 1H), 7.30 (d, J=8.0 Hz,
2H), 6.87 (d, J=8.4 Hz, 2H), 4.25 (s, 2H), 3.83 (s, 3H), 3.79-3.75
(m, 1H), 3.72 (s, 3H), 2.20 (s, 3H), 1.21 (d, J=6.8 Hz, 3H), LCMS
Observed (m/z): 402.10 (M+1).sup.+.
Synthesis of Methyl
2,3-dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]thiazepine-7-carboxylate
(26)
##STR00084##
[0444] A mixture of compound 25 (0.3 g, 0.744 mmol) and PPA (3 g)
was heated at 100.degree. C. for 2 h. The progress of the reaction
was monitored by TLC. After completion, the reaction mixture was
quenched with ice cold water (50 mL) and extracted with ethyl
acetate (3.times.50 mL). The combined organic layers were dried
over anhydrous sodium sulfate, filtered and concentrated in vacuo
to obtain the crude. The crude was purified by silica gel column
chromatography using 10% EtOAc/hexane to afford the title compound
26 (0.075 g, 38%) as an off-white solid TLC: 30% EtOAc/hexane
(R.sub.f: 0.2); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 10.48
(s, 1H), 7.75-7.62 (m, 2H), 7.58 (d, J=8.1 Hz, 1H), 3.85 (s, 3H),
2.08 (s, 3H), 1.82 (s, 3H).
Synthesis of
2,3-Dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]thiazepine-7-carboxylic
acid (27)
##STR00085##
[0446] To a stirred solution of compound 26 (0.11 g, 0.418 mmol) in
THF:H.sub.2O (3:1, 8 mL). LiOH (0.053 g, 1.25 mmol) was added and
stirred at RT for 4 h. The progress of the reaction was monitored
by TLC. After completion, the volatiles were removed in vacuo. The
crude was acidified with 2 N HCl to pH.about.5; the obtained solid
was filtered and dried in vacuo to afford title compound 27 (0.1 g,
96.41) as an off-white solid. LCMS Observed (m/z): 249.95
(M+1).sup.+.
Example 5: Synthesis of
2,3-dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]thiazepine-7-carboxylic
acid 1,1-dioxide (29): A Common Intermediate
##STR00086##
[0447] Synthesis of Methyl
2,3-dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]thiazepine-7-carboxylate
1,1-dioxide (28)
[0448] To a stirred solution of compound 26 (0.4 g, 1.52 mmol) in
1,2 dichloro ethane:CH.sub.3CN:H.sub.2O (1:1:2, 64 mL), sodium
metaperiodate (0.976 g, 4.56 mmol) were added and stirred for 10
min. To this solution, ruthenium trichloride hydrate (0.016 g,
0.076 mmol) was added at 0.degree. C. The resulting reaction
mixture was stirred at RT for 16 h. The progress of the reaction
was monitored by TLC. After completion; the reaction mixture was
diluted with water (50 mL) and extracted with ethyl acetate
(3.times.50 mL). The combined organic layers were dried over
anhydrous sodium sulfate, filtered and concentrated in vacuo to
afford the crude compound. The crude was purified by silica gel
column chromatography using 20% EtOAc/hexane to afford compound 28
(0.2 g, 44.57%) as an off-white solid TLC: 50% EtOAc/hexane
(R.sub.1: 0.2); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.47
(s, 1H), 7.98 (d, J=8.2 Hz, 1H), 7.94-7.89 (m, 2H), 3.90 (s, 3H),
2.13 (s, 3H), 2.05 (s, 3H). LCMS Observed (m/z): 296.05
(M+1).sup.+.
Synthesis of
2,3-Dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]thiazepine-7-carboxylic
acid 1,1-dioxide (29)
[0449] To a stirred solution of compound 28 (0.2 g, 0.677 mmol) in
THF:H.sub.2O (3:1, 16 mL). LiOH (0.086 g, 2.03 mmol) was added and
stirred at RT for 4 h. The progress of the reaction was monitored
by TLC. After completion, the volatiles were removed in vacuo. The
residue was acidified with 2 N HCl to pH.about.5; the obtained
solid was filtered and dried in vacuo to afford title compound 29
(180 mg, 94%) as an off-white solid. TLC: 100% ethyl acetate
(R.sub.f: 0.1); .sup.1H NMR (400 MHz, DMSO-d.sub.6): 13.50 (br.s,
1H), 11.44 (s, 1H), 7.98-7.84 (m, 3H), 2.12 (s, 3H), 2.05 (s, 3H);
LCMS Observed (m/z): 281.95 (M+1).sup.+.
Example 6: Synthesis of
11-oxo-1,2,3,10,11,11a-hexahydrobenzo[f]pyrrolo[1,2-b][1,2,5]thiadiazepin-
e-8-carboxylic acid 5,5-dioxide (39): A Common Intermediate
##STR00087## ##STR00088##
[0450] Synthesis of 4-Bromo-2-nitrobenzenesulfonic acid (31)
##STR00089##
[0452] To a stirred solution of compound 30 (25 g, 113.6 mmol) in
MeOH (300 mL), solution of Na.sub.2SO.sub.3 (31.5 g, 250 mmol,
dissolved in 600 mL H.sub.2O and 500 mL MeOH) was added slowly. The
resulting reaction mixture was stirred at 70.degree. C. for 24 h.
The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was cooled to RT and acidified
with conc. HCl to pH.about.2 and filtered. The filtrate was
concentrated in vacuo. The obtained residue was dissolved in 500 mL
brine solution and heated at 100.degree. C. till getting clear
solution, then cooled it at 0.degree. C., diluted with water (50
mL), the precipitated solid was collected by filtration and dried
in vacuo to afford the title compound 31 (24.2 g, 76%) as a
light-yellow solid. TLC: 100% ethyl acetate (R.sub.f: 0.2);
.sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta. 7.95 (s, 1H),
7.80-7.74 (m, 2H).
Synthesis of 4-bromo-2-nitrobenzenesulfonyl chloride (32)
##STR00090##
[0454] A suspension of compound 31 (2.5 g, 8.86 mmoL) in SOCl.sub.2
(10 mL {4 vo.}) and DMF (0.2 mL) under argon atmosphere was heated
to reflux for 2 h. The progress of the reaction was monitored by
TLC. After completion of the reaction, excess thionyl chloride was
removed in vacuo to obtain crude compound 32 (2.6 g crude) as a
pale-yellow semi solid. The crude was carried to the next step
without further purification. TLC: 50% EtOAc/hexanes (R.sub.f:
0.7).
Synthesis of methyl ((4-bromo-2-nitrophenyl)sulfonyl)prolinate
(34)
##STR00091##
[0456] To a stirred solution of compound 33 (2.15 g, 12.98 mmol) in
DCM (10 mL) at 0.degree. C. under argon atmosphere was added DIPEA
(4.5 mL, 25.96 mmol) and a prepared solution of compound 32 (2.6 g,
6.65 mmol) in DCM (20 mL). The reaction mixture was slowly warmed
to RT and stirred at RT for 4 h. The progress of the reaction was
monitored by TLC. After completion of the reaction, the reaction
mixture was diluted with water (20 mL) and extracted with DCM
(3.times.30 mL). The combined organic layer was dried over
anhydrous sodium sulfate, filtered and concentrated in vacuo to
obtain the crude. The crude compound was purified by silica gel
column chromatography using 20% EtOAc/hexane to afford the title
compound 34 (1.9 g, 55.9%) as a pale yellow solid TLC: 50%
EtOAc/hexanes (R.sub.f: 0.5); .sup.1H-NMR (400 MHz, DMSO-d.sub.6):
.delta. 8.37 (d, J=1.6 Hz, 1H), 8.06 (d, J=8.8 Hz, 1.6 Hz, 1H),
7.96 (d, J=8.8 Hz, 1H), 4.47-4.46 (m, 1H), 3.61 (s, 3H), 3.49-3.44
(m, 1H), 3.37-3.3 (m, 1H), 2.21-2.16 (m, 1H), 1.98-1.84 (m, 3H).
LCMS Observed: 395 (M+2).sup.+.
Synthesis of methyl ((2-amino-4-bromophenyl)sulfonyl)prolinate
(35)
##STR00092##
[0458] To a stirred solution of compound 34 (1.2 g, 3.05 mmol) in
acetic acid (12 mL) under argon atmosphere was added iron powder
(0.68 g, 12.2 mmol) at RT; the reaction mixture was heated to
90.degree. C. and stirred for 12 h. The progress of the reaction
was monitored by TLC. After completion, the reaction mixture was
filtered through a pad of celite. The filtrate was concentrated in
vacuo. The residue was diluted with water (200 mL) and pH was
adjusted to .about.7 using sat. NaHCO.sub.3 solution and extracted
with ethyl acetate (3.times.50 mL). The combined organic extracts
were dried over sodium sulfate, filtered and concentrated in vacuo
to afford compound 35 (0.9 g, 81.8%) an as pale brown oil. The
crude compound was used as such for the next step without further
purification. TLC: 50% EtOAc/hexanes (R.sub.f: 0.5) .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 7.41 (d, J=8.4 Hz, 1H), 7.07 (d,
J=2 Hz, 1H), 6.78 (d, J=8.4, 2 Hz, 1H), 6.36 (s, 2H), 4.37-4.34 (m,
1H), 3.65 (s, 3H), 3.27-3.15 (m, 2H), 2.14-2.04 (m, 1H), 1.94-1.87
(m, 3H). LCMS Observed: 365 (M+2).sup.+.
Synthesis of ((2-amino-4-bromophenyl)sulfonyl)proline (36)
##STR00093##
[0460] To a stirred solution of compound 35 (0.8 g, 2.2 mmol) in
THF:H.sub.2O (3:1, 15 mL) at 0.degree. C. was added lithium
hydroxide monohydrate (0.55 g, 13.2 mmol) and stirred at 80.degree.
C. for 12 h. The progress of the reaction was monitored by TLC.
After completion of the reaction, the volatiles were removed in
vacuo. The residue was diluted with water (30 mL); pH was adjusted
to .about.2 using 2N Hydrochloric acid and the obtained solid was
filtered and dried in vacuo to afford title compound 36 (0.6 g,
78%) as white solid. TLC: 50% EtOAc/hexane (R.sub.f: 0.1) .sup.1H
NMR (400 MHz, DMSO-d.sub.6): 12.86 (s, 1H), 7.43 (d, J=8.8 Hz, 1H),
7.06 (d, J=1.6 Hz, 1H), 6.77 (d, J=8.8, 1.6 Hz, 1H), 6.45 (s, 2H),
4.28-4.25 (m, 1H), 3.16 (t, J=6.4, 2H), 2.17-2.04 (m, 1H),
1.94-1.71 (m, 3H). LCMS Observed: 351 (M+2).sup.+.
Synthesis of
8-bromo-1,2,3,11a-tetrahydrobenzo[f]pyrrolo[1,2-b][1,2,5]thiadiazepin-11(-
10H)-one 5,5-dioxide (37)
##STR00094##
[0462] To a stirred solution of compound 36 (4.5 g, 12.88 mmol) in
DMF (25 mL) at RT were added DIPEA (6.7 mL, 38.65 mmol) and HATU
(7.34 g, 19.32 mmol) stirred at RT for 12 h. The progress of the
reaction was monitored by TLC. After completion, the reaction
mixture was quenched with ice cold water (200 mL), the obtained
solid was filtered and dried in vacuo to obtain the crude. The
crude compound was purified by silica gel column chromatography
using 50% EtOAc/hexane to afford the title compound 37 (2.1 g,
49.3%) as light yellow solid. TLC: 50% EtOAc/hexanes (R.sub.f:
0.7). LCMS Observed: 333 (M+2).sup.+.
Synthesis of methyl
11-oxo-1,2,3,10,11,11a-hexahydrobenzo[f]pyrrolo[1,2-b] [1,2,5]
thiadiazepine-8-carboxylate 5,5-dioxide (38)
##STR00095##
[0464] To a stirred solution of compound 37 (1.7 g, 5.13 mmol) in
MeOH:ACN (4:1, 20 mL) mixture under inert atmosphere in a autoclave
were added TEA (2.14 mL, 15.4 mmol), dppf (0.281 g, 0.508 mmol) and
Pd(OAc).sub.2 (0.093 g, 0.415 mmol) at RT, heated to 100.degree.
C., under CO gas atmosphere (150 psi) and stirred for 6 h. The
progress of the reaction was monitored by TLC. After completion of
the reaction, the reaction mixture was filtered through a pad of
celite and filtrate was concentrated in vacuo. The crude was
purified by silica gel column chromatography using 50% EtOAc/hexane
to afford the title compound 38 (0.65 g, 40.9%) as off white solid.
TLC: 50% EtOAc/hexane (R.sub.f: 0.4); .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.6 (s, 1H), 7.91-7.87 (m, 2H), 7.76-7.74
(m, 1H), 4.41 (t, J=7.2H, 1H), 3.89 (s, 3H), 3.38-3.30 (m, 1H),
2.89-2.68 (m, 1H), 2.39-2.33 (m, 1H), 1.98-1.73 (m, 3H). LCMS
Observed: 309 (M-1).sup.-.
Synthesis of
12-oxo-1,3,4,11,12,12a-hexahydro-2H-benzo[f]pyrido[1,2-b][1,2,5]thiadiaze-
pine-9-carboxylic acid 6,6-dioxide (39)
[0465] To a stirred solution of compound 38 (0.55 g, 1.77 mmol) in
THF:H.sub.2O (3:1.12 mL) mixture at 0.degree. C. was added lithium
hydroxide (0.22 g, 5.31 mmol). The reaction mixture was slowly
warmed to RT and stirred at RT for 4 h. The progress of the
reaction was monitored by TLC. After completion of the reaction,
the volatiles were removed in vacuo. The residue was diluted with
water (200 mL); pH was adjusted to .about.2 using 2N Hydrochloric
acid and extracted with DCM (2.times.25 mL). The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to afford the crude compound 39 (0.30 g,
57.7%) as off white solid. The crude compound was used as such for
the next step without further purification. TLC: 60% EtOAc/hexane
(R.sub.f: 0.2) LCMS Observed: 295 (M-1).sup.-.
Example 7: Synthesis of
12-oxo-1,3,4,11,12,12a-hexahydro-2H-benzo[f]pyrido[1,2-b][1,2,5]
thiadiazepine-9-carboxylic acid 6,6-dioxide (46): A Common
Intermediate
##STR00096##
[0466] Synthesis of Methyl
1-((4-bromo-2-nitrophenyl)sulfonyl)piperidine-2-carboxylate
(41)
##STR00097##
[0468] To a stirred solution of compound 32 (10.6 g, 30.19 mmol) in
DCM (50 mL) at 0.degree. C. under argon atmosphere was added DIPEA
(24 mL, 105 mmol) and a prepared solution of compound 40 (8.9 mL,
53.57 mmol) in DCM (20 mL). The reaction mixture was slowly warmed
to RT and stirred at RT for 4 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mixture was
diluted with water (500 mL) and extracted with DCM (3.times.600
mL). The combined organic layers were dried over anhydrous sodium
sulfate, filtered and concentrated in vacuo to obtain the crude.
The crude compound was purified by silica gel column chromatography
using 20% EtOAc/hexane to afford the title compound 41 (6.2 g, 42%)
as a brown oil. TLC: 50% EtOAc/hexanes (R.sub.f: 0.4); .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 8.37 (d, J=2.0 Hz, 1H), 8.09-8.06
(m, 1H), 7.98 (d, J=8.4 Hz, 1H), 4.65 (d, J=4.4 Hz, 1H), 3.74-3.59
(m, 1H), 3.56 (s, 3H), 3.19-3.12 (m, 1H), 2.09-1.98 (m, 1H),
1.72-1.63 (m, 3H), 1.36-1.29 (m, 1H), 1.18-1.10 (m, 1H).
Synthesis of Methyl
1-((2-amino-4-bromophenyl)sulfonyl)piperidine-2-carboxylate
(42)
##STR00098##
[0470] To a stirred solution of compound 41 (6.2 g, 15.2 mmol) in
AcOH (50 mL), iron powder (3.4 g, 60.93 mmol) was added and stirred
at 90.degree. C. for 12 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mixture was
filtered through a pad of celite. The filtrate was concentrated in
vacuo. The residue was diluted with water (200 mL) and pH was
adjusted to .about.7 using sat. NaHCO.sub.3 solution and extracted
with ethyl acetate (3.times.200 mL). The combined organic extracts
were dried over sodium sulfate, filtered and concentrated in vacuo
to afford compound 42 (4.8 g, 84%) as a yellow oil. TLC: 20%
EtOAc/hexanes (R.sub.f: 0.6, stain in ninhydrin solution); The
crude compound was used as such for the next step without further
purification. .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 7.38 (d,
J=8.4 Hz, 1H), 7.06 7.38 (d, J=2.0 Hz, 1H), 6.78-6.75 (m, 1H), 6.15
(s, 2H), 4.71 (d, J=4.4 Hz, 1H), 3.60 (s, 3H), 3.55-3.52 (m, 1H),
3.16-3.09 (m, 1H), 1.98-1.96 (m, 1H), 1.64-1.51 (m, 3H), 1.23-1.18
(m, 2H).
Synthesis of
1-((2-Amino-4-bromophenyl)sulfonyl)piperidine-2-carboxylic acid
(43)
##STR00099##
[0472] To a stirred solution of compound 42 (4.8 g, 12.76 mmol) in
THF:H.sub.2O (2:1, 75 mL). LiOH (3.2 g, 76.5 mmol) was added and
stirred at 80.degree. C. for 12 h. The progress of the reaction was
monitored by TLC. After completion, the volatiles were removed in
vacuo. The crude was acidified with 1N HCl to pH.about.3; the
obtained solid was filtered and dried in vacuo to afford title
compound 43 (3.8 g, 82.2%) as a white solid. The crude compound was
used as such for the next step without further purification.
.sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 7.40 (d, J=8.4 Hz,
1H), 7.05 (s, 1H), 6.77-6.74 (m, 1H), 6.15 (s, 2H), 4.59 (d, J=4.0
Hz, 1H), 3.53-3.35 (m, 2H), 1.58-1.51 (m, 3H), 1.23-1.16 (m, 3H).
LCMS Observed (m/z): 363 (M+1).sup.+.
Synthesis of
9-Bromo-1,3,4,12a-tetrahydro-2H-benzo[f]pyrido[1,2-b][1,2,5]
thiadiazepin-12(11H)-one 6,6-dioxide (44)
##STR00100##
[0474] To a stirred solution of compound 43 (3.8 g, 10.49 mmol) in
DMF (40 mL), DIPEA (5.5 mL, 31.47 mmol) and HATU (5.9 g, 15.74
mmol) was added and stirred at RT for 12 h. The progress of the
reaction was monitored by TLC. After completion, the reaction
mixture was quenched with ice cold water, the obtained solid was
filtered and dried in vacuo to obtain the crude. The crude compound
was purified by silica gel column chromatography using 50%
EtOAc/hexane to afford the title compound 44 (2.1 g, 58%) as alight
yellow solid. TLC: 50% EtOAc/hexanes (R.sub.f: 0.5); .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 10.63 (s, 1H), 7.66 (d, J=8.4 Hz,
1H), 7.53-7.49 (m, 2H), 3.84-3.81 (m, 1H), 3.06-2.87 (m, 2H),
2.05-1.98 (m, 1H), 1.69-1.43 (m, 5H). LCMS Observed (m/z): 345
(M+1).sup.+.
Synthesis of Methyl
12-oxo-1,3,4,11,12,12a-hexahydro-2H-benzo[f]pyrido[1,2-b][1,2,5]
thiadiazepine-9-carboxylate 6,6-dioxide (45)
##STR00101##
[0476] To a stirred solution of compound 44 (1.5 g, 4.34 mmol) in
MeOH:ACN (4:1, 20 mL) mixture under argon atmosphere TEA (1.8 mL,
13.07 mmol), dppf (0.238 g, 0.434 mmol) and Pd(OAc).sub.2 (0.078 g,
0.351 mmol) was added and stirred at 100.degree. C. under CO gas
atmosphere for 6 h. The progress of the reaction was monitored by
TLC. After completion, the reaction mixture was filtered through a
pad of celite and filtrate was concentrated in vacuo. The crude was
purified through silica gel column chromatography using 20%
EtOAc/hexane to afford the title compound 45 (0.23 g, 16%) as a
yellow solid. TLC: 15% EtOAc/hexane (R.sub.f: 0.3); .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 10.73 (s, 1H), 7.91-7.88 (m, 2H),
7.83 (d, J=8.4 Hz, 1H), 3.90 (s, 3H), 3.84-3.81 (m, 1H), 3.17-3.09
(m, 1H), 2.92-2.87 (m, 1H), 1.70-1.45 (m, 6H). LCMS observed (m/z):
325 (M+1).sup.+.
Synthesis of
12-Oxo-1,3,4,11,12,12a-hexahydro-2H-benzo[f]pyrido[1,2-b][1,2,5]
thiadiazepine-9-carboxylic acid 6,6-dioxide (46)
##STR00102##
[0478] To a stirred solution of compound 45 (0.23 g, 0.709 mmol) in
THF:H.sub.2O (2:1, 5 mL) mixture, LiOH (0.089 g, 2.12 mmol) was
added and stirred at RT for 4 h. The progress of the reaction was
monitored by TLC. After completion, the volatiles were removed in
vacuo. The residue was acidified with 1N HCl to pH.about.3 and
extracted with DCM (2.times.25 mL). The combined organic layers
were dried over anhydrous sodium sulfate, filtered and concentrated
in vacuo to afford the crude compound 46 (0.19 g, 86%) as a white
solid. TLC: 50% EtOAc/hexane (R.sub.f: 0.2); .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 13.58 (br.s, 1H), 10.73 (s, 1H), 7.87-7.80
(m, 3H), 4.09-4.00 (m, 1H), 3.77-3.75 (m, 1H), 2.88-2.84 (m, 1H),
2.04-1.90 (m, 1H), 1.68-1.45 (m, 5H).
Example 8: Synthesis of
2,3-dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]oxazepine-7-carboxylic
acid (53): A Common Intermediate
##STR00103##
[0479] Synthesis of Benzyl 2-methyl-3-oxobutanoate (48)
##STR00104##
[0481] To a stirred solution of benzyl 3-oxobutanoate 47 (20 g,
104.16 mmol) in CH.sub.3CN (200 mL), K.sub.2CO.sub.3 (28.74 g,
208.3 mmol) was added and stirred at RT for 15 min. To this
solution, MeI (13.25 mL, 208.3 mmol) was added. The resulting
reaction mixture was stirred at 80.degree. C. for 12 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mixture was diluted with water (700 mL) and extracted
with ethyl acetate (3.times.700 mL). The combined organic layers
were dried over anhydrous sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude compound was purified by
silica gel column chromatography using 10% EtOAc/hexane to afford
the title compound 48 (15 g, 71%) as an off-white solid. TLC: 30%
EtOAc/hexanes (R.sub.f: 0.3); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 7.39-7.31 (m, 5H), 5.14 (s, 2H), 3.78-3.74 (m, 1H), 2.16
(s, 3H), 1.20 (d, J=7.2 Hz, 3H).
Synthesis of 2-Methyl-3-oxobutanoic acid (21)
##STR00105##
[0483] To a stirred solution of compound 48 (3 g, 14.56 mmol) in
dry THF (10 mL) under argon atmosphere, 10% Pd/C (0.6 mg) was added
and the reaction mass was stirred at room temperature under
hydrogen pressure (balloon pressure) for 3 h. The progress of the
reaction was monitored by TLC. After completion, the reaction mass
was filtered through a pad of celite and washed with methanol. The
filtrate was concentrated in vacuo (at temp. 20.degree. C.) to
afford the crude compound 21 (2 g, crude) as an off-white solid.
The crude compound was used as such for the next step without
further purification. TLC: 5% MeOH/DCM (R.sub.f: 0.2, stain in
KMnO.sub.4 solution); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta.
12.71 (s, 1H), 3.60-3.55 (m, 1H), 2.16 (s, 3H), 1.16-1.14 (m,
3H).
Synthesis of Methyl 3-amino-4-hydroxybenzoate (50)
##STR00106##
[0485] To a stirred solution of compound 49 (5 g, 25.38 mmol) in
THF:MeOH (1:1, 10 mL) mixture under argon atmosphere, 10% Pd/C (1
g) was added. The reaction mass was stirred at room temperature
under hydrogen pressure (balloon pressure) for 12 h. The progress
of the reaction was monitored by TLC. After completion, the
reaction mass was filtered through a pad of celite and washed with
methanol. The filtrate was concentrated in vacuo to afford the
crude compound 50 (4 g, crude) as an off-white solid. The crude
compound was used as such for the next step without further
purification. TLC: 5% MeOH/DCM (R.sub.f: 0.2); .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 10.00 (br.s, 1H), 7.24 (s, 1H), 7.09
(d, J=7.6 Hz, 1H), 6.70 (d, J=8.4 Hz, 1H), 4.81 (br.s, 2H), 3.74
(s, 3H), LCMS Observed (m/z): 168 (M+1).sup.+.
Synthesis of Methyl 4-hydroxy-3-(2-methyl-3-oxobutanamido) benzoate
(51)
##STR00107##
[0487] To a stirred solution of compound 50 (0.2 g, 1.19 mmol) in
DMF (5 mL), compound 21 (0.416 g, 3.50 mmol), EDCI (0.276 g, 1.78
mmol) and HOBt (0.218 g, 1.42 mmol) was added and stirred at RT for
12 h. The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was diluted with water (20 mL) and
extracted with 5% MeOH/DCM (3.times.20 mL). The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to obtain the crude. The crude was purified
through silica gel column chromatography using 5% MeOH/DCM to
afford compound 51 (0.166 g, 52%) as an off-white solid. TLC: 5%
MeOH/DCM (R.sub.f: 0.3); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 10.88 (s, 1H), 9.62 (s, 1H), 8.53 (s, 1H), 7.62-7.59 (m,
1H), 6.96 (d, J=8.4 Hz, 1H), 3.97-3.95 (m, 1H), 3.92 (s, 3H), 2.18
(s, 3H), 1.22 (d, J=9.2 Hz, 3H).
Synthesis of Methyl
2,3-dimethyl-4-oxo-4,5-dihydrobenzo[b][1,4]oxazepine-7-carboxylate
(52)
##STR00108##
[0489] A mixture of compound 51 (0.1 g, 0.377 mmol) and PPA (1.2 g,
7.93 mmol) was heated at 100.degree. C. for 2 h. The progress of
the reaction was monitored by TLC. After completion, the reaction
mixture was quenched with sat. aq. NaHCO.sub.3 solution and
extracted with DCM (3.times.20 mL). The combined organic layers
were dried over anhydrous sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel column chromatography using 5% MeOH/DCM to afford compound 52
(0.1 g, 17%) as an off-white solid. TLC: 5% MeOH/DCM (R.sub.f:
0.4); LCMS Observed (m/z): 247.90 (M+1).sup.+.
Synthesis of 2,3-Dimethyl-4-oxo-4,5-dihydrobenzo
[b][1,4]oxazepine-7-carboxylic acid (53)
##STR00109##
[0491] To a stirred solution of compound 52 (0.1 g, 0.405 mmol) in
THF:MeOH:H.sub.2O (2.5 mL:2.5 mL, 1 mL) mixture, LiOH (0.015 g,
0.60 mmol) was added and stirred at RT for 4 h. The progress of the
reaction was monitored by TLC. After completion, the volatiles were
removed in vacuo. The residue was acidified with sat. citric acid
solution and extracted with 10% MeOH/DCM (2.times.20 mL). The
combined organic layers were dried over anhydrous sodium sulfate,
filtered and concentrated in vacuo to afford the crude compound 53
(0.1 g, crude) as an off-white solid. The crude compound was used
as such for the next step without further purification TLC: 5%
MeOH/DCM (R.sub.f: 0.2); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 13.02 (br.s, 1H), 10.62 (s, 1H), 7.67-7.62 (m, 2H), 7.19
(d, J=8.4 Hz, 1H), 2.07 (s, 3H), 1.73 (s, 3H). LCMS Observed (m/z):
233.95 (M+1).sup.+.
Example 9: Synthesis of
6-oxo-5,6,7,7a,8,9,10,11-octahydrobenzo[b]pyrido[1,2-d][1,4]
diazepine-3-carboxylic acid (58): A Common Intermediate
##STR00110##
[0492] Synthesis of methyl 2-(piperidin-2-yl) acetate (55)
##STR00111##
[0494] To a stirred solution of compound 54 (3 g, 18.18 mmol) in
methanol (25 mL), PtO.sub.2 (0.82 g, 3.63 mmol) was added and
stirred at RT under hydrogen atmosphere at 50 psi for 18 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mass was filtered through a pad of celite. The
filtrate was concentrated in vacuo. to afford the crude compound 55
(2.7 g, 87.09%) as a colorless liquid. The crude compound was used
as such for the next step without further purification. TLC: 50%
ethyl acetate/hexane (R.sub.f: 0.2); Note: Trans esterified
compound was observed as a major product. ES-MS Observed for ethyl
ester (m/z): 172 (M+1).sup.+ and ES-MS Observed for methyl ester
(m/z): 158 (M+1).sup.+.
Synthesis of Ethyl 4-(2-(2-ethoxy-2-oxoethyl)
piperidin-1-yl)-3-nitrobenzoate (56)
##STR00112##
[0496] To a stirred solution of compound 6 (1 g, 5.03 mmol) in ACN
(10 mL), TEA (2.7 mL, 20.10 mmol) and compound 55 (1.03 g, 6.03
mmol) were added and stirred at 60.degree. C. for 12 h. The
progress of the reaction was monitored by TLC. After completion,
the volatiles were removed in vacuo. The residue was diluted with
water (100 mL) and extracted with ethyl acetate (3.times.100 mL).
The combined organic layers were dried over anhydrous sodium
sulfate, filtered and concentrated in vacuo to afford the crude
compound 56 (1.8 g, crude) as a yellow solid. The crude compound
was used as such for the next step without further purification.
TLC: 30% ethyl acetate/hexane (R.sub.f: 0.2; Note: Major methyl
ester was observed. LC-MS Observed for methyl ester (m/z): 337.10
(M+1).sup.+.
Synthesis of Methyl
6-oxo-5,6,7,7a,8,9,10,11-octahydrobenzo[b]pyrido[1,2-d][1,4]diazepine-3-c-
arboxylate (57)
##STR00113##
[0498] To a stirred solution of compound 56 (1 g, 2.85 mmol) in
ethyl acetate (10 mL), Zinc powder (0.56 g, 8.57, mmol) and 1N HCl
(10 mL) was added and stirred at 80.degree. C. for 12 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mixture was filtered through a pad of celite. The
filtrate was washed with water and extracted with ethyl acetate.
The combined organic layers were dried over anhydrous sodium
sulfate, filtered and concentrated in vacuo to afford the crude
compound. The crude was purified through silica gel column
chromatography using 10% EtOAc/hexane to afford compound 57 (0.29
g, 35.58%) as a light yellow solid. TLC: 40% ethyl acetate/hexane
(R.sub.f: 0.3); LC-MS Observed (m/z): 275.10 (M+1).sup.+.
Synthesis of
6-Oxo-5,6,7,7a,8,9,10,11-octahydrobenzo[b]pyrido[1,2-d][1,4]diazepine-3-c-
arboxylic acid (58)
##STR00114##
[0500] To a stirred solution of compound 57 (0.29 g, 1.01 mmol) in
THF:MeOH:H.sub.2O (1:1:1, 10 mL) mixture, LiOH (0.096 g, 4.03 mmol)
was added and stirred at 60.degree. C. for 4 h. The progress of the
reaction was monitored by TLC. After completion, the volatiles were
removed in vacuo. The residue was acidified with 1 N HCl up to
P.sup.H=6 and extracted with ethyl acetate (3.times.50 mL). The
combined organic layers were dried over anhydrous sodium sulfate,
filtered and concentrated in vacuo to afford the crude compound 58
(0.225 g, 89.64%) as a white solid. The crude compound was used as
such for the next step without further purification. TLC: 10%
MeOH/DCM (R.sub.f: 0.2); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 12.55 (br.s, 1H), 9.61 (s, 1H), 7.66 (dd, J=8.4 & 1.6
Hz, 1H), 7.47 (d, J=1.6 Hz, 1H), 7.11 (d, J=8.4 Hz, 1H), 3.26-3.17
(m, 2H), 2.94-2.91 (m, 1H), 2.75-2.67 (m, 2H), 1.98-1.33 (m, 6H),
LCMS (m/z): 261.10 (M+1).sup.+.
Preparation of Amines for Coupling Reaction:
Example 10: Synthesis of (2-methylthiazol-5-yl) methanamine
hydrochloride (67)
##STR00115##
[0501] Synthesis of ethyl 2-chloro-3-oxopropanoate (61)
[0502] To a stirred solution of ethyl 2-chloroacetate 59 (5 g,
40.98 mmol) and 60 (3.03 g, 40.98 mmol) in diisopropyl ether (100
mL) under argon atmosphere was added potassium tert-butoxide (5.49
g, 45.08 mmol) portion wise for 10 min at 0.degree. C.; warmed to
RT and stirred for 24 h. The reaction was monitored by TLC; after
completion of the reaction, the pH of the reaction mixture was
adjusted to .about.6 using 5 N HCl. The obtained solid was
filtered, washed with diethyl ether (200 mL) and dried in vacuo to
afford compound 61 (6 g) as pale brown syrup. TLC: 30%
EtOAc/hexanes (R.sub.f: 0.2); LC-MS: 21.49%+75.58%; 149.0
(M-1).sup.-; (column; X-Select C-18, (50.times.3.0 mm, 3.5 .mu.m);
RT 0.56 min, 0.77 min. 5 Mm Aq.NH.sub.4OAc:ACN 0.8 mL/min).
Synthesis of ethyl 2-methylthiazole-5-carboxylate (63)
[0503] To a stirred solution of ethyl 2-chloro-3-oxopropanoate 61
(26 g, 173.33 mmol) in ethanol (200 mL) under argon atmosphere were
added ethanethioamide 62 (10 g, 133.33 mmol), dry magnesium sulfate
(10 g) at RT and heated to reflux for 24 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo, diluted with EtOAc (500 mL). The combined
organic extracts were washed with saturated sodium bicarbonate
solution (2.times.200 mL), brine (200 mL), dried over sodium
sulfate, filtered and concentrated in vacuo to obtain the crude.
The crude was purified through flash column chromatography using 6%
EtOAc/hexanes to afford compound 63 (8 g, 35%) as brown syrup. TLC:
25% EtOAc/hexanes (R.sub.f: 0.7); .sup.1H-NMR (DMSO-d.sub.6, 500
MHz): .delta. 8.24 (s, 1H), 4.27 (q, J=7.2 Hz, 2H), 2.70 (s, 3H),
1.27 (t, J=7.1 Hz, 3H).
Synthesis of (2-methylthiazol-5-yl) methanol (64)
[0504] To a stirred suspension of lithium aluminium hydride (3.1 g,
93.56 mmol) in dry THF (10 mL) under inert atmosphere was added
compound 63 (8 g, 46.78 mmol) in dry THF (50 mL) dropwise for 15
min at 0.degree. C.; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was cooled to 0.degree. C., quenched with 15%
aqueous sodium hydroxide solution (10 mL), filtered through celite
and washed with EtOAc (3.times.100 mL). The filtrate was dried over
sodium sulfate, filtered and concentrated in vacuo to afford
compound 64 (5 g, 83%) as an off-white solid. TLC: 50%
EtOAc/hexanes (R.sub.f: 0.3). LC-MS: 97.32%; 130.22 (M+1).sup.+;
(column; X-select CSH C18, (50.times.3.0 mm, 2.5 .mu.m); RT 0.65
min. 2.5 mM Aq. NH.sub.4OAc:ACN:0.8 mL/min).
Synthesis of 5-(chloromethyl)-2-methylthiazole (65)
[0505] To a stirred solution of compound 64 (5 g, 38.75 mmol) in
CH.sub.2Cl.sub.2 (150 mL) under inert atmosphere were added
triethyl amine (8.3 mL, 58.13 mmol), methanesulfonyl chloride (4.6
mL, 46.51 mmol) at 0.degree. C.; warmed to RT and stirred for 4 h.
The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was diluted with water (50 mL) and
extracted with CH.sub.2Cl.sub.2 (2.times.100 mL). The combined
organic extracts were dried over sodium sulfate, filtered and
concentrated in vacuo to afford compound 65 (5 g, 87%) as a
pale-yellow syrup. TLC: 30% EtOAc/hexanes (R.sub.f: 0.8); LC-MS:
77.92%; 147.7 (M+1).sup.+; (column; Ascends Express C18,
(50.times.3.0 mm, 2.7 .mu.m); RT 1.71 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of 5-(azidomethyl)-2-methylthiazole (66)
[0506] To a stirred solution of compound 65 (5 g, 34.01 mmol) in
DMF (100 mL) under inert atmosphere was added sodium azide (2.21 g,
34.01 mmol) at RT and heated to 80.degree. C. for 6 h. The reaction
was monitored by TLC; after completion of the reaction, the
reaction mixture was diluted with ice cold water (50 mL) and
extracted with EtOAc (3.times.100 mL). The combined organic
extracts were dried over sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel column chromatography using 10% EtOAc/hexanes to afford
compound 66 (2.3 g, 44%) as an off-white, thick syrup. TLC: 20%
EtOAc/hexanes (R.sub.f: 0.5); .sup.1H-NMR (DMSO-d.sub.6, 500 MHz):
.delta. 7.64 (s, 1H), 4.67 (s, 2H), 2.65 (s, 3H).
Synthesis of (2-methylthiazol-5-yl) methanamine hydrochloride
(67)
[0507] To a stirred solution of compound 66 (2.3 g, 14.93 mmol) in
THF:H.sub.2O (5:1, 80 mL) was added triphenyl phosphine (7.8 g,
29.87 mmol) at 0.degree. C.; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the volatiles were removed in vacuo to obtain the crude, which was
triturated with diethyl ether (20 mL) to afford amine (900 mg, 47%)
as a colorless syrup. TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.1:
0.2).
[0508] The above compound was dissolved in CH.sub.2Cl.sub.2 (10 mL)
added 4 N HCl in 1, 4-dioxane (5 mL) under inert atmosphere at
0.degree. C.; warmed to RT and stirred for 3 h. The volatiles were
removed in vacuo to obtain the crude, which was triturated with
EtOAc (2 mL), diethyl ether (2 mL) to afford compound 67 (1.1 g,
95%) as an off-white solid. TLC: 10% MeOH/CH.sub.2Cl.sub.2
(R.sub.f: 0.2); .sup.1H NMR (DMSO-d.sub.6, 500 MHz): .delta. 8.59
(br. s, 3H), 7.74 (s, 1H), 4.23 (q, J=5.6 Hz, 2H), 2.66 (s,
3H).
Example 11: Synthesis of (2-(trifluoromethyl) thiazol-5-yl)
methanamine (71)
##STR00116##
[0509] Synthesis of (2-(trifluoromethyl) thiazol-5-yl) methanol
(69)
[0510] To a stirred solution of ethyl
2-(trifluoromethyl)thiazole-5-carboxylate 68 (500 mg, 2.22 mmol) in
THF (25 mL) under inert atmosphere was added lithium aluminium
hydride (126 mg, 3.33 mmol) at 0.degree. C.; warmed to RT and
stirred for 3 h. The reaction was monitored by TLC; after
completion of the reaction, the reaction mixture was cooled to
0.degree. C., quenched with ice-cold water (5 mL), followed by 10%
aqueous sodium hydroxide solution (3 mL), filtered through celite
and washed with THF (10 mL). The filtrate was dried over sodium
sulfate, filtered and concentrated in vacuo to afford compound 69
(300 mg, 73%) as a pale-yellow liquid. .sup.1H NMR (DMSO-d.sub.6,
400 MHz): .delta. 7.98 (s, 1H), 5.90 (t, J=5.7 Hz, 2H), 4.79 (d,
J=5.6 Hz, 3SH).
Synthesis of (2-(trifluoromethyl) thiazol-5-yl) methyl
methanesulfonate (70)
[0511] To a stirred solution of compound 69 (200 mg, 1.09 mmol) in
CH.sub.2Cl.sub.2 (10 mL) under inert atmosphere were added triethyl
amine (0.47 mL, 3.27 mmol), methanesulfonyl chloride (0.16 mL, 2.18
mmol) at 0.degree. C.; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was diluted with CH.sub.2Cl.sub.2 (100 mL),
washed with 10% NaHCO.sub.3 solution (50 mL). The organic extract
was dried over sodium sulfate, filtered and concentrated in vacuo
to afford crude compound 70 (200 mg) as a yellow liquid. TLC: 40%
EtOAc/hexanes (R.sub.f: 0.2); LC-MS: 24.48%; 261.8 (M+1).sup.+;
(column; Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT
2.29 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2
mL/min).
Synthesis of (2-(trifluoromethyl) thiazol-5-yl) methanamine
(71)
[0512] To a stirred solution of compound 70 (200 mg, crude) in EtOH
(10 mL) was added aqueous ammonia (10 mL) at 0.degree. C.; heated
to 100.degree. C. and stirred for 16 h in a sealed tube. The
reaction was monitored by TLC; after completion of the reaction,
the volatiles were removed in vacuo to obtain the crude. The crude
was purified through silica gel column chromatography using 10%
MeOH/CH.sub.2Cl.sub.2 to afford compound 71 (56 mg) as a
pale-yellow sticky solid. .sup.1H NMR (DMSO-d.sub.6, 400 MHz):
.delta. 7.92 (s, 1H), 6.80 (br s, 2H), 4.01 (s, 2H).
Example 12: Synthesis of (2-phenylthiazol-5-yl) methanamine
hydrochloride (78)
##STR00117##
[0513] Synthesis of 5-(azidomethyl)-2-chlorothiazole (73)
[0514] To a stirred solution of 2-chloro-5-(chloromethyl) thiazole
72 (10 g, 59.52 mmol) in EtOH (150 mL) under argon atmosphere was
added sodium azide (5.8 g, 89.23 mmol) at RT and heated to reflux
for 4 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was filtered, washed with EtOAc (100
mL) and the filtrate was concentrated in vacuo to obtain the crude.
The crude was purified through silica gel flash column
chromatography using 5% EtOAc/hexanes to afford compound 73 (10 g,
97%) as a pale-yellow oil. TLC: 10% EtOAc/hexanes (R.sub.f: 0.5);
LC-MS: 99.33%; 174.7 (M+1).sup.+; (column; Ascentis Express C18,
(50.times.3.0 mm, 2.7 .mu.m); RT 2.28 min. 0.025% Aq. TFA+5%
ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of (2-chlorothiazol-5-yl) methanamine (74)
[0515] To a stirred solution of compound 73 (10 g, 57.47 mmol) in
THF:H.sub.2O (15:1, 160 mL) was added triphenyl phosphine (15.05 g,
57.45 mmol) portion wise for 15 min at RT and stirred for 3 h. The
reaction was monitored by TLC; after completion of the reaction,
the volatiles were removed in vacuo. The residue was diluted with
EtOAc (3.times.100 mL). The combined organic extracts were dried
over sodium sulfate, filtered and concentrated in vacuo to obtain
the crude compound 74 (10 g) as an off-white solid; which was
carried forward for next step without further purification. TLC:
10% EtOAc/hexanes (R.sub.f: 0.2). LC-MS: 21.47%+7.59%; 149.0
(M+1).sup.+; (column; X-select CSH C-18 (50.times.3.0 mm, 2.5
.mu.m); RT 0.73 min & 0.82 min. 2.5 mM NH400CH (Aq).sup.+5%
ACN:ACN+5% 2.5 mM NH400CH (Aq); 0.8 mL/min).
Synthesis of tert-butyl ((2-chlorothiazol-5-yl) methyl) carbamate
(75)
[0516] To a stirred solution of compound 74 (10 g, Crude) in
CH.sub.2Cl.sub.2 (150 mL) under argon atmosphere were added
triethylamine (19.48 mL, 135.05 mmol) at 0.degree. C. and stirred
for 10 min. To this was added Boc-anhydride (17.67 g, 81.05 mmol)
at the same temperature; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was diluted with water (200 mL) and extracted
with CH.sub.2Cl.sub.2 (3.times.100 mL). The combined organic
extracts were dried over sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel flash column chromatography using 10-20% EtOAc/hexanes to
afford compound 75 (8 g, 56% over 2 steps) as a pale-yellow liquid.
TLC: 20% EtOAc/hexanes (R.sub.f: 0.8); .sup.1H-NMR (DMSO-d.sub.6,
400 MHz): .delta. 7.57 (d, J=4.0 Hz, 1H), 7.49 (s, 1H), 4.24 (d,
J=6.1 Hz, 2H), 1.39 (s, 9H).
Synthesis of tert-butyl ((2-phenylthiazol-5-yl) methyl) carbamate
(77)
[0517] To a stirred solution of compound 75 (250 mg, 1.00 mmol) in
2-methyltetrahydrofuran (10 mL) under argon atmosphere were added
phenylboronic acid 76 (136 mg, 1.10 mmol), sodium carbonate (265
mg, 2.50 mmol) at RT and purged under argon atmosphere for 20 min.
To this was added Pd(dppf)Cl.sub.2 (36.5 mg, 0.05 mmol) at RT;
heated to 110.degree. C. and stirred for 16 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo to obtain the crude. The crude was purified
through silica gel column chromatography using 20% EtOAc/hexanes to
afford compound 77 (110 mg, 37%) as an off-white solid. TLC: 30%
EtOAc/hexanes (R.sub.f: 0.4); .sup.1H-NMR (DMSO-d.sub.6, 500 MHz):
.delta. 7.89 (d, J=6.4 Hz, 2H), 7.69 (s, 1H), 7.56 (t, J=6.4 Hz,
1H), 7.51-7.46 (m, 3H), 4.34 (d, J=5.8 Hz, 2H), 1.40 (s, 9H).
Synthesis of (2-phenylthiazol-5-yl) methanamine hydrochloride
(78)
[0518] To a stirred solution of compound 77 (1.6 g, 5.51 mmol) in
CH.sub.2Cl.sub.2 (25 mL) under inert atmosphere was added 4 N HCl
in 1, 4-dioxane (10 mL) at 0.degree. C.; warmed to RT and stirred
for 3 h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo to obtain the crude.
The crude was washed with diethyl ether (2.times.5 mL) and dried in
vacuo to afford compound 78 (1 g, 83%) as an off-white solid. TLC:
30% EtOAc/hexanes (R.sub.f: 0.2); .sup.1H-NMR (DMSO-d.sub.6, 400
MHz): .delta. 8.25 (br s, 2H), 7.98 (s, 1H), 7.94-7.92 (m, 2H),
7.54-7.51 (m, 3H), 4.35 (q, J=6.0 Hz, 2H).
Example 13: Synthesis of 4-(5-(aminomethyl)
thiazol-2-yl)-3-fluorobenzonitrile hydrochloride (82)
##STR00118##
[0519] Synthesis of 3-fluoro-4-(4, 4, 5, 5-tetramethyl-1, 3,
2-dioxaborolan-2-yl) benzonitrile (80)
[0520] To a stirring solution of 4-bromo-3-fluorobenzonitrile 79
(15 g, 75.0 mmol) in 1,4-dioxane (200 mL) under inert atmosphere
were added bis pinacolato diboron (28.56 g, 112.5 mmol), potassium
acetate (25.76 g, 262.5 mmol) at RT and purged under argon
atmosphere for 20 min; to this was added Pd(dppf).sub.2Cl.sub.2
(5.5 g, 7.51 mmol) and purged under argon atmosphere for 20 min,
heated to 100.degree. C. and stirred for 16 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was filtered through celite, washed with EtOAc (2.times.500
mL). The filtrate was concentrated in vacuo and the residue was
diluted with H.sub.2O (500 mL) and extracted with EtOAc
(2.times.700 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel flash column
chromatography using 15-20% EtOAc/hexanes to afford compound 80
(10.2 g, 55%) as an off-white solid. TLC: 20% EtOAc/hexanes
(R.sub.f: 0.3); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta.
7.82-7.75 (m, 2H), 7.67 (dd, J=7.7, 1.4 Hz, 1H), 1.30 (s, 12H).
Synthesis of tert-butyl ((2-(4-cyano-2-fluorophenyl) thiazol-5-yl)
methyl) carbamate (81)
[0521] To a stirring solution of compound 75 (8 g, 32.16 mmol) in
1, 2-dimethoxy ethane:H.sub.2O (4:1, 100 mL) under inert atmosphere
were added compound 80 (10.4 g, 42.09 mmol), sodium carbonate (12
g, 113.20 mmol) in a sealed tube at RT and purged under argon
atmosphere for 15 min, added Pd(dppf)Cl.sub.2 (2.36 g, 3.22 mmol)
and heated to 100.degree. C. and stirred for 16 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was diluted with water (100 mL) and extracted with EtOAc
(2.times.800 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel flash column
chromatography using 25-30% EtOAc/hexanes and triturated using 10%
EtOAc/hexanes to afford compound 81 (6.5 g, 61%) as an off-white
solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.3); .sup.1H-NMR
(DMSO-d.sub.6, 400 MHz): .delta. 8.36 (t, J=7.9 Hz, 1H), 8.10 (dd,
J=11.3, 1.4 Hz, 1H), 7.91 (d, J=2.4 Hz, 1H), 7.83 (dd, J=8.2, 1.6
Hz, 1H), 7.62 (br t, J=5.5 Hz, 1H), 4.40 (br d, J=5.9 Hz, 2H), 1.40
(s, 9H); LC-MS: 94.47%; 333.9 (M+1).sup.+; (column; Ascentis
Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.61 min 0.025% Aq.
TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of 4-(5-(aminomethyl) thiazol-2-yl)-3-fluorobenzonitrile
hydrochloride (82)
[0522] To a stirring solution of compound 81 (6.5 g, 19.51 mmol) in
CH.sub.2Cl.sub.2 (70 mL) was added 4 N HCl in 1, 4-dioxane (70 mL)
under argon atmosphere at 0.degree. C.; warmed to RT and stirred
for 2 h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The crude washed
with EtOAc (2.times.100 mL) and dried in vacuo to afford compound
82 (4.7 g; 89% as HCl salt) as white solid. TLC: 30% EtOAc/hexanes
(R.sub.f: 0.2); .sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta. 8.60
(br s, 3H), 8.39 (t, J=7.9 Hz, 1H), 8.23-8.08 (m, 2H), 7.87 (dd,
J=8.2, 1.5 Hz, 1H), 4.42 (br s, 2H); LC-MS: 98.68%; 234.9
(M+1).sup.+; (column; Ascentis Express C18, (50.times.3.0 mm, 2.7
.mu.m); RT 1.40 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA,
1.2 mL/min).
Example 14: Synthesis of 4-(5-(aminomethyl) thiazol-2-yl) phenol
hydrochloride (85)
##STR00119##
[0523] Synthesis of Cert-butyl ((2-(4-hydroxyphenyl) thiazol-5-yl)
methyl) carbamate (84)
[0524] To a stirred solution of tert-butyl ((2-chlorothiazol-5-yl)
methyl) carbamate 75 (500 mg, 2.01 mmol) in 1, 2-dimethoxy
ethane:H.sub.2O (4:1, 20 mL) were added sodium carbonate (640 mg,
6.03 mmol) and (4-hydroxyphenyl) boronic acid 83 (416 mg, 3.01
mmol) and purged under argon atmosphere for 30 min in a sealed
tube. To this was added Pd(PPh.sub.3).sub.4 (231 mg, 0.20 mmol) at
RT; heated to 90.degree. C. and stirred for 6 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo. The residue was diluted with EtOAc (200 mL),
washed with water (100 mL). The organic extract was dried over
sodium sulfate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel column
chromatography using 40% EtOAc/hexanes to afford compound 84 (250
mg, 41%) as an off-white solid. TLC: 50% EtOAc/hexanes (R.sub.f:
0.5); .sup.1H-NMR (DMSO-d.sub.6, 500 MHz): 9.92 (s, 1H), 7.69 (d,
J=8.4 Hz, 2H), 7.55 (s, 1H), 7.50 (t, J=5.5 Hz, 1H), 6.83 (d, J=8.7
Hz, 2H), 4.28 (d, J=5.8 Hz, 2H), 1.38 (s, 9H).
Synthesis of 4-(5-(aminomethyl) thiazol-2-yl) phenol hydrochloride
(85)
[0525] To a stirred solution of compound 84 (150 mg, 0.49 mmol) in
CH/Cl.sub.2 (4 mL) was added 4 N HCl in 1, 4-Dioxane (1.25 mL, 4.90
mmol) under inert atmosphere at 0.degree. C.; warmed to RT and
stirred for 2 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo.
The crude was washed with diethyl ether (2.times.10 mL) and dried
in vacuo to afford compound 85 (110 mg, 93%; HCl salt) as white
solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.2); .sup.1H-NMR
(DMSO-d.sub.6, 400 MHz): .delta. 10.07 (br s, 1H), 8.51 (br s, 3H),
7.84 (s, 1H), 7.74 (d, J=8.4 Hz, 2H), 6.88 (d, J=8.7 Hz, 2H), 4.28
(q, J=5.4 Hz, 2H).
Example 15: Synthesis of 3-(4-(5-(aminomethyl) thiazol-2-yl)
phenoxy)-N, N-dimethylpropan-1-amine hydrochloride (89)
##STR00120## ##STR00121##
[0526] Synthesis of 3-chloro-N, N-dimethylpropan-1-amine (87)
[0527] To a stirred solution of 3-(dimethylamino) propan-1-ol 86
(2.0 g, 1.94 mmol) in CHCl.sub.3 (50 mL) under inert atmosphere was
added thionyl chloride (4.22 mL, 58.23 mmol) at 0.degree. C.;
heated to 70.degree. C. and stirred for 4 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo to obtain the crude. The crude was washed
with diethyl ether (2.times.30 mL) to afford compound 87 (2.5 g,
83%) as white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2);
.sup.1H-NMR (DMSO-d.sub.6, 500 MHz): .delta. 10.97 (br s, 1H), 3.74
(t, J=6.4 Hz, 2H), 3.12 (t, J=7.8 Hz, 2H), 2.72 (s, 6H), 2.20-2.12
(m, 2H).
Synthesis of tert-butyl ((2-(4-(3-(dimethylamino) propoxy) phenyl)
thiazol-5-yl) methyl) carbamate (88)
[0528] To a stirred solution of compound 84 (400 mg, 1.30 mmol) and
compound 87 (411 mg, 2.61 mmol) in acetone (20 mL) under inert
atmosphere was added potassium carbonate (541 mg, 3.91 mmol) at RT;
heated to 80.degree. C. and stirred for 8 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo. The residue was diluted with water (100 mL)
and extracted with EtOAc (2.times.100 mL). The combined organic
extracts were dried over sodium sulfate, filtered and concentrated
in vacuo to obtain the crude. The crude was purified through silica
gel column chromatography using 5% MeOH/CH.sub.2Cl.sub.2 to afford
compound 88 (350 mg, 68%) as off-white sticky solid. TLC: 5%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.1); .sup.1H NMR (DMSO-d.sub.6,
400 MHz): .delta. 7.81 (d, J=8.8 Hz, 2H), 7.60 (s, 1H), 7.53 (t,
J=5.5 Hz, 1H), 7.02 (d, J=8.8 Hz, 2H), 4.31 (d, J=5.7 Hz, 2H), 4.06
(t, J=6.3 Hz, 2H), 2.52-2.48 (m, 2H), 2.28 (s, 6H), 1.96-1.87 (m,
2H), 1.40 (s, 9H).
Synthesis of 3-(4-(5-(aminomethyl) thiazol-2-yl) phenoxy)-N,
N-dimethylpropan-1-amine hydrochloride (89)
[0529] To a stirred solution of compound 88 (350 mg, 0.89 mmol) in
CH.sub.2Cl.sub.2 (5 mL) under inert atmosphere was added 4 N HCl in
1, 4-dioxane (2 mL) at 0.degree. C.; warmed to RT and stirred for 2
h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo to obtain the crude.
The crude was washed with EtOAc (2.times.5 mL) and dried in vacuo
to afford compound 89 (300 mg, 92%) as an off-white solid. TLC: 10%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2); .sup.1H-NMR (DMSO-d.sub.6,
400 MHz): .delta. 10.86 (br s, 1H), 8.65 (br s, 3H), 7.91 (s, 1H),
7.87 (d, J=8.9 Hz, 2H), 7.08 (d, J=8.8 Hz, 2H), 4.31 (q, J=5.6 Hz,
2H), 4.14 (t, J=6.1 Hz, 2H), 3.28-3.15 (m, 2H), 2.76 (s, 3H), 2.77
(s, 3H), 2.23-2.14 (m, 2H).
Example 16: Synthesis of (2-(1H-pyrazol-1-yl) thiazol-5-yl)
methanamine hydrochloride (93)
##STR00122##
[0530] Synthesis of N-((2-chlorothiazol-5-yl) methyl)-1, 1,
1-triphenylmethanamine (90)
[0531] To a stirring solution of (2-chlorothiazol-5-yl) methanamine
74 (1.0 g, 5.43 mmol) in CH.sub.2Cl.sub.2 (40 mL) under inert
atmosphere were added triethyl chloride (1.57 mL, 10.86 mmol),
trityl chloride (1.57 mL, 6.46 mmol) at 0.degree. C.; warmed to RT
and stirred for 2 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 10% EtOAc/hexanes to afford compound 90 (1.5
g, 71%) as white solid. TLC: 10% EtOAc/(R.sub.f: 0.8); .sup.1H-NMR
(DMSO-d.sub.6, 500 MHz): .delta. 7.46-7.40 (m, 5H), 7.36-7.27 (m,
5H), 7.26-7.17 (m, 5H), 3.97 (br t, J=8.4 Hz, 1H), 3.34-3.27 (m,
2H).
Synthesis of N-((2-(1H-pyrazol-1-yl) thiazol-5-yl) methyl)-1, 1,
1-triphenylmethanamine (92)
[0532] To a stirring solution of compound 90 (2 g, 0.51 mmol) in
DMF (15 mL) under inert atmosphere were added 1H-pyrazole 91 (70
mg, 1.02 mmol), cesium carbonate (333 mg, 1.02 mmol) at RT; heated
to 100.degree. C. and stirred for 16 h. The reaction was monitored
by TLC; after completion of the reaction, the reaction mixture was
diluted with water (30 mL) and extracted with EtOAc (2.times.60
mL). The combined organic extracts were dried over sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
was purified through silica gel column flash chromatography using
5-7% EtOAc/hexanes to afford compound 92 (HO mg, 51%) as an
off-white solid. TLC: 15% EtOAc/hexanes (R.sub.f: 0.4). .sup.1H-NMR
(DMSO-d.sub.6, 400 MHz): .delta. 8.46 (d, J=2.6, 0.6 Hz, 1H), 7.86
(d, J=1.7 Hz, 1H), 7.48-7.44 (m, 6H), 7.38-7.30 (m, 7H), 7.24-7.19
(m, 3H), 6.62 (dd, J=2.5, 1.8 Hz, 1H), 3.87 (t, J=8.4 Hz, 1H), 3.31
(s, 2H); LC-MS (Agilent 6310 Ion trap): 99.52%; 423.2 (M+1).sup.+;
(column; Kinetex EVO C-18 (50.times.3.0 mm, 2.6 um); RT 5.33 min.
2.5 mM Aq. NH.sub.4OOCH:ACN; 0.8 mL/min).
Synthesis of (2-(1H-pyrazol-1-yl) thiazol-5-yl) methanamine
hydrochloride (93)
[0533] To a stirring solution of compound 92 (200 mg, 0.47 mmol) in
CH.sub.2Cl.sub.2 (5 mL) was added 4 N HCl in 1, 4-dioxane (1 mL)
under inert atmosphere at 0.degree. C.; warmed to RT and stirred
for 2 h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo to obtain the crude,
which was triturated with diethyl ether (2.times.10 mL) and dried
in vacuo to afford compound 93 (90 mg, 88%; HCl salt) as an
off-white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.1);
.sup.1H-NMR (DMSO-d.sub.6, 400 MHz): .delta. 8.56 (br s, 2H), 8.50
(d, J=2.6 Hz, 1H), 7.88 (d, J=1.5 Hz, 1H), 7.72 (s, 1H), 6.66-6.64
(m, 1H), 4.28 (br s, 2H); LC-MS: 95.50%; 181.9 (M+1).sup.+;
(column; Kinetex EVO C-18 (50.times.3.0 mm, 2.6 um); RT 0.69 min.
2.5 mM Aq. NH.sub.4OOCH+5% ACN:ACN+5% 2.5 mM Aq.NH.sub.4OOCH, 0.8
mL/min).
Example 17: Compound Preparation
[0534] Acids similar to compound 10 (compounds 11, 19, 27, 29, 39,
46, 53, 58) were synthesized as mentioned above and converted to
final products either using commercially available amines or
prepared amines employing typical procedure A or B and the results
are captured in the Table 2.
Typical Procedure A:
[0535] To a stirred solution of acid core (1 eq.) in DMF (5-10V)
were added HATU (1.5 eq.) and DIPEA (3 eq.) at 0.degree. C. and was
stirred for 10 min. To this solution, amine (1.2 eq.) was added and
the reaction mixture was stirred at room temperature for further
8-16 h. The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was diluted with water and
extracted with DCM. The combined organic layers were dried over
anhydrous sodium sulfate, filtered and concentrated in vacuo to
obtain the crude. The crude compound was purified by silica gel
column chromatography/prep-HPLC to afford the title compound.
Typical Procedure B:
[0536] To a stirred solution of compound 10 (100 mg, 0.36 mmol) in
DMF (5 mL) under inert atmosphere were added EDCI.HCl (105 mg, 0.55
mmol), HOBt (75 mg, 0.55 mmol), compound 67 (73 mg) and
diisopropylethylamine (0.1 mL, 1.10 mmol) at 0.degree. C. warmed to
RT and stirred for 16 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo to
obtain the crude. The crude was either directly dried in vacuo or
triturated or purified through silica gel column chromatography to
afford the desired compound.
TABLE-US-00002 TABLE 2 Procedure, Com- Inter- Rx. Mass pound
mediate Yield Spec. Mass Spec. No. Structure amine (%) Found
Calculated .sup.1H-NMR 576 ##STR00123## B, 10, 67 42 382.8 (M +
1).sup.+ 382.06 for C.sub.18H.sub.14N.sub.4O.sub.2S.sub.2
.sup.1H-NMR (DMSO- d.sub.6, 400 MHz): .delta. 11.04 (s, 1H), 9.19
(t, J = 5.9 Hz, 1H), 8.73 (s, 1H), 8.65 (d, J = 4.9 Hz, 1H),
7.73-7.68 (m, 2H), 7.65-7.59 (m, 2H), 7.48 (s, 1H), 4.55 (d, J =
5.9 Hz, 2H), 2.57 (s, 3H); 578 ##STR00124## B, 10, 78 31 444.8 (M +
1).sup.+ 444.07 for C.sub.23H.sub.16N.sub.4O.sub.2S.sub.2
.sup.1H-NMR (DMSO- d.sub.6, 400 MHz): .delta. 11.06 (s, 1H), 9.31
(t, J = 5.7 Hz, 1H), 8.73 (s, 1H), 8.65 (d, J = 4.9 Hz, 1H), 7.88
(dd, J = 7.4, 2.2 Hz, 2H), 7.79 (s, 1H), 7.76-7.70 (m, 2H), 7.67-
7.61 (m, 2H), 7.51-7.43 (m, 3H), 4.67 (d, J = 5.7 Hz, 2H); 762
##STR00125## B, 10, 85 8 460.9 (M + 1).sup.+ 460.07 for
C.sub.23H.sub.16N.sub.4O.sub.3S.sub.2 .sup.1H-NMR (DMSO- d.sub.6,
400 MHz): .delta. 11.06 (s, 1H), 9.94 (s, 1H), 9.26 (t, J = 5.7 Hz,
1H), 8.73 (s, 1H), 8.65 (d, J = 5.0 Hz, 1H), 7.75-7.61 (m, 7H),
6.83 (d, J = 8.7 Hz, 2H), 4.62 (d, J = 5.5 Hz, 2H); 1020
##STR00126## B.sup.c, 11, 71 18 469.0 (M + 1).sup.+ 468.02 for
C.sub.18H.sub.11F.sub.3N.sub.4O.sub.4S.sub.2 .sup.1H NMR (DMSO-
d.sub.6, 400 MHz): .delta. 11.77 (br s, 1H), 9.61 (br t, J = 5.2
Hz, 1H), 9.13 (s, 1H), 9.10 (d, J = 5.0 Hz, 1H), 8.11 (d, J = 8.3
Hz, 1H), 8.07 (s, 1H), 7.93 (d, J = 4.9 Hz, 1H), 7.89-7.83 (m, 2H),
4.75 (br d, J = 5.4 Hz, 2H); 1021 ##STR00127## B.sup.c, 11, 82 6
520.1 (M + 1).sup.+ 519.05 for
C.sub.24H.sub.14FN.sub.5O.sub.4S.sub.2 .sup.1H NMR (DMSO- d.sub.6,
400 MHz): .delta. 11.77 (s, 1H), 9.56 (t, J = 5.5 Hz, 1H), 9.13 (s,
1H), 9.10 (d, J = 4.9 Hz, 1H), 8.35 (t, J = 7.8 Hz, 1H), 8.14-8.07
(m, 2H), 8.02 (s, 1H), 7.92 (d, J = 4.9 Hz, 1H), 7.89-7.79 (m, 2H),
4.75 (d, J = 5.3 Hz, 2H); C46-01 ##STR00128## A, 11, 89 9 578
577.15 for C.sub.28H.sub.27N.sub.5O.sub.5S.sub.2 .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 9.50 (t, J = 5.8 Hz, 1H), 9.16-9.07 (m,
2H), 8.19-8.07 (m, 2H), 7.96-7.74 (m, 6H), 7.01 (d, J = 8.4 Hz,
2H), 4.67 (d, J = 5.6 Hz, 2H), 4.05 (t, J = 6.3 Hz, 2H), 2.45 (t, J
= 7.1 Hz, 2H), 2.22 (s, 6H), 1.88 (p, J = 6.6 Hz, 2H) C46-02
##STR00129## A, 11, 93 20 467 (M + 1).sup.+ 466.05 for
C.sub.20H.sub.14N.sub.6O.sub.4S.sub.2 .sup.1H NMR (400 MHz,
DMSO-d.sub.6) .delta. 11.78 (s, 1H), 9.52 (t, J = 5.7 Hz, 1H),
9.16-9.07 (m, 2H), 8.46 (d, J = 2.6 Hz, 1H), 8.11 (d, J = 8.2 Hz,
1H), 7.96-7.80 (m, 4H), 7.55 (s, 1H), 6.60 (t, J = 2.1 Hz, 1H),
4.62 d, J = 5.7 Hz, 2H) C22-01 ##STR00130## A, 19, 89 23 592.10 (M
+ 1).sup.+ 591.16 for C.sub.29H.sub.29N.sub.5O.sub.5S.sub.2 .sup.1H
NMR (400 MHz, DMSO-d.sub.6): .delta. 10.80 (bs, 1H), 9.20 (t, J =
6.0 Hz, 1H), 9.06-9.04 (m, 2H), 7.92-7.87 (m, 2H), 7.81 (d, J = 8.8
Hz, 2H), 7.70 (s, 1H), 7.38 (d, J = 7.6 Hz, 1H), 7.02 (d, J = 8.8
Hz, 2H), 4.62 (d, J = 6.0 Hz, 2H), 4.06 (t, J = 6.4 Hz, 2H), 2.32
(s, 3H), 2.25 (s, 6H), 1.93-1.82 (m, 2H), 2H merged in solvent peak
C22-02 ##STR00131## A, 19, 93 27 481.10 (M + 1).sup.+ 480.07 for
C.sub.21H.sub.16N.sub.6O.sub.4S.sub.2 .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 11.15 (s, 1H), 9.24 (t, J = 6.0 Hz, 1H),
9.08- 9.06 (m, 2H), 8.48 (s, 1H), 7.94-7.85 (m, 3H), 7.54 (s, 1H),
7.40 (d, J = 8.4 Hz, 1H), 6.63 (s, 1H), 4.59 (d, J = 6.0 Hz, 2H),
2.33 (s, 3H) C22-03 ##STR00132## A, 19, 82 48 534.15 (M + 1).sup.+
533.06 for C.sub.25H.sub.16FN.sub.5O.sub.4S.sub.2 .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 11.08 (bs, 1H), 9.29 (t, J = 5.2 Hz,
1H), 9.08-9.06 (m, 2H), 8.37 (t, J = 8.0 Hz, 1H), 8.14- 8.02 (m,
1H), 8.02 (s, 1H), 7.94-7.84 (m, 3H), 7.40 (d, J = 7.6 Hz, 1H),
4.72 (d, J = 4.4 Hz, 2H), 2.33 (s, 3H) C12-02 ##STR00133## A, 27,
82 8 465 (M + 1).sup.+ 464.53 for C23H17FN4O2S2 .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 10.41 (s, 1H), 9.31 (t, J = 6.0 Hz,
1H), 8.35 (t, J = 7.9 Hz, 1H), 8.08 (d, J = 11.2 Hz, 1H), 8.00 (s,
1H), 7.81 (d, J = 8.3 Hz, 1H), 7.63 (s, 1H), 7.57-7.52 (m, 2H),
4.72 (d, J = 5.7 Hz, 2H), 2.06 (s, 3H), 1.80 (s, 3H) C10-01
##STR00134## A, 29, 71 26 446.00 (M + 1).sup.+ 445.43 for
C17H14F3N3O4S2 .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.41
(s, 1H), 9.59 (t, J = 5.8 Hz, 1H), 8.08 (s, 1H), 7.94 (d, J = 8.7
Hz, 1H), 7.84-7.76 (m, 2H), 4.76 (d, J = 5.6 Hz, 2H), 2.11 (s, 3H),
2.04 (s, 3H) C10-02 ##STR00135## A, 29, 82 4 497.20 (M + 1).sup.+
496.07 for C.sub.23H.sub.17FN.sub.4O.sub.4S.sub.2 .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 11.42 (s, 1H), 9.55 (t, J = 5.7 Hz,
1H), 8.36 (t, J = 7.9 Hz, 1H), 8.12- 8.03 (m, 2H), 7.94 (d, J = 8.4
Hz, 1H), 7.87-7.77 (m, 3H), 4.76 (d, J = 5.7 Hz, 2H), 2.11 (s, 3H),
2.04 (s, 3H) C10-04 ##STR00136## A, 29, 93 36 444.05 (M + 1).sup.+
443.50 for C.sub.19H.sub.17N.sub.5O.sub.4S.sub.2 .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 11.41 (s, 1H), 9.49 (t, J = 5.2 Hz,
1H), 8.46 (s, 1H), 7.93 (d, J = 8.2 Hz, 1H), 7.83-7.78 (m, 3H),
7.56 (s, 1H), 6.61 (s, 1H), 4.63 (d, J = 5.6 Hz, 2H), 2.11 (s, 3H),
2.03 (s, 3H) C10-05 ##STR00137## A, 29, 89 8 555.15 (M + 1).sup.+
554.68 for C.sub.27H.sub.30N.sub.4O.sub.5S.sub.2 .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 9.47 (t, J = 5.8 Hz, 1H), 8.19 (s, 1H),
7.92 (d, J = 7.2 Hz, 1H), 7.80- 7.78 (m, 4H), 7.72 (s, 1H),
7.05-6.96 (m, 2H), 4.66 (d, J = 6.0 Hz, 2H), 4.04 (t, J = 6.4 Hz,
2H), 2.45 (t, J = 1.1 Hz, 2H), 2.21 (s, 6H), 2.10 (s, 3H), 2.02 (s,
3H), 1.89-185 (m, 2H) C24-02 ##STR00138## A, 39, 82 5 512 (M +
1).sup.+ 511.08 for C.sub.23H.sub.18FN.sub.5O.sub.4S.sub.2 .sup.1H
NMR (400 MHz, DMSO-d.sub.6): .delta. 10.55 (s, 1H), 9.51 (t, J =
5.6 Hz, 1H), 8.37 (t, J = 7.6 Hz, 1H), 8.11 (d, J = 11.2 Hz, 1H),
8.04 (s, 1H), 7.83 (d, J = 8.4 Hz, 2H), 7.75 (s, 1H), 7.65 (d, J =
7.6 Hz, 1H), 4.76-4.72 (m, 2H), 4.40-4.37 (m, 1H), 2.87-2.81 (m,
1H), 2.36-2.31 (m, 1H), 1.97-1.71 (m, 3H), 1H merged in solvent
peak C24-04 ##STR00139## A, 39, 93 4 459.10 (M + 1).sup.+ 458.08
for C.sub.19H.sub.18N.sub.6O.sub.4S.sub.2 .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.54 (s, 1H), 9.45 (t, J = 5.6 Hz, 1H),
8.46 (d, J = 2.4 Hz, 1H), 7.84- 7.82 (m, 2H), 7.75 (s, 1H), 7.64
(d, J = 7.6 Hz, 1H), 7.56 (s, 1H), 6.61 (s, 1H), 4.65-4.58 (m, 2H),
4.40-4.36 (m, 1H), 2.87-2.81 (m, 1H), 2.36-2.31 (m, 1H), 1.96-1.72
(m, 3H), 1H merged in solvent peak; C25-04 ##STR00140## A, 46, 93
29 473.10 (M + 1).sup.+ 472.10 for
C.sub.20H.sub.20N.sub.6O.sub.4S.sub.2 .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.67 (s, 1H), 9.49 (t, J = 5.7 Hz, 1H),
8.47 (s, 1H), 7.93-7.71 (m, 4H), 7.56 (s, 1H), 6.64- 6.58 (m, 1H),
4.63 (d, J = 5.6 Hz, 2H), 3.70-3.68 (m, 1H), 3.16-3.11 (m, 1H),
2.84-2.79 (m, 1H), 1.99-1.97 (m, 1H), 1.69-1.53 (m, 4H), 1.42-1.39
(m, 1H) C25-04- Isomer I ##STR00141## A.sup.b 46, 93 473.10 (M +
1).sup.+ 472.10 for C.sub.20H.sub.20N.sub.6O.sub.4S.sub.2 .sup.1H
NMR (400 MHz, Methanol- d.sub.4): .delta. 8.36 (d, J = 2.6 Hz, 1H),
7.92 (d, J = 8.5 Hz, 1H), 7.77-7.68 (m, 3H), 7.51 (s, 1H), 6.57 (s,
1H), 3.88- 3.76 (m, 1H), 3.25-3.21 (m, 1H), 3.09-2.88 (m, 1H),
2.20-2.17 (m, 1H), 1.85-1.50 (m, 4H), 1.19-1.12 (m, 1H), 2H merged
in solvent peak C25-04- Isomer II ##STR00142## A.sup.b 46, 93
473.10 (M + 1).sup.+ 472.10 for
C.sub.20H.sub.20N.sub.6O.sub.4S.sub.2 .sup.1H NMR (400 MHz,
Methanol- d.sub.4): .delta. 8.36 (d, J = 2.7 Hz, 1H), 7.92 (d, J =
8.6 Hz, 1H), 7.78-7.69 (m, 3H), 7.52 (s, 1H), 6.58 (t, J = 2.2 Hz,
1H), 3.86-3.74 (m, 1H), 3.25-3.21 (m, 1H), 2.94-2.92 (m, 1H),
2.24-2.06 (m, 1H), 1.86-1.57 (m, 4H), 1.52-1.48 (m, 1H), 2H merged
in solvent
peak C25-02 ##STR00143## A, 46, 82 26 526.10 (M + 1).sup.+ 525.09
for C.sub.24H.sub.20FN.sub.5O.sub.4S.sub.2 .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.68 (s, 1H), 9.54 (t, J = 5.7 Hz, 1H),
8.37 (t, J = 7.9 Hz, 1H), 8.11 (d, J = 11.2 Hz, 1H), 8.04 (s, 1H),
7.89-7.72 (m, 4H), 4.77 (d, J = 5.6 Hz, 2H), 3.70-3.68 (m, 1H),
3.20-3.09 (m, 1H), 2.84-2.79 (m, 1H), 1.99-1.97 (m, 1H), 1.72-1.49
(m, 4H), 1.46-1.36 (m, 1H) C25-02- Isomer I ##STR00144## A.sup.a
46, 82 -- 526.10 (M + 1).sup.+ 525.09 for
C.sub.24H.sub.20FN.sub.5O.sub.4S.sub.2 .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.67 (brs, 1H), 9.55-9.53 (m, 1H), 8.36 (t,
J = 7.9 Hz, 1H), 8.13-8.00 (m, 2H), 7.93-7.71 (m, 4H), 4.76 (d, J =
5.6 Hz, 2H), 3.69- 3.67 (m, 1H), 3.16-3.12 (m, 1H), 2.83-2.79 (m,
1H), 2.09-1.91 (m, 1H), 1.74-1.52 (m, 4H), 1.41-1.37 (m, 1H)
C25-02- Isomer II ##STR00145## A.sup.a 46, 82 -- 526.10 (M +
1).sup.+ 525.09 for C.sub.24H.sub.20FN.sub.5O.sub.4S.sub.2 .sup.1H
NMR (400 MHz, DMSO-d.sub.6): .delta. 10.69 (s, 1H), 9.55 (t, J =
5.3 Hz, 1H), 8.36 (t, J = 7.9 Hz, 1H), 8.13- 8.00 (m, 2H), 7.88-
7.71 (m, 4H), 4.76 (d, J = 4.6 Hz, 2H), 3.67 (dd, J = 8.0, 3.4 Hz,
1H), 3.14 (dt, J = 10.6, 4.2 Hz, 1H), 2.81 (ddd, J = 11.8, 8.5, 3.5
Hz, 1H), 1.98 (dtd, J = 12.6, 8.7, 3.4 Hz, 1H), 1.74-1.32 (m, 5H)
C1-01 ##STR00146## A, 53, 71 35 398.00 (M + 1).sup.+ 397.07 for
C.sub.17H.sub.14F.sub.3N.sub.3O.sub.3S .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.21 (s, 1H), 9.31 (t, J = 5.2 Hz, 1H),
8.06 (s, 1H), 7.57-7.54 (m, 2H), 7.19 (d, J = 8.0 Hz, 1H), 4.71 (d,
J = 5.2 Hz, 2H), 2.06 (s, 3H), 1.73 (s, 3H) C1-02 ##STR00147## A,
53, 82 20 449 (M + 1).sup.+ 448.10 for
C.sub.23H.sub.17FN.sub.4O.sub.3S .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.20 (s, 1H), 9.26-9.25 (m, 1H), 8.36 (d, J
= 8.0 Hz, 1H), 8.11-8.08 (m, 1H), 8.00 (s, 1H), 7.84-7.77 (m, 1H),
7.58-7.55 (m, 2H), 7.19 (d, J = 7.6 Hz, 1H), 4.70 (d, J = 4.8 Hz,
2H), 2.06 (s, 3H), 1.72 (s, 3H) C21-01 ##STR00148## A, 58, 71 18
425.05 (M + 1).sup.+ 424.12 for
C.sub.19H.sub.19F.sub.3N.sub.4O.sub.2S .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 9.58 (s, 1H), 9.21 (t, J = 6.0 Hz, 1H), 8.05
(s, 1H), 7.64-7.61 (m, 1H), 7.45 (s, 1H), 7.11 (d, J = 8.8 Hz, 1H),
4.70 (d, J = 5.6 Hz, 2H), 3.27- 3.17 (m, 2H), 3.00-2.94 (m, 1H),
2.57-2.54 (m, 1H), 1.97-1.94 (m, 1H), 1.84-1.81 (m, 1H), 1.70-1.60
(m, 3H), 1.49-1.38 (m, 2H) C21-02 ##STR00149## A, 58, 82 25 476.10
(M + 1).sup.+ 475.15 for C.sub.25H.sub.22FN.sub.5O.sub.2S .sup.1H
NMR (400 MHz, DMSO-d.sub.6): .delta. 9.58 (s, 1H), 9.16 (t, J = 6.0
Hz, 1H), 8.36 (t, J = 7.6 Hz, 1H), 8.11- 8.05 (m, 1H), 8.00 (s,
1H), 7.84-7.82 (m, 1H), 7.65- 7.62 (m, 1H), 7.45 (s, 1H), 7.10 (d,
J = 8.8 Hz, 1H), 4.71 (d, J = 5.6 Hz, 2H), 3.24- 3.17 (m, 2H),
3.00-2.95 (m, 1H), 2.59-2.52 (m, 1H), 1.97-1.94 (m, 1H), 1.83-1.81
(m, 1H), 1.70-1.58 (m, 3H), 1.49-1.38 (m, 2H) .sup.a:SFC
purification: Column: YMC-CHIRALART-CELLULOSE, 250 mm*21.2 mm*
5.quadrature., Mobile phase: A:DCM; B: IPA + 0.1% DEA, Flow rate:
60 mL/min, Isocratic 80% B; .sup.b:SFC purification: Column:
YMC-CHIRALART-CELLULOSE, 250 mm*21.2 mm* 5.quadrature., Mobile
phase: A: MTBE + 0.1% DEA_0.1% TFA; B: CH.sub.3CN:MeOH (1:1), Flow
rate: 60 mL/min, Isocratic 15% B; .sup.c: EDCI (1.5 eq), HOBt (1.5
eq) & DIPEA (5.0 eq)
Example 18: Synthesis of
2,3-Dimethyl-4-oxo-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-4,5-dihydr-
obenzo [b][1,4]thiazepine-7-carboxamide (C12-01)
##STR00150##
[0537] Synthesis of
2,3-Dimethyl-4-oxo-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-4,5-dihydr-
obenzo [b][1,4]thiazepine-7-carboxamide (C12-01)
[0538] To a stirred solution of
(2-(trifluoromethyl)thiazol-5-yl)methanamine 71 (0.052 g, 0.285
mmol) in DCM at 0.degree. C., AlMe.sub.3 (0.041 g, 0.57 mmol) was
added and stirred at same temperature for 30 min. To this solution,
compound 26 (0.05 g, 0.19 mmol) was added and stirred at RT for 12
h. The progress of the reaction was monitored by TLC. After
completion; the volatiles were removed in vacuo. The residue was
diluted with water (10 mL) and extracted with ethyl acetate
(3.times.25 mL). The combined organic layers were dried over
anhydrous sodium sulfate, filtered and concentrated in vacuo to
afford the crude compound. The crude was purified by
crystallization in DCM to afford compound C12-01 (27 mg, 32.05%) as
white solid; TLC: 70% EtOAc/hexane (R.sub.f: 0.3); .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 10.44 (s, 1H), 9.39 (t, J=5.9 Hz, 1H),
8.06 (s, 1H), 7.68-7.51 (m, 3H), 4.73 (d, J=5.6 Hz, 2H), 2.07 (s,
3H), 1.81 (s, 3H); HPLC purity: 92.93%; LCMS Calculated for
C.sub.17H.sub.14F.sub.3N.sub.3O S.sub.2: 413.05; Observed (m/z):
414 (M+1).sup.+.
Example 19: Synthesis of
N-((2-(1H-pyrazol-1-yl)thiazol-5-yl)methyl)-10-oxo-3,4,10,11-tetrahydrobe-
nzo[f]pyrido[4,3-b] [1,4]thiazepine-2(1H)-carboxamide 5,5-dioxide
(C43-01)
##STR00151## ##STR00152##
[0539] Synthesis of Methyl 2-((3-nitropyridin-4-yl)thio)benzoate
(96)
[0540] To a stirred solution of compound 94 (10 g, 59.5 mmol) in
acetonitrile (50 mL) at 0.degree. C. under argon atmosphere was
added triethylamine (24.9 mL, 178.5 mmol) followed by compound 95
(18.1 g, 59.5 mmol). The reaction mixture was slowly warmed to RT
and stirred at RT for 12 h. The reaction was monitored by TLC;
after completion of the reaction, the volatiles were removed in
vacuo to obtain the crude. The crude was purified through silica
gel column chromatography using 20% EtOAc/hexanes to afford
compound 96 (8.9 g, 51.6%) as yellow solid. TLC: 40% EtOAc/hexanes
(R.sub.f: 0.7); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 9.3
(s, 1H), 8.49 (d, J=5.6 Hz, 1H), 8-7.97 (m, 1H), 7.81-7.73 (m, 3H),
6.72 (d, J=6 Hz, 1H). LCMS Observed: 290.9 (M+1).sup.+.
Synthesis of Methyl 2-((3-aminopyridin-4-yl)thio)benzoate (97)
[0541] To a stirred solution of compound 96 (8 g, 27.6 mmol) in
THF:H.sub.2O (3:1, 80 mL) mixture, iron powder (4.62 g, 82.8 mmol)
and NH.sub.4Cl (4.42 g, 82.8 mmol) was added and stirred at
70.degree. C. for 6 h. The progress of the reaction was monitored
by TLC. After completion, the reaction mixture was filtered through
a pad of celite. The filtrate was concentrated in vacuo. The
residue was diluted with water (100 mL) and extracted with ethyl
acetate (2.times.100 mL). The combined organic layers were dried
over anhydrous sodium sulfate, filtered and concentrated in vacuo
to obtain the crude. The crude was purified through silica gel
column chromatography using 30% EtOAc/hexane to afford compound 97
(6 g, 84.3%) as a pale brown solid. TLC: 60% EtOAc/Hexane (R.sub.f:
0.3); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 8.16 (s, 1H),
8.97 (d, J=1.2 Hz, 1H), 7.78 (d, J=8 Hz, 1H), 7.44-7.40 (m, 1H),
7.28-7.21 (m, 2H), 6.71 (d, J=8.4 Hz, 1H), 5.60 (br.s, 2H), 3.87
(s, 3H). LCMS Observed: 260.95 (M+1).sup.+.
Synthesis of 2-((3-Aminopyridin-4-yl)thio)benzoic acid (98)
[0542] To a stirred solution of compound 97 (6 g, 2.3 mmol) in
THF:H.sub.2O (3:1, 60 mL) mixture at 0.degree. C. was added lithium
hydroxide (5.8 g, 13.8 mmol). The reaction mixture was slowly
warmed to RT and stirred at RT for 12 h. The progress of the
reaction was monitored by TLC. After completion of the reaction,
the volatiles were removed in vacuo. The residue was diluted with
water (200 mL); pH was adjusted to .about.2 using 2N Hydrochloric
acid and extracted with DCM (2.times.25 mL). The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to afford the crude compound 98 (4.6 g,
81.2%) as pale brown solid. The crude compound was used as such for
the next step without further purification. TLC: 80% EtOAc/hexane
(R.sub.f: 0.2) LCMS Observed: 246.95 (M+1).sup.+.
Synthesis of Benzo[f]pyrido[4,3-b][1,4]thiazepin-10(11H)-one
(99)
[0543] To a stirred solution of compound 98 (4 g, 16.24 mmol) in
DMF (20 mL) at RT were added DIPEA (8.6 mL, 48.72 mmol) and HATU
(9.25 g, 24.36 mmol) stirred at RT for 12 h. The progress of the
reaction was monitored by TLC. After completion, the reaction
mixture was quenched with ice cold water (200 mL), the obtained
solid was filtered and dried in vacuo to obtain the crude. The
crude compound was purified by silica gel column chromatography
using 40% EtOAc/hexane to afford the title compound 99 (3 g, 81.8%)
as off white solid. TLC: 70% EtOAc/hexanes (R.sub.f: 0.7). LCMS
Observed: 228.95 (M+1).sup.+.
Synthesis of Benzo[f]pyrido[4,3-b][1,4]thiazepin-10(11H)-one
5,5-dioxide (100)
[0544] To a stirred solution of compound 99 (1 g, 4.38 mmol) in 1,
2 dichloro ethane:CH.sub.3CN:H.sub.2O (1:1:2, 25 mL) at 0.degree.
C., sodium metaperiodate (2.8 g, 13.14 mmol) was added and stirred
for 10 min. To this solution, ruthenium trichloride hydrate (0.045
g, 0.22 mmol) was added at 0.degree. C. The resulting reaction
mixture was stirred at RT for 2 h. The progress of the reaction was
monitored by TLC. After completion; the reaction mixture was
filtered through a pad of celite. The filtrate was concentrated in
vacuo. The crude compound was purified by silica gel column
chromatography using 70% EtOAc/hexane to afford compound 100 (400
mg, 35%) as a white solid. TLC: 80% EtOAc/Hexane (R.sub.f: 0.4);
.sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.68 (br.s, 1H), 8.73
(s, 1H), 8.63 (d, J=4.8 Hz, 1H), 8.03-7.86 (m, 5H), LCMS Observed
(m/z): 261 (M+1).sup.+
Synthesis of
2-(4-methoxybenzyl)-10-oxo-10,11-dihydrobenzo[f]pyrido[4,3-b][1,4]thiazep-
in-2-ium 5,5-dioxide chloride (102)
[0545] To a stirred solution of compound 100 (2 g, 7.69 mmol) in
ACN (25 mL), PMB-Cl 101 (2.40 g, 15.38 mmol) was added and stirred
at 100.degree. C. for 12 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mixture was
filtered. The solid was taken in 50% ethyl acetate/hexane and
stirred at RT for 10 min. and filtered. The filtrate was
concentrated in vacuo to afford the title compound 102 (2.2 g,
75.08%) as an off white solid. TLC: 50% EtOAc/Hexane (R.sub.f:
0.6); .sup.1H NMR (400 MHz, DMSO-d.sub.6): 312.57 (s, 1H), 9.37 (s,
1H), 9.13 (d, J=6.4 Hz, 1H), 8.57 (d, J=6.4 Hz, 1H), 8.03-7.83 (m,
4H), 7.54 (d, J=8.8 Hz, 2H), 6.99 (d, J=8.8 Hz, 2H), 5.90 (s, 2H),
3.75 (s, 3H).
Synthesis of
2-(4-Methoxybenzyl)-2,3,4,11-tetrahydrobenzo[f]pyrido[4,3-b][1,4]
thiazepin-10(1H)-one 5,5-dioxide (103)
[0546] To a stirred solution of compound 102 (2.2 g, 5.77 mmol) in
MeOH (30 mL) at 0.degree. C., NaBH.sub.4 (0.427 g, 11.54 mmol). The
reaction mixture was slowly warmed to RT and stirred at RT for 8 h.
The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was quenched with ice cold water
and concentrated in vacuo. The residue was diluted with water (100
mL) and extracted with DCM (3.times.100 mL). The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to afford the crude compound 103 (1.5 g,
67.87%) as an off white solid. The crude compound was used as such
for the next step without further purification. TLC: 50%
EtOAc/hexane (R.sub.f: 0.2) LCMS Observed: 385.10 (M+1).sup.+.
Synthesis of
2,3,4,11-Tetrahydrobenzo[f]pyrido[4,3-b][1,4]thiazepin-10(1H)-one
5,5-dioxide (104)
[0547] A mixture of compound 103 (3 g, 7.81 mmol) and TFA (15 mL)
was heated at 100.degree. C. for 12 h. The progress of the reaction
was monitored by TLC. After completion, the reaction mixture was
concentrated in vacuo. The residue was diluted with sat.
NaHCO.sub.3 solution and extracted with 10% MeOH/DCM (3.times.100
mL). The combined organic layers were dried over anhydrous sodium
sulfate, filtered and concentrated in vacuo to afford the crude
compound 104 (1.4 g, 67.96%) as a brown solid. The crude compound
was used as such for the next step without further purification.
TLC: 10% MeOH/DCM (R.sub.f: 0.1) LCMS Observed: 265
(M+1).sup.+.
Synthesis of
N-((2-(1H-pyrazol-1-yl)thiazol-5-yl)methyl)-10-oxo-3,4,10,11-tetrahydrobe-
nzo[f]pyrido[4,3-b] [1,4]thiazepine-2(1H)-carboxamide 5,5-dioxide
(C43-01)
[0548] To a solution of
(2-(1H-pyrazol-1-yl)thiazol-5-yl)methanamine hydrochloride 93 (0.3
g, 1.48 mmol) in DCM (10 mL) at 0.degree. C. under argon atmosphere
was added DIPEA (0.79 mL, 12.54) followed by CDI (0.24 g, 1.48
mmol). The reaction mixture was stirred at 0.degree. C. for 1 h.
104 (0.47 g, 1.78 mol) was the added to the reaction mixture. The
reaction mixture was slowly warmed to RT and stirred at RT for 12
h. The progress of the reaction was monitored by TLC. After
completion of the reaction, the reaction mixture was diluted with
water (5 mL) and extracted with DCM (3.times.15 mL). The combined
organic layer was dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to obtain the crude. The crude compound was
purified by prep. HPLC to afford the title compound 75 mg C43-01
(Yield: 18.9%); as an off white solid; TLC: 10% MeOH/DCM (R.sub.f:
0.3); .sup.1H NMR (400 MHz, Chloroform-d): .delta. 9.08 (br.s, 1H),
8.27 (d, J=2.6 Hz, 1H), 8.08-8.01 (m, 1H), 7.97-7.90 (m, 1H),
7.79-7.65 (m, 3H), 7.38 (s, 1H), 6.46-6.44 (m, 1H), 5.28 (s, 1H),
4.63 (d, J=5.4 Hz, 2H), 4.31-4.30 (m, 2H), 3.48-3.46 (m, 2H),
2.76-2.74 (m, 2H); HPLC purity: 94.09%; LCMS Calculated for
C.sub.20H.sub.18N.sub.6O.sub.4S.sub.2: 470.08; LCMS Observed (m/z):
471.15 (M+1).sup.+.
Compounds of Group 3:
Example 1: Synthesis of (1-(thiazol-2-yl)-1H-pyrazol-4-yl)
methanamine hydrochloride (6): A Common Amine for Coupling
Reaction
##STR00153##
[0549] Synthesis of ethyl
1-(thiazol-2-yl)-1H-pyrazole-4-carboxylate (2)
[0550] To a stirring solution of ethyl 1H-pyrazole-4-carboxylate
(1) (5.0 g, 35.71 mmol) and 2-bromo thiazole (8.7 g, 53.57 mmol) in
DMF (100 mL) in sealed tube under argon atmosphere was added cesium
carbonate (35.0 g, 107.13 mmol) at room temperature. The reaction
mixture was heated to 80.degree. C. and stirred for 24 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was diluted with EtOAc (100 mL), washed with
water (2.times.100 mL). The organic extract was dried over sodium
sulfate, filtered and concentrated in vacuo to obtain the crude.
The crude was purified through silica gel column chromatography
using 10% EtOAc/hexanes to afford compound 2 (5 g, 63%) as off
white solid. TLC: 20% EtOAc/hexanes (R.sub.f: 0.8); .sup.1H NMR
(500 MHz, DMSO-d.sub.6): .delta. 8.89 (s, 1H), 8.24 (s, 1H), 7.73
(d, J=3.5 Hz, 1H), 7.66 (d, J=3.5 Hz, 1H), 4.30-4.26 (m, 2H), 1.30
(t, J=7.0 Hz, 3H); LC-MS: 99.79%; 224.0 (M+1).sup.+; (column;
Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.29 min.
0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of (1-(thiazol-2-yl)-1H-pyrazol-4-yl) methanol (3)
[0551] To a stirring solution of compound 2 (5.0 g, 22.42 mmol) in
dry THF (50 mL) under argon atmosphere was added lithium aluminium
hydride (2.55 g, 67.26 mmol) portion wise for 10 min at 0.degree.
C.; warmed to RT and stirred for 3 h. The reaction was monitored by
TLC; after completion of the reaction, quenched with aqueous sodium
hydroxide solution and extracted with EtOAc (2.times.100 mL). The
organic extract was dried over sodium sulfate, filtered and
concentrated in vacuo to obtain the crude. The crude was purified
through silica gel column chromatography using 30% EtOAc/hexanes to
afford to afford compound 3 (3.0 g, 75%) as gummy syrup. TLC: 40%
EtOAc/hexanes (R.sub.f: 0.3); .sup.1H NMR (500 MHz, DMSO-d.sub.6):
.delta. 8.34 (s, 1H), 7.78 (s, 1H), 7.62 (d, J=3.5 Hz, 1H), 7.50
(s, 1H), 5.10-5.08 (m, 1H), 4.44 (d, J=5.2 Hz, 2H); LC-MS: 88.67%;
182.0 (M+1).sup.+; (column; Ascentis Express C18, (50.times.3.0 mm,
2.7 .mu.m); RT 1.34 min. 0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq.
TFA, 1.2 mL/min).
Synthesis of (1-(thiazol-2-yl)-1H-pyrazol-4-yl) methyl
methanesulfonate (4)
[0552] To a stirring solution of compound 3 (2.0 g, 11.04 mmol) in
CH.sub.2Cl.sub.2 (30 mL) under inert atmosphere were added
triethylamine (4.64 mL, 33.12 mmol) and methanesulfonyl chloride
(1.35 mL, 16.57 mmol) at 0.degree. C.; warmed to RT and stirred for
3 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was diluted with CH.sub.2Cl.sub.2
(50 mL), washed with saturated NaHCO.sub.3 solution (2.times.50
mL). The organic extract was dried over sodium sulfate, filtered
and concentrated in vacuo to afford compound 4 (2 g, crude) as
colorless syrup. TLC: 30% EtOAc/hexanes (R.sub.f: 0.7); .sup.1H NMR
(500 MHz, DMSO-d.sub.6): .delta. 8.60 (s, 1H), 7.94 (s, 1H), 7.65
(d, J=3.5 Hz, 1H), 7.56 (d, J=3.5 Hz, 1H), 4.77 (s, 2H), 3.18 (s,
3H).
Synthesis of 2-(4-(azidomethyl)-1H-pyrazol-1-yl) thiazole (5)
[0553] To a stirred solution of compound 4 (2.0 g, 7.77 mmol) in
DMF (20 mL) under argon atmosphere was added sodium azide (1.0 g,
15.44 mmol) at 0.degree. C.; heated to 50.degree. C. and stirred
for 6 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was diluted with water (40 mL) and
extracted with EtOAc (2.times.50 mL). The organic extract was dried
over sodium sulfate, filtered and concentrated in vacuo to obtain
the crude. The crude was purified through silica gel column
chromatography using 5% EtOAc/hexanes to afford compound 5 (412 mg,
25%) as liquid. TLC: 10% EtOAc/hexanes (R.sub.f: 0.4); .sup.1H NMR
(500 MHz, DMSO-d.sub.6): .delta. 8.60 (s, 1H), 7.91 (s, 1H), 7.64
(d, J=3.5 Hz, 1H), 7.55 (d, J=3.5 Hz, 1H), 4.41 (s, 2H) LC-MS:
91.47%; 206.9 (M+1).sup.+; (column; Ascentis Express C18,
(50.times.3.0 mm, 2.7 .mu.m); RT 2.49 min. 2.5 mM Aq.
NH.sub.4OOCH+5% ACN:ACN+5% 2.5 mM Aq.NH.sub.4OOCH, 0.8 mL/min).
Synthesis of (1-(thiazol-2-yl)-1H-pyrazol-4-yl) methanamine
hydrochloride (6)
[0554] To a stirred solution of compound 5 (400 mg, 1.94 mmol) in
THF:H.sub.2O (5:1, 12 mL) was added triphenyl phosphine (507 mg,
1.94 mmol) portion wise for 15 min at RT and then stirred for 16 h.
The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The residue was
diluted with DCM (10 mL) and 4N HCl in 1,4-Dioxane (10 mL) and
stirred for 30 min. solvents were evaporated, triturated with EtOAc
(10 mL) and dried in vacuo to afford compound 6 (300 g, HCl salt)
as an off-white solid. TLC: 10% EtOAc/hexanes (R.sub.f: 0.1).
.sup.1H NMR (500 MHz, DMSO-d.sub.6): .delta. 8.64 (s, 1H), 8.45 (s,
3H), 7.94 (s, 1H), 7.65 (d, J=2.9 Hz, 1H), 7.56 (d, J=2.9 Hz, 1H),
4.00-3.97 (m, 2H).
Example 2: Synthesis of 1155
##STR00154## ##STR00155##
[0555] Synthesis of methyl 4-((2-(methoxycarbonyl) phenyl)
thio)-3-nitrobenzoate (9)
[0556] To a stirred solution of methyl 4-fluoro-3-nitrobenzoate 8
(30 g, 150.67 mmol) in DMF (300 mL) under inert atmosphere were
added cesium carbonate (58.76 g, 180.8 mmol) and methyl
2-mercaptobenzoate 7 (22.6 mL, 165.47 mmol) at RT; heated to
55-60.degree. C. and stirred for 2 h. The reaction was monitored by
TLC; after completion of the reaction, the reaction mixture was
diluted with water (1500 mL) and the precipitated solid was
filtered to obtain the crude. The crude was washed with water (500
mL), hexane (200 mL) and dried in vacuo to afford compound 9 (48.8
g, 93%) as yellow solid. TLC: 20% EtOAc/hexanes (R.sub.f: 0.4);
.sup.1H NMR (CDCl.sub.3, 400 MHz): .delta. 8.85 (s, 1H), 7.99-7.92
(m, 2H), 7.66-7.56 (m, 3H), 6.93 (d, J=8.6 Hz, 1H), 3.94 (s, 3H),
3.79 (s, 3H).
Synthesis of methyl 3-amino-4-((2-(methoxycarbonyl) phenyl) thio)
benzoate (10)
[0557] To a stirred solution of compound 9 (48 g, 138.32 mmol) in
MeOH (1000 mL) under inert atmosphere was added 10% Pd/C (20 g,
wet) at RT under hydrogen atmosphere in an autoclave (100 psi
pressure) and stirred for 24 h. The reaction was monitored by TLC;
after completion of the reaction, the reaction mixture was filtered
through celite, washed with 50% MeOH/CH.sub.2Cl.sub.2 (500 mL). The
filtrate was removed in vacuo to obtain the crude which as
triturated with diethyl ether (200 mL), washed with hexane (200 mL)
and dried in vacuo to afford compound 10 (40 g, 91%) as yellow
solid. TLC: 10% EtOAc/hexanes (R.sub.f: 0.3); .sup.1H NMR
(DMSO-d.sub.6, 400 MHz): .delta. 7.95 (dd, J=7.8, 1.4 Hz, 1H),
7.48-7.35 (m, 3H), 7.23 (td, J=7.5, 1.1 Hz, 1H), 7.15 (dd, J=8.0,
1.8 Hz, 1H), 6.66 (dd, J=8.2, 0.8 Hz, 1H), 5.67 (br s, 2H), 3.88
(s, 3H), 3.84 (s, 3H).
Synthesis of 3-amino-4-((2-carboxyphenyl) thio) benzoic acid
(11)
[0558] To a stirred solution of compound 10 (40 g, 126.18 mmol) in
THF:H.sub.2O (5:1, 400 mL) was added lithium hydroxide monohydrate
(26 g, 619.0 mmol) at 0.degree. C.; warmed to RT and stirred for 48
h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The pH of the
residue was acidified with 2 N HCl to .about.2. The precipitated
solid was filtered and dried in vacuo to afford compound 11 (34.6
g, 95%) as an off-white solid. TLC: 30% EtOAc/hexanes (R.sub.f:
0.1); .sup.1H NMR (DMSO-d.sub.6, 500 MHz): .delta. 13.00 (br s,
2H), 7.93 (dd, J=7.7, 1.0 Hz, 1H), 7.42 (s, 1H), 7.40-7.31 (m, 2H),
7.18 (t, J=7.4 Hz, 1H), 7.13 (dd, J=8.0, 1.6 Hz, 1H), 6.61 (d,
J=7.8 Hz, 1H), 5.55 (br s, 2H).
Synthesis of 11-oxo-10, 11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxylic acid (12)
[0559] To a stirred solution of compound 11 (31 g, 107.26 mmol) in
THF (600 mL) under inert atmosphere was added CDI (86.88 g, 536.29
mmol) at 0.degree. C.; warmed to RT and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the reaction mixture was acidified with 2 N HCl to pH.about.4. The
obtained solid was filtered and further dried by using toluene
(2.times.200 mL) to afford compound 12 (26 g, 90%) as white solid.
TLC: 10% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.3); .sup.1H NMR
(DMSO-d.sub.6, 400 MHz): .delta. 13.22 (br s, 1H), 10.81 (s, 1H),
7.78 (s, 1H), 7.72-7.64 (m, 3H), 7.57-7.44 (m, 3H).
Synthesis of methyl 11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxylate (13)
[0560] To a stirred solution of 12 (500 mg, 1.84 mmol) in
MeOH:CH.sub.2Cl.sub.2 (1:1, 20 mL) under argon atmosphere was added
CH.sub.2N.sub.2 (in situ prepared using N-nitrosomethyl urea (0.95
g, 9.2 mmol)+KOH (0.51 g, 9.22 mmol) at 0.degree. C.; warmed to RT
and stirred for 1 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo to
obtain the crude. The crude was purified through silica gel column
chromatography using 20% EtOAc/hexanes to afford compound 13 (450
mg, 86%) as white solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.5);
.sup.1H-NMR (DMSO-d.sub.6, 500 MHz): .delta. 10.82 (s, 1H), 7.82
(s, 1H), 7.75-7.69 (m, 3H), 7.58-7.63 (m, 3H), 3.82 (s, 3H).
Synthesis of methyl 11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxylate 5, 5-dioxide (14)
[0561] To a stirred solution of 13 (5 g, 17.54 mmol) in acetic acid
(25 mL) was added 30% aqueous hydrogen peroxide (100 mL) at
0.degree. C.; warmed to 50.degree. C. and stirred for 72 h. The
reaction was monitored by TLC; after completion of the reaction,
the obtained solid was filtered, washed with water (100 mL), 10%
EtOAc/hexanes (100 mL) and dried in vacuo to afford compound 14
(3.5 g, 64%) as white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2
(R.sub.f: 0.3); .sup.1H NMR (DMSO-d.sub.6, 500 MHz): .delta. 11.58
(s, 1H), 8.09 (d, J=8.4 Hz, 1H), 8.01-7.95 (m, 3H), 7.93-7.83 (m,
3H), 3.88 (s, 3H);
Synthesis of 11-oxo-10, 11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxylic acid 5, 5-dioxide (15)
[0562] To a stirred solution of compound 14 (3.5 g, 11.04 mmol) in
a mixture of THF:MeOH:H.sub.2O (2:2:1, 25 mL) was added lithium
hydroxide monohydrate (1.3 g, 33.12 mmol) portion wise for 10 min
at 0.degree. C.; warmed to RT and stirred for 3 h. The reaction was
monitored by TLC; after completion of the reaction, the volatiles
were removed in vacuo. The residue was diluted with water (20 mL)
and acidified with 1 N HCl to pH.about.2. The obtained solid was
filtered, washed with isopropyl alcohol (15 mL) and dried in vacuo
to obtain compound 15 (2.8 g, 84%) as white solid. TLC: 5%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.1); .sup.1H NMR (DMSO-d.sub.6,
400 MHz): .delta.13.65 (br s, 1H), 11.55 (s, 1H), 8.07 (d, J=8.3
Hz, 1H), 8.03-7.82 (m, 6H).
Synthesis of 11-oxo-N-((1-(thiazol-2-yl)-1H-pyrazol-4-yl)
methyl)-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxamide 5, 5-dioxide (1155)
[0563] To a stirring solution of compound 15 (150 mg, 0.495 mmol)
in DMF (5 mL) under inert atmosphere were added HATU (282 mg, 0.742
mmol), diisopropylethylamine (0.44 mL, 2.47 mmol) and compound 6
(128 mg, 0.594 mmol) at 0.degree. C. warmed to RT and stirred for
16 h. The reaction was monitored by TLC; after completion of the
reaction, the diluted with water (5 mL) and extracted with EtOAc
(2.times.5 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel column
chromatography using 5% MeOH/CH.sub.2Cl.sub.2 to afford 1155 (60
mg, 26%) as an off-white solid. TLC: 10% MeOH/CH.sub.2Cl.sub.2
(R.sub.f: 0.4); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.50
(s, 1H), 9.17 (t, J=5.6 Hz, 1H), 8.39 (s, 1H), 8.03 (d, J=8.2 Hz,
1H), 8.00-7.94 (m, 2H), 7.92-7.77 (m, 5H), 7.60 (d, J=3.5 Hz, 1H),
7.50 (d, J=3.4 Hz, 1H), 4.39 (d, J=5.6 Hz, 2H); LC-MS: 98.66%;
466.1 (M+1).sup.+; (column; Ascentis Express C18, (50.times.3.0 mm,
2.6 .mu.m); RT 2.43 min. 2.5 mM Aq. NH.sub.4OOCH+5% ACN:ACN+5% 2.5
mM Aq.NH.sub.4OOCH, 0.8 mL/min); HPLC (purity): 99.65%; (column; X
select CSH C-18 (150.times.4.6 mm, 3.5 .mu.m); RT 7.89 min. 0.05%
TFA+5% ACN:ACN+5% 0.05% TFA; 1.0 mL/min,
Diluent:water:ACN:DMSO).
Example 3: Synthesis of 1153
##STR00156## ##STR00157##
[0564] Synthesis of Mixture of 4-fluoro-2-methyl-3-nitrobenzoic
acid (17) and 4-fluoro-2-methyl-5-nitrobenzoic acid (18)
[0565] To a stirred solution of 4-fluoro-2-methylbenzoic acid 16
(10 g, 64.51 mmol) in acetic acid (50 mL) under inert atmosphere
was added fuming nitric acid (50 mL) at RT and heated to 80.degree.
C. for 6 h. The reaction was monitored by TLC; after completion of
the reaction, the reaction mixture was diluted with ice cold water
(100 mL). The precipitate was filtered and dried in vacuo to afford
mixture of compounds 17 and 18 (5.3 g, 40%) as white solid. TLC:
70% EtOAc/hexanes (R.sub.f: 0.4); .sup.1H NMR (DMSO-d.sub.6, 400
MHz): .delta. 13.30 (br s, 2H), 8.52 (d, J=8.0 Hz, 2H), 8.10 (dd,
J=8.9 5.9, Hz, 1H), 7.60 (d, J=12.5 Hz, 2H), 7.56 (t, J=9.3 Hz,
1H), 2.63 (s, 6H), 2.48 (s, 3H); ('H NMR showed mixture of
compounds 17 & 18 in the ratio of 2:1).
Synthesis of Mixture of methyl 4-fluoro-2-methyl-3-nitrobenzoate
(19) and methyl 4-fluoro-2-methyl-5-nitrobenzoate (20)
[0566] To a stirred solution of compound 17 & 18 (10 g) in MeOH
(100 mL) under argon atmosphere was conc. sulfuric acid (20 mL) at
0.degree. C. and heated to reflux for 48 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was diluted with water (100 mL) and extracted with EtOAc
(2.times.100 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated in vacuo to afford
mixture of compounds 19 & 20 (6 g) as a colorless, thick syrup.
TLC: 30% EtOAc/hexane (R.sub.f: 0.5); .sup.1H NMR (DMSO-d.sub.6,
500 MHz): .delta. 8.51 (d, J=7.8 Hz, 1H), 8.09 (dd, J=8.8, 5.6 Hz,
0.5H), 7.63 (d, J=12.4 Hz, 1H), 7.58 (t, J=9.1 Hz, 0.5H), 3.87 (s,
4.5H), 2.62 (s, 3H), 2.45 (s, 1.5H); (.sup.1H NMR showed mixture of
compounds 19:20 in the ratio of 2:1).
Synthesis of Mixture of methyl 4-((2-(methoxycarbonyl) phenyl)
thio)-2-methyl-3-nitrobenzoate (21) and methyl
4-((2-(methoxycarbonyl) phenyl) thio)-2-methyl-5-nitrobenzoate
(22)
[0567] To a stirred solution of compounds 19 & 20 (11 g) in DMF
(100 mL) under inert atmosphere were added methyl
2-mercaptobenzoate 7 (10.4 g, 61.97 mmol), cesium carbonate (18.5
g, 56.81 mmol) at 0.degree. C.; heated to 80.degree. C. and stirred
for 4 h. The reaction was monitored by TLC; after completion of the
reaction, the reaction mixture was diluted with ice cold water (100
mL) and extracted with EtOAc (2.times.100 mL). The combined organic
extracts were washed with water (200 mL), brine (200 mL), dried
over sodium sulfate, filtered and concentrated in vacuo to afford
mixture of compounds 21 & 22 (12 g) as yellow solid. TLC: 20%
EtOAc/hexanes (R.sub.f: 0.2); LC-MS: 12.57%+81.14%; 370.8
(M+1).sup.+; (column; X-Select CSH C18, (50.times.3.0 mm, 3.5
.mu.m); RT 2.77 min. 0.05% Aq. TFA:ACN; 0.8 mL/min); RT 4.05, 4.14
min.
Synthesis of methyl 5-amino-4-((2-(methoxycarbonyl) phenyl)
thio)-2-methylbenzoate (23) and Synthesis of methyl
5-amino-4-((2-(methoxycarbonyl) phenyl) thio)-2-methylbenzoate
(24)
[0568] To a stirred solution of compound 21 & 22 (14 g, crude)
in MeOH (500 mL) under inert atmosphere was added Pd/C (1.4 g, 50%
wet) at RT and stirred under hydrogen atmosphere in an autoclave (6
kg/cm.sup.2 pressure) for 18 h. The reaction was monitored by TLC;
after completion of the reaction, the reaction mixture was filtered
through celite, washed with MeOH (100 mL). The filtrate was
concentrated in vacuo to obtain the crude. The crude was
recrystallized with EtOH (20 mL) and further purified through
silica gel column chromatography column chromatography using 10%
EtOAc/hexanes to afford compound 23 (8 g, 63%) and 24 (3 g, 30%) as
sticky off-white solids. TLC: 30% EtOAc/hexanes (R.sub.f: 0.4);
.sup.1H NMR (DMSO-d.sub.6, 400 MHz) (23): .delta. 7.94 (d, J=7.1
Hz, 1H), 7.40 (1, J=7.3 Hz, 1H), 7.33-7.26 (m, 2H), 7.22 (dt,
J=7.6, 1.1 Hz, 1H), 6.67 (dd, J=8.2, 0.8 Hz, 1H), 5.41 (s, 2H),
3.89 (s, 3H), 3.83 (s, 3H), 2.33 (s, 3H). .sup.1H NMR
(DMSO-d.sub.6, 400 MHz) (24): .delta. 7.94 (dd, J=7.8, 1.4 Hz, 1H),
7.42-7.38 (m, 1H), 7.32 (s, 1H), 7.26 (s, 1H), 7.22 (td, J=7.5, 1.0
Hz, 1H), 6.67 (dd, J=8.1, 0.8 Hz, 1H), 5.41 (s, 2H), 3.88 (s, 2H),
3.82 (s, 3H), 2.33 (s, 3H).
Synthesis of 3-amino-4-((2-carboxyphenyl) thio)-2-methylbenzoic
acid (25)
[0569] To a stirred solution of compound 24 (2 g, 6.04 mmol) in
THF:H.sub.2O (4:1, 50 mL) was added lithium hydroxide monohydrate
(2.5 g, 10.0 mmol) at 0.degree. C.; warmed to RT and stirred for 48
h. The reaction was monitored by TLC; after completion of the
reaction, the volatiles were removed in vacuo. The residue was
diluted with water (10 mL) and washed with diethyl ether
(2.times.50 mL). The pH of the aqueous layer was acidified with 4 N
HCl to .about.1. The precipitated solid was filtered and dried in
vacuo to afford compound 25 (1.2 g, 66%) as white solid. TLC: 20%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2); .sup.1H NMR (DMSO-d.sub.6,
400 MHz): .delta. 13.01 (br s, 2H), 7.94 (d, J=7.4 Hz, 1H), 7.36
(t, J=7.8 Hz, 1H), 7.28 (d, J=8.0 Hz, 1H), 7.20 (dt, J=7.4, 6.3 Hz,
1H), 6.95 (d, J=8.0 Hz, 1H), 6.61 (d, J=7.4 Hz, 1H), 5.25 (br s,
2H), 2.27 (s, 3H).
Synthesis of 9-methyl-11-oxo-10, 11-dihydrodibenzo [b,f] [1, 4]
thiazepine-8-carboxylic acid (26)
[0570] To a stirred solution of compound 25 (2.6 g, 4.30 mmol) in
THF (30 mL) under argon atmosphere was added CDI (3.5 g, 21.50
mmol) at RT; heated to 80.degree. C. and stirred for 16 h. The
reaction was monitored by TLC; after completion of the reaction,
the volatiles were removed in vacuo. The residue was diluted with
water (20 mL) and pH was adjusted with 4 N HCl to .about.2. The
obtained solid was filtered, washed with diethyl ether and dried in
vacuo to obtain compound 26 (1.6 g, 67%) as an off white solid.
TLC: 15% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.2); .sup.1H NMR
(DMSO-d.sub.6, 400 MHz): .delta. 13.20 (br s, 1H), 10.23 (s, 1H),
7.74-7.60 (m, 1H), 7.56-7.51 (m, 2H), 7.50-7.42 (m, 3H), 2.47 (s,
3H).
Synthesis of methyl 9-methyl-11-oxo-10, 11-dihydrodibenzo [b, f]
[1, 4] thiazepine-8-carboxylate (27)
[0571] To a stirring solution of compound 26 (400 mg, 1.40 mmol) in
MeOH (30 mL) under argon atmosphere was added CH.sub.2N.sub.2
[insitu prepared using N-nitrosomethyl urea (723 mg, 7.01 mmol)+30%
KOH solution (100 mL) in diethyl ether (200 mL)] at 0.degree. C.
and stirred for 3 h. The reaction was monitored by TLC; after
completion of the reaction, the volatiles were removed in vacuo to
obtain the crude, which was triturated with diethyl ether
(2.times.20 mL) and dried in vacuo to afford compound 27 (300 mg,
71%) as an off-white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2 (R.sub.f:
0.8); .sup.1H-NMR (DMSO-d.sub.6, 500 MHz): .delta. 10.40 (s, 1H),
7.83-7.79 (m, 1H), 7.72-7.65 (m, 2H), 7.64-7.56 (m, 3H), 3.95 (s,
3H), 2.58 (s, 3H); LC-MS: 95.08%; 299.8 (M+1).sup.+; (column;
Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.38 min.
0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of methyl 9-methyl-11-oxo-10, 11-dihydrodibenzo [b, f]
[1, 4] thiazepine-8-carboxylate 5, 5-dioxide (28)
[0572] To a stirring solution of 27 (300 mg, 1.00 mmol) in acetic
acid (4 mL) was added 30% hydrogen peroxide (8 mL) at 0.degree. C.;
warmed to 60.degree. C. and stirred for 72 h. The reaction was
monitored by TLC; after completion of the reaction, the reaction
mixture was diluted with ice-cold water (50 mL), stirred for 15
min, the obtained solid was filtered, washed with water (100 mL)
and dried in vacuo to afford compound 28 (210 mg, 63%) as an
off-white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.3);
.sup.1H NMR (DMSO-d.sub.6, 500 MHz): .delta. 10.86 (s, 1H),
7.94-7.89 (m, 3H), 7.88-7.76 (m, 2H), 7.67 (d, J=8.4 Hz, 1H), 3.83
(s, 3H), 2.43 (s, 3H). LC-MS: 94.24%; 331.9 (M+1).sup.+; (column;
Ascentis Express C18, (50.times.3.0 mm, 2.7 .mu.m); RT 2.22 min.
0.025% Aq. TFA+5% ACN:ACN+5% 0.025% Aq. TFA, 1.2 mL/min).
Synthesis of 9-methyl-11-oxo-10, 11-dihydrodibenzo [b, f] [1, 4]
thiazepine-8-carboxylic acid 5, 5-dioxide (29)
[0573] To a stirring solution of compound 28 (230 mg, 0.69 mmol) in
THF:MeOH:H.sub.2O (2:2:1, 20 mL) was added lithium hydroxide
monohydrate (87 mg, 2.08 mmol) portion wise for 10 mM at 0.degree.
C.; warmed to RT and stirred for 24 h. The reaction was monitored
by TLC; after completion of the reaction, the volatiles were
removed in vacuo. The residue was diluted with water (20 mL) and
acidified with 3 N HCl to pH.about.3. The obtained solid was
filtered, washed with water (20 mL) and dried in vacuo to obtain
compound 29 (210 mg, 95%) as an off-white solid. TLC: 10%
MeOH/CH.sub.2Cl.sub.2 (R.sub.f: 0.1); .sup.1H NMR (DMSO-d.sub.6,
400 MHz): .delta. 13.62 (br s, 1H), 10.85 (s, 1H), 7.97-7.84 (m,
4H), 7.82-7.79 (m, 1H), 7.65 (d, J=8.4 Hz, 1H), 2.43 (s, 3H).
LC-MS: 96.06%; 317.9 (M+1).sup.+; (column; X Select CSH C-18,
(50.times.3.0 mm, 2.5 .mu.m); RT 1.68 min. 2.5 mM Aq. NH4OCH+5%
ACN:ACN+5% 2.5 mM Aq.NH4OOCH, 0.8 mL/min).
Synthesis of
9-methyl-11-oxo-N-((1-(thiazol-2-yl)-1H-pyrazol-4-yl)methyl)-10,11-dihydr-
odibenzo[b,f][1,4]thiazepine-8-carboxamide 5,5-dioxide (1153)
[0574] To a stirring solution of compound 29 (150 mg, 0.473 mmol)
in DMF (5 mL) under inert atmosphere were added HATU (269 mg, 0.709
mmol), diisopropylethylamine (0.42 mL, 2.36 mmol) and compound 6
(123 mg, 0.567 mmol) at 0.degree. C. warmed to RT and stirred for
16 h. The reaction was monitored by TLC; after completion of the
reaction, the diluted with water (5 mL) and extracted with EtOAc
(2.times.5 mL). The combined organic extracts were dried over
sodium sulfate, filtered and concentrated in vacuo to obtain the
crude. The crude was purified through silica gel column
chromatography using 3% MeOH/CH.sub.2Cl.sub.2 to afford 1153 (100
mg, 44%) as an off-white solid. TLC: 5% MeOH/CH.sub.2Cl.sub.2
(R.sub.f: 0.1); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 10.86
(s, 1H), 8.91 (t, J=5.6 Hz, 1H), 8.41 (s, 1H), 7.96-7.90 (m, 2H),
7.88-7.83 (m, 2H), 7.83-7.76 (m, 2H), 7.62 (d, J=3.5 Hz, 1H), 7.52
(d, J=3.5 Hz, 1H), 7.38 (d, J=8.2 Hz, 1H), 4.37 (d, J=5.6 Hz, 2H),
2.32 (s, 3H); LC-MS: 98.82%; 480.0 (M+1).sup.+; (column; Ascends
Express C18, (50.times.3.0 mm, 2.6 .mu.m); RT 2.36 min. 2.5 mM Aq.
NH.sub.4OOCH+5% ACN:ACN+5% 2.5 mM Aq.NH.sub.4OOCH, 0.8 mL/min);
HPLC (purity): 99.37%; (column; X select CSH C-18 (150.times.4.6
mm, 3.5 .mu.m); RT 7.71 min. 0.05% TFA+5% ACN:ACN+5% 0.05% TFA; 1.0
mL/min, Diluent:water:ACN).
Example 4: Additional Compounds
[0575] The following prophetic compounds are also contemplated as
compounds of the invention.
##STR00158##
Compounds of Group 4:
Example 1: General Synthetic Procedure for Amide Coupling
[0576] Method A: To a stirred solution of acid core (1 eq.) in DMF
(5-10V) were added HATU (1.5 eq.) and DIPEA (3 eq.) at 0.degree. C.
and was stirred for 10 min. To this solution, amine (1.2 eq.) was
added and the reaction mixture was stirred at room temperature for
further 8-16 h. The progress of the reaction was monitored by TLC.
After completion, the reaction mixture was diluted with water and
extracted with DCM. The combined organic layers were dried over
anhydrous sodium sulfate, filtered and concentrated in vacuo to
obtain the crude. The crude compound was purified by silica gel
column chromatography/prep-HPLC to afford the title compound.
[0577] Method B: To a stirred solution of acid core (1 eq.) in DMF
(5-10V) were added EDCI (2 eq.), HOBt (1.5 eq.) and DIPEA (3 eq.)
at 0.degree. C. and was stirred for 10 min. To this solution, amine
(1.2 eq.) was added and the reaction mixture was stirred at room
temperature for further 8-16 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mixture was
diluted with water and extracted with DCM. The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to obtain the crude. The crude compound was
purified by silica gel column chromatography/prep-HPLC to afford
the title compound.
Example 2: Synthesis of
4-Methyl-2-oxo-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1,2-dihydroqui-
noline-7-carboxamide (C2-01)
##STR00159##
[0578] Step 1: Synthesis of N-(3-Bromophenyl)-3-oxobutanamide
(10)
[0579] To a stirred solution of compound 9 (10 g, 58.13 mmol) in
toluene (60 mL), ethyl 3-oxobutanoate (12.1 g, 93.2 mmol) was
added. The resulting reaction mixture was refluxed for 12 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mixture was quenched with sat. Na.sub.2CO.sub.3
solution and extracted with ethyl acetate (3.times.500 mL). The
combined organic layers were dried over anhydrous sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
compound was purified by silica gel column chromatography using 50%
EtOAc/hexane to afford the title compound 10 (10.2 g, 68.5%) as an
off-white solid. TLC: 50% EtOAc/hexanes (R.sub.f: 0.2); .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 10.24 (s, 1H), 7.39 (s, 1H), 7.42
(d, J=7.2 Hz, 1H), 7.29-7.22 (m, 2H), 3.55 (s, 2H), 2.20 (s, 3H);
LCMS Observed (m/z): 258 (M+2).sup.+.
Step 2: Synthesis of 7-Bromo-4-methylquinolin-2(1H)-one (11)
[0580] A mixture of compound 10 (3 g, 11.67 mmol) and Conc.
H.sub.2SO.sub.4 (15 mL) was heated at 120.degree. C. for 2 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mixture was quenched with ice, the obtained solid was
filtered and dried in vacuo to afford title compound 11 (1.9 g,
68.84%) as an off-white solid. The crude compound was used as such
for the next step without further purification. TLC: 5% MeOH/DCM
(R.sub.f: 0.2); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.63
(br.s, 1H), 7.62 (d, J=8.8 Hz, 1H), 7.46 (s, 1H), 7.33 (d, J=8.4
Hz, 1H), 6.41 (s, 1H), 2.48 (s, 3H). LCMS Observed (m/z): 240
(M+2).sup.+.
Step 3: Synthesis of
4-Methyl-2-oxo-1,2-dihydroquinoline-7-carboxylic acid (C2)
[0581] To a stirred solution of compound 11 (1 g, 4.21 mmol) in dry
THF (20 mL) at -78.degree. C. under argon atmosphere, n-BuLi (1.6 M
in THF, 9.53 mL, 15.19 mmol) was added drop wise and stirred at
-78.degree. C. for 30 min. To this solution, CO.sub.2 gas was
purged for 15 min. at -78.degree. C., followed by addition of
dry-ice pieces. The resulting reaction was stirred at RT for 30
min. The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was quenched with sat. NH.sub.4Cl
solution; acidified with dil HCl to pH.about.3; the obtained solid
was filtered and dried in vacuo to afford title compound C2 (0.35
g, 41%) as an off-white solid. The crude compound was used as such
for the next step without further purification. TLC: 5% MeOH/DCM
(R.sub.f: 0.1); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 13.40
(br.s, 1H), 11.78 (s, 1H), 7.92 (s, 1H), 7.80 (d, J=8.8 Hz, 1H),
7.70 (d, J=8.4 Hz, 1H), 6.51 (s, 1H), 2.45 (s, 3H). LCMS Observed
(m/z): 204 (M+1).sup.+.
Step 4: Synthesis of
4-Methyl-2-oxo-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1,2-dihydroqui-
noline-7-carboxamide (C2-01)
[0582] The title compound has been synthesized by following the
general procedure as described above (Method A) for amide coupling
by using corresponding amine and acid C2. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 150
mg; Yield: 20 mg (7.4%); Appearance: White solid; TLC: 5% MeOH/DCM
(R.sub.f: 0.2); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.75
(s, 1H), 9.47 (t, J=5.8 Hz, 1H), 8.08 (s, 1H), 7.81-7.78 (m, 2H),
7.62 (d, J=8.4 Hz, 1H), 6.48 (s, 1H), 4.76 (d, J=5.6 Hz, 2H), 2.44
(d, J=1.3 Hz, 3H), HPLC purity: 98.90%; LCMS Calculated for
C.sub.16H.sub.12F.sub.3N.sub.3O.sub.2S: 367.06; LCMS Observed: 368
(M+1).sup.+.
Example 3: Synthesis of
4-Isopropyl-2-oxo-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1,2-dihydro-
quinoline-7-carboxamide (C3-01)
##STR00160##
[0583] Step 1: Synthesis of
N-(3-Bromophenyl)-4-methyl-3-oxopentanamide (12)
[0584] To a stirred solution of compound 9 (4 g, 23.2 mmol) in
toluene (50 mL), ethyl 4-methyl-3-oxopentanoate (5.88 g, 37.1 mmol)
was added and refluxed at 120.degree. C. for 12 h. The progress of
the reaction was monitored by TLC. After completion, the reaction
mixture was quenched with sat. Na.sub.2CO.sub.3 solution and
extracted with ethyl acetate (3.times.100 mL). The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to obtain the crude. The crude compound was
purified by silica gel column chromatography using 10% EtOAc/hexane
to afford the title compound 12 (3.5 g, 53.2%) as white solid. TLC:
30% EtOAc/hexanes (R.sub.f: 0.5); .sup.1H NMR (400 MHz,
CDCl.sub.3): .delta. 9.36 (s, 1H), 7.84 (t, J=2.0 Hz, 1H),
7.47-7.45 (m, 1H), 7.29-7.15 (m, 2H), 3.62 (s, 2H), 2.79-2.71 (1H),
1.19 (d, J=6.8 Hz, 6H). LCMS Observed (m/z): 283.90
(M+1).sup.+.
Step 2: Synthesis of 7-Bromo-4-isopropylquinolin-2(1H)-one (13)
[0585] A mixture of compound 12 (3.5 g, 12.3 mmol) and conc.
H.sub.2SO.sub.4 (17.5 mL) was refluxed at 120.degree. C. for 2 h.
The progress of the reaction was monitored by TLC. After
completion, reaction mixture was poured in to ice cold water (100
mL), the obtained solid was filtered and dried in vacuo to afford
title compound 13 (1.5 g, 46.01) as an off-white solid. TLC: 40%
EtOAc/hexanes (R.sub.f: 0.2); The crude compound was used as such
for the next step without further purification .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 11.70 (s, 1H), 7.77 (d, J=9.2 Hz, 1H),
7.50 (s, 1H), 7.36-7.26 (m, 1H), 6.38 (s, 1H), 3.40-3.33 (m, 1H),
1.23 (d, J=6.8 Hz, 6H), LCMS Observed (m/z): 266 (M+1).sup.+.
Step 3: Synthesis of
4-Isopropyl-2-oxo-1,2-dihydroquinoline-7-carboxylic acid (C3)
[0586] To a stirred solution of compound 13 (0.5 g, 1.88 mmol) in
dry THF (5 mL) at -78.degree. C. under argon atmosphere, n-BuLi
(1.6 M in THF, 4.7 mL, 7.5 mmol) was added drop wise and stirred at
same temperature for 30 min. To this solution, CO, gas was purged
for 30 min at -78.degree. C., followed by the addition of dry-ice
pieces. The resulting reaction was stirred at RT for 1 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mixture was quenched with sat. NH.sub.4Cl solution and
extracted with ethyl acetate (3.times.50 mL). The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to afford the title compound C3 (0.4 g,
crude) as an off-white solid. TLC: 50% EtOAc/hexanes (R.sub.f:
0.1); The crude compound was used as such for the next step without
further purification. LCMS Observed (m/z): 232 (M+1).sup.+.
Step 4: Synthesis of
4-Isopropyl-2-oxo-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1,2-dihydro-
quinoline-7-carboxamide (E16069-008-02, C3-01)
[0587] The title compound has been synthesized by following the
general procedure as described above (Method B) for amide coupling
by using corresponding amine and acid C3. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 200
mg; Yield: 20 mg (6%); Appearance: White solid; TLC: 10% MeOH/DCM
(R.sub.f: 0.3); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.78
(s, 1H), 9.47 (t, J=5.7 Hz, 1H), 8.08 (s, 1H), 7.92 (d, J=8.5 Hz,
1H), 7.82 (d, J=1.7 Hz, 1H), 7.62 (d, J=8.6, 1H), 6.44 (s, 1H),
4.76 (d, J=5.6 Hz, 2H), 3.46-3.42 (m, 1H), 1.26 (d, J=6.7 Hz, 6H);
HPLC purity: 99.48%; LCMS Calculated for
C.sub.18H.sub.16F.sub.3N.sub.3O.sub.2S: 395.09; LCMS Observed
(m/z): 395.95 (M+1).sup.+.
Example 4: Synthesis of
N-((2-(4-Cyano-2-fluorophenyl)thiazol-5-yl)methyl)-2'-oxospiro[cyclohexan-
e-1-3'-indoline]-6'-carboxamide (C6-02)
##STR00161##
[0588] Step 1: Synthesis of
6'-Bromospiro[cyclohexane-1,3'-indolin]-2'-one (15)
[0589] To a stirred solution of compound 14 (3 g, 14.15 mmol) in
dry THF (30 mL) at -78.degree. C. under argon atmosphere, LiHMDS
(1M in THF, 42 mL, 42.45 mmol) was added drop wise and stirred at
same temperature for 30 min. To this solution, 1, 5-dibromopentane
(1.91 mL, 14.15 mmol) was added at -78.degree. C. and stirred for
another 30 min. The resulting reaction was stirred at RT for 12 h.
The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was quenched with sat. NH.sub.4Cl
solution and extracted with ethyl acetate (3.times.100 mL). The
combined organic layers were dried over anhydrous sodium sulfate,
filtered and concentrated in vacuo. The crude compound was purified
by combi flash column chromatography to afford compound 15 (2.4 g,
60.6%) as an off white solid. TLC: 50% EtOAc/hexane (R.sub.f: 0.6);
.sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 10.42 (s, 1H), 7.40
(d, J=7.6 Hz, 1H), 7.11 (d, J=7.6 Hz, 1H), 6.98 (s, 1H), 1.85-1.82
(m, 2H), 1.65-1.63 (m, 5H), 1.53-1.48 (m, 3H), LCMS Observed (m/z):
279.95 (M+1).sup.+.
Step 2: Synthesis of Methyl
2'-oxospiro[cyclohexane-1,3'-indoline]-6'-carboxylate (16)
[0590] To a stirred solution of compound 15 (1 g, 3.57 mmol) in
MeOH (50 mL) under argon atmosphere in autoclave, DMF (1 mL) was
added and purged with argon for 30 min followed by the addition of
PdCl.sub.2(dppf) (0.261 g, 0.357 mmol) and DIPEA (6.14 mL, 35.7
mmol) and purged with argon for another 30 min. The resulting
reaction mixture was stirred in autoclave at 100.degree. C. under
CO gas atmosphere (15 kg) for 8 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mixture was
filtered through a pad of celite and filtrate was concentrated in
vacuo to afford the compound 16 (0.41 g, 44%) as an off white
solid. TLC: 50% EtOAc/hexane (R.sub.f: 0.5); .sup.1H NMR (400 MHz,
CDCl.sub.3): .delta. 8.24 (s, 1H), 7.76 (d, J=8.0 Hz, 1H), 7.58 (s,
1H), 7.50 (d, J=7.6 Hz, 1H), 3.03 (s, 3H), 1.99-1.62 (m, 10H); LCMS
Observed (m/z): 260 (M+1).sup.+.
Step 3: Synthesis of
2'-Oxospiro[cyclohexane-1,3'-indoline]-6'-carboxylic acid (C6)
[0591] To a stirred solution of compound 16 (0.4 g, 1.54 mmol) in
THF:H.sub.2O (1:1, 10 mL), LiOH (0.071 g, 3.08 mmol) was added and
stirred at 60.degree. C. for 1 h. The progress of the reaction was
monitored by TLC. After completion, the volatiles were removed in
vacuo. The residue was acidified with KHSO.sub.4 solution to
pH.about.4; the obtained solid was filtered and dried in vacuo to
afford title compound C6 (0.35 g, 93%) as an off-white solid. TLC:
50% EtOAc/hexane (R.sub.f: 0.2); .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 12.86 (bs, 1H), 10.46 (s, 1H), 7.58-7.56 (m,
2H), 7.36 (m, 1H), 1.86-1.74 (m, 4H), 1.68-1.65 (m, 4H), 1.55-1.51
(m, 2H), LCMS Observed (m/z): 246 (M+1).sup.+.
Step 4: Synthesis of
N-((2-(4-Cyano-2-fluorophenyl)thiazol-5-yl)methyl)-2'-oxospiro[cyclohexan-
e-1,3'-indoline]-6'-carboxamide (C6-02)
[0592] The title compound has been synthesized by following the
general procedure as described above (Method A) for amide coupling
by using corresponding amine and acid C6. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 100
mg; Yield: 20 mg (10.6%); Appearance: Off-white solid. TLC: 50%
ethyl acetate/hexane (R.sub.f: 0.3); .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 10.49 (s, 1H), 9.24 (t, J=5.2 Hz, 1H), 8.34
(t, J=7.6 Hz, 1H), 8.10-8.07 (m, 1H), 7.99 (s, 1H), 7.81 (d, J=7.6
Hz, 1H), 7.55-7.45 (m, 2H), 7.30 (s, 1H), 4.71 (d, J=5.6 Hz, 2H),
1.84-1.81 (m, 2H), 1.65-1.62 (m, 5H), 152-1.48 (m, 3H); HPLC
purity: 98.55%; LCMS Calculated for
C.sub.25H.sub.21FN.sub.4O.sub.2S: 460.14; LCMS observed (m/z): 461
(M+1).sup.+.
Example 5: Synthesis of
N-((2-(4-cyano-2-fluorophenyl)thiazol-5-yl)methyl)-1H-indole-6-carboxamid-
e (C13-02)
##STR00162##
[0594] Step 1: Synthesis of
N-((2-(4-cyano-2-fluorophenyl)thiazol-5-yl)methyl)-1H-indole-6-carboxamid-
e (C13-02)
[0595] The title compound has been synthesized by following the
general procedure described above (Method A) for amide coupling by
using corresponding amine and acid 25. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 50
mg; Yield: 10 mg (9%); Appearance: Brown solid; TLC: 10% MeOH/DCM
(R.sub.f: 0.5); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 11.41
(s, 1H), 9.17 (t, J=5.8 Hz, 1H), 8.37 (t, J=7.9 Hz, 1H), 8.11-8.08
(m, 1H), 8.05-7.96 (m, 2H), 7.97-7.64 (m, 1H), 7.62-7.48 (m, 3H),
6.49 (t, J=2.3 Hz, 1H), 4.75 (d, J=5.8 Hz, 2H); HPLC purity:
93.40%; LCMS Calculated for C.sub.20H.sub.13FN.sub.4OS: 376.41;
LCMS observed (m/z): 377.00 (M+1).sup.+.
Example 6: Synthesis of
3-Methyl-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1H-indole-6-carboxam-
ide (C14-01)
##STR00163##
[0596] Step 1: Synthesis of Methyl 3-formyl-1H-indole-6-carboxylate
(27)
[0597] To a stirred solution of compound 26 (2.5 g, 14.28 mmol) in
DMF (30 mL) at 0.degree. C., POCl.sub.3 (5.47 g, 35.7 mmol) was
added and stirred at RT for 30 min. The progress of the reaction
was monitored by TLC. After completion, the reaction mixture was
quenched with ice cold water (100 mL); the obtained solid was
filtered and dried in vacuo. The crude compound was purified by
silica gel column chromatography using 10% EtOAc/hexane to afford
compound 27 (0.78 g, 27%) as an off-white solid. TLC: 30%
EtOAc/Hexane (R.sub.f: 0.4); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 12.42 (s, 1H), 9.98 (s, 1H), 8.50 (s, 1H), 8.21-8.04 (m,
2H), 7.84 (d, J=8.4 Hz, 1H), 3.88 (s, 3H), LCMS Observed (m/z):
203.95 (M+1).sup.+.
Step 2: Synthesis of Methyl 3-methyl-1H-indole-6-carboxylate
(28)
[0598] To a stirred solution of compound 27 (0.78 g, 3.84 mmol) in
dry THF (30 mL) at 0.degree. C. under argon atmosphere, borane in
THF (1M, 15.36 mL, 15.36 mmol) was added drop wise. The resulting
reaction mass was stirred at 50.degree. C. for 1 h. The progress of
the reaction was monitored by TLC. After completion, the reaction
mixture was quenched with sat. NH.sub.4Cl solution (50 mL) and
extracted with ethyl acetate (3.times.50 mL). The combined organic
layers were dried over anhydrous sodium sulfate, filtered and
concentrated in vacuo to obtain the crude. The crude compound was
purified by silica gel column chromatography using 10% EtOAc/hexane
to afford compound 28 (0.36 g, 49.58%) as a brown solid. TLC: 30%
EtOAc/Hexane (R.sub.f: 0.6); .sup.1H-NMR (400 MHz, DMSO-d.sub.6):
.delta. 11.15 (s, 1H), 8.00 (s, 1H), 7.62-7.55 (m, 2H), 7.37 (s,
1H), 3.84 (s, 3H), 3.27 (s, 3H), LCMS Observed (m/z): 189.90
(M+1).sup.+.
Step 3: Synthesis of 3-Methyl-1H-indole-6-carboxylic acid (C14)
[0599] To a stirred solution of compound 28 (0.36 g, 1.90 mmol) in
MeOH (3 mL), aqueous LiOH (0.378 g, 7.62 mmol, in 1 mL water) was
added and stirred at 50.degree. C. for 2 h. The progress of the
reaction was monitored by TLC. After completion, the volatiles were
removed in vacuo. The residue was acidified with 1N HCl to
pH.about.6 and extracted with ethyl acetate (2.times.50 mL). The
combined organic layers were dried over anhydrous sodium sulfate,
filtered and concentrated in vacuo to afford the crude compound C14
(0.28 g, crude) a white solid. TLC: 100% EtOAc (R.sub.f: 0.2). The
crude compound was used as such for the next step without further
purification.
[0600] Step 4: Synthesis of
3-Methyl-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1H-indole-6-carboxam-
ide (C14-01)
[0601] The title compound has been synthesized by following the
general procedure described above (Method A) for amide coupling by
using corresponding amine and acid C14. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 140
mg; Yield: 10 mg (9%); Appearance: off white solid; TLC: 5%
MeOH/DCM (R.sub.f: 0.5); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 11.07 (s, 1H), 9.20 (t, J=5.8 Hz, 1H), 8.06 (s, 1H), 7.91
(s, 1H), 7.55-7.53 (m, 2H), 7.29 (d, J=2.3 Hz, 1H), 4.74 (d, J=5.6
Hz, 2H), 2.27 (s, 3H); HPLC purity: 98.91%; LCMS Calculated for
C.sub.15H.sub.12F.sub.3N.sub.3OS: 339.07; LCMS observed (ink):
340.00 (M+1).sup.+.
Example 7: Synthesis of
N-((2-(4-cyano-2-fluorophenyl)thiazol-5-yl)methyl)-3-((tetrahydro-2H-pyra-
n-4-yl)methyl)-1H-indole-6-carboxamide (C18-02)
##STR00164##
[0602] Step 1 and 2: Synthesis of methyl
3-(tetrahydro-2H-pyran-4-carbonyl)-1H-indole-6-carboxylate (31)
[0603] A mixture of compound 29 (1 g, 7.69 mmoL) and SOCl.sub.2 (10
mL) was refluxed at 90.degree. C. for 1 h. The progress of reaction
was monitored by TLC. After completion, the reaction mixture was
concentrated in vacuo, the residue obtained was dissolved in DCM
(10 mL), AlCl.sub.3 (1.02 g, 7.69 mmol) was added at 0.degree. C.
and stirred for 5 min. To this solution compound 26 (1.13 g, 7.69
mmol) was added portion wise at 0.degree. C. and the resulting
reaction mixture was heated at 70.degree. C. for 2 h. The progress
of reaction was monitored by TLC. After completion, the reaction
mixture was quenched with ice cold water; basified with sat. aq.
NaHCO.sub.3 solution and extracted with DCM (3.times.100 mL). The
combined organic layers were dried over anhydrous sodium sulfate,
filtered and concentrated in vacuo to obtain the crude. The crude
compound was purified by silica gel column chromatography using 15%
EtOAc/hexane to afford the title compound 31 (0.9 g, 41%) as white
semi-solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.4); .sup.1H NMR (400
MHz, DMSO-d.sub.6): .delta. 12.32 (s, 1H), 8.65 (s, 1H), 8.28 (d,
J=8.8 Hz, 1H), 8.09 (s, 1H), 7.79 (d, J=8.8 Hz, 1H), 3.92-3.91 (m,
2H), 3.90 (s, 3H), 3.52-3.44 (m, 2H), 1.76-1.67 (m, 5H). LCMS
Calculated for C.sub.mH.sub.17NO.sub.4: 287.12; LCMS Observed
(m/z): 288 (M+1).sup.+.
Step 3: Synthesis of methyl
3-((tetrahydro-2H-pyran-4-yl)methyl)-1H-indole-6-carboxylate
(32)
[0604] To a stirred solution of compound 31 (0.9 g, 3.13 mmol) in
dry THF (20 mL) at 0.degree. C. under argon atmosphere,
BH.sub.3.THF (1M, 9.4 mL, 9.40 mmol) was added drop wise. The
resulting reaction mass was stirred at 50.degree. C. for 2 h. The
progress of the reaction was monitored by TLC. After completion,
the reaction mixture was quenched with sat. NH.sub.4Cl solution (50
mL) and extracted with ethyl acetate (3.times.50 mL). The combined
organic layers were dried over anhydrous sodium sulfate, filtered
and concentrated in vacuo to obtain the crude. The crude compound
was purified by silica gel column chromatography using 10%
EtOAc/hexane to afford the title compound 32 (0.42 g, 49%) as light
yellow solid. TLC: 30% EtOAc/hexanes (R.sub.f: 0.6); .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 11.34 (5, 1H), 8.03 (s, 1H),
7.59-7.54 (m, 2H), 7.38 (s, 1H), 3.83-3.78 (m, 5H), 3.24-3.21 (m,
2H), 2.64-2.62 (m, 2H), 1.80-1.74 (m, 1H), 2.15-1.41 (m, 2H),
1.30-1.15 (m, 2H); LCMS Calculated for C.sub.16H.sub.19NO.sub.3:
273.14; LCMS observed (m/z): 274 (M+1).sup.+.
Step 4: Synthesis of
3-((tetrahydro-2H-pyran-4-yl)methyl)-1H-indole-6-carboxylic acid
(C18)
[0605] To a stirred solution of compound 32 (0.2 g, 0.732 mmol) in
MeOH (5 mL), aqueous NaOH (0.147 g, 3.66 mmol in 1 mL water) was
added and stirred at RT for 12 h. The progress of the reaction was
monitored by TLC. After completion, the volatiles were removed in
vacuo. The crude was acidified with 1N HCl to pH.about.6; the
obtained solid was filtered and dried in vacuo to afford title
compound C18 (0148 g, 77.8%) as an off white solid TLC: 1% MeOH/DCM
(R.sub.f: 0.2); The crude compound was used as such for the next
step without further purification. .sup.1H NMR (400 MHz,
DMSO-d.sub.6): .delta. 11.12 (s, 1H), 7.99 (s, 1H), 7.60-7.55 (m,
2H), 7.34 (s, 1H), 3.82-3.78 (m, 2H), 3.24-3.16 (m, 2H), 2.64-2.62
(m, 2H), 1.80-1.75 (m, 1H), 1.55-1.51 (m, 2H), 1.27-1.17 (m, 2H);
LCMS Calculated for C.sub.15H.sub.17NO.sub.3: 259.12; LCMS observed
(m/z): 260.10 (M+1).sup.+.
Step 5: Synthesis of
N-((2-(4-cyano-2-fluorophenyl)thiazol-5-yl)methyl)-3-((tetrahydro-2H-pyra-
n-4-yl)methyl)-1H-indole-6-carboxamide (C18-02)
[0606] The title compound has been synthesized by following the
general procedure described above (Method A) for amide coupling by
using amine compound 6 and acid core C18. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 70
mg; Yield: 0.046 g (36%); Appearance: Off-white solid; TLC: 1%
MeOH/DCM (R.sub.f: 0.6); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 11.14 (s, 1H), 9.14 (t, J=5.8 Hz, 1H), 8.36 (t, J=7.9 Hz,
1H), 8.09 (d, J=10.4 Hz, 1H), 8.01 (s, 1H), 7.92 (s, 1H), 7.82 (d,
J=8.0 Hz, 1H), 7.60-7.48 (m, 2H), 7.29 (s, 1H), 4.75 (d, J=6.0 Hz,
2H), 3.84-3.75 (m, 2H), 3.30-3.14 (m, 2H), 2.63 (d, J=7.0 Hz, 2H),
1.78-1.75 (m, 1H), 1.57-1.49 (m, 2H), 1.26-1.13 (m, 2H); HPLC
purity: 95.57%; LCMS Calculated for
C.sub.26H.sub.23FN.sub.4O.sub.2S: 474.15; LCMS Observed (in/z):
475.20 (M+1).sup.+.
Example 8: Synthesis of
3-Cyclohexyl-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1H-indole-6-carb-
oxamide (C19-01)
##STR00165##
[0608] Step 1: Synthesis of
3-(Cyclohex-1-en-1-yl)-1H-indole-6-carboxylic acid (34) To a
stirred solution of compound 26 (2 g, 11.4 mmol) and cyclohexanone
(3.36 g, 34.2 mmol) in MeOH (15 mL), aqueous KOH (1.92 g, 34.2
mmol, dissolved in 13 mL water) was added. The resulting reaction
mixture was stirred at 75.degree. C. for 18 h. The progress of the
reaction was monitored by LCMS. After completion, the reaction
mixture was concentrated in vacuo. The residue was diluted with
water, acidified with acetic acid pH.about.6; the obtained solid
was filtered; washed with water and dried in vacuo to afford the
crude. The crude compound was triturated with IPA to afford
compound 34 (1.6 g, 58%) as light brown solid. .sup.1H-NMR (400
MHz, DMSO-d.sub.6): .delta. 11.33 (s, 1H), 7.97 (s, 1H), 7.75 (d,
J=8.0 Hz, 1H), 7.61 (d, J=8.4 Hz, 1H), 7.47 (s, 1H), 6.19 (s, 1H),
2.42-2.39 (m, 2H), 2.22-2.20 (m, 2H), 1.76-1.72 (m, 4H). LCMS
observed (m/z): 242 (M+1).sup.+.
Step 2: Synthesis of 3-Cyclohexyl-1H-indole-6-carboxylic acid
(C19)
[0609] To a stirred solution of compound 34 (2 g, 8.29 mmol) in
EtOH (20 mL) under argon atmosphere, 10% Pd/C (200 mg) and ammonium
formate (5.2 g, 82.9 mmol) was added. The reaction mass was stirred
at 50.degree. C. for 4 h. The progress of the reaction was
monitored by TLC. After completion, the reaction mass cooled to RT,
quenched with 1N HCl and ethyl acetate and filtered through a pad
of celite. The organic layer was separated, dried over anhydrous
sodium sulfate and concentrated in vacuo to afford the crude. The
crude compound was triturated with DCM to afford compound C19 (1 g,
50%) as a light-brown solid. .sup.1H-NMR (400 MHz, DMSO-d.sub.6):
.delta. 12.42 (s, 1H), 11.13 (s, 1H), 7.98 (s, 1H), 7.62-7.57 (m,
2H), 7.30 (s, 1H), 2.80-2.76 (m, 1H), 1.99-1.97 (m, 2H), 1.88-1.71
(m, 4H), 1.50-1.38 (m, 4H), LCMS Observed (in/z): 244.05
(M+1).sup.+.
Step 3: Synthesis of
3-Cyclohexyl-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1H-indole-6-carb-
oxamide (C19-01)
[0610] The title compound has been synthesized by following the
general procedure described above (Method A) for amide coupling by
using corresponding amine and acid C19. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 100
mg; Yield: 25 mg (15%); Appearance: White solid; TLC: 50%
EtOAc/hexanes (R.sub.f: 0.5); .sup.1H NMR (400 MHz, DMSO-d.sub.6):
.delta. 11.09 (s, 1H), 9.19 (t, J=5.9 Hz, 1H), 8.05 (s, 1H), 7.90
(s, 1H), 7.58 (d, J=8.3 Hz, 1H), 7.49 (d, J=8.5 Hz, 1H), 7.24 (d,
J=2.5 Hz, 1H), 4.75-4.69 (m, 2H), 2.78-2.76 (m, 1H), 1.97-1.95 (m,
2H), 1.82-1.67 (m, 3H), 1.50-1.34 (m, 4H), 1.31-1.21 (m, 1H); HPLC
purity: 96.74%; LCMS Calculated for
C.sub.20H.sub.20F.sub.3N.sub.3OS: 407.13; LCMS Observed (m/z): 408
(M+1).sup.+.
Example 9: Synthesis of
3-Cyclohexyl-2-methyl-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1H-indo-
le-6-carboxamide (C20-01)
##STR00166## ##STR00167##
[0611] Step 1: Synthesis of Methyl
3-cyclohexyl-1H-indole-6-carboxylate (35)
[0612] To a stirred solution of compound C19 (0.5 g, 2.07 mmol) in
DMF (6 mL), K.sub.2CO.sub.3 (0.395 g, 2.85 mmol) and MeI (0.32 g,
2.26 mmol) were added. The resulting reaction mixture was stirred
at RT for 4 h. The progress of the reaction was monitored by TLC.
After completion, the reaction mixture was diluted with ice cold
water (50 mL) and extracted with DCM (3.times.50 mL). The combined
organic layers were dried over anhydrous sodium sulfate, filtered
and concentrated in vacuo to afford the crude compound 35 (0.49 g,
92.6%) as a pale-yellow oil. The crude compound was used as such
for the next step without further purification. TLC: 50%
EtOAc/hexane (R.sub.f: 0.6), .sup.1H-NMR (400 MHz, CDCl.sub.3):
.delta. 8.17 (br.s, 1H), 8.12 (s, 1H), 7.79 (d, J=8.4 Hz, 1H), 7.68
(d, J=8.4 Hz, 1H), 7.13 (s, 1H), 3.90 (s, 3H), 2.86-2.84 (m, 1H),
2.12-2.06 (m, 2H), 1.86-1.79 (m, 2H), 1.58-1.43 (m, 4H), 1.38-1.27
(m, 2H); LCMS Observed (m/z): 258 (M+1).sup.+.
Step 2: Synthesis of Methyl
2-bromo-3-cyclohexyl-1H-indole-6-carboxylate (36)
[0613] To a stirred solution of compound 35 (0.49 g, 1.92 mmol) in
CCl.sub.4 (5 mL) at 0.degree. C., NBS (0.41 g, 2.30 mmol) was added
portion wise. The resulting reaction mixture was stirred at RT for
12 h. The progress of the reaction was monitored by TLC. After
completion, the reaction mixture was quenched with 10%
Na.sub.2S.sub.2O.sub.4 solution (50 mL) and extracted with DCM
(3.times.50 mL). The combined organic layers were dried over
anhydrous sodium sulfate, filtered and concentrated in vacuo to
afford the crude compound 36 (0.32 g, 50%) as a white solid. The
crude compound was used as such for the next step without further
purification. TLC: 50% EtOAc/hexane (R.sub.f: 0.6); .sup.1H NMR
(400 MHz, DMSO-d.sub.6): .delta. 12.03 (s, 1H), 7.88 (s, 1H),
7.76-7.73 (m, 1H), 7.60-7.58 (m, 1H), 3.83 (s, 3H), 2.81-2.75 (m,
1H), 1.98-1.65 (m, 10H).
Step 3: Synthesis of Methyl
3-cyclohexyl-2-methyl-1H-indole-6-carboxylate (37)
[0614] To a stirred solution of compound 36 (100 mg, 0.299 mmol) in
1,4 dioxane (3 mL) under argon atmosphere, (CH.sub.3).sub.2Zn (0.5
mL, 0.598 mmol) and Pd(dppf)Cl.sub.2 (7 mg, 0.898 mmol) were added
and refluxed for 4 h. The progress of the reaction was monitored by
TLC. After completion, reaction mixture was quenched with MeOH (1
mL) and ethyl acetate (5 mL), washed with 1N HCl, dried over
anhydrous sodium sulfate and concentrated in vacuo to afford the
crude. The crude compound was purified by comb flash column
chromatography using 10% EtOAc/hexane to afford the title compound
37 (68 mg, 85%) as a light yellow solid. TLC: 10% EtOAc/hexanes
(R.sub.f: 0.4); .sup.1H-NMR (400 MHz, DMSO-d.sub.6): .delta. 11.10
(s, 1H), 7.86 (s, 1H), 7.62 (d, J=8.4 Hz, 1H), 7.52 (d, J=8.4 Hz,
1H), 3.82 (s, 3H), 2.73-2.50 (m, 1H), 2.36 (s, 3H), 1.86-1.70 (m,
7H), 1.43-1.31 (m, 3H), LCMS Observed (m/z): 272 (M+1).sup.+.
Step 4: Synthesis of 3-Cyclohexyl-2-methyl-1H-indole-6-carboxylic
acid (C20)
[0615] To a stirred solution of compound 37 (0.7 g, 2.58 mmol) in
THF:H.sub.2O (1:1, 10 mL), LiOH (0.216 g, 5.16 mmol) was added and
stirred at 50.degree. C. for 12 h. The progress of the reaction was
monitored by TLC. After completion, the volatiles were removed in
vacuo. The crude was acidified with 1 N HCl to pH.about.2; the
obtained solid was filtered and dried in vacuo to afford title
compound C20 (0.56 g, 84%) as an off-white solid. The crude
compound was used as such for the next step without further
purification. TLC: 50% EtOAc/hexane (R.sub.f: 0.1); .sup.1H-NMR
(400 MHz, DMSO-d.sub.6): .delta. 12.35 (s, 1H), 11.03 (s, 1H), 7.85
(s, 1H), 7.59 (d, J=8.4 Hz, 1H), 7.50 (d, J=8.4 Hz, 1H), 2.75-2.69
(m, 1H), 2.37 (s, 3H), 1.86-1.67 (m, 7H), 1.43-1.30 (m, 3H), LCMS
Observed (m/z): 258 (M+1).sup.+.
Step 5: Synthesis of
3-Cyclohexyl-2-methyl-N-((2-(trifluoromethyl)thiazol-5-yl)methyl)-1H-indo-
le-6-carboxamide (C20-01)
[0616] The title compound has been synthesized by following the
general procedure described above (Method A) for amide coupling by
using corresponding amine and acid DBTP-C20. The crude compound was
purified by silica gel column chromatography. Reaction Scale: 100
mg; Yield: 30 mg (18%); Appearance: White solid; TLC: 100% EtOAc
(R.sub.f: 0.5); .sup.1H NMR (400 MHz, DMSO-d.sub.6): .delta. 10.97
(s, 1H), 9.13 (t, J=5.9 Hz, 1H), 8.05 (s, 1H), 7.80 (s, 1H), 7.58
(d, J=8.4 Hz, 1H), 7.45 (d, J=8.4 Hz, 1H), 4.72 (d, J=5.6 Hz, 2H),
2.75-2.69 (m, 1H), 2.36 (s, 3H), 1.86-1.67 (m, 7H), 1.44-1.32 (m,
3H); HPLC purity: 97.54%; LCMS Calculated for
C.sub.21H.sub.22F.sub.3N.sub.3OS: 421.14; LCMS Observed (m/z):
422.05 (M+1).sup.+.
Assay Measuring Activity of Compounds on Viral Production in and on
Viability of AD38 Cells
[0617] AD38 cells grown in a 175 cm flask with "Growth Medium"
(DMEM/F12 (1:1) (cat #SH30023.01, Hyclone, 1.times. Pen/step (cat
#: 30-002-CL, Mediatech, Inc), 10% FBS (cat #: 101, Tissue Culture
Biologics), 250 .mu.g/mL G418 (cat #: 30-234-CR, Mediatech, Inc), 1
.mu.g/mL Tetracycline (cat #: T3325, Teknova)) were detached with
0.25% trypsin. Tetracycline-free "treatment medium" (15 mL DMEM/F12
(1:1) (cat #SH30023.01, Hyclone, 1.times. Pen/step (cat #:
30-002-CL, Mediatech, Inc), with 2% FBS, Tet-system approved (cat
#: 631106, Clontech) were then added to mix and spun at 1300 rpm
for 5 min. Pelleted cells were then re-suspended/washed with 50 mL
of 1.times.PBS 2 times and 10 mL Treatment Medium one time. AD38
cells were then re-suspended with 10 mL of Treatment Medium and
counted. Wells of a collagen coated 96-well NUNC microtiter plate
were seeded at 50,000/well in 180 .mu.L of Treatment Medium, and 20
.mu.L of in treatment media with either 10% DMSO (Control) or a
10.times. solution of compound in 10% DMSO was added. Plates were
incubated for 6 days at 37.degree. C.
[0618] Viral load production was assayed by quantitative PCR of the
core sequence. Briefly, 5 .mu.L of clarified supernatant was added
to a PCR reaction mixture that contained forward primers HBV-f
5'-CTGTGCCTTGGGTGGCTTT-3', Reverse primers HBV-r
5'-AAGGAAAGAAGTCAGAAGGCAAAA-3' and Fluorescent TaqMan.TM. Probes
HBV-probe 5'-FAM/AGCTCCAAA/ZEN/TTCTTTATAAGGGTCGATGTCCATG/3IABkFQ-3'
in Quanta Biosciences PerfeCTa.RTM. qPCR Toughmix.RTM., and was
subsequently on an Applied Biosystems VIIA7 in a final volume of 20
.mu.L. The PCR mixture was incubated at 45.degree. C. for 5
minutes, then 95.degree. C. for 10 min, followed by 40 cycles of 10
seconds at 95.degree. C. and 20 seconds at 60.degree. C. Viral load
was quantitated against known standards by using ViiA.TM. 7
Software. Viral load in the supernatant from wells with treated
cells were compared against viral load in supernatant from DMSO
control wells 3 per plate).
[0619] At the end of compound treatment period cell viability was
assessed using a Promega CellTiter-Glo protocol. All supernatant
was removed the previously treated 96-well microtiter plate, and 50
.mu.L Tetracycline-free treatment medium (DMEM/F12 (1:1), 1.times.
Pen/step (cat #: 30-002-CL, Mediatech, Inc), with 2% FBS,
Tet-system approved (cat #: 631106, Clontech), and 1% DMSO was
added back to each well. Another 50 .mu.L of CellTiter-Glo reagent
solution (Promega, G7573) was then added at room temperature and
the contents mixed for 2 minutes on an orbital shaker to induce
cell lysis. This was followed by incubation at room temperature for
10 minutes to stabilize the luminescent signal. The luminescence
was recorded for 0.2 seconds per well on a Tecan multimode
platereader (Infinite M1000 pro). The luminescent signal from each
well was normalized against that of untreated (DMSO) control wells.
All results in Tables 3-6 were reported with percent viability
(with controls being 100%).
TABLE-US-00003 TABLE 3 Compounds of Group 1 and Biological activity
AD38 Viral Load AD38 Viability (%) (VL with Normalized Result
cmpd/VL in DMSO (cmpd/DMSO %) at Compound No. control) at 10 .mu.M
10 .mu.M 926-A 3.6 98 884 15.1 94 927 4.7 92 818 1.3 84 1034 67.7
106 1035-A 57.8 102 924 0.7 95 979 0.5 59 980-A 1.2 97 980-B 0.9
93
TABLE-US-00004 TABLE 4 Compounds of Group 2 and Biological activity
AD38 Viral Load (%) AD38 Viability (VL with cmpd/VL in Normalized
Result DMSO control) at 10 (cmpd/DMSO %) at 10 Compound No. .mu.M
.mu.M 576 11.7 98 578 3.0 100 762 45.6 102 1020 6.1 97 1021 0.3 96
C12-01 15.5 97 C1-01 27.9 106 C1-02 20.4 103 C10-01 12.2 101 C10-02
4.0 95 C12-02 21.4 99 C21-01 45.9 39 C21-02 48.9 15 C10-04 1.8 92
C10-05 11.3 90 C22-02 0.9 85 C22-03 0.5 90 C25-02 0.5 95 C25-04 5.4
98 C22-01 7.1 92 C24-02 43.0 100 C24-04 7.7 104 C46-01 8.5 101
C46-02 0.9 102 C25-04-Isomer I 8.3 104 C25-04-Isomer II 1.7 99
C43-01 64.4 97 C25-02-Isomer I 3.0 108 025-02-Isomer II 0.6 111
TABLE-US-00005 TABLE 5 Compounds of Group 3 and Biological activity
AD38 Viral Load (%) AD38 Viability (VL with cmpd/VL in Normalized
Result DMSO control) at 10 (cmpd/DMSO %) at 10 Compound No. .mu.M
.mu.M 1153 2.1 92 1155 0.6 104
TABLE-US-00006 TABLE 6 Compounds of Goup 4 and Biological activity
AD38 Viral AD38 Viability Load Normalized Result (CpAM/DMSO
(CPAM/DMSO Compound %) at 10 .mu.M %) at 10 .mu.M C2-01 69.7 113
C3-01 44.6 105 C14-01 63.0 113 C6-02 41.2 91 C13-02 16.1 105 C18-02
62.9 106 C19-01 30.8 79 C20-01 45.9 47
INCORPORATION BY REFERENCE
[0620] All publications and patents mentioned herein, including
those items listed below, are hereby incorporated by reference in
their entirety for all purposes as if each individual publication
or patent was specifically and individually incorporated by
reference. In case of conflict, the present application, including
any definitions herein, will control.
EQUIVALENTS
[0621] While specific embodiments of the subject invention have
been discussed, the above specification is illustrative and not
restrictive. Many variations of the invention will become apparent
to those skilled in the art upon review of this specification. The
full scope of the invention should be determined by reference to
the claims, along with their full scope of equivalents, and the
specification, along with such variations.
[0622] Unless otherwise indicated, all numbers expressing
quantities of ingredients, reaction conditions, and so forth used
in the specification and claims are to be understood as being
modified in all instances by the term "about." Accordingly, unless
indicated to the contrary, the numerical parameters set forth in
this specification and attached claims are approximations that may
vary depending upon the desired properties sought to be obtained by
the present invention.
* * * * *