U.S. patent application number 17/496742 was filed with the patent office on 2022-01-20 for methods of generating nanoarrays and microarrays.
The applicant listed for this patent is NAUTILUS BIOTECHNOLOGY, INC.. Invention is credited to Rachel GALIMIDI, Dmitriy GREMYACHINSKIY, Parag MALLICK, Sujal M. PATEL.
Application Number | 20220017567 17/496742 |
Document ID | / |
Family ID | 1000005880309 |
Filed Date | 2022-01-20 |
United States Patent
Application |
20220017567 |
Kind Code |
A1 |
GREMYACHINSKIY; Dmitriy ; et
al. |
January 20, 2022 |
METHODS OF GENERATING NANOARRAYS AND MICROARRAYS
Abstract
The methods described herein provide a means of producing an
array of spatially separated proteins. The method relies on
covalently attaching each protein of the plurality of proteins to a
structured nucleic acid particle (SNAP), and attaching the SNAPs to
a solid support.
Inventors: |
GREMYACHINSKIY; Dmitriy;
(Sunnyvale, CA) ; GALIMIDI; Rachel; (Belmont,
CA) ; MALLICK; Parag; (San Mateo, CA) ; PATEL;
Sujal M.; (Seattle, WA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
NAUTILUS BIOTECHNOLOGY, INC. |
Seattle |
WA |
US |
|
|
Family ID: |
1000005880309 |
Appl. No.: |
17/496742 |
Filed: |
October 7, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
17062405 |
Oct 2, 2020 |
|
|
|
17496742 |
|
|
|
|
PCT/US2019/025909 |
Apr 4, 2019 |
|
|
|
17062405 |
|
|
|
|
62652849 |
Apr 4, 2018 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C07K 1/047 20130101;
C12Q 1/6837 20130101; G01N 33/54353 20130101 |
International
Class: |
C07K 1/04 20060101
C07K001/04; C12Q 1/6837 20060101 C12Q001/6837; G01N 33/543 20060101
G01N033/543 |
Claims
1. A method of producing an array of different proteins,
comprising: (a) attaching a plurality of structured nucleic acid
particles to a plurality of different proteins, such that each of
the plurality of structured nucleic acid particles is attached to
only one protein of the plurality of different proteins; and (b)
attaching the plurality of structured nucleic acid particles to an
array of attachment sites on a solid support, such that each of the
array of attachment sites is attached, via a structured nucleic
acid particle, to only one protein of the plurality of different
proteins, thereby producing the array of different proteins.
2. The method of claim 1, wherein the plurality of structured
nucleic acid particles comprises nucleic acid origami.
3. The method of claim 2, wherein the nucleic acid origami
comprises a long nucleic acid strand that is hybridized to a
plurality of short nucleic acid strands.
4. The method of claim 3, wherein the long nucleic acid strand is
hybridized to at least 10 short nucleic acid strands.
5. The method of claim 3, wherein the long nucleic acid strand
comprises at least 10 engineered folds.
6. The method of claim 3, wherein the long nucleic acid strand
comprises at least 100 nucleotides.
7. The method of claim 1, wherein the structured nucleic acid
particle has a diameter between 50 nanometers and 100
micrometers.
8. The method of claim 12, wherein the structured nucleic acid
particle has a diameter of at least 75 nanometers.
9. The method of claim 1, wherein the proteins in the array of
different proteins are separated by less than 1 micrometers.
10. The method of claim 1, further comprising detecting proteins in
the array of different proteins.
11. The method of claim 1, wherein the plurality of structured
nucleic acid particles is attached to the array of attachment sites
through electrostatic interactions.
12. The method of claim 1, wherein the plurality of structured
nucleic acid particles is covalently attached to the array of
attachment sites.
13. The method of claim 1, wherein the plurality of structured
nucleic acid particles occludes binding of more than one protein to
individual attachment sites of the array of attachment sites.
14. The method of claim 1, wherein (a) comprises covalently
attaching the plurality of structured nucleic acid particles to the
plurality of different proteins, such that each of the plurality of
structured nucleic acid particles is covalently attached to only
one protein of the plurality of different proteins.
15. The method of claim 1, wherein the array of different proteins
comprises 1000.times.1000 of the plurality of structured nucleic
acid particles.
16. The method of claim 1, wherein the plurality of structured
nucleic acid particles comprises self-hybridized regions.
17. The method of claim 1, wherein the plurality of structured
nucleic acid particles comprises circular plasmids comprising a
length of at least 5 kilobases.
Description
CROSS-REFERENCE
[0001] This application is a continuation of application Ser. No.
17/062,405, filed Oct. 2, 2020, which is a continuation of
International Application No. PCT/US2019/025909, filed Apr. 4,
2019, which claims the benefit of U.S. Provisional Application No.
62/652,849, filed Apr. 4, 2018, each of which is incorporated by
reference herein in its entirety.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which
has been submitted electronically in ASCII format and is hereby
incorporated by reference in its entirety. Said ASCII copy, created
on Oct. 7, 2021, is named 51612-706_302_SL.txt and is 1,461 bytes
in size.
BACKGROUND OF THE INVENTION
[0003] Microarrays and nanoarrays may be used for assessing
biological and chemical entities. It may be beneficial to tailor
the design of nanoarrays and microarray to particular
assessments.
SUMMARY OF THE INVENTION
[0004] The present disclosure provides methods and systems for
separating biological and chemical entities.
[0005] An aspect of the invention provides a composition comprising
a structured nucleic acid particle (SNAP) covalently attached to a
protein. In some cases, said SNAP is attached to a solid support.
In some cases, said SNAP is covalently attached to a solid support.
In some cases, said SNAP is non-covalently attached to a solid
support.
[0006] An aspect of the invention provides a composition comprising
a SNAP covalently attached to a biomolecule. In some cases, said
SNAP is attached to a solid support. In some cases, said SNAP is
covalently attached to a solid support. In some cases, said SNAP is
non-covalently attached to a solid support.
[0007] An aspect of the invention provides a composition comprising
a solid support attached to a plurality of structured nucleic acid
particles (SNAPs), wherein each of said plurality of SNAPs is
attached to a biomolecule. In some cases, the plurality of SNAPs
are arranged in an array.
[0008] An aspect of the invention provides a method of attaching a
single protein to an attachment site on a solid support, wherein
the attachment site is larger than the protein; the method
comprising covalently attaching the protein to a SNAP; wherein the
diameter of said SNAP is at least as large as the diameter of the
attachment site; and attaching the SNAP to the attachment site. In
some cases, each of said plurality of proteins is attached to an
attachment site on said solid support; such that each attachment
site is attached to a single protein.
[0009] An aspect of the invention provides a biomolecule array
comprising a plurality of biomolecules attached to a solid support;
wherein each biomolecule of the plurality of biomolecules is
covalently attached to a linker and the linker is attached to the
solid support; and wherein each linker is attached to only one
biomolecule of the plurality of biomolecules and each linker has a
diameter of at least 50 nm.
[0010] An aspect of the invention provides a method of producing an
array of spatially separated proteins from a plurality of proteins,
the method comprising covalently attaching each protein of the
plurality of proteins to an end of a nucleic acid molecule
comprising a SNAP, and attaching the SNAPs to a solid support,
thereby producing an array of spatially separated proteins.
[0011] An aspect of the invention provides a composition comprising
a protein, a SNAP and a solid support; wherein the protein is
covalently bound to the SNAP, and wherein the protein does not
contact the solid support.
[0012] An aspect of the invention provides a method of producing an
array of spatially separated biological or chemical entities, the
method comprising: obtaining a solid support with attachment sites,
obtaining a sample comprising a plurality of biological or chemical
entities, obtaining seeds, each with a functional group, covalently
attaching each biological or chemical entity of the plurality of
biological or chemical entities to a single seed via the functional
group, growing each attached seed to a SNAP of desired size,
attaching the SNAPs to the attachment sites of the array, thereby
producing an array of spatially separated biological or chemical
entities.
[0013] In some cases, a solid support is a glass, silica, plastic,
silicon, gold, metal, chromium, titanium, titanium oxide, tin, or
tin oxide support. In some cases, a solid support is optically
opaque. In some cases, the solid support is optically clear. In
some cases, said solid support is modified to have a positive
charge. In some cases, said solid support is modified to have a
negative charge. In some cases, said solid support is modified to
have functional groups which may bind the SNAPs. In some cases,
said solid support comprises attachment sites which are modified to
be different to surrounding surfaces. In some cases, said solid
support comprises an array of attachment sites. In some cases, each
attachment site is at least 70 nm from each other attachment site.
In some cases, each attachment site is at least 25 nm from each
other attachment site. In some cases, the distance between the
edges of any two attachment sites is greater than the radius of the
SNAP used. In some cases, the distance between the edges of any two
attachment sites is greater than the diameter of the SNAP used.
[0014] In some cases, the molecules are proteins. In some cases,
the seeds are oligonucleotides.
[0015] In some cases, the oligonucleotides are modified on the 3'
end with a functional group. In some cases, the oligonucleotides
are modified on the 5' end with a functional group. In some cases,
the functional group is selected from the group consisting of
amines, thiols, carboxylic acids, triple bonds, double bonds,
epoxides, alkynes, alkenes, cycloalkynes, azides, cyclo-octynes,
cycloalkynes, norbornenes, tetrazines, cyclloctanes, epoxides, and
hydroxyls. In some cases, the oligonucleotides are modified to
comprise a photocleaveable bond. In some cases, the SNAPs are
formed by rolling circle amplification. In some cases, the SNAPs
are dendrimers. In some cases, the dendrimers are positively
charged and the attachment sites on the array are negatively
charged. In some cases, the dendrimers are negatively charged and
the attachment sites on the array are positively charged. In some
cases, the SNAPs have a diameter of approximately 100 nm. In some
cases, the SNAPs have a diameter of approximately 300 nm. In some
cases the SNAPs have a diameter of between about 10 nm and 500 m.
In some cases, the SNAPs have a diameter of between about 10 nm and
50 m. In some cases, the SNAPs have a diameter of between about 10
nm and 5 m. In some cases, the SNAPs have a diameter of between
about 100 nm and 500 nm. In some cases, SNAPs adhere to the solid
support through an electrostatic interaction.
[0016] An aspect of the invention provides a method of achieving
spatial separation of molecules, the method comprising: obtaining a
plurality of molecules, obtaining seeds, each with a functional
group, covalently attaching each of the plurality of molecules to a
single seed via the functional group, growing each attached seed to
a SNAP of desired size, attaching the SNAPs to a solid support,
thereby achieving spatial separation of single molecules.
[0017] An aspect of the invention provides an array of single
molecules, each single molecule being attached to a SNAP of desired
size, the SNAP being attached to the array via an attachment
site.
[0018] An aspect of the invention provides a kit for producing an
array of single molecules, the kit comprising: an array with
attachment sites, seeds, each seed having a single attachment site,
and reagents to grow the seeds into SNAPs.
[0019] An aspect of the invention provides a composition,
comprising: a solid support; and a polymer-based molecule attached
directly to the solid support, wherein the polymer-based molecule
comprises a protein moiety that is oriented substantially opposite
of the solid support, and wherein the protein moiety is accessible
to affinity reagents.
[0020] An aspect of the invention provides a method of isolating
biological or chemical entities on an array, the method comprising:
generating a plurality of SNAPs; coupling a single biological or
chemical entity to each of the plurality of SNAPs; attaching the
plurality of SNAPs to an array, wherein the biological or chemical
entity is substantially opposite the array, thereby isolating each
biological or chemical entity of each of the plurality of SNAPs by
a distance that is based on the size of each SNAP of the plurality
of SNAPs.
[0021] An aspect of the invention provides a method of separating
molecules, the method comprising converting each molecule into a
larger charged molecule.
[0022] In some cases, converting each molecule into a larger
charged molecule comprises conjugating the molecule to a biopolymer
which can be grown to a desired size.
[0023] In some cases, converting each molecule into a larger
charged molecule comprises converting each molecule into a molecule
10 times larger.
[0024] In some cases, converting each molecule into a larger
charged molecule comprises conjugating each molecule to a larger
charged molecule.
[0025] An aspect of the invention provides a method of producing an
array of spatially separated biological or chemical entities, the
method comprising: obtaining a solid support with attachment sites,
obtaining a sample comprising a plurality of biological or chemical
entities, obtaining SNAPs, each with a functional group, covalently
attaching each biological or chemical entity of the plurality of
biological or chemical entities to a single SNAP, attaching the
SNAPs to the attachment sites of the array, thereby producing an
array of spatially separated biological or chemical entities.
[0026] In some cases, a SNAP is a rolling circle amplification
product. In some cases, a SNAP is a plasmid. In some cases, a SNAP
is a DNA origami molecule. In some cases, a SNAP is a nucleic acid
cluster.
INCORPORATION BY REFERENCE
[0027] All publications, patents, and patent applications mentioned
in this specification are herein incorporated by reference to the
same extent as if each individual publication, patent, or patent
application was specifically and individually indicated to be
incorporated by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] The novel features of the invention are set forth with
particularity in the appended claims. A better understanding of the
features and advantages of the present invention will be obtained
by reference to the following detailed description that sets forth
illustrative embodiments, in which the principles of the invention
are utilized, and the accompanying drawings of which:
[0029] FIG. 1A illustrates an example method of attaching proteins
to a substrate via a structured nucleic acid particle (SNAP),
wherein a protein is covalently attached to an oligonucleotide
primer which is then annealed to a circular DNA template which
contains regions of internal complementarity, rolling circle DNA
amplification of the primer on the template results in a DNA
molecule with regions of internal hybridization resulting in
formation of a DNA cluster (an example of a SNAP), since the SNAP
is negatively charged it can attach to a positively charged
attachment site on a solid support.
[0030] FIG. 1B illustrates an alternative method of attaching
proteins to a substrate, wherein the SNAP is formed initially and
then attached to a protein.
[0031] FIG. 1C illustrates an alternative method of attaching
proteins to a substrate, wherein the SNAP is formed initially and
covalently attached to a crosslinker that is then attached to a
protein.
[0032] FIG. 1D illustrates an alternative method of attaching
proteins to a substrate, wherein SNAPs are deposited onto a surface
and proteins with chemical moieties react with the chemical moiety
of a SNAP to attach the protein to the SNAP.
[0033] FIG. 2 illustrates a method for producing a solid support
with attachment sites arrayed at desired intervals.
[0034] FIG. 3A illustrates absorbance spectra of SNAPs produced in
Example 1.
[0035] FIG. 3B illustrates fluorescence intensity of the SNAPs
imaged as a dot blot.
[0036] FIG. 4 illustrates co-localization of the SNAPs and attached
Deep Red 200 nm beads in microscopy images of the SNAPs produced in
Example 1. The Sybr Gold used to visualize the DNA fluoresces at
488 nm, and the linked Deep Red bead fluoresces at 647 nm, regions
of the images are blown up to show details, and arrow heads point
to examples of co-localization.
[0037] FIG. 5 illustrates the radii of particles in a sample
comprising SNAPs before and after anion exchange purification.
[0038] FIG. 6 illustrates the intensities detected in fractions
collected during the anion exchange purification of samples
comprising SNAPs.
[0039] FIG. 7 illustrates the absorption spectra at 260 nm traces
of different batches of SNAPs.
[0040] FIG. 8 illustrates the co-localization of small SNAPs on a
chip.
[0041] FIG. 9 illustrates the absence of co-localization of large
SNAPs on a chip.
[0042] FIG. 10 illustrates the counts and number of features
occupied when a titration of SNAPs is applied to a chip.
[0043] FIG. 11 illustrates the brightness of a batch of SNAPs.
[0044] FIG. 12 illustrates the measurement of the concentration of
SNAPs using an OPA assay.
[0045] FIG. 13 illustrates fluorescent images at 488 nm and 568 nm
chips having SNAPs pre- and post-conjugation with Azide-AlexaFluor
568.
[0046] FIG. 14 illustrates quantification of the intensity from
fluorescent images at 488 nm and 575 nm chips having SNAPs pre- and
post-conjugation with Azide-AlexaFluor 568.
[0047] FIG. 15 illustrates fluorescent images at 488 nm of chips
having SNAPs, pre- and post-incubation with Azide-AlexaFluor 568 in
excess.
[0048] FIG. 16 illustrates fluorescent images at 568 nm of chips
having SNAPs, pre- and post-incubation with Azide-AlexaFluor 568 in
excess.
[0049] FIG. 17 illustrates the fluorescent image of a chip having
SNAPs on the surface after click-conjugation with PE-conjugated
azide.
[0050] FIGS. 18A-18F illustrate the immobilization of proteins from
E. coli lysate on an array having features which is coated with
SNAPs. FIGS. 18A and 18D illustrate SNAPs detected using
fluorescence with a 100.times.100 micron field of view. FIGS. 18B
and 18E illustrate binding of fluorescent streptavidin to
biotinylated lysate (FIG. 18B), or control lysate (FIG. 18E). FIGS.
18C and 18F show colocalization of the SNAPs and streptavidin from
FIGS. 18A and 18B; and FIGS. 18D and 18E respectively.
[0051] FIGS. 19A-F illustrates the specific detection of short
peptides of a short trimer peptide epitope using SNAPs. FIGS. 19A
and 19D illustrate SNAPs detected using fluorescence with a
35.times.35 micron field of view. FIGS. 19B and 19E illustrate
fluorescence from the anti peptide aptamer on the peptide treat
array (FIG. 19B), or control array (FIG. 19E). FIGS. 19C and 19F
show colocalization of the SNAPs and aptamer from FIGS. 19A and
19B; and FIGS. 19D and 19E respectively.
DETAILED DESCRIPTION OF THE INVENTION
[0052] Microarrays and nanoarrays having a plurality of molecules
spatially distributed over and stably associated with the surface
of a solid support are becoming an increasingly important tool in
bioanalysis and related fields. Microarrays of both polypeptides
and polynucleotides have been developed and find use in a variety
of applications, such as gene sequencing, monitoring gene
expression, gene mapping, bacterial identification, drug discovery,
and combinatorial chemistry. One area in particular in which
microarrays find use is in gene expression analysis.
[0053] In some instances it may be desirable to produce a
microarray or nanoarray wherein a plurality of biological or
chemical entities are spatially distributed over and stably
associated with the surface of a solid support such that each
individual biological or chemical entity is spatially separated
from each other biological or chemical entity.
[0054] In some embodiments this disclosure provides methods of
producing an array of spatially separated biological or chemical
entities, a method may comprise: obtaining a solid support with
attachment sites, obtaining a sample comprising biological or
chemical entities, obtaining seeds, each with a functional group,
covalently attaching each biological or chemical entity to a single
seed via the functional group, growing each attached seed to a SNAP
(Structured Nucleic Acid Particles) of desired size, attaching the
SNAPs to the attachment sites of the array, thereby producing a
regular array of biological or chemical entities. In some
instances, SNAPs can be any type of DNA based nanoparticle, such as
rolling circle amplification based nanoparticles, plasmids, or DNA
origami nanoparticles.
[0055] Examples of such methods of producing an array of entities
such as proteins are provided in FIGS. 1 A-D. FIG. 1A depicts a
method which begins with the attachment of a protein to an
oligonucleotide primer via a linker. The primer can be then
annealed to a circular DNA template, and rolling circle
amplification can be performed to produce a SNAP (indicated in this
example as a DNA cluster). The SNAP can be then deposited onto a
chip. In this example, the negative charge of the DNA backbone can
interact with positively charged features of an array, such that
the SNAP becomes immobilized on the array.
[0056] FIG. 1B depicts a method which begins with a primer having a
linker initiating rolling circle amplification with a circular DNA
template. The resulting SNAP (indicated in this example as a DNA
cluster) thus comprises a linker, which can then be conjugated to a
protein. The SNAP can be then deposited onto a chip. In this
example, the negative charge of the DNA backbone can interact with
positively charged features of an array, such that the SNAP becomes
immobilized on the array.
[0057] FIG. 1C depicts a method which begins with a primer
initiating rolling circle amplification with a circular DNA
template. The resulting SNAP (indicated in this example as a DNA
cluster) can then be joined with a crosslinker, which can then be
conjugated with a protein, to result in a SNAP which is crosslinked
to a protein. The SNAP can be then deposited onto a chip. In this
example, the negative charge of the DNA backbone can interact with
positively charged features of an array, such that the SNAP becomes
immobilized on the array.
[0058] FIG. 1D depicts SNAPs which have already been created, for
example by rolling circle amplification or other acceptable method.
These SNAPs can be then deposited onto a chip. For example, the
negative charge of the DNA backbone can interact with positively
charged features of an array, such that the SNAP becomes
immobilized on the array. Separately, proteins can be modified with
chemical handles which can bind a chemical moiety which can be on
the SNAPs. The handled proteins can then be applied to the SNAPs,
such that they covalently attach to the SNAPs.
[0059] In some embodiments this disclosure provides arrays of
single molecules and methods and kits for producing arrays of
single molecules. In some embodiments this disclosure provides
arrays of biological or chemical entities and methods and kits for
producing arrays of biological or chemical entities. In some
examples, an array of biological or chemical entities may comprise
an ordered series of biological or chemical entities arrayed on a
solid support. In other examples, an array of biological or
chemical entities may comprise an irregular array of biological or
chemical entities.
[0060] In some examples, biological or chemical entities on an
array may be separated by less than 10 nm, about 10 nm, 20 nm, 30
nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 120 nm, 140
nm, 160 nm, 180 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm,
500 nm, 550 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, 900
nm, 950 nm, 1 m, 1.2 m, 1.4 m, 1.6 m, 1.8 m, 2 m, 2.5 m, 3 m, 4 m,
5 m, 6 m, 7 m, 8 m, 9 m, 10 m, 11 m, 12 m, 13 m, 14 m, 15 m, 16 m,
17 m, 18 m, 19 m, 20 m, 25 m, 30 m, 40 m, 50 m, 75 m, 100 m, 200 m,
300 m, 400 m, 500 m, or more than 500 m. In some cases, biological
or chemical entities on the array may be separated by between about
50 nm and about 1 m, about 50 nm and about 500 nm, about 100 nm and
about 400 nm, about 200 nm and about 300 nm, about 500 nm and about
10 m, about 50 nm and about 1 m, or about 300 nm and about 1 m. In
some cases, the spacing of biological or chemical entities on the
array may be determined by the presence of attachment sites arrayed
on a solid support
[0061] In some embodiments an array is created on a solid support.
The solid support may be any solid surface to which molecules can
be covalently or non-covalently attached. Non-limiting examples of
solid substrates include slides, surfaces of elements of devices,
membranes, flow cells, wells, chambers, and macrofluidic chambers.
Solid supports used herein may be flat or curved, or can have other
shapes, and can be smooth or textured. In some cases, solid support
surfaces may contain microwells. In some cases, substrate surfaces
may contain nanowells. In some cases, solid support surfaces may
contain one or more microwells in combination with one or more
nanowells. In some embodiments, the solid support can be composed
of glass, carbohydrates such as dextrans, plastics such as
polystyrene or polypropylene, polyacrylamide, latex, silicon,
metals such as gold, chromium, titanium, or tin, titanium oxide,
tin oxide, or cellulose. In some examples, the solid support may be
a slide or a flow cell.
[0062] In some embodiments, surfaces of the solid support may be
modified to allow or enhance covalent or non-covalent attachment of
molecules such as the SNAPs described herein. The solid support and
process for molecule attachment are preferably stable for repeated
binding, washing, imaging and eluting steps. In some cases,
surfaces may be modified to have a positive or negative charge. In
some cases, surfaces may be functionalized by modification with
specific functional groups, such as maleic or succinic moieties, or
derivatized by modification with a chemically reactive group, such
as amino, thiol, or acrylate groups, such as by silanization.
Suitable silane reagents include aminopropyltrimethoxysilane,
aminopropyltriethoxysilane and 4-aminobutyltriethoxysilane. The
surfaces may be functionalized with N-Hydroxysuccinimide (NHS)
functional groups. Glass surfaces can also be derivatized with
other reactive groups, such as acrylate or epoxy, using, e.g.,
epoxysilane, acrylatesilane or acrylamidesilane.
[0063] In some embodiments, the solid support may be modified to
reduce non-specific attachment of SNAPs to the solid support. In
some embodiments, the solid support may be modified to reduce
non-specific attachment of biological entities and/or chemical
entities to the solid support. In some embodiments, the solid
support may be passivated. In some further embodiments, the surface
of the solid support may be passivated. In some embodiments, the
passivation layer may include diamond-like carbon,
hexa-methyldisilizane, Teflon, fluorocarbon, a polymer such as
polyethylene glycol (PEG) and/or Parylene. In some embodiments, a
solid support may be passivated by the attachment of Polyethylene
glycol (PEG) molecules across the solid support. In some
embodiments, a solid support may be passivated using salmon sperm
DNA, glycols, albumin, or a combination of the above. In some
embodiments, a solid support may be passivated using one or more
components selected from the group consisting of salmon sperm DNA,
glycols, and albumin. In some embodiments, passivation components
may be exposed to a surface. In some embodiments, passivation
components may not be covalently bound to a surface. In some
embodiments, passivation materials may be not covalently bound to
the solid support.
[0064] In some embodiments, the solid support may be modified
across the entire surface to which molecules are to be attached. In
other embodiments, the solid support may contain regions which are
modified to allow attachment of molecules and regions which are not
modified, or regions which are modified to decrease attachment of
molecules and regions which are not modified, or regions which are
modified to increase attachment of molecules and regions which are
modified to decrease attachment of molecules. In some cases
attachment sites may be created in an array, for example an ordered
array.
[0065] An ordered array of attachment sites may be created by, for
example, photolithography, Dip-Pen nanolithography, nanoimprint
lithography, nanosphere lithography, cluster lithography,
nanopillar arrays, nanowire lithography, scanning probe
lithography, thermochemical lithography, thermal scanning probe
lithography, local oxidation nanolithography, molecular
self-assembly, stencil lithography, or electron-beam lithography.
Attachment sites in an ordered array may be located such that each
attachment site is less than 20 nanometers (nm), or about 20 nm,
about 50 nm, about 75 nm, about 100 nm, about 125 nm, about 150 nm,
about 175 nm, about 200 nm, about 225 nm, about 250 nm, about 275
nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about
400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm,
about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625
nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about
750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm,
about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975
nm, about 1000 nm, about 1025 nm, about 1050 nm, about 1075 nm,
about 1100 nm, about 1125 nm, about 1150 nm, about 1175 nm, about
1200 nm, about 1225 nm, about 1250 nm, about 1275 nm, about 1300
nm, about 1325 nm, about 1350 nm, about 1375 nm, about 1400 nm,
about 1425 nm, about 1450 nm, about 1475 nm, about 1500 nm, about
1525 nm, about 1550 nm, about 1575 nm, about 1600 nm, about 1625
nm, about 1650 nm, about 1675 nm, about 1700 nm, about 1725 nm,
about 1750 nm, about 1775 nm, about 1800 nm, about 1825 nm, about
1850 nm, about 1875 nm, about 1900 nm, about 1925 nm, about 1950
nm, about 1975 nm, about 2000 nm, or more than 2000 nm from any
other attachment site.
[0066] In some cases, the spacing of attachment sites on the solid
support may be selected depending on the size of the SNAPs to be
used. For example the spacing of the attachment sites may be
selected such that the distance between the edges of any two
attachment sites is greater than the diameter of the SNAP used.
[0067] In some cases, the size of the attachment sites on the solid
support may be selected depending on the size of the SNAPs to be
used. For example the size of the attachment sites may be selected
such that the diameter of each attachment sites is less than the
diameter of the SNAP used.
[0068] In some cases, the attachment sites may be provided in
microwells or nanowells.
[0069] In some cases, functional groups may be present in a random
spacing and may be provided at a concentration such that functional
groups are on average at least about 50 nm, about 100 nm, about 150
nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about
400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm,
about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850
nm, about 900 nm, about 950 nm, about 1000 nm, or more than 100 nm
from any other functional group.
[0070] The solid support may be indirectly functionalized. For
example, the solid support may be PEGylated and a functional group
may be applied to all or a subset of the PEG molecules.
[0071] In some cases, the efficiency of attachment of the SNAPs to
the solid support may be high. In some cases, the efficiency of
attachment of the SNAPs to the solid support may be moderate. In
some cases, the efficiency of attachment of the SNAPs to the solid
support may be low. The efficiency of the attachment of the SNAPs
to the solid support may be influenced by many factors, including,
but not limited to: sequence of clusters, size of SNAPs relative to
size of a corresponding binding patch, the extent to which SNAPs
have had their structure modified in such a way so as to influence
their binding, age of SNAPs, storage conditions of a buffer or
buffers that come into contact with SNAPs, storage conditions of
SNAPs, pH or other properties of solvent in which the binding is
hoping to be achieved can massively affect, percentages of positive
cations, and temperature. In some cases, the reliability of
attachment of the SNAPs to the solid support may be high. In some
cases, the reliability of attachment of the SNAPs to the solid
support may be moderate. In some cases, the reliability of
attachment of the SNAPs to the solid support may be low.
[0072] In some embodiments the solid support may be optically
opaque. In some cases the solid support may be optically clear at
one or more wavelengths. In some cases, the solid support may be
partially optically clear, or may be optically clear in some
regions. For example a solid support may be optically opaque in
regions that are not functionalized, and optically clear in regions
that are functionalized.
[0073] FIG. 2 illustrates a method for producing a solid support
with attachment sites arrayed at desired intervals. Initially, a
substrate is provided. In some embodiments, the substrate may be
glass. In particular, in some embodiments, the substrate may be
amorphous glass, fused silica, or quartz, among other examples. In
some embodiments, the substrate may be silicon. In some
embodiments, the thickness of the substrate may be less than 100
microns, 100 microns, 150 microns, 200 microns, 300 microns, 400
microns, 500 microns, 600 microns, 700 microns, 800 microns, 900
microns, 1 millimeter, 2 millimeters, or more than 2
millimeters.
[0074] Initially, the substrate is cleaned, such as with a piranha
cleaning. In some embodiments, a substrate may be cleaned using a
strong acid so as to clean the substrate without etching the
substrate. In some embodiments, the substrate may be cleaned using
a detergent. Alternatively, the substrate may be cleaned with
solvent, sonication or with plasma such as O.sub.2 or N.sub.2
plasma, or with a combination thereof.
[0075] Once the substrate has been cleaned, a chrome layer is
deposited on the backside of the substrate. Deposition methods may
include, for example, evaporation or sputtering. In some
embodiments, a backside chrome evaporation may not be applied when
a substrate is opaque. A backside chrome evaporation may have a
thickness of one Angstrom, two Angstroms, 10 Angstroms, 10
nanometers, 20 nanometers, 30 nanometers, 40 nanometers, 50
nanometers, 60 nanometers, 70 nanometers, 80 nanometers, 90
nanometers, 100 nanometers, 150 nanometers, 200 nanometers, 250
nanometers, 300 nanometers, 400 nanometers, 500 nanometers, or more
than 500 nanometers. Alternatively, other metals can be used for
deposition on the backside of the substrate, such as Aluminum,
Tungsten, and/or Titanium, among other examples. Alternatively,
dielectric mirrors can be used for deposition on the backside of
the substrate.
[0076] Further, fiducials may be created on the front side of the
substrate. Fiducials may be created by adding at least one layer of
material and by patterning this at least one layer. In some
embodiments, such material can be chrome, and/or such materials may
be other metals like tungsten or gold. Alternatively, dielectric
mirrors could be used as a material for fiducials. Alternatively,
metal oxide could be used for the fiducials as for example
ZrO.sub.2. The patterning of such materials can be performed in a
variety of ways. A first way to pattern the fiducial material is to
deposit a blanket layer of the material, then to protect this
material in selected areas and remove the material in the areas
where it is not protected. This can for example be achieved by
coating the front side of the substrate with photosensitive
material (e.g. photoresist), patterning this photoresist by
exposing it to UV light through a mask and then developing it. The
etching of the fiducial material can then be performed by wet etch
(for example acid) or dry etch (for example Reactive Ion Etching,
RIE). Alternatively, the photoresist may be deposited and patterned
first. In some embodiments where the photoresist is deposited and
patterned first, areas are defined that are free of such
photoresist and then the fiducial material may be deposited on top
of the photoresist. The photoresist may then be removed (for
example, in a solvent bath with sonication) and the fiducial
material may be left on the areas that were initially free of
photoresist (e.g., using a lift-off technique). Alternatively,
fiducials may be created by removing material from the substrate in
selected areas, for example by patterning a layer of photoresist on
the front side of the substrate and then by dry etching the
substrate in the areas that are not coated with photoresist. In an
another alternative, fiducials may be defined by modifying the
substrate locally (for example by laser melting and/or
fractioning). Fiducials may come in a variety of shapes, lines,
and/or orientations. In some embodiments, a pattern of fiducials
may be applied to the substrate. In yet another embodiment, the
shape of fiducials may vary in order to code information about
their location on the surface of the substrate.
[0077] Once a pattern of fiducials is created on the front side of
the substrate, this front side may be differentially coated to
define features where the biological objects of interest (for
example, nucleic acid clusters covalently attached to a protein)
may be immobilized. In a first embodiment, the surface may be
differentially patterned with two silanes, for example HMDS or a
PEG-silane in the field and APTES on the immobilization spots. This
differential patterning is achieved by, for example, depositing an
initial HMDS layer on the surface, followed by a lift-off layer,
followed by an optional anti-reflective layer, and followed by a
photoresist layer. In some embodiments, an anti-reflective layer
may not be provided when an opaque substrate is being used.
[0078] Once the photoresist is applied, a second lithography step
may be provided. In particular, desired features may be provided.
In some embodiments, desired features may have a length of
approximately 300 nm. In some embodiments, features may have a
length of less than 50 nm, 100 nm, 150 nm, 200 nm, 250 nm, 300 nm,
350 nm, 400 nm, 450 nm, 500 nm, 600 nm, 700 nm, or more than 700
nm. In some further embodiments, one or more layers deposited on
the surface to perform this second lithography may not be etched by
the developing step of this second lithography (for example, the
antireflective coating).
[0079] In embodiments where a backside coating is provided, the
backside coating may be removed, such as through the use of a wet
etch or dry etch etc. Further, a directional reactive ion etch
(RIE) may be provided so as to remove layers that haven't been
removed by the lithography step (for example the antireflective
coating).
[0080] Once the holes have been provided, cleaning may be
performed. As seen in FIG. 2, an oxygen plasma cleaning and
activation step is provided. Once the chip has been cleaned, an
amino-silane deposition may be provided. Once the amino-silane
deposition is provided, portions of the chip manufacture may be
lifted-off, such as using hot DMF. Further, a sonication step may
be performed. The resulting chip may be used in flow cells for
assessments of biological assays.
[0081] In an alternative embodiment, the surface may be
differentially patterned with a silane layer and a metal layer (for
example, (3-Aminopropyl)triethoxysilane (APTES) on the
immobilization spots and chrome in the field). In another
embodiment, the surface may be differentially patterned with a
silane layer and a metal oxide layer (for example a PEG-silane
layer in the field and a ZrO.sub.2 layer on the immobilization
spots). In yet another embodiment, the surface may be
differentially patterned with a silane layer on the immobilization
spots (for example, acyl protein thioesterases (APTS)) and a metal
oxide layer (for example a ZrO.sub.2) and a PEG-phosphonic acid
layer in the field.
[0082] The biological or chemical entities of this disclosure may
be any biological or chemical entities for which spatial separation
is desired. In some embodiments, the biological or chemical
entities are proteins. In some cases, the proteins may be proteins
from a cell or tissue homogenate, from a biological fluid, or from
an environmental sample. In some cases, the biological or chemical
entities may be antibodies. In some embodiments the biological or
chemical entities are nucleic acids. For example the biological or
chemical entities may be DNAs, RNAs, mRNAs, tRNAs, or miRNAs. In
some embodiments the biological or chemical entities are
carbohydrates. In some embodiments, the biological or chemical
entities are complex polymers. In some embodiments the biological
or chemical entities are small molecules, for example chemical
compounds rather than complex polymers.
[0083] The biological or chemical entities of this disclosure may
be attached to seeds. These seeds are molecules which can be used
as a starting `seed` to grow a larger polymeric molecule. The seed
may be a monomer capable of being grown into a polymer, or may
comprise a monomer capable of being grown into a polymer.
Generally, the seeds are molecules which can be covalently attached
to the molecules. The seeds may have a polarity such that only one
functional group of the seed is able to bind to a molecule of the
molecules to be separated, while another one or more functional
groups of the seed can form the starting point for a polymer.
[0084] Examples of monomers which may be present in the seeds
include, but are not limited to, oligonucleotides, carbohydrates,
proteins, amyloids, fibrils, and tetratricopeptide repeats. In some
cases the seeds are small molecules.
[0085] The seeds may comprise a monomer and a functional group able
to bind to a biological or chemical entity to be separated.
Examples of such functional groups may include, but are not limited
to, amines, thiols, carboxylic acids, triple bonds, double bonds,
epoxides, alkynes, alkenes, cycloalkynes, azides, cyclo-octynes,
cycloalkynes, norbornenes, tetrazines, cyclloctanes, epoxides, and
hydroxyls. In some cases, the seed may comprise a functional group
that is compatible with a click chemistry. In some cases, the seed
may also comprise a linker or spacer between the seed and the
functional group. In some cases, the linker or spacer may comprise
a photo-cleavable bond. In some cases, the seed may comprise an
oligonucleotide conjugated to an amine group on the 5' terminal. In
some cases, the seed may comprise an oligonucleotide conjugated to
a click chemistry component on the 5' terminal.
[0086] In some cases, bioconjugation may be used to form a covalent
bond between two molecules, at least one of which is a biomolecule.
Bioconjugation may be formed but not limited to via chemical
conjugation, enzymatic conjugation, photo-conjugation,
thermal-conjugation, or a combination thereof. (Spicer, C. D.,
Pashuck, E. T., & Stevens, M. M., Achieving Controlled
Biomolecule-Biomaterial Conjugation. Chemical Reviews., 2018, 118,
Pgs. 7702-7743, and Greg T. Hermanson, "Bioconjugate Techniques",
Academic Press; 3.sup.rd Edition, 2013, herein incorporated by
reference for this disclosure). In some cases, both the seed and
the biological (e.g. SNAP) or chemical entity may be
functionalized. Functionalizing both partners may improve the
efficiency or speed of a conjugation reaction. For example, a
sulfhydryl group (--SH) or amine (--NH.sub.2) of a chemically
active site of a seed, biological, or chemical entity may be
functionalized to allow for greater reactivity or efficiency of a
conjugation reaction. Any of a variety of sulfhydryl-reactive (or
thiol-reactive) or amine conjugation chemistries may be used to
couple chemical moieties to sulfhydryl or amine groups. Examples
include, but are not limited to, use of haloacetyls, maleimides,
aziridines, acryloyls, arylating agents, vinylsulfones, pyridyl
disulfides, TNB-thiols and/or other
sulfhydryl-reactive/amine-reactive/thiol-reactive agents. Many of
these groups conjugate to sulfhydryl groups through either
alkylation (e.g., by formation of a thioether or amine bond) or
disulfide exchange (e.g., by formation of a disulfide bond). More
strategies and detail regarding reactions for bioconjugation are
described down below and may be extended to other appropriate
biomolecules.
[0087] Bioconjugation can be accomplished in part by a chemical
reaction of a chemical moiety or linker molecule with a chemically
active site on the biomolecule. The chemical conjugation may
proceed via an amide formation reaction, reductive amination
reaction, N-terminal modification, thiol Michael addition reaction,
disulfide formation reaction, copper(I)-catalyzed alkyne-azide
cycloaddition (CuAAC) reaction, strain-promoted alkyne-azide
cycloaddtion reaction (SPAAC), Strain-promoted alkyne-nitrone
cycloaddition (SPANC), invers electron-demand Diels-Alder (IEDDA)
reaction, oxime/hydrazone formation reaction, free-radical
polymerization reaction, or a combination thereof. Enzyme-mediated
conjugation may proceed via transglutaminases, peroxidases,
sortase, SpyTag-SpyCatcher, or a combination thereof.
Photoconjugated and activation may proceed via photoacrylate
cross-linking reaction, photo thiol-ene reaction, photo thiol-yne
reaction, or a combination thereof. In some cases, conjugation may
proceed via noncovalent interactions, these may be through
self-assembling peptides, binding sequences, host-guest chemistry,
nucleic acids, or a combination thereof.
[0088] In some cases, site-selectivity methods may be employed to
modify reaction moieties of biomolecules to increase conjugation
efficiency, ease of use, reproducibility. Three common strategies
are typically employed for site-selective bioconjugation (i)
Modification strategies that can select a single motif among many,
rather than targeting a generic reactive handle. This may be
determined by surrounding a sequence, local environment, or subtle
differences in reactivity. The ability of enzymes to modify a
specific amino acid within a protein sequence or a glycan at a
single position are particularly prominent. Reactions that display
exquisite chemo-selectivity also fall within this category, such as
those that target the unique reactivity of the protein N-terminus
or the anomeric position of glycans. (ii) The site-specific
incorporation of unnatural functionalities, by hijacking native
biosynthetic pathways may be utilized. (iii) The installation of
unique reactivity via chemical synthesis may be utilized. The
complete or partial synthesis of peptides and oligonucleotides is
widespread, particularly using solid-phase approaches. These
techniques allow access to sequences of up to 100 amino acids or
200 nucleotides, with the ability to install a wide variety of
functionalized monomers with precise positional control.
[0089] In some cases, chemical conjugation techniques may be
applied for creating biomaterial-biomolecule conjugates. Functional
groups used for bioconjugation may be native to the biomolecule or
may be incorporated synthetically. In the illustrations below, R
and R' may be a biomolecule (for example, but not limited to: SNAP,
proteins, nucleic acids, carbohydrates, lipids, metabolites, small
molecules, monomers, oligomers, polymers) and/or a solid
support.
[0090] In some cases, reductive amination may be utilized for
bioconjugation. Amines can react reversibly with aldehydes to form
a transient imine moiety, with accompanying elimination of water.
This reaction takes place in rapid equilibrium, with the
unconjugated starting materials being strongly favored in aqueous
conditions due to the high concentration of water. However, in a
second step the unstable imine can be irreversibly reduced to the
corresponding amine via treatment with sodium cyanoborohydride.
This mild reducing reagent enables the selective reduction of
imines even in the presence of unreacted aldehydes. As a result,
irreversible conjugation of a biomolecule can gradually occur to a
biomaterial of interest. In contrast, stronger reducing agents such
as sodium borohydride are also able to reduce aldehydes. This
two-step reductive amination process can also be utilized for the
modification of ketones. For example, reductive amination has
therefore been primarily used for the modification of sodium
periodate-treated alginate and chitosan scaffolds. The order of
reactivity may also be reversed for the attachment of reducing
sugars, by exploiting the terminal aldehyde/ketone generated in the
open-chain form. This strategy, for example, may be exploited to
mimic the glucosylation and galactosylation patterns of native
collagen in ECM, via reductive amination of maltose and lactose
respectively.
[0091] In some cases, isothiocyanates of a biomolecule or solid
support may be utilized for bioconjugation. For example,
isothiocyanate of a biomolecule may react with nucleophiles such as
amines, sulfhydryls, the phenolate ion of tyrosine side chains or
other biomolecules to form a stable bond between two molecules.
##STR00001##
[0092] In some cases, an isocyanate of a biomolecule or solid
support may be utilized for bioconjugation. For example,
isocyanates can react with amine-containing molecules to form
stable isourea linkages.
##STR00002##
[0093] In some cases, an acyl azide of a biomolecule or solid
support may be utilized for bioconjugation. For example, acyl azide
are activated carboxylate groups that can react with primary amines
to form amide bonds.
##STR00003##
[0094] In some cases, an amide of a biomolecule or solid support
may be utilized for bioconjugation. For example, the use of
reactive N-hydroxysuccinimide (NHS) esters is particularly
widespread. While NHS-esters can be preformed, often they are
instead generated in situ through the use of
N-(3-(dimethylamino)propyl)-N'-ethylcarbodiimide (EDC) coupling
chemistry and coupled directly to the species of interest. Although
formation of the activated NHS-ester is favored under mildly acidic
conditions (pH.about.5), subsequent amide coupling is accelerated
at higher pHs at which the amine coupling partner is not
protonated. One-step modification at an intermediate pH of
.about.6.5 is possible. Conjugation is typically undertaken by
first forming the active NHS-ester at pH 5, before raising the pH
to .about.8 and adding the amine coupling partner in a two-step
procedure. In some cases, water-soluble derivative sulfo-NHS may be
utilized as an alternative. In some cases, NHS esters of a
biomolecule can react and couple with tyrosine, serine, and
threonine --OH groups as opposed to N-terminal .alpha.-amines and
lysine side-chain .epsilon.-amines.
##STR00004##
[0095] In some cases, a sulfonyl chloride of a biomolecule or solid
support may be utilized for bioconjugation. For example, reaction
of a sulfonyl chloride compound with a primary amine-containing
molecule proceeds with loss of the chlorine atom and formation of a
sulfonamide linkage.
##STR00005##
[0096] In some cases, a tosylate ester of a biomolecule or solid
support may be utilized for bioconjugation. For example, reactive
groups comprising tosylate esters can be formed from the reaction
of 4-toluenesulfonyl chloride (also called tosyl chloride or TsCl)
with a hydroxyl group to yield the sulfonyl ester derivative. The
sulfonyl ester may couple with nucleophiles to produce a covalent
bond and may result in a secondary amine linkage with primary
amines, a thioether linkage with sulf-hydryl groups, or an ether
bond with hydroxyls.
[0097] In some cases, a carbonyl of a biomolecule or solid support
may be utilized for bioconjugation. For example, carbonyl groups
such as aldehydes, ketones, and glyoxals can react with amines to
form Schiff base intermediates which are in equilibrium with their
free forms. In some cases, the addition of sodium borohydride or
sodium cyanoborohydride to a reaction medium containing an aldehyde
compound and an amine-containing molecule will result in reduction
of the Schiff base intermediate and covalent bond formation,
creating a secondary amine linkage between the two molecules.
##STR00006##
[0098] In some cases, an epoxide or oxirane of a biomolecule or
solid support may be utilized for bioconjugation. For example, an
epoxide or oxirane group of a biomolecule may react with
nucleophiles in a ring-opening process. The reaction can take place
with primary amines, sulfhydryls, or hydroxyl groups to create
secondary amine, thioether, or ether bonds, respectively.
##STR00007##
[0099] In some cases, a carbonate of a biomolecule or solid support
may be utilized for bioconjugation. For example, carbonates may
react with nucleophiles to form carbamate linkages, disuccinimidyl
carbonate, can be used to activate hydroxyl-containing molecules to
form amine-reactive succinimidyl carbonate intermediates. In some
cases, this carbonate activation procedure can be used in coupling
polyethylene glycol (PEG) to proteins and other amine-containing
molecules. In some cases, nucleophiles, such as the primary amino
groups of proteins, can react with the succinimidyl carbonate
functional groups to give stable carbamate (aliphatic urethane)
bonds
##STR00008##
[0100] In some cases, an aryl halide of a biomolecule or solid
support may be utilized for bioconjugation. For example, aryl
halide compounds such as fluorobenzene derivatives can be used to
form covalent bonds with amine-containing molecules like proteins.
Other nucleophiles such as thiol, imidazolyl, and phenolate groups
of amino acid side chains can also react to form stable bonds with
a biomolecule or solid support. In some cases, fluorobenzene-type
compounds have been used as functional groups in homobifunctional
crosslinking agents. For example, their reaction with amines
involves nucleophilic displacement of the fluorine atom with the
amine derivative, creating a substituted aryl amine bond.
##STR00009##
[0101] In some cases, an imidoester of a biomolecule or solid
support may be utilized for bioconjugation. For example, the
.alpha.-amines and .epsilon.-amines of proteins may be targeted and
crosslinked by reacting with homobifunctional imidoesters. In some
cases, after conjugating two proteins with a bifunctional
imidoester crosslinker, excess imidoester functional groups may be
blocked with ethanolamine.
##STR00010##
[0102] In some cases carbodiimides may be utilized for
bioconjugation. Generally, carbodiimides are zero-length
crosslinking agents that may be used to mediate the formation of an
amide or phos-phoramidate linkage between a carboxylate group and
an amine or a phosphate and an amine, respectively. Carbodiimides
are zero-length reagents because in forming these bonds no
additional chemical structure is introduced between the conjugating
molecules. In some cases, N-substituted carbodiimides can react
with carboxylic acids to form highly reactive, O-acylisourea
derivatives. This active species may then react with a nucleophile
such as a primary amine to form an amide bond. In some cases,
sulfhydryl groups may attack the active species and form thioester
linkages. In some cases, hydrazide-containing compounds can also be
coupled to carboxylate groups using a carbodiimide-mediated
reaction. Using bifunctional hydrazide reagents, carboxylates may
be modified to possess terminal hydra-zide groups able to conjugate
with other carbonyl compounds.
[0103] In some cases, a biomolecule containing phosphate groups,
such as the 5'phosphate of oligonucleotides, may also be conjugated
to amine-containing molecules by using a carbodiimide-mediated
reaction. For example, the carbodiimide of a biomolecule may
activate the phosphate to an intermediate phosphate ester similar
to its reaction with carboxylates. In the presence of an amine, the
ester reacts to form a stable phosphoramidate bond.
##STR00011##
[0104] In some cases, an acid anhydride of a biomolecule or solid
support may be utilized for bioconjugation. Anhydrides are highly
reactive toward nucleophiles and are able to acylate a number of
the important functional groups of proteins and other biomolecules.
For example, protein functional groups able to react with
anhydrides include but not limited to the .epsilon.-amines at the
N-terminals, the .epsilon.-amine of lysine side chains, cysteine
sulfhydryl groups, the phenolate ion of tyrosine residues, and the
imid-azolyl ring of histidines. In some cases, the site of
reactivity for anhydrides in protein molecules is modification of
any attached carbohydrate chains. In some cases, in addition to
amino group modification in a polypeptide chain, glycoproteins may
be modified at their polysaccharide hydroxyl groups to form
esterified derivatives.
[0105] In some cases, a fluorophenyl ester of a biomolecule or
solid support may be utilized for bioconjugation. Fluorphenyl
esters can be another type of carboxylic acid derivative that may
react with amines consists of the ester of a fluorophenol compound,
which creates a group capable of forming amide bonds with proteins
and other molecules. In some cases, fluorophenyl esters may be: a
pentafluorophenyl (PFP) ester, a tetrafluorophenyl (TFP) ester, or
a sulfo-tetrafluoro-phenyl (STP) ester. In some cases, fluorophenyl
esters react with amine-containing molecules at slightly alkaline
pH values to give the same amide bond linkages as NHS esters.
[0106] In some cases, hydroxymethyl phosphine of a biomolecule or
solid support may be utilized for bioconjugation. Phosphine
derivatives with hydroxymethyl group substitutions may act as
bioconjugation agents for coupling or crosslinking purposes. For
example, tris(hydroxymethyl) phosphine (THP) and
.beta.-[tris(hydroxymethyl)phos-phino] propionic acid (THPP) are
small trifunctional compounds that spontaneously react with
nucleophiles, such as amines, to form covalent linkages.
[0107] In some cases, the thiol reactivity of a biomolecule or
solid support may be utilized for bioconjugation. For example, the
thiol group of cysteine is the most nucleophilic functional group
found among the 20 proteinogenic amino acids. Through careful
control of pH, selective modification over other nucleophilic
residues such as lysine can be readily achieved. Another example,
thiol modification of oligonucleotides may be used to enable
derivatization, though the ease with which alternative reactive
handles with enhanced chemical orthogonality can be installed has
limited use for biomaterial-conjugation. Further, the conjugate
addition of thiols to .alpha.,.beta.-unsaturated carbonyls, also
known as Michael addition, may be used to form polypeptide
conjugates in the fields of tissue engineering, functional
materials, and protein modification. In general, reaction rates and
conjugation efficiencies are primarily controlled by three factors
and may be modified as needed: (i) the pK.sub.a of the thiol; (ii)
the electrophilicity of the Michael-acceptor; (iii) the choice of
catalyst. Regarding (i): the thiolate anion is the active
nucleophile during Michael addition, and the propensity of the
thiol to undergo deprotonation may determine thiolate concentration
and thus reaction rates. For example, the lower pK.sub.a of
aromatic thiols, when compared to their aliphatic counterparts,
leads to a higher rate of reaction rate a weak base is used to
catalyze the. As a result, local structure can significantly alter
conjugation efficiency, particularly for polypeptide substrates.
The pK.sub.a and reactivity of cysteine containing peptides can be
altered significantly through rational choice of surrounding amino
acids, the presence of positively charged amino acids, such as
lysine and arginine, acts to lower the thiol pK.sub.a and thus
enhance reactivity. Regarding (ii): the Michael-acceptor becomes
more electron deficient it becomes more activated toward
nucleophilic attack, and thus reaction rates increase. Within the
most widely utilized acceptors in the biomaterial field, a trend of
reactivity can be generalized as maleimides>vinyl
sulfones>acrylates>acrylamides>methacrylates. Regarding
(iii) Michael additions can be accelerated by either basic or
nucleophilic catalysis (although both act by increasing the
concentration of the active thiolate).
[0108] In some cases, the unique nucleophilicity of thiols can be
exploited for selective reaction with a number of alternative
electrophiles, which allow efficient and selective biomolecule
attachment to be achieved. For example, one such group are
.alpha.-halocarbonyls, with iodoacetamide based reagents finding
particular utility. Higher thiol selectivity may be achieved using
less electrophilic bromo and even chloro derivatives, though
reactivity is also drastically reduced. More recently,
methylsulfonyl heteroaromatic derivatives have emerged as promising
reagents for thiol-specific conjugation. In other cases,
alternative thiol-reactive handles, such as disulfide-bridging
pyridazinediones, carbonylacrylic reagents, and cyclopropenyl
ketones may be utilized for bioconjugation.
[0109] In some cases, sulfhydryl of a biomolecule or solid support
may be utilized for bioconjugation. In some cases, three forms of
activated halogen derivatives can be used to create
sulfhydryl-reactive compounds: haloacetyl, benzyl halides, and
alkyl halides. In each of these compounds, the halogen group may be
easily displaced by an attacking nucleophilic substance to form an
alkylated derivative with loss of HX (where X is the halogen and
the hydrogen comes from the nucleophile). Haloacetyl compounds and
benzyl halides typically are iodine or bromine derivatives, whereas
the halo-mustards mainly employ chlorine and bromine forms.
Iodoacetyl groups have also been used successfully to couple
affinity ligands to chromatography supports.
##STR00012##
[0110] In some cases, a maleimide of a biomolecule or solid support
may be utilized for bioconjugation. The double bond of maleimides
may undergo an alkylation reaction with sulfhydryl groups to form
stable thioether bonds.
##STR00013##
[0111] In some cases, an aziridine of a biomolecule or solid
support may be utilized for bioconjugation. The highly hindered
nature of this heterocyclic ring gives it strong reactivity toward
nucleophiles. For example, sulfhydryls will react with
aziridine-containing reagents in a ring-opening process, forming
thioether bonds. The simplest aziridine compound, ethylenimine, can
be used to transform available sulfhydryl groups into amines. In
some cases, substituted aziridines may be used to form
homobifunctional and trifunctional crosslinking agents.
##STR00014##
[0112] In some cases, thiol-maleimide reactions are particularly
useful for undertaking conjugation at low concentrations or when
requiring extremely high efficiencies due to the value of the
biomolecule substrate. The use of maleimides in bioconjugation is
further enhanced by the ease with which they may be introduced into
a wide range of scaffold materials, through the modification of
amines with the difunctional reagent succinimidyl
4-(N-maleimidomethyl) cyclohexane-1-carboxylate, more commonly
referred to by its abbreviation SMCC. For example, this reagent has
been widely used to first introduce a maleimide reactive handle on
a biomaterial of choice and then to enable the attachment of both
peptides and growth factors to produce bioactive scaffolds.
[0113] In some cases, an acryloyl of a biomolecule or solid support
may be utilized for bioconjugation. The reactive double bonds are
capable of undergoing additional reactions with sulfhydryl groups.
In some cases, the reaction of an acryloyl compound with a
sulfhydryl group occurs with the creation of a stable thioether
bond. In some cases, the acryloyl has found use in the design of
the sulfhydryl-reactive fluorescent probe,
6-acryloyl-2-dimethylaminonaphthalene.
##STR00015##
[0114] In some cases, an aryl group of a biomolecule or solid
support may be utilized for bioconjugation with a sulfhydryl group.
Although aryl halides are commonly used to modify amine-containing
molecules to form aryl amine derivatives, they also may react quite
readily with sulfhydryl groups. For example, fluorobenzene-type
compounds have been used as functional groups in homobifunctional
crosslinking agents. Their reaction with nucleophiles involves
bimolecular nucleophilic substitution, causing the replacement of
the fluorine atom with the sulfhydryl derivative and creating a
substituted aryl bond. Conjugates formed with sulfhydryl groups are
reversible by cleaving with an excess of thiol (such as DTT).
##STR00016##
[0115] In some cases, the disulfide group of a biomolecule or solid
support may be utilized for bioconjugation. In some cases,
compounds containing a disulfide group are able to participate in
disulfide exchange reactions with another thiol. The disulfide
exchange (also called interchange) process involves attack of the
thiol at the disulfide, breaking the --S--S-- bond, with subsequent
formation of a new mixed disulfide comprising a portion of the
original disulfide compound. The reduction of disulfide groups to
sulfhydryls in proteins using thiol-containing reductants proceeds
through the intermediate formation of a mixed disulfide. In some
cases, crosslinking or modification reactions may use disulfide
exchange processes to form disulfide linkages with
sulfhydryl-containing molecules.
##STR00017##
[0116] In some cases, disulfide bonds may be utilized for
bioconjugation. For example, the use of disulfide exchange
reactions may be favored for introducing peptides or proteins of
interest. The most commonly used reagents in tissue engineering are
based upon reactive pyridylthio-disulfides, which undergo rapid
thiol-exchange to release the poorly nucleophilic and
spectroscopically active 2-mercaptopyridine. Additionally, due to
the reversible nature of disulfide bond formation, cleavage can be
controlled with temporal precision by the addition of reducing
agents such as dithiothreitol (DTT) or glutathione.
[0117] In some cases, a pyridyl dithiol functional group may be
used in the construction of crosslinkers or modification reagents
for bioconjugation. Pyridyl disulfides may be created from
available primary amines on molecules through the reaction of
2-iminothiolane in tandem with 4,4'-dipyridyl disulfide. For
instance, the simultaneous reaction among a protein or other
biomolecule, 2-iminothiolane, and 4,4'-dipyri-dyl disulfide yields
a modification containing reactive pyridyl disulfide groups in a
single step. A pyridyl disulfide will readily undergo an
interchange reaction with a free sulfhydryl to yield a single mixed
disulfide product.
##STR00018##
[0118] In some cases, sulfhydryl groups activated with the leaving
group 5-thio-2-nitrobenzoic acid can be used to couple free thiols
by disulfide interchange similar to pyridyl disulfides, as
described herein. The disulfide of Ellman's reagent readily
undergoes disulfide exchange with a free sulfhydryl to form a mixed
disulfide with concomitant release of one molecule of the
chromogenic substance 5-sulfido-2-nitroben-zoate, also called
5-thio-2-nitrobenzoic acid (TNB). The TNB-thiol group can again
undergo interchange with a sulfhydryl-containing target molecule to
yield a disulfide crosslink. Upon coupling with a sulfhy-dryl
compound, the TNB group is released.
##STR00019##
[0119] In some cases, disulfide reduction may be performed using
thiol-containing compounds such as TCEP, DTT, 2-mercaptoethanol, or
2-mercaptoethylamine.
##STR00020##
[0120] In some cases, a vinyl sulfone group of a biomolecule or
solid support may be utilized for bioconjugation. For example, the
Michael addition of thiols to activated vinyl sulfones to form
biomolecule-material conjugates have been used to demonstrate that
cysteine capped peptides could cross-link vinyl-sulfone
functionalized multiarm PEGs to form protease responsive hydrogels,
enabling cell invasion during tissue growth. In some cases, in
addition to thiols, vinyl sulfone groups can react with amines and
hydroxyls under higher pH conditions. The product of the reaction
of a thiol with a vinyl sulfone gives a single stereoisomer
structure. In addition, crosslinkers and modification reagents
containing a vinyl sulfone can be used to activate surfaces or
molecules to contain thiol-reactive groups.
##STR00021##
[0121] In some cases, thiol-containing biomolecules can interact
with metal ions and metal surfaces to form dative bonds for
bioconjugation. In some cases, oxygen- and nitrogen-containing
organic or biomolecules may be used to chelate metal ions, such as
in various lanthanide chelates, bifunctional metal chelating
compounds, and FeBABE. In addition, amino acid side chains and
prosthetic groups in proteins frequently form bioinorganic motifs
by coordinating a metal ion as part of an active center
##STR00022##
[0122] In some cases, thiol organic compounds may be used routinely
to coat metallic surfaces or particles to form biocompatible layers
or create functional groups for further conjugation of
biomolecules. For instance, thiol-containing aliphatic/PEG linkers
have been used to form self-assembled monolayers (SAMs) on planar
gold surfaces and particles.
##STR00023##
[0123] In some cases, a number of alternative coupling systems may
be used for biomolecule functionalization. These include the use of
O-nitrophenyl esters (which possess reduced stability in aqueous
conditions) or 1,1'-carbonyldiimidazole (CDI) to form
amine-bridging carbamate linkages rather than amides. Hydrazines
can also be used in place of amines during EDC/NHS mediated
couplings. Hydrazine-functionalized peptides can be coupled to
biomaterials in a single step at pH 5-6. In doing so, a degree of
site-selectivity can be achieved over lysine residues present. This
approach has been successfully implemented by Madl and co-workers
to conjugate reactive groups to alginate hydrogels, enabling
indirect functionalization with growth factors and adhesion
peptides.
[0124] In some cases, N-terminal modification of a biomolecule may
be utilized for bioconjugation. For example,
2-pyridinecarboxaldehyde modified acrylamide hydrogels may react
specifically with the N-terminus of ECM proteins, forming a cyclic
imidazolidinone product with the adjacent amide bond and enabling
the orientated display of these key bioinstructive motifs.
[0125] In some cases, acrylates, acrylamides, and methacrylates of
a biomolecule or solid support may be utilized for bioconjugation.
In some cases, thiol-ynes of a biomolecule or solid support may be
utilized for bioconjugation.
[0126] In some cases, thiol-reactive conjugation such as native
chemical ligation (NCL) can be utilized to attach peptides and
proteins to biomaterial scaffolds via peptide bond formation. For
example, a peptide having a C-terminal thioester reacts with an
N-terminal cysteine residue in another peptide to undergo a
trans-thioesterification reaction, which results in the formation
of an intermediate thioester with the cysteine thiol.
[0127] In some cases, strong binding of (strept)avidin may be used
for the small molecule biotin for bioconjugation. In some cases,
(strept)avidin and biotin may be attached to a biomolecule or solid
support for bioconjugation. In some cases, modification reagents
can add a functional biotin group to proteins, nucleic acids, and
other biomolecules. In some cases, depending on the functionality
present on the biotinylation compound, specific reactive groups on
antibodies or other proteins may be modified to create a
(strept)avidin binding site. Amines, carboxylates, sulfhydryls, and
carbohydrate groups can be specifically targeted for biotinylation
through the appropriate choice of biotin derivative. In some cases,
photoreactive biotinylation reagents are used to add nonselectively
a biotin group to molecules containing no convenient functional
groups for modification. In some cases, biotin-binding proteins can
be immobilized onto surfaces, chromatography supports,
microparticles, and nanoparticles for use in coupling biotinylated
molecules. In some cases, a series of (strept)avidin-biotin
interactions can be built upon each other to utilize the
multivalent nature of each tetrameric (strept)avidin molecule and
enhance the detection capability for the target. In some cases,
amine-reactive biotinylation reagents that may contain reactive
groups off biotin's valeric acid side chain are able to form
covalent bonds with primary amines in proteins and other molecules.
In some cases, NHS esters spontaneously react with amines to form
amide linkages whereas carboxylate-containing biotin compounds can
be coupled to amines via a carbodiimide-mediated reaction using
EDC. In some cases, NHS-iminobiotin can be used to label
amine-containing molecules with an iminobiotin tag, providing
reversible binding potential with avidin or streptavidin. In some
cases, Sulfo-NHS--SS-biotin (also known as NHS--SS-biotin) is
sulfosuccinimidyl-2-(biotinamido)ethyl-1,3-dithiopropionate, a
long-chain cleavable bio-tinylation reagent that can be used to
modify amine-containing proteins and other molecules. In some
cases, 1-biotinamido-4-[4'-(maleimidomethyl)
cyclohexane-carboxamido]butane, a biotinylation reagent containing
a maleimide group at the end of an extended spacer arm reacts with
sulfhydryl groups in proteins and other molecules to form stable
thioether linkages. In some cases,
N-[6-(biotinamido)hexyl]-3'-(2'-pyridyldithio)propionamide where
the reagent contains a 1,6-diaminohexane spacer group which is
attached to biotin's valeric acid side chain, the terminal amino
group of the spacer may be further modified via an amide linkage
with the acid precursor of SPDP to create a terminal,
sulfhydryl-reactive group. The pyridyl disulfide end of biotin-HPDP
may react with free thiol groups in proteins and other molecules to
form a disulfide bond with loss of pyridine-2-thione.
[0128] In some cases, a carboxylate of a biomolecule or solid
support may be utilized for bioconjugation. In some cases,
diazomethane and other diazoalkyl derivatives may be used to label
caroxylate groups. In some cases, N,N'-Carbonyl diimidazole (CDI)
may be used to react with carboxylic acids under nonaqueous
conditions to form N-acylimidazoles of high reactivity. An active
carboxylate can then react with amines to form amide bonds or with
hydroxyl groups to form ester linkages. In addition, activation of
a styrene/4-vinylbenzoic acid copolymer with CDI may be used to
immobilize an enzyme lysozyme or other biomolecule through its
available amino groups to the carboxyl groups on to a matrix.
##STR00024##
[0129] In some cases, carbodiimides function as zero-length
crosslinking agents capable of activating a carboxylate group for
coupling with an amine-containing compound for bioconjugation or a
solid support. In some cases, carbodiimides are used to mediate the
formation of amide or phosphoramidate linkages between a
carboxylate and an amine or a phosphate and an amine.
[0130] In some cases, N,N'-disuccinimidyl carbonate or
N-hydroxysuccinimidyl chloroformate may be utilized in
bioconjugation. N,N'-Disuccinimidyl carbonate (DSC) consists of a
carbonyl group containing, in essence, two NHS esters. The compound
is highly reactive toward nucleophiles. In aqueous solutions, DSC
will hydrolyze to form two molecules of N-hydroxysuccinimide (NHS)
with release of one molecule of CO.sub.2. In nonaqueous
environments, the reagent can be used to activate a hydroxyl group
to a succinimidyl carbonate derivative. DSC-activated hydroxylic
compounds can be used to conjugate with amine-containing molecules
to form stable crosslinked products.
##STR00025##
[0131] In some cases, sodium periodate can be used to oxidize
hydroxyl groups on adjacent carbon atoms, forming reactive aldehyde
residues suitable for coupling with amine- or hydrazide-containing
molecules for bioconjugation. For example, these reactions can be
used to generate crosslinking sites in carbohydrates or
glyco-proteins for subsequent conjugation of amine-containing
molecules by reductive amination.
[0132] In some cases, enzymes may be used to oxidize
hydroxyl-containing carbohydrates to create aldehyde groups for
bioconjugation. For example, the reaction of galactose oxidase on
terminal galactose or N-acetyl-d-galactose residues proceeds to
form C-6 aldehyde groups on polysaccharide chains. These groups can
then be used for conjugation reactions with amine- or
hydrazide-containing molecules.
[0133] In some cases, reactive alkyl halogen compounds can be used
to specifically modify hydroxyl groups in carbohydrates, polymers,
and other biomolecules for bioconjugation.
[0134] In some cases, an aldehyde or ketone of a biomolecule or
solid support may be used for bioconjugation. For example,
derivatives of hydrazine, especially the hydrazide compounds formed
from carboxylate groups, can react specifically with aldehyde or
ketone functional groups in target biomolecules. To further
stabilize the bond between a hydrazide and an aldehyde, the
hydrazone may be reacted with sodium cyanoborohydride to reduce the
double bond and form a secure covalent linkage.
##STR00026##
[0135] In some cases, an aminooxy group of a biomolecule or solid
support may be used for bioconjugation. For example, the
chemoselective ligation reaction that occurs between an aldehyde
group and an aminooxy group yields an oxime linkage (aldoxime) that
has been used in many bioconjugation reactions, as well as in the
coupling of ligands to insoluble supports including surfaces. This
reaction is also quite efficient with ketones to form an oxime
called a ketoxime.
##STR00027##
[0136] In some cases, cycloaddition reactions may be utilized for
bioconjugation. In cycloaddition reactions for bioconjugation, two
or more unsaturated molecules are brought together to form a cyclic
product with a reduction in the degree of unsaturation, these
reaction partners required are typically absent from natural
systems, and so the use of cycloadditions for conjugation requires
the introduction of unnatural functionality within the biomolecule
coupling partner.
##STR00028## ##STR00029##
[0137] In some cases, Copper-Catalyzed Azide-Alkyne Cycloadditions
may be utilized for bioconjugation. In some cases, the (3+2)
cycloaddition between an azide and alkyne proceeds spontaneously at
high temperatures (>90.degree. C.), producing a mixture of two
triazole isomers. In some cases, this reaction proceeds at room
temperature, ambient, oxygenated, and/or aqueous environments. In
some cases, for example, the formation of peptide-material
conjugates by CuAAC, using alkyne-capped peptides to form hydrogels
with azide-functionalized PEG. In some cases, CuAAC has been widely
used to functionalize scaffolds with alkyne and azide
functionalized peptides and carbohydrates, in part due to the ease
with which the amino acids azidolysine and homopropargylglycine can
be introduced by solid-phase peptide synthesis. In some cases, To
achieve biomaterial conjugation via CuAAC, the required copper(I)
catalyst can either be added directly, or generated in situ by
reduction of an initial copper(II) complex, most commonly using
ascorbic acid. The addition of a reducing agent further reduces the
sensitivity of the CuAAC ligation to oxygen. Although no additional
ligand is necessary for triazole formation, the addition of
tertiary amine based ligands may be used.
[0138] In some cases, Strain-Promoted Azide-Alkyne Cycloadditions
(SPAAC) may be utilized for bioconjugation. In some cases, highly
strained cyclooctynes react readily with azides to form triazoles
under physiological conditions, without the need for any added
catalyst. In some cases, in addition to the use of SPAAC for
peptide conjugation, a number of prominent reports have used SPAAC
to conjugate protein substrates to cyclooctyne functionalized
biomaterials via the introduction of an unnatural azide motif into
the protein coupling partner. In some cases, for example, this is
achieved by including maleimide functionalization of native
cysteines present in bone morphogenetic protein-2 (BMP-2), via
enzyme-mediated N-terminal modification of IFN-7, or via codon
reassignment with the unnatural amino acid 4-azidophenylalanine in
a number of protein substrates. In some cases, supramolecular
host-guest interactions can also be used to promote azide-alkyne
cycloaddition. For example, by bringing two reactive partners into
close proximity within the cavity of a cucurbit[6]uril host,
efficient cycloaddition could be achieved on the surface of
proteins, this strategy may be extended to other appropriate
biomolecules.
[0139] In some cases, inverse-electron demand Diels-Alder reactions
(IEDDA) may be utilized for bioconjugation. For example, the
inverse-electron demand Diels-Alder (IEDDA) reaction between
1,2,4,5-tetrazines and strained alkenes or alkynes may be employed.
A wide range of suitable derivatives for undertaking biomolecule
conjugation have been reported, for example, a series of
increasingly strained (and thus reactive) trans-cyclooctenes may be
utilized. In some cases, functionalized norbornene derivatives may
be utilized for undertaking IEDDA reactions. In some cases,
triazines may be utilized. In some cases, spirohexene may be
utilized. These strategies may be extended to other appropriate
biomolecules. In some cases, hetero-Diels-Alder cycloaddition of
maleimides and furans may be utilized for bioconjugation. For
example, the coupling of furan-functionalized RGDS peptides to
maleimide-functionalized PEG-hydrogels may be utilized, this
strategy may be extended to other appropriate biomolecules. In some
cases, furan-functionalized hyraluronic acid hydrogels can be
cross-linked with a dimaleimide-functionalized peptide via
Diels-Alder cycloaddition. MMP-cleavable peptides enable the
migration of seeded cancer through the gel.
[0140] In some cases, oxime and hydrazone formation may be utilized
for bioconjugation. In some cases, the stable attachment of
peptides and DNA to biomaterials via hydrazone formation can be
achieved via difunctional cross-linking, this strategy may be
extended to other appropriate biomolecules. In some cases, the
attachment of ketone or aldehyde modified green fluorescent protein
(GFP) or metallothionein to hydroxylamine-functionalized synthetic
polymers may be extended to other appropriate biomolecules. For
example, protein cross-linked hydrogels were produced through oxime
modification at both the protein N- and C-termini.
[0141] In some cases, the Diels-Alder reaction consists of the
covalent coupling of a diene with an alkene to form a six-membered
ring complex for bioconjugation.
##STR00030##
[0142] In some cases, transition metal complexes may be utilized
for bioconjugation. The nature of late transition metals may make a
transition metal complex well suited to the manipulation of
unsaturated and polarizable functional groups (olefins, alkynes,
aryl iodides, arylboronic acids, etc.). For example,
Pd(O)-functionalized microspheres may mediate allyl carbamate
deprotections and Suzuki-Miyaura cross-coupling in the cytoplasm.
In other examples, a ruthenium catalyst may be used to mediate
allyl carbamate deprotection of a caged fluorophore inside living
cells. In some cases, applications of palladium-based applications
in cell culture include copper-free Sonagashira coupling,
extracellular Suzuki coupling on the surface of E. coli cells, and
conjugation of thiol groups with allyl selenosulfate salts. In some
cases, olefin metathesis may be utilized for bioconjugation. For
example, with ruthenium complexes, S-allylcysteine can be easily
introduced into proteins by a variety of methods, including
conjugate addition of allyl thiol to dehydroalanine, direct
allylation of cysteine, desulfurization of allyl disulfide, or
metabolic incorporation as a methionine surrogate in methionine
auxotrophic E. coli.
##STR00031##
[0143] In some cases, complex formation with boronic acid
derivatives may be used for bioconjugation. For example, boronic
acid derivatives are able to form ring structures with other
molecules having neighboring functional groups consisting of 1,2-
or 1,3-diols, 1,2- or 1,3-hydroxy acids, 1,2- or
1,3-hydroxylamines, 1-2- or 1,3-hydroxyamides, 1,2- or
1,3-hydroxyoximes, as well as various sugars or biomolecules
containing these species.
##STR00032##
[0144] In some cases, enzyme-mediated conjugation may be utilized
for bioconjugation. For example, the transglutaminase enzyme family
catalyzes the formation of isopeptide bonds between the primary
amine of lysine side chains and the amide bonds of a complementary
glutamine residue, this strategy may be extended to other
appropriate biomolecules. In other cases, peroxidase-mediated
conjugation may be utilized for bioconjugation. For example, horse
radish peroxidase (HRP) may be utilized to oxidize a wide range of
organic substrates such as phenol group of tyrosie to generate a
highly reactive radical or quinone intermediate that undergoes
spontaneous dimerization, resulting in the formation of an ortho
carbon-carbon bond between two tyrosine residues, this strategy may
be extended to other appropriate biomolecules. In some cases short
peptide tags may be utilized for bioconjugation. These peptide tags
may be as short as 5 amino acids long and may be appended to a
peptide or protein substrate which allows for their subsequent
modification.
[0145] In some cases, polymerization of low molecular weight
monomers may be utilized for bioconjugation. Polymerization may be
classified as proceeding via one of two mechanisms, either
chain-growth or step-growth. During chain-growth polymerization,
monomers are added at the "active" end of a growing polymer chain,
resulting in the formation of high molecular weight materials even
at low conversions. During step-growth polymerizations short
oligomer chains couple to form polymeric species, requiring high
conversions in order to reach high molecular weights. Both
techniques can be used to form biomolecule-polymer conjugates. The
polymerization of acrylate and methacrylate monomers has proven
particularly fruitful. For example, acrylate and methacrylate
modified peptides and glycans can be readily polymerized.
Similarly, availability of the synthetic oligonucleotide
phosphoramidite building block "Acrydite", free-radical
polymerization remains one of the most common methods through which
to form DNA and RNA functionalized biomaterials. By undertaking
polymerization in the presence of a comonomer, the density of
biomolecule presentation can be easily tuned, allowing potential
difficulties from steric hindrance to be overcome. Initiation of
polymerization can be triggered by a number of means, including
heat, UV and visible light, redox reactions, and electrochemistry.
Acrylate modified proteins can also undergo polymerization to
produce functional materials, while retaining biological activity.
In some cases living radical polymerizations (LRPs) may be utilized
for bioconjugation. For example, the most commonly used LRPs for
the formation of bioconjugates include atom-transfer radical
polymerization (ATRP), reversible addition-fragmentation chain
transfer (RAFT) polymerization, and nitroxide-mediated
polymerization (NMP).
[0146] In some cases, photoconjugation may be utilized for
bioconjugation. In some cases polymerization is initiated by the
production of a radical species, which then propagates through bond
formation to create an active polymer chain. The initiation step
can be induced via a number of stimuli, with thermal decomposition,
redox activation, and electrochemical ionization of an initiating
species being among the most common. Alternatively, many initiators
can be activated via light-induced photolytic bond breakage (type
I) or photoactivated abstraction of protons from a co-initiator
(type II). Photoinitiation offers the benefits of being applicable
across a wide temperature range, using narrow and tunable
activation wavelengths dependent on the initiator used, rapidly
generating radicals, and the ability to control polymerization by
removing the light source. Importantly, the tolerance of
polymerizations to oxygen is greatly enhanced, enabling
polymerization in the presence of cells and tissues. The
incorporation of acrylate-functionalized peptides and proteins
during photopolymerization may be used as a method for producing
biomaterial conjugates. Alternatively, the photoinitiated
attachment of polypeptides to pendant vinyl groups on preformed
materials has also been widely reported and more recently used for
3D patterning via two-photon excitation. A wide range of
photoinitators may be used in photoconjugation conjugations. For
example but not limited to, Eosin Y,
2,2-dimethoxy-2-phenyl-acetophenone, Igracure D2959, lithium
phenyl-2,4,6-trimethylbenzoylphosphinate, and riboflavin may be
used as photoinitiators. Photoinitiators generally absorb light to
initiate the photoreaction processes. In some cases,
photoconjugation may utilize a photo thiol-ene reaction. Thiols can
also react with alkenes via a free-radical mechanism. A thiol
radical first reacts with an alkene to generate a carbon-centered
radical, which can then abstract a proton from another thiol and
thus propagate the reaction. Photo thiol-ene reactions may be
accelerated by electron-rich alkenes, which generate unstable
carbon-radical intermediates able to rapidly abstract
thiol-hydrogens. Exceptions to this rule are norbornene
derivatives, in which reactivity is driven instead by the release
of ring strain upon thiol addition. This leads to a general trend
in reactivity of norbornene>vinyl ether>propenyl>allyl
ether>acrylate>maleimide. Norbornenes and allyloxycarbonyls
(alloc groups) have been particularly widely used for
peptide/protein-biomaterial functionalization, due to the almost
negligible contribution of chain transfer and their ease of
introduction during peptide synthesis, respectively. For example,
an alloc group, typically used as an orthogonal lysine protecting
group during solid-phase peptide synthesis, is an efficient photo
thiol-ene reactive handle. In other examples, norbornene photo
thiol-ene reactions may be used for the tethering and spatial
patterning of bioactive peptides and growth factor proteins. In
addition to the most commonly used alloc and norbornene reactive
groups, other alkenes have also been used for biomaterial
functionalization. For example, codon reassignment has been used to
site-specifically incorporate allyl-cysteine residues into
proteins, which can subsequently undergo conjugation through the
use of photo thiol-ene reactions. Alternatively, acrylates can
undergo mixed-mode photopolymerizations in the presence of cysteine
capped peptides, while allyl disulfide structures have recently
been shown to undergo reversible and controlled exchange of
conjugated thiols.
[0147] In some cases, aryl azide or halogenate aryl azides of a
biomolecule or solid support may be utilized for
bioconjugation.
##STR00033##
[0148] In some cases, photoreactive group benzophenone may be
utilized for bioconjugation.
##STR00034##
[0149] In some cases, photoreactive group anthraquinone may be
utilized for bioconjugation.
[0150] In some cases, photo thiol-yne reactions may be utilized for
bioconjugation. Most examples of photo thiol-yne reactions have
exploited simple propargyl-ether or -amine reactive handles.
[0151] In some cases, photocaging and activation of reactive
functionalities may be utilized for bioconjugation. Generally, a
transient reactive species is formed whether it be an acrylate or
thiol derived radical. In some cases, photocaging may be used to
mask or protect a functional group until it is desirable for it to
be exposed. In some cases, the most widely utilized cages are based
around o-nitrobenzyl and coumarin chromophores. For example,
nitrobenzyl-capped cysteine residues may be decaged by irradiation
with 325 nm UV light, the released thiol may then react with
maleimide-functionalized peptides via Michael addition, to generate
a patterned hydrogel able to guide cell migration. In some cases,
6-bromo-hydroxycoumarins may be used for thiol-caging. In some
cases, photoaffinitiy probes may be utilized for bioconjugation
where a highly reactive intermediate upon irradiation, which then
reacts rapidly with the nearest accessible functional group with
high spatial precision. In some cases, the most commonly used are
phenylazides, benzophenones, and phenyl-diazirines. In some cases,
photocaged cycloadditions may be used. For example, the UV
irradiation of tetrazoles has been shown to generate a reactive
nitrile-imine intermediate which can undergo rapid cycloaddition
with electron-deficient alkenes such as acrylates or acrylamides.
In some cases, the nitrile-imine side-reactivity with thiols may be
utilized for site-specifically conjugate cysteine containing
proteins to tetrazole functionalized surfaces.
[0152] In some cases, noncovalent interactions may be utilized for
bioconjugation. In some cases, noncovalent binding plays a vital
role in cells, controlling biomolecular interfaces and influencing
protein-protein interactions, DNA-DNA complexation, DNA-protein
interfaces, protein localization, and more. In some cases,
noncovalent sequences which display a binding affinity for the
biomolecule of interest, allow for postfabrication modification or
for native biomolecules to be simply sequestered from the
surroundings within biological samples. The most commonly used
binding sequences are short peptides between 7 and 20 amino acids
in length, derived from a variety of sources, including known
protein binding domains present in vivo or determined through
techniques such as phage display. In some cases, short
oligonucleotides known as aptamers can also be used to bind a
variety of protein substrates, including the cytokines vascular
endothelial growth factor (VEGF) and platelet derived growth factor
(PDGF), as well as cell surface proteins such as epidermal growth
factor receptor (EGFR). In some cases, binding sequences can also
be introduced into a biomaterial with affinity for native
biopolymers, such as heparin. In some cases, by first inducing
biopolymer binding, the adsorption of an added or endogenous growth
factor or signaling protein to a biomaterial scaffold can then be
controlled. In some cases, binding affinity at the amino acid level
can also be exploited to enable peptide and protein conjugation to
certain biomaterial substrates. For example, the binding of
unnatural catechol-based amino acids can be used to induce binding
to metal oxide containing bioglasses and metallic implants,
enabling the bioactivity of these important technologies to be
enhanced.
[0153] In some cases, self-assembling peptides may be utilized for
bioconjugation. For example, native peptides and proteins adopt a
series of secondary structures, including .beta.-sheets and
.alpha.-helices, which can both stabilize individual sequences and
control interprotein aggregation. In some cases, self-assembling
peptides have been used extensively to assemble hydrogels and
fibrous materials. In many of these structures, biological epitopes
or functional groups can be appended to some or all of the peptide
building blocks during peptide synthesis, to add the desired
bioactivity into the system. Peptide-ligands ranging from simple
adhesion motifs, to laminin derived epitopes, and growth factor
mimetics have all been displayed on the surface of self-assembled
fibrils. Alternatively, glycopeptides can be assembled in order to
recruit extracellular signaling proteins and growth factors, mimic
glycosylation patterns within hyaluronic acid, or investigate
optimal sulfonation ratios in glycosaminoglycan scaffolds. In some
cases, self-assembling domains can also be added to full-length
proteins, leading to the incorporation of pendant functionality
during hydrogel formation. In some cases, the propensity of
peptides to form secondary structures has also been exploited
within nonself-assembling scaffolds. This may be achieved by mixing
a self-assembling peptide into a covalent hydrogel, composed of
either a noninteracting polymer such as interpenetrating networks
of PEG or systems where additional charge interactions further
stabilize the final construct, for example between positively
charged peptides and negatively charged alginate gels. As an
alternative, pendant helical groups can be attached to a covalent
material and used to drive the noncovalent attachment of bioactive
groups such as growth factors via self-assembly into coiled-coil
triple helices.
[0154] In some cases, host-guest chemistry may be utilized for
bioconjugation. For example, the adhesive properties of a
.beta.-cyclodextrin modified alginate scaffold could be controlled
in situ through the addition of a guest naphthyl-functionalized
RGDS peptide and by subsequently introducing a non-cell adhesive
adamantane-RGES peptide with a higher host binding constant,
dynamic modulation of fibroblast cell attachment was enabled.
Host-guest interactions between cyclodextrin and naphthyl- or
adamantane-functionalized peptides allow alginate
functionalization, this may be applied to other appropriate
biomolecules.
[0155] In some cases, biotin-(strept)avidin may be utilized for
bioconjugation. For example, avidin and streptavidin are
homotetrameric proteins that can simultaneously bind up to four
molecules of their small molecule binding partner biotin. The small
size of biotin (with a mass of just 244 Da) and the ease with which
it can be functionalized via its free carboxylic acid has led to
biotin-(strept)avidin binding finding widespread use as a means to
undertake biomaterial conjugation. Streptavidin-protein fusions can
be produced recombinantly and bound to suitably functionalized
surfaces to achieve conjugation. In some cases, biomolecule
biotinylation is undertaken, and this construct is then bound to a
(strept)avidin functionalized surface. In some cases, this can
either be achieved by a direct route, via chemical preconjugation
of the material with (strept)-avidin, or by exploiting the
tetrameric binding of (strept)avidin to mediate indirect
modification or cross-linking of biotin-functionalized
scaffolds.
[0156] In some cases, nucleic acids may be utilized for
bioconjugation. In some cases, in an analogous fashion to
self-assembling peptides, nucleic acids can also form assembled
materials themselves, to generate tunable platforms for the display
of biomolecules. In some cases, DNA-tagged peptides and growth
factors can be conjugated to a suitably functionalized biomaterial
and used to elicit a desired biological effect on a localized cell
population.
[0157] Generally, incorporating reactive handles may be utilized
for bioconjugation. For example, introducing uniquely reactive
motifs into biomolecule substrates provides a chemical "tag" which
allows single-site selectivity or specificity to be achieved. In
some cases, short peptides and oligonucleotides can typically be
produced via solid phase synthesis (SPS). The versatility of
organic synthesis allows difficulties in reactive handle
incorporation to be overcome, with a wide range of suitably
functionalized amino acids and oligonucleotides available as
described herein. In some cases, an alternative approach is to
introduce unnatural amino acids (UAAs) bearing the desired reactive
handles. This may be achieved via the modification of lysine
residues with amine-reactive derivatives. In some cases, the use of
auxotrophic bacterial strains, which are unable to biosynthesise a
particular amino acid and thus require uptake from the growth
media, by starving the bacteria of the native amino acid and
supplementing it with a structurally related unnatural analogue,
the bacterial cells can will incorporate the UAA during
translation. This technique may be used to install azide- and
alkyne-based mimics of methionine, leading to the introduction of
reactive handles for undertaking CuAAC and SPAAC reactions.
Analogous strategies can be used for the incorporation of unnatural
monosaccharides, enabling the remodelling of complex glycans. In
some cases, the use of codon reassignment using orthogonal tRNA and
tRNA synthetase pairs that selectively recognize and charge an UAA
during translation. In some cases, this may be achieved by
reassigning the amber stop-codon, UAG, by incorporating a
tRNA.sub.CUA/tRNA synthetase pair from an alternative kingdom into
the host cell. This pair may be able to install the desired UAA,
while being effectively invisible to the endogenous cell machinery.
As a result, site-directed mutagenesis can be used to introduce a
single TAG codon at the desired position of the coding DNA, leading
to the singular introduction of the UAA with high specificity and
selectivity.
[0158] In some cases, one or more functional groups may release a
reporter when reacted with another functional group, or with a SNAP
or biological entity or chemical entity. Having a reporter released
when the SNAP and biological or chemical entity are conjugated may
allow tracking of the reaction. In some cases, it may be possible
to monitor the degree of completion of a SNAP-biological/chemical
entity conjugation reaction by monitoring the concentration of free
reporter. In some cases, the reporter may fluoresce once released
by the conjugation reaction.
[0159] In some cases, the biological or chemical entity may be
functionalized with a linker. In some cases, functionalizing the
biological or chemical entity with a linker may decrease steric
hindrance. A linker may comprise a rigid or semi-rigid moiety which
can hold the biological or chemical entity away from the SNAP. In
some cases, the linker may be a long, moderate or short linker. In
some cases, the linker may comprise one or more component selected
from PEG, DNA, short carboxyl, carbon chain, peptoid, spacer,
and/or glycer, among other examples.
[0160] In some cases, the SNAPs, seeds, and/or biological or
chemical entities may be functionalized using single pot proteomics
methods. Single pot proteomics methods may result in very high
efficiency of functionalization. In some cases, single pot
proteomics methods may be useful to functionalize biological or
chemical entities with very low levels of loss of the entities.
[0161] In some embodiments, a SNAP is a polymer which may be grown
from the seed. For example if the seed is a DNA oligonucleotide
then the SNAP may be a DNA molecule. In some cases, the SNAP may be
a DNA molecule with regions of internal complementarity such that
the molecule may self-hybridize. For example, the SNAP may be a DNA
cluster, formed by self hybridization within the molecule. In some
cases, the SNAP may be formed from DNA, RNA, L-DNA, L-RNA, LNA,
PNA, or a mixture of two or more different types of nucleic acid.
In some cases, the SNAP may have a repeating structure, such as a
repeating sequence of nucleotides. In some cases, the SNAP may be
an irregular polymer without a repeating sequence. For example, the
SNAP may comprise a random sequence of nucleotides.
[0162] In some cases, a SNAP may be formed by rolling circle
amplification. A plasmid, or other circular nucleic acid molecule,
may be provided as a template, together with a primer that binds to
the circular nucleic acid molecule, wherein the primer comprises a
functional group on the 5' end. Performing a polymerase chain
reaction (PCR) with a sufficiently long extension step, or merely a
polymerase extension reaction, will allow the functionalized primer
to bind the circular nucleic acid molecule and produce a single
stranded nucleic acid product. The length of the single stranded
nucleic acid product may be influenced by altering the extension
time, the polymerase enzyme used, or the reaction conditions. In
some cases, the circular nucleic acid template contains regions of
internal complementarity, such that the single stranded nucleic
acid product will contain regions which may self-hybridize. In some
cases, the circular nucleic acid template is a dsDNA molecule. In
some cases, the single stranded nucleic acid product is an ssDNA
molecule. In some cases, the polymerase used is a DNA
polymerase.
[0163] In some cases, a SNAP may be formed by nucleic acid origami,
or DNA origami. DNA origami generally refers to the nanoscale
folding of DNA to create non-arbitrary two- and three-dimensional
shapes at the nanoscale. The specificity of the interactions
between complementary base pairs can make DNA a useful construction
material. In some cases, the interactions between different regions
may be controlled through design of the base sequences. DNA origami
may be used to create scaffolds that hold other molecules in place
or to create structures all on its own.
[0164] SNAPs as described herein can include those created via
nucleic acid origami. Commonly, nucleic acid origami can refer to
DNA origami, but it can also refer to RNA origami, origami of a
combination of DNA and RNA molecules, or origami of nucleic acid
molecules which can be other than DNA or RNA, such as a
silicon-based nucleic acid, among other examples. Nucleic acid
origami can result in a nucleic acid molecule which has an
engineered shape. The engineered shape can be a shape which has
been partially or fully planned. The planning of the shape can
comprise planning or engineering what sections of nucleic acid
bind, where a segment of nucleic acid can fold, where a segment of
nucleic acid can be single stranded, where a segment of nucleic
acid can be double stranded, where a segment of nucleic acid can be
bound to a segment of nucleic acid of the same strand, or where a
segment of nucleic acid can be bound to a segment of nucleic acid
on another strand. In some cases, non-nucleic acid molecules, such
as protein, can be used to encourage nucleic acid into the
engineered shape.
[0165] Generally, nucleic acid origami can comprise at least one or
more long nucleic acid strand and one or more short nucleic acid
strands. Commonly, these nucleic acid strands are single stranded,
although they can have segments which can be double stranded. One
of the short strands can comprise at least a first segment which
can be complementary to a first segment of the long strand, as well
as a second segment which can be complementary to a second segment
of the long strand. When the short and long strands are incubated
under conditions that can allow hybridization of nucleotides, the
shorter oligonucleotide can hybridize with the longer
oligonucleotide. This hybridization can give shape to the nucleic
acid molecule. For example, if the two segments on the first strand
are separated, then these two segments can be brought together
during hybridization to create a shape. In some cases, a short
strand can bind to at least 2, 3, 4, 5, or 6 segments which can
bind to at least 2, 3, 4, 5, or 6 complementary segments of the
long nucleic acid strand.
[0166] In some cases, a short strand can have one or more segments
which can be not complementary to the long strand. In such a case,
the segment which is not complementary to the long strand can be at
least about 1, 2, 3, 4, 5, 10, 15, or 20 nucleotides long.
[0167] This process can be performed with at least about 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150,
200, 250, 300, or more short nucleic acid strands. These short
nucleic acid strands can each bind to one or more different
segments of the long nucleic acid strand. Each short nucleic acid
strand which hybridizes to the long nucleic acid strand can lead to
a fold in the long nucleic acid strand. In some cases, the number
of short strands can be correlated with the complexity of the
engineered shape. For example, an engineered shape with many folds
can utilize more short nucleic acid strands than an engineered
shape with few folds. An engineered shape can have at least about
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90,
100, 150, 200, 250, 300, or more folds.
[0168] In some cases, more than one long strand can be incorporated
into the nucleic acid origami structure. This can be done for
example to increase the complexity of the engineered shape, to ease
the designing or planning of the engineered shape, to avoid the
creating of a shape which is more thermodynamically stable than the
desired engineered shape, to make the creation of the engineered
shape easier, or to manage costs of creating the engineered
shape.
[0169] Incorporation of more than one long strand can be
accomplished by designing the 2 or more long strands such that each
strand has at least one segment that can be complimentary to a
segment of the other strand, or by designing the 2 or more long
strands such that each has at least one segment which can be
complementary to a region of a short nucleic acid strand, such that
both long strands have segments complementary to the short nucleic
acid strand.
[0170] Short nucleic acid strands can have complementarity to one
long nucleic acid strand or more than one long nucleic acid strand.
In some cases, a short nucleic acid strand can also have
complementarity to one or more short nucleic acid strands.
[0171] The terms "long" and "short" herein are meant to be general
terms. A long strand can be longer than a short strand, although in
some instances a long strand can be the same size as a short
strand. In some cases, a long strand can be at least about 30, 40,
50, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, or
more nucleotides long. In some cases, a short strand can be at
least about 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70,
80, 90, 100, or more nucleotides long.
[0172] An engineered shape can be designed for a specific purpose.
For example, an engineered shape can be designed to support a load,
encapsulate a molecule, bind a molecule, connect two or more
molecules, fit into a cavity, bind a protuberance, or other
purpose. An engineered shape can any shape, such as oblong,
rectangular, round, circular, spherical, flat, textured, smooth,
symmetrical, asymmetrical, conical, or irregular. An engineered
shape can be a cube, pyramid, box, cage, ladder, or tree.
[0173] An engineered shape or SNAP formed via nucleic acid origami
as described above can be assembled. Assembly can refer to the
process by which the nucleic acid strands hybridize to each other
to create the engineered shape.
[0174] An engineered shape or SNAP can be spontaneously
self-assembling. Self-assembly can occur when long and short
oligonucleotides having regions which can be complimentary are
incubated together. During spontaneous self-assembly, the
nucleotides can hybridize and the engineered shape can be created
during incubation without the help of a helper molecule or
catalyst. Such self-assembling can occur under specific conditions
or a range of specific conditions. Conditions which can be
considered when incubating DNA strands for self-assembly can be
salt concentration, temperature, and time.
[0175] Sometimes, assembly can utilize or require a catalyst. In
such cases, the catalyst can speed up assembly or ensure the
assembly results in a particular desired engineered shape. A
catalyst can comprise RNA, DNA, or protein components.
[0176] The salt concentration during assembly can be less than 1 M,
less than 0.5M, less than 0.25 M, less than 0.1M, less than 0.05 M,
less than 0.01 M, less than 0.005 M, or less than 0.001 M.
[0177] The temperature during assembly can be at least room
temperature. In some cases, the temperature during assembly can be
at least about 50, 60, 70, 80, 85, 90, or 95.degree. C. In some
cases, the temperature during assembly can vary. For instance, the
temperature can be increased to at least about 20, 30, 40, 50, 60,
70, 80, 85, 90, or 95.degree. C. This increase can ensure the
nucleic acid strands do not comprise a secondary structure prior to
assembly. Once the temperature is increased as described, it can be
decreased, for example to about 20, 30, 40, 50, 60, 70, or
80.degree. C. This decrease in temperature can allow the nucleic
acids to hybridize. In some cases, the decrease in temperature can
occur over about 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 45, or 60
minutes.
[0178] Assembly can be performed stepwise. In such cases, a subset
of the nucleic acid molecules can be incubated together first.
After these molecules are allowed to hybridize, one or more
additional nucleic acid molecules can be added and allowed to
hybridize. In some cases, two or more engineered shapes which have
been assembled can be incubated together for assembly into a larger
engineered shape.
[0179] In some cases, assembly can comprise fractal assembly.
Fractal assembly can create a SNAP which can be an array of
engineered shapes. Assembly can occur in stages, which can simplify
the design process or ensure correct assembly. Such an array can be
assembled in at least 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60,
70, 80, 90, 100, 200, 300, 400, 500, 1000, or more stages. In some
cases, the number of stages used can correlate with a reduction of
spurious interactions. This can be due to a reduction in the total
number of possible reactions at any given time.
[0180] SNAPs can be assembled into an array which can be at least
3.times.3, at least 5.times.5, at least 10.times.10, at least
50.times.50, at least 100.times.100, or at least 1000.times.1000
(engineered shapes.times.engineered shapes).
[0181] Each hybridization reaction can take about 10, 20, 30, 40,
50, or 60 seconds. In some cases, each hybridization reaction can
take about 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, or 60 minutes. In
some cases, a hybridization reaction can take more than 1 hour.
[0182] Nucleic acid origami may be used to preferentially choose
how the SNAP will "land" on the solid support. For example, nucleic
acid origami may be used to construct a SNAP with a landing surface
that can preferentially contact the solid support, A SNAP such as
one made via nucleic acid origami can be designed to comprise a
region that can create steric or electrostatic interactions with
the support that can influence the orientation of the SNAP on the
support. For example, the region can comprise nucleotides having
modifications e.g. to the backbone of the nucleic acid which can
promote interaction between the SNAP and the solid support. In
further examples, the region can comprise protuberances or cavities
which can "fit" to cavities or protuberances on the solid support.
In some cases, the support surface can comprise chemical
structuring (e.g. nanoparticles or oligonucleotides), click
reagents, or other rationally designed materials that can influence
the position and orientation of SNAP structures, including SNAPs
synthesized via nucleic acid origami.
[0183] Nucleic acid origami can be used to construct a SNAP with a
linker which can attach a biological or chemical entity, wherein
the linker is positioned relative to the landing surface such that
the biological or chemical entity can be distal or approximately
distal to the solid support. The linker may also comprise a region
of dsDNA to force a rigid outpost from the SNAP. In some cases,
protein origami may also be used.
[0184] A surface can have properties such that a SNAP can bind to
the surface in such a way that it can flop or lean. The SNAP can
flop or lean to the left, to the right, to the front, to the back,
or to any combination of sides thereof. The SNAP can flop or lean
once and remain in place, or it can flop freely between sides over
time. In some cases, the SNAP can preferentially flop in one
direction over one or more other directions. In some cases, the
SNAP can preferentially avoid flopping in a particular
direction.
[0185] In some cases, for example, filamentous or stranded
molecules, such as nanoparticles or oligonucleotide strands, can be
attached to a surface. A SNAP, which can comprise an engineered
shape, can comprise one or more moieties which can bind to a
filamentous or stranded molecule, such as a dangling single
stranded oligonucleotide or nanoparticle. Upon contacting the
surface with such SNAPs, the one or more moieties can interact with
one or more of the filamentous or stranded molecules. In some
cases, the moieties can bind tightly to the filamentous or stranded
molecules. The SNAPs can be removable or non-removable in such
cases.
[0186] Computational modeling or simulation tools may be employed
to design and optimize oligonucleotide or protein sequences to
create particular SNAP structures.
[0187] In some cases, a SNAP may be a nucleic acid plasmid, such as
a DNA plasmid. Plasmids may exist in a compact form known as
supercoiled DNA. The radii of a supercoiled plasmid may be
determined by the plasmid size--i.e. a plasmid with a longer
backbone will form a larger supercoiled entity. In some cases, a
SNAP may comprise a plasmid with a backbone of between 5 kb and 150
kb. In some cases, a SNAP may comprise a plasmid with a backbone of
between 5 kb and 100 kb. In some cases, a SNAP may comprise a
plasmid with a backbone of between 5 kb and 90 kb. In some cases, a
SNAP may comprise a plasmid with a backbone of between 25 kb and 50
kb. In some cases, a SNAP may comprise a plasmid with a backbone of
at least about 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40
kb, 45 kb, 50 kb, 55 kb, 60 kb, 65 kb, 70 kb, 75 kb, 80 kb, 85 kb,
90 kb, 95 kb, 100 kb, 105 kb, 110 kb, 115 kb, 120 kb, 125 kb, 130
kb, 135 kb, 140 kb, 145 kb, or 150 kb. In some embodiments, SNAPs
may be imaged using an imaging platform, such as Nanocyte or
Leica.
[0188] In some cases, a SNAP may have a branched structure. For
example the SNAP may be a dendrimer. Some examples of dendrimers
may be found in Newkome, George R., and Carol D. Shreiner. "Poly
(amidoamine), polypropylenimine, and related dendrimers and
dendrons possessing different 1->2 branching motifs: an overview
of the divergent procedures." Polymer 49.1 (2008): 1-173. A
dendrimer used with the methods of this disclosure may be a G1, G2,
G3, G4, G5, G6, G7, G8, G9, G10, G11, G12, G13, G14, or G15
dendrimer. In some cases, the dendrimer may be higher than a G15
dendrimer, for example dendrimer between G15 and G30.
[0189] In some embodiments, the SNAP may be a protein, or comprised
of proteins. For example the SNAP may be a protein fibril. The SNAP
may be comprised of proteins known to form into fibrils, such as,
for example, the tau protein, or portions of the tau protein. A 31
residue portion of tau which assembles into fibrils is described in
Stohr, Jan, et al. "A 31-residue peptide induces aggregation of
tau's microtubule-binding region in cells." Nature chemistry 9.9
(2017): 874. In some cases, the SNAP may comprise tetratricopeptide
repeats. Examples of tetratricopeptide repeats may be found in
Blatch, Gregory L., and Michael Lassle. "The tetratricopeptide
repeat: a structural motif mediating protein-protein interactions."
Bioessays 21.11 (1999): 932-939. Other examples of proteins which
may assemble may be found in Speltz, Elizabeth B., Aparna Nathan,
and Lynne Regan. "Design of protein-peptide interaction modules for
assembling supramolecular structures in vivo and in vitro." ACS
chemical biology 10.9 (2015): 2108-2115.
[0190] In some embodiments, the SNAP may be a single molecule. In
some embodiments the SNAP may not be a single molecule. In some
cases, the SNAP may be assembled from several molecules which bind
non-covalently. For example the SNAP may be formed from two or more
nucleic acid molecules which hybridize together. In another example
the SNAP may be formed from two or more protein molecules which
assemble together via non-covalent bonds.
[0191] In some embodiments, the SNAPs are between about 50 nm and
about 100 um in diameter.
[0192] The SNAPs are generally polymeric molecules. These may be
grown through a controlled polymerization reaction, a stepwise
polymerization reaction, or a step by step synthesis method. The
growth of the SNAPs may be controlled by the amount of monomers
available, the length of time the reaction is allowed to proceed,
or the number of synthesis steps performed.
[0193] Each SNAP may have a diameter of at least about 10
nanometers (nm), or about 10 nm, about 50 nm, about 75 nm, about
100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm,
about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325
nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about
450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm,
about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675
nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about
800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm,
about 925 nm, about 950 nm, about 975 nm, about 1000 nm, about 1025
nm, about 1050 nm, about 1075 nm, about 1100 nm, about 1125 nm,
about 1150 nm, about 1175 nm, about 1200 nm, about 1225 nm, about
1250 nm, about 1275 nm, about 1300 nm, about 1325 nm, about 1350
nm, about 1375 nm, about 1400 nm, about 1425 nm, about 1450 nm,
about 1475 nm, about 1500 nm, about 1525 nm, about 1550 nm, about
1575 nm, about 1600 nm, about 1625 nm, about 1650 nm, about 1675
nm, about 1700 nm, about 1725 nm, about 1750 nm, about 1775 nm,
about 1800 nm, about 1825 nm, about 1850 nm, about 1875 nm, about
1900 nm, about 1925 nm, about 1950 nm, about 1975 nm, about 2000
nm, about 3000 nm, about 4000 nm, about 5000 nm, about 6000 nm,
about 7000 nm, about 8000 nm, about 9000 nm, about 10 m, about 15
m, about 20 m, about 25 m, about 30 m, about 40 m, about 50 m,
about 75 m, about 100 am, about 200 am, about 300 m, about 400 am,
about 500 am, or more than about 500 am. In some cases, the SNAP
may have a diameter between about 100 nm and 500 nm, between about
200 nm and about 400 nm, between about 500 nm and about 10 am, or
between about 1000 nm and about 10 m.
[0194] In some cases the SNAPs may be covalently attached to the
solid support using a click chemistry. Generally, the term "click
chemistry" is used to describe reactions that are high yielding,
wide in scope, create only byproducts that can be removed without
chromatography, are stereospecific, simple to perform, and can be
conducted in easily removable or benign solvents (McKay, C., &
Finn M. G. (2014) Click Chemistry in Complex Mixtures Bioorthogonal
Bioconjugation vol 21, Issue 9, pp 1075-1101; M. G. Meldal, M.,
& Tornoe, C. W. (2008). Cu-Catalyzed Azide-Alkyne
Cycloaddition. Chemical Reviews, 108(8), 2952-3015; Lutz, J., &
Zarafshani, Z. (2008). Efficient construction of therapeutics,
bioconjugates, biomaterials and bioactive surfaces using
azide-alkyne "click" chemistry. Advanced Drug Delivery Reviews,
60(9), 958-970., herein incorporated by reference).
[0195] In some cases, the click chemistry reaction may be a CuAAC,
SPAAC, SPANC, or as described elsewhere herein. In some cases, the
click chemistry reaction may need a copper source such as, for
example, CuSO.sub.4, Cu(0), CuBr(Ph.sub.3P).sub.3, CuBr,
CuBr/Cu(OAc).sub.2, CuBr.sub.2, [Cu(CH3CN)4]PF6, PS--NMe2:CuI,
silica:CuI, (EtO)3P:CuI, CuCl/Pd2(dba)3, CuBF4, CuCl, CuCl2,
Cu(AcO)2, Cu(2), TTA:CuSO4, Cu(1) zeolite (USY), Cu(CH3CN)4OTf,
CuOTf, Cu(2):bis-batho, or a combination thereof. In some cases a
copper source is not needed for the click chemistry reaction to
proceed. In some cases, the reducing agent of the click chemistry
reaction may be, for example, NaAsc, air, ICl, oxygen, N.sub.2,
HAsc, TCEP, dithithreitol (DTT), PPh.sub.3, mercaptoethanol,
tris(2-carboxyethyl)phosphine (TCEP), TCEPT-hydrochloric acid a
combination thereof, or no reducing agent. In some cases, the
solvent of the click chemistry reaction may be, for example, THF,
pyridine, DMSO, DMF, toluene, NMP, acetonitrile, water, tBuOH,
iBuOH, EtOH, MeOH, dioxane, dichloromethane, HEPES, NaCl buffer,
acetone, PBS, SFM, Tris buffer, borate buffer, PB, TFH, AcOEt,
PIPES, urea, acetone, Tris, saline, AllOCO.sub.2Me, TMS-N.sub.3,
urea solution, bicarbonate buffer, a combination thereof, or no
solution. In some cases, the base of the click chemistry reaction
may be, for example, DIPEA, Lut Na2CO3, iPr.sub.2NH, DBU,
Et.sub.3N, Et.sub.3N HCl, Et.sub.3NH+-OAc, K.sub.2CO.sub.3, TBAF,
CuSO.sub.4, PS--NMe.sub.2, piperidine, a desired pH, or a
combination thereof. In some cases, the ligand of the click
chemistry reaction may be, for example, TBTA, proline, BMAH, Lut,
chiral Lig's, pyridine, His, Batho, TTA, Bim, Phen, Bipy, PMDETA,
dNbipy, TRMEDA, or a combination thereof. In some cases, the
temperature of the click chemistry reaction may be, for example,
0-5.degree. C., 5-15.degree. C., 15-25.degree. C., 20-25.degree.
C., 25-35.degree. C., 35-45.degree. C., 45-55.degree. C.,
55-65.degree. C., 65-75.degree. C., 75-85.degree. C., 85-95.degree.
C., or greater. In some cases, the temperature of the click
chemistry reaction may be less than 0.degree. C. In some reactions,
the click chemistry reaction may be covered by aluminum foil. In
some cases, the click chemistry reaction may include an acid, for
example, trifluoroacetic acid, trichloroacetic acid, or
tribromoacetic acid.
[0196] In some cases, a crosslinker may be used for conjugation. In
some cases, the crosslinker may be a zero-length crosslinker,
homobifunctional crosslinker, heterobifunctional crosslinker, or a
trifunctional cross linker. Crosslinkers may be incorporated into a
biomolecule preformed or in-situ.
[0197] In some cases, zero-length crosslinkers mediate the
conjugation for bioconjugation by forming a bond containing no
additional atoms. Thus, one atom of a molecule is covalently
attached to an atom of a second molecule with no intervening linker
or spacer. In so conjugation schemes, the final complex is bound
together by virtue of chemical components that add foreign
structures to the substances being crosslinked. Carbodiimides may
be used to mediate the formation of amide linkages between
carboxylates and amines or phosphoramidate linkages between
phosphates and amines and are popular type of zero-length
crosslinker that may be used, being efficient in forming conjugates
between two protein molecules, between a peptide and a protein,
between an oligonucleotide and a protein, between a biomolecule and
a surface or particle, or any combination of these with small
molecules. In some cases, EDC (or EDAC;
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) may
be used for conjugating biomolecules containing carboxylates and
amines. In some cases, CMC, or 1-cyclohexyl-3-(2-morpholinoethyl)
carbodiimide (usually synthesized as the metho p-toluene sulfonate
salt), is a water soluble reagent used to form amide bonds between
one molecule containing a carboxylate and a second molecule
containing an amine that may be used as a crosslinker for
bioconjugation. In some cases, DIC, or diisopropyl carbodiimide may
be used for bioconjugation as a zero-length crosslinker. In some
cases, DCC (dicyclohexyl carbodiimide) may be used for
bioconjugation as a zero-length crosslinker. In some cases,
Woodward's reagent K is N-ethyl-3-phenylisoxazolium-3'-sulfonate, a
zero-length crosslinking agent able to cause the condensation of
carboxylates and amines to form amide bonds. In some cases, CDI, or
N,N'-carbonyl diimidazole may be used for bioconjugation as a
zero-length crosslinker. In some cases, schiff base formation and
reductive amination may be used for bioconjugation as a zero-length
cross linker.
[0198] In some cases, homobifuctional crosslinkers mediate the
conjugation for bioconjugation. In some cases, homofictuional NHS
esters may be used for bioconjugation. For example, Lomant's
reagent [(dithiobis(succinimidylpropionate), or DSP]) is a
homobifunctional NHS ester crosslinking agent containing an
eight-atom spacer 12 .ANG. in length. The sulfo-NHS version of DSP,
dithiobis(sulfosuccin-imidylpropionate) or DTSSP, is a water
soluble analog of Lomant's reagent that can be added directly to
aqueous reactions without prior organic solvent dissolution. In
some cases, disuccinimidyl suberate (DSS), an amine-reactive,
homobifunctional, NHS ester, crosslinking reagent produces an
eight-atom bridge (11.4 .ANG.) between conjugated biomolecules. In
some cases, disuccinimidyl tartarate (DST), a homobifunctional NHS
ester crosslinking reagent that contains a central diol that is
susceptible to cleavage with sodium periodate may be used forms
amide linkages with .alpha.-amines and F-amines of proteins or
other amine-containing molecules. In some cases, BSOCOES
[bis[2-(succinimidyloxycarbonyloxy)ethyl] sulfone], a
water-insoluble, homobifunctional NHS ester crosslinking reagent
that contains a central sulfone group, where the two NHS ester ends
are reactive with amine groups in proteins and other molecules to
form stable amide linkages. In some cases, ethylene
glycolbis(succinimidylsuccinate) (EGS), a homobifunctional
crosslinking agent that contains NHS ester groups on both ends. The
two NHS esters are amine reactive, forming stable amide bonds
between cross-linked molecules within a pH range of about 7 to 9.
In some cases, disuccinimidyl glutarate (DSG), a water-insoluble,
homobifunctional crosslinker containing amine-reactive NHS esters
at both ends, may be used for biconjugation. In some cases,
N,N'-Disuccinimidyl carbonate (DSC), the smallest homobifunctional
NHS ester crosslinking reagent available may be used. In some
cases, Dimethyl adipimidate (DMA), Dimethyl pimelimidate (DMP),
Dimethyl suberimidate (DMS), dimethyl 3,3'-dithiobispropionimidate
(DTBP), 1,4-di-[3'-(2'-pyridyldithio)propionamido] butane,
bismaleimidohexane, 1,5-difluoro-2,4-dinitrobenzene or
1,3-difluoro-4,6-dinitrobenzene, DFDNPS
(4,4'-difluoro-3,3'-dinitrophenylsulfone),
Bis-[.beta.-(4-azidosalicylamido)ethyl]disulfide (BASED),
formaldehyde, Glutaraldehyde, 1,4-butanediol diglycidyl ether,
adipic dihydrazide, carbohydrazide, 3,3'-dimethylbenzidine,
p-diaminodiphenyl, or haloacetyl derivatives may be used as
homobifunctional crosslinkers.
##STR00035##
[0199] In some cases, heterobifuctional crosslinkers mediate the
conjugation for bioconjugation. Heterobifunctional reagents can be
used to crosslink proteins and other molecules in a two- or
three-step process. In some cases, one protein is modified with a
heterobifunctional compound using the crosslinker's most reactive
or most labile end. The modified protein may then be purified from
excess reagent by gel filtration or rapid dialysis. In some cases,
heterobifunctionals contain at least one reactive group that
displays extended stability in aqueous environments, therefore
allowing purification of an activated intermediate before adding
the second molecule to be conjugated. For instance, an
N-hydroxysuccinimide (NHS ester-aleimide hetero-bifunctional can be
used to react with the amine groups of one protein through its NHS
ester end (the most labile functionality), while preserving the
activity of its maleimide functionality. Since the maleimide group
has greater stability in aqueous solution than the NHS ester group,
a maleimide-activated intermediate may be created. After a quick
purification step, the maleimide end of the crosslinker can then be
used to conjugate to a sulfhydryl-containing molecule.
Heterobifunctional crosslinking reagents may also be used to
site-direct a conjugation reaction toward particular parts of
target molecules. In some cases, amines may be coupled on one
molecule while sulfhydryls or carbohydrates are targeted on another
molecule. In some cases, heterobifunctional reagents containing one
photo-reactive end may be used to insert nonselectively into target
molecules by UV irradiation. Another component of
heterobifunctional reagents is the cross-bridge or spacer that ties
the two reactive ends together. Crosslinkers may be selected based
not only on their reactivities, but also on the length and type of
cross-bridge they possess. Some heterobifunctional families differ
solely in the length of their spacer. The nature of the
cross-bridge may also govern the overall hydrophilicity of the
reagent. For instance, polyethylene glycol (PEG)-based
cross-bridges create hydrophilic reagents that provide water
solubility to the entire heterobifunctional compound. In some
cases, a number of heterobifunctionals contain cleavable groups
within their cross-bridges, lending greater flexibility to the
experimental design. A few crosslinkers contain peculiar
cross-bridge constituents that actually affect the reactivity of
their functional groups. For instance, it is known that a maleimide
group that has an aromatic ring immediately next to it is less
stable to ring opening and loss of activity than a maleimide that
has an aliphatic ring adjacent to it. In addition, conjugates
destined for use in vivo may have different properties depending on
the type of spacer on the associated crosslinker. Some spacers may
be immunogenic and cause specific antibody production to occur
against them. In other instances, the half-life of a conjugate in
vivo may be altered by the choice of cross-bridge, especially when
using cleavable reagents. In some cases, the heterobifunctional
crosslinker may be N-succinimidyl 3-(2-pyridyldithio)propionate
(SPDP), standard SPDP, LC-SPDP, sulfo-LC-SPDP,
succinimidyloxycarbonyl-.alpha.-methyl-.alpha.-(2-pyri-dyldithio)
toluene,
succinimidyl-4-(N-maleimidomethyl)cyclo-hexane-1-carboxylate,
sulfosuccinimidyl-4-(N-maleimidomethyl) cyclohexane-1-carboxylate,
m-maleimidobenzoyl-N-hydroxysuccinimide ester,
m-maleimidobenzoyl-N-hydroxysulfo-succinimide ester,
N-succinimidyl(4-iodoacetyl)aminobenzoate,
sulfosuccinimidyl(4-iodoacetyl)amino-benzoate,
succinimidyl-4-(p-maleimidophenyl)butyrate,
N-(.gamma.-maleimidobutyryloxy)succinimide ester,
succinimidyl-3-(bromoacetamide)propionate, succinimidyl
iodoacetate, 4-(4-N-maleimidophenyl)butyric acid hydrazide,
4-(N-maleimidomethyl)cyclohexane-1-carboxyl-hydrazide,
3-(2-pyridyldithio)propionyl hydrazide,
N-hydroxysuccinimidyl-4-azidosalicylic acid,
sulfosuccinimidyl-2-(p-azidosalicylamido)
ethyl-1,3'-dithiopropionate,
N-hydroxysulfosuccinimidyl-4-azido-benzoate,
N-succinimidyl-6-(4'-azido-2'-nitropheny-lamino)hexanoate,
sulfosuccinimidyl-6-(4'-azido-2'-nitrophenylamino)hexanoate,
N-5-Azido-2-nitrobenzoyloxysuccinimide,
Sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3'-dithiopropionat-
e, N-succinimidyl-(4-azidophenyl)1,3'-dithiopropionate,
sulfosuccinimidyl 4-(p-azidophenyl) butyrate, Sulfosuccinimidyl
2-(7-azido-4-methylcoumarin-3-acetamide)ethyl-1,3'-dithiopropionate,
sulfosuccinimidyl 7-azido-4-methylcoumain-3-acetate, p-Nitrophenyl
diazopyruvate, p-nitrophenyl-2-diazo-3,3,3-trifluoropropionate,
1-(p-azidosalicylamido)-4-(iodoacetamido)butane,
N-[4-(p-azidosalicylamido)butyl]-3'-(2'-pyridyldithio)
propionamide, Benzophenone-4-maleimide, p-azidobenzoyl hydrazide,
4-(p-azidosalicylamido)butylamine, or p-azidophenyl glyoxal.
##STR00036##
[0200] Other examples of crosslinkers, but not limited to, may be
NHS-PEG.sub.4-Azide, NHS-phosphine,
N-7-maleimidobutyryl-oxysulfosuccinimide ester,
m-maleimidobenzoyl-N-hydroxysuccinimide ester, sulfosuccinimidyl
(4-iodoacetyl)aminobenzoate, succinimidyl
3-(2-pyridyldithio)propionate), sulfosuccinimidyl
(4-iodoacetyl)aminobenzoate,
m-maleimidobenzoyl-N-hydroxysuccinimide ester,
1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride,
dimethyl pimelimidate, sulfosuccinimidyl
6-(3'-(2-pyridyldithio)propionamido)hexanoate,
6-(3'-[2-pyridyldithio]-propionamido)hexanoate,
tris-(succinimidyl)aminotriacetate, Sulfo-NHS-LC-Diazirine,
bismaleimidohexane, 1,4-bismaleimidobutane, sulfosuccinimidyl
4-(N-maleimidophenyl)butyrate, Sulfo-SBED Biotin Label Transfer
Reagent, succinimidyl 6-(3(2-pyridyldithio)propionamido)hexanoate,
succinimidyl 3-(2-pyridyldithio)propionate, sulfosuccinimidyl
6-(3'-(2-pyridyldithio)propionamido)hexanoate, L-Photo-Leucine,
L-Photo-Methionine, sulfosuccinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carboxylate, Pierce BS(PEG)5,
sulfosuccinimidyl
2-((4,4'-azipentanamido)ethyl)-1,3'-dithiopropionate,
Sulfo-NHS--SS-Diazirine, Pierce SM(PEG)n, NHS-dPEG-Mal,
N-hydroxysulfosuccinimide, sulfosuccinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carboxylate,
Sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate,
1-Ethyl-3-(3-Dimethylaminopropyl)carbodiimide Hydrochloride,
N-.alpha.-maleimidoacet-oxysuccinimide ester, Sulfo-NHS-LC-Biotin,
bis(sulfosuccinimidyl)suberate,
trans-4-(maleimidylmethyl)cyclohexane-1-Carboxylate,
bismaleimidohexane, 1,8-bismaleimido-diethyleneglycol,
N-.beta.-maleimidopropionic acid hydrazide, N-succinimidyl
3-(2-pyridyldithio)-propionate, sulfosuccinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carboxylate,
3-(2-pyridyldithio)propionyl hydrazide,
4-(4-N-maleimidophenyl)butyric acid hydrazide,
3,3'-dithiobis(sulfosuccinimidyl propionate, bis(sulfosuccinimidyl)
2,2,4,4-glutarate-d4, or
Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate.
[0201] In some cases, the alkyne derivative attached to the solid
support or SNAP may be, for example, dibenzocyclooctyne-amine,
dibenzocyclooctyne-acid, dibenzocyclooctyne-N-hydroxysuccinimidyl
ester, dibenzocyclooctyne-N-hydroxysuccinimidyl ester,
dibenzocyclooctyne-sulfo-N-hydroxysuccinimidyl ester,
ibenzocyclooctyne-sulfo-N-hydroxysuccinimidyl ester,
Dibenzocyclooctyne-S--S--N-hydroxysuccinimidyl ester,
dibenzocyclooctyne-PEG4-N-hydroxysuccinimidyl ester,
dibenzocyclooctyne-PEG4-acid, dibenzocyclooctyne-maleimide,
sulfo-dibenzocyclooctyne-biotin conjugate,
(1R,8S,9s)-Bicyclo[6.1.0]non-4-yn-9-ylmethyl N-succinimidyl
carbonate, (1R,8S,9s)-Bicyclo6.1.0non-4-yn-9-ylmethanol, APN-BCN,
(1R,8S,9s)-Bicyclo6.1.0non-4-yn-9-ylmethanol, ethyl
(1R,8S,9s)-bicyclo6.1.0non-4-ene-9-carboxylate, Alkyne-PEG5-acid,
(R)-3-Amino-5-hexynoic acid hydrochloride, (S)-3-Amino-5-hexynoic
acid hydrochloride, (R)-3-(Boc-amino)-5-hexynoic acid,
(S)-3-(Boc-amino)-5-hexynoic acid, N-Boc-4-pentyne-1-amine,
4-pentyne-1-amine, Boc-propargyl-Gly-OH, 3-Ethynylaniline,
4-Ethynylaniline, PC biotin-alkyne, Propargyl chloroformate,
Propargyl-N-hydroxysuccinimidyl ester, N--Z-4-pentyne-1-amine,
1-Azido-2-(2-(2-ethoxyethoxy)ethoxy)ethane,
0-(2-Azidoethyl)heptaethylene glycol, Click-iT.RTM. DIBO-Alexa
Fluor.RTM. 488, Click-iT.RTM. DIBO-Alexa Fluor.RTM. 555,
Click-iT.RTM. DIBO-Alexa Fluor.RTM. 594, Click-iT.RTM. DIBO-Alexa
Fluor.RTM. 647, Click-iT.RTM. DIBO TAMRA, Click-iT.RTM.
DIBO-biotin, Click-iT.RTM. DIBO-amine, Click-iT.RTM.
DIBO-maleimide, Click-iT.RTM. DIBO-succinimidyl ester, Alexa
Fluor.RTM. 488 alkyne, Alexa Fluor.RTM. 555 alkyne,
triethylammonium salt, Alexa Fluor.RTM. 594 carboxamido-(5-(and
6-)propargyl), bis(triethylammonium salt, 3-propargyloxypropanoic
acid, succinimidyl ester, biotin alkyne, tetraacetyl fucose alkyne,
Oregon Green.RTM. 488 alkyne *6-isomer*, iodoacetamide alkyne, or
5-carboxytetramethylrhodamine propargylamide.
[0202] In some cases, the azide derivative attached to a solid
support, SNAP, or biomolecule may be, for example,
(S)-5-Azido-2-(Fmoc-amino)pentanoic acid,
(S)-(-)-2-Azido-6-(Boc-amino)hexanoic acid (dicyclohexylammonium),
(S)-2-Azido-3-(4-tert-butoxyphenyl)propionic acid
cyclohexylammonium salt, L-Azidohomoalanine hydrochloride, (S)-2
Azido-3-(3-indolyl)propionic acid cyclohexylammonium salt,
(S)-2-Azido-3-methylbutyric acid cyclohexylammonium salt,
(S)-2-Azido-3-phenylpropionic acid (dicyclohexylammonium) salt,
Boc-3-azido-Ala-OH (dicyclohexylammonium) salt,
N-Boc-4-azido-L-homoalanine (dicyclohexylammonium) salt,
N-Boc-6-azido-L-norleucine (dicyclohexylammonium) salt,
Boc-4-azido-Phe-OH, (S)-(-)-4-tert-Butyl hydrogen 2-azidosuccinate
(dicyclohexylammonium) salt,
N2-[(1,1-Dimethylethoxy)carbonyl]-N6-[(2-propynyloxy)carbonyl]-L-lysine,
Fmoc-.beta.-azido-Ala-OH,
2-Acetamido-2-deoxy-.beta.-D-glucopyranosyl azide,
2-Acetamido-2-deoxy-.beta.-D-glucopyranosyl azide 3,4,6-triacetate,
2-Acetamido-3,4,6-tri-O-benzyl-2-deoxy-.beta.-D-glucopyranosyl
azide, N-Azidoacetylgalactosamine-tetraacylated,
N-Azidoacetylglucosamine, N-Azidoacetylglucosamine-tetraacylated,
6-Azido-6-deoxy-1,2:3,4-di-O-isopropylidene-.alpha.-D-galactopyranose,
1-Azido-1-deoxy-.beta.-D-galactopyranoside,
1-Azido-1-deoxy-.beta.-D-galactopyranoside tetraacetate,
6-Azido-6-deoxy-D-galactose,
1-Azido-1-deoxy-.beta.-D-glucopyranoside,
2-Azido-2-deoxy-D-glucose, 6-Azido-6-deoxy-D-glucose,
1-Azido-1-deoxy-.beta.-D-lactopyranoside,
3-Azido-2,3-dideoxy-1-O-(tert-butyldimethylsilyl)-3-D-arabino-hexopyranos-
e, 2-Azido-D-galactose tetraacetate,
1,2-Di-O-acetyl-3-azido-3-deoxy-5-.beta.-(p-toluoyl)-D-ribofuranose,
.alpha.-D-Mannopyranosyl azide tetraacetate,
2,3,4,6-Tetra-O-acetyl-1-azido-1-deoxy-.alpha.-D-galactopyranosyl
cyanide, 2,3,4-Tri-O-acetyl-.beta.-D-xylopyranosyl azide,
3'-Azido-3'-deoxythymidine, .gamma.-(2-Azidoethyl)-ATP sodium salt
solution, .gamma.-[(6-Azidohexyl)-imido]-ATP sodium salt,
(2'S)-2'-Deoxy-2'-fluoro-5-ethynyluridine,
5-Ethynyl-2'-deoxycytidine, N6-Propargyl-ATP sodium salt,
4-Acetamidobenzenesulfonyl azide,
(E)-N-(2-Aminoethyl)-4-{2-[4-(3-azidopropoxy)phenyl]diazenyl}benzamide
hydrochloride, Azidoacetic acid NHS ester, 1-Azidoadamantane,
4-Azidoaniline hydrochloride,
(4S)-4-[(1R)-2-Azido-1-(benzyloxy)ethyl]-2,2-dimethyl-1,3-dioxolane,
NHS-PEG.sub.4-azide,
[3aS-(3a.alpha.,4.alpha.,5.beta.,7a.alpha.)]-5-Azido-7-bromo-3a,4,5,7.alp-
ha.-tetrahydro-2,2-dimethyl-1,3-benzodioxol-4-ol,
3'-Azido-3'-2-azido-1-methylquinolinium tetrafluoroborate,
5-Azidopentanoic acid, 4-Azidophenacyl bromide, 4-Azidophenyl
isothiocyanate, 3-(4-Azidophenyl)propionic acid,
3-Azido-1-propanamine, 3-Azido-1-propanol, Azo biotin-azide, Biotin
picolyl azide, tert-Butyl
2-(4-{[4-(3-azidopropoxy)phenyl]azo}benzamido)ethylcarbamate,
4-Carboxybenzenesulfonazide, 7-(Diethylamino)coumarin-3-carbonyl
azide, Ethidium bromide monoazide, Ethyl azidoacetate,
4-Methoxybenzyloxycarbonyl azide, aryl azides, diazierines, or
O-(2-Aminoethyl)-O'-(2-azidoethyl)heptaethylene glycol,
bromoacetomido-PEG.sub.3-azide, iodoacetamide-azide, Alexa
Fluor.RTM. 488 azide, Alexa Fluor.RTM. 488
5-carboxamido-(6-azidohexanyl), bis(triethylammonium salt), Alexa
Fluor.RTM. 555 azide triethylammonium salt, Alexa Fluor.RTM. 594
carboxamido-(6-azidohexanyl), bis(triethylammonium salt), Alexa
Fluor.RTM. 647 azide triethylammonium salt,
3-(azidotetra(ethyleneoxy))propionic acid succinimidyl ester,
biotin azide, L-azidohomoalanine, L-homopropargylglycine,
Click-iT.RTM. farnesyl alcohol azide, 15-azidopentadecanoic acid,
12-azidododecanoic acid, tetraacetylated
N-azidoacetylgalactosamine, tetraacetylated
N-azidoacetyl-D-mannosamine, tetraacetylated
N-azidoacetylglucosamine, iodoacetamide azide, or
tetramethylrhodamine 5-carboxamido-(6-azidohexanyl).
[0203] In some cases, the SNAPs may be covalently attached to the
solid support using an inherent chemistry of the SNAP. In some
cases, the solid support may be covered with functional groups that
may be reactive to the SNAP. These functional groups, for example,
may be hydroxyl, carbonyl, carboxyl, amino, amides, azides,
alkynes, alkenes, phosphates, sulfhydryl, thiols, isothiocyanates,
isocyanates, acyl azides, NHS esters, silane, sulfonyl chlorides,
aldehydes, esters, glyoxals, epoxides, oxiranes, alkanethiols,
carbonates, aryl halides, imidoesters, carbodiimides, anhydrides,
fluorophenyl esters, amines, thymines or a combination thereof. In
some cases, the SNAP may have a functional group that may react
with a functional group on the solid support to form a covalent
bond. For example, a DNA SNAP may be attached to a solid support by
reacting one or more thymines in the DNA with amines on the solid
support. For example, the --NH.sub.2 at the N-terminus of a
polypeptide chain or --COOH at the C-terminus of a polypeptide
chain may react with an appropriate functional group and be
attached to the solid support through a covalent bond. In some
cases, for example, the functional group of a SNAP may be hydroxyl,
carbonyl, carboxyl, amino, amides, azides, alkynes, silane,
alkenes, phosphates, sulfhydryl, thiols, isothiocyanates,
isocyanates, acyl azides, NHS esters, sulfonyl chlorides,
aldehydes, esters, glyoxals, epoxides, oxiranes, alkanethiols,
carbonates, aryl halides, imidoesters, carbodiimides, anhydrides,
fluorophenyl esters, amines, thymines or a combination thereof.
Other bioconjugation processes, reactions, and functional groups
are described elsewhere within that may be used to attach a SNAP to
a solid support. Such a reaction could be spontaneous, or could be
induced by application of heat or ultraviolet radiation.
[0204] In some cases, silane chemistry may be employed for
bioconjugation. In some cases, functional silane compounds
containing an organofunctional or organo-reactive arm can be used
to conjugate biomolecules to inorganic substrates. The appropriate
selection of the functional or reactive group for a particular
application can allow the attachment of proteins, oligonucleotides,
whole cells, organelles, or even tissue sections to substrates. The
organosilanes used for these applications may include functional or
reactive groups such as hydroxyl, amino, aldehyde, epoxy,
carboxylate, thiol, and even alkyl groups to bind molecules through
hydrophobic interactions. In some cases,
3-Aminopropyltriethoxysilane (APTS) and
3-Aminopropyltrimethoxysilane are used to create a functional group
on an inorganic surface or particle. In some cases, once deposited
on a substrate, the alkoxy groups form a covalent polymer coating
with the primary amine groups sticking off the surface and
available for subsequent conjugation. Carboxyl- or
aldehyde-containing ligands may be directly coupled to the
aminopropyl groups using a carbodiimide reaction or reductive
amination. In some cases, alternatively, surfaces initially
derivatized with an aminopropylsilane compound can be modified
further with spacer arms or crosslinkers to create reactive groups
for coupling affinity ligands or biomolecules. For instance, the
amine groups may be derivatized with an NHS-PEGn-azide compound for
use in click chemistry or Staudinger ligation reactions for linking
proteins or other biomolecules. In some cases, APTS-modified
surfaces may be further derivatized with amine-reactive
crosslinkers to create additional surface characteristics and
reactivity. Modification with NHS-PEG4-azide forms a hydrophilic
PEG spacer terminating in an azido group that can be used in a
click chemistry or Staudinger ligation reaction to couple other
molecules.
[0205] In some cases, other crosslinking agents that contain an
amine-reactive group on one end also may be used to modify and
activate the APTS-modified substrate. Surfaces may be designed to
contain, for instance, reactive hydrazine or aminooxy groups for
conjugation with carbonyl-containing molecules, such as aldehydes
formed through periodate oxidation of carbohydrates or natively
present at the reducing end of sugars and glycans.
[0206] In some cases, the amine groups on ATPS surfaces may be
acylated using glutaric anhydride to create carboxylate
functionalities, which were then activated with NHS/DCC to form the
NHS ester. This derivative could be used to couple amine-containing
proteins and other molecules via amide bond formation. In a second
activation strategy, the aminopropyl groups on the surface were
activated with 1,4-phenylenediisothiocyanate (PDITC) to create
terminal isothiocyanate groups for coupling amines. Both methods
resulted in the successful coupling of amine-dendrimers to silica
surfaces for use in arrays. In some cases, amine surfaces prepared
using an aminosilane compound can be modified to contain
carboxylate groups using the following protocol involving the
reaction with an anhydride, such as succinic anhydride or glutaric
anhydride. After modification, the carboxylates then can be used to
couple amine-containing molecules using a carbodiimide reaction
with EDC plus sulfo-NHS. In some cases, modification of an APTS
surface with glutaric anhydride creates terminal carboxylates for
coupling of amine-containing ligands which may be used for
bioconjugation.
[0207] In some cases, aminosilane surfaces also may be activated by
use of a bifunctional crosslinker to contain reactive groups for
subsequent coupling to biomolecules. In one such reaction,
N,N'-disuccinimidyl carbonate (DSC) was used to react with the
amines on a slide surface and create terminal NHS-carbonate groups,
which then could be coupled to amine-containing molecules, which
may be used for bioconjugation. In some cases, APTS-modified
surfaces can be activated with DSC to form amine-reactive
succinimidyl carbonates for coupling proteins or other
amine-containing molecules.
[0208] In some cases, silane coupling agents containing carboxylate
groups may be used to functionalize a surface with carboxylic acids
for subsequent conjugation with amine-containing molecules. For
example, carboxyethylsilanetriol contains an acetate organo group
on a silanetriol inorganic reactive end. The silanetriol component
is reactive immediately with inorganic --OH substrates without
prior hydrolysis of alkoxy groups, as in the case with most other
silanization reagents. In some cases, carboxyethylsilanetriol has
been used to add carboxylate groups to fluorescent silica
nanoparticles to couple antibodies for multiplexed bacteria
monitoring. This reagent can be used in similar fashion to add
carboxylate functionality to many inorganic or metallic
nano-materials, which also will create negative charge repulsion to
maintain particle dispersion in aqueous solutions. In some cases,
covalent coupling to the carboxylated surface then can be done by
activation of the carboxylic acid groups with a carbodiimide to
facilitate direct reaction with amine-containing molecules or to
form intermediate NHS esters, which may be used for bioconjugation.
In some cases, carboxylethylsilanetriol can be used to modify an
inorganic substrate to containing carboxylate groups for coupling
amine-containing ligands.
[0209] In some cases, silane modification agents such as glycidoxy
may be utilized for bioconjugation to a surface substrate.
Glycidoxy compounds contain reactive epoxy groups. Surfaces
covalently coated with these silane coupling agents can be used to
conjugate thiol-, amine-, or hydroxyl-containing ligands, depending
on the pH of the reaction. In some cases,
3-glycidoxy-propyltrimethoxysilane (GOPTS) or
3-glycidoxypro-pyltriethoxysilane can be used to link inorganic
silica or other metallic surfaces containing --OH groups with
biological molecules containing any three of these major functional
groups. In some cases, epoxy-containing silane coupling agents form
reactive surfaces that can be used to couple amine-, thiol-, or
hydroxyl-containing ligands which may be used for
bioconjugation.
[0210] In some cases, the reaction of the epoxide with a thiol
group yields a thioether linkage, whereas reaction with a hydroxyl
gives an ether and reaction with an amine results in a secondary
amine bond. The relative reactivity of an epoxy group is
thiol>amine>hydroxyl, and this is reflected by the optimal pH
range for each reaction. In this case, the lower the reactivity of
the functional group the higher the pH required to drive the
reaction efficiently.
[0211] In some cases, isocyanates groups may be utilized for
bioconjugation to a surface support. Isocyanate groups are
extremely reactive toward nucleophiles and will hydrolyze rapidly
in aqueous solution which are especially useful for covalent
coupling to hydroxyl groups under nonaqueous conditions, which is
appropriate for conjugation to many carbohydrate ligands.
Silanization can be accomplished in dry organic solvent to form
reactive surfaces while preserving the activity of the isocyanates.
Isocyanatopropyltriethoxysilane (ICPTES) contains an isocyanate
group at the end of a short propyl spacer, which is connected to
the triethoxysilane group useful for attachment to inorganic
substrates. In some cases, the isocyanate-containing silane
coupling magnet can be used to couple hydroxyl-containing molecules
to inorganic surfaces which may be used for bioconjugation.
[0212] In some cases, ICPTES may be used to create novel
chitosan-siloxane hybrid polymers by coupling the isocyanate groups
to the functional groups of the carbohydrate and forming a silica
polymer using the triethoxysilane backbone. In some cases, ICPTES
and APTS have been used in combination to create organically
modified silica xerogels through carboxylic acid solvolysis that
formed hybrid materials with luminescent properties.
[0213] In some cases, nanoparticles or microparticles may be
utilized as a surface support for bioconjugation. In some cases,
particle types and compositions of almost limitless shape and size,
including spherical, amorphous, or aggregate particles, as well as
elaborate geometric shapes like rods, tubes, cubes, triangles, and
cones. In addition, new symmetrical organic constructs have emerged
in the nanometer range that include fullerenes (e.g., Bucky-balls),
carbon nanotubes, and dendrimers, which are highly defined
synthetic structures used as bioconjugation scaffolds. The chemical
composition of particles may be just as varied as their shape.
Particles can comprise of polymers or copolymers, inorganic
constructs, metals, semiconductors, superparamagnetic composites,
biodegradable constructs, synthetic dendrimers, and dendrons.
Polymeric particles can be constructed from a number of different
monomers or copolymer combinations. Some of the more common ones
include polystyrene (traditional "latex" particles),
poly(styrene/divinylbenzene) copolymers, poly(styrene/acrylate)
copolymers, polymethylmethacrylate (PMMA), poly (hydroxyethyl
methacrylate) (pHEMA), poly (vinyltoluene), poly(styrene/butadiene)
copolymers, and poly(styrene/vinyltoluene) copolymers. In some
cases, by mixing into the polymerization reaction combinations of
functional monomers, one can create reactive or functional groups
on the particle surface for subsequent coupling to affinity
ligands. One example of this is a poly(styrene/acrylate) copolymer
particle, which creates carboxylate groups within the polymer
structure, the number of which is dependent on the ratio of
monomers used in the polymerization process. In some cases,
inorganic particles are used extensively in various
bioapplications. For example, gold nanoparticles may be used for
detection labels for immunohistochemical (IHC) staining and lateral
flow diagnostic testing. In some cases, the use of particles in
bioapplications like bioconjugation involves the attachment of
affinity capture ligands to their surface, by either passive
adsorption or covalent coupling. The coupling of an affinity ligand
to such particles creates the ability to bind selectively
biological targets in complex sample mixtures. The affinity
particle complexes can thus be used to separate and isolate
proteins or other biomolecules or to specifically detect the
presence of these targets in cells, tissue sections, lysates, or
other complex biological samples. In some cases, the reactions used
for coupling affinity ligands to nanoparticles or microparticles
are basically the same as those used for bioconjugation of
molecules described herein.
[0214] In some cases, particle type used for bioapplications (e.g.
bioconjugation) is the polymeric microsphere or nano-sphere, which
comprises a spherical, nonporous, "hard" particle made up of long,
entwined linear or crosslinked polymers. In some cases, creation of
these particles involves an emulsion polymerization process that
uses vinyl monomers, sometimes in the presence of divinyl
crosslinking monomers. In some cases, larger microparticles may be
built from successive polymerization steps through growth of much
smaller nanoparticle seeds. In some cases, polymeric particles
comprise of polystyrene or copolymers of styrene, like
styrene/divinylbenzene, styrene/butadiene, sty-rene/acrylate, or
styrene/vinyltoluene. Other common polymer supports include
polymethylmethacrylate (PMMA), polyvinyltoluene, poly(hydroxyethyl
meth-acrylate) (pHEMA), and the copolymer poly(ethylene glycol
dimethacrylate 2-hydroxyethylmetacrylate) [poly(EGDMA/HEMA)].
[0215] In some cases, one method of attaching biomolecules to
hydrophobic polymeric particles is the use of passive adsorption.
In some cases, protein adsorption onto hydrophobic particles takes
place through strong interactions of nonpolar or aromatic amino
acid residues with the surface polymer chains on the particles with
concomitant exclusion of water molecules. Since proteins usually
contain hydrophobic core structures with predominately hydrophilic
surfaces, their interaction with hydrophobic particles must involve
significant conformational changes to create large-scale
hydrophobic contacts.
[0216] In some cases, particle types contain functional groups that
are built into the polymer backbone and displayed on their surface.
The quantity of these groups can vary widely depending on the type
and ratios of monomers used in the polymerization process or the
degree of secondary surface modifications that have been performed.
In some cases, functionalized particles can be used to couple
covalently biomolecules through the appropriate reaction
conditions.
##STR00037##
Common Functional Groups or Reactive Groups on Particles for
Bioconjugation
[0217] In some cases, a particle may couple with a crosslinker for
bioconjugation.
[0218] In some cases, the rate of attachment of DNA SNAPs s to the
solid support, or the efficacy or strength of attachment, may be
altered by altering the sequence of DNA comprising the SNAP. For
example, in the case of a DNA SNAP attached to a solid support by a
reaction involving one or more thymines the attachment may be
varied by varying the number of thymines in the DNA sequence. In
some cases, increasing the number of thymines may facilitate the
attachment of the SNAP to the solid support.
[0219] In some cases, the solid support is a part of a flow cell.
In some cases, the SNAPs may be attached to a solid support in a
flow cell. In some cases, the SNAPs may be directly conjugated to a
solid support in a flow cell. In some cases, the SNAPs may be
adsorbed to a solid support in a flow cell. Attaching the SNAPs in
the flow cell may allow visualization of the SNAPs as they attach
to the solid support. The attachment of the SNAPs may be optimized
by monitoring the number of attached SNAPs compared to the number
of attachment sites during the attachment process. In some cases,
the attachment of the SNAPs may be optimized by monitoring the area
of the solid support covered by the SNAPs and the area of the solid
support that is unoccupied by the SNAPs during the attachment
process.
[0220] In some cases, the SNAPs may be conjugated directly in a
flow cell. In some cases, the SNAPs may be conjugated to a surface
within the flow cell. In some cases, the SNAPs may be conjugated to
a surface within the flow cell before being conjugated to the
biological or chemical entities. In some cases, a biological or
chemical entity may be flowed into a flow cell and conjugated to a
SNAP that is already conjugated to the solid support. In some
cases, a biological or chemical entity may be conjugated to a SNAP
before the SNAP is introduced into a flow cell and conjugated to a
solid support in a flow cell. In some cases, a biological or
chemical entity and a SNAP may be introduced into a flow cell and
conjugated to each other within the flow cell, before the SNAP is
conjugated to a solid support within the flow cell.
[0221] In some cases, the biological or chemical entities may be
conjugated to the SNAPs prior to attaching the SNAPs to a solid
support. After performing such a reaction the products may be
purified to separate out conjugated SNAP-biological/chemical entity
moieties from unconjugated SNAPs and biological/chemical
entities.
[0222] The methods of this disclosure may be used to spatially
separate biological or chemical entities. In some embodiments,
methods of this disclosure may be used to spatially separate
proteins, small molecules, DNAs, RNAs, glycoproteins, metabolites,
carbohydrates, enzymes, or antibodies. In some embodiments, methods
of this disclosure may be used to spatially separate complexes,
such as protein complexes comprising two or more proteins, protein
nucleic acid complexes, or other complexes. In some cases, the
methods may be used to spatially separate viral particles or
viroids. In some cases, the methods may be used to separate cells,
such as bacterial cells, microbial cells, mammalian cells or other
cells.
[0223] In some embodiments, the SNAP may be formed on the seed
prior to the seed being attached to the biological or chemical
entity.
[0224] In some embodiments this disclosure provides a composition
comprising a nucleic acid SNAP attached to a protein, a nucleic
acid SNAP attached to a small molecule, a nucleic acid SNAP
attached to a protein complex, a nucleic acid SNAP attached to a
protein nucleic acid SNAP, a nucleic acid SNAP attached to a
carbohydrate, a nucleic acid SNAP attached to a viral particle or a
nucleic acid SNAP attached to a cell.
[0225] In some embodiments this disclosure provides a composition
comprising a dendrimer attached to a protein, a dendrimer attached
to a small molecule, a dendrimer attached to a protein complex, a
dendrimer attached to a protein dendrimer, a dendrimer attached to
a carbohydrate, a dendrimer attached to a viral particle or a
dendrimer attached to a cell.
[0226] In some cases, the biological or chemical entities may be
eluted from the solid support either by cleaving a photo-cleavable
bond, or by chemically or enzymatically digesting the SNAP.
[0227] In some cases, the biological or chemical entities may
attach to the solid support directly, while the SNAPs occlude other
biological or chemical entities from attaching in the immediate
vicinity. In some cases the biological or chemical entities may
attach directly to an attachment site within a microwell or
nanowell, and the size of the SNAPs may be selected to prevent more
than one SNAP from occupying the microwell or nanowell. In such
cases, the SNAP may be removed, either by cleaving a
photo-cleavable bond, or by chemically or enzymatically digesting
the SNAP.
[0228] In some embodiments, SNAPs of this disclosure may be used as
nanoparticles. For example, SNAPs of this disclosure may be used as
nanoparticles for detection or visualization. In some cases, a
nucleic acid SNAP may be formed which incorporates modified
nucleotides which comprise fluorescent moieties. Any fluorescently
labeled nucleotide known in the art may be used in a SNAP of this
disclosure. Examples of fluorescently labeled nucleotides include,
but are not limited to, Alexa Fluor.TM. 555-aha-dCTP, Alexa
Fluor.TM. 555-aha-dUTP, 1 mM in TE buffer, Alexa Fluor.TM. 647 ATP
(Adenosine 5'-Triphosphate, Alexa Fluor.TM. 647
2'-(or-3')-O--(N-(2-Aminoethyl) Urethane), Hexa(Triethylammonium)
Salt), Alexa Fluor.TM. 647-aha-dCTP, Alexa Fluor.TM. 647-aha-dUTP,
1 mM in TE buffer, BODIPY.TM. FL ATP (Adenosine 5'-Triphosphate,
BODIPY.TM. FL 2'-(or-3')-O--(N-(2-Aminoethyl)Urethane), Trisodium
Salt), 5 mM in buffer, BODIPY.TM. FL ATP-7-S, Thioester (Adenosine
5'-O-(3-Thiotriphosphate), BODIPY.TM. FL Thioester, Sodium Salt),
BODIPY.TM. FL GDP (Guanosine 5'-Diphosphate, BODIPY.TM. FL
2'-(or-3')-O--(N-(2-Aminoethyl) Urethane), Bis (Triethylammonium)
Salt), ChromaTide.TM. Alexa Fluor.TM. 488-5-UTP, ChromaTide.TM.
Alexa Fluor.TM. 488-5-dUTP, ChromaTide.TM. Alexa Fluor.TM.
546-14-UTP, ChromaTide.TM. Alexa Fluor.TM. 546-14-dUTP,
ChromaTide.TM. Alexa Fluor.TM. 568-5-dUTP, ChromaTide.TM. Alexa
Fluor.TM. 594-5-dUTP, ChromaTide.TM. Fluorescein-12-dUTP,
ChromaTide.TM. Texas Red.TM.-12-dUTP, Fluorescein-12-dUTP Solution
(1 mM), Fluorescein-aha-dUTP--1 mM in TE Buffer, Guanosine
5'-O-(3-Thiotriphosphate), BODIPY.TM. FL Thioester, Sodium Salt
(BODIPY.TM. FL GTP-7-S, Thioester), Guanosine 5'-Triphosphate,
BODIPY.TM. FL 2'-(or-3')-O--(N-(2-Aminoethyl) Urethane), Trisodium
Salt (BODIPY.TM. FL GTP), Guanosine 5'-Triphosphate, BODIPY.TM. TR
2'-(or-3')-O--(N-(2-Aminoethyl) Urethane), Trisodium Salt
(BODIPY.TM. TR GTP), MANT-ADP (2'-(or-3')-O--(N-Methylanthraniloyl)
Adenosine 5'-Diphosphate, Disodium Salt), MANT-ATP
(2'-(or-3')-O--(N-Methylanthraniloyl) Adenosine 5'-Triphosphate,
Trisodium Salt), MANT-GDP (2'-(or-3')-O--(N-Methylanthraniloyl)
Guanosine 5'-Diphosphate, Disodium Salt), MANT-GMPPNP
(2'-(or-3')-O--(N-Methylanthraniloyl)-.beta.:.gamma.-Imidoguanosine
5'-Triphosphate, and Trisodium Salt), MANT-GTP
(2'-(or-3')-O--(N-Methylanthraniloyl) Guanosine 5'-Triphosphate,
Trisodium Salt).
[0229] In some cases, a SNAP of this disclosure may be designed
such that probes may be attached onto the surface of the SNAP. A
SNAP with attached probes may be used as a detection reagent. In
some cases, a SNAP with attached probes is also labeled with
fluorescent moieties to form a fluorescent detection reagent. In
some cases, a SNAP with attached probes and fluorescent moieties
may provide a high degree of signal amplification. The amount of
probes on the SNAP may be titrated to achieve a desired degree of
sample amplification. In some cases, differently sized SNAPs may be
attached to different probes. In some cases, differently colored
SNAPs may be attached to different probes. In some cases a library
of different probes may be attached to fluorescently labeled SNAPs
such that a first probe is attached to a SNAP which is a different
size and/or color from a SNAP each other probe is attached to.
EXAMPLES
Example 1--Generation of DNA SNAPs
[0230] Oligos were reconstituted in dH20 to a final concentration
of 100 uM with the exception of the extension primer which was
reconstituted to 500 uM (2.9 mg/ml). The extension primer was
conjugated to Deep Red 200 nm bead.
TABLE-US-00001 Primer 1- (SEQ ID NO: 1)
5'-GCCAGGGTGCGAGGGTTTGTTTCATTGC TTCACGCCCTTACCCTCGCACCCTGGCACGG
Primer 2- (SEQ ID NO: 2) 5'-TCCCACGGTGGCACCTCGCACCT Primer 3- (SEQ
ID NO: 3) 5'-CGCACGCTGCCACCCTCGCTTTTGCGAG GGTGGCAGCGT Primer 4-
(SEQ ID NO: 4) 5'-GCGAGGTGCGAGGTGCCACCGTGGGACC GT Extension Primer-
(SEQ ID NO: 5) 5'-AAGGGCGTGAAGCAATGA
Amplification of Template
[0231] The following submixes were prepared:
[0232] Submix 1:
TABLE-US-00002 Water 187.5 .mu.L 1M Tris-HCl pH 7.5 12.5 .mu.L
Primer 1 [100 uM] 50 .mu.L
[0233] Submix 2:
TABLE-US-00003 Water 375 .mu.L 1M Tris-HCl pH 7.5 25 .mu.L Primer 2
[100 uM] 50 .mu.L Primer 4 [100 uM] 50 .mu.L
[0234] Submix 3:
TABLE-US-00004 Water 187.5 .mu.L 1M Tris-HCl pH 7.5 12.5 .mu.L
Primer 3 [100 uM] 50 .mu.L
[0235] Each submix was aliquoted into 100 .mu.L aliquots and
incubated as described below:
[0236] Thermocycler conditions: [0237] 95.degree. C. 30 seconds
[0238] Ramp down to 50.degree. C. at 0.1.degree. C./s [0239] Hold
at 4.degree. C.
Ligation of the Rolling Circle Template
[0240] Mix: [0241] Submix 1 100 .mu.L [0242] Submix 2 100 .mu.L
[0243] Submix 3 100 .mu.L
[0244] Ligation:
TABLE-US-00005 10X NEB T4 DNA ligase buffer 200 .mu.L Mixed Oligo
submix [5 uM] 200 .mu.L Water 1500 .mu.L Mix.
Add 100 .mu.L NEB T4 DNA Ligase [400,000 u/ml]
[0245] Complete mixture was aliquoted into PCR tubes and incubated
at 20.degree. C. for .about.20 hr followed by 65.degree. C. for 10
minutes.
[0246] Solutions were pooled and 50 .mu.L of 100 uM stock extension
primers were added and mixed. Mixture was aliquoted into 100 .mu.L
aliquots in PCR tubes and subjected to the following temperature
conditions:
[0247] Thermocycler conditions: [0248] 70.degree. C. 30 seconds
[0249] Ramp down to 40.degree. C. at 0.1.degree. C./s [0250] Hold
at 4.degree. C.
[0251] Template can now be stored at -20.degree. C. until ready to
use.
Rolling Circle Amplification for Nanoparticle Construction
[0252] PCR Mix:
TABLE-US-00006 Water 969 .mu.L 10X NEB phi29 buffer 150 .mu.L TCEP
[500 mM] 15 .mu.L BSA [100X] 15 .mu.L dNTP mix [10 mM] 1.5
.mu.L
Vortexed to Mix then Added:
TABLE-US-00007 Primed Rolling Circle Template 300 .mu.L
Vortexed to Mix then Added:
TABLE-US-00008 NEB phi29 polymerase [10 Ku/ml] 50 .mu.L
Inverted to mix. Aliquoted reaction mixture into 63 .mu.L aliquots
in PCR tubes.
[0253] Incubated at [0254] 30.degree. C. for 120 minutes [0255]
65.degree. C. for 10 minutes Pooled samples and added 90 ul of 250
mM EDTA. Centrifuged sample at 12,500 G for 5 minutes at 4.degree.
C. Recovered supernatant and discarded white pellet.
Analysis of Nanoballs
[0256] Serial dilutions were performed 1:100 on sample (100
ul)+1:10 dilution and 2 ul of Sybr Gold (1.times.) was added.
Applied 1 ul spots on amine surface treated slides and imaged. As
seen in FIG. 3 and FIG. 4 DNA SNAPs were successfully formed, and a
high degree of co-localization was seen between the DNA SNAPs and
the Deep Red balls.
Analysis of Binding
[0257] In some cases, SNAPs can be removed from a surface they
attach to, such as a chip or array. Removal of SNAPs can be
mediated for example by a high amount of acetonitrile, a high
concentration of sodium hydroxide, or a high concentration of salt.
A high amount of acetonitrile can be a final percentage of at least
about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% acetonitrile.
A high amount of sodium hydroxide can be at least about 0.1 M, 0.5
M, 1 M, 2 M, 3 M, 4 M, 5 M, 6 M, 7 M, 8 M, 9 M, or 10 M. A high
amount of salt can be at least about 0.1 M, 0.5 M, 1 M, 2 M, 3 M, 4
M, 5 M, 6 M, 7 M, 8 M, 9 M, or 10 M. The salt used can be for
example MgCl.sub.2 or NaCl. In some cases, a chaotropic reagent
such as DMSO or formamide can mediate the removal of SNAPs.
Example 2--SNAP Production Using an Epimark Taq Polymerase
[0258] In a further example, SNAP production was optimized using an
Epimark Taq polymerase. SNAP templates were prepared according to
the method described in Example 1, paragraphs [0093]-[0098]. The
Taq polymerase was determined to have better control over SNAP size
than phi29 polymerases. A 500 .mu.l reaction mixture was prepared
using an 8683 ng template. The following reagents were mixed in a
1.5 ml PCR tube:
[0259] PCR Mix:
TABLE-US-00009 5X reaction buffer 100 .mu.l 10 mM dNTPs 10 .mu.l
Template DNA 16.3 .mu.l Fluorescent dNTPs 5 .mu.l Nuclease-free
water 369 .mu.l Total volume 500 .mu.l
The PCR mix was vortexed briefly in the PCR tube. After vortexing,
2.5 .mu.l of Epimark Taq Polymerase was added to the PCR mix. The
PCR tube was inverted to mix the polymerase with the other
reagents. The PCR mix was placed in a thermal cycler. The template
DNA was initially denatured at 94.degree. C. for 30 seconds. The
reaction mixture was amplified for 30 cycles under the following
thermal conditions: [0260] Denaturation at 94.degree. C. for 30
seconds [0261] Annealing at 53.degree. C. for 60 seconds [0262]
Extension at 68.degree. C. for 30 seconds After the final thermal
cycle, the SNAPs were held at 68.degree. C. for 5 further minutes.
The PCR tube was then cooled to 4.degree. C. and held until
purification.
[0263] SNAPs were purified after synthesis. dNTPs were removed via
an EDTA spin purification method. 30 .mu.l of 250 mM EDTA was added
to the 500 .mu.l PCR mix in the PCR tube. The PCR tube was
centrifuged at 12,500 G for 5 minutes at 4.degree. C. The
supernatant was saved and the pellet was discarded. SNAP samples
were filtered with 0.22 .mu.m filter tubes, then purified using
AKTA FPLC using a gradient method. SNAPs were purified via anion
exchange chromatography using 1 L each of deionized water and 1M
NaCl solution that had been filtered through 0.22 .mu.m filters.
After collecting the SNAP-containing fraction, the solution was
desalted using overnight dialysis in a dialysis cassette. SNAPs
were concentrated using a vacuum centrifuge. The solvent was
evaporated at 28.degree. C. for approximately 4 hours until the
final volume was less than 500 .mu.l.
Example 3: Purification of SNAPs
[0264] A batch of SNAPs can be produced as described herein. Once
the SNAPs are produced, they can be purified. A three step example
protocol of how SNAPs can be purified is described below.
Step 1: Anion Exchange Chromatography
[0265] Fast protein liquid chromatography (FPLC) anion exchange
chromatography was used to purify SNAPs. Here, a salt gradient was
used to separate differentially charged DNA molecules (SNAPs) for
collection. Three fractions (bottom, middle, top) were collected
for analysis.
[0266] An example of the anion exchange purification is shown in
FIG. 5. Dynamic light scattering was used to measure the
hydrodynamic radius of particles in a sample prior to purification
(left panel). The radii are distributed between about 0.1 nm and
10,000 nm. During anion exchange purification, samples present in
an identified target peak (middle panel) were collected. Dynamic
light scattering was used to measure the hydrodynamic radius of
particles in the purified sample, and the samples were found to
comprise SNAPs having hydrodynamic radii around about 100 nm and
around about 1000 nm.
[0267] In some cases, size exclusion chromatography can be
performed in lieu of anion exchange chromatography for
purification.
[0268] Samples from the three channels were imaged (FIG. 6, left)
using a standard microscopy protocol, and intensities were
quantified (right). SNAPs from the bottom channel displayed a
higher intensity than those from the middle and top channels. Thus,
in some cases, the size and/or brightness of the SNAPs can elute in
a particular anion exchange fraction.
Step 2: Dialysis
[0269] After the anion exchange chromatography was performed, salt
was removed by a standard dialysis protocol. Briefly, dialysis is a
separation technique that can facilitate the removal of small,
unwanted compounds (e.g. salt) from macromolecules (e.g. SNAPs) in
solution by selective and passive diffusion through a
semi-permeable membrane. An anion exchange purified sample
comprising SNAPs requiring salt removal and a buffer solution were
placed on opposite sides of the membrane. SNAPs were retained on
the sample side of the membrane, but salt was able to pass freely
through the membrane. The salt collected on the side of the
membrane opposite the SNAPs, thus reducing the concentration of
salt in the sample. In this way, the concentrations of small
contaminants such as salt within the sample were decreased to
acceptable or negligible levels.
Step 3: Concentration
[0270] Using a standard vacuum centrifugation protocol, batches of
SNAPs were concentrated with minimal loss compared to conventional
approaches.
[0271] SNAPs can be concentrated to a final concentration of
between 1 .mu.M and 100 .mu.M. For example, batches of SNAPs
produced have had concentrations of about 63.6 .mu.M, 47.5 .mu.M,
38 .mu.M, and 8.9 .mu.M.
[0272] FIG. 7 shows the absorption spectra at 260 nm (A260) traces
of different SNAP batches. The individual batches were produced
using varying fluorescent dNTP types, fluorescent dNTPs from
varying vendors, varying fluorescent dyes, varying Taq polymerases,
and/or Taq polymerases used from varying vendors. Each SNAP
displays a similar absorption profile.
Example 4: Production of SNAPs of a Desired Size
[0273] SNAPs were produced as described herein, and nanoparticle
size was measured.
[0274] Methods for measuring nanoparticle (e.g. SNAP) size can
include dynamic light scattering, nanoparticle tracking analysis,
and microscopy techniques such as transmission electron microscopy
(TEM), scanning electron microscopy (SEM), and atomic force
microscopy (AFM).
[0275] Dynamic light scattering, which was used herein, can measure
a diffusion coefficient through constructive and destructive
interference patterns of an entire population of SNAPs.
Nanoparticle tracking analysis can measure the diffusion
coefficient through particle tracking of individual particles if
the particles are greater than 30 nm in size. Microscopy techniques
including TEM, SEM, and AFM can measure particle size and allow
subsequent image analysis of individual particles without relying
on the scattering of light.
[0276] Images were taken using a standard imaging protocol, and
hydrodynamic radii of the SNAPs were determined to be between 25 nm
and 27 nm by anion exchange chromatography. This size range may
allow for multiple SNAPs to occupy each feature in some
applications. These small SNAPs were observed to co-localize within
a single feature, as seen in FIG. 8. In this example, SNAPs were
applied to an array and imaged (SNAP 1 on the bottom panel, SNAP 2
in the middle panel), and co-localization was determined by merging
the images (top panel).
[0277] In an additional experiment, larger SNAPs were applied to a
chip surface. In this case, the large SNAPs arranged themselves on
the chip surface, thus achieving a "single occupancy of features."
FIG. 9 shows SNAPs having a large hydrodynamic radius applied to a
chip having features. The SNAPs were imaged in the bottom (SNAP1)
and middle (SNAP2) images, and these images are overlaid (SNAP 1
and SNAP 2) in the top image. Significant co-localization was not
observed. Thus, when SNAPs are larger in size, they can sit on the
features with very little co-localization. In contrast, when SNAPs
are smaller in size, they can co-localize to features in some
cases.
[0278] To determine an appropriate size range for SNAPs, SNAP
occupancy on array can be measured. This can be measured as
brightness vs. dilution.
[0279] SNAPs were titrated to dilutions ranging between 10.sup.-5
and 10.sup.0 and applied to an array and signals were measured
using dynamic light scattering. For each dilution, the number of
counts and number of features occupied by a SNAPs was determined
(FIG. 10). The dark lines represent a fluorescent control, while
the light lines represent the SNAPs. The dotted lines represent the
number of features occupied, while the solid lines represent the
number of counts. Different signal trends for small molecules were
observed for dye vs. SNAPs on the array.
[0280] A constant number of counts was recorded for the SNAPs
(solid light line) regardless of dilution factor, which can suggest
discrete occupancy of the SNAPs on features of the array.
[0281] The apparent number of occupied features was observed to
change with detection threshold (dotted light line). This can
suggest that the number of features occupied can be a function of
the dilution. A receiver operating characteristic (ROC) curve can
be developed for detection sensitivity and specificity.
[0282] SNAPs produced can be a variety of sizes. In some cases,
SNAPs can be about 1 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm,
70 nm, 80 nm, 90 nm, 100 nm, 150 nm, 200 nm, 250 nm, or 300 nm in
diameter. The diameter can be a major diameter, a minor diameter,
or an average diameter. In some cases, SNAPs can be produced such
that SNAPs having a range of diameters can be produced.
Example 5: Brightness of SNAPs
[0283] A batch of SNAPs were separately applied to an array having
features and imaged using a standard imaging protocol. with a
maximum grey value of about 12,000 and a difference in grey value
between areas having and not having SNAPs of about 6,000, as
measured by the variations in gray value across the array. Thus,
SNAPs are able to bind to the array, and conjugated SNAPs can and
be detected.
Example 6: Measurement of the Concentration of SNAPs
[0284] After the SNAPs are concentrated, the concentration of the
SNAPs can be measured. For example, amine conjugated SNAPs can be
quantitated using an o-phthaldialdehyde (OPA) free amine reaction,
as shown in the top left of FIG. 12. Briefly, OPA can react with
the amine to enable fluorescent detection, and can enable
quantitation when a standard curve (e.g. PolyT amine serial
dilutions between 0 and 100 .mu.M, bottom left of FIG. 12) is
performed.
[0285] The fluorescence resulting from such a reaction in three
separate batches of SNAPs was measured at Ex/Em: 380 nm/460 nm, as
shown in FIG. 12 (right). The A260 (absorbance at 260 nm) was
quantified, and applied to the standard curve to determine the
concentration of each batch. The three batches were determined to
have concentrations of 47.5 .mu.M, 38 .mu.M, and 8.9 .mu.M. Another
batch was determined to have a concentration of 63.6 .mu.M (data
not shown). This assay can measure the concentrations of SNAPs at
least in the range of 1 .mu.M and 100 .mu.M. In some cases, a
sample of SNAPs can be diluted as necessary to fit into this range.
Using this assay, relatively small amounts of amine modified DNA
(e.g. SNAPs) can be measured.
Example 7: SNAP Conjugation #1
[0286] An experiment was performed such that click conjugation of
Azide-AlexaFluor 586 to a SNAP was carried out on a chip.
DBCO-SNAPs (488) (SNAPs having a DBCO group conjugated to a dye
that can fluoresce at 488 nm) was immobilized onto an array by
flow, and images were acquired at 488 nm (SNAP channel) and 575 nm
(Azide dye channel). Then, Azide-568 (Azide-AlexaFluor 568), which
can fluoresce at 568 nm, was incubated on the array to allow for a
conjugation reaction between the DBCO and the Azide, and the array
was washed after the incubation. Following this protocol, images
were again acquired at 488 nm and 575 nm to assess the extent of
the DBCO-Azide reaction. After incubation, the Azide dye channel
showed significantly more fluorescence than before. The SNAP
channel (control) showed similar signal before and after the
reaction (FIG. 14). This shows that the click conjugation between
DBCO and Azide on a chip (array) can be feasible.
[0287] For both channels, pre- and post-incubation, signal to noise
ratio and intensity were measured for the dark (darker shading) and
bright (brighter shading) sections (FIG. 14). These data confirm
that the intensity is significantly increased after the click
reaction, and that the click reaction performs well on the
chip.
[0288] An additional set of SNAPs was then immobilized on arrays
and conjugated to Azide-AlexaFluor 568, wherein the
Azide-AlexaFluor 568 was applied at 10.times. excess of the total
number of features. There were about 23.5 million features per flow
channel. Images were taken at 488 nm and 568 nm, pre- and
post-incubation, and the intensities were quantified. The
intensities at 488 nm were slightly lower at 488 nm, which can be
an effect of differential manual washing of block solution (FIG.
15). Intensities at 568 nm were significantly higher after
incubation with 10.times. Azide-AlexaFluor 568 (about 2-2.5 fold),
as shown in FIG. 16. In other words, uniform, localized signal at
568 nm was observed after Azide-AlexaFluor 568 was conjugated in
10.times. excess of the number of features per channel.
Example 8: SNAP Conjugation #2
[0289] An experiment was performed such that click conjugation of
PE-conjugated (R-Phycoerythrin-conjugated) azide was carried out on
a chip. SNAPs were prepared with a DBCO handle and a nucleotide
capable of fluorescing at 488 nm. SNAPs were deposited on a chip
surface and allowed to incubate for 1 hour to attach to the chip
surface. The chip was incubated for between 15 minutes and 30
minutes with a blocking buffer, and PE (1 mg/ml) with Azide handles
on Amines was flown over the chip such that there was a 1000.times.
molar excess of PE SNAPs. The chip was then incubated overnight.
The channels were then washed with phosphate buffered saline with
2% tween (PBST) and imaged.
[0290] The image is shown in FIG. 17. Overall, there was a high PE
signal throughout the flow channel, which can suggest an apparently
high non-specific binding. A punctate signal, or an on and off
feature, was observed. The on feature was observed to be typically
higher by approximately 2000 counts. DBCO SNAPs were present on
features, and produced a signal which was low compared with the
signal from the PE. In some cases, the batch of SNAPs can be
optimized e.g. by improving the quality and increasing the
concentration to yield even better results. A titration series
(titrating amount of PE used) can be performed as well. In
addition, optimization of the blocking procedure can improve
results.
Example 9: Biotinylated Click Handled Lysate Conjugation
[0291] SNAPs prepared with a DBCO handle can be deposited on a chip
surface and allowed to incubate sufficiently long to attach to the
chip surface. The chip can be then incubated for between 15 minutes
and 30 minutes with a blocking buffer.
[0292] Lysate can be biotinylated and handled with an Azide click
modifier. The biotinylated Lysate can be flown over the chip to
allow click conjugation of the Lysate to the DBCO SNAPs. The Lysate
can then be detected, for example via Streptavidin Lobe.
Example 10: DNA Origami
[0293] DNA origami SNAPs can be prepared for example with a DBCO
handle, and can be deposited on a chip surface and allowed to
incubate sufficiently long to attach to the chip surface. In some
cases, the DNA origami SNAPs can be deposited on an array in a
grid-like fashion. In some cases, the origami SNAPs can be about
300 nm.
[0294] In some cases, DNA origami SNAPs can provide flexibility of
SNAP organization, shape, design, and sizing of the SNAPs compared
with other types of SNAPs.
Example 11: Immobilization of Proteins from Lysate on Array
[0295] SNAPs were immobilized onto an array by flow. SNAP
fluorescence was detected using a standard imaging protocol with a
100.times.100 micron field of view (FIGS. 18 A and 18 D). E. coli
lysate comprising biotin handles was applied to the array, and
proteins were allowed to bind the SNAPs. As a control, SNAPs were
exposed to and allowed to conjugate with lysate lacking the biotin
handle. Fluorescence imaging was performed using a standard imaging
protocol using fluorescent streptavidin, which can bind to biotin
for detection, with a 100.times.100 micron field of view to detect
the lysate, As seen in FIGS. 18 B (biotin handle) and 18 E
(control). Because the immobilized lysate does not contain the
biotin tag, proteins are not detected by fluorescent streptavidin.
This control demonstrates that the detection signal observed in (B)
is specific to immobilized proteins (i.e., that there is no
non-specific binding of the streptavidin detection reagent to the
array surface).
[0296] The black and white images were multiplied to show
co-localization of SNAPs and biotin handled lysate in FIGS. 18 C
(biotin handle) and 18 F (control). In the co-localization images,
white indicates co-localization, and black indicates no
co-localization.
[0297] A fiducial can be seen in the bottom left corner of the
image. HMIDS lanes without feature patterning can be seen as dark
stripes on the top and right edges of the field of view. SNAPs on
individual features within the sub-array can be seen. Note: SNAPs
are also easier to visualize because of fluorescence cross-talk
into this channel from the detection channel (see B)
Example 12: Specific Detection of Short Peptide Epitopes
(Trimers)
[0298] Fluorescently labeled SNAPs were immobilized onto an array
by flow. A small peptide (HHH*) was allowed to conjugate with the
SNAPs. As a control, SNAPs were immobilized to a chip and no
peptide was conjugated to the SNAPs. A fluorescent aptamer that is
specific for the small HHH peptide was applied. SNAP fluorescence
was detected using a standard imaging protocol with a 35.times.35
micron field of view (FIGS. 19 A and 19 D). This field of view can
show the corner of one sub-array on a chip. The immobilized SNAPs
can be seen as discrete spots on the array (each of these spots is
300 nm in diameter).
[0299] Fluorescence imaging was performed in the same region in a
different fluorescence channel which can detect the aptamer, using
a standard protocol to detect the peptide (FIGS. 19 B (peptide) and
19 E (no peptide control)).
[0300] The black and white images were multiplied to show
co-localization of SNAPs and the HHH peptide. FIGS. 19 C (peptide)
and 19 F (no peptide control) shows the co-localization of
fluorescence between the SNAP-peptide channel and the aptamer
detection channel. Co-localization can indicate successful binding
and identification of the HHH peptide on SNAPs on the features of
the array. Because there is no bound aptamer in FIG. 19 F, the
merge image for the control image shows no co-localization.
[0301] In the no peptide control images, because the HHH peptide
was unable to bind to the SNAPs on the array, there is no detection
of HHH in the aptamer fluorescence channel. Thus, this result can
confirm that the HHH peptide was 1) directly attached to the SNAPs
and 2) the signal observed in the aptamer channel can be observed
only when the target peptide is present.
[0302] Two chrome fiducial marks can be seen in the lower right
corner of the image. The darker lanes in the image are HMIDS-coated
areas that do not contain patterned features.
[0303] While preferred embodiments of the present invention have
been shown and described herein, it will be obvious to those
skilled in the art that such embodiments are provided by way of
example only. Numerous variations, changes, and substitutions will
now occur to those skilled in the art without departing from the
invention. It should be understood that various alternatives to the
embodiments of the invention described herein may be employed in
practicing the invention. It is intended that the following claims
define the scope of the invention and that methods and structures
within the scope of these claims and their equivalents be covered
thereby.
Sequence CWU 1
1
5159DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1gccagggtgc gagggtttgt ttcattgctt cacgccctta
ccctcgcacc ctggcacgg 59223DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 2tcccacggtg gcacctcgca cct
23339DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 3cgcacgctgc caccctcgct tttgcgaggg tggcagcgt
39430DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4gcgaggtgcg aggtgccacc gtgggaccgt
30518DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5aagggcgtga agcaatga 18
* * * * *