U.S. patent application number 17/479010 was filed with the patent office on 2022-01-06 for methods of detecting a polypeptide having anaplastic lymphoma kinase activity in kidney cancer.
This patent application is currently assigned to Cell Signaling Technology, Inc.. The applicant listed for this patent is Cell Signaling Technology, Inc.. Invention is credited to Katherine Eleanor Crosby, Herbert Haack, Victoria McGuinness Rimkunas, Matthew Ren Silver.
Application Number | 20220003771 17/479010 |
Document ID | / |
Family ID | 1000005841864 |
Filed Date | 2022-01-06 |
United States Patent
Application |
20220003771 |
Kind Code |
A1 |
Haack; Herbert ; et
al. |
January 6, 2022 |
METHODS OF DETECTING A POLYPEPTIDE HAVING ANAPLASTIC LYMPHOMA
KINASE ACTIVITY IN KIDNEY CANCER
Abstract
The invention provides methods to identify, diagnose, and treat
kidney cancer through the detection of expression and/or activity
of anaplastic lymphoma kinase (ALK). The detection of the presence
of a polypeptide with ALK kinase activity (e.g., by detecting
expression and/or activity of the polypeptide), identify those
kidney cancers that are likely to respond to an ALK-inhibiting
therapeutic.
Inventors: |
Haack; Herbert; (South
Hamilton, MA) ; Crosby; Katherine Eleanor;
(Middleton, MA) ; Rimkunas; Victoria McGuinness;
(Reading, MA) ; Silver; Matthew Ren; (Rockport,
MA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Cell Signaling Technology, Inc. |
Danvers |
MA |
US |
|
|
Assignee: |
Cell Signaling Technology,
Inc.
Danvers
MA
|
Family ID: |
1000005841864 |
Appl. No.: |
17/479010 |
Filed: |
September 20, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16729736 |
Dec 30, 2019 |
|
|
|
17479010 |
|
|
|
|
14844832 |
Sep 3, 2015 |
10551383 |
|
|
16729736 |
|
|
|
|
13204342 |
Aug 5, 2011 |
|
|
|
14844832 |
|
|
|
|
61371525 |
Aug 6, 2010 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 2333/70596
20130101; A61K 31/517 20130101; G01N 33/57438 20130101; C12Q
2600/112 20130101; A61K 31/4545 20130101; C12Q 1/6886 20130101;
G01N 2800/52 20130101; G01N 33/57484 20130101; A61K 31/4162
20130101 |
International
Class: |
G01N 33/574 20060101
G01N033/574; A61K 31/4162 20060101 A61K031/4162; A61K 31/4545
20060101 A61K031/4545; A61K 31/517 20060101 A61K031/517; C12Q
1/6886 20060101 C12Q001/6886 |
Claims
1. A method for detecting the presence or activity of a polypeptide
with ALK kinase activity in a biological sample from a mammalian
kidney cancer or suspected mammalian kidney cancer, said method
comprising the steps of: (a) obtaining a biological sample from a
mammalian kidney cancer or suspected mammalian kidney cancer and
(b) contacting the biological sample with a detection molecule
selected from the group consisting of a reagent that detects ALK
kinase activity, a reagent that detects a polypeptide with ALK
kinase activity, and a reagent that detects to a polynucleotide
encoding the polypeptide with ALK kinase activity, wherein reaction
of the detection molecule with the biological sample indicates said
polypeptide with ALK kinase activity is present or active in said
mammalian kidney cancer or suspected mammalian kidney cancer.
2. The method of claim 1, wherein the mammalian kidney cancer or
suspected mammalian kidney cancer in which the presence or activity
of said polypeptide with ALK kinase activity is detected is
identified as a mammalian kidney cancer or suspected mammalian
kidney cancer belonging to a subset of kidney cancers driven by ALK
kinase activity.
3. The method of claim 1, wherein the mammalian kidney cancer or
suspected mammalian kidney cancer in which the presence or activity
of said polypeptide with ALK kinase activity is detected is
identified as a mammalian kidney cancer or suspected mammalian
kidney cancer likely to respond to an ALK-inhibiting
therapeutic.
4. A method for identifying a mammalian kidney cancer or suspected
mammalian kidney cancer that belongs to a subset of kidney cancers
driven by ALK kinase activity, said method comprising the steps of
(a) contacting a biological sample obtained from a mammalian kidney
cancer or suspected mammalian kidney cancer with at least one
detection molecule selected from the group consisting of a reagent
that detects ALK kinase activity, a reagent that detects a
polypeptide with ALK kinase activity, and a reagent that detects to
a polynucleotide encoding the polypeptide with ALK kinase activity,
and (b) detecting reaction of the detection molecule with said
biological sample, wherein the reaction of the detection molecule
with said biological sample indicates that said mammalian kidney
cancer or suspected mammalian kidney cancer is driven by ALK kinase
activity.
5. The method of claim 4, wherein said mammalian kidney cancer or
suspected mammalian kidney cancer driven by ALK kinase activity is
likely to respond to a composition comprising at least one
ALK-inhibiting therapeutic.
6. A method for identifying a mammalian kidney cancer or suspected
mammalian kidney cancer that belongs to a subset of kidney cancers
driven by ALK kinase activity, said method comprising the steps of
(a) contacting a biological sample obtained from a mammalian kidney
cancer or suspected mammalian kidney cancer with at least one
detection molecule selected from the group consisting of a reagent
that detects ALK kinase activity, a reagent that detects a
polypeptide with ALK kinase activity, and a reagent that detects to
a polynucleotide encoding the polypeptide with ALK kinase activity,
and (b) detecting reaction of the detection molecule with said
biological sample, wherein the reaction of the detection molecule
with said biological sample indicates that said mammalian kidney
cancer or suspected mammalian kidney cancer is driven by ALK kinase
activity and wherein said mammalian kidney cancer or suspected
mammalian kidney cancer driven by ALK kinase activity is likely to
respond to a composition comprising at least one ALK-inhibiting
therapeutic.
7. The method of claim 1, 4, or 6, wherein the polypeptide with ALK
kinase activity is aberrantly expressed full-length ALK
protein.
8. The method of claim 1, 4, or 6, wherein the polypeptide with ALK
kinase activity is an ALK fusion polypeptide comprising at least a
portion of a first fusion member and at least a portion of a second
fusion member, wherein the second fusion member is an ALK
protein.
9. The method of claim 5, wherein the first fusion member is
selected from the group consisting of a NPM polypeptide, a ALO17
polypeptide, a TFG polypeptide, a MSN polypeptide, a TPM3
polypeptide, a TPM4 polypeptide, an ATIC polypeptide, a MYH9
polypeptide, a CLTC polypeptide, a SEC31L1 polypeptide, an RANBP2
polypeptide, a CARS polypeptide, an EML4 polypeptide, a KIF5B
polypeptide, and a VCL polypeptide.
10. The method of claim 1, 4, or 6, wherein the reagent that
detects ALK kinase activity is a substrate of ALK kinase or a
reagent that specifically binds to phosphorylated ALK protein.
11. The method of claim 10, wherein the method is implemented in an
in vitro kinase assay format.
12. The method of claim 1, 4, or 6, wherein the reagent that
detects a polypeptide with ALK kinase activity is a reagent that
specifically binds to the polypeptide with ALK kinase activity.
13. The method of claim 12, wherein the reagent that specifically
binds to the polypeptide with ALK kinase activity is an antibody
that specifically binds to the polypeptide with ALK kinase
activity.
14. The method of claim 13, wherein the antibody specifically binds
to a full length ALK protein.
15. The method of claim 13, wherein the polypeptide with ALK kinase
activity is an ALK fusion polypeptide comprising at least a portion
of a first fusion member and at least a portion of a second fusion
member, wherein the second fusion member is an ALK protein and the
antibody specifically binds the ALK fusion polypeptide.
16. The method of claim 15, wherein the antibody specifically binds
to a portion of the ALK protein present in the ALK fusion
polypeptide, a portion of the first fusion member present in the
ALK fusion polypeptide, or a junction between the first fusion
member and the portion of the ALK protein present in the ALK
fusion.
17. The method of claim 12, wherein said method is implemented in a
format selected from the group consisting of a flow cytometry
assay, an immunohistochemistry (IHC) assay, an immunofluorescence
(IF) assay, an Enzyme-linked immunosorbent assay (ELISA) assay, a
Western blotting analysis assay, and a mass spectrometry assay.
18. The method of claim 1, 4, or 6, wherein the reagent that
detects a polynucleotide encoding the polypeptide with ALK kinase
activity is a nucleic acid probe or primer that hybridizes to said
polynucleotide.
19. The method of claim 18, wherein the nucleic acid probe or
primer is selected from the group consisting of a polymerase chain
reaction (PCR) probe, an in situ hybridization (ISH) probe, and a
Southern blotting probe.
20. The method of claim 18, wherein said method is implemented in a
format selected from the group consisting of a polymerase chain
reaction (PCR) assay, an in situ hybridization (ISH) assay, and a
Southern blotting assay.
21. The method of claim 1, 4, or 6, Therein the detection molecule
is detectably labeled.
22. The method of claim 1, 4, or 6, wherein said mammalian kidney
cancer or suspected mammalian kidney cancer is a granular cell
cancer or a squamous cell cancer.
23. The method of claim 1, 4, or 6, wherein said biological sample
comprises at least one circulating tumor cell from said mammalian
kidney cancer or suspected mammalian kidney cancer.
24. The method of claim 1, 4, or 6, wherein said biological sample
comprises cells obtained from a tumor biopsy, a tumor fine needle
aspirate, or a pleural effusion.
25. The method of claim 1, 4, or 6, wherein said mammalian kidney
cancer or suspected mammalian kidney cancer is from a human.
26. A method for determining whether a compound inhibits the
progression of a mammalian kidney cancer or suspected mammalian
kidney cancer driven by a polypeptide with ALK kinase activity,
said method comprising the step of determining whether said
compound inhibits the expression and/or activity of said
polypeptide in said cancer mammalian kidney cancer or suspected
mammalian kidney cancer.
27. The method of claim 26, wherein inhibition of the expression
and/or activity of the polypeptide is determined using at least one
detection molecule selected from the group consisting of a reagent
that detects ALK kinase activity, a reagent that detects a
polypeptide with ALK kinase activity, and a reagent that detects to
a polynucleotide encoding the polypeptide with ALK kinase
activity.
28. A method for inhibiting the progression of a mammalian kidney
cancer or suspected mammalian kidney cancer driven by a polypeptide
with ALK kinase activity, said method comprising the step of
inhibiting the expression and/or activity of said polypeptide in
said mammalian kidney cancer or suspected mammalian kidney
cancer.
29. The method of claim 26 or 28, wherein the mammalian kidney
cancer or suspected mammalian kidney cancer is from a human.
30. The method of claim 28, wherein expression and/or activity of
said polypeptide is inhibited with a composition comprising a
ALK-inhibiting therapeutic.
31. A method for treating a mammalian patient with mammalian kidney
cancer or suspected mammalian kidney cancer driven by a polypeptide
with ALK kinase activity, said method comprising the step of
administering a composition comprising a therapeutically effective
amount of an ALK-inhibiting therapeutic to the mammalian
patient.
32. The method of claim 26, 28, or 31, wherein said polypeptide is
a full length ALK polypeptide aberrantly expressed in said
mammalian kidney cancer.
33. The method of claim 26, 28, or 31, wherein said polypeptide is
an ALK fusion polypeptide.
34. The method of claim 33, wherein said ALK fusion polypeptide is
selected from the group consisting of an NPM-ALK fusion
polypeptide, an ALO17-ALK fusion polypeptide, an MSN-ALK fusion
polypeptide, a TPM3-ALK fusion polypeptide, TPM4-ALK fusion
polypeptide, an ATIC-ALK fusion polypeptide, a MYH9-ALK fusion
polypeptide, a CLTC-ALK fusion polypeptide, a SEC31L1-ALK fusion
polypeptide, an RANBP2-ALK fusion polypeptide, a CARS-ALK fusion
polypeptide, an EMLA-ALK fusion polypeptide, a KIF5B-ALK fusion
polypeptide, a TFG-ALK fusion polypeptide, and a VCL-ALK fusion
polypeptide.
35. A method for treating a mammalian patient having a mammalian
kidney cancer or suspected mammalian kidney cancer comprising the
steps of: (a) detecting the presence or activity of said
polypeptide with ALK kinase activity a biological sample of the
mammalian kidney cancer or suspected mammalian kidney cancer of the
patient; and (b) administering a therapeutically effective amount
of a composition comprising an ALK-inhibiting therapeutic to the
mammalian patient.
36. The method of claim 31 or 35, wherein the mammalian patient is
a human.
37. The method of claim 3, 5, 6, 30, 31 or 35, wherein the
ALK-inhibiting therapeutic is selected from the group consisting of
PE-02341066, NVT TAE-684, and AP26113.
38. The method of claim 3, 5, 6, 30, 31 or 35, wherein the
ALX-inhibiting therapeutic is selected from the group consisting of
CEP-14083, CEP-14513, CEP11988, WHI-P131 and WHI-P154.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/729,736, filed Dec. 30, 2019, which is a
continuation of U.S. patent application Ser. No. 14/844,832, filed
Sep. 3, 2015, now U.S. Pat. No. 10,551,383, which is a continuation
of U.S. patent application Ser. No. 13/204,342, filed Aug. 5, 2011,
now abandoned, which claims priority to U.S. Provisional
Application Ser. No. 61/371,525, filed Aug. 6, 2010, the entire
contents of which are hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The invention relates generally to proteins and genes
involved in cancer (e.g., kidney cancer), and to the detection,
diagnosis and treatment of cancer.
BACKGROUND OF THE INVENTION
[0003] Many cancers are characterized by disruptions in cellular
signaling pathways that lead to aberrant control of cellular
processes, or to uncontrolled growth and proliferation of cells.
These disruptions are often caused by changes in the activity of
particular signaling proteins, such as kinases.
[0004] Aberrant expression of protein kinase proteins can be the
causative agent of (and the driver of) cancer. Aberrant expression
can be caused by the fusion of the protein (or kinase portion
thereof) with a secondary protein (or portion there), expression of
a truncated portion of the protein, or by abnormal regulation of
expression of the full-length protein.
[0005] It is known that gene translocations resulting in kinase
fusion proteins with aberrant signaling activity can directly lead
to certain cancers (see, e.g., Mitelman et al, Nature Reviews
Cancer 7: 233-245, 2007, Futreal et al., Nat Rev Cancer 4(3):
177-183 (2004), and Falini et al., Blood 99(2): 409-426 (2002). For
example, it has been shown that the BCR-ABL oncoprotein, a tyrosine
kinase fusion protein, is the causative agent and drives human
chronic myeloid leukemia (CML). The BCR-ABL oncoprotein, which is
found in at least 90-95% of CML cases, is generated by the
translocation of gene sequences from the c-ABL protein tyrosine
kinase on chromosome 9 into BCR sequences on chromosome 22,
producing the so-called Philadelphia chromosome. See, e.g. Kurzock
et al., N. Engl. Med. 319: 990-998 (1988). The translocation is
also observed in acute lymphocytic leukemia (ALL) and acute myeloid
leukemia (AML) cases. These discoveries spurred FDA approval of
imatinib mesylate (sold under the trademark Gleevec.RTM. by
Novartis) and dasatinig (sold by Bristol-Mysers Squibb under the
trademark Sprycel.RTM.), small molecule inhibitors of the ABL
kinase, for the treatment of CML and ALL. These drugs are examples
of drugs that are designed to interfere with the signaling pathways
that drive the growth of tumor cells. The development of such drugs
represents a significant advance over the conventional therapies
for CML and ALL, chemotherapy and radiation, which are plagued by
well known side-effects and are often of limited effect since they
fail to specifically target the underlying causes of the
malignancies.
[0006] Thus, it would be useful to identify proteins that drive
cancers in order to detect cancers at an early stage, when they are
more likely to respond to therapy, and for the development of new
reagents and methods for the study, diagnosis, and treatment of
such cancers. Additionally, identification of such proteins will,
among other things, desirably enable new methods for selecting
patients for targeted therapies, as well as for the screening and
development of new drugs that inhibit such proteins and, thus,
treat cancer.
SUMMARY OF THE INVENTION
[0007] The invention is based on the discovery of ALK kinase in
kidney cancer cells. This unexpected discovery enables methods to
detect, treat, and cure kidney cancers driven by ALK kinase
activity.
[0008] In a first aspect, the invention provides a method for
detecting the presence and/or activity of a polypeptide with ALK
kinase activity in a biological sample from a mammalian kidney
cancer or suspected mammalian kidney cancer. The method includes
(a) obtaining a biological sample from a mammalian kidney cancer or
suspected mammalian kidney cancer and (b) contacting the biological
sample with a detection molecule selected from the group consisting
of a reagent that detects ALK kinase activity, a reagent that
detects a polypeptide with ALK kinase activity, and a reagent that
detects to a polynucleotide encoding the polypeptide with ALK
kinase activity, and (c) detecting reaction of the detection
molecule with the biological sample, wherein reaction of the
detection molecule with the biological sample indicates said
polypeptide with ALK kinase activity is present or active in said
mammalian kidney cancer or suspected mammalian kidney cancer. In
some embodiments, the detection molecule is detectably labeled.
[0009] In another aspect, the invention provides a method for
identifying a mammalian kidney cancer or suspected mammalian kidney
cancer that belongs to a subset of kidney cancers driven by ALK
kinase activity, said method comprising the steps of (a) contacting
a biological sample obtained from a mammalian kidney cancer or
suspected mammalian kidney cancer with at least one detection
molecule selected from the group consisting of a reagent that
detects ALK kinase activity, a reagent that detects a polypeptide
with ALK kinase activity, and a reagent that detects to a
polynucleotide encoding the polypeptide with ALK kinase activity,
and (b) detecting reaction of the detection molecule with said
biological sample, wherein the reaction of the detection molecule
with said biological sample indicates that said mammalian kidney
cancer or suspected mammalian kidney cancer is driven by ALK kinase
activity in some embodiments, the mammalian kidney cancer or
suspected mammalian kidney cancer driven by ALK kinase activity is
likely to respond to a composition comprising at least one
ALK-inhibiting therapeutic.
[0010] In another aspect, the invention provides method for
determining whether a compound inhibits the progression of a
mammalian kidney cancer or suspected mammalian kidney cancer driven
by a polypeptide with ALK kinase activity, said method comprising
the step of determining whether said compound inhibits the
expression and/or activity of said polypeptide in said cancer
mammalian kidney cancer or suspected mammalian kidney cancer.
[0011] In another aspect, the invention provides a method for
inhibiting the progression of a mammalian kidney cancer or
suspected mammalian kidney cancer driven by polypeptide with ALK
kinase activity, comprising inhibiting the expression and/or
activity of said polypeptide in said mammalian kidney cancer or
suspected mammalian kidney cancer.
[0012] In another aspect, the invention provides a method for
treating a mammalian patient with mammalian kidney cancer or
suspected mammalian kidney cancer driven by a polypeptide with AIX
kinase activity, said method comprising the step of administering a
composition comprising a therapeutically effective amount of a
composition comprising an ALK-inhibiting therapeutic to the
mammalian patient.
[0013] In still a further aspect, the invention provides a method
for treating a patient having a mammalian kidney cancer or
suspected mammalian kidney cancer comprising the steps of: (a)
detecting the presence or activity of said polypeptide with ALK
kinase activity a biological sample of the mammalian kidney cancer
or suspected mammalian kidney cancer of the patient; and (b)
administering a composition comprising an ALK-inhibiting
therapeutic to the patient. In some embodiments, the patient is a
human.
[0014] In various embodiments of all of the aspects of the
invention, the method for detecting the presence and/or activity of
a polypeptide with ALK kinase activity in a biological sample from
a mammalian kidney cancer or suspected mammalian kidney cancer
comprising the steps of: (a) obtaining a biological sample from a
mammalian kidney cancer or suspected mammalian kidney cancer and
(b) contacting the biological sample with a reagent that detects
ALK kinase activity, wherein detection of ALK kinase activity by
the reagent in the biological sample indicates said polypeptide
with ALK kinase activity is present in said biological sample. In
some embodiments, the method for detecting the presence and/or
activity of a polypeptide with ALK kinase activity in a biological
sample from a mammalian kidney cancer or suspected mammalian kidney
cancer comprises the steps of: (a) obtaining a biological sample
from a mammalian kidney cancer or suspected mammalian kidney cancer
and (b) contacting the biological sample with a reagent that
detects a polypeptide with ALK kinase activity, wherein detection
of said polypeptide in said biological sample indicates said
polypeptide with ALK kinase activity is present in said biological
sample. In some embodiments, the method for detecting the presence
and/or activity of a polypeptide with ALK kinase activity in a
biological sample from a mammalian kidney cancer or suspected
mammalian kidney cancer comprises the steps of: (a) obtaining a
biological sample from a mammalian kidney cancer or suspected
mammalian kidney cancer and (b) contacting the biological sample
with a reagent that detects a polynucleotide encoding the
polypeptide with ALK kinase activity, wherein detection of said
polynucleotide in said biological sample indicates said polypeptide
with ALK kinase activity is present in said biological sample.
[0015] In various embodiments of all of the aspects of the
invention, the inhibition of the expression and/or activity of the
polypeptide is determined using a reagent that detects ALK kinase
activity, a reagent that detects a polypeptide with ALK kinase
activity, or a reagent that detects to a polynucleotide encoding
the polypeptide with ALK kinase activity.
[0016] In various embodiments of all of the aspects of the
invention, the detection molecule is detectably labeled.
[0017] In various embodiments of all of the aspects of the
invention, the mammalian kidney cancer or suspected mammalian
kidney cancer in which the presence or activity of said polypeptide
with ALK kinase activity is detected is identified as a mammalian
kidney cancer or suspected mammalian kidney cancer belonging to a
subset of kidney cancers driven by ALK kinase activity. In some
embodiments, the mammalian kidney cancer or suspected mammalian
kidney cancer in which the presence or activity of said polypeptide
with ALK kinase activity is detected is identified as a mammalian
kidney cancer or suspected mammalian kidney cancer likely to
respond to an ALK-inhibiting therapeutic.
[0018] In various embodiments of all of the aspects of the
invention, the polypeptide with ALK kinase activity is aberrantly
expressed full-length ALK protein. In various embodiments, the
polypeptide with ALK kinase activity is an ALK fusion polypeptide
comprising at least a portion of a first fusion member and at least
a portion of a second fusion member, wherein the second fusion
member is an ALK protein comprises an ALK kinase domain. In some
embodiments, the portion of the ALK protein In some emibodiments,
the first fusion member is an NPM polypeptide, a ALO17 polypeptide,
a TFG polypeptide, a MSN polypeptide, a TPM3 polypeptide, a TPM4
polypeptide, an ATIC polypeptide, a MYH9 polypeptide, a CLTC
polypeptide, a sEc31L1 polypeptide, an RANBP2 polypeptide, a CARS
polypeptide, an EML4 polypeptide, a KIF5B polypeptide, or a VCL
polypeptide. In some embodiments, the ALK fusion polypeptide is an
NPM-ALK fusion polypeptide, an ALO17-ALK fusion polypeptide, an
MSN-ALK fusion polypeptide, an TPM3-ALK fusion polypeptide,
TPM4-ALK fusion polypeptide, an ATIC-ALK fusion polypeptide, an
MYH9-ALK fusion polypeptide, an CLTC-ALK fusion polypeptide, an
SEC31L1-ALK fusion polypeptide, an RANBP2-ALK fusion polypeptide,
an CARS-ALK fusion polypeptide, an EML4-LK fusion polypeptide, an
KIF5B-ALK fusion polypeptide, a TFG-ALK fusion polypeptide, or a
VCL-ALK fusion polypeptide.
[0019] In various embodiments of all of the aspects of the
invention, the polypeptide with ALK kinase activity is a truncated
ALK polypeptide. In some embodiments, the reagent that detects ALK
kinase activity is a substrate of ALK. In some embodiments, the
method is implemented in an in vitro kinase assay format. In some
embodiments, the method is implemented in an immunological assay
employing a phosphorylated tyrosine-specific binding agent (e.g.,
an antibody that specifically binds to phosphorylated tyrosine
residues).
[0020] In various embodiments of all of the aspects of the
invention, the reagent that detects a polypeptide with ALK kinase
activity is a reagent that specifically binds to the polypeptide.
In some embodiments, the reagent that specifically binds to the
polypeptide is an antibody. In some embodiments, the reagent that
specifically binds to the polypeptide is an AQUA peptide. In some
embodiments, the antibody specifically binds to a full length ALK
protein.
[0021] In various embodiments of all of the aspects of the
invention, where the protein with ALK kinase activity is a ALK
fusion polypeptide, the reagent that detects a polypeptide with ALK
kinase activity is reagent that specifically binds the ALK fusion
polypeptide. In some embodiments, the reagent that specifically
binds to the ALK fusion polypeptide is an antibody. In some
embodiments, the reagent that specifically binds to the ALK fusion
polypeptide is an AQUA peptide. In some embodiments, the antibody
specifically binds to the portion of the ALK protein present in the
ALK fusion, to the portion of the first fusion member present in
the ALK fusion, or to a junction between t first fusion member and
the portion of the ALK protein present in the ALK fusion.
[0022] In various embodiments of all of the aspects of the
invention, the method is implemented in a flow cytometry assay
format, an immunohistochemistry (IHC) assay format, an
immunofluorescence (IF) assay format, an Enzyme-linked
immunosorbent assay (SLISA) assay format, a Western blotting
analysis assay format, or a mass spectrometry assay format.
[0023] In various embodiments of all of the aspects of the
invention, the reagent that detects a polynucleotide encoding the
polypeptide with ALK kinase activity is a nucleic acid molecule
that hybridizes to said polynucleotide. In some embodiments, the
nucleic acid molecule hybridizes to the polynucleotide under
stringent conditions.
[0024] In various embodiments of all of the aspects of the
invention, the nucleic acid molecule is a polymerase chain reaction
(PCR) probe, a fluorescence in situ hybridization (FISH) probe, or
a Southern blotting probe. In some embodiments, the method is
implemented in a polymerase chain reaction (PCR) assay format, a in
situ hybridization (ISH) assay format, or a Southern blotting assay
format.
[0025] In various embodiments of all of the aspects of the
invention, the mammalian kidney cancer or suspected mammalian
kidney cancer is a granular cell cancer or a squamous cell cancer.
In various embodiments, the mammalian kidney cancer or suspected
mammalian kidney cancer is from a mammal. In various embodiments,
the mammalian kidney cancer or suspected mammalian kidney cancer is
from a human.
[0026] In various embodiments of all of the aspects of the
invention, the biological sample is a circulating tumor cell from
said mammalian kidney cancer or suspected mammalian kidney cancer.
In certain embodiments, the biological sample is a tissue biopsy or
a fine needle aspirate from said mammalian kidney cancer or
suspected mammalian kidney cancer.
[0027] In various embodiments of all of the aspects of the
invention, a patient from whom said biological sample is obtained
is diagnosed as having a mammalian kidney cancer or suspected
mammalian kidney cancer driven by the polypeptide with ALK kinase
activity. In some embodiments, the patient is administered
pharmaceutical composition comprising an ALK-inhibiting therapeutic
(e.g., PF-02341066, NVT TAE-684, AP26113, CEP-14083, CEP-14513,
CEP11988, WHI-P131 or WHI-P154).
[0028] In various embodiments of all of the aspects of the
invention, the expression and/or activity of the polypeptide with
ALK kinase activity is inhibited with a composition comprising an
ALK-inhibiting therapeutic. In some embodiments, the ALK-inhibiting
therapeutic is PF-02341066 (also known as crizotinib). In some
embodiments, the ALK-inhibiting therapeutic is NVT TAE-684,
AP26113, or CEP-14083, CEP-14513, CEP11988, WHI-P131 and
WHI-P154.
[0029] In still another aspect, the invention provides methods for
diagnosing kidney cancer in a patient (also referred to as a
subject). The methods comprise obtaining a biological sample from a
subject suspected of having kidney cancer, obtaining a control
biological sample from a normal individual not suspected of having
kidney cancer, measuring the level of expression and/or activity of
a polypeptide with ALK kinase activity or polynucleotide encoding a
polypeptide with ALK kinase activity in the biological sample and
control biological sample using a detection device, generating a
database of the detected levels of expression and/or activity of
said polypeptide with LK kinase activity or polynucleotide in the
biological sample and control biological sample, and obtaining a
report from the database of the detection device wherein a higher
level of expression and/or activity of the polypeptide with ALK
kinase activity or polynucleotide in the biological sample relative
to the control biological sample is correlated to a kidney cancer
diagnosis. Suitably, the kidney cancer is likely to respond to
treatment with an ALK inhibitor (i.e., an ALK-inhibiting
therapeutic).
[0030] In certain embodiments, the polynucleotide encoding a
polypeptide with ALK kinase activity is an mRNA or cDNA encoding
full-length ALK protein or encoding an ALK fusion polypeptide,
including a ALK fusion polypeptide comprising the intracellular
domain of ALK, the tyrosine kinase domain of ALK, or the C-terminal
domain of ALK. Detecting of the mRNA can be performed by any method
including, for example, by RT-PCR or Northern blot analysis.
[0031] The polypeptide with ALK kinase activity can be detected by
an antibody specific for the intracellular domain of ALK, including
an antibody that does not cross-react with c-Met, and an antibody
that is specific for the tyrosine kinase domain of ALK.
[0032] In another embodiment, the polypeptide with ALK kinase
activity can be detected using a reagent that is specific for an
ALK fusion polypeptide comprising amino acids 1376-1620 of full
length ALK (where full length ALK is 1620 amino acids and is set
forth in SEQ ID NO: 2), amino acid residues 1504-1507 of full
length ALK, or amino acid residues 1603-1606 of fill length
ALK.
[0033] In embodiments, the ALK fusion polypeptide is selected from
the group consisting of VCL-ALK, EML4-ALK, NPM-ALK, TPM3-ALK,
TFG-ALK, ATIC-ALK, CLTC-ALK, MSN-ALK, TPM4-ALK, ALO17-ALK,
RANBP2-ALK, IMI-19-ALK, CARS-ALK, SEC31L1-ALK, and KIF5B-ALK.
[0034] In additional aspects, the invention provides methods for
treating a kidney cancer in a patient (also referred to as a
subject). The methods comprise obtaining a biological sample from a
patient suspected of having kidney cancer, obtaining a control
biological sample from a normal individual not suspected of having
kidney cancer, detecting a level of expression and/or activity of a
polypeptide with ALK kinase activity in the biological sample and
the control biological sample and treating the subject with an AIX
inhibitor if the level of expression and/or activity of the
polypeptide with ALK kinase activity in the biological sample is
greater than the level of expression and/or activity of the
polypeptide with ALK kinase activity in the control biological
sample.
[0035] In further aspects, the invention provides methods for
diagnosing kidney cancer in a subject comprising obtaining a
biological sample from a patient suspected of having kidney cancer
and determining whether a polypeptide with ALK kinase activity or
polynucleotide encoding the same is present in the biological
sample.
[0036] The invention also provides methods for treating a kidney
cancer in a patient comprising obtaining a biological sample from a
patient suspected of having kidney cancer, determining whether a
polypeptide with ALK kinase activity or polynucleotide encoding the
same is present in the biological sample and treating the patient
with an ALK inhibitor if the polypeptide with ALK kinase activity
or polynucleotide encoding the same is present.
BRIEF DESCRIPTION OF THE DRAWINGS
[0037] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawings will be provided by the Office upon
request and payment of the necessary fee.
[0038] FIG. 1 is an immunohistochemical representation
demonstrating ALK-specific monoclonal antibody staining of squamous
cell carcinoma of the kidney.
[0039] FIG. 2 is an immunohistochemical representation
demonstrating ALK-specific monoclonal antibody staining of granular
cell carcinoma of the kidney.
[0040] FIG. 3 is an image (with the inset showing a expanded view
of the cell immediately to the upper right of the inset) depicting
the detection of ALK by FISH assay employing a dual-color
(orange/green) break-apart probe specific to the ALK locus in
kidney squamous cells. The yellow arrows point to orange/green
signals either immediately adjacent to each other or fused together
confirming the presence of the 2p23 ALK region in its native state.
The red arrows point to a rearranged ALK locus. Images were taken
at 100.times. magnification with digital zoom inset.
[0041] FIG. 4A depicts a Western blot of MDCK cell lysates probed
with antibodies directed to pMet Y1234/5 antibody (Cell Signaling
Technology, Inc., Danvers, Mass.; Catalog #3077), Met (25H2) mouse
monoclonal antibody (Cell Signaling Technology #3127), pALK
Y1278/82/83 antibody, (Cell Signaling Technology, #3983), ALK
(D5F3) XP.RTM.RmAb (Cell Signaling Technology #3633), and Beta
Actin (Cell Signaling Technology #4970) after a 1 second exposure.
The lanes represented MDCK serum starved overnight (lane 1), MDCK
serum starved overnight, followed by HGF stimulation (50 ng/ml) for
5 minutes (lane 2), MDCK serum starved overnight, then serum
starved over 24 hours (lane 3), MDCK serum starved followed by HGF
stimulation (50 ng/ml) for 24 hours (lane 4), H3122 cells (positive
control for ALK (EML4-ALK v1))(lane 5), and MKN45 cells (positive
control for pMet)(lane 6) are depicted.
[0042] FIG. 4B depicts a Western blot of MUCK cell lysates probed
with antibodies directed to pMet Y1234/5 antibody (Cell Signaling
Technology, #3077), Met (25H2) mouse monoclonal antibody (Cell
Signaling Technology, #3127), pALK Y1278/82/83 antibody (Cell
Signaling Technology #3983), ALK (D5F3) XP.RTM.RmAb (Cell Signaling
Technology #3633), and Beta Actin (Cell Signaling Technology #4970)
after a 15 second exposure. The lanes represented MUCK serum
starved overnight (lane 1), MDCK serum starved overnight, followed
by HGF stimulation (50 mg/ml) for 5 minutes (lane 2), MUCK serum
starved overnight, then serum starved over 24 hours (lane 3), MDCK
serum starved followed by HGF stimulation (50 ng/ml) for 24 hours
(lane 4), H3122 cells (positive control for ALK (EML4-ALK
v1)10)(lane 5), and MKN45 cells (positive control for pMet)(lane 6)
are depicted.
DETAILED DESCRIPTION OF TRE PREFERRED EMBODIMENTS
[0043] The invention is based upon the unexpected discovery of ALK
kinase in human kidney cancer. As ALK kinase is not known to be
expressed in normal kidney tissue and cells, the presence of ALK
kinase (and ALK kinase activity) is expected to drive the
proliferation and survival of the subset of kidney cancer in which
it is expressed. Such kidney cancers may be identified (e.g.,
diagnosed) and/or treated in accordance with the teachings provided
herein.
[0044] Based on these discoveries, a patient whose kidney cancer
(or suspected kidney cancer) expresses a polypeptide with ALK
activity where healthy patients (i.e., non-cancerous patients) do
not express such proteins with ALK activity in their normal kidney
tissue may respond favorably to administration of an ALK inhibitor
(e.g., the growth of the kidney cancer may slow or stop as compared
to an untreated patient suffering from the same cancer).
[0045] The published patents, patent applications, websites,
company names, and scientific literature referred to herein
establish the knowledge that is available to those with skill in
the art and are hereby incorporated by reference in their entirety
to the same extent as if each was specifically and individually
indicated to be incorporated by reference. Any conflict between any
reference cited herein and the specific teachings of this
specification shall be resolved in favor of the latter.
[0046] The further aspects, advantages, and embodiments of the
invention are described in more detail below. The patents,
published applications, and scientific literature referred to
herein establish the knowledge of those with skill in the art and
are hereby incorporated by reference in their entirety to the same
extent as if each was specifically and individually indicated to be
incorporated by reference. Any conflict between any reference cited
herein and the specific teachings of this specification shall be
resolved in favor of the latter. Likewise, any conflict between an
art-understood definition of a word or phrase and a definition of
the word or phrase as specifically taught in this specification
shall be resolved in favor of the latter. As used herein, the
following terms have the meanings indicated. As used in this
specification, the singular forms "a," "an" and "the" specifically
also encompass the plural forms of the terms to which they refer,
unless the content clearly dictates otherwise. The term "about" is
used herein to mean approximately, in the region of, roughly, or
around. When the term "about" is used in conjunction with a
numerical range, it modifies that range by extending the boundaries
above and below the numerical values set forth. In general, the
term "about" is used herein to modify a numerical value above and
below the stated value by a variance of 20%.
[0047] Technical and scientific terms used herein have the meaning
commonly understood by one of skill in the art to which the present
invention pertains, unless otherwise defined. Reference is made
herein to various methodologies and materials known to those of
skill in the art. Standard reference works setting forth the
general principles of recombinant DNA technology include Ausubel et
al. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons,
New York, N.Y. (1989 and updates through August 2010); Sambrook et
al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring
Harbor Laboratory Press, New York (1989); Kaufman et al., Eds.,
Handbook of Molecular and Cellular Methods in Biology in Medicine,
CRC Press, Boca Raton (1995); McPherson, Ed., Directed Mutagenesis:
A Practical Approach, IRE, Press, Oxford (1991). Standard reference
works setting forth the general principles of pharmacology include
Goodman and Gilman's The Pharmacological Basis of Therapeutics,
11th Ed., McGraw Hill Companies Inc., New York (2006); and
Remington: The Science and Practice of Pharmacy, 21.sup.st Edition,
Lippincott Williams & Wilkins, 2005.
[0048] In a first aspect, the invention provides a method for
detecting the presence and/or activity of a polypeptide with ALK
kinase activity in a biological sample from a mammalian kidney
cancer or suspected mammalian kidney cancer. The method includes
(a) obtaining a biological sample from a mammalian kidney cancer or
suspected mammalian kidney cancer and (b) contacting the biological
sample with a detection molecule selected from the group consisting
of a reagent that detects ALK kinase activity, a reagent that
detects a polypeptide with ALK kinase activity, and a reagent that
detects to a polynucleotide encoding the polypeptide with ALK
kinase activity, and (c) detecting reaction of the detection
molecule with the biological sample, wherein reaction of the
detection molecule with the biological sample indicates said
polypeptide with ALK kinase activity is present or active in said
mammalian kidney cancer or suspected mammalian kidney cancer.
[0049] In another aspect, the invention provides a method for
identifying a mammalian kidney cancer or suspected mammalian kidney
cancer that belongs to a subset of kidney cancers driven by ALK
kinase activity, said method comprising the steps of (a) contacting
a biological sample obtained from a mammalian kidney cancer or
suspected mammalian kidney cancer with at least one detection
molecule selected from the group consisting of a reagent that
detects ALK kinase activity, a reagent that detects a polypeptide
with ALK kinase activity, and a reagent that detects to a
polynucleotide encoding the polypeptide with ALK kinase activity,
and (b) detecting reaction of the detection molecule with said
biological sample, wherein the reaction of the detection molecule
with said biological sample indicates that said mammalian kidney
cancer or suspected mammalian kidney cancer is driven by ALK kinase
activity. In some embodiments, the mammalian kidney cancer or
suspected mammalian kidney cancer driven by ALK kinase activity is
likely to respond to a composition comprising at least one
ALK-inhibiting therapeutic.
[0050] In another aspect, the invention provides method for
determining whether a compound inhibits the progression of a
mammalian kidney cancer or suspected mammalian kidney cancer driven
by a polypeptide with ALK kinase activity, said method comprising
the step of determining whether said compound inhibits the
expression and/or activity of said polypeptide in said cancer
mammalian kidney cancer or suspected mammalian kidney cancer.
[0051] In another aspect, the invention provides a method for
inhibiting the progression of a mammalian kidney cancer or
suspected mammalian kidney cancer driven by polypeptide with ALK
kinase activity, comprising inhibiting the expression and/or
activity of said polypeptide in said mammalian kidney cancer or
suspected mammalian kidney cancer.
[0052] In another aspect, the invention provides a method for
treating a mammalian patient with mammalian kidney cancer or
suspected mammalian kidney cancer driven by a polypeptide with ALK
kinase activity, said method comprising the step of administering a
composition comprising a therapeutically effective amount of a
composition comprising an ALK-inhibiting therapeutic to the
mammalian patient.
[0053] In still a further aspect, the invention provides a method
for treating a patient having a mammalian kidney cancer or
suspected mammalian kidney cancer comprising the steps of: (a)
detecting the presence or activity of said polypeptide with ALK
kinase activity a biological sample of the mammalian kidney cancer
or suspected mammalian kidney cancer of the patient; and (b)
administering a composition comprising an ALK-inhibiting
therapeutic to the patient. In some embodiments, the patient is a
human.
[0054] As used herein, by "reaction" as in the reaction of the
detection molecule with a biological sample is meant that the
detection molecule is detecting its target in the biological
sample. The nature of the reaction will, of course, depend upon the
type of detection molecule used. The methods of the invention
include the use of detection molecules that may be reagents that
detect ALK kinase activity (e.g., a phosphotyrosine-specific
antibody that detects phosphorylation of an ALK substrate or
detecting autophosphorylation of ALK). In this case, detection of
reaction may be made by detecting specific binding of the
pbosphotyrosine-specific antibody to the biological sample. The
methods of the invention also include the use of detection
molecules that may be reagents that detect a polypeptide with ALK
kinase activity (e.g., an antibody that specifically binds the
polypeptide). In this case, detection of reaction may be made by
detecting specific binding of the polypeptide with ALK kinase
activity-specific antibody to the biological sample. The methods of
the invention also include the use of detection molecules that may
be reagents that detect a polynucleotide that encodes a polypeptide
with ALK kinase activity (e.g., a nucleic acid probe that
hybridizes to an exonic or intronic sequence from a portion of the
ALK gene that encodes the ALK kinase domain). In this case,
detection of reaction may be made by detecting hybridization (e.g.,
under stringent conditions) of the probe to the biological
sample.
[0055] The various aspects and embodiments of the invention are
based on the discovery of ALK in cancerous cells in the kidney.
[0056] The term "ALK" refers to Anaplastic Lymphoma Kinase. ALK
(Anaplastic Lymphoma Kinase) (GenBank accession Number: AB209477,
UniProt Accession No. Q9UM73) is a receptor tyrosine kinase. This
protein (which is 1620 amino acids long in humans) has a
transmembrane domain in the central part and has a
carboxyl-terminal tyrosine kinase region and an amino-terminal
extracellular domain (Oncogene. 1997 Jan. 30; 14 (4): 439-49). See
Pulford et al., Journal of Cellular Physiology, 199:330-358, 2004
for a comprehensive review relating to ALK. The full-length ALK
sequence is disclosed in U.S. Pat. No. 5,770,421. In normal humans,
full-length ALK protein expression has been detected in the brain
and central nervous system, and has been reported in the small
intestine and testis (see, e.g., Morris et al, Oncogene
14:2175-2188, 1997). The amino acid sequence of full length human
ALK. cDNA and protein is provided herein as SEQ ID NOs: 1 and 2,
respectively. As shown in Table 1, the signal peptide,
extracellular, transmembrane, and kinase domains of ALK are found
at the following amino acid residues in SEQ ID NO: 2:
TABLE-US-00001 TABLE 1 Domain Amino acid residues in SEQ ID NO: 2
Signal peptide 1-18 Extracellular domain 19-1038 Transmembrane
domain 1039-1059 Cytoplasmic domain 1060-1620 Kinase domain
1116-1392
[0057] The polypeptide sequence of exon 20 onward of the ALK is
included herein as SEQ ID NO: 15. The polypeptide sequence of the
ALK protein starting with the transmembrane domain and including
the rest of the C'terminal portion of the protein is set forth in
amino acid residues 1060-1620 of SEQ ID NO: 2.
[0058] The term "polypeptide" (or "amino acid sequence" or
"protein") refers to a polymer formed from the linking, in a
defined order, of preferably, .alpha.-amino acids, D-, L-amino
acids, and combinations thereof. The link between one amino acid
residue and the next is referred to as an amide bond or a peptide
bond. Non-limiting examples of polypeptides include an
oligopeptide, peptide, or protein sequence, and fragments or
portions thereof, and naturally occurring or synthetic molecules
(e.g., peptide synthesized by artificial means). Polypeptides also
include derivatized molecules such as glycoproteins and
lipoproteins as well as lower molecular weight polypeptides. "Amino
acid sequence" and like terms, such as "polypeptide" or "protein",
are not meant to limit the indicated amino acid sequence to the
complete, naturally-occurring amino acid sequence associated with
the recited polypeptide molecule. Accordingly, the term
"polypeptide" also includes variants of the recited polypeptide
that do not vary significantly from the structure or function of
the recited polypeptide. If such differences in sequence are
contemplated, it should be remembered that there will be critical
areas on the protein which determine activity (e.g. the kinase
domain of ALK polypeptide), in general, it is possible to replace
residues that form the tertiary structure, provided that residues
performing a similar function are used. In other instances, the
type of residue may be completely unimportant if the alteration
occurs at a non-critical region of the protein.
[0059] As used herein, the term "biological sample" refers to
saliva, cells, mucous, tears, blood, serum, lymph/interstitial
fluids, buccal cells, mucosal cells, cerebrospinal fluid, semen,
feces, plasma, urine, marrow, a suspension of cells, or a
suspension of cells and viruses or extracts or any of the
foregoing, and may comprise a cell, chromosomes isolated from a
cell (e.g., a spread of metaphase chromosomes), genomic DNA (in
solution or bound to a solid support such as for Southern
analysis), RNA (in solution or bound to a solid support such as for
northern analysis), cDNA (in solution or bound to a solid support)
obtainable from any mammal (e.g., a human), such as a normal mammal
or a mammal having or suspected of having kidney cancer. In some
embodiments, a biological sample is mammalian (e.g., human) and is
a biopsy sample or a blood sample including a circulating tumor
cell. Biological samples useful in the practice of the methods of
the invention may be obtained from any mammal.
[0060] Any biological sample comprising cells (or extracts of
cells) from a mammalian cancer is suitable for use in the methods
of the invention. In one embodiment, the biological sample
comprises cells obtained from a tumor biopsy. The biopsy may be
obtained, according to standard clinical techniques, from primary
tumors occurring in an organ of a mammal, or by secondary tumors
that have metastasized in other tissues. In another embodiment, the
biological sample comprises cells obtained from a fine needle
aspirate taken from a tumor, and techniques for obtaining such
aspirates are well known in the art (see Cristallini et al., Acta
Cytol. 36(3): 416-22 (1992)).
[0061] In some embodiments, the biological sample comprises
circulating tumor cells. Circulating tumor cells ("CTCs") may be
purified, for example, using the kits and reagents sold under the
trademarks Vita-Assays.TM., Vita-Cap.TM., and CellSearch.RTM.
(commercially available from Vitatex, LLC (a Johnson and Johnson
corporation). Other methods for isolating CTCs are described (see,
for example, PCT Publication No. WO/2002/020825, Cristofanilli et
al, New Engl. J. of Med, 351 (8):781-791 (2004), and Adams et al,
J. Amer. Chem. Soc. 130(27): 8633-8641 (July 2008)). In a
particular embodiment, a circulating tumor cell ("CTC") may be
isolated and identified as having originated from the kidney.
[0062] Accordingly, the invention provides a method for isolating a
CTC, and then screening the CTC one or more assay formats to
identify the presence of a polypeptide with ALK kinase activity a
polynucleotide encoding the same in the CTC. Some non-limiting
assay formats include Western blotting analysis, flow-cytometry
(FC), immuno-histochemistry (IHC), immuno-fluorescence (IF), in
situ hybridization (ISH), fluorescence in situ hybridization
(FISH), and polymerase chain reaction (PCR). A CTC from a patient
that is identified as comprising a polypeptide with ALK kinase
activity or polynucleotide encoding the same may indicate that the
patient's originating cancer (e.g., a kidney cancer such as an
squamous kidney cancer cell or a granular kidney cancer cell) is
likely to respond to a composition comprising at least one ALK
kinase-inhibiting therapeutic.
[0063] Biological samples useful in the practice of the methods of
the invention may be obtained from any mammal in which a cancer
driven by polypeptide with ALK kinase activity is or might be
present or developing.
[0064] In various embodiments, the mammal (e.g., from which the
mammalian kidneys cancer or suspected mammalian kidney cancer
originates) is a human, and the human may be a candidate for an
ALK-inhibiting therapeutic for the treatment of cancer driven by a
polypeptide with ALK kinase activity. The human candidate may be a
patient currently being treated with, or considered for treatment
with, an ALK-inhibiting therapeutic or other kinase-inhibiting
therapeutic (e.g., Tarceva.RTM.). In another embodiment, the mammal
is large animal, such as a horse or cow, while in other
embodiments, the mammal is a small animal, such as a dog or cat,
all of which are known to develop kidney cancer.
[0065] Any biological sample comprising cells (or extracts of
cells) from a mammalian cancer is suitable for use in the methods
of the invention. In one embodiment, the biological sample
comprises cells obtained from a tumor biopsy. The biopsy may be
obtained, according to standard clinical techniques, from primary
tumors occurring in an organ of a mammal, or by secondary tumors
that have metastasized in other tissues. In another embodiment, the
biological sample comprises cells obtained from a fine needle
aspirate taken from a tumor by methods well known in the art (see
Cristallini et al., Acta Cytol. 36(3): 416-22 (1992)).
[0066] Cellular extracts of the foregoing biological samples may be
prepared, either crude or partially (or entirely) purified, in
accordance with standard techniques, and used in the various
methods of the invention. Alternatively, biological samples
comprising whole cells may be utilized in assay formats such as
immunohistochemistry (IHC), flow cytometry (FC), and
immunofluorescence (IF), as further described herein. Such
whole-cell assays are advantageous in that they minimize
manipulation of the tumor cell sample and thus reduce the risks of
altering the in vivo signaling/activation state of the cells and/or
introducing artifact signals. Whole cell assays are also
advantageous because they characterize expression and signaling
only in tumor cells, rather than a mixture of tumor and normal
cells.
[0067] As used herein, by "polypeptide having ALK kinase activity"
is meant any protein or polypeptide (or fusion or fragment thereof)
that retains the signaling properties of a full length ALK protein
(i.e., retains ALK kinase activity). Thus, polypeptides having ALK
kinase activity include, without limitation, full-length ALK
protein, portions of ALK comprising the kinase domain of ALK
protein, truncated forms of ALK which retain ALK kinase activity
(e.g., a truncated ALK polypeptide comprising the ALK kinase domain
without the extracellular or transmembrane domain of full-length
ALK) and all other ALK polypeptides, which may or may not be fused
with other polypeptides, that retain their ALK biological activity
and/or tyrosine kinase activity. ALK may be derived from any
species, such as mammalian, including bovine, ovine, porcine,
murine, equine, and human, and may be derived from any source
whether natural, synthetic, semi-synthetic, or recombinant. The
human full length ALK protein is set forth in SEQ ID NO: 2. Persons
of skill in the art would be readily able to determine
corresponding sequences in non-human mammalian ALK homologues.
[0068] In various embodiments of all of the aspects of the
invention, the polypeptide with ALK kinase activity is aberrantly
expressed full-length ALK protein.
[0069] By "aberrantly expressed full-length ALK polypeptide" is
meant that full length ALK is expressed in a cell of the kidney or
kidney tissue of a cancer or suspected cancer patient where, in the
same cell or tissue type of a normal individual, full-length ALK is
not expressed. Such aberrant expression may be due to, for example,
mutations in regulatory sequences (such the promoter, enhancer, or
intronic genomic sequences) operably linked to exons encoding amino
acids of foil-length ALK polypeptide which result in aberrant
expression of full-length ALK polypeptide in the cell bearing the
mutation. Numerous examples of aberrantly expressed ALK kinase have
been found in other cancers. For example, point mutations within
the kinase domain have been found in neuroblastoma and
overexpression of ALK has been found in numerous cancers
(including, e.g., retinoblastoma, breast cancer, and melanoma). See
review in Palmer et al., Biochem. J. 420(3): 345-361 (May 2009),
herein incorporated by reference in its entirety. Aberrant
expression (e.g., overexpression) of foil length ALK polypeptide in
a cancer (e.g., a kidney cancer) may be the result of amplification
of the ALK gene in the cancer cell's genome.
[0070] In various embodiments, the polypeptide with ALK kinase
activity is an ALK fusion polypeptide comprising at least a portion
of a first fusion member and at least a portion of a second fusion
member, wherein the second fusion member is an ALK protein
comprises an ALK kinase domain.
[0071] The term "ALK fusion polypeptide" refers to a portion or
fragment of the ALK protein fused to at least a portion or fragment
of another protein. In some embodiments, the portion of ALK protein
present in an ALK fusion polypeptide comprises the kinase domain of
full-length ALK protein. In some embodiments, the portions of the
ALK present in an ALK fusion polypeptide comprise amino acids
encoded by exon 20 onward of an ALK-encoding gene. In some
embodiments, an ALK fusion polypeptide comprises the amino acid
sequence set forth in SEQ ID NO: 3. In some embodiments, an ALK
fusion polypeptide comprises the amino acid sequence set forth in
SEQ ID NO: 4. In some embodiments, an ALK fusion polypeptide
comprises the amino acid sequence set forth in SEQ ID NO: 15. An
ALK fusion polypeptide often results from a chromosomal
translocation or inversion. Non-limiting examples of ALK fusion
polypeptides include VCL-ALK, EML4-ALK, NPM-ALK, TPM3-ALK, TFG-ALK,
AT1C-ALK, CLTC-ALK, MSN-ALK, TPM4-ALK, ALO17-ALK, RANBP2-ALK,
MYH9-ALK, CARS-ALK, 8EC31L1-ALK, and KIF5B-ALK (see, e.g.,
Debelenko et al., Modern Pathology 24: 430-442, 2011;
Marino-Enriquez et al, Genes, Chromosome, and Cancer 50(3):
146-153, 2011; Palmer et al., Biochem. J. 420(3); 345-361, 2009
(and the articles cited therein), Rikova et al, Cell 131:
1190-1203, 2007; Soda et al., Nature 448: 561-566, 2007; Morris et
al., Science 263: 1281-1284, 1994; Du et al, J. Mol. Med 84:
863-875, 2007; Panagopoulos et al., Int. 0.1. Cancer 118:
1181-1186, 2006; Cools et al, Genes Chromosomes Cancer 34: 354-362,
2002; Debelenko et al., Lab. Invest. 83: 1255-1265, 2003; Ma et al,
Genes Chromosomes Cancer 37: 98-105, 2003; Lawrence et al, Am. J.
Pathol. 157: 377-384, 2000; Hernandez et al., Blood 94: 3265-3268,
1999; Hernandez et al, Am J Pathol 160: 1487-1494, 2002; Takeuchi
K., Clin Cancer Res. 15(9):3143-3149, 2009; Tort et al, Lab.
Invest. 81: 419-426, 2001; Trinei et al., Cancer Res. 60: 793-798,
2000; Colleoni et al., Am J Pathol. 156 (3): 781-9, 2000; Shiota et
al, Blood 86: 1954-1960, 1995; Kuefer et al, Blood 90: 2901-2910,
1997; Shiota et al, Oncogene 9: 1567-1574, 1994; Touriol et al,
Blood 95: 3204-3207, 2000; and Pulford et al, Journal of Cellular
Physiology, 199:330-358, 2004. Some of these ALK fusions have
multiple variants, all of which are considered ALK fusions and,
thus, are included in the definition of mutant ALK of the
invention. For example, there are multiple variants of TFG-ALK
(see, e.g., Hernandez et al., Amer. J. Pathol. 160: 1487-1494,
2002) and at least nine known variants of EML4-ALK (see, e.g., Horn
et al., J. of Clinical Oncology 27(26): 4232-4235, 2009, U.S. Pat.
Nos. 7,728,120; 7,700,339 and EP Patent No. 1 914 240). Moreover, a
method for identifying a protein as a fusion partner for ALK using
ALK antibodies has been reported (Elenitoba-Johnson et al, Proc.
Natl. Acad. Sci. 103: 7402-7407, 2006).
[0072] It should be noted that in all of the ALK fusion proteins
described herein, the amino acid at the fusion junction (regardless
of the numbering) may appear in either full-length protein member
of the fusion, or the amino acid, being created by a codon with
nucleotides from fused exons and/or of both protein members, may be
unique to the fusion polypeptide and not appear in either
full-length protein member of the fusion.
[0073] As used herein, a "portion" or "fragment" means a sequence
fragment less than the whole sequence. For example, a 50 nucleotide
sequence is a portion of a 100 nucleotide long sequence. Similarly,
a 50 amino acid residue long sequence is a portion of a 100 amino
acid long sequence. In some embodiments, a nucleic acid fragment or
portion comprises at least 20 nucleotides, or at least 30
nucleotides, or at least 45 nucleotides, or at least 60
nucleotides, or at least 70 nucleotides, or at least 90
nucleotides, in some embodiments, a polypeptide fragment or portion
comprises at least 6 amino acid residues, or at least 10 amino acid
residues, or at least 20 amino acid residues, or at least 30 amino
acid residues, or at least 45 amino acid residues, or at least 60
amino acid residues, or at least 70 amino acid residues, or at
least 90 amino acid residues.
[0074] In one embodiment, the ALK fusion polypeptide contains the
complete ALK tyrosine kinase domain located at amino acids
1116-1392 of ALK (SEQ ID NO: 3). In another embodiment, the ALK
fusion polypeptide contains the complete intracytoplasmic domain
located at amino acids 1060-1620 of ALK (SEQ ID NO: 4), In another
embodiment, the ALK fusion polypeptide contains amino acid residues
1504-1507 (SEQ ID NQ:5) of ALK making up the
phosphotyrosine-binding site of the C-terminal domain of ALK. In
yet another embodiment, the ALK fusion polypeptide contains amino
acid residues 1603-1606 (SEQ ID NO:6) of ALK representing the
interaction site for the phosphotyrosine-dependent binding of the
substrate phospholipase C-.gamma. (PLC-.gamma.).
[0075] Because ALK is not known to be expressed in normal kidney
cells, the presence or activity of a polypeptide with ALK kinase
activity in mammalian kidney cancer or suspected mammalian kidney
cancer is, in accordance with the invention, identified as a
mammalian kidney cancer or suspected mammalian kidney cancer
belonging to a subset of kidney cancers driven by ALK kinase
activity.
[0076] As used herein, by "drive" or "driven" is meant that a
mammalian kidney cancer or suspected mammalian kidney cancer has
gained its cancerous state because of the presence within the cells
of the mammalian kidney cancer or suspected mammalian kidney cancer
of a polypeptide with ALK kinase activity. Such a presence may be
detected by detecting the presence of a polynucleotide encoding the
polypeptide with ALK kinase activity (e.g., detecting a gene
translocation involving the ALK gene and another gene or detecting
a mutation in the promoter of the ALK gene that would result in
aberrant expression of full-length ALK polypeptide), detecting the
polypeptide with ALK kinase activity, or by detecting ALK kinase
activity of the polypeptide with ALK kinase activity. In other
words, the presence of a polypeptide with ALK kinase activity
stimulates or is the causative agent of the cancerous state of the
mammalian kidney cancer or suspected mammalian kidney cancer.
[0077] As used herein, by "cancer" or "cancerous" is meant a cell
that shows abnormal growth as compared to a normal (i.e.,
non-cancerous) cell of the same cell type. For example, a cancerous
cell may be hyperplastic, anaplastic, metastatic, or benign (but
shows abnormal growth). A cancerous cell may also show lack of
contact inhibition where a normal cell of that same cell type shows
contact inhibition.
[0078] In various embodiments of the invention, the activity of a
polypeptide with ALK kinase activity is detected using as a
detection molecule a reagent that detects ALK kinase activity.
[0079] Numerous reagents can be employed that detect ALK kinase
activity. For example, substrates of ALK kinase are known (see,
e.g., Donella-Deana et al., Biochemistry 44(23):8533-8542, 2005;
Simonitsch et al., FASEB J 15:1416-1418,2001; and the
Poly(Glu:Tyr)4:1 substrate commercially available from
Sigma-Aldrich (St. Louis, Mo.; Catalog No, P-0275)). These
substrates can be added to standard in vitro kinase assays and
their phosphorylation on tyrosine determined (using, e.g., a
phosphotyrosine-specific antibody such as the 4G10 antibody
commercially available from Millipore, Bedford, Mass. or the
P-Tyr-100 antibody (Catalog No. 9411) commercially available from
Cell Signaling Technology, Inc., Danvers, Mass.
[0080] Note that because ALK autophosphorylates when its kinase
activity is active (see Perez-Pinera et al, Journal of Bio logical
Chemistry 282: 28683-28690, 207), the reagent that detects ALK
kinase activity may itself be a phosphotyrosine-specific antibody
that binds to tyrosine-phosphorylated ALK protein.
[0081] In some embodiments, ALK kinase activity is detected in an
in vitro kinase assay format. In vitro kinase assays have been well
known for many years (see, e.g., Ausubel et al., supra; Hernandez
et al, Blood 94: 3265-3268, 1999). Indeed, in vitro kinase services
for detecting ALK kinase activity are commercially available (from
ProQinase GmbH, Freiburg, Germany).
[0082] In some embodiments, the method for detecting the presence
and/or activity of a polypeptide with ALK kinase activity in a
biological sample from a mammalian kidney cancer or suspected
mammalian kidney cancer comprises the steps of: (a) obtaining a
biological sample from a mammalian kidney cancer or suspected
mammalian kidney cancer and (b) contacting the biological sample
with a reagent that detects a polypeptide with ALK kinase activity,
wherein detection of said polypeptide in said biological sample
indicates said polypeptide with ALK kinase activity is present in
said biological sample.
[0083] In various embodiments of the invention, the expression of a
polypeptide with ALK kinase activity is detected using as a
detection molecule a reagent that detects a polypeptide with ALK
kinase activity. In some embodiments, the reagent specifically
binds to a polypeptide with ALK kinase activity.
[0084] By "specifically binding" or "specifically binds" means that
a reagent that may be used in the various methods of the invention
(e.g., an antibody or AQUA peptide) interacts with its target
molecule (e.g., a polypeptide with ALK kinase activity such as a
full-length ALK polypeptide or a ALK fusion polypeptide), where the
interaction is dependent upon the presence of a particular
structure (e.g., the antigenic determinant or epitope on the
polypeptide or the nucleotide sequence of the polynucleotide); in
other words, the reagent is recognizing and binding to a specific
polypeptide or polynucleotide structure rather than to all
polypeptides or polynucleotides in general. By "binding fragment
thereof" means a fragment or portion of a reagent that specifically
binds the target molecule (e.g., an Fab fragment of an
antibody).
[0085] A reagent that specifically binds to the target molecule may
be referred to as a target-specific reagent or an anti-target
reagent. For example, an antibody that specifically binds to a
NPM-ALK polypeptide may be referred to as a NPM-ALK-specific
antibody or an anti-NPM-ALK antibody. Likewise, an antibody that
specifically binds to the full length ALK polypeptide may be
referred to as an ALK-specific antibody or an anti-ALK
antibody.
[0086] In some embodiments, a reagent that specifically binds its
target molecule has a binding affinity (K.sub.D) for its target
molecule (e.g., an ALK fusion polypeptide) of 1.times.10.sup.-6 M
or less. In some embodiments, a reagent that specifically binds to
its target molecule binds to its target molecule with a K.sub.D of
1.times.10.sup.-7 M or less, or a K.sub.D of 1.times.10.sup.-8 M or
less, or a K.sub.D of 1.times.10.sup.-9 M or less, or a K.sub.D of
1.times.10.sup.-10 M or less, of a K.sub.D of 1.times.10.sup.-11 M
or less, of a K.sub.D of 1.times.10.sup.-12 M or less. In certain
embodiments, a reagent that specifically binds to its target
molecule binds to its target molecule with a K.sub.D of 1 pM to 500
pM, or between 500 pM to 1 .mu.M, or between 1 .mu.M to 100 nM, or
between 100 mM to 10 nM.
[0087] In some embodiments, a reagent that specifically binds to a
polypeptide with ALK kinase activity is a heavy-isotope labeled
peptide (i.e., an AQUA peptide). Such an AQUA peptide may be
suitable for the absolute quantification of an expressed
polypeptide with ALK kinase activity in a biological sample. As
used herein, the term "heavy-isotope labeled peptide" is used
interchangeably with "AQUA peptide". The production and use of AQUA
peptides for the absolute quantification or detection of proteins
(AQUA) in complex mixtures has been described. See PCT Publication
No. WO/03016861 and also Gerber et al, Proc. Natl. Acad. Sci.
U.S.A. 100: 6940-5 (2003). The term "specifically detects" with
respect to such an AQUA peptide means the peptide will only detect
and quantify polypeptides and proteins that contain the AQUA
peptide sequence and will not substantially detect polypeptides and
proteins that do not contain the AQUA peptide sequence.
[0088] AQUA internal peptide standards (heavy-isotope labeled
peptides) may desirably be produced to detect any quantify any
unique site (e.g., the fusion junction within an ALK fusion
polypeptide) within a polypeptide with ALK kinase activity.
[0089] The AQUA methodology employs the introduction of a known
quantity of at least one heavy-isotope labeled peptide standard
(which has a unique signature detectable by LC-SRM chromatography)
into a digested biological sample in order to determine, by
comparison to the peptide standard, the absolute quantity of a
peptide with the same sequence and protein modification in the
biological sample. Briefly, the AQUA methodology has two stages:
peptide internal standard selection and validation and method
development; and implementation using validated peptide internal
standards to detect and quantify a target protein in sample. The
method is a powerful technique for detecting and quantifying a
given peptide/protein within a complex biological mixture, such as
a cell lysate, and may be employed, e.g., to quantify change in
protein phosphorylation as a result of drug treatment, or to
quantify differences in the level of a protein in different
biological states.
[0090] Generally, to develop a suitable internal standard, a
particular peptide (or modified peptide) within a target protein
sequence is chosen based on its amino acid sequence and the
particular protease to be used to digest. The peptide is then
generated by solid-phase peptide synthesis such that one residue is
replaced with that same residue containing stable isotopes
(.sup.13C, .sup.15N). The result is a peptide that is chemically
identical to its native counterpart formed by proteolysis, but is
easily distinguishable by MS via a 7-Da mass shift. The newly
synthesized AQUA internal standard peptide is then evaluated by
LC-MS/MS. This process provides qualitative information about
peptide retention by reverse-phase chromatography, ionization
efficiency, and fragmentation via collision-induced dissociation.
Informative and abundant fragment ions for sets of native and
internal standard peptides are chosen and then specifically
monitored in rapid succession as a function of chromatographic
retention to form a selected reaction monitoring (LC-SRM) method
based on the unique profile of the peptide standard.
[0091] The second stage of the AQUA strategy is its implementation
to measure the amount of a protein or modified protein from complex
mixtures. Whole cell lysates are typically fractionated by SDS-PAGE
gel electrophoresis, and regions of the gel consistent with protein
migration are excised. This process is followed by in-gel
proteolysis in the presence of the AQUA peptides and LC-SRM
analysis. (See Gerber et al, supra.) AQUA peptides are spiked in to
the complex peptide mixture obtained by digestion of the whole cell
lysate with a proteolytic enzyme and subjected to immunoaffinity
purification as described above. The retention time and
fragmentation pattern of the native peptide formed by digestion
(e.g., trypsinization) is identical to that of the AQUA internal
standard peptide determined previously; thus, LC-MS/MS analysis
using an SRM experiment results in the highly specific and
sensitive measurement of both internal standard and analyte
directly from extremely complex peptide mixtures.
[0092] Since an absolute amount of the AQUA peptide is added (e.g.,
250 fmol), the ratio of the areas under the curve can be used to
determine the precise expression levels of a protein or
phosphorylated form of a protein in the original cell lysate. In
addition, the internal standard is present during in-gel digestion
as native peptides are formed, such that peptide extraction
efficiency from gel pieces, absolute losses during sample handling
(including vacuum centrifugation), and variability during
introduction into the LC-MS system do not affect the determined
ratio of native and AQUA peptide abundances.
[0093] An AQUA peptide standard is developed for a known sequence
previously identified by the IAP-LC-MS/MS method within in a target
protein. If the site is modified, one AQUA peptide incorporating
the modified form of the particular residue within the site may be
developed, and a second AQUA peptide incorporating the unmodified
form of the residue developed. In this way, the two standards may
be used to detect and quantify both the modified an unmodified
forms of the site in a biological sample.
[0094] Peptide internal standards may also be generated by
examining the primary amino acid sequence of a protein and
determining the boundaries of peptides produced by protease
cleavage. Alternatively, a protein may actually be digested with a
protease and a particular peptide fragment produced can then
sequenced. Suitable proteases include, but are not limited to,
serine proteases (e.g. trypsin, hepsin), metallo proteases (e.g.,
PUMP1), chymotrypsin, cathepsin, pepsin, thermolysin,
carboxypeptidases, etc.
[0095] A peptide sequence within a target protein is selected
according to one or more criteria to optimize the use of the
peptide as an internal standard. Preferably, the size of the
peptide is selected to minimize the chances that the peptide
sequence will be repeated elsewhere in other non-target proteins.
Thus, a peptide is preferably at least about 6 amino acids. The
size of the peptide is also optimized to maximize ionization
frequency. Thus, in some embodiments, the peptide is not longer
than about 20 amino acids. In some embodiments, the peptide is
between about 7 to 15 amino acids in length. A peptide sequence is
also selected that is not likely to be chemically reactive during
mass spectrometry, thus sequences comprising cysteine, tryptophan,
or methionine are avoided.
[0096] A peptide sequence that does not include a modified region
of the target region may be selected so that the peptide internal
standard can be used to determine the quantity of all forms of the
protein. Alternatively, a peptide internal standard encompassing a
modified amino acid may be desirable to defect and quantify only
the modified form of the target protein. Peptide standards for both
modified and unmodified regions can be used together, to determine
the extent of a modification in a particular sample (i.e. to
determine what traction of the total amount of protein is
represented by the modified form). For example, peptide standards
for both the phosphorylated and unphosphorylated form of a protein
known to be phosphorylated at a particular site can be used to
quantify the amount of phosphorylated form in a sample.
[0097] The peptide is labeled using one or more labeled amino acids
(i.e., the label is an actual part of the peptide) or less
preferably, labels may be attached after synthesis according to
standard methods. Preferably, the label is a mass-altering label
selected based on the following considerations: The mass should be
unique to shift fragments masses produced by MS analysis to regions
of the spectrum with low background; the ion mass signature
component is the portion of the labeling moiety that preferably
exhibits a unique ion mass signature in MS analysis; the sum of the
masses of the constituent atoms of the label is preferably uniquely
different than the fragments of all the possible amino acids. As a
result, the labeled amino acids and peptides are readily
distinguished from unlabeled ones by the ion/mass pattern in the
resulting mass spectrum. Preferably, the ion mass signature
component imparts a mass to a protein fragment that does not match
the residue mass for any of the 20 natural amino acids.
[0098] The label should be robust under the fragmentation
conditions of MS and not undergo unfavorable fragmentation.
Labeling chemistry should be efficient under a range of conditions,
particularly denaturing conditions, and the labeled tag preferably
remains soluble in the MS buffer system of choice. The label
preferably does not suppress the ionization efficiency of the
protein and is not chemically reactive. The label may contain a
mixture of two or more isotopically distinct species to generate a
unique mass spectrometric pattern at each labeled fragment
position. Stable isotopes, such as .sup.2H, .sup.13C, .sup.15N,
.sup.17O, .sup.18O, or .sup.34S, are some non-limiting labels.
Pairs of peptide internal standards that incorporate a different
isotope label may also be prepared. Non-limiting amino acid
residues into which a heavy isotope label may be incorporated
include leucine, pro line, valine, and phenylalanine.
[0099] Peptide internal standards are characterized according to
their mass-to-charge (m/z) ratio, and preferably, also according to
their retention time on a chromatographic column (e.g., an HPLC
column). Internal standards that co-elute with unlabeled, peptides
of identical sequence are selected as optimal internal standards.
The internal standard is then analyzed by fragmenting the peptide
by any suitable means, for example by collision-induced
dissociation (CID) using, e.g., argon or helium as a collision gas.
The fragments are then analyzed, for example by multi-stage mass
spectrometry (MS.sup.n) to obtain a fragment ion spectrum, to
obtain a peptide fragmentation signature. Preferably, peptide
fragments have significant differences in m/z ratios to enable
peaks corresponding to each fragment to be well separated, and a
signature is that is unique for the target peptide is obtained. If
a suitable fragment signature is not obtained at the first stage,
additional stages of MS are performed until a unique signature is
obtained.
[0100] Fragment ions in the MS/MS and MS.sup.3 spectra are
typically highly specific for the peptide of interest, and, in
conjunction with LC methods, allow a highly selective means of
detecting and quantifying a target peptide/protein in a, complex
protein mixture, such as a cell lysate, containing many thousands
or tens of thousands of proteins. Any biological sample potentially
containing a target protein/peptide of interest may be assayed.
Crude or partially purified cell extracts are preferably employed.
Generally, the sample has at least 0.01 mg of protein, typically a
concentration of 0.1-10 mg/mL, and may be adjusted to a desired
buffer concentration and pH.
[0101] A known amount of a labeled peptide internal standard,
preferably about 10 femtomoles, corresponding to a target protein
to be detected/quantified is then added to a biological sample,
such as a cell lysate. The spiked sample is then digested with one
or more protease(s) for a suitable time period to allow digestion.
A separation is then performed (e.g. by HPLC, reverse-phase HPLC,
capillary electrophoresis, ion exchange chromatography, etc.) to
isolate the labeled internal standard and its corresponding target
peptide from other peptides in the sample. Microcapillary LC is a
one non-limiting method.
[0102] Each isolated peptide is then examined by monitoring of a
selected reaction in the MS. This involves using the prior
knowledge gained by the characterization of the peptide internal
standard and then requiring the MS to continuously monitor a
specific ion in the MS/MS or MS.sup.n spectrum for both the peptide
of interest and the internal standard. After elution, the area
under the curve (AUC) for both peptide standard and target peptide
peaks are calculated. The ratio of the two areas provides the
absolute quantification that can be normalized for the number of
cells used in the analysis and the protein's molecular weight, to
provide the precise number of copies of the protein per cell.
Further details of the AQUA methodology are described in PCT
Publication No. WO/03016861 and Gerber et al. supra.
[0103] In some embodiments, a reagent that specifically binds to a
polypeptide with ALK kinase activity is an antibody, in some
embodiments, the antibody is specific for (i.e., specifically binds
to) full length ALK polypeptide. In some embodiments, the antibody
does not cross-react with (i.e., does not specifically bind to)
c-Met. In some embodiments, the antibody is specific for the kinase
domain of ALK. In some embodiments, the antibody is specific for
the extracellular domain of ALK. In some embodiments, where the
polypeptide with ALK kinase activity is an ALK fusion polypeptide,
the antibody specifically binds to the portion of ALK polypeptide
that is fused to the portion of ALK kinase present in the ALK
fusion polypeptide. For example, if the fusion is EML4-ALK (the 796
variant), the antibody specifically binds to the portion of the ALK
protein (e.g., the ALK kinase domain) present in the fusion, in
some embodiments, where the polypeptide with ALK kinase activity is
an ALK fusion polypeptide, the antibody specifically binds to the
portion of the fusion partner that is fused to the portion of ALK
kinase present in the ALK fusion polypeptide. For example, if the
fusion is EML4-ALK (the 796 variant), the antibody specifically
binds to the N-terminus of the EML4 protein present in the
fusion.
[0104] The term "antibody" or "antibodies" refers to all types of
immunoglobulins, including IgG, IgM, IgA, IgD, and IgE, including
binding fragments thereof (i.e., fragments of an antibody that are
capable of specifically binding to the antibody's target molecule,
such as F.sub.ab, and F(ab').sub.2 fragments), as well as
recombinant, humanized, polyclonal, and monoclonal antibodies
and/or binding fragments thereof. Antibodies of the invention can
be derived from any species of animal, such as from a mammal.
Non-limiting exemplary natural antibodies include antibodies
derived from, human, chicken, goats, and rodents (e.g., rats, mice,
hamsters and rabbits), including transgenic rodents genetically
engineered to produce human antibodies (see, e.g., Lonberg et ah,
WO93/12227; U.S. Pat. No. 5,545,806; and Kucherlapati, et al,
WO91/10741; U.S. Pat. No. 6,150,584, which are herein incorporated
by reference in their entirety). Antibodies of the invention may be
also be chimeric antibodies. See, e.g., M Walker et al, Molec.
Immunol. 26: 403-11 (1989); Morrision et al, Proc. Nat'l Acad. Sci.
81: 6851 (1984); Neuberger et al, Nature 312: 604 (1984)), The
antibodies may be recombinant monoclonal antibodies produced
according to known methods (see, e.g., U.S. Pat. Nos. 4,474,893;
4,816,567; 7,485,291, and US Patent Publication No. 20110045534).
The antibodies may also be chemically constructed specific
antibodies made according to the method disclosed in U.S. Pat. No.
4,676,980.
[0105] Natural antibodies are the antibodies produced by a host
animal, however the invention contemplates also genetically altered
antibodies wherein the amino acid sequence has been varied from
that of a native antibody. Because of the relevance of recombinant
DNA techniques to this application, one need not be confined to the
sequences of amino acids found in natural antibodies; antibodies
can be redesigned to obtain desired characteristics. The possible
variations are many and range from the changing of just one or a
few amino acids to the complete redesign of, for example, the
variable or constant region. Changes in the constant region wall,
in general, be made in order to improve or alter characteristics,
such as complement fixation, interaction with membranes and other
effector functions. Changes in the variable region wall be made in
order to improve the antigen binding characteristics. The term
"humanized antibody", as used herein, refers to antibody molecules
in which amino acids have been replaced in the non-antigen binding
regions in order to more closely resemble a human antibody, while
still retaining the original binding ability. Other antibodies
specifically contemplated are oligoclonal antibodies. As used
herein, the phrase "oligoclonal antibodies" refers to a
predetermined mixture of distinct monoclonal antibodies. See, e.g.,
PCT publication WO 95/20401; U.S. Pat. Nos. 5,789,208 and
6,335,163. In one embodiment, oligoclonal antibodies consisting of
a predetermined mixture of antibodies against one or more epitopes
are generated in a single cell. In other embodiments, oligoclonal
antibodies comprise a plurality of heavy chains capable of pairing
with a common light chain to generate antibodies with multiple
specificities (e.g., PCT publication WO 04/009618), Oligoclonal
antibodies are particularly useful when it is desired to target
multiple epitopes on a single target molecule. In view of the
assays and epitopes disclosed herein, those skilled in the art can
generate or select antibodies or mixtures of antibodies that are
applicable for an intended purpose and desired need.
[0106] Recombinant antibodies are also included in the present
invention. These recombinant antibodies have the same amino acid
sequence as the natural antibodies or have altered amino acid
sequences of the natural antibodies. They can be made in any
expression systems including both prokaryotic and eukaryotic
expression systems or using phage display methods (see, e.g., Dower
et al, WO91/17271 and McCafferty et al., WO92/01047; U.S. Pat. No.
5,969,108, which are herein incorporated by reference in their
entirety). Antibodies can be engineered in numerous ways. They can
be made as single-chain antibodies (including small modular
immunopharmaceuticals or SMIPs.TM.), Fab and F(ab').sub.2
fragments, etc. Antibodies can be humanized, chimerized,
deimmunized, or fully human. Numerous publications set forth the
many types of antibodies and the methods of engineering such
antibodies. For example, see U.S. Pat. Nos. 6,355,245; 6,180,370;
5,693,762; 6,407,213; 6,548,640; 5,565,332; 5,225,539; 6,103,889;
and 5,260,203. The genetically altered antibodies of the invention
may be functionally equivalent to the above-mentioned natural
antibodies. In certain embodiments, modified antibodies of the
invention provide improved stability or/and therapeutic
efficacy.
[0107] Non-limiting examples of modified antibodies include those
with conservative substitutions of amino acid residues, and one or
more deletions or additions of amino acids that do not
significantly deleteriously alter the antigen binding utility.
Substitutions can range from changing or modifying one or more
amino acid residues to complete redesign of a region as long as the
therapeutic utility is maintained. Antibodies of the invention can
be modified post-translationally (e.g., acetylation, and/or
phosphorylation) or can be modified synthetically (e.g., the
attachment of a labeling group). Antibodies with engineered or
variant constant or Fc regions can be useful in modulating effector
functions, such as, for example, antigen-dependent cytotoxicity
(ADCC) and complement-dependent cytotoxicity (CDC). Such antibodies
with engineered or variant constant or Fc regions may be useful in
instances where a parent singling protein is expressed in normal
tissue; variant antibodies without effector function in these
instances may elicit the desired therapeutic response while not
damaging normal tissue. Accordingly, certain aspects and methods of
the present disclosure relate to antibodies with altered effector
functions that comprise one or more amino acid substitutions,
insertions, and/or deletions. The term "biologically active" refers
to a protein having structural, regulatory, or biochemical
functions of a naturally occurring molecule. Likewise, "immuno
logically active" refers to the capability of the natural,
recombinant, or synthetic full-length ALK protein or ALK fusion
polypeptide (e.g., a FN1-ALK fusion polypeptide or an FN1-tmALK
fusion polypeptide of the invention), or any oligopeptide thereof,
to induce a specific immune response in appropriate animals or
cells and to bind with specific antibodies.
[0108] Also within the invention are antibody molecules with fewer
than 4 chains, including single chain antibodies, Camelid
antibodies and the like and components of an antibody, including a
heavy chain or a light chain. In some embodiments an immunoglobulin
chain may comprise in order from 5' to 3', a variable region and a
constant region. The variable region may comprise three
complementarity determining regions (CDRs), with interspersed
framework (FR) regions for a structure FR1, CDR1, FR2, CDR2, FR3,
CDR3 and FR4. Also within the invention are heavy or light chain
variable regions, framework regions and CDRs. An antibody of the
invention may comprise a heavy chain constant region that comprises
some or ail of a CH1 region, hinge, CH2 and CH3 region.
[0109] One non-limiting epitopic site of a ALK fusion
polypeptide-specific antibody of the invention is a peptide
fragment consisting essentially of about 11 to 17 amino acids of a
fusion polypeptide sequence, which fragment encompasses the fusion
junction between the ALK portion and the portion of the second
fusion partner present in the ALK fusion polypeptide. It will be
appreciated that antibodies that specifically binding shorter or
longer peptides/epitopes encompassing the fusion junction of an ALK
fusion polypeptide are within the scope of the present
invention.
[0110] The invention is not limited to use of antibodies, but
includes equivalent molecules, such as protein binding domains or
nucleic acid aptamers, which bind, in a fusion-protein or
truncated-protein specific manner, to essentially the same epitope
to which a polypeptide with kinase activity-specific antibody
useful in the methods of the invention binds. See, e.g., Neuberger
et al., Nature 312: 604 (1984). Such equivalent non-antibody
reagents may be suitably employed in the methods of the invention
further described below.
[0111] Polyclonal antibodies useful in practicing the methods of
the invention may be produced according to standard techniques by
immunizing a suitable animal (e.g., rabbit, goat, etc.) with an
antigen encompassing a desired epitope (e.g. the fusion junction
between the ALK portion and the portion of the second fusion
partner present in the ALK fusion polypeptide), collecting immune
serum from the animal, and separating the polyclonal antibodies
from the immune serum, and purifying polyclonal antibodies having
the desired specificity, in accordance with known procedures. The
antigen may be a synthetic peptide antigen comprising the desired
epitopic sequence, selected and constructed in accordance with
well-known techniques. See, e.g., ANTIBODIES: A LABORATORY MANUAL,
Chapter 5, p. 75-76, Harlow & Lane Eds., Cold Spring Harbor
Laboratory (1988); Czernik, Methods In Enzymology, 201: 264-283
(1991); Merrifield, J. Am. Chem. Soc. 85: 21-49 (1962)). Polyclonal
antibodies produced as described herein may be screened and
isolated as further described below.
[0112] Monoclonal antibodies may also be beneficially employed in
the methods of the invention, and may be produced in hybridoma cell
lines according to the well-known technique of Kohler and Milstein.
Nature 265: 495-97 (1975); Kohler and Milstein, Eur. J. Immunol. 6:
511 (1976); see also, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY,
Ausubel et al. Eds. (Wiley and Sins, New York, N Y 1989 and yearly
updates up to and including 2010). Monoclonal antibodies so
produced are highly specific, and improve the selectivity and
specificity of assay methods provided by the invention. For
example, a solution containing the appropriate antigen (e.g. a
synthetic peptide comprising the fusion junction of the ALK portion
and the portion of the second fusion partner present in the ALK
fusion polypeptide) may be injected into a mouse and, after a
sufficient time (in keeping with conventional techniques), the
mouse sacrificed and spleen cells obtained. The spleen cells are
then immortalized by fusing them with myeloma cells, typically in
the presence of polyethylene glycol, to produce hybridoma cells.
Rabbit fusion hybridomas, for example, may be produced as described
in U.S. Pat. No. 5,675,063. The hybridoma cells are then grown in a
suitable selection media, such as hypoxanthine-amino
pterin-thymidine (HAT), and the supernatant screened for monoclonal
antibodies having the desired specificity, as described below. The
secreted antibody may be recovered from tissue culture supernatant
by conventional methods such as precipitation, ion exchange or
affinity chromatography, or the like.
[0113] Monoclonal Fab fragments may also be produced in Escherichia
coli by recombinant techniques known to those skilled in the art.
See, e.g., W. Huse, Science 246: 1275-81 (1989); Mullinax et al.,
Proc. Nat'l Acad, Sci. 87: 8095 (1990). If monoclonal antibodies of
one isotype are desired for a particular application, particular
isotypes can be prepared directly, fry selecting from the initial
fusion, or prepared secondarily, from a parental hybridoma
secreting a monoclonal antibody of different iso type by using the
sib selection technique to isolate class-switch variants
(Steplewski, et al., Proc. Nat'l. Acad. Sci., 82: 8653 (1985);
Spira et al., J. Immunol. Methods, 74: 307 (1984)). The antigen
combining site of the monoclonal antibody can be cloned by PCR and
single-chain antibodies produced as phage-displayed recombinant
antibodies or soluble antibodies in E. coli (see, e.g., ANTIBODY
ENGINEERING PROTOCOLS, 1995, Humana Press, Sudhir Paul editor.)
[0114] Further still, U.S. Pat. No. 5,194,392, Geysen (1990)
describes a general method of detecting or determining the sequence
of monomers (amino acids or other compounds) which is a topological
equivalent of the epitope (i.e., a "mimotope") which is
complementary to a particular paratope (antigen binding site) of an
antibody of interest. More generally, this method involves
detecting or determining a sequence of monomers which is a
topographical equivalent of a ligand which is complementary to the
ligand binding site of a particular receptor of interest.
Similarly, U.S. Pat. No. 5,480,971, Houghten et al. (1996)
discloses linear C.sub.1-C-alkyl peralkylated oligopeptides and
sets and libraries of such peptides, as well as methods for using
such oligopeptide sets and libraries for determining the sequence
of a peralkylated oligopeptide that preferentially binds to an
acceptor molecule of interest. Thus, non-peptide analogs of the
epitope-bearing peptides of the invention also can be made
routinely by these methods.
[0115] Antibodies useful in the methods of the invention, whether
polyclonal or monoclonal, may be screened for epitope and fusion
protein specificity according to standard techniques. See, e.g.,
Czernik et al., Methods in Enzymology, 201: 264-283 (1991). For
example, the antibodies may be screened against a peptide library
by ELISA to ensure specificity tor both the desired antigen and, if
desired, for reactivity only with the full-length ALK protein, a
particular ALK fusion polypeptide (e.g., an EML4-ALK. (1059 amino
acid variant) polypeptide), or fragments thereof of the invention.
The antibodies may also be tested by Western blotting against cell
preparations containing target protein to confirm reactivity with
the only the desired target and to ensure no appreciable binding to
other proteins. The production, screening, and use of fusion
protein-specific antibodies is known to those of skill in the art,
and has been described. See, e.g., U.S. Patent Publication No.
20050214301.
[0116] Full-length ALK protein-specific and ALK fusion
polypeptide-specific antibodies useful in the methods of the
invention may exhibit some limited cross-reactivity with similar
epitopes in other proteins or polypeptides, such as similar fusion
polypeptides. This is not unexpected as most antibodies exhibit
some degree of cross-reactivity, and anti-peptide antibodies will
often cross-react with epitopes having high homology or identity to
the immunizing peptide. See, e.g., Czernik, supra. Cross-reactivity
with other fusion proteins is readily characterized by Western
blotting alongside markers of known molecular weight. Amino acid
sequences of cross-reacting proteins may be examined to identify
sites highly homologous or identical to full length ALK protein
sequence or the ALK fusion polypeptide sequence to which the
antibody binds. Undesirable cross-reactivity can be removed by
negative selection using antibody purification on peptide
columns.
[0117] Polypeptide with ALK kinase activity-specific antibodies and
ALK fusion polypeptide-specific antibodies of the invention that
are useful in practicing the methods disclosed herein are ideally
specific for human fusion polypeptide, but are not limited only to
binding the human species, per se. The invention includes the
production and use of antibodies that also bind conserved and
highly homologous or identical epitopes in other mammalian species
(e.g., mouse, rat, monkey). Highly homologous or identical
sequences in other species can readily be identified by standard
sequence comparisons, such as using BLAST, with the human ALK
protein sequence (SEQ ID NO: 2.
[0118] Antibodies employed in the methods of the invention may be
further characterized by, and validated for, use in a particular
assay format, for example flow cytometry (FC), immunohistochcmistry
(IHC), and/or immunocytochemistry (ICC). The use of polypeptide
with ALK kinase activity-specific antibodies in such methods is
further described herein. The antibodies described herein, used
alone or in the below-described assays, may also be advantageously
conjugated to fluorescent dyes (e.g. Alexa488, phycoerythrin), or
labels such as quantum dots, for use in multi-parametric analyses
along with other signal transduction (phospho-AKT, phospho-Erk 1/2)
and/or cell marker (cytokeratin) antibodies, as further described
below.
[0119] In practicing the methods of the invention, the expression
and/or activity of a polypeptide with ALK kinase activity (e.g., a
full-length ALK polypeptide) in a given biological sample may also
be advantageously examined using antibodies specific for (i.e.,
that specifically bind to) full length ALK protein or antibodies
specific for ALK fusion polypeptides. For example, ALK-specific
antibodies (i.e., antibodies that specifically bind full-length
ALK) are commercially available (see CELL SIGNALING TECHNOLOGY,
INC., Danvers, Mass., Catalog Nos. 3333 and 3791; Abeam, 2010
Catalogue, #ab17127, ab59286, and Sigma-Aldrich, 2010 Catalog,
#HPA010694, for example). In some embodiments, ALK-specific
antibodies used in the methods of the invention specifically bind
the cytoplasmic domain of ALK and, thus, will detect full-length
ALK and ALK fusion polypeptides. In some embodiments, ALK-specific
antibodies used in the methods of the invention specifically bind
the kinase domain of ALK. Furthermore, ALK fusion-specific
antibodies are commercially available (see CELL SIGNALING
TECHNOLOGY, INC., Beverly Mass., 2009/10 Catalogue, #'s 3343S
(phospho-NPM-ALK), 3983 (phospho-NPM-ALK), Abeam, 2010 Catalogue,
#ab4061 (NPM-ALK), and Thermo Scientific, 2010 Catalogue,
#PA1-37060 (NPM-ALK), for example). Such antibodies may also be
produced according to standard methods, as described above.
[0120] Detection of expression and/or activity of full-length ALK
and/or ALK fusion polypeptide in a biological sample (e.g. a tumor
sample) can provide information on whether the fusion protein alone
is driving the tumor, or whether aberrantly expressed full length
ALK is also present and driving the tumor. Such information is
clinically useful in assessing whether targeting the fusion protein
or the foil-length protein(s), or both, or is likely to be most
beneficial in inhibiting progression of the tumor, and in selecting
an appropriate therapeutic or combination thereof. Antibodies
specific for the ALK kinase extracellular domain, which is not
present in the mutant ALK disclosed herein, may be particularly
useful for determining the presence/absence of the mutant ALK
kinase.
[0121] It will be understood that more than one antibody may be
used in the practice of the above-described methods. For example,
one or more polypeptide with ALK kinase activity-specific
antibodies together with one or more antibodies specific for
full-length ALK kinase, another kinase, receptor, or kinase
substrate that is suspected of being, or potentially is, activated
in a cancer in which a polypeptide with ALK kinase activity is
expressed and/or active may be simultaneously employed to detect
the activity of such other signaling molecules in a biological
sample comprising cells from such cancer.
[0122] Those of skill in the art will, appreciate that fusion
polypeptides of the present invention and the epitope-bearing
fragments thereof described above can be combined with parts of
other molecules to create chimeric polypeptides. For example, an
epitope-bearing fragment of an ALK fusion polypeptide may be
combined with the constant domain of immunoglobulins (IgG) to
facilitate purification of the chimeric polypeptide and increase
the in vivo half-life of the chimeric polypeptide (see, e.g.,
examples of CD4-Ig chimeric proteins in EPA 394,827; Traunecker et
al., Nature 331: 84-86 (1988)). Fusion proteins that have a
disulfide-linked dimeric structure (e.g., from an IgG portion may
also be more efficient in binding and neutralizing other molecules
than the monomeric ALK fusion polypeptide alone (see Fountoulakis
et al, J Biochem 270: 3958-3964(1995)).
[0123] In some embodiments, the detection molecule used in the
methods of the invention is attached to a detectable label. By
"detectable label" with respect to a polypeptide, polynucleotide,
or reagent disclosed herein means a chemical, biological, or other
modification of or to the polypeptide, polynucleotide, or binding
agent, including but not limited to fluorescence, mass, residue,
dye, radioisotope, label, or tag modifications, etc., by which the
presence of the molecule of interest (e.g., a polypeptide with ALK
kinase activity or a polynucleotide encoding a polypeptide with ALK
kinase activity) may be detected. The detectable label may be
directly or indirectly attached to the detection molecule by a
covalent or non-covalent chemical bond. Methods for attaching
detectable labels to molecules (e.g., to the detection molecules
described herein) are well known.
[0124] Immunoassays useful in the practice of the methods of the
invention may be homogenous immunoassays or heterogeneous
immunoassays. In a homogeneous assay the immunological reaction
usually involves a specific reagent (e.g., an ALK-specific
antibody), a delectably labeled analyte, and the biological sample
of interest. The signal arising from the detectable label is
modified, directly or indirectly, upon the binding of the antibody
to the delectably labeled analyte. Both the immunological reaction
and detection of the extent thereof are carried out in a
homogeneous solution. Immunochemical detectable labels that may be
employed include free radicals, radio-isotopes, fluorescent dyes,
enzymes, bacteriophages, coenzymes, and so forth. Semi-conductor
nanocrystal labels, or "quantum dots", may also be advantageously
employed, and their preparation and use has been well described.
See generally, K. Barovsky, Nanotech. Law & Bus. 1(2): Article
14 (2004) and patents cited therein.
[0125] In a heterogeneous assay approach, the reagents are usually
the biological sample, binding reagent (e.g., an antibody), and
suitable means for producing a detectable signal. Biological
samples as further described below may be used. The antibody is
generally immobilized on a support, such as a bead, plate or slide,
and contacted with the sample suspected of containing the antigen
in a liquid phase. The support is then separated from the liquid
phase and either the support phase or the liquid phase is examined
for a detectable signal employing means for producing such signal.
The signal is related to the presence of the analyte in the
biological sample. Means for producing a detectable signal include
the use of radioactive labels, fluorescent labels, enzyme labels,
quantum dots, and so forth. For example, if the antigen to be
detected contains a second binding site, an antibody which binds to
that site can be conjugated to a detectable group and added to the
liquid phase reaction solution before the separation step. The
presence of the detectable group on the solid support indicates the
presence of the antigen in the test sample. Examples of suitable
immunoassays are the radioimmunoassay, immunofluorescence methods,
enzyme-linked immunoassays, and the like.
[0126] Immunoassay formats and variations thereof, which may be
useful for carrying out the methods disclosed herein, are well
known in the art. See generally E. Maggio, Enzyme-Immunoassay,
(1980) (CRC Press, Inc., Boca Raton, Fla.); see also, e.g., U.S.
Pat. No. 4,727,022 (Skold et al., "Methods for Modulating
Ligand-Receptor Interactions and their Application"); U.S. Pat. No.
4,659,678 (Forrest et al., "Immunoassay of Antigens"); U.S. Pat.
No. 4,376,110 (David et al., "Immunometric Assays Using Monoclonal
Antibodies"). Conditions suitable for the formation of
reagent-antibody complexes are well known to those of skill in the
art. See id. FN1-ALK fusion polypeptide-specific monoclonal
antibodies may be used in a "two-site" or "sandwich" assay, with a
single hybridoma cell line serving as a source for both the labeled
monoclonal antibody and the bound monoclonal antibody. Such assays
are described in U.S. Pat. No. 4,376,110. The concentration of
detectable reagent should be sufficient such that the binding of a
protein with ALK kinase activity (e.g., a full-length ALK protein,
a truncated ALK, or ALK fusion polypeptide) is detectable compared
to background.
[0127] Antibodies useful in the practice of the methods disclosed
herein may be conjugated to a solid support suitable for a
diagnostic assay (e.g., beads, plates, slides or wells formed from
materials such as latex or polystyrene) in accordance with known
techniques, such as precipitation. Antibodies or other binding
reagents binding reagents may likewise be conjugated to detectable
groups such as radiolabels (e.g., .sup.35S, .sup.125I, .sup.131I),
enzyme labels (e.g., horseradish peroxidase, alkaline phosphatase),
and fluorescent labels (e.g., fluorescein) in accordance with known
techniques.
[0128] Cell-based assays, such flow cytometry (FC),
immuno-histochemistry (IHC), immunocytochemistry (ICC), or
immunofluorescence (IF) are particularly desirable in practicing
the methods of the invention, since such assay formats are
clinically-suitable, allow the detection of expression of a protein
with ALK kinase activity (e.g., a mutant ALK polypeptide or an
FN1-ALK fusion polypeptide) in vivo, and avoid the risk of artifact
changes in activity resulting from manipulating cells obtained
from, e.g. a tumor sample in order to obtain extracts. Accordingly,
in some embodiments, the methods of the invention are implemented
in a flow-cytometry (FC), immunocytochemistry (ICC),
immuno-histochemistry (IHC), or immunofluorescence (IF) assay
format.
[0129] Flow cytometry (FC) may be employed to determine the
expression of polypeptide with ALK kinase activity in a mammalian
tumor before, during, and after treatment with a drug targeted at
inhibiting ALK kinase activity. For example, tumor ceils from a
fine needle aspirate may be analyzed by flow cytometry for
expression and/or activation of a polypeptide with ALK kinase
activity or polynucleotide encoding the same as well as for markers
identifying cancer cell types, etc., if so desired. Flow cytometry
may be carried out according to standard methods. See, e.g. Chow et
al, Cytometry (Communications in Clinical Cytometry) 46: 72-78
(2001). Briefly and by way of example, the following protocol for
cytometric analysis may be employed: fixation of the cells with 2%
paraformaldehyde for 10 minutes at 37.degree. C. followed by
permeabilization in 90% methanol for 10 minutes on ice. Cells may
then be stained with the primary antibody (e.g., a full-length
ALK-specific or a ALK fusion polypeptide-specific antibody), washed
and labeled with a fluorescent-labeled secondary antibody. The
cells would then be analyzed on a flow cytometer (e.g. a Beckman
Coulter FC500) according to the specific protocols of the
instrument used. Such an analysis would identify the level of
expressed polypeptide with ALK kinase activity in the tumor.
Similar analysis after treatment of the tumor with an
ALK-inhibiting therapeutic would reveal the responsiveness of a
polypeptide with ALK kinase activity-expressing tumor to the
targeted inhibitor of ALK kinase.
[0130] Immunohistochemical (IHC) staining may be also employed to
determine the expression and/or activation status of polypeptide
with ALK kinase activity in a mammalian cancer (e.g., kidney
cancer) before, during, and after treatment with a drug targeted at
inhibiting ALK kinase activity (i.e., an ALK-inhibiting
therapeutic), IHC may be carried out according to well-known
techniques. See, e.g., ANTIBODIES: A LABORATORY MANUAL, Chapter 10,
Harlow & Lane Eds., Cold Spring Harbor Laboratory (1988).
Briefly, and by way of example, paraffin-embedded tissue (e.g.
tumor tissue from a biopsy) is prepared for immunohistochemicai
staining by deparaffinizing tissue sections with xylene followed by
ethanol; hydrating in water then PBS; unmasking antigen by heating
slide in sodium citrate buffer; incubating sections in hydrogen
peroxide; blocking in blocking solution; incubating slide in
primary antibody (e.g., an ALK-specific or ALK fusion
polypeptide-specific antibody) and secondary antibody; and finally
detecting using ABC avidin/biotin method according to
manufacturer's instructions.
[0131] Immunofluorescence (IF) assays may be also employed to
determine the expression and/or activation status of a polypeptide
with ALK kinase activity in a mammalian cancer before, during, and
after treatment with a drug targeted at inhibiting ALK kinase
activity. IF may be carried out according to well-known techniques.
See, e.g., J. M. polak and S. Van Noorden (1997) INTRODUCTION TO
IMMUNOCYTOCITEMISTRY, 2nd Ed.; ROYAL MICROSCOPY SOCIETY MICROSCOPY
HANDBOOK 37, BioScientific/Springer-Verlag. Briefly, and by way of
example, patient samples may be fixed in paraformaldehyde followed
by methanol, blocked with a blocking solution such as horse serum,
incubated with a primary antibody against (i.e., that specifically
binds to) a polypeptide with ALK kinase activity followed by a
secondary antibody labeled with a fluorescent dye such as Alexa 488
and analyzed with an epifluorescent microscope.
[0132] A variety of other protocols, including enzyme-linked
immunosorbent assay (ELISA), radio-immunoassay (RIA), and
fluorescent-activated cell sorting (FACS), for measuring expression
and/or activity of a polypeptide with ALK kinase activity are known
in the art and provide a basis for diagnosing the presence of the
polypeptide with ALK kinase activity (e.g., full-length ALK,
truncated ALK, or an ALK fusion polypeptide such as an NPM-ALK
fusion polypeptide). Normal or standard values for polypeptide with
ALK kinase activity expression are established by combining body
fluids or cell extracts taken from normal mammalian subjects,
preferably human, with an antibody that specifically binds to the
polypeptide with ALK kinase activity under conditions suitable for
complex formation. The amount of standard complex formation may be
quantified by various methods, but preferably by photometric means.
Quantities of the polypeptide with ALK kinase activity expressed in
subject (i.e., a patient) and control samples from biopsied tissues
are compared with the standard values. Deviation between standard
and subject values establishes the parameters for diagnosing
disease. Of course, since the polypeptide with ALK kinase activity
described herein are discovered in cancerous kidney cells, no
biological samples of normal kidney tissue are expected to contain
these polypeptide with ALK kinase activity or polynucleotides
encoding the same.
[0133] In some embodiments, the method for detecting the presence
and/or activity of a polypeptide with ALK kinase activity in a
biological sample from a mammalian kidney cancer or suspected
mammalian kidney cancer comprises the steps of: (a) obtaining a
biological sample from a mammalian kidney cancer or suspected
mammalian kidney cancer and (b) contacting the biological sample
with a reagent that detects a polynucleotide encoding the
polypeptide with ALEC kinase activity, wherein detection of said
polynucleotide in said biological sample indicates said polypeptide
with ALK kinase activity is present in said biological sample.
[0134] As used herein, by "polynucleotide" (or "nucleotide
sequence" or "nucleic acid molecule") refers to a polymer of
individual nucleotides covalently joined together (e.g., via a
phosphodiester bond). Thus, the definition includes, without
limitation, DNA, RNA, genomic DNA, intronic DNA, exonic DNA, cDNA,
hnRNA. mRNA, oligonucleotides, or synthetic nucleotides, all of
which may be single- or double-stranded, and may represent the
sense or anti-sense strand. Probes and primers are within the
definition of polynucleotides of the invention.
[0135] As used herein, by "polynucleotide encoding a polypeptide
with ALK kinase activity" is meant to include, without limitation,
any polynucleotide encoding a polypeptide with ALK kinase activity,
any polynucleotide encoding a portion of a polypeptide with ALK
kinase activity (e.g., the ALK kinase domain), and any
polynucleotide from a gene encoding a polypeptide with ALK kinase
activity regardless of whether that particular polynucleotide codes
for any amino acid residues in that polypeptide with ALK kinase
activity. For example, intronic sequences from an ALK gene (e.g.,
from an intron separating two exons coding for portions of the ALK
kinase domain) are included in the definition of polynucleotide
encoding a polypeptide with ALK kinase activity.
[0136] The nucleotide sequences, including cDNA and mRNA, of
polynucleotides encoding polypeptides with ALK kinase activity have
been previously published. Non-limiting examples include the
nucleotide and protein sequences of human ALK (Genbank Accession
Codes: U62540, U66559), the nucleo tide and protein sequences of
mouse ALK cDNAs (D83002), nucleotide and polypeptide sequences for
EML4-ALK (U.S. Pat. No. 7,605,131), EML4-ALK (U.S. Pat. No.
7,700,339), EML4-ALK (GenBank AB462412.1), EML4-ALK (GenBank
AB462411.1), KIF5B-ALK (GenBank AB462413.1), and TFG-ALK (GenBank
AF143407.1). Furthermore, K, Pulford et al., Anaplastic Lymphoma
Kinase Proteins in Growth Control and Cancer, J. Cell. Physiol.
199, 330-358 (2004) discloses other publicly available ALK fusion
polypeptides.
[0137] In various embodiments of all of the aspects of the
invention, the reagent that detects a polynucleotide encoding the
polypeptide with ALK kinase activity is a nucleic acid probe or
primer that hybridizes to said polynucleotide. In some embodiments,
the nucleic acid probe or primer hybridizes to the polynucleotide
encoding the polypeptide with ALK kinase activity under stringent
conditions.
[0138] As used herein, by "probe," "primer," or "oligonucleotide"
is meant a single-stranded nucleic acid molecule of defined
sequence that can base-pair to a second DNA or RNA molecule that
contains a complementary sequence (the "target"). The target is
generally a nucleic acid ALK gene product of an ALK fusion gene.
The stability of the resulting hybrid depends upon the extent of
the base-pairing that occurs. The extent of base-pairing is
affected by parameters such as the degree of complementarity
between the probe and target molecules, and the degree of
stringency of the hybridization conditions. The degree of
hybridization stringency is affected by parameters such as
temperature, salt concentration, and the concentration of organic
molecules such as formamide, and is determined by methods known to
one skilled in the art.
[0139] Probes or primers that specifically bind to a polynucleotide
encoding a polypeptide having ALK kinase activity (or a portion of
such a polynucleotide) specifically bind the polynucleotide by
hybridizing to the polynucleotide. To do this, the probe or primer
that specifically binds (e.g., hybridizes) to the polynucleotide
encoding a polypeptide having ALK kinase activity (or a fragment of
such a polynucleotide) preferably has at least 50%-55% sequence
complementarity, more preferably at least 60%-75% sequence
complementarity, even more preferably at least 80%-90% sequence
complementarity, yet more preferably at least 91%-99% sequence
complementarity, and most preferably 100% sequence complementarity
to the polynucleotide encoding a polypeptide having ALK kinase
activity (or a fragment of such a polynucleotide) to be detected.
Probes, primers, and oligonucleotides may be detectable-labeled,
either radioactively, or non-radioactively, by methods well-known
to those skilled in the art. Probes, primers, and oligonucleotides
are used for methods involving nucleic acid hybridization, such as:
nucleic acid sequencing, reverse transcription and/or nucleic acid
amplification by the polymerase chain reaction, single stranded
conformational polymorphism (SSCP) analysis, restriction fragment
polymorphism (RFLP) analysis, Southern hybridization, Northern
hybridization, in situ hybridization, electrophoretic mobility
shift assay (EMSA).
[0140] As used herein, by "hybridizes" is meant that a probe,
primer, or oligonucleotide recognizes and physically interact
(i.e., forms base-pairs) with a substantially complementary nucleic
acid (e.g., an mRNA encoding full-length ALK or an ALK fusion
polypeptide of the invention) under stringent conditions, and does
not substantially base pair with other nucleic acids. A nucleic
acid probe, primer, or oligonucleotide that hybridizes under
stringent conditions to its target may be referred to as a
target-specific nucleic acid probe (or primer or oligonucleotide)
or an anti-target nucleic acid probe (or primer or
oligonucleotide). For example, a nucleic acid probe that hybridizes
to a polynucleotide encoding an EML4-ALK fusion polypeptide may be
referred to as an EML4-ALK-specific nucleic acid probe or an
anti-EML4-ALK nucleic acid probe.
[0141] As used herein, the term "stringent conditions" with respect
to nucleotide sequence or nucleotide probe hybridization conditions
is the "stringency" that occurs within a range from about T.sub.m
minus 5.degree. C. (i.e., 5.degree. C. below the melting
temperature (T.sub.m) of the reagent or nucleic acid probe) to
about 20.degree. C. to 25.degree. C. below T.sub.m. Typical
stringent conditions are: overnight incubation at 42.degree. C. in
a solution comprising: 50% formamide, 5.times..SSC (750 mM NaCl, 75
mM trisodium citrate), 50 mM sodium phosphate (pH 7.6),
5.times.Denhardt's solution, 10% dextran sulfate, and 20
micrograms/ml denatured, sheared salmon sperm DNA, followed by
washing the filters in 0.1.times.SSC at about 65.degree. C. As will
be understood by those of skill in the art, the stringency of
hybridization may be altered in order to identify or detect
identical or related polynucleotide sequences. For example, for a
DNA probe of at least 500 nucleotides in length, stringent
conditions may be achieved by hybridization occurring in a buffer
containing 0.5 M NaHPO.sub.4, pH 7.2, 7% SDS, 1 mM EDTA, and 1% BSA
(fraction Y), at a temperature of 65.degree. C., or a buffer
containing 48% formamide, 4.8.times.SSC, 0.2 M Tris-Cl, pH 7.6, lx
Denhardt's solution, 10% dextran sulfate, and 0.1% SDS, at a
temperature of 42.degree. C. (or similarly typical conditions for
stringenct Northern or Southern hybridizations). Stringent
hybridization is relied upon for the success of numerous techniques
routinely performed by molecular biologists, such as high
stringency PCR, DNA sequencing, single strand conformational
polymorphism analysis, and in situ hybridization. In contrast to
Northern and Southern hybridizations, these techniques are usually
performed with relatively short probes (e.g., usually 16
nucleotides or longer for PCR or sequencing, and 40 nucleotides or
longer for in situ hybridization). The stringent conditions used in
these techniques are well known to those skilled in the art of
molecular biology, and may be found, for example, in F. Ausubel et
al., Current Protocols in Molecular Biology, supra, herein
incorporated by reference.
[0142] In various embodiments of all of the aspects of the
invention, the nucleic acid probe or primer is a polymerase chain
reaction (PCR) probe, a fluorescence in situ hybridization (FISH)
probe, or a Southern blotting probe. In some embodiments, the
method is implemented in a polymerase chain reaction (PCR) assay
format, a in situ hybridization (ISH) assay format, or a Southern
blotting assay format.
[0143] Polynucleotides encoding a polypeptide with ALK kinase
activity may also be used for diagnostic purposes. The
polynucleotides that may be used include oligonucleotide sequences,
antisense RNA and DNA molecules, and PNAs. The polynucleotides may
be used to detect and quantitate gene expression in biopsied
tissues in which expression of a polypeptide with ALK kinase
activity (e.g., foil length ALK, or an ALK fusion polypeptide. The
diagnostic assay may be used to distinguish between absence,
presence, and aberrant expression of a polypeptide with ALK kinase
activity, and to monitor regulation of levels of a polypeptide with
ALK kinase activity during therapeutic intervention.
[0144] In one embodiment, hybridization with PCR probes which are
capable of detecting a polynucleotide, including genomic sequences,
encoding a polypeptide with ALK kinase activity may be used to
identify polynucleotides that encode such polypeptides with ALK
kinase activity. The construction and use of such probes is
described herein. The specificity of the probe, whether it is made
from a highly specific region, e.g., 10 unique nucleotides in the
fusion junction, or a less specific region, e.g., the 3' coding
region, and the degree of the hybridization or amplification (e.g.,
stringent hybridization or not stringent) will determine whether
the probe identifies only naturally occurring sequences encoding
mutant ALK kinase polypeptide, alleles, or related sequences. In
some embodiments, nucleic acid probes useful in the methods
described herein may hybridize to nucleotide sequences encoding the
kinase domain of ALK (amino acids 1116-1392 of SEQ 113 NO:2). The
probes may alternatively hybridize nucleotides encoding the
C-terminal domain located at amino acids 1376-1620 of SEQ ID NO: 2,
amino acid residues 1504-1507 of SEQ ID NO:2 making up the
phosphotyrosine-binding site of the C-terminal domain of ALK, or
amino acid residues 1603-1606 of SEQ ID NO: 2 representing the
interaction site for the phosphotyrosine-dependent binding of the
substrate phosphlipase C-.gamma. (PLC-.gamma.).
[0145] In another embodiment of the invention, the polynucleotides
encoding a polypeptide with ALK kinase activity may be used to
generate hybridization probes which are useful for mapping the
naturally occurring genomic sequence. The sequences may be mapped
to a particular chromosome or to a specific region of the
chromosome using well known techniques. Such techniques include
in-situ hybridization (ISH), FACS, or artificial chromosome
constructions, such as yeast artificial chromosomes, bacterial
artificial chromosomes, bacterial PI constructions or single
chromosome cDN A libraries, as reviewed in Price, C. M., Blood Rev.
7: 127-134 (1993), and Trask, B. J., Trends Genet. 7: 149-154
(1991).
[0146] In situ hybridization (ISH) of chromosomal preparations and
physical mapping techniques such as linkage analysis using
established chromosomal markers may be used for extending genetic
maps. Often the placement of a gene on the chromosome of another
mammalian species, such as mouse, may reveal associated markers
even if the number or arm of a particular human chromosome is not
known. New sequences can be assigned to chromosomal arms, or parts
thereof, by physical mapping. This provides valuable information to
investigators searching for disease genes using positional cloning
or other gene discovery techniques. Once the disease or syndrome
has been crudely localized by genetic linkage to a particular
genomic region, for example, AT to 11q22-23 (Gatti et al, Nature
336: 577-580 (1988)), any sequences mapping to that area may
represent associated or regulatory genes for farther investigation.
The nucleotide sequence of the subject invention may also be used
to detect differences in the chromosomal location due to
translocation, inversion, etc., among normal, carrier, or affected
individuals.
[0147] In one embodiment, fluorescence in-situ hybridization (FISH)
(a non-limiting type of in situ hybridization assay) is employed
(as described in Verma et al. HUMAN CHROMOSOMES: A MANUAL OF BASIC
TECHNIQUES, Pergamon Press, New York, N.Y. (1988)) and may be
correlated with other physical chromosome mapping techniques and
genetic map data. The FISH technique is well known (see, e.g., U.S.
Pat. Nos. 5,756,696; 5,447,841; 5,776,688; and 5,663,319). Examples
of genetic map data can be found in the 1994 Genome Issue of
Science (265: 1981f). Correlation between the location of the gene
encoding ALK protein and/or the gene encoding the fusion partner of
an ALK fusion polypeptide on a physical chromosomal map and a
specific disease, or predisposition to a specific disease, may help
delimit the region of DNA associated with that genetic disease. The
nucleotide sequences of the subject invention may be used to detect
differences in gene sequences between normal, carrier, or affected
individuals. FISH protocols for detect translocations involving the
ALK gene have been described (see, e.g., U.S. Pat. No. 7,700,339
and US Patent Publication No. 20110110923. A dual color, break
apart probe designed to detect ALK gene translocation is also
commercially available from Abbott Molecular (Abbott Park, Ill.,
US; Catalog No. 05J89-001).
[0148] It shall be understood that all of the methods (e.g., PCR
and FISH) that detect a polynucleotide encoding a polypeptide with
ALK kinase activity may be combined with other methods that detect
expression and/or acti vity of a polypeptide with ALK kinase
activity. For example, detection of a polynucleotide encoding an
ALK fusion polypeptide in the genetic material of a biological
sample (e.g., TFG-ALK in a circulating tumor cell) may be followed
by Western blotting analysis or immuno-histochemistry (IHC)
analysis of the proteins of the sample to determine if the
polynucleotide encoding the TFG-ALK fusion polypeptide is actually
expressed as a TFG-ALK fusion polypeptide in the biological sample.
Such Western blotting or IHC analyses may be performed using an
antibody that specifically binds to the polypeptide encoded by the
detected polynucleotide, or the analyses may be performed using
antibodies that specifically bind either to full length TFG (e.g.,
bind to the N-terminus of the TFG protein) or to full length ALK.
(e.g., bind an epitope in the kinase domain of ALK protein). Such
assays are known in the art (see, e.g., U.S. Pat. No.
7,468,252).
[0149] In another example, the CISH technology of Dako allows
chromatogenic in situ hybridization with immuno-histochemistry on
the same tissue section. See Elliot et al, Br J Biomed Sci 2008;
65(4): 167-171, 2008 for a comparison of CISH and FISH.
[0150] In another aspect, the invention relates to detecting the
detection molecules utilizing a detection device. By "detection
device" is meant any device that is used to detect, measure, or
otherwise quantify the expression and/or activity levels of the
polypeptide with ALK kinase activity or polynucleotide encoding the
polypeptide with ALK kinase activity. The detected levels of
expression and/or activity may be used to generate a database of
the samples, particularly of the test and control samples. The
database can be used to generate a report to analyze and compare
the levels of expression and/or activity of the polypeptide with
ALK kinase activity or polynucleotide encoding the polypeptide with
ALK kinase activity of the samples. Non-limiting examples of
detection devices include a PCR cycler, DNA analyzer, DNA
sequencer, DNA extraction column, gel, or kit, image analysis
device, chromatographic device, or mass spectrometer, combinations
thereof, and automated versions thereof. An image analysis device
is any device that is used to create a visible image of the
biological sample for detection of the polypeptide with ALK kinase
activity or polynucleotide encoding the polypeptide with ALK kinase
activity and includes the following non-limiting examples: FlowCAM,
a biosensor imaging device, an infrared imaging systems, or a
chemiluminescent imaging systems. A chromatographic device may
alternatively be used to detect the ALK gene product, which can
perform high performance liquid chromatography (HPLC), reverse
HPLC, gas chromatography, or liquid chromatography. In another
embodiment, a mass spectrometer may be utilized.
[0151] In one embodiment, polypeptide with ALK kinase activity or
polynucleotide encoding the polypeptide with ALK kinase activity
are detected in a biological sample using a mass spectrometer. The
term "mass spectrometer" (MS) means a device capable of detecting
specific molecular species and measuring their accurate masses. The
term is meant to include any molecular detector into which a
polypeptide or peptide may be eluted for detection and/or
characterization and includes, for example, MALDI and SELDI
devices. In the preferred MS procedure, a sample, e.g., the elution
solution, is loaded onto the MS instrument, and undergoes
vaporization. The components of the sample are ionized by one of a
variety of methods (e.g., by electrospray ionization or "ESI"),
which results in the formation of positively charged particles
(ions). The positive ions are then accelerated by a magnetic field.
The computation of the mass-to-charge ratio of the particles is
based on the details of motion of the ions as they transit through
electromagnetic fields, and detection of the ions. The preferred
mass measurement error of a mass spectrometer of the invention is
10 ppm or less, more preferable is 7 ppm or less; and most
preferably 5 ppm or less.
[0152] Fragment ions in the MS/MS and MS.sup.3 spectra are
generally highly specific and diagnostic for peptides of interest.
In contrast, to prior methods, the identification of peptide
diagnostic signatures provides for a way to perform highly
selective analysis of a complex protein mixture, such as a cellular
lysate in which there may be greater than about 100, about 1000,
about 10,000, or even about 100,000 different kinds of proteins.
Thus, while conventional mass spectroscopy would not be able to
distinguish between peptides with different sequences but similar
m/z ratios (which would tend to co-elute with any labeled standard
being analyzed), the use of peptide fragmentation methods and
multistage mass spectrometry in conjunction with LC methods,
provide a way to detect and quantify target proteins which are only
a small fraction of a complex mixture (e.g., present in less than
2000 copies per cell or less than about 0.001% of total cellular
protein) through these diagnostic signatures.
[0153] Test peptides in a biological sample are preferably examined
by monitoring of a selected reaction in the mass spectrometer. This
involves using the prior knowledge gained by the characterization
of a standard peptide and then requiring the mass spectrometer to
continuously monitor a specific ion in the MS/MS or MS.sup.n
spectrum for both the peptide of interest and the standard peptide.
After elution, the areas-under-the-curve (AUC) for both the
standard peptide and target peptide peaks may be calculated. The
ratio of the two areas provides the absolute quantification that
may then be normalized for the number of cells used in the analysis
and the protein's molecular weight, to provide the precise number
of copies of the protein per cell.
[0154] As used herein the term, "accurate mass" refers to an
experimentally or theoretically determined mass of an ion that is
used to determine an elemental formula. For ions containing
combinations of the elements C, H, N, O, P, S, and the halogens,
with mass less than 200 Unified Atomic Mass Units, a measurement
about 5 ppm uncertainty is sufficient to uniquely determine the
elemental composition.
[0155] As used herein the term, "predetermined peptide accurate
mass" refers to the experimentally determined or calculated
accurate mass of a peptide with a known amino acid sequence (along
with any associated post-translational modifications). The accurate
mass of any such specific amino acid sequence may be readily
calculated by one of skill in the art.
[0156] As used herein, "a peptide fragmentation signature" refers
to the distribution of mass-to-charge ratios of fragmented peptide
ions obtained from fragmenting a peptide, for example, by collision
induced disassociation, BCD, LID, PSD, IRNPD, SID, and other
fragmentation methods. A peptide fragmentation signature which is
"diagnostic" or a "diagnostic signature" of a target protein or
target polypeptide is one which is reproducibly observed when a
peptide digestion product of a target protein/polypeptide identical
in sequence to the peptide portion of a standard peptide, is
fragmented and which differs only from the fragmentation pattern of
the standard peptide by the mass of the mass-altering label and/or
the presence of a ubiquitin remnant. Preferably, a diagnostic
signature is unique to the target protein (i.e., the specificity of
the assay is at least about 95%, at least about 99%, and
preferably, approaches 100%).
[0157] In some embodiments, the mammalian kidney cancer or
suspected mammalian kidney cancer in which the presence or activity
of said polypeptide with ALK kinase activity is detected is
identified as a mammalian kidney cancer or suspected mammalian
kidney cancer likely to respond to an ALK-inhibiting
therapeutic.
[0158] As used herein, by "likely to respond" is meant that a
cancer is more likely to show growth retardation or growth
abrogation in response to (e.g., upon contact with or treatment by)
an ALK inhibitor (also referred to as an ALK-inhibiting
therapeutic) as compared to an untreated cancer (e.g., of the same
tissue Ape as the treated cancer). In some embodiments, a cancer
that is likely to respond to an ALK inhibitor is one that shrinks
in size (e.g., the cancer cells apoptose) in response to the ALK
inhibitor as compared to an untreated cancer. In some embodiments,
a cancer that is likely to respond to an ALK inhibitor is one that
dies (e.g., the cancer cells apoptose) in response to the ALK
inhibitor as compared to an untreated cancer.
[0159] Accordingly, should a patient or subject whose kidney cancer
or suspected kidney cancer is identified as comprising a
polypeptide with ALK kinase activity (e.g., by detection of ALK
kinase activity, a polypeptide with ALK kinase activity, and/or a
polynucleotide encoding a polypeptide with ALK kinase activity),
that patient may be treated with (e.g., administered with) a
therapeutically effective amount of an ALK-inhibiting therapeutic.
In some embodiments, the ALK-inhibiting therapeutic is administered
in a pharmaceutically acceptable formulation.
[0160] As used herein, by "therapeutically effective amount" or
"pharmaceutically effective amount" is mean an amount of an
ALK-inhibiting therapeutic that is adequate to inhibit the cancer
(or cell thereof) or suspected cancer (or cells thereof), as
compared to an untreated cancer or suspected cancer, by either
slowing the growth of the cancer or suspected cancer, reducing the
mass of the cancer or suspected cancer, reducing the number of
cells of the cancer or suspected cancer, or killing the cancer.
[0161] An ALK-inhibiting therapeutic may be any composition
comprising at least one ALK inhibitor. Such compositions also
include compositions comprising only a single ALK-inhibiting
compound, as well as compositions comprising multiple therapeutics
(including those against other RTKs), which may also include a
non-specific therapeutic agent like a chemotherapeutic agent or
general transcription inhibitor.
[0162] In some embodiments, an ALK-inhibiting therapeutic useful in
the practice of the methods of the invention is a targeted, small
molecule inhibitor. Small molecule targeted inhibitors are a class
of molecules that typically inhibit the activity of then target
enzyme by specifically, and often irreversibly, binding to the
catalytic site of the enzyme, and/or binding to an ATP-binding
cleft or other binding site within the enzyme that prevents the
enzyme from adopting a conformation necessary for its activity.
[0163] Crizotinib (also known as PF-02341066 or 1066), is a
c-MET/HGFR and ALK (anaplastic lymphoma kinase) inhibitor of the
aminopyridine chemical series that is being developed by Pfizer
Incorporated (see Zou et al, Cancer Research 67: 4408-4417, 2007
and supplemental data). Crizotinib is currently undergoing clinical
trials testing its safety and efficacy in treating several forms of
cancer, particularly non-smalt cell lung carcinoma (NSCLC),
anaplastic large cell lymphoma, neuroblastoma, and other advanced
solid tumors in both adults and children.
[0164] U.S. Pub. No. 2008/0300273 discloses that PF-02341066 was
able to reduce cell colony scattering in HGF-stimulated Madin-Darby
Canine Kidney (MDCK) cells. As such, the compound was able to
inhibit epithelial cell dispersion and motility in response to HGF.
See also Zou et al, Cancer Research 67: 4408-4417, 2007. However,
these publications do not disclose whether or not ALK or ALK
fusions are actually expressed in kidney cells or kidney cancer
cells. In fact, Zou et al., Cancer Research 67: 4408-4417, 2007
references Christensen et al, Cancer Res. 63: 7345, 2003 as
describing a cMET-inhibiting assay using the MDCK cell model. To
determine whether or not HGF-stimulated MDCK cells actually express
ALK kinase, the present inventors replicated the conditions
described in U.S. Pub. No. 2008/0300273. As described below in
Example 3, using Western blotting analysis, it was determined that
HGF-stimulated MDCK cells do not express any ALK kinase. The cells
did not express phosphorylated or non-phosphorylated ALK kinase.
Accordingly, the effects on HGF-stimulated M DCK cells in response
to crizotinib described in U.S. Pub. No. 2008/0300273 could not
have been mediated by the ALK kinase since ALK kinase was not
present in the cells. Accoringly, as proposed in U.S. Pub. No.
2008/0300273, the effects of crizotinib on HGF-stimulated MDCK
cells were mediated through MET kinase.
[0165] Additional small molecule kinase inhibitors that may target
ALK include TAE-684 (from Novartis; see Galkin, et al, Proc.
National Acad. Sci 104(1) 270-275, 2007), AP26113 (Ariad
Pharmaceuticals, Inc.), and CEP-14083, CEP-14513, and CEP-11988
(Cephalon; see Wan et al., Blood 107: 1617-1623, 2006); and
WHI-P131 and WHI-P154 (EMD Biosciences; see Marzec et al.,
(Laboratory Investigation: A journal of Technical Methods and
Pathology 2005, Vol. 85, p. 1544-1554, 2005). Another group has
developed their own low-molecular-weight ALK-inhibiting substance
and has demonstrated that this inhibitor induces the cell death of
NPM-ALK-expressing lymphoma cell lines (Blood, 2006, Vol. 107, p.
1617-1623). In addition, numerous other compounds having an
inhibitory activity against ALK have been reported including
5-chloro-N.sup.4-[2-(isopropylsulfonyl)phenyl]-N.sub.2-{2-methoxy-4-[4-(4-
-methylpiperazin-1-yl)piperidin-1-yl]phenyl}pyrimidine-2,4-diamine
and
2-[(5-bromo-2-{[2-methoxy-4-(4-methylpiperazin-1-yl)phenyl]amino}pyrimidi-
-n-4-yl)amino]-N-methylbenzenesulfonamide (see Mosse et al, Clin
Cancer Res, 2009 Sep. 15; 15(18):5609-14, 2009; Journal of
Medicinal Chemistry 49: 1006-1015, 2006; Cancer Research, (US),
2004, Vol. 64, p, 8919-8923, 2004; Proc. Natl Acad, Sci.
101:13306-13311, 2004; Annual Review of Medicine, (US) 54; 73,
2003; Laboratory Investigation; A Journal of Technical Methods and
Pathology, (US) 83: 1255-1265, 2003; Cellular and Molecular Life
Sciences 61: 2897-2911, 2004; Science 278: 1309-1312, 1997;
Oncogene 14 (4): 439-449, 1997; Oncogene 9: 1567-1574, 1994; Am J
Pathol 160: 1487-1494, 2002; Am J Pathol 157: 377-384, 2000; Blood
90: 2901-2910, 1997; Am J Pathol. 156 (3): 781-9, 2000; J Comb
Chem, 8: 401-409, 2006 and U.S. Pub, Nos. 20100152182; 20100099658;
20100048576; 20090286778; 20090221555; 20090186801; 20090118216;
20090099193; 20080176881; 20080090776; 2008/0300273; WO
2005/097765; WO 2005/009389; WO 2005/016894; WO 2004/080980; and
WO2004079326.
[0166] Additional small molecule inhibitors and other inhibitors
(e.g., indirect inhibitors) of ALK kinase activity may be
rationally designed using X-ray crystallographic or computer
modeling of ALK three dimensional structure, or may found by high
throughput screening of compound libraries for inhibition of key
upstream regulatory enzymes and/or necessary binding molecules,
which results in inhibition of ALK kinase activity. Such approaches
are well known in the art, and have been described. ALK inhibition
by such therapeutics may be confirmed, for example, by examining
the ability of the compound to inhibit ALK activity, but not other
kinase activity, in a panel of kinases, and/or by examining the
inhibition of ALK activity in a biological sample comprising cancer
cells (e.g., kidney cancer cells). Methods for identifying
compounds that inhibit a cancer characterized by the
expression/presence of polypeptide with ALK kinase activity, are
further described below.
[0167] ALK-inhibiting therapeutics useful in the methods of the
invention may also be targeted antibodies that specifically bind to
critical catalytic or binding sites or domains required for ALK
activity, and inhibit the kinase by blocking access of ligands,
substrates or secondary molecules to .alpha. and/or preventing the
enzyme from adopting a conformation necessary for its activity. The
production, screening, and therapeutic use of humanized
target-specific antibodies has been well-described. See Merluzzi et
al., Adv Clin Path. 4(2): 77-85 (2000). Commercial technologies and
systems, such as Morphosys, Inc.'s Human Combinatorial Antibody
Library (HuCAL.RTM.), for the high-throughput generation and
screening of humanized target-specific inhibiting antibodies are
available.
[0168] The production of various anti-receptor kinase targeted
antibodies and their use to inhibit activity of the targeted
receptor has been described. See, e.g. U.S. Patent Publication No.
20040202655, U.S. Patent Publication No. 20040086503, U.S. Patent
Publication No. 20040033543, Standardized methods for producing,
and using, receptor tyrosine kinase activity-inhibiting antibodies
are known in the art. See, e.g., European Patent No. EP1423428.
[0169] Phage display approaches may also be employed to generate
ALK-specific antibody inhibitors, and protocols for bacteriophage
library construction and selection of recombinant antibodies are
provided in the well-known reference text CURRENT PROTOCOLS IN
IMMUNOLOGY, Colligan et al (Eds.), John Wiley & Sons, Inc.
(1992-2000), Chapter 17, Section 17.1. See also U.S. Pat. Nos.
6,319,690, 6,300,064, 5,840,479, and U.S. Patent Publication No.
20030219839.
[0170] ALK-binding targeted antibodies identified in screening of
antibody libraries as describe above may then be further screened
for their ability to block the activity of ALK, both in vitro
kinase assay and in vivo in cell lines and/or tumors. ALK
inhibition may be confirmed, for example, by examining the ability
of such antibody therapeutic to inhibit ALK kinase activity in a
panel of kinases, and/or by examining the inhibition of ALK
activity in a biological sample comprising cancer cells, as
described above. In some embodiments, a ALK-inhibiting compound of
the invention reduces ALK kinase activity, but reduces the kinase
activity of other kinases to a lesser extent (or not at all).
Methods for screening such compounds for ALK kinase inhibition are
further described above.
[0171] ALK-inhibiting compounds that useful in the practice of the
disclosed methods may also be compounds that indirectly inhibit ALK
activity by inhibiting the activity of proteins or molecules other
than ALK kinase itself. Such inhibiting therapeutics may be
targeted inhibitors that modulate the activity of key regulatory
kinases that phosphorylate or de-phosphorylate (and hence activate
or deactivate) ALK itself, or interfere with binding of ligands. As
with other receptor tyrosine kinases, ALK regulates downstream
signaling through a network of adaptor proteins and downstream
kinases. As a result, induction of cell growth and survival by ALK
activity may be inhibited by targeting these interacting or
downstream proteins.
[0172] ALK kinase activity may also be indirectly inhibited by
using a compound that inhibits the binding of an activating
molecule necessary for full length ALK, an ALK fusion polypeptide
(e.g., an FN1-ALK fusion polypeptide), or mutant ALK (e.g., a
truncated ALK polypeptide or an FN1-tmALK fusion polypeptide) to
adopt its active conformation. For example, the production and use
of anti-PDGF antibodies has been described. See U.S. Patent
Publication No. 20030219839, "Anti-PDGF Antibodies and Methods for
Producing Engineered Antibodies," Bowdish et al. Inhibition of
ligand (PDGF) binding to the receptor directly down-regulates the
receptor activity.
[0173] ALK inhibiting compounds or therapeutics may also comprise
anti-sense and/or transcription inhibiting compounds that inhibit
ALK kinase activity by blocking transcription of the gene encoding
ALK, an FN1-ALK fusion-encoding gene, or a mutant A LK-encoding
gene. The inhibition of various receptor kinases, including VEGFR,
EGFR, and IGFR, and FGFR, by antisense therapeutics for the
treatment of cancer has been described. See, e.g., U.S. Pat. Nos.
6,734,017; 6,710,174, 6,617,162; 6,340,674; 5,783,683;
5,610,288.
[0174] Antisense oligonucleotides may be designed, constructed, and
employed as therapeutic agents against target genes in accordance
with known techniques. See, e.g. Cohen, J., Trends in Pharmacol.
Sci. 10(11): 435-437 (1989); Marcus-Sekura, Anal Biochem. 172:
289-295 (1988); Weintraub, H., Sci. AM. pp. 40-46 (1990); Van Der
Krol et al., BioTechniques 6(10): 958-976 (1988); Skorski et al.
Proc. Natl. Acad. Sci. USA (1994) 91: 4504-4508. Inhibition of
human carcinoma growth in vivo using an antisense RNA inhibitor of
EGFR has recently been described. See U.S. Patent Publication No.
20040047847. Similarly, a ALK-inhibiting therapeutic comprising at
least one antisense oligonucleotide against a mammalian ALK gene,
FN1-ALK fusion polynucleotide or mutant ALK polynucleotide may be
prepared according to methods described above. Pharmaceutical
compositions comprising ALK-inhibiting antisense compounds may be
prepared and administered as further described below.
[0175] Small Interfering RNA molecule (siRNA) compositions, which
inhibit translation, and hence activity, of ALK through the process
of RNA interference, may also be desirably employed in the methods
of the invention. RNA interference, and the selective silencing of
target protein expression by introduction of exogenous small
double-stranded RNA molecules comprising sequence complimentary to
mRNA encoding the target protein, has been well described. See,
e.g. U.S. Patent Publication No. 20040038921, U.S. Patent
Publication No. 20020086356, and U.S. Patent Publication
20040229266.
[0176] Double-stranded RNA molecules (dsRNA) have been shown to
block gene expression in a highly conserved regulatory mechanism
known as RNA interference (RNAi), Briefly, the RNAse III Dicer
processes dsRNA into small interfering RNAs (siRNA) of
approximately 22 nucleotides, which serve as guide sequences to
induce target-specific mRNA cleavage by an RNA-induced silencing
complex RISC (see Hammond et al., Nature (2000) 404: 293-296). RNAi
involves a catalytic-type reaction whereby new siRNAs are generated
through successive cleavage of longer dsRNA, Thus, unlike
antisense, RNAi degrades target RNA in a non-stoichiometric manner.
When administered to a cell or organism, exogenous dsRNA has been
shown to direct the sequence-specific degradation of endogenous
messenger RN A (mRNA) through RNAi.
[0177] A wide variety of target-specific siRNA products, including
vectors and systems for their expression and use in mammalian
cells, are now commercially available (e.g., Promega, Inc.; and
Dharmacon, Inc. Detailed technical manuals on the design,
construction, and use of dsRNA for RNAi are available. See, e.g.,
Dharmacon's "RNAi Technical Reference & Application Guide";
Promega's "RNAi: A Guide to Gene Silencing." ALK-inhibiting siRNA
products are also commercially available, and may be suitably
employed in the method of the invention. See, e.g., Dharmacon,
Inc., Lafayette, Colo. (Cat Nos. M-003162-03, MU-003162-03,
D-003162-07 thru -10 (siGENOME.TM. SMARTselection and
SMARTpool.circle-solid. siRNAs).
[0178] It has recently been established that small dsRNA less than
49 nucleotides in length, and preferably 19-25 nucleotides,
comprising at least one sequence that is substantially identical to
part of a target mRNA sequence, and which dsRNA optimally has at
least one overhang of 1-4 nucleotides at an end, are most effective
in mediating RNAi in mammals. See U.S. Patent Publication Nos.
20040038921 and 20040229266. The construction of such dsRNA, and
their use in pharmaceutical preparations to silence expression of a
target protein, in vivo, are described in detail in such
publications.
[0179] If the sequence of the gene to be targeted in a mammal is
known, 21-23 nt RNAs, for example, can be produced and tested for
their ability to mediate RNAi in a mammalian cell, such as a human
or other primate cell. Those 21-23 nt RNA molecules shown to
mediate RNAi can be tested, if desired, in an appropriate animal
model to further assess their in vivo effectiveness. Target sites
that are known, for example target sites determined to be effective
target sites based on studies with other nucleic acid molecules,
for example ribozymes or antisense, or those targets known to be
associated with a disease or condition such as those sites
containing mutations or deletions, can be used to design si RNA
molecules targeting those sites as well.
[0180] Alternatively, the sequences of effective dsRNA can be
rationally designed/predicted screening the target mRNA of interest
for target sites, for example by using a computer folding
algorithm. The target sequence can be parsed in silico into a list
of all fragments or subsequences of a particular length, for
example 23 nucleotide fragments, using a custom Perl script or
commercial sequence analysis programs such as Oligo, MacVector, or
the GCG Wisconsin Package.
[0181] Various parameters can be used to determine which sites are
the most suitable target sites within the target RNA sequence.
These parameters include but are not limited to secondary or
tertiary RNA structure, the nucleotide base composition of the
target sequence, the degree of homology between various regions of
the target sequence, or the relative position of the target
sequence within the RNA transcript. Based on these determinations,
any number of target sites within the RNA transcript can be chosen
to screen siRNA molecules for efficacy, for example by using in
vitro RNA cleavage assays, cell culture, or animal models. See,
e.g., U.S. Patent Publication No. 20030170891. An algorithm for
identifying and selecting RNAi target sites has also recently been
described. See U.S. Patent Publication No. 20040236517.
[0182] Commonly used gene transfer techniques include calcium
phosphate, DEAE-dextran, electroporation and micro injection and
viral methods (Graham et al., (1973) Virol, 52: 456; McCutchan et
al., (1968), J. Natl. Cancer Inst. 41: 351; Chu et al. (1987),
Nucl. Acids Res. 15: 1311; Fraley et al. (1980), J. Biol. Chem.
255: 10431; Capecchi (1980), Cell 22: 479). DNA may also be
introduced into cells using cationic liposomes (Feigner et al.
(1987), Proc. Natl. Acad. Sci USA 84: 7413). Commercially available
cationic lipid formulations include Tfx 50 (Promega) or
Lipofectamin 200 (Life Technologies). Alternatively, viral vectors
may be employed to deliver dsRNA to a cell and mediate RNAi. See
U.S. Patent Publication No. 20040023390.
[0183] Transfection and vector/expression systems for RNAi in
mammalian cells are commercially available and have been well
described. See, e.g., Dharmacon, Inc., DharmaFECT.TM. system;
Promega, Inc., siSTRIKE.TM. U6 Hairpin system; see also Gou et al.
(2003) FEBS. 548, 113-118; Sui, G. et al. A DNA vector-based RNAi
technology to suppress gene expression in mammalian cells (2002)
Proc. Natl. Acad. Sci. 99, 5515-5520; Yu et al (2002) Proc. Natl
Acad. Sci. 99, 6047-6052; Paul, C, et al (2002) Nature
Biotechnology 19, 505-508; McManus et al. (2002) RNA 8,
842-850.
[0184] siRNA interference in a mammal using prepared dsRNA
molecules may then be effected by administering a pharmaceutical
preparation comprising the dsRNA to the mammal. The pharmaceutical
composition is administered in a dosage sufficient to inhibit
expression of the target gene. dsRNA can typically be administered
at a dosage of less than 5 mg dsRNA per kilogram body weight per
day, and is sufficient to inhibit or completely suppress expression
of the target gene. In general a suitable dose of dsRNA will be in
the range of 0.01 to 2.5 milligrams per kilogram body weight of the
recipient per day, preferably in the range of 0.1 to 200 micrograms
per kilogram body weight per day, more preferably in the range of
0.1 to 100 micrograms per kilogram body weight per day, even more
preferably in the range of 1.0 to 50 micrograms per kilogram body
weight per day, and most preferably in the range of 1.0 to 25
micrograms per kilogram body weight per day. A pharmaceutical
composition comprising the dsRNA is administered once daily, or in
multiple sub-doses, for example, using sustained release
formulations well known in the art. The preparation and
administration of such pharmaceutical compositions may be carried
out accordingly to standard techniques, as further described
below.
[0185] Such dsRNA may then be used to inhibit ALK expression and
activity in a cancer, by preparing a pharmaceutical preparation
comprising a therapeutically-effective amount of such dsRNA, as
described above, and administering the preparation to a human
subject having a cancer (e.g., kidney cancer) expressing an ALK
fusion protein or aberrantly expressing full length ALK
polypeptide, for example, via direct injection to the tumor. The
similar inhibition of other receptor tyrosine kinases, such as
VEGFR and EGFR using siRNA inhibitors has been described. See U.S.
Patent Publication No. 20040209832, U.S. Patent Publication No.
20030170891, and U.S. Patent Publication No. 20040175703.
[0186] ALK inhibitors (or their pharmaceutically acceptable salts)
are to be provided to patients in an amount/dosage, frequency and
form (including standard excipients if needed) as determined by a
competent clinician or pharmacist. The inhibitors may be provided
orally, parentally, intravenously, for example. If the PF02341066
is used as an ALK inhibitor in the context of the invention,
guidance for its delivery, dosage and formulation may be found in
U.S. Pub. No. 2008/0300273, for example.
[0187] Of course ALK-inhibiting therapeutic compositions useful in
the practice of the methods of the invention may be administered to
a mammal by any means known in the art including, but not limited
to oral or peritoneal routes, including intravenous, intramuscular,
intraperitoneal, subcutaneous, transdermal, airway (aerosol),
rectal, vaginal and topical (including buccal and sublingual)
administration.
[0188] For oral administration, a ALK-inhibiting therapeutic will
generally be provided in the form of tablets or capsules, as a
powder or granules, or as an aqueous solution or suspension.
Tablets for oral use may include the active ingredients mixed with
pharmaceutically acceptable carriers and excipients such as inert
diluents, disintegrating agents, binding agents, lubricating
agents, sweetening agents, flavoring agents, coloring agents and
preservatives. Suitable inert diluents include sodium and calcium
carbonate, sodium and calcium phosphate, and lactose, while corn
starch and alginic acid are suitable disintegrating agents. Binding
agents may include starch and gelatin, while the lubricating agent,
if present, will generally be magnesium stearate, stearic acid or
talc. If desired, the tablets may be coated with a material such as
glyceryl monostearate or glyceryl distearate, to delay absorption
in the gastrointestinal tract.
[0189] Capsules for oral use include hard gelatin capsules in which
the active ingredient is mixed with a solid diluent, and soft
gelatin capsules wherein the active ingredients is mixed with water
or an oil such as peanut oil, liquid paraffin or olive oil. For
intramuscular, intraperitoneal, subcutaneous and intravenous use,
the pharmaceutical compositions of the invention will generally be
provided in sterile aqueous solutions or suspensions, buffered to
an appropriate pH and isotonicity. Suitable aqueous vehicles
include Ringer's solution and isotonic sodium chloride. The carrier
may consist exclusively of an aqueous buffer ("exclusively" means
no auxiliary agents or encapsulating substances are present which
might affect or mediate uptake of the ALK-inhibiting therapeutic).
Such substances include, for example, micellar structures, such as
liposomes or capsids, as described below. Aqueous suspensions may
include suspending agents such as cellulose derivatives, sodium
alginate, polyvinyl-pyrrolidone and gum tragacanth, and a wetting
agent such as lecithin. Suitable preservatives for aqueous
suspensions include ethyl and n-propyl p-hydroxybenzoate.
[0190] ALK-inhibiting therapeutic compositions may also include
encapsulated formulations to protect the therapeutic (e.g., a dsRNA
compound or an antibody that specifically binds an ALK fusion
polypeptide) against rapid elimination from the body, such as a
controlled release formulation, including implants and
microencapsulated delivery systems. Biodegradable, biocompatible
polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No. 4,522,811;
PCT publication WO 91/06309; and European patent publication
EP-A-43075. An encapsulated formulation may comprise a viral coat
protein. The viral coat protein may be derived from or associated
with a virus, such as a polyoma virus, or it may be partially or
entirely artificial. For example, the coat protein may be a Virus
Protein 1 and/or Virus Protein 2 of the polyoma virus, or a
derivative thereof.
[0191] ALK-inhibiting compounds can also comprise a delivery
vehicle, including liposomes, for administration to a subject,
carriers and diluents and their salts, and/or can be present in
pharmaceutically acceptable formulations. For example, methods for
the delivery of nucleic acid molecules are described in Akhtar et
al., 1992, Trends Cell Bio., 2, 139; DELIVERY STRATEGIES FOR
ANTISENSE OLIGONUCLEOTIDE THERAPEUTICS, ed. Akbtar, 1995, Maurer et
al., 1999, Mol. Membr. Biol., 16, 129-140; Holland and Huang, 1999,
Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS
Symp, Ser., 752, 184-192. U.S. Pat. No. 6,395,713 and PCT
Publication No. WO 94/02595 further describe the general methods
for delivery of nucleic acid molecules. These protocols can be
utilized for the delivery of virtually any nucleic acid
molecule.
[0192] ALK-inhibiting therapeutics can be administered to a
mammalian tumor by a variety of methods known to those of skill in
the art, including, but not restricted to, encapsulation in
liposomes, by iontophoresis, or by incorporation into other
vehicles, such as hydrogels, cyclodextrins, biodegradable
nanocapsules, and bioadhesive microspheres, or by proteinaceous
vectors (see PCT Publication No. WO 00/53722). Alternatively, the
therapeutic/vehicle combination is locally delivered by direct
injection or by use of an infusion pump. Direct injection of the
composition, whether subcutaneous, intramuscular, or intradermal,
can take place using standard needle and syringe methodologies, or
by needle-free technologies such as those described in Corny et
al., 1999, Clin. Cancer Res., 5, 2330-2337 and PCT Publication No.
WO 99/3 1262.
[0193] Pharmaceutically acceptable formulations of ALK-inhibiting
therapeutics include salts of the above described compounds, e.g.,
acid addition salts, for example, salts of hydrochloric, hydro
bromic, acetic acid, and benzene sulfonic acid. A pharmacological
composition or formulation refers to a composition or formulation
in a form suitable for administration, e.g., systemic
administration, into a cell or patient, including for example a
human. Suitable forms, in part, depend upon the use or the route of
entry, for example oral, transdermal, or by injection. Such forms
should not prevent the composition or formulation from reaching a
target cell. For example, pharmacological compositions injected
into the blood stream should be soluble. Other factors are known in
the art, and include considerations such as toxicity and forms that
prevent the composition or formulation from exerting its
effect.
[0194] Administration routes that lead to systemic absorption
(e.g., systemic absorption or accumulation of drugs in the blood
stream followed by distribution throughout the entire body), are
desirable and include, without limitation: intravenous,
subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and
intramuscular. Each of these administration routes exposes the
ALK-inhibiting therapeutic to an accessible diseased tissue or
tumor. The rate of entry of a drug into the circulation has been
shown to be a function of molecular weight or size. The use of a
liposome or other drug carrier comprising the compounds of the
instant invention can potentially localize the drug, for example,
in certain tissue types, such as the tissues of the reticular
endothelial system (RES). A liposome formulation that can
facilitate the association of drug with the surface of cells, such
as, lymphocytes and macrophages is also useful. This approach can
provide enhanced delivery of the drug to target cells by taking
advantage of the specificity of macrophage and lymphocyte immune
recognition of abnormal cells, such as cancer cells.
[0195] By "pharmaceutically acceptable formulation" is meant, a
composition or formulation that allows for the effective
distribution of the nucleic acid molecules of the instant invention
in the physical location most suitable for their desired activity.
Nonlimiting examples of agents suitable for formulation with the
nucleic acid molecules of the instant invention include:
P-glycoprotein inhibitors (such as Pluronic P85), which can enhance
entry of drugs into the CNS (Jolliet-Riant and Tillement, 1999,
Fundam. Clin. Pharmacol, 13, 16-26); biodegradable polymers, such
as poly (DL-lactide-coglycolide) microspheres for sustained release
delivery after intracerebral implantation (Emerich et al, 1999,
Cell Transplant, 8, 47-58) (Alkermes, Inc. Cambridge, Mass.); and
loaded nanoparticles, such as those made of polybutylcyanoacrylate,
which can deliver drugs across the blood brain barrier and can
alter neuronal uptake mechanisms (Prog Neuro-psychopharmacol Biol
Psychiatry, 23, 941-949, 1999). Other non-limiting examples of
delivery strategies for the ALK-inhibiting compounds useful in the
method of the invention include material described in Boado et al,
1998, J, Pharm. Sci, 87, 1308-1315; Tyler et al., 1999, FEBS Lett.,
421, 280-284; Pardridge et al, 1995, PNAS USA., 92, 5592-5596;
Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107; Aldrian-Herrada
et al., 1998, Nucleic Acids Res., 26, 4910-4916; and Tyler et al,
1999, PNAS USA, 96, 7053-7058.
[0196] Therapeutic compositions comprising surface-modified
liposomes containing poly (ethylene glycol) lipids (PEG-modified,
or long-circulating liposomes or stealth liposomes) may also be
suitably employed in the methods of the invention. These
formulations offer a method for increasing the accumulation of
drugs in target tissues. This class of drug carriers resists
opsonization and elimination by the mononuclear phagocytic system
(MPS or RES), thereby enabling longer blood circulation times and
enhanced tissue exposure for the encapsulated drug (Lasic et al.
Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Phann. Bull.
1995, 43, 1005-1011). Such liposomes have been shown to accumulate
selectively in tumors, presumably by extravasation and capture in
the neovascularized target tissues (Lasic et al, Science 1995, 267,
1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90).
The long-circulating liposomes enhance the pharmacokinetics and
pharmacodynamics of DNA and RNA, particularly compared to
conventional cationic liposomes which are known to accumulate in
tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42,
24864-24870; PCI Publication No. WO 96/10391; PCT Publication No.
WO 96/10390; and PCT Publication No. WO 96/10392). Long-circulating
liposomes are also likely to protect drugs from nuclease
degradation to a greater extent compared to cationic liposomes,
based on their ability to avoid accumulation in metabolically
aggressive MPS tissues such as the liver and spleen.
[0197] Therapeutic compositions may include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in REMINGTON'S PHARMACEUTICAL SCIENCES,
Mack Publishing Co. (A. R. Gennaro edit, 1985). For example,
preservatives, stabilizers, dyes and flavoring agents can be
provided. These include sodium benzoate, sorbic acid and esters of
p-hydroxybenzoic acid. In addition, antioxidants and suspending
agents can be used.
[0198] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence, or treat (alleviate a symptom to
some extent, preferably all of the symptoms) of a disease state.
The pharmaceutically effective dose depends on the type of disease,
the composition used, the route of administration, the type of
mammal being treated, the physical characteristics of the specific
mammal under consideration, concurrent medication, and other
factors that those skilled in the medical arts will recognize.
Generally, an amount between 0.1 mg/kg and 100 mg/kg body
weight/day of active ingredients is administered dependent upon
potency of the negatively charged polymer.
[0199] Dosage levels of the order of from about 0.1 mg to about 140
mg per kilogram of body weight per day are useful, in the treatment
of the above-indicated conditions (about 0.5 mg to about 7 g per
patient per day). The amount of active ingredient that can be
combined with the carrier materials to produce a single dosage form
varies depending upon the host treated and the particular mode of
administration. Dosage unit forms generally contain between from
about 1 mg to about 500 mg of an active ingredient. It is
understood that the specific dose level for any particular patient
depends upon a variety of factors including the activity of the
specific compound employed, the age, body weight, general health,
sex, diet, time of administration, route of administration, and
rate of excretion, drug combination and the severity of the
particular disease undergoing therapy.
[0200] For administration to non-human animals, the composition can
also be added to the animal feed or drinking water. It can be
convenient to formulate the animal feed and drinking water
compositions so that the animal takes in a therapeutically
appropriate quantity of the composition along with its diet. It can
also be convenient to present the composition as a premix for
addition to the feed or drinking water.
[0201] An ALK-inhibiting therapeutic useful in the practice of the
invention may comprise a single compound as described above, or a
combination of multiple compounds, whether in the same class of
inhibitor (e.g., antibody inhibitor), or in different classes
(e.g., antibody inhibitors and small-molecule inhibitors). Such
combination of compounds may increase the overall therapeutic
effect in inhibiting the progression of a fusion protein-expressing
cancer. For example, Crizotinib (also known as PF-02341066)
produced by Pfizer, Inc. (see U.S. Pub. No. 2008/0300273) may be
administered alone, or in combination with other Crizotinib
analogues targeting ALK activity and/or small molecule inhibitors
of ALK, such as NVP-TAE684 produced by Novartis, Inc. The
therapeutic composition may also comprise one or more non-specific
chemotherapeutic agent in addition to one or more targeted
inhibitors. Such combinations have recently been shown to provide a
synergistic tumor killing effect in many cancers. The effectiveness
of such combinations in inhibiting ALK activity and tumor growth in
vivo can be assessed according to standard methods.
[0202] The present invention is further directed to a method of
monitoring the effectiveness of a cancer therapy, such as kidney
cancer therapy. The method involves detecting the expression levels
or activity levels of a polypeptide with ALK kinase activity in the
relevant biological sample of the cancer patient prior to and after
the cancer therapy. The expression levels of the polypeptide with
ALK kinase activity are further quantified so as to be able to
compare the values prior to therapy and after therapy. An increase
or steady value in the expression and/or levels of the polypeptide
with ALK kinase activity after therapy as compared to before
therapy indicates that the cancer therapy is not effective. A
decrease in the expression and/or activity level of the polypeptide
with ALK kinase activity (i.e., the level of the polypeptide with
ALK kinase activity is less after the therapy compared to prior to
therapy) indicates an effective cancer therapy. In accordance with
the invention, the cancer therapy may include biological therapies,
such as surgery, immunotherapeutics, chemotherapeutics, and
radiation therapies, and targeted therapies, such as drugs or other
substances intended to block the growth and spread of cancer by
interfering with specific molecular in tumor growth. ALK inhibitor
treatments, such as the use of crizotinib (PF02341066), may be
monitored according to the present invention.
[0203] The invention further provides a method for determining
whether a compound inhibits the progression of a cancer (e.g., a
kidney cancer) driven by polypeptide with ALK kinase activity. In
this embodiment, the method comprises the step of determining
whether the compound inhibits the expression and/or activity of the
polypeptide with ALK kinase activity in the cancer. In some
embodiments, inhibition of expression and/or activity of the
polypeptide with ALK kinase is determined by examining a biological
sample comprising cells from bone marrow, blood, or a tumor. In
another embodiment, inhibition of expression and/or activity of
polypeptide with ALK kinase is determined using at least one
detection molecule as described herein.
[0204] The tested compound may be any type of therapeutic or
composition as described above. Methods for assessing the efficacy
of a compound, both in vitro and in vivo, are well established and
known in the art. For example, a composition may be tested for
ability to inhibit ALK in vitro using a cell or cell extract in
which ALK kinase is activated. A panel of compounds may be employed
to test the specificity of the compound for ALK (as opposed to
other targets, such as EGFR or PDGFR).
[0205] Another technique for drug screening which may be used
provides for high throughput screening of compounds having suitable
binding affinity to a protein of interest, as described in PCT
Publication No. WO 84/03564. In this method, as applied to ALK
fusion polypeptides or full-length ALK polypeptide, large numbers
of different small test compounds are synthesized on a solid
substrate, such as plastic pins or some other surface. The test
compounds are reacted with a polypeptide of the invention, or
fragments thereof, and washed. Bound polypeptide is then detected
by methods well known in the art. A purified polypeptide can also
be coated directly onto plates for use in the aforementioned drug
screening techniques. Alternatively, non-neutralizing antibodies
can be used to capture the peptide and immobilize it on a solid
support.
[0206] A compound found to be an effective inhibitor of ALK
activity in vitro may then be examined for its ability to inhibit
the progression of a cancer expressing a polypeptide with kinase
activity (such as kidney cancer), in vivo, using, for example,
mammalian xenografts harboring human kidney tumors that are express
a polypeptide with ALK kinase activity. In this procedure, cancer
ceil lines known to express a polypeptide with ALK kinase activity
may be placed subcutaneously in an animal (e.g., into a nude or
SCID mouse, or other immune-compromised animal). The cells then
grow into a tumor mass that may be visually monitored. The animal
may then be treated with the drug. The effect of the drug treatment
on tumor size may be externally observed. The animal is then
sacrificed and the tumor removed for analysis by IHC and Western
blot. Similarly, mammalian bone marrow transplants may be prepared,
by standard methods, to examine drug response in hematological
tumors expressing a mutant ALK kinase. In this way, the effects of
the drug may be observed in a biological setting most closely
resembling a patient. The drug's ability to alter signaling in the
tumor cells or surrounding stromal cells may be determined by
analysis with phosphorylation-specific antibodies. The drug's
effectiveness in inducing cell death or inhibition of ceil
proliferation may also be observed by analysis with apoptosis
specific markers such as cleaved caspase 3 and cleaved PARP.
[0207] Toxicity and therapeutic efficacy of such compounds can be
determined by standard pharmaceutical procedures in cell cultures
or experimental animals, e.g., for determining the LD50 (the dose
lethal to 50% of the population) and the ED50 (the dose
therapeutically effective in 50% of the population). The dose ratio
between toxic and therapeutic effects is the therapeutic index and
it can be expressed as the ratio LD50/ED50. In some embodiments,
the compounds exhibit high therapeutic indices.
[0208] The following Examples are provided only to further
illustrate the invention, and are not intended to limit its scope,
except as provided in the claims appended hereto. The present
invention encompasses modifications and variations of the methods
taught herein which would be obvious to one of ordinary skill in
the art. Materials, reagents and the like to which reference is
made are obtainable from commercial sources, unless otherwise
noted.
Example 1
Identification of ALK or ALK Fusion Polypeptides in Kidney Cancer
Patients
[0209] Tissue microarrays comprised of samples of cancers of the
breast, pancreas, prostate, bladder, endometrium, kidney and
various metastases were obtained from BioChain Institute, Inc.,
Hayward, Calif.
[0210] Tissue arrays were deparaffinized through three changes of
xylene for 5 minutes each, then rehydrated through two changes of
100% ethanol and 2 changes of 95% ethanol, each for 5 minutes.
Slides were rinsed for 5 minutes each in three changes of
diH.sub.2O, then were subjected to antigen retrieval in a
Decloaking Chamber (Biocare Medical, Concord, Calif.) as follow's.
Slides were immersed in 250 ml 1.0 mM EDTA, pH 8.0 in a 24 slide
holder from Tissue Tek. The Decloaking Chamber was filled with 500
ml diH2O, the slide holder was placed in the chamber touching the
heat shield, and retrieval was performed, with the following
settings as set by the manufacturer: SP1 125.degree. C. for 30
seconds and SP2 90.degree. C. for 10 seconds. Slides were cooled on
the bench for 10 minutes, rinsed in diH.sub.2O, submerged in 3%
H.sub.2O.sub.2 for 10 minutes, then washed twice in diH.sub.2O.
After blocking for 1 hour at room temperature in Tris buffered
saline+0.5% Tween-20 (TBST)/5% goat serum in a humidified chamber,
slides were incubated overnight at 4.degree. C. with ALK (D5F3)
XP.RTM. Rabbit mAb (Cell Signaling Technology, Inc., Danvers,
Mass.; Catalog No. 3633) at 9.8 .mu.g/ml diluted in
SignalStain.RTM. Antibody Diluent (Catalog No. 8112 Cell Signaling
Technology, Inc.). After washing three times in TEST, detection was
performed with Envision+ (DAKO, Carpinteria, Calif.) with a 30
minute incubation at room temperature in a humidified chamber.
After washing three times in TEST slides were exposed to NovaRed
(Vector Laboratories, Burlingame, Calif.) prepared per the
manufacturer's instructions. Slides were developed for 1 minute
then rinsed in diH.sub.2O. Slides were counterstained by incubating
in hematoxylin (Ready to Use Invitrogen, Carlsbad, Calif.; Catalog
#00-8011) for 1 minute, rinsed for 30 seconds in diH2O, incubated
for 20 seconds in bluing reagent (Richard Allan Scientific, Catalog
#7301), then finally washed for 30 seconds in diH2O. Slides were
dehydrated in 2 changes of 95% ethanol for 20 seconds each and 2
changes of 100% ethanol for 2 minutes each. Slides were cleared in
2 changes of xylene for 20 seconds each, then air dried. Coverslips
were mounted using VectaMount (Vector Laboratories, Burlingame,
Calif.). Slides were air dried, then evaluated under the
microscope.
[0211] Staining was observed in 1 lymphoma in the kidney and 1
squamous cell carcinoma of the kidney.
[0212] Additional arrays of kidney carcinomas and normal kidney
tissue (331 carcinomas and 26 normal tissues) were acquired from
BioChain Institute, Inc., Hayward, Calif. and Folio Biosciences
Columbus, Ohio and stained with ALK (D5F3) XP.RTM. Rabbit mAb as
described above. Staining was observed in 1 squamous cell carcinoma
of the kidney (FIG. 1) and 1 granular cell carcinoma (FIG. 2).
[0213] Total kidney cancer cases stained, including lymphomas: 331
[0214] Positive cases identified: 4 [0215] Frequency: 1.2% [0216]
Total cancers stained, excluding lymphoma: 327 [0217] Positive
cases identified: 3 [0218] Frequency: 0.9%
Breakdown of Frequency by Cancer Type:
TABLE-US-00002 [0219] TABLE 1 Cancer Cases Positive Staining
Frequency Granular cell 26 1 3.8% Squamous cell 9 2 22.2% Lymphoma
4 1 25%
Example 2
Evaluation of ALK in Kidney Using FISH Analysis
[0220] ALK was analyzed by fluorescent in situ hybridization (FISH)
in a lymphoma tissue of the kidney (Z7020052 I6/J6) and a squamous
cell carcinoma tissue of the kidney (Z6020052 G8/H8) with the use
of a break-apart probe specific to the ALK locus (Vysis LSI ALK
Dual Color, Break Apart Rearrangement Probe; Abbott Molecular). The
Vysis probe contains two differently labeled probes on opposite
sides of the breakpoint of the ALK gene: one approximately 250 kb
probe for the telomeric side of the ALK breakpoint is labeled with
SpectrumOrange and the centromeric probe is approximately 300 kb
and labeled with SpectrumGreen. When hybridized with the LSI ALK
Dual Color, Break Apart Rearrangement Probe, the 2p23 ALK region in
its native state is seen as two immediately adjacent or fused
orange/green (yellow) signals. Paraffin embedded tissue sections
were re-hydrated and incubated for 1 hour in TE buffer pH 8 in
boiling water. Sections were digested with pepsin Digest All III
(Invitrogen) at 37.degree. C. for 20-40 minutes. Slides were then
fixed with NBF for 1 minute and then dehydrated. The probe and
tissue were then co-denatured at 93.degree. C. for 3 minutes and
then allowed to incubate at 37.degree. C. for 18 hours. After
washing, 4',6-diamidino-2-phenylindole (DAPI; mg/nil) in
Vectashield mounting medium (Vector Laboratories, Burlingame,
Calif.) was applied for nuclear counterstaining. Cytogenetic
rearrangement of the ALK locus were confirmed by FISH in the kidney
lymphoma and squamous cell carcinoma of the kidney (FIG. 3). The
results (with IHC results of the same tissues) are summarized in
Table 2.
TABLE-US-00003 TABLE 2 TUMOR ID TYPE ALK IHC ALK FISH Z702005216/J6
Kidney Lymphoma + + Z6020052 G8/H8 Kidney Squamous + +
Example 3
Evaluation of MDCK for ALK and c-Met in Western Blot Experiment
[0221] U.S. Patent Application Publication No. 2008/0300273, herein
incorporated by reference, describes the application of the c-Met
and ALK inhibitor, crizotinib (PF-02341066) to Madin-Darby Canine
Kidney (MDCK) cell lines to reduce HGF-stimulated ceil
scattering.
[0222] HGF-stimulated MDCK cell lines were evaluated to assess
whether crizotinib was acting by inhibition of c-Met or ALK using
antibodies specific for either c-Met, ALK or ALK fusion
polypeptides.
[0223] MDCK were maintained in Dulbecco's modified Eagle's medium
supplemented with 10% fetal bovine serum. The cells were
serum-starved overnight and then either stimulated with hepatocyte
growth factor (HGF) (50 ng/ml) at 37.degree. C. for 5 min or 24 h,
or serum-starved for an additional 5 min or 24 h. Cells were then
washed in ice-cold PBS, treated with IX Cell Lysis Buffer (20 mM
Tris-HCl (pH7.5), 150 mM NaCl, 1 mM Na.sub.2EDTA, 1 mM EGTA, 1%
Triton, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerophosphate, 1
mM Na.sub.3VO.sub.4, 1 ug/mL leupeptin, 1% SDS and 40 mM DTT) for 5
min on ice, and then scraped. H3122 cells (expressing EML4-ALK
fusion polypeptide) were used as a positive control for ALK. MKN45
cells were used as a positive control for pMet.
[0224] The MDCK, H3122, and MKN45 cell lysates were analyzed by
Western Blot. The membranes were probed with the following
antibodies: pMet Y1234/5 antibody (Cell Signaling Technology,
#3077), Met (25H2) mouse monoclonal antibody (Cell Signaling
Technology, #3127), pALK Y1278/82/83 antibody (Cell Signaling
Technology #3983), ALK (D5F3) XP.RTM.RmAb (Cell Signaling
Technology #3633), and Beta Actin (Cell Signaling Technology
#4970).
[0225] The results of the Western blot are represented by a 1
second exposure (FIG. 4A) and a 15 second exposure (FIG. 4B). As
shown, the MDCK cells (lanes 1, 2, 3, and 4) are positive for Met
(Cell Signaling Technology #3127), but not ALK (Cell Signaling
Technology #3633).
[0226] These results demonstrate that MDCK cells stimulated by HGF
do not express ALK. Therefore, to the extent crizotinib inhibits
MDCK cell scattering in response to HGF stimulation, the mechanism
of action appears to be that it inhibits c-Met/HGFR activity.
[0227] Therefore, inhibition of MDCK cell lines in scattering
assays, as described in the US Patent Publication 2008/0300273,
appears to be acting through Met-related activity and not ALK
activity.
Example 4
Detection of ALK or ALK Fusion Polypeptide Expression in a Human
Cancer Sample Using PCR Assay
[0228] The presence of ALK and/or an ALK fusion polypeptide of the
invention in cancer sample is detected using RT-PCR. These methods
have been previously described. See, e.g., Cools et al., N. Engl.
J. Med. 348: 1201-1214 (2003).
[0229] PCR Assay
[0230] To confirm the existence of an EML4-ALK fusion gene in
genomic DNA, standard PCR methods known in the art for detecting
the relevant translocation may be used.
[0231] Genomic PCR is done with 50 to 100 ng of DNA in a 25 .mu.L
reaction containing LongAmp Taq DNA polymerase (New England Bio
labs, Ipswich, Mass.) under the following conditions: 3 min at
95.degree. C. followed by 30 cycles of 10 s at 95.degree. C., 1 min
at 55.degree. C., and 10 min at 68.degree. C. plus a final
extension for 20 min at 68.degree. C. The genomic fusion points for
the E13; A20 variant are identified using forward PCR primer
Fusion-genome-S or a primer residing in EML4 intron 13 (AGGA
GAGAAAGAGCTGCAGTG) (SEQ ID NO: 7) and reverse primer
Fusion-genome-AS or a primer located in ALK intron 19
(GCTCTGAACCTTTCCATCATACTT) (SEQ ID NO:8). For the detection of the
E20; A20 and E21; A20 variants, the forward primers are placed
within EML4 exon 20 (ACTGOTCCCCAGACAACAAG) (SEQ ID NO:9) or intron
20 (TTACTCTGTCAAATTGATGCTGCT) (SEQ ID NO: 10), whereas the reverse
primer is Fusion-genome-AS. The PCR products are resolved on
agarose gel; if they appear specific, the original PCR product is
used for direct sequencing. However, if additional nonspecific
fragments are present, the desired fragments are excised, gel
purified, cloned, and sequenced.
[0232] A fusion partner of ALK is determined by performing RNA
ligase-mediated rapid amplification of 5' and 3' cDNA ends with
GeneRacer kit (Invitrogen). First-strand cDNA is amplified with
Advantage HD DNA polymerase mix (Clontech) using GeneRacer 5'
primer and ALK-6R primer (CATGAGGAAATCCAGTTCGTCCTG) (SEQ ID NO:11).
Subsequent nested PCR is done using GeneRacer 5' nested primer and
ALK-2R primer (GAGGTCTTGCCAGCAAAGCAGTAG) (SEQ ID NO: 12),
Amplification products are gel purified with Q1Aquick gel
extraction (Qiagen) and cloned using pCR4-TOPO TA Cloning
(Invitrogen), Sequencing is done using 3730.times.1 DNA Analyzer
(Applied Biosystems). Sequencing products may be analyzed with
Sequencer software (Gene Codes). Basic Local Alignment and Search
Tool against the BEAT databased is used to determine the identity
of unknown sequences
[0233] To determine whether EML4-ALK gene product is expressed,
RT-PCR is performed on RNA extracted from the kidney cancer cell
samples of patients. RT-PCR is carried out using One Step RT-PCR
(Qiagen) and primers previously described in (Soda et al, Nature
2007; 448:561-6. Choi Y L, Takeuchi K, Soda M, et al.
Identification of novel iso forms of the EML-4-ALK transforming
gene in non-small cell lung cancer. Cancer Res 2008; 68:4971-76.
PCR conditions for the detection of EML4-ALK fusion transcript
include cDNA synthesis at 50.degree. C. for 30 min, denaturation at
95.degree. C. for 15 min, 40 cycles consisting of denaturation at
95.degree. C. for 30 s, annealing at 60.degree. C. for 30 s, and
strand elongation at 72.degree. C. for 1 min and a final elongation
step at 72.degree. C. for 10 min. As an internal control, primers
for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH;
AACGACCACTTTGTCAAGCTC (SEQ ID NO: 13) and CTCTCTTCCTCTTGTGCTCTTGC)
(SEQ ID NO: 14) are used. Twenty cycles of amplification are
performed. PCR products are resolved on agarose gel and their sizes
are determined by using Trackit 1 kb Plus DNA ladder (Invitrogen).
Fragments representing EML4-ALK fusion product are excised, gel
purified, cloned, and sequenced.
[0234] Expression of ALK Protein or ALK Fusion Polypeptide
[0235] The expression of ALK and ALK fusion polypeptides is
investigated by Western blotting and immunoprecipitation with
anti-ALK antibodies.
[0236] Cell lysates are prepared from kidney cancer cells by
removing media and rinsing the cells with ice-cold PBS. The PBS is
removed and 0.5 ml ice-cold IX cell lysis buffer (20 mM Tris pH
7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM
Sodium pyrophosphate, 1 mM .beta.-glycerophosphate, 1 mM
Na.sub.3VO.sub.4, 1 .mu.g/ml Leupeptin) is added to each plate and
incubated. The cells are transferred to micro centrifuge tubes and
samples are sonicated on ice three times for 5 second each and
microcentrifuged for 10 min at 14,000.times.g.
[0237] The cell lysate is incubated with the primary antibodies
specific for ALK protein, pALK Y1278/82/83 antibody (CST #3893) and
ALK (D5F3) XP.TM.RmAb (CST #3633) overnight at 4.degree. C. Protein
A or G agarose beads are added and incubated with gentle rocking
for 1-3 hours at 4.degree. C. The sample is microcentrifuged for 30
s at 4.degree. C., washed, and resuspended with 20 .mu.l
3.times.SDS sample buffer. The sample is loaded on an SDS-PAGE gel
and analyzed by Western blotting.
[0238] Those skilled in the art will recognize, or be able to
ascertain, using no more than routine experimentation, numerous
equivalents to the specific embodiments described specifically
herein. Such equivalents are intended to be encompassed in the
scope of the following claims.
Sequence CWU 1
1
1516226DNAArtificial SequenceSynthetic Polynucleotide 1aagcgggggc
ggcagcggtg gtagcagctg gtacctcccg ccgcctctgt tcggagggtc 60gcggggcacc
gaggtgcttt ccggccgccc tctggtcggc cacccaaagc cgcgggcgct
120gatgatgggt gaggaggggg cggcaagatt tcgggcgccc ctgccctgaa
cgccctcagc 180tgctgccgcc ggggccgctc cagtgcctgc gaactctgag
gagccgaggc gccggtgaga 240gcaaggacgc tgcaaacttg cgcagcgcgg
gggctgggat tcacgcccag aagttcagca 300ggcagacagt ccgaagcctt
cccgcagcgg agagatagct tgagggtgcg caagacggca 360gcctccgccc
tcggttcccg cccagaccgg gcagaagagc ttggaggagc cacaaggaac
420gcaaaaggcg gccaggacag cgtgcagcag ctgggagccg ccgttctcag
ccttaaaagt 480tgcagagatt ggaggctgcc ccgagagggg acagacccca
gctccgactg cggggggcag 540gagaggacgg tacccaactg ccacctccct
tcaaccatag tagttcctct gtaccgagcg 600cagcgagcta cagacggggg
cgcggcactc ggcgcggaga gcgggaggct caaggtccca 660gccagtgagc
ccagtgtgct tgagtgtctc tggactcgcc cctgagcttc caggtctgtt
720tcatttagac tcctgctcgc ctccgtgcag ttgggggaaa gcaagagact
tgcgcgcacg 780cacagtcctc tggagatcag gtggaaggag ccgctgggta
ccaaggactg ttcagagcct 840cttcccatct cggggagagc gaagggtgag
gctgggcccg gagagcagtg taaacggcct 900cctccggcgg gatgggagcc
atcgggctcc tgtggctgct gccgctgctg ctttccacgg 960cagctgtggg
ctccgggatg gggaccggcc agcgcgcggg ctccccagct gcggggtcgc
1020cgctgcagcc ccgggagcca ctcagctact cgcgcctgca gaggaagagt
ctggcagttg 1080acttcgtggt gccctcgctc ttccgtgtct acgcccggga
cctactgctg ccaccatcct 1140cctcggagct gaaggctggc aggcccgagg
cccgcggctc gctagctctg gactgcgccc 1200cgctgctcag gttgctgggg
ccggcgccgg gggtctcctg gaccgccggt tcaccagccc 1260cggcagaggc
ccggacgctg tccagggtgc tgaagggcgg ctccgtgcgc aagctccggc
1320gtgccaagca gttggtgctg gagctgggcg aggaggcgat cttggagggt
tgcgtcgggc 1380cccccgggga ggcggctgtg gggctgctcc agttcaatct
cagcgagctg ttcagttggt 1440ggattcgcca aggcgaaggg cgactgagga
tccgcctgat gcccgagaag aaggcgtcgg 1500aagtgggcag agagggaagg
ctgtccgcgg caattcgcgc ctcccagccc cgccttctct 1560tccagatctt
cgggactggt catagctcct tggaatcacc aacaaacatg ccatctcctt
1620ctcctgatta ttttacatgg aatctcacct ggataatgaa agactccttc
cctttcctgt 1680ctcatcgcag ccgatatggt ctggagtgca gctttgactt
cccctgtgag ctggagtatt 1740cccctccact gcatgacctc aggaaccaga
gctggtcctg gcgccgcatc ccctccgagg 1800aggcctccca gatggacttg
ctggatgggc ctggggcaga gcgttctaag gagatgccca 1860gaggctcctt
tctccttctc aacacctcag ctgactccaa gcacaccatc ctgagtccgt
1920ggatgaggag cagcagtgag cactgcacac tggccgtctc ggtgcacagg
cacctgcagc 1980cctctggaag gtacattgcc cagctgctgc cccacaacga
ggctgcaaga gagatcctcc 2040tgatgcccac tccagggaag catggttgga
cagtgctcca gggaagaatc gggcgtccag 2100acaacccatt tcgagtggcc
ctggaataca tctccagtgg aaaccgcagc ttgtctgcag 2160tggacttctt
tgccctgaag aactgcagtg aaggaacatc cccaggctcc aagatggccc
2220tgcagagctc cttcacttgt tggaatggga cagtcctcca gcttgggcag
gcctgtgact 2280tccaccagga ctgtgcccag ggagaagatg agagccagat
gtgccggaaa ctgcctgtgg 2340gtttttactg caactttgaa gatggcttct
gtggctggac ccaaggcaca ctgtcacccc 2400acactcctca gtggcaggtc
aggaccctaa aggatgcccg gttccaggac caccaagacc 2460atgctctatt
gctcagtacc actgatgtcc ccgcttctga aagtgctaca gtgaccagtg
2520ctacgtttcc tgcaccgatc aagagctctc catgtgagct ccgaatgtcc
tggctcattc 2580gtggagtctt gaggggaaac gtgtccttgg tgctagtgga
gaacaaaacc gggaaggagc 2640aaggcaggat ggtctggcat gtcgccgcct
atgaaggctt gagcctgtgg cagtggatgg 2700tgttgcctct cctcgatgtg
tctgacaggt tctggctgca gatggtcgca tggtggggac 2760aaggatccag
agccatcgtg gcttttgaca atatctccat cagcctggac tgctacctca
2820ccattagcgg agaggacaag atcctgcaga atacagcacc caaatcaaga
aacctgtttg 2880agagaaaccc aaacaaggag ctgaaacccg gggaaaattc
accaagacag acccccatct 2940ttgaccctac agttcattgg ctgttcacca
catgtggggc cagcgggccc catggcccca 3000cccaggcaca gtgcaacaac
gcctaccaga actccaacct gagcgtggag gtggggagcg 3060agggccccct
gaaaggcatc cagatctgga aggtgccagc caccgacacc tacagcatct
3120cgggctacgg agctgctggc gggaaaggcg ggaagaacac catgatgcgg
tcccacggcg 3180tgtctgtgct gggcatcttc aacctggaga aggatgacat
gctgtacatc ctggttgggc 3240agcagggaga ggacgcctgc cccagtacaa
accagttaat ccagaaagtc tgcattggag 3300agaacaatgt gatagaagaa
gaaatccgtg tgaacagaag cgtgcatgag tgggcaggag 3360gcggaggagg
agggggtgga gccacctacg tatttaagat gaaggatgga gtgccggtgc
3420ccctgatcat tgcagccgga ggtggcggca gggcctacgg ggccaagaca
gacacgttcc 3480acccagagag actggagaat aactcctcgg ttctagggct
aaacggcaat tccggagccg 3540caggtggtgg aggtggctgg aatgataaca
cttccttgct ctgggccgga aaatctttgc 3600aggagggtgc caccggagga
cattcctgcc cccaggccat gaagaagtgg gggtgggaga 3660caagaggggg
tttcggaggg ggtggagggg ggtgctcctc aggtggagga ggcggaggat
3720atataggcgg caatgcagcc tcaaacaatg accccgaaat ggatggggaa
gatggggttt 3780ccttcatcag tccactgggc atcctgtaca ccccagcttt
aaaagtgatg gaaggccacg 3840gggaagtgaa tattaagcat tatctaaact
gcagtcactg tgaggtagac gaatgtcaca 3900tggaccctga aagccacaag
gtcatctgct tctgtgacca cgggacggtg ctggctgagg 3960atggcgtctc
ctgcattgtg tcacccaccc cggagccaca cctgccactc tcgctgatcc
4020tctctgtggt gacctctgcc ctcgtggccg ccctggtcct ggctttctcc
ggcatcatga 4080ttgtgtaccg ccggaagcac caggagctgc aagccatgca
gatggagctg cagagccctg 4140agtacaagct gagcaagctc cgcacctcga
ccatcatgac cgactacaac cccaactact 4200gctttgctgg caagacctcc
tccatcagtg acctgaagga ggtgccgcgg aaaaacatca 4260ccctcattcg
gggtctgggc catggcgcct ttggggaggt gtatgaaggc caggtgtccg
4320gaatgcccaa cgacccaagc cccctgcaag tggctgtgaa gacgctgcct
gaagtgtgct 4380ctgaacagga cgaactggat ttcctcatgg aagccctgat
catcagcaaa ttcaaccacc 4440agaacattgt tcgctgcatt ggggtgagcc
tgcaatccct gccccggttc atcctgctgg 4500agctcatggc ggggggagac
ctcaagtcct tcctccgaga gacccgccct cgcccgagcc 4560agccctcctc
cctggccatg ctggaccttc tgcacgtggc tcgggacatt gcctgtggct
4620gtcagtattt ggaggaaaac cacttcatcc accgagacat tgctgccaga
aactgcctct 4680tgacctgtcc aggccctgga agagtggcca agattggaga
cttcgggatg gcccgagaca 4740tctacagggc gagctactat agaaagggag
gctgtgccat gctgccagtt aagtggatgc 4800ccccagaggc cttcatggaa
ggaatattca cttctaaaac agacacatgg tcctttggag 4860tgctgctatg
ggaaatcttt tctcttggat atatgccata ccccagcaaa agcaaccagg
4920aagttctgga gtttgtcacc agtggaggcc ggatggaccc acccaagaac
tgccctgggc 4980ctgtataccg gataatgact cagtgctggc aacatcagcc
tgaagacagg cccaactttg 5040ccatcatttt ggagaggatt gaatactgca
cccaggaccc ggatgtaatc aacaccgctt 5100tgccgataga atatggtcca
cttgtggaag aggaagagaa agtgcctgtg aggcccaagg 5160accctgaggg
ggttcctcct ctcctggtct ctcaacaggc aaaacgggag gaggagcgca
5220gcccagctgc cccaccacct ctgcctacca cctcctctgg caaggctgca
aagaaaccca 5280cagctgcaga ggtctctgtt cgagtcccta gagggccggc
cgtggaaggg ggacacgtga 5340atatggcatt ctctcagtcc aaccctcctt
cggagttgca caaggtccac ggatccagaa 5400acaagcccac cagcttgtgg
aacccaacgt acggctcctg gtttacagag aaacccacca 5460aaaagaataa
tcctatagca aagaaggagc cacacgacag gggtaacctg gggctggagg
5520gaagctgtac tgtcccacct aacgttgcaa ctgggagact tccgggggcc
tcactgctcc 5580tagagccctc ttcgctgact gccaatatga aggaggtacc
tctgttcagg ctacgtcact 5640tcccttgtgg gaatgtcaat tacggctacc
agcaacaggg cttgccctta gaagccgcta 5700ctgcccctgg agctggtcat
tacgaggata ccattctgaa aagcaagaat agcatgaacc 5760agcctgggcc
ctgagctcgg tcgcacactc acttctcttc cttgggatcc ctaagaccgt
5820ggaggagaga gaggcaatgg ctccttcaca aaccagagac caaatgtcac
gttttgtttt 5880gtgccaacct attttgaagt accaccaaaa aagctgtatt
ttgaaaatgc tttagaaagg 5940ttttgagcat gggttcatcc tattctttcg
aaagaagaaa atatcataaa aatgagtgat 6000aaatacaagg cccagatgtg
gttgcataag gtttttatgc atgtttgttg tatacttcct 6060tatgcttctt
ttaaattgtg tgtgctctgc ttcaatgtag tcagaattag ctgcttctat
6120gtttcatagt tggggtcata gatgtttcct tgccttgttg atgtggacat
gagccatttg 6180aggggagagg gaacggaaat aaaggagtta tttgtaatga ctaaaa
622621620PRTArtificial SequenceSynthetic Peptide 2Met Gly Ala Ile
Gly Leu Leu Trp Leu Leu Pro Leu Leu Leu Ser Thr1 5 10 15Ala Ala Val
Gly Ser Gly Met Gly Thr Gly Gln Arg Ala Gly Ser Pro 20 25 30Ala Ala
Gly Ser Pro Leu Gln Pro Arg Glu Pro Leu Ser Tyr Ser Arg 35 40 45Leu
Gln Arg Lys Ser Leu Ala Val Asp Phe Val Val Pro Ser Leu Phe 50 55
60Arg Val Tyr Ala Arg Asp Leu Leu Leu Pro Pro Ser Ser Ser Glu Leu65
70 75 80Lys Ala Gly Arg Pro Glu Ala Arg Gly Ser Leu Ala Leu Asp Cys
Ala 85 90 95Pro Leu Leu Arg Leu Leu Gly Pro Ala Pro Gly Val Ser Trp
Thr Ala 100 105 110Gly Ser Pro Ala Pro Ala Glu Ala Arg Thr Leu Ser
Arg Val Leu Lys 115 120 125Gly Gly Ser Val Arg Lys Leu Arg Arg Ala
Lys Gln Leu Val Leu Glu 130 135 140Leu Gly Glu Glu Ala Ile Leu Glu
Gly Cys Val Gly Pro Pro Gly Glu145 150 155 160Ala Ala Val Gly Leu
Leu Gln Phe Asn Leu Ser Glu Leu Phe Ser Trp 165 170 175Trp Ile Arg
Gln Gly Glu Gly Arg Leu Arg Ile Arg Leu Met Pro Glu 180 185 190Lys
Lys Ala Ser Glu Val Gly Arg Glu Gly Arg Leu Ser Ala Ala Ile 195 200
205Arg Ala Ser Gln Pro Arg Leu Leu Phe Gln Ile Phe Gly Thr Gly His
210 215 220Ser Ser Leu Glu Ser Pro Thr Asn Met Pro Ser Pro Ser Pro
Asp Tyr225 230 235 240Phe Thr Trp Asn Leu Thr Trp Ile Met Lys Asp
Ser Phe Pro Phe Leu 245 250 255Ser His Arg Ser Arg Tyr Gly Leu Glu
Cys Ser Phe Asp Phe Pro Cys 260 265 270Glu Leu Glu Tyr Ser Pro Pro
Leu His Asp Leu Arg Asn Gln Ser Trp 275 280 285Ser Trp Arg Arg Ile
Pro Ser Glu Glu Ala Ser Gln Met Asp Leu Leu 290 295 300Asp Gly Pro
Gly Ala Glu Arg Ser Lys Glu Met Pro Arg Gly Ser Phe305 310 315
320Leu Leu Leu Asn Thr Ser Ala Asp Ser Lys His Thr Ile Leu Ser Pro
325 330 335Trp Met Arg Ser Ser Ser Glu His Cys Thr Leu Ala Val Ser
Val His 340 345 350Arg His Leu Gln Pro Ser Gly Arg Tyr Ile Ala Gln
Leu Leu Pro His 355 360 365Asn Glu Ala Ala Arg Glu Ile Leu Leu Met
Pro Thr Pro Gly Lys His 370 375 380Gly Trp Thr Val Leu Gln Gly Arg
Ile Gly Arg Pro Asp Asn Pro Phe385 390 395 400Arg Val Ala Leu Glu
Tyr Ile Ser Ser Gly Asn Arg Ser Leu Ser Ala 405 410 415Val Asp Phe
Phe Ala Leu Lys Asn Cys Ser Glu Gly Thr Ser Pro Gly 420 425 430Ser
Lys Met Ala Leu Gln Ser Ser Phe Thr Cys Trp Asn Gly Thr Val 435 440
445Leu Gln Leu Gly Gln Ala Cys Asp Phe His Gln Asp Cys Ala Gln Gly
450 455 460Glu Asp Glu Ser Gln Met Cys Arg Lys Leu Pro Val Gly Phe
Tyr Cys465 470 475 480Asn Phe Glu Asp Gly Phe Cys Gly Trp Thr Gln
Gly Thr Leu Ser Pro 485 490 495His Thr Pro Gln Trp Gln Val Arg Thr
Leu Lys Asp Ala Arg Phe Gln 500 505 510Asp His Gln Asp His Ala Leu
Leu Leu Ser Thr Thr Asp Val Pro Ala 515 520 525Ser Glu Ser Ala Thr
Val Thr Ser Ala Thr Phe Pro Ala Pro Ile Lys 530 535 540Ser Ser Pro
Cys Glu Leu Arg Met Ser Trp Leu Ile Arg Gly Val Leu545 550 555
560Arg Gly Asn Val Ser Leu Val Leu Val Glu Asn Lys Thr Gly Lys Glu
565 570 575Gln Gly Arg Met Val Trp His Val Ala Ala Tyr Glu Gly Leu
Ser Leu 580 585 590Trp Gln Trp Met Val Leu Pro Leu Leu Asp Val Ser
Asp Arg Phe Trp 595 600 605Leu Gln Met Val Ala Trp Trp Gly Gln Gly
Ser Arg Ala Ile Val Ala 610 615 620Phe Asp Asn Ile Ser Ile Ser Leu
Asp Cys Tyr Leu Thr Ile Ser Gly625 630 635 640Glu Asp Lys Ile Leu
Gln Asn Thr Ala Pro Lys Ser Arg Asn Leu Phe 645 650 655Glu Arg Asn
Pro Asn Lys Glu Leu Lys Pro Gly Glu Asn Ser Pro Arg 660 665 670Gln
Thr Pro Ile Phe Asp Pro Thr Val His Trp Leu Phe Thr Thr Cys 675 680
685Gly Ala Ser Gly Pro His Gly Pro Thr Gln Ala Gln Cys Asn Asn Ala
690 695 700Tyr Gln Asn Ser Asn Leu Ser Val Glu Val Gly Ser Glu Gly
Pro Leu705 710 715 720Lys Gly Ile Gln Ile Trp Lys Val Pro Ala Thr
Asp Thr Tyr Ser Ile 725 730 735Ser Gly Tyr Gly Ala Ala Gly Gly Lys
Gly Gly Lys Asn Thr Met Met 740 745 750Arg Ser His Gly Val Ser Val
Leu Gly Ile Phe Asn Leu Glu Lys Asp 755 760 765Asp Met Leu Tyr Ile
Leu Val Gly Gln Gln Gly Glu Asp Ala Cys Pro 770 775 780Ser Thr Asn
Gln Leu Ile Gln Lys Val Cys Ile Gly Glu Asn Asn Val785 790 795
800Ile Glu Glu Glu Ile Arg Val Asn Arg Ser Val His Glu Trp Ala Gly
805 810 815Gly Gly Gly Gly Gly Gly Gly Ala Thr Tyr Val Phe Lys Met
Lys Asp 820 825 830Gly Val Pro Val Pro Leu Ile Ile Ala Ala Gly Gly
Gly Gly Arg Ala 835 840 845Tyr Gly Ala Lys Thr Asp Thr Phe His Pro
Glu Arg Leu Glu Asn Asn 850 855 860Ser Ser Val Leu Gly Leu Asn Gly
Asn Ser Gly Ala Ala Gly Gly Gly865 870 875 880Gly Gly Trp Asn Asp
Asn Thr Ser Leu Leu Trp Ala Gly Lys Ser Leu 885 890 895Gln Glu Gly
Ala Thr Gly Gly His Ser Cys Pro Gln Ala Met Lys Lys 900 905 910Trp
Gly Trp Glu Thr Arg Gly Gly Phe Gly Gly Gly Gly Gly Gly Cys 915 920
925Ser Ser Gly Gly Gly Gly Gly Gly Tyr Ile Gly Gly Asn Ala Ala Ser
930 935 940Asn Asn Asp Pro Glu Met Asp Gly Glu Asp Gly Val Ser Phe
Ile Ser945 950 955 960Pro Leu Gly Ile Leu Tyr Thr Pro Ala Leu Lys
Val Met Glu Gly His 965 970 975Gly Glu Val Asn Ile Lys His Tyr Leu
Asn Cys Ser His Cys Glu Val 980 985 990Asp Glu Cys His Met Asp Pro
Glu Ser His Lys Val Ile Cys Phe Cys 995 1000 1005Asp His Gly Thr
Val Leu Ala Glu Asp Gly Val Ser Cys Ile Val 1010 1015 1020Ser Pro
Thr Pro Glu Pro His Leu Pro Leu Ser Leu Ile Leu Ser 1025 1030
1035Val Val Thr Ser Ala Leu Val Ala Ala Leu Val Leu Ala Phe Ser
1040 1045 1050Gly Ile Met Ile Val Tyr Arg Arg Lys His Gln Glu Leu
Gln Ala 1055 1060 1065Met Gln Met Glu Leu Gln Ser Pro Glu Tyr Lys
Leu Ser Lys Leu 1070 1075 1080Arg Thr Ser Thr Ile Met Thr Asp Tyr
Asn Pro Asn Tyr Cys Phe 1085 1090 1095Ala Gly Lys Thr Ser Ser Ile
Ser Asp Leu Lys Glu Val Pro Arg 1100 1105 1110Lys Asn Ile Thr Leu
Ile Arg Gly Leu Gly His Gly Ala Phe Gly 1115 1120 1125Glu Val Tyr
Glu Gly Gln Val Ser Gly Met Pro Asn Asp Pro Ser 1130 1135 1140Pro
Leu Gln Val Ala Val Lys Thr Leu Pro Glu Val Cys Ser Glu 1145 1150
1155Gln Asp Glu Leu Asp Phe Leu Met Glu Ala Leu Ile Ile Ser Lys
1160 1165 1170Phe Asn His Gln Asn Ile Val Arg Cys Ile Gly Val Ser
Leu Gln 1175 1180 1185Ser Leu Pro Arg Phe Ile Leu Leu Glu Leu Met
Ala Gly Gly Asp 1190 1195 1200Leu Lys Ser Phe Leu Arg Glu Thr Arg
Pro Arg Pro Ser Gln Pro 1205 1210 1215Ser Ser Leu Ala Met Leu Asp
Leu Leu His Val Ala Arg Asp Ile 1220 1225 1230Ala Cys Gly Cys Gln
Tyr Leu Glu Glu Asn His Phe Ile His Arg 1235 1240 1245Asp Ile Ala
Ala Arg Asn Cys Leu Leu Thr Cys Pro Gly Pro Gly 1250 1255 1260Arg
Val Ala Lys Ile Gly Asp Phe Gly Met Ala Arg Asp Ile Tyr 1265 1270
1275Arg Ala Ser Tyr Tyr Arg Lys Gly Gly Cys Ala Met Leu Pro Val
1280 1285 1290Lys Trp Met Pro Pro Glu Ala Phe Met Glu Gly Ile Phe
Thr Ser 1295 1300 1305Lys Thr Asp Thr Trp Ser Phe Gly Val Leu Leu
Trp Glu Ile Phe 1310 1315 1320Ser Leu Gly Tyr Met Pro Tyr Pro Ser
Lys Ser Asn Gln Glu Val 1325 1330 1335Leu Glu Phe Val Thr Ser Gly
Gly Arg Met Asp Pro Pro Lys Asn 1340 1345 1350Cys Pro Gly Pro Val
Tyr Arg Ile Met Thr Gln Cys Trp Gln His 1355 1360 1365Gln Pro Glu
Asp Arg Pro Asn Phe Ala Ile Ile Leu Glu Arg Ile 1370 1375 1380Glu
Tyr Cys Thr Gln Asp Pro Asp Val Ile Asn Thr Ala Leu Pro 1385 1390
1395Ile Glu Tyr Gly Pro Leu Val Glu Glu Glu Glu Lys Val Pro Val
1400 1405 1410Arg Pro Lys Asp Pro Glu Gly Val Pro Pro Leu Leu Val
Ser Gln 1415
1420 1425Gln Ala Lys Arg Glu Glu Glu Arg Ser Pro Ala Ala Pro Pro
Pro 1430 1435 1440Leu Pro Thr Thr Ser Ser Gly Lys Ala Ala Lys Lys
Pro Thr Ala 1445 1450 1455Ala Glu Val Ser Val Arg Val Pro Arg Gly
Pro Ala Val Glu Gly 1460 1465 1470Gly His Val Asn Met Ala Phe Ser
Gln Ser Asn Pro Pro Ser Glu 1475 1480 1485Leu His Lys Val His Gly
Ser Arg Asn Lys Pro Thr Ser Leu Trp 1490 1495 1500Asn Pro Thr Tyr
Gly Ser Trp Phe Thr Glu Lys Pro Thr Lys Lys 1505 1510 1515Asn Asn
Pro Ile Ala Lys Lys Glu Pro His Asp Arg Gly Asn Leu 1520 1525
1530Gly Leu Glu Gly Ser Cys Thr Val Pro Pro Asn Val Ala Thr Gly
1535 1540 1545Arg Leu Pro Gly Ala Ser Leu Leu Leu Glu Pro Ser Ser
Leu Thr 1550 1555 1560Ala Asn Met Lys Glu Val Pro Leu Phe Arg Leu
Arg His Phe Pro 1565 1570 1575Cys Gly Asn Val Asn Tyr Gly Tyr Gln
Gln Gln Gly Leu Pro Leu 1580 1585 1590Glu Ala Ala Thr Ala Pro Gly
Ala Gly His Tyr Glu Asp Thr Ile 1595 1600 1605Leu Lys Ser Lys Asn
Ser Met Asn Gln Pro Gly Pro 1610 1615 16203277PRTArtificial
SequenceSynthetic Peptide 3Ile Thr Leu Ile Arg Gly Leu Gly His Gly
Ala Phe Gly Glu Val Tyr1 5 10 15Glu Gly Gln Val Ser Gly Met Pro Asn
Asp Pro Ser Pro Leu Gln Val 20 25 30Ala Val Lys Thr Leu Pro Glu Val
Cys Ser Glu Gln Asp Glu Leu Asp 35 40 45Phe Leu Met Glu Ala Leu Ile
Ile Ser Lys Phe Asn His Gln Asn Ile 50 55 60Val Arg Cys Ile Gly Val
Ser Leu Gln Ser Leu Pro Arg Phe Ile Leu65 70 75 80Leu Glu Leu Met
Ala Gly Gly Asp Leu Lys Ser Phe Leu Arg Glu Thr 85 90 95Arg Pro Arg
Pro Ser Gln Pro Ser Ser Leu Ala Met Leu Asp Leu Leu 100 105 110His
Val Ala Arg Asp Ile Ala Cys Gly Cys Gln Tyr Leu Glu Glu Asn 115 120
125His Phe Ile His Arg Asp Ile Ala Ala Arg Asn Cys Leu Leu Thr Cys
130 135 140Pro Gly Pro Gly Arg Val Ala Lys Ile Gly Asp Phe Gly Met
Ala Arg145 150 155 160Asp Ile Tyr Arg Ala Ser Tyr Tyr Arg Lys Gly
Gly Cys Ala Met Leu 165 170 175Pro Val Lys Trp Met Pro Pro Glu Ala
Phe Met Glu Gly Ile Phe Thr 180 185 190Ser Lys Thr Asp Thr Trp Ser
Phe Gly Val Leu Leu Trp Glu Ile Phe 195 200 205Ser Leu Gly Tyr Met
Pro Tyr Pro Ser Lys Ser Asn Gln Glu Val Leu 210 215 220Glu Phe Val
Thr Ser Gly Gly Arg Met Asp Pro Pro Lys Asn Cys Pro225 230 235
240Gly Pro Val Tyr Arg Ile Met Thr Gln Cys Trp Gln His Gln Pro Glu
245 250 255Asp Arg Pro Asn Phe Ala Ile Ile Leu Glu Arg Ile Glu Tyr
Cys Thr 260 265 270Gln Asp Pro Asp Val 2754561PRTArtificial
SequenceSynthetic Peptide 4Arg Arg Lys His Gln Glu Leu Gln Ala Met
Gln Met Glu Leu Gln Ser1 5 10 15Pro Glu Tyr Lys Leu Ser Lys Leu Arg
Thr Ser Thr Ile Met Thr Asp 20 25 30Tyr Asn Pro Asn Tyr Cys Phe Ala
Gly Lys Thr Ser Ser Ile Ser Asp 35 40 45Leu Lys Glu Val Pro Arg Lys
Asn Ile Thr Leu Ile Arg Gly Leu Gly 50 55 60His Gly Ala Phe Gly Glu
Val Tyr Glu Gly Gln Val Ser Gly Met Pro65 70 75 80Asn Asp Pro Ser
Pro Leu Gln Val Ala Val Lys Thr Leu Pro Glu Val 85 90 95Cys Ser Glu
Gln Asp Glu Leu Asp Phe Leu Met Glu Ala Leu Ile Ile 100 105 110Ser
Lys Phe Asn His Gln Asn Ile Val Arg Cys Ile Gly Val Ser Leu 115 120
125Gln Ser Leu Pro Arg Phe Ile Leu Leu Glu Leu Met Ala Gly Gly Asp
130 135 140Leu Lys Ser Phe Leu Arg Glu Thr Arg Pro Arg Pro Ser Gln
Pro Ser145 150 155 160Ser Leu Ala Met Leu Asp Leu Leu His Val Ala
Arg Asp Ile Ala Cys 165 170 175Gly Cys Gln Tyr Leu Glu Glu Asn His
Phe Ile His Arg Asp Ile Ala 180 185 190Ala Arg Asn Cys Leu Leu Thr
Cys Pro Gly Pro Gly Arg Val Ala Lys 195 200 205Ile Gly Asp Phe Gly
Met Ala Arg Asp Ile Tyr Arg Ala Ser Tyr Tyr 210 215 220Arg Lys Gly
Gly Cys Ala Met Leu Pro Val Lys Trp Met Pro Pro Glu225 230 235
240Ala Phe Met Glu Gly Ile Phe Thr Ser Lys Thr Asp Thr Trp Ser Phe
245 250 255Gly Val Leu Leu Trp Glu Ile Phe Ser Leu Gly Tyr Met Pro
Tyr Pro 260 265 270Ser Lys Ser Asn Gln Glu Val Leu Glu Phe Val Thr
Ser Gly Gly Arg 275 280 285Met Asp Pro Pro Lys Asn Cys Pro Gly Pro
Val Tyr Arg Ile Met Thr 290 295 300Gln Cys Trp Gln His Gln Pro Glu
Asp Arg Pro Asn Phe Ala Ile Ile305 310 315 320Leu Glu Arg Ile Glu
Tyr Cys Thr Gln Asp Pro Asp Val Ile Asn Thr 325 330 335Ala Leu Pro
Ile Glu Tyr Gly Pro Leu Val Glu Glu Glu Glu Lys Val 340 345 350Pro
Val Arg Pro Lys Asp Pro Glu Gly Val Pro Pro Leu Leu Val Ser 355 360
365Gln Gln Ala Lys Arg Glu Glu Glu Arg Ser Pro Ala Ala Pro Pro Pro
370 375 380Leu Pro Thr Thr Ser Ser Gly Lys Ala Ala Lys Lys Pro Thr
Ala Ala385 390 395 400Glu Ile Ser Val Arg Val Pro Arg Gly Pro Ala
Val Glu Gly Gly His 405 410 415Val Asn Met Ala Phe Ser Gln Ser Asn
Pro Pro Ser Glu Leu His Lys 420 425 430Val His Gly Ser Arg Asn Lys
Pro Thr Ser Leu Trp Asn Pro Thr Tyr 435 440 445Gly Ser Trp Phe Thr
Glu Lys Pro Thr Lys Lys Asn Asn Pro Ile Ala 450 455 460Lys Lys Glu
Pro His Asp Arg Gly Asn Leu Gly Leu Glu Gly Ser Cys465 470 475
480Thr Val Pro Pro Asn Val Ala Thr Gly Arg Leu Pro Gly Ala Ser Leu
485 490 495Leu Leu Glu Pro Ser Ser Leu Thr Ala Asn Met Lys Glu Val
Pro Leu 500 505 510Phe Arg Leu Arg His Phe Pro Cys Gly Asn Val Asn
Tyr Gly Tyr Gln 515 520 525Gln Gln Gly Leu Pro Leu Glu Ala Ala Thr
Ala Pro Gly Ala Gly His 530 535 540Tyr Glu Asp Thr Ile Leu Lys Ser
Lys Asn Ser Met Asn Gln Pro Gly545 550 555 560Pro54PRTArtificial
SequenceSynthetic Peptide 5Asn Pro Thr Tyr164PRTArtificial
SequenceSynthetic Peptide 6His Tyr Glu Asp1721DNAArtificial
SequenceSynthetic Polynucleotide 7aggagagaaa gagctgcagt g
21824DNAArtificial SequenceSynthetic Polynucleotide 8gctctgaacc
tttccatcat actt 24920DNAArtificial SequenceSynthetic Polynucleotide
9actggtcccc agacaacaag 201024DNAArtificial SequenceSynthetic
Polynucleotide 10ttactctgtc aaattgatgc tgct 241124DNAArtificial
SequenceSynthetic Polynucleotide 11catgaggaaa tccagttcgt cctg
241224DNAArtificial SequenceSynthetic Polynucleotide 12gaggtcttgc
cagcaaagca gtag 241321DNAArtificial SequenceSynthetic
Polynucleotide 13aacgaccact ttgtcaagct c 211423DNAArtificial
SequenceSynthetic Polynucleotide 14ctctcttcct cttgtgctct tgc
2315562PRTArtificial SequenceSynthetic Peptide 15Tyr Arg Arg Lys
His Gln Glu Leu Gln Ala Met Gln Met Glu Leu Gln1 5 10 15Ser Pro Glu
Tyr Lys Leu Ser Lys Leu Arg Thr Ser Thr Ile Met Thr 20 25 30Asp Tyr
Asn Pro Asn Tyr Cys Phe Ala Gly Lys Thr Ser Ser Ile Ser 35 40 45Asp
Leu Lys Glu Val Pro Arg Lys Asn Ile Thr Leu Ile Arg Gly Leu 50 55
60Gly His Gly Ala Phe Gly Glu Val Tyr Glu Gly Gln Val Ser Gly Met65
70 75 80Pro Asn Asp Pro Ser Pro Leu Gln Val Ala Val Lys Thr Leu Pro
Glu 85 90 95Val Cys Ser Glu Gln Asp Glu Leu Asp Phe Leu Met Glu Ala
Leu Ile 100 105 110Ile Ser Lys Phe Asn His Gln Asn Ile Val Arg Cys
Ile Gly Val Ser 115 120 125Leu Gln Ser Leu Pro Arg Phe Ile Leu Leu
Glu Leu Met Ala Gly Gly 130 135 140Asp Leu Lys Ser Phe Leu Arg Glu
Thr Arg Pro Arg Pro Ser Gln Pro145 150 155 160Ser Ser Leu Ala Met
Leu Asp Leu Leu His Val Ala Arg Asp Ile Ala 165 170 175Cys Gly Cys
Gln Tyr Leu Glu Glu Asn His Phe Ile His Arg Asp Ile 180 185 190Ala
Ala Arg Asn Cys Leu Leu Thr Cys Pro Gly Pro Gly Arg Val Ala 195 200
205Lys Ile Gly Asp Phe Gly Met Ala Arg Asp Ile Tyr Arg Ala Ser Tyr
210 215 220Tyr Arg Lys Gly Gly Cys Ala Met Leu Pro Val Lys Trp Met
Pro Pro225 230 235 240Glu Ala Phe Met Glu Gly Ile Phe Thr Ser Lys
Thr Asp Thr Trp Ser 245 250 255Phe Gly Val Leu Leu Trp Glu Ile Phe
Ser Leu Gly Tyr Met Pro Tyr 260 265 270Pro Ser Lys Ser Asn Gln Glu
Val Leu Glu Phe Val Thr Ser Gly Gly 275 280 285Arg Met Asp Pro Pro
Lys Asn Cys Pro Gly Pro Val Tyr Arg Ile Met 290 295 300Thr Gln Cys
Trp Gln His Gln Pro Glu Asp Arg Pro Asn Phe Ala Ile305 310 315
320Ile Leu Glu Arg Ile Glu Tyr Cys Thr Gln Asp Pro Asp Val Ile Asn
325 330 335Thr Ala Leu Pro Ile Glu Tyr Gly Pro Leu Val Glu Glu Glu
Glu Lys 340 345 350Val Pro Val Arg Pro Lys Asp Pro Glu Gly Val Pro
Pro Leu Leu Val 355 360 365Ser Gln Gln Ala Lys Arg Glu Glu Glu Arg
Ser Pro Ala Ala Pro Pro 370 375 380Pro Leu Pro Thr Thr Ser Ser Gly
Lys Ala Ala Lys Lys Pro Thr Ala385 390 395 400Ala Glu Val Ser Val
Arg Val Pro Arg Gly Pro Ala Val Glu Gly Gly 405 410 415His Val Asn
Met Ala Phe Ser Gln Ser Asn Pro Pro Ser Glu Leu His 420 425 430Lys
Val His Gly Ser Arg Asn Lys Pro Thr Ser Leu Trp Asn Pro Thr 435 440
445Tyr Gly Ser Trp Phe Thr Glu Lys Pro Thr Lys Lys Asn Asn Pro Ile
450 455 460Ala Lys Lys Glu Pro His Asp Arg Gly Asn Leu Gly Leu Glu
Gly Ser465 470 475 480Cys Thr Val Pro Pro Asn Val Ala Thr Gly Arg
Leu Pro Gly Ala Ser 485 490 495Leu Leu Leu Glu Pro Ser Ser Leu Thr
Ala Asn Met Lys Glu Val Pro 500 505 510Leu Phe Arg Leu Arg His Phe
Pro Cys Gly Asn Val Asn Tyr Gly Tyr 515 520 525Gln Gln Gln Gly Leu
Pro Leu Glu Ala Ala Thr Ala Pro Gly Ala Gly 530 535 540His Tyr Glu
Asp Thr Ile Leu Lys Ser Lys Asn Ser Met Asn Gln Pro545 550 555
560Gly Pro
* * * * *