U.S. patent application number 17/483364 was filed with the patent office on 2022-01-06 for insecticidal proteins from plants and methods for their use.
This patent application is currently assigned to PIONEER HI-BRED INTERNATIONAL, INC.. The applicant listed for this patent is PIONEER HI-BRED INTERNATIONAL, INC.. Invention is credited to JENNIFER KARA BARRY, CATHERINE J CLARK, RYAN MICHAEL GERBER, AMY LUM, JOHN P MATHIS, AZALEA S ONG, BROOKE PETERSON-BURCH, THOMAS CHAD WOLFE, WEIPING XIE, NASSER YALPANI, XIAOHONG ZHONG.
Application Number | 20220002747 17/483364 |
Document ID | / |
Family ID | 1000005854219 |
Filed Date | 2022-01-06 |
United States Patent
Application |
20220002747 |
Kind Code |
A1 |
BARRY; JENNIFER KARA ; et
al. |
January 6, 2022 |
INSECTICIDAL PROTEINS FROM PLANTS AND METHODS FOR THEIR USE
Abstract
Compositions and methods for controlling pests are provided. The
methods involve transforming organisms with a nucleic acid sequence
encoding an insecticidal protein. In particular, the nucleic acid
sequences are useful for preparing plants and microorganisms that
possess insecticidal activity. Thus, transformed bacteria, plants,
plant cells, plant tissues and seeds are provided. Compositions are
insecticidal nucleic acids and proteins of bacterial species. The
sequences find use in the construction of expression vectors for
subsequent transformation into organisms of interest including
plants, as probes for the isolation of other homologous (or
partially homologous) genes. The pesticidal proteins find use in
controlling, inhibiting growth or killing Lepidopteran,
Coleopteran, Dipteran, fungal, Hemipteran and nematode pest
populations and for producing compositions with insecticidal
activity.
Inventors: |
BARRY; JENNIFER KARA; (AMES,
IA) ; CLARK; CATHERINE J; (ALTOONA, IA) ;
GERBER; RYAN MICHAEL; (APEX, NC) ; LUM; AMY;
(REDWOOD CITY, CA) ; MATHIS; JOHN P; (JOHNSTON,
IA) ; ONG; AZALEA S; (CASTRO VALLEY, CA) ;
PETERSON-BURCH; BROOKE; (ANKENY, IA) ; WOLFE; THOMAS
CHAD; (DES MOINES, IA) ; XIE; WEIPING; (EAST
PALO ALTO, CA) ; YALPANI; NASSER; (KELOWNA, CA)
; ZHONG; XIAOHONG; (SAN LEANDRO, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
PIONEER HI-BRED INTERNATIONAL, INC. |
JOHNSTON |
IA |
US |
|
|
Assignee: |
PIONEER HI-BRED INTERNATIONAL,
INC.
JOHNSTON
IA
|
Family ID: |
1000005854219 |
Appl. No.: |
17/483364 |
Filed: |
September 23, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16311765 |
Dec 20, 2018 |
11155829 |
|
|
PCT/US2017/039376 |
Jun 27, 2017 |
|
|
|
17483364 |
|
|
|
|
62357501 |
Jul 1, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
Y02A 40/146 20180101;
C12N 15/8286 20130101; A01N 63/50 20200101; A01N 37/46 20130101;
C07K 14/415 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; A01N 37/46 20060101 A01N037/46; C07K 14/415 20060101
C07K014/415; A01N 63/50 20060101 A01N063/50 |
Claims
1. (canceled)
2. (canceled)
3. (canceled)
4. (canceled)
5. (canceled)
6. (canceled)
7. (canceled)
8. (canceled)
9. A DNA construct comprising a polynucleotide encoding an
insecticidal polypeptide comprising an amino acid sequence having
at least 70% sequence identity to SEQ ID NO: 38, wherein the
polynucleotide is operably linked to a heterologous regulatory
element.
10. The DNA construct of claim 9, wherein the amino acid sequence
has at least 80% sequence identity to SEQ ID NO: 38.
11. A transgenic plant comprising the DNA construct of claim 9.
12. (canceled)
13. (canceled)
14. A method for controlling pest infestation comprising providing
in the diet of the pest the transgenic plant of claim 11 or a part
thereof.
15. A method for improving the yield of a crop comprising growing
the transgenic plant of claim 11, wherein the yield of the crop is
increased in the presence of an insect pest relative to the crop
not comprising said transgenic plant.
16. The method of claim 14 or 15, wherein the insect pest or pest
population is resistant to at least one Cry insecticidal protein.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. provisional patent
application Ser. No. 62/357,501 filed Jul. 1, 2016, herein
incorporated by reference in its entirety.
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] The official copy of the sequence listing is submitted
electronically via EFS-Web as an ASCII formatted sequence listing
with a file named "6762WOPCT_SequenceListing" created on Jun. 1,
2017, and having a size of 546 kilobytes and is filed concurrently
with the specification. The sequence listing contained in this
ASCII formatted document is part of the specification and is herein
incorporated by reference in its entirety.
FIELD
[0003] This disclosure relates to the field of molecular biology.
Provided are novel genes that encode pesticidal proteins. These
pesticidal proteins and the nucleic acid sequences that encode them
are useful in preparing pesticidal formulations and in the
production of transgenic pest-resistant plants.
BACKGROUND
[0004] Biological control of insect pests of agricultural
significance using a microbial agent, such as fungi, bacteria or
another species of insect affords an environmentally friendly and
commercially attractive alternative to synthetic chemical
pesticides. Generally speaking, the use of biopesticides presents a
lower risk of pollution and environmental hazards and biopesticides
provide greater target specificity than is characteristic of
traditional broad-spectrum chemical insecticides. In addition,
biopesticides often cost less to produce and thus improve economic
yield for a wide variety of crops.
[0005] Certain species of microorganisms of the genus Bacillus are
known to possess pesticidal activity against a range of insect
pests including Lepidoptera, Diptera, Coleoptera, Hemiptera and
others. Bacillus thuringiensis (B) and Bacillus popilliae are among
the most successful biocontrol agents discovered to date. Insect
pathogenicity has also been attributed to strains of B. larvae, B.
lentimorbus, B. sphaericus and B. cereus. Microbial insecticides,
particularly those obtained from Bacillus strains, have played an
important role in agriculture as alternatives to chemical pest
control.
[0006] Crop plants have been developed with enhanced insect
resistance by genetically engineering crop plants to produce
pesticidal proteins from Bacillus. For example, corn and cotton
plants have been genetically engineered to produce pesticidal
proteins isolated from strains of Bacillus thuringiensis. These
genetically engineered crops are now widely used in agriculture and
have provided the farmer with an environmentally friendly
alternative to traditional insect-control methods. While they have
proven to be very successful commercially, these genetically
engineered, insect-resistant crop plants provide resistance to only
a narrow range of the economically important insect pests. In some
cases, insects can develop resistance to different insecticidal
compounds, which raises the need to identify alternative biological
control agents for pest control.
[0007] Accordingly, there remains a need for new pesticidal
proteins with different ranges of insecticidal activity against
insect pests, e.g., insecticidal proteins which are active against
a variety of insects in the order Lepidoptera and the order
Coleoptera including but not limited to insect pests that have
developed resistance to existing insecticides.
SUMMARY
[0008] In one aspect compositions and methods for conferring
pesticidal activity to bacteria, plants, plant cells, tissues and
seeds are provided. Compositions include nucleic acid molecules
encoding sequences for pesticidal and insecticidal polypeptides,
vectors comprising those nucleic acid molecules, and host cells
comprising the vectors. Compositions also include the pesticidal
polypeptide sequences and antibodies to those polypeptides.
Compositions also comprise transformed bacteria, plants, plant
cells, tissues and seeds.
[0009] In another aspect isolated or recombinant nucleic acid
molecules are provided encoding IPD103 polypeptides including amino
acid substitutions, deletions, insertions, and fragments thereof.
Provided are isolated or recombinant nucleic acid molecules capable
of encoding IPD103 polypeptides of SEQ ID NO: 2, SEQ ID NO: 4, SEQ
ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO:
14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ
ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO:
32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38, as well as amino
acid substitutions, deletions, insertions, fragments thereof, and
combinations thereof. Nucleic acid sequences that are complementary
to a nucleic acid sequence of the embodiments or that hybridize to
a sequence of the embodiments are also encompassed. The nucleic
acid sequences can be used in DNA constructs or expression
cassettes for transformation and expression in organisms, including
microorganisms and plants. The nucleotide or amino acid sequences
may be synthetic sequences that have been designed for expression
in an organism including, but not limited to, a microorganism or a
plant.
[0010] In another aspect IPD103 polypeptides are encompassed. Also
provided are isolated or recombinant IPD103 polypeptides of SEQ ID
NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ
ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO:
20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ
ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, and SEQ ID
NO: 38, as well as amino acid substitutions, deletions, insertions,
fragments thereof and combinations thereof.
[0011] In another aspect methods are provided for producing the
polypeptides and for using those polypeptides for controlling or
killing a Lepidopteran, Coleopteran, nematode, fungi, and/or
Dipteran pests. The transgenic plants of the embodiments express
one or more of the pesticidal sequences disclosed herein. In
various embodiments, the transgenic plant further comprises one or
more additional genes for insect resistance, for example, one or
more additional genes for controlling Coleopteran, Lepidopteran,
Hemipteran or nematode pests. It will be understood by one of skill
in the art that the transgenic plant may comprise any gene
imparting an agronomic trait of interest.
[0012] In another aspect methods for detecting the nucleic acids
and polypeptides of the embodiments in a sample are also included.
A kit for detecting the presence of an IPD103 polypeptide or
detecting the presence of a polynucleotide encoding an IPD103
polypeptide in a sample is provided. The kit may be provided along
with all reagents and control samples necessary for carrying out a
method for detecting the intended agent, as well as instructions
for use.
[0013] In another aspect the compositions and methods of the
embodiments are useful for the production of organisms with
enhanced pest resistance or tolerance. These organisms and
compositions comprising the organisms are desirable for
agricultural purposes. The compositions of the embodiments are also
useful for generating altered or improved proteins that have
pesticidal activity or for detecting the presence of IPD103
polypeptides.
BRIEF DESCRIPTION OF THE FIGURES
[0014] FIG. 1A-1B shows an amino acid sequence alignment, using the
ALIGNX.RTM. module of the Vector NTI.RTM. suite, of the IPD103Aa
polypeptide (SEQ ID NO: 2), IPD103Ab polypeptide (SEQ ID NO: 4),
IPD103Ac polypeptide (SEQ ID NO: 6), IPD103Ad polypeptide (SEQ ID
NO: 8), IPD103Ae polypeptide (SEQ ID NO: 10), IPD103Ba polypeptide
(SEQ ID NO: 12), IPD103Bb polypeptide (SEQ ID NO: 14), IPD103Bc
polypeptide (SEQ ID NO: 16), IPD103Bd polypeptide (SEQ ID NO: 18),
IPD103Be polypeptide (SEQ ID NO: 20), IPD103Bf polypeptide (SEQ ID
NO: 22), IPD103Bg polypeptide (SEQ ID NO: 24), IPD103Bh polypeptide
(SEQ ID NO: 26), IPD103Ca polypeptide (SEQ ID NO: 34), IPD103 Da
polypeptide (SEQ ID NO: 38), and IPD103Db polypeptide (SEQ ID NO:
40). The amino acid sequence diversity between the amino acid
sequences is highlighted. Conservative amino acid differences are
indicated by () shading and non-conservative amino acid difference
by () shading. The start site of the truncation variant M20
IPD103Aa polypeptide (SEQ ID NO: 417) of Example 6, is indicated
above the IPD103Aa sequence (SEQ ID NO: 2) by a ".cndot." above
residue 20. The position of residues R10 and R42 where amino acid
substitutions were made Example 16 are indicated above the IPD103Aa
sequence (SEQ ID NO: 2) by a "" above the residue.
[0015] FIG. 2 shows the % leaf damage by CEW, ECB and FAW of
individual transgenic TO maize events from constructs PHP79658,
PHP79559 and PHP79660 expressing the IPD103Aa polypeptide (SEQ ID
NO: 2).
[0016] FIG. 3 shows the Total Corn Ear Feeding (cm.sup.2) by CEW of
individual transgenic TO maize events from constructs PHP79658,
PHP79559 and PHP79660 expressing the IPD103Aa polypeptide (SEQ ID
NO: 2).
[0017] FIG. 4 shows a curve reflecting densitometry values of
in-gel fluorescence, from the SDS-PAGE gel of Example 16, for
homologous competition of 25 nM IPD103Aa.sup.Alexa binding to
Helicoverpa zea (Corn Earworm) BBMVs normalized to the amount bound
in the absence of unlabeled IPD103Aa (SEQ ID NO: 2). The solid line
reflects the best fit of a square logistic equation to the
data.
[0018] FIG. 5 shows a curve reflecting densitometry values of
in-gel fluorescence, from the SDS-PAGE gel of Example 16, for
homologous competition of 25 nM IPD103Aa.sup.a binding to Ostrinia
nubilalis (European Corn Borer) BBMVs normalized to the amount
bound in the absence of unlabeled IPD103Aa (SEQ ID NO: 2). The
solid line reflects the best fit of a square logistic equation to
the data.
DETAILED DESCRIPTION
[0019] It is to be understood that this disclosure is not limited
to the particular methodology, protocols, cell lines, genera, and
reagents described, as such may vary. It is also to be understood
that the terminology used herein is for the purpose of describing
particular embodiments only, and is not intended to limit the scope
of the present disclosure.
[0020] As used herein the singular forms "a", "and", and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a cell" includes a
plurality of such cells and reference to "the protein" includes
reference to one or more proteins and equivalents thereof known to
those skilled in the art, and so forth. All technical and
scientific terms used herein have the same meaning as commonly
understood to one of ordinary skill in the art to which this
disclosure belongs unless clearly indicated otherwise.
[0021] The present disclosure is drawn to compositions and methods
for controlling pests. The methods involve transforming organisms
with nucleic acid sequences encoding IPD103 polypeptides. In
particular, the nucleic acid sequences of the embodiments are
useful for preparing plants and microorganisms that possess
pesticidal activity. Thus, transformed bacteria, plants, plant
cells, plant tissues and seeds are provided. The compositions
include pesticidal nucleic acids and proteins of bacterial species.
The nucleic acid sequences find use in the construction of
expression vectors for subsequent transformation into organisms of
interest, as probes for the isolation of other homologous (or
partially homologous) genes, and for the generation of altered
IPD103 polypeptides by methods known in the art, such as site
directed mutagenesis, domain swapping or DNA shuffling. The IPD103
polypeptides find use in controlling or killing Lepidopteran,
Coleopteran, Dipteran, fungal, Hemipteran and nematode pest
populations and for producing compositions with pesticidal
activity. Insect pests of interest include, but are not limited to,
Lepidoptera species including but not limited to: Corn Earworm,
(CEW) (Helicoverpa zea), European Corn Borer (ECB) (Ostrinia
nubialis), diamond-back moth, e.g., Helicoverpa zea Boddie; soybean
looper, e.g., Pseudoplusia includens Walker; and velvet bean
caterpillar e.g., Anticarsia gemmatalis Hubner and Coleoptera
species including but not limited to Western corn rootworm
(Diabrotica virgifera)--WCRW, Southern corn rootworm (Diabrotica
undecimpunctata howardi)--SCRW, and Northern corn rootworm
(Diabrotica barberi)--NCRW.
[0022] By "pesticidal toxin" or "pesticidal protein" is used herein
to refer to a toxin that has toxic activity against one or more
pests, including, but not limited to, members of the Lepidoptera,
Diptera, Hemiptera and Coleoptera orders or the Nematoda phylum or
a protein that has homology to such a protein. Pesticidal proteins
have been isolated from organisms including, for example, Bacillus
sp., Pseudomonas sp., Photorhabdus sp., Xenorhabdus sp.,
Clostridium bifermentans and Paenibacillus popilliae. Pesticidal
proteins include but are not limited to: insecticidal proteins from
Pseudomonas sp. such as PSEEN3174 (Monalysin; (2011) PLoS Pathogens
7:1-13); from Pseudomonas protegens strain CHAO and Pf-5
(previously fluorescens) (Pechy-Tarr, (2008) Environmental
Microbiology 10:2368-2386; GenBank Accession No. EU400157); from
Pseudomonas taiwanensis (Liu, et al., (2010) J. Agric. Food Chem.,
58:12343-12349) and from Pseudomonas pseudoalcaligenes (Zhang, et
al., (2009) Annals of Microbiology 59:45-50 and Li, et al., (2007)
Plant Cell Tiss. Organ Cult. 89:159-168); insecticidal proteins
from Photorhabdus sp. and Xenorhabdus sp. (Hinchliffe, et al.,
(2010) The Open Toxicology Journal, 3:101-118 and Morgan, et al.,
(2001) Applied and Envir. Micro. 67:2062-2069); U.S. Pat. Nos.
6,048,838, and 6,379,946; a PIP-1 polypeptide of US Patent
Publication US20140007292; an AfIP-1A and/or AfIP-1B polypeptide of
US Patent Publication US20140033361; a PHI-4 polypeptide of US
Patent Publication US20140274885 and US20160040184; a PIP-47
polypeptide of PCT Publication Number WO2015/023846, a PIP-72
polypeptide of PCT Publication Number WO2015/038734; a PtIP-50
polypeptide and a PtIP-65 polypeptide of PCT Publication Number
WO2015/120270; a PtIP-83 polypeptide of PCT Publication Number
WO2015/120276; a PtIP-96 polypeptide of PCT Serial Number
PCT/US15/55502; an IPD079 polypeptide of U.S. Ser. No. 62/201,977;
an IPD082 polypeptide of U.S. Ser. No. 62/269,482, and 6-endotoxins
including, but not limited to, the Cry1, Cry2, Cry3, Cry4, Cry5,
Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14, Cry15,
Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24,
Cry25, Cry26, Cry27, Cry28, Cry29, Cry30, Cry31, Cry32, Cry33,
Cry34, Cry35,Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42,
Cry43, Cry44, Cry45, Cry46, Cry47, Cry49, Cry50, Cry51, Cry52,
Cry53, Cry54, Cry55, Cry56, Cry57, Cry58, Cry59, Cry60, Cry61,
Cry62, Cry63, Cry64, Cry65, Cry66, Cry67, Cry68, Cry69, Cry70,
Cry71, and Cry 72 classes of 6-endotoxin genes and the B.
thuringiensis cytolytic cyt1 and cyt2 genes. Members of these
classes of B. thuringiensis insecticidal proteins well known to one
skilled in the art (see, Crickmore, et al., "Bacillus thuringiensis
toxin nomenclature" (2011), at
lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/which can be accessed
on the world-wide web using the "www" prefix).
[0023] Examples of .delta.-endotoxins also include but are not
limited to Cry1A proteins of U.S. Pat. Nos. 5,880,275 and
7,858,849; a DIG-3 or DIG-11 toxin (N-terminal deletion of
.alpha.-helix 1 and/or .alpha.-helix 2 variants of cry proteins
such as Cry1A, Cry3A) of U.S. Pat. Nos. 8,304,604, 8,304,605 and
8,476,226; Cry1B of U.S. patent application Ser. No. 10/525,318;
Cry1C of U.S. Pat. No. 6,033,874; Cry1F of U.S. Pat. Nos. 5,188,960
and 6,218,188; Cry1A/F chimeras of U.S. Pat. Nos. 7,070,982;
6,962,705 and 6,713,063); a Cry2 protein such as Cry2Ab protein of
U.S. Pat. No. 7,064,249); a Cry3A protein including but not limited
to an engineered hybrid insecticidal protein (eHIP) created by
fusing unique combinations of variable regions and conserved blocks
of at least two different Cry proteins (US Patent Application
Publication Number 2010/0017914); a Cry4 protein; a Cry5 protein; a
Cry6 protein; Cry8 proteins of U.S. Pat. Nos. 7,329,736, 7,449,552,
7,803,943, 7,476,781, 7,105,332, 7,378,499 and 7,462,760; a Cry9
protein such as such as members of the Cry9A, Cry9B, Cry9C, Cry9D,
Cry9E and Cry9F families; a Cry15 protein of Naimov, et al., (2008)
Applied and Environmental Microbiology, 74:7145-7151; a Cry22, a
Cry34Ab1 protein of U.S. Pat. Nos. 6,127,180, 6,624,145 and
6,340,593; a CryET33 and cryET34 protein of U.S. Pat. Nos.
6,248,535, 6,326,351, 6,399,330, 6,949,626, 7,385,107 and
7,504,229; a CryET33 and CryET34 homologs of US Patent Publication
Number 2006/0191034, 2012/0278954, and PCT Publication Number WO
2012/139004; a Cry35Ab1 protein of U.S. Pat. Nos. 6,083,499,
6,548,291 and 6,340,593; a Cry46 protein, a Cry 51 protein, a Cry
binary toxin; a TIC901 or related toxin; TIC807 of US Patent
Application Publication Number 2008/0295207; ET29, ET37, TIC809,
TIC810, TIC812, TIC127, TIC128 of PCT US 2006/033867; AXMI-027,
AXMI-036, and AXMI-038 of U.S. Pat. No. 8,236,757; AXMI-031,
AXMI-039, AXMI-040, AXMI-049 of U.S. Pat. No. 7,923,602; AXMI-018,
AXMI-020 and AXMI-021 of WO 2006/083891; AXMI-010 of WO
2005/038032; AXMI-003 of WO 2005/021585; AXMI-008 of US Patent
Application Publication Number 2004/0250311; AXMI-006 of US Patent
Application Publication Number 2004/0216186; AXMI-007 of US Patent
Application Publication Number 2004/0210965; AXMI-009 of US Patent
Application Number 2004/0210964; AXMI-014 of US Patent Application
Publication Number 2004/0197917; AXMI-004 of US Patent Application
Publication Number 2004/0197916; AXMI-028 and AXMI-029 of WO
2006/119457; AXMI-007, AXMI-008, AXMI-0080rf2, AXMI-009, AXMI-014
and AXMI-004 of WO 2004/074462; AXMI-150 of U.S. Pat. No.
8,084,416; AXMI-205 of US Patent Application Publication Number
2011/0023184; AXMI-011, AXMI-012, AXMI-013, AXMI-015, AXMI-019,
AXMI-044, AXMI-037, AXMI-043, AXMI-033, AXMI-034, AXMI-022,
AXMI-023, AXMI-041, AXMI-063 and AXMI-064 of US Patent Application
Publication Number 2011/0263488; AXMI-R1 and related proteins of US
Patent Application Publication Number 2010/0197592; AXMI221Z,
AXMI222z, AXMI223z, AXMI224z and AXMI225z of WO 2011/103248;
AXMI218, AXMI219, AXMI220, AXMI226, AXMI227, AXMI228, AXMI229,
AXMI230 and AXMI231 of WO 2011/103247; AXMI-115, AXMI-113,
AXMI-005, AXMI-163 and AXMI-184 of U.S. Pat. No. 8,334,431;
AXMI-001, AXMI-002, AXMI-030, AXMI-035 and AXMI-045 of US Patent
Application Publication Number 2010/0298211; AXMI-066 and AXMI-076
of US Patent Application Publication Number 2009/0144852; AXMI128,
AXMI130, AXMI131, AXMI133, AXMI140, AXMI141, AXMI142, AXMI143,
AXMI144, AXMI146, AXMI148, AXMI149, AXMI152, AXMI153, AXMI154,
AXMI155, AXMI156, AXMI157, AXMI158, AXMI162, AXMI165, AXMI166,
AXMI167, AXMI168, AXMI169, AXMI170, AXMI171, AXMI172, AXMI173,
AXMI174, AXMI175, AXMI176, AXMI177, AXMI178, AXMI179, AXMI180,
AXMI181, AXMI182, AXMI185, AXMI186, AXMI187, AXMI188, AXMI189 of
U.S. Pat. No. 8,318,900; AXMI079, AXMI080, AXMI081, AXMI082,
AXMI091, AXMI092, AXMI096, AXMI097, AXMI098, AXMI099, AXMI100,
AXMI101, AXMI102, AXMI103, AXMI104, AXMI107, AXMI108, AXMI109,
AXMI110, AXMI111, AXMI112, AXMI114, AXMI116, AXMI117, AXMI118,
AXMI119, AXMI120, AXMI121, AXMI122, AXMI123, AXMI124, AXMI1257,
AXMI1268, AXMI127, AXMI129, AXMI164, AXMI151, AXMI161, AXMI183,
AXMI132, AXMI138, AXMI137 of US Patent Application Publication
Number 2010/0005543, cry proteins such as Cry1A and Cry3A having
modified proteolytic sites of U.S. Pat. No. 8,319,019; a Cry1Ac,
Cry2Aa and Cry1Ca toxin protein from Bacillus thuringiensis strain
VBTS 2528 of US Patent Application Publication Number 2011/0064710.
The insecticidal activity of Cry proteins is well known to one
skilled in the art (for review, see, van Frannkenhuyzen, (2009) J.
Invert. Path. 101:1-16). The use of Cry proteins as transgenic
plant traits is well known to one skilled in the art and
Cry-transgenic plants including but not limited to plants
expressing Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab, Cry1A.105, Cry1F,
Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A, Cry3Bb1, Cry34Ab1,
Cry35Ab1, Vip3A, mCry3A, Cry9c and CBI-Bt have received regulatory
approval (see, Sanahuja, (2011) Plant Biotech Journal 9283-300 and
the CERA. (2010) GM Crop Database Center for Environmental Risk
Assessment (CERA), ILSI Research Foundation, Washington D.C. at
cera-gmc.org/index.php?action=gm_crop_database which can be
accessed on the world-wide web using the "www" prefix). More than
one pesticidal proteins well known to one skilled in the art can
also be expressed in plants such as Vip3Ab & Cry1Fa
(US2012/0317682); Cry1BE & Cry1F (US2012/0311746); Cry1CA &
Cry1AB (US2012/0311745); Cry1F & CryCa (US2012/0317681); Cry1DA
& Cry1BE (US2012/0331590); Cry1DA & Cry1Fa
(US2012/0331589); Cry1AB & Cry1BE (US2012/0324606); Cry1Fa
& Cry2Aa and Cry1I & Cry1E (US2012/0324605); Cry34Ab/35Ab
and Cry6Aa (US20130167269); Cry34Ab/VCry35Ab & Cry3Aa
(US20130167268); and Cry3A and Cry1Ab or Vip3Aa (US20130116170).
Pesticidal proteins also include insecticidal lipases including
lipid acyl hydrolases of U.S. Pat. No. 7,491,869, and cholesterol
oxidases such as from Streptomyces (Purcell et al. (1993) Biochem
Biophys Res Commun 15:1406-1413). Pesticidal proteins also include
VIP (vegetative insecticidal proteins) toxins of U.S. Pat. Nos.
5,877,012, 6,107,2796,137,033, 7,244,820, 7,615,686, and 8,237,020
and the like. Other VIP proteins are well known to one skilled in
the art (see, lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html
which can be accessed on the world-wide web using the "www"
prefix). Pesticidal proteins also include toxin complex (TC)
proteins, obtainable from organisms such as Xenorhabdus,
Photorhabdus and Paenibacillus (see, U.S. Pat. Nos. 7,491,698 and
8,084,418). Some TC proteins have "stand alone" insecticidal
activity and other TC proteins enhance the activity of the
stand-alone toxins produced by the same given organism. The
toxicity of a "stand-alone" TC protein (from Photorhabdus,
Xenorhabdus or Paenibacillus, for example) can be enhanced by one
or more TC protein "potentiators" derived from a source organism of
a different genus. There are three main types of TC proteins. As
referred to herein, Class A proteins ("Protein A") are stand-alone
toxins. Class B proteins ("Protein B") and Class C proteins
("Protein C") enhance the toxicity of Class A proteins. Examples of
Class A proteins are TcbA, TcdA, XptA1 and XptA2. Examples of Class
B proteins are TcaC, TcdB, XptB1Xb and XptC1Wi. Examples of Class C
proteins are TccC, XptC1Xb and XptB1Wi. Pesticidal proteins also
include spider, snake and scorpion venom proteins. Examples of
spider venom peptides include but not limited to lycotoxin-1
peptides and mutants thereof (U.S. Pat. No. 8,334,366).
[0024] In some embodiments the IPD103 polypeptide includes an amino
acid sequence deduced from the full-length nucleic acid sequence
disclosed herein and amino acid sequences that are shorter than the
full-length sequences, either due to the use of an alternate
downstream start site or due to processing that produces a shorter
protein having pesticidal activity. Processing may occur in the
organism the protein is expressed in or in the pest after ingestion
of the protein.
[0025] Thus, provided herein are novel isolated or recombinant
nucleic acid sequences that confer pesticidal activity. Also
provided are the amino acid sequences of IPD103 polypeptides. The
protein resulting from translation of these IPD103 genes allows
cells to control or kill pests that ingest it.
IPD103 Proteins and Variants and Fragments Thereof
[0026] IPD103 polypeptides are encompassed by the disclosure.
"IPD103 polypeptide" and "IPD103 protein" as used herein
interchangeably refers to a polypeptide having insecticidal
activity including but not limited to insecticidal activity against
one or more insect pests of the Lepidoptera and/or Coleoptera
orders, and is sufficiently homologous to the IPD103Aa polypeptide
of SEQ ID NO: 2. A variety of IPD103 polypeptides are contemplated.
Sources of IPD103 polypeptides or related proteins include fern or
other primitive plant species selected from but not limited to
Athyrium species, Platycerium species, Pteris species, Colysis
species, Nephrolepis species, Polystichium species, Thelypteris
species, Tectaria species, and Davallia species. Alignment of the
amino acid sequences of IPD103 polypeptide homologs (for
example--FIG. 1), allows for the identification of residues that
are highly conserved amongst the natural homologs of this
family.
[0027] In some embodiments the IPD103 polypeptide is derived from a
fem species in the Order Athyriales.
[0028] In some embodiments the IPD103 polypeptide is derived from a
fem species in the Order Athyriales, Family Athyriaceae.
[0029] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Athyriales, Family Athyriaceae, Genus
Athyrium selected from but not limited to Athyrium arisanense,
Athyrium atkinsonii, Athyrium biserrulatum, Athyrium brevifrons,
Athyrium chingianum, Athyrium clarkei, Athyrium clivicola, Athyrium
cryptogrammoides, Athyrium cumingianum, Athyrium cuspidatum,
Athyrium deltoidofrons, Athyrium distentifolium, Athyrium
epirachis, Athyrium eremicola, Athyrium fangii, Athyrium
filix-femina, Athyrium frangulum, Athyrium giraldii, Athyrium
iseanum, Athyrium kirisimaense, Athyrium kuratae, Athyrium
masamunei, Athyrium melanolepis, Athyrium monomachi, Athyrium
multidentatum, Athyrium nakanoi, Athyrium neglectum, Athyrium
nigripes, Athyrium nikkoense, Athyrium niponicum, Athyrium
nyalamense, Athyrium oblitescens, Athyrium otophorum, Athyrium
palustre, Athyrium pinetorum, Athyrium pubicostatum, Athyrium
reflexipinnum, Athyrium rhachidosorum, Athyrium rupestre, Athyrium
scandicinum, Athyrium setuligerum, Athyrium sheareri, Athyrium
silvicola, Athyrium sinense, Athyrium skinneri, Athyrium
spinulosum, Athyrium strigillosum, Athyrium subrigescens, Athyrium
subtriangulare, Athyrium supraspinescens, Athyrium tashiroi,
Athyrium tozanense, Athyrium vidalii, Athyrium viridescentipes,
Athyrium wardii, Athyrium x akiense, Athyrium x hisatsuanum,
Athyrium x tokashikii, Athyrium yokoscense, and Athyrium yui.
[0030] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales.
[0031] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family
Nephrolepidaceae.
[0032] n some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Nephrolepidaceae,
Genus Nephrolepis selected from but not limited to Nephrolepis
abrupta, Nephrolepis acutifolia, Nephrolepis averyi, Nephrolepis
biserrata, Nephrolepis brownii, Nephrolepis copelandi, Nephrolepis
cordifolia, Nephrolepis davalliae, Nephrolepis davallioides,
Nephrolepis dicksonioides, Nephrolepis exaltata, Nephrolepis
falcata, Nephrolepis falciformis, Nephrolepis hippocrepicis,
Nephrolepis launfolia, Nephrolepis lauterbachii, Nephrolepis
medlerae, Nephrolepis obliterata, Nephrolepis pectinata,
Nephrolepis pendula, Nephrolepis pseudobiserrata, Nephrolepis
radicans, Nephrolepis rivulans, and Nephrolepis undulata.
[0033] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Polypodiaceae.
[0034] In some embodiments the IPD103 polypeptide is derived from a
fern species in the order Polypodiales, Family Polypodiaceae, Genus
Platycerium selected from but not limited to Platycerium alcicorne,
Platycerium andinum, Platycerium angolense, Platycerium bifurcatum,
Platycerium coronarium, Platycerium elephantotis, Platycerium
ellisii, Platycerium grande, Platycerium hillii, Platycerium
holttumii, Platycerium madagascanense, Platycerium
quadridichotomum, Platycerium ridleyi, Platycerium stemaria,
Platycerium superbum, Platycerium veitchii, Platycerium wallichii,
Platycerium wandae, Platycerium wilhelminae-reginae, and
Platycerium willinkii.
[0035] In some embodiments the IPD103 polypeptide is derived from a
fern species in the order Polypodiales, Family Polypodiaceae, Genus
Colysis selected from but not limited to Colysis ampla, Colysis
digitata, Colysis diversifolia, Colysis elegans Colysis elliptica,
Colysis flexiloba, Colysis hemionitidea, Colysis hemitoma, Colysis
henryi, Colysis insignis, Colysis intermedia, Colysis leveillei,
Colysis longipes, Colysis pedunculata, Colysis pentaphylla, Colysis
pothifolia, Colysis pteropus, Colysis shintenensis, Colysis
simplicifrons, Colysis triphylla, Colysis wrightii, and Colysis x
shintenensis.
[0036] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Pteridaceae.
[0037] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Pteridaceae, Genus
Pteris selected from but not limited to Pteris actiniopteroides,
Pteris amoena, Pteris angustipinna, Pteris angustipinnula, Pteris
aspericaulis, Pteris austrosinica, Pteris baksaensis, Pteris bella,
Pteris biaurita, Pteris bomiensis, Pteris cadieri, Pteris
changjiangensis, Pteris confertinervia, Pteris crassiuscula, Pteris
cretica, Pteris cryptogrammoides, Pteris dactylina, Pteris
dangiana, Pteris decrescens, Pteris deltodon, Pteris dispar, Pteris
dissitifolia, Pteris ensiformis, Pteris esquirolin, Pteris excelsa,
Pteris fauriei, Pteris finotii, Pteris formosana, Pteris galinopes,
Pteris gracillima, Pteris grevilleana, Pteris guangdongensis,
Pteris guizhouensis, Pteris henryi, Pteris heteromorpha, Pteris
hui, Pteris insignis, Pteris kidoi, Pteris kiuschinensis, Pteris
kiuschiuensis, Pteris laurisilvicola, Pteris libonsis, Pteris
linearis, Pteris longipes, Pteris longipinna, Pteris longipinnula,
Pteris maclurei, Pteris maclurioides, Pteris medogensis, Pteris
morii, Pteris multifida, Pteris nipponica, Pteris obtusiloba,
Pteris occidentali-sinica, Pteris oshimensis, Pteris paucipinnula,
Pteris plumbea, Pteris pseudodactylina, Pteris pseudopellucida,
Pteris puberula, Pteris quadristipitis, Pteris quinquefoliata,
Pteris rufopilosa, Pteris ryukyuensis, Pteris sanduensis, Pteris
scabristipes, Pteris semipinnata, Pteris setulosocostulata, Pteris
shimianensis, Pteris sichuanensis, Pteris sinensis, Pteris
splendida, Pteris stenophylla, Pteris subquinata, Pteris
taiwanensis, Pteris tibetica, Pteris tripartita, Pteris
undulatipinna, Pteris venusta, Pteris viridissima, Pteris vittata,
Pteris wallichiana, Pteris wangiana, Pteris xiaoyingiae, Pteris
xichouensis, and Pteris wulaiensis.
[0038] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Tectariaceae.
[0039] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Tectariaceae, Genus
Tectaria selected from but not limited to Tectaria acerifolia,
Tectaria acrocarpa, Tectaria adenophora, Tectaria aequatoriensis,
Tectaria amblyotis, Tectaria amphiblestra, Tectaria andersonii,
Tectaria angelicifolia, Tectaria angulata, Tectaria antioquiana,
Tectaria athyrioides, Tectaria athyriosora, Tectaria aurita,
Tectaria balansae, Tectaria barberi, Tectana barteri, Tectaria
beccariana, Tectaria blumeana, Tectaria brachiata, Tectaria
brauniana, Tectaria brevilobata, Tectaria brooksii, Tectaria
buchtienii, Tectaria calcarea, Tectaria camerooniana, Tectaria
chattagramica, Tectaria cherasica, Tectaria chimborazensis,
Tectaria chinensis, Tectaria christii, Tectaria christovalensis,
Tectaria cicutaria, Tectana coadunata, Tectana confluens, Tectaria
consimilis, Tectaria cordulata, Tectaria coriandrifolia, Tectaria
craspedocarpa, Tectaria crenata, Tectaria crinigera, Tectaria
croftii, Tectaria curtisii, Tectaria danfuensis, Tectaria
decaryana, Tectaria decastroi, Tectaria decurrens, Tectaria
degeneri, Tectaria dolichosora, Tectana draconoptera, Tectana
dubia, Tectana durvillei, Tectaria ebenina, Tectaria estremerana,
Tectana exaunculata, Tectaria faunei, Tectaria fengii, Tectana
fernandensis, Tectana ferruginea, Tectana filisquamata, Tectaria
fimbriata, Tectaria fissa, Tectaria gaudichaudii, Tectaria
gemmifera, Tectaria godeffroyi, Tectaria grandidentata, Tectaria
griffithii var. singaporeana, Tectana grossedentata, Tectaria
hederifolia, Tectaria hekouensis, Tectaria heracleifolia, Tectaria
herpetocaulos, Tectaria heterocarpa, Tectaria hilocarpa, Tectaria
holttumii, Tectaria hookeri, Tectaria humbertiana, Tectaria
hymenodes, Tectaria hymenophylla, Tectaria impressa, Tectaria
incisa, Tectaria inopinata, Tectaria isomorpha, Tectaria jacobsif,
Tectaria jardini, Tectaria johannis-winkleri, Tectaria keckii,
Tectaria kehdingiana, Tectana kingii, Tectaria kouniensis, Tectana
kweichowensis, Tectaria labrusca, Tectaria lacei, Tectaria laotica,
Tectaria latifolia, Tectaria lawrenceana, Tectaria laxa, Tectaria
leptophylla, Tectaria lifuensis, Tectaria lizarzaburui, Tectaria
lobbii, Tectaria lombokensis, Tectaria macrosora, Tectaria macrota,
Tectaria madagascarica, Tectaria magnifica, Tectana manilensis,
Tectaria marchionica, Tectana media, Tectana melanocaulis, Tectana
melanocauloides, Tectana melanorachis, Tectana menyanthidis,
Tectaria mesodon, Tectaria mexicana, Tectaria microchlamys,
Tectaria microlepis, Tectaria minuta, Tectaria moorei, Tectaria
morlae, Tectaria moussetii, Tectaria murrayi, Tectaria nabirensis,
Tectana nausoriensis, Tectana nebulosa, Tectana nesiotica, Tectaria
nicaraguensis, Tectaria nicotianifolia, Tectaria nitens, Tectaria
novoguineensis, Tectaria organensis, Tectaria palmate, Tectaria
pandurifolia, Tectaria pedata, Tectaria pentagonalis, Tectaria
perdimorpha, Tectaria phaeocaulis, Tectaria pica, Tectaria pilosa,
Tectana plantaginea, Tectana pleiosora, Tectana pleiotoma, Tectaria
poilanei, Tectana polymorpha, Tectaria prolifera, Tectana
pseudosinuata, Tectaria x pteropus-minor, Tectaria pubens, Tectaria
puberula, Tectaria pubescens, Tectaria quinquefida, Tectaria
quitensis, Tectana ramosii, Tectana rara, Tectaria remotipinna,
Tectaria repanda, Tectaria rheophytica, Tectana ngida, Tectaria
rivalis, Tectaria rockii, Tectana rufescens, Tectaria rufovillosa,
Tectaria sagenioides, Tectaria schmutzii, Tectana schultzei,
Tectaria seemannii, Tectaria semibipinnata, Tectana semipinnata,
Tectana seramensis, Tectana siifolia, Tectana simaoensis, Tectaria
simonsii, Tectaria simulans, Tectaria singaporeana, Tectaria
sinuata, Tectaria squamipes, Tectaria stalactica, Tectaria
stearnsii, Tectaria stenosemioides, Tectaria subcaudata, Tectaria
subconfluens, Tectaria subcordata, Tectaria subdigitata, Tectaria
subebenea, Tectaria subrepanda, Tectaria subsageniacea, Tectaria
subtriloba, Tectaria subtnphylla, Tectaria sulitii, Tectaria
suluensis, Tectaria sumatrana, Tectaria tabonensis, Tectaria
taccifolia, Tectaria tahitensis, Tectaria tenenfrons, Tectana
tenuifolia, Tectana teratocarpa, Tectaria ternata, Tectana
transiens, Tectana translucens, Tectana tricuspis, Tectaria
trifida, Tectaria trifoliata, Tectana tnglossa, Tectaria trloba,
Tectana tnmenii, Tectaria trinitensis, Tectaria tripartita,
Tectaria variabilis, Tectaria vasta, Tectaria viellardii, Tectaria
villosa, Tectaria vitiensis, Tectaria vivipara, Tectana waterloti,
Tectaria weberi, Tectaria wightii, Tectana x amesiana, Tectaria x
cynthiae, Tectaria yunnanensis, Tectaria zeylanica, and Tectaria
zollingeri.
[0040] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Davalliaceae.
[0041] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Davalliaceae Genus
Davallia selected from but not limited to Davallia adiantoides,
Davallia amabilis, Davallia assamica, Davallia austrosinica,
Davallia biflora, Davallia boryana, Davallia brachypoda, Davallia
brevisora, Davallia bullata, Davallia bullata, Davallia calvescens,
Davallia calvescens, Davallia canariensis, Davallia chaerophylla,
Davallia chaerophylloide, Davallia chrysanthemifolia, Davallia
clarkei, Davallia cumingii, Davallia cylindrica, Davallia
divaricata, Davallia divaricata, Davallia divaricata var.
orientale, Davallia domingensis, Davallia dubia, Davallia elmeri,
Davallia falcata, Davallia falcinella, Davallia ferulacea, Davallia
flaccida, Davallia formosana, Davallia fumarioides, Davallia
goudotiana, Davallia gracilis, Davallia griffithiana, Davallia
griffithiana, Davallia henryana, Davallia heterophylla, Davallia
hookeriana, Davallia hymenophylloides, Davallia immersa, Davallia
inaequalis var. minor, Davallia jamaicensis, Davallia khasiyana,
Davallia kurzii, Davallia lepida, Davallia lepida, Davallia
macraeana, Davallia magellanica, Davallia mariesii, Davallia
membranulosa, Davallia membranulosa, Davallia millefolium, Davallia
moorei, Davallia multidentata, Davallia nodosa, Davallia
novae-guineae, Davallia orientalis, Davallia parallela, Davallia
parkeri, Davallia parvipinnula, Davallia patens, Davallia
pectinata, Davallia perdurans, Davallia pilosula, Davallia
platylepis, Davallia polypodioides, Davallia polypodioides var.
hispida, Davallia polypodioides var. pilosula, Davallia
pseudocystopteris, Davallia puberula, Davallia pyramidata, Davallia
pyxidata, Davallia repens, Davallia rhomboidea, Davallia
rhomboidea, Davallia rhomboidea, Davallia sinensis, Davallia
sloanei, Davallia solida, Davallia solida, Davallia stipellata,
Davallia strigosa, Davallia strigosa, Davallia strigosa var.
rhomboidea, Davallia subalpina, Davallia subsolida, Davallia
teyermannii, Davallia trangularis, Davallia trpinnata, Davallia
truncata, Davallia tyermanni, Davallia tyermannii, Davallia
uncinella, Davallia urophylla, Davallia vestita, Davallia wilfordii
var. contracta, and Davallia yunnanensis.
[0042] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Dryopteridaceae.
[0043] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Dryopteridaceae,
Genus Polystichum selected from but not limited to Polystichum
acanthophyllum, Polystichum aculeatum, Polystichum acutidens,
Polystichum acutipinnulum, Polystichum adungense, Polystichum
alcicome, Polystichum altum, Polystichum anomalum, Polystichum
ariticulatipilosum, Polystichum assurgentipinnum, Polystichum
atkinsonii, Polystichum attenuatum, Polystichum auriculum,
Polystichum bakerianum, Polystichum baoxingense, Polystichum
biaristatum, Polystichum bifidum, Polystichum bigemmatum,
Polystichum bissectum, Polystichum bomiense, Polystichum
brachypterum, Polystichum braunii, Polystichum capillipes,
Polystichum castaneum, Polystichum chingiae, Polystichum christii,
Polystichum chunii, Polystichum consimile, Polystichum
costularisorum, Polystichum craspedosorum, Polystichum
crassinervium, Polystichum cringerum, Polystichum cuneatiforme,
Polystichum cyclolobum, Polystichum daguanense, Polystichum dangii,
Polystichum delavayi, Polystichum deltodon, Polystichum dielsii,
Polystichum diffundens, Polystichum discretum, Polystichum
disjunctum, Polystichum duthiei, Polystichum elevatovenusum,
Polystichum erosum, Polystichum exauriforme, Polystichum excellens,
Polystichum excelsius, Polystichum fimbriatum, Polystichum
formosanum, Polystichum frigidicola, Polystichum fugongense,
Polystichum gongboense, Polystichum grandifrons, Polystichum
guangxiense, Polystichum gymnocarpium, Polystichum habaense,
Polystichum hancockii, Polystichum hecatopteron, Polystichum
herbaceum, Polystichum houchangense, Polystichum huae, Polystichum
ichangense, Polystichum inaense, Polystichum incisopinnulum,
Polystichum integrilimbum, Polystichum integrilobum, Polystichum
jinfoshaense, Polystichum jiulaodongense, Polystichum
jizhushanense, Polystichum kangdingense, Polystichum kungianum,
Polystichum kwangtungense, Polystichum lachenense, Polystichum
lanceolatum, Polystichum langchungense, Polystichum latilepis,
Polystichum lentum, Polystichum leveillei, Polystichum liui,
Polystichum lonchitis, Polystichum longiaristatum, Polystichum
longidens, Polystichum longipaleatum, Polystichum longipes,
Polystichum longipinnulum, Polystichum longispinosum, Polystichum
longissimum, Polystichum macrochlaenum, Polystichum makinoi,
Polystichum manmeiense, Polystichum martinii, Polystichum
mayebarae, Polystichum medogense, Polystichum mehrae, Polystichum
meiguense, Polystichum melanostipes, Polystichum mollissimum,
Polystichum morii, Polystichum moupinense, Polystichum muscicola,
Polystichum nayongense, Polystichum neoliufi, Polystichum
neolobatum, Polystichum nepalense, Polystichum nigrum, Polystichum
ningshenense, Polystichum nudisorum, Polystichum obliquum,
Polystichum oblongum, Polystichum oligocarpum, Polystichum
omeiense, Polystichum oreodoxa, Polystichum orientalitibeticum,
Polystichum otophorum, Polystichum ovato-paleaceum, Polystichum
paramoupinense, Polystichum parvifoliolatum, Polystichum
parvipinnulum, Polystichum pianmaense, Polystichum piceo-paleaceum,
Polystichum polyblepharum, Polystichum prescottianum, Polystichum
prionolepis, Polystichum pseudocastaneum, Polystichum
pseudolanceolatum, Polystichum pseudomakinoi, Polystichum
pseudorhomboideum, Polystichum pseudosetosum, Polystichum
pseudoxiphophyllum, Polystichum punctiferum, Polystichum puteicola,
Polystichum pycnopterum, Polystichum qamdoense, Polystichum
retrosopaleaceum, Polystichum revolutum, Polystichum rhombiforme,
Polystichum rigens, Polystichum robustum, Polystichum
rufopaleaceum, Polystichum saxicola, Polystichum semifertile,
Polystichum setillosum, Polystichum shandongense, Polystichum
shensiense, Polystichum shimurae, Polystichum simplicipinnum,
Polystichum sinense, Polystichum sinotsus-simense, Polystichum
sozanense, Polystichum speluncicola, Polystichum squarrosum,
Polystichum stenophyllum, Polystichum stimulans, Polystichum
subacutidens, Polystichum subdeltodon, Polystichum subfimbriatum,
Polystichum submarginale, Polystichum submite, Polystichum
subulatum, Polystichum tacticopterum, Polystichum taizhongense,
Polystichum tangmaiense, Polystichum thomsonii, Polystichum
tibeticum, Polystichum tonkinense, Polystichum tripteron,
Polystichum tsingkanshanense, Polystichum tsus-simense, Polystichum
wattii, Polystichum xiphophyllum, Polystichum yadongense,
Polystichum yuanum, Polystichum yunnanense, and Polystichum
zayuense.
[0044] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family
Thelypteridaceae.
[0045] In some embodiments the IPD103 polypeptide is derived from a
fern species in the Order Polypodiales, Family Thelypteridaceae,
Genus Thelypteris selected from but not limited to Thelypteris
abrupta, Thelypteris acuminata, Thelypteris affinis, Thelypteris
angulariloba, Thelypteris angustifrons, Thelypteris aurita,
Thelypteris beddomei, Thelypteris boninensis, Thelypteris
bukoensis, Thelypteris castanea, Thelypteris clypeolutata,
Thelypteris consanguinea, Thelypteris cystopteroides, Thelypteris
dayi, Thelypteris erubescens, Thelypteris esquirolin, Thelypteris
flexilis, Thelypteris gemmulifera, Thelypteris glandulosa,
Thelypteris globulifera, Thelypteris gracilescens, Thelypteris
gracilis, Thelypteris interrupta, Thelypteris jaculosa, Thelypteris
japonica, Thelypteris laxa, Thelypteris linkiana, Thelypteris
liukiuensis, Thelypteris longissima, Thelypteris meniscioides,
Thelypteris miyagii, Thelypteris musashiensis, Thelypteris
navarrensis, Thelypteris nevadensis, Thelypteris nipponica,
Thelypteris ogasawarensis, Thelypteris oligocarpa, Thelypteris
omeiensis, Thelypteris opulenta, Thelypteris ovata, Thelypteris
palustris, Thelypteris parasitica, Thelypteris poiteana,
Thelypteris reticulata, Thelypteris rustica, Thelypteris seemannii,
Thelypteris sp. b1-007, Thelypteris sp. Janssen 2679, Thelypteris
subaurita, Thelypteris taiwanensis, Thelypteris truncata,
Thelypteris tylodes, Thelypteris uraiensis, and Thelypteris
viridifrons.
[0046] "Sufficiently homologous" is used herein to refer to an
amino acid sequence that has at least about 40%, 45%, 50%, 51%,
52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%,
65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,
78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence
homology compared to a reference sequence using one of the
alignment programs described herein using standard parameters. In
some embodiments the sequence homology is against the full length
sequence of an IPD103 polypeptide. In some embodiments the IPD103
polypeptide has at least about 40%, 45%, 50%, 51%, 52%, 53%, 54%,
55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,
68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%,
81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity compared
to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID
NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18,
SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID
NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36
or SEQ ID NO: 38. The term "about" when used herein in context with
percent sequence identity means +/-0.5%. One of skill in the art
will recognize that these values can be appropriately adjusted to
determine corresponding homology of proteins taking into account
amino acid similarity and the like. In some embodiments the
sequence identity is calculated using ClustalW algorithm in the
ALIGNX.RTM. module of the Vector NTI.RTM. Program Suite (Invitrogen
Corporation, Carlsbad, Calif.) with all default parameters. In some
embodiments the sequence identity is across the entire length of
polypeptide calculated using ClustalW algorithm in the ALIGNX.RTM.
module of the Vector NTI.RTM. Program Suite (Invitrogen
Corporation, Carlsbad, Calif.) with all default parameters.
[0047] As used herein, the terms "protein," "peptide molecule," or
"polypeptide" includes any molecule that comprises five or more
amino acids. It is well known in the art that protein, peptide or
polypeptide molecules may undergo modification, including
post-translational modifications, such as, but not limited to,
disulfide bond formation, glycosylation, phosphorylation or
oligomerization. Thus, as used herein, the terms "protein,"
"peptide molecule" or "polypeptide" includes any protein that is
modified by any biological or non-biological process. The terms
"amino acid" and "amino acids" refer to all naturally occurring
L-amino acids.
[0048] A "recombinant protein" is used herein to refer to a protein
that is no longer in its natural environment, for example in vitro
or in a recombinant bacterial or plant host cell. An IPD103
polypeptide that is substantially free of cellular material
includes preparations of protein having less than about 30%, 20%,
10% or 5% (by dry weight) of non-pesticidal protein (also referred
to herein as a "contaminating protein").
[0049] "Fragments" or "biologically active portions" include
polypeptide fragments comprising amino acid sequences sufficiently
identical to an IPD103 polypeptide and that exhibit insecticidal
activity. "Fragments" or "biologically active portions" of IPD103
polypeptides includes fragments comprising amino acid sequences
sufficiently identical to the amino acid sequence set forth in
IPD103 polypeptides of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6,
SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID
NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24,
SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID
NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38 wherein the IPD103
polypeptide has insecticidal activity. Such biologically active
portions can be prepared by recombinant techniques and evaluated
for insecticidal activity. In some embodiments, the IPD103
polypeptide fragment is an N-terminal and/or a C-terminal
truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31 or more amino acids from the N-terminus and/or C-terminus
relative to IPD103 polypeptides of SEQ ID NO: 2, SEQ ID NO: 4, SEQ
ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO:
14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ
ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO:
32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38, e.g., by
proteolysis, by insertion of a start codon, by deletion of the
codons encoding the deleted amino acids and concomitant insertion
of a start codon, and/or insertion of a stop codon. In some
embodiments, the IPD103 polypeptide fragment is an N-terminal
truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 amino acids from the
N-terminus of IPD103 polypeptides of SEQ ID NO: 2, SEQ ID NO: 4,
SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID
NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22,
SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID
NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38. In some
embodiments, the IPD103 polypeptide fragment is an N-terminal
and/or a C-terminal truncation of at least 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30, 31, 32, 33, 34 or more amino acids from the
N-terminus and/or C-terminus relative to IPD103 polypeptides of SEQ
ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10,
SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID
NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28,
SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ
ID NO: 38. In some embodiments the truncated variant is the
polypeptide of SEQ ID NO: 445.
[0050] "Variants" as used herein refers to proteins or polypeptides
having an amino acid sequence that is at least about 50%, 55%, 60%,
65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater
identical to the parental amino acid sequence.
[0051] In some embodiments an IPD103 polypeptide comprises an amino
acid sequence having at least about 40%, 45%, 50%, 51%, 52%, 53%,
54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%,
67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%,
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity to the amino
acid sequence of IPD103 polypeptides of SEQ ID NO: 2, SEQ ID NO: 4,
SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID
NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22,
SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID
NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38, wherein the
IPD103 polypeptide has insecticidal activity.
[0052] In some embodiments an IPD103 polypeptide comprises an amino
acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% or greater identity across the entire length of the amino acid
sequence of the IPD103 polypeptide of SEQ ID NO: 2, SEQ ID NO: 4,
SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID
NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22,
SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID
NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38.
[0053] In some embodiments the sequence identity is across the
entire length of the polypeptide calculated using ClustalW
algorithm in the ALIGNX.RTM. module of the Vector NTI.RTM. Program
Suite (Invitrogen Corporation, Carlsbad, Calif.) with all default
parameters.
[0054] In some embodiments the IPD103 polypeptide comprises an
amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%,
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or greater identity across the entire length of the amino
acid sequence of SEQ ID NO: 2.
[0055] In some embodiments an IPD103 polypeptide comprises an amino
acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID
NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16,
SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID
NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34,
SEQ ID NO: 36 or SEQ ID NO: 38, having 1, 2, 3, 4, 5, 6, 7, 8, 9,
1011, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35 or more amino acid
substitutions, deletions and/or insertions compared to the native
amino acid at the corresponding position of IPD103 polypeptides of
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO:
10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ
ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO:
28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, and
SEQ ID NO: 38.
[0056] In some embodiments an IPD103 polypeptide variant comprises
any one or more active amino acid substitutions of Table 5 and/or
7.
[0057] Methods for such manipulations are generally known in the
art. For example, amino acid sequence variants of an IPD103
polypeptide can be prepared by mutations in the DNA. This may also
be accomplished by one of several forms of mutagenesis and/or in
directed evolution. In some aspects, the changes encoded in the
amino acid sequence will not substantially affect the function of
the protein. Such variants will possess the desired pesticidal
activity. However, it is understood that the ability of an IPD103
polypeptide to confer pesticidal activity may be improved by the
use of such techniques upon the compositions of this
disclosure.
[0058] For example, conservative amino acid substitutions may be
made at one or more predicted nonessential amino acid residues. A
"nonessential" amino acid residue is a residue that can be altered
from the wild-type sequence of an IPD103 polypeptide without
altering the biological activity. Nonessential amino acid residues
can be identified by aligning related IPD103 homologs such as is
shown in FIG. 1. A "conservative amino acid substitution" is one in
which the amino acid residue is replaced with an amino acid residue
having a similar side chain. Families of amino acid residues having
similar side chains have been defined in the art. These families
include: amino acids with basic side chains (e.g., lysine,
arginine, histidine); acidic side chains (e.g., aspartic acid,
glutamic acid); polar, negatively charged residues and their amides
(e.g., aspartic acid, asparagine, glutamic, acid, glutamine;
uncharged polar side chains (e.g., glycine, asparagine, glutamine,
serine, threonine, tyrosine, cysteine); small aliphatic, nonpolar
or slightly polar residues (e.g., Alanine, serine, threonine,
proline, glycine); nonpolar side chains (e.g., alanine, valine,
leucine, isoleucine, proline, phenylalanine, methionine,
tryptophan); large aliphatic, nonpolar residues (e.g., methionine,
leucine, isoleucine, valine, cystine); beta-branched side chains
(e.g., threonine, valine, isoleucine); aromatic side chains (e.g.,
tyrosine, phenylalanine, tryptophan, histidine); large aromatic
side chains (e.g., tyrosine, phenylalanine, tryptophan).
[0059] Amino acid substitutions may be made in nonconserved regions
that retain function. In general, such substitutions would not be
made for conserved amino acid residues or for amino acid residues
residing within a conserved motif, where such residues are
essential for protein activity. Examples of residues that are
conserved and that may be essential for protein activity include,
for example, residues that are identical between all proteins
contained in an alignment of similar or related toxins to the
sequences of the embodiments (e.g., residues that are identical in
an alignment of homologous proteins). Examples of residues that are
conserved but that may allow conservative amino acid substitutions
and still retain activity include, for example, residues that have
only conservative substitutions between all proteins contained in
an alignment of similar or related toxins to the sequences of the
embodiments (e.g., residues that have only conservative
substitutions between all proteins contained in the alignment
homologous proteins). However, one of skill in the art would
understand that functional variants may have minor conserved or
nonconserved alterations in the conserved residues. Guidance as to
appropriate amino acid substitutions that do not affect biological
activity of the protein of interest may be found in the model of
Dayhoff, et al., (1978) Atlas of Protein Sequence and Structure
(Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated
by reference.
[0060] In making such changes, the hydropathic index of amino acids
may be considered. The importance of the hydropathic amino acid
index in conferring interactive biologic function on a protein is
generally understood in the art (Kyte and Doolittle, (1982) J Mol
Biol. 157(1):105-32). It is accepted that the relative hydropathic
character of the amino acid contributes to the secondary structure
of the resultant protein, which in turn defines the interaction of
the protein with other molecules, for example, enzymes, substrates,
receptors, DNA, antibodies, antigens, and the like.
[0061] It is known in the art that certain amino acids may be
substituted by other amino acids having a similar hydropathic index
or score and still result in a protein with similar biological
activity, i.e., still obtain a biological functionally equivalent
protein. Each amino acid has been assigned a hydropathic index on
the basis of its hydrophobicity and charge characteristics (Kyte
and Doolittle, ibid). These are: isoleucine (+4.5); valine (+4.2);
leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5);
methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine
(-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline
(-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5); asparagine (-3.5); lysine (-3.9) and arginine
(-4.5). In making such changes, the substitution of amino acids
whose hydropathic indices are within +2 is preferred, those which
are within +1 are particularly preferred, and those within +0.5 are
even more particularly preferred.
[0062] It is also understood in the art that the substitution of
like amino acids can be made effectively on the basis of
hydrophilicity. U.S. Pat. No. 4,554,101, states that the greatest
local average hydrophilicity of a protein, as governed by the
hydrophilicity of its adjacent amino acids, correlates with a
biological property of the protein.
[0063] As detailed in U.S. Pat. No. 4,554,101, the following
hydrophilicity values have been assigned to amino acid residues:
arginine (+3.0); lysine (+3.0); aspartate (+3.0.+0.1); glutamate
(+3.0.+0.1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0); threonine (-0.4); proline (-0.5.+0.1); alanine (-0.5);
histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine
(-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3);
phenylalanine (-2.5); tryptophan (-3.4).
[0064] Alternatively, alterations may be made to the protein
sequence of many proteins at the amino or carboxy terminus without
substantially affecting activity. This can include insertions,
deletions or alterations introduced by modern molecular methods,
such as PCR, including PCR amplifications that alter or extend the
protein coding sequence by virtue of inclusion of amino acid
encoding sequences in the oligonucleotides utilized in the PCR
amplification. Alternatively, the protein sequences added can
include entire protein-coding sequences, such as those used
commonly in the art to generate protein fusions. Such fusion
proteins are often used to (1) increase expression of a protein of
interest (2) introduce a binding domain, enzymatic activity or
epitope to facilitate either protein purification, protein
detection or other experimental uses known in the art (3) target
secretion or translation of a protein to a subcellular organelle,
such as the periplasmic space of Gram-negative bacteria,
mitochondria or chloroplasts of plants or the endoplasmic reticulum
of eukaryotic cells, the latter of which often results in
glycosylation of the protein.
[0065] Variant nucleotide and amino acid sequences of the
disclosure also encompass sequences derived from mutagenic and
recombinogenic procedures such as DNA shuffling. With such a
procedure, one or more different IPD103 polypeptide coding regions
can be used to create a new IPD103 polypeptide possessing the
desired properties. In this manner, libraries of recombinant
polynucleotides are generated from a population of related sequence
polynucleotides comprising sequence regions that have substantial
sequence identity and can be homologously recombined in vitro or in
vivo. For example, using this approach, sequence motifs encoding a
domain of interest may be shuffled between a pesticidal gene and
other known pesticidal genes to obtain a new gene coding for a
protein with an improved property of interest, such as an increased
insecticidal activity. Strategies for such DNA shuffling are known
in the art. See, for example, Stemmer, (1994) Proc. Natl. Acad.
Sci. USA 91:10747-10751; Stemmer, (1994) Nature 370:389-391;
Crameri, et al., (1997) Nature Biotech. 15:436-438; Moore, et al.,
(1997) J. Mol. Biol. 272:336-347; Zhang, et al., (1997) Proc. Natl.
Acad. Sci. USA 94:4504-4509; Crameri, et al., (1998) Nature
391:288-291; and U.S. Pat. Nos. 5,605,793 and 5,837,458.
[0066] Domain swapping or shuffling is another mechanism for
generating altered IPD103 polypeptides. Domains may be swapped
between IPD103 polypeptides resulting in hybrid or chimeric toxins
with improved insecticidal activity or target spectrum. Methods for
generating recombinant proteins and testing them for pesticidal
activity are well known in the art (see, for example, Naimov, et
al., (2001) Appl. Environ. Microbiol. 67:5328-5330; de Maagd, et
al., (1996) Appl. Environ. Microbiol. 62:1537-1543; Ge, et al.,
(1991) J. Biol. Chem. 266:17954-17958; Schnepf, et al., (1990) J.
Biol. Chem. 265:20923-20930; Rang, et al., 91999) Appl. Environ.
Microbiol. 65:2918-2925).
[0067] Phylogenetic, sequence motif, and structural analyses of
insecticidal protein families. A sequence and structure analysis
method can be employed, which is composed of four components:
phylogenetic tree construction, protein sequence motifs finding,
secondary structure prediction, and alignment of protein sequences
and secondary structures. Details about each component are
illustrated below.
[0068] 1) Phylogenetic Tree Construction
[0069] The phylogenetic analysis can be performed using the
software MEGA5. Protein sequences can be subjected to ClustalW
version 2 analysis (Larkin M. A et al (2007) Bioinformatics 23(21):
2947-2948) for multiple sequence alignment. The evolutionary
history is then inferred by the Maximum Likelihood method based on
the JTT matrix-based model. The tree with the highest log
likelihood is obtained, exported in Newick format, and further
processed to extract the sequence IDs in the same order as they
appeared in the tree. A few clades representing sub-families can be
manually identified for each insecticidal protein family.
[0070] 2) Protein Sequence Motifs Finding
[0071] Protein sequences are re-ordered according to the
phylogenetic tree built previously, and fed to the MOTIF analysis
tool MEME (Multiple EM for MOTIF Elicitation) (Bailey T. L., and
Elkan C., Proceedings of the Second International Conference on
Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press,
Menlo Park, Calif., 1994.) for identification of key sequence
motifs. MEME is setup as follows: Minimum number of sites 2,
Minimum motif width 5, and Maximum number of motifs 30. Sequence
motifs unique to each sub-family were identified by visual
observation. The distribution of MOTIFs across the entire gene
family could be visualized in HTML webpage. The MOTIFs are numbered
relative to the ranking of the E-value for each MOTIF.
[0072] 3) Secondary Structure Prediction
[0073] PSIPRED, top ranked secondary structure prediction method
(Jones D T. (1999) J. Mol. Biol. 292: 195-202), can be used for
protein secondary structure prediction. The tool provides accurate
structure prediction using two feed-forward neural networks based
on the PSI-BLAST output. The PSI-BLAST database is created by
removing low-complexity, transmembrane, and coiled-coil regions in
Uniref100. The PSIPRED results contain the predicted secondary
structures (Alpha helix: H, Beta strand: E, and Coil: C) and the
corresponding confidence scores for each amino acid in a given
protein sequence.
[0074] 4) Alignment of Protein Sequences and Secondary
Structures
[0075] A script can be developed to generate gapped secondary
structure alignment according to the multiple protein sequence
alignment from step 1 for all proteins. All aligned protein
sequences and structures are concatenated into a single FASTA file,
and then imported into MEGA for visualization and identification of
conserved structures.
[0076] In some embodiments the IPD103 polypeptide has a modified
physical property. As used herein, the term "physical property"
refers to any parameter suitable for describing the
physical-chemical characteristics of a protein. As used herein,
"physical property of interest" and "property of interest" are used
interchangeably to refer to physical properties of proteins that
are being investigated and/or modified. Examples of physical
properties include, but are not limited to, net surface charge and
charge distribution on the protein surface, net hydrophobicity and
hydrophobic residue distribution on the protein surface, surface
charge density, surface hydrophobicity density, total count of
surface ionizable groups, surface tension, protein size and its
distribution in solution, melting temperature, heat capacity, and
second virial coefficient. Examples of physical properties also
include, IPD103 polypeptide having increased expression, increased
solubility, decreased phytotoxicity, and digestibility of
proteolytic fragments in an insect gut. Models for digestion by
simulated gastric fluids are known to one skilled in the art
(Fuchs, R. L. and J. D. Astwood. Food Technology 50: 83-88, 1996;
Astwood, J. D., et al Nature Biotechnology 14: 1269-1273, 1996; Fu
T J et al J. Agric Food Chem. 50: 7154-7160, 2002).
[0077] In some embodiments variants include polypeptides that
differ in amino acid sequence due to mutagenesis. Variant proteins
encompassed by the disclosure are biologically active, that is they
continue to possess the desired biological activity (i.e.
pesticidal activity) of the native protein. In some embodiment the
variant will have at least about 10%, at least about 30%, at least
about 50%, at least about 70%, at least about 80% or more of the
insecticidal activity of the native protein. In some embodiments,
the variants may have improved activity over the native
protein.
[0078] Bacterial genes quite often possess multiple methionine
initiation codons in proximity to the start of the open reading
frame. Often, translation initiation at one or more of these start
codons will lead to generation of a functional protein. These start
codons can include ATG codons. However, bacteria such as Bacillus
sp. also recognize the codon GTG as a start codon, and proteins
that initiate translation at GTG codons contain a methionine at the
first amino acid. On rare occasions, translation in bacterial
systems can initiate at a TTG codon, though in this event the TTG
encodes a methionine. Furthermore, it is not often determined a
priori which of these codons are used naturally in the bacterium.
Thus, it is understood that use of one of the alternate methionine
codons may also lead to generation of pesticidal proteins. These
pesticidal proteins are encompassed in the present disclosure and
may be used in the methods of the present disclosure. It will be
understood that, when expressed in plants, it will be necessary to
alter the alternate start codon to ATG for proper translation.
[0079] One skilled in the art understands that the polynucleotide
coding sequence can be modified to add a codon at the penultimate
position following the methionine start codon to create a
restriction enzyme site for recombinant cloning purposes and/or for
expression purposes. In some embodiments the IPD103 polypeptide
further comprises an alanine residue at the penultimate position
after the translation initiator methionine.
[0080] In some embodiments the translation initiator methionine of
the IPD103 polypeptide is cleaved off post translationally. One
skilled in the art understands that the N-terminal translation
initiator methionine can be removed by methionine aminopeptidase in
many cellular expression systems.
[0081] In some embodiments the IPD103 polypeptide comprises the
amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6,
SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID
NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24,
SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID
NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38.
[0082] In some embodiments the IPD103 polypeptide comprises the
amino acid sequence of SEQ ID NO: 229, SEQ ID NO: 230, SEQ ID NO:
231, SEQ ID NO: 232, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO:
235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO:
239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO:
243, SEQ ID NO: 244, SEQ ID NO: 245, SEQ ID NO: 246, SEQ ID NO:
247, SEQ ID NO: 248, SEQ ID NO: 249, SEQ ID NO: 250, SEQ ID NO:
251, SEQ ID NO: 252, SEQ ID NO: 253, SEQ ID NO: 254, SEQ ID NO:
255, SEQ ID NO: 256, SEQ ID NO: 257, SEQ ID NO: 258, SEQ ID NO:
259, SEQ ID NO: 260, SEQ ID NO: 261, SEQ ID NO: 262, SEQ ID NO:
263, SEQ ID NO: 264, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO:
267, SEQ ID NO: 268, SEQ ID NO: 269, SEQ ID NO: 270, SEQ ID NO:
271, SEQ ID NO: 272, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO:
275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO:
279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO:
283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO:
287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO:
291, SEQ ID NO: 292, SEQ ID NO: 293, SEQ ID NO: 294, SEQ ID NO:
295, SEQ ID NO: 296, SEQ ID NO: 297, SEQ ID NO: 298, SEQ ID NO:
299, SEQ ID NO: 300, SEQ ID NO: 301, SEQ ID NO: 302, SEQ ID NO:
303, SEQ ID NO: 304, SEQ ID NO: 305, SEQ ID NO: 306, SEQ ID NO:
307, SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO: 310, SEQ ID NO:
311, SEQ ID NO: 312, SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO:
315, SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318, SEQ ID NO:
319, SEQ ID NO: 320, SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO:
323, SEQ ID NO: 324, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO:
327, SEQ ID NO: 328, SEQ ID NO: 329, SEQ ID NO: 330, SEQ ID NO:
331, SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, SEQ ID NO:
335, SEQ ID NO: 336, SEQ ID NO: 337, SEQ ID NO: 338, SEQ ID NO:
339, SEQ ID NO: 340, SEQ ID NO: 341, SEQ ID NO: 342, SEQ ID NO:
343, SEQ ID NO: 344, SEQ ID NO: 345, SEQ ID NO: 346, SEQ ID NO:
347, SEQ ID NO: 348, SEQ ID NO: 349, SEQ ID NO: 350, SEQ ID NO:
351, SEQ ID NO: 352, SEQ ID NO: 353, SEQ ID NO: 354, SEQ ID NO:
355, SEQ ID NO: 356, SEQ ID NO: 357, SEQ ID NO: 358, SEQ ID NO:
359, SEQ ID NO: 360, SEQ ID NO: 361, SEQ ID NO: 362, SEQ ID NO:
363, SEQ ID NO: 364, SEQ ID NO: 365, SEQ ID NO: 366, SEQ ID NO:
367, SEQ ID NO: 368, SEQ ID NO: 369, SEQ ID NO: 370, SEQ ID NO:
371, SEQ ID NO: 372, SEQ ID NO: 373, SEQ ID NO: 374, SEQ ID NO:
375, SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO: 378, SEQ ID NO:
379, SEQ ID NO: 380, SEQ ID NO: 381, SEQ ID NO: 382, SEQ ID NO:
383, SEQ ID NO: 384, SEQ ID NO: 385, SEQ ID NO: 386, SEQ ID NO:
387, SEQ ID NO: 388, SEQ ID NO: 389, SEQ ID NO: 390, SEQ ID NO:
391, SEQ ID NO: 392, SEQ ID NO: 393, SEQ ID NO: 394, SEQ ID NO:
395, SEQ ID NO: 396, SEQ ID NO: 397, SEQ ID NO: 398, SEQ ID NO:
399, SEQ ID NO: 400, SEQ ID NO: 401, SEQ ID NO: 402, SEQ ID NO:
403, SEQ ID NO: 404, SEQ ID NO: 405, SEQ ID NO: 406, SEQ ID NO:
407, SEQ ID NO: 408, SEQ ID NO: 409, SEQ ID NO: 410, SEQ ID NO:
411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID NO:
415, SEQ ID NO: 416, SEQ ID NO: 445, SEQ ID NO: 446, SEQ ID NO:
447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 450, SEQ ID NO:
451, SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO: 454, SEQ ID NO:
455, SEQ ID NO: 456, SEQ ID NO: 457, SEQ ID NO: 458, SEQ ID NO:
459, SEQ ID NO: 460, SEQ ID NO: 461, SEQ ID NO: 462, SEQ ID NO:
463, SEQ ID NO: 464, SEQ ID NO: 465, SEQ ID NO: 466, SEQ ID NO:
467, SEQ ID NO: 468, SEQ ID NO: 469, SEQ ID NO: 470, SEQ ID NO: 471
or SEQ ID NO: 472.
[0083] In some embodiments, chimeric polypeptides are provided
comprising regions of at least two different IPD103 polypeptides of
the disclosure.
[0084] In some embodiments, chimeric polypeptides are provided
comprising regions of at least two different IPD103 polypeptides
selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO:
8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ
ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO:
26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ
ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 229, SEQ ID NO: 230, SEQ ID
NO: 231, SEQ ID NO: 232, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO:
235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO:
239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO:
243, SEQ ID NO: 244, SEQ ID NO: 245, SEQ ID NO: 246, SEQ ID NO:
247, SEQ ID NO: 248, SEQ ID NO: 249, SEQ ID NO: 250, SEQ ID NO:
251, SEQ ID NO: 252, SEQ ID NO: 253, SEQ ID NO: 254, SEQ ID NO:
255, SEQ ID NO: 256, SEQ ID NO: 257, SEQ ID NO: 258, SEQ ID NO:
259, SEQ ID NO: 260, SEQ ID NO: 261, SEQ ID NO: 262, SEQ ID NO:
263, SEQ ID NO: 264, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO:
267, SEQ ID NO: 268, SEQ ID NO: 269, SEQ ID NO: 270, SEQ ID NO:
271, SEQ ID NO: 272, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO:
275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO:
279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO:
283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO:
287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO:
291, SEQ ID NO: 292, SEQ ID NO: 293, SEQ ID NO: 294, SEQ ID NO:
295, SEQ ID NO: 296, SEQ ID NO: 297, SEQ ID NO: 298, SEQ ID NO:
299, SEQ ID NO: 300, SEQ ID NO: 301, SEQ ID NO: 302, SEQ ID NO:
303, SEQ ID NO: 304, SEQ ID NO: 305, SEQ ID NO: 306, SEQ ID NO:
307, SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO: 310, SEQ ID NO:
311, SEQ ID NO: 312, SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO:
315, SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318, SEQ ID NO:
319, SEQ ID NO: 320, SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO:
323, SEQ ID NO: 324, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO:
327, SEQ ID NO: 328, SEQ ID NO: 329, SEQ ID NO: 330, SEQ ID NO:
331, SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, SEQ ID NO:
335, SEQ ID NO: 336, SEQ ID NO: 337, SEQ ID NO: 338, SEQ ID NO:
339, SEQ ID NO: 340, SEQ ID NO: 341, SEQ ID NO: 342, SEQ ID NO:
343, SEQ ID NO: 344, SEQ ID NO: 345, SEQ ID NO: 346, SEQ ID NO:
347, SEQ ID NO: 348, SEQ ID NO: 349, SEQ ID NO: 350, SEQ ID NO:
351, SEQ ID NO: 352, SEQ ID NO: 353, SEQ ID NO: 354, SEQ ID NO:
355, SEQ ID NO: 356, SEQ ID NO: 357, SEQ ID NO: 358, SEQ ID NO:
359, SEQ ID NO: 360, SEQ ID NO: 361, SEQ ID NO: 362, SEQ ID NO:
363, SEQ ID NO: 364, SEQ ID NO: 365, SEQ ID NO: 366, SEQ ID NO:
367, SEQ ID NO: 368, SEQ ID NO: 369, SEQ ID NO: 370, SEQ ID NO:
371, SEQ ID NO: 372, SEQ ID NO: 373, SEQ ID NO: 374, SEQ ID NO:
375, SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO: 378, SEQ ID NO:
379, SEQ ID NO: 380, SEQ ID NO: 381, SEQ ID NO: 382, SEQ ID NO:
383, SEQ ID NO: 384, SEQ ID NO: 385, SEQ ID NO: 386, SEQ ID NO:
387, SEQ ID NO: 388, SEQ ID NO: 389, SEQ ID NO: 390, SEQ ID NO:
391, SEQ ID NO: 392, SEQ ID NO: 393, SEQ ID NO: 394, SEQ ID NO:
395, SEQ ID NO: 396, SEQ ID NO: 397, SEQ ID NO: 398, SEQ ID NO:
399, SEQ ID NO: 400, SEQ ID NO: 401, SEQ ID NO: 402, SEQ ID NO:
403, SEQ ID NO: 404, SEQ ID NO: 405, SEQ ID NO: 406, SEQ ID NO:
407, SEQ ID NO: 408, SEQ ID NO: 409, SEQ ID NO: 410, SEQ ID NO:
411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID NO:
415, SEQ ID NO: 416, SEQ ID NO: 445, SEQ ID NO: 446, SEQ ID NO:
447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 450, SEQ ID NO:
451, SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO: 454, SEQ ID NO:
455, SEQ ID NO: 456, SEQ ID NO: 457, SEQ ID NO: 458, SEQ ID NO:
459, SEQ ID NO: 460, SEQ ID NO: 461, SEQ ID NO: 462, SEQ ID NO:
463, SEQ ID NO: 464, SEQ ID NO: 465, SEQ ID NO: 466, SEQ ID NO:
467, SEQ ID NO: 468, SEQ ID NO: 469, SEQ ID NO: 470, SEQ ID NO:
471, and SEQ ID NO: 472.
[0085] In some embodiments, chimeric IPD103 polypeptide are
provided comprising an N-terminal Region of a first IPD103
polypeptide of the disclosure operably fused to a C-terminal Region
of a second IPD103 polypeptide of the disclosure.
[0086] In some embodiments, chimeric IPD103 polypeptide are
provided comprising an N-terminal Region of a first IPD103
polypeptide operably fused to a C-terminal Region of a second
IPD103 polypeptide, where the first and second IPD103 polypeptide
is selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID
NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16,
SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID
NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34,
SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 229, SEQ ID NO: 230, SEQ
ID NO: 231, SEQ ID NO: 232, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID
NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO:
239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO:
243, SEQ ID NO: 244, SEQ ID NO: 245, SEQ ID NO: 246, SEQ ID NO:
247, SEQ ID NO: 248, SEQ ID NO: 249, SEQ ID NO: 250, SEQ ID NO:
251, SEQ ID NO: 252, SEQ ID NO: 253, SEQ ID NO: 254, SEQ ID NO:
255, SEQ ID NO: 256, SEQ ID NO: 257, SEQ ID NO: 258, SEQ ID NO:
259, SEQ ID NO: 260, SEQ ID NO: 261, SEQ ID NO: 262, SEQ ID NO:
263, SEQ ID NO: 264, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO:
267, SEQ ID NO: 268, SEQ ID NO: 269, SEQ ID NO: 270, SEQ ID NO:
271, SEQ ID NO: 272, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO:
275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO:
279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO:
283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO:
287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO:
291, SEQ ID NO: 292, SEQ ID NO: 293, SEQ ID NO: 294, SEQ ID NO:
295, SEQ ID NO: 296, SEQ ID NO: 297, SEQ ID NO: 298, SEQ ID NO:
299, SEQ ID NO: 300, SEQ ID NO: 301, SEQ ID NO: 302, SEQ ID NO:
303, SEQ ID NO: 304, SEQ ID NO: 305, SEQ ID NO: 306, SEQ ID NO:
307, SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO: 310, SEQ ID NO:
311, SEQ ID NO: 312, SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO:
315, SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318, SEQ ID NO:
319, SEQ ID NO: 320, SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO:
323, SEQ ID NO: 324, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO:
327, SEQ ID NO: 328, SEQ ID NO: 329, SEQ ID NO: 330, SEQ ID NO:
331, SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO: 334, SEQ ID NO:
335, SEQ ID NO: 336, SEQ ID NO: 337, SEQ ID NO: 338, SEQ ID NO:
339, SEQ ID NO: 340, SEQ ID NO: 341, SEQ ID NO: 342, SEQ ID NO:
343, SEQ ID NO: 344, SEQ ID NO: 345, SEQ ID NO: 346, SEQ ID NO:
347, SEQ ID NO: 348, SEQ ID NO: 349, SEQ ID NO: 350, SEQ ID NO:
351, SEQ ID NO: 352, SEQ ID NO: 353, SEQ ID NO: 354, SEQ ID NO:
355, SEQ ID NO: 356, SEQ ID NO: 357, SEQ ID NO: 358, SEQ ID NO:
359, SEQ ID NO: 360, SEQ ID NO: 361, SEQ ID NO: 362, SEQ ID NO:
363, SEQ ID NO: 364, SEQ ID NO: 365, SEQ ID NO: 366, SEQ ID NO:
367, SEQ ID NO: 368, SEQ ID NO: 369, SEQ ID NO: 370, SEQ ID NO:
371, SEQ ID NO: 372, SEQ ID NO: 373, SEQ ID NO: 374, SEQ ID NO:
375, SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO: 378, SEQ ID NO:
379, SEQ ID NO: 380, SEQ ID NO: 381, SEQ ID NO: 382, SEQ ID NO:
383, SEQ ID NO: 384, SEQ ID NO: 385, SEQ ID NO: 386, SEQ ID NO:
387, SEQ ID NO: 388, SEQ ID NO: 389, SEQ ID NO: 390, SEQ ID NO:
391, SEQ ID NO: 392, SEQ ID NO: 393, SEQ ID NO: 394, SEQ ID NO:
395, SEQ ID NO: 396, SEQ ID NO: 397, SEQ ID NO: 398, SEQ ID NO:
399, SEQ ID NO: 400, SEQ ID NO: 401, SEQ ID NO: 402, SEQ ID NO:
403, SEQ ID NO: 404, SEQ ID NO: 405, SEQ ID NO: 406, SEQ ID NO:
407, SEQ ID NO: 408, SEQ ID NO: 409, SEQ ID NO: 410, SEQ ID NO:
411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID NO:
415, SEQ ID NO: 416, SEQ ID NO: 445, SEQ ID NO: 446, SEQ ID NO:
447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 450, SEQ ID NO:
451, SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO: 454, SEQ ID NO:
455, SEQ ID NO: 456, SEQ ID NO: 457, SEQ ID NO: 458, SEQ ID NO:
459, SEQ ID NO: 460, SEQ ID NO: 461, SEQ ID NO: 462, SEQ ID NO:
463, SEQ ID NO: 464, SEQ ID NO: 465, SEQ ID NO: 466, SEQ ID NO:
467, SEQ ID NO: 468, SEQ ID NO: 469, SEQ ID NO: 470, SEQ ID NO:
471, and SEQ ID NO: 472.
[0087] In other embodiments the IPD103 polypeptide may be expressed
as a precursor protein with an intervening sequence that catalyzes
multi-step, post translational protein splicing. Protein splicing
involves the excision of an intervening sequence from a polypeptide
with the concomitant joining of the flanking sequences to yield a
new polypeptide (Chong, et al., (1996) J. Biol. Chem.,
271:22159-22168). This intervening sequence or protein splicing
element, referred to as inteins, which catalyze their own excision
through three coordinated reactions at the N-terminal and
C-terminal splice junctions: an acyl rearrangement of the
N-terminal cysteine or serine; a transesterification reaction
between the two termini to form a branched ester or thioester
intermediate and peptide bond cleavage coupled to cyclization of
the intein C-terminal asparagine to free the intein (Evans, et al.,
(2000) J. Biol. Chem., 275:9091-9094. The elucidation of the
mechanism of protein splicing has led to a number of intein-based
applications (Comb, et al., U.S. Pat. No. 5,496,714; Comb, et al.,
U.S. Pat. No. 5,834,247; Camarero and Muir, (1999) J. Amer. Chem.
Soc. 121:5597-5598; Chong, et al., (1997) Gene 192:271-281, Chong,
et al., (1998) Nucleic Acids Res. 26:5109-5115; Chong, et al.,
(1998) J. Biol. Chem. 273:10567-10577; Cotton, et al., (1999) J.
Am. Chem. Soc. 121:1100-1101; Evans, et al., (1999) J. Biol. Chem.
274:18359-18363; Evans, et al., (1999) J. Biol. Chem.
274:3923-3926; Evans, et al., (1998) Protein Sci. 7:2256-2264;
Evans, et al., (2000) J. Biol. Chem. 275:9091-9094; Iwai and
Pluckthun, (1999) FEBS Lett. 459:166-172; Mathys, et al., (1999)
Gene 231:1-13; Mills, et al., (1998) Proc. Natl. Acad. Sci. USA
95:3543-3548; Muir, et al., (1998) Proc. Natl. Acad. Sci. USA
95:6705-6710; Otomo, et al., (1999) Biochemistry 38:16040-16044;
Otomo, et al., (1999) J. Biolmol. NMR 14:105-114; Scott, et al.,
(1999) Proc. Natl. Acad. Sci. USA 96:13638-13643; Severinov and
Muir, (1998) J. Biol. Chem. 273:16205-16209; Shingledecker, et al.,
(1998) Gene 207:187-195; Southworth, et al., (1998) EMBO J.
17:918-926; Southworth, et al., (1999) Biotechniques 27:110-120;
Wood, et al., (1999) Nat. Biotechnol. 17:889-892; Wu, et al.,
(1998a) Proc. Natl. Acad. Sci. USA 95:9226-9231; Wu, et al.,
(1998b) Biochim Biophys Acta 1387:422-432; Xu, et al., (1999) Proc.
Natl. Acad. Sci. USA 96:388-393; Yamazaki, et al., (1998) J. Am.
Chem. Soc., 120:5591-5592). For the application of inteins in plant
transgenes, see, Yang, et al., (Transgene Res 15:583-593 (2006))
and Evans, et al., (Annu. Rev. Plant Biol. 56:375-392 (2005)).
[0088] In another embodiment the IPD103 polypeptide may be encoded
by two separate genes where the intein of the precursor protein
comes from the two genes, referred to as a split-intein, and the
two portions of the precursor are joined by a peptide bond
formation. This peptide bond formation is accomplished by
intein-mediated trans-splicing. For this purpose, a first and a
second expression cassette comprising the two separate genes
further code for inteins capable of mediating protein
trans-splicing. By trans-splicing, the proteins and polypeptides
encoded by the first and second fragments may be linked by peptide
bond formation. Trans-splicing inteins may be selected from the
nucleolar and organellar genomes of different organisms including
eukaryotes, archaebacteria and eubacteria. Inteins that may be used
for are listed at neb.com/neb/inteins.html, which can be accessed
on the world-wide web using the "www" prefix). The nucleotide
sequence coding for an intein may be split into a 5' and a 3' part
that code for the 5' and the 3' part of the intein, respectively.
Sequence portions not necessary for intein splicing (e.g. homing
endonuclease domain) may be deleted. The intein coding sequence is
split such that the 5' and the 3' parts are capable of
trans-splicing. For selecting a suitable splitting site of the
intein coding sequence, the considerations published by Southworth,
et al., (1998) EMBO J. 17:918-926 may be followed. In constructing
the first and the second expression cassette, the 5' intein coding
sequence is linked to the 3' end of the first fragment coding for
the N-terminal part of the IPD103 polypeptide and the 3' intein
coding sequence is linked to the 5' end of the second fragment
coding for the C-terminal part of the IPD103 polypeptide.
[0089] In general, the trans-splicing partners can be designed
using any split intein, including any naturally-occurring or
artificially-split split intein. Several naturally-occurring split
inteins are known, for example: the split intein of the DnaE gene
of Synechocystis sp. PCC6803 (see, Wu, et al., (1998) Proc Natl
Acad Sci USA. 95(16):9226-31 and Evans, et al., (2000) J Biol Chem.
275(13):9091-4 and of the DnaE gene from Nostoc punctiforme (see,
Iwai, et al., (2006) FEBS Lett. 580(7):1853-8). Non-split inteins
have been artificially split in the laboratory to create new split
inteins, for example: the artificially split Ssp DnaB intein (see,
Wu, et al., (1998) Biochim Biophys Acta. 1387:422-32) and split Sce
VMA intein (see, Brenzel, et al., (2006) Biochemistry.
45(6):1571-8) and an artificially split fungal mini-intein (see,
Elleuche, et al., (2007) Biochem Biophys Res Commun. 355(3):830-4).
There are also intein databases available that catalogue known
inteins (see for example the online-database available at:
bioinformatics.weizmann.ac.il/.sup..about.pietro/inteins/Inteinstable.htm-
l, which can be accessed on the world-wide web using the "www"
prefix).
[0090] Naturally-occurring non-split inteins may have endonuclease
or other enzymatic activities that can typically be removed when
designing an artificially-split split intein. Such mini-inteins or
minimized split inteins are well known in the art and are typically
less than 200 amino acid residues long (see, Wu, et al., (1998)
Biochim Biophys Acta. 1387:422-32). Suitable split inteins may have
other purification enabling polypeptide elements added to their
structure, provided that such elements do not inhibit the splicing
of the split intein or are added in a manner that allows them to be
removed prior to splicing. Protein splicing has been reported using
proteins that comprise bacterial intein-like (BIL) domains (see,
Amitai, et al., (2003) Mol Microbiol. 47:61-73) and hedgehog (Hog)
auto-processing domains (the latter is combined with inteins when
referred to as the Hog/intein superfamily or HINT family (see,
Dassa, et al., (2004) J Biol Chem. 279:32001-7) and domains such as
these may also be used to prepare artificially-split inteins. In
particular, non-splicing members of such families may be modified
by molecular biology methodologies to introduce or restore splicing
activity in such related species. Recent studies demonstrate that
splicing can be observed when a N-terminal split intein component
is allowed to react with a C-terminal split intein component not
found in nature to be its "partner"; for example, splicing has been
observed utilizing partners that have as little as 30 to 50%
homology with the "natural" splicing partner (see, Dassa, et al.,
(2007) Biochemistry. 46(1):322-30). Other such mixtures of
disparate split intein partners have been shown to be unreactive
one with another (see, Brenzel, et al., (2006) Biochemistry.
45(6):1571-8). However, it is within the ability of a person
skilled in the relevant art to determine whether a particular pair
of polypeptides is able to associate with each other to provide a
functional intein, using routine methods and without the exercise
of inventive skill.
[0091] In some embodiments the IPD103 polypeptide is a circular
permuted variant. In certain embodiments the IPD103 polypeptide is
a circular permuted variant of the polypeptide of SEQ ID NO: 2, SEQ
ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12,
SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID
NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30,
SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID
NO: 229, SEQ ID NO: 230, SEQ ID NO: 231, SEQ ID NO: 232, SEQ ID NO:
233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO:
237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO:
241, SEQ ID NO: 242, SEQ ID NO: 243, SEQ ID NO: 244, SEQ ID NO:
245, SEQ ID NO: 246, SEQ ID NO: 247, SEQ ID NO: 248, SEQ ID NO:
249, SEQ ID NO: 250, SEQ ID NO: 251, SEQ ID NO: 252, SEQ ID NO:
253, SEQ ID NO: 254, SEQ ID NO: 255, SEQ ID NO: 256, SEQ ID NO:
257, SEQ ID NO: 258, SEQ ID NO: 259, SEQ ID NO: 260, SEQ ID NO:
261, SEQ ID NO: 262, SEQ ID NO: 263, SEQ ID NO: 264, SEQ ID NO:
265, SEQ ID NO: 266, SEQ ID NO: 267, SEQ ID NO: 268, SEQ ID NO:
269, SEQ ID NO: 270, SEQ ID NO: 271, SEQ ID NO: 272, SEQ ID NO:
273, SEQ ID NO: 274, SEQ ID NO: 275, SEQ ID NO: 276, SEQ ID NO:
277, SEQ ID NO: 278, SEQ ID NO: 279, SEQ ID NO: 280, SEQ ID NO:
281, SEQ ID NO: 282, SEQ ID NO: 283, SEQ ID NO: 284, SEQ ID NO:
285, SEQ ID NO: 286, SEQ ID NO: 287, SEQ ID NO: 288, SEQ ID NO:
289, SEQ ID NO: 290, SEQ ID NO: 291, SEQ ID NO: 292, SEQ ID NO:
293, SEQ ID NO: 294, SEQ ID NO: 295, SEQ ID NO: 296, SEQ ID NO:
297, SEQ ID NO: 298, SEQ ID NO: 299, SEQ ID NO: 300, SEQ ID NO:
301, SEQ ID NO: 302, SEQ ID NO: 303, SEQ ID NO: 304, SEQ ID NO:
305, SEQ ID NO: 306, SEQ ID NO: 307, SEQ ID NO: 308, SEQ ID NO:
309, SEQ ID NO: 310, SEQ ID NO: 311, SEQ ID NO: 312, SEQ ID NO:
313, SEQ ID NO: 314, SEQ ID NO: 315, SEQ ID NO: 316, SEQ ID NO:
317, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO: 320, SEQ ID NO:
321, SEQ ID NO: 322, SEQ ID NO: 323, SEQ ID NO: 324, SEQ ID NO:
325, SEQ ID NO: 326, SEQ ID NO: 327, SEQ ID NO: 328, SEQ ID NO:
329, SEQ ID NO: 330, SEQ ID NO: 331, SEQ ID NO: 332, SEQ ID NO:
333, SEQ ID NO: 334, SEQ ID NO: 335, SEQ ID NO: 336, SEQ ID NO:
337, SEQ ID NO: 338, SEQ ID NO: 339, SEQ ID NO: 340, SEQ ID NO:
341, SEQ ID NO: 342, SEQ ID NO: 343, SEQ ID NO: 344, SEQ ID NO:
345, SEQ ID NO: 346, SEQ ID NO: 347, SEQ ID NO: 348, SEQ ID NO:
349, SEQ ID NO: 350, SEQ ID NO: 351, SEQ ID NO: 352, SEQ ID NO:
353, SEQ ID NO: 354, SEQ ID NO: 355, SEQ ID NO: 356, SEQ ID NO:
357, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO:
361, SEQ ID NO: 362, SEQ ID NO: 363, SEQ ID NO: 364, SEQ ID NO:
365, SEQ ID NO: 366, SEQ ID NO: 367, SEQ ID NO: 368, SEQ ID NO:
369, SEQ ID NO: 370, SEQ ID NO: 371, SEQ ID NO: 372, SEQ ID NO:
373, SEQ ID NO: 374, SEQ ID NO: 375, SEQ ID NO: 376, SEQ ID NO:
377, SEQ ID NO: 378, SEQ ID NO: 379, SEQ ID NO: 380, SEQ ID NO:
381, SEQ ID NO: 382, SEQ ID NO: 383, SEQ ID NO: 384, SEQ ID NO:
385, SEQ ID NO: 386, SEQ ID NO: 387, SEQ ID NO: 388, SEQ ID NO:
389, SEQ ID NO: 390, SEQ ID NO: 391, SEQ ID NO: 392, SEQ ID NO:
393, SEQ ID NO: 394, SEQ ID NO: 395, SEQ ID NO: 396, SEQ ID NO:
397, SEQ ID NO: 398, SEQ ID NO: 399, SEQ ID NO: 400, SEQ ID NO:
401, SEQ ID NO: 402, SEQ ID NO: 403, SEQ ID NO: 404, SEQ ID NO:
405, SEQ ID NO: 406, SEQ ID NO: 407, SEQ ID NO: 408, SEQ ID NO:
409, SEQ ID NO: 410, SEQ ID NO: 411, SEQ ID NO: 412, SEQ ID NO:
413, SEQ ID NO: 414, SEQ ID NO: 415, SEQ ID NO: 416, SEQ ID NO:
445, SEQ ID NO: 446, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO:
449, SEQ ID NO: 450, SEQ ID NO: 451, SEQ ID NO: 452, SEQ ID NO:
453, SEQ ID NO: 454, SEQ ID NO: 455, SEQ ID NO: 456, SEQ ID NO:
457, SEQ ID NO: 458, SEQ ID NO: 459, SEQ ID NO: 460, SEQ ID NO:
461, SEQ ID NO: 462, SEQ ID NO: 463, SEQ ID NO: 464, SEQ ID NO:
465, SEQ ID NO: 466, SEQ ID NO: 467, SEQ ID NO: 468, SEQ ID NO:
469, SEQ ID NO: 470, SEQ ID NO: 471, and SEQ ID NO: 472, or variant
thereof having an amino acid substitution, deletion, addition or
combinations thereof. The development of recombinant DNA methods
has made it possible to study the effects of sequence transposition
on protein folding, structure and function. The approach used in
creating new sequences resembles that of naturally occurring pairs
of proteins that are related by linear reorganization of their
amino acid sequences (Cunningham, et al., (1979) Proc. Natl. Acad.
Sci. U.S.A. 76:3218-3222; Teather and Erfle, (1990) J. Bacteriol.
172:3837-3841; Schimming, et al., (1992) Eur. J. Biochem.
204:13-19; Yamiuchi and Minamikawa, (1991) FEBS Lett. 260:127-130;
MacGregor, et al., (1996) FEBS Lett. 378:263-266). The first in
vitro application of this type of rearrangement to proteins was
described by Goldenberg and Creighton (J. Mol. Biol. 165:407-413,
1983). In creating a circular permuted variant a new N-terminus is
selected at an internal site (breakpoint) of the original sequence,
the new sequence having the same order of amino acids as the
original from the breakpoint until it reaches an amino acid that is
at or near the original C-terminus. At this point the new sequence
is joined, either directly or through an additional portion of
sequence (linker), to an amino acid that is at or near the original
N-terminus and the new sequence continues with the same sequence as
the original until it reaches a point that is at or near the amino
acid that was N-terminal to the breakpoint site of the original
sequence, this residue forming the new C-terminus of the chain. The
length of the amino acid sequence of the linker can be selected
empirically or with guidance from structural information or by
using a combination of the two approaches. When no structural
information is available, a small series of linkers can be prepared
for testing using a design whose length is varied in order to span
a range from 0 to 50 .ANG. and whose sequence is chosen in order to
be consistent with surface exposure (hydrophilicity, Hopp and
Woods, (1983) Mol. Immunol. 20:483-489; Kyte and Doolittle, (1982)
J. Mol. Biol. 157:105-132; solvent exposed surface area, Lee and
Richards, (1971) J. Mol. Biol. 55:379-400) and the ability to adopt
the necessary conformation without deranging the configuration of
the pesticidal polypeptide (conformationally flexible; Karplus and
Schulz, (1985) Naturwissenschaften 72:212-213). Assuming an average
of translation of 2.0 to 3.8 .ANG. per residue, this would mean the
length to test would be between 0 to 30 residues, with 0 to 15
residues being the preferred range. Exemplary of such an empirical
series would be to construct linkers using a cassette sequence such
as Gly-Gly-Gly-Ser repeated n times, where n is 1, 2, 3 or 4. Those
skilled in the art will recognize that there are many such
sequences that vary in length or composition that can serve as
linkers with the primary consideration being that they be neither
excessively long nor short (cf., Sandhu, (1992) Critical Rev.
Biotech. 12:437-462); if they are too long, entropy effects will
likely destabilize the three-dimensional fold, and may also make
folding kinetically impractical, and if they are too short, they
will likely destabilize the molecule because of torsional or steric
strain. Those skilled in the analysis of protein structural
information will recognize that using the distance between the
chain ends, defined as the distance between the c-alpha carbons,
can be used to define the length of the sequence to be used or at
least to limit the number of possibilities that must be tested in
an empirical selection of linkers. They will also recognize that it
is sometimes the case that the positions of the ends of the
polypeptide chain are ill-defined in structural models derived from
x-ray diffraction or nuclear magnetic resonance spectroscopy data,
and that when true, this situation will therefore need to be taken
into account in order to properly estimate the length of the linker
required. From those residues whose positions are well defined are
selected two residues that are close in sequence to the chain ends,
and the distance between their c-alpha carbons is used to calculate
an approximate length for a linker between them. Using the
calculated length as a guide, linkers with a range of number of
residues (calculated using 2 to 3.8 .ANG. per residue) are then
selected. These linkers may be composed of the original sequence,
shortened or lengthened as necessary, and when lengthened the
additional residues may be chosen to be flexible and hydrophilic as
described above; or optionally the original sequence may be
substituted for using a series of linkers, one example being the
Gly-Gly-Gly-Ser cassette approach mentioned above; or optionally a
combination of the original sequence and new sequence having the
appropriate total length may be used. Sequences of pesticidal
polypeptides capable of folding to biologically active states can
be prepared by appropriate selection of the beginning (amino
terminus) and ending (carboxyl terminus) positions from within the
original polypeptide chain while using the linker sequence as
described above. Amino and carboxyl termini are selected from
within a common stretch of sequence, referred to as a breakpoint
region, using the guidelines described below. A novel amino acid
sequence is thus generated by selecting amino and carboxyl termini
from within the same breakpoint region. In many cases the selection
of the new termini will be such that the original position of the
carboxyl terminus immediately preceded that of the amino terminus.
However, those skilled in the art will recognize that selections of
termini anywhere within the region may function, and that these
will effectively lead to either deletions or additions to the amino
or carboxyl portions of the new sequence. It is a central tenet of
molecular biology that the primary amino acid sequence of a protein
dictates folding to the three-dimensional structure necessary for
expression of its biological function. Methods are known to those
skilled in the art to obtain and interpret three-dimensional
structural information using x-ray diffraction of single protein
Crystals or nuclear magnetic resonance spectroscopy of protein
solutions. Examples of structural information that are relevant to
the identification of breakpoint regions include the location and
type of protein secondary structure (alpha and 3-10 helices,
parallel and anti-parallel beta sheets, chain reversals and turns,
and loops; Kabsch and Sander, (1983) Biopolymers 22:2577-2637; the
degree of solvent exposure of amino acid residues, the extent and
type of interactions of residues with one another (Chothia, (1984)
Ann. Rev. Biochem. 53:537-572) and the static and dynamic
distribution of conformations along the polypeptide chain (Alber
and Mathews, (1987) Methods Enzymol. 154:511-533). In some cases
additional information is known about solvent exposure of residues;
one example is a site of post-translational attachment of
carbohydrate which is necessarily on the surface of the protein.
When experimental structural information is not available or is not
feasible to obtain, methods are also available to analyze the
primary amino acid sequence in order to make predictions of protein
tertiary and secondary structure, solvent accessibility and the
occurrence of turns and loops. Biochemical methods are also
sometimes applicable for empirically determining surface exposure
when direct structural methods are not feasible; for example, using
the identification of sites of chain scission following limited
proteolysis in order to infer surface exposure (Gentile and
Salvatore, (1993) Eur. J. Biochem. 218:603-621). Thus using either
the experimentally derived structural information or predictive
methods (e.g., Srinivisan and Rose, (1995) Proteins: Struct.,
Funct. & Genetics 22:81-99) the parental amino acid sequence is
inspected to classify regions according to whether or not they are
integral to the maintenance of secondary and tertiary structure.
The occurrence of sequences within regions that are known to be
involved in periodic secondary structure (alpha and 3-10 helices,
parallel and anti-parallel beta sheets) are regions that should be
avoided. Similarly, regions of amino acid sequence that are
observed or predicted to have a low degree of solvent exposure are
more likely to be part of the so-called hydrophobic core of the
protein and should also be avoided for selection of amino and
carboxyl termini. In contrast, those regions that are known or
predicted to be in surface turns or loops, and especially those
regions that are known not to be required for biological activity,
are the preferred sites for location of the extremes of the
polypeptide chain. Continuous stretches of amino acid sequence that
are preferred based on the above criteria are referred to as a
breakpoint region. Polynucleotides encoding circular permuted
IPD103 polypeptides with new N-terminus/C-terminus which contain a
linker region separating the original C-terminus and N-terminus can
be made essentially following the method described in Mullins, et
al., (1994) J. Am. Chem. Soc. 116:5529-5533. Multiple steps of
polymerase chain reaction (PCR) amplifications are used to
rearrange the DNA sequence encoding the primary amino acid sequence
of the protein. Polynucleotides encoding circular permuted IPD103
polypeptides with new N-terminus/C-terminus which contain a linker
region separating the original C-terminus and N-terminus can be
made based on the tandem-duplication method described in Horlick,
et al., (1992) Protein Eng. 5:427-431. Polymerase chain reaction
(PCR) amplification of the new N-terminus/C-terminus genes is
performed using a tandemly duplicated template DNA.
[0092] In another embodiment fusion proteins are provided that
include within its amino acid sequence an amino acid sequence
comprising an IPD103 polypeptide or chimeric IPD103 polypeptide of
the disclosure. Methods for design and construction of fusion
proteins (and polynucleotides encoding same) are known to those of
skill in the art. Polynucleotides encoding an IPD103 polypeptide
may be fused to signal sequences which will direct the localization
of the IPD103 polypeptide to particular compartments of a
prokaryotic or eukaryotic cell and/or direct the secretion of the
IPD103 polypeptide of the embodiments from a prokaryotic or
eukaryotic cell. For example, in E. coli, one may wish to direct
the expression of the protein to the periplasmic space. Examples of
signal sequences or proteins (or fragments thereof) to which the
IPD103 polypeptide may be fused in order to direct the expression
of the polypeptide to the periplasmic space of bacteria include,
but are not limited to, the pelB signal sequence, the maltose
binding protein (MBP) signal sequence, MBP, the ompA signal
sequence, the signal sequence of the periplasmic E. coli
heat-labile enterotoxin B-subunit and the signal sequence of
alkaline phosphatase. Several vectors are commercially available
for the construction of fusion proteins which will direct the
localization of a protein, such as the pMAL series of vectors
(particularly the pMAL-p series) available from New England
Biolabs. In a specific embodiment, the IPD103 polypeptide may be
fused to the pelB pectate lyase signal sequence to increase the
efficiency of expression and purification of such polypeptides in
Gram-negative bacteria (see, U.S. Pat. Nos. 5,576,195 and
5,846,818). Plant plastid transit peptide/polypeptide fusions are
well known in the art. Apoplast transit peptides such as rice or
barley alpha-amylase secretion signal are also well known in the
art. The plastid transit peptide is generally fused N-terminal to
the polypeptide to be targeted (e.g., the fusion partner). In one
embodiment, the fusion protein consists essentially of the plastid
transit peptide and the IPD103 polypeptide to be targeted. In
another embodiment, the fusion protein comprises the plastid
transit peptide and the polypeptide to be targeted. In such
embodiments, the plastid transit peptide is preferably at the
N-terminus of the fusion protein. However, additional amino acid
residues may be N-terminal to the plastid transit peptide providing
that the fusion protein is at least partially targeted to a
plastid. In a specific embodiment, the plastid transit peptide is
in the N-terminal half, N-terminal third or N-terminal quarter of
the fusion protein. Most or all of the plastid transit peptide is
generally cleaved from the fusion protein upon insertion into the
plastid. The position of cleavage may vary slightly between plant
species, at different plant developmental stages, as a result of
specific intercellular conditions or the particular combination of
transit peptide/fusion partner used. In one embodiment, the plastid
transit peptide cleavage is homogenous such that the cleavage site
is identical in a population of fusion proteins. In another
embodiment, the plastid transit peptide is not homogenous, such
that the cleavage site varies by 1-10 amino acids in a population
of fusion proteins. The plastid transit peptide can be
recombinantly fused to a second protein in one of several ways. For
example, a restriction endonuclease recognition site can be
introduced into the nucleotide sequence of the transit peptide at a
position corresponding to its C-terminal end and the same or a
compatible site can be engineered into the nucleotide sequence of
the protein to be targeted at its N-terminal end. Care must be
taken in designing these sites to ensure that the coding sequences
of the transit peptide and the second protein are kept "in frame"
to allow the synthesis of the desired fusion protein. In some
cases, it may be preferable to remove the initiator methionine of
the second protein when the new restriction site is introduced. The
introduction of restriction endonuclease recognition sites on both
parent molecules and their subsequent joining through recombinant
DNA techniques may result in the addition of one or more extra
amino acids between the transit peptide and the second protein.
This generally does not affect targeting activity as long as the
transit peptide cleavage site remains accessible and the function
of the second protein is not altered by the addition of these extra
amino acids at its N-terminus. Alternatively, one skilled in the
art can create a precise cleavage site between the transit peptide
and the second protein (with or without its initiator methionine)
using gene synthesis (Stemmer, et al., (1995) Gene 164:49-53) or
similar methods. In addition, the transit peptide fusion can
intentionally include amino acids downstream of the cleavage site.
The amino acids at the N-terminus of the mature protein can affect
the ability of the transit peptide to target proteins to plastids
and/or the efficiency of cleavage following protein import. This
may be dependent on the protein to be targeted. See, e.g., Comai,
et al., (1988) J. Biol. Chem. 263(29):15104-9. In some embodiments
the IPD103 polypeptide is fused to a heterologous signal peptide or
heterologous transit peptide.
[0093] In some embodiments fusion proteins are provide comprising
an IPD103 polypeptide or chimeric IPD103 polypeptide of the
disclosure represented by a formula selected from the group
consisting of:
R.sup.1-L-R.sup.2, R.sup.2-L-R.sup.1, R.sup.1-R.sup.2 or
R.sup.2-R.sup.1
wherein R.sup.1 is an IPD103 polypeptide or chimeric IPD103
polypeptide of the disclosure and R.sup.2 is a protein of interest.
In some embodiments R.sup.1 and R.sup.2 are an IPD103 polypeptide
or chimeric IPD103 polypeptide of the disclosure. The R.sup.1
polypeptide is fused either directly or through a linker (L)
segment to the R.sup.2 polypeptide. The term "directly" defines
fusions in which the polypeptides are joined without a peptide
linker. Thus "L" represents a chemical bound or polypeptide segment
to which both R.sup.1 and R.sup.2 are fused in frame, most commonly
L is a linear peptide to which R.sup.1 and R.sup.2 are bound by
amide bonds linking the carboxy terminus of R.sup.1 to the amino
terminus of L and carboxy terminus of L to the amino terminus of
R.sup.2. By "fused in frame" is meant that there is no translation
termination or disruption between the reading frames of R.sup.1 and
R.sup.2. The linking group (L) is generally a polypeptide of
between 1 and 500 amino acids in length. The linkers joining the
two molecules are preferably designed to (1) allow the two
molecules to fold and act independently of each other, (2) not have
a propensity for developing an ordered secondary structure which
could interfere with the functional domains of the two proteins,
(3) have minimal hydrophobic or charged characteristic which could
interact with the functional protein domains and (4) provide steric
separation of R.sup.1 and R.sup.2 such that R.sup.1 and R.sup.2
could interact simultaneously with their corresponding receptors on
a single cell. Typically surface amino acids in flexible protein
regions include Gly, Asn and Ser. Virtually any permutation of
amino acid sequences containing Gly, Asn and Ser would be expected
to satisfy the above criteria for a linker sequence. Other neutral
amino acids, such as Thr and Ala, may also be used in the linker
sequence. Additional amino acids may also be included in the
linkers due to the addition of unique restriction sites in the
linker sequence to facilitate construction of the fusions.
[0094] In some embodiments the linkers comprise sequences selected
from the group of formulas: (Gly.sub.3Ser).sub.n,
(Gly.sub.4Ser).sub.n, (Gly.sub.5Ser).sub.n, (Gly.sub.nSer).sub.n or
(AlaGlySer).sub.n where n is an integer. One example of a
highly-flexible linker is the (GlySer)-rich spacer region present
within the pIII protein of the filamentous bacteriophages, e.g.
bacteriophages M13 or fd (Schaller, et al., 1975). This region
provides a long, flexible spacer region between two domains of the
pIII surface protein. Also included are linkers in which an
endopeptidase recognition sequence is included. Such a cleavage
site may be valuable to separate the individual components of the
fusion to determine if they are properly folded and active in
vitro. Examples of various endopeptidases include, but are not
limited to, Plasmin, Enterokinase, Kallikerin, Urokinase, Tissue
Plasminogen activator, clostripain, Chymosin, Collagenase,
Russell's Viper Venom Protease, Postproline cleavage enzyme, V8
protease, Thrombin and factor Xa. In some embodiments the linker
comprises the amino acids EEKKN (SEQ ID NO: 508) from the
multi-gene expression vehicle (MGEV), which is cleaved by vacuolar
proteases as disclosed in US Patent Application Publication Number
US 2007/0277263. In other embodiments, peptide linker segments from
the hinge region of heavy chain immunoglobulins IgG, IgA, IgM, IgD
or IgE provide an angular relationship between the attached
polypeptides. Especially useful are those hinge regions where the
cysteines are replaced with serines. Linkers of the present
disclosure include sequences derived from murine IgG gamma 2b hinge
region in which the cysteines have been changed to serines. The
fusion proteins are not limited by the form, size or number of
linker sequences employed and the only requirement of the linker is
that functionally it does not interfere adversely with the folding
and function of the individual molecules of the fusion.
Nucleic Acid Molecules, and Variants and Fragments Thereof
[0095] Isolated or recombinant nucleic acid molecules comprising
nucleic acid sequences encoding IPD103 polypeptides or biologically
active portions thereof, as well as nucleic acid molecules
sufficient for use as hybridization probes to identify nucleic acid
molecules encoding proteins with regions of sequence homology are
provided. As used herein, the term "nucleic acid molecule" refers
to DNA molecules (e.g., recombinant DNA, cDNA, genomic DNA, plastid
DNA, mitochondrial DNA) and RNA molecules (e.g., mRNA) and analogs
of the DNA or RNA generated using nucleotide analogs. The nucleic
acid molecule can be single-stranded or double-stranded, but
preferably is double-stranded DNA.
[0096] An "isolated" nucleic acid molecule (or DNA) is used herein
to refer to a nucleic acid sequence (or DNA) that is no longer in
its natural environment, for example in vitro. A "recombinant"
nucleic acid molecule (or DNA) is used herein to refer to a nucleic
acid sequence (or DNA) that is in a recombinant bacterial or plant
host cell. In some embodiments, an "isolated" or "recombinant"
nucleic acid is free of sequences (preferably protein encoding
sequences) that naturally flank the nucleic acid (i.e., sequences
located at the 5' and 3' ends of the nucleic acid) in the genomic
DNA of the organism from which the nucleic acid is derived. For
purposes of the disclosure, "isolated" or "recombinant" when used
to refer to nucleic acid molecules excludes isolated chromosomes.
For example, in various embodiments, the recombinant nucleic acid
molecules encoding IPD103 polypeptides can contain less than about
5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleic acid
sequences that naturally flank the nucleic acid molecule in genomic
DNA of the cell from which the nucleic acid is derived.
[0097] In some embodiments an isolated nucleic acid molecule
encoding IPD103 polypeptides has one or more change in the nucleic
acid sequence compared to the native or genomic nucleic acid
sequence. In some embodiments the change in the native or genomic
nucleic acid sequence includes but is not limited to: changes in
the nucleic acid sequence due to the degeneracy of the genetic
code; changes in the nucleic acid sequence due to the amino acid
substitution, insertion, deletion and/or addition compared to the
native or genomic sequence; removal of one or more intron; deletion
of one or more upstream or downstream regulatory regions; and
deletion of the 5' and/or 3' untranslated region associated with
the genomic nucleic acid sequence. In some embodiments the nucleic
acid molecule encoding an IPD103 polypeptide is a non-genomic
sequence.
[0098] A variety of polynucleotides that encode IPD103 polypeptides
or related proteins are contemplated. Such polynucleotides are
useful for production of IPD103 polypeptides in host cells when
operably linked to a suitable promoter, transcription termination
and/or polyadenylation sequences. Such polynucleotides are also
useful as probes for isolating homologous or substantially
homologous polynucleotides that encode IPD103 polypeptides or
related proteins.
Polynucleotides Encoding IPD103 Polypeptides
[0099] One source of polynucleotides that encode IPD103
polypeptides or related proteins is a fern or other primitive plant
species selected from but not limited to Athyrium species,
Platycerium species, Pteris species, Colysis species, Nephrolepis
species, Polystichium species, Thelypteris species, Tectana
species, and Davallia species, which contains an IPD103
polynucleotide of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID
NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15,
SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID
NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33,
SEQ ID NO: 35 or SEQ ID NO: 37, encoding an IPD103 polypeptide of
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO:
10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ
ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO:
28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, and
SEQ ID NO: 38, respectively. The polynucleotides of SEQ ID NO: 1,
SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO:
11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ
ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO:
29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35 or SEQ ID NO: 37
can be used to express IPD103 polypeptides in recombinant bacterial
hosts that include but are not limited to Agrobacterium, Bacillus,
Escherichia, Salmonella, Pseudomonas and Rhizobium bacterial host
cells. The polynucleotides are also useful as probes for isolating
homologous or substantially homologous polynucleotides that encode
IPD103 polypeptides or related proteins. Such probes can be used to
identify homologous or substantially homologous polynucleotides
derived from fern or other primitive plant species selected from
but not limited to Athyrium species, Platycerium species, Pteris
species, Colysis species, Nephrolepis species, Polystichium
species, Thelypteris species, Tectaria species, and Davallia
species.
[0100] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Athyriales.
[0101] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Athyriales, Family Athyriaceae.
[0102] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Athyriales, Family Athyriaceae, Genus Athyrium selected from but
not limited to Athyrium arisanense, Athyrium atkinsonii, Athyrium
biserrulatum, Athyrium brevifrons, Athyrium chingianum, Athyrium
clarkei, Athyrium clivicola, Athyrium cryptogrammoides, Athyrium
cumingianum, Athyrium cuspidatum, Athyrium deltoidofrons, Athyrium
distentifolium, Athyrium epirachis, Athyrium eremicola, Athyrium
fangii, Athyrium filix-femina, Athyrium frangulum, Athyrium
giraldii, Athyrium iseanum, Athyrium kirisimaense, Athyrium
kuratae, Athyrium masamunei, Athyrium melanolepis, Athyrium
monomachi, Athyrium multidentatum, Athyrium nakanoi, Athyrium
neglectum, Athyrium nigripes, Athyrium nikkoense, Athyrium
niponicum, Athyrium nyalamense, Athyrium oblitescens, Athyrium
otophorum, Athyrium palustre, Athyrium pinetorum, Athyrium
pubicostatum, Athyrium reflexipinnum, Athyrium rhachidosorum,
Athyrium rupestre, Athyrium scandicinum, Athyrium setuligerum,
Athyrium sheareri, Athyrium silvicola, Athyrium sinense, Athyrium
skinneri, Athyrium spinulosum, Athyrium strigillosum, Athyrium
subrigescens, Athyrium subtriangulare, Athyrium supraspinescens,
Athyrium tashiroi, Athyrium tozanense, Athyrium vidalii, Athyrium
viridescentipes, Athyrium wardii, Athyrium x akiense, Athyrium x
hisatsuanum, Athyrium x tokashikii, Athyrium yokoscense, and
Athyrium yui.
[0103] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales.
[0104] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Nephrolepidaceae.
[0105] n some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Nephrolepidaceae, Genus Nephrolepis selected
from but not limited to Nephrolepis abrupta, Nephrolepis
acutifolia, Nephrolepis averyi, Nephrolepis biserrata, Nephrolepis
brownii, Nephrolepis copelandi, Nephrolepis cordifolia, Nephrolepis
davalliae, Nephrolepis davallioides, Nephrolepis dicksonioides,
Nephrolepis exaltata, Nephrolepis falcata, Nephrolepis falciformis,
Nephrolepis hippocrepicis, Nephrolepis laurifolia, Nephrolepis
lauterbachii, Nephrolepis medlerae, Nephrolepis obliterata,
Nephrolepis pectinata, Nephrolepis pendula, Nephrolepis
pseudobiserrata, Nephrolepis radicans, Nephrolepis rivularis, and
Nephrolepis undulata.
[0106] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Polypodiaceae.
[0107] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the order
Polypodiales, Family Polypodiaceae, Genus Platycerium selected from
but not limited to Platycerium alcicome, Platycerium andinum,
Platycerium angolense, Platycerium bifurcatum, Platycerium
coronarium, Platycerium elephantotis, Platycerium ellisii,
Platycerium grande, Platycerium hillii, Platycerium holttumii,
Platycerium madagascariense, Platycerium quadridichotomum,
Platycerium ridleyi, Platycerium stemana, Platycerium superbum,
Platycerium veitchin, Platycerium wallichin, Platycerium wandae,
Platycerium wilhelminae-reginae, and Platycerium willinkii.
[0108] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the order
Polypodiales, Family Polypodiaceae, Genus Colysis selected from but
not limited to Colysis ampla, Colysis digitata, Colysis
diversifolia, Colysis elegans Colysis elliptica, Colysis flexiloba,
Colysis hemionitidea, Colysis hemitoma, Colysis henryi, Colysis
insignis, Colysis intermedia, Colysis leveillei, Colysis longipes,
Colysis pedunculata, Colysis pentaphylla, Colysis pothifolia,
Colysis pteropus, Colysis shintenensis, Colysis simplicifrons,
Colysis triphylla, Colysis wrightii, and Colysis x
shintenensis.
[0109] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Pteridaceae.
[0110] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Pteridaceae, Genus Pteris selected from but
not limited to Pteris actiniopteroides, Pteris amoena, Pteris
angustipinna, Pteris angustipinnula, Pteris aspericaulis, Pteris
austrosinica, Pteris baksaensis, Pteris bella, Pteris biaurita,
Pteris bomiensis, Pteris cadieri, Pteris changjiangensis, Pteris
confertinervia, Pteris crassiuscula, Pteris cretica, Pteris
cryptogrammoides, Pteris dactylina, Pteris dangiana, Pteris
decrescens, Pteris deltodon, Pteris dispar, Pteris dissitifolia,
Pteris ensiformis, Pteris esquirolii, Pteris excelsa, Pteris
fauriei, Pteris finotii, Pteris formosana, Pteris gallinopes,
Pteris gracillima, Pteris grevilleana, Pteris guangdongensis,
Pteris guizhouensis, Pteris henryi, Pteris heteromorpha, Pteris
hui, Pteris insignis, Pteris kidoi, Pteris kiuschinensis, Pteris
kiuschiuensis, Pteris laurisilvicola, Pteris libonsis, Pteris
linearis, Pteris longipes, Pters longipinna, Pteris longipinnula,
Pteris maclurei, Pteris maclurioides, Pteris medogensis, Pteris
morii, Pteris multifida, Pteris nipponica, Pteris obtusiloba,
Pteris occidentali-sinica, Pteris oshimensis, Pteris paucipinnula,
Pteris plumbea, Pteris pseudodactylina, Pteris pseudopellucida,
Pteris puberula, Pteris quadristipitis, Pteris quinquefoliata,
Pteris rufopilosa, Pteris ryukyuensis, Pteris sanduensis, Pteris
scabristipes, Pteris semipinnata, Pteris setulosocostulata, Pteris
shimianensis, Pteris sichuanensis, Pteris sinensis, Pteris
splendida, Pteris stenophylla, Pteris subquinata, Pteris
taiwanensis, Pteris tibetica, Pteris tripartita, Pteris
undulatipinna, Pteris venusta, Pteris viridissima, Pteris vittata,
Pteris wallichiana, Pteris wangiana, Pteris xiaoyingiae, Pteris
xichouensis, and Pteris x wulaiensis.
[0111] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Tectariaceae.
[0112] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Tectariaceae, Genus Tectaria selected from but
not limited to Tectaria acerifolia, Tectaria acrocarpa, Tectaria
adenophora, Tectaria aequatoriensis, Tectaria amblyotis, Tectaria
amphiblestra, Tectaria andersonii, Tectaria angelicifolia, Tectaria
angulata, Tectaria antioquiana, Tectaria athyrioides, Tectaria
athyriosora, Tectana aurita, Tectana balansae, Tectaria barberi,
Tectaria barteri, Tectaria beccariana, Tectana blumeana, Tectana
brachiata, Tectaria brauniana, Tectaria brevilobata, Tectaria
brooksii, Tectaria buchtienii, Tectaria calcarea, Tectana
camerooniana, Tectana chattagramica, Tectana cherasica, Tectaria
chimborazensis, Tectaria chinensis, Tectaria christii, Tectana
christovalensis, Tectaria cicutaria, Tectaria coadunata, Tectaria
confluens, Tectaria consimilis, Tectaria cordulata, Tectaria
coriandrifolia, Tectaria craspedocarpa, Tectaria crenata, Tectaria
crinigera, Tectaria croftii, Tectaria curtisin, Tectaria
danfuensis, Tectaria decaryana, Tectana decastroi, Tectaria
decurrens, Tectaria degeneri, Tectaria dolichosora, Tectaria
draconoptera, Tectana dubia, Tectana durvillei, Tectaria ebenina,
Tectana estremerana, Tectaria exaunculata, Tectana fauriei,
Tectaria fengii, Tectaria femandensis, Tectana ferruginea, Tectaria
filisquamata, Tectaria fimbriata, Tectaria fissa, Tectaria
gaudichaudii, Tectaria gemmifera, Tectaria godeffroyi, Tectaria
grandidentata, Tectaria griffithii var. singaporeana, Tectaria
grossedentata, Tectaria hederifolia, Tectaria hekouensis, Tectaria
heracleifolia, Tectaria herpetocaulos, Tectaria heterocarpa,
Tectaria hilocarpa, Tectaria hoittumif, Tectaria hookeri, Tectaria
humbertiana, Tectaria hymenodes, Tectaria hymenophylla, Tectaria
impressa, Tectaria incisa, Tectaria inopinata, Tectaria isomorpha,
Tectaria jacobsii, Tectaria jardini, Tectaria johannis-winkleri,
Tectaria keckii, Tectaria kehdingiana, Tectaria kingii, Tectaria
kouniensis, Tectana kweichowensis, Tectana labrusca, Tectana lacei,
Tectaria laotica, Tectana latifolia, Tectana lawrenceana, Tectaria
laxa, Tectaria leptophylla, Tectana lifuensis, Tectaria
lizarzaburui, Tectana lobbii, Tectaria lombokensis, Tectaria
macrosora, Tectana macrota, Tectana madagascarica, Tectaria
magnifica, Tectana manilensis, Tectana marchionica, Tectaria media,
Tectaria melanocaulis, Tectaria melanocauloides, Tectaria
melanorachis, Tectaria menyanthidis, Tectaria mesodon, Tectaria
mexicana, Tectaria microchlamys, Tectaria microlepis, Tectaria
minuta, Tectaria moorei, Tectaria morlae, Tectaria moussetii,
Tectaria murrayi, Tectaria nabirensis, Tectana nausoriensis,
Tectana nebulosa, Tectana nesiotica, Tectaria nicaraguensis,
Tectaria nicotianifolia, Tectaria nitens, Tectaria novoguineensis,
Tectaria organensis, Tectaria palmate, Tectaria pandurifolia,
Tectaria pedata, Tectaria pentagonalis, Tectaria perdimorpha,
Tectaria phaeocaulis, Tectaria pica, Tectaria pilosa, Tectana
plantaginea, Tectana pleiosora, Tectana pleiotoma, Tectaria
poilanei, Tectana polymorpha, Tectaria prolifera, Tectana
pseudosinuata, Tectaria x pteropus-minor, Tectaria pubens, Tectaria
puberula, Tectaria pubescens, Tectaria quinquefida, Tectaria
quitensis, Tectana ramosii, Tectana rara, Tectaria remotipinna,
Tectaria repanda, Tectaria rheophytica, Tectana ngida, Tectaria
rivalis, Tectaria rockii, Tectana rufescens, Tectaria rufovillosa,
Tectaria sagenioides, Tectaria schmutzii, Tectana schultzei,
Tectaria seemannii, Tectaria semibipinnata, Tectana semipinnata,
Tectana seramensis, Tectana siifolia, Tectaria simaoensis, Tectaria
simonsii, Tectana simulans, Tectana singaporeana, Tectaria sinuata,
Tectaria squamipes, Tectaria stalactica, Tectaria stearnsii,
Tectaria stenosemioides, Tectaria subcaudata, Tectaria
subconfluens, Tectaria subcordata, Tectaria subdigitata, Tectaria
subebenea, Tectaria subrepanda, Tectaria subsageniacea, Tectaria
subtriloba, Tectaria subtriphylla, Tectaria sulitii, Tectaria
suluensis, Tectaria sumatrana, Tectaria tabonensis, Tectaria
taccifolia, Tectaria tahitensis, Tectaria tenerfrons, Tectaria
tenuifolia, Tectaria teratocarpa, Tectaria ternata, Tectana
transiens, Tectana translucens, Tectana tricuspis, Tectaria
trifida, Tectaria trifoliata, Tectana triglossa, Tectaria trloba,
Tectana tinmenii, Tectaria tinnitensis, Tectaria tripartita,
Tectana variabilis, Tectaria vasta, Tectana vieillardii, Tectana
villosa, Tectana vitiensis, Tectana vivipara, Tectana waterlotii,
Tectaria weberi, Tectaria wightii, Tectana x amesiana, Tectaria x
cynthiae, Tectaria yunnanensis, Tectaria zeylanica, and Tectaria
zollinger.
[0113] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Davalliaceae.
[0114] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fem species in the Order
Polypodiales, Family Davalliaceae Genus Davallia selected from but
not limited to Davallia adiantoides, Davallia amabilis, Davallia
assamica, Davallia austrosinica, Davallia biflora, Davallia
boryana, Davallia brachypoda, Davallia brevisora, Davallia bullata,
Davallia bullata, Davallia calvescens, Davallia calvescens,
Davallia canariensis, Davallia chaerophylla, Davallia
chaerophylloide, Davallia chrysanthemifolia, Davallia clarkei,
Davallia cumingii, Davallia cylindrica, Davallia divaricata,
Davallia divaricata, Davallia divaricata var. orientale, Davallia
domingensis, Davallia dubia, Davallia elmeri, Davallia falcata,
Davallia falcinella, Davallia ferulacea, Davallia flaccida,
Davallia formosana, Davallia fumaroides, Davallia goudotiana,
Davallia gracilis, Davallia griffithiana, Davallia griffithiana,
Davallia henryana, Davallia heterophylla, Davallia hookeriana,
Davallia hymenophylloides, Davallia immersa, Davallia inaequalis
var. minor, Davallia jamaicensis, Davallia khasiyana, Davallia
kurzii, Davallia lepida, Davallia lepida, Davallia macraeana,
Davallia magellanica, Davallia mariesii, Davallia membranulosa,
Davallia membranulosa, Davallia millefolium, Davallia moorei,
Davallia multidentata, Davallia nodosa, Davallia novae-guineae,
Davallia orientalis, Davallia parallela, Davallia parkeri, Davallia
parvipinnula, Davallia patens, Davallia pectinata, Davallia
perdurans, Davallia pilosula, Davallia platylepis, Davallia
polypodioides, Davallia polypodioides var. hispida, Davallia
polypodioides var. pilosula, Davallia pseudocystopteris, Davallia
puberula, Davallia pyramidata, Davallia pyxidata, Davallia repens,
Davallia rhomboidea, Davallia rhomboidea, Davallia rhomboidea,
Davallia sinensis, Davallia sloanei, Davallia solida, Davallia
solida, Davallia stipellata, Davallia strigosa, Davallia strigosa,
Davallia strigosa var. rhomboidea, Davallia subalpina, Davallia
subsolida, Davallia teyermannii, Davallia triangularis, Davallia
tripinnata, Davallia truncata, Davallia tyermanni, Davallia
tyermannii, Davallia uncinella, Davallia urophylla, Davallia
vestita, Davallia wilfordii var. contracta, and Davallia
yunnanensis.
[0115] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Dryopteridaceae.
[0116] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Dryopteridaceae, Genus Polystichum selected
from but not limited to Polystichum acanthophylum, Polystichum
aculeatum, Polystichum acutidens, Polystichum acutipinnulum,
Polystichum adungense, Polystichum alcicorne, Polystichum altum,
Polystichum anomalum, Polystichum ariticulatipilosum, Polystichum
assurgentipinnum, Polystichum atkinsonii, Polystichum attenuatum,
Polystichum auriculum, Polystichum bakeranum, Polystichum
baoxingense, Polystichum biaristatum, Polystichum bifidum,
Polystichum bigemmatum, Polystichum bissectum, Polystichum
bomiense, Polystichum brachypterum, Polystichum braunii,
Polystichum capillipes, Polystichum castaneum, Polystichum
chingiae, Polystichum christii, Polystichum chunii, Polystichum
consimile, Polystichum costularisorum, Polystichum craspedosorum,
Polystichum crassinervium, Polystichum cringerum, Polystichum
cuneatiforme, Polystichum cyclolobum, Polystichum daguanense,
Polystichum dangii, Polystichum delavayi, Polystichum deltodon,
Polystichum dielsii, Polystichum diffundens, Polystichum discretum,
Polystichum disjunctum, Polystichum duthiei, Polystichum
elevatovenusum, Polystichum erosum, Polystichum exauriforme,
Polystichum excellens, Polystichum excelsius, Polystichum
fimbriatum, Polystichum formosanum, Polystichum frigidicola,
Polystichum fugongense, Polystichum gongboense, Polystichum
grandifrons, Polystichum guangxiense, Polystichum gymnocarpium,
Polystichum habaense, Polystichum hancockif, Polystichum
hecatopteron, Polystichum herbaceum, Polystichum houchangense,
Polystichum huae, Polystichum ichangense, Polystichum inaense,
Polystichum incisopinnulum, Polystichum integrlimbum, Polystichum
integrilobum, Polystichum jinfoshaense, Polystichum jiulaodongense,
Polystichum jizhushanense, Polystichum kangdingense, Polystichum
kungianum, Polystichum kwangtungense, Polystichum lachenense,
Polystichum lanceolatum, Polystichum langchungense, Polystichum
latilepis, Polystichum lentum, Polystichum leveillei, Polystichum
liui, Polystichum lonchitis, Polystichum longiaristatum,
Polystichum longidens, Polystichum longipaleatum, Polystichum
longipes, Polystichum longipinnulum, Polystichum longispinosum,
Polystichum longissimum, Polystichum macrochlaenum, Polystichum
makinoi, Polystichum manmeiense, Polystichum martinii, Polystichum
mayebarae, Polystichum medogense, Polystichum mehrae, Polystichum
meiguense, Polystichum melanostipes, Polystichum mollissimum,
Polystichum morii, Polystichum moupinense, Polystichum muscicola,
Polystichum nayongense, Polystichum neoliuii, Polystichum
neolobatum, Polystichum nepalense, Polystichum nigrum, Polystichum
ningshenense, Polystichum nudisorum, Polystichum obliquum,
Polystichum oblongum, Polystichum oligocarpum, Polystichum
omeiense, Polystichum oreodoxa, Polystichum orientalitibeticum,
Polystichum otophorum, Polystichum ovato-paleaceum, Polystichum
paramoupinense, Polystichum parvifoliolatum, Polystichum
parvipinnulum, Polystichum pianmaense, Polystichum piceo-paleaceum,
Polystichum polyblepharum, Polystichum prescottianum, Polystichum
prionolepis, Polystichum pseudocastaneum, Polystichum
pseudolanceolatum, Polystichum pseudomakinoi, Polystichum
pseudorhomboideum, Polystichum pseudosetosum, Polystichum
pseudoxiphophyllum, Polystichum punctiferum, Polystichum puteicola,
Polystichum pycnopterum, Polystichum qamdoense, Polystichum
retrosopaleaceum, Polystichum revolutum, Polystichum rhombiforme,
Polystichum rigens, Polystichum robustum, Polystichum
rufopaleaceum, Polystichum saxicola, Polystichum semifertile,
Polystichum setillosum, Polystichum shandongense, Polystichum
shensiense, Polystichum shimurae, Polystichum simplicipinnum,
Polystichum sinense, Polystichum sinotsus-simense, Polystichum
sozanense, Polystichum speluncicola, Polystichum squarrosum,
Polystichum stenophyllum, Polystichum stimulans, Polystichum
subacutidens, Polystichum subdeltodon, Polystichum subfimbriatum,
Polystichum submarginale, Polystichum submite, Polystichum
subulatum, Polystichum tacticopterum, Polystichum taizhongense,
Polystichum tangmaiense, Polystichum thomsonii, Polystichum
tibeticum, Polystichum tonkinense, Polystichum tripteron,
Polystichum tsingkanshanense, Polystichum tsus-simense, Polystichum
wattii, Polystichum xiphophyllum, Polystichum yadongense,
Polystichum yuanum, Polystichum yunnanense, and Polystichum
zayuense.
[0117] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Thelypteridaceae.
[0118] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is derived from a fern species in the Order
Polypodiales, Family Thelypteridaceae, Genus Thelypteris selected
from but not limited to Thelypteris abrupta, Thelypteris acuminata,
Thelypteris affinis, Thelypteris angulariloba, Thelypteris
angustifrons, Thelypteris aurita, Thelypteris beddomei, Thelypteris
boninensis, Thelypteris bukoensis, Thelypteris castanea,
Thelypteris clypeolutata, Thelypteris consanguinea, Thelypteris
cystopteroides, Thelypteris dayi, Thelypteris erubescens,
Thelypteris esquirolin, Thelypteris flexilis, Thelypteris
gemmulifera, Thelypteris glandulosa, Thelypteris globulifera,
Thelypteris gracilescens, Thelypteris gracilis, Thelypteris
interrupta, Thelypteris jaculosa, Thelypteris japonica, Thelypteris
laxa, Thelypteris linkiana, Thelypteris liukiuensis, Thelypteris
longissima, Thelypteris meniscioides, Thelypteris miyagii,
Thelypteris musashiensis, Thelypteris navarrensis, Thelypteris
nevadensis, Thelypteris nipponica, Thelypteris ogasawarensis,
Thelypteris oligocarpa, Thelypteris omeiensis, Thelypteris
opulenta, Thelypteris ovata, Thelypteris palustris, Thelypteris
parasitica, Thelypteris poiteana, Thelypteris reticulata,
Thelypteris rustica, Thelypteris seemannii, Thelypteris sp. b1-007,
Thelypteris sp. Janssen 2679, Thelypteris subaurita, Thelypteris
taiwanensis, Thelypteris truncata, Thelypteris tylodes, Thelypteris
uraiensis, and Thelypteris viridifrons.
[0119] Polynucleotides that encode IPD103 polypeptides can also be
synthesized de novo from an IPD103 polypeptide sequence. The
sequence of the polynucleotide gene can be deduced from an IPD103
polypeptide sequence through use of the genetic code. Computer
programs such as "BackTranslate" (GCG.TM. Package, Acclerys, Inc.
San Diego, Calif.) can be used to convert a peptide sequence to the
corresponding nucleotide sequence encoding the peptide. Examples of
IPD103 polypeptide sequences that can be used to obtain
corresponding nucleotide encoding sequences include, but are not
limited to the IPD103 polypeptides of SEQ ID NO: 2, SEQ ID NO: 4,
SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID
NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22,
SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID
NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, and SEQ ID NO: 38.
Furthermore, synthetic IPD103 polynucleotide sequences of the
disclosure can be designed so that they will be expressed in
plants.
[0120] In some embodiments the nucleic acid molecule encoding an
IPD103 polypeptide is a polynucleotide having the sequence set
forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7,
SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID
NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25,
SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID
NO: 35 or SEQ ID NO: 37, and variants, fragments and complements
thereof. "Complement" is used herein to refer to a nucleic acid
sequence that is sufficiently complementary to a given nucleic acid
sequence such that it can hybridize to the given nucleic acid
sequence to thereby form a stable duplex. "Polynucleotide sequence
variants" is used herein to refer to a nucleic acid sequence that
except for the degeneracy of the genetic code encodes the same
polypeptide.
[0121] In some embodiments the nucleic acid molecule encoding the
IPD103 polypeptide is a non-genomic nucleic acid sequence. As used
herein a "non-genomic nucleic acid sequence" or "non-genomic
nucleic acid molecule" or "non-genomic polynucleotide" refers to a
nucleic acid molecule that has one or more change in the nucleic
acid sequence compared to a native or genomic nucleic acid
sequence. In some embodiments the change to a native or genomic
nucleic acid molecule includes but is not limited to: changes in
the nucleic acid sequence due to the degeneracy of the genetic
code; optimization of the nucleic acid sequence for expression in
plants; changes in the nucleic acid sequence to introduce at least
one amino acid substitution, insertion, deletion and/or addition
compared to the native or genomic sequence; removal of one or more
intron associated with the genomic nucleic acid sequence; insertion
of one or more heterologous introns; deletion of one or more
upstream or downstream regulatory regions associated with the
genomic nucleic acid sequence; insertion of one or more
heterologous upstream or downstream regulatory regions; deletion of
the 5' and/or 3' untranslated region associated with the genomic
nucleic acid sequence; insertion of a heterologous 5' and/or 3'
untranslated region; and modification of a polyadenylation site. In
some embodiments the non-genomic nucleic acid molecule is a
synthetic nucleic acid sequence.
[0122] In some embodiments the nucleic acid molecule encoding an
IPD103 polypeptide is a non-genomic polynucleotide having a
nucleotide sequence having at least 50%, 51%, 52%, 53%, 54%, 55%,
56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%,
69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%,
82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99% or greater identity, to the nucleic acid
sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7,
SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID
NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25,
SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID
NO: 35 or SEQ ID NO: 37, wherein the IPD103 polypeptide has
insecticidal activity.
[0123] In some embodiments the nucleic acid molecule encodes an
IPD103 polypeptide comprising an amino acid sequence of SEQ ID NO:
2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID
NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20,
SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID
NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, and SEQ ID NO:
38 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 1011, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35 or more amino acid substitutions, deletions and/or insertions
compared to the native amino acid at the corresponding position of
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO:
10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ
ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO:
28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, and
SEQ ID NO: 38.
[0124] In some embodiments the nucleic acid molecule encodes an
IPD103 polypeptide variant comprising any one or more amino acid
substitutions of Table 5 or 7.
[0125] Also provided are nucleic acid molecules that encode
transcription and/or translation products that are subsequently
spliced to ultimately produce functional IPD103 polypeptides.
Splicing can be accomplished in vitro or in vivo, and can involve
cis- or trans-splicing. The substrate for splicing can be
polynucleotides (e.g., RNA transcripts) or polypeptides. An example
of cis-splicing of a polynucleotide is where an intron inserted
into a coding sequence is removed and the two flanking exon regions
are spliced to generate an IPD103 polypeptide encoding sequence. An
example of trans-splicing would be where a polynucleotide is
encrypted by separating the coding sequence into two or more
fragments that can be separately transcribed and then spliced to
form the full-length pesticidal encoding sequence. The use of a
splicing enhancer sequence, which can be introduced into a
construct, can facilitate splicing either in cis or trans-splicing
of polypeptides (U.S. Pat. Nos. 6,365,377 and 6,531,316). Thus, in
some embodiments the polynucleotides do not directly encode a
full-length IPD103 polypeptide, but rather encode a fragment or
fragments of an IPD103 polypeptide. These polynucleotides can be
used to express a functional IPD103 polypeptide through a mechanism
involving splicing, where splicing can occur at the level of
polynucleotide (e.g., intron/exon) and/or polypeptide (e.g.,
intein/extein). This can be useful, for example, in controlling
expression of pesticidal activity, since a functional pesticidal
polypeptide will only be expressed if all required fragments are
expressed in an environment that permits splicing processes to
generate functional product. In another example, introduction of
one or more insertion sequences into a polynucleotide can
facilitate recombination with a low homology polynucleotide; use of
an intron or intein for the insertion sequence facilitates the
removal of the intervening sequence, thereby restoring function of
the encoded variant.
[0126] Nucleic acid molecules that are fragments of these nucleic
acid sequences encoding IPD103 polypeptides are also encompassed by
the embodiments. "Fragment" as used herein refers to a portion of
the nucleic acid sequence encoding an IPD103 polypeptide. A
fragment of a nucleic acid sequence may encode a biologically
active portion of an IPD103 polypeptide or it may be a fragment
that can be used as a hybridization probe or PCR primer using
methods disclosed below. Nucleic acid molecules that are fragments
of a nucleic acid sequence encoding an IPD103 polypeptide comprise
at least about 150, 180, 210, 240, 270, 300, 330 or 360, contiguous
nucleotides or up to the number of nucleotides present in a
full-length nucleic acid sequence encoding an IPD103 polypeptide
disclosed herein, depending upon the intended use. "Contiguous
nucleotides" is used herein to refer to nucleotide residues that
are immediately adjacent to one another. Fragments of the nucleic
acid sequences of the embodiments will encode protein fragments
that retain the biological activity of the IPD103 polypeptide and,
hence, retain insecticidal activity. "Retains insecticidal
activity" is used herein to refer to a polypeptide having at least
about 10%, at least about 30%, at least about 50%, at least about
70%, 80%, 90%, 95% or higher of the insecticidal activity of the
full-length IPD103Aa polypeptide (SEQ ID NO: 2). In some
embodiments, the insecticidal activity is against a Lepidopteran
species. In one embodiment, the insecticidal activity is against a
Coleopteran species. In some embodiments, the insecticidal activity
is against one or more insect pests of the corn rootworm complex:
western corn rootworm, Diabrotica virgifera; northern corn
rootworm, D. barberi Southern corn rootworm or spotted cucumber
beetle; Diabrotica undecimpunctata howardi, and the Mexican corn
rootworm, D. virgifera zeae. In one embodiment, the insecticidal
activity is against a Diabrotica species.
[0127] In some embodiments the IPD103 polypeptide is encoded by a
nucleic acid sequence sufficiently homologous to the nucleic acid
sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7,
SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID
NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25,
SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID
NO: 35 or SEQ ID NO: 37. "Sufficiently homologous" is used herein
to refer to an amino acid or nucleic acid sequence that has at
least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%,
85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, 99% or greater sequence homology compared to a reference
sequence using one of the alignment programs described herein using
standard parameters. One of skill in the art will recognize that
these values can be appropriately adjusted to determine
corresponding homology of proteins encoded by two nucleic acid
sequences by taking into account degeneracy, amino acid similarity,
reading frame positioning, and the like. In some embodiments the
sequence homology is against the full length sequence of the
polynucleotide encoding an IPD103 polypeptide or against the full
length sequence of an IPD103 polypeptide.
[0128] In some embodiments the nucleic acid encodes an IPD103
polypeptide having at least about 50%, 55%, 60%, 65%, 70%, 75%,
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity
compared to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8,
SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID
NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26,
SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID
NO: 36 or SEQ ID NO: 38. In some embodiments the sequence identity
is calculated using ClustalW algorithm in the ALIGNX.RTM. module of
the Vector NTIO Program Suite (Invitrogen Corporation, Carlsbad,
Calif.) with all default parameters. In some embodiments the
sequence identity is across the entire length of polypeptide
calculated using ClustalW algorithm in the ALIGNX module of the
Vector NTI Program Suite (Invitrogen Corporation, Carlsbad, Calif.)
with all default parameters.
[0129] To determine the percent identity of two amino acid
sequences or of two nucleic acid sequences, the sequences are
aligned for optimal comparison purposes. The percent identity
between the two sequences is a function of the number of identical
positions shared by the sequences (i.e., percent identity=number of
identical positions/total number of positions (e.g., overlapping
positions).times.100). In one embodiment, the two sequences are the
same length. In another embodiment, the comparison is across the
entirety of the reference sequence (e.g., across the entirety of
SEQ ID NO: 1). The percent identity between two sequences can be
determined using techniques similar to those described below, with
or without allowing gaps. In calculating percent identity,
typically exact matches are counted.
[0130] Another non-limiting example of a mathematical algorithm
utilized for the comparison of sequences is the algorithm of
Needleman and Wunsch, (1970) J. Mol. Biol. 48(3):443-453, used GAP
Version 10 software to determine sequence identity or similarity
using the following default parameters: % identity and % similarity
for a nucleic acid sequence using GAP Weight of 50 and Length
Weight of 3, and the nwsgapdna.cmpii scoring matrix; % identity or
% similarity for an amino acid sequence using GAP weight of 8 and
length weight of 2, and the BLOSUM62 scoring program. Equivalent
programs may also be used. "Equivalent program" is used herein to
refer to any sequence comparison program that, for any two
sequences in question, generates an alignment having identical
nucleotide residue matches and an identical percent sequence
identity when compared to the corresponding alignment generated by
GAP Version 10.
[0131] In some embodiments the IPD103 polynucleotide encodes an
IPD103 polypeptide comprising an amino acid sequence having at
least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater identity
across the entire length of the amino acid sequence of SEQ ID NO:
2.
[0132] In some embodiments polynucleotides are provided encoding
chimeric polypeptides comprising regions of at least two different
IPD103 polypeptides of the disclosure.
[0133] In some embodiments polynucleotides are provided encoding
chimeric polypeptides comprising regions of at least two different
IPD103 polypeptides selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ
ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO:
14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ
ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO:
32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 229,
SEQ ID NO: 230, SEQ ID NO: 231, SEQ ID NO: 232, SEQ ID NO: 233, SEQ
ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID NO: 237, SEQ ID
NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO: 241, SEQ ID NO:
242, SEQ ID NO: 243, SEQ ID NO: 244, SEQ ID NO: 245, SEQ ID NO:
246, SEQ ID NO: 247, SEQ ID NO: 248, SEQ ID NO: 249, SEQ ID NO:
250, SEQ ID NO: 251, SEQ ID NO: 252, SEQ ID NO: 253, SEQ ID NO:
254, SEQ ID NO: 255, SEQ ID NO: 256, SEQ ID NO: 257, SEQ ID NO:
258, SEQ ID NO: 259, SEQ ID NO: 260, SEQ ID NO: 261, SEQ ID NO:
262, SEQ ID NO: 263, SEQ ID NO: 264, SEQ ID NO: 265, SEQ ID NO:
266, SEQ ID NO: 267, SEQ ID NO: 268, SEQ ID NO: 269, SEQ ID NO:
270, SEQ ID NO: 271, SEQ ID NO: 272, SEQ ID NO: 273, SEQ ID NO:
274, SEQ ID NO: 275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO:
278, SEQ ID NO: 279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO:
282, SEQ ID NO: 283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO:
286, SEQ ID NO: 287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO:
290, SEQ ID NO: 291, SEQ ID NO: 292, SEQ ID NO: 293, SEQ ID NO:
294, SEQ ID NO: 295, SEQ ID NO: 296, SEQ ID NO: 297, SEQ ID NO:
298, SEQ ID NO: 299, SEQ ID NO: 300, SEQ ID NO: 301, SEQ ID NO:
302, SEQ ID NO: 303, SEQ ID NO: 304, SEQ ID NO: 305, SEQ ID NO:
306, SEQ ID NO: 307, SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO:
310, SEQ ID NO: 311, SEQ ID NO: 312, SEQ ID NO: 313, SEQ ID NO:
314, SEQ ID NO: 315, SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO:
318, SEQ ID NO: 319, SEQ ID NO: 320, SEQ ID NO: 321, SEQ ID NO:
322, SEQ ID NO: 323, SEQ ID NO: 324, SEQ ID NO: 325, SEQ ID NO:
326, SEQ ID NO: 327, SEQ ID NO: 328, SEQ ID NO: 329, SEQ ID NO:
330, SEQ ID NO: 331, SEQ ID NO: 332, SEQ ID NO: 333, SEQ ID NO:
334, SEQ ID NO: 335, SEQ ID NO: 336, SEQ ID NO: 337, SEQ ID NO:
338, SEQ ID NO: 339, SEQ ID NO: 340, SEQ ID NO: 341, SEQ ID NO:
342, SEQ ID NO: 343, SEQ ID NO: 344, SEQ ID NO: 345, SEQ ID NO:
346, SEQ ID NO: 347, SEQ ID NO: 348, SEQ ID NO: 349, SEQ ID NO:
350, SEQ ID NO: 351, SEQ ID NO: 352, SEQ ID NO: 353, SEQ ID NO:
354, SEQ ID NO: 355, SEQ ID NO: 356, SEQ ID NO: 357, SEQ ID NO:
358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO: 361, SEQ ID NO:
362, SEQ ID NO: 363, SEQ ID NO: 364, SEQ ID NO: 365, SEQ ID NO:
366, SEQ ID NO: 367, SEQ ID NO: 368, SEQ ID NO: 369, SEQ ID NO:
370, SEQ ID NO: 371, SEQ ID NO: 372, SEQ ID NO: 373, SEQ ID NO:
374, SEQ ID NO: 375, SEQ ID NO: 376, SEQ ID NO: 377, SEQ ID NO:
378, SEQ ID NO: 379, SEQ ID NO: 380, SEQ ID NO: 381, SEQ ID NO:
382, SEQ ID NO: 383, SEQ ID NO: 384, SEQ ID NO: 385, SEQ ID NO:
386, SEQ ID NO: 387, SEQ ID NO: 388, SEQ ID NO: 389, SEQ ID NO:
390, SEQ ID NO: 391, SEQ ID NO: 392, SEQ ID NO: 393, SEQ ID NO:
394, SEQ ID NO: 395, SEQ ID NO: 396, SEQ ID NO: 397, SEQ ID NO:
398, SEQ ID NO: 399, SEQ ID NO: 400, SEQ ID NO: 401, SEQ ID NO:
402, SEQ ID NO: 403, SEQ ID NO: 404, SEQ ID NO: 405, SEQ ID NO:
406, SEQ ID NO: 407, SEQ ID NO: 408, SEQ ID NO: 409, SEQ ID NO:
410, SEQ ID NO: 411, SEQ ID NO: 412, SEQ ID NO: 413, SEQ ID NO:
414, SEQ ID NO: 415, SEQ ID NO: 416, SEQ ID NO: 445, SEQ ID NO:
446, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO:
450, SEQ ID NO: 451, SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO:
454, SEQ ID NO: 455, SEQ ID NO: 456, SEQ ID NO: 457, SEQ ID NO:
458, SEQ ID NO: 459, SEQ ID NO: 460, SEQ ID NO: 461, SEQ ID NO:
462, SEQ ID NO: 463, SEQ ID NO: 464, SEQ ID NO: 465, SEQ ID NO:
466, SEQ ID NO: 467, SEQ ID NO: 468, SEQ ID NO: 469, SEQ ID NO:
470, SEQ ID NO: 471, and SEQ ID NO: 472.
[0134] In some embodiments polynucleotides are provided encoding
chimeric polypeptides comprising an N-terminal Region of a first
IPD103 polypeptide of the disclosure operably fused to a C-terminal
Region of a second IPD103 polypeptide of the disclosure.
[0135] In some embodiments polynucleotides are provided encoding
chimeric polypeptides comprising an N-terminal Region of a first
IPD103 polypeptide operably fused to a C-terminal Region of a
second IPD103 polypeptide, where the IPD103 polypeptide is selected
from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID
NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18,
SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID
NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36,
SEQ ID NO: 38, SEQ ID NO: 229, SEQ ID NO: 230, SEQ ID NO: 231, SEQ
ID NO: 232, SEQ ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID
NO: 236, SEQ ID NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO:
240, SEQ ID NO: 241, SEQ ID NO: 242, SEQ ID NO: 243, SEQ ID NO:
244, SEQ ID NO: 245, SEQ ID NO: 246, SEQ ID NO: 247, SEQ ID NO:
248, SEQ ID NO: 249, SEQ ID NO: 250, SEQ ID NO: 251, SEQ ID NO:
252, SEQ ID NO: 253, SEQ ID NO: 254, SEQ ID NO: 255, SEQ ID NO:
256, SEQ ID NO: 257, SEQ ID NO: 258, SEQ ID NO: 259, SEQ ID NO:
260, SEQ ID NO: 261, SEQ ID NO: 262, SEQ ID NO: 263, SEQ ID NO:
264, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, SEQ ID NO:
268, SEQ ID NO: 269, SEQ ID NO: 270, SEQ ID NO: 271, SEQ ID NO:
272, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO: 275, SEQ ID NO:
276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO: 279, SEQ ID NO:
280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO: 283, SEQ ID NO:
284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO: 287, SEQ ID NO:
288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO: 291, SEQ ID NO:
292, SEQ ID NO: 293, SEQ ID NO: 294, SEQ ID NO: 295, SEQ ID NO:
296, SEQ ID NO: 297, SEQ ID NO: 298, SEQ ID NO: 299, SEQ ID NO:
300, SEQ ID NO: 301, SEQ ID NO: 302, SEQ ID NO: 303, SEQ ID NO:
304, SEQ ID NO: 305, SEQ ID NO: 306, SEQ ID NO: 307, SEQ ID NO:
308, SEQ ID NO: 309, SEQ ID NO: 310, SEQ ID NO: 311, SEQ ID NO:
312, SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO: 315, SEQ ID NO:
316, SEQ ID NO: 317, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO:
320, SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO: 323, SEQ ID NO:
324, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO: 327, SEQ ID NO:
328, SEQ ID NO: 329, SEQ ID NO: 330, SEQ ID NO: 331, SEQ ID NO:
332, SEQ ID NO: 333, SEQ ID NO: 334, SEQ ID NO: 335, SEQ ID NO:
336, SEQ ID NO: 337, SEQ ID NO: 338, SEQ ID NO: 339, SEQ ID NO:
340, SEQ ID NO: 341, SEQ ID NO: 342, SEQ ID NO: 343, SEQ ID NO:
344, SEQ ID NO: 345, SEQ ID NO: 346, SEQ ID NO: 347, SEQ ID NO:
348, SEQ ID NO: 349, SEQ ID NO: 350, SEQ ID NO: 351, SEQ ID NO:
352, SEQ ID NO: 353, SEQ ID NO: 354, SEQ ID NO: 355, SEQ ID NO:
356, SEQ ID NO: 357, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO:
360, SEQ ID NO: 361, SEQ ID NO: 362, SEQ ID NO: 363, SEQ ID NO:
364, SEQ ID NO: 365, SEQ ID NO: 366, SEQ ID NO: 367, SEQ ID NO:
368, SEQ ID NO: 369, SEQ ID NO: 370, SEQ ID NO: 371, SEQ ID NO:
372, SEQ ID NO: 373, SEQ ID NO: 374, SEQ ID NO: 375, SEQ ID NO:
376, SEQ ID NO: 377, SEQ ID NO: 378, SEQ ID NO: 379, SEQ ID NO:
380, SEQ ID NO: 381, SEQ ID NO: 382, SEQ ID NO: 383, SEQ ID NO:
384, SEQ ID NO: 385, SEQ ID NO: 386, SEQ ID NO: 387, SEQ ID NO:
388, SEQ ID NO: 389, SEQ ID NO: 390, SEQ ID NO: 391, SEQ ID NO:
392, SEQ ID NO: 393, SEQ ID NO: 394, SEQ ID NO: 395, SEQ ID NO:
396, SEQ ID NO: 397, SEQ ID NO: 398, SEQ ID NO: 399, SEQ ID NO:
400, SEQ ID NO: 401, SEQ ID NO: 402, SEQ ID NO: 403, SEQ ID NO:
404, SEQ ID NO: 405, SEQ ID NO: 406, SEQ ID NO: 407, SEQ ID NO:
408, SEQ ID NO: 409, SEQ ID NO: 410, SEQ ID NO: 411, SEQ ID NO:
412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID NO: 415, SEQ ID NO:
416, SEQ ID NO: 445, SEQ ID NO: 446, SEQ ID NO: 447, SEQ ID NO:
448, SEQ ID NO: 449, SEQ ID NO: 450, SEQ ID NO: 451, SEQ ID NO:
452, SEQ ID NO: 453, SEQ ID NO: 454, SEQ ID NO: 455, SEQ ID NO:
456, SEQ ID NO: 457, SEQ ID NO: 458, SEQ ID NO: 459, SEQ ID NO:
460, SEQ ID NO: 461, SEQ ID NO: 462, SEQ ID NO: 463, SEQ ID NO:
464, SEQ ID NO: 465, SEQ ID NO: 466, SEQ ID NO: 467, SEQ ID NO:
468, SEQ ID NO: 469, SEQ ID NO: 470, SEQ ID NO: 471, and SEQ ID NO:
472.
[0136] In some embodiments an IPD103 polynucleotide encodes the
IPD103 polypeptide comprising an amino acid sequence of SEQ ID NO:
2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID
NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20,
SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID
NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38,
SEQ ID NO: 229, SEQ ID NO: 230, SEQ ID NO: 231, SEQ ID NO: 232, SEQ
ID NO: 233, SEQ ID NO: 234, SEQ ID NO: 235, SEQ ID NO: 236, SEQ ID
NO: 237, SEQ ID NO: 238, SEQ ID NO: 239, SEQ ID NO: 240, SEQ ID NO:
241, SEQ ID NO: 242, SEQ ID NO: 243, SEQ ID NO: 244, SEQ ID NO:
245, SEQ ID NO: 246, SEQ ID NO: 247, SEQ ID NO: 248, SEQ ID NO:
249, SEQ ID NO: 250, SEQ ID NO: 251, SEQ ID NO: 252, SEQ ID NO:
253, SEQ ID NO: 254, SEQ ID NO: 255, SEQ ID NO: 256, SEQ ID NO:
257, SEQ ID NO: 258, SEQ ID NO: 259, SEQ ID NO: 260, SEQ ID NO:
261, SEQ ID NO: 262, SEQ ID NO: 263, SEQ ID NO: 264, SEQ ID NO:
265, SEQ ID NO: 266, SEQ ID NO: 267, SEQ ID NO: 268, SEQ ID NO:
269, SEQ ID NO: 270, SEQ ID NO: 271, SEQ ID NO: 272, SEQ ID NO:
273, SEQ ID NO: 274, SEQ ID NO: 275, SEQ ID NO: 276, SEQ ID NO:
277, SEQ ID NO: 278, SEQ ID NO: 279, SEQ ID NO: 280, SEQ ID NO:
281, SEQ ID NO: 282, SEQ ID NO: 283, SEQ ID NO: 284, SEQ ID NO:
285, SEQ ID NO: 286, SEQ ID NO: 287, SEQ ID NO: 288, SEQ ID NO:
289, SEQ ID NO: 290, SEQ ID NO: 291, SEQ ID NO: 292, SEQ ID NO:
293, SEQ ID NO: 294, SEQ ID NO: 295, SEQ ID NO: 296, SEQ ID NO:
297, SEQ ID NO: 298, SEQ ID NO: 299, SEQ ID NO: 300, SEQ ID NO:
301, SEQ ID NO: 302, SEQ ID NO: 303, SEQ ID NO: 304, SEQ ID NO:
305, SEQ ID NO: 306, SEQ ID NO: 307, SEQ ID NO: 308, SEQ ID NO:
309, SEQ ID NO: 310, SEQ ID NO: 311, SEQ ID NO: 312, SEQ ID NO:
313, SEQ ID NO: 314, SEQ ID NO: 315, SEQ ID NO: 316, SEQ ID NO:
317, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO: 320, SEQ ID NO:
321, SEQ ID NO: 322, SEQ ID NO: 323, SEQ ID NO: 324, SEQ ID NO:
325, SEQ ID NO: 326, SEQ ID NO: 327, SEQ ID NO: 328, SEQ ID NO:
329, SEQ ID NO: 330, SEQ ID NO: 331, SEQ ID NO: 332, SEQ ID NO:
333, SEQ ID NO: 334, SEQ ID NO: 335, SEQ ID NO: 336, SEQ ID NO:
337, SEQ ID NO: 338, SEQ ID NO: 339, SEQ ID NO: 340, SEQ ID NO:
341, SEQ ID NO: 342, SEQ ID NO: 343, SEQ ID NO: 344, SEQ ID NO:
345, SEQ ID NO: 346, SEQ ID NO: 347, SEQ ID NO: 348, SEQ ID NO:
349, SEQ ID NO: 350, SEQ ID NO: 351, SEQ ID NO: 352, SEQ ID NO:
353, SEQ ID NO: 354, SEQ ID NO: 355, SEQ ID NO: 356, SEQ ID NO:
357, SEQ ID NO: 358, SEQ ID NO: 359, SEQ ID NO: 360, SEQ ID NO:
361, SEQ ID NO: 362, SEQ ID NO: 363, SEQ ID NO: 364, SEQ ID NO:
365, SEQ ID NO: 366, SEQ ID NO: 367, SEQ ID NO: 368, SEQ ID NO:
369, SEQ ID NO: 370, SEQ ID NO: 371, SEQ ID NO: 372, SEQ ID NO:
373, SEQ ID NO: 374, SEQ ID NO: 375, SEQ ID NO: 376, SEQ ID NO:
377, SEQ ID NO: 378, SEQ ID NO: 379, SEQ ID NO: 380, SEQ ID NO:
381, SEQ ID NO: 382, SEQ ID NO: 383, SEQ ID NO: 384, SEQ ID NO:
385, SEQ ID NO: 386, SEQ ID NO: 387, SEQ ID NO: 388, SEQ ID NO:
389, SEQ ID NO: 390, SEQ ID NO: 391, SEQ ID NO: 392, SEQ ID NO:
393, SEQ ID NO: 394, SEQ ID NO: 395, SEQ ID NO: 396, SEQ ID NO:
397, SEQ ID NO: 398, SEQ ID NO: 399, SEQ ID NO: 400, SEQ ID NO:
401, SEQ ID NO: 402, SEQ ID NO: 403, SEQ ID NO: 404, SEQ ID NO:
405, SEQ ID NO: 406, SEQ ID NO: 407, SEQ ID NO: 408, SEQ ID NO:
409, SEQ ID NO: 410, SEQ ID NO: 411, SEQ ID NO: 412, SEQ ID NO:
413, SEQ ID NO: 414, SEQ ID NO: 415, SEQ ID NO: 416, SEQ ID NO:
445, SEQ ID NO: 446, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO:
449, SEQ ID NO: 450, SEQ ID NO: 451, SEQ ID NO: 452, SEQ ID NO:
453, SEQ ID NO: 454, SEQ ID NO: 455, SEQ ID NO: 456, SEQ ID NO:
457, SEQ ID NO: 458, SEQ ID NO: 459, SEQ ID NO: 460, SEQ ID NO:
461, SEQ ID NO: 462, SEQ ID NO: 463, SEQ ID NO: 464, SEQ ID NO:
465, SEQ ID NO: 466, SEQ ID NO: 467, SEQ ID NO: 468, SEQ ID NO:
469, SEQ ID NO: 470, SEQ ID NO: 471, and SEQ ID NO: 472.
[0137] The embodiments also encompass nucleic acid molecules
encoding IPD103 polypeptide variants. "Variants" of the IPD103
polypeptide encoding nucleic acid sequences include those sequences
that encode the IPD103 polypeptides disclosed herein but that
differ conservatively because of the degeneracy of the genetic code
as well as those that are sufficiently identical as discussed
above. Naturally occurring allelic variants can be identified with
the use of well-known molecular biology techniques, such as
polymerase chain reaction (PCR) and hybridization techniques as
outlined below. Variant nucleic acid sequences also include
synthetically derived nucleic acid sequences that have been
generated, for example, by using site-directed mutagenesis but
which still encode the IPD103 polypeptides disclosed as discussed
below.
[0138] The present disclosure provides isolated or recombinant
polynucleotides that encode any of the IPD103 polypeptides
disclosed herein. Those having ordinary skill in the art will
readily appreciate that due to the degeneracy of the genetic code,
a multitude of nucleotide sequences encoding IPD103 polypeptides of
the present disclosure exist.
[0139] The skilled artisan will further appreciate that changes can
be introduced by mutation of the nucleic acid sequences thereby
leading to changes in the amino acid sequence of the encoded IPD103
polypeptides, without altering the biological activity of the
proteins. Thus, variant nucleic acid molecules can be created by
introducing one or more nucleotide substitutions, additions and/or
deletions into the corresponding nucleic acid sequence disclosed
herein, such that one or more amino acid substitutions, additions
or deletions are introduced into the encoded protein. Mutations can
be introduced by standard techniques, such as site-directed
mutagenesis and PCR-mediated mutagenesis. Such variant nucleic acid
sequences are also encompassed by the present disclosure.
[0140] Alternatively, variant nucleic acid sequences can be made by
introducing mutations randomly along all or part of the coding
sequence, such as by saturation mutagenesis, and the resultant
mutants can be screened for ability to confer pesticidal activity
to identify mutants that retain activity. Following mutagenesis,
the encoded protein can be expressed recombinantly, and the
activity of the protein can be determined using standard assay
techniques.
[0141] The polynucleotides of the disclosure and fragments thereof
are optionally used as substrates for a variety of recombination
and recursive recombination reactions, in addition to standard
cloning methods as set forth in, e.g., Ausubel, Berger and
Sambrook, i.e., to produce additional pesticidal polypeptide
homologues and fragments thereof with desired properties. A variety
of such reactions are known, including those developed by the
inventors and their co-workers. Methods for producing a variant of
any nucleic acid listed herein comprising recursively recombining
such polynucleotide with a second (or more) polynucleotide, thus
forming a library of variant polynucleotides are also embodiments
of the disclosure, as are the libraries produced, the cells
comprising the libraries and any recombinant polynucleotide
produced by such methods. Additionally, such methods optionally
comprise selecting a variant polynucleotide from such libraries
based on pesticidal activity, as is wherein such recursive
recombination is done in vitro or in vivo.
[0142] A variety of diversity generating protocols, including
nucleic acid recursive recombination protocols are available and
fully described in the art. The procedures can be used separately,
and/or in combination to produce one or more variants of a nucleic
acid or set of nucleic acids, as well as variants of encoded
proteins. Individually and collectively, these procedures provide
robust, widely applicable ways of generating diversified nucleic
acids and sets of nucleic acids (including, e.g., nucleic acid
libraries) useful, e.g., for the engineering or rapid evolution of
nucleic acids, proteins, pathways, cells and/or organisms with new
and/or improved characteristics.
[0143] While distinctions and classifications are made in the
course of the ensuing discussion for clarity, it will be
appreciated that the techniques are often not mutually exclusive.
Indeed, the various methods can be used singly or in combination,
in parallel or in series, to access diverse sequence variants.
[0144] The result of any of the diversity generating procedures
described herein can be the generation of one or more nucleic
acids, which can be selected or screened for nucleic acids with or
which confer desirable properties or that encode proteins with or
which confer desirable properties. Following diversification by one
or more of the methods herein or otherwise available to one of
skill, any nucleic acids that are produced can be selected for a
desired activity or property, e.g. pesticidal activity or, such
activity at a desired pH, etc. This can include identifying any
activity that can be detected, for example, in an automated or
automatable format, by any of the assays in the art, see, e.g.,
discussion of screening of insecticidal activity, infra. A variety
of related (or even unrelated) properties can be evaluated, in
serial or in parallel, at the discretion of the practitioner.
[0145] Descriptions of a variety of diversity generating procedures
for generating modified nucleic acid sequences, e.g., those coding
for polypeptides having pesticidal activity or fragments thereof,
are found in the following publications and the references cited
therein: Soong, et al., (2000) Nat Genet 25(4):436-439; Stemmer, et
al., (1999) Tumor Targeting 4:1-4; Ness, et al., (1999) Nat
Biotechnol 17:893-896; Chang, et al., (1999) Nat Biotechnol
17:793-797; Minshull and Stemmer, (1999) Curr Opin Chem Biol
3:284-290; Christians, et al., (1999) Nat Biotechnol 17:259-264;
Crameri, et al., (1998) Nature 391:288-291; Crameri, et al., (1997)
Nat Biotechnol 15:436-438; Zhang, et al., (1997) PNAS USA
94:4504-4509; Patten, et al., (1997) Curr Opin Biotechnol
8:724-733; Crameri, et al., (1996) Nat Med 2:100-103; Crameri, et
al., (1996) Nat Biotechnol 14:315-319; Gates, et al., (1996) J Mol
Biol 255:373-386; Stemmer, (1996) "Sexual PCR and Assembly PCR" In:
The Encyclopedia of Molecular Biology. VCH Publishers, New York.
pp. 447-457; Crameri and Stemmer, (1995) BioTechniques 18:194-195;
Stemmer, et al., (1995) Gene, 164:49-53; Stemmer, (1995) Science
270: 1510; Stemmer, (1995) Bio/Technology 13:549-553; Stemmer,
(1994) Nature 370:389-391 and Stemmer, (1994) PNAS USA
91:10747-10751.
[0146] Mutational methods of generating diversity include, for
example, site-directed mutagenesis (Ling, et al., (1997) Anal
Biochem 254(2):157-178; Dale, et al., (1996) Methods Mol Biol
57:369-374; Smith, (1985) Ann Rev Genet 19:423-462; Botstein and
Shortle, (1985) Science 229:1193-1201; Carter, (1986) Biochem J
237:1-7 and Kunkel, (1987) "The efficiency of oligonucleotide
directed mutagenesis" in Nucleic Acids & Molecular Biology
(Eckstein and Lilley, eds., Springer Verlag, Berlin)); mutagenesis
using uracil containing templates (Kunkel, (1985) PNAS USA
82:488-492; Kunkel, et al., (1987) Methods Enzymol 154:367-382 and
Bass, et al., (1988) Science 242:240-245); oligonucleotide-directed
mutagenesis (Zoller and Smith, (1983) Methods Enzymol 100:468-500;
Zoller and Smith, (1987) Methods Enzymol 154:329-350 (1987); Zoller
and Smith, (1982) Nucleic Acids Res 10:6487-6500),
phosphorothioate-modified DNA mutagenesis (Taylor, et al., (1985)
Nucl Acids Res 13:8749-8764; Taylor, et al., (1985) Nucl Acids Res
13:8765-8787 (1985); Nakamaye and Eckstein, (1986) Nucl Acids Res
14:9679-9698; Sayers, et al., (1988) Nucl Acids Res 16:791-802 and
Sayers, et al., (1988) Nucl Acids Res 16:803-814); mutagenesis
using gapped duplex DNA (Kramer, et al., (1984) Nucl Acids Res
12:9441-9456; Kramer and Fritz, (1987) Methods Enzymol 154:350-367;
Kramer, et al., (1988) Nucl Acids Res 16:7207 and Fritz, et al.,
(1988) Nucl Acids Res 16:6987-6999).
[0147] Additional suitable methods include point mismatch repair
(Kramer, et al., (1984) Cell 38:879-887), mutagenesis using
repair-deficient host strains (Carter, et al., (1985) Nucl Acids
Res 13:4431-4443 and Carter, (1987) Methods in Enzymol
154:382-403), deletion mutagenesis (Eghtedarzadeh and Henikoff,
(1986) Nucl Acids Res 14:5115), restriction-selection and
restriction-purification (Wells, et al., (1986) Phil Trans R Soc
Lond A 317:415-423), mutagenesis by total gene synthesis (Nambiar,
et al., (1984) Science 223:1299-1301; Sakamar and Khorana, (1988)
Nucl Acids Res 14:6361-6372; Wells, et al., (1985) Gene 34:315-323
and Grundstrum, et al., (1985) Nucl Acids Res 13:3305-3316),
double-strand break repair (Mandecki, (1986) PNAS USA, 83:7177-7181
and Arnold, (1993) Curr Opin Biotech 4:450-455). Additional details
on many of the above methods can be found in Methods Enzymol Volume
154, which also describes useful controls for trouble-shooting
problems with various mutagenesis methods.
[0148] Additional details regarding various diversity generating
methods can be found in the following US Patents, PCT Publications
and Applications and EPO publications: U.S. Pat. Nos. 5,723,323,
5,763,192, 5,814,476, 5,817,483, 5,824,514, 5,976,862, 5,605,793,
5,811,238, 5,830,721, 5,834,252, 5,837,458, WO 1995/22625, WO
1996/33207, WO 1997/20078, WO 1997/35966, WO 1999/41402, WO
1999/41383, WO 1999/41369, WO 1999/41368, EP 752008, EP 0932670, WO
1999/23107, WO 1999/21979, WO 1998/31837, WO 1998/27230, WO
1998/27230, WO 2000/00632, WO 2000/09679, WO 1998/42832, WO
1999/29902, WO 1998/41653, WO 1998/41622, WO 1998/42727, WO
2000/18906, WO 2000/04190, WO 2000/42561, WO 2000/42559, WO
2000/42560, WO 2001/23401 and PCT/US01/06775.
[0149] The nucleotide sequences of the embodiments can also be used
to isolate corresponding sequences from a bacterial source,
including but not limited to a Pseudomonas species. In this manner,
methods such as PCR, hybridization, and the like can be used to
identify such sequences based on their sequence homology to the
sequences set forth herein. Sequences that are selected based on
their sequence identity to the entire sequences set forth herein or
to fragments thereof are encompassed by the embodiments. Such
sequences include sequences that are orthologs of the disclosed
sequences. The term "orthologs" refers to genes derived from a
common ancestral gene and which are found in different species as a
result of speciation. Genes found in different species are
considered orthologs when their nucleotide sequences and/or their
encoded protein sequences share substantial identity as defined
elsewhere herein. Functions of orthologs are often highly conserved
among species.
[0150] In a PCR approach, oligonucleotide primers can be designed
for use in PCR reactions to amplify corresponding DNA sequences
from cDNA or genomic DNA extracted from any organism of interest.
Methods for designing PCR primers and PCR cloning are generally
known in the art and are disclosed in Sambrook, et al., (1989)
Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor
Laboratory Press, Plainview, N.Y.), hereinafter "Sambrook". See
also, Innis, et al., eds. (1990) PCR Protocols: A Guide to Methods
and Applications (Academic Press, New York); Innis and Gelfand,
eds. (1995) PCR Strategies (Academic Press, New York); and Innis
and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New
York). Known methods of PCR include, but are not limited to,
methods using paired primers, nested primers, single specific
primers, degenerate primers, gene-specific primers, vector-specific
primers, partially-mismatched primers, and the like.
[0151] To identify potential IPD103 polypeptides from fern or other
primitive plants, the fern or other primitive plant cell lysates
can be screened with antibodies generated against an IPD103
polypeptides and/or IPD103 polypeptides using Western blotting
and/or ELISA methods. This type of assays can be performed in a
high throughput fashion. Positive samples can be further analyzed
by various techniques such as antibody based protein purification
and identification. Methods of generating antibodies are well known
in the art as discussed infra.
[0152] Alternatively, mass spectrometry based protein
identification method can be used to identify homologs of IPD103
polypeptides using protocols in the literatures (Scott Patterson,
(1998), 10.22, 1-24, Current Protocol in Molecular Biology
published by John Wiley & Son Inc). Specifically, LC-MS/MS
based protein identification method is used to associate the MS
data of given cell lysate or desired molecular weight enriched
samples (excised from SDS-PAGE gel of relevant molecular weight
bands to IPD103 polypeptides) with sequence information of IPD103
polypeptides of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID
NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16,
SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID
NO: 26 or SEQ ID NO: 28 and their homologs. Any match in peptide
sequences indicates the potential of having the homologous proteins
in the samples. Additional techniques (protein purification and
molecular biology) can be used to isolate the protein and identify
the sequences of the homologs.
[0153] In hybridization methods, all or part of the pesticidal
nucleic acid sequence can be used to screen cDNA or genomic
libraries. Methods for construction of such cDNA and genomic
libraries are generally known in the art and are disclosed in
Sambrook and Russell, (2001), supra. The so-called hybridization
probes may be genomic DNA fragments, cDNA fragments, RNA fragments
or other oligonucleotides and may be labeled with a detectable
group such as 32P or any other detectable marker, such as other
radioisotopes, a fluorescent compound, an enzyme or an enzyme
co-factor. Probes for hybridization can be made by labeling
synthetic oligonucleotides based on the known IPD103
polypeptide-encoding nucleic acid sequence disclosed herein.
Degenerate primers designed on the basis of conserved nucleotides
or amino acid residues in the nucleic acid sequence or encoded
amino acid sequence can additionally be used. The probe typically
comprises a region of nucleic acid sequence that hybridizes under
stringent conditions to at least about 12, at least about 25, at
least about 50, 75, 100, 125, 150, 175 or 200 consecutive
nucleotides of nucleic acid sequence encoding an IPD103 polypeptide
of the disclosure or a fragment or variant thereof. Methods for the
preparation of probes for hybridization are generally known in the
art and are disclosed in Sambrook and Russell, (2001), supra,
herein incorporated by reference.
[0154] For example, an entire nucleic acid sequence, encoding an
IPD103 polypeptide, disclosed herein or one or more portions
thereof may be used as a probe capable of specifically hybridizing
to corresponding nucleic acid sequences encoding IPD103
polypeptide-like sequences and messenger RNAs. To achieve specific
hybridization under a variety of conditions, such probes include
sequences that are unique and are preferably at least about 10
nucleotides in length or at least about 20 nucleotides in length.
Such probes may be used to amplify corresponding pesticidal
sequences from a chosen organism by PCR. This technique may be used
to isolate additional coding sequences from a desired organism or
as a diagnostic assay to determine the presence of coding sequences
in an organism. Hybridization techniques include hybridization
screening of plated DNA libraries (either plaques or colonies; see,
for example, Sambrook, et al., (1989) Molecular Cloning: A
Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, N.Y.).
[0155] Hybridization of such sequences may be carried out under
stringent conditions. "Stringent conditions" or "stringent
hybridization conditions" is used herein to refer to conditions
under which a probe will hybridize to its target sequence to a
detectably greater degree than to other sequences (e.g., at least
2-fold over background). Stringent conditions are
sequence-dependent and will be different in different
circumstances. By controlling the stringency of the hybridization
and/or washing conditions, target sequences that are 100%
complementary to the probe can be identified (homologous probing).
Alternatively, stringency conditions can be adjusted to allow some
mismatching in sequences so that lower degrees of similarity are
detected (heterologous probing). Generally, a probe is less than
about 1000 nucleotides in length, preferably less than 500
nucleotides in length
Compositions
[0156] Compositions comprising at least one IPD103 polypeptide or
IPD103 chimeric polypeptide of the disclosure are also
embraced.
Antibodies
[0157] Antibodies to an IPD103 polypeptide of the embodiments or to
variants or fragments thereof are also encompassed. The antibodies
of the disclosure include polyclonal and monoclonal antibodies as
well as fragments thereof which retain their ability to bind to an
IPD103 polypeptide found in the insect gut. An antibody, monoclonal
antibody or fragment thereof is said to be capable of binding a
molecule if it is capable of specifically reacting with the
molecule to thereby bind the molecule to the antibody, monoclonal
antibody or fragment thereof. The term "antibody" (Ab) or
"monoclonal antibody" (Mab) is meant to include intact molecules as
well as fragments or binding regions or domains thereof (such as,
for example, Fab and F(ab).sub.2 fragments) which are capable of
binding hapten. Such fragments are typically produced by
proteolytic cleavage, such as papain or pepsin. Alternatively,
hapten-binding fragments can be produced through the application of
recombinant DNA technology or through synthetic chemistry. Methods
for the preparation of the antibodies of the present disclosure are
generally known in the art. For example, see, Antibodies, A
Laboratory Manual, Ed Harlow and David Lane (eds.) Cold Spring
Harbor Laboratory, N.Y. (1988), as well as the references cited
therein. Standard reference works setting forth the general
principles of immunology include: Klein, J. Immunology: The Science
of Cell-Noncell Discrimination, John Wiley & Sons, N.Y. (1982);
Dennett, et al., Monoclonal Antibodies, Hybridoma: A New Dimension
in Biological Analyses, Plenum Press, N.Y. (1980) and Campbell,
"Monoclonal Antibody Technology," In Laboratory Techniques in
Biochemistry and Molecular Biology, Vol. 13, Burdon, et al.,
(eds.), Elsevier, Amsterdam (1984). See also, U.S. Pat. Nos.
4,196,265; 4,609,893; 4,713,325; 4,714,681; 4,716,111; 4,716,117
and 4,720,459. Antibodies against IPD103 polypeptides or
antigen-binding portions thereof can be produced by a variety of
techniques, including conventional monoclonal antibody methodology,
for example the standard somatic cell hybridization technique of
Kohler and Milstein, (1975) Nature 256:495. Other techniques for
producing monoclonal antibody can also be employed such as viral or
oncogenic transformation of B lymphocytes. An animal system for
preparing hybridomas is a murine system. Immunization protocols and
techniques for isolation of immunized splenocytes for fusion are
known in the art. Fusion partners (e.g., murine myeloma cells) and
fusion procedures are also known. The antibody and monoclonal
antibodies of the disclosure can be prepared by utilizing an IPD103
polypeptide as antigens.
[0158] A kit for detecting the presence of an IPD103 polypeptide or
detecting the presence of a nucleotide sequence encoding an IPD103
polypeptide in a sample is provided. In one embodiment, the kit
provides antibody-based reagents for detecting the presence of an
IPD103 polypeptide in a tissue sample. In another embodiment, the
kit provides labeled nucleic acid probes useful for detecting the
presence of one or more polynucleotides encoding an IPD103
polypeptide. The kit is provided along with appropriate reagents
and controls for carrying out a detection method, as well as
instructions for use of the kit.
Receptor Identification and Isolation
[0159] Receptors to the IPD103 polypeptide of the embodiments or to
variants or fragments thereof are also encompassed. Methods for
identifying receptors are well known in the art (see, Hofmann, et.
al., (1988) Eur. J. Biochem. 173:85-91; Gill, et al., (1995) J.
Biol. Chem. 27277-27282) can be employed to identify and isolate
the receptor that recognizes the IPD103 polypeptide using the
brush-border membrane vesicles from susceptible insects. In
addition to the radioactive labeling method listed in the cited
literatures, an IPD103 polypeptide can be labeled with fluorescent
dye and other common labels such as streptavidin. Brush-border
membrane vesicles (BBMV) of susceptible insects such as soybean
looper and stink bugs can be prepared according to the protocols
listed in the references and separated on SDS-PAGE gel and blotted
on suitable membrane. Labeled IPD103 polypeptide can be incubated
with blotted membrane of BBMV and labeled IPD103 polypeptide can be
identified with the labeled reporters. Identification of protein
band(s) that interact with the IPD103 polypeptide can be detected
by N-terminal amino acid gas phase sequencing or mass spectrometry
based protein identification method (Patterson, (1998) 10.22, 1-24,
Current Protocol in Molecular Biology published by John Wiley &
Son Inc). Once the protein is identified, the corresponding gene
can be cloned from genomic DNA or cDNA library of the susceptible
insects and binding affinity can be measured directly with the
IPD103 polypeptide. Receptor function for insecticidal activity by
the IPD103 polypeptide can be verified by accomplished by RNAi type
of gene knock out method (Rajagopal, et al., (2002) J. Biol. Chem.
277:46849-46851).
Nucleotide Constructs, Expression Cassettes and Vectors
[0160] The use of the term "nucleotide constructs" herein is not
intended to limit the embodiments to nucleotide constructs
comprising DNA. Those of ordinary skill in the art will recognize
that nucleotide constructs particularly polynucleotides and
oligonucleotides composed of ribonucleotides and combinations of
ribonucleotides and deoxyribonucleotides may also be employed in
the methods disclosed herein. The nucleotide constructs, nucleic
acids, and nucleotide sequences of the embodiments additionally
encompass all complementary forms of such constructs, molecules,
and sequences. Further, the nucleotide constructs, nucleotide
molecules, and nucleotide sequences of the embodiments encompass
all nucleotide constructs, molecules, and sequences which can be
employed in the methods of the embodiments for transforming plants
including, but not limited to, those comprised of
deoxyribonucleotides, ribonucleotides, and combinations thereof.
Such deoxyribonucleotides and ribonucleotides include both
naturally occurring molecules and synthetic analogues. The
nucleotide constructs, nucleic acids, and nucleotide sequences of
the embodiments also encompass all forms of nucleotide constructs
including, but not limited to, single-stranded forms,
double-stranded forms, hairpins, stem-and-loop structures and the
like.
[0161] A further embodiment relates to a transformed organism such
as an organism selected from plant and insect cells, bacteria,
yeast, baculovirus, protozoa, nematodes and algae. The transformed
organism comprises a DNA molecule of the embodiments, an expression
cassette comprising the DNA molecule or a vector comprising the
expression cassette, which may be stably incorporated into the
genome of the transformed organism.
[0162] The sequences of the embodiments are provided in DNA
constructs for expression in the organism of interest. The
construct will include 5' and 3' regulatory sequences operably
linked to a sequence of the embodiments. The term "operably linked"
as used herein refers to a functional linkage between a promoter
and a second sequence, wherein the promoter sequence initiates and
mediates transcription of the DNA sequence corresponding to the
second sequence. Generally, operably linked means that the nucleic
acid sequences being linked are contiguous and where necessary to
join two protein coding regions in the same reading frame. The
construct may additionally contain at least one additional gene to
be cotransformed into the organism. Alternatively, the additional
gene(s) can be provided on multiple DNA constructs.
[0163] Such a DNA construct is provided with a plurality of
restriction sites for insertion of the IPD103 polypeptide gene
sequence of the disclosure to be under the transcriptional
regulation of the regulatory regions. The DNA construct may
additionally contain selectable marker genes.
[0164] The DNA construct will generally include in the 5' to 3'
direction of transcription: a transcriptional and translational
initiation region (i.e., a promoter), a DNA sequence of the
embodiments, and a transcriptional and translational termination
region (i.e., termination region) functional in the organism
serving as a host. The transcriptional initiation region (i.e., the
promoter) may be native, analogous, foreign or heterologous to the
host organism and/or to the sequence of the embodiments.
Additionally, the promoter may be the natural sequence or
alternatively a synthetic sequence. The term "foreign" as used
herein indicates that the promoter is not found in the native
organism into which the promoter is introduced. Where the promoter
is "foreign" or "heterologous" to the sequence of the embodiments,
it is intended that the promoter is not the native or naturally
occurring promoter for the operably linked sequence of the
embodiments. As used herein, a chimeric gene comprises a coding
sequence operably linked to a transcription initiation region that
is heterologous to the coding sequence. Where the promoter is a
native or natural sequence, the expression of the operably linked
sequence is altered from the wild-type expression, which results in
an alteration in phenotype.
[0165] In some embodiments the DNA construct comprises a
polynucleotide encoding an IPD103 polypeptide of the
embodiments.
[0166] In some embodiments the DNA construct comprises a
polynucleotide encoding a chimeric IPD103 polypeptide of the
embodiments.
[0167] In some embodiments the DNA construct comprises a
polynucleotide encoding a fusion protein comprising an IPD103
polypeptide of the embodiments.
[0168] In some embodiments the DNA construct comprises a
polynucleotide comprising a first coding sequence encoding the
N-terminal Region of a first IPD103 polypeptide of the disclosure
and a second coding sequence encoding the C-terminal Region of a
second IPD103 polypeptide of the disclosure.
[0169] In some embodiments the DNA construct may also include a
transcriptional enhancer sequence. As used herein, the term an
"enhancer" refers to a DNA sequence which can stimulate promoter
activity, and may be an innate element of the promoter or a
heterologous element inserted to enhance the level or
tissue-specificity of a promoter. Various enhancers are known in
the art including for example, introns with gene expression
enhancing properties in plants (US Patent Application Publication
Number 2009/0144863, the ubiquitin intron (i.e., the maize
ubiquitin intron 1 (see, for example, NCBI sequence S94464)), the
omega enhancer or the omega prime enhancer (Gallie, et al., (1989)
Molecular Biology of RNA ed. Cech (Liss, New York) 237-256 and
Gallie, et al., (1987) Gene 60:217-25), the CaMV 35S enhancer (see,
e.g., Benfey, et al., (1990) EMBO J. 9:1685-96) and the enhancers
of U.S. Pat. No. 7,803,992 may also be used, each of which is
incorporated by reference. The above list of transcriptional
enhancers is not meant to be limiting. Any appropriate
transcriptional enhancer can be used in the embodiments.
[0170] The termination region may be native with the
transcriptional initiation region, may be native with the operably
linked DNA sequence of interest, may be native with the plant host
or may be derived from another source (i.e., foreign or
heterologous to the promoter, the sequence of interest, the plant
host or any combination thereof).
[0171] Convenient termination regions are available from the
Ti-plasmid of A. tumefaciens, such as the octopine synthase and
nopaline synthase termination regions. See also, Guerineau, et al.,
(1991) Mol. Gen. Genet. 262:141-144; Proudfoot, (1991) Cell
64:671-674; Sanfacon, et al., (1991) Genes Dev. 5:141-149; Mogen,
et al., (1990) Plant Cell 2:1261-1272; Munroe, et al., (1990) Gene
91:151-158; Ballas, et al., (1989) Nucleic Acids Res. 17:7891-7903
and Joshi, et al., (1987) Nucleic Acid Res. 15:9627-9639.
[0172] Where appropriate, a nucleic acid may be optimized for
increased expression in the host organism. Thus, where the host
organism is a plant, the synthetic nucleic acids can be synthesized
using plant-preferred codons for improved expression. See, for
example, Campbell and Gowri, (1990) Plant Physiol. 92:1-11 for a
discussion of host-preferred usage. For example, although nucleic
acid sequences of the embodiments may be expressed in both
monocotyledonous and dicotyledonous plant species, sequences can be
modified to account for the specific preferences and GC content
preferences of monocotyledons or dicotyledons as these preferences
have been shown to differ (Murray et al. (1989) Nucleic Acids Res.
17:477-498). Thus, the maize-preferred for a particular amino acid
may be derived from known gene sequences from maize. Maize usage
for 28 genes from maize plants is listed in Table 4 of Murray, et
al., supra. Methods are available in the art for synthesizing
plant-preferred genes. See, for example, Murray, et al., (1989)
Nucleic Acids Res. 17:477-498, and Liu H et al. Mol Bio Rep
37:677-684, 2010, herein incorporated by reference. A Zea maize
usage table can be also found at
kazusa.or.jp//cgi-bin/show.cgi?species=4577, which can be accessed
using the www prefix.
[0173] A Glycine max usage table can be found at
kazusa.or.jp//cgi-bin/show.cgi?species=3847&aa=1&style=N,
which can be accessed using the www prefix.
[0174] In some embodiments the recombinant nucleic acid molecule
encoding an IPD103 polypeptide has maize optimized codons.
[0175] Additional sequence modifications are known to enhance gene
expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon-intron
splice site signals, transposon-like repeats, and other
well-characterized sequences that may be deleterious to gene
expression. The GC content of the sequence may be adjusted to
levels average for a given cellular host, as calculated by
reference to known genes expressed in the host cell. The term "host
cell" as used herein refers to a cell which contains a vector and
supports the replication and/or expression of the expression vector
is intended. Host cells may be prokaryotic cells such as E. coli or
eukaryotic cells such as yeast, insect, amphibian or mammalian
cells or monocotyledonous or dicotyledonous plant cells. An example
of a monocotyledonous host cell is a maize host cell. When
possible, the sequence is modified to avoid predicted hairpin
secondary mRNA structures.
[0176] The expression cassettes may additionally contain 5' leader
sequences. Such leader sequences can act to enhance translation.
Translation leaders are known in the art and include: picomavirus
leaders, for example, EMCV leader (Encephalomyocarditis 5'
noncoding region) (Elroy-Stein, et al., (1989) Proc. Natl. Acad.
Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader
(Tobacco Etch Virus) (Gallie, et al., (1995) Gene 165(2):233-238),
MDMV leader (Maize Dwarf Mosaic Virus), human immunoglobulin
heavy-chain binding protein (BiP) (Macejak, et al., (1991) Nature
353:90-94); untranslated leader from the coat protein mRNA of
alfalfa mosaic virus (AMV RNA 4) (Jobling, et al., (1987) Nature
325:622-625); tobacco mosaic virus leader (TMV) (Gallie, et al.,
(1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp.
237-256) and maize chlorotic mottle virus leader (MCMV) (Lommel, et
al., (1991) Virology 81:382-385). See also, Della-Cioppa, et al.,
(1987) Plant Physiol. 84:965-968. Such constructs may also contain
a "signal sequence" or "leader sequence" to facilitate
cotranslational or post-translational transport of the peptide to
certain intracellular structures such as the chloroplast (or other
plastid), endoplasmic reticulum or Golgi apparatus.
[0177] "Signal sequence" as used herein refers to a sequence that
is known or suspected to result in cotranslational or
post-translational peptide transport across the cell membrane. In
eukaryotes, this typically involves secretion into the Golgi
apparatus, with some resulting glycosylation. Insecticidal toxins
of bacteria are often synthesized as protoxins, which are
proteolytically activated in the gut of the target pest (Chang,
(1987) Methods Enzymol. 153:507-516). In some embodiments, the
signal sequence is located in the native sequence or may be derived
from a sequence of the embodiments. "Leader sequence" as used
herein refers to any sequence that when translated, results in an
amino acid sequence sufficient to trigger cotranslational transport
of the peptide chain to a subcellular organelle. Thus, this
includes leader sequences targeting transport and/or glycosylation
by passage into the endoplasmic reticulum, passage to vacuoles,
plastids including chloroplasts, mitochondria, and the like.
Nuclear-encoded proteins targeted to the chloroplast thylakoid
lumen compartment have a characteristic bipartite transit peptide,
composed of a stromal targeting signal peptide and a lumen
targeting signal peptide. The stromal targeting information is in
the amino-proximal portion of the transit peptide. The lumen
targeting signal peptide is in the carboxyl-proximal portion of the
transit peptide, and contains all the information for targeting to
the lumen. Recent research in proteomics of the higher plant
chloroplast has achieved in the identification of numerous
nuclear-encoded lumen proteins (Kieselbach et al. FEBS LETT
480:271-276, 2000; Peltier et al. Plant Cell 12:319-341, 2000;
Bricker et al. Biochim. Biophys Acta 1503:350-356, 2001), the lumen
targeting signal peptide of which can potentially be used in
accordance with the present disclosure. About 80 proteins from
Arabidopsis, as well as homologous proteins from spinach and garden
pea, are reported by Kieselbach et al., Photosynthesis Research,
78:249-264, 2003. In particular, Table 2 of this publication, which
is incorporated into the description herewith by reference,
discloses 85 proteins from the chloroplast lumen, identified by
their accession number (see also US Patent Application Publication
2009/09044298). In addition, the recently published draft version
of the rice genome (Goff et al, Science 296:92-100, 2002) is a
suitable source for lumen targeting signal peptide which may be
used in accordance with the present disclosure.
[0178] Suitable chloroplast transit peptides (CTP) are well known
to one skilled in the art also include chimeric CT's comprising but
not limited to, an N-terminal domain, a central domain or a
C-terminal domain from a CTP from Oryza sativa 1-decoy-D
xylose-5-Phosphate Synthase Oryza sativa-Superoxide dismutase Oryza
sativa-soluble starch synthase Oryza sativa-NADP-dependent Malic
acid enzyme Oryza sativa-Phospho-2-dehydro-3-deoxyheptonate
Aldolase 2 Oryza sativa-L-Ascorbate peroxidase 5 Oryza
sativa-Phosphoglucan water dikinase, Zea Mays ssRUBISCO, Zea
Mays-beta-glucosidase, Zea Mays-Malate dehydrogenase, Zea Mays
Thioredoxin M-type US Patent Application Publication
2012/0304336).
[0179] The IPD103 polypeptide gene to be targeted to the
chloroplast may be optimized for expression in the chloroplast to
account for differences in usage between the plant nucleus and this
organelle. In this manner, the nucleic acids of interest may be
synthesized using chloroplast-preferred sequences.
[0180] In preparing the expression cassette, the various DNA
fragments may be manipulated so as to provide for the DNA sequences
in the proper orientation and, as appropriate, in the proper
reading frame. Toward this end, adapters or linkers may be employed
to join the DNA fragments or other manipulations may be involved to
provide for convenient restriction sites, removal of superfluous
DNA, removal of restriction sites or the like. For this purpose, in
vitro mutagenesis, primer repair, restriction, annealing,
resubstitutions, e.g., transitions and transversions, may be
involved.
[0181] A number of promoters can be used in the practice of the
embodiments. The promoters can be selected based on the desired
outcome. The nucleic acids can be combined with constitutive,
tissue-preferred, inducible or other promoters for expression in
the host organism. Suitable constitutive promoters for use in a
plant host cell include, for example, the core promoter of the
Rsyn7 promoter and other constitutive promoters disclosed in WO
1999/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter
(Odell, et al., (1985) Nature 313:810-812); rice actin (McElroy, et
al., (1990) Plant Cell 2:163-171); ubiquitin (Christensen, et al.,
(1989) Plant Mol. Biol. 12:619-632 and Christensen, et al., (1992)
Plant Mol. Biol. 18:675-689); pEMU (Last, et al., (1991) Theor.
Appl. Genet. 81:581-588); MAS (Velten, et al., (1984) EMBO J.
3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026) and the like.
Other constitutive promoters include, for example, those discussed
in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597;
5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611.
[0182] Depending on the desired outcome, it may be beneficial to
express the gene from an inducible promoter. Of particular interest
for regulating the expression of the nucleotide sequences of the
embodiments in plants are wound-inducible promoters. Such
wound-inducible promoters, may respond to damage caused by insect
feeding, and include potato proteinase inhibitor (pin II) gene
(Ryan, (1990) Ann. Rev. Phytopath. 28:425-449; Duan, et al., (1996)
Nature Biotechnology 14:494-498); wun1 and wun2, U.S. Pat. No.
5,428,148; win1 and win2 (Stanford, et al., (1989) Mol. Gen. Genet.
215:200-208); systemin (McGuri, et al., (1992) Science
225:1570-1573); WIP1 (Rohmeier, et al., (1993) Plant Mol. Biol.
22:783-792; Eckelkamp, et al., (1993) FEBS Letters 323:73-76); MPI
gene (Corderok, et al., (1994) Plant J. 6(2):141-150) and the like,
herein incorporated by reference.
[0183] Additionally, pathogen-inducible promoters may be employed
in the methods and nucleotide constructs of the embodiments. Such
pathogen-inducible promoters include those from
pathogenesis-related proteins (PR proteins), which are induced
following infection by a pathogen; e.g., PR proteins, SAR proteins,
beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi, et
al., (1983) Neth. J. Plant Pathol. 89:245-254; Uknes, et al.,
(1992) Plant Cell 4: 645-656 and Van Loon, (1985) Plant Mol. Virol.
4:111-116. See also, WO 1999/43819, herein incorporated by
reference.
[0184] Of interest are promoters that are expressed locally at or
near the site of pathogen infection. See, for example, Marineau, et
al., (1987) Plant Mol. Biol. 9:335-342; Matton, et al., (1989)
Molecular Plant-Microbe Interactions 2:325-331; Somsisch, et al.,
(1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch, et al.,
(1988) Mol. Gen. Genet. 2-93-98 and Yang, (1996) Proc. Natl. Acad.
Sci. USA 93:14972-14977. See also, Chen, et al., (1996) Plant J.
10:955-966; Zhang, et al., (1994) Proc. Natl. Acad. Sci. USA
91:2507-2511; Warner, et al., (1993) Plant J. 3:191-201; Siebertz,
et al., (1989) Plant Cell 1:961-968; U.S. Pat. No. 5,750,386
(nematode-inducible) and the references cited therein. Of
particular interest is the inducible promoter for the maize PRms
gene, whose expression is induced by the pathogen Fusarium
moniliforme (see, for example, Cordero, et al., (1992) Physiol.
Mol. Plant Path. 41:189-200).
[0185] Chemical-regulated promoters can be used to modulate the
expression of a gene in a plant through the application of an
exogenous chemical regulator. Depending upon the objective, the
promoter may be a chemical-inducible promoter, where application of
the chemical induces gene expression or a chemical-repressible
promoter, where application of the chemical represses gene
expression. Chemical-inducible promoters are known in the art and
include, but are not limited to, the maize In2-2 promoter, which is
activated by benzenesulfonamide herbicide safeners, the maize GST
promoter, which is activated by hydrophobic electrophilic compounds
that are used as pre-emergent herbicides, and the tobacco PR-1a
promoter, which is activated by salicylic acid. Other
chemical-regulated promoters of interest include steroid-responsive
promoters (see, for example, the glucocorticoid-inducible promoter
in Schena, et al., (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425
and McNellis, et al., (1998) Plant J. 14(2):247-257) and
tetracycline-inducible and tetracycline-repressible promoters (see,
for example, Gatz, et al., (1991) Mol. Gen. Genet. 227:229-237 and
U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by
reference.
[0186] Tissue-preferred promoters can be utilized to target
enhanced an IPD103 polypeptide expression within a particular plant
tissue. Tissue-preferred promoters include those discussed in
Yamamoto, et al., (1997) Plant J. 12(2)255-265; Kawamata, et al.,
(1997) Plant Cell Physiol. 38(7):792-803; Hansen, et al., (1997)
Mol. Gen Genet. 254(3):337-343; Russell, et al., (1997) Transgenic
Res. 6(2):157-168; Rinehart, et al., (1996) Plant Physiol.
112(3):1331-1341; Van Camp, et al., (1996) Plant Physiol.
112(2):525-535; Canevascini, et al., (1996) Plant Physiol.
112(2):513-524; Yamamoto, et al., (1994) Plant Cell Physiol.
35(5):773-778; Lam, (1994) Results Probl. Cell Differ. 20:181-196;
Orozco, et al., (1993) Plant Mol Biol. 23(6):1129-1138; Matsuoka,
et al., (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590 and
Guevara-Garcia, et al., (1993) Plant J. 4(3):495-505. Such
promoters can be modified, if necessary, for weak expression.
[0187] Leaf-preferred promoters are known in the art. See, for
example, Yamamoto, et al., (1997) Plant J. 12(2):255-265; Kwon, et
al., (1994) Plant Physiol. 105:357-67; Yamamoto, et al., (1994)
Plant Cell Physiol. 35(5):773-778; Gotor, et al., (1993) Plant J.
3:509-18; Orozco, et al., (1993) Plant Mol. Biol. 23(6):1129-1138
and Matsuoka, et al., (1993) Proc. Natl. Acad. Sci. USA
90(20):9586-9590.
[0188] Root-preferred or root-specific promoters are known and can
be selected from the many available from the literature or isolated
de novo from various compatible species. See, for example, Hire, et
al., (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific
glutamine synthetase gene); Keller and Baumgartner, (1991) Plant
Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8
gene of French bean); Sanger, et al., (1990) Plant Mol. Biol.
14(3):433-443 (root-specific promoter of the mannopine synthase
(MAS) gene of Agrobacterium tumefaciens) and Miao, et al., (1991)
Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic
glutamine synthetase (GS), which is expressed in roots and root
nodules of soybean). See also, Bogusz, et al., (1990) Plant Cell
2(7):633-641, where two root-specific promoters isolated from
hemoglobin genes from the nitrogen-fixing nonlegume Parasponia
andersonii and the related non-nitrogen-fixing nonlegume Trema
tomentosa are described. The promoters of these genes were linked
to a 0-glucuronidase reporter gene and introduced into both the
nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and
in both instances root-specific promoter activity was preserved.
Leach and Aoyagi, (1991) describe their analysis of the promoters
of the highly expressed roIC and roID root-inducing genes of
Agrobacterium rhizogenes (see, Plant Science (Limerick)
79(1):69-76). They concluded that enhancer and tissue-preferred DNA
determinants are dissociated in those promoters. Teeri, et al.,
(1989) used gene fusion to IacZ to show that the Agrobacterum T-DNA
gene encoding octopine synthase is especially active in the
epidermis of the root tip and that the TR2' gene is root specific
in the intact plant and stimulated by wounding in leaf tissue, an
especially desirable combination of characteristics for use with an
insecticidal or larvicidal gene (see, EMBO J. 8(2):343-350). The
TR1' gene fused to nptll (neomycin phosphotransferase II) showed
similar characteristics. Additional root-preferred promoters
include the VfENOD-GRP3 gene promoter (Kuster, et al., (1995) Plant
Mol. Biol. 29(4):759-772) and rolB promoter (Capana, et al., (1994)
Plant Mol. Biol. 25(4):681-691. See also, U.S. Pat. Nos. 5,837,876;
5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732 and
5,023,179. Arabidopsis thaliana root-preferred regulatory sequences
are disclosed in US20130117883.
[0189] "Seed-preferred" promoters include both "seed-specific"
promoters (those promoters active during seed development such as
promoters of seed storage proteins) as well as "seed-germinating"
promoters (those promoters active during seed germination). See,
Thompson, et al., (1989) BioEssays 10:108, herein incorporated by
reference. Such seed-preferred promoters include, but are not
limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa
zein); and milps (myo-inositol-1-phosphate synthase) (see, U.S.
Pat. No. 6,225,529, herein incorporated by reference). Gamma-zein
and Glb-1 are endosperm-specific promoters. For dicots,
seed-specific promoters include, but are not limited to, Kunitz
trypsin inhibitor 3 (KTi3) (Jofuku and Goldberg, (1989) Plant Cell
1:1079-1093), bean .beta.-phaseolin, napin, .beta.-conglycinin,
glycinin 1, soybean lectin, cruciferin, and the like. For monocots,
seed-specific promoters include, but are not limited to, maize 15
kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1,
shrunken 2, globulin 1, etc. See also, WO 2000/12733, where
seed-preferred promoters from end1 and end2 genes are disclosed;
herein incorporated by reference. In dicots, seed specific
promoters include but are not limited to seed coat promoter from
Arabidopsis, pBAN; and the early seed promoters from Arabidopsis,
p26, p63, and p63tr (U.S. Pat. Nos. 7,294,760 and 7,847,153). A
promoter that has "preferred" expression in a particular tissue is
expressed in that tissue to a greater degree than in at least one
other plant tissue. Some tissue-preferred promoters show expression
almost exclusively in the particular tissue.
[0190] Where low level expression is desired, weak promoters will
be used. Generally, the term "weak promoter" as used herein refers
to a promoter that drives expression of a coding sequence at a low
level. By low level expression at levels of between about 1/1000
transcripts to about 1/100,000 transcripts to about 1/500,000
transcripts is intended. Alternatively, it is recognized that the
term "weak promoters" also encompasses promoters that drive
expression in only a few cells and not in others to give a total
low level of expression. Where a promoter drives expression at
unacceptably high levels, portions of the promoter sequence can be
deleted or modified to decrease expression levels.
[0191] Such weak constitutive promoters include, for example the
core promoter of the Rsyn7 promoter (WO 1999/43838 and U.S. Pat.
No. 6,072,050), the core 35S CaMV promoter, and the like. Other
constitutive promoters include, for example, those disclosed in
U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597;
5,466,785; 5,399,680; 5,268,463; 5,608,142 and 6,177,611, herein
incorporated by reference.
[0192] The above list of promoters is not meant to be limiting. Any
appropriate promoter can be used in the embodiments.
[0193] Generally, the expression cassette will comprise a
selectable marker gene for the selection of transformed cells.
Selectable marker genes are utilized for the selection of
transformed cells or tissues. Marker genes include genes encoding
antibiotic resistance, such as those encoding neomycin
phosphotransferase II (NEO) and hygromycin phosphotransferase
(HPT), as well as genes conferring resistance to herbicidal
compounds, such as glufosinate ammonium, bromoxynil, imidazolinones
and 2,4-dichlorophenoxyacetate (2,4-D). Additional examples of
suitable selectable marker genes include, but are not limited to,
genes encoding resistance to chloramphenicol (Herrera Estrella, et
al., (1983) EMBO J. 2:987-992); methotrexate (Herrera Estrella, et
al., (1983) Nature 303:209-213 and Meijer, et al., (1991) Plant
Mol. Biol. 16:807-820); streptomycin (Jones, et al., (1987) Mol.
Gen. Genet. 210:86-91); spectinomycin (Bretagne-Sagnard, et al.,
(1996) Transgenic Res. 5:131-137); bleomycin (Hille, et al., (1990)
Plant Mol. Biol. 7:171-176); sulfonamide (Guerineau, et al., (1990)
Plant Mol. Biol. 15:127-136); bromoxynil (Stalker, et al., (1988)
Science 242:419-423); glyphosate (Shaw, et al., (1986) Science
233:478-481 and U.S. patent application Ser. Nos. 10/004,357 and
10/427,692); phosphinothricin (DeBlock, et al., (1987) EMBO J.
6:2513-2518). See generally, Yarranton, (1992) Curr. Opin. Biotech.
3:506-511; Christopherson, et al., (1992) Proc. Natl. Acad. Sci.
USA 89:6314-6318; Yao, et al., (1992) Cell 71:63-72; Reznikoff,
(1992) Mol. Microbiol. 62419-2422; Barkley, et al., (1980) in The
Operon, pp. 177-220; Hu, et al., (1987) Cell 48:555-566; Brown, et
al., (1987) Cell 49:603-612; Figge, et al., (1988) Cell 52:713-722;
Deuschle, et al., (1989) Proc. Nat. Acad. Sci. USA 86:5400-5404;
Fuerst, et al., (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553;
Deuschle, et al., (1990) Science 248:480-483; Gossen, (1993) Ph.D.
Thesis, University of Heidelberg; Reines, et al., (1993) Proc.
Natl. Acad. Sci. USA 90:1917-1921; Labow, et al., (1990) Mol. Cell.
Biol. 10:3343-3356; Zambretti, et al., (1992) Proc. Natl. Acad.
Sci. USA 89:3952-3956; Baim, et al., (1991) Proc. Natl Acad. Sci.
USA 88:5072-5076; Wyborski, et al., (1991) Nucleic Acids Res.
19:4647-4653; Hillenand-Wissman, (1989) Topics Mol. Struc. Biol.
10:143-162; Degenkolb, et al., (1991) Antimicrob. Agents Chemother.
35:1591-1595; Kleinschnidt, et al., (1988) Biochemistry
27:1094-1104; Bonin, (1993) Ph.D. Thesis, University of Heidelberg;
Gossen, et al., (1992) Proc. Nat. Acad. Sci. USA 89:5547-5551;
Oliva, et al., (1992) Antimicrob. Agents Chemother. 36:913-919;
Hlavka, et al., (1985) Handbook of Experimental Pharmacology, Vol.
78 (Springer-Verlag, Berlin) and Gill, et al., (1988) Nature
334:721-724. Such disclosures are herein incorporated by
reference.
[0194] The above list of selectable marker genes is not meant to be
limiting. Any selectable marker gene can be used in the
embodiments.
Plant Transformation
[0195] The methods of the embodiments involve introducing a
polypeptide or polynucleotide into a plant. "Introducing" is as
used herein means presenting to the plant the polynucleotide or
polypeptide in such a manner that the sequence gains access to the
interior of a cell of the plant. The methods of the embodiments do
not depend on a particular method for introducing a polynucleotide
or polypeptide into a plant, only that the polynucleotide or
polypeptides gains access to the interior of at least one cell of
the plant. Methods for introducing polynucleotide or polypeptides
into plants are known in the art including, but not limited to,
stable transformation methods, transient transformation methods,
and virus-mediated methods.
[0196] "Stable transformation" is as used herein means that the
nucleotide construct introduced into a plant integrates into the
genome of the plant and is capable of being inherited by the
progeny thereof. "Transient transformation" as used herein means
that a polynucleotide is introduced into the plant and does not
integrate into the genome of the plant or a polypeptide is
introduced into a plant. "Plant" as used herein refers to whole
plants, plant organs (e.g., leaves, stems, roots, etc.), seeds,
plant cells, propagules, embryos and progeny of the same. Plant
cells can be differentiated or undifferentiated (e.g. callus,
suspension culture cells, protoplasts, leaf cells, root cells,
phloem cells and pollen).
[0197] Transformation protocols as well as protocols for
introducing nucleotide sequences into plants may vary depending on
the type of plant or plant cell, i.e., monocot or dicot, targeted
for transformation. Suitable methods of introducing nucleotide
sequences into plant cells and subsequent insertion into the plant
genome include microinjection (Crossway, et al., (1986)
Biotechniques 4:320-334), electroporation (Riggs, et al., (1986)
Proc. Natl. Acad. Sci. USA 83:5602-5606), Agrobacterium-mediated
transformation (U.S. Pat. Nos. 5,563,055 and 5,981,840), direct
gene transfer (Paszkowski, et al., (1984) EMBO J. 3:2717-2722) and
ballistic particle acceleration (see, for example, U.S. Pat. Nos.
4,945,050; 5,879,918; 5,886,244 and 5,932,782; Tomes, et al.,
(1995) in Plant Cell, Tissue, and Organ Culture: Fundamental
Methods, ed. Gamborg and Phillips, (Springer-Verlag, Berlin) and
McCabe, et al., (1988) Biotechnology 6:923-926) and Led
transformation (WO 00/28058). For potato transformation see, Tu, et
al., (1998) Plant Molecular Biology 37:829-838 and Chong, et al.,
(2000) Transgenic Research 9:71-78. Additional transformation
procedures can be found in Weissinger, et al., (1988) Ann. Rev.
Genet. 22:421-477; Sanford, et al., (1987) Particulate Science and
Technology 5:27-37 (onion); Christou, et al., (1988) Plant Physiol.
87:671-674 (soybean); McCabe, et al., (1988) Bio/Technology
6:923-926 (soybean); Finer and McMullen, (1991) In Vitro Cell Dev.
Biol. 27P:175-182 (soybean); Singh, et al., (1998) Theor. Appl.
Genet. 96:319-324 (soybean); Datta, et al., (1990) Biotechnology
8:736-740 (rice); Klein, et al., (1988) Proc. Natl. Acad. Sci. USA
85:4305-4309 (maize); Klein, et al., (1988) Biotechnology 6:559-563
(maize); U.S. Pat. Nos. 5,240,855; 5,322,783 and 5,324,646; Klein,
et al., (1988) Plant Physiol. 91:440-444 (maize); Fromm, et al.,
(1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren, et
al., (1984) Nature (London) 311:763-764; U.S. Pat. No. 5,736,369
(cereals); Bytebier, et al., (1987) Proc. Natl. Acad. Sci. USA
84:5345-5349 (Liliaceae); De Wet, et al., (1985) in The
Experimental Manipulation of Ovule Tissues, ed. Chapman, et al.,
(Longman, N.Y.), pp. 197-209 (pollen); Kaeppler, et al., (1990)
Plant Cell Reports 9:415-418 and Kaeppler, et al., (1992) Theor.
Appl. Genet. 84:560-566 (whisker-mediated transformation);
D'Halluin, et al., (1992) Plant Cell 4:1495-1505 (electroporation);
Li, et al., (1993) Plant Cell Reports 12:250-255 and Christou and
Ford, (1995) Annals of Botany 75:407-413 (rice); Osjoda, et al.,
(1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium
tumefaciens); all of which are herein incorporated by
reference.
[0198] In specific embodiments, the sequences of the embodiments
can be provided to a plant using a variety of transient
transformation methods. Such transient transformation methods
include, but are not limited to, the introduction of the IPD103
polynucleotide or variants and fragments thereof directly into the
plant or the introduction of the IPD103 polypeptide transcript into
the plant. Such methods include, for example, microinjection or
particle bombardment. See, for example, Crossway, et al., (1986)
Mol Gen. Genet. 202:179-185; Nomura, et al., (1986) Plant Sci.
44:53-58; Hepler, et al., (1994) Proc. Natl. Acad. Sci.
91:2176-2180 and Hush, et al., (1994) The Journal of Cell Science
107:775-784, all of which are herein incorporated by reference.
Alternatively, the IPD103 polynucleotide can be transiently
transformed into the plant using techniques known in the art. Such
techniques include viral vector system and the precipitation of the
polynucleotide in a manner that precludes subsequent release of the
DNA. Thus, transcription from the particle-bound DNA can occur, but
the frequency with which it is released to become integrated into
the genome is greatly reduced. Such methods include the use of
particles coated with polyethylimine (PEI; Sigma #P3143).
[0199] Methods are known in the art for the targeted insertion of a
polynucleotide at a specific location in the plant genome. In one
embodiment, the insertion of the polynucleotide at a desired
genomic location is achieved using a site-specific recombination
system. See, for example, WO 1999/25821, WO 1999/25854, WO
1999/25840, WO 1999/25855 and WO 1999/25853, all of which are
herein incorporated by reference. Briefly, the polynucleotide of
the embodiments can be contained in transfer cassette flanked by
two non-identical recombination sites. The transfer cassette is
introduced into a plant have stably incorporated into its genome a
target site which is flanked by two non-identical recombination
sites that correspond to the sites of the transfer cassette. An
appropriate recombinase is provided and the transfer cassette is
integrated at the target site. The polynucleotide of interest is
thereby integrated at a specific chromosomal position in the plant
genome.
[0200] Plant transformation vectors may be comprised of one or more
DNA vectors needed for achieving plant transformation. For example,
it is a common practice in the art to utilize plant transformation
vectors that are comprised of more than one contiguous DNA segment.
These vectors are often referred to in the art as "binary vectors".
Binary vectors as well as vectors with helper plasmids are most
often used for Agrobacterium-mediated transformation, where the
size and complexity of DNA segments needed to achieve efficient
transformation is quite large, and it is advantageous to separate
functions onto separate DNA molecules. Binary vectors typically
contain a plasmid vector that contains the cis-acting sequences
required for T-DNA transfer (such as left border and right border),
a selectable marker that is engineered to be capable of expression
in a plant cell, and a "gene of interest" (a gene engineered to be
capable of expression in a plant cell for which generation of
transgenic plants is desired). Also present on this plasmid vector
are sequences required for bacterial replication. The cis-acting
sequences are arranged in a fashion to allow efficient transfer
into plant cells and expression therein. For example, the
selectable marker gene and the pesticidal gene are located between
the left and right borders. Often a second plasmid vector contains
the trans-acting factors that mediate T-DNA transfer from
Agrobacterium to plant cells. This plasmid often contains the
virulence functions (Vir genes) that allow infection of plant cells
by Agrobacterium, and transfer of DNA by cleavage at border
sequences and vir-mediated DNA transfer, as is understood in the
art (Hellens and Mullineaux, (2000) Trends in Plant Science
5:446-451). Several types of Agrobacterium strains (e.g. LBA4404,
GV3101, EHA101, EHA105, etc.) can be used for plant transformation.
The second plasmid vector is not necessary for transforming the
plants by other methods such as microprojection, microinjection,
electroporation, polyethylene glycol, etc.
[0201] In general, plant transformation methods involve
transferring heterologous DNA into target plant cells (e.g.,
immature or mature embryos, suspension cultures, undifferentiated
callus, protoplasts, etc.), followed by applying a maximum
threshold level of appropriate selection (depending on the
selectable marker gene) to recover the transformed plant cells from
a group of untransformed cell mass. Following integration of
heterologous foreign DNA into plant cells, one then applies a
maximum threshold level of appropriate selection in the medium to
kill the untransformed cells and separate and proliferate the
putatively transformed cells that survive from this selection
treatment by transferring regularly to a fresh medium. By
continuous passage and challenge with appropriate selection, one
can identify and proliferate the cells that are transformed with
the plasmid vector. Molecular and biochemical methods can then be
used to confirm the presence of the integrated heterologous gene of
interest into the genome of the transgenic plant.
[0202] Explants are typically transferred to a fresh supply of the
same medium and cultured routinely. Subsequently, the transformed
cells are differentiated into shoots after placing on regeneration
medium supplemented with a maximum threshold level of selecting
agent. The shoots are then transferred to a selective rooting
medium for recovering rooted shoot or plantlet. The transgenic
plantlet then grows into a mature plant and produces fertile seeds
(e.g., Hiei, et al., (1994) The Plant Journal 6:271-282; Ishida, et
al., (1996) Nature Biotechnology 14:745-750). Explants are
typically transferred to a fresh supply of the same medium and
cultured routinely. A general description of the techniques and
methods for generating transgenic plants are found in Ayres and
Park, (1994) Critical Reviews in Plant Science 13:219-239 and
Bommineni and Jauhar, (1997) Maydica 42:107-120. Since the
transformed material contains many cells; both transformed and
non-transformed cells are present in any piece of subjected target
callus or tissue or group of cells. The ability to kill
non-transformed cells and allow transformed cells to proliferate
results in transformed plant cultures. Often, the ability to remove
non-transformed cells is a limitation to rapid recovery of
transformed plant cells and successful generation of transgenic
plants.
[0203] The cells that have been transformed may be grown into
plants in accordance with conventional ways. See, for example,
McCormick, et al., (1986) Plant Cell Reports 5:81-84. These plants
may then be grown, and either pollinated with the same transformed
strain or different strains, and the resulting hybrid having
constitutive or inducible expression of the desired phenotypic
characteristic identified. Two or more generations may be grown to
ensure that expression of the desired phenotypic characteristic is
stably maintained and inherited and then seeds harvested to ensure
that expression of the desired phenotypic characteristic has been
achieved.
[0204] The nucleotide sequences of the embodiments may be provided
to the plant by contacting the plant with a virus or viral nucleic
acids. Generally, such methods involve incorporating the nucleotide
construct of interest within a viral DNA or RNA molecule. It is
recognized that the recombinant proteins of the embodiments may be
initially synthesized as part of a viral polyprotein, which later
may be processed by proteolysis in vivo or in vitro to produce the
desired IPD103 polypeptide. It is also recognized that such a viral
polyprotein, comprising at least a portion of the amino acid
sequence of an IPD103 of the embodiments, may have the desired
pesticidal activity. Such viral polyproteins and the nucleotide
sequences that encode for them are encompassed by the embodiments.
Methods for providing plants with nucleotide constructs and
producing the encoded proteins in the plants, which involve viral
DNA or RNA molecules, are known in the art. See, for example, U.S.
Pat. Nos. 5,889,191; 5,889,190; 5,866,785; 5,589,367 and 5,316,931;
herein incorporated by reference.
[0205] Methods for transformation of chloroplasts are known in the
art. See, for example, Svab, et al., (1990) Proc. Natl. Acad. Sci.
USA 87:8526-8530; Svab and Maliga, (1993) Proc. Natl. Acad. Sci.
USA 90:913-917; Svab and Maliga, (1993) EMBO J. 12:601-606. The
method relies on particle gun delivery of DNA containing a
selectable marker and targeting of the DNA to the plastid genome
through homologous recombination. Additionally, plastid
transformation can be accomplished by transactivation of a silent
plastid-borne transgene by tissue-preferred expression of a
nuclear-encoded and plastid-directed RNA polymerase. Such a system
has been reported in McBride, et al., (1994) Proc. Natl. Acad. Sci.
USA 91:7301-7305.
[0206] The embodiments further relate to plant-propagating material
of a transformed plant of the embodiments including, but not
limited to, seeds, tubers, corms, bulbs, leaves and cuttings of
roots and shoots.
[0207] The embodiments may be used for transformation of any plant
species, including, but not limited to, monocots and dicots.
Examples of plants of interest include, but are not limited to,
corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea),
particularly those Brassica species useful as sources of seed oil,
alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale
cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g.,
pearl millet (Pennisetum glaucum), proso millet (Panicum
miliaceum), foxtail millet (Setaria italica), finger millet
(Eleusine coracana)), sunflower (Helianthus annuus), safflower
(Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine
max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum),
peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium
hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot
esculenta), coffee (Coffea spp.), coconut (Cocos nucifera),
pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa
(Theobroma cacao), tea (CamelIia sinensis), banana (Musa spp.),
avocado (Persea americana), fig (Ficus casica), guava (Psidium
guajava), mango (Mangifera indica), olive (Olea europaea), papaya
(Carica papaya), cashew (Anacardium occidentale), macadamia
(Macadamia integrifolia), almond (Prunus amygdalus), sugar beets
(Beta vulgars), sugarcane (Saccharum spp.), oats, barley,
vegetables ornamentals, and conifers.
[0208] Vegetables include tomatoes (Lycopersicon esculentum),
lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris),
lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members
of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C.
cantalupensis), and musk melon (C. melo). Ornamentals include
azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea),
hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa
spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida),
carnation (Dianthus caryophyllus), poinsettia (Euphorbia
pulcherrima), and chrysanthemum. Conifers that may be employed in
practicing the embodiments include, for example, pines such as
loblolly pine (Pinus taeda), slash pine (Pinus ellioti), ponderosa
pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and
Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menzaesfi);
Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca);
redwood (Sequoia sempervirens); true firs such as silver fir (Abies
amabilis) and balsam fir (Abies balsamea); and cedars such as
Western red cedar (Thuja plicata) and Alaska yellow-cedar
(Chamaecyparis nootkatensis). Plants of the embodiments include
crop plants (for example, corn, alfalfa, sunflower, Brassica,
soybean, cotton, safflower, peanut, sorghum, wheat, millet,
tobacco, etc.), such as corn and soybean plants.
[0209] Turf grasses include, but are not limited to: annual
bluegrass (Poa annua); annual ryegrass (Lolium multiflorum); Canada
bluegrass (Poa compressa); Chewing's fescue (Festuca rubra);
colonial bentgrass (Agrostis tenuis); creeping bentgrass (Agrostis
palustris); crested wheatgrass (Agropyron desertorum); fairway
wheatgrass (Agropyron cristatum); hard fescue (Festuca longifolia);
Kentucky bluegrass (Poa pratensis); orchardgrass (Dactylis
glomerata); perennial ryegrass (Lolium perenne); red fescue
(Festuca rubra); redtop (Agrostis alba); rough bluegrass (Poa
trivialis); sheep fescue (Festuca ovina); smooth bromegrass (Bromus
inermis); tall fescue (Festuca arundinacea); timothy (Phleum
pratense); velvet bentgrass (Agrostis canina); weeping alkaligrass
(Puccinellia distans); western wheatgrass (Agropyron smithii);
Bermuda grass (Cynodon spp.); St. Augustine grass (Stenotaphrum
secundatum); zoysia grass (Zoysia spp.); Bahia grass (Paspalum
notatum); carpet grass (Axonopus affinis); centipede grass
(Eremochloa ophiuroides); kikuyu grass (Pennisetum clandesinum);
seashore paspalum (Paspalum vaginatum); blue gramma (Bouteloua
gracilis); buffalo grass (Buchloe dactyloids); sideoats gramma
(Bouteloua curtipendula).
[0210] Plants of interest include grain plants that provide seeds
of interest, oil-seed plants, and leguminous plants. Seeds of
interest include grain seeds, such as corn, wheat, barley, rice,
sorghum, rye, millet, etc. Oil-seed plants include cotton, soybean,
safflower, sunflower, Brassica, maize, alfalfa, palm, coconut,
flax, castor, olive, etc. Leguminous plants include beans and peas.
Beans include guar, locust bean, fenugreek, soybean, garden beans,
cowpea, mung bean, lima bean, fava bean, lentils, chickpea,
etc.
Evaluation of Plant Transformation
[0211] Following introduction of heterologous foreign DNA into
plant cells, the transformation or integration of heterologous gene
in the plant genome is confirmed by various methods such as
analysis of nucleic acids, proteins and metabolites associated with
the integrated gene.
[0212] PCR analysis is a rapid method to screen transformed cells,
tissue or shoots for the presence of incorporated gene at the
earlier stage before transplanting into the soil (Sambrook and
Russell, (2001) Molecular Cloning: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y.). PCR is carried
out using oligonucleotide primers specific to the gene of interest
or Agrobacterium vector background, etc.
[0213] Plant transformation may be confirmed by Southern blot
analysis of genomic DNA (Sambrook and Russell, (2001) supra). In
general, total DNA is extracted from the transformant, digested
with appropriate restriction enzymes, fractionated in an agarose
gel and transferred to a nitrocellulose or nylon membrane. The
membrane or "blot" is then probed with, for example, radiolabeled
32P target DNA fragment to confirm the integration of introduced
gene into the plant genome according to standard techniques
(Sambrook and Russell, (2001) supra).
[0214] In Northern blot analysis, RNA is isolated from specific
tissues of transformant, fractionated in a formaldehyde agarose
gel, and blotted onto a nylon filter according to standard
procedures that are routinely used in the art (Sambrook and
Russell, (2001) supra). Expression of RNA encoded by the pesticidal
gene is then tested by hybridizing the filter to a radioactive
probe derived from a pesticidal gene, by methods known in the art
(Sambrook and Russell, (2001) supra).
[0215] Western blot, biochemical assays and the like may be carried
out on the transgenic plants to confirm the presence of protein
encoded by the pesticidal gene by standard procedures (Sambrook and
Russell, 2001, supra) using antibodies that bind to one or more
epitopes present on the IPD103 polypeptide.
Methods to Introduce Genome Editing Technologies into Plants
[0216] In some embodiments, the disclosed IPD103 polynucleotide
compositions can be introduced into the genome of a plant using
genome editing technologies, or previously introduced IPD103
polynucleotides in the genome of a plant may be edited using genome
editing technologies. For example, the disclosed polynucleotides
can be introduced into a desired location in the genome of a plant
through the use of double-stranded break technologies such as
TALENs, meganucleases, zinc finger nucleases, CRISPR-Cas, and the
like. For example, the disclosed polynucleotides can be introduced
into a desired location in a genome using a CRISPR-Cas system, for
the purpose of site-specific insertion. The desired location in a
plant genome can be any desired target site for insertion, such as
a genomic region amenable for breeding or may be a target site
located in a genomic window with an existing trait of interest.
Existing traits of interest could be either an endogenous trait or
a previously introduced trait.
[0217] In some embodiments, where the disclosed IPD103
polynucleotide has previously been introduced into a genome, genome
editing technologies may be used to alter or modify the introduced
polynucleotide sequence. Site specific modifications that can be
introduced into the disclosed IPD103 polynucleotide compositions
include those produced using any method for introducing site
specific modification, including, but not limited to, through the
use of gene repair oligonucleotides (e.g. US Publication
2013/0019349), or through the use of double-stranded break
technologies such as TALENs, meganucleases, zinc finger nucleases,
CRISPR-Cas, and the like. Such technologies can be used to modify
the previously introduced polynucleotide through the insertion,
deletion or substitution of nucleotides within the introduced
polynucleotide. Alternatively, double-stranded break technologies
can be used to add additional nucleotide sequences to the
introduced polynucleotide. Additional sequences that may be added
include, additional expression elements, such as enhancer and
promoter sequences. In another embodiment, genome editing
technologies may be used to position additional
insecticidally-active proteins in close proximity to the disclosed
IPD103 polynucleotide compositions disclosed herein within the
genome of a plant, in order to generate molecular stacks of
insecticidally-active proteins.
[0218] An "altered target site," "altered target sequence."
"modified target site," and "modified target sequence" are used
interchangeably herein and refer to a target sequence as disclosed
herein that comprises at least one alteration when compared to
non-altered target sequence. Such "alterations" include, for
example: (i) replacement of at least one nucleotide, (ii) a
deletion of at least one nucleotide, (iii) an insertion of at least
one nucleotide, or (iv) any combination of (i)-(iii).
Stacking of Traits in Transgenic Plant
[0219] Transgenic plants may comprise a stack of one or more
insecticidal polynucleotides disclosed herein with one or more
additional polynucleotides resulting in the production or
suppression of multiple polypeptide sequences. Transgenic plants
comprising stacks of polynucleotide sequences can be obtained by
either or both of traditional breeding methods or through genetic
engineering methods. These methods include, but are not limited to,
breeding individual lines each comprising a polynucleotide of
interest, transforming a transgenic plant comprising a gene
disclosed herein with a subsequent gene and co-transformation of
genes into a single plant cell. As used herein, the term "stacked"
includes having the multiple traits present in the same plant
(i.e., both traits are incorporated into the nuclear genome, one
trait is incorporated into the nuclear genome and one trait is
incorporated into the genome of a plastid or both traits are
incorporated into the genome of a plastid). In one non-limiting
example, "stacked traits" comprise a molecular stack where the
sequences are physically adjacent to each other. A trait, as used
herein, refers to the phenotype derived from a particular sequence
or groups of sequences. Co-transformation of genes can be carried
out using single transformation vectors comprising multiple genes
or genes carried separately on multiple vectors. If the sequences
are stacked by genetically transforming the plants, the
polynucleotide sequences of interest can be combined at any time
and in any order. The traits can be introduced simultaneously in a
co-transformation protocol with the polynucleotides of interest
provided by any combination of transformation cassettes. For
example, if two sequences will be introduced, the two sequences can
be contained in separate transformation cassettes (trans) or
contained on the same transformation cassette (cis). Expression of
the sequences can be driven by the same promoter or by different
promoters. In certain cases, it may be desirable to introduce a
transformation cassette that will suppress the expression of the
polynucleotide of interest. This may be combined with any
combination of other suppression cassettes or overexpression
cassettes to generate the desired combination of traits in the
plant. It is further recognized that polynucleotide sequences can
be stacked at a desired genomic location using a site-specific
recombination system. See, for example, WO 1999/25821, WO
1999/25854, WO 1999/25840, WO 1999/25855 and WO 1999/25853, all of
which are herein incorporated by reference.
[0220] In some embodiments the polynucleotides encoding the IPD103
polypeptide disclosed herein, alone or stacked with one or more
additional insect resistance traits can be stacked with one or more
additional input traits (e.g., herbicide resistance, fungal
resistance, virus resistance, stress tolerance, disease resistance,
male sterility, stalk strength, and the like) or output traits
(e.g., increased yield, modified starches, improved oil profile,
balanced amino acids, high lysine or methionine, increased
digestibility, improved fiber quality, drought resistance, and the
like). Thus, the polynucleotide embodiments can be used to provide
a complete agronomic package of improved crop quality with the
ability to flexibly and cost effectively control any number of
agronomic pests.
[0221] Transgenes useful for stacking include but are not limited
to:
1. Transgenes that Confer Resistance to Insects or Disease and that
Encode:
[0222] (A) Plant disease resistance genes. Plant defenses are often
activated by specific interaction between the product of a disease
resistance gene (R) in the plant and the product of a corresponding
avirulence (Avr) gene in the pathogen. A plant variety can be
transformed with cloned resistance gene to engineer plants that are
resistant to specific pathogen strains. See, for example, Jones, et
al., (1994) Science 266:789 (cloning of the tomato Cf-9 gene for
resistance to Cladosporium fulvum); Martin, et al., (1993) Science
262:1432 (tomato Pto gene for resistance to Pseudomonas syringae
pv. tomato encodes a protein kinase); Mindrinos, et al., (1994)
Cell 78:1089 (Arabidopsis RSP2 gene for resistance to Pseudomonas
syringae), McDowell and Woffenden, (2003) Trends Biotechnol.
21(4):178-83 and Toyoda, et al., (2002) Transgenic Res.
11(6):567-82. A plant resistant to a disease is one that is more
resistant to a pathogen as compared to the wild type plant.
[0223] (B) Genes encoding a Bacillus thuringiensis protein, a
derivative thereof or a synthetic polypeptide modeled thereon. See,
for example, Geiser, et al., (1986) Gene 48:109, who disclose the
cloning and nucleotide sequence of a Bt delta-endotoxin gene.
Moreover, DNA molecules encoding delta-endotoxin genes can be
purchased from American Type Culture Collection (Rockville, Md.),
for example, under ATCC.RTM. Accession Numbers 40098, 67136, 31995
and 31998. Other non-limiting examples of Bacillus thuringiensis
transgenes being genetically engineered are given in the following
patents and patent applications and hereby are incorporated by
reference for this purpose: U.S. Pat. Nos. 5,188,960; 5,689,052;
5,880,275; 5,986,177; 6,023,013, 6,060,594, 6,063,597, 6,077,824,
6,620,988, 6,642,030, 6,713,259, 6,893,826, 7,105,332; 7,179,965,
7,208,474; 7,227,056, 7,288,643, 7,323,556, 7,329,736, 7,449,552,
7,468,278, 7,510,878, 7,521,235, 7,544,862, 7,605,304, 7,696,412,
7,629,504, 7,705,216, 7,772,465, 7,790,846, 7,858,849 and WO
1991/14778; WO 1999/31248; WO 2001/12731; WO 1999/24581 and WO
1997/40162.
[0224] Genes encoding pesticidal proteins may also be stacked
including but are not limited to: insecticidal proteins from
Pseudomonas sp. such as PSEEN3174 (Monalysin, (2011) PLoS
Pathogens, 7:1-13), from Pseudomonas protegens strain CHAO and Pf-5
(previously fluorescens) (Pechy-Tarr, (2008) Environmental
Microbiology 10:2368-2386: GenBank Accession No. EU400157); from
Pseudomonas taiwanensis (Liu, et al., (2010) J. Agric. Food Chem.
58:12343-12349) and from Pseudomonas pseudoalcaligenes (Zhang, et
al., (2009) Annals of Microbiology 59:45-50 and Li, et al., (2007)
Plant Cell Tiss. Organ Cult. 89:159-168); insecticidal proteins
from Photorhabdus sp. and Xenorhabdus sp. (Hinchliffe, et al.,
(2010) The Open Toxinology Journal 3:101-118 and Morgan, et al.,
(2001) Applied and Envir. Micro. 67:2062-2069), U.S. Pat. Nos.
6,048,838, and 6,379,946; a PIP-1 polypeptide of US Patent
Publication US20140007292; an AfIP-1A and/or AfIP-1B polypeptide of
US Patent Publication US20140033361; a PHI-4 polypeptide of US
Patent Publication US20140274885 and US20160040184; a PIP-47
polypeptide of PCT Publication Number WO2015/023846, a PIP-72
polypeptide of PCT Publication Number WO2015/038734; a PtIP-50
polypeptide and a PtIP-65 polypeptide of PCT Publication Number
WO2015/120270; a PtIP-83 polypeptide of PCT Publication Number
WO2015/120276; a PtIP-96 polypeptide of PCT Serial Number
PCT/US15/55502; an IPD079 polypeptide of U.S. Ser. No. 62/201,977;
an IPD082 polypeptide of U.S. Ser. No. 62/269,482, and 6-endotoxins
including, but not limited to, the Cry1, Cry2, Cry3, Cry4, Cry5,
Cry6, Cry7, Cry8, Cry9, Cry10, Cry11, Cry12, Cry13, Cry14, Cry15,
Cry16, Cry17, Cry18, Cry19, Cry20, Cry21, Cry22, Cry23, Cry24,
Cry25, Cry26, Cry27, Cry 28, Cry 29, Cry 30, Cry31, Cry32, Cry33,
Cry34, Cry35, Cry36, Cry37, Cry38, Cry39, Cry40, Cry41, Cry42,
Cry43, Cry44, Cry45, Cry 46, Cry47, Cry49, Cry50, Cry51, Cry52,
Cry53, Cry 54, Cry55, Cry56, Cry57, Cry58, Cry59, Cry60, Cry61,
Cry62, Cry63, Cry64, Cry65, Cry66, Cry67, Cry68, Cry69, Cry70,
Cry71, and Cry 72 classes of 6-endotoxin genes and the B.
thuringiensis cytolytic Cyt1 and Cyt2 genes. Members of these
classes of B. thuringiensis insecticidal proteins well known to one
skilled in the art (see, Crickmore, et al., "Bacillus thuringiensis
toxin nomenclature" (2011), at
lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/which can be accessed
on the world-wide web using the "www" prefix).
[0225] Examples of .delta.-endotoxins also include but are not
limited to Cry1A proteins of U.S. Pat. Nos. 5,880,275 and
7,858,849; a DIG-3 or DIG-11 toxin (N-terminal deletion of
.alpha.-helix 1 and/or .alpha.-helix 2 variants of Cry proteins
such as Cry1A) of U.S. Pat. Nos. 8,304,604 and 8,304,605, Cry1B of
U.S. patent application Ser. No. 10/525,318; Cry1C of U.S. Pat. No.
6,033,874; Cry1F of U.S. Pat. Nos. 5,188,960, 6,218,188; Cry1A/F
chimeras of U.S. Pat. Nos. 7,070,982; 6,962,705 and 6,713,063); a
Cry2 protein such as Cry2Ab protein of U.S. Pat. No. 7,064,249); a
Cry3A protein including but not limited to an engineered hybrid
insecticidal protein (eHIP) created by fusing unique combinations
of variable regions and conserved blocks of at least two different
Cry proteins (US Patent Application Publication Number
2010/0017914); a Cry4 protein; a Cry5 protein; a Cry6 protein; Cry8
proteins of U.S. Pat. Nos. 7,329,736, 7,449,552, 7,803,943,
7,476,781, 7,105,332, 7,378,499 and 7,462,760; a Cry9 protein such
as such as members of the Cry9A, Cry9B, Cry9C, Cry9D, Cry9E, and
Cry9F families; a Cry15 protein of Naimov, et al., (2008) Applied
and Environmental Microbiology 74:7145-7151; a Cry22, a Cry34Ab1
protein of U.S. Pat. Nos. 6,127,180, 6,624,145 and 6,340,593; a
CryET33 and CryET34 protein of U.S. Pat. Nos. 6,248,535, 6,326,351,
6,399,330, 6,949,626, 7,385,107 and 7,504,229; a CryET33 and
CryET34 homologs of US Patent Publication Number 2006/0191034,
2012/0278954, and PCT Publication Number WO 2012/139004; a Cry35Ab1
protein of U.S. Pat. Nos. 6,083,499, 6,548,291 and 6,340,593; a
Cry46 protein, a Cry 51 protein, a Cry binary toxin; a TIC901 or
related toxin; TIC807 of US 2008/0295207; ET29, ET37, TIC809,
TIC810, TIC812, TIC127, TIC128 of PCT US 2006/033867; AXMI-027,
AXMI-036, and AXMI-038 of U.S. Pat. No. 8,236,757; AXMI-031,
AXMI-039, AXMI-040, AXMI-049 of U.S. Pat. No. 7,923,602; AXMI-018,
AXMI-020, and AXMI-021 of WO 2006/083891; AXMI-010 of WO
2005/038032; AXMI-003 of WO 2005/021585; AXMI-008 of US
2004/0250311; AXMI-006 of US 2004/0216186; AXMI-007 of US
2004/0210965; AXMI-009 of US 2004/0210964; AXMI-014 of US
2004/0197917; AXMI-004 of US 2004/0197916; AXMI-028 and AXMI-029 of
WO 2006/119457; AXMI-007, AXMI-008, AXMI-0080rf2, AXMI-009,
AXMI-014 and AXMI-004 of WO 2004/074462; AXMI-150 of U.S. Pat. No.
8,084,416; AXMI-205 of US20110023184; AXMI-011, AXMI-012, AXMI-013,
AXMI-015, AXMI-019, AXMI-044, AXMI-037, AXMI-043, AXMI-033,
AXMI-034, AXMI-022, AXMI-023, AXMI-041, AXMI-063, and AXMI-064 of
US 2011/0263488; AXMI-R1 and related proteins of US 2010/0197592;
AXMI221Z, AXMI222z, AXMI223z, AXMI224z and AXMI225z of WO
2011/103248; AXMI218, AXMI219, AXMI220, AXMI226, AXMI227, AXMI228,
AXMI229, AXMI230, and AXMI231 of WO11/103247; AXMI-115, AXMI-113,
AXMI-005, AXMI-163 and AXMI-184 of U.S. Pat. No. 8,334,431;
AXMI-001, AXMI-002, AXMI-030, AXMI-035, and AXMI-045 of US
2010/0298211; AXMI-066 and AXMI-076 of US2009/0144852; AXMI128,
AXMI130, AXMI131, AXMI133, AXMI140, AXMI141, AXMI142, AXMI143,
AXMI144, AXMI146, AXMI148, AXMI149, AXMI152, AXMI153, AXMI154,
AXMI155, AXMI156, AXMI157, AXMI158, AXMI162, AXMI165, AXMI166,
AXMI167, AXMI168, AXMI169, AXMI170, AXMI171, AXMI172, AXMI173,
AXMI174, AXMI175, AXMI176, AXMI177, AXMI178, AXMI179, AXMI180,
AXMI181, AXMI182, AXMI185, AXMI186, AXMI187, AXMI188, AXMI189 of
U.S. Pat. No. 8,318,900; AXMI079, AXMI080, AXMI081, AXMI082,
AXMI091, AXMI092, AXMI096, AXMI097, AXMI098, AXMI099, AXMI100,
AXMI101, AXMI102, AXMI103, AXMI104, AXMI107, AXMI108, AXMI109,
AXMI110, AXMI111, AXMI112, AXMI114, AXMI116, AXMI117, AXMI118,
AXMI119, AXMI120, AXMI121, AXMI122, AXMI123, AXMI124, AXMI1257,
AXMI1268, AXMI127, AXMI129, AXMI164, AXMI151, AXMI161, AXMI183,
AXMI132, AXMI138, AXMI137 of US 2010/0005543; and Cry proteins such
as Cry1A and Cry3A having modified proteolytic sites of U.S. Pat.
No. 8,319,019; and a Cry1Ac, Cry2Aa and Cry1Ca toxin protein from
Bacillus thuringiensis strain VBTS 2528 of US Patent Application
Publication Number 2011/0064710. Other Cry proteins are well known
to one skilled in the art (see, Crickmore, et al., "Bacillus
thuringiensis toxin nomenclature" (2011), at
lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/which can be accessed
on the world-wide web using the "www" prefix). The insecticidal
activity of Cry proteins is well known to one skilled in the art
(for review, see, van Frannkenhuyzen, (2009) J. Invert. Path.
101:1-16). The use of Cry proteins as transgenic plant traits is
well known to one skilled in the art and Cry-transgenic plants
including but not limited to Cry1Ac, Cry1Ac+Cry2Ab, Cry1Ab,
Cry1A.105, Cry1F, Cry1Fa2, Cry1F+Cry1Ac, Cry2Ab, Cry3A, mCry3A,
Cry3Bb1, Cry34Ab1, Cry35Ab1, Vip3A, mCry3A, Cry9c and CBI-Bt have
received regulatory approval (see, Sanahuja, (2011) Plant Biotech
Journal 9:283-300 and the CERA (2010) GM Crop Database Center for
Environmental Risk Assessment (CERA), ILSI Research Foundation,
Washington D.C. at cera-gmc.org/index.php?action=gm_crop_database
which can be accessed on the world-wide web using the "www"
prefix). More than one pesticidal proteins well known to one
skilled in the art can also be expressed in plants such as Vip3Ab
& Cry1Fa (US2012/0317682), Cry1BE & Cry1F (US2012/0311746),
Cry1CA & Cry1AB (US2012/0311745), Cry1F & CryCa
(US2012/0317681), Cry1DA & Cry1BE (US2012/0331590), Cry1DA
& Cry1Fa (US2012/0331589), Cry1AB & Cry1BE
(US2012/0324606), and Cry1Fa & Cry2Aa, Cry1I or Cry1E
(US2012/0324605). Pesticidal proteins also include insecticidal
lipases including lipid acyl hydrolases of U.S. Pat. No. 7,491,869,
and cholesterol oxidases such as from Streptomyces (Purcell et al.
(1993) Biochem Biophys Res Commun 15:1406-1413). Pesticidal
proteins also include VIP (vegetative insecticidal proteins) toxins
of U.S. Pat. Nos. 5,877,012, 6,107,279, 6,137,033, 7,244,820,
7,615,686, and 8,237,020, and the like. Other VIP proteins are well
known to one skilled in the art (see,
lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html which can be
accessed on the world-wide web using the "www" prefix). Pesticidal
proteins also include toxin complex (TC) proteins, obtainable from
organisms such as Xenorhabdus, Photorhabdus and Paenibacillus (see,
U.S. Pat. Nos. 7,491,698 and 8,084,418). Some TC proteins have
"stand alone" insecticidal activity and other TC proteins enhance
the activity of the stand-alone toxins produced by the same given
organism. The toxicity of a "stand-alone" TC protein (from
Photorhabdus, Xenorhabdus or Paenibacillus, for example) can be
enhanced by one or more TC protein "potentiators" derived from a
source organism of a different genus. There are three main types of
TC proteins. As referred to herein, Class A proteins ("Protein A")
are stand-alone toxins. Class B proteins ("Protein B") and Class C
proteins ("Protein C") enhance the toxicity of Class A proteins.
Examples of Class A proteins are TcbA, TcdA, XptA1 and XptA2.
Examples of Class B proteins are TcaC, TcdB, XptB1Xb and XptC1Wi.
Examples of Class C proteins are TccC, XptC1Xb and XptB1Wi.
Pesticidal proteins also include spider, snake and scorpion venom
proteins. Examples of spider venom peptides include but are not
limited to lycotoxin-1 peptides and mutants thereof (U.S. Pat. No.
8,334,366).
[0226] (C) A polynucleotide encoding an insect-specific hormone or
pheromone such as an ecdysteroid and juvenile hormone, a variant
thereof, a mimetic based thereon or an antagonist or agonist
thereof. See, for example, the disclosure by Hammock, et al.,
(1990) Nature 344:458, of baculovirus expression of cloned juvenile
hormone esterase, an inactivator of juvenile hormone.
[0227] (D) A polynucleotide encoding an insect-specific peptide
which, upon expression, disrupts the physiology of the affected
pest. For example, see the disclosures of, Regan, (1994) J. Biol.
Chem. 269:9 (expression cloning yields DNA coding for insect
diuretic hormone receptor); Pratt, et al., (1989) Biochem. Biophys.
Res. Comm. 163:1243 (an allostatin is identified in Diploptera
puntata); Chattopadhyay, et al., (2004) Critical Reviews in
Microbiology 30(1):33-54; Zjawiony, (2004) J Nat Prod
67(2):300-310; Carlini and Grossi-de-Sa, (2002) Toxicon
40(11):1515-1539; Ussuf, et al., (2001) Curr Sci. 80(7):847-853 and
Vasconcelos and Oliveira, (2004) Toxicon 44(4):385-403. See also,
U.S. Pat. No. 5,266,317 to Tomalski, et al., who disclose genes
encoding insect-specific toxins.
[0228] (E) A polynucleotide encoding an enzyme responsible for a
hyperaccumulation of a monoterpene, a sesquiterpene, a steroid,
hydroxamic acid, a phenylpropanoid derivative or another
non-protein molecule with insecticidal activity.
[0229] (F) A polynucleotide encoding an enzyme involved in the
modification, including the post-translational modification, of a
biologically active molecule; for example, a glycolytic enzyme, a
proteolytic enzyme, a lipolytic enzyme, a nuclease, a cyclase, a
transaminase, an esterase, a hydrolase, a phosphatase, a kinase, a
phosphorylase, a polymerase, an elastase, a chitinase and a
glucanase, whether natural or synthetic. See, PCT Application WO
1993/02197 in the name of Scott, et al., which discloses the
nucleotide sequence of a callase gene. DNA molecules which contain
chitinase-encoding sequences can be obtained, for example, from the
ATCC.RTM. under Accession Numbers 39637 and 67152. See also,
Kramer, et al., (1993) Insect Biochem. Molec. Biol. 23:691, who
teach the nucleotide sequence of a cDNA encoding tobacco hookworm
chitinase and Kawalleck, et al., (1993) Plant Molec. Biol. 21:673,
who provide the nucleotide sequence of the parsley ubi4-2
polyubiquitin gene, and U.S. Pat. Nos. 6,563,020; 7,145,060 and
7,087,810.
[0230] (G) A polynucleotide encoding a molecule that stimulates
signal transduction. For example, see the disclosure by Botella, et
al., (1994) Plant Molec. Biol. 24:757, of nucleotide sequences for
mung bean calmodulin cDNA clones, and Griess, et al., (1994) Plant
Physiol. 104:1467, who provide the nucleotide sequence of a maize
calmodulin cDNA clone.
[0231] (H) A polynucleotide encoding a hydrophobic moment peptide.
See, PCT Application WO 1995/16776 and U.S. Pat. No. 5,580,852
disclosure of peptide derivatives of Tachyplesin which inhibit
fungal plant pathogens) and PCT Application WO 1995/18855 and U.S.
Pat. No. 5,607,914 (teaches synthetic antimicrobial peptides that
confer disease resistance).
[0232] (I) A polynucleotide encoding a membrane permease, a channel
former or a channel blocker. For example, see the disclosure by
Jaynes, et al., (1993) Plant Sci. 89:43, of heterologous expression
of a cecropin-beta lytic peptide analog to render transgenic
tobacco plants resistant to Pseudomonas solanacearum.
[0233] (J) A gene encoding a viral-invasive protein or a complex
toxin derived therefrom. For example, the accumulation of viral
coat proteins in transformed plant cells imparts resistance to
viral infection and/or disease development effected by the virus
from which the coat protein gene is derived, as well as by related
viruses. See, Beachy, et al., (1990) Ann. Rev. Phytopathol. 28:451.
Coat protein-mediated resistance has been conferred upon
transformed plants against alfalfa mosaic virus, cucumber mosaic
virus, tobacco streak virus, potato virus X, potato virus Y,
tobacco etch virus, tobacco rattle virus and tobacco mosaic virus.
Id.
[0234] (K) A gene encoding an insect-specific antibody or an
immunotoxin derived therefrom.
[0235] Thus, an antibody targeted to a critical metabolic function
in the insect gut would inactivate an affected enzyme, killing the
insect. Cf. Taylor, et al., Abstract #497, SEVENTH INT'L SYMPOSIUM
ON MOLECULAR PLANT-MICROBE INTERACTIONS (Edinburgh, Scotland, 1994)
(enzymatic inactivation in transgenic tobacco via production of
single-chain antibody fragments).
[0236] (L) A gene encoding a virus-specific antibody. See, for
example, Tavladoraki, et al., (1993) Nature 366:469, who show that
transgenic plants expressing recombinant antibody genes are
protected from virus attack.
[0237] (M) A polynucleotide encoding a developmental-arrestive
protein produced in nature by a pathogen or a parasite. Thus,
fungal endo alpha-1,4-D-polygalacturonases facilitate fungal
colonization and plant nutrient release by solubilizing plant cell
wall homo-alpha-1,4-D-galacturonase. See, Lamb, et al., (1992)
Bio/Technology 10:1436. The cloning and characterization of a gene
which encodes a bean endopolygalacturonase-inhibiting protein is
described by Toubart, et al., (1992) Plant J. 2:367.
[0238] (N) A polynucleotide encoding a developmental-arrestive
protein produced in nature by a plant. For example, Logemann, et
al., (1992) Bio/Technology 10:305, have shown that transgenic
plants expressing the barley ribosome-inactivating gene have an
increased resistance to fungal disease.
[0239] (O) Genes involved in the Systemic Acquired Resistance (SAR)
Response and/or the pathogenesis related genes. Briggs, (1995)
Current Biology 5(2), Pieterse and Van Loon, (2004) Curr. Opin.
Plant Bio. 7(4):456-64 and Somssich, (2003) Cell 113(7):815-6.
[0240] (P) Antifungal genes (Comelissen and Melchers, (1993) Pl.
Physiol. 101:709-712 and Parijs, et al., (1991) Planta 183:258-264
and Bushnell, et al., (1998) Can. J. of Plant Path. 20(2):137-149.
Also see, U.S. patent application Ser. Nos. 09/950,933; 11/619,645;
11/657,710; 11/748,994; 11/774,121 and U.S. Pat. Nos. 6,891,085 and
7,306,946. LysM Receptor-like kinases for the perception of chitin
fragments as a first step in plant defense response against fungal
pathogens (US 2012/0110696).
[0241] (Q) Detoxification genes, such as for fumonisin,
beauvericin, moniliformin and zearalenone and their structurally
related derivatives. For example, see, U.S. Pat. Nos. 5,716,820;
5,792,931; 5,798,255; 5,846,812; 6,083,736; 6,538,177; 6,388,171
and 6,812,380.
[0242] (R) A polynucleotide encoding a Cystatin and cysteine
proteinase inhibitors. See, U.S. Pat. No. 7,205,453.
[0243] (S) Defensin genes. See, WO 2003/000863 and U.S. Pat. Nos.
6,911,577; 6,855,865; 6,777,592 and 7,238,781.
[0244] (T) Genes conferring resistance to nematodes. See, e.g., PCT
Application WO 1996/30517; PCT Application WO 1993/19181, WO
2003/033651 and Urwin, et al., (1998) Planta 204:472-479,
Williamson, (1999) Curr Opin Plant Bio. 2(4):327-31; U.S. Pat. Nos.
6,284,948 and 7,301,069 and miR164 genes (WO 2012/058266).
[0245] (U) Genes that confer resistance to Phytophthora Root Rot,
such as the Rps 1, Rps 1-a, Rps 1-b, Rps 1-c, Rps 1-d, Rps 1-e, Rps
1-k, Rps 2, Rps 3-a, Rps 3-b, Rps 3-c, Rps 4, Rps 5, Rps 6, Rps 7
and other Rps genes. See, for example, Shoemaker, et al.,
Phytophthora Root Rot Resistance Gene Mapping in Soybean, Plant
Genome IV Conference, San Diego, Calif. (1995).
[0246] (V) Genes that confer resistance to Brown Stem Rot, such as
described in U.S. Pat. No. 5,689,035 and incorporated by reference
for this purpose.
[0247] (W) Genes that confer resistance to Colletotrichum, such as
described in US Patent Application Publication US 2009/0035765 and
incorporated by reference for this purpose. This includes the Rcg
locus that may be utilized as a single locus conversion.
2. Transgenes that Confer Resistance to a Herbicide, for
Example:
[0248] (A) A polynucleotide encoding resistance to a herbicide that
inhibits the growing point or meristem, such as an imidazolinone or
a sulfonylurea. Exemplary genes in this category code for mutant
ALS and AHAS enzyme as described, for example, by Lee, et al.,
(1988) EMBO J. 7:1241 and Miki, et al., (1990) Theor. Appl. Genet.
80:449, respectively. See also, U.S. Pat. Nos. 5,605,011;
5,013,659; 5,141,870; 5,767,361; 5,731,180; 5,304,732; 4,761,373;
5,331,107; 5,928,937 and 5,378,824; U.S. patent application Ser.
No. 11/683,737 and International Publication WO 1996/33270.
[0249] (B) A polynucleotide encoding a protein for resistance to
Glyphosate (resistance imparted by mutant
5-enolpyruvl-3-phosphikimate synthase (EPSP) and aroA genes,
respectively) and other phosphono compounds such as glufosinate
(phosphinothricin acetyl transferase (PAT) and Streptomyces
hygroscopicus phosphinothricin acetyl transferase (bar) genes), and
pyridinoxy or phenoxy proprionic acids and cyclohexones (ACCase
inhibitor-encoding genes). See, for example, U.S. Pat. No.
4,940,835 to Shah, et al., which discloses the nucleotide sequence
of a form of EPSPS which can confer glyphosate resistance. U.S.
Pat. No. 5,627,061 to Barry, et al., also describes genes encoding
EPSPS enzymes. See also, U.S. Pat. Nos. 6,566,587; 6,338,961;
6,248,876; 6,040,497; 5,804,425; 5,633,435; 5,145,783; 4,971,908;
5,312,910; 5,188,642; 5,094,945, 4,940,835; 5,866,775; 6,225,114;
6,130,366; 5,310,667; 4,535,060; 4,769,061; 5,633,448; 5,510,471;
Re. 36,449; RE 37,287 E and 5,491,288 and International
Publications EP 1173580; WO 2001/66704; EP 1173581 and EP 1173582,
which are incorporated herein by reference for this purpose.
Glyphosate resistance is also imparted to plants that express a
gene encoding a glyphosate oxido-reductase enzyme as described more
fully in U.S. Pat. Nos. 5,776,760 and 5,463,175, which are
incorporated herein by reference for this purpose. In addition
glyphosate resistance can be imparted to plants by the over
expression of genes encoding glyphosate N-acetyltransferase. See,
for example, U.S. Pat. Nos. 7,462,481; 7,405,074 and US Patent
Application Publication Number US 2008/0234130. A DNA molecule
encoding a mutant aroA gene can be obtained under ATCC.RTM.
Accession Number 39256, and the nucleotide sequence of the mutant
gene is disclosed in U.S. Pat. No. 4,769,061 to Comai. EP
Application Number 0333033 to Kumada, et al., and U.S. Pat. No.
4,975,374 to Goodman, et al., disclose nucleotide sequences of
glutamine synthetase genes which confer resistance to herbicides
such as L-phosphinothricin. The nucleotide sequence of a
phosphinothricin-acetyl-transferase gene is provided in EP
Application Numbers 0242246 and 0242236 to Leemans, et al., De
Greef, et al., (1989) Bio/Technology 7:61, describe the production
of transgenic plants that express chimeric bar genes coding for
phosphinothricin acetyl transferase activity. See also, U.S. Pat.
Nos. 5,969,213; 5,489,520; 5,550,318; 5,874,265; 5,919,675;
5,561,236; 5,648,477; 5,646,024; 6,177,616 and 5,879,903, which are
incorporated herein by reference for this purpose. Exemplary genes
conferring resistance to phenoxy proprionic acids and cyclohexones,
such as sethoxydim and haloxyfop, are the Acc1-S1, Acc1-S2 and
Acc1-S3 genes described by Marshall, et al., (1992) Theor. Appl.
Genet. 83:435.
[0250] (C) A polynucleotide encoding a protein for resistance to
herbicide that inhibits photosynthesis, such as a triazine (psbA
and gs+ genes) and a benzonitrile (nitrilase gene). Przibilla, et
al., (1991) Plant Cell 3:169, describe the transformation of
Chlamydomonas with plasmids encoding mutant psbA genes. Nucleotide
sequences for nitrilase genes are disclosed in U.S. Pat. No.
4,810,648 to Stalker and DNA molecules containing these genes are
available under ATCC.RTM. Accession Numbers 53435, 67441 and 67442.
Cloning and expression of DNA coding for a glutathione
S-transferase is described by Hayes, et al., (1992) Biochem. J.
285:173.
[0251] (D) A polynucleotide encoding a protein for resistance to
Acetohydroxy acid synthase, which has been found to make plants
that express this enzyme resistant to multiple types of herbicides,
has been introduced into a variety of plants (see, e.g., Hattori,
et al., (1995) Mol Gen Genet. 246:419). Other genes that confer
resistance to herbicides include: a gene encoding a chimeric
protein of rat cytochrome P4507A1 and yeast NADPH-cytochrome P450
oxidoreductase (Shiota, et al., (1994) Plant Physiol 106:17), genes
for glutathione reductase and superoxide dismutase (Aono, et al.,
(1995) Plant Cell Physiol 36:1687) and genes for various
phosphotransferases (Datta, et al., (1992) Plant Mol Biol
20:619).
[0252] (E) A polynucleotide encoding resistance to a herbicide
targeting Protoporphyrinogen oxidase (protox) which is necessary
for the production of chlorophyll. The protox enzyme serves as the
target for a variety of herbicidal compounds. These herbicides also
inhibit growth of all the different species of plants present,
causing their total destruction. The development of plants
containing altered protox activity which are resistant to these
herbicides are described in U.S. Pat. Nos. 6,288,306; 6,282,83 and
5,767,373 and International Publication WO 2001/12825.
[0253] (F) The aad-1 gene (originally from Sphingobium
herbicidovorans) encodes the aryloxyalkanoate dioxygenase (AAD-1)
protein. The trait confers tolerance to 2,4-dichlorophenoxyacetic
acid and aryloxyphenoxypropionate (commonly referred to as "fop"
herbicides such as quizalofop) herbicides. The aad-1 gene, itself,
for herbicide tolerance in plants was first disclosed in WO
2005/107437 (see also, US 2009/0093366). The aad-12 gene, derived
from Delftia acidovorans, which encodes the aryloxyalkanoate
dioxygenase (AAD-12) protein that confers tolerance to
2,4-dichlorophenoxyacetic acid and pyridyloxyacetate herbicides by
deactivating several herbicides with an aryloxyalkanoate moiety,
including phenoxy auxin (e.g., 2,4-D, MCPA), as well as pyridyloxy
auxins (e.g., fluroxypyr, triclopyr).
[0254] (G) A polynucleotide encoding a herbicide resistant dicamba
monooxygenase disclosed in US Patent Application Publication
2003/0135879 for imparting dicamba tolerance;
[0255] (H) A polynucleotide molecule encoding bromoxynil nitrilase
(Bxn) disclosed in U.S. Pat. No. 4,810,648 for imparting bromoxynil
tolerance;
[0256] (I) A polynucleotide molecule encoding phytoene (crtI)
described in Misawa, et al., (1993) Plant J. 4:833-840 and in
Misawa, et al., (1994) Plant J. 6:481-489 for norflurazon
tolerance.
3. Transgenes that Confer or Contribute to an Altered Grain
Characteristic Such as:
[0257] (A) Altered fatty acids, for example, by
[0258] (1) Down-regulation of stearoyl-ACP to increase stearic acid
content of the plant. See, Knultzon, et al., (1992) Proc. Natl.
Acad. Sci. USA 89:2624 and WO 1999/64579 (Genes to Alter Lipid
Profiles in Corn).
[0259] (2) Elevating oleic acid via FAD-2 gene modification and/or
decreasing linolenic acid via FAD-3 gene modification (see, U.S.
Pat. Nos. 6,063,947; 6,323,392; 6,372,965 and WO 1993/11245).
[0260] (3) Altering conjugated linolenic or linoleic acid content,
such as in WO 2001/12800.
[0261] (4) Altering LEC1, AGP, Dek1, Superal1, mil ps, and various
Ipa genes such as Ipa1, Ipa3, hpt or hggt. For example, see, WO
2002/42424, WO 1998/22604, WO 2003/011015, WO 2002/057439, WO
2003/011015, U.S. Pat. Nos. 6,423,886, 6,197,561, 6,825,397 and US
Patent Application Publication Numbers US 2003/0079247, US
2003/0204870 and Rivera-Madrid, et al., (1995) Proc. Natl. Acad.
Sci. 92:5620-5624.
[0262] (5) Genes encoding delta-8 desaturase for making long-chain
polyunsaturated fatty acids (U.S. Pat. Nos. 8,058,571 and
8,338,152), delta-9 desaturase for lowering saturated fats (U.S.
Pat. No. 8,063,269), Primula .DELTA.6-desaturase for improving
omega-3 fatty acid profiles.
[0263] (6) Isolated nucleic acids and proteins associated with
lipid and sugar metabolism regulation, in particular, lipid
metabolism protein (LMP) used in methods of producing transgenic
plants and modulating levels of seed storage compounds including
lipids, fatty acids, starches or seed storage proteins and use in
methods of modulating the seed size, seed number, seed weights,
root length and leaf size of plants (EP 2404499).
[0264] (7) Altering expression of a High-Level Expression of
Sugar-Inducible 2 (HSI2) protein in the plant to increase or
decrease expression of HSI2 in the plant. Increasing expression of
HSI2 increases oil content while decreasing expression of HSI2
decreases abscisic acid sensitivity and/or increases drought
resistance (US Patent Application Publication Number
2012/0066794).
[0265] (8) Expression of cytochrome b5 (Cb5) alone or with FAD2 to
modulate oil content in plant seed, particularly to increase the
levels of omega-3 fatty acids and improve the ratio of omega-6 to
omega-3 fatty acids (US Patent Application Publication Number
2011/0191904).
[0266] (9) Nucleic acid molecules encoding wrinkled1-like
polypeptides for modulating sugar metabolism (U.S. Pat. No.
8,217,223).
[0267] (B) Altered phosphorus content, for example, by the
[0268] (1) Introduction of a phytase-encoding gene would enhance
breakdown of phytate, adding more free phosphate to the transformed
plant. For example, see, Van Hartingsveldt, et al., (1993) Gene
127:87, for a disclosure of the nucleotide sequence of an
Aspergillus niger phytase gene.
[0269] (2) Modulating a gene that reduces phytate content. In
maize, this, for example, could be accomplished, by cloning and
then re-introducing DNA associated with one or more of the alleles,
such as the LPA alleles, identified in maize mutants characterized
by low levels of phytic acid, such as in WO 2005/113778 and/or by
altering inositol kinase activity as in WO 2002/059324, US Patent
Application Publication Number 2003/0009011, WO 2003/027243, US
Patent Application Publication Number 2003/0079247, WO 1999/05298,
U.S. Pat. Nos. 6,197,561, 6,291,224, 6,391,348, WO 2002/059324, US
Patent Application Publication Number 2003/0079247, WO 1998/45448,
WO 1999/55882, WO 2001/04147.
[0270] (C) Altered carbohydrates affected, for example, by altering
a gene for an enzyme that affects the branching pattern of starch
or, a gene altering thioredoxin such as NTR and/or TRX (see, U.S.
Pat. No. 6,531,648. which is incorporated by reference for this
purpose) and/or a gamma zein knock out or mutant such as cs27 or
TUSC27 or en27 (see, U.S. Pat. No. 6,858,778 and US Patent
Application Publication Number 2005/0160488, US Patent Application
Publication Number 2005/0204418, which are incorporated by
reference for this purpose). See, Shiroza, et al., (1988) J.
Bacteriol. 170:810 (nucleotide sequence of Streptococcus mutant
fructosyltransferase gene), Steinmetz, et al., (1985) Mol. Gen.
Genet. 200:220 (nucleotide sequence of Bacillus subtilis
levansucrase gene), Pen, et al., (1992) Bio/Technology 10:292
(production of transgenic plants that express Bacillus
licheniformis alpha-amylase), Elliot, et al., (1993) Plant Molec.
Biol. 21:515 (nucleotide sequences of tomato invertase genes),
Sogaard, et al., (1993) J. Biol. Chem. 268:22480 (site-directed
mutagenesis of barley alpha-amylase gene) and Fisher, et al.,
(1993) Plant Physiol. 102:1045 (maize endosperm starch branching
enzyme II), WO 1999/10498 (improved digestibility and/or starch
extraction through modification of UDP-D-xylose 4-epimerase,
Fragile 1 and 2, Ref1, HCHL, C4H), U.S. Pat. No. 6,232,529 (method
of producing high oil seed by modification of starch levels (AGP)).
The fatty acid modification genes mentioned herein may also be used
to affect starch content and/or composition through the
interrelationship of the starch and oil pathways.
[0271] (D) Altered antioxidant content or composition, such as
alteration of tocopherol or tocotrienols. For example, see, U.S.
Pat. No. 6,787,683, US Patent Application Publication Number
2004/0034886 and WO 2000/68393 involving the manipulation of
antioxidant levels and WO 2003/082899 through alteration of a
homogentisate geranyl geranyl transferase (hggt).
[0272] (E) Altered essential seed amino acids. For example, see,
U.S. Pat. No. 6,127,600 (method of increasing accumulation of
essential amino acids in seeds), U.S. Pat. No. 6,080,913 (binary
methods of increasing accumulation of essential amino acids in
seeds), U.S. Pat. No. 5,990,389 (high lysine), WO 1999/40209
(alteration of amino acid compositions in seeds), WO 1999/29882
(methods for altering amino acid content of proteins), U.S. Pat.
No. 5,850,016 (alteration of amino acid compositions in seeds), WO
1998/20133 (proteins with enhanced levels of essential amino
acids), U.S. Pat. No. 5,885,802 (high methionine), U.S. Pat. No.
5,885,801 (high threonine), U.S. Pat. No. 6,664,445 (plant amino
acid biosynthetic enzymes), U.S. Pat. No. 6,459,019 (increased
lysine and threonine), U.S. Pat. No. 6,441,274 (plant tryptophan
synthase beta subunit), U.S. Pat. No. 6,346,403 (methionine
metabolic enzymes), U.S. Pat. No. 5,939,599 (high sulfur), U.S.
Pat. No. 5,912,414 (increased methionine), WO 1998/56935 (plant
amino acid biosynthetic enzymes), WO 1998/45458 (engineered seed
protein having higher percentage of essential amino acids), WO
1998/42831 (increased lysine), U.S. Pat. No. 5,633,436 (increasing
sulfur amino acid content), U.S. Pat. No. 5,559,223 (synthetic
storage proteins with defined structure containing programmable
levels of essential amino acids for improvement of the nutritional
value of plants), WO 1996/01905 (increased threonine), WO
1995/15392 (increased lysine), US Patent Application Publication
Number 2003/0163838, US Patent Application Publication Number
2003/0150014, US Patent Application Publication Number
2004/0068767, U.S. Pat. No. 6,803,498, WO 2001/79516.
4. Genes that Control Male-Sterility:
[0273] There are several methods of conferring genetic male
sterility available, such as multiple mutant genes at separate
locations within the genome that confer male sterility, as
disclosed in U.S. Pat. Nos. 4,654,465 and 4,727,219 to Brar, et
al., and chromosomal translocations as described by Patterson in
U.S. Pat. Nos. 3,861,709 and 3,710,511. In addition to these
methods, Albertsen, et al., U.S. Pat. No. 5,432,068, describe a
system of nuclear male sterility which includes: identifying a gene
which is critical to male fertility; silencing this native gene
which is critical to male fertility; removing the native promoter
from the essential male fertility gene and replacing it with an
inducible promoter; inserting this genetically engineered gene back
into the plant; and thus creating a plant that is male sterile
because the inducible promoter is not "on" resulting in the male
fertility gene not being transcribed. Fertility is restored by
inducing or turning "on", the promoter, which in turn allows the
gene that, confers male fertility to be transcribed.
[0274] (A) Introduction of a deacetylase gene under the control of
a tapetum-specific promoter and with the application of the
chemical N-Ac-PPT (WO 2001/29237).
[0275] (B) Introduction of various stamen-specific promoters (WO
1992/13956, WO 1992/13957).
[0276] (C) Introduction of the barnase and the barstar gene (Paul,
et al., (1992) Plant Mol. Biol. 19:611-622).
[0277] For additional examples of nuclear male and female sterility
systems and genes, see also, U.S. Pat. Nos. 5,859,341; 6,297,426;
5,478,369; 5,824,524; 5,850,014 and 6,265,640, all of which are
hereby incorporated by reference.
5. Genes that Create a Site for Site Specific DNA Integration.
[0278] This includes the introduction of FRT sites that may be used
in the FLP/FRT system and/or Lox sites that may be used in the
Cre/Loxp system. For example, see, Lyznik, et al., (2003) Plant
Cell Rep 21:925-932 and WO 1999/25821, which are hereby
incorporated by reference. Other systems that may be used include
the Gin recombinase of phage Mu (Maeser, et al., (1991) Vicki
Chandler, The Maize Handbook ch. 118 (Springer-Verlag 1994), the
Pin recombinase of E. coli (Enomoto, et al., 1983) and the R/RS
system of the pSRi plasmid (Araki, et al., 1992).
6. Genes that Affect Abiotic Stress Resistance
[0279] Including but not limited to flowering, ear and seed
development, enhancement of nitrogen utilization efficiency,
altered nitrogen responsiveness, drought resistance or tolerance,
cold resistance or tolerance and salt resistance or tolerance and
increased yield under stress.
[0280] (A) For example, see: WO 2000/73475 where water use
efficiency is altered through alteration of malate; U.S. Pat. Nos.
5,892,009, 5,965,705, 5,929,305, 5,891,859, 6,417,428, 6,664,446,
6,706,866, 6,717,034, 6,801,104, WO 2000/060089, WO 2001/026459, WO
2001/035725, WO 2001/034726, WO 2001/035727, WO 2001/036444, WO
2001/036597, WO 2001/036598, WO 2002/015675, WO 2002/017430, WO
2002/077185, WO 2002/079403, WO 2003/013227, WO 2003/013228, WO
2003/014327, WO 2004/031349, WO 2004/076638, WO 199809521.
[0281] (B) WO 199938977 describing genes, including CBF genes and
transcription factors effective in mitigating the negative effects
of freezing, high salinity and drought on plants, as well as
conferring other positive effects on plant phenotype.
[0282] (C) US Patent Application Publication Number 2004/0148654
and WO 2001/36596 where abscisic acid is altered in plants
resulting in improved plant phenotype such as increased yield
and/or increased tolerance to abiotic stress.
[0283] (D) WO 2000/006341, WO 2004/090143, U.S. Pat. Nos. 7,531,723
and 6,992,237 where cytokinin expression is modified resulting in
plants with increased stress tolerance, such as drought tolerance,
and/or increased yield. Also see, WO 2002/02776, WO 2003/052063, JP
2002/281975, U.S. Pat. No. 6,084,153, WO 2001/64898, U.S. Pat. Nos.
6,177,275 and 6,107,547 (enhancement of nitrogen utilization and
altered nitrogen responsiveness).
[0284] (E) For ethylene alteration, see, US Patent Application
Publication Number 2004/0128719, US Patent Application Publication
Number 2003/0166197 and WO 2000/32761.
[0285] (F) For plant transcription factors or transcriptional
regulators of abiotic stress, see, e.g., US Patent Application
Publication Number 2004/0098764 or US Patent Application
Publication Number 2004/0078852.
[0286] (G) Genes that increase expression of vacuolar
pyrophosphatase such as AVP1 (U.S. Pat. No. 8,058,515) for
increased yield; nucleic acid encoding a HSFA4 or a HSFA5 (Heat
Shock Factor of the class A4 or A5) polypeptides, an oligopeptide
transporter protein (OPT4-like) polypeptide; a plastochron2-like
(PLA2-like) polypeptide or a Wuschel related homeobox 1-like
(WOX1-like) polypeptide (U. Patent Application Publication Number
US 2011/0283420).
[0287] (H) Down regulation of polynucleotides encoding poly
(ADP-ribose) polymerase (PARP) proteins to modulate programmed cell
death (U.S. Pat. No. 8,058,510) for increased vigor.
[0288] (I) Polynucleotide encoding DTP21 polypeptides for
conferring drought resistance (US Patent Application Publication
Number US 2011/0277181).
[0289] (J) Nucleotide sequences encoding ACC Synthase 3 (ACS3)
proteins for modulating development, modulating response to stress,
and modulating stress tolerance (US Patent Application Publication
Number US 2010/0287669).
[0290] (K) Polynucleotides that encode proteins that confer a
drought tolerance phenotype (DTP) for conferring drought resistance
(WO 2012/058528).
[0291] (L) Tocopherol cyclase (TC) genes for conferring drought and
salt tolerance (US Patent Application Publication Number
2012/0272352).
[0292] (M) CAAX amino terminal family proteins for stress tolerance
(U.S. Pat. No. 8,338,661).
[0293] (N) Mutations in the SAL1 encoding gene have increased
stress tolerance, including increased drought resistant (US Patent
Application Publication Number 2010/0257633).
[0294] (O) Expression of a nucleic acid sequence encoding a
polypeptide selected from the group consisting of: GRF polypeptide,
RAA1-like polypeptide, SYR polypeptide, ARKL polypeptide, and YTP
polypeptide increasing yield-related traits (US Patent Application
Publication Number 2011/0061133).
[0295] (P) Modulating expression in a plant of a nucleic acid
encoding a Class III Trehalose Phosphate Phosphatase (TPP)
polypeptide for enhancing yield-related traits in plants,
particularly increasing seed yield (US Patent Application
Publication Number 2010/0024067).
[0296] Other genes and transcription factors that affect plant
growth and agronomic traits such as yield, flowering, plant growth
and/or plant structure, can be introduced or introgressed into
plants, see e.g., WO 1997/49811 (LHY), WO 1998/56918 (ESD4), WO
1997/10339 and U.S. Pat. No. 6,573,430 (TFL), U.S. Pat. No.
6,713,663 (FT), WO 1996/14414 (CON), WO 1996/38560, WO 2001/21822
(VRN1), WO 2000/44918 (VRN2), WO 1999/49064 (GI), WO 2000/46358
(FR1), WO 1997/29123, U.S. Pat. Nos. 6,794,560, 6,307,126 (GAI), WO
1999/09174 (D8 and Rht) and WO 2004/076638 and WO 2004/031349
(transcription factors).
7. Genes that Confer Increased Yield
[0297] (A) A transgenic crop plant transformed by a
1-AminoCyclopropane-1-Carboxylate Deaminase-like Polypeptide
(ACCDP) coding nucleic acid, wherein expression of the nucleic acid
sequence in the crop plant results in the plant's increased root
growth, and/or increased yield, and/or increased tolerance to
environmental stress as compared to a wild type variety of the
plant (U.S. Pat. No. 8,097,769).
[0298] (B) Over-expression of maize zinc finger protein gene
(Zm-ZFP1) using a seed preferred promoter has been shown to enhance
plant growth, increase kernel number and total kernel weight per
plant (US Patent Application Publication Number 2012/0079623).
[0299] (C) Constitutive over-expression of maize lateral organ
boundaries (LOB) domain protein (Zm-LOBDP1) has been shown to
increase kernel number and total kernel weight per plant (US Patent
Application Publication Number 2012/0079622).
[0300] (D) Enhancing yield-related traits in plants by modulating
expression in a plant of a nucleic acid encoding a VIM1 (Variant in
Methylation 1)-like polypeptide or a VTC2-like (GDP-L-galactose
phosphorylase) polypeptide or a DUF1685 polypeptide or an ARF6-like
(Auxin Responsive Factor) polypeptide (WO 2012/038893).
[0301] (E) Modulating expression in a plant of a nucleic acid
encoding a Ste20-like polypeptide or a homologue thereof gives
plants having increased yield relative to control plants (EP
2431472).
[0302] (F) Genes encoding nucleoside diphosphatase kinase (NDK)
polypeptides and homologs thereof for modifying the plant's root
architecture (US Patent Application Publication Number
2009/0064373).
8. Genes that Confer Plant Digestibility.
[0303] (A) Altering the level of xylan present in the cell wall of
a plant by modulating expression of xylan synthase (U.S. Pat. No.
8,173,866).
[0304] In some embodiment the stacked trait may be a trait or event
that has received regulatory approval including but not limited to
the events with regulatory approval that are well known to one
skilled in the art and can be found at the Center for Environmental
Risk Assessment (cera-gmc.org/?action=gm_crop_database, which can
be accessed using the www prefix) and at the International Service
for the Acquisition of Agri-Biotech Applications
(isaaa.org/gmapprovaldatabase/default.asp, which can be accessed
using the www prefix).
Gene Silencing
[0305] In some embodiments the stacked trait may be in the form of
silencing of one or more polynucleotides of interest resulting in
suppression of one or more target pest polypeptides. In some
embodiments the silencing is achieved through the use of a
suppression DNA construct.
[0306] In some embodiments one or more polynucleotide encoding the
polypeptides of the IPD103 polypeptide or fragments or variants
thereof may be stacked with one or more polynucleotides encoding
one or more polypeptides having insecticidal activity or agronomic
traits as set forth supra and optionally may further include one or
more polynucleotides providing for gene silencing of one or more
target polynucleotides as discussed infra.
[0307] "Suppression DNA construct" is a recombinant DNA construct
which when transformed or stably integrated into the genome of the
plant, results in "silencing" of a target gene in the plant. The
target gene may be endogenous or transgenic to the plant.
"Silencing," as used herein with respect to the target gene, refers
generally to the suppression of levels of mRNA or protein/enzyme
expressed by the target gene, and/or the level of the enzyme
activity or protein functionality. The term "suppression" includes
lower, reduce, decline, decrease, inhibit, eliminate and prevent.
"Silencing" or "gene silencing" does not specify mechanism and is
inclusive, and not limited to, anti-sense, cosuppression,
viral-suppression, hairpin suppression, stem-loop suppression,
RNAi-based approaches and small RNA-based approaches.
[0308] A suppression DNA construct may comprise a region derived
from a target gene of interest and may comprise all or part of the
nucleic acid sequence of the sense strand (or antisense strand) of
the target gene of interest. Depending upon the approach to be
utilized, the region may be 100% identical or less than 100%
identical (e.g., at least 50% or any integer between 51% and 100%
identical) to all or part of the sense strand (or antisense strand)
of the gene of interest.
[0309] Suppression DNA constructs are well-known in the art, are
readily constructed once the target gene of interest is selected,
and include, without limitation, cosuppression constructs,
antisense constructs, viral-suppression constructs, hairpin
suppression constructs, stem-loop suppression constructs,
double-stranded RNA-producing constructs, and more generally, RNAi
(RNA interference) constructs and small RNA constructs such as
siRNA (short interfering RNA) constructs and miRNA (microRNA)
constructs.
[0310] "Antisense inhibition" refers to the production of antisense
RNA transcripts capable of suppressing the expression of the target
protein.
[0311] "Antisense RNA" refers to an RNA transcript that is
complementary to all or part of a target primary transcript or mRNA
and that blocks the expression of a target isolated nucleic acid
fragment. The complementarity of an antisense RNA may be with any
part of the specific gene transcript, i.e., at the 5' non-coding
sequence, 3' non-coding sequence, introns or the coding
sequence.
[0312] "Cosuppression" refers to the production of sense RNA
transcripts capable of suppressing the expression of the target
protein. "Sense" RNA refers to RNA transcript that includes the
mRNA and can be translated into protein within a cell or in vitro.
Cosuppression constructs in plants have been previously designed by
focusing on overexpression of a nucleic acid sequence having
homology to a native mRNA, in the sense orientation, which results
in the reduction of all RNA having homology to the overexpressed
sequence (see, Vaucheret, et al., (1998) Plant J. 16:651-659 and
Gura, (2000) Nature 404:804-808).
[0313] Another variation describes the use of plant viral sequences
to direct the suppression of proximal mRNA encoding sequences (PCT
Publication WO 1998/36083).
[0314] Recent work has described the use of "hairpin" structures
that incorporate all or part, of an mRNA encoding sequence in a
complementary orientation that results in a potential "stem-loop"
structure for the expressed RNA (PCT Publication WO 1999/53050). In
this case the stem is formed by polynucleotides corresponding to
the gene of interest inserted in either sense or anti-sense
orientation with respect to the promoter and the loop is formed by
some polynucleotides of the gene of interest, which do not have a
complement in the construct. This increases the frequency of
cosuppression or silencing in the recovered transgenic plants. For
review of hairpin suppression, see, Wesley, et al., (2003) Methods
in Molecular Biology, Plant Functional Genomics: Methods and
Protocols 236:273-286.
[0315] A construct where the stem is formed by at least 30
nucleotides from a gene to be suppressed and the loop is formed by
a random nucleotide sequence has also effectively been used for
suppression (PCT Publication WO 1999/61632).
[0316] The use of poly-T and poly-A sequences to generate the stem
in the stem-loop structure has also been described (PCT Publication
WO 2002/00894).
[0317] Yet another variation includes using synthetic repeats to
promote formation of a stem in the stem-loop structure. Transgenic
organisms prepared with such recombinant DNA fragments have been
shown to have reduced levels of the protein encoded by the
nucleotide fragment forming the loop as described in PCT
Publication WO 2002/00904.
[0318] RNA interference refers to the process of sequence-specific
post-transcriptional gene silencing in animals mediated by short
interfering RNAs (siRNAs) (Fire, et al., (1998) Nature 391:806).
The corresponding process in plants is commonly referred to as
post-transcriptional gene silencing (PTGS) or RNA silencing and is
also referred to as quelling in fungi. The process of
post-transcriptional gene silencing is thought to be an
evolutionarily-conserved cellular defense mechanism used to prevent
the expression of foreign genes and is commonly shared by diverse
flora and phyla (Fire, et al., (1999) Trends Genet. 15:358). Such
protection from foreign gene expression may have evolved in
response to the production of double-stranded RNAs (dsRNAs) derived
from viral infection or from the random integration of transposon
elements into a host genome via a cellular response that
specifically destroys homologous single-stranded RNA of viral
genomic RNA. The presence of dsRNA in cells triggers the RNAi
response through a mechanism that has yet to be fully
characterized.
[0319] The presence of long dsRNAs in cells stimulates the activity
of a ribonuclease Ill enzyme referred to as dicer. Dicer is
involved in the processing of the dsRNA into short pieces of dsRNA
known as short interfering RNAs (siRNAs) (Berstein, et al., (2001)
Nature 409:363). Short interfering RNAs derived from dicer activity
are typically about 21 to about 23 nucleotides in length and
comprise about 19 base pair duplexes (Elbashir, et al., (2001)
Genes Dev. 15:188). Dicer has also been implicated in the excision
of 21- and 22-nucleotide small temporal RNAs (stRNAs) from
precursor RNA of conserved structure that are implicated in
translational control (Hutvagner, et al., (2001) Science 293:834).
The RNAi response also features an endonuclease complex, commonly
referred to as an RNA-induced silencing complex (RISC), which
mediates cleavage of single-stranded RNA having sequence
complementarity to the antisense strand of the siRNA duplex.
Cleavage of the target RNA takes place in the middle of the region
complementary to the antisense strand of the siRNA duplex
(Elbashir, et al., (2001) Genes Dev. 15:188). In addition, RNA
interference can also involve small RNA (e.g., miRNA) mediated gene
silencing, presumably through cellular mechanisms that regulate
chromatin structure and thereby prevent transcription of target
gene sequences (see, e.g., Allshire, (2002) Science 297:1818-1819;
Volpe, et al., (2002) Science 297:1833-1837; Jenuwein, (2002)
Science 297:2215-2218 and Hall, et al., (2002) Science
297:2232-2237). As such, miRNA molecules of the disclosure can be
used to mediate gene silencing via interaction with RNA transcripts
or alternately by interaction with particular gene sequences,
wherein such interaction results in gene silencing either at the
transcriptional or post-transcriptional level.
[0320] Methods and compositions are further provided which allow
for an increase in RNAi produced from the silencing element. In
such embodiments, the methods and compositions employ a first
polynucleotide comprising a silencing element for a target pest
sequence operably linked to a promoter active in the plant cell;
and, a second polynucleotide comprising a suppressor enhancer
element comprising the target pest sequence or an active variant or
fragment thereof operably linked to a promoter active in the plant
cell. The combined expression of the silencing element with
suppressor enhancer element leads to an increased amplification of
the inhibitory RNA produced from the silencing element over that
achievable with only the expression of the silencing element alone.
In addition to the increased amplification of the specific RNAi
species itself, the methods and compositions further allow for the
production of a diverse population of RNAi species that can enhance
the effectiveness of disrupting target gene expression. As such,
when the suppressor enhancer element is expressed in a plant cell
in combination with the silencing element, the methods and
composition can allow for the systemic production of RNAi
throughout the plant; the production of greater amounts of RNAi
than would be observed with just the silencing element construct
alone; and, the improved loading of RNAi into the phloem of the
plant, thus providing better control of phloem feeding insects by
an RNAi approach. Thus, the various methods and compositions
provide improved methods for the delivery of inhibitory RNA to the
target organism. See, for example, US Patent Application
Publication 2009/0188008.
[0321] As used herein, a "suppressor enhancer element" comprises a
polynucleotide comprising the target sequence to be suppressed or
an active fragment or variant thereof. It is recognize that the
suppressor enhancer element need not be identical to the target
sequence, but rather, the suppressor enhancer element can comprise
a variant of the target sequence, so long as the suppressor
enhancer element has sufficient sequence identity to the target
sequence to allow for an increased level of the RNAi produced by
the silencing element over that achievable with only the expression
of the silencing element. Similarly, the suppressor enhancer
element can comprise a fragment of the target sequence, wherein the
fragment is of sufficient length to allow for an increased level of
the RNAi produced by the silencing element over that achievable
with only the expression of the silencing element.
[0322] It is recognized that multiple suppressor enhancer elements
from the same target sequence or from different target sequences or
from different regions of the same target sequence can be employed.
For example, the suppressor enhancer elements employed can comprise
fragments of the target sequence derived from different region of
the target sequence (i.e., from the 3'UTR, coding sequence, intron,
and/or 5'UTR). Further, the suppressor enhancer element can be
contained in an expression cassette, as described elsewhere herein,
and in specific embodiments, the suppressor enhancer element is on
the same or on a different DNA vector or construct as the silencing
element. The suppressor enhancer element can be operably linked to
a promoter as disclosed herein. It is recognized that the
suppressor enhancer element can be expressed constitutively or
alternatively, it may be produced in a stage-specific manner
employing the various inducible or tissue-preferred or
developmentally regulated promoters that are discussed elsewhere
herein.
[0323] In specific embodiments, employing both a silencing element
and the suppressor enhancer element the systemic production of RNAi
occurs throughout the entire plant. In further embodiments, the
plant or plant parts of the disclosure have an improved loading of
RNAi into the phloem of the plant than would be observed with the
expression of the silencing element construct alone and, thus
provide better control of phloem feeding insects by an RNAi
approach. In specific embodiments, the plants, plant parts and
plant cells of the disclosure can further be characterized as
allowing for the production of a diversity of RNAi species that can
enhance the effectiveness of disrupting target gene expression.
[0324] In specific embodiments, the combined expression of the
silencing element and the suppressor enhancer element increases the
concentration of the inhibitory RNA in the plant cell, plant, plant
part, plant tissue or phloem over the level that is achieved when
the silencing element is expressed alone.
[0325] As used herein, an "increased level of inhibitory RNA"
comprises any statistically significant increase in the level of
RNAi produced in a plant having the combined expression when
compared to an appropriate control plant. For example, an increase
in the level of RNAi in the plant, plant part or the plant cell can
comprise at least about a 1%, about a 1%-5%, about a 5%-10%, about
a 10%-20%, about a 20%-30%, about a 30%-40%, about a 40%-50%, about
a 50%-60%, about 60-70%, about 70%-80%, about a 80%-90%, about a
90%-100% or greater increase in the level of RNAi in the plant,
plant part, plant cell or phloem when compared to an appropriate
control. In other embodiments, the increase in the level of RNAi in
the plant, plant part, plant cell or phloem can comprise at least
about a 1 fold, about a 1 fold-5 fold, about a 5 fold-10 fold,
about a 10 fold-20 fold, about a 20 fold-30 fold, about a 30
fold-40 fold, about a 40 fold-50 fold, about a 50 fold-60 fold,
about 60 fold-70 fold, about 70 fold-80 fold, about a 80 fold-90
fold, about a 90 fold-100 fold or greater increase in the level of
RNAi in the plant, plant part, plant cell or phloem when compared
to an appropriate control. Examples of combined expression of the
silencing element with suppressor enhancer element for the control
of Stinkbugs and Lygus can be found in US Patent Application
Publication 2011/0301223 and US Patent Application Publication
2009/0192117.
[0326] Some embodiments relate to down-regulation of expression of
target genes in insect pest species by interfering ribonucleic acid
(RNA) molecules. PCT Publication WO 2007/074405 describes methods
of inhibiting expression of target genes in invertebrate pests
including Colorado potato beetle. PCT Publication WO 2005/110068
describes methods of inhibiting expression of target genes in
invertebrate pests including in particular Western corn rootworm as
a means to control insect infestation. Furthermore, PCT Publication
WO 2009/091864 describes compositions and methods for the
suppression of target genes from insect pest species including
pests from the Lygus genus. Nucleic acid molecules including RNAi
for targeting the vacuolar ATPase H subunit, useful for controlling
a coleopteran pest population and infestation as described in US
Patent Application Publication 2012/0198586. PCT Publication WO
2012/055982 describes ribonucleic acid (RNA or double stranded RNA)
that inhibits or down regulates the expression of a target gene
that encodes: an insect ribosomal protein such as the ribosomal
protein L19, the ribosomal protein L40 or the ribosomal protein
S27A; an insect proteasome subunit such as the Rpn6 protein, the
Pros 25, the Rpn2 protein, the proteasome beta 1 subunit protein or
the Pros beta 2 protein; an insect .beta.-coatomer of the COPI
vesicle, the .gamma.-coatomer of the COPI vesicle, the
.beta.'-coatomer protein or the .zeta.-coatomer of the COPI
vesicle; an insect Tetraspanine 2 A protein which is a putative
transmembrane domain protein; an insect protein belonging to the
actin family such as Actin 5C; an insect ubiquitin-5E protein; an
insect Sec23 protein which is a GTPase activator involved in
intracellular protein transport; an insect crinkled protein which
is an unconventional myosin which is involved in motor activity; an
insect crooked neck protein which is involved in the regulation of
nuclear alternative mRNA splicing; an insect vacuolar H+-ATPase
G-subunit protein and an insect Tbp-1 such as Tat-binding protein.
PCT publication WO 2007/035650 describes ribonucleic acid (RNA or
double stranded RNA) that inhibits or down regulates the expression
of a target gene that encodes Snf7. US Patent Application
publication 2011/0054007 describes polynucleotide silencing
elements targeting RPS10. US Patent Application publication
2014/0275208 and US2015/0257389 describes polynucleotide silencing
elements targeting RyanR and PAT3. US Patent Application
Publications 2012/029750, US 20120297501, and 2012/0322660 describe
interfering ribonucleic acids (RNA or double stranded RNA) that
functions upon uptake by an insect pest species to down-regulate
expression of a target gene in said insect pest, wherein the RNA
comprises at least one silencing element wherein the silencing
element is a region of double-stranded RNA comprising annealed
complementary strands, one strand of which comprises or consists of
a sequence of nucleotides which is at least partially complementary
to a target nucleotide sequence within the target gene. US Patent
Application Publication 2012/0164205 describe potential targets for
interfering double stranded ribonucleic acids for inhibiting
invertebrate pests including: a Chd3 Homologous Sequence, a
Beta-Tubulin Homologous Sequence, a 40 kDa V-ATPase Homologous
Sequence, a EF1a Homologous Sequence, a 26S Proteosome Subunit p28
Homologous Sequence, a Juvenile Hormone Epoxide Hydrolase
Homologous Sequence, a Swelling Dependent Chloride Channel Protein
Homologous Sequence, a Glucose-6-Phosphate 1-Dehydrogenase Protein
Homologous Sequence, an Act42A Protein Homologous Sequence, a
ADP-Ribosylation Factor 1 Homologous Sequence, a Transcription
Factor IIB Protein Homologous Sequence, a Chitinase Homologous
Sequences, a Ubiquitin Conjugating Enzyme Homologous Sequence, a
Glyceraldehyde-3-Phosphate Dehydrogenase Homologous Sequence, an
Ubiquitin B Homologous Sequence, a Juvenile Hormone Esterase
Homolog, and an Alpha Tubuliln Homologous Sequence.
Use in Pesticidal Control
[0327] General methods for employing strains comprising a nucleic
acid sequence of the embodiments or a variant thereof, in pesticide
control or in engineering other organisms as pesticidal agents are
known in the art.
[0328] Microorganism hosts that are known to occupy the
"phytosphere" (phylloplane, phyllosphere, rhizosphere, and/or
rhizoplana) of one or more crops of interest may be selected. These
microorganisms are selected so as to be capable of successfully
competing in the particular environment with the wild-type
microorganisms, provide for stable maintenance and expression of
the gene expressing the IPD103 polypeptide and desirably provide
for improved protection of the pesticide from environmental
degradation and inactivation.
[0329] Alternatively, the IPD103 polypeptide is produced by
introducing a heterologous gene into a cellular host. Expression of
the heterologous gene results, directly or indirectly, in the
intracellular production and maintenance of the pesticide. These
cells are then treated under conditions that prolong the activity
of the toxin produced in the cell when the cell is applied to the
environment of target pest(s). The resulting product retains the
toxicity of the toxin. These naturally encapsulated IPD103
polypeptides may then be formulated in accordance with conventional
techniques for application to the environment hosting a target
pest, e.g., soil, water, and foliage of plants. See, for example
EPA 0192319, and the references cited therein.
Pesticidal Compositions
[0330] In some embodiments the active ingredients can be applied in
the form of compositions and can be applied to the crop area or
plant to be treated, simultaneously or in succession, with other
compounds. These compounds can be fertilizers, weed killers,
Cryoprotectants, surfactants, detergents, pesticidal soaps, dormant
oils, polymers, and/or time-release or biodegradable carrier
formulations that permit long-term dosing of a target area
following a single application of the formulation. They can also be
selective herbicides, chemical insecticides, virucides,
microbicides, amoebicides, pesticides, fungicides, bacteriocides,
nematocides, molluscicides or mixtures of several of these
preparations, if desired, together with further agriculturally
acceptable carriers, surfactants or application-promoting adjuvants
customarily employed in the art of formulation. Suitable carriers
and adjuvants can be solid or liquid and correspond to the
substances ordinarily employed in formulation technology, e.g.
natural or regenerated mineral substances, solvents, dispersants,
wetting agents, tackifiers, binders or fertilizers. Likewise the
formulations may be prepared into edible "baits" or fashioned into
pest "traps" to permit feeding or ingestion by a target pest of the
pesticidal formulation.
[0331] Methods of applying an active ingredient or an agrochemical
composition that contains at least one of the IPD103 polypeptide
produced by the bacterial strains include leaf application, seed
coating and soil application. The number of applications and the
rate of application depend on the intensity of infestation by the
corresponding pest.
[0332] The composition may be formulated as a powder, dust, pellet,
granule, spray, emulsion, colloid, solution or such like, and may
be prepared by such conventional means as desiccation,
lyophilization, homogenation, extraction, filtration,
centrifugation, sedimentation or concentration of a culture of
cells comprising the polypeptide. In all such compositions that
contain at least one such pesticidal polypeptide, the polypeptide
may be present in a concentration of from about 1% to about 99% by
weight.
[0333] Lepidopteran, Dipteran, Heteropteran, nematode, Hemiptera or
Coleopteran pests may be killed or reduced in numbers in a given
area by the methods of the disclosure or may be prophylactically
applied to an environmental area to prevent infestation by a
susceptible pest. Preferably the pest ingests or is contacted with,
a pesticidally-effective amount of the polypeptide.
"Pesticidally-effective amount" as used herein refers to an amount
of the pesticide that is able to bring about death to at least one
pest or to noticeably reduce pest growth, feeding or normal
physiological development. This amount will vary depending on such
factors as, for example, the specific target pests to be
controlled, the specific environment, location, plant, crop or
agricultural site to be treated, the environmental conditions and
the method, rate, concentration, stability, and quantity of
application of the pesticidally-effective polypeptide composition.
The formulations may also vary with respect to climatic conditions,
environmental considerations, and/or frequency of application
and/or severity of pest infestation.
[0334] The pesticide compositions described may be made by
formulating the bacterial cell, Crystal and/or spore suspension or
isolated protein component with the desired
agriculturally-acceptable carrier. The compositions may be
formulated prior to administration in an appropriate means such as
lyophilized, freeze-dried, desiccated or in an aqueous carrier,
medium or suitable diluent, such as saline or other buffer. The
formulated compositions may be in the form of a dust or granular
material or a suspension in oil (vegetable or mineral) or water or
oil/water emulsions or as a wettable powder or in combination with
any other carrier material suitable for agricultural application.
Suitable agricultural carriers can be solid or liquid and are well
known in the art. The term "agriculturally-acceptable carrier"
covers all adjuvants, inert components, dispersants, surfactants,
tackifiers, binders, etc. that are ordinarily used in pesticide
formulation technology; these are well known to those skilled in
pesticide formulation. The formulations may be mixed with one or
more solid or liquid adjuvants and prepared by various means, e.g.,
by homogeneously mixing, blending and/or grinding the pesticidal
composition with suitable adjuvants using conventional formulation
techniques. Suitable formulations and application methods are
described in U.S. Pat. No. 6,468,523, herein incorporated by
reference. The plants can also be treated with one or more chemical
compositions, including one or more herbicide, insecticides or
fungicides. Exemplary chemical compositions include:
Fruits/Veaetables Herbicides: Atrazine, Bromacil, Diuron,
Glyphosate, Linuron, Metribuzin, Simazine, Trifluralin, Fluazifop,
Glufosinate, Halo sulfuron Gowan, Paraquat, Propyzamide,
Sethoxydim, Butafenacil, Halosulfuron, Indaziflam;
Fruits/Vegetables Insecticides: Aldicarb, Bacillus thuringiensis,
Carbaryl, Carbofuran, Chlorpyrifos, Cypermethrin, Deltamethrin,
Diazinon, Malathion, Abamectin, Cyfluthrin/beta-cyfluthrin,
Esfenvalerate, Lambda-cyhalothrin, Acequinocyl, Bifenazate,
Methoxyfenozide, Novaluron, Chromafenozide, Thiacloprid,
Dinotefuran, FluaCrypyrim, Tolfenpyrad, Clothianidin,
Spirodiclofen, Gamma-cyhalothrin, Spiromesifen, Spinosad,
Rynaxypyr, Cyazypyr, Spinoteram, Triflumuron, Spirotetramat,
Imidacloprid, Flubendiamide, Thiodicarb, Metaflumizone,
Sulfoxaflor, Cyflumetofen, Cyanopyrafen, Imidacloprid,
Clothianidin, Thiamethoxam, Spinotoram, Thiodicarb, Flonicamid,
Methiocarb, Emamectin-benzoate, Indoxacarb, Forthiazate,
Fenamiphos, Cadusaphos, Pyriproxifen, Fenbutatin-oxid, Hexthiazox,
Methomyl,
4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on;
Fruits/Veaetables Funaicides: Carbendazim, Chlorothalonil, EBDCs,
Sulphur, Thiophanate-methyl, Azoxystrobin, Cymoxanil, Fluazinam,
Fosetyl, Iprodione, Kresoxim-methyl, Metalaxyl/mefenoxam,
Trifloxystrobin, Ethaboxam, Iprovalicarb, Trifloxystrobin,
Fenhexamid, Oxpoconazole fumarate, Cyazofamid, Fenamidone,
Zoxamide, Picoxystrobin, Pyraclostrobin, Cyflufenamid, Boscalid;
Cereals Herbicides: Isoproturon, Bromoxynil, Ioxynil, Phenoxies,
Chlorsulfuron, Clodinafop, Diclofop, Diflufenican, Fenoxaprop,
Florasulam, Fluoroxypyr, Metsulfuron, Triasulfuron, Flucarbazone,
Iodosulfuron, Propoxycarbazone, Picolinafen, Mesosulfuron,
Beflubutamid, Pinoxaden, Amidosulfuron, Thifensulfuron Methyl,
Tribenuron, Flupyrsulfuron, Sulfosulfuron, Pyrasulfotole,
Pyroxsulam, Flufenacet, Tralkoxydim, Pyroxasulfon; Cereals
Fungicides: Carbendazim, Chlorothalonil, Azoxystrobin,
Cyproconazole, Cyprodinil, Fenpropimorph, Epoxiconazole,
Kresoxim-methyl, Quinoxyfen, Tebuconazole, Trifloxystrobin,
Simeconazole, Picoxystrobin, Pyraclostrobin, Dimoxystrobin,
Prothioconazole, Fluoxastrobin; Cereals Insecticides: Dimethoate,
Lambda-cyhalthrin, Deltamethrin, alpha-Cypermethrin, s-cyfluthrin,
Bifenthrin, Imidacloprid, Clothianidin, Thiamethoxam, Thiacloprid,
Acetamiprid, Dinetofuran, Clorphyriphos, Metamidophos,
Oxidemethon-methyl, Pirimicarb, Methiocarb; Maize Herbicides:
Atrazine, Alachlor, Bromoxynil, Acetochlor, Dicamba, Clopyralid,
(S-) Dimethenamid, Glufosinate, Glyphosate, Isoxaflutole,
(S-)Metolachlor, Mesotrione, Nicosulfuron, Primisulfuron,
Rimsulfuron, Sulcotrione, Foramsulfuron, Topramezone, Tembotrione,
Saflufenacil, Thiencarbazone, Flufenacet, Pyroxasulfon; Maize
Insecticides: Carbofuran, Chlorpyrifos, Bifenthrin, Fipronil,
Imidacloprid, Lambda-Cyhalothrin, Tefluthrin, Terbufos,
Thiamethoxam, Clothianidin, Spiromesifen, Flubendiamide,
Triflumuron, Rynaxypyr, Deltamethrin, Thiodicarb, s-Cyfluthrin,
Cypermethrin, Bifenthrin, Lufenuron, Triflumoron, Tefluthrin,
Tebupirimphos, Ethiprole, Cyazypyr, Thiacloprid, Acetamiprid,
Dinetofuran, Avermectin, Methiocarb, Spirodiclofen, Spirotetramat;
Maize Fungicides: Fenitropan, Thiram, Prothioconazole,
Tebuconazole, Trifloxystrobin; Rice Herbicides: Butachlor,
Propanil, Azimsulfuron, Bensulfuron, Cyhalofop, Daimuron,
Fentrazamide, Imazosulfuron, Mefenacet, Oxaziclomefone,
Pyrazosulfuron, Pyributicarb, Quinclorac, Thiobencarb, Indanofan,
Flufenacet, Fentrazamide, Halosulfuron, Oxaziclomefone,
Benzobicyclon, Pyriftalid, Penoxsulam, Bispyribac, Oxadiargyl,
Ethoxysulfuron, Pretilachlor, Mesotrione, Tefuryltrione,
Oxadiazone, Fenoxaprop, Pyrimisulfan; Rice Insecticides: Diazinon,
Fenitrothion, Fenobucarb, Monocrotophos, Benfuracarb, Buprofezin,
Dinotefuran, Fipronil, Imidacloprid, Isoprocarb, Thiacloprid,
Chromafenozide, Thiacloprid, Dinotefuran, Clothianidin, Ethiprole,
Flubendiamide, Rynaxypyr, Deltamethrin, Acetamiprid, Thiamethoxam,
Cyazypyr, Spinosad, Spinotoram, Emamectin-Benzoate, Cypermethrin,
Chlorpyriphos, Cartap, Methamidophos, Etofenprox, Triazophos,
4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on,
Carbofuran, Benfuracarb; Rigg Fungicides: Thiophanate-methyl,
Azoxystrobin, Carpropamid, Edifenphos, Ferimzone, Iprobenfos,
Isoprothiolane, Pencycuron, Probenazole, Pyroquilon, Tricyclazole,
Trifloxystrobin, Diclocymet, Fenoxanil, Simeconazole, Tiadinil;
Cotton Herbicides: Diuron, Fluometuron, MSMA, Oxyfluorfen,
Prometryn, Trifluralin, Carfentrazone, Clethodim, Fluazifop-butyl,
Glyphosate, Norflurazon, Pendimethalin, Pyrithiobac-sodium,
Trifloxysulfuron, Tepraloxydim, Glufosinate, Flumioxazin,
Thidiazuron; Cotton Insecticides: Acephate, Aldicarb, Chlorpyrifos,
Cypermethrin, Deltamethrin, Malathion, Monocrotophos, Abamectin,
Acetamiprid, Emamectin Benzoate, Imidacloprid, Indoxacarb,
Lambda-Cyhalothrin, Spinosad, Thiodicarb, Gamma-Cyhalothrin,
Spiromesifen, Pyridalyl, Flonicamid, Flubendiamide, Triflumuron,
Rynaxypyr, Beta-Cyfluthrin, Spirotetramat, Clothianidin,
Thiamethoxam, Thiacloprid, Dinetofuran, Flubendiamide, Cyazypyr,
Spinosad, Spinotoram, gamma Cyhalothrin,
4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on,
Thiodicarb, Avermectin, Flonicamid, Pyridalyl, Spiromesifen,
Sulfoxaflor, Profenophos, Thriazophos, Endosulfan; Cotton
Funaicides: Etridiazole, Metalaxyl, Quintozene; Soybean Herbicides:
Alachlor, Bentazone, Trifluralin, Chlorimuron-Ethyl,
Cloransulam-Methyl, Fenoxaprop, Fomesafen, Fluazifop, Glyphosate,
Imazamox, Imazaquin, Imazethapyr, (S-)Metolachlor, Metribuzin,
Pendimethalin, Tepraloxydim, Glufosinate; Sovbean Insecticides:
Lambda-cyhalothrin, Methomyl, Parathion, Thiocarb, Imidacloprid,
Clothianidin, Thiamethoxam, Thiacloprid, Acetamiprid, Dinetofuran,
Flubendiamide, Rynaxypyr, Cyazypyr, Spinosad, Spinotoram,
Emamectin-Benzoate, Fipronil, Ethiprole, Deltamethrin,
s-Cyfluthrin, gamma and lambda Cyhalothrin,
4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on,
Spirotetramat, Spinodiclofen, Triflumuron, Flonicamid, Thiodicarb,
beta-Cyfluthrin; Soybean Fungicides: Azoxystrobin, Cyproconazole,
Epoxiconazole, Flutriafol, Pyraclostrobin, Tebuconazole,
Trifloxystrobin, Prothioconazole, Tetraconazole; Sugarbeet
Herbicides: Chloridazon, Desmedipham, Ethofumesate, Phenmedipham,
Triallate, Clopyralid, Fluazifop, Lenacil, Metamitron, Quinmerac,
Cycloxydim, Triflusulfuron, Tepraloxydim, Quizalofop; Suaarbeet
Insecticides: Imidacloprid, Clothianidin, Thiamethoxam,
Thiacloprid, Acetamiprid, Dinetofuran, Deltamethrin, s-Cyfluthrin,
gamma/lambda Cyhalothrin,
4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on,
Tefluthrin, Rynaxypyr, Cyaxypyr, Fipronil, Carbofuran; Canola
Herbicides: Clopyralid, Diclofop, Fluazifop, Glufosinate,
Glyphosate, Metazachlor, Trifluralin Ethametsulfuron, Quinmerac,
Quizalofop, Clethodim, Tepraloxydim; Canola Funaicides:
Azoxystrobin, Carbendazim, Fludioxonil, Iprodione, Prochloraz,
Vinclozolin; Canola Insecticides: Carbofuran organophosphates,
Pyrethroids, Thiacloprid, Deltamethrin, Imidacloprid, Clothianidin,
Thiamethoxam, Acetamiprid, Dinetofuran, .beta.-Cyfluthrin, gamma
and lambda Cyhalothrin, tau-Fluvaleriate, Ethiprole, Spinosad,
Spinotoram, Flubendiamide, Rynaxypyr, Cyazypyr,
4-[[(6-Chlorpyridin-3-yl)methyl](2,2-difluorethyl)amino]furan-2(5H)-on.
[0335] In some embodiments the herbicide is Atrazine, Bromacil,
Diuron, Chlorsulfuron, Metsulfuron, Thifensulfuron Methyl,
Tribenuron, Acetochlor, Dicamba, Isoxaflutole, Nicosulfuron,
Rimsulfuron, Pyrithiobac-sodium, Flumioxazin, Chlorimuron-Ethyl,
Metribuzin, Quizalofop, S-metolachlor, Hexazinne or combinations
thereof.
[0336] In some embodiments the insecticide is Esfenvalerate,
Chlorantraniliprole, Methomyl, Indoxacarb, Oxamyl or combinations
thereof.
Pesticidal and Insecticidal Activity
[0337] "Pest" includes but is not limited to, insects, fungi,
bacteria, nematodes, mites, ticks and the like. Insect pests
include insects selected from the orders Coleoptera, Diptera,
Hymenoptera, Lepidoptera, Mallophaga, Homoptera, Hemiptera
Orthroptera, Thysanoptera, Dermaptera, Isoptera, Anoplura,
Siphonaptera, Trichoptera, etc., particularly Lepidoptera and
Coleoptera.
[0338] Those skilled in the art will recognize that not all
compounds are equally effective against all pests. Compounds of the
embodiments display activity against insect pests, which may
include economically important agronomic, forest, greenhouse,
nursery ornamentals, food and fiber, public and animal health,
domestic and commercial structure, household and stored product
pests.
[0339] Larvae of the order Lepidoptera include, but are not limited
to, armyworms, cutworms, loopers and heliothines in the family
Noctuidae Spodoptera frugiperda JE Smith (fall armyworm); S. exigua
Hubner (beet armyworm); S. litura Fabricius (tobacco cutworm,
cluster caterpillar); Mamestra configurata Walker (bertha
armyworm); M. brassicae Linnaeus (cabbage moth); Agrotis ipsilon
Hufnagel (black cutworm); A. orthogonia Morrison (western cutworm);
A. subterranea Fabricius (granulate cutworm); Alabama argillacea
Hubner (cotton leaf worm); Trichoplusia ni Hubner (cabbage looper);
Pseudoplusia includens Walker (soybean looper); Anticarsia
gemmatalis Hubner (velvetbean caterpillar); Hypena scabra Fabricius
(green cloverworm); Heliothis virescens Fabricius (tobacco
budworm); Pseudaletia unipuncta Haworth (armyworm); Athetis mindara
Barnes and Mcdunnough (rough skinned cutworm); Euxoa messoria
Harris (darksided cutworm); Earias insulana Boisduval (spiny
bollworm); E. vittella Fabricius (spotted bollworm); Helicoverpa
armigera Hubner (American bollworm); H. zea Boddie (corn earworm or
cotton bollworm); Melanchra picta Harris (zebra caterpillar); Egira
(Xylomyges) curialis Grote (citrus cutworm); borers, casebearers,
webworms, coneworms, and skeletonizers from the family Pyralidae
Ostrinia nubilalis Hubner (European corn borer); Amyelois
transitella Walker (naval orangeworm); Anagasta kuehniella Zeller
(Mediterranean flour moth); Cadra cautella Walker (almond moth);
Chilo suppressalis Walker (rice stem borer); C. partellus, (sorghum
borer); Corcyra cephalonica Stainton (rice moth); Crambus
caliginosellus Clemens (corn root webworm); C. teterrellus Zincken
(bluegrass webworm); Cnaphalocrocis medinalis Guenee (rice leaf
roller); Desmia funeralis Hubner (grape leaffolder); Diaphania
hyalinata Linnaeus (melon worm); D. nihidalis Stoll (pickleworm);
Diatraea grandiosella Dyar (southwestern corn borer), D.
saccharalis Fabricius (surgarcane borer); Eoreuma loftini Dyar
(Mexican rice borer); Ephestia elutella Hubner (tobacco (cacao)
moth); Galleria mellonella Linnaeus (greater wax moth);
Herpetogramma licarsisalis Walker (sod webworm); Homoeosoma
electellum Hulst (sunflower moth); Elasmopalpus lignosellus Zeller
(lesser cornstalk borer); Achroia grisella Fabricius (lesser wax
moth); Loxostege sticticalis Linnaeus (beet webworm); Orthaga
thyrisalis Walker (tea tree web moth); Maruca testulalis Geyer
(bean pod borer); Plodia interpunctella Hubner (Indian meal moth);
Scirpophaga incertulas Walker (yellow stem borer); Udea rubigalis
Guenee (celery leaftier); and leafrollers, budworms, seed worms and
fruit worms in the family Tortricidae Aceris gloverana Walsingham
(Western blackheaded budworm); A. variana Fernald (Eastern
blackheaded budworm); Archips argyrospila Walker (fruit tree leaf
roller); A. rosana Linnaeus (European leaf roller); and other
Archips species, Adoxophyes orana Fischer von Rosslerstamm (summer
fruit tortrix moth); Cochylis hospes Walsingham (banded sunflower
moth); Cydia latiferreana Walsingham (filbertworm); C. pomonella
Linnaeus (coding moth); Platynota flavedana Clemens (variegated
leafroller); P. stultana Walsingham (omnivorous leafroller);
Lobesia botrana Denis & Schiffermuller (European grape vine
moth); Spilonota ocellana Denis & Schiffermuller (eyespotted
bud moth); Endopiza viteana Clemens (grape berry moth); Eupoecilia
ambiguella Hubner (vine moth); Bonagota salubricola Meyrick
(Brazilian apple leafroller); Grapholita molesta Busck (oriental
fruit moth); Suleima helianthana Riley (sunflower bud moth);
Argyrotaenia spp.; Choristoneura spp.
[0340] Selected other agronomic pests in the order Lepidoptera
include, but are not limited to, Alsophila pometaria Harris (fall
cankerworm); Anarsia lineatella Zeller (peach twig borer); Anisota
senatora J. E. Smith (orange striped oakworm); Antheraea pernyi
Guerin-Meneville (Chinese Oak Tussah Moth); Bombyx mori Linnaeus
(Silkworm); Bucculatrix thurberiella Busck (cotton leaf
perforator); Colias eurytheme Boisduval (alfalfa caterpillar);
Datana integerrima Grote & Robinson (walnut caterpillar);
Dendrolimus sibiricus Tschetwerikov (Siberian silk moth), Ennomos
subsignaria Hubner (elm spanworm); Erannis tiliaria Harris (linden
looper); Euproctis chrysorrhoea Linnaeus (browntail moth);
Harrisina americana Guerin-Meneville (grapeleaf skeletonizer);
Hemileuca oliviae Cockrell (range caterpillar); Hyphantria cunea
Drury (fall webworm); Keiferia lycopersicella Walsingham (tomato
pinworm); Lambdina fiscellaria fiscellaria Hulst (Eastern hemlock
looper); L. fiscellaria lugubrosa Hulst (Western hemlock looper);
Leucoma salicis Linnaeus (satin moth); Lymantria dispar Linnaeus
(gypsy moth); Manduca quinquemaculata Haworth (five spotted hawk
moth, tomato hornworm); M. sexta Haworth (tomato hornworm, tobacco
hornworm); Operophtera brumata Linnaeus (winter moth); Paleacrita
vernata Peck (spring cankerworm); Papilio cresphontes Cramer (giant
swallowtail orange dog); Phryganidia californica Packard
(California oakworm); Phyllocnistis citrella Stainton (citrus
leafminer); Phyllonorycter blancardella Fabricius (spotted
tentiform leafminer); Pieris brassicae Linnaeus (large white
butterfly); P. rapae Linnaeus (small white butterfly); P. napi
Linnaeus (green veined white butterfly); Platyptilia carduidactyla
Riley (artichoke plume moth); Plutella xylostella Linnaeus
(diamondback moth); Pectinophora gossypiella Saunders (pink
bollworm); Pontia protodice Boisduval and Leconte (Southern
cabbageworm); Sabulodes aegrotata Guenee (omnivorous looper);
Schizura concinna J. E. Smith (red humped caterpillar); Sitotroga
cerealella Olivier (Angoumois grain moth); Thaumetopoea pityocampa
Schiffermuller (pine processionary caterpillar); Tineola
bisselliella Hummel (webbing clothesmoth); Tuta absoluta Meyrick
(tomato leafminer); Yponomeuta padella Linnaeus (ermine moth);
Heliothis subflexa Guenee; Malacosoma spp. and Orgyia spp.
[0341] Of interest are larvae and adults of the order Coleoptera
including weevils from the families Anthribidae, Bruchidae and
Curculionidae (including, but not limited to: Anthonomus grandis
Boheman (boll weevil); Lissorhoptrus oryzophilus Kuschel (rice
water weevil); Sitophilus granarius Linnaeus (granary weevil); S.
oryzae Linnaeus (rice weevil); Hypera punctata Fabricius (clover
leaf weevil); Cylindrocopturus adspersus LeConte (sunflower stem
weevil); Smicronyx fulvus LeConte (red sunflower seed weevil); S.
sordidus LeConte (gray sunflower seed weevil); Sphenophorus maidis
Chittenden (maize billbug)); flea beetles, cucumber beetles,
rootworms, leaf beetles, potato beetles and leafminers in the
family Chrysomelidae (including, but not limited to: Leptinotarsa
decemlineata Say (Colorado potato beetle); Diabrotica virgifera
virgifera LeConte (western corn rootworm); D. barberi Smith and
Lawrence (northern corn rootworm); D. undecimpunctata howardi
Barber (southern corn rootworm); Chaetocnema pulicaria Melsheimer
(corn flea beetle); Phyllotreta cruciferae Goeze (Crucifer flea
beetle); Phyllotreta striolata (stripped flea beetle); Colaspis
brunnea Fabricius (grape colaspis); Oulema melanopus Linnaeus
(cereal leaf beetle); Zygogramma exclamationis Fabricius (sunflower
beetle)); beetles from the family Coccinellidae (including, but not
limited to: Epilachna varivestis Mulsant (Mexican bean beetle));
chafers and other beetles from the family Scarabaeidae (including,
but not limited to: Popillia japonica Newman (Japanese beetle);
Cyclocephala borealis Arrow (northern masked chafer, white grub);
C. immaculata Olivier (southern masked chafer, white grub);
Rhizotrogus majalis Razoumowsky (European chafer); Phyllophaga
crinita Burmeister (white grub); Ligyrus gibbosus De Geer (carrot
beetle)); carpet beetles from the family Dermestidae; wireworms
from the family Elateridae, Eleodes spp., Melanotus spp.; Conoderus
spp.; Limonius spp.; Agrotes spp.; Ctenicera spp.; Aeolus spp.;
bark beetles from the family Scolytidae and beetles from the family
Tenebrionidae.
[0342] Adults and immatures of the order Diptera are of interest,
including leafminers Agromyza parvicomis Loew (corn blotch
leafminer); midges (including, but not limited to: Contarinia
sorghicola Coquillett (sorghum midge); Mayetiola destructor Say
(Hessian fly); Sitodiplosis mosellana Gehin (wheat midge);
Neolasioptera murtfeldtiana Felt, (sunflower seed midge)); fruit
flies (Tephritidae), Oscinella frit Linnaeus (fruit flies); maggots
(including, but not limited to: Delia platura Meigen (seedcom
maggot); D. coarctata Fallen (wheat bulb fly) and other Delia spp.,
Meromyza americana Fitch (wheat stem maggot); Musca domestica
Linnaeus (house flies); Fannia canicularis Linnaeus, F. femoralis
Stein (lesser house flies); Stomoxys calcitrans Linnaeus (stable
flies)); face flies, horn flies, blow flies, Chrysomya spp.;
Phormia spp. and other muscoid fly pests, horse flies Tabanus spp.;
bot flies Gastrophilus spp.; Oestrus spp.; cattle grubs Hypoderma
spp.; deer flies Chrysops spp.; Melophagus ovinus Linnaeus (keds)
and other Brachycera, mosquitoes Aedes spp.; Anopheles spp.; Culex
spp.; black flies Prosimulium spp.; Simulium spp.; biting midges,
sand flies, sciarids, and other Nematocera.
[0343] Included as insects of interest are adults and nymphs of the
orders Hemiptera and Homoptera such as, but not limited to,
adelgids from the family Adelgidae, plant bugs from the family
Miridae, cicadas from the family Cicadidae, leafhoppers, Empoasca
spp.; from the family Cicadellidae, planthoppers from the families
Cixiidae, Flatidae, Fulgoroidea, Issidae and Delphacidae,
treehoppers from the family Membracidae, psyllids from the family
Psyllidae, whiteflies from the family Aleyrodidae, aphids from the
family Aphididae, phylloxera from the family Phylloxeridae,
mealybugs from the family Pseudococcidae, scales from the families
Asterolecanidae, Coccidae, Dactylopiidae, Diaspididae, Eriococcidae
Ortheziidae, Phoenicococcidae and Margarodidae, lace bugs from the
family Tingidae, stink bugs from the family Pentatomidae, cinch
bugs, Blissus spp.; and other seed bugs from the family Lygaeidae,
spittlebugs from the family Cercopidae squash bugs from the family
Coreidae and red bugs and cotton stainers from the family
Pyrrhocoridae.
[0344] Agronomically important members from the order Homoptera
further include, but are not limited to: Acyrthisiphon pisum Harris
(pea aphid); Aphis craccivora Koch (cowpea aphid); A. fabae Scopoli
(black bean aphid); A. gossypii Glover (cotton aphid, melon aphid);
A. maidiradicis Forbes (corn root aphid); A. pomi De Geer (apple
aphid); A. spiraecola Patch (spirea aphid); Aulacorthum solani
Kaltenbach (foxglove aphid); Chaetosiphon fragaefolii Cockerell
(strawberry aphid); Diuraphis noxia Kurdjumov/Mordvilko (Russian
wheat aphid); Dysaphis plantaginea Paaserini (rosy apple aphid);
Eriosoma lanigerum Hausmann (woolly apple aphid); Brevicoryne
brassicae Linnaeus (cabbage aphid); Hyalopterus pruni Geoffroy
(mealy plum aphid); Lipaphis erysimi Kaltenbach (turnip aphid);
Metopolophium dirrhodum Walker (cereal aphid); Macrosiphum
euphorbiae Thomas (potato aphid); Myzus persicae Sulzer
(peach-potato aphid, green peach aphid); Nasonovia ribisnigri
Mosley (lettuce aphid); Pemphigus spp. (root aphids and gall
aphids); Rhopalosiphum maidis Fitch (corn leaf aphid); R. padi
Linnaeus (bird cherry-oat aphid); Schizaphis graminum Rondani
(greenbug); Sipha flava Forbes (yellow sugarcane aphid); Sitobion
avenae Fabricius (English grain aphid); Therioaphis maculata
Buckton (spotted alfalfa aphid); Toxoptera aurantii Boyer de
Fonscolombe (black citrus aphid) and T. citricida Kirkaldy (brown
citrus aphid); Adelges spp. (adelgids); Phylloxera devastatrix
Pergande (pecan phylloxera); Bemisia tabaci Gennadius (tobacco
whitefly, sweetpotato whitefly); B. argentifolii Bellows &
Perring (silverleaf whitefly); Dialeurodes citri Ashmead (citrus
whitefly); Trialeurodes abutiloneus (bandedwinged whitefly) and T.
vaporariorum Westwood (greenhouse whitefly); Empoasca fabae Harris
(potato leafhopper); Laodelphax striatellus Fallen (smaller brown
planthopper); Macrolestes quadrilineatus Forbes (aster leafhopper);
Nephotettix cinticeps Uhler (green leafhopper); N. nigropictus StNl
(rice leafhopper); Nilaparvata lugens StNl (brown planthopper);
Peregrinus maidis Ashmead (corn planthopper); Sogatella furcifera
Horvath (white-backed planthopper); Sogatodes orizicola Muir (rice
delphacid); Typhlocyba pomaria McAtee (white apple leafhopper);
Erythroneoura spp. (grape leafhoppers); Magicicada septendecim
Linnaeus (periodical cicada); Icerya purchasi Maskell (cottony
cushion scale); Quadraspidiotus perniciosus Comstock (San Jose
scale); Planococcus citri Risso (citrus mealybug); Pseudococcus
spp. (other mealybug complex); Cacopsylla pyricola Foerster (pear
psylla); Trioza diospyri Ashmead (persimmon psylla).
[0345] Agronomically important species of interest from the order
Hemiptera include, but are not limited to: Acrosternum hilare Say
(green stink bug); Anasa tristis De Geer (squash bug); Blissus
leucopterus leucopterus Say (chinch bug); Corythuca gossypii
Fabricius (cotton lace bug); Cyrtopeltis modesta Distant (tomato
bug); Dysdercus suturellus Herrich-SchAffer (cotton stainer);
Euschistus servus Say (brown stink bug); E. variolarius Palisot de
Beauvois (one-spotted stink bug); Graptostethus spp. (complex of
seed bugs); Leptoglossus corculus Say (leaf-footed pine seed bug);
Lygus lineolaris Palisot de Beauvois (tarnished plant bug); L.
Hesperus Knight (Western tarnished plant bug); L. pratensis
Linnaeus (common meadow bug); L. rugulipennis Poppius (European
tarnished plant bug); Lygocoris pabulinus Linnaeus (common green
capsid); Nezara viridula Linnaeus (southern green stink bug);
Oebalus pugnax Fabricius (rice stink bug); Oncopeltus fasciatus
Dallas (large milkweed bug); Pseudatomoscelis seriatus Reuter
(cotton fleahopper).
[0346] Furthermore, embodiments may be effective against Hemiptera
such, Calocoris norvegicus Gmelin (strawberry bug); Orthops
campestris Linnaeus; Plesiocoris rugicollis Fallen (apple capsid);
Cyrtopeltis modestus Distant (tomato bug); Cyrtopeltis notatus
Distant (suckfly); Spanagonicus albofasciatus Reuter (whitemarked
fleahopper); Diaphnocoris chlorionis Say (honeylocust plant bug);
Labopidicola allii Knight (onion plant bug); Pseudatomoscelis
seriatus Reuter (cotton fleahopper); Adelphocoris rapidus Say
(rapid plant bug); Poecilocapsus lineatus Fabricius (four-lined
plant bug); Nysius ericae Schilling (false chinch bug); Nysius
raphanus Howard (false chinch bug); Nezara viridula Linnaeus
(Southern green stink bug); Eurygaster spp.; Coreidae spp.;
Pyrrhocoridae spp.; Tinidae spp.; Blostomatidae spp.; Reduviidae
spp. and Cimicidae spp.
[0347] Also included are adults and larvae of the order Acari
(mites) such as Aceria tosichella Keifer (wheat curl mite);
Petrobia latens Muller (brown wheat mite); spider mites and red
mites in the family Tetranychidae, Panonychus ulmi Koch (European
red mite); Tetranychus urticae Koch (two spotted spider mite); (T.
mcdanieli McGregor (McDaniel mite); T. cinnabarinus Boisduval
(carmine spider mite); T. turkestani Ugarov & Nikolski
(strawberry spider mite); flat mites in the family Tenuipalpidae,
Brevipalpus lewisi McGregor (citrus flat mite); rust and bud mites
in the family Eriophyidae and other foliar feeding mites and mites
important in human and animal health, i.e., dust mites in the
family Epidermoptidae, follicle mites in the family Demodicidae,
grain mites in the family Glycyphagidae, ticks in the order
Ixodidae. Ixodes scapularis Say (deer tick); I. holocyclus Neumann
(Australian paralysis tick); Dermacentor variabilis Say (American
dog tick); Amblyomma americanum Linnaeus (lone star tick) and scab
and itch mites in the families Psoroptidae, Pyemotidae and
Sarcoptidae.
[0348] Insect pests of the order Thysanura are of interest, such as
Lepisma saccharina Linnaeus (silverfish); Thermobia domestica
Packard (firebrat).
[0349] Additional arthropod pests covered include: spiders in the
order Araneae such as Loxosceles reclusa Gertsch and Mulaik (brown
recluse spider) and the Latrodectus mactans Fabricius (black widow
spider) and centipedes in the order Scutigeromorpha such as
Scutigera coleoptrata Linnaeus (house centipede).
[0350] Insect pest of interest include the superfamily of stink
bugs and other related insects including but not limited to species
belonging to the family Pentatomidae (Nezara viridula, Halyomorpha
halys, Piezodorus guildini, Euschistus servus, Acrosternum hilare,
Euschistus heros, Euschistus tristigmus, Acrostemum hilare,
Dichelops furcatus, Dichelops melacanthus, and Bagrada hilaris
(Bagrada Bug)), the family Plataspidae (Megacopta cribraria--Bean
plataspid) and the family Cydnidae (Scaptocoris castanea--Root
stink bug) and Lepidoptera species including but not limited to:
diamond-back moth, e.g., Helicoverpa zea Boddie; soybean looper,
e.g., Pseudoplusia includens Walker and velvet bean caterpillar
e.g., Anticarsia gemmatalis Hubner.
[0351] Methods for measuring pesticidal activity are well known in
the art. See, for example, Czapla and Lang, (1990) J. Econ.
Entomol. 83:2480-2485; Andrews, et al., (1988) Biochem. J.
252:199-206; Marrone, et al., (1985) J. of Economic Entomology
78:290-293 and U.S. Pat. No. 5,743,477, all of which are herein
incorporated by reference in their entirety. Generally, the protein
is mixed and used in feeding assays. See, for example Marrone, et
al., (1985) J. of Economic Entomology 78:290-293. Such assays can
include contacting plants with one or more pests and determining
the plant's ability to survive and/or cause the death of the
pests.
[0352] Nematodes include parasitic nematodes such as root-knot,
cyst and lesion nematodes, including Heterodera spp., Meloidogyne
spp. and Globodera spp.; particularly members of the cyst
nematodes, including, but not limited to, Heterodera glycines
(soybean cyst nematode); Heterodera schachtii (beet cyst nematode);
Heterodera avenae (cereal cyst nematode) and Globodera
rostochiensis and Globodera pailida (potato cyst nematodes). Lesion
nematodes include Pratylenchus spp.
Seed Treatment
[0353] To protect and to enhance yield production and trait
technologies, seed treatment options can provide additional crop
plan flexibility and cost effective control against insects, weeds
and diseases. Seed material can be treated, typically surface
treated, with a composition comprising combinations of chemical or
biological herbicides, herbicide safeners, insecticides,
fungicides, germination inhibitors and enhancers, nutrients, plant
growth regulators and activators, bactericides, nematocides,
avicides and/or molluscicides. These compounds are typically
formulated together with further carriers, surfactants or
application-promoting adjuvants customarily employed in the art of
formulation. The coatings may be applied by impregnating
propagation material with a liquid formulation or by coating with a
combined wet or dry formulation. Examples of the various types of
compounds that may be used as seed treatments are provided in The
Pesticide Manual: A World Compendium, C.D.S. Tomlin Ed., Published
by the British Crop Production Council, which is hereby
incorporated by reference.
[0354] Some seed treatments that may be used on crop seed include,
but are not limited to, one or more of abscisic acid,
acibenzolar-S-methyl, avermectin, amitrol, azaconazole,
azospirillum, azadirachtin, azoxystrobin, Bacillus spp. (including
one or more of cereus, firmus, megaterium, pumilis, sphaericus,
subtilis and/or thuringiensis species), bradyrhizobium spp.
(including one or more of betae, canariense, elkanii, iriomotense,
japonicum, liaonigense, pachyrhizi and/or yuanmingense), captan,
carboxin, chitosan, clothianidin, copper, cyazypyr, difenoconazole,
etidiazole, fipronil, fludioxonil, fluoxastrobin, fluquinconazole,
flurazole, fluxofenim, harpin protein, imazalil, imidacloprid,
ipconazole, isoflavenoids, lipo-chitooligosaccharide, mancozeb,
manganese, maneb, mefenoxam, metalaxyl, metconazole, myclobutanil,
PCNB, penflufen, penicillium, penthiopyrad, permethrine,
picoxystrobin, prothioconazole, pyraclostrobin, rynaxypyr,
S-metolachlor, saponin, sedaxane, TCMTB, tebuconazole,
thiabendazole, thiamethoxam, thiocarb, thiram, tolclofos-methyl,
triadimenol, trichoderma, trifloxystrobin, triticonazole and/or
zinc. PCNB seed coat refers to EPA Registration Number 00293500419,
containing quintozen and terrazole. TCMTB refers to
2-(thiocyanomethylthio) benzothiazole.
[0355] Seed varieties and seeds with specific transgenic traits may
be tested to determine which seed treatment options and application
rates may complement such varieties and transgenic traits in order
to enhance yield. For example, a variety with good yield potential
but head smut susceptibility may benefit from the use of a seed
treatment that provides protection against head smut, a variety
with good yield potential but cyst nematode susceptibility may
benefit from the use of a seed treatment that provides protection
against cyst nematode, and so on. Likewise, a variety encompassing
a transgenic trait conferring insect resistance may benefit from
the second mode of action conferred by the seed treatment, a
variety encompassing a transgenic trait conferring herbicide
resistance may benefit from a seed treatment with a safener that
enhances the plants resistance to that herbicide, etc. Further, the
good root establishment and early emergence that results from the
proper use of a seed treatment may result in more efficient
nitrogen use, a better ability to withstand drought and an overall
increase in yield potential of a variety or varieties containing a
certain trait when combined with a seed treatment.
Methods for Killing an Insect Pest and Controlling an Insect
Population
[0356] In some embodiments methods are provided for killing an
insect pest, comprising contacting the insect pest, either
simultaneously or sequentially, with an insecticidally-effective
amount of a recombinant IPD103 polypeptide or IPD103 chimeric
polypeptide of the disclosure.
[0357] In some embodiments methods are provided for killing an
insect pest, comprising contacting the insect pest with an
insecticidally-effective amount of a recombinant pesticidal protein
of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID
NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18,
SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID
NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36,
SEQ ID NO: 38 or a variant thereof.
[0358] In some embodiments methods are provided for controlling an
insect pest population, comprising contacting the insect pest
population, either simultaneously or sequentially, with an
insecticidally-effective amount of a recombinant IPD103 polypeptide
or IPD103 chimeric polypeptide of the disclosure. In some
embodiments methods are provided for controlling an insect pest
population, comprising contacting the insect pest population with
an insecticidally-effective amount of a recombinant IPD103
polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO:
8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ
ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO:
26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ
ID NO: 36, SEQ ID NO: 38 or a variant thereof. As used herein,
"controlling a pest population" or "controls a pest" refers to any
effect on a pest that results in limiting the damage that the pest
causes. Controlling a pest includes, but is not limited to, killing
the pest, inhibiting development of the pest, altering fertility or
growth of the pest in such a manner that the pest provides less
damage to the plant, decreasing the number of offspring produced,
producing less fit pests, producing pests more susceptible to
predator attack or deterring the pests from eating the plant.
[0359] In some embodiments methods are provided for controlling an
insect pest population resistant to a pesticidal protein,
comprising contacting the insect pest population, either
simultaneously or sequentially, with an insecticidally-effective
amount of a recombinant IPD103 polypeptide or chimeric IPD103
polypeptide of the disclosure. In some embodiments methods are
provided for controlling an insect pest population resistant to a
pesticidal protein, comprising contacting the insect pest
population with an insecticidally-effective amount of a recombinant
IPD103 polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ
ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO:
16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ
ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO:
34, SEQ ID NO: 36, SEQ ID NO: 38 or a variant thereof.
[0360] In some embodiments methods are provided for protecting a
plant from an insect pest, comprising expressing in the plant or
cell thereof at least one recombinant polynucleotide encoding an
IPD103 polypeptide or chimeric IPD103 polypeptide. In some
embodiments methods are provided for protecting a plant from an
insect pest, comprising expressing in the plant or cell thereof a
recombinant polynucleotide encoding IPD103 polypeptide of SEQ ID
NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ
ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO:
20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ
ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO:
38 or variants thereof.
Insect Resistance Management (IRM) Strategies
[0361] Expression of B. thuringiensis 6-endotoxins in transgenic
corn plants has proven to be an effective means of controlling
agriculturally important insect pests (Perlak, et al., 1990; 1993).
However, insects have evolved that are resistant to B.
thuringiensis 6-endotoxins expressed in transgenic plants. Such
resistance, should it become widespread, would clearly limit the
commercial value of germplasm containing genes encoding such B.
thuringiensis 6-endotoxins.
[0362] One way to increasing the effectiveness of the transgenic
insecticides against target pests and contemporaneously reducing
the development of insecticide-resistant pests is to use provide
non-transgenic (i.e., non-insecticidal protein) refuges (a section
of non-insecticidal crops/corn) for use with transgenic crops
producing a single insecticidal protein active against target
pests. The United States Environmental Protection Agency
(epa.gov/oppbppdlbiopesticides/pips/bt_corn_refuge_2006.htm, which
can be accessed using the www prefix) publishes the requirements
for use with transgenic crops producing a single Bt protein active
against target pests. In addition, the National Corn Growers
Association, on their website:
(ncga.com/insect-resistance-management-fact-sheet-bt-corn, which
can be accessed using the www prefix) also provides similar
guidance regarding refuge requirements. Due to losses to insects
within the refuge area, larger refuges may reduce overall
yield.
[0363] Another way of increasing the effectiveness of the
transgenic insecticides against target pests and contemporaneously
reducing the development of insecticide-resistant pests would be to
have a repository of insecticidal genes that are effective against
groups of insect pests and which manifest their effects through
different modes of action.
[0364] Expression in a plant of two or more insecticidal
compositions toxic to the same insect species, each insecticide
being expressed at efficacious levels would be another way to
achieve control of the development of resistance. This is based on
the principle that evolution of resistance against two separate
modes of action is far more unlikely than only one. Roush, for
example, outlines two-toxin strategies, also called "pyramiding" or
"stacking," for management of insecticidal transgenic crops. (The
Royal Society. Phil. Trans. R. Soc. Lond. B. (1998) 353:1777-1786).
Stacking or pyramiding of two different proteins each effective
against the target pests and with little or no cross-resistance can
allow for use of a smaller refuge. The US Environmental Protection
Agency requires significantly less (generally 5%) structured refuge
of non-Bt corn be planted than for single trait products (generally
20%). There are various ways of providing the IRM effects of a
refuge, including various geometric planting patterns in the fields
and in-bag seed mixtures, as discussed further by Roush.
[0365] In some embodiments the IPD103 polypeptides of the
disclosure are useful as an insect resistance management strategy
in combination (i.e., pyramided) with other pesticidal proteins
include but are not limited to Bt toxins, Xenorhabdus sp. or
Photorhabdus sp. insecticidal proteins, other insecticidally active
proteins, and the like.
[0366] Provided are methods of controlling Lepidoptera and/or
Coleoptera insect infestation(s) in a transgenic plant that promote
insect resistance management, comprising expressing in the plant at
least two different insecticidal proteins having different modes of
action.
[0367] In some embodiments the methods of controlling Lepidoptera
and/or Coleoptera insect infestation in a transgenic plant and
promoting insect resistance management comprises the presentation
of at least one of the IPD103 polypeptide insecticidal proteins to
insects in the order Lepidoptera and/or Coleoptera.
[0368] In some embodiments the methods of controlling Lepidoptera
and/or Coleoptera insect infestation in a transgenic plant and
promoting insect resistance management comprises the presentation
of at least one of the IPD103 polypeptides of SEQ ID NO: 2, SEQ ID
NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12,
SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID
NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30,
SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38 or
variants thereof, insecticidal to insects in the order Lepidoptera
and/or Coleoptera.
[0369] In some embodiments the methods of controlling Lepidoptera
and/or Coleoptera insect infestation in a transgenic plant and
promoting insect resistance management comprise expressing in the
transgenic plant an IPD103 polypeptide and a Cry protein or other
insecticidal protein to insects in the order Lepidoptera and/or
Coleoptera having different modes of action.
[0370] In some embodiments the methods, of controlling Lepidoptera
and/or Coleoptera insect infestation in a transgenic plant and
promoting insect resistance management, comprise expression in the
transgenic plant an IPD103 polypeptide of SEQ ID NO: 2, SEQ ID NO:
4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID
NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22,
SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID
NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38 or variants
thereof and a Cry protein or other insecticidal protein to insects
in the order Lepidoptera and/or Coleoptera, where the IPD103
polypeptide and Cry protein have different modes of action.
[0371] Also provided are methods of reducing likelihood of
emergence of Lepidoptera and/or Coleoptera insect resistance to
transgenic plants expressing in the plants insecticidal proteins to
control the insect species, comprising expression of an IPD103
polypeptide insecticidal to the insect species in combination with
a second insecticidal protein to the insect species having
different modes of action.
[0372] Also provided are means for effective Lepidoptera and/or
Coleoptera insect resistance management of transgenic plants,
comprising co-expressing at high levels in the plants two or more
insecticidal proteins toxic to Lepidoptera and/or Coleoptera
insects but each exhibiting a different mode of effectuating its
killing activity, wherein the two or more insecticidal proteins
comprise an IPD103 polypeptide and a Cry protein. Also provided are
means for effective Lepidoptera and/or Coleoptera insect resistance
management of transgenic plants, comprising co-expressing at high
levels in the plants two or more insecticidal proteins toxic to
Lepidoptera and/or Coleoptera insects but each exhibiting a
different mode of effectuating its killing activity, wherein the
two or more insecticidal proteins comprise an IPD103 polypeptide of
SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO:
10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ
ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO:
28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ
ID NO: 38 or variants thereof and a Cry protein or other
insecticidally active protein.
[0373] In addition, methods are provided for obtaining regulatory
approval for planting or commercialization of plants expressing
proteins insecticidal to insects in the order Lepidoptera and/or
Coleoptera, comprising the step of referring to, submitting or
relying on insect assay binding data showing that the IPD103
polypeptide does not compete with binding sites for Cry proteins in
such insects. In addition, methods are provided for obtaining
regulatory approval for planting or commercialization of plants
expressing proteins insecticidal to insects in the order
Lepidoptera and/or Coleoptera, comprising the step of referring to,
submitting or relying on insect assay binding data showing that the
IPD103 polypeptide of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ
ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO:
16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ
ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO:
34, SEQ ID NO: 36, SEQ ID NO: 38 or variant thereof does not
compete with binding sites for Cry proteins in such insects.
Methods for Increasing Plant Yield
[0374] Methods for increasing plant yield are provided. The methods
comprise providing a plant or plant cell expressing a
polynucleotide encoding the pesticidal polypeptide sequence
disclosed herein and growing the plant or a seed thereof in a field
infested with a pest against which the polypeptide has pesticidal
activity. In some embodiments, the polypeptide has pesticidal
activity against a Lepidopteran, Coleopteran, Dipteran, Hemipteran
or nematode pest, and the field is infested with a Lepidopteran,
Hemipteran, Coleopteran, Dipteran or nematode pest.
[0375] As defined herein, the "yield" of the plant refers to the
quality and/or quantity of biomass produced by the plant. "Biomass"
as used herein refers to any measured plant product. An increase in
biomass production is any improvement in the yield of the measured
plant product. Increasing plant yield has several commercial
applications. For example, increasing plant leaf biomass may
increase the yield of leafy vegetables for human or animal
consumption. Additionally, increasing leaf biomass can be used to
increase production of plant-derived pharmaceutical or industrial
products. An increase in yield can comprise any statistically
significant increase including, but not limited to, at least a 1%
increase, at least a 3% increase, at least a 5% increase, at least
a 10% increase, at least a 20% increase, at least a 30%, at least a
50%, at least a 70%, at least a 100% or a greater increase in yield
compared to a plant not expressing the pesticidal sequence.
[0376] In specific methods, plant yield is increased as a result of
improved pest resistance of a plant expressing an IPD103
polypeptide disclosed herein. Expression of the IPD103 polypeptide
results in a reduced ability of a pest to infest or feed on the
plant, thus improving plant yield.
Methods of Processing
[0377] Further provided are methods of processing a plant, plant
part or seed to obtain a food or feed product from a plant, plant
part or seed comprising an IPD103 polynucleotide. The plants, plant
parts or seeds provided herein, can be processed to yield oil,
protein products and/or by-products that are derivatives obtained
by processing that have commercial value. Non-limiting examples
include transgenic seeds comprising a nucleic acid molecule
encoding an IPD103 polypeptide which can be processed to yield soy
oil, soy products and/or soy by-products.
[0378] "Processing" refers to any physical and chemical methods
used to obtain any soy product and includes, but is not limited to,
heat conditioning, flaking and grinding, extrusion, solvent
extraction or aqueous soaking and extraction of whole or partial
seeds
[0379] The following examples are offered by way of illustration
and not by way of limitation.
EXPERIMENTALS
Example 1--Identification of Insecticidal Proteins Active Against
Corn Earworm, European Corn Borer Fall Armyworm, Soybean Looper,
and Velvet Bean Caterpillar from the Fern, Athyrium niponicum `Red
Beauty`
[0380] An insecticidal protein, IPD103Aa (SEQ ID NO: 2), was
identified by protein purification, mass spectroscopy (MS) and PCR
cloning from the commercial cultivar Athyrium niponicum `Red
Beauty`, designated herein as NY15. Insecticidal activity against
lepidopteran pests was observed from a protein extract from
Athyrium niponicum, `Red Beauty` with an artificial diet-based
assay.
[0381] NY15 plant material was flash frozen in liquid nitrogen and
stored at -80.degree. C. The frozen sample was removed from storage
and ground to a fine powder at liquid nitrogen temperatures with a
GenoGrinder.RTM. 2010 (SPEX SamplePrep.RTM., Metuchen, N.J.). To
extract protein, 5 mL Extraction Buffer (50 mM Tris, pH 8.0, 150 mM
Potassium Chloride, 2.5 mM EDTA, 1.5% Polyvinylpolypyridone and
"Complete, EDTA-free" protease inhibitor cocktail (Roche,
Indianapolis, Ind.) was added per gram of fresh weight of NY15. The
extracted material was clarified by centrifugation at 20,000 g for
10 min. The remaining cell pellet was re-extracted with 1/2 the
volume of Extraction Buffer, centrifuged and the supernatants
combined, filtered and desalted into 20 mM Tris, pH 8, using a
Sephadex.TM. G25 (GE Healthcare, Piscataway, N.J.) column and
concentrated on 10 kDa molecular weight cutoff centrifugal
concentrators (Sartorius Stedim, Goettingen, Germany).
[0382] Bioassays against Soybean Looper (SBL) (Pseudoplusia
includens), Corn Earworm (CEW) (Helicoverpa zea) and European Corn
Borer (ECB) (Ostrinia nubialis) were conducted using the desalted
protein extract overlaid onto agar based Lepidoptera diet
(Southland Products Inc., Lake Village, Ark.) in 96-well format.
The sample was allowed to dry on top of the diet. A variable number
of neonate insects (2-5) were placed individually into each well of
the treated plate. The assay was run for four days at 27'C and then
scored for insect mortality, and various stages of stunting of
insect growth. The scores were recorded numerically as dead (3),
severely stunted (2) (little or no growth but alive and equivalent
to a 1.sup.st instar larvae), stunted (1) (growth to second instar
but not equivalent to controls), or normal (0). The crude NY15
extract scored 1 against CEW in each of 4 replicates of the
diet-based assay.
[0383] For protein purification, extract of NY15 was generated as
described above and the supernatant desalted into 20 mM Tris, pH 8,
before loading onto a 15 mL Capto.TM. Q column (GE Healthcare) that
was equilibrated in the same buffer. A linear 10 column volume
gradient from 0 M to 0.3 M NaCl in 50 mM Tris, pH 8.0 was applied.
Eluted 1 mL fractions were assayed against CEW in the bioassay
described above. Activity against CEW was detected in fractions
eluting at .about.7 to 11 mS/cm conductivity. These fractions were
pooled and desalted into 20 mM Tris, pH 8.7 and loaded onto a 1 ml
Mono Q.TM. column (GE Healthcare) equilibrated in the same buffer.
A linear 20 CV gradient to 40% Elution Buffer (20 mM Tris+0.35 M
NaCl, pH 8.7) was applied and 1 mL fractions were collected.
Activity against CEW was detected in fractions eluting at
.about.8.5-13.3 mS/cm.sup.2 conductivity. Active fractions were
pooled and desalted into 25 mM BisTris, pH 7.2 and loaded on a 4 mL
Mono P.TM. column (GE Healthcare). An isocratic gradient of 100%
Polybuffer 74 was applied and 1 mL eluate fractions assayed against
CEW. The fractions were submitted directly as well as after
concentrating with 10 kDa MWCO units. There were three regions of
activity associated with the Mono P.TM. run, where Mono P.TM.
fractions C2-3, C7-8 and D12 all showed activity against CEW. The
first two regions were active at 1.times. and 4.times.
concentration while fraction D12 showed activity only after
4.times. concentration. Denaturing electrophoresis of the Mono
P.TM. fractions on LDS polyacrylamide gels indicated that the
abundance of a protein band at approximately 20 kDa correlated
directly with the three regions of eluted CEW activity.
[0384] Protein sequencing and identification were performed by MS
analysis after protein digestion. Proteins for MS identification
were obtained from running sample on an LDS-PAGE gel stained with
Coomassie.TM. Brilliant Blue G-250 stain. The bands of interest
were excised from the gel, de-stained, reduced with dithiothreitol
and then alkylated with iodoacetamide. Following overnight
digestion with trypsin, the samples were subjected to nano-liquid
chromatography/electrospray tandem mass spectrometry
(nano-LC/ESI-MS/MS) on a Thermo Q Exactive.TM. Orbitrap.TM. mass
spectrometer (Thermo Fisher Scientificde, 81 Wyman Street, Waltham,
Mass. 02454) interfaced with an Eksigent.TM. NanoLC.TM. Ultra 1-D
Plus nano-Ic system (AB Sciex.TM., 500 Old Connecticut Path,
Framingham, Mass. 01701). Protein identification was done by
database searches using Mascot.RTM. (Matrix Science, 10 Perrins
Lane, London NW3 1QY UK). The searches were conducted against an
in-house transcriptome database containing transcripts from the
Athyrium niponicum `Red Beauty`, NY15 source plant and the public
protein database Swiss-Prot using the Mascot search engine (Matrix
Science). The amino acid sequences for all three gel bands aligned
with the predicted protein from a NY15.
Example 2--Transcriptomic Sequencing of Athyrium niponicum `Red
Beauty` and Cloning of IPD103Aa
[0385] A transcriptome for Athyrium niponicum `Red Beauty` (NY15)
was prepared as follows. Total RNA was isolated from frozen tissues
with an RNeasy.RTM. kit (Qiagen.RTM.). Sequencing libraries from
the resulting total RNAs were prepared using the TruSeq.TM.
mRNA-Seq kit and protocol from Illumina.RTM., Inc. (San Diego,
Calif.). Briefly, mRNAs were isolated via attachment to oligo(dT)
beads, fragmented to a mean size of 180 nt, reverse transcribed
into cDNA by random hexamer prime, end repaired, 3' A-tailed, and
ligated with Illumina.RTM. indexed TruSeq.TM. adapters. Ligated
cDNA fragments were PCR amplified using Illumina.RTM. TruSeq.TM.
primers and purified PCR products were checked for quality and
quantity on the Agilent Bioanalyzer.RTM. DNA 7500 chip. Post
quality and quantity assessment, 100 ng of the transcript library
was normalized by treatment with Duplex Specific Nuclease (DSN)
(Evrogen.RTM., Moscow, Russia). Normalization was accomplished by
addition of 200 mM Hepes buffer, followed by heat denaturation and
five hour anneal at 68.degree. C. Annealed library was treated with
2 .mu.l of DSN enzyme for 25 minutes, purified by Qiagen.RTM.
MinElute.RTM. columns according to manufacturer protocols, and
amplified twelve cycles using Illumina.RTM. adapter specific
primers. Final products were purified with Ampure.RTM. XP beads
(Beckman Genomics, Danvers, Mass.) and checked for quality and
quantity on the Agilent Bioanalyzer.RTM. DNA 7500 chip.
[0386] Normalized transcript libraries were sequenced according to
manufacturer protocols on the Illumina.RTM. HiSeq.RTM. 2500.
Libraries were pooled, hybridized and sequenced three per flowcell
lane using onboard clustering methods followed by sequencing to a
target depth of sixty million 75 bp paired end reads per normalized
library.
[0387] Peptide sequences identified for IPD103Aa (SEQ ID NO: 2) by
LCMS sequencing (described in Example 2) were searched against
protein sequences predicted by open reading frames (ORFs) from the
transcriptome assemblies for NY15. The peptides gave a perfect
match to a transcript corresponding to IPD103Aa (SEQ ID NO: 2). The
coding sequence was used to design the following primers:
AGCATATGGCGGACAAAGCAGCAGCAGCAGCTAGAGAAGC (SEQ ID NO: 473) and
CGACTCGAGATGGGTGCCGGCAGGCAGGCATATTGC (SEQ ID NO: 474) to clone the
IPD103Aa polynucleotide sequence (SEQ ID NO: 1). This clone was
produced by polymerase chain reaction using the Kappa HiFi.TM.
polymerase (Kapa Bioscience, Wilmington, Mass.) and the cDNA
prepared from the total RNA from Athyrium niponicum `Red Beauty`
using the SuperScript.RTM. II kit (Thermo Fischer Scientific,
Waltham, Mass.) as the template. PCR products were gel purified,
digested with NdeI and XhoI restriction enzymes (New England
Biolabs) and ligated into pET14b (Novagen.RTM.) also digested with
the same enzymes. Colonies were sequenced to confirm the clone.
Example 3--Purification of IPD103Aa Expressed in E. coli
[0388] The polynucleotide of SEQ ID NO: 1, encoding IPD103Aa (SEQ
ID NO: 2) was subcloned into the pET14b vector (Novagen.RTM.) using
the NdeI/XhoI restriction sites in frame with the coding sequence
for an N-terminal 6.times. His tag followed by a thrombin cleavage
site (SEQ ID NO: 40). Chemically competent OverExpress.RTM.
C41(DE3) SOLOs cells (Lucigen.RTM.) were transformed with pET
plasmid DNA, containing the IPD103Aa gene for recombinant protein
expression. The transformed E. coli cells were grown overnight at
37.degree. C. with ampicillin selection and then inoculated to a
fresh 2xYT medium (1:25) and further grown to an optical density of
about 0.8. Protein expression was induced by adding 0.3 mM IPTG and
cells were further grown at 16.degree. C. for 16 hours. The E. coli
expressed proteins were purified by immobilized metal ion
chromatography using HisPuri.TM. Cobalt resin (Clonetech, Mountain
View, Calif.) according to the manufacturer's protocols. The
purified fractions were desalted using PD-10 columns (GE Life
Sciences, Pittsburgh, USA) pre-equilibrated with PBS buffer. The
eluted protein was used in diet bioassays to evaluate the protein
activity on larvae of a diversity of Lepidoptera.
Example 4--Identification of IPD103Aa Homologs and their
Purification after Expression in E. coli
[0389] Gene identities may be determined by conducting
BLAST.TM..sup.M (Basic Local Alignment Search Tool; Altschul, et
al., (1993) J. Mol. Biol. 215:403-410; see also
ncbi.nlm.nih.gov/BLAST/, which can be accessed using the www
prefix) searches under default parameters for similarity to
sequences. The polynucleotide sequence for IPD103Aa (SEQ ID NO: 1)
was analyzed. Gene identities conducted by BLAST.TM. in a DUPONT
PIONEER internal plant transcriptomes database identified multiple
homologs of IPD103Aa protein (SEQ ID NO: 2). The IPD13Aa homologs
and the organism they were identified from are shown in Table
1.
TABLE-US-00001 TABLE 1 Gene Name Source Organism DNA Seq AA Seq
IPD103Aa NY15 Athyrium niponicum `Red SEQ ID NO: 1 SEQ ID NO: 2
Beauty` IPD103Ab NY15 Athyrium niponicum `Red SEQ ID NO: 3 SEQ ID
NO: 4 Beauty` IPD103Ac PS9092AF Platycerium wandae SEQ ID NO: 5 SEQ
ID NO: 6 IPD103Ad PS12349 Pteris ensiformis SEQ ID NO: 7 SEQ ID NO:
8 `Evergemiensis` IPD103Ae PS12349 Pteris ensiformis SEQ ID NO: 9
SEQ ID NO: 10 `Evergemiensis` IPD103Ba PS9092AF Platycerium wandae
SEQ ID NO: 11 SEQ ID NO: 12 IPD103Bb PS9092AF Platycerium wandae
SEQ ID NO: 13 SEQ ID NO: 14 IPD103Bc PS12409 Athyrium filix-femina
SEQ ID NO: 15 SEQ ID NO: 16 IPD103Bd PS78970F Colysis wrightii SEQ
ID NO: 17 SEQ ID NO: 18 IPD103Be PS88370F Nephrolepis falcata SEQ
ID NO: 19 SEQ ID NO: 20 IPD103Bf PS11699 Nephrolepis cordifolia SEQ
ID NO: 21 SEQ ID NO: 22 IPD103Bg PS13327 Polystichum tsus-simense
SEQ ID NO: 23 SEQ ID NO: 24 IPD103Bh PS13327 Polystichum
tsus-simense SEQ ID NO: 25 SEQ ID NO: 26 IPD103Bi PS12861
Thelypteris palustris SEQ ID NO: 27 SEQ ID NO: 28 IPD103Bj PS12410
Athyrium filix-femina SEQ ID NO: 29 SEQ ID NO: 30 IPD103Bk PS12337
Nephrolepis cordifolia SEQ ID NO: 31 SEQ ID NO: 32 IPD103Ca
PS9092AF Platycerium wandae SEQ ID NO: 33 SEQ ID NO: 34 IPD103Da
PS9539 Tectaria milnei SEQ ID NO: 35 SEQ ID NO: 36 IPD103Db PS12356
Davaffia tyermannii SEQ ID NO: 37 SEQ ID NO: 38
[0390] cDNAs were generated from source organisms with identified
homologs from the internal database by reverse transcription from
total RNA. Homologs were PCR amplified from their respective cDNA's
using primers designed to the coding sequences of each homolog
(Table 2). The PCR products were digested with NdeI/XhoI (New
England Biolabs, Ipswich, Mass.) and ligated into a pET14b
(Novagen) plasmid digested by the same enzymes. Cloned PCR products
were confirmed by sequencing. The amino acid sequence identity of
the IPD103Aa homologs as calculated using the Needleman-Wunsch
algorithm, as implemented in the Needle program (EMBOSS tool suite)
are shown in Table 3.
TABLE-US-00002 TABLE 2 Forward Reverse Gene Primer Primer Reverse
Name SEQ ID Forward Primer SEQ ID Primer IPD103Aa SEQ ID
AGCATATGGCGGAC SEQ ID CGACTCGAGA NO: 473 AAAGCAGCAGCAGC NO: 474
TGGGTGCCGG AGCTAGAGAAGC CAGGCAGGCA TATTGC IPD103Ab SEQ ID
AGCATATGGCGGAC SEQ ID CGACTCGAGA NO: 475 CAAGCAGCAGCAGC NO: 474
TGGGTGCCGG TAGAGAAGC CAGGCAGGCA TATTGC IPD103Ac SEQ ID
AACATATGGCCGAA SEQ ID TTCTCGAGTC NO: 476 CCAGCAGCAGC NO: 477
AAGGGAGCGC CCCA IPD103Ad SEQ ID AACATATGGCCGAC SEQ ID TTCTCGAGTC
NO: 478 CAAGGAGCAGCAG NO: 479 AAGGGAGCG CCCC IPD103Ae SEQ ID
AACATATGGCCGAC SEQ ID TTCTCGAGTC NO: 480 CAAGCTGCAGC NO: 479
AAGGGAGCGC CCC IPD103Ba SEQ ID AACATATGAGAGAG SEQ ID TTCTCGAGTC NO:
481 CGAGAGCGAGAGCG NO: 477 AAGGGAGCGC CCCA IPD103Bb SEQ ID
AACATATGGCCGAA SEQ ID TTCTCGAGTC NO: 482 CCAGCAGCAGC NO: 477
AAGGGAGCGC CCCA IPD103Bc SEQ ID AACATATGGCCGAC SEQ ID TTCTCGAGTC
NO: 483 AAAGCGCCTC NO: 484 AAGGGAGTGC CCCG IPD103Bd SEQ ID
AACATATGGCCGAC SEQ ID TTCTCGAGTC NO: 485 CAAGTAGCAGCAG NO: 479
AAGGGAGCGC CCC IPD103Be SEQ ID AACATATGGCCGAC SEQ ID TTCTCGAGTC NO:
486 CCAGCAACAGC NO: 479 AAGGGAGCGC CCC IPD103Bf SEQ ID
AACATATGCAGAGA SEQ ID TTCTCGAGTC NO: 487 GAGAGAGAGAGAGA NO: 479
AAGGGAGCGC GATGG CCC IPD103Bg SEQ ID AACATATGGCCGAC SEQ ID
TTCTCGAGTC NO: 488 AAAGTAGCAGCAGC NO: 479 AAGGGAGCGC CCC IPD103Bh
SEQ ID AACATATGGCCGAC SEQ ID TTCTCGAGTC NO: 488 AAAGTAGCAGCAGC NO:
479 CAAGGGAGCG CCC IPD103Bi SEQ ID AACATATGGCCGAC SEQ ID TTCTCGAGTC
NO: 488 AAAGTAGCAGCAGC NO: 489 AAGGGAGTGC CCC IPD103Ca SEQ ID
AACATATGAGAGAG SEQ ID TTCTCGAGTC NO: 490 CGAGAGCGAGAGCG NO: 477
AAGGGAGCGC CCCA IPD103Cb SEQ ID AACATATGGCCGAT SEQ ID TTCTCGAGTC
NO: 491 GACAAAGTAGCAAG NO: 492 AAGGGAGGGC CC IPD103Da SEQ ID
AACATATGGCCGAT SEQ ID TTCTCGAGTC NO: 493 GAGGTAGCTGGTC NO: 479
AAGGGAGCGC CCC IPD103Db SEQ ID AACATATGGACGCC SEQ ID TTCTCGAGTC NO:
494 GCTGCCG NO: 495 AAGGGAGCGC CC
[0391] Table 3 provides a matrix of percent identity of IPD103
homolog proteins. The Needleman-Wunsch algorithm, as implemented in
the Needle program (EMBOSS tool suite), was used to calculate
pairwise identities.
TABLE-US-00003 TABLE 3 IPD103Ab IPD103Ac IPD103Ad IPD103Ae IPD103Ba
IPD103Bb IPD103Bc IPD103Bd IPD103Be SEQ ID SEQ ID SEQ ID SEQ ID SEQ
ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 4 NO: 6 NO: 8 NO: 10 NO: 12 NO:
14 NO: 16 NO: 18 NO: 20 IPD103Aa 98.8 98.3 93.6 93.6 82.0 86.6 89.5
93.0 85.5 SEQ ID NO: 2 IPD103Ab -- 98.8 94.7 94.7 81.4 86.0 89.0
94.2 86.0 SEQ ID NO: 4 IPD103Ac -- -- 93.6 93.6 82.5 87.2 88.4 93.0
86.0 SEQ ID NO: 6 IPD103Ad -- -- -- 99.4 78.6 83.0 86.0 92.9 83.0
SEQ ID NO: 8 IPD103Ae -- -- -- -- 78.6 83.0 86.5 92.9 83.6 SEQ ID
NO: 10 IPD103Ba -- -- -- -- -- 92.9 79.7 83.5 82.5 SEQ ID NO: 12
IPD103Bb -- -- -- -- -- -- 84.2 87.7 86.6 SEQ ID NO: 14 IPD103Bc --
-- -- -- -- -- -- 86.0 84.3 SEQ ID NO: 16 IPD103Bd -- -- -- -- --
-- -- -- 87.7 SEQ ID NO: 18 IPD103Be -- -- -- -- -- -- -- -- -- SEQ
ID NO: 20 IPD103Bf -- -- -- -- -- -- -- -- -- SEQ ID NO: 22
IPD103Bg -- -- -- -- -- -- -- -- -- SEQ ID NO: 24 IPD103Bh -- -- --
-- -- -- -- -- -- SEQ ID NO: 26 IPD103Bi -- -- -- -- -- -- -- -- --
SEQ ID NO: 28 IPD103Bj -- -- -- -- -- -- -- -- -- SEQ ID NO: 30
IPD103Bk -- -- -- -- -- -- -- -- -- SEQ ID NO: 32 IPD103Ca -- -- --
-- -- -- -- -- -- SEQ ID NO: 34 IPD103Da -- -- -- -- -- -- -- -- --
SEQ ID NO: 36 IPD103Bf IPD103Bg IPD103Bh IPD103Bi IPD103Bj IPD103Bk
IPD103Ca IPD103Da IPD103Db SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ
ID SEQ ID SEQ ID SEQ ID NO: 22 NO: 24 NO: 26 NO: 28 NO: 30 NO: 32
NO: 34 NO: 36 NO: 38 IPD103Aa 86.1 87.4 87.4 85.0 89.0 90.1 81.4
72.0 61.8 SEQ ID NO: 2 IPD103Ab 86.1 86.3 86.3 84.4 88.4 90.1 80.9
72.2 62.2 SEQ ID NO: 4 IPD103Ac 85.0 85.7 85.7 83.8 87.8 89.0 82.0
71.6 62.2 SEQ ID NO: 6 IPD103Ad 84.9 83.9 83.9 83.8 85.4 88.9 78.0
71.8 62.0 SEQ ID NO: 8 IPD103Ae 84.9 83.3 83.3 83.8 86.0 88.9 78.0
71.1 62.4 SEQ ID NO: 10 IPD103Ba 87.9 76.2 76.2 73.9 79.1 84.6 98.9
64.1 57.9 SEQ ID NO: 12 IPD103Bb 85.5 80.5 80.5 79.2 83.6 89.5 94.0
67.1 61.0 SEQ ID NO: 14 IPD103Bc 81.6 92.5 92.5 82.1 99.4 85.4 79.1
71.8 59.3 SEQ ID NO: 16 IPD103Bd 86.6 84.5 84.5 82.1 85.4 90.6 82.4
71.1 62.6 SEQ ID NO: 18 IPD103Be 85.6 81.1 81.1 77.6 83.7 89.5 81.4
69.9 59.9 SEQ ID NO: 20 IPD103Bf -- 79.7 79.7 77.3 81.0 95.5 87.4
67.4 61.7 SEQ ID NO: 22 IPD103Bg -- -- 99.4 80.6 93.1 83.3 75.7
71.5 58.1 SEQ ID NO: 24 IPD103Bh -- -- -- 80.6 93.1 83.3 75.7 71.5
58.1 SEQ ID NO: 26 IPD103Bi -- -- -- -- 81.5 84.8 78.6 71.3 58.7
SEQ ID NO: 28 IPD103Bj -- -- -- -- -- 84.8 78.6 71.3 58.7 SEQ ID
NO: 30 IPD103Bk -- -- -- -- -- -- 84.1 70.5 64.5 SEQ ID NO: 32
IPD103Ca -- -- -- -- -- -- -- 63.0 57.4 SEQ ID NO: 34 IPD103Da --
-- -- -- -- -- -- -- 51.2 SEQ ID NO: 36
Example 5--Lepidoptera Assays with Purified Tagged Proteins
Expressed in E. coli
[0392] Bioassays against the five pest species, Corn earworm (CEW)
(Helicoverpa zea), European corn borer (ECB) (Ostrinia nubialis),
fall armyworm (FAW) (Spodoptera frugiperda JE Smith), Soybean
looper (SBL) (Pseudoplusia includens), and velvet bean caterpillar
(VBC) (Anticarsia gemmatalis Hubner) were conducted using a
dilution series of purified N-6.times. His-IPD103Aa (SEQ ID NO: 40)
or N-6.times. His IPD103Ab (SEQ ID NO: 507) polypeptides
incorporated into an agar-based Lepidoptera diet (Southland
Products Inc., Lake Village, Ark.) in a 96-well plate format. Four
replicates were used per sample. Two to five neonate insects were
placed into each well of the treated plate. After four days of
incubation at 27.degree. C. larvae were scored for mortality or
severity of stunting. The scores were recorded numerically as dead
(3), severely stunted (2) (little or no growth but alive and
equivalent to a 1.sup.st instar larvae), stunted (1) (growth to
second instar but not equivalent to controls), or normal (0).
Results from bioassays of a dilution series of N-xHis-tagged
IPD103Aa (SEQ ID NO: 40) and N-6.times. His IPD13Ab (SEQ ID NO:
507) against the Lepidoptera pests are shown in Table 4. Values
represent the mean larval inhibition score of 4 replicate
assays.
TABLE-US-00004 TABLE 4 Dose (ppm) CEW ECB FAW SBL VBC NT-6xHis 1350
3 2 2 3 3 IPD103Aa 675 2.25 2 2 2 2 SEQ ID 338 2 2 2 1.5 2 NO: 40
169 2 2 2 2 2 84 2 2 0.75 2 2 42 2 1.5 0 1 1 21 1.5 1.5 0 0 0 11
0.25 1 0 0 0 Buffer Control 0 0 0 0 0 0 NT-6xHis 925 2.5 2 2 2 3
IPD103Ab 463 2 2 2 2 2.25 SEQ ID 231 2 2 1.25 2 2 NO: 507 116 2 2
1.25 2 2 58 2 2 1 2 2 29 1.25 2 0 1 0.5 14 0.75 2 0 0 0 7 0.25 2 0
0 0 Buffer Control 0 0 0 0 0 0
Example 6--IPD103Aa and M20 Truncated IPD103Aa Variants with
Multiple Amino Acid Substitutions at R10 and R42
[0393] To create variants of IPD103Aa (SEQ ID NO: 2) at amino acid
residue R10 and R42, multiple amino acid changes were created by
NNK mutagenesis. For mutations at Arg 42, a synthetic DNA (SEQ ID
NO: 497) was generated compromising 5 nucleotides upstream of pET14
NdeI site and nucleotides 1-487 of IPD103Aa (SEQ ID NO: 1) where nt
124 and 125 were synthesized as either A, C, G or T and nt 126 was
synthesized as either G or T to create a library of amino acid
changes at the Arg42 position. The pET14b plasmid with the IPD103Aa
gene (SEQ ID NO: 1) inserted in the NdeI/XhoI sites was amplified
using the primers IPD103 start rev Gibson (SEQ ID NO: 498) and
IPD103-for Gibson (SEQ ID NO: 499) using the Advantage.RTM. HF 2
PCR Kit (Clontech Laboratories, Inc. Mountain View, Calif.) to
produce a plasmid that contained a 26 and a 30 nucleotide overlap
sequence at either end that matched with the synthesized IPD103Aa
R42 NNK gene (SEQ ID NO: 497). The IPD103Aa R42 NNK library was
generated using the Gibson reaction (New England Biolabs, Ipswich
Mass.) to combine the amplified pET14b IPD103Aa vector with the
synthetic DNA. Clones were confirmed by DNA sequencing to identify
the amino acid substitution at the Arg42 position.
[0394] For mutations at the Arg 10 residue, the primers IPD103Aa
R10 NNK--for (SEQ ID NO: 500) and IPD103Aa_Rev primer (SEQ ID NO:
474) were used to amplify the IPD103Aa using the Advantage.RTM. HF
2 PCR Kit (Clontech Laboratories, Inc. Mountain View, Calif.). The
PCR products were digested with NdeI/XhoI (New England Biolabs,
Ipswich Mass.) and ligated into a pET14b (Novagen.RTM.) plasmid
digested by the same enzymes to create the IPD103Aa R10 NNK
library. The same reaction was performed on the IPD103Aa R42W (SEQ
ID NO: 422) backbone to create a construct with mutations at R10
with R42W. Clones were confirmed by DNA sequencing to identify the
amino acid substitution at the Arg10 position.
[0395] Combinations of the mutations at R10 and R42 were created in
the IPD103Aa (SEQ ID NO: 1), IPD103Ab (SEQ ID NO: 4) backbone and
the R42 mutations were created in the M20 start site IPD103Aa (SEQ
ID NO: 417) backbone. To create the IPD103Aa M20 start site
sequence (SEQ ID NO: 417) and produce Arg42 mutations in the
IPD103Aa M20 start site sequence (SEQ ID NO: 417), the IPD103Aa
M(20)DETE start (SEQ ID NO: 501) primer was used with the
IPD103Aa_Rev primer (SEQ ID NO: 474) to amplify the IPD103Aa (SEQ
ID NO: 2), IPD103Aa R42T (SEQ ID NO: 419), IPD103Aa R42W (SEQ ID
NO: 422), and IPD103Aa R42Y (SEQ ID NO: 423) sequences with the
Advantage.RTM. HF 2 PCR Kit (Clontech Laboratories, Inc. Mountain
View, Calif.). The PCR products were digested with NdeI/XhoI (New
England Biolabs, Ipswich Mass.) and ligated into a pET14b (Novagen)
plasmid digested by the same enzymes. Clones were confirmed by DNA
sequencing. To create the mutations on the IPD103Ab (SEQ ID NO: 3)
backbone the primer, IPD103Ab R10 NNK for (SEQ ID NO: 502) and
IPD103Aa_Rev primer (SEQ ID NO: 474) were used to amplify the
IPD103Aa R42P (SEQ ID NO: 421), IPD103Aa R42T (SEQ ID NO: 419), and
IPD103Aa R42L (SEQ ID NO: 420) sequences with the Advantage.RTM. HF
2 PCR Kit (Clontech Laboratories, Inc. Mountain View, Calif.). The
PCR products were digested with NdeI/XhoI (New England Biolabs,
Ipswich Mass.) and ligated into a pET14b (Novagen) plasmid digested
by the same enzymes. Clones were confirmed by DNA sequencing.
Specific mutations at R10 were combined with the IPD103Aa R42T (SEQ
ID NO: 419), R42L (SEQ ID NO: 420), R42W (SEQ ID NO: 422) and R42Y
(SEQ ID NO: 423) by amplifying the sequence using either the
IPD103Aa R10A--for primer (SEQ ID NO: 503), IPD103Aa R10M--for
primer (SEQ ID NO: 504), or the IPD103Aa R10S--for primer (SEQ ID
NO: 505) with the IPD103Aa_Rev primer (SEQ ID NO: 474). The PCR
products were digested with NdeI/XhoI (New England Biolabs, Ipswich
Mass.) and ligated using (NEB) into a pET14b (Novagen) plasmid
digested by the same enzymes. Clones were confirmed by DNA
sequencing.
[0396] Sequence confirmed IPD103Aa R10 and R42 mutants were
transformed into chemically competent OverExpress.RTM. C41 (DE3)
SOLOs E. coli cells (Lucigen) for recombinant protein expression.
The transformed E. coli cells were grown overnight at 37.degree. C.
with ampicillin selection and then inoculated to a fresh 2xYT
medium (1:25) and further grown to an optical density of about 0.8.
Protein expression was induced by adding 0.3 mM IPTG and cells were
further grown at 16.degree. C. for 16 hours. The E. coli expressed
proteins were purified by immobilized metal ion chromatography
using HisPur.TM. Cobalt resin (Thermo Fischer Scientific, Waltham,
Mass.) according to the manufacturer's protocols. The purified
fractions were desalted using PD-10 desalting columns (GE Life
Sciences, Pittsburgh, Pa.) pre-equilibrated with PBS buffer. The
eluted protein was run in diet assay to evaluate the insecticidal
protein effects on larvae of a diversity of Lepidoptera. Bioassays
were run against six pest species: Soybean Looper (SBL)
(Pseudoplusia includens), Corn Earworm (CEW) (Helicoverpa zea),
European Corn Borer (ECB) (Ostrinia nubialis), Fall Armyworm (FAW)
(Spodoptera frugiperda), Velvetbean Caterpillar (VBC) (Anticarsia
gemmatalis) and Black Cutworm (BCW) (Agrotis ipsilon) and were
conducted using the purified protein at a concentration greater
than 22 ug/cm.sup.2 overlaid onto an agar-based Lepidoptera diet
(Southland Products Inc., Lake Village, Ark.) in a 96-well plate
format. Samples were allowed to dry on top of the diet and one to
five neonate insects were placed into each well of the treated
plate. After three days of incubation at 27.degree. C. larvae were
scored for mortality or severity of stunting. The scores were
recorded numerically as dead (3), severely stunted (2) (little or
no growth but alive and equivalent to a 1 st instar larvae),
stunted (1) (growth to second instar but not equivalent to
controls), or normal (0). Activity is recorded as a "+" if an
average score of 1 or greater was recorded at concentrations of
purified protein greater than 22 .mu.g/cm.sup.2. Bioassay results
are summarized in Table 5.
TABLE-US-00005 TABLE 5 Additional amino acid Backbone R10 R42
Polypeptide CEW ECB FAW SBL VBC BCW change M20 Start SEQ ID NO: 445
+ + + + + - IPD103Aa Gly SEQ ID NO: 446 - + + - - nd H163P IPD103Aa
Thr SEQ ID NO: 447 - - - - - nd A8G IPD103Aa Leu SEQ ID NO: 448 + +
- - + nd IPD103Aa Pro SEQ ID NO: 449 + - - - - nd IPD103Aa Trp SEQ
ID NO: 450 + + - - + nd IPD103Aa Tyr SEQ ID NO: 451 + + - + + nd
IPD103Aa Tyr SEQ ID NO: 452 + + + + + + K123E IPD103Aa Thr SEQ ID
NO: 453 + + + + + - IPD103Aa Ala SEQ ID NO: 454 + + + + + +
IPD103Aa Met SEQ ID NO: 455 + + + + + - IPD103Aa Ser SEQ ID NO: 456
+ + + + + - M20 start Thr SEQ ID NO: 457 + + + + + nd M20 start Trp
SEQ ID NO: 458 + + + + + nd M20 start Tyr SEQ ID NO: 459 + + + + +
nd IPD103Ab Cys Pro SEQ ID NO: 460 + + + + + nd IPD103Ab Val Pro
SEQ ID NO: 461 + + - + + nd IPD103Ab Asp Thr SEQ ID NO: 462 + + - +
+ nd IPD103Ab Gln Leu SEQ ID NO: 463 + + + + + nd IPD103Aa Gly Trp
SEQ ID NO: 464 + + + + + nd IPD103Aa Ala Thr SEQ ID NO: 465 + + + +
+ nd IPD103Aa Met Thr SEQ ID NO: 466 + + + + + nd IPD103Aa Gly Leu
SEQ ID NO: 467 + + + + + nd IPD103Aa Ser Leu SEQ ID NO: 468 + + + +
+ nd IPD103Aa Ala Trp SEQ ID NO: 469 + + + + + nd IPD103Aa Met Trp
SEQ ID NO: 470 + + + + + nd IPD103Aa Met Tyr SEQ ID NO: 471 + + + +
+ nd IPD103Aa Ala Tyr SEQ ID NO: 472 + + + + + nd nd - not
determined
Example 7--Purification and Bioassay of IPD103 Homologs Expressed
in E. coli
[0397] The genes encoding IPD103 homologs were subcloned into the
pET14b vector (Novagen) using the NdeI/XhoI restriction sites in
frame with an N-terminal 6.times. His tag followed by a thrombin
cleavage site with the IPD103 homolog native stop codon. Chemically
competent OverExpress.RTM. 041 (DE3) SOLOs cells (Lucigen) were
transformed with pET14b plasmid DNA, containing the IPD13Aa homolog
gene for recombinant protein expression. The transformed E. coli
cells were grown overnight at 37.degree. C. with ampicillin
selection and then inoculated to a fresh 2xYT medium (1:100) and
further grown to an optical density of about 0.8-1.2. Protein
expression was induced by adding 1.0 mM IPTG and cells were further
grown at 16.degree. C. for 16 hours. The E. coli expressed proteins
were purified by immobilized metal ion chromatography (IMAC) using
Talon.RTM. Cobalt resin (Clonetech, Mountain View, Calif.)
according to the manufacturer's protocols. The purified 1.5 mL
fractions eluted in 250 mM imidazole were dialyzed into PBS buffer
using 6K MWCO Flextubes (IBI, Peosta, Iowa) on a stir plate at 4 C
overnight. The dialyzed protein was run in the diet assay to
evaluate the insecticidal protein effects on larvae of a selection
of Lepidoptera. The activity of a series of homologs of IPD103Aa is
summarized in Table 6.
TABLE-US-00006 TABLE 6 Homolog ID AA Seq CEW ECB FAW SBL VBC
IPD103Ab SEQ ID NO: 4 + + + + + IPD103Ac SEQ ID NO: 6 + + + + +
IPD103Ad SEQ ID NO: 8 + + + + + IPD103Ae SEQ ID NO: 10 + + + + +
IPD103Ba SEQ ID NO: 12 + + + + + IPD103Bb SEQ ID NO: 14 + + + - +
IPD103Bc SEQ ID NO: 16 + + + - + IPD103Bd SEQ ID NO: 18 + + + + +
IPD103Be SEQ ID NO: 20 + + + + + IPD103Bf SEQ ID NO: 22 + + + + +
IPD103Bg SEQ ID NO: 24 + + + + + IPD103Bh SEQ ID NO: 26 + - + - +
IPD103Bi SEQ ID NO: 28 + + + + + IPD103Ca SEQ ID NO: 34 + + + + +
IPD103Da SEQ ID NO: 36 + + + + +
Example 8--IPD103Aa Variants with Multiple Amino Acid
Substitutions
[0398] To create variants of IPD103Aa (SEQ ID NO: 2) with multiple
amino acid changes, variant libraries were generated by family
shuffling (Chia-Chun J. Chang et al, 1999, Nature Biotechnology 17,
793-797) the polynucleotide sequences of SEQ ID NO: 1, SEQ ID NO:
19, and SEQ ID NO: 37, encoding IPD103Aa (SEQ ID NO: 12), IPD103Be
(SEQ ID NO: 20), and IPD103 Da (SEQ ID NO: 38). Three libraries
were constructed for generating IPD103 variants. In a first library
(Libraryl1), the native polynucleotide sequence of IPD103Aa (SEQ ID
NO: 1) and the native polynucleotide sequence of IPD103Be (SEQ ID
NO: 19) were used as library parents. In a second library, the
native polynucleotide sequence of IPD103Be (SEQ ID NO: 19) and the
polynucleotide sequence of SEQ ID NO: 496, encoding the IPD103 Da
polypeptide, with codons optimized to increase the similarity to
SEQ ID NO: 1 were used as library parents. In a third library,
native polynucleotide sequences of IPD103Aa (SEQ ID NO: 1) and
IPD103Be (SEQ ID NO: 19) and the codon-optimized polynucleotide
sequence of IPD103 Da (SEQ ID NO: 496) were used as library
parents. The second and third libraries were picked and screened
together (Libraryl23).
[0399] After transforming the library variants into E. coli cells,
the colonies were picked and cultured in 24-well plates for protein
expression. Cell lysates were generated by B-PER.RTM. Protein
Extraction Reagent (Thermo Scientific, Rockford, Ill.) and screened
for CEW and/or FAW insecticidal activity. The active variants were
sequenced and the amino acid substitutions were identified. From
library 11, 460 variants were screened and 110 active unique
variants were sequence identified. From library 123, 552 variants
were screened and 78 active unique variants were sequence
identified.
[0400] The percent identity of the variant proteins compared to
IPD103Aa (SEQ ID NO: 2), variant designation, nucleotide sequences,
and amino acid sequences of the resulting active IPD103Aa
polypeptide variants are summarized in Table 7. Table 8 summarizes
the % identity of the active variants compared to IPD103Aa (SEQ ID
NO: 2), the number of variants with each % identity, and the
variant identification.
TABLE-US-00007 TABLE 7 % Identity to IPD103Aa (SEQ ID NO: 2)
Variant Polynucleotide Polypeptide 92 IPD103-11Reary-01 SEQ ID NO:
41 SEQ ID NO: 229 90 IPD103-11Reary-04 SEQ ID NO: 42 SEQ ID NO: 230
92 IPD103-11Reary-05 SEQ ID NO: 43 SEQ ID NO: 231 92
IPD103-11Reary-06 SEQ ID NO: 44 SEQ ID NO: 232 89 IPD103-11Reary-08
SEQ ID NO: 45 SEQ ID NO: 233 94 IPD103-11Reary-09 SEQ ID NO: 46 SEQ
ID NO: 234 92 IPD103-11Reary-10 SEQ ID NO: 47 SEQ ID NO: 235 91
IPD103-11Reary-11 SEQ ID NO: 48 SEQ ID NO: 236 94 IPD103-11Reary-13
SEQ ID NO: 49 SEQ ID NO: 237 98 IPD103-11Reary-14 SEQ ID NO: 50 SEQ
ID NO: 238 90 IPD103-11Reary-15 SEQ ID NO: 51 SEQ ID NO: 239 95
IPD103-11Reary-16 SEQ ID NO: 52 SEQ ID NO: 240 93 IPD103-11Reary-17
SEQ ID NO: 53 SEQ ID NO: 241 92 IPD103-11Reary-18 SEQ ID NO: 54 SEQ
ID NO: 242 89 IPD103-11Reary-19 SEQ ID NO: 55 SEQ ID NO: 243 90
IPD103-11Reary-20 SEQ ID NO: 56 SEQ ID NO: 244 91 IPD103-11Reary-21
SEQ ID NO: 57 SEQ ID NO: 245 94 IPD103-11Reary-22 SEQ ID NO: 58 SEQ
ID NO: 246 91 IPD103-11Reary-24 SEQ ID NO: 59 SEQ ID NO: 247 98
IPD103-11Reary-25 SEQ ID NO: 60 SEQ ID NO: 248 88 IPD103-11Reary-26
SEQ ID NO: 61 SEQ ID NO: 249 95 IPD103-11Reary-29 SEQ ID NO: 62 SEQ
ID NO: 250 89 IPD103-11Reary-31 SEQ ID NO: 63 SEQ ID NO: 251 90
IPD103-11Reary-32 SEQ ID NO: 64 SEQ ID NO: 252 94 IPD103-11Reary-33
SEQ ID NO: 65 SEQ ID NO: 253 95 IPD103-11Reary-34 SEQ ID NO: 66 SEQ
ID NO: 254 92 IPD103-11Reary-35 SEQ ID NO: 67 SEQ ID NO: 255 92
IPD103-11Reary-36 SEQ ID NO: 68 SEQ ID NO: 256 96 IPD103-11Reary-37
SEQ ID NO: 69 SEQ ID NO: 257 87 IPD103-11Reary-38 SEQ ID NO: 70 SEQ
ID NO: 258 88 IPD103-11Reary-39 SEQ ID NO: 71 SEQ ID NO: 259 92
IPD103-11Reary-40 SEQ ID NO: 72 SEQ ID NO: 260 86 IPD103-11Reary-41
SEQ ID NO: 73 SEQ ID NO: 261 92 IPD103-11Reary-42 SEQ ID NO: 74 SEQ
ID NO: 262 94 IPD103-11Reary-43 SEQ ID NO: 75 SEQ ID NO: 263 91
IPD103-11Reary-44 SEQ ID NO: 76 SEQ ID NO: 264 94 IPD103-11Reary-45
SEQ ID NO: 77 SEQ ID NO: 265 89 IPD103-11Reary-46 SEQ ID NO: 78 SEQ
ID NO: 266 89 IPD103-123Reary-01 SEQ ID NO: 79 SEQ ID NO: 267 89
IPD103-123Reary-02 SEQ ID NO: 80 SEQ ID NO: 268 94
IPD103-123Reary-05 SEQ ID NO: 81 SEQ ID NO: 269 88
IPD103-123Reary-06 SEQ ID NO: 82 SEQ ID NO: 270 92
IPD103-123Reary-07 SEQ ID NO: 83 SEQ ID NO: 271 76
IPD103-123Reary-08 SEQ ID NO: 84 SEQ ID NO: 272 82
IPD103-123Reary-09 SEQ ID NO: 85 SEQ ID NO: 273 89
IPD103-123Reary-10 SEQ ID NO: 86 SEQ ID NO: 274 90
IPD103-123Reary-11 SEQ ID NO: 87 SEQ ID NO: 275 93
IPD103-123Reary-12 SEQ ID NO: 88 SEQ ID NO: 276 87
IPD103-123Reary-13 SEQ ID NO: 89 SEQ ID NO: 277 89
IPD103-123Reary-14 SEQ ID NO: 90 SEQ ID NO: 278 84
IPD103-123Reary-15 SEQ ID NO: 91 SEQ ID NO: 279 90
IPD103-123Reary-16 SEQ ID NO: 92 SEQ ID NO: 280 81
IPD103-123Reary-17 SEQ ID NO: 93 SEQ ID NO: 281 88
IPD103-123Reary-18 SEQ ID NO: 94 SEQ ID NO: 282 81
IPD103-123Reary-19 SEQ ID NO: 95 SEQ ID NO: 283 78
IPD103-123Reary-21 SEQ ID NO: 96 SEQ ID NO: 284 85
IPD103-123Reary-22 SEQ ID NO: 97 SEQ ID NO: 285 77
IPD103-123Reary-23 SEQ ID NO: 98 SEQ ID NO: 286 75
IPD103-123Reary-24 SEQ ID NO: 99 SEQ ID NO: 287 82
IPD103-123Reary-25 SEQ ID NO: 100 SEQ ID NO: 288 92
IPD103-123Reary-26 SEQ ID NO: 101 SEQ ID NO: 289 79
IPD103-123Reary-28 SEQ ID NO: 102 SEQ ID NO: 290 90
IPD103-123Reary-30 SEQ ID NO: 103 SEQ ID NO: 291 91
IPD103-123Reary-31 SEQ ID NO: 104 SEQ ID NO: 292 84
IPD103-123Reary-32 SEQ ID NO: 105 SEQ ID NO: 293 93
IPD103-123Reary-33 SEQ ID NO: 106 SEQ ID NO: 294 85
IPD103-123Reary-34 SEQ ID NO: 107 SEQ ID NO: 295 87
IPD103-123Reary-35 SEQ ID NO: 108 SEQ ID NO: 296 88
IPD103-123Reary-37 SEQ ID NO: 109 SEQ ID NO: 297 89
IPD103-123Reary-38 SEQ ID NO: 110 SEQ ID NO: 298 75
IPD103-123Reary-40 SEQ ID NO: 111 SEQ ID NO: 299 87
IPD103lib11reary-01 SEQ ID NO: 112 SEQ ID NO: 300 89
IPD103lib11reary-03 SEQ ID NO: 113 SEQ ID NO: 301 95
IPD103lib11reary-07 SEQ ID NO: 114 SEQ ID NO: 302 93
IPD103lib11reary-08 SEQ ID NO: 115 SEQ ID NO: 303 89
IPD103lib11reary-09 SEQ ID NO: 116 SEQ ID NO: 304 90
IPD103lib11reary-10 SEQ ID NO: 117 SEQ ID NO: 305 89
IPD103lib11reary-11 SEQ ID NO: 118 SEQ ID NO: 306 93
IPD103lib11reary-12 SEQ ID NO: 119 SEQ ID NO: 307 93
IPD103lib11reary-13 SEQ ID NO: 120 SEQ ID NO: 308 90
IPD103lib11reary-14 SEQ ID NO: 121 SEQ ID NO: 309 96
IPD103lib11reary-15 SEQ ID NO: 122 SEQ ID NO: 310 92
IPD103lib11reary-16 SEQ ID NO: 123 SEQ ID NO: 311 91
IPD103lib11reary-17 SEQ ID NO: 124 SEQ ID NO: 312 97
IPD103lib11reary-18 SEQ ID NO: 125 SEQ ID NO: 313 98
IPD103lib11reary-19 SEQ ID NO: 126 SEQ ID NO: 314 90
IPD103lib11reary-20 SEQ ID NO: 127 SEQ ID NO: 315 94
IPD103lib11reary-21 SEQ ID NO: 128 SEQ ID NO: 316 87
IPD103lib11reary-22 SEQ ID NO: 129 SEQ ID NO: 317 92
IPD103lib11reary-23 SEQ ID NO: 130 SEQ ID NO: 318 92
IPD103lib11reary-25 SEQ ID NO: 131 SEQ ID NO: 319 92
IPD103lib11reary-27 SEQ ID NO: 132 SEQ ID NO: 320 90
IPD103lib11reary-28 SEQ ID NO: 133 SEQ ID NO: 321 91
IPD103lib11reary-29 SEQ ID NO: 134 SEQ ID NO: 322 89
IPD103lib11reary-30 SEQ ID NO: 135 SEQ ID NO: 323 92
IPD103lib11reary-31 SEQ ID NO: 136 SEQ ID NO: 324 91
IPD103lib11reary-32 SEQ ID NO: 137 SEQ ID NO: 325 89
IPD103lib11reary-33 SEQ ID NO: 138 SEQ ID NO: 326 93
IPD103lib11reary-34 SEQ ID NO: 139 SEQ ID NO: 327 92
IPD103lib11reary-35 SEQ ID NO: 140 SEQ ID NO: 328 88
IPD103lib11reary-38 SEQ ID NO: 141 SEQ ID NO: 329 94
IPD103lib11reary-39 SEQ ID NO: 142 SEQ ID NO: 330 96
IPD103lib11reary-40 SEQ ID NO: 143 SEQ ID NO: 331 98
IPD103lib11reary-41 SEQ ID NO: 144 SEQ ID NO: 332 91
IPD103lib11reary-42 SEQ ID NO: 145 SEQ ID NO: 333 86
IPD103lib11reary-43 SEQ ID NO: 146 SEQ ID NO: 334 95
IPD103lib11reary-44 SEQ ID NO: 147 SEQ ID NO: 335 91
IPD103lib11reary-45 SEQ ID NO: 148 SEQ ID NO: 336 89
IPD103lib11reary-46 SEQ ID NO: 149 SEQ ID NO: 337 88
IPD103lib11reary-47 SEQ ID NO: 150 SEQ ID NO: 338 89
IPD103lib11reary-48 SEQ ID NO: 151 SEQ ID NO: 339 90
IPD103lib11reary-49 SEQ ID NO: 152 SEQ ID NO: 340 95
IPD103lib11reary-50 SEQ ID NO: 153 SEQ ID NO: 341 91
IPD103lib11reary-51 SEQ ID NO: 154 SEQ ID NO: 342 92
IPD103lib11reary-52 SEQ ID NO: 155 SEQ ID NO: 343 91
IPD103lib11reary-53 SEQ ID NO: 156 SEQ ID NO: 344 89
IPD103lib11reary-54 SEQ ID NO: 157 SEQ ID NO: 345 96
IPD103lib11reary-55 SEQ ID NO: 158 SEQ ID NO: 346 92
IPD103lib11reary-56 SEQ ID NO: 159 SEQ ID NO: 347 93
IPD103lib11reary-58 SEQ ID NO: 160 SEQ ID NO: 348 92
IPD103lib11reary-59 SEQ ID NO: 161 SEQ ID NO: 349 90
IPD103lib11reary-62 SEQ ID NO: 162 SEQ ID NO: 350 91
IPD103lib11reary-63 SEQ ID NO: 163 SEQ ID NO: 351 91
IPD103lib11reary-64 SEQ ID NO: 164 SEQ ID NO: 352 95
IPD103lib11reary-65 SEQ ID NO: 165 SEQ ID NO: 353 96
IPD103lib11reary-66 SEQ ID NO: 166 SEQ ID NO: 354 94
IPD103lib11reary-67 SEQ ID NO: 167 SEQ ID NO: 355 93
IPD103lib11reary-68 SEQ ID NO: 168 SEQ ID NO: 356 95
IPD103lib11reary-69 SEQ ID NO: 169 SEQ ID NO: 357 93
IPD103lib11reary-70 SEQ ID NO: 170 SEQ ID NO: 358 96
IPD103lib11reary-73 SEQ ID NO: 171 SEQ ID NO: 359 89
IPD103lib11reary-74 SEQ ID NO: 172 SEQ ID NO: 360 89
IPD103lib11reary-75 SEQ ID NO: 173 SEQ ID NO: 361 88
IPD103lib11reary-76 SEQ ID NO: 174 SEQ ID NO: 362 88
IPD103lib11reary-78 SEQ ID NO: 175 SEQ ID NO: 363 96
IPD103lib11reary-79 SEQ ID NO: 176 SEQ ID NO: 364 91
IPD103lib11reary-80 SEQ ID NO: 177 SEQ ID NO: 365 91
IPD103lib11reary-82 SEQ ID NO: 178 SEQ ID NO: 366 85
IPD103lib11reary-83 SEQ ID NO: 179 SEQ ID NO: 367 93
IPD103lib11reary-85 SEQ ID NO: 180 SEQ ID NO: 368 89
IPD103lib11reary-86 SEQ ID NO: 181 SEQ ID NO: 369 94
IPD103lib11reary-87 SEQ ID NO: 182 SEQ ID NO: 370 96
IPD103lib11reary-88 SEQ ID NO: 183 SEQ ID NO: 371 78
IPD103lib123reary-01 SEQ ID NO: 184 SEQ ID NO: 372 94
IPD103lib123reary-05 SEQ ID NO: 185 SEQ ID NO: 373 85
IPD103lib123reary-07 SEQ ID NO: 186 SEQ ID NO: 374 82
IPD103lib123reary-11 SEQ ID NO: 187 SEQ ID NO: 375 75
IPD103lib123reary-14 SEQ ID NO: 188 SEQ ID NO: 376 87
IPD103lib123reary-15 SEQ ID NO: 189 SEQ ID NO: 377 81
IPD103lib123reary-16 SEQ ID NO: 190 SEQ ID NO: 378 76
IPD103lib123reary-17 SEQ ID NO: 191 SEQ ID NO: 379 88
IPD103lib123reary-18 SEQ ID NO: 192 SEQ ID NO: 380 80
IPD103lib123reary-19 SEQ ID NO: 193 SEQ ID NO: 381 84
IPD103lib123reary-23 SEQ ID NO: 194 SEQ ID NO: 382 90
IPD103lib123reary-27 SEQ ID NO: 195 SEQ ID NO: 383 86
IPD103lib123reary-28 SEQ ID NO: 196 SEQ ID NO: 384 96
IPD103lib123reary-29 SEQ ID NO: 197 SEQ ID NO: 385 83
IPD103lib123reary-30 SEQ ID NO: 198 SEQ ID NO: 386 86
IPD103lib123reary-31 SEQ ID NO: 199 SEQ ID NO: 387 76
IPD103lib123reary-32 SEQ ID NO: 200 SEQ ID NO: 388 74
IPD103lib123reary-34 SEQ ID NO: 201 SEQ ID NO: 389 82
IPD103lib123reary-37 SEQ ID NO: 202 SEQ ID NO: 390 79
IPD103lib123reary-38 SEQ ID NO: 203 SEQ ID NO: 391 75
IPD103lib123reary-39 SEQ ID NO: 204 SEQ ID NO: 392 97
IPD103lib123reary-40 SEQ ID NO: 205 SEQ ID NO: 393 76
IPD103lib123reary-41 SEQ ID NO: 206 SEQ ID NO: 394 76
IPD103lib123reary-42 SEQ ID NO: 207 SEQ ID NO: 395 96
IPD103lib123reary-45 SEQ ID NO: 208 SEQ ID NO: 396 76
IPD103lib123reary-46 SEQ ID NO: 209 SEQ ID NO: 397 78
IPD103lib123reary-47 SEQ ID NO: 210 SEQ ID NO: 398 91
IPD103lib123reary-48 SEQ ID NO: 211 SEQ ID NO: 399 92
IPD103lib123reary-49 SEQ ID NO: 212 SEQ ID NO: 400 73
IPD103lib123reary-52 SEQ ID NO: 213 SEQ ID NO: 401 81
IPD103lib123reary-54 SEQ ID NO: 214 SEQ ID NO: 402 85
IPD103lib123reary-55 SEQ ID NO: 215 SEQ ID NO: 403 76
IPD103lib123reary-58 SEQ ID NO: 216 SEQ ID NO: 404 87
IPD103lib123reary-59 SEQ ID NO: 217 SEQ ID NO: 405 73
IPD103lib123reary-60 SEQ ID NO: 218 SEQ ID NO: 406 81
IPD103lib123reary-62 SEQ ID NO: 219 SEQ ID NO: 407 74
IPD103lib123reary-63 SEQ ID NO: 220 SEQ ID NO: 408 88
IPD103lib123reary-65 SEQ ID NO: 221 SEQ ID NO: 409 76
IPD103lib123reary-67 SEQ ID NO: 222 SEQ ID NO: 410 90
IPD103lib123reary-68 SEQ ID NO: 223 SEQ ID NO: 411 75
IPD103lib123reary-69 SEQ ID NO: 224 SEQ ID NO: 412 73
IPD103lib123reary-70 SEQ ID NO: 225 SEQ ID NO: 413 90
IPD103lib123reary-72 SEQ ID NO: 226 SEQ ID NO: 414 73
IPD103lib123reary-73 SEQ ID NO: 227 SEQ ID NO: 415 74
IPD103lib123reary-77 SEQ ID NO: 228 SEQ ID NO: 416
TABLE-US-00008 TABLE 8 % Identity to IPD103Aa # of Unique (SEQ ID
NO: 2) Sequences Variants 98 4 IPD103lib11reary-19,
IPD103lib11reary-41, IPD103-11Reary-14, IPD103-11Reary-25 97 2
IPD103lib123reary-40, IPD103lib11reary-18 96 10
IPD103lib123reary-29, IPD103lib123reary-45, IPD103lib11reary-15,
IPD103lib11reary-40, IPD103lib11reary-55, IPD103lib11reary-66,
IPD103lib11reary-73, IPD103lib11reary-79, IPD103lib11reary-88,
IPD103-11Reary-37 95 8 IPD103lib11reary-07, IPD103lib11reary-44,
IPD103lib11reary-50, IPD103lib11reary-65, IPD103lib11reary-69,
IPD103-11Reary-16, IPD103-11Reary-29, IPD103-11Reary-34 94 12
IPD103lib123reary-05, IPD103lib11reary-21, IPD103lib11reary-39,
IPD103lib11reary-67, IPD103lib11reary-87, IPD103-11Reary-09,
IPD103-11Reary-13, IPD103-11Reary-22, IPD103- 11Reary-33,
IPD103-11Reary-43, IPD103-11Reary-45, IPD103-123Reary-05 93 11
IPD103lib11reary-08, IPD103lib11reary-12, IPD103lib11reary-13,
IPD103lib11reary-34, IPD103lib11reary-58, IPD103lib11reary-68,
IPD103lib11reary-70, IPD103lib11reary-85, IPD103-11Reary-17,
IPD103-123Reary-12, IPD103-123Reary-33 92 21 IPD103lib123reary-49,
IPD103lib11reary-16, IPD103lib11reary-23, IPD103lib11reary-25,
IPD103lib11reary-27, IPD103lib11reary-31, IPD103lib11reary-35,
IPD103lib11reary-52, IPD103lib11reary-56, IPD103lib11reary-59,
IPD103-11Reary-01, IPD103-11Reary-05, IPD103- 11Reary-06,
IPD103-11Reary-10, IPD103-11Reary-18, IPD103-11Reary-35,
IPD103-11Reary- 36, IPD103-11Reary-40, IPD103-11Reary-42,
IPD103-123Reary-07, IPD103-123Reary-26 91 17 IPD103lib123reary-48,
IPD103lib11reary-17, IPD103lib11reary-29, IPD103lib11reary-32,
IPD103lib11reary-42, IPD103lib11reary-45, IPD103lib11reary-51,
IPD103lib11reary-53, IPD103lib11reary-63, IPD103lib11reary-64,
IPD103lib11reary-80, IPD103lib11reary-82, IPD103-11Reary-11,
IPD103-11Reary-21, IPD103-11Reary-24, IPD103-11Reary-44, IPD103-
123Reary-31 90 16 IPD103lib123reary-27, IPD103lib123reary-68,
IPD103lib123reary-72, IPD103lib11reary-10, IPD103lib11reary-14,
IPD103lib11reary-20, IPD103lib11reary-28, IPD103lib11reary-49,
IPD103lib11reary-62, IPD103-11Reary-04, IPD103-11Reary-15,
IPD103-11Reary-20, IPD103- 11Reary-32, IPD103-123Reary-11,
IPD103-123Reary-16, IPD103-123Reary-30 89 20 IPD103lib11reary-03,
IPD103lib11reary-09, IPD103lib11reary-11, IPD103lib11reary-30,
IPD103lib11reary-33, IPD103lib11reary-46, IPD103lib11reary-48,
IPD103lib11reary-54, IPD103lib11reary-74, IPD103lib11reary-75,
IPD103lib11reary-86, IPD103-11Reary-08, IPD103- 11Reary-19,
IPD103-11Reary-31, IPD103-11Reary-46, IPD103-123Reary-01,
IPD103-123Reary- 02, IPD103-123Reary-10, IPD103-123Reary-14,
IPD103-123Reary-38 88 11 IPD103lib123reary-18,
IPD103lib123reary-65, IPD103lib11reary-38, IPD103lib11reary-47,
IPD103lib11reary-76, IPD103lib11reary-78, IPD103-11Reary-26,
IPD103-11Reary-39, IPD103- 123Reary-06, IPD103-123Reary-18,
IPD103-123Reary-37 87 7 IPD103lib123reary-15, IPD103lib123reary-59,
IPD103lib11reary-01, IPD103lib11reary-22, IPD103-11Reary-38,
IPD103-123Reary-13, IPD103-123Reary-35 86 4 IPD103lib123reary-28,
IPD103lib123reary-31, IPD103lib11reary-43, IPD103-11Reary-41 85 5
IPD103lib123reary-55, IPD103lib123reary-07, IPD103lib11reary-83,
IPD103-123Reary-22, IPD103-123Reary-34 84 3 IPD103lib123reary-23,
IPD103-123Reary-15, IPD103-123Reary-32 83 1 IPD103lib123reary-30 82
4 IPD103lib123reary-11, IPD103lib123reary-37, IPD103-123Reary-09,
IPD103-123Reary-25 81 5 IPD103lib123reary-16, IPD103lib123reary-54,
IPD103lib123reary-62, IPD103-123Reary-17, IPD103-123Reary-19 80 1
IPD103lib123reary-19 79 2 IPD103lib123reary-38, IPD103-123Reary-28
78 3 IPD103lib123reary-47, IPD103lib123reary-01, IPD103-123Reary-21
77 1 IPD103-123Reary-23 76 8 IPD103lib123reary-17,
IPD103lib123reary-32, IPD103lib123reary-41, IPD103lib123reary-42,
IPD103lib123reary-46, IPD103lib123reary-58, IPD103lib123reary-67,
IPD103-123Reary-08 75 5 IPD103lib123reary-14, IPD103lib123reary-39,
IPD103lib123reary-69, IPD103-123Reary-24, IPD103-123Reary-40 74 3
IPD103lib123reary-34, IPD103lib123reary-63, IPD103lib123reary-77 73
4 IPD103lib123reary-52, IPD103lib123reary-60, IPD103lib123reary-70,
IPD103lib123reary-73
Example 9--Vector Constructs for Expression of IPD103 Polypeptides
in Plants
[0401] For testing in maize, expression vectors PHP79658, PHP70659,
and PHP7600 were constructed to include a transgene cassette
containing one of three different gene designs encoding IPD103Aa
(SEQ ID NO: 2), the MMV ENH:MMV ENH:BYDV promoter (U.S. Ser. No.
62/260,819), linked to the PINII terminator (US-2014-0130205).
Example 10--Expression and Insect Bioassay on Transient Leaf
Tissues
[0402] To confirm activity of IPD103Aa (SEQ ID NO: 2) and IPD103Ab
(SEQ ID NO: 4) the corresponding genes were cloned into a transient
expression system under control of the viral promoter dMMV or
AtUBQ10 promoter (Dey, et. al., (1999) Plant Mol. Biol. 40:771-782;
PCT Patent Publication WO2011133387; Norris S R et al (1993) Plant
Mol Biol. 21(5):895-906)). The constructs were infiltrated into
leaves. The agro-infiltration method of introducing an
Agrobacterium cell suspension to plant cells of intact tissues so
that reproducible infection and subsequent plant derived transgene
expression may be measured or studied is well known in the art
(Kapila, et. al., (1997) Plant Science 122:101-108). Briefly, the
unifoliate stage of bush bean (common bean, Phaseolus vulgaris) or
soybean (Glycine max), were agro-infiltrated with normalized
bacterial cell cultures of test and control strains. Leaf discs
were excised from each plantlet and infested with neonates of Soy
Bean Looper (SBL) (Pseudoplusia includens), Corn Earworm, (CEW)
(Helicoverpa zea), [FAW], Velvet Bean Caterpillar (VBC) (Anticarsia
gemmatalis) or European Corn Borer (ECB) (Ostrinia nubialis). Leaf
discs from a control were generated with Agrobacterium containing
only empty expression vector. Leaf discs from a non-infiltrated
plant were used as a second control. The consumption of green leaf
tissue was scored after two (CEW, VBC), three (SBL) or four (ECB)
days after infestation and given scores of 0 to 9 as indicated by
Table 9. The transiently expressed IPD103Aa (SEQ ID NO: 2) and
homologs protected bush bean leaf discs from consumption by the
infested insects while total green tissue consumption was observed
for the negative control and untreated tissue. Transient protein
expression of IPD103Aa (SEQ ID NO: 2) and IPD103Ab (SEQ ID NO: 4)
were confirmed by a mass spectrometry-based protein identification
method using extracted protein lysates from infiltrated leave
tissues (Patterson, (1998) 10(22):1-24, Current Protocol in
Molecular Biology published by John Wiley & Son Inc). As shown
in Table 10, IPD103Aa (SEQ ID NO: 2) and all the homologs tested
resulted in protection of bush bean against leaf feeding damage
from a diversity of Lepidoptera. A selection of IPD103 R10 mutants
described in Table 5 were also transiently expressed in bush bean
and shown to be active against Lepidoptera (Table 11). Larval
feeding damage to soybean leaves transiently expressing
insecticidal genes under the control of the viral promoter dMMV
(Dey, et. al., (1999) Plant Mol. Biol. 40:771-782) was assessed
using a scale described in Table 9. The effect of expression of
IPD103 proteins was compared to non-agro-infiltrated controls and
controls expressing DsRed2 fluorescence marker (Clontech, Mountain
View, Calif.). Activity of selected IPD103 polypeptides,
transiently expressed in bush bean, against leaf feeding damage
from a selection of Lepidoptera is shown in Table 10. The average
score and standard error (SE) for 6 replicate measurements are
shown.
[0403] Activity of selected IPD103Aa R10 variants, transiently
expressed in bush bean, against leaf feeding damage from a
selection of Lepidoptera is shown in Table 11.
[0404] Activity of selected IPD103Aa polypeptides, transiently
expressed in Soybean, against leaf feeding damage from a selection
of Lepidoptera is shown in Table 12 The average leaf feeding score
and standard deviation (StdDev) for 12 replicates/treatment is
shown.
TABLE-US-00009 TABLE 9 Leaf Feeding Score % Consumed 1 86-100 2
71-85 3 61-70 4 51-60 5 36-50 6 11-35 7 11-36 8 1-3 9 0
TABLE-US-00010 TABLE 10 Avg. Avg. Avg. Leaf Leaf Leaf Target Damage
Target Damage Target Damage Gene Insect Score SE Insect Score SE
Insect Score SE IPD103Aa SEQ ID NO: 2 CEW 7.7 0.3 ECB 5.2 1.1 FAW
4.7 0.4 IPD103Ac SEQ ID NO: 6 7.5 0.3 6.7 0.7 4.8 0.7 IPD103Ad SEQ
ID NO: 8 8.2 0.3 3.2 1.2 4.5 0.3 IPD103Ae SEQ ID NO: 10 7.3 0.3 2.0
0.7 3.8 0.7 IPD103Ba SEQ ID NO: 12 6.0 0.4 1.8 0.5 3.2 0.2 IPD103Bb
SEQ ID NO: 14 6.3 0.4 5.8 0.2 3.7 0.2 IPD103Bc SEQ ID NO: 16 7.0
0.6 3.2 1.4 3.7 0.2 IPD103Bd SEQ ID NO: 18 7.7 0.3 7 .5 0.3 5.7 0.3
IPD103Be SEQ ID NO: 20 7.7 0.3 5.8 0.8 5.5 0.4 IPD103Bf SEQ ID NO:
22 7.3 0.6 6.2 0.7 4.3 0.6 IPD103Bg SEQ ID NO: 24 8.0 0.4 4.2 1.2
4.2 0.6 IPD103Bh SEQ ID NO: 26 8.0 0.4 6.5 1.2 6.0 0.8 IPD103Ca SEQ
ID NO: 34 6.0 0.8 3.8 1.5 3.0 0.4 IPD103Da SEQ ID NO: 36 6.3 0.3
3.3 1.1 3.5 0.3 Negative Control 3.7 1.1 2.3 1.3 2.2 0.2 Untreated
3.5 0.4 1.2 0.2 2.8 0.3 IPD103Aa SEQ ID NO: 2 SBL 6.0 0.4 VBC 8.0
0.0 IPD103Ac SEQ ID NO: 6 5.2 0.2 8.0 0.0 IPD103Ad SEQ ID NO: 8 6.0
0.3 8.2 0.2 IPD103Ae SEQ ID NO: 10 6.0 0.4 8.2 0.2 IPD103Ba SEQ ID
NO: 12 4.3 0.3 5.7 0.7 IPD103Bb SEQ ID NO: 14 3.8 0.3 6.7 0.4
IPD103Bc SEQ ID NO: 16 5.3 0.9 6.5 0.2 IPD103Bd SEQ ID NO: 18 6.0
0.4 8.0 0.0 IPD103Be SEQ ID NO: 20 5.3 0.2 7.8 0.2 IPD103Bf SEQ ID
NO: 22 4.5 0.3 7.7 0.2 IPD103Bg SEQ ID NO: 24 5.7 0.6 7.8 0.2
IPD103Bh SEQ ID NO: 26 5.3 0.4 8.5 0.2 IPD103Ca SEQ ID NO: 34 3.8
0.4 4.8 1.3 IPD103Da SEQ ID NO: 36 4.5 0.5 7.2 0.5 Negative Control
3.3 0.3 1.0 0.0 Untreated 4.0 0.7 2.7 1.1
TABLE-US-00011 TABLE 11 SEQ ID SBL FAW CEW ECB IPD103-R10Y SEQ ID
NO: 452 - + + - IPD103-R10T SEQ ID NO: 453 + + + + IPD103-R10A SEQ
ID NO: 454 + + + + IPD103-R10M SEQ ID NO: 455 + + + + IPD103-R10S
SEQ ID NO: 456 + + + + IPD103lib11reary-54 SEQ ID NO: 345 + + + +
IPD103Be SEQ ID NO: 20 + + + + IPD103Aa SEQ ID NO: 2 + - + + Empty
- - - -
TABLE-US-00012 TABLE 12 CEW SBL VBC SEQ ID NO Avg. Score Std. DEV
Avg. Score Avg. Score IPD103Aa SEQ ID NO: 2 7.8 0.5 7.8 0.8 7.2 0.7
IPD103Bc SEQ ID NO: 16 7.8 0.7 6.3 0.7 6.0 1.3 IPD103Bd SEQ ID NO:
18 8.2 0.4 7.8 0.6 6.8 1.8 IPD103Be SEQ ID NO: 20 6.8 0.6 6.7 0.8
6.4 1.2 IPD103Bh SEQ ID NO: 26 8.0 0.4 7.8 0.6 6.7 2.1 IPD103Da SEQ
ID NO: 36 2.0 1.6 4.4 1.6 1.3 0.7 DsRed control 1.0 0.0 1.3 0.5 1.0
0.0 Neg. control 1.0 0.0 1.7 1.5 1.2 0.4
Example 11--Agrobacterium-Mediated Transformation of Maize and
Regeneration of Transgenic Plants
[0405] For Agrobacterium-mediated transformation of maize with
IPD103Aa nucleotide sequences the method of Zhao was used (U.S.
Pat. No. 5,981,840 and POT Patent Publication Number WO 1998/32326;
the contents of which are hereby incorporated by reference).
Briefly, immature embryos were isolated from maize and the embryos
contacted with a suspension of Agrobacterium under conditions
whereby the bacteria are capable of transferring the PHP79658,
PHP70659, and PHP7600 vectors to at least one cell of at least one
of the immature embryos (step 1: the infection step). In this step
the immature embryos were immersed in an Agrobacterium suspension
for the initiation of inoculation. The embryos were co-cultured for
a time with the Agrobacterium (step 2: the co-cultivation step).
The immature embryos were cultured on solid medium following the
infection step. Following this co-cultivation period an optional
"resting" step is contemplated. In this resting step, the embryos
were incubated in the presence of at least one antibiotic known to
inhibit the growth of Agrobacterium without the addition of a
selective agent for plant transformation (step 3: resting step).
The immature embryos were cultured on solid medium with antibiotic,
but without a selecting agent, for elimination of Agrobacterium and
for a resting phase for the infected cells. Next, inoculated
embryos were cultured on medium containing a selective agent and
growing transformed callus is recovered (step 4: the selection
step). The immature embryos were cultured on solid medium with a
selective agent resulting in the selective growth of transformed
cells. The callus was then regenerated into plants (step 5: the
regeneration step), and calli grown on selective medium or cultured
on solid medium to regenerate the plants.
[0406] For detection of the IPD103 proteins in leaf tissue 4
lyophilized leaf punches/sample were pulverized and resuspended in
100 .mu.L PBS containing 0.1% Tween 20 (PBST), 1%
beta-mercaoptoethanol containing 1 tablet/7 mL complete Mini
proteinase inhibitor (Roche 1183615301). The suspension was
sonicated for 2 min and then centrifuged at 4.degree. C., 20,000 g
for 15 min. To a supernatant aliquot 1/3 volume of 3.times.
NuPAGE.RTM. LDS Sample Buffer (Invitrogen.TM. (CA, USA), 1% B-ME
containing 1 tablet/7 mL complete Mini proteinase inhibitor was
added. The reaction was heated at 80.degree. C. for 10 min and then
centrifuged. A supernatant sample was loaded on 4-12% Bis-Tris Midi
gels with MES running buffer as per manufacturer's (Invitrogen.TM.)
instructions and transferred onto a nitrocellulose membrane using
an iBlot.RTM. apparatus (Invitrogen.TM.). The nitrocellulose
membrane was incubated in PBST containing 5% skim milk powder for 2
hours before overnight incubation in affinity-purified rabbit
anti-IPD103Aa polyclonal antibody in PBST overnight. The membrane
was rinsed three times with PBST and then incubated in PBST for 15
min and then two times 5 min before incubating for 2 hours in PBST
with goat anti-rabbit-HRP for 3 hours. The detected proteins were
visualized using ECL Western Blotting Reagents (GE Healthcare cat
#RPN2106) and visualized using a luminescent image analyzer
(ImageQuant LAS 4000, GE Healthcare Transgenic maize plants
positive for expression of the insecticidal proteins are tested for
pesticidal activity using standard bioassays known in the art. Such
methods include, for example, whole plant bioassays.
Example 12--Particle Bombardment Transformation and Regeneration of
Transgenic Maize Plants
[0407] Immature maize embryos from greenhouse donor plants are
bombarded with a plasmid containing a nucleotide sequence encoding
the insecticidal protein. The ears are husked and surface
sterilized in 30% Clorox.RTM. bleach plus 0.5% Micro detergent for
20 minutes and rinsed two times with sterile water. The immature
embryos are excised and placed embryo axis side down (scutellum
side up), 25 embryos per plate, on 560Y medium for 4 hours and then
aligned within the 2.5 cm target zone in preparation for
bombardment. A plasmid vector DNA comprising the nucleotide
sequence encoding the insecticidal protein operably linked to a
promoter is precipitated onto 1.1 .mu.m (average diameter) tungsten
pellets using a CaCl.sub.2 precipitation procedure as follows: 100
.mu.l prepared tungsten particles in water; 10 .mu.l (1 pg) DNA in
Tris EDTA buffer (1 .mu.g total DNA); 100 .mu.l 2.5 M CaCl.sub.2
and 10 .mu.l 0.1 M spermidine.
[0408] Each reagent is added sequentially to the tungsten particle
suspension, while maintained on the multitube vortexer. The final
mixture is sonicated briefly and allowed to incubate under constant
vortexing for 10 minutes. After the precipitation period, the tubes
are centrifuged briefly, liquid removed, washed with 500 ml 100%
ethanol and centrifuged for 30 seconds. Again the liquid is
removed, and 105 .mu.l 100% ethanol is added to the final tungsten
particle pellet. For particle gun bombardment, the tungsten/DNA
particles are briefly sonicated and 10 .mu.l spotted onto the
center of each macrocarrier and allowed to dry about 2 minutes
before bombardment. The sample plates are bombarded at level #4 in
a particle gun. All samples receive a single shot at 650 PSI, with
a total of ten aliquots taken from each tube of prepared
particles/DNA
[0409] Following bombardment, the embryos are kept on 560Y medium
for 2 days, then transferred to 560R selection medium containing 3
mg/liter Bialaphos, and subcultured every 2 weeks. After
approximately 10 weeks of selection, selection-resistant callus
clones are transferred to 288J medium to initiate plant
regeneration. Following somatic embryo maturation (2-4 weeks),
well-developed somatic embryos are transferred to medium for
germination and transferred to the lighted culture room.
Approximately 7-10 days later, developing plantlets are transferred
to 272V hormone-free medium in tubes for 7-10 days until plantlets
are well established. Plants are then transferred to inserts in
flats (equivalent to 2.5'' pot) containing potting soil and grown
for 1 week in a growth chamber, subsequently grown an additional
1-2 weeks in the greenhouse, then transferred to classic 600 pots
(1.6 gallon) and grown to maturity. Plants are monitored and scored
for expression of an IPD103 polypeptide by assays known in the art,
such as, for example, immunoassays and Western blotting.
[0410] Transgenic maize plants positive for expression of the
insecticidal proteins are tested for pesticidal activity using
standard bioassays known in the art. Such methods include, for
example, root excision bioassays and whole plant bioassays. See,
e.g., US Patent Application Publication Number US 2003/0120054 and
International Publication Number WO 2003/018810.
[0411] Bombardment medium (560Y) comprises 4.0 g/l N6 basal salts
(SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix
(1000.times.SIGMA-1511), 0.5 mg/l thiamine HCl, 120.0 g/l sucrose,
10.0 mg/l 2,4-D and 2.88 g/l L-proline (brought to volume with D-I
H.sub.2O following adjustment to pH 5.8 with KOH); 2.0 g/l Gelrite
(added after bringing to volume with D-I H.sub.2O) and 8.5 mg/l
silver nitrate (added after sterilizing the medium and cooling to
room temperature). Selection medium (560R) comprises 4.0 g/l N6
basal salts (SIGMA C-1416), 1.0 ml/l Eriksson's Vitamin Mix
(1000.times.SIGMA-1511), 0.5 mg/l thiamine HCl, 30.0 g/l sucrose
and 2.0 mg/l 2,4-D (brought to volume with D-I H.sub.2O following
adjustment to pH 5.8 with KOH); 3.0 g/l Gelrite (added after
bringing to volume with D-I H.sub.2O) and 0.85 mg/l silver nitrate
and 3.0 mg/l bialaphos (both added after sterilizing the medium and
cooling to room temperature).
[0412] Plant regeneration medium (288J) comprises 4.3 g/l MS salts
(GIBCO 1 1 1 17-074), 5.0 ml/l MS vitamins stock solution (0.100 g
nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l pyridoxine HCL, and
0.40 g/l glycine brought to volume with polished D-I H.sub.2O)
(Murashige and Skoog, (1962) Physiol. Plant. 15:473), 100 mg/l
myo-inositol, 0.5 mg/l zeatin, 60 g/l sucrose and 1.0 ml/l of 0.1
mM abscisic acid (brought to volume with polished D-I H.sub.2O
after adjusting to pH 5.6); 3.0 g/l Gelrite (added after bringing
to volume with D-I H.sub.2O) and 1.0 mg/l indoleacetic acid and 3.0
mg/l bialaphos (added after sterilizing the medium and cooling to
60.degree. C.). Hormone-free medium (272V) comprises 4.3 g/l MS
salts (GIBCO 1 1 1 17-074), 5.0 m/l MS vitamins stock solution
(0.100 g/l nicotinic acid, 0.02 g/l thiamine HCL, 0.10 g/l
pyridoxine HCL and 0.40 g/l glycine brought to volume with polished
D-I H.sub.2O), 0.1 g/l myoinositol and 40.0 g/l sucrose (brought to
volume with polished D-I H.sub.2O after adjusting pH to 5.6) and 6
g/l bacto-agar (added after bringing to volume with polished D-I
H.sub.2O), sterilized and cooled to 60.degree. C.
Example 13--Insect Control Efficacy of Stable Transformed Corn
Plants Against a Spectrum of Lepidopteran Insects
[0413] Leaf discs were excised from transformed maize plants and
tested for insecticidal activity of IPD103Aa polypeptides against
the European Corn Borer (ECB) (Ostrinia nubilalis), Corn Earworm,
(CEW) (Helicoverpa zea), and Fall Armyworm (Spodoptera frugiperda).
The constructs, PHP79658, PHP79559 and PHP79660 for the expression
of three IPD103Aa gene designs were used to generate transgenic
maize events to test for efficacy against feeding damage caused by
lepidopteran pests provided by expression of these polypeptides.
FIG. 2 demonstrates that strong protection from leaf feeding by a
broad spectrum of Lepidoptera pests was conferred by expression of
IPD103Aa genes.
Example 14--Greenhouse Efficacy of IPD103 Polypeptide Events
[0414] TO greenhouse efficacy results for events generated from
PHP79658, PHP79659 and PHP79660 constructs are shown in FIG. 4.
Efficacy for events derived from all 3 constructs was observed
relative to negative control events (Empty) as measured by corn ear
protection from corn earworm (CEW). Ear protection was measured,
using a grid, as the number of square centimeters (CEWSCM) of ear
feeding damage. FIG. 4 shows that a large proportion of events from
PHP79658, PHP79659 and PHP79660 performed better than the negative
control and have earworm injury scores of 2 cm.sup.2 or less
Example 15--Transformation and Regeneration of Soybean (Glycine
max)
[0415] Transgenic soybean lines are generated by the method of
particle gun bombardment (Klein et al., Nature (London) 327:70-73
(1987); U.S. Pat. No. 4,945,050) using a BIORAD Biolistic
PDS1000/He instrument and either plasmid or fragment DNA. The
following stock solutions and media are used for transformation and
regeneration of soybean plants:
Stock Solutions:
[0416] Sulfate 100.times. Stock:
[0417] 37.0 g MgSO.sub.4.7H.sub.2O, 1.69 g MnSO.sub.4.H.sub.2O,
0.86 g ZnSO.sub.4.7H.sub.2O, 0.0025 g CuSO.sub.4.5H.sub.2O
[0418] Halides 100.times. Stock:
[0419] 30.0 g CaCl.sub.2.2H.sub.2O, 0.083 g KI, 0.0025 g
CoCl.sub.2.6H.sub.2O
[0420] P, B, Mo 100.times. Stock:
[0421] 18.5 g KH.sub.2PO.sub.4, 0.62 g H.sub.3BO.sub.3, 0.025 g
Na.sub.2MoO.sub.4.2H.sub.2O
[0422] Fe EDTA 100.times. Stock:
[0423] 3.724 g Na.sub.2EDTA, 2.784 g FeSO.sub.4.7H.sub.2O
[0424] 2,4-D Stock:
[0425] 10 mg/mL Vitamin
[0426] B5 vitamins, 1000.times. Stock:
[0427] 100.0 g myo-inositol, 1.0 g nicotinic acid, 1.0 g pyridoxine
HCl, 10 g thiamine.HCL.
Media (Per Liter):
[0428] SB199 Solid Medium: [0429] 1 package MS salts
(Gibco/BRL--Cat. No. 11117-066), 1 mL B5 vitamins 1000.times.
stock, 30 g Sucrose, 4 ml 2, 4-D (40 mg/L final concentration), pH
7.0, 2 g Gelrite
[0430] SB1 Solid Medium: [0431] 1 package MS salts (Gibco/BRL--Cat.
No. 11117-066), 1 mL B5 vitamins 1000.times. stock, 31.5 g Glucose,
2 mL 2, 4-D (20 mg/L final concentration), pH 5.7, 8 g TC agar
[0432] SB196: [0433] 10 mL of each of the above stock solutions
1-4, 1 mL B5 Vitamin stock, 0.463 g (NH4)2 SO4, 2.83 g KNO3, 1 mL
2,4 D stock, 1 g asparagine, 10 g Sucrose, pH 5.7
[0434] SB71-4: [0435] Gamborg's B5 salts, 20 g sucrose, 5 g TC
agar, pH 5.7.
[0436] SB103: [0437] 1 pk. Murashige & Skoog salts mixture, 1
mL B5 Vitamin stock, 750 mg MgCl2 hexahydrate, 60 g maltose, 2 g
gelrite, pH 5.7.
[0438] SB166: [0439] SB103 supplemented with 5 g per liter
activated charcoal.
Soybean Embryogenic Susoension Culture Initiation:
[0440] Pods with immature seeds from available soybean plants 45-55
days after planting are picked, removed from their shells and
placed into a sterilized magenta box. The soybean seeds are
sterilized by shaking them for 15 min in a 5% Clorox solution with
1 drop of ivory soap (i.e., 95 mL of autoclaved distilled water
plus 5 mL Clorox and 1 drop of soap, mixed well). Seeds are rinsed
using 2, 1-liter bottles of sterile distilled water and those less
than 3 mm are placed on individual microscope slides. The small end
of the seed is cut and the cotyledons pressed out of the seed coat.
Cotyledons are transferred to plates containing SB199 medium (25-30
cotyledons per plate) for 2 weeks, then transferred to SB1 for 2-4
weeks. Plates are wrapped with fiber tape. After this time,
secondary embryos are cut and placed into SB196 liquid medium for 7
days.
Culture Conditions:
[0441] Soybean embryogenic suspension cultures (cv. 93Y21) were
maintained in 50 mL liquid medium SB196 on a rotary shaker, 100-150
rpm, 26.degree. C. on 16:8 h day/night photoperiod at light
intensity of 80-100 .mu.E/m2/s. Cultures are subcultured every 7-14
days by inoculating up to 1/2 dime size quantity of tissue (clumps
bulked together) into 50 mL of fresh liquid SB196.
Preparation of DNA for Bombardment:
[0442] In particle gun bombardment procedures it is possible to use
purified 1) entire plasmid DNA; or 2) DNA fragments containing only
the recombinant DNA expression cassette(s) of interest. For every
seventeen bombardment transformations, 85 .mu.L of suspension is
prepared containing 1 to 90 picograms (pg) of plasmid DNA per base
pair of each DNA plasmid. DNA plasmids or fragments are
co-precipitated onto gold particles as follows. The DNAs in
suspension are added to 50 .mu.L of a 10-60 mg/mL 0.6 .mu.m gold
particle suspension and then combined with 50 .mu.L CaCl.sub.2 (2.5
M) and 20 .mu.L spermidine (0.1 M). The mixture is vortexed for 5
sec, spun in a microfuge for 5 sec, and the supernatant removed.
The DNA-coated particles are then washed once with 150 .mu.L of
100% ethanol, vortexed and spun in a microfuge again, then
resuspended in 85 .mu.L of anhydrous ethanol. Five .mu.L of the
DNA-coated gold particles are then loaded on each macrocarrier
disk.
Tissue Preparation and Bombardment with DNA:
[0443] Approximately 100 mg of two-week-old suspension culture is
placed in an empty 60 mm.times.15 mm petri plate and the residual
liquid removed from the tissue using a pipette. The tissue is
placed about 3.5 inches away from the retaining screen and each
plate of tissue is bombarded once. Membrane rupture pressure is set
at 650 psi and the chamber is evacuated to -28 inches of Hg.
Following bombardment, the tissue from each plate is divided
between two flasks, placed back into liquid media, and cultured as
described above.
Selection of Transformed Embryos and Plant Regeneration:
[0444] After bombardment, tissue from each bombarded plate is
divided and placed into two flasks of SB196 liquid culture
maintenance medium per plate of bombarded tissue. Seven days post
bombardment, the liquid medium in each flask is replaced with fresh
SB196 culture maintenance medium supplemented with 100 ng/mL
selective agent (selection medium). For selection of transformed
soybean cells the selective agent used can be a sulfonylurea (SU)
compound with the chemical name, 2-chloro-N-((4-methoxy-6
methy-1,3,5-triazine-2-yl)aminocarbonyl) benzenesulfonamide (common
names: DPX-W4189 and Chlorsulfuron). Chlorsulfuron is the active
ingredient in the DuPont sulfonylurea herbicide, GLEAN.RTM.. The
selection medium containing SU is replaced every two weeks for 8
weeks. After the 8 week selection period, islands of green,
transformed tissue are observed growing from untransformed,
necrotic embryogenic clusters. These putative transgenic events are
isolated and kept in SB196 liquid medium with SU at 100 ng/mL for
another 5 weeks with media changes every 1-2 weeks to generate new,
clonally propagated, transformed embryogenic suspension cultures.
Embryos spend a total of around 13 weeks in contact with SU.
Suspension cultures are subcultured and maintained as clusters of
immature embryos and also regenerated into whole plants by
maturation and germination of individual somatic embryos.
[0445] Somatic embryos became suitable for germination after four
weeks on maturation medium (1 week on SB166 followed by 3 weeks on
SB103). They are then removed from the maturation medium and dried
in empty petri dishes for up to seven days. The dried embryos are
then planted in SB71-4 medium where they are allowed to germinate
under the same light and temperature conditions as described above.
Germinated embryos are transferred to potting medium and grown to
maturity for seed production.
Example 16--Testing Cross-Resistance of Cry1Ab and Cry1F-Selected
European Corn Borer
[0446] To determine if Cry1Ab or Cry1F-resistant insects were
cross-resistant to N-6.times. His-IPD103Aa (SEQ ID NO: 40),
European corn borer (ECB, Ostrinia nubilalis) larvae susceptible or
resistant to Cry1Ab (Crespo A. et al., Pest Manag Sci 65:
1071-1081, 2009) or Cry1F (Siegfried B. et al., Pest Manag Sci 70:
725-733, 2014), were treated with N-6.times. His-IPD103Aa (SEQ ID
NO: 40). The laboratory Cry1F-selected strain (Cry1F-R) originated
from a combination of five field populations collected in 2007 and
was selected for resistance using increasing amounts of lyophilized
leaf tissue of Cry1F-expressing maize (Alves, A, US 2012/0148497
A1, 2012).
[0447] Larval susceptibility of ECB strains resistant to Cry1Ab
(Cry1Ab-res) or Cry1F (Cry1F-res) and susceptible strains (SS) to
the insecticidal proteins was determined using a diet incorporated
bioassay method. Briefly, 25 .mu.L of a sample was mixed with 75
.mu.L of artificial diet per well in a 96-well plate. Each bioassay
included eight concentrations of the sample as well as the negative
buffer control, four replications for each concentration, and eight
individuals for each replicate. One ECB neonate larva (<24 h
after hatch) was placed in each assay well. Once infested, the
plates were sealed with Mylar and ventilation holes were added to
each well using #1 or #2 insect pins. Plates were incubated at
27.degree. C., 50% RH, and a photoperiod of 16:8 hours (L:D).
Mortality and larval growth inhibition (defined as inhibition if
larva did not enter second instar within 6 days) by each sample
were scored after a 6 day exposure. Concentrations resulting in 50%
mortality (LC50) or inhibition of 50% of the individuals (IC50)
were calculated based on Probit analysis. The resistance ratio
(RR)=(LC50 of resistant ECB)/(LC50 of susceptible ECB) was >300
fold to Cry1Ab for the Cry1A-res colony and >1000 to Cry1F for
the Cry1F-res colony. Table 13 shows that the Cry1A- or
Cry1F-resistant ECB were not cross-resistant to N-6.times.
His-IPD103Aa (SEQ ID NO: 40).
TABLE-US-00013 TABLE 13 N-6xHis-IPD103Aa (SEQ ID NO: 40) activity
against ECB resistant to Cry1A or Cry1F Lower Upper ECB 95% 95%
Resistance colony LC/IC ppm CL CL Ratio SS LC50 128.7 97.1 187.5
IC50 40.8 33.2 50 Cry1A- LC50 >256 (38% mortality) >2 res
IC50 194.5 143.3 314.9 4.8 Cry1F- LC50 ~256 ~2 res IC50 168.8 117.7
293.2 4.1
Example 17--Testing Cross-Resistance of Cry1A-Selected Diamondback
Moth
[0448] A diet overlay assay similar to the method described by Kain
et al. (J. Econ. Entomol. 97: 2073-2078, 2004) was used to
determine the susceptibility of diamondback moth (DBM, Plutella
xylostella) to N-6.times. His-IPD103Aa (SEQ ID NO: 40). Eight
concentrations of N-6.times. His-IPD103Aa (SEQ ID NO: 40) plus a
control and three cups (replications) for each concentration were
included in each bioassay with the resistant (Cry1A-res) or
susceptible DBM colony. An aliquot of 0.2 mL of IPD103Aa solution
was applied to and evenly distributed over the diet surface
(surface area 7 cm.sup.2) of 30-mL plastic cups with 5 ml of
artificial diet. Ten DBM neonates were transferred into each cup.
Cups were covered with lids and held at 27.degree. C., 50% RH, and
a photoperiod of 16:8 (L:D) h and mortality or growth inhibition
assessed after 5 days. Concentrations for 50% mortality (LC50) or
inhibition of 50% of the individuals (IC50) were calculated based
on Probit analysis. The RR was .about.100 fold with Cry1A.88 for
the Cry1A-res colony. Table 14 shows that the Cry1A resistant DBM
were not cross-resistant to N-6.times. His-IPD103Aa (SEQ ID NO:
40).
TABLE-US-00014 TABLE 14 Lower Upper DBM 95% 95% Resistance strain
LC/IC .mu.g/cm.sup.2 CL CL Ratio SS LC50 2.9 2.1 4.0 IC50 1.7 1.3
2.2 Cry1A- LC50 4.6 3.6 6.0 1.6 res IC50 1.7 1.2 2.2 1
Example 18--Site of Action of IPD103Aa
[0449] IPD103Aa (SEQ ID NO: 2) was evaluated for stability in the
presence of midgut fluid extracts from Helicoverpa zea (Corn
Earworm) and Ostrinia nubilalis (European Corn Borer) to determine
if the full length state represents pro-forms of the proteins and
whether midgut proteolysis is required for activation to a toxic
state in vivo.
[0450] The direct binding of the IPD103Aa (SEQ ID NO: 2) to
Helicoverpa zea (Corn Earworm) brush border membrane vesicles was
tested for target site identification. FIG. 4 shows the average
densitometry values for bound Alexa-IPD103Aa (SEQ ID NO: 2) in the
presence of different concentrations of unlabeled IPD103Aa (SEQ ID
NO: 2) normalized to the amount bound in the absence of unlabeled
IPD103Aa (SEQ ID NO: 2). The solid line reflects the best fit of a
square logistic equation to the data. The data are best fit by a
sigmoidal dose response equation having EC50 values of 38 nM.
[0451] The direct binding of the IPD103Aa (SEQ ID NO: 2) to
Ostrinia nubilalis (European Corn Borer) brush border membrane
vesicles was tested for target site identification. FIG. 5 shows
the average densitometry values for bound Alexa-IPD103Aa (SEQ ID
NO: 2) in the presence of different concentrations of unlabeled
IPD103Aa (SEQ ID NO: 2) normalized to the amount bound in the
absence of unlabeled IPD103Aa (SEQ ID NO: 2). The solid line
reflects the best fit of a square logistic equation to the data.
The data are best fit by a sigmoidal dose response equation having
EC50 values of 83 nM.
Example 19--Saturation Mutagenesis of IPD103Aa Variant
[0452] Saturation mutagenesis was performed at selected codons of
the IPD103 polynucleotide of SEQ ID: 157 encoding the IPD103
variant IPD103lib11reary-54 of SEQ ID: 345 (Example 8--Table 7).
Mutants were generated by site directed mutagenesis
(QuikChange.RTM. Lightning Multi Site Directed Mutagenesis Kit,
Agilent Technologies). After transforming the resulting library
variants into E. coli cells, colonies were sequence identified.
Unique clones were picked and cultured in 96-well plates for
protein expression. Cell lysates were generated by B-PER.RTM.
Protein Extraction Reagent from Thermo Scientific (3747 N Meridian
Rd, Rockford, Ill. USA 61101) and screened for CEW insecticidal
activity. Table 15 summarizes the amino acid substitutions
identified at each mutagenized position of IPD103lib11 reary-54
(SEQ ID: 345) and amino acid substitutions that retained
insecticidal activity.
TABLE-US-00015 TABLE 15 AA Position Identified substitutions Active
substitutions A 002 G, V, L, I, P, S, T, C, N, Q, D, E, K, R G, V,
L, I, P, S, T, C, N, Q, E, K, R D 003 G, A, V, L, I, W, F, P, S, T,
C, E, R G, A, V, L, I, W, F, P, S, T, C, E, R P 004 G, A, L, W, S,
Y, Q, D, E, K, R, H G, A, L, W, S, Y, Q, D, E, K, R, H A 005 G, V,
L, P, S, C, Q, D, E, K, R G, V, L, P, S, C, Q, D, E, K, R T 006 G,
A, V, L, I, P, S, N, Q, D, E, K, R G, A, V, L, I, P, S, N, Q, D, E,
K, R A 007 G, V, L, W, F, P, T, C, D, K, R G, V, L, W, F, P, T, C,
D, K, R A 008 G, L, W, P, S, T, Y, N, D, E, K, R G, L, W, P, S, T,
Y, N, D, E, K, R R 009 G, A, V, L, I, W, F, P, S, T, N, D, E G, A,
V, L, I, W, F, P, S, T, N, D, E E 010 G, A, V, L, M, W, S, K, R G,
A, V, L, M, W, S, K, R A 011 G, V, W, P, S, T, C, Y, E, K, R, H G,
V, W, P, S, T, C, Y, E, K, R, H E 012 G, V, L, W, P, S, T, Y, K, R,
H G, V, L, W, P, S, T, Y, K, R, H E 013 G, V, L, I, M, W, F, S, D,
K, R G, V, L, I, M, W, F, S, D, K, R E 014 G, A, V, L, F, S, T, C,
Y, N, Q, R G, A, V, L, F, S, T, C, Y, N, Q, R V 015 G, A, L, I, S,
Q, D, E, K, R G, A, L, I, S, Q, D, E, K, R Q 016 G, A, V, L, I, W,
F, P, S, T, D, R, H G, A, V, L, I, W, F, P, S, T, D, R, H E 017 G,
A, V, L, M, S, T, C, D, K, R G, A, V, L, M, S, T, C, D, K, R T 018
G, V, L, I, M, W, P, S, C, Q, D, E, R G, V, L, I, M, W, P, S, C, Q,
D, E, R L 019 G, A, W, F, P, S, T, C, Y, N, Q, E, K, R G, W, F, P,
S, T, C, Y, N, Q, E, K, R M 020 A, V, L, I, W, F, P, S, T, Q, D, E,
K, R, H S, T D 021 G, A, V, L, W, F, S, C, N, Q, K, R, H G, A, V,
C, N, H E 022 G, A, V, L, M, W, P, S, Y, D, R, H G, A, M, P, S, D T
023 G, A, V, L, I, M, W, P, S, N, Q, E, K, R, H V, I, S E 024 G, V,
L, M, W, P, C, Y, Q, K, R V, M, W, P, C, Q A 025 G, V, I, M, W, C,
Y, E, R G, V, I, M, C, E, R V 026 G, A, L, I, M, W, S, T, Q, D, E,
K, R, H Q G 027 A, V, L, I, M, W, P, S, C, D, K, R T 028 G, A, V,
L, I, M, W, F, C, Q, E, K, R A, V, I, M, C, Q, E H 029 G, A, V, L,
M, W, P, S, T, Y, N, Q, D, E, R V, S L 030 G, A, I, W, P, S, T, C,
N, Q, D, E, K, R, H I, P D 031 G, A, V, L, M, F, S, T, E, R, H S F
032 G, A, V, L, I, M, W, P, T, N, Q, E, R, H G, A, V, L, I, M, W,
T, N, Q, E, H V 033 G, L, M, W, F, P, S, T, C, Q, D, E, R, H G, L,
M, W, P, S, T, C, Q, E, R, H A 034 G, V, L, I, M, W, F, S, T, C, Y,
Q, E, K, R, H G, V, L, M, S, T, C, Y, Q, E, K, R, H G 035 A, V, L,
I, M, P, S, T, N, Q, D, K, R, H A, M, P, S, T, N, D L 036 G, A, M,
W, P, S, T, C, Q, D, E, R A, M E 037 G, A, V, L, M, S, N, D, K, R
G, A, V, L, M, S, N, D, K, R V 038 G, L, M, W, S, T, Q, E, K, R, H
L, K Q 039 G, A, L, P, S, C, Y, N, D, E, R A, L, C, Y, N, D, E, R P
040 G, A, V, I, M, F, S, T, C, Q, D, E, K, R A R 041 G, A, V, L, I,
M, W, F, P, S, T, C, N, D, E A, V, L, I, M, F, P, S, T, N, E K 042
G, A, V, L, M, F, P, S, T, C, Y, Q, E, R, H G, A, V, S, T, Q, E, R
V 043 G, L, I, M, W, P, S, T, E, K, R M, T I 044 G, A, V, L, M, W,
P, S, T, Y, E, K, R V, M T 045 G, A, V, L, I, W, P, S, C, Q, E, K,
R A, S, E V 046 G, A, L, F, S, C, Y, Q, E, K, R, H L, Q, H E 047 G,
V, L, M, W, F, S, N, K, R V 048 A, L, I, M, W, P, S, D, E, R, H A,
L, I, M D 049 G, A, V, L, M, W, F, P, S, Q, R, H A 050 G, V, L, M,
W, P, S, E, K, R G, V, L, M, W, P, S A 051 G, V, L, M, W, S, T, C,
Q, D, E, K, R G, V, T, C, Q A 052 G, V, L, I, M, P, S, T, C, N, Q,
D, R G, V, L, M, P, S, T, N, Q, D V 053 G, L, W, F, S, C, Y, Q, E,
K, R, H L I 054 G, A, V, L, W, S, T, C, Y, E, R, H A, V, L, W, Y Q
055 G, V, L, I, W, P, S, C, Y, E, K, R, H G, V, L, I, S, C, Y, E,
K, H Q 056 G, A, V, L, W, P, S, T, N, E, K, R G, A, L, S, T, N, E,
K, R I 057 G, A, V, L, M, W, P, S, T, Y, N, D, R V, L, T R 058 G,
A, L, M, W, P, S, T, C, Y, Q, D, K G, A, L, M, W, P, S, T, C, Y, Q,
D, K E 059 G, A, L, M, P, S, Y, N, D, K, R G, A, L, M, S, Y, N, D,
K, R I 060 G, A, V, L, M, W, S, T, N, Q, E, R, H V, L, M, W, T, N,
Q, E F 061 G, A, V, L, M, W, S, Q, E, R A, L, M, S Q 062 G, A, V,
L, M, F, P, S, T, R G, A, V, L, M, F, S, T, R T 063 G, A, V, L, P,
S, Y, N, D, E, K, R, H G, A, V, L, S, Y, N, D, E, K, R, H M 064 G,
A, L, I, W, P, S, T, N, Q, E, K, R A, L, I A 065 G, V, L, M, W, F,
S, T, Q, D, E, R, H G, V, L, M, W, F, S, T, Q, D, E, R, H R 066 G,
A, V, L, I, P, S, T, C, N, D, K, H G, A, V, I, P, S, T, C, N, D, K,
H H 067 G, A, V, L, W, F, S, C, N, K, R G, W, F, N, K F 068 G, A,
V, L, W, S, T, N, Q, K, R, H A, V, L, S, T, Q, H N 069 G, A, V, L,
M, W, F, S, Y, Q, D, E, K, R G, A, V, L, F, Y, Q, D S 070 G, W, F,
T, C, Y, N, Q, K, R G, F, T, C, Y, N, Q, K, R T 071 G, A, V, L, I,
M, W, F, P, S, Q, E, K, R A, L, I, S, Q, E, K, R R 072 G, A, V, L,
M, F, S, T, Y, Q, D, K, H G, A, V, L, M, F, S, T, Y, Q, D, K, H V
073 G, A, L, I, M, F, P, S, T, N, E, R A, L, I, S, T V 074 G, A, L,
I, W, P, S, T, N, E, K, R, H G, L, I, W, P, S, T, E, K, H R 075 G,
A, V, I, M, W, F, P, S, T, C, N, D, E, K P D 076 G, A, V, L, I, M,
W, P, S, Y, N, E, R G, A, W, P, S, Y, N E 077 G, V, L, M, W, F, P,
S, C, Y, N, Q, D, K, R, H V, M, C, Y, N, Q, K, R, H A 078 G, L, I,
M, F, S, T, C, N, K, R, H S, C, N I 079 G, A, V, L, P, S, T, C, Y,
N, D, E, K, R, H G, V, P, Y, E K 080 G, A, V, L, M, W, P, S, T, C,
N, D, E, R A, V, M, S, T, C, R G 081 A, V, L, F, S, C, Y, N, D, E,
R A, V, L, S, C, N, D, R I 082 G, A, V, L, M, S, Y, N, D, E, K, R
L, M R 083 A, V, I, M, W, F, P, T, C, Q, D, K, H K D 084 G, A, V,
L, I, M, P, S, C, E, R, H H 085 A, V, L, I, W, F, S, C, Y, N, Q, D,
K, R F 086 G, A, V, L, I, P, S, T, C, Y, N, D, K, R C R 087 G, A,
V, L, W, P, S, Q, E, K, H V, L, Q A 088 G, V, L, I, M, P, S, T, C,
Y, N, Q, D, E, R, H V, T, C, Y A 089 G, V, L, I, M, F, P, S, C, Y,
D, K, R, H S V 090 G, A, L, I, M, P, S, D, R I, M P 091 G, V, L, M,
W, F, S, T, C, E, K, R, H T 092 G, A, V, L, I, W, S, Y, Q, E, R, H
V, L, S R 093 G, A, V, L, M, F, P, S, T, C, D, E, K P, S N 094 G,
A, V, L, M, W, P, T, Y, Q, D, E, R, H V 095 G, A, L, I, W, P, S, T,
C, N, Q, D, K, R, H I, T, C, R V 096 G, L, M, W, P, S, T, Y, N, Q,
R, H L V 097 G, A, L, W, F, P, T, Y, E, R A V 098 G, A, L, M, W, S,
Y, Q, E, K, R A H 099 G, A, V, L, I, M, W, F, T, Y, N, D, E, R G,
A, V, I, T, Y, N, R T 100 G, A, V, L, M, W, P, S, C, N, Q, K, R, H
G, A, V, P, S, C, N, Q, H Q 101 G, A, V, L, I, S, T, D, E, K, R L,
I, T, D, E, K, R H 102 G, A, L, M, P, S, T, N, Q, D, E, R A, S, N,
Q, E, R V 103 G, A, L, M, W, F, P, S, T, N, D, E, R G, A, L, M, W,
F, P, S, T, R H 104 G, A, L, M, P, S, C, D, K, R G, A, L, M, S, C,
D, K, R T 105 G, A, V, L, I, M, F, P, S, C, Y, Q, D, R A, L, M, S,
C, Y, Q L 106 I, F, P, S, T, Y, D, R, H I, F V 107 L, I, M, W, P,
S, T, Y, D, E, K, R, H L, I, M, P, S, T, Y, D, E, K, R, H G 108 V,
L, M, P, S, T, C, Q, D, K S, Q, D L 109 I, M, W, F, P, S, T, Y, N,
Q, D, E, K, R I, M, W, F, P, S, T, Y, N, Q, D, E, K, R E 110 G, A,
V, L, I, W, F, S, T, Q, K, R A, V, L, I, S, T, Q, K, R H 111 G, A,
V, L, W, F, P, S, T, Y, N, Q, D, R G, A, V, L, W, F, P, S, T, Y, N,
Q, D, R T 112 G, A, V, L, M, W, P, S, Q, R G, A, V, L, M, W, P, S,
Q, R H 113 G, A, V, L, M, W, F, P, S, N, Q, D, R G, V, L, M, F, S,
N, Q, R L 114 G, A, V, I, M, W, P, S, N, Q, E, K, R, H V, I, M, P,
Q V 115 G, A, L, W, P, S, R, H G, A, L, W, P, S, R, H L 116 G, A,
V, M, S, C, Y, Q, R, H V, M Q 117 G, A, V, L, W, P, S, T, E, K, R,
H G, A, V, L, S, T, E, K, R, H T 118 G, A, L, W, P, C, Y, Q, E, K,
R A, C G 119 A, V, L, I, M, W, F, S, C, Y, N, D, E, R, H A, V, M,
S, N, D, E, H I 120 G, A, V, L, M, W, F, S, T, Q, D, E, K, R G, A,
V, L, M, W, F, S, T, Q, E, K, R F 121 G, V, L, M, W, P, S, Y, Q, D,
E, K, R G, V, L, M, W, S, Y, Q, E, K K 122 G, V, P, S, T, C, Y, N,
Q, R G, P, S, T, C, N, R K 123 G, A, V, L, M, W, P, S, T, C, Y, E,
R G, A, W, P, T, Y V 124 G, A, W, T, C, N, Q, D, E, R A, W, T, C,
N, Q, R P 125 G, A, V, L, W, S, T, Y, Q, E, R G, A, V, L, W, S, T,
Y, Q, E, R V 126 G, A, I, F, P, S, T, Y, Q, E A, I, F, S, T D 127
G, A, V, L, M, W, P, S, C, Q, R, H A, V, L, M, W, S, C, Q, R, H I
128 A, V, L, M, W, P, S, Q, D, E, K, R V, L, M Y 129 G, A, V, L, I,
M, W, F, P, S, T, D, R, H V 130 G, A, L, M, W, F, S, T, Y, D, E, R
A, L F 131 G, V, L, W, S, T, E, R K 132 G, A, V, L, M, P, S, C, Q,
E, R, H G, A, V, L, P, S, C, Q, E, R S 133 G, A, L, M, W, P, T, C,
Y, Q, D, K, R G, L, M, P, T, C, Q, D, K, R G 134 A, V, L, M, W, P,
C, Y, Q, E, R V 135 G, A, L, M, P, S, T, Q, E, K, R G, A, L, M, P,
S, T, Q, E, K, R F 136 G, A, V, I, M, P, S, T, C, Y, N, Q, K, R I,
M, C, Y, R T 137 G, A, V, L, W, P, S, E, R S L 138 G, A, V, M, W,
P, S, Q, D, K, R V, M, S, Q L 139 G, A, V, W, F, P, S, T, C, Y, Q,
E, K, R, H A, V G 140 A, L, M, W, P, T, C, Q, D, R D 141 G, V, L,
M, W, S, T, N, R G, V, M, S, T, N, R G 142 A, V, L, P, T, C, E, K,
R A, V G 143 A, V, L, W, S, Q, E, R A, W, S, Q, E F 144 G, A, V, L,
W, P, S, Q, D, K, R G, A, V, L, W, P, S, Q, K, R I 145 G, A, V, M,
W, C, Q, E, R, H G, A, V, M, W, C, Q, E, R, H N 146 G, L, M, W, P,
S, T, E, K, R W 147 G, V, M, P, S, C, E, R A 148 G, V, L, I, M, W,
P, S, Y, Q, K, R G, S W 149 G, A, V, L, F, S, T, N, E G 150 A, V,
L, I, W, S, T, Y, Q, E, K, R I, Q G 151 V, L, M, W, S, D, E, R S F
152 G, A, V, L, M, W, P, S, T, C, Q, D, R, H W V 153 G, A, L, I, M,
W, P, S, N, E, K, R A, L, I, P Q 154 G, V, L, W, F, P, S, T, N, D,
E, K, R, H G, V, L, W, F, P, S, T, N, D, E, K, R, H E 155 G, V, L,
M, F, P, S, N, Q, K, R G, V, L, M, F, S, N, Q, K, R V 156 G, A, L,
M, F, P, S, Q, E, K, R A, L, M, F, S, Q, E, K, R A 157 G, V, L, I,
M, W, P, S, T, N, Q, E, K, R, H G, V, L, I, M, W, S, T, N, Q, E, K,
R, H G 158 A, V, W, P, T, C, E, K, R A, V, W, P, T, C, E, K, R K
159 G, A, V, L, I, W, P, S, T, Y, Q, R, H G, A, V, L, P, S, T, Y,
Q, R, H R 160 G, A, V, L, I, M, F, S, T, C, Y, E, K I, M, Y, K I
161 G, A, V, L, M, W, F, P, S, T, Y, Q, D, E, R A, V, L H 162 G, A,
L, I, W, F, P, S, T, C, Y, Q, K, R G, A, L, I, W, F, S, T, C, Y, Q,
K, R F 163 A, L, S, T, C, Y, D, E R 164 G, V, L, I, M, W, F, P, S,
T, Y, N, D V, L, I, M, S, T, N, D L 165 G, V, I, M, W, F, P, S, N,
Q, E, K, R G, V, I, M, W, F, P, S, N, Q, E, K, R P 166 G, A, V, L,
I, M, W, S, T, C, Y, N, Q, D, E, K, R, H A, T, C, Q P 167 G, A, V,
L, M, W, S, T, C, Y, N, D, R, H A, N, D G 168 A, V, L, M, W, P, S,
T, Q, R, H A 169 G, V, L, M, W, F, S, T, C, N, Q, R, H G, S, T, C,
Q L 170 A, V, I, M, P, S, T, Y, Q, R, H A, V, I, M, S, T, Y, Q, R,
H P 171 G, A, V, M, W, S, T, C, E, R G, A, V, M, W, S, T, C, E,
R
Example 20 Identification of Amino Acid Positions Affecting the
Protein Stability and Function of IPD103
[0453] Additional mutagenesis was performed on selected positions
within IPD103lib11 reary-54 (SEQ ID:157). Protein was purified from
the single mutants and screened for activity on CEW. Table 16
summarizes additional amino acid substitutions identified, amino
acid substitutions allowing retention of insecticidal activity, and
amino acid substitutions resulting in reduced protein yields from
E. coli.
TABLE-US-00016 TABLE 16 Reduced Posi- Identified Active Expression
AA tion substitutions substitutions substitutions A 002 F, H, M, W,
Y F, H, M, W, Y A 011 D, F, L, M, N, Q D, F, L, M, N, Q T 018 A, F,
H, K, N, Y A, H, K, N M 020 C, G, N, Y D 021 E, I, M, P, T, Y E, P,
T M G 027 E, F, H, N, Q, T, Y F D 031 I, K, P, Q A 034 D, N, P D,
N, P A 065 C, I, K, N, P, Y C, I, N, Y K, P R 066 E, F, M, Q, S, W,
Y E, F, M, S, W, Y F 068 C, D, E, I, M, P, Y C, I, M S 070 A, D, E,
H, I, L, M, P, V A, D, E, H, L, I, P M, V N 094 C, F, I, K, S I, K
H 104 E, Q, T, W, Y E, Q, T, W G 140 E, F, H, I, K, N, S, V, Y S I,
N, V W 147 A, D, F, H, I, K, L, N, Q, F D, K T, Y W 149 C, D, H, I,
K, M, P, Q, Y C, D, H, K, M, Q Q 154 A, C, I, M A C, I, M E 155 A,
C, D, I, T, W A, C, D, I, T, W G 168 C, D, E, F, I, K, N, Y F
[0454] The above description of various illustrated embodiments of
the disclosure is not intended to be exhaustive or to limit the
scope to the precise form disclosed. While specific embodiments of
and examples are described herein for illustrative purposes,
various equivalent modifications are possible within the scope of
the disclosure, as those skilled in the relevant art will
recognize. The teachings provided herein can be applied to other
purposes, other than the examples described above. Numerous
modifications and variations are possible in light of the above
teachings and, therefore, are within the scope of the appended
claims.
[0455] These and other changes may be made in light of the above
detailed description. In general, in the following claims, the
terms used should not be construed to limit the scope to the
specific embodiments disclosed in the specification and the
claims.
[0456] The entire disclosure of each document cited (including
patents, patent applications, journal articles, abstracts, manuals,
books or other disclosures) in the Background, Detailed
Description, and Examples is herein incorporated by reference in
their entireties.
[0457] Efforts have been made to ensure accuracy with respect to
the numbers used (e.g. amounts, temperature, concentrations, etc.)
but some experimental errors and deviations should be allowed for.
Unless otherwise indicated, parts are parts by weight, molecular
weight is average molecular weight; temperature is in degrees
centigrade; and pressure is at or near atmospheric.
Sequence CWU 1
1
5081516DNAAthyrium niponicum 1atggcggaca aagcagcagc agcagctaga
gaagctgaag aagaggtgga gacgacgatg 60gacgagactg aggcggtggg gacgcacctg
gacttcttgg gcgcggacgt gaagttgcaa 120ccccgcaaca tcatcaccgt
ggaggtggac gcggctgccg taatccaaca gatcagagag 180atcttccaga
caatggcgcg tcacttcaac tctacgaggg tggtgcggga tgaagccatc
240aagggcattc gagaccactt cagggccgcc gtcccgactc gcaacgtggt
ggtcattcac 300actcagcacg ttcacacact ggtgggcttg gagcacaccc
acctcgtctt gcagaccggc 360atcttcaaaa aggtccccgt cgacatctat
gtcttcaagt ccggcgtctt caccaacctt 420ggagacggag gcttcatcaa
ctgggcatgg ggtggcttcg tcgaccaggt cgtcggcaag 480cgtatccact
tccgcttgcc ccccggggcg ctccct 5162172PRTAthyrium niponicum 2Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 1703513DNAAthyrium
niponicum 3atggcggacc aagcagcagc agctagagaa gctgaagaag aggtggagac
gacgatggac 60gagactgagg cggtggggac gcacctggac ttcttgggcg cggacgtgaa
gttgcaaccc 120cgcaacatca tcaccgtgga ggtggacgcc gctgccgtaa
tccaacagat cagagagatc 180ttccagacaa tggcgcgtca cttcaactct
acgagggtgg tgcgggatga agccatcaag 240ggcattcgag accacttcag
ggccgccgtc ccgactcgca acgtggtggt cattcacact 300cagcacgttc
acacactggt gggcttggag cacacccacc tcgtcttgca gaccggcatc
360ttcaaaaagg tccccgtcga catctatgtc ttcaagtccg gcgtcttcac
caaccttgga 420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg
accaggtcgt cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
5134171PRTAthyrium niponicum 4Met Ala Asp Gln Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe Leu 20 25 30Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105
110His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile
115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly
Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val
Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 1705513DNAPlatycerium wandae 5atggccgaac cagcagcagc
agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg cggtggggac
gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc 120cgcaacatca
tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat cagagagatc
180ttccagacaa tggcgcgtca cttcaactct acgagggtgg tgcgggatga
agccatcaag 240ggcattcgag accacttcag ggccgccgtc ccgactcgca
acgtggtggt cattcacact 300cagcacgttc acacactggt gggcttggag
cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg tccccgtcga
catctatgtc ttcaagtccg gcgtcttcac caaccttgga 420gacggaggct
tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt cggcaagcgt
480atccacttcc gcttgccccc cggggcgctc cct 5136171PRTPlatycerium
wandae 6Met Ala Glu Pro Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val
Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp
Phe Leu 20 25 30Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr
Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile
Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg
Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala
Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val His
Thr Leu Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr
Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys
Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn
Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155
160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 1707510DNAPteris
ensiformis 7atggccgacc aaggagcagc agctagagaa gctgaggaag aggtggagac
gacgatggac 60gagacggagg cggtggggac gcacctggac tttttggcgg acgtgaaggt
gcagccccgc 120aacatcatca ccgtggaggt ggacgccgct gccgtaatcc
aacagatcag agagatcttc 180caaaccatgg cacgtcactt caactctacg
agggtggtgc gggatgaagc cattaagggc 240attcgagacc acttcagggc
cgccgttccg actcgcaacg tggtggtcat tcacactcag 300cacgttcaaa
cactggtggc cgtggagcac agccacatcg tcttgcagac cggcatcttc
360aagaaggtcc ccgtcgacat ctatgttttc aagtccggcg tcttcaccaa
ccttggagac 420ggaggctaca tcaactgggc atggggtggc ttcgtagacc
aggtcgtcgg caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
5108170PRTPteris ensiformis 8Met Ala Asp Gln Gly Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe Leu 20 25 30Ala Asp Val Lys Val Gln Pro
Arg Asn Ile Ile Thr Val Glu Val Asp 35 40 45Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met Ala 50 55 60Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys Gly65 70 75 80Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val Val 85 90 95Ile His
Thr Gln His Val Gln Thr Leu Val Ala Val Glu His Ser His 100 105
110Ile Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile Tyr
115 120 125Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
Tyr Ile 130 135 140Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys Arg Ile145 150 155 160His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 1709507DNAPteris ensiformis 9atggccgacc aagctgcagc
tagagaagct gaggaagagg tggagacgac gatggacgag 60acggaggcgg tggggacgca
cctggacttt ttggcggacg tgaaggtgca gccccgcaac 120atcatcaccg
tggaggtgga cgccgctgcc gtaatccaac agatcagaga gatcttccaa
180accatggcac gtcacttcaa ctctacgagg gtggtgcggg atgaagccat
taagggcatt 240cgagaccact tcagggccgc cgttccgact cgcaacgtgg
tggtcattca cactcagcac 300gttcaaacac tggtggccgt ggagcacagc
cacatcgtct tgcagaccgg catcttcaag 360aaggtccccg tcgacatcta
tgttttcaag tccggcgtct tcaccaacct tggagacgga 420ggctacatca
actgggcatg gggtggcttc gtagaccagg tcgtcggcaa gcgtatccac
480ttccgcttgc cccccggggc gctccct 50710169PRTPteris ensiformis 10Met
Ala Asp Gln Ala Ala Ala Arg Glu Ala Glu Glu Glu Val Glu Thr1 5 10
15Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu Ala
20 25 30Asp Val Lys Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val Asp
Ala 35 40 45Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
Ala Arg 50 55 60His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys Gly Ile65 70 75 80Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val Val Ile 85 90 95His Thr Gln His Val Gln Thr Leu Val Ala
Val Glu His Ser His Ile 100 105 110Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile Tyr Val 115 120 125Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Tyr Ile Asn 130 135 140Trp Ala Trp Gly
Gly Phe Val Asp Gln Val Val Gly Lys Arg Ile His145 150 155 160Phe
Arg Leu Pro Pro Gly Ala Leu Pro 16511546DNAPlatycerium wandae
11atgagagagc gagagcgaga gcgagagaga gagatggccg aaccagcagc agcagcagct
60aaaaaagctg aagaagaggt ggagatattt atggacgaca ctgaggcggt ggggacgcat
120ctggacttct tggcgggctt gaaggtgcag ccccgcaaga tcatcaccgt
ggaggtggac 180cccgctgccg taatccagca gatcagggag atcttccaaa
ccatggcacg tcacttcaac 240tcgacgacgg tggtgcggga tgaagccatc
aagggcattc gagaccactt cagggccgcc 300gttccgactc gcaacgtggt
ggtcgttcac actcagcaca ttcacaccct ggagggcttg 360gagcacacca
accttgtctt gcagaccggc ctcttcagaa aggtccccgt cgacatctac
420gtcttcaagt ctggcgtctt caccctcctt ggagatggag gcttcatcaa
ctgggcgtgg 480ggtggcttcg tagagcaggt cgtcggcaag cgtatccact
tccgcttacc ccctggggcg 540ctccct 54612182PRTPlatycerium wandae 12Met
Arg Glu Arg Glu Arg Glu Arg Glu Arg Glu Met Ala Glu Pro Ala1 5 10
15Ala Ala Ala Ala Lys Lys Ala Glu Glu Glu Val Glu Ile Phe Met Asp
20 25 30Asp Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu Ala Gly Leu
Lys 35 40 45Val Gln Pro Arg Lys Ile Ile Thr Val Glu Val Asp Pro Ala
Ala Val 50 55 60Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala Arg
His Phe Asn65 70 75 80Ser Thr Thr Val Val Arg Asp Glu Ala Ile Lys
Gly Ile Arg Asp His 85 90 95Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val Val Val His Thr Gln 100 105 110His Ile His Thr Leu Glu Gly Leu
Glu His Thr Asn Leu Val Leu Gln 115 120 125Thr Gly Leu Phe Arg Lys
Val Pro Val Asp Ile Tyr Val Phe Lys Ser 130 135 140Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly Phe Ile Asn Trp Ala Trp145 150 155 160Gly
Gly Phe Val Glu Gln Val Val Gly Lys Arg Ile His Phe Arg Leu 165 170
175Pro Pro Gly Ala Leu Pro 18013513DNAPlatycerium wandae
13atggccgaac cagcagcagc agcagctaaa aaagctgaag aagaggtgga gatatttatg
60gacgacactg aggcggtggg gacgcatctg gacttcttgg cgggcttgaa ggtgcagccc
120cgcaagatca tcaccgtgga ggtggacccc gctgccgtaa tccagcagat
aagagagatc 180tttcaaaccc tggcacgtca cttcaactcg acgacggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtt
ccgactcgca acgtggtggt cgttcacact 300cagcacattc acaccctgga
gggcttggag cacaccaacc ttgtcttgca gaccggccgc 360ttcagaaagg
tccccgtcga catctacgtc ttcaagtctg gcgtcttcac cctccttgga
420gatggaggct tcatcaactg ggcgtggggt ggcttcgtag agcaggtcgt
cggcaagcgt 480atccacttcc gcttaccccc tggggcgctc cct
51314171PRTPlatycerium wandae 14Met Ala Glu Pro Ala Ala Ala Ala Ala
Lys Lys Ala Glu Glu Glu Val1 5 10 15Glu Ile Phe Met Asp Asp Thr Glu
Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu Ala Gly Leu Lys Val Gln
Pro Arg Lys Ile Ile Thr Val Glu Val 35 40 45Asp Pro Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr Leu 50 55 60Ala Arg His Phe Asn
Ser Thr Thr Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val
His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105
110Asn Leu Val Leu Gln Thr Gly Arg Phe Arg Lys Val Pro Val Asp Ile
115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly
Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Glu Gln Val
Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 17015513DNAAthyrium filix-femina 15atggccgaca
aagcgcctcc tcctgctaga gaagcagaag aagaggtgga ggagacgatg 60gacgagactg
aggcagtggg gacgcacctg gacttgatag cgcacctgag tgtgcaaccc
120cgcggcatca tcaccgtgga ggtggacccc gccgctgtaa tccaacagat
cagagagatc 180ttccaaacca tggcacgtca tttcaactct acgagggtgg
tacgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300caacacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360tttagaacgg
tccccgtcga catctacgtc ttcaagtccg gcgtgttcac caacctcgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtga ccgaggtcgt
tgggaagcgt 480gtccacttcc gcttgccccc cggggcactc cct
51316171PRTAthyrium filix-femina 16Met Ala Asp Lys Ala Pro Pro Pro
Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Glu Thr Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu Asp Leu 20 25 30Ile Ala His Leu Ser Val
Gln Pro Arg Gly Ile Ile Thr Val Glu Val 35 40 45Asp Pro Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val
Ile His Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105
110His Leu Val Leu Gln Thr Gly Ile Phe Arg Thr Val Pro Val Asp Ile
115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly
Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Thr Glu Val
Val Gly Lys Arg145 150 155 160Val His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 17017510DNAColysis wrightii 17atggccgacc aagtagcagc
agcgagaggg gctgaagaag aggtggagac gacgatggac 60gagactgagg ctgtggggac
gcacctggac ttcttggcgg acgtgaaggt gcaaccccgg 120agcatcatca
ccgtggaggt ggacgccgct gctgtaatcc aacagatcag agagatcttc
180caaaccatgg cacgtcactt caactctacg agggtggtgc gggacgaagc
catcaagggg 240attcgagacc acttccgggc cgccgtcccg actcgcaacg
tggtggtcgt tcacactcag 300cacgttcaca cactggtggg cctggagcac
accaacatcg tcttgcagac cggcctcttc 360aaaaaggtcc ccgtcgacat
ctatgtcttc aagtccggcg tcttcaccct ccttggagac 420ggaggcttca
tcaactgggc atggggtggc ttcgtagacc aggtcgtcgg caagcgtatc
480cacttccgct tgccccccgg ggcgctccct 51018170PRTColysis wrightii
18Met Ala Asp Gln Val Ala Ala Ala Arg Gly Ala Glu Glu Glu Val Glu1
5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe
Leu 20 25 30Ala Asp Val Lys Val Gln Pro Arg Ser Ile Ile Thr Val Glu
Val Asp 35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr Met Ala 50 55 60Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile Lys Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val Val Val 85 90 95Val His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His Thr Asn 100 105 110Ile Val Leu Gln Thr Gly Leu
Phe Lys Lys Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg Ile145 150 155
160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
17019513DNAunknownIPD103 variantmisc_feature(484)..(484)n is a, c,
g, or t 19atggccgacc cagcaacagc agctagagaa gctgaagaag aggtgcagga
gactttgatg 60gacgagactg aggcggtggg gacgcacctg gacttcgtgg cgggcttgga
ggtgcaaccc 120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa
tccagcagat cagagagatc 180ttccgaacca tggcaagtca cttcaactcg
acgagggtgg tgcgggatga agccatcaag
240ggcattcgag accacttcag ggccgccgtc ccgactcgca acgtggtggt
cgttcacacc 300cagcacattc acacactgga gggcttggag cacaccaacc
tcgtcttgca gaccggcctc 360ttcaaaaagg tccccgtcga catctacgtc
ttcaagtccg gcgtcttcac cctccttgga 420gacggaggct tcatcaactg
ggcatggggt ggcttcgtac aggaggtcgc cggcaagcgt 480atcnacttcc
gcttgccccc cggggcgctc cct 51320171PRTunknownIPD103
variantmisc_feature(162)..(162)Xaa can be any naturally occurring
amino acid 20Met Ala Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu
Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr
His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val
Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg
Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val
Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg
Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His
Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn Leu Val Leu
Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val
Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135
140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys
Arg145 150 155 160Ile Xaa Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
17021537DNANephrolepsis cordifolia 21atgcagagag agagagagag
agagatggcc gaccaagctg cagcagcagc tagagaagct 60gaagaagagg tggaggtttt
tatggacgag actgaggcgg tggggacgca cctggacttc 120ttggcgggct
tgaacgttca accccgcaag gtcatcaccg tggaggtgga cgccgctgcc
180gtaatccaac agatcagaga gatcttccaa accatggcac gtcacttcaa
ctcgacgagg 240gtggtgcggg atgaagccat caagggcatt cgcgaccact
tcagggccgc cgtcccgact 300cgcaacgtgg tggtcgttca cactcagcac
attcacactc tggtggacgt ggagcacacc 360aacctcgtct tgcagaccgg
catcttcaaa aaggtccccg tcgacatcta tgtcttcaag 420tccggcgtct
tcaccctcct tggagacggc ggcttcatca actgggcatg gggtggcttc
480gtagaccagg ttgacggcaa gcgtatccac ttccgcttgc cccccggggc gctccct
53722179PRTNephrolepsis cordifolia 22Met Gln Arg Glu Arg Glu Arg
Glu Met Ala Asp Gln Ala Ala Ala Ala1 5 10 15Ala Arg Glu Ala Glu Glu
Glu Val Glu Val Phe Met Asp Glu Thr Glu 20 25 30Ala Val Gly Thr His
Leu Asp Phe Leu Ala Gly Leu Asn Val Gln Pro 35 40 45Arg Lys Val Ile
Thr Val Glu Val Asp Ala Ala Ala Val Ile Gln Gln 50 55 60Ile Arg Glu
Ile Phe Gln Thr Met Ala Arg His Phe Asn Ser Thr Arg65 70 75 80Val
Val Arg Asp Glu Ala Ile Lys Gly Ile Arg Asp His Phe Arg Ala 85 90
95Ala Val Pro Thr Arg Asn Val Val Val Val His Thr Gln His Ile His
100 105 110Thr Leu Val Asp Val Glu His Thr Asn Leu Val Leu Gln Thr
Gly Ile 115 120 125Phe Lys Lys Val Pro Val Asp Ile Tyr Val Phe Lys
Ser Gly Val Phe 130 135 140Thr Leu Leu Gly Asp Gly Gly Phe Ile Asn
Trp Ala Trp Gly Gly Phe145 150 155 160Val Asp Gln Val Asp Gly Lys
Arg Ile His Phe Arg Leu Pro Pro Gly 165 170 175Ala Leu
Pro23513DNAPolystichium tsus-simense 23atggccgaca aagtagcagc
agcgcctcct cctgctagag aagcagaaga agaggtggag 60gagacgatgg acgagactga
ggcggtgggg acgcacctgg acttgatagc gaccctaccg 120cgtggcatca
tcaccgtgga ggtggactcc gccgccgtaa tccaacagat cagagagatc
180ttccaaacca tggcacgtca tttcaactct acgagggtgg taagggatga
agccatcaag 240ggcattcgag accacttcag ggccgccatc ccgactcgca
acgtggtggt cattcacact 300caacacgttc acacactggt gggcttggag
cacacccacc tcgtcttgca gaccggcatc 360tttaaaaagg tccccgtcga
cgtctacgtc ttcaagtccg gcgtgctcac caacctcgga 420gacggaggct
tcatcaactg ggcatggggt ggcttcgtga ccgaggtcgt tgggaagcgt
480gtccacttcc gcttgccccc cggggcgctc cct 51324171PRTPolystichium
tsus-simense 24Met Ala Asp Lys Val Ala Ala Ala Pro Pro Pro Ala Arg
Glu Ala Glu1 5 10 15Glu Glu Val Glu Glu Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His 20 25 30Leu Asp Leu Ile Ala Thr Leu Pro Arg Gly Ile
Ile Thr Val Glu Val 35 40 45Asp Ser Ala Ala Val Ile Gln Gln Ile Arg
Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val
Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg
Ala Ala Ile Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His
Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu
Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Val 115 120 125Tyr Val
Phe Lys Ser Gly Val Leu Thr Asn Leu Gly Asp Gly Gly Phe 130 135
140Ile Asn Trp Ala Trp Gly Gly Phe Val Thr Glu Val Val Gly Lys
Arg145 150 155 160Val His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
17025513DNAPolystichium tsus-simense 25atggccgaca aagtagcagc
agcgcctcct cctgctagag aagcagaaga agaggtggag 60gagacgatgg acgagactga
ggcggtgggg acgcacctgg acttgatagc aaccctaccg 120cgtggcatca
tcaccgtgga ggtggacggc gccgccgtaa tccaacagat cagagagatc
180ttccaaacca tggcacgtca tttcaactct acgagggtgg taagggatga
agccatcaag 240ggcattcgag accacttcag ggccgccatc ccgactcgca
acgtggtggt cattcacact 300caacacgttc acacactggt gggcttggag
cacacccacc tcgtcttgca gaccggcatc 360tttaaaaagg tccccgtcga
cgtctacgtc ttcaagtccg gcgtgctcac caacctcgga 420gacggaggct
tcatcaactg ggcatggggt ggcttcgtga ccgaggtcgt tgggaagcgt
480gtccacttcc gcttgccccc cggggcgctc cct 51326171PRTPolystichium
tsus-simense 26Met Ala Asp Lys Val Ala Ala Ala Pro Pro Pro Ala Arg
Glu Ala Glu1 5 10 15Glu Glu Val Glu Glu Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His 20 25 30Leu Asp Leu Ile Ala Thr Leu Pro Arg Gly Ile
Ile Thr Val Glu Val 35 40 45Asp Gly Ala Ala Val Ile Gln Gln Ile Arg
Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val
Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg
Ala Ala Ile Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His
Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu
Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Val 115 120 125Tyr Val
Phe Lys Ser Gly Val Leu Thr Asn Leu Gly Asp Gly Gly Phe 130 135
140Ile Asn Trp Ala Trp Gly Gly Phe Val Thr Glu Val Val Gly Lys
Arg145 150 155 160Val His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
17027519DNAThelypteris palustris 27atggccgaca aagtagcagc agcttctcgg
gctcaaggag cagaagaggt ggaggatctg 60atggacgaga cagaggcggt ggggacgcac
ctggactgca tgggcggcga cgtgaaggtg 120caagcacgcg gcatcatcac
cgtggaggtg gaccccgccg ccgtaatcca acagatcaga 180gagatcttcc
aaaccctggc acgtcactac aactctacga gggtggtacg ggatgcagcc
240atcaaggcca ttcgagacca cttcagggcc gccgtcccga ctcgcaacgt
ggtggtcatc 300cacactcaac acgttcacac actggcggac gtagagcaca
gccacctcgt cttgcagacc 360ggcatcttca agaaggtccc cgtcgacatc
tacgtcttca agtccggcgt gttcaccaac 420ctcggcgacg gaggcttcat
caactgggca tggggtggct acgtgacaga ggtcgttggg 480aagcgtatcc
acttccgctt gcccccgggg gcactccct 51928173PRTThelypteris palustris
28Met Ala Asp Lys Val Ala Ala Ala Ser Arg Ala Gln Gly Ala Glu Glu1
5 10 15Val Glu Asp Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu
Asp 20 25 30Cys Met Gly Gly Asp Val Lys Val Gln Ala Arg Gly Ile Ile
Thr Val 35 40 45Glu Val Asp Pro Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Gln 50 55 60Thr Leu Ala Arg His Tyr Asn Ser Thr Arg Val Val
Arg Asp Ala Ala65 70 75 80Ile Lys Ala Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln His Val
His Thr Leu Ala Asp Val Glu 100 105 110His Ser His Leu Val Leu Gln
Thr Gly Ile Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr Val Phe
Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile
Asn Trp Ala Trp Gly Gly Tyr Val Thr Glu Val Val Gly145 150 155
160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
17029513DNAAthyrium filix-femina 29atggccgaca aagcgcctcc tcctgctaga
gaagcagaag aagaggtgga ggagacgatg 60gacgagactg aggcagtggg gacgcacctg
gacttgatag cgcacctgag tgtgcaaccc 120cgcggcatca tcaccgtgga
ggtggacccc gccgctgtaa tccaacagat cagagagatc 180ttccaaacca
tggcacgtca tttcaactct acgagggtgg tacgggatga agccatcaag
240ggcattcgag accacttcag ggccgccgtc ccgactcgca acgtggtggt
cattcacact 300caacacgttc acacactggt gggcttggag cacacccacc
tcgtcttgca gaccggcatc 360tttagaacgg tccccgtcga catctacgtc
ttcaagtccg gcgtgctcac caacctcgga 420gacggaggct tcatcaactg
ggcatggggt ggcttcgtga ccgaggtcgt tgggaagcgt 480gtccacttcc
gcttgccccc cggggcactc cct 51330171PRTAthyrium filix-femina 30Met
Ala Asp Lys Ala Pro Pro Pro Ala Arg Glu Ala Glu Glu Glu Val1 5 10
15Glu Glu Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Leu
20 25 30Ile Ala His Leu Ser Val Gln Pro Arg Gly Ile Ile Thr Val Glu
Val 35 40 45Asp Pro Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile
Phe Arg Thr Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly
Val Leu Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala
Trp Gly Gly Phe Val Thr Glu Val Val Gly Lys Arg145 150 155 160Val
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 17031513DNANephrolepis
cordifolia 31atggccgacc aagctgcagc agcagctaga gaagctgaag aagaggtgga
ggtttttatg 60gacgagactg aggcggtggg gacgcacctg gacttcttgg cgggcttgaa
cgttcaaccc 120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa
tccaacagat cagagagatc 180ttccaaacca tggcacgtca cttcaactcg
acgagggtgg tgcgggatga agccatcaag 240ggcattcgcg accacttcag
ggccgccgtc ccgactcgca acgtggtggt cgttcacact 300cagcacattc
acactctggt ggacgtggag cacaccaacc tcgtcttgca gaccggcatc
360ttcaaaaagg tccccgtcga catctatgtc ttcaagtccg gcgtcttcac
cctccttgga 420gacggcggct tcatcaactg ggcatggggt ggcttcgtag
accaggttga cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51332171PRTNephrolepis cordifolia 32Met Ala Asp Gln Ala Ala Ala Ala
Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Val Phe Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu Ala Gly Leu Asn Val
Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val
Val His Thr Gln His Ile His Thr Leu Val Asp Val Glu His Thr 100 105
110Asn Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile
115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly
Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val
Asp Gly Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 17033546DNAPlatycerium wandae 33atgagagagc gagagcgaga
gcgagagaga gagatggccg aaccagcagc agcagcagct 60aaaaaagctg aagaagaggt
ggagatattt atggacgaca ctgaggcggt ggggacgcat 120ctggacttct
tggcgggctt gaaggtgcag ccccgcaaga tcatcaccgt ggaggtggac
180cccgctgccg taatccagca gataagagag atctttcaaa ccctggcacg
tcacttcaac 240tcgacgacgg tggtgcggga tgaagccatc aagggcattc
gagaccactt cagggccgcc 300gttccgactc gcaacgtggt ggtcgttcac
actcagcaca ttcacaccct ggagggcttg 360gagcacacca accttgtctt
gcagaccggc cgcttcagaa aggtccccgt cgacatctac 420gtcttcaagt
ctggcgtctt caccctcctt ggagatggag gcttcatcaa ctgggcgtgg
480ggtggcttcg tggagcaggt cgtcggcaag cgtatccact tccgcttacc
ccctggggcg 540ctccct 54634182PRTPlatycerium wandae 34Met Arg Glu
Arg Glu Arg Glu Arg Glu Arg Glu Met Ala Glu Pro Ala1 5 10 15Ala Ala
Ala Ala Lys Lys Ala Glu Glu Glu Val Glu Ile Phe Met Asp 20 25 30Asp
Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu Ala Gly Leu Lys 35 40
45Val Gln Pro Arg Lys Ile Ile Thr Val Glu Val Asp Pro Ala Ala Val
50 55 60Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Leu Ala Arg His Phe
Asn65 70 75 80Ser Thr Thr Val Val Arg Asp Glu Ala Ile Lys Gly Ile
Arg Asp His 85 90 95Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val Val
Val His Thr Gln 100 105 110His Ile His Thr Leu Glu Gly Leu Glu His
Thr Asn Leu Val Leu Gln 115 120 125Thr Gly Arg Phe Arg Lys Val Pro
Val Asp Ile Tyr Val Phe Lys Ser 130 135 140Gly Val Phe Thr Leu Leu
Gly Asp Gly Gly Phe Ile Asn Trp Ala Trp145 150 155 160Gly Gly Phe
Val Glu Gln Val Val Gly Lys Arg Ile His Phe Arg Leu 165 170 175Pro
Pro Gly Ala Leu Pro 18035513DNATectaria milnei 35atggccgatg
aggtagctgg tcatcacggt cctgcctgtg aagaagaaga agaagagatg 60ctgatggatg
agactgaggc ggtgggggtg catgcaatcg atggcctgcc ggtgcaaaac
120cgtagcatca ttaccgtgga ggtggacgcc gcagccgtaa tccagcagat
cagagagata 180tttgcatcga tgatcaagca ctacaactcc acgcgagtgg
tgcgggatga ggccatcaag 240tccattcgag accacttcag gctcgccgtg
cccactcgca acgtggtggt gattcacact 300cagcacgttc acacactgga
cgccgtggag agctcgcacc tggtcttgcg aaccggtcta 360ttcaaaaagg
tgccagtgga catcttcgtc ttcaagtctg gcgtgttcac caacctggga
420gacgggggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
tgccaagcgt 480gttgtcttca gtcggccccc tggggcgctc cct
51336171PRTTectaria milnei 36Met Ala Asp Glu Val Ala Gly His His
Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu
Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln
Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Ala Ser Met 50 55 60Ile Lys His Tyr Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Ser Ile Arg
Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile
His Thr Gln His Val His Thr Leu Asp Ala Val Glu Ser Ser 100 105
110His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile
115 120 125Phe Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly
Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His
Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg Pro Pro Gly Ala
Leu Pro 165 17037375DNADavallia tyermannii 37atggacgccg ctgccgtaat
ccagcagatt agagagatct tccaatccat ggcagatgac 60ttcagctcga cgaaggtggt
gcgggatgaa gccatcaagg gcattcgaga ccacttcagg 120gccgccgtcc
cgactcgcaa cgtggtggtc gttcacaccc cgcacattca cacacagctg
180gtggacgtgg agcacaccaa actcgtcttg aagaccggca tcttcgaaaa
ggtccccgtc 240gacatctatg tcttcaagtc cggcgtcttc accctccttg
gagacggagg ctacaacaac 300tgggcatggg gtggcttcgt agaccaggtc
gtcggcaagc gtatccactt ccgcttgccc 360cccggggcgc tccct
37538125PRTDavallia tyermannii 38Met Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Ser1 5 10 15Met Ala Asp Asp Phe Ser Ser
Thr Lys Val Val Arg Asp Glu Ala Ile 20 25 30Lys Gly Ile Arg Asp His
Phe Arg Ala Ala Val Pro Thr Arg Asn Val 35 40 45Val Val Val His Thr
Pro His Ile His Thr Gln Leu Val Asp Val Glu 50 55 60His Thr Lys Leu
Val Leu Lys Thr Gly Ile Phe Glu Lys Val Pro Val65 70 75 80Asp Ile
Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly 85 90 95Gly
Tyr Asn Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly 100 105
110Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 115 120
12539579DNAArtificial SequenceIPD103 variant 39atgggcagca
gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg
120gacgagactg aggcggtggg gacgcacctg gacttcttgg gcgcggacgt
gaagttgcaa 180ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg
taatccaaca gatcagagag 240atcttccaga caatggcgcg tcacttcaac
tctacgaggg tggtgcggga tgaagccatc 300aagggcattc gagaccactt
cagggccgcc gtcccgactc gcaacgtggt ggtcattcac 360actcagcacg
ttcacacact ggtgggcttg gagcacaccc acctcgtctt gcagaccggc
420atcttcaaaa aggtccccgt cgacatctat gtcttcaagt ccggcgtctt
caccaacctt 480ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg
tcgaccaggt cgtcggcaag 540cgtatccact tccgcttgcc ccccggggcg ctcccttga
57940192PRTArtificial SequenceIPD103 variant 40Met Gly Ser Ser His
His His His His His Ser Ser Gly Leu Val Pro1 5 10 15Arg Gly Ser His
Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala 20 25 30Glu Glu Glu
Val Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr 35 40 45His Leu
Asp Phe Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile 50 55 60Ile
Thr Val Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu65 70 75
80Ile Phe Gln Thr Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg
85 90 95Asp Glu Ala Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val
Pro 100 105 110Thr Arg Asn Val Val Val Ile His Thr Gln His Val His
Thr Leu Val 115 120 125Gly Leu Glu His Thr His Leu Val Leu Gln Thr
Gly Ile Phe Lys Lys 130 135 140Val Pro Val Asp Ile Tyr Val Phe Lys
Ser Gly Val Phe Thr Asn Leu145 150 155 160Gly Asp Gly Gly Phe Ile
Asn Trp Ala Trp Gly Gly Phe Val Asp Gln 165 170 175Val Val Gly Lys
Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 180 185
19041513DNAArtificial SequenceIPD103 variant 41atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51342510DNAArtificial SequenceIPD103 variant 42atggccgacc
cagcagcagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cagacaatgg cgcgtcactt caactctacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacattcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcatcttc 360aaaaaggtcc
ccgtcgacat ctatgtcttc aagtccggcg tcttcaccaa ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtacagg aggtcgccgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
51043516DNAArtificial SequenceIPD103 variant 43atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51644516DNAArtificial SequenceIPD103 variant 44atggcggaca
aaacagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51645513DNAArtificial SequenceIPD103 variant 45atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51346513DNAArtificial SequenceIPD103
variantmisc_feature(412)..(412)n is a, c, g, or t 46atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga acccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtattgca gaccggcatc 360ttcaaaaagg
tccccgtcga catttatgtc ttcaagtccg gtgttttcac cntcctcgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcggtc cct
51347513DNAArtificial SequenceIPD103 variant 47atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51348513DNAArtificial SequenceIPD103 variant 48atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51349519DNAArtificial SequenceIPD103 variant 49atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgcggctg ccgtaatcca
acagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactcgacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacacccagc acgttcacac
actggtgggc ttggagcaca ccaacctcgt cttgcagacc 360ggcctcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccctc
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
51950516DNAArtificial SequenceIPD103 variant 50atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51651513DNAArtificial SequenceIPD103 variant 51atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51352513DNAArtificial SequenceIPD103 variant 52atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51353516DNAArtificial SequenceIPD103 variant 53atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51654513DNAArtificial SequenceIPD103 variant 54acggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51355510DNAArtificial SequenceIPD103 variant 55atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacactcag 300cacgttcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
51056513DNAArtificial SequenceIPD103 variant 56atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51357513DNAArtificial SequenceIPD103 variant 57atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51358516DNAArtificial SequenceIPD103 variant 58atggcggaca
aaacagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51659513DNAArtificial SequenceIPD103 variant 59atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51360516DNAArtificial SequenceIPD103 variant 60atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51661513DNAArtificial SequenceIPD103 variant 61atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51362516DNAArtificial SequenceIPD103 variant 62atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gactttgatg 60gacgagactg
aggcggtggg
gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa 120ccccgcaaca
tcatcaccgt ggaggtggac gccgctgccg taatccagca gatcagagag
180atcttccgaa ccatggcaaa tcacttcaac tcgacgaggg tggtgcggga
tgaagccatc 240aagggcattc gagaccactt cagggccgcc gtcccgactc
gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact ggagggcttg
gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa aggtccccgt
cgacatctat gtcttcaagt ccggcgtctt caccaacctt 420ggagacggag
gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt cgtcggcaag
480cgtatccact tccgcttgcc ccccggggcg ctccct 51663510DNAArtificial
SequenceIPD103 variant 63atggccgacc cagcagcagc agctagagaa
gctgaagaag aggtggagac gacgatggac 60gagactgagg cggtggggac gcacctggac
ttcgtggcgg gcttggaggt gcaaccccgc 120aaggtcatca ccgtggaggt
ggacgcggct gccgtaatcc aacagatcag agagatcttc 180cagacaatgg
cgcgtcactt caactcgacg agggtggtgc gggatgaagc catcaagggc
240attcgagacc acttcagggc cgccgtcccg actcgcaacg tggtggtcgt
tcacactcag 300cacgttcaca cactggtggg cttggagcac accaacctcg
tcttgcagac cggcctcttc 360aaaaaggtcc ccgtcgacat ctacgtcttc
aagtccggcg tcttcaccct ccttggagac 420ggaggcttca tcaactgggc
atggggtggc ttcgtacagg aggtcgccgg caagcgtatc 480cacttccgct
tgccccccgg ggcgctccct 51064513DNAArtificial SequenceIPD103 variant
64atggcggaca aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg
60gacgagactg aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51365516DNAArtificial SequenceIPD103 variant 65atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcaca ttcacacact
ggagggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51666519DNAArtificial SequenceIPD103 variant 66atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca aggtcatcac cgtggaggtg gacgccgctg ccgtaatcca
acagatcaga 180gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtagtcgtt 300cacacccagc acattcacac
actggagggc ttggagcaca cccacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tacgtcttca agtccggcgt cttcaccaac
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
51967513DNAArtificial SequenceIPD103 variant 67atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgaaactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacgttc acacactggt
gggctcggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51368513DNAArtificial SequenceIPD103 variant 68atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51369516DNAArtificial SequenceIPD103 variant 69atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccca
51670513DNAArtificial SequenceIPD103 variant 70atggccgacc
cagcaacagc ggctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51371513DNAArtificial SequenceIPD103 variant 71atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacaccaacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51372513DNAArtificial SequenceIPD103 variant 72atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51373513DNAArtificial SequenceIPD103 variant 73atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51374513DNAArtificial SequenceIPD103 variant 74atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51375189DNAArtificial SequenceIPD103 variant 75atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagaca 18976513DNAArtificial SequenceIPD103
variant 76atggcggaca aagcagcagc agcagctaga gaagctgaag aagaggtgga
gacgacgatg 60gacgagactg aggcggtggg gacgcacctg gacttcgtgg cgggcttgga
ggtgcaaccc 120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa
tccagcagat cagagagatc 180ttccgaacca tggcaagtca cttcaactcg
acgagggtgg tgcgggatga agccatcaag 240ggcattcgag accacttcag
ggccgccgtc ccgactcgca acgtggtggt cgttcacact 300cagcacgttc
acacactgga gggcttggag cacacccacc tcgtcttgca gaccggcatc
360ttcaaaaagg tccccgtcga catctacgtc ttcaagtccg gcgtcttcac
cctccttgga 420gacggaggct tcatcaactg ggcatggggt ggcttcgtac
aggaggtcgc cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51377513DNAArtificial SequenceIPD103 variant 77atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51378513DNAArtificial SequenceIPD103 variantmisc_feature(55)..(56)n
is a, c, g, or tmisc_feature(165)..(165)n is a, c, g, or
tmisc_feature(195)..(196)n is a, c, g, or t 78atggcggaca cagcagcagc
agctgctaga gaagatgaag aagagctgga gacgnngatg 60gacgagactg aggcggtggg
gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc 120cgcaaggtca
tcaccgtgga ggtggacgcg gctgccgtaa tccancagat cagagagatc
180ttccggacca tggcnngtca cttcaactct acgagggtgg tgcgggatga
agccatcaag 240ggcattcgag accacttcag ggccgccgtc ccgactcgca
acgtggtggt cgttcacacc 300cagcacgttc acacactgga gggcttggag
cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg tccccgtcga
catctacgtc ttcaagtccg gcgtcttcac catccttgga 420gacggaggct
tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt cggcaagcgt
480atccacttcc gcttgccccc cggggcgctc cct 51379510DNAArtificial
SequenceIPD103 variant 79atggcggaca aagcagcagc agctagagaa
gctgaagaag aggtggagac gacgatggac 60gagactgagg cggtggggac gcacctggac
ttcgtggcgg gcttggaggt gcaaccccgc 120aacatcatca ccgtggaggt
ggacgcggct gccgtaatcc aacagatcag agagatcttc 180cagacaatgg
cgcgtcactt caactctacg agggtggtgc gggatgaagc catcaagggc
240attcgagacc acttcagggc cgccgtcccg actcgcaacg tggtggtcgt
tcacacccag 300cacattcaca cactggaggg cttggagcac accaacctcg
tcttgcagac cggcctcttc 360aaaaaggtcc ccgtcgacat ctacgtcttc
aagtccggcg tcttcaccaa cctgggagac 420ggaggcttca tcaactgggc
atggggtggc ttcgtacagg aggtcgccgg caagcgtatc 480cacttccgct
tgccccccgg ggcgctccct 51080510DNAArtificial SequenceIPD103 variant
80atggcggaca aagcagcagc agcagctaga gaagctgaag aagaggagga ggaaatgctg
60atggacgaga ctgaggcggt gggggtgcac gcgatcgacg gtctgccggt gcaaaaccgc
120agcatcatca ccgtggaggt ggacgcggct gccgtaatcc agcagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagagc 240attcgagacc acttcaggct cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacgttcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcatcttc 360aaaaaggtcc
ccgtcgacat ctatgtcttc aagtccggcg tcttcaccaa ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
51081513DNAArtificial SequenceIPD103 variant 81atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51382510DNAArtificial SequenceIPD103 variant 82atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggagga ggaaatgctg 60atggacgaga
ctgaggcggt gggggtgcac gcgatcgacg gtctgccggt gcaaaaccgc
120agcatcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcaggct cgccgtcccg
actcgcaacg tggtggtcat tcacactcag 300cacgttcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccaa cctgggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtacagg aggtcgccgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
51083513DNAArtificial SequenceIPD103 variant 83atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51384513DNAArtificial SequenceIPD103 variant 84atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgcgtcaa tgatcaaaca ctacaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
51385519DNAArtificial SequenceIPD103 variant 85atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaccccgca aggtcatcac cgtggaggtg gacgccgctg ccgtaatcca
gcagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacacccagc acattcacac
actggagggc ttggagcaca cccacctcgt cttgcggacc 360ggcctgttca
aaaaggtccc tgtcgacatc tttgtcttca agtccggcgt cttcaccaac
420cttggagacg gaggcttcat caactgggca tggggtggct acgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
51986522DNAArtificial SequenceIPD103 variant 86atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcttgggcgc ggacgtgaag
120ttgcaacccc gcaacatcat caccgtggag gtggacgcgg ctgccgtaat
ccaacagatc 180agagagatct tccagacaat ggcgcgtcac ttcaactcga
cgagggtggt gcgggatgaa 240gccatcaagg gcattcgaga ccacttcagg
gccgccgtcc cgactcgcaa cgtggtggtc 300gttcacaccc agcacattca
cacactggag ggcttggagc acaccaacct cgtcttgcag 360accggcctct
tcaaaaaggt ccccgtcgac atctatgtct tcaagtccgg cgtcttcacc
420aaccttggag acggaggctt catcaactgg gcatggggtg gcttcgtaca
ggaggtcgcc 480ggcaagcgta tccacttccg cttgcccccc ggggcgctcc ct
52287516DNAArtificial SequenceIPD103 variant 87atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggacgccgtg gagtcctccc acctcgtctt gcggaccggc 360ctgttcaaaa
aggtccctgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggctacg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51688513DNAArtificial SequenceIPD103 variant 88atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag
240agcattcgag accacttcag ggccgccgtc ccgactcgca acgtggtggt
cattcacact 300cagcacgttc acacactggt gggcttggag cacacccacc
tcgtcttgca gaccggcctc 360ttcaaaaagg tccccgtcga catctatgtc
ttcaagtccg gcgtcttcac caacctggga 420gacggaggct tcatcaactg
ggcatggggt ggcttcgtac aggaggtcgt cggcaagcgt 480atccacttcc
gcttgccccc cggggcgctc cct 51389513DNAArtificial SequenceIPD103
variant 89atggccgacc cagcaacagc agctagagaa gctgaagaag aggtgcagga
gactttgatg 60gacgagactg aggcggtggg gacgcacctg gacttcgtgg cgggcttgga
ggtgcaaccc 120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa
tccaacagat cagagagatc 180ttccgaacca tggcaagtca cttcaactcg
acgagggtgg tgcgggatga agccatcaag 240ggcattcgag accacttcag
ggccgccgtc ccgactcgca acgtggtggt cattcacact 300cagcacgttc
acacactgga cgccgtggag tcctcccacc tcgtcttgca gaccggcctc
360ttcaaaaagg tccccgtcga catctatgtc ttcaagtccg gcgtcttcac
caaccttgga 420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg
accaggtcgt cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51390519DNAArtificial SequenceIPD103 variant 90atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagaggt gcaggagact 60ttgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaccccgca gcatcatcac cgtggaggtg gacgccgctg ccgtaatcca
acagatcaga 180gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcaggctc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacacccagc acgttcacac
actggtgggc ttggagcaca cccacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccaac
420ctgggagacg gaggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
51991519DNAArtificial SequenceIPD103 variant 91aaggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaccccgca aggtcatcac cgtggaggtg gacgccgctg ccgtaatcca
acagatcaga 180gagatcttcc gaaccatggc aagtcactac aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggacgcc gtggagtcct cccacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tacgtcttca agtccggcgt cttcaccaac
420ctgggagacg gaggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
51992522DNAArtificial SequenceIPD103 variant 92atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcttgggcgc ggacgtgaag
120ttgcaacccc gcaacatcat caccgtggag gtggacgcgg ctgccgtaat
ccagcagatc 180agagagatct tccagacaat ggcgcgtcac ttcaactcta
cgagggtggt gcgggatgaa 240gccatcaagg gcattcgaga ccacttcagg
gccgccgtcc cgactcgcaa cgtggtggtc 300attcacactc agcacgttca
cacactggac gccgtggagt cctcccacct cgtcttgcgg 360accggcctgt
tcaaaaaggt ccctgtcgac atctatgtct tcaagtccgg cgtcttcacc
420aacctgggag acggaggctt catcaactgg gcatggggtg gcttcgtcga
ccaggtcgtc 480ggcaagcgta tccacttccg cttgcccccc ggggcgctcc ct
52293513DNAArtificial SequenceIPD103 variant 93atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgcg gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51394516DNAArtificial SequenceIPD103 variant 94atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagaggt ggagacgacg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagagcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccaacctg
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
51695513DNAArtificial SequenceIPD103 variant 95atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51396517DNAArtificial SequenceIPD103
variantmisc_feature(469)..(469)n is a, c, g, or
tmisc_feature(494)..(494)n is a, c, g, or t 96atggcggacg aagtagcagg
tcaccatggt ccagcactga agaagaggag agagagatgg 60atgatggacg agacgagacg
aggcggtgca cctgcacgtg atcgccggtc tggaggtgca 120accccgcagc
atcatcaccg tggaggtgga cgccgctgcc gtaatccagc agatcagaga
180gatcttccag acaatggcga gtcacttcaa ctctacgagg gtggtgcggg
atgaagccat 240caagggcatt cgagaccact tcagggccgc cgtcccgact
cgcaacgtgg tggtcattca 300cactcagcac gttcacacac tggaggccgt
ggagtcctcc cacctcgtct tgcggaccgg 360cctgttcaaa aaggtccctg
tcgacatcta cgtcttcaag tccggcgtct tcaccctcct 420tggagacgga
ggcttcatca actgggcatg gggtggcttc gtcgtccang tcgtcggcaa
480gcgtgtccac ttcngccggc cccccggggc gctccct 51797513DNAArtificial
SequenceIPD103 variantmisc_feature(412)..(412)n is a, c, g, or t
97atggcggacc cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg
60gacgagagtg aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccatcagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcatttgag accacttcag ggccgctgtc
ccgactcgca acgtggtggt cattcactcc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcatg 360ttcaaaaagg
tccccgtcga catctttgtc ttcaagtccg gcgtcttcac cntccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
51398513DNAArtificial SequenceIPD103 variant 98atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
51399513DNAArtificial SequenceIPD103 variant 99atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctttgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513100513DNAArtificial SequenceIPD103 variant 100atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513101519DNAArtificial SequenceIPD103 variant 101atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca aggtcatcac cgtggaggtg gacgccgctg ccgtaatcca
acagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactcgacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacacccagc acattcacac
actggagggc ttggagcaca ccaacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tacgtcttca agtccggcgt cttcaccctc
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519102513DNAArtificial SequenceIPD103 variant 102atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513103522DNAArtificial SequenceIPD103 variant 103atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcttgggcgc ggacgtgaag
120ttgcaacccc gcaaggtcat caccgtggag gtggacgccg ctgccgtaat
ccaacagatc 180agagagatct tccgaaccat ggcaagtcac ttcaactcga
cgagggtggt gcgggatgaa 240gccatcaagg gcattcgaga ccacttcagg
gccgccgtcc cgactcgcaa cgtggtggtc 300gttcacactc agcacgttca
cacactggtg ggcttggagc acacccacct cgtcttgcag 360accggcctct
tcaaaaaggt ccccgtcgac atctatgtct tcaagtccgg cgtcttcacc
420aacctgggag acggaggctt catcaactgg gcatggggtg gcttcgtcga
ccaggtcgtc 480ggcaagcgta tccacttccg cttgcccccc ggggcgctcc ct
522104507DNAArtificial SequenceIPD103 variant 104atggcggacg
aagtagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg ggtgcacgcg atcgacggtc tgccggtgca aaaccgcagc
120atcatcaccg tggaggtgga cgccgctgcc gtaatccagc agatcagaga
gatcttccga 180accatggcaa gtcacttcaa ctcgacgagg gtggtgcggg
atgaagccat caagggcatt 240cgagaccact tcaggctcgc cgtcccgact
cgcaacgtgg tggtcattca cactcagcac 300gttcacacac tggtgggctt
ggagcacacc cacctcgtct tgcagaccgg catcttcaaa 360aaggtccccg
tcgacatcta tgtcttcaag tccggcgtct tcaccaacct tggagacgga
420ggcttcatca actgggcatg gggtggcttc gtcgaccagg tcgtcggcaa
gcgtatccac 480ttccgcttgc cccccggggc gctccct 507105513DNAArtificial
SequenceIPD103 variant 105atggcggaca aagcagcagc agcagctaga
gaagctgaag aagaggtgga gacgacgatg 60gacgagactg aggcggtggg gacgcacctg
gacttcgtgg cgggcttgga ggtgcaaccc 120cgcaaggtca tcaccgtgga
ggtggacgcc gctgccgtaa tccagcagat cagagagatc 180ttccgaacca
tggcaagtca cttcaactcg acgagggtgg tgcgggatga agccatcaag
240ggcattcgag accacttcag ggccgccgtc ccgactcgca acgtggtggt
cattcacact 300cagcacgttc acacactgga cgccgtggag tcctcccacc
tcgtcttgcg gaccggcctg 360ttcaaaaagg tccccgtcga catctacgtc
ttcaagtccg gcgtcttcac caacctggga 420gacggaggct tcatcaactg
ggcatggggt ggcttcggcg tcaaccacac cgccaagcgt 480gtcgtcttca
gccggccccc cggggcgctc cct 513106516DNAArtificial SequenceIPD103
variant 106atggcggaca aagcagcagc agcagctaga gaagctgaag aagaggtgga
gacgacgatg 60gacgagactg aggcggtggg gacgcacctg gacttcttgg gcgcggacgt
gaagttgcaa 120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg
taatccagca gatcagagag 180atcttccgaa ccatggcaag tcacttcaac
tcgacgaggg tggtgcggga tgaagccatc 240aagggcattt gagaccactt
cagggccgcc gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca
ttcacacact ggagggcttg gagcacacca acctcgtctt gcagaccggc
360ctcttcaaaa aggtccccgt cgacatctat gtcttcaagt ccggcgtctt
caccaacctt 420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg
tacaggaggt cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516107516DNAArtificial SequenceIPD103 variant 107atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagaggt ggagacgacg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagagcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcacg ttcacacact
ggtgggcttg gagcacacca acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggc
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516108513DNAArtificial SequenceIPD103 variant 108atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggcgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gagttgatgg cgggcttgga ggtgcaaccc
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accccttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcactcc 300cagcacattc acacactggt
gggcttggag cacacccacc tcgtgttgca gaccggcatg 360ttcaaaaagg
tccccgtcga catctatctc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac agcaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcggtc ccc
513109513DNAArtificial SequenceIPD103 variant 109atagccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513110513DNAArtificial SequenceIPD103 variant 110atggccgacc
cagcaacagc agcagctaga gaagatgaag aagaggtgga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgttttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480gtcctcttca gccggccccc cggggcgctc cct
513111513DNAArtificial SequenceIPD103 variant 111atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513112513DNAArtificial SequenceIPD103 variant 112atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactggt
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513113513DNAArtificial SequenceIPD103 variant 113atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513114516DNAArtificial SequenceIPD103 variant 114atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg
gcgcggacgt gaagttgcaa 120ccccgcaagg tcatcaccgt ggaggtggac
gccgctgccg taatccagca gatcagagag 180atcttccgaa ccatggcaag
tcacttcaac tcgacgaggg tggtgcggga tgaagccatc 240aagggcattc
gagaccactt cagggccgcc gtcccgactc gcaacgtggt ggtcgttcac
300acccagcacg ttcacacact ggtgggcttg gagcacacca acctcgtctt
gcagaccggc 360atcttcaaaa aggtccccgt cgacatctac gtcttcaagt
ccggcgtctt caccaacctt 420ggagacggag gcttcatcaa ctgggcatgg
ggtggcttcg tacaggaggt cgccggcaag 480cgtatccact tccgcttgcc
ccccggggcg ctccct 516115513DNAArtificial SequenceIPD103 variant
115atggcggaca aagcagcagc agcagctaga gaagctgaag aagaggtgga
gacgacgatg 60gacgagactg aggcggtggg gacgcacctg gacttcgtgg cgggcttgga
ggtgcaaccc 120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa
tccaacagat cagagagatc 180ttccagacaa tggcgcgtca cttcaactct
acgagggtgg tgcgggatga agccatcaag 240ggcattcgag accacttcag
ggccgccgtc ccgactcgca acgtggtggt cgttcacacc 300cagcacattc
acacactgga gggcttggag cacacccacc tcgtcttgca gaccggcctc
360ttcaaaaagg tccccgtcga catctatgtc ttcaagtccg gcgtcttcac
caaccttgga 420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg
accaggtcgt cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513116510DNAArtificial SequenceIPD103 variant 116atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc aacagatcag
agagatcttc 180cagacaatgg cgcgtcactt caactctacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcat tcacactcag 300cacgttcaca cactggaggg
cttggagcac accaacctcg tcttgcagac cggcatcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtacagg aggtcgccgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510117516DNAArtificial SequenceIPD103 variant 117atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcacg ttcacacatt
ggagggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516118510DNAArtificial SequenceIPD103 variant 118atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aacatcatca ccgtggaggt ggacgcggct gccgtaatcc agcagatcag
agagatcttc 180cagacaatgg cgagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacattcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtacagg aggtcgccgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510119516DNAArtificial SequenceIPD103 variant 119atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516120513DNAArtificial SequenceIPD103 variant 120atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513121510DNAArtificial SequenceIPD103 variant 121atggccgacc
cagcagcagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aacatcatca ccgtggaggt ggacgcggct gccgtaatcc aacagatcag
cgagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacattcaca cactggaggg
cttggagcac acccacctcg tcttgcagac cggcatcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510122516DNAArtificial SequenceIPD103 variant 122atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516123516DNAArtificial SequenceIPD103 variant 123atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggagggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516124513DNAArtificial SequenceIPD103 variant 124atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513125516DNAArtificial SequenceIPD103 variant 125atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516126516DNAArtificial SequenceIPD103 variant 126atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516127513DNAArtificial SequenceIPD103 variant 127atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513128519DNAArtificial SequenceIPD103 variant 128atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgccgctg ccgtaatcca
gcagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacacccagc acattcacac
actggagggc ttggagcaca cccacctcgt cttgcagacc 360ggcctcttca
aaaaggtccc cgtcgacatc tacgtcttca agtccggcgt cttcaccctc
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519129510DNAArtificial SequenceIPD103 variant 129atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc aacagatcag
agagatcttc 180cagacaatgg cgcgtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacattcaca cactggaggg
cttggagcac accaacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtacagg aggtcgccgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510130513DNAArtificial SequenceIPD103 variant 130atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513131513DNAArtificial SequenceIPD103 variant 131atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513132516DNAArtificial SequenceIPD103 variant 132atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516133513DNAArtificial SequenceIPD103 variant 133atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513134516DNAArtificial SequenceIPD103 variant 134atggcggaca
aagcagcagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516135513DNAArtificial SequenceIPD103 variant 135atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513136513DNAArtificial SequenceIPD103 variant 136atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513137513DNAArtificial SequenceIPD103 variant 137atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513138513DNAArtificial SequenceIPD103 variant 138atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513139516DNAArtificial SequenceIPD103 variant 139atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516140516DNAArtificial SequenceIPD103 variant 140atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt
ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa 120ccccgcaagg
tcatcaccgt ggaggtggac gccgctgccg taatccagca gatcagagag
180atcttccaga caatggcgcg tcacttcaac tctacgaggg tggtgcggga
tgaagccatc 240aagggcattc gagaccactt cagggccgcc gtcccgactc
gcaacgtggt ggtcgttcac 300actcagcacg ttcacacact ggtgggcttg
gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa aggtccccgt
cgacatctac gtcttcaagt ccggcgtctt caccaacctt 420ggagacggag
gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt cgccggcaag
480cgtatccact tccgcttgcc ccccggggcg ctccct 516141513DNAArtificial
SequenceIPD103 variant 141atggccgacc cagcaacagc agctagagaa
gctgaagaag aggtgcagga gactttgatg 60gacgagactg aggcggtggg gacgcacctg
gacttcgtgg cgggcttgga ggtgcaaccc 120cgcaaggtca tcaccgtgga
ggtggacgcc gctgccgtaa tccagcagat cagagagatc 180ttccgaacca
tggcaagtca cttcaactcg acgagggtgg tgcgggatga agccatcaag
240ggcattcgag accacttcag ggccgccgtc ccgactcgca acgtggtggt
cgttcacact 300cagcacgttc acacactgga gggcttggag cacaccaacc
tcgtcttgca gaccggcatc 360ttcaaaaagg tccccgtcga catctatgtc
ttcaagtccg gcgtcttcac cctccttgga 420gacggaggct tcatcaactg
ggcatggggt ggcttcgtcg accaggtcgt cggcaagcgt 480atccacttcc
gcttgccccc cggggcgctc cct 513142516DNAArtificial SequenceIPD103
variant 142atggcggaca aagcagcagc agcagctaga gaagctgaag aagaggtgga
gacgacgatg 60gacgagactg aggcggtggg gacgcacctg gacttcttgg gcgcggacgt
gaagttgcaa 120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg
taatccagca gatcagagag 180atcttccgaa ccatggcaag tcacttcaac
tcgacgaggg tggtgcggga tgaagccatc 240aagggcattc gagaccactt
cagggccgcc gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca
ttcacacact ggagggcttg gagcacacca acctcgtctt gcagaccggc
360ctcttcaaaa aggtccccgt cgacatctac gtcttcaagt ccggcgtctt
caccctcctt 420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg
tacaggaggt cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516143516DNAArtificial SequenceIPD103 variant 143atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516144516DNAArtificial SequenceIPD103 variant 144atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccagca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516145516DNAArtificial SequenceIPD103 variant 145atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516146510DNAArtificial SequenceIPD103 variant 146atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcat tcacactcag 300cacattcaca cactggaggg
cttggagcac accaacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctatgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtacagg aggtcgccgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510147513DNAArtificial SequenceIPD103 variant 147atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513148513DNAArtificial SequenceIPD103
variantmisc_feature(127)..(127)n is a, c, g, or t 148atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaagntca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactggt
gggcttggag cacaccaacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac catccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513149516DNAArtificial SequenceIPD103 variant 149atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516150513DNAArtificial SequenceIPD103 variant 150atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513151510DNAArtificial SequenceIPD103
variantmisc_feature(32)..(32)n is a, c, g, or t 151atggccgacc
cagcaacagc agctagagaa gntgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacattcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcatcttc 360aaaaaggtcc
ccgtcgacat ttatgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510152513DNAArtificial SequenceIPD103 variant 152atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513153516DNAArtificial SequenceIPD103 variant 153atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516154516DNAArtificial SequenceIPD103 variant 154atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516155513DNAArtificial SequenceIPD103 variant 155atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513156516DNAArtificial SequenceIPD103 variant 156atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516157513DNAArtificial SequenceIPD103 variant 157atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatt 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513158519DNAArtificial SequenceIPD103 variant 158atggccgaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccgaa ccacggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300tcccagcaca ttcacacatt
ggagggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatgtac gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctcccccga
519159513DNAArtificial SequenceIPD103 variant 159atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513160516DNAArtificial SequenceIPD103 variant 160atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516161513DNAArtificial SequenceIPD103 variant 161atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccatcagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcactcc 300cagcacattc acacattggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catgtacgta ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513162516DNAArtificial SequenceIPD103 variant 162atggcggacc
cagcaacagc agctagagaa gatgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggtttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516163513DNAArtificial SequenceIPD103 variant 163atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513164516DNAArtificial SequenceIPD103 variant 164atggcggaca
aagcagcaac agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccgga ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacagcaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516165516DNAArtificial SequenceIPD103 variant 165atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgacgaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516166519DNAArtificial SequenceIPD103 variant 166atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgcggctg ccgtaatcca
gcagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactcgacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggtgggc ttggagcaca cccacctcgt cttgctgacc 360ggcatcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccaac
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519167516DNAArtificial SequenceIPD103 variant 167atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516168513DNAArtificial SequenceIPD103 variant 168atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513169516DNAArtificial SequenceIPD103 variant 169atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516170516DNAArtificial SequenceIPD103 variant 170atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300acccagcaca ttcacacact
ggtgggcttg gagcacacca acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516171516DNAArtificial SequenceIPD103 variant 171atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcacg ttcacacact
ggagggcttg gagcacacca acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516172513DNAArtificial SequenceIPD103 variant 172atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513173516DNAArtificial SequenceIPD103 variant 173atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300acccagcaca ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516174510DNAArtificial SequenceIPD103 variant 174atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacattcaca cactggaggg
cttggaacac accaacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccaa ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510175513DNAArtificial SequenceIPD103 variant 175atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacgcc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513176519DNAArtificial SequenceIPD103 variant 176atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgccgctg ccgtaatcca
gcagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactcgacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggtgggc ttggagcaca cccacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccctc
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519177513DNAArtificial SequenceIPD103 variant 177atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacgttc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513178513DNAArtificial SequenceIPD103 variant 178ataaccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513179519DNAArtificial SequenceIPD103 variant 179atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
gtgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcacctt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcccttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300tcccagcaca ttcacacatt
ggagggattg gagcacacca acttcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt ggacatgtac gtattcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccctcga
519180513DNAArtificial SequenceIPD103 variant 180atggcggaca
aagcagcagc agcaggtaga gaagatgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagcca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513181513DNAArtificial SequenceIPD103 variant 181atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactagt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513182513DNAArtificial SequenceIPD103 variant 182atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513183519DNAArtificial SequenceIPD103 variant 183atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgcggctg ccgtaatcca
gcagatcaga 180gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacacccagc acattcacac
actggagggc ttggagcaca cccacctcgt cttgcagacc 360ggcctcttca
aaaaggtccc cgtcgacatc tacgtcttca agtccggcgt cttcaccctc
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519184513DNAArtificial SequenceIPD103 variant 184atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513185516DNAArtificial SequenceIPD103 variant 185atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggacgccgtg gagtcctccc acctcgtctt gcggaccggc 360ctgttcaaaa
aggtccctgt cgacatcttt gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516186507DNAArtificial SequenceIPD103 variant 186atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg ggtgcacgcg atcgacggtc tgccggtgca aaaccgcagc
120atcatcaccg tggaggtgga cgccgctgcc gtaatccagc agatcagaga
gatcttccga 180accatggcaa gtcacttcaa ctcgacgagg gtggtgcggg
atgaagccat caagagcatt 240cgagaccact tcaggctcgc cgtcccgact
cgcaacgtgg tggtcgttca cacccagcac 300gttcacacac tggacgccgt
ggagtcctcc cacctcgtct tgcggaccgg cctgttcaaa 360aaggtccctg
tcgacatctt tgtcttcaag tccggcgtct tcaccaacct gggagacgga
420ggcttcatca actgggcatg gggtggcttc gtacaggagg tcgccggcaa
gcgtatccac 480ttccgcttgc cccccggggc gctccct 507187516DNAArtificial
SequenceIPD103 variant 187atggcggacg aagtagcagg tcaccatggt
ccagcatgtg aagaagagga ggagacgacg 60atggacgaga ctgaggcggt ggggacgcac
ctggacttcg tggcgggctt ggaggtgcaa 120ccccgcaagg tcatcaccgt
ggaggtggac gccgctgccg taatccagca gatcagagag 180atcttccgaa
ccatggcaag tcacttcaac tcgacgaggg tggtgcggga tgaagccatc
240aagggcattc gagaccactt cagggccgcc gtcccgactc gcaacgtggt
ggtcgttcac 300actcagcacg ttcacacact ggacgccgtg gagtcctccc
acctcgtctt gcggaccggc 360ctgttcaaaa aggtccctgt cgacatcttt
gtcttcaagt ccggcgtctt caccaacctg 420ggagacggag gcttcatcaa
ctgggcatgg ggtggctacg tacaggaggt cgtcggcaag 480cgtatccact
tccgcttgcc ccccggggcg ctccct 516188513DNAArtificial SequenceIPD103
variant 188atggcggacg aagtagcagg tcaccatggt ccagcatgtg aagaagagga
ggaggaaatg 60ctgatggacg agactgaggc ggtgggggtg cacgcgatcg acggtctgcc
ggtgcaaaac 120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa
tccagcagat cagagagatc 180ttccgaacca tggcaagtca cttcaactcg
acgagggtgg tgcgggatga agccatcaag 240ggcattcgag accacttcag
gctcgccgtc ccgactcgca acgtggtggt cattcacact 300cagcacgttc
acacactgga cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg
360ttcaaaaagg tccctgtcga catctttgtc ttcaagtccg gcgtcttcac
caacctggga 420gacggaggct tcatcaactg ggcatggggt ggctacggcg
tcaaccacac cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513189510DNAArtificial SequenceIPD103 variant 189atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcgtggcgg gcttggaggt gcaaccccgc
120aaggtcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cagacaatgg cgcgtcactt caactctacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcat tcacactcag 300cacgttcaca cactggacgc
cgtggagtcc tcccacctcg tcttgcggac cggcctgttc 360aaaaaggtcc
ctgtcgacat ctttgtcttc aagtccggcg tcttcaccaa cctgggagac
420ggaggcttca tcaactgggc atggggtggc tacgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510190516DNAArtificial SequenceIPD103 variant 190atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggagaggacg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttcg tggcgggctt ggaggtgcaa
120ccccgcaagg tcatcaccgt ggaggtggac gccgctgccg taatccagca
tatcagagag 180atcttcggaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcacg ttcacacact
ggacgccgtg gagtcctccc acctcgtctt gcggaccggc 360ctgttcaaaa
aggtccctgt cgacatcttt gtcttcaagt ccggcgtctt caccaacctg
420ggagacggag gcttcatcaa ctgggcatgg ggtggctacg tacaggaggt
cgtcggcaag 480cgtatccact tccgcctgcc ccccggggcg ctccct
516191519DNAArtificial SequenceIPD103 variant 191atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaccccgca aggtcatcac cgtggaggtg gacgccgctg ccgtaatcca
gcagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactcgacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcaggctc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacactcagc acgttcacac
actggacgcc gtggagtcct cccacctcgt cttgcggacc 360ggcctgttca
aaaaggtccc tgtcgacatc tttgtcttca agtccggcgt cttcaccaac
420ctgggagacg gaggcttcat caactgggca tggggtggct acggcgtcaa
ccacaccgcc 480aagcgtgtcg tcttcagccg gccccccggg gcgctccct
519192513DNAArtificial SequenceIPD103 variant 192atggcggacg
cagcagcagc agctgctaga gaagaagaag aagagcagga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagtcaa tgatcagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggtcgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
gggcgtggag tcctcccacc tcgtcttgca gaccggcatg 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac catcctggga
420gacggaggct tcatcaactg ggcatggggt ggcttcggcg accaggtcgt
cggcaagcgt 480gtccacttcc gcctgccccc cggggcgctc cct
513193513DNAArtificial SequenceIPD103 variant 193atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctttgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513194519DNAArtificial SequenceIPD103 variant 194atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaccccgca acatcatcac cgtggaggtg gacgccgctg ccgtaatcca
acagatcaga 180gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggacgcc gtggagtcct cccacctcgt cttgcggacc 360ggcctgttca
aaaaggtccc tgtcgacatc tttgtcttca agtccggcgt cttcaccaac
420ctgggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519195513DNAArtificial SequenceIPD103 variant 195atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcgtggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513196510DNAArtificial SequenceIPD103 variant 196atggcggacg
aagcagcagc agcagctaga gaagctgaag aagaggagga ggaaatgctg 60atggacgaga
ctgaggcggt gggggtgcac gcgatcgacg gtctgccggt gcaaaaccgc
120agcatcatca ccgtggaggt ggacgccgct gccgtaatcc aacagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcaggct cgccgtcccg
actcgcaacg tggtggtcat tcacactcag 300cacattcaca cactggtggg
cttggagtcc tcccacctcg ccttgcggac cggcctgttc 360aaaaaggtcc
ctgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510197516DNAArtificial SequenceIPD103 variant 197atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacacca acctcgtctt gcggaccggc 360ctgttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516198510DNAArtificial SequenceIPD103 variant 198atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagaggt ggagacgacg 60atggacgaga
ctgaggcggt gggggtgcac gcgatcgacg gtctgccggt gcaaaaccgc
120agcatcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcaggct cgccgtcccg
actcgcaacg tggtggtcgt tcacacccag 300cacgttcaca cactggaggg
cttggagcac accaacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtacagg aggtcgccgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510199513DNAArtificial SequenceIPD103 variant 199atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513200513DNAArtificial SequenceIPD103 variant 200atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacgttc acacactgga
gggcttggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513201513DNAArtificial SequenceIPD103 variant 201atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgcgtcaa tgatcaaaca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513202513DNAArtificial SequenceIPD103 variant 202atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctg 360ttcaaaaagg
tccctgtcga catctacgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtac aggaggtcgc
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513203513DNAArtificial SequenceIPD103 variant 203atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtgcagga gactttgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513204513DNAArtificial SequenceIPD103 variant 204atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catttttgtc ttcaagtccg gtgttttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513205516DNAArtificial SequenceIPD103 variant 205atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccagca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tcgacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcgttcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctac gtcttcaagt ccggcgtctt caccctcctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516206519DNAArtificial SequenceIPD103 variant 206atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaaaccgca gcatcatcac cgtggaggtg gacgccgctg ccgtaatcca
acagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactcgacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcaggctc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacactcagc acgttcacac
actggacgcc gtggagtcct cccacctcgt cttgcggacc 360ggcctgttca
aaaaggtccc tgtcgacatc tttgtcttca agtccggcgt cttcaccaac
420ctgggagacg gaggcttcat caactgggca tggggtggct acggcgtcaa
ccacaccgcc 480aagcgtgtcg tcttcagccg gccccccggg gcgctccct
519207513DNAArtificial SequenceIPD103 variant 207atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513208516DNAArtificial SequenceIPD103 variant 208atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gccgctgccg taatccaaca
gatcagagag 180atcttccgaa ccatggcaag tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360ctcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctg
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tacaggaggt
cgccggcaag 480cgtatccact tccgccggcc ccccggggcg ctccct
516209513DNAArtificial SequenceIPD103 variant 209atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgcgtcaa tgatcaaaca ctacaactct acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacgttc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513210513DNAArtificial SequenceIPD103 variant 210atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513211513DNAArtificial SequenceIPD103 variant 211atggccgacc
cagcaacagc agctagagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120cgcaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccagcagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacacc 300cagcacgttc acacactgga
cgccgtggag tcctcccgcc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513212519DNAArtificial SequenceIPD103 variant 212atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca aggtcatcac cgtggaggtg gacgcggctg ccgtaatcca
gcagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacactcagc acgttcacac
actggacgcc gtggagtcct cccacctcgt cttgcggacc 360ggcctgttca
aaaaggtccc cgtcgacatc tacgtcttca agtccggcgt cttcaccctc
420cttggagacg ggggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519213513DNAArtificial SequenceIPD103 variant 213atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgcgtcaa tgatcaaaca ctacaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513214519DNAArtificial SequenceIPD103 variant 214atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaccccgca aggtcatcac cgtggaggtg gacgccgctg ccgtaatcca
acagatcaga 180gagatcttcc agacaatggc gcgtcactac aactctacga
gggtggtgcg ggatgaagcc 240atcaagagca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcgtt 300cacacccagc acattcacac
actggacgcc gtggagtcct cccacctcgt cttgcggacc 360ggcctgttca
aaaaggtccc tgtcgacatc tttgtcttca agtccggcgt cttcaccaac
420ctgggagacg gaggcttcat caactgggca tggggtggct tcgtacagga
ggtcgccggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519215513DNAArtificial SequenceIPD103 variant 215atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg ggtgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgggtcca tgatcaatca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
ggccgtggag tcctcccacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcggac tcgagctcgc
cggcaagcgt 480gtccacttcc gccggccccc cggggcgctc cct
513216513DNAArtificial SequenceIPD103 variant 216atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgca gaccggcctc 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513217510DNAArtificial SequenceIPD103 variant 217atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt gggggtgcac gcgatcgacg gtctgccggt gcaaaaccgc
120agcatcatca ccgtggaggt ggacgccgct gccgtaatcc agcagatcag
agagatcttc 180gcgtcaatga tcaaacacta caactctacg agggtggtgc
gggatgaagc catcaagagc 240attcgagacc acttcaggct cgccgtcccg
actcgcaacg tggtggtcat tcacactcag 300cacgttcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcctcttc 360aaaaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg
ggcgctccct 510218513DNAArtificial SequenceIPD103 variant
218atggcggacg aagtagcagg tcaccatggt ccagcatgtg aagaagagga
ggaggaaatg 60ctgatggacg agactgaggc ggtgggggtg cacgcgatcg acggtctgcc
ggtgcaaaac 120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa
tccagcagat cagagagatc 180ttccgaacca tggcaagtca cttcaactcg
acgagggtgg tgcgggatga agccatcaag 240agcattcgag accacttcag
gctcgccgtc ccgactcgca acgtggtggt cgttcacact 300cagcacgttc
acacactgga cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg
360ttcaaaaagg tccctgtcga catctttgtc ttcaagtccg gcgtcttcac
cctccttgga 420gacggaggct tcatcaactg ggcatggggt ggctacggcg
tcaaccacac cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513219519DNAArtificial SequenceIPD103 variant 219atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcgtggcggg cttggaggtg
120caaccccgca aggtcatcac cgtggaggtg gacgccgctg ccgtaatcca
gcagatcaga 180gagatcttcc gaaccatggc aagtcacttc aactcgacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggacgcc gtggagtcct cccacctcgt cttgcggacc 360ggcctgttca
aaaaggtccc tgtcgacatc tttgtcttca agtccggcgt cttcaccctc
420cttggagacg gaggcttcat caactgggca tggggtggct acgtacagga
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519220513DNAArtificial SequenceIPD103 variant 220atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgcgtcaa tgatcaaaca ctacaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
gggcttggag cacaccaacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513221513DNAArtificial SequenceIPD103 variant 221atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcgtgg cgggcttgga ggtgcaaccc
120cgcaaggtca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cgttcacacc 300cagcacattc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513222513DNAArtificial SequenceIPD103 variant 222atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccaaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac caacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513223522DNAArtificial SequenceIPD103 variant 223atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtggggacg cacctggact tcttgggcgc ggacgtgaag
120ttgcaacccc gcaacatcat caccgtggag gtggacgcgg ctgccgtaat
ccaacagatc 180agagagatct tccagacaat ggcgcgtcac ttcaactcga
cgagggtggt gcgggatgaa 240gccatcaagg gcattcgaga ccacttcagg
gccgccgtcc cgactcgcaa cgtggtggtc 300gttcacaccc agcacattca
cacactggag ggcttggagc acaccaacct cgtcttgcag 360accggcctct
tcaaaaaggt ccccgtcgac atctatgtct tcaagtccgg cgtcttcacc
420aaccttggag acggaggctt catcaactgg gcatggggtg gcttcgtaca
ggaggtcgcc 480ggcaagcgta tccacttccg cttgcccccc ggggcgctcc ct
522224511DNAArtificial SequenceIPD103 variant 224atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc ctgccgtaat ccaacagatc
agagagatct 180tcgaaccatg gcaagtcact tcaactcgac gagggtggtg
cgggatgaag ccatcaagag 240cattcgagac cacttcaggc tcgccgtccc
gactcgcaac gtggtggtca ttcacactca 300gcacgttcac acactggacg
ccgtggagtc ctcccacctc gtcttgcgga ccggcctgtt 360caaaaaggtc
cctgtcgaca tctacgtctt caagtccggc gtcttcacca accttggaga
420cggaggcttc atcaactggg catggggtgg ctacggcgtc aaccacaccg
ccaagcgtgt 480cgtcttcagc cggccccccg gggcgctccc t
511225513DNAArtificial SequenceIPD103 variant 225atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgcgtcaa tgatcaaaca ctacaactct acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac taacctggga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513226510DNAArtificial SequenceIPD103 variant 226atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgca ggagactttg 60atggacgaga
ctgaggcggt gggggtgcac gcgatcgacg gtctgccggt gcaaccccgc
120aacatcatca ccgtggaggt ggacgcggct gccgtaatcc aacagatcag
agagatcttc 180cgaaccatgg caagtcactt caactcgacg agggtggtgc
gggatgaagc catcaagggc 240attcgagacc acttcagggc cgccgtcccg
actcgcaacg tggtggtcgt tcacactcag 300cacgttcaca cactggtggg
cttggagcac acccacctcg tcttgcagac cggcctcttc 360ataaaggtcc
ccgtcgacat ctacgtcttc aagtccggcg tcttcaccct ccttggagac
420ggaggcttca tcaactgggc atggggtggc ttcgtcgacc aggtcgtcgg
caagcgtatc 480cacttccgct tgccccccgg ggcgctccct
510227513DNAArtificial SequenceIPD103 variant 227atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat
cagagagatc 180ttcgcgtcaa tgatcaaaca ctacaactct acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgca gaccggcctg 360ttcaaaaagg
tccccgtcga catctacgtc ttcaagtccg gcgtcttcac cctccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513228513DNAArtificial SequenceIPD103 variant 228atggcggacg
aagtagcagg tcaccatggt ccagcatgtg aagaagagga ggaggaaatg 60ctgatggacg
agactgaggc ggtgggggtg cacgcgatcg acggtctgcc ggtgcaaaac
120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa tccagcagat
cagagagatc 180ttccgaacca tggcaagtca cttcaactcg acgagggtgg
tgcgggatga agccatcaag 240agcattcgag accacttcag gctcgccgtc
ccgactcgca acgtggtggt cgttcacact 300cagcacgttc acacactgga
cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg 360ttcaaaaagg
tccctgtcga catctttgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggctacggcg tcaaccacac
cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc cct
513229171PRTArtificial SequenceIPD103 variant 229Met Ala Asp Pro
Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met
Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu 20 25 30Gly Ala
Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu
His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170230170PRTArtificial SequenceIPD103
variant 230Met Ala Asp Pro Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu
Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu
Asp Phe Val 20 25 30Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr
Val Glu Val Asp 35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile
Phe Gln Thr Met Ala 50 55 60Arg His Phe Asn Ser Thr Arg Val Val Arg
Asp Glu Ala Ile Lys Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala
Val Pro Thr Arg Asn Val Val Val 85 90 95Val His Thr Gln His Ile His
Thr Leu Val Gly Leu Glu His Thr His 100 105 110Leu Val Leu Gln Thr
Gly Ile Phe Lys Lys Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys
Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn
Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg Ile145 150
155 160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170231172PRTArtificial SequenceIPD103 variant 231Met Ala Asp Pro
Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly
Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55
60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170232172PRTArtificial
SequenceIPD103 variant 232Met Ala Asp Lys Thr Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
Asn Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170233171PRTArtificial SequenceIPD103 variant 233Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val
35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170234171PRTArtificial
SequenceIPD103 variantmisc_feature(138)..(138)Xaa can be any
naturally occurring amino acid 234Met Ala Asp Lys Ala Ala Ala Ala
Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val
Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Pro Ile Lys65 70 75 80Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val
Ile His Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105
110His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile
115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Xaa Leu Gly Asp Gly
Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val
Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala
Val Pro 165 170235171PRTArtificial SequenceIPD103 variant 235Met
Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10
15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe
20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu
Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg
Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu
Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala
Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170236171PRTArtificial
SequenceIPD103 variant 236Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170237173PRTArtificial
SequenceIPD103 variant 237Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Leu Gly Ala Asp Val Lys Leu
Gln Pro Arg Asn Ile Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Arg 50 55 60Thr Met Ala Ser His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val
Val His Thr Gln His Val His Thr Leu Val Gly Leu Glu 100 105 110His
Thr Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val 115 120
125Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly
130 135 140Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val
Ala Gly145 150 155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 170238172PRTArtificial SequenceIPD103 variant 238Met
Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10
15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe
20 25 30Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val
Glu 35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe
Arg Thr 50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp
Glu Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val
Pro Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr
Leu Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly
Leu Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser
Gly Val Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp
Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg
Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170239171PRTArtificial SequenceIPD103 variant 239Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55
60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu
His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170240171PRTArtificial SequenceIPD103
variant 240Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His
Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His Val
His Thr Leu Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln
Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150
155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170241172PRTArtificial SequenceIPD103 variant 241Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55
60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170242171PRTArtificial
SequenceIPD103 variant 242Thr Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170243170PRTArtificial SequenceIPD103 variant 243Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25 30Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val Asp 35 40
45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met Ala
50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys
Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val Val Val 85 90 95Val His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His Thr His 100 105 110Leu Val Leu Gln Thr Gly Leu Phe Lys Lys
Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys Arg Ile145 150 155 160His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170244171PRTArtificial
SequenceIPD103 variant 244Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170245171PRTArtificial SequenceIPD103 variant 245Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Val Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170246172PRTArtificial
SequenceIPD103 variant 246Met Ala Asp Lys Thr Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170247171PRTArtificial SequenceIPD103 variant 247Met Ala
Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Val Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val
35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val
Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170248172PRTArtificial
SequenceIPD103 variant 248Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Ile His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170249171PRTArtificial SequenceIPD103 variant 249Met Ala
Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val
35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170250172PRTArtificial
SequenceIPD103 variant 250Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Asn His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly
Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170251170PRTArtificial SequenceIPD103 variant 251Met Ala Asp
Pro Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25 30Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val Asp 35 40
45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala
50 55 60Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys
Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val Val Val 85 90 95Val His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His Thr Asn 100 105 110Leu Val Leu Gln Thr Gly Leu Phe Lys Lys
Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys Arg Ile145 150 155 160His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170252171PRTArtificial
SequenceIPD103 variant 252Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170253172PRTArtificial SequenceIPD103 variant 253Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Lys Val Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170254173PRTArtificial
SequenceIPD103 variant 254Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Leu Gly Ala Asp Val Lys Leu
Gln Pro Arg Lys Val Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Gln 50 55 60Thr Met Ala Arg His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val
Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu 100 105 110His
Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val 115 120
125Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly
130 135 140Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val
Ala Gly145 150 155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 170255171PRTArtificial SequenceIPD103 variant 255Met
Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10
15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe
20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu
Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg
Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His Val His Thr Leu
Val Gly Ser Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170256171PRTArtificial
SequenceIPD103 variant 256Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170257172PRTArtificial SequenceIPD103 variant 257Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Lys Val Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Val
Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170258171PRTArtificial
SequenceIPD103 variant 258Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170259171PRTArtificial SequenceIPD103 variant 259Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly
Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170260171PRTArtificial
SequenceIPD103 variant 260Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170261171PRTArtificial SequenceIPD103 variant 261Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170262171PRTArtificial
SequenceIPD103 variant 262Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170263171PRTArtificial SequenceIPD103 variant 263Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Glu Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170264171PRTArtificial
SequenceIPD103 variant 264Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135
140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys
Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170265171PRTArtificial SequenceIPD103 variant 265Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Val Gly Leu Glu
His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170266171PRTArtificial SequenceIPD103
variantmisc_feature(19)..(19)Xaa can be any naturally occurring
amino acidmisc_feature(55)..(55)Xaa can be any naturally occurring
amino acidmisc_feature(66)..(66)Xaa can be any naturally occurring
amino acid 266Met Ala Asp Thr Ala Ala Ala Ala Ala Arg Glu Asp Glu
Glu Glu Leu1 5 10 15Glu Thr Xaa Met Asp Glu Thr Glu Ala Val Gly Thr
His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val
Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Xaa Gln Ile Arg
Glu Ile Phe Arg Thr Met 50 55 60Ala Xaa His Phe Asn Ser Thr Arg Val
Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg
Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His
Val His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His Leu Val Leu
Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val
Phe Lys Ser Gly Val Phe Thr Ile Leu Gly Asp Gly Gly Phe 130 135
140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys
Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170267170PRTArtificial SequenceIPD103 variant 267Met Ala Asp Lys
Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met
Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25 30Ala Gly
Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val Asp 35 40 45Ala
Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala 50 55
60Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys Gly65
70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val
Val 85 90 95Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His
Thr Asn 100 105 110Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro
Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr Asn Leu
Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly Phe Val
Gln Glu Val Ala Gly Lys Arg Ile145 150 155 160His Phe Arg Leu Pro
Pro Gly Ala Leu Pro 165 170268170PRTArtificial SequenceIPD103
variant 268Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Glu1 5 10 15Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val
His Ala Ile 20 25 30Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr
Val Glu Val Asp 35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile
Phe Arg Thr Met Ala 50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg
Asp Glu Ala Ile Lys Ser65 70 75 80Ile Arg Asp His Phe Arg Leu Ala
Val Pro Thr Arg Asn Val Val Val 85 90 95Val His Thr Gln His Val His
Thr Leu Val Gly Leu Glu His Thr His 100 105 110Leu Val Leu Gln Thr
Gly Ile Phe Lys Lys Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys
Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn
Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg Ile145 150
155 160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170269171PRTArtificial SequenceIPD103 variant 269Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu Glu
His Thr 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170270170PRTArtificial SequenceIPD103
variant 270Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Glu1 5 10 15Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val
His Ala Ile 20 25 30Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr
Val Glu Val Asp 35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile
Phe Arg Thr Met Ala 50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg
Asp Glu Ala Ile Lys Gly65 70 75 80Ile Arg Asp His Phe Arg Leu Ala
Val Pro Thr Arg Asn Val Val Val 85 90 95Ile His Thr Gln His Val His
Thr Leu Val Gly Leu Glu His Thr His 100 105 110Leu Val Leu Gln Thr
Gly Leu Phe Lys Lys Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys
Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn
Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg Ile145 150
155 160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170271171PRTArtificial SequenceIPD103 variant 271Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu
His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170272171PRTArtificial SequenceIPD103
variant 272Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Ala Ser Met 50 55 60Ile Lys His Tyr Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His Val
His Thr Leu Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150
155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro 165
170273173PRTArtificial SequenceIPD103 variant 273Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu 20 25 30Asp Phe
Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val 35 40 45Glu
Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg 50 55
60Thr Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala65
70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn 85 90 95Val Val Val Val His Thr Gln His Ile His Thr Leu Glu Gly
Leu Glu 100 105 110His Thr His Leu Val Leu Arg Thr Gly Leu Phe Lys
Lys Val Pro Val 115 120 125Asp Ile Phe Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile Asn Trp Ala Trp Gly
Gly Tyr Val Gln Glu Val Ala Gly145 150 155 160Lys Arg Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170274174PRTArtificial
SequenceIPD103 variant 274Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu 20 25 30Asp Phe Leu Gly Ala Asp Val Lys
Leu Gln Pro Arg Asn Ile Ile Thr 35 40 45Val Glu Val Asp Ala Ala Ala
Val Ile Gln Gln Ile Arg Glu Ile Phe 50 55 60Gln Thr Met Ala Arg His
Phe Asn Ser Thr Arg Val Val Arg Asp Glu65 70 75 80Ala Ile Lys Gly
Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg 85 90 95Asn Val Val
Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu 100 105 110Glu
His Thr Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro 115 120
125Val Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp
130 135 140Gly Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu
Val Ala145 150 155 160Gly Lys Arg Ile His Phe Arg Leu Pro Pro Gly
Ala Leu Pro 165 170275172PRTArtificial SequenceIPD103 variant
275Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1
5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu
Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr
Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile
Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg
Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala
Val Pro Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His
Thr Leu Asp Ala Val Glu Ser 100 105 110Ser His Leu Val Leu Arg Thr
Gly Leu Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys
Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn
Trp Ala Trp Gly Gly Tyr Val Asp Gln Val Val Gly Lys145 150 155
160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170276171PRTArtificial SequenceIPD103 variant 276Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu Glu
His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Gln Glu Val Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170277171PRTArtificial SequenceIPD103
variant 277Met Ala Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu
Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His
Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val
His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His Leu Val Leu Gln
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150
155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170278173PRTArtificial SequenceIPD103 variant 278Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Val Gln Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu 20 25 30Asp Phe
Val Ala Gly Leu Glu Val Gln Pro Arg Ser Ile Ile Thr Val 35 40 45Glu
Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln 50 55
60Thr Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala65
70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg
Asn 85 90 95Val Val Val Val His Thr Gln His Val His Thr Leu Val Gly
Leu Glu 100 105
110His Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val
115 120 125Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly
Asp Gly 130 135 140Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp
Gln Val Val Gly145 150 155 160Lys Arg Ile His Phe Arg Leu Pro Pro
Gly Ala Leu Pro 165 170279173PRTArtificial SequenceIPD103 variant
279Lys Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1
5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Thr His
Leu 20 25 30Asp Phe Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile
Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Arg 50 55 60Thr Met Ala Ser His Tyr Asn Ser Thr Arg Val Val
Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln His Val
His Thr Leu Asp Ala Val Glu 100 105 110Ser Ser His Leu Val Leu Gln
Thr Gly Ile Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr Val Phe
Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile
Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly145 150 155
160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170280174PRTArtificial SequenceIPD103 variant 280Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu 20 25 30Asp Phe
Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr 35 40 45Val
Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe 50 55
60Gln Thr Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu65
70 75 80Ala Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg 85 90 95Asn Val Val Val Ile His Thr Gln His Val His Thr Leu Asp
Ala Val 100 105 110Glu Ser Ser His Leu Val Leu Arg Thr Gly Leu Phe
Lys Lys Val Pro 115 120 125Val Asp Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp 130 135 140Gly Gly Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val145 150 155 160Gly Lys Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170281171PRTArtificial
SequenceIPD103 variant 281Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn
Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Ser Ile Arg Asp
His Phe Arg Leu Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170282172PRTArtificial SequenceIPD103 variant 282Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Val Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe
Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Ser Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Glu
Gly Leu Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170283171PRTArtificial
SequenceIPD103 variant 283Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn
Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Ser Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His
Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170284172PRTArtificial SequenceIPD103 variant 284Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Ser Glu Glu Glu1 5 10 15Glu Glu
Arg Met Met Asp Glu Thr Glu Thr Glu Ala Val His Leu His 20 25 30Val
Ile Ala Gly Leu Glu Val Gln Pro Arg Ser Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Glu
Ala Val Glu Ser 100 105 110Ser His Leu Val Leu Arg Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Val His Val Val Gly Lys145 150 155 160Arg Val His
Phe Ser Arg Pro Pro Gly Ala Leu Pro 165 170285171PRTArtificial
SequenceIPD103 variant 285Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Ser Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile His
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Ser Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Met Phe Lys Lys Val Pro Val Asp Ile 115 120
125Phe Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170286171PRTArtificial SequenceIPD103 variant 286Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu
Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile
Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly
Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe
Ser Arg Pro Pro Gly Ala Leu Pro 165 170287171PRTArtificial
SequenceIPD103 variant 287Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn
Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Ser Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Phe Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala
Lys Arg145 150 155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro
165 170288171PRTArtificial SequenceIPD103 variant 288Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu
Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile
Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Ser Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Asp Ala
Val Glu Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170289173PRTArtificial
SequenceIPD103 variant 289Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Leu Gly Ala Asp Val Lys Leu
Gln Pro Arg Lys Val Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Arg 50 55 60Thr Met Ala Ser His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val
Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu 100 105 110His
Thr Asn Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val 115 120
125Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly
130 135 140Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val
Ala Gly145 150 155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 170290171PRTArtificial SequenceIPD103 variant 290Met
Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10
15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala
20 25 30Ile Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu
Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg
Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile Lys65 70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro
Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu
Asp Ala Val Glu Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu
Phe Lys Lys Val Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala
Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170291174PRTArtificial
SequenceIPD103 variant 291Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu 20 25 30Asp Phe Leu Gly Ala Asp Val Lys
Leu Gln Pro Arg Lys Val Ile Thr 35 40 45Val Glu Val Asp Ala Ala Ala
Val Ile Gln Gln Ile Arg Glu Ile Phe 50 55 60Arg Thr Met Ala Ser His
Phe Asn Ser Thr Arg Val Val Arg Asp Glu65 70 75 80Ala Ile Lys Gly
Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg 85 90 95Asn Val Val
Val Val His Thr Gln His Val His Thr Leu Val Gly Leu 100 105 110Glu
His Thr His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro 115 120
125Val Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp
130 135 140Gly Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln
Val Val145 150 155 160Gly Lys Arg Ile His Phe Arg Leu Pro Pro Gly
Ala Leu Pro 165 170292169PRTArtificial SequenceIPD103 variant
292Met Ala Asp Glu Val Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1
5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Val His Ala Ile
Asp 20 25 30Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val
Asp Ala 35 40 45Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
Met Ala Ser 50 55 60His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys Gly Ile65 70 75 80Arg Asp His Phe Arg Leu Ala Val Pro Thr
Arg Asn Val Val Val Ile 85 90 95His Thr Gln His Val His Thr Leu Val
Gly Leu
Glu His Thr His Leu 100 105 110Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp Ile Tyr Val 115 120 125Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly Phe Ile Asn 130 135 140Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys Arg Ile His145 150 155 160Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165293171PRTArtificial SequenceIPD103
variant 293Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His
Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val
His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His Leu Val Leu Arg
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Phe Gly Val Asn His Thr Ala Lys Arg145 150
155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro 165
170294172PRTArtificial SequenceIPD103 variant 294Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly
Ala Asp Val Lys Leu Gln Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55
60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu
Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170295172PRTArtificial
SequenceIPD103 variant 295Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Val Glu Thr Thr Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Ser Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
Asn Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Ala Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170296171PRTArtificial SequenceIPD103 variant 296Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Ala1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Glu Leu 20 25
30Met Ala Gly Leu Glu Val Gln Pro Arg Ser Ile Ile Thr Val Glu Val
35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Gly Ile Arg Asp Pro Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Val His Ser Gln His Ile His Thr Leu Val
Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Met Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Leu Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Gln Val Ala Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Val Pro 165 170297171PRTArtificial
SequenceIPD103 variant 297Ile Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170298171PRTArtificial SequenceIPD103 variant 298Met Ala Asp
Pro Ala Thr Ala Ala Ala Arg Glu Asp Glu Glu Glu Val1 5 10 15Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Val Leu Phe
Ser Arg Pro Pro Gly Ala Leu Pro 165 170299171PRTArtificial
SequenceIPD103 variant 299Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His
Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Phe Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala
Lys Arg145 150 155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro
165 170300171PRTArtificial SequenceIPD103 variant 300Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Val Gly
Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170301171PRTArtificial
SequenceIPD103 variant 301Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170302172PRTArtificial SequenceIPD103 variant 302Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Lys Val Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu Val
Gly Leu Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170303171PRTArtificial
SequenceIPD103 variant 303Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170304170PRTArtificial SequenceIPD103 variant 304Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25 30Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val Asp 35 40
45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala
50 55 60Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys
Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val Val Val 85 90 95Ile His Thr Gln His Val His Thr Leu Glu Gly Leu
Glu His Thr Asn 100 105 110Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys Arg Ile145 150 155 160His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170305172PRTArtificial
SequenceIPD103 variant 305Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Val His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170306170PRTArtificial SequenceIPD103 variant 306Met Ala
Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25
30Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val Asp
35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
Ala 50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val Val 85 90 95Val His
Thr Gln His Ile His Thr Leu Val Gly Leu Glu His Thr His 100 105
110Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile Tyr
115 120 125Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys Arg Ile145 150 155 160His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170307172PRTArtificial SequenceIPD103 variant 307Met Ala
Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Leu
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170308171PRTArtificial
SequenceIPD103 variant 308Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170309170PRTArtificial SequenceIPD103 variant 309Met Ala Asp
Pro Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25 30Ala
Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val Asp 35 40
45Ala Ala Ala Val Ile Gln Gln Ile Ser Glu Ile Phe Arg Thr Met Ala
50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys
Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val Val Val 85 90 95Val His Thr Gln His Ile His Thr Leu Glu Gly Leu
Glu His Thr His 100 105 110Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys Arg Ile145 150 155 160His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170310172PRTArtificial
SequenceIPD103 variant 310Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170311172PRTArtificial SequenceIPD103 variant 311Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln
Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25
30Phe Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg
Thr 50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu
Glu Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Leu
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170312171PRTArtificial
SequenceIPD103 variant 312Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170313172PRTArtificial SequenceIPD103 variant 313Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Val
Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170314172PRTArtificial
SequenceIPD103 variant 314Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170315171PRTArtificial SequenceIPD103 variant 315Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val
35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170316173PRTArtificial
SequenceIPD103 variant 316Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Leu Gly Ala Asp Val Lys Leu
Gln Pro Arg Asn Ile Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Arg 50 55 60Thr Met Ala Ser His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val
Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu 100 105 110His
Thr His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val 115 120
125Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly
130 135 140Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val
Ala Gly145 150 155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 170317170PRTArtificial SequenceIPD103 variant 317Met
Ala Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10
15Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val
20 25 30Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val
Asp 35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
Met Ala 50 55 60Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val Val 85 90 95Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His Thr Asn 100 105 110Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg Ile145 150 155 160His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170318171PRTArtificial
SequenceIPD103 variant 318Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170319171PRTArtificial SequenceIPD103 variant 319Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170320172PRTArtificial
SequenceIPD103 variant 320Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85
90 95Val Val Ile His Thr Gln His Val His Thr Leu Glu Gly Leu Glu
His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val
Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe
Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170321171PRTArtificial SequenceIPD103
variant 321Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His
Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Ile
His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150
155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170322172PRTArtificial SequenceIPD103 variant 322Met Ala Asp Lys
Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly
Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55
60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu
Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170323171PRTArtificial
SequenceIPD103 variant 323Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170324171PRTArtificial SequenceIPD103 variant 324Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170325171PRTArtificial
SequenceIPD103 variant 325Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170326171PRTArtificial SequenceIPD103 variant 326Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Ile His Thr Leu Glu Gly
Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170327172PRTArtificial
SequenceIPD103 variant 327Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170328172PRTArtificial SequenceIPD103 variant 328Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln
Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25
30Phe Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170329171PRTArtificial
SequenceIPD103 variant 329Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170330172PRTArtificial SequenceIPD103 variant 330Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170331172PRTArtificial
SequenceIPD103 variant 331Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170332172PRTArtificial SequenceIPD103 variant 332Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Leu
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Ala Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170333172PRTArtificial
SequenceIPD103 variant 333Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170334170PRTArtificial SequenceIPD103 variant 334Met Ala
Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25
30Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val Asp
35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
Ala 50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys Gly65 70 75 80Ile Arg Asp His Phe
Arg Ala Ala Val Pro Thr Arg Asn Val Val Val 85 90 95Ile His Thr Gln
His Ile His Thr Leu Glu Gly Leu Glu His Thr Asn 100 105 110Leu Val
Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile Tyr 115 120
125Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe Ile
130 135 140Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys
Arg Ile145 150 155 160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170335171PRTArtificial SequenceIPD103 variant 335Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu Glu
His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170336171PRTArtificial SequenceIPD103
variantmisc_feature(43)..(43)Xaa can be any naturally occurring
amino acid 336Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu
Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr
His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Xaa
Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg
Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val
Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg
Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His
Ile His Thr Leu Val Gly Leu Glu His Thr 100 105 110Asn Leu Val Leu
Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val
Phe Lys Ser Gly Val Phe Thr Ile Leu Gly Asp Gly Gly Phe 130 135
140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Val Gly Lys
Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170337172PRTArtificial SequenceIPD103 variant 337Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55
60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu
Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170338171PRTArtificial
SequenceIPD103 variant 338Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170339170PRTArtificial SequenceIPD103 variant 339Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Val 20 25 30Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val Asp 35 40
45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met Ala
50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys
Gly65 70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val Val Val 85 90 95Val His Thr Gln His Ile His Thr Leu Val Gly Leu
Glu His Thr His 100 105 110Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys Arg Ile145 150 155 160His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170340171PRTArtificial
SequenceIPD103 variant 340Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170341172PRTArtificial SequenceIPD103 variant 341Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170342172PRTArtificial
SequenceIPD103 variant 342Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Ile His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170343171PRTArtificial SequenceIPD103 variant 343Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val
35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170344172PRTArtificial
SequenceIPD103 variant 344Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170345171PRTArtificial SequenceIPD103 variant 345Met Ala
Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val
35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Val
Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170346173PRTArtificial
SequenceIPD103 variant 346Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Thr Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Ser Gln His Ile His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Met Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro Arg 165 170347171PRTArtificial SequenceIPD103 variant 347Met
Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10
15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe
20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu
Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu
Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala
Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170348172PRTArtificial
SequenceIPD103 variant 348Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55
60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170349171PRTArtificial
SequenceIPD103 variant 349Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val
Gly Thr His Leu Asp Phe Leu 20 25 30Gly Ala Asp Val Lys Leu Gln Pro
Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile His
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Ser Gln His Ile His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Met 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170350172PRTArtificial SequenceIPD103 variant 350Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Asp Glu Glu Glu Val Gln1 5 10 15Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170351171PRTArtificial
SequenceIPD103 variant 351Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170352172PRTArtificial SequenceIPD103 variant 352Met Ala Asp
Lys Ala Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe
Val Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Gln Val Val Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170353172PRTArtificial
SequenceIPD103 variant 353Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His 100 105 110Thr
Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Glu Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170354173PRTArtificial SequenceIPD103 variant 354Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln
Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25
30Phe Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val
35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe
Arg 50 55 60Thr Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp
Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val
Pro Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln His Val His Thr
Leu Val Gly Leu Glu 100 105 110His Thr His Leu Val Leu Leu Thr Gly
Ile Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr Val Phe Lys Ser
Gly Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile Asn Trp
Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly145 150 155 160Lys Arg
Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170355172PRTArtificial SequenceIPD103 variant 355Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe Val
Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55
60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170356171PRTArtificial
SequenceIPD103 variant 356Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170357172PRTArtificial SequenceIPD103 variant 357Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170358172PRTArtificial
SequenceIPD103 variant 358Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Val Ala Gly Leu Glu Val Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Ile His Thr Leu Val Gly Leu Glu His 100 105 110Thr
Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170359172PRTArtificial SequenceIPD103 variant 359Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu
Glu Gly Leu Glu His 100 105 110Thr Asn Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170360171PRTArtificial
SequenceIPD103 variant 360Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170361172PRTArtificial SequenceIPD103 variant 361Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe
Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Val His Thr Gln His Ile His Thr Leu Val
Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Leu Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170362170PRTArtificial
SequenceIPD103 variant 362Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val
Gly Thr His Leu Asp Phe Val 20 25 30Ala Gly Leu Glu Val Gln Pro Arg
Lys Val Ile Thr Val Glu Val Asp 35 40 45Ala Ala Ala Val Ile Gln Gln
Ile Arg
Glu Ile Phe Arg Thr Met Ala 50 55 60Ser His Phe Asn Ser Thr Arg Val
Val Arg Asp Glu Ala Ile Lys Gly65 70 75 80Ile Arg Asp His Phe Arg
Ala Ala Val Pro Thr Arg Asn Val Val Val 85 90 95Val His Thr Gln His
Ile His Thr Leu Glu Gly Leu Glu His Thr Asn 100 105 110Leu Val Leu
Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile Tyr 115 120 125Val
Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe Ile 130 135
140Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg
Ile145 150 155 160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170363171PRTArtificial SequenceIPD103 variant 363Met Ala Asp Pro
Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Ala Gln His Ile His Thr Leu Glu Gly Leu Glu
His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170364173PRTArtificial SequenceIPD103
variant 364Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr
His Leu Asp 20 25 30Phe Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn
Ile Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile
Arg Glu Ile Phe Arg 50 55 60Thr Met Ala Ser His Phe Asn Ser Thr Arg
Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe
Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln
His Val His Thr Leu Val Gly Leu Glu 100 105 110His Thr His Leu Val
Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr
Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly 130 135 140Gly
Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly145 150
155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170365171PRTArtificial SequenceIPD103 variant 365Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55
60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Glu Gly Leu Glu
His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170366171PRTArtificial SequenceIPD103
variant 366Ile Thr Asp Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu
Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu
Asp Phe Leu 20 25 30Gly Ala Asp Val Lys Leu Gln Pro Arg Lys Val Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val
His Thr Leu Val Gly Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150
155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170367173PRTArtificial SequenceIPD103 variant 367Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr
Leu Met Asp Glu Ser Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Leu Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55
60Met Ala Ser Pro Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Val His Ser Gln His Ile His Thr Leu Glu Gly Leu
Glu His 100 105 110Thr Asn Phe Val Leu Gln Thr Gly Leu Phe Lys Lys
Val Pro Val Asp 115 120 125Met Tyr Val Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro Arg 165 170368171PRTArtificial
SequenceIPD103 variant 368Met Ala Asp Lys Ala Ala Ala Ala Gly Arg
Glu Asp Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170369171PRTArtificial SequenceIPD103 variant 369Met Ala Asp
Pro Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Val Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170370171PRTArtificial
SequenceIPD103 variant 370Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Glu Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170371173PRTArtificial SequenceIPD103 variant 371Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu
Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe
Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val 35 40
45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
50 55 60Thr Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn 85 90 95Val Val Val Val His Thr Gln His Ile His Thr Leu
Glu Gly Leu Glu 100 105 110His Thr His Leu Val Leu Gln Thr Gly Leu
Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Leu Leu Gly Asp Gly 130 135 140Gly Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly145 150 155 160Lys Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170372171PRTArtificial
SequenceIPD103 variant 372Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn
Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Leu Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala
Lys Arg145 150 155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro
165 170373172PRTArtificial SequenceIPD103 variant 373Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Asp
Ala Val Glu Ser 100 105 110Ser His Leu Val Leu Arg Thr Gly Leu Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Phe Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170374169PRTArtificial
SequenceIPD103 variant 374Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Val His Ala Ile Asp 20 25 30Gly Leu Pro Val Gln Asn Arg Ser
Ile Ile Thr Val Glu Val Asp Ala 35 40 45Ala Ala Val Ile Gln Gln Ile
Arg Glu Ile Phe Arg Thr Met Ala Ser 50 55 60His Phe Asn Ser Thr Arg
Val Val Arg Asp Glu Ala Ile Lys Ser Ile65 70 75 80Arg Asp His Phe
Arg Leu Ala Val Pro Thr Arg Asn Val Val Val Val 85 90 95His Thr Gln
His Val His Thr Leu Asp Ala Val Glu Ser Ser His Leu 100 105 110Val
Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile Phe Val 115 120
125Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe Ile Asn
130 135 140Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg
Ile His145 150 155 160Phe Arg Leu Pro Pro Gly Ala Leu Pro
165375172PRTArtificial SequenceIPD103 variant 375Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55
60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu Asp Ala Val
Glu Ser 100 105 110Ser His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Phe Val Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Tyr Val Gln Glu Val Val Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170376171PRTArtificial
SequenceIPD103 variant 376Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn
Arg Ser Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Asp Ala
Val Glu Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe
Ser Arg Pro Pro Gly Ala Leu Pro 165 170377170PRTArtificial
SequenceIPD103 variant 377Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val
Gly Thr His Leu Asp Phe Val 20 25 30Ala Gly Leu Glu Val Gln Pro Arg
Lys Val Ile Thr Val Glu Val Asp 35 40 45Ala Ala Ala Val Ile Gln Gln
Ile Arg Glu Ile Phe Gln Thr Met Ala 50 55 60Arg His Phe Asn Ser Thr
Arg Val Val Arg Asp Glu Ala Ile Lys Gly65 70 75 80Ile Arg Asp His
Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val Val 85 90 95Ile His Thr
Gln His Val His Thr Leu Asp Ala Val Glu Ser Ser His 100 105 110Leu
Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile Phe 115 120
125Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe Ile
130 135 140Asn Trp Ala Trp Gly Gly Tyr Val Asp Gln Val Val Gly Lys
Arg Ile145 150 155 160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170378172PRTArtificial SequenceIPD103 variant 378Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Arg
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25 30Phe Val
Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln His Ile Arg Glu Ile Phe Gly Thr 50 55
60Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Val His Thr Gln His Val His Thr Leu Asp Ala Val
Glu Ser 100 105 110Ser His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Phe Val Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Tyr Val Gln Glu Val Val Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170379173PRTArtificial
SequenceIPD103 variant 379Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu 20 25 30Asp Phe Val Ala Gly Leu Glu Val
Gln Pro Arg Lys Val Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Arg 50 55 60Thr Met Ala Ser His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile
Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn 85 90 95Val Val Val
Val His Thr Gln His Val His Thr Leu Asp Ala Val Glu 100 105 110Ser
Ser His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val 115 120
125Asp Ile Phe Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly
130 135 140Gly Phe Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His
Thr Ala145 150 155 160Lys Arg Val Val Phe Ser Arg Pro Pro Gly Ala
Leu Pro 165 170380171PRTArtificial SequenceIPD103 variant 380Met
Ala Asp Ala Ala Ala Ala Ala Ala Arg Glu Glu Glu Glu Glu Gln1 5 10
15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe
20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val Glu
Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Ser Met 50 55 60Ile Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Val Ala Val Pro
Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu
Glu Gly Val Glu Ser Ser 100 105 110His Leu Val Leu Gln Thr Gly Met
Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly
Val Phe Thr Ile Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala
Trp Gly Gly Phe Gly Asp Gln Val Val Gly Lys Arg145 150 155 160Val
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170381171PRTArtificial
SequenceIPD103 variant 381Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn
Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Phe Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala
Lys Arg145 150 155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro
165 170382173PRTArtificial SequenceIPD103 variant 382Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu
Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu 20 25 30Asp
Phe Val Ala Gly Leu Glu Val Gln Pro Arg Asn Ile Ile Thr Val 35 40
45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
50 55 60Thr Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln His Val His Thr Leu
Asp Ala Val Glu 100 105 110Ser Ser His Leu Val Leu Arg Thr Gly Leu
Phe Lys Lys Val Pro Val 115 120 125Asp Ile Phe Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Gln Glu Val Ala Gly145 150 155 160Lys Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170383171PRTArtificial
SequenceIPD103 variant 383Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Ser Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Glu Gly Leu Glu His Thr 100 105 110Asn
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170384170PRTArtificial SequenceIPD103 variant 384Met Ala Asp
Glu Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Glu1 5 10 15Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala Ile 20 25 30Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val Asp 35 40
45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met Ala
50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys
Gly65 70 75 80Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn
Val Val Val 85 90 95Ile His Thr Gln His Ile His Thr Leu Val Gly Leu
Glu Ser Ser His 100 105 110Leu Ala Leu Arg Thr Gly Leu Phe Lys Lys
Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr
Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys Arg Ile145 150 155 160His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170385172PRTArtificial
SequenceIPD103 variant 385Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
Asn Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170386170PRTArtificial SequenceIPD103 variant 386Met Ala
Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Val
Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Val His Ala Ile 20 25
30Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val Asp
35 40 45Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
Ala 50 55 60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys Gly65 70 75 80Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg
Asn Val Val Val 85 90 95Val His Thr Gln His Val His Thr Leu Glu Gly
Leu Glu His Thr Asn 100 105 110Leu Val Leu Gln Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe
Thr Leu Leu Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly
Gly Phe Val Gln Glu Val Ala Gly Lys Arg Ile145 150 155 160His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170387171PRTArtificial
SequenceIPD103 variant 387Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His
Thr Gln His Ile His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170388171PRTArtificial SequenceIPD103 variant 388Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu
Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile
Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Glu Gly
Leu Glu Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe
Ser Arg Pro Pro Gly Ala Leu Pro 165 170389171PRTArtificial
SequenceIPD103 variant 389Met Ala Asp Glu Val Ala Gly His His Gly
Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr
Glu Ala Val Gly Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn
Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Ala Ser Met 50 55 60Ile Lys His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His
Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Phe Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala
Lys Arg145 150 155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro
165 170390171PRTArtificial SequenceIPD103 variant 390Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu
Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile
Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35
40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr
Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile Lys65 70 75 80Ser Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu
Gly Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe
Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp
Gly Gly Phe Val Gln Glu Val Ala Gly Lys Arg145 150 155 160Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170391171PRTArtificial
SequenceIPD103 variant 391Met Ala Asp Pro Ala Thr Ala Ala Arg Glu
Ala Glu Glu Glu Val Gln1 5 10 15Glu Thr Leu Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro
Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His
Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120
125Phe Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala
Lys Arg145 150 155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro
165 170392171PRTArtificial SequenceIPD103 variant 392Met Ala Asp
Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu
Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile
Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Asp Ala
Val Glu Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe
Ser Arg Pro Pro Gly Ala Leu Pro 165 170393172PRTArtificial
SequenceIPD103 variant 393Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Val
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170394173PRTArtificial SequenceIPD103 variant 394Met Ala
Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu
Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly Thr His Leu 20 25
30Asp Phe Val Ala Gly Leu Glu Val Gln Asn Arg Ser Ile Ile Thr Val
35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe
Arg 50 55 60Thr Met Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp
Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Leu Ala Val
Pro Thr Arg Asn 85 90 95Val Val Val Val His Thr Gln His Val His Thr
Leu Asp Ala Val Glu 100 105 110Ser Ser His Leu Val Leu Arg Thr Gly
Leu Phe Lys Lys Val Pro Val 115 120 125Asp Ile Phe Val Phe Lys Ser
Gly Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile Asn Trp
Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala145 150 155 160Lys Arg
Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro 165
170395171PRTArtificial SequenceIPD103 variant 395Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55
60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Asp Ala Val Glu
Ser Ser 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170396172PRTArtificial SequenceIPD103
variant 396Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His
Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile
Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg
Glu Ile Phe Arg Thr 50 55 60Met Ala Ser His Phe Asn Ser Thr Arg Val
Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg
Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His
Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu
Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val
Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe
Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly Lys145 150
155 160Arg Ile His Phe Arg Arg Pro Pro Gly Ala Leu Pro 165
170397171PRTArtificial SequenceIPD103 variant 397Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Ala Ser Met 50 55
60Ile Lys His Tyr Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Glu Gly Leu Glu
His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170398171PRTArtificial SequenceIPD103
variant 398Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val
His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His Leu Val Leu Gln
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150
155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro 165
170399171PRTArtificial SequenceIPD103 variant 399Met Ala Asp Pro
Ala Thr Ala Ala Arg Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met
Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu 20 25 30Gly Ala
Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Asp Ala Val Glu
Ser Ser 100 105 110Arg Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe Arg Leu
Pro Pro Gly Ala Leu Pro 165 170400173PRTArtificial SequenceIPD103
variant 400Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu Ala Val Gly Thr
His Leu Asp 20 25 30Phe Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Lys
Val Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile
Arg Glu Ile Phe Arg 50 55 60Thr Met Ala Ser His Phe Asn Ser Thr Arg
Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe
Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val Val His Thr Gln
His Val His Thr Leu Asp Ala Val Glu 100 105 110Ser Ser His Leu Val
Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr
Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly 130 135 140Gly
Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly145 150
155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170401171PRTArtificial SequenceIPD103 variant 401Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Ala Ser Met 50 55
60Ile Lys His Tyr Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Asp Ala Val Glu
Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170402173PRTArtificial SequenceIPD103
variant 402Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Thr His Leu 20 25 30Asp Phe Val Ala Gly Leu Glu Val Gln Pro Arg Lys
Val Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile
Arg Glu Ile Phe Gln 50 55 60Thr Met Ala Arg His Tyr Asn Ser Thr Arg
Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Ser Ile Arg Asp His Phe
Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val Val His Thr Gln
His Ile His Thr Leu Asp Ala Val Glu 100 105 110Ser Ser His Leu Val
Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val 115 120 125Asp Ile Phe
Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly
Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala Gly145 150
155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170403171PRTArtificial SequenceIPD103 variant 403Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Val His Leu Asp Phe 20 25 30Val Ala
Gly Leu Glu Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gly Ser Met 50 55
60Ile Asn His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Ala Val Glu
Ser Ser 100 105 110His Leu Val Leu Gln Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Phe
Gly Leu Glu Leu Ala Gly Lys Arg145 150 155 160Val His Phe Arg Arg
Pro Pro Gly Ala Leu Pro 165 170404171PRTArtificial SequenceIPD103
variant 404Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Val His Ala 20 25 30Ile
Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met
50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly
Leu Glu His Thr 100 105 110Asn Leu Val Leu Gln Thr Gly Leu Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe
Ser Arg Pro Pro Gly Ala Leu Pro 165 170405170PRTArtificial
SequenceIPD103 variant 405Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr Leu Met Asp Glu Thr Glu
Ala Val Gly Val His Ala Ile 20 25 30Asp Gly Leu Pro Val Gln Asn Arg
Ser Ile Ile Thr Val Glu Val Asp 35 40 45Ala Ala Ala Val Ile Gln Gln
Ile Arg Glu Ile Phe Ala Ser Met Ile 50 55 60Lys His Tyr Asn Ser Thr
Arg Val Val Arg Asp Glu Ala Ile Lys Ser65 70 75 80Ile Arg Asp His
Phe Arg Leu Ala Val Pro Thr Arg Asn Val Val Val 85 90 95Ile His Thr
Gln His Val His Thr Leu Val Gly Leu Glu His Thr His 100 105 110Leu
Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile Tyr 115 120
125Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe Ile
130 135 140Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys
Arg Ile145 150 155 160His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170406171PRTArtificial SequenceIPD103 variant 406Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55
60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Asp Ala Val Glu
Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170407173PRTArtificial SequenceIPD103
variant 407Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Thr His Leu 20 25 30Asp Phe Val Ala Gly Leu Glu Val Gln Pro Arg Lys
Val Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile
Arg Glu Ile Phe Arg 50 55 60Thr Met Ala Ser His Phe Asn Ser Thr Arg
Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe
Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln
His Val His Thr Leu Asp Ala Val Glu 100 105 110Ser Ser His Leu Val
Leu Arg Thr Gly Leu Phe Lys Lys Val Pro Val 115 120 125Asp Ile Phe
Val Phe Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly 130 135 140Gly
Phe Ile Asn Trp Ala Trp Gly Gly Tyr Val Gln Glu Val Val Gly145 150
155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170408171PRTArtificial SequenceIPD103 variant 408Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Pro Arg Lys Val Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Ala Ser Met 50 55
60Ile Lys His Tyr Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Gly Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Ile His Thr Leu Glu Gly Leu Glu
His Thr 100 105 110Asn Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Leu
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170409171PRTArtificial SequenceIPD103
variant 409Met Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu
Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His
Leu Asp Phe 20 25 30Val Ala Gly Leu Glu Val Gln Pro Arg Lys Val Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Arg Thr Met 50 55 60Ala Ser His Phe Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Val His Thr Gln His Ile
His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His Leu Val Leu Arg
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150
155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170410171PRTArtificial SequenceIPD103 variant 410Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55
60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Asp Ala Val Glu
Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170411174PRTArtificial SequenceIPD103
variant 411Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Thr His Leu 20 25 30Asp Phe Leu Gly Ala Asp Val Lys Leu Gln Pro Arg
Asn Ile Ile Thr 35 40 45Val Glu Val Asp Ala Ala Ala Val Ile Gln Gln
Ile Arg Glu Ile Phe 50 55 60Gln Thr Met Ala Arg His Phe Asn Ser Thr
Arg Val Val Arg Asp Glu65 70 75 80Ala Ile Lys Gly Ile Arg Asp His
Phe Arg Ala Ala Val Pro Thr Arg 85 90 95Asn Val Val Val Val His Thr
Gln His Ile His Thr Leu Glu Gly Leu 100 105 110Glu His Thr Asn Leu
Val Leu Gln Thr Gly Leu Phe Lys Lys Val Pro 115 120 125Val Asp Ile
Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp 130 135 140Gly
Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Gln Glu Val Ala145 150
155 160Gly Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170412171PRTArtificial SequenceIPD103 variant 412Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55
60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Asp Ala Val Glu
Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170413171PRTArtificial SequenceIPD103
variant 413Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Ala Ser Met 50 55 60Ile Lys His Tyr Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Ser Ile Arg Asp His Phe Arg Leu
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val
His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His Leu Val Leu Arg
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150
155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro 165
170414170PRTArtificial SequenceIPD103 variant 414Met Ala Asp Lys
Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Gln Glu Thr
Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala Ile 20 25 30Asp Gly
Leu Pro Val Gln Pro Arg Asn Ile Ile Thr Val Glu Val Asp 35 40 45Ala
Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met Ala 50 55
60Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys Gly65
70 75 80Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val
Val 85 90 95Val His Thr Gln His Val His Thr Leu Val Gly Leu Glu His
Thr His 100 105 110Leu Val Leu Gln Thr Gly Leu Phe Ile Lys Val Pro
Val Asp Ile Tyr 115 120 125Val Phe Lys Ser Gly Val Phe Thr Leu Leu
Gly Asp Gly Gly Phe Ile 130 135 140Asn Trp Ala Trp Gly Gly Phe Val
Asp Gln Val Val Gly Lys Arg Ile145 150 155 160His Phe Arg Leu Pro
Pro Gly Ala Leu Pro 165 170415171PRTArtificial SequenceIPD103
variant 415Met Ala Asp Glu Val Ala Gly His His Gly Pro Ala Cys Glu
Glu Glu1 5 10 15Glu Glu Glu Met Leu Met Asp Glu Thr Glu Ala Val Gly
Val His Ala 20 25 30Ile Asp Gly Leu Pro Val Gln Asn Arg Ser Ile Ile
Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu
Ile Phe Ala Ser Met 50 55 60Ile Lys His Tyr Asn Ser Thr Arg Val Val
Arg Asp Glu Ala Ile Lys65 70 75 80Ser Ile Arg Asp His Phe Arg Leu
Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His Thr Gln His Val
His Thr Leu Asp Ala Val Glu Ser Ser 100 105 110His Leu Val Leu Gln
Thr Gly Leu Phe Lys Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe
Lys Ser Gly Val Phe Thr Leu Leu Gly Asp Gly Gly Phe 130 135 140Ile
Asn Trp Ala Trp Gly Gly Tyr Gly Val Asn His Thr Ala Lys Arg145 150
155 160Val Val Phe Ser Arg Pro Pro Gly Ala Leu Pro 165
170416171PRTArtificial SequenceIPD103 variant 416Met Ala Asp Glu
Val Ala Gly His His Gly Pro Ala Cys Glu Glu Glu1 5 10 15Glu Glu Glu
Met Leu Met Asp Glu Thr Glu Ala Val Gly Val His Ala 20 25 30Ile Asp
Gly Leu Pro Val Gln Asn Arg Ser Ile Ile Thr Val Glu Val 35 40 45Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Arg Thr Met 50 55
60Ala Ser His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys65
70 75 80Ser Ile Arg Asp His Phe Arg Leu Ala Val Pro Thr Arg Asn Val
Val 85 90 95Val Val His Thr Gln His Val His Thr Leu Asp Ala Val Glu
Ser Ser 100 105 110His Leu Val Leu Arg Thr Gly Leu Phe Lys Lys Val
Pro Val Asp Ile 115 120 125Phe Val Phe Lys Ser Gly Val Phe Thr Asn
Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly Gly Tyr
Gly Val Asn His Thr Ala Lys Arg145 150 155 160Val Val Phe Ser Arg
Pro Pro Gly Ala Leu Pro 165 170417459DNAArtificial SequenceIPD103
variant 417atggacgaga ctgaggcggt ggggacgcac ctggacttct tgggcgcgga
cgtgaagttg 60caaccccgca acatcatcac cgtggaggtg gacgcggctg ccgtaatcca
acagatcaga 120gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 180atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 240cacactcagc acgttcacac
actggtgggc ttggagcaca cccacctcgt cttgcagacc 300ggcatcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccaac
360cttggagacg gaggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 420aagcgtatcc acttccgctt gccccccggg gcgctccct
459418516DNAArtificial SequenceIPD103 variant 418atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120cccgggaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatcccct tccgcttgcc ccccggggcg ctccct
516419516DNAArtificial SequenceIPD103 variant 419atggcggaca
aagcagcagc aggagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120cccacgaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516420516DNAArtificial SequenceIPD103 variant 420atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120cccctgaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516421516DNAArtificial SequenceIPD103 variant 421atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccctaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516422516DNAArtificial SequenceIPD103 variant 422atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccctggaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516423516DNAArtificial SequenceIPD103 variant 423atggcggaca
aagcagcagc agcagctaga gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccctataaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516424516DNAArtificial SequenceIPD103 variant 424atggcggaca
aagcagcagc agcagcttat gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516425519DNAArtificial SequenceIPD103 variant 425atggcggaca
aagcagcagc agcagcagct acggaagctg aagaagaggt ggagacgacg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgcggctg ccgtaatcca
acagatcaga 180gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggtgggc ttggagcaca cccacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccaac
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519426516DNAArtificial SequenceIPD103 variant 426atggcggaca
aagcagcagc agcagctgcc gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccccgcaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516427519DNAArtificial SequenceIPD103 variant 427atggcggaca
aagcagcagc agcagcagct atggaagctg aagaagaggt ggagacgacg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgcggctg ccgtaatcca
acagatcaga 180gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggtgggc ttggagcaca cccacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccaac
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519428519DNAArtificial SequenceIPD103 variant 428atggcggaca
aagcagcagc agcagcagct agtgaagctg aagaagaggt ggagacgacg 60atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg
120caaccccgca acatcatcac cgtggaggtg gacgcggctg ccgtaatcca
acagatcaga 180gagatcttcc agacaatggc gcgtcacttc aactctacga
gggtggtgcg ggatgaagcc 240atcaagggca ttcgagacca cttcagggcc
gccgtcccga ctcgcaacgt ggtggtcatt 300cacactcagc acgttcacac
actggtgggc ttggagcaca cccacctcgt cttgcagacc 360ggcatcttca
aaaaggtccc cgtcgacatc tatgtcttca agtccggcgt cttcaccaac
420cttggagacg gaggcttcat caactgggca tggggtggct tcgtcgacca
ggtcgtcggc 480aagcgtatcc acttccgctt gccccccggg gcgctccct
519429459DNAArtificial SequenceIPD103 variant 429atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg 60caacccacga
acatcatcac cgtggaggtg gacgcggctg ccgtaatcca acagatcaga
120gagatcttcc agacaatggc gcgtcacttc aactctacga gggtggtgcg
ggatgaagcc 180atcaagggca ttcgagacca cttcagggcc gccgtcccga
ctcgcaacgt ggtggtcatt 240cacactcagc acgttcacac actggtgggc
ttggagcaca cccacctcgt cttgcagacc 300ggcatcttca aaaaggtccc
cgtcgacatc tatgtcttca agtccggcgt cttcaccaac 360cttggagacg
gaggcttcat caactgggca tggggtggct tcgtcgacca ggtcgtcggc
420aagcgtatcc acttccgctt gccccccggg gcgctccct
459430459DNAArtificial SequenceIPD103 variant 430atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg 60caaccctgga
acatcatcac cgtggaggtg gacgcggctg ccgtaatcca acagatcaga
120gagatcttcc agacaatggc gcgtcacttc aactctacga gggtggtgcg
ggatgaagcc 180atcaagggca ttcgagacca cttcagggcc gccgtcccga
ctcgcaacgt ggtggtcatt 240cacactcagc acgttcacac actggtgggc
ttggagcaca cccacctcgt cttgcagacc 300ggcatcttca aaaaggtccc
cgtcgacatc tatgtcttca agtccggcgt cttcaccaac 360cttggagacg
gaggcttcat caactgggca tggggtggct tcgtcgacca ggtcgtcggc
420aagcgtatcc acttccgctt gccccccggg gcgctccct
459431459DNAArtificial SequenceIPD103 variant 431atggacgaga
ctgaggcggt ggggacgcac ctggacttct tgggcgcgga cgtgaagttg 60caaccctata
acatcatcac cgtggaggtg gacgcggctg ccgtaatcca acagatcaga
120gagatcttcc agacaatggc gcgtcacttc aactctacga gggtggtgcg
ggatgaagcc 180atcaagggca ttcgagacca cttcagggcc gccgtcccga
ctcgcaacgt ggtggtcatt 240cacactcagc acgttcacac actggtgggc
ttggagcaca cccacctcgt cttgcagacc 300ggcatcttca aaaaggtccc
cgtcgacatc tatgtcttca agtccggcgt cttcaccaac 360cttggagacg
gaggcttcat caactgggca tggggtggct tcgtcgacca ggtcgtcggc
420aagcgtatcc acttccgctt gccccccggg gcgctccct
459432513DNAArtificial SequenceIPD103 variant 432atggcggacc
aagcagcagc agcttgtgaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120cctaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513433513DNAArtificial SequenceIPD103 variant 433atggcggacc
aagcagcagc agctgtggaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120cctaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513434513DNAArtificial SequenceIPD103 variant 434atggcggacc
aagcagcagc agctgacgaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120acgaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513435513DNAArtificial SequenceIPD103 variant 435atggcggacc
aagcagcagc agctcaagaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120ctgaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513436513DNAArtificial SequenceIPD103 variant 436atggcggacc
aagcagcagc agctggcgaa gctgaagaag aggtggagac gacgatggac 60gagactgagg
cggtggggac gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc
120ctgaacatca tcaccgtgga ggtggacgcg gctgccgtaa tccaacagat
cagagagatc 180ttccagacaa tggcgcgtca cttcaactct acgagggtgg
tgcgggatga agccatcaag 240ggcattcgag accacttcag ggccgccgtc
ccgactcgca acgtggtggt cattcacact 300cagcacgttc acacactggt
gggcttggag cacacccacc tcgtcttgca gaccggcatc 360ttcaaaaagg
tccccgtcga catctatgtc ttcaagtccg gcgtcttcac caaccttgga
420gacggaggct tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt
cggcaagcgt 480atccacttcc gcttgccccc cggggcgctc cct
513437516DNAArtificial SequenceIPD103 variant 437atggcggaca
aagcagcagc agcagctagg gcagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccctggaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516438516DNAArtificial SequenceIPD103 variant 438atggcggaca
aagcagcagc agcagctgcc gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120cccacgaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516439516DNAArtificial SequenceIPD103 variant 439atggcggaca
aagcagcagc agcagctatg gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120cccacgaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516440516DNAArtificial SequenceIPD103 variant 440atggcggaca
aagcagcagc agcagctagt gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120cccctgaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516441516DNAArtificial SequenceIPD103 variant 441atggcggaca
aagcagcagc agcagctgcc gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccctggaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516442516DNAArtificial SequenceIPD103 variant 442atggcggaca
aagcagcagc agcagctatg gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccctggaaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516443516DNAArtificial SequenceIPD103 variant 443atggcggaca
aagcagcagc agcagctatg gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccctataaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516444516DNAArtificial SequenceIPD103 variant 444atggcggaca
aagcagcagc agcagctgcc gaagctgaag aagaggtgga gacgacgatg 60gacgagactg
aggcggtggg gacgcacctg gacttcttgg gcgcggacgt gaagttgcaa
120ccctataaca tcatcaccgt ggaggtggac gcggctgccg taatccaaca
gatcagagag 180atcttccaga caatggcgcg tcacttcaac tctacgaggg
tggtgcggga tgaagccatc 240aagggcattc gagaccactt cagggccgcc
gtcccgactc gcaacgtggt ggtcattcac 300actcagcacg ttcacacact
ggtgggcttg gagcacaccc acctcgtctt gcagaccggc 360atcttcaaaa
aggtccccgt cgacatctat gtcttcaagt ccggcgtctt caccaacctt
420ggagacggag gcttcatcaa ctgggcatgg ggtggcttcg tcgaccaggt
cgtcggcaag 480cgtatccact tccgcttgcc ccccggggcg ctccct
516445153PRTArtificial SequenceIPD103 variant 445Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu Asp Phe Leu Gly Ala1 5 10 15Asp Val Lys
Leu Gln Pro Arg Asn Ile Ile Thr Val Glu Val Asp Ala 20 25 30Ala Ala
Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala Arg 35 40
45His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys Gly Ile
50 55 60Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val Val
Ile65 70 75 80His Thr Gln His Val His Thr Leu Val Gly Leu Glu His
Thr His Leu 85 90 95Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val
Asp Ile Tyr Val 100 105 110Phe Lys Ser Gly Val Phe Thr Asn Leu Gly
Asp Gly Gly Phe Ile Asn 115 120 125Trp Ala Trp Gly Gly Phe Val Asp
Gln Val Val Gly Lys Arg Ile His 130 135 140Phe Arg Leu Pro Pro Gly
Ala Leu Pro145 150446172PRTArtificial SequenceIPD103 variant 446Met
Ala Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10
15Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe
20 25 30Leu Gly Ala Asp Val Lys Leu Gln Pro Gly Asn Ile Ile Thr Val
Glu 35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe
Gln Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp
Glu Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val
Pro Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr
Leu Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly
Ile Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser
Gly Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp
Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg
Ile Pro Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170447172PRTArtificial SequenceIPD103 variant 447Met Ala Asp Lys
Ala Ala Ala Gly Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly
Ala Asp Val Lys Leu Gln Pro Thr Asn Ile Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55
60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170448172PRTArtificial
SequenceIPD103 variant 448Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Leu Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170449172PRTArtificial SequenceIPD103 variant 449Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Pro Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170450172PRTArtificial
SequenceIPD103 variant 450Met Ala Asp Lys Ala Ala Ala Ala Ala Arg
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Trp Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170451172PRTArtificial SequenceIPD103 variant 451Met Ala
Asp Lys Ala Ala Ala Ala Ala Arg Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Tyr Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170452172PRTArtificial
SequenceIPD103 variant 452Met Ala Asp Lys Ala Ala Ala Ala Ala Tyr
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170453173PRTArtificial SequenceIPD103 variant 453Met Ala
Asp Lys Ala Ala Ala Ala Ala Ala Thr Glu Ala Glu Glu Glu1 5 10 15Val
Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp 20 25
30Phe Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val
35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe
Gln 50 55 60Thr Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp
Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val
Pro Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln His Val His Thr
Leu Val Gly Leu Glu 100 105 110His Thr His Leu Val Leu Gln Thr Gly
Ile Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr Val Phe Lys Ser
Gly Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile Asn Trp
Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly145 150 155 160Lys Arg
Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170454172PRTArtificial SequenceIPD103 variant 454Met Ala Asp Lys
Ala Ala Ala Ala Ala Ala Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly
Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr Val Glu 35 40 45Val
Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55
60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile65
70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn
Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys
Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr
Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp Gly Gly
Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile His Phe Arg
Leu Pro Pro Gly Ala Leu Pro 165 170455173PRTArtificial
SequenceIPD103 variant 455Met Ala Asp Lys Ala Ala Ala Ala Ala Ala
Met Glu Ala Glu Glu Glu1 5 10 15Val Glu Thr Thr Met Asp Glu Thr Glu
Ala Val Gly Thr His Leu Asp 20 25 30Phe Leu Gly Ala Asp Val Lys Leu
Gln Pro Arg Asn Ile Ile Thr Val 35 40 45Glu Val Asp Ala Ala Ala Val
Ile Gln Gln Ile Arg Glu Ile Phe Gln 50 55 60Thr Met Ala Arg His Phe
Asn Ser Thr Arg Val Val Arg Asp Glu Ala65 70 75 80Ile Lys Gly Ile
Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn 85 90 95Val Val Val
Ile His Thr Gln His Val His Thr Leu Val Gly Leu Glu 100 105 110His
Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val 115 120
125Asp Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly
130 135 140Gly Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val
Val Gly145 150 155 160Lys Arg Ile His Phe Arg Leu Pro Pro Gly Ala
Leu Pro 165 170456173PRTArtificial SequenceIPD103 variant 456Met
Ala Asp Lys Ala Ala Ala Ala Ala Ala Ser Glu Ala Glu Glu Glu1 5 10
15Val Glu Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp
20 25 30Phe Leu Gly Ala Asp Val Lys Leu Gln Pro Arg Asn Ile Ile Thr
Val 35 40 45Glu Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile
Phe Gln 50 55 60Thr Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg
Asp Glu Ala65 70 75 80Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala
Val Pro Thr Arg Asn 85 90 95Val Val Val Ile His Thr Gln His Val His
Thr Leu Val Gly Leu Glu 100 105 110His Thr His Leu Val Leu Gln Thr
Gly Ile Phe Lys Lys Val Pro Val 115 120 125Asp Ile Tyr Val Phe Lys
Ser Gly Val Phe Thr Asn Leu Gly Asp Gly 130 135 140Gly Phe Ile Asn
Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly145 150 155 160Lys
Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165
170457153PRTArtificial SequenceIPD103 variant 457Met Asp Glu Thr
Glu Ala Val Gly Thr His Leu Asp Phe Leu Gly Ala1 5 10 15Asp Val Lys
Leu Gln Pro Thr Asn Ile Ile Thr Val Glu Val Asp Ala 20 25 30Ala Ala
Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala Arg 35 40 45His
Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys Gly Ile 50 55
60Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val Val Ile65
70 75 80His Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr His
Leu 85 90 95Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile
Tyr Val 100 105 110Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly
Gly Phe Ile Asn 115 120 125Trp Ala Trp Gly Gly Phe Val Asp Gln Val
Val Gly Lys Arg Ile His 130 135 140Phe Arg Leu Pro Pro Gly Ala Leu
Pro145 150458153PRTArtificial SequenceIPD103 variant 458Met Asp Glu
Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu Gly Ala1 5 10 15Asp Val
Lys Leu Gln Pro Trp Asn Ile Ile Thr Val Glu Val Asp Ala 20 25 30Ala
Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala Arg 35 40
45His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys Gly Ile
50 55 60Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val Val
Ile65 70 75 80His Thr Gln His Val His Thr Leu Val Gly Leu Glu His
Thr His Leu 85 90 95Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val
Asp Ile Tyr Val 100 105 110Phe Lys Ser Gly Val Phe Thr Asn Leu Gly
Asp Gly Gly Phe Ile Asn 115 120 125Trp Ala Trp Gly Gly Phe Val Asp
Gln Val Val Gly Lys Arg Ile His 130 135 140Phe Arg Leu Pro Pro Gly
Ala Leu Pro145 150459153PRTArtificial SequenceIPD103 variant 459Met
Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu Gly Ala1 5 10
15Asp Val Lys Leu Gln Pro Tyr Asn Ile Ile Thr Val Glu Val Asp Ala
20 25 30Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met Ala
Arg 35 40 45His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile Lys
Gly Ile 50 55 60Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val
Val Val Ile65 70 75 80His Thr Gln His Val His Thr Leu Val Gly Leu
Glu His Thr His Leu 85 90 95Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp Ile Tyr Val 100 105 110Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly Phe Ile Asn 115 120 125Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys Arg Ile His 130 135
140Phe Arg Leu Pro Pro Gly Ala Leu Pro145 150460171PRTArtificial
SequenceIPD103 variant 460Met Ala Asp Gln Ala Ala Ala Ala Cys Glu
Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val
Gly Thr His Leu Asp Phe Leu 20 25 30Gly Ala Asp Val Lys Leu Gln Pro
Pro Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170461171PRTArtificial SequenceIPD103 variant 461Met Ala Asp
Gln Ala Ala Ala Ala Val Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu 20 25 30Gly
Ala Asp Val Lys Leu Gln Pro Pro Asn Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170462171PRTArtificial
SequenceIPD103 variant 462Met Ala Asp Gln Ala Ala Ala Ala Asp Glu
Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val
Gly Thr His Leu Asp Phe Leu 20 25 30Gly Ala Asp Val Lys Leu Gln Pro
Thr Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170463171PRTArtificial SequenceIPD103 variant 463Met Ala Asp
Gln Ala Ala Ala Ala Gln Glu Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr
Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe Leu 20 25 30Gly
Ala Asp Val Lys Leu Gln Pro Leu Asn Ile Ile Thr Val Glu Val 35 40
45Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr Met
50 55 60Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala Ile
Lys65 70 75 80Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr Arg
Asn Val Val 85 90 95Val Ile His Thr Gln His Val His Thr Leu Val Gly
Leu Glu His Thr 100 105 110His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val Pro Val Asp Ile 115 120 125Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly Asp Gly Gly Phe 130 135 140Ile Asn Trp Ala Trp Gly
Gly Phe Val Asp Gln Val Val Gly Lys Arg145 150 155 160Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 165 170464171PRTArtificial
SequenceIPD103 variant 464Met Ala Asp Gln Ala Ala Ala Ala Gly Glu
Ala Glu Glu Glu Val Glu1 5 10 15Thr Thr Met Asp Glu Thr Glu Ala Val
Gly Thr His Leu Asp Phe Leu 20 25 30Gly Ala Asp Val Lys Leu Gln Pro
Leu Asn Ile Ile Thr Val Glu Val 35 40 45Asp Ala Ala Ala Val Ile Gln
Gln Ile Arg Glu Ile Phe Gln Thr Met 50 55 60Ala Arg His Phe Asn Ser
Thr Arg Val Val Arg Asp Glu Ala Ile Lys65 70 75 80Gly Ile Arg Asp
His Phe Arg Ala Ala Val Pro Thr Arg Asn Val Val 85 90 95Val Ile His
Thr Gln His Val His Thr Leu Val Gly Leu Glu His Thr 100 105 110His
Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp Ile 115 120
125Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly Phe
130 135 140Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val Gly
Lys Arg145 150 155 160Ile His Phe Arg Leu Pro Pro Gly Ala Leu Pro
165 170465172PRTArtificial SequenceIPD103 variant 465Met Ala Asp
Lys Ala Ala Ala Ala Ala Arg Ala Ala Glu Glu Glu Val1 5 10 15Glu Thr
Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25 30Leu
Gly Ala Asp Val Lys Leu Gln Pro Trp Asn Ile Ile Thr Val Glu 35 40
45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln Thr
50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu Ala
Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr
Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu Val
Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile Phe
Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly Val
Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile His
Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170466172PRTArtificial
SequenceIPD103 variant 466Met Ala Asp Lys Ala Ala Ala Ala Ala Ala
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Thr Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170467172PRTArtificial SequenceIPD103 variant 467Met Ala
Asp Lys Ala Ala Ala Ala Ala Met Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Thr Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170468172PRTArtificial
SequenceIPD103 variant 468Met Ala Asp Lys Ala Ala Ala Ala Ala Ser
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Leu Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170469172PRTArtificial SequenceIPD103 variant 469Met Ala
Asp Lys Ala Ala Ala Ala Ala Ala Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Trp Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170470172PRTArtificial
SequenceIPD103 variant 470Met Ala Asp Lys Ala Ala Ala Ala Ala Met
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Trp Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 170471172PRTArtificial SequenceIPD103 variant 471Met Ala
Asp Lys Ala Ala Ala Ala Ala Met Glu Ala Glu Glu Glu Val1 5 10 15Glu
Thr Thr Met Asp Glu Thr Glu Ala Val Gly Thr His Leu Asp Phe 20 25
30Leu Gly Ala Asp Val Lys Leu Gln Pro Tyr Asn Ile Ile Thr Val Glu
35 40 45Val Asp Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile Phe Gln
Thr 50 55 60Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp Glu
Ala Ile65 70 75 80Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro
Thr Arg Asn Val 85 90 95Val Val Ile His Thr Gln His Val His Thr Leu
Val Gly Leu Glu His 100 105 110Thr His Leu Val Leu Gln Thr Gly Ile
Phe Lys Lys Val Pro Val Asp 115 120 125Ile Tyr Val Phe Lys Ser Gly
Val Phe Thr Asn Leu Gly Asp Gly Gly 130 135 140Phe Ile Asn Trp Ala
Trp Gly Gly Phe Val Asp Gln Val Val Gly Lys145 150 155 160Arg Ile
His Phe Arg Leu Pro Pro Gly Ala Leu Pro 165 170472172PRTArtificial
SequenceIPD103 variant 472Met Ala Asp Lys Ala Ala Ala Ala Ala Ala
Glu Ala Glu Glu Glu Val1 5 10 15Glu Thr Thr Met Asp Glu Thr Glu Ala
Val Gly Thr His Leu Asp Phe 20 25 30Leu Gly Ala Asp Val Lys Leu Gln
Pro Tyr Asn Ile Ile Thr Val Glu 35 40 45Val Asp Ala Ala Ala Val Ile
Gln Gln Ile Arg Glu Ile Phe Gln Thr 50 55 60Met Ala Arg His Phe Asn
Ser Thr Arg Val Val Arg Asp Glu Ala Ile65 70 75 80Lys Gly Ile Arg
Asp His Phe Arg Ala Ala Val Pro Thr Arg Asn Val 85 90 95Val Val Ile
His Thr Gln His Val His Thr Leu Val Gly Leu Glu His 100 105 110Thr
His Leu Val Leu Gln Thr Gly Ile Phe Lys Lys Val Pro Val Asp 115 120
125Ile Tyr Val Phe Lys Ser Gly Val Phe Thr Asn Leu Gly Asp Gly Gly
130 135 140Phe Ile Asn Trp Ala Trp Gly Gly Phe Val Asp Gln Val Val
Gly Lys145 150 155 160Arg Ile His Phe Arg Leu Pro Pro Gly Ala Leu
Pro 165 17047340DNAArtificial Sequencemutagenesis primer
473agcatatggc ggacaaagca gcagcagcag ctagagaagc 4047436DNAArtificial
Sequencemutagenesis primer 474cgactcgaga tgggtgccgg caggcaggca
tattgc 3647537DNAArtificial Sequencemutagenesis primer
475agcatatggc ggaccaagca gcagcagcta gagaagc 3747625DNAArtificial
Sequencemutagenesis primer 476aacatatggc cgaaccagca gcagc
2547724DNAArtificial Sequencemutagenesis primer 477ttctcgagtc
aagggagcgc ccca 2447827DNAArtificial Sequencemutagenesis primer
478aacatatggc cgaccaagga gcagcag 2747923DNAArtificial
Sequencemutagenesis primer 479ttctcgagtc aagggagcgc ccc
2348025DNAArtificial Sequencemutagenesis primer 480aacatatggc
cgaccaagct gcagc 2548128DNAArtificial Sequencemutagenesis primer
481aacatatgag agagcgagag cgagagcg 2848225DNAArtificial
Sequencemutagenesis primer 482aacatatggc cgaaccagca gcagc
2548324DNAArtificial Sequencemutagenesis primer 483aacatatggc
cgacaaagcg cctc 2448424DNAArtificial Sequencemutagenesis primer
484ttctcgagtc aagggagtgc cccg 2448527DNAArtificial
Sequencemutagenesis primer 485aacatatggc cgaccaagta gcagcag
2748625DNAArtificial Sequencemutagenesis primer 486aacatatggc
cgacccagca acagc 2548733DNAArtificial Sequencemutagenesis primer
487aacatatgca gagagagaga gagagagaga tgg 3348828DNAArtificial
Sequencemutagenesis primer 488aacatatggc cgacaaagta gcagcagc
2848923DNAArtificial Sequencemutagenesis primer 489ttctcgagtc
aagggagtgc ccc 2349028DNAArtificial Sequencemutagenesis primer
490aacatatgag agagcgagag cgagagcg 2849128DNAArtificial
Sequencemutagenesis primer 491aacatatggc cgatgacaaa gtagcaag
2849222DNAArtificial Sequencemutagenesis primer 492ttctcgagtc
aagggagggc cc 2249327DNAArtificial Sequencemutagenesis primer
493aacatatggc cgatgaggta gctggtc 2749421DNAArtificial
Sequencemutagenesis primer 494aacatatgga cgccgctgcc g
2149522DNAArtificial Sequencemutagenesis primer 495ttctcgagtc
aagggagcgc cc 22496516DNAArtificial SequenceIPD103 variant
496atggcggacg aagtagcagg tcaccatggt ccagcatgtg aagaagagga
ggaggaaatg 60ctgatggacg agactgaggc ggtgggggtg cacgcgatcg acggtctgcc
ggtgcaaaac 120cgcagcatca tcaccgtgga ggtggacgcc gctgccgtaa
tccaacagat cagagagatc 180ttcgcgtcaa tgatcaaaca ctacaactct
acgagggtgg tgcgggatga agccatcaag 240agcattcgag accacttcag
gctcgccgtc ccgactcgca acgtggtggt cattcacact 300cagcacgttc
acacactgga cgccgtggag tcctcccacc tcgtcttgcg gaccggcctg
360ttcaaaaagg tccctgtcga catctttgtc ttcaagtccg gcgtcttcac
caacctggga 420gacggaggct tcatcaactg ggcatggggt ggctacggcg
tcaaccacac cgccaagcgt 480gtcgtcttca gccggccccc cggggcgctc ccttga
516497495DNAArtificial SequenceMutagenesis assembly
blockmisc_feature(132)..(133)n is a, c, g, or
tmisc_feature(134)..(134)k is g or t 497gcagccatat ggcggacaaa
gcagcagcag cagctagaga agctgaagaa gaggtggaga 60cgacgatgga cgagactgag
gcggtgggga cgcacctgga cttcttgggc gcggacgtga 120agttgcaacc
cnnkaacatc atcaccgtgg aggtggacgc ggctgccgta atccaacaga
180tcagagagat cttccagaca atggcgcgtc acttcaactc tacgagggtg
gtgcgggatg 240aagccatcaa gggcattcga gaccacttca gggccgccgt
cccgactcgc aacgtggtgg 300tcattcacac tcagcacgtt cacacactgg
tgggcttgga gcacacccac ctcgtcttgc 360agaccggcat cttcaaaaag
gtccccgtcg acatctatgt cttcaagtcc ggcgtcttca 420ccaaccttgg
agacggaggc ttcatcaact gggcatgggg tggcttcgtc gaccaggtcg
480tcggcaagcg tatcc 49549830DNAArtificial Sequencemutagenesis
primer 498ctgctgctgc tttgtccgcc atatggctgc 3049926DNAArtificial
Sequencemutagenesis primer 499cgaccaggtc gtcggcaagc gtatcc
2650051DNAArtificial Sequencemutagensis
primermisc_feature(33)..(34)n is a, c, g, or
tmisc_feature(35)..(35)k is g or t 500agcatatggc ggacaaagca
gcagcagcag ctnnkgaagc tgaagaagag g 5150132DNAArtificial
Sequencemutagensis primer 501agcatatgga cgagactgag gcggtgggga cg
3250248DNAArtificial Sequencemutagensis
primermisc_feature(30)..(31)n is a, c, g, or
tmisc_feature(32)..(32)k is g or t 502agcatatggc ggaccaagca
gcagcagctn nkgaagctga agaagagg 4850351DNAArtificial
Sequencemutagensis primer 503agcatatggc ggacaaagca gcagcagcag
ctgctgaagc tgaagaagag g 5150451DNAArtificial Sequencemutagensis
primer 504agcatatggc ggacaaagca gcagcagcag ctatggaagc tgaagaagag g
5150551DNAArtificial Sequencemutagensis primer 505agcatatggc
ggacaaagca gcagcagcag ctagtgaagc tgaagaagag g 51506576DNAArtificial
SequenceIPD103 his-tagged 506atgggcagca gccatcatca tcatcatcac
agcagcggcc tggtgccgcg cggcagccat 60atggcggacc aagcagcagc agctagagaa
gctgaagaag aggtggagac gacgatggac 120gagactgagg cggtggggac
gcacctggac ttcttgggcg cggacgtgaa gttgcaaccc 180cgcaacatca
tcaccgtgga ggtggacgcc gctgccgtaa tccaacagat cagagagatc
240ttccagacaa tggcgcgtca cttcaactct acgagggtgg tgcgggatga
agccatcaag 300ggcattcgag accacttcag ggccgccgtc ccgactcgca
acgtggtggt cattcacact 360cagcacgttc acacactggt gggcttggag
cacacccacc tcgtcttgca gaccggcatc 420ttcaaaaagg tccccgtcga
catctatgtc ttcaagtccg gcgtcttcac caaccttgga 480gacggaggct
tcatcaactg ggcatggggt ggcttcgtcg accaggtcgt cggcaagcgt
540atccacttcc gcttgccccc cggggcgctc ccttga 576507191PRTArtificial
SequenceIPD103 his-tagged 507Met Gly Ser Ser His His His His His
His Ser Ser Gly Leu Val Pro1 5 10 15Arg Gly Ser His Met Ala Asp Gln
Ala Ala Ala Ala Arg Glu Ala Glu 20 25 30Glu Glu Val Glu Thr Thr Met
Asp Glu Thr Glu Ala Val Gly Thr His 35 40 45Leu Asp Phe Leu Gly Ala
Asp Val Lys Leu Gln Pro Arg Asn Ile Ile 50 55 60Thr Val Glu Val Asp
Ala Ala Ala Val Ile Gln Gln Ile Arg Glu Ile65 70 75 80Phe Gln Thr
Met Ala Arg His Phe Asn Ser Thr Arg Val Val Arg Asp 85 90 95Glu Ala
Ile Lys Gly Ile Arg Asp His Phe Arg Ala Ala Val Pro Thr 100 105
110Arg Asn Val Val Val Ile His Thr Gln His Val His Thr Leu Val Gly
115 120 125Leu Glu His Thr His Leu Val Leu Gln Thr Gly Ile Phe Lys
Lys Val 130 135 140Pro Val Asp Ile Tyr Val Phe Lys Ser Gly Val Phe
Thr Asn Leu Gly145 150 155 160Asp Gly Gly Phe Ile Asn Trp Ala Trp
Gly Gly Phe Val Asp Gln Val 165 170 175Val Gly Lys Arg Ile His Phe
Arg Leu Pro Pro Gly Ala Leu Pro 180 185 1905085PRTArtificial
Sequencefusion linker 508Glu Glu Lys Lys Asn1 5
* * * * *