U.S. patent application number 17/460138 was filed with the patent office on 2021-12-30 for macromolecule analysis employing nucleic acid encoding.
This patent application is currently assigned to Encodia, Inc.. The applicant listed for this patent is Encodia, Inc.. Invention is credited to Mark S. CHEE, Kevin L. GUNDERSON, Michael Phillip Weiner.
Application Number | 20210405058 17/460138 |
Document ID | / |
Family ID | 1000005828044 |
Filed Date | 2021-12-30 |
United States Patent
Application |
20210405058 |
Kind Code |
A1 |
CHEE; Mark S. ; et
al. |
December 30, 2021 |
MACROMOLECULE ANALYSIS EMPLOYING NUCLEIC ACID ENCODING
Abstract
A method for analyzing macromolecules, including peptides,
polypeptides, and proteins, employing nucleic acid encoding is
disclosed.
Inventors: |
CHEE; Mark S.; (San Diego,
CA) ; GUNDERSON; Kevin L.; (San Diego, CA) ;
Weiner; Michael Phillip; (San Diego, CA) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Encodia, Inc. |
San Diego |
CA |
US |
|
|
Assignee: |
Encodia, Inc.
San Diego
CA
|
Family ID: |
1000005828044 |
Appl. No.: |
17/460138 |
Filed: |
August 27, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
17197796 |
Mar 10, 2021 |
|
|
|
17460138 |
|
|
|
|
16098436 |
Nov 1, 2018 |
|
|
|
PCT/US17/30702 |
May 2, 2017 |
|
|
|
17197796 |
|
|
|
|
62376886 |
Aug 18, 2016 |
|
|
|
62339071 |
May 19, 2016 |
|
|
|
62330841 |
May 2, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/6845 20130101;
C40B 70/00 20130101; G01N 2458/00 20130101; G01N 33/6803 20130101;
G01N 2458/10 20130101; G01N 33/6824 20130101 |
International
Class: |
G01N 33/68 20060101
G01N033/68; C40B 70/00 20060101 C40B070/00 |
Claims
1-177. (canceled)
178. A method for analyzing a polypeptide, the method comprising
the steps of: (a) providing the polypeptide and an associated
recording tag joined to a solid support; (b) contacting the
polypeptide with a binding agent capable of binding to the
polypeptide, wherein the binding agent comprises a coding tag with
identifying information regarding the binding agent; (c)
transferring the information of the coding tag to the recording tag
to generate an extended recording tag; (d) analyzing the extended
recording tag, thereby characterizing, identifying or quantifying
all or a portion of components of the polypeptide.
179. The method of claim 178, wherein providing the polypeptide and
the associated recording tag at step (a) comprises the steps of:
(q) partitioning a plurality of polypeptides from a sample into a
plurality of compartments, wherein each compartment comprises a
plurality of recoding tags optionally attached to beads, wherein
each recoding tag of the plurality of recoding tags comprises a
compartment tag that is the same within an individual compartment
and different from the compartment tags of other compartments; (r)
contacting the partitioned polypeptides with pluralities of
recording tags within the plurality of compartments under
conditions sufficient to permit joining of the partitioned
polypeptides to recoding tags, thereby generating a plurality of
recoding tag-labeled polypeptides; (s) optionally releasing
recoding tags from the plurality of recoding tags from the beads;
(t) collecting the recoding tag-labeled polypeptides from the
plurality of compartments; and (u) immobilizing the recoding
tag-labeled polypeptides on the solid support.
180. The method of claim 178, further comprising fragmenting the
plurality of polypeptides after partitioning into the plurality of
compartments to obtain fragmented polypeptides and before step (t),
wherein recoding tag-labeled fragmented polypeptides are collected
from the plurality of compartments and immobilized on the solid
support.
181. The method of claim 178, wherein providing the polypeptide at
step (a) comprises the steps of: (q) partitioning a plurality of
polypeptides from a sample into a plurality of compartments,
wherein each compartment comprises a plurality of recoding tags
attached to beads, wherein each recoding tag of the plurality of
recoding tags comprises a compartment tag that is the same within
an individual compartment and different from the compartment tags
of other compartments; (r) contacting the partitioned polypeptides
with pluralities of recording tags within the plurality of
compartments under conditions sufficient to permit joining of the
partitioned polypeptides to recoding tags, thereby generating a
plurality of recoding tag-labeled polypeptides; (s) releasing
recoding tags from the plurality of recoding tags from the beads;
(t) collecting the recoding tag-labeled polypeptides from the
plurality of compartments; and (u) immobilizing the recoding
tag-labeled polypeptides on the solid support.
182. The method of claim 178, wherein at step (q) an interacting
protein complex within the sample is partitioned into a compartment
of the plurality of compartments, and the method provides analysis
of polypeptides derived from the interacting protein complex.
183. The method of claim 178, wherein the binding agent binds
specifically to a post-translationally modified amino acid of the
polypeptide.
184. The method of claim 183, wherein the post-translationally
modified amino acid of the polypeptide comprises phosphorylation or
glycosylation.
185. The method of claim 183, further comprising contacting an
amino acid of the polypeptide with a modifying reagent before step
(b) to obtain the post-translationally modified amino acid.
186. The method of claim 179, wherein at step (r) the partitioned
polypeptides are covalently joined to the recoding tags.
187. The method of claim 178, wherein the polypeptide has from 10
amino acid residues to 70 amino acid residues.
188. The method of claim 178, wherein analyzing the polypeptide
comprises identifying a component or a portion of the
polypeptide.
189. The method of claim 178, wherein analyzing the extended
recording tag comprises a nucleic acid sequencing method.
190. The method of claim 178, wherein the binding agent is joined
to the coding tag via a SpyCatcher-SpyTag interaction.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a U.S. national phase fling of
International Patent Application Serial No. PCT/US2017/030702,
entitled "Macromolecule analysis employing Nucleic Acid encoding,"
having and international filing date of May 2, 2017, which claims
priority to U.S. Provisional Patent Application No. 62/330,841,
filed on May 2, 2016, U.S. Provisional Patent Application No.
62/339,071, filed on May 19, 2016, and U.S. Provisional Patent
Application No. 62/376,886, filed on Aug. 18, 2016, the content of
each of these applications are incorporated herein by reference in
their entireties for all purposes.
STATEMENT REGARDING SEQUENCE LISTING
[0002] The Sequence Listing associated with this application is
provided in computer readable ASCII format (file name: 4614-2000801
SeqList2.txt, recorded: Jun. 11, 2021, size 40,467 bytes), and is
hereby incorporated by reference into the specification. The text
file is being submitted electronically via EFS-Web.
BACKGROUND
Technical Field
[0003] This disclosure generally relates to analysis of
macromolecules, including peptides, polypeptides, and proteins,
employing barcoding and nucleic acid encoding of molecular
recognition events.
Description of the Related Art
[0004] Proteins play an integral role in cell biology and
physiology, performing and facilitating many different biological
functions. The repertoire of different protein molecules is
extensive, much more complex than the transcriptome, due to
additional diversity introduced by post-translational modifications
(PTMs). Additionally, proteins within a cell dynamically change (in
expression level and modification state) in response to the
environment, physiological state, and disease state. Thus, proteins
contain a vast amount of relevant information that is largely
unexplored, especially relative to genomic information. In general,
innovation has been lagging in proteomics analysis relative to
genomics analysis. In the field of genomics, next-generation
sequencing (NGS) has transformed the field by enabling analysis of
billions of DNA sequences in a single instrument run, whereas in
protein analysis and peptide sequencing, throughput is still
limited.
[0005] Yet this protein information is direly needed for a better
understanding of proteome dynamics in health and disease and to
help enable precision medicine. As such, there is great interest in
developing "next-generation" tools to miniaturize and
highly-parallelize collection of this proteomic information.
[0006] Highly-parallel macromolecular characterization and
recognition of proteins is challenging for several reasons. The use
of affinity-based assays is often difficult due to several key
challenges. One significant challenge is multiplexing the readout
of a collection of affinity agents to a collection of cognate
macromolecules; another challenge is minimizing cross-reactivity
between the affinity agents and off-target macromolecules; a third
challenge is developing an efficient high-throughput read out
platform. An example of this problem occurs in proteomics in which
one goal is to identify and quantitate most or all the proteins in
a sample. Additionally, it is desirable to characterize various
post-translational modifications (PTMs) on the proteins at a single
molecule level. Currently this is a formidable task to accomplish
in a high-throughput way.
[0007] Molecular recognition and characterization of a protein or
peptide macromolecule is typically performed using an immunoassay.
There are many different immunoassay formats including ELISA,
multiplex ELISA (e.g., spotted antibody arrays, liquid particle
ELISA arrays), digital ELISA (e.g., Quanterix, Singulex), reverse
phase protein arrays (RPPA), and many others. These different
immunoassay platforms all face similar challenges including the
development of high affinity and highly-specific (or selective)
antibodies (binding agents), limited ability to multiplex at both
the sample and analyte level, limited sensitivity and dynamic
range, and cross-reactivity and background signals. Binding agent
agnostic approaches such as direct protein characterization via
peptide sequencing (Edman degradation or Mass Spectroscopy) provide
useful alternative approaches. However, neither of these approaches
is very parallel or high-throughput.
[0008] Peptide sequencing based on Edman degradation was first
proposed by Pehr Edman in 1950; namely, stepwise degradation of the
N-terminal amino acid on a peptide through a series of chemical
modifications and downstream HPLC analysis (later replaced by mass
spectrometry analysis). In a first step, the N-terminal amino acid
is modified with phenyl isothiocyanate (PITC) under mildly basic
conditions (NMP/methanol/H.sub.2O) to form a phenylthiocarbamoyl
(PTC) derivative. In a second step, the PTC-modified amino group is
treated with acid (anhydrous TFA) to create a cleaved cyclic
ATZ(2-anilino-5(4)-thiozolinone) modified amino acid, leaving a new
N-terminus on the peptide. The cleaved cyclic ATZ-amino acid is
converted to a PTH-amino acid derivative and analyzed by reverse
phase HPLC. This process is continued in an iterative fashion until
all or a partial number of the amino acids comprising a peptide
sequence has been removed from the N-terminal end and identified.
In general, Edman degradation peptide sequencing is slow and has a
limited throughput of only a few peptides per day.
[0009] In the last 10-15 years, peptide analysis using MALDI,
electrospray mass spectroscopy (MS), and LC-MS/MS has largely
replaced Edman degradation. Despite the recent advances in MS
instrumentation (Riley et al., 2016, Cell Syst 2:142-143), MS still
suffers from several drawbacks including high instrument cost,
requirement for a sophisticated user, poor quantification ability,
and limited ability to make measurements spanning the dynamic range
of the proteome. For example, since proteins ionize at different
levels of efficiencies, absolute quantitation and even relative
quantitation between sample is challenging. The implementation of
mass tags has helped improve relative quantitation, but requires
labeling of the proteome. Dynamic range is an additional
complication in which concentrations of proteins within a sample
can vary over a very large range (over 10 orders for plasma). MS
typically only analyzes the more abundant species, making
characterization of low abundance proteins challenging. Finally,
sample throughput is typically limited to a few thousand peptides
per run, and for data independent analysis (DIA), this throughput
is inadequate for true bottoms-up high-throughput proteome
analysis. Furthermore, there is a significant compute requirement
to de-convolute thousands of complex MS spectra recorded for each
sample.
[0010] Accordingly, there remains a need in the art for improved
techniques relating to macromolecule sequencing and/or analysis,
with applications to protein sequencing and/or analysis, as well as
to products, methods and kits for accomplishing the same. There is
a need for proteomics technology that is highly-parallelized,
accurate, sensitive, and high-throughput. The present disclosure
fulfills these and other needs.
[0011] These and other aspects of the invention will be apparent
upon reference to the following detailed description. To this end,
various references are set forth herein which describe in more
detail certain background information, procedures, compounds and/or
compositions, and are each hereby incorporated by reference in
their entirety.
BRIEF SUMMARY
[0012] Embodiments of the present disclosure relate generally to
methods of highly-parallel, high throughput digital macromolecule
analysis, particularly peptide analysis.
[0013] In a first embodiment is a method for analyzing a
macromolecule, comprising the steps of:
[0014] (a) providing a macromolecule and an associated recording
tag joined to a solid support;
[0015] (b) contacting the macromolecule with a first binding agent
capable of binding to the macromolecule, wherein the first binding
agent comprises a first coding tag with identifying information
regarding the first binding agent;
[0016] (c) transferring the information of the first coding tag to
the recording tag to generate a first order extended recording
tag;
[0017] (d) contacting the macromolecule with a second binding agent
capable of binding to the macromolecule, wherein the second binding
agent comprises a second coding tag with identifying information
regarding the second binding agent;
[0018] (e) transferring the information of the second coding tag to
the first order extended recording tag to generate a second order
extended recording tag; and analyzing the second order extended
recording tag.
[0019] In a second embodiment is the method of the first
embodiment, wherein contacting steps (b) and (d) are performed in
sequential order.
[0020] In a third embodiment is the method of the first embodiment,
where wherein contacting steps (b) and (d) are performed at the
same time.
[0021] In a fourth embodiment is the method of the first
embodiment, further comprising, between steps (e) and (f), the
following steps:
[0022] (x) repeating steps (d) and (e) one or more times by
replacing the second binding agent with a third (or higher order)
binding agent capable of binding to the macromolecule, wherein the
third (or higher order) binding agent comprises a third (or higher
order) coding tag with identifying information regarding the third
(or higher order) bind agent; and
[0023] (y) transferring the information of the third (or higher
order) coding tag to the second (or higher order) extended
recording tag to generate a third (or higher order) extended
recording tag;
[0024] and wherein the third (or higher order) extended recording
tag is analyzed in step (f).
[0025] In a fifth embodiment is a method for analyzing a
macromolecule, comprising the steps of:
[0026] (a) providing a macromolecule, an associated first recording
tag and an associated second recording tag joined to a solid
support;
[0027] (b) contacting the macromolecule with a first binding agent
capable of binding to the macromolecule, wherein the first binding
agent comprises a first coding tag with identifying information
regarding the first binding agent;
[0028] (c) transferring the information of the first coding tag to
the first recording tag to generate a first extended recording
tag;
[0029] (d) contacting the macromolecule with a second binding agent
capable of binding to the macromolecule, wherein the second binding
agent comprises a second coding tag with identifying information
regarding the second binding agent;
[0030] (e) transferring the information of the second coding tag to
the second recording tag to generate a second extended recording
tag; and analyzing the first and second extended recording
tags.
[0031] In a sixth embodiment is the method of fifth embodiment,
wherein contacting steps (b) and (d) are performed in sequential
order.
[0032] In a seventh embodiment is the method of the fifth
embodiment, wherein contacting steps (b) and (d) are performed at
the same time.
[0033] In an eight embodiment is the method of fifth embodiment,
wherein step (a) further comprises providing an associated third
(or higher odder) recording tag joined to the solid support.
[0034] In a ninth embodiment is the method of the eighth
embodiment, further comprising, between steps (e) and (f), the
following steps:
[0035] (x) repeating steps (d) and (e) one or more times by
replacing the second binding agent with a third (or higher order)
binding agent capable of binding to the macromolecule, wherein the
third (or higher order) binding agent comprises a third (or higher
order) coding tag with identifying information regarding the third
(or higher order) bind agent; and
[0036] (y) transferring the information of the third (or higher
order) coding tag to the third (or higher order) recording tag to
generate a third (or higher order) extended recording tag;
[0037] and wherein the first, second and third (or higher order)
extended recording tags are analyzed in step (f).
[0038] In a 10.sup.th embodiment is the method of any one of the
5th-9.sup.th embodiments, wherein the first coding tag, second
coding tag, and any higher order coding tags comprise a binding
cycle specific spacer sequence.
[0039] In an 11.sup.th embodiment is a method for analyzing a
peptide, comprising the steps of:
[0040] (a) providing a peptide and an associated recording tag
joined to a solid support;
[0041] (b) modifying the N-terminal amino acid (NTAA) of the
peptide with a chemical agent;
[0042] (c) contacting the peptide with a first binding agent
capable of binding to the modified NTAA, wherein the first binding
agent comprises a first coding tag with identifying information
regarding the first binding agent;
[0043] (d) transferring the information of the first coding tag to
the recording tag to generate an extended recording tag; and
[0044] (e) analyzing the extended recording tag.
[0045] In a 12.sup.th embodiment is the method of 11.sup.th
embodiment, wherein step (c) further comprises contacting the
peptide with a second (or higher order) binding agent comprising a
second (or higher order) coding tag with identifying information
regarding the second (or higher order) binding agent, wherein the
second (or higher order) binding agent is capable of binding to a
modified NTAA other than the modified NTAA of step (b).
[0046] In a 13.sup.th embodiment is the method of the 12.sup.th
embodiment, wherein contacting the peptide with the second (or
higher order) binding agent occurs in sequential order following
the peptide being contacted with the first binding agent.
[0047] In a 14.sup.th embodiment is the method of 12.sup.th
embodiment, wherein contacting the peptide with the second (or
higher order) binding agent occurs simultaneously with the peptide
being contacted with the first binding agent.
[0048] In a 15.sup.th embodiment is the method of any one the
11.sup.th-14.sup.th embodiments, wherein the chemical agent is an
isothiocyanate derivative, 2,4-dinitrobenzenesulfonic (DNBS),
4-sulfonyl-2-nitrofluorobenzene (SNFB) 1-fluoro-2,4-dinitrobenzene,
dansyl chloride, 7-methoxycoumarin acetic acid, a thioacylation
reagent, a thioacetylation reagent, or a thiobenzylation
reagent.
[0049] In a 16.sup.th embodiment is a method for analyzing a
peptide, comprising the steps of:
[0050] (a) providing a peptide and an associated recording tag
joined to a solid support;
[0051] (b) modifying the N-terminal amino acid (NTAA) of the
peptide with a chemical agent to yield a modified NTAA;
[0052] (c) contacting the peptide with a first binding agent
capable of binding to the modified NTAA, wherein the first binding
agent comprises a first coding tag with identifying information
regarding the first binding agent;
[0053] (d) transferring the information of the first coding tag to
the recording tag to generate a first extended recording tag;
[0054] (e) removing the modified NTAA to expose a new NTAA;
[0055] (f) modifying the new NTAA of the peptide with a chemical
agent to yield a newly modified NTAA;
[0056] (g) contacting the peptide with a second binding agent
capable of binding to the newly modified NTAA, wherein the second
binding agent comprises a second coding tag with identifying
information regarding the second binding agent;
[0057] (h) transferring the information of the second coding tag to
the first extended recording tag to generate a second extended
recording tag; and
[0058] (i) analyzing the second extended recording tag.
[0059] In a 17.sup.th embodiment is a method for analyzing a
peptide, comprising the steps of:
[0060] (a) providing a peptide and an associated recording tag
joined to a solid support;
[0061] (b) contacting the peptide with a first binding agent
capable of binding to the N-terminal amino acid (NTAA) of the
peptide, wherein the first binding agent comprises a first coding
tag with identifying information regarding the first binding
agent;
[0062] (c) transferring the information of the first coding tag to
the recording tag to generate an extended recording tag; and
[0063] (d) analyzing the extended recording tag.
[0064] In an 18.sup.th embodiment is the method of the 17.sup.th
embodiment, wherein step (b) further comprises contacting the
peptide with a second (or higher order) binding agent comprising a
second (or higher order) coding tag with identifying information
regarding the second (or higher order) binding agent, wherein the
second (or higher order) binding agent is capable of binding to a
NTAA other than the NTAA of the peptide.
[0065] In a 19.sup.th embodiment is the method of the 18.sup.th
embodiment, wherein contacting the peptide with the second (or
higher order) binding agent occurs in sequential order following
the peptide being contacted with the first binding agent.
[0066] In a 20.sup.th embodiment is the method of the 18.sup.th
embodiment, wherein contacting the peptide with the second (or
higher order) binding agent occurs simultaneously with the peptide
being contacted with the first binding agent.
[0067] In a 21.sup.st embodiment is a method for analyzing a
peptide, comprising the steps of:
[0068] (a) providing a peptide and an associated recording tag
joined to a solid support;
[0069] (b) contacting the peptide with a first binding agent
capable of binding to the N-terminal amino acid (NTAA) of the
peptide, wherein the first binding agent comprises a first coding
tag with identifying information regarding the first binding
agent;
[0070] (c) transferring the information of the first coding tag to
the recording tag to generate a first extended recording tag;
[0071] (d) removing the NTAA to expose a new NTAA of the
peptide;
[0072] (e) contacting the peptide with a second binding agent
capable of binding to the new NTAA, wherein the second binding
agent comprises a second coding tag with identifying information
regarding the second binding agent;
[0073] (h) transferring the information of the second coding tag to
the first extended recording tag to generate a second extended
recording tag; and
[0074] (i) analyzing the second extended recording tag.
[0075] In a 22.sup.nd embodiment is the method of any one of the
1st-10.sup.th embodiments, wherein the macromolecule is a protein,
polypeptide or peptide.
[0076] In a 23.sup.rd embodiment is the method of any one of the
1st-10.sup.th embodiments, wherein the macromolecule is a
peptide.
[0077] In a 24.sup.th embodiment is the method of any one of the
11th-23.sup.rd embodiments, wherein the peptide is obtained by
fragmenting a protein from a biological sample.
[0078] In a 25.sup.th embodiment is the method of any one of the
1st-10.sup.th embodiments, wherein the macromolecule is a lipid, a
carbohydrate, or a macrocycle.
[0079] In a 26.sup.th embodiment is the method of any one of the
1st-25.sup.th embodiments, wherein the recording tag is a DNA
molecule, DNA with pseudo-complementary bases, an RNA molecule, a
BNA molecule, an XNA molecule, a LNA molecule, a PNA molecule, a
.gamma.PNA molecule, or a combination thereof.
[0080] In a 27.sup.th embodiment is the method of any one of the
1.sup.st-26.sup.th embodiments, wherein the recording tag comprises
a universal priming site.
[0081] In a 28.sup.th embodiment is the method of the 27.sup.th
embodiment, wherein the universal priming site comprises a priming
site for amplification, sequencing, or both.
[0082] In a 29.sup.th embodiment is the method of the
1.sup.st-28.sup.th embodiments, where the recording tag comprises a
unique molecule identifier (UMI).
[0083] In a 30.sup.th embodiment is the method of any one of the
1st-29.sup.th embodiments, wherein the recording tag comprises a
barcode.
[0084] In a 31.sup.st embodiment is the method of any one of the
1st-30.sup.th embodiments, wherein the recording tag comprises a
spacer at its 3'-terminus.
[0085] In a 32.sup.nd embodiment is the method of claim any one of
the 1st-31.sup.st embodiments, wherein the macromolecule and the
associated recording tag are covalently joined to the solid
support.
[0086] In a 33.sup.rd embodiment is the method of any one of the
1st-32.sup.nd embodiments, wherein the solid support is a bead, a
porous bead, a porous matrix, an array, a glass surface, a silicon
surface, a plastic surface, a filter, a membrane, nylon, a silicon
wafer chip, a flow through chip, a biochip including signal
transducing electronics, a microtitre well, an ELISA plate, a
spinning interferometry disc, a nitrocellulose membrane, a
nitrocellulose-based polymer surface, a nanoparticle, or a
microsphere.
[0087] In a 34.sup.th embodiment is the method of the 33.sup.rd
embodiment, wherein the solid support is a polystyrene bead, a
polymer bead, an agarose bead, an acrylamide bead, a solid core
bead, a porous bead, a paramagnetic bead, glass bead, or a
controlled pore bead.
[0088] In a 35.sup.th embodiment is the method of any one of the
1st-34.sup.th embodiments, wherein a plurality of macromolecules
and associated recording tags are joined to a solid support.
[0089] In a 36.sup.th embodiment is the method of the 35.sup.th
embodiment, wherein the plurality of macromolecules are spaced
apart on the solid support at an average distance >50 nm.
[0090] In a 37.sup.th embodiment is the method of any one of
1st-36.sup.th embodiments, wherein the binding agent is a
polypeptide or protein.
[0091] In a 38.sup.th embodiment is the method of the 37.sup.th
embodiment, wherein the binding agent is a modified aminopeptidase,
a modified amino acyl tRNA synthetase, a modified anticalin, or a
modified ClpS.
[0092] In a 39.sup.th embodiment is the method of any one of the
1st-38.sup.th embodiments, wherein the binding agent is capable of
selectively binding to the macromolecule.
[0093] In a 40.sup.th embodiment is the method of any one of the
1st-39.sup.th embodiments, wherein the coding tag is DNA molecule,
an RNA molecule, a BNA molecule, an XNA molecule, a LNA molecule, a
PNA molecule, a .gamma.PNA molecule, or a combination thereof.
[0094] In a 41.sup.st embodiment is the method of any one of the
1st-40.sup.th embodiments, wherein the coding tag comprises an
encoder sequence.
[0095] In a 42.sup.nd embodiment is the method of any one of the
1st-41.sup.st embodiments, wherein the coding tag further comprises
a spacer, a binding cycle specific sequence, a unique molecular
identifier, a universal priming site, or any combination
thereof.
[0096] In a 43.sup.rd embodiment is the method of any one of the
1st-42.sup.nd embodiments, wherein the binding agent and the coding
tag are joined by a linker. In a 44.sup.th embodiment is the method
of any one of the 1st-42.sup.nd embodiments, wherein the binding
agent and the coding tag are joined by a SpyTag/SpyCatcher or
SnoopTag/SnoopCatcher peptide-protein pair.
[0097] In a 45.sup.th embodiment is the method of any one of the
1st-44.sup.th embodiments, wherein transferring the information of
the coding tag to the recording tag is mediated by a DNA
ligase.
[0098] In a 46.sup.th embodiment is the method of any one of the
1st-44.sup.th embodiments, wherein transferring the information of
the coding tag to the recording tag is mediated by a DNA
polymerase.
[0099] In a 47.sup.th embodiment is the method of any one of the
1st-44.sup.th embodiments, wherein transferring the information of
the coding tag to the recording tag is mediated by chemical
ligation.
[0100] In a 48.sup.th embodiment is the method of any one of claims
1st-47.sup.th embodiments, wherein analyzing the extended recording
tag comprises a nucleic acid sequencing method.
[0101] In a 49.sup.th embodiment is the method of the 48.sup.th
embodiment, wherein the nucleic acid sequencing method is
sequencing by synthesis, sequencing by ligation, sequencing by
hybridization, polony sequencing, ion semiconductor sequencing, or
pyrosequencing.
[0102] In a 50.sup.th embodiment is the method of the 48.sup.th
embodiment, wherein the nucleic acid sequencing method is single
molecule real-time sequencing, nanopore-based sequencing, or direct
imaging of DNA using advanced microscopy.
[0103] In a 51.sup.st embodiment is the method of any one of the
1st-50.sup.th embodiments, wherein the extended recording tag is
amplified prior to analysis.
[0104] In a 52.sup.nd embodiment is the method of any one of the
1.sup.st-51.sup.st embodiments, wherein the order of coding tag
information contained on the extended recording tag provides
information regarding the order of binding by the binding agents to
the macromolecule.
[0105] In a 53.sup.rd embodiment is the method of any one of the
1.sup.st-52.sup.nd embodiments, wherein frequency of the coding tag
information contained on the extended recording tag provides
information regarding the frequency of binding by the binding
agents to the macromolecule.
[0106] In a 54.sup.th embodiment is the method of any one of the
1st-53.sup.rd embodiments, wherein a plurality of extended
recording tags representing a plurality of macromolecules are
analyzed in parallel.
[0107] In a 55.sup.th embodiment is the method of the 54.sup.th
embodiment, wherein the plurality of extended recording tags
representing a plurality of macromolecules is analyzed in a
multiplexed assay.
[0108] In a 56.sup.th embodiment is the method of any one of the
1st-55.sup.th embodiments, wherein the plurality of extended
recording tags undergoes a target enrichment assay prior to
analysis.
[0109] In a 57.sup.th embodiment is the method of any one of the
1st-56.sup.th embodiments, wherein the plurality of extended
recording tags undergoes a subtraction assay prior to analysis.
[0110] In a 58.sup.th embodiment is the method of any one of the
1st-57.sup.th embodiments, wherein the plurality of extended
recording tags undergoes a normalization assay to reduce highly
abundant species prior to analysis. In a 59.sup.th embodiment is
the method of any one of the 1st-58.sup.th embodiments, wherein the
NTAA is removed by a modified aminopeptidase, a modified amino acid
tRNA synthetase, mild Edman degradation, Edmanase enzyme, or
anhydrous TFA.
[0111] In a 60.sup.th embodiment is the method of any one of the
1st-59.sup.th embodiments, wherein at least one binding agent binds
to a terminal amino acid residue.
[0112] In a 61st embodiment is the method of any one of the
1st-60.sup.th embodiments, wherein at least one binding agent binds
to a post-translationally modified amino acid.
[0113] In a 62.sup.nd embodiment is a method for analyzing one or
more peptides from a sample comprising a plurality of protein
complexes, proteins, or polypeptides, the method comprising:
[0114] (a) partitioning the plurality of protein complexes,
proteins, or polypeptides within the sample into a plurality of
compartments, wherein each compartment comprises a plurality of
compartment tags optionally joined to a solid support, wherein the
plurality of compartment tags are the same within an individual
compartment and are different from the compartment tags of other
compartments;
[0115] (b) fragmenting the plurality of protein complexes,
proteins, and/or polypeptides into a plurality of peptides;
[0116] (c) contacting the plurality of peptides to the plurality of
compartment tags under conditions sufficient to permit annealing or
joining of the plurality of peptides with the plurality of
compartment tags within the plurality of compartments, thereby
generating a plurality of compartment tagged peptides;
[0117] (d) collecting the compartment tagged peptides from the
plurality of compartments; and
[0118] (e) analyzing one or more compartment tagged peptide
according to a method of any one of the 1st-21.sup.st embodiments
and 26.sup.th-61.sup.st embodiments.
[0119] In a 63.sup.rd embodiment is the method of the 62.sup.nd
embodiment, wherein the compartment is a microfluidic droplet.
[0120] In a 64.sup.th embodiment is the method of the 62.sup.nd
embodiment, wherein the compartment is a microwell.
[0121] In a 65.sup.th embodiment is the method of the 62.sup.nd
embodiment, wherein the compartment is a separated region on a
surface.
[0122] In a 66.sup.th embodiment is the method of any one of the
62.sup.nd-65.sup.th embodiments, wherein each compartment comprises
on average a single cell.
[0123] In a 67.sup.th embodiment is a method for analyzing one or
more peptides from a sample comprising a plurality of protein
complexes, proteins, or polypeptides, the method comprising:
[0124] (a) labeling of the plurality of protein complexes,
proteins, or polypeptides with a plurality of universal DNA
tags;
[0125] (b) partitioning the plurality of labeled protein complexes,
proteins, or polypeptides within the sample into a plurality of
compartments, wherein each compartment comprises a plurality of
compartment tags, wherein the plurality of compartment tags are the
same within an individual compartment and are different from the
compartment tags of other compartments;
[0126] (c) contacting the plurality of protein complexes, proteins,
or polypeptides to the plurality of compartment tags under
conditions sufficient to permit annealing or joining of the
plurality of protein complexes, proteins, or polypeptides with the
plurality of compartment tags within the plurality of compartments,
thereby generating a plurality of compartment tagged protein
complexes, proteins or polypeptides;
[0127] (d) collecting the compartment tagged protein complexes,
proteins, or polypeptides from the plurality of compartments;
[0128] (e) optionally fragmenting the compartment tagged protein
complexes, proteins, or polypeptides into a compartment tagged
peptides; and analyzing one or more compartment tagged peptide
according to a method of any one of the 1st-21.sup.st embodiments
and 26.sup.th-61.sup.st embodiments.
[0129] In a 68.sup.th embodiment is the method of any one of the
62.sup.nd-67.sup.th embodiments, wherein compartment tag
information is transferred to a recording tag associated with a
peptide via primer extension or ligation.
[0130] In a 69.sup.th embodiment is the method of any one of the
62.sup.nd-68.sup.th embodiments, wherein the solid support
comprises a bead.
[0131] In a 70.sup.th embodiment is the method of the 69.sup.th
embodiment, wherein the bead is a polystyrene bead, a polymer bead,
an agarose bead, an acrylamide bead, a solid core bead, a porous
bead, a paramagnetic bead, glass bead, or a controlled pore
bead.
[0132] In a 71.sup.st embodiment is the method of any one of the
62.sup.nd-70.sup.th embodiments, wherein the compartment tag
comprises a single stranded or double stranded nucleic acid
molecule.
[0133] In a 72.sup.nd embodiment is the method of any one of the
62.sup.nd-71.sup.st embodiments, wherein the compartment tag
comprises a barcode and optionally a UMI.
[0134] In a 73.sup.rd embodiment is the method of the 72.sup.nd
embodiment, wherein the solid support is a bead and the compartment
tag comprises a barcode, further wherein beads comprising the
plurality of compartment tags joined thereto are formed by
split-and-pool synthesis.
[0135] In a 74.sup.th embodiment is the method of the 72.sup.nd
embodiment, wherein the solid support is a bead and the compartment
tag comprises a barcode, further wherein beads comprising a
plurality of compartment tags joined thereto are formed by
individual synthesis or immobilization.
[0136] In a 75.sup.th embodiment is the method of any one of the
62nd-74.sup.th embodiments, wherein the compartment tag is a
component within a recording tag, wherein the recording tag
optionally further comprises a spacer, a unique molecular
identifier, a universal priming site, or any combination
thereof.
[0137] In a 76.sup.th embodiment is the method of any one of the
62nd-75.sup.th embodiments, wherein the compartment tags further
comprise a functional moiety capable of reacting with an internal
amino acid or N-terminal amino acid on the plurality of protein
complexes, proteins, or polypeptides.
[0138] In a 77.sup.th embodiment is the method of the 76.sup.th
embodiment, wherein the functional moiety is an NHS group.
[0139] In a 78.sup.th embodiment is the method of the 76.sup.th
embodiment, wherein the functional moiety is an aldehyde group.
[0140] In a 79.sup.th embodiment is the method of any one of the
62nd-78.sup.th embodiments, wherein the plurality of compartment
tags is formed by: printing, spotting, ink-jetting the compartment
tags into the compartment, or a combination thereof.
[0141] In an 80.sup.th embodiment is the method of any one of the
62nd-79.sup.th embodiments, wherein the compartment tag further
comprises a peptide.
[0142] In an 81.sup.st embodiment is the method of the 80.sup.th
embodiment, wherein the compartment tag peptide comprises a protein
ligase recognition sequence.
[0143] In an 82.sup.nd embodiment is the method of the 81.sup.st
embodiment, wherein the protein ligase is butelase I or a homolog
thereof.
[0144] In an 83.sup.rd. embodiment is the method of any one of the
62nd-82.sup.nd embodiments, wherein the plurality of polypeptides
is fragmented with a protease.
[0145] In an 84.sup.th embodiment is the method of the 83.sup.rd
embodiment, wherein the protease is a metalloprotease.
[0146] In an 85.sup.th embodiment is the method of the 84.sup.th
embodiment, wherein the activity of the metalloprotease is
modulated by photo-activated release of metallic cations.
[0147] In an 86.sup.th embodiment is the method of any one of the
62nd-85.sup.th embodiments, further comprising subtraction of one
or more abundant proteins from the sample prior to partitioning the
plurality of polypeptides into the plurality of compartments.
[0148] In an 87.sup.th embodiment is the method of any one of the
62nd-86.sup.th embodiments, further comprising releasing the
compartment tags from the solid support prior to joining of the
plurality of peptides with the compartment tags.
[0149] In an 88.sup.th embodiment is the method of the 62.sup.nd
embodiment, further comprising following step (d), joining the
compartment tagged peptides to a solid support in association with
recording tags.
[0150] In an 89.sup.th embodiment is the method of the 88.sup.th
embodiment, further comprising transferring information of the
compartment tag on the compartment tagged peptide to the associated
recording tag.
[0151] In a 90.sup.th embodiment is the method of the 89.sup.th
embodiment, further comprising removing the compartment tags from
the compartment tagged peptides prior to step (e).
[0152] In a 91.sup.st embodiment is the method of any one of the
62nd-90.sup.th embodiments, further comprising determining the
identity of the single cell from which the analyzed peptide derived
based on the analyzed peptide's compartment tag sequence.
[0153] In a 92.sup.nd embodiment is the method of any one of the
62nd-90.sup.th embodiments, further comprising determining the
identity of the protein or protein complex from which the analyzed
peptide derived based on the analyzed peptide's compartment tag
sequence.
[0154] In a 93.sup.rd embodiment is a method for analyzing a
plurality of macromolecules, comprising the steps of:
[0155] (a) providing a plurality macromolecules and associated
recording tags joined to a solid support;
[0156] (b) contacting the plurality of macromolecules with a
plurality of binding agents capable of binding to the plurality of
macromolecules, wherein each binding agent comprises a coding tag
with identifying information regarding the binding agent;
[0157] (c) (i) transferring the information of the macromolecule
associated recording tags to the coding tags of the binding agents
that are bound to the macromolecules to generate extended coding
tags; or (ii) transferring the information of macromolecule
associated recording tags and coding tags of the binding agents
that are bound to the macromolecules to a di-tag construct;
[0158] (d) collecting the extended coding tags or di-tag
constructs;
[0159] (e) optionally repeating steps (b)-(d) for one or more
binding cycles;
[0160] (f) analyzing the collection of extended coding tags or
di-tag constructs.
[0161] In a 94.sup.th embodiment is the method of the 93.sup.rd
embodiment, wherein the macromolecule is a protein.
[0162] In a 95.sup.th embodiment is the method of the 93.sup.rd
embodiment, wherein the macromolecule is a peptide.
[0163] In a 96.sup.th embodiment is the method of the 95.sup.th
embodiment, wherein the peptide is obtained by fragmenting a
protein from a biological sample.
[0164] In a 97.sup.th embodiment is the method of any one of the
93.sup.rd-96.sup.th embodiments, wherein the recording tag is a DNA
molecule, an RNA molecule, a PNA molecule, a BNA molecule, an XNA,
molecule, an LNA molecule, a .gamma.PNA molecule, or a combination
thereof.
[0165] In a 98.sup.th embodiment is the method of any one of the
93rd-97.sup.th embodiments, wherein the recording tag comprises a
unique molecular identifier (UMI).
[0166] In a 99.sup.th embodiment is the method of embodiments
93-98, wherein the recording tag comprises a compartment tag.
[0167] In a 100.sup.th embodiment is the method of any one of
embodiments 93-99, wherein the recording tag comprises a universal
priming site.
[0168] In a 101.sup.st embodiment is the method of any one of
embodiment 93-100, wherein the recording tag comprises a spacer at
its 3'-terminus.
[0169] In a 102.sup.nd embodiment is the method of any one of
embodiment 93-101, wherein the 3'-terminus of the recording tag is
blocked to prevent extension of the recording tag by a polymerase
and the information of macromolecule associated recording tag and
coding tag of the binding agent that is bound to the macromolecule
is transferred to a di-tag construct.
[0170] In a 103.sup.rd embodiment is the method of any one of
embodiment 93-102, wherein the coding tag comprises an encoder
sequence.
[0171] In a 104.sup.th embodiment is the method of any one of
embodiments 93-103, wherein the coding tag comprises a UMI.
[0172] In a 105.sup.th embodiment is the method of any one of
embodiments 93-104, wherein the coding tag comprises a universal
priming site.
[0173] In a 106.sup.th embodiment is the method of any one of
embodiments 93-105, wherein the coding tag comprises a spacer at
its 3'-terminus.
[0174] In a 107.sup.th embodiment is the method of any one of
embodiments 93-106, wherein the coding tag comprises a binding
cycle specific sequence.
[0175] In a 108.sup.th embodiment is the method of any one of
embodiments 93-107, wherein the binding agent and the coding tag
are joined by a linker.
[0176] In a 109.sup.th embodiment is the method of any one of
embodiments 93-108, wherein transferring information of the
recording tag to the coding tag is effected by primer
extension.
[0177] In a 110.sup.th embodiment is the method of any one of
embodiments 93-108, wherein transferring information of the
recording tag to the coding tag is effected by ligation.
[0178] In an 111.sup.th embodiment is the method of any one of
embodiments 93-108, wherein the di-tag construct is generated by
gap fill, primer extension, or both.
[0179] In a 112.sup.th embodiment is the method of any one of
embodiments 93-97, 107, 108, and 111, wherein the di-tag molecule
comprises a universal priming site derived from the recording tag,
a compartment tag derived from the recording tag, a unique
molecular identifier derived from the recording tag, an optional
spacer derived from the recording tag, an encoder sequence derived
from the coding tag, a unique molecular identifier derived from the
coding tag, an optional spacer derived from the coding tag, and a
universal priming site derived from the coding tag.
[0180] In a 113.sup.th embodiment is the method of any one of
embodiments 93-112, wherein the macromolecule and the associated
recording tag are covalently joined to the solid support.
[0181] In a 114.sup.th embodiment is the method of embodiment 113,
wherein the solid support is a bead, a porous bead, a porous
matrix, an array, a glass surface, a silicon surface, a plastic
surface, a filter, a membrane, nylon, a silicon wafer chip, a flow
through chip, a biochip including signal transducing electronics, a
microtitre well, an ELISA plate, a spinning interferometry disc, a
nitrocellulose membrane, a nitrocellulose-based polymer surface, a
nanoparticle, or a microsphere.
[0182] In a 115.sup.th embodiment is the method of embodiment 114,
wherein the solid support is a polystyrene bead, a polymer bead, an
agarose bead, an acrylamide bead, a solid core bead, a porous bead,
a paramagnetic bead, glass bead, or a controlled pore bead.
[0183] In a 116.sup.th embodiment is the method of any one of
embodiments 93-115, wherein the binding agent is a polypeptide or
protein.
[0184] In a 117.sup.th embodiment is the method of embodiment 116,
wherein the binding agent is a modified aminopeptidase, a modified
amino acyl tRNA synthetase, a modified anticalin, or an antibody or
binding fragment thereof.
[0185] In an 118.sup.th embodiment is the method of any one of
embodiment 95-117 wherein the binding agent binds to a single amino
acid residue, a dipeptide, a tripeptide or a post-translational
modification of the peptide.
[0186] In a 119.sup.th embodiment is the method of embodiment 118,
wherein the binding agent binds to an N-terminal amino acid
residue, a C-terminal amino acid residue, or an internal amino acid
residue.
[0187] In a 120.sup.th embodiment is the method of embodiment 118,
wherein the binding agent binds to an N-terminal peptide, a
C-terminal peptide, or an internal peptide.
[0188] In a 121.sup.st embodiment is method of embodiment 119,
wherein the binding agent binds to the N-terminal amino acid
residue and the N-terminal amino acid residue is cleaved after each
binding cycle.
[0189] In a 122.sup.nd embodiment is the method of embodiment 119,
wherein the binding agent binds to the C-terminal amino acid
residue and the C-terminal amino acid residue is cleaved after each
binding cycle.
[0190] Embodiment 123. The method of embodiment 121, wherein the
N-terminal amino acid residue is cleaved via Edman degradation.
[0191] Embodiment 124. The method of embodiment 93, wherein the
binding agent is a site-specific covalent label of an amino acid or
post-translational modification.
[0192] Embodiment 125. The method of any one of embodiment 93-124,
wherein following step (b), complexes comprising the macromolecule
and associated binding agents are dissociated from the solid
support and partitioned into an emulsion of droplets or
microfluidic droplets.
[0193] Embodiment 126. The method of embodiment 125, wherein each
microfluidic droplet, on average, comprises one complex comprising
the macromolecule and the binding agents.
[0194] Embodiment 127. The method of embodiment 125 or 126, wherein
the recording tag is amplified prior to generating an extended
coding tag or di-tag construct.
[0195] Embodiment 128. The method of any one of embodiments
125-127, wherein emulsion fusion PCR is used to transfer the
recording tag information to the coding tag or to create a
population of di-tag constructs.
[0196] Embodiment 129. The method of any one of embodiments 93-128,
wherein the collection of extended coding tags or di-tag constructs
are amplified prior to analysis.
[0197] Embodiment 130. The method of any one of embodiments 93-129,
wherein analyzing the collection of extended coding tags or di-tag
constructs comprises a nucleic acid sequencing method.
[0198] Embodiment 131. The method of embodiment 130, wherein the
nucleic acid sequencing method is sequencing by synthesis,
sequencing by ligation, sequencing by hybridization, polony
sequencing, ion semiconductor sequencing, or pyrosequencing.
[0199] Embodiment 132. The method of embodiment 130, wherein the
nucleic acid sequencing method is single molecule real-time
sequencing, nanopore-based sequencing, or direct imaging of DNA
using advanced microscopy.
[0200] Embodiment 133. The method of embodiment 130, wherein a
partial composition of the macromolecule is determined by analysis
of a plurality of extended coding tags or di-tag constructs using
unique compartment tags and optionally UMIs.
[0201] Embodiment 134. The method of any one of embodiments 1-133,
wherein the analysis step is performed with a sequencing method
having a per base error rate of >5%, >10%, >15%, >20%,
>25%, or >30%.
[0202] Embodiment 135. The method of any one of embodiments 1-134,
wherein the identifying components of a coding tag, recording tag,
or both comprise error correcting codes.
[0203] Embodiment 136. The method of embodiment 135, wherein the
identifying components are selected from an encoder sequence,
barcode, UMI, compartment tag, cycle specific sequence, or any
combination thereof.
[0204] Embodiment 137. The method of embodiment 135 or 136, wherein
the error correcting code is selected from Hamming code, Lee
distance code, asymmetric Lee distance code, Reed-Solomon code, and
Levenshtein-Tenengolts code.
[0205] Embodiment 138. The method of any one of embodiments 1-134,
wherein the identifying components of a coding tag, recording tag,
or both are capable of generating a unique current or ionic flux or
optical signature, wherein the analysis step comprises detection of
the unique current or ionic flux or optical signature in order to
identify the identifying components.
[0206] Embodiment 139. The method of embodiment 138, wherein the
identifying components are selected from an encoder sequence,
barcode, UMI, compartment tag, cycle specific sequence, or any
combination thereof.
[0207] Embodiment 140. A method for analyzing a plurality of
macromolecules, comprising the steps of:
[0208] (a) providing a plurality macromolecules and associated
recording tags joined to a solid support;
[0209] (b) contacting the plurality of macromolecules with a
plurality of binding agents capable of binding to cognate
macromolecules, wherein each binding agent comprises a coding tag
with identifying information regarding the binding agent;
[0210] (c) transferring the information of a first coding tag of a
first binding agent to a first recording tag associated with the
first macromolecule to generate a first order extended recording
tag, wherein the first binding agent binds to the first
macromolecule;
[0211] (d) contacting the plurality of macromolecules with the
plurality of binding agents capable of binding to cognate
macromolecules;
[0212] (e) transferring the information of a second coding tag of a
second binding agent to the first order extended recording tag to
generate a second order extended recording tag, wherein the second
binding agent binds to the first macromolecule;
[0213] (f) optionally repeating steps (d)-(e) for "n" binding
cycles, wherein the information of each coding tag of each binding
agent that binds to the first macromolecule is transferred to the
extended recording tag generated from the previous binding cycle to
generate an n.sup.th order extended recording tag that represents
the first macromolecule;
[0214] (g) analyzing the n.sup.th order extended recording tag.
[0215] Embodiment 141. The method of embodiment 140, wherein a
plurality of n.sup.th order extended recording tags that represent
a plurality of macromolecules are generated and analyzed.
[0216] Embodiment 142. The method of embodiment 140 or 141, wherein
the macromolecule is a protein.
[0217] Embodiment 143. The method of embodiment 142, wherein the
macromolecule is a peptide.
[0218] Embodiment 144. The method of embodiment 143, wherein the
peptide is obtained by fragmenting proteins from a biological
sample.
[0219] Embodiment 145. The method of any one of embodiments
140-144, wherein the plurality of macromolecules comprises
macromolecules from multiple, pooled samples.
[0220] Embodiment 146. The method of any one of embodiments
140-145, wherein the recording tag is a DNA molecule, an RNA
molecule, a PNA molecule, a BNA molecule, an XNA, molecule, an LNA
molecule, a .gamma.PNA molecule, or a combination thereof.
[0221] Embodiment 147. The method of any one of embodiments
140-146, wherein the recording tag comprises a unique molecular
identifier (UMI).
[0222] Embodiment 148. The method of embodiments 140-147, wherein
the recording tag comprises a compartment tag.
[0223] Embodiment 149. The method of any one of embodiments
140-148, wherein the recording tag comprises a universal priming
site.
[0224] Embodiment 150. The method of any one of embodiments
140-149, wherein the recording tag comprises a spacer at its
3'-terminus.
[0225] Embodiment 151. The method of any one of embodiments
140-150, wherein the coding tag comprises an encoder sequence.
[0226] Embodiment 152. The method of any one of embodiments
140-151, wherein the coding tag comprises a UMI.
[0227] Embodiment 153. The method of any one of embodiments
140-152, wherein the coding tag comprises a universal priming
site.
[0228] Embodiment 154. The method of any one of embodiments
140-153, wherein the coding tag comprises a spacer at its
3'-terminus.
[0229] Embodiment 155. The method of any one of embodiments
140-154, wherein the coding tag comprises a binding cycle specific
sequence.
[0230] Embodiment 156. The method of any one of embodiments
140-155, wherein the coding tag comprises a unique molecular
identifier.
[0231] Embodiment 157. The method of any one of embodiments
140-156, wherein the binding agent and the coding tag are joined by
a linker.
[0232] Embodiment 158. The method of any one of embodiments
140-157, wherein transferring information of the recording tag to
the coding tag is mediated by primer extension.
[0233] Embodiment 159. The method of any one of embodiments
140-158, wherein transferring information of the recording tag to
the coding tag is mediated by ligation.
[0234] Embodiment 160. The method of any one of embodiments
140-159, wherein the plurality of macromolecules, the associated
recording tags, or both are covalently joined to the solid
support.
[0235] Embodiment 161. The method of any one of embodiments
140-160, wherein the solid support is a bead, a porous bead, a
porous matrix, an array, a glass surface, a silicon surface, a
plastic surface, a filter, a membrane, nylon, a silicon wafer chip,
a flow through chip, a biochip including signal transducing
electronics, a microtitre well, an ELISA plate, a spinning
interferometry disc, a nitrocellulose membrane, a
nitrocellulose-based polymer surface, a nanoparticle, or a
microsphere.
[0236] Embodiment 162. The method of embodiment 161, wherein the
solid support is a polystyrene bead, a polymer bead, an agarose
bead, an acrylamide bead, a solid core bead, a porous bead, a
paramagnetic bead, glass bead, or a controlled pore bead.
[0237] Embodiment 163. The method of any one of embodiments
140-162, wherein the binding agent is a polypeptide or protein.
[0238] Embodiment 164. The method of embodiment 163, wherein the
binding agent is a modified aminopeptidase, a modified amino acyl
tRNA synthetase, a modified anticalin, or an antibody or binding
fragment thereof.
[0239] Embodiment 165. The method of any one of embodiments 142-164
wherein the binding agent binds to a single amino acid residue, a
dipeptide, a tripeptide or a post-translational modification of the
peptide.
[0240] Embodiment 166. The method of embodiment 165, wherein the
binding agent binds to an N-terminal amino acid residue, a
C-terminal amino acid residue, or an internal amino acid
residue.
[0241] Embodiment 167. The method of embodiment 165, wherein the
binding agent binds to an N-terminal peptide, a C-terminal peptide,
or an internal peptide.
[0242] Embodiment 168. The method of any one of embodiments
142-164, wherein the binding agent binds to a chemical label of a
modified N-terminal amino acid residue, a modified C-terminal amino
acid residue, or a modified internal amino acid residue.
[0243] Embodiment 169. The method of embodiment 166 or 168, wherein
the binding agent binds to the N-terminal amino acid residue or the
chemical label of the modified N-terminal amino acid residue, and
the N-terminal amino acid residue is cleaved after each binding
cycle.
[0244] Embodiment 170. The method of embodiment 166 or 168, wherein
the binding agent binds to the C-terminal amino acid residue or the
chemical label of the modified C-terminal amino acid residue, and
the C-terminal amino acid residue is cleaved after each binding
cycle.
[0245] Embodiment 171. The method of embodiment 169, wherein the
N-terminal amino acid residue is cleaved via Edman degradation,
Edmanase, a modified amino peptidase, or a modified acylpeptide
hydrolase.
[0246] Embodiment 172. The method of embodiment 163, wherein the
binding agent is a site-specific covalent label of an amino acid or
post-translational modification.
[0247] Embodiment 173. The method of any one of embodiments
140-172, wherein the plurality of n.sup.th order extended recording
tags are amplified prior to analysis.
[0248] Embodiment 174. The method of any one of embodiments
140-173, wherein analyzing the n.sup.th order extended recording
tag comprises a nucleic acid sequencing method.
[0249] Embodiment 175. The method of embodiment 174, wherein a
plurality of n.sup.th order extended recording tags representing a
plurality of macromolecules are analyzed in parallel.
[0250] Embodiment 176. The method of embodiment 174 or 175, wherein
the nucleic acid sequencing method is sequencing by synthesis,
sequencing by ligation, sequencing by hybridization, polony
sequencing, ion semiconductor sequencing, or pyrosequencing.
[0251] Embodiment 177. The method of embodiment 174 or 175, wherein
the nucleic acid sequencing method is single molecule real-time
sequencing, nanopore-based sequencing, or direct imaging of DNA
using advanced microscopy.
BRIEF DESCRIPTION OF THE FIGURES
[0252] Non-limiting embodiments of the present invention will be
described by way of example with reference to the accompanying
figures, which are schematic and are not intended to be drawn to
scale. For purposes of illustration, not every component is labeled
in every figure, nor is every component of each embodiment of the
invention shown where illustration is not necessary to allow those
of ordinary skill in the art to understand the invention.
[0253] FIGS. 1A-B: FIG. 1A illustrates key for functional elements
shown in the figures. FIG. 1B illustrates a general overview of
transducing protein code to a DNA code where a plurality of
proteins or polypeptides are fragmented into a plurality of
peptides, which are then converted into a library of extended
recording tags, representing the plurality of peptides. The
extended recording tags constitute a DNA Encoded Library
representing the peptide sequences. The library can be
appropriately modified to sequence on any Next Generation
Sequencing (NGS) platform.
[0254] FIGS. 2A-2D illustrate an example of protein macromolecule
analysis according to the methods disclosed herein, using multiple
cycles of binding agents (e.g., antibodies, anticalins, N-recognins
proteins (e.g., ATP-dependent Clp protease adaptor protein (ClpS)),
aptamers, etc. and variants/homologues thereof) comprising coding
tags interacting with an immobilized protein that is co-localized
or co-labeled with a single or multiple recording tags. The
recording tag is comprised of a universal priming site, a barcode
(e.g., partition barcode, compartment barcode, fraction barcode),
an optional unique molecular identifier (UMI) sequence, and a
spacer sequence (Sp) used in information transfer of the coding
tag. The spacer sequence (Sp) can be constant across all binding
cycles, be binding agent specific, or be binding cycle number
specific. The coding tag is comprised of an encoder sequence
providing identifying information for the binding agent, an
optional UMI, and a spacer sequence that hybridizes to the
complementary spacer sequence on the recording tag, facilitating
transfer of coding tag information to the recording tag (e.g.,
primer extension, also referred to herein as polymerase extension).
FIG. 2A illustrates a process of creating an extended recording tag
through the cyclic binding of cognate binding agents to a protein,
and corresponding information transfer from the binding agent's
coding tag to the protein's recording tag. After a series of
sequential binding and coding tag information transfer steps, the
final extended recording tag is produced, containing binding agent
coding tag information including encoder sequences from "n" binding
cycles providing identifying information for the binding agents
(e.g., antibody 1 (Ab1), antibody 2 (Ab2), antibody 3 (Ab3), . . .
antibody "n" (Abn)), a barcode/optional UMI sequence from the
recording tag, an optional UMI sequence from the binding agent's
coding tag, and flanking universal priming sequences at each end of
the library construct to facilitate amplification and analysis by
digital next-generation sequencing.
[0255] FIG. 2B illustrates an example of a scheme for labeling a
protein with DNA barcoded recording tags. In the top panel,
N-hydroxysuccinimide (NHS) is an amine reactive coupling agent, and
Dibenzocyclooctyl (DBCO) is a strained alkyne useful in "click"
coupling to the surface of a solid substrate. In this scheme, the
recording tags are coupled to c amines of lysine (K) residues (and
optionally N-terminal amino acids) of the protein via NHS moieties.
In the bottom panel, a heterobifunctional linker, NHS-alkyne, is
used to label the c amines of lysine (K) residues to create an
alkyne "click" moiety. Azide-labeled DNA recording tags can then
easily be attached to these reactive alkyne groups via standard
click chemistry. Moreover, the DNA recording tag can also be
designed with an orthogonal methyltetrazine (mTet) moiety for
downstream coupling to a TCO-derivatized sequencing substrate via
an inverse iEDDA reaction. FIG. 2C illustrates two examples of the
protein analysis methods using recording tags. In the top panel,
protein macromolecules are immobilized on a solid support via a
capture agent and optionally cross-linked. Either the protein or
capture agent may be labeled with a recording tag. In the bottom
panel, proteins with associated recording tags are directly
immobilized on a solid support. FIG. 2D illustrates an example of
an overall workflow for a simple protein immunoassay using DNA
encoding of cognate binders and sequencing of the resultant
extended recording tag. The proteins can be sample barcoded (i.e.,
indexed) via recording tags and pooled prior to cyclic binding
analysis, greatly increasing sample throughput and economizing on
binding reagents. This approach is effectively a digital, simpler,
and more scalable approach to performing reverse phase protein
assays (RPPA).
[0256] FIG. 3 illustrates a process for a degradation-based peptide
sequencing assay by construction of a DNA extended recording tag
representing the peptide sequence. This is accomplished through an
Edman degradation-like approach using a cyclic process of
N-terminal amino acid (NTAA) binding, coding tag information
transfer to a recording tag attached to the peptide, NTAA cleavage,
and repeating the process in a cyclic manner, all on a solid
support. Provided is an overview of an exemplary construction of an
extended recording tag from N-terminal degradation of a peptide:
first at Step a), "Label NTAA", the N-terminal amino acid of a
peptide is labeled (e.g., with a phenylthiocarbamoyl (PTC),
dinitrophenyl (DNP), sulfonyl nitrophenyl (SNP), acetyl, or
guanidindyl moiety); Step b) shows a binding agent and an
associated coding tag bound to the labeled NTAA; Step c) shows the
peptide bound to a solid support (e.g., bead) and associated with a
recording tag (e.g., via a trifunctional linker), wherein upon
binding of the binding agent to the NTAA of the peptide,
information of the coding tag is transferred to the recording tag
(e.g., via primer extension) to generate an extended recording tag;
and in Step d), the labeled NTAA is cleaved via chemical or
enzymatic means to expose a new NTAA. As illustrated by the arrows,
the cycle is repeated "n" times to generate a final extended
recording tag. The final extended recording tag is optionally
flanked by universal priming sites to facilitate downstream
amplification and DNA sequencing. The forward universal priming
site (e.g., Illumina's P5-S1 sequence) can be part of the original
recording tag design and the reverse universal priming site (e.g.,
Illumina's P7-S2' sequence) can be added as a final step in the
extension of the recording tag. This final step may be done
independently of a binding agent.
[0257] FIGS. 4A-B illustrate exemplary protein sequencing workflows
according to the methods disclosed herein. FIG. 4A illustrates
exemplary work flows with alternative modes outlined in light grey
dashed lines, with a particular embodiment shown in boxes linked by
arrows. Alternative modes for each step of the workflow are shown
in boxes below the arrows. FIG. 4B illustrates options in
conducting a cyclic binding and coding tag information transfer
step to improve the efficiency of information transfer. Multiple
recording tags per molecule can be employed. Moreover, for a given
binding event, the transfer of coding tag information to the
recording tag can be conducted multiples times, or alternatively, a
surface amplification step can be employed to create copies of the
extended recording tag library, etc.
[0258] FIGS. 5A-B illustrate an overview of an exemplary
construction of an extended recording tag using primer extension to
transfer identifying information of a coding tag of a binding agent
to a recording tag associated with a macromolecule (e.g., peptide)
to generate an extended recording tag. A coding tag comprising a
unique encoder sequence with identifying information regarding the
binding agent is optionally flanked on each end by a common spacer
sequence (Sp'). FIG. 5A illustrates an NTAA binding agent
comprising a coding tag binding to an NTAA of a recording-tag
labeled peptide linked to a bead. The recording tag anneals to the
coding tag via complementary spacer sequence (Sp), and a primer
extension reaction mediates transfer of coding tag information to
the recording tag using the spacer (Sp) as a priming site. The
coding tag is illustrated as a duplex with a single stranded spacer
(Sp') sequence at the terminus distal to the binding agent. This
configuration minimizes hybridization of the coding tag to internal
sites in the recording tag and favors hybridization of the
recording tag's terminal spacer (Sp) sequence with the single
stranded spacer overhang (Sp') of the coding tag. Moreover, the
extended recording tag may be pre-annealed with oligonucleotides
(complementary to encoder, spacer sequences) to block hybridization
of the coding tag to internal recording tag sequence elements. FIG.
5B shows a final extended recording tag produced after "n" cycles
of binding ("***" represents intervening binding cycles not shown
in the extended recording tag) and transfer of coding tag
information and the addition of a universal priming site at the
3'-end.
[0259] FIG. 6 illustrates coding tag information being transferred
to an extended recording tag via enzymatic ligation. Two different
macromolecules are shown with their respective recording tags, with
recording tag extension proceeding in parallel. Ligation can be
facilitated by designing the double stranded coding tags so that
the spacer sequences (Sp) have a "sticky end" overhang that anneals
with a complementary spacer (Sp') on the recording tag. The
complementary strand of a double stranded coding tag transfers
information to the recording tag. When ligation is used to extend
the recording tag, the direction of extension can be 5' to 3' as
illustrated, or optionally 3' to 5'.
[0260] FIG. 7 illustrates a "spacer-less" approach of transferring
coding tag information to a recording tag via chemical ligation to
link the 3' nucleotide of a recording tag or extended recording tag
to the 5' nucleotide of the coding tag (or its complement) without
inserting a spacer sequence into the extended recording tag. The
orientation of the extended recording tag and coding tag could also
be inverted such that the 5' end of the recording tag is ligated to
the 3' end of the coding tag (or complement). In the example shown,
hybridization between complementary "helper" oligonucleotide
sequences on the recording tag ("recording helper") and the coding
tag are used to stabilize the complex to enable specific chemical
ligation of the recording tag to coding tag complementary strand.
The resulting extended recording tag is devoid of spacer sequences.
Also illustrated is a "click chemistry" version of chemical
ligation (e.g., using azide and alkyne moieties (shown as a triple
line symbol)) which can employ DNA, PNA, or similar nucleic acid
polymers.
[0261] FIGS. 8A-B illustrate an exemplary method of writing of
post-translational modification (PTM) information of a peptide into
an extended recording tag prior to N-terminal amino acid
degradation. FIG. 8A: A binding agent comprising a coding tag with
identifying information regarding the binding agent (e.g., a
phosphotyrosine antibody comprising a coding tag with identifying
information for phosphotyrosine antibody) is capable of binding to
the peptide. If phosphotyrosine is present in the recording
tag-labeled peptide, as illustrated, upon binding of the
phosphotyrosine antibody to phosphotyrosine, the coding tag and
recording tag anneal via complementary spacer sequences and the
coding tag information is transferred to the recording tag to
generate an extended recording tag. FIG. 8B: An extended recording
tag may comprise coding tag information for both primary amino acid
sequence (e.g., "aa.sub.1", "aa.sub.2", "aa.sub.3", . . . ,
"aa.sub.N") and post-translational modifications (e.g.,
"PTM.sub.1", "PTM.sub.2") of the peptide.
[0262] FIGS. 9A-B illustrate a process of multiple cycles of
binding of a binding agent to a macromolecule and transferring
information of a coding tag that is attached to a binding agent to
an individual recording tag among a plurality of recording tags
co-localized at a site of a single macromolecule attached to a
solid support (e.g., a bead), thereby generating multiple extended
recording tags that collectively represent the macromolecule. In
these figures, for purposes of example only, the macromolecule is a
peptide and each cycle involves binding a binding agent to an
N-terminal amino acid (NTAA), recording the binding event by
transferring coding tag information to a recording tag, followed by
removal of the NTAA to expose a new NTAA. FIG. 9A illustrates a
plurality of recording tags (comprising universal forward priming
sequence and a UMI) co-localized on a solid support with the
macromolecule. Individual recording tags possess a common spacer
sequence (Sp) complementary to a common spacer sequence within
coding tags of binding agents, which can be used to prime an
extension reaction to transfer coding tag information to a
recording tag. FIG. 9B illustrates different pools of
cycle-specific NTAA binding agents that are used for each
successive cycle of binding, each pool having cycle specific spacer
sequences.
[0263] FIGS. 10A-C illustrate an exemplary mode comprising multiple
cycles of transferring information of a coding tag that is attached
to a binding agent to a recording tag among a plurality of
recording tags co-localized at a site of a single macromolecule
attached to a solid support (e.g., a bead), thereby generating
multiple extended recording tags that collectively represent the
macromolecule. In this figure, for purposes of example only, the
macromolecule is a peptide and each round of processing involves
binding to an NTAA, recording the binding event, followed by
removal of the NTAA to expose a new NTAA. FIG. 10A illustrates a
plurality of recording tags (comprising a universal forward priming
sequence and a UMI) co-localized on a solid support with the
macromolecule, preferably a single molecule per bead. Individual
recording tags possess different spacer sequences at their 3'-end
with different "cycle specific" sequences (e.g., C.sub.1, C.sub.2,
C.sub.3, . . . C.sub.n). Preferably, the recording tags on each
bead share the same UMI sequence. In a first cycle of binding
(Cycle 1), a plurality of NTAA binding agents is contacted with the
macromolecule. The binding agents used in Cycle 1 possess a common
5'-spacer sequence (C'1) that is complementary to the Cycle 1
C.sub.1 spacer sequence of the recording tag. The binding agents
used in Cycle 1 also possess a 3'-spacer sequence (C'2) that is
complementary to the Cycle 2 spacer C.sub.2. During binding Cycle
1, a first NTAA binding agent binds to the free N-terminus of the
macromolecule, and the information of a first coding tag is
transferred to a cognate recording tag via primer extension from
the C.sub.1 sequence hybridized to the complementary C'.sub.1
spacer sequence. Following removal of the NTAA to expose a new
NTAA, binding Cycle 2 contacts a plurality of NTAA binding agents
that possess a Cycle 2 5'-spacer sequence (C'2) that is identical
to the 3'-spacer sequence of the Cycle 1 binding agents and a
common Cycle 3 3'-spacer sequence (C'3), with the macromolecule. A
second NTAA binding agent binds to the NTAA of the macromolecule,
and the information of a second coding tag is transferred to a
cognate recording tag via primer extension from the complementary
C.sub.2 and C'.sub.2 spacer sequences. These cycles are repeated up
to "n" binding cycles, wherein the last extended recording tag is
capped with a universal reverse priming sequence, generating a
plurality of extended recording tags co-localized with the single
macromolecule, wherein each extended recording tag possesses coding
tag information from one binding cycle. Because each set of binding
agents used in each successive binding cycle possess cycle specific
spacer sequences in the coding tags, binding cycle information can
be associated with binding agent information in the resulting
extended recording tags. FIG. 10B illustrates different pools of
cycle-specific binding agents that are used for each successive
cycle of binding, each pool having cycle specific spacer sequences.
FIG. 10C illustrates how the collection of extended recording tags
that are co-localized at the site of the macromolecule can be
assembled in a sequential order based on PCR assembly of the
extended recording tags using cycle specific spacer sequences,
thereby providing an ordered sequence of the macromolecule. In a
preferred mode, multiple copies of each extended recording tag are
generated via amplification prior to concatenation.
[0264] FIGS. 11A-B illustrate information transfer from recording
tag to a coding tag or di-tag construct. Two methods of recording
binding information are illustrated in FIG. 11A and FIG. 11B. A
binding agent may be any type of binding agent as described herein;
an anti-phosphotyrosine binding agent is shown for illustration
purposes only. For extended coding tag or di-tag construction,
rather than transferring binding information from the coding tag to
the recording tag, information is either transferred from the
recording tag to the coding tag to generate an extended coding tag
(FIG. 11A), or information is transferred from both the recording
tag and coding tag to a third di-tag-forming construct (FIG. 11B).
The di-tag and extended coding tag comprise the information of the
recording tag (containing a barcode, an optional UMI sequence, and
an optional compartment tag (CT) sequence (not illustrated)) and
the coding tag. The di-tag and extended coding tag can be eluted
from the recording tag, collected, and optionally amplified and
read out on a next generation sequencer.
[0265] FIGS. 12A-D illustrate design of PNA combinatorial
barcode/UMI recording tag and di-tag detection of binding events.
In FIG. 12A, the construction of a combinatorial PNA barcode/UMI
via chemical ligation of four elementary PNA word sequences (A,
A'-B, B'-C, and C') is illustrated. Hybridizing DNA arms are
included to create a spacer-less combinatorial template for
combinatorial assembly of a PNA barcode/UMI. Chemical ligation is
used to stitch the annealed PNA "words" together. FIG. 12B shows a
method to transfer the PNA information of the recording tag to a
DNA intermediate. The DNA intermediate is capable of transferring
information to the coding tag. Namely, complementary DNA word
sequences are annealed to the PNA and chemically ligated
(optionally enzymatically ligated if a ligase is discovered that
uses a PNA template). In FIG. 12C, the DNA intermediate is designed
to interact with the coding tag via a spacer sequence, Sp. A
strand-displacing primer extension step displaces the ligated DNA
and transfers the recording tag information from the DNA
intermediate to the coding tag to generate an extended coding tag.
A terminator nucleotide may be incorporated into the end of the DNA
intermediate to prevent transfer of coding tag information to the
DNA intermediate via primer extension. FIG. 12D: Alternatively,
information can be transferred from coding tag to the DNA
intermediate to generate a di-tag construct. A terminator
nucleotide may be incorporated into the end of the coding tag to
prevent transfer of recording tag information from the DNA
intermediate to the coding tag.
[0266] FIG. 13 illustrates proteome partitioning on a compartment
barcoded bead, and subsequent di-tag assembly via emulsion fusion
PCR to generate a library of elements representing peptide sequence
composition. The amino acid content of the peptide can be
subsequently characterized through N-terminal sequencing or
alternatively through attachment (covalent or non-covalent) of
amino acid specific chemical labels or binding agents associated
with a coding tag. The coding tag is comprised of universal priming
sequence, as well as an encoder sequence for the amino acid
identity, a compartment tag, and an amino acid UMI. After
information transfer, the ditags are mapped back to the originating
molecule via the recording tag UMI. In Step a), the proteome is
compartmentalized into droplets with barcoded beads. Peptides with
associated recording tags (comprising compartment barcode
information) are attached to the bead surface. The droplet emulsion
is then broken releasing barcoded beads with partitioned peptides.
In Step b),_specific amino acid residues on the peptides are
chemically labeled with DNA coding tags that are conjugated to
site-specific labeling moieties. The DNA coding tags comprise amino
acid barcode information and optionally an amino acid UMI. In Step
c), labeled peptide-recording tag complexes are released from the
beads. In Step d), the labeled peptide-recording tag complexes are
emulsified into nano or microemulsions such that there is, on
average, less than one peptide-recording tag complex per
compartment. In Step e), an emulsion fusion PCR transfers recording
tag information (e.g., compartment barcode) to all of the DNA
coding tags attached to the amino acid residues (indicated as PCR 1
and PCR 2).
[0267] FIG. 14 illustrates generation of extended coding tags from
emulsified peptide recording tag--coding tags complex. The
dissociated peptide complexes from Step c) of FIG. 13 are
co-emulsified with PCR reagents into droplets with on average a
single peptide complex per droplet. A three-primer fusion PCR
approach is used to amplify the recording tag associated with the
peptide, fuse the amplified recording tags to multiple binding
agent coding tags or coding tags of covalently labeled amino acids,
extend the coding tags via primer extension to transfer peptide UMI
and compartment tag information from the recording tag to the
coding tag, and amplify the resultant extended coding tags. There
are multiple extended coding tag species per droplet, with a
different species for each amino acid encoder sequence-UMI coding
tag present. In this way, both the identity and count of amino
acids within the peptide can be determined. The U1 universal primer
and Sp primer are designed to have a higher melting Tm than the
U2.sub.tr universal primer. This enables a two-step PCR in which
the first few cycles are performed at a higher annealing
temperature to amplify the recording tag, and then stepped to a
lower Tm so that the recording tags and coding tags prime on each
other during PCR to produce an extended coding tag, and the U1 and
U2.sub.tr universal primers are used to prime amplification of the
resultant extended coding tag product. In certain embodiments,
premature polymerase extension from the U2.sub.tr primer can be
prevented by using a photo-labile 3' blocking group (Young et al.,
2008, Chem. Commun. (Camb) 4:462-464). After the first round of PCR
amplifying the recording tags, and a second-round fusion PCR step
in which the coding tag Sp.sub.tr primes extension of the coding
tag on the amplified Sp' sequences of the recording tag, the 3'
blocking group of U2.sub.tr is removed, and a higher temperature
PCR is initiated for amplifying the extended coding tags with U1
and U2.sub.tr primers.
[0268] FIGS. 15A-15B illustrate of proteome partitioning and
barcoding facilitating enhanced mappability and phasing of
proteins. In peptide sequencing, proteins are typically digested
into peptides. In this process, information about the relationship
between individual peptides that originated from a parent protein
molecule, and their relationship to the parent protein molecule is
lost. In order to reconstruct this information, individual peptide
sequences are mapped back to a collection of protein sequences from
which they may have derived. The task of finding a unique match in
such a set is rendered more difficult with short and/or partial
peptide sequences, and as the size and complexity of the collection
(e.g., proteome sequence complexity) increases. The partitioning of
the proteome into barcoded (e.g., compartment tagged) compartments
or partitions, subsequent digestion of the protein into peptides,
and the joining of the compartment tags to the peptides reduces the
"protein" space to which a peptide sequence needs to be mapped to,
greatly simplifying the task in the case of complex protein
samples. Labeling of a protein with unique molecular identifier
(UMI) prior to digestion into peptides facilitates mapping of
peptides back to the originating protein molecule and allows
annotation of phasing information between post-translational
modified (PTM) variants derived from the same protein molecule and
identification of individual proteoforms. FIG. 15A shows an example
of proteome partitioning comprising labeling proteins with
recording tags comprising a partition barcode and subsequent
fragmentation into recording-tag labeled peptides. FIG. 15B: For
partial peptide sequence information or even just composition
information, this mapping is highly-degenerate. However, partial
peptide sequence or composition information coupled with
information from multiple peptides from the same protein, allow
unique identification of the originating protein molecule.
[0269] FIG. 16 illustrates exemplary modes of compartment tagged
bead sequence design. The compartment tags comprise a barcode of
X.sub.5-20 to identify an individual compartment and a unique
molecular identifier (UMI) of N.sub.5-10 to identify the peptide to
which the compartment tag is joined, where X and N represent
degenerate nucleobases or nucleobase words. Compartment tags can be
single stranded (upper depictions) or double stranded (lower
depictions). Optionally, compartment tags can be a chimeric
molecule comprising a peptide sequence (CGSNVH, SEQ ID NO:181) with
a recognition sequence for a protein ligase (e.g., butelase I) for
joining to a peptide of interest (left depictions). Alternatively,
a chemical moiety can be included on the compartment tag for
coupling to a peptide of interest (e.g., azide as shown in right
depictions).
[0270] FIGS. 17A-B. FIG. 17A illustrates a plurality of extended
recording tags representing a plurality of peptides; and FIG. 17B
illustrates an exemplary method of target peptide enrichment via
standard hybrid capture techniques. For example, hybrid capture
enrichment may use one or more biotinylated "bait" oligonucleotides
that hybridize to extended recording tags representing one or more
peptides of interest ("target peptides") from a library of extended
recording tags representing a library of peptides. The bait
oligonucleotide:target extended recording tag hybridization pairs
are pulled down from solution via the biotin tag after
hybridization to generate an enriched fraction of extended
recording tags representing the peptide or peptides of interest.
The separation ("pull down") of extended recording tags can be
accomplished, for example, using streptavidin-coated magnetic
beads. The biotin moieties bind to streptavidin on the beads, and
separation is accomplished by localizing the beads using a magnet
while solution is removed or exchanged. A non-biotinylated
competitor enrichment oligonucleotide that competitively hybridizes
to extended recording tags representing undesirable or
over-abundant peptides can optionally be included in the
hybridization step of a hybrid capture assay to modulate the amount
of the enriched target peptide. The non-biotinylated competitor
oligonucleotide competes for hybridization to the target peptide,
but the hybridization duplex is not captured during the capture
step due to the absence of a biotin moiety. Therefore, the enriched
extended recording tag fraction can be modulated by adjusting the
ratio of the competitor oligonucleotide to the biotinylated "bait"
oligonucleotide over a large dynamic range. This step will be
important to address the dynamic range issue of protein abundance
within the sample.
[0271] FIG. 18 illustrates exemplary methods of single cell and
bulk proteome partitioning into individual droplets, each droplet
comprising a bead having a plurality of compartment tags attached
thereto to correlate peptides to their originating protein complex,
or to proteins originating from a single cell. The compartment tags
comprise barcodes. Manipulation of droplet constituents after
droplet formation: Method A illustrates single cell partitioning
into an individual droplet followed by cell lysis to release the
cell proteome, and proteolysis to digest the cell proteome into
peptides, and inactivation of the protease following sufficient
proteolysis; B illustrates bulk proteome partitioning into a
plurality of droplets wherein an individual droplet comprises a
protein complex followed by proteolysis to digest the protein
complex into peptides, and inactivation of the protease following
sufficient proteolysis. A heat labile metallo-protease can be used
to digest the encapsulated proteins into peptides after
photo-release of photo-caged divalent cations to activate the
protease. The protease can be heat inactivated following sufficient
proteolysis, or the divalent cations may be chelated. Droplets
contain hybridized or releasable compartment tags comprising
nucleic acid barcodes (separate from recording tag) capable of
being ligated to either an N- or C-terminal amino acid of a
peptide.
[0272] FIG. 19 illustrates exemplary methods of single cell and
bulk proteome partitioning into individual droplets, each droplet
comprising a bead having a plurality of bifunctional recording tags
with compartment tags attached thereto to correlate peptides to
their originating protein or protein complex, or proteins to
originating single cell. Manipulation of droplet constituents after
post droplet formation: Method A illustrates single cell
partitioning into an individual droplet followed by cell lysis to
release the cell proteome, and proteolysis to digest the cell
proteome into peptides, and inactivation of the protease following
sufficient proteolysis; Method B illustrates bulk proteome
partitioning into a plurality of droplets wherein an individual
droplet comprises a protein complex followed by proteolysis to
digest the protein complex into peptides, and inactivation of the
protease following sufficient proteolysis. A heat labile
metallo-protease can be used to digest the encapsulated proteins
into peptides after photo-release of photo-caged divalent cations
(e.g., Zn2+). The protease can be heat inactivated following
sufficient proteolysis or the divalent cations may be chelated.
Droplets contain hybridized or releasable compartment tags
comprising nucleic acid barcodes (separate from recording tag)
capable of being ligated to either an N- or C-terminal amino acid
of a peptide.
[0273] FIGS. 20A-L illustrate generation of compartment barcoded
recording tags attached to peptides. Compartment barcoding
technology (e.g., barcoded beads in microfluidic droplets, etc.)
can be used to transfer a compartment-specific barcode to molecular
contents encapsulated within a particular compartment. FIG. 20 A:
In a particular embodiment, the protein molecule is denatured, and
the .epsilon.-amine group of lysine residues (K) is chemically
conjugated to an activated universal DNA tag molecule (comprising a
universal priming sequence (U1)), shown with NHS moiety at the 5'
end). After conjugation of universal DNA tags to the polypeptide,
excess universal DNA tags are removed. FIG. 20 B: The universal DNA
tagged-polypeptides are hybridized to nucleic acid molecules bound
to beads, wherein the nucleic acid molecules bound to an individual
bead comprise a unique population of compartment tag (barcode)
sequences. The compartmentalization can occur by separating the
sample into different physical compartments, such as droplets
(illustrated by the dashed oval). Alternatively,
compartmentalization can be directly accomplished by the
immobilization of the labeled polypeptides on the bead surface,
e.g., via annealing of the universal DNA tags on the polypeptide to
the compartment DNA tags on the bead, without the need for
additional physical separation. A single polypeptide molecule
interacts with only a single bead (e.g., a single polypeptide does
not span multiple beads). Multiple polypeptides, however, may
interact with the same bead. In addition to the compartment barcode
sequence (BC), the nucleic acid molecules bound to the bead may be
comprised of a common Sp (spacer) sequence, a unique molecular
identifier (UMI), and a sequence complementary to the polypeptide
DNA tag, U1'. FIG. 20 C: After annealing of the universal DNA
tagged polypeptides to the compartment tags bound to the bead, the
compartment tags are released from the beads via cleavage of the
attachment linkers. FIG. 20 D: The annealed U1 DNA tag primers are
extended via polymerase-based primer extension using the
compartment tag nucleic acid molecule originating from the bead as
template. The primer extension step may be carried out after
release of the compartment tags from the bead as shown in (C) or,
optionally, while the compartment tags are still attached to the
bead (not shown). This effectively writes the barcode sequence from
the compartment tags on the bead onto the U1 DNA-tag sequence on
the polypeptide. This new sequence constitutes a recording tag.
After primer extension, a protease, e.g., Lys-C (cleaves on
C-terminal side of lysine residues), Glu-C (cleaves on C-terminal
side of glutamic acid residues and to a lower extent glutamic acid
residues), or random protease such as Proteinase K, is used to
cleave the polypeptide into peptide fragments. FIG. 20 E: Each
peptide fragment is labeled with an extended DNA tag sequence
constituting a recording tag on its C-terminal lysine for
downstream peptide sequencing as disclosed herein. FIG. 20 F: The
recording tagged peptides are coupled to azide beads through a
strained alkyne label, DBCO. The azide beads optionally also
contain a capture sequence complementary to the recording tag to
facilitate the efficiency of DBCO-azide immobilization. It should
be noted that removing the peptides from the original beads and
re-immobilizing to a new solid support (e.g., beads) permits
optimal intermolecular spacing between peptides to facilitate
peptide sequencing methods as disclosed herein. FIGS. 20G-L
illustrates a similar concept as illustrated in FIGS. 20A-F except
using click chemistry conjugation of DNA tags to an alkyne
pre-labeled polypeptide (as described in FIG. 2B). The Azide and
mTet chemistries are orthogonal allowing click conjugation to DNA
tags and click iEDDA conjugation (mTet and TCO) to the sequencing
substrate.
[0274] FIG. 21 illustrates an exemplary method using flow-focusing
T-junction for single cell and compartment tagged (e.g., barcode)
compartmentalization with beads. With two aqueous flows, cell lysis
and protease activation (Zn.sup.2+ mixing) can easily be initiated
upon droplet formation.
[0275] FIGS. 22A-B illustrate exemplary tagging details. FIG. 22A:
A compartment tag (DNA-peptide chimera) is attached onto the
peptide using peptide ligation with Butelase I. FIG. 22B:
Compartment tag information is transferred to an associated
recording tag prior to commencement of peptide sequencing.
Optionally, an endopeptidase AspN, which selectively cleaves
peptide bonds N-terminal to aspartic acid residues, can be used to
cleave the compartment tag after information transfer to the
recording tag.
[0276] FIGS. 23A-C: Array-based barcodes for a spatial
proteomics-based analysis of a tissue slice. FIG. 23A: An array of
spatially-encoded DNA barcodes (feature barcodes denoted by
BC.sub.ij), is combined with a tissue slice (FFPE or frozen). In
one embodiment, the tissue slice is fixed and permeabilized. In a
preferred embodiment, the array feature size is smaller than the
cell size (.about.10 .mu.m for human cells). FIG. 23B: The
array-mounted tissue slice is treated with reagents to reverse
cross-linking (e.g., antigen retrieval protocol w/ citraconic
anhydride (Namimatsu, Ghazizadeh et al. 2005), and then the
proteins therein are labeled with site-reactive DNA labels, that
effectively label all protein molecules with DNA recording tags
(e.g., lysine labeling, liberated after antigen retrieval). After
labeling and washing, the array bound DNA barcode sequences are
cleaved and allowed to diffuse into the mounted tissue slice and
hybridize to DNA recording tags attached to the proteins therein.
FIG. 23C: The array-mounted tissue is now subjected to polymerase
extension to transfer information of the hybridized barcodes to the
DNA recording tags labeling the proteins. After transfer of the
barcode information, the array-mounted tissue is scraped from the
slides, optionally digested with a protease, and the proteins or
peptides extracted into solution.
[0277] FIGS. 24A-B illustrate two different exemplary DNA target
macromolecules (AB and CD) that are immobilized on beads and
assayed by binding agents attached to coding tags. This model
system serves to illustrate the single molecule behavior of coding
tag transfer from a bound agent to a proximal reporting tag. In the
preferred embodiment, the coding tags are incorporated into an
extended recoding tag via primer extension. FIG. 24A illustrates
the interaction of an AB macromolecule with an A-specific binding
agent ("A'", an oligonucleotide sequence complementary to the "A"
component of the AB macromolecule) and transfer of information of
an associated coding tag to a recording tag via primer extension,
and a B-specific binding agent ("B'", an oligonucleotide sequence
complementary to the "B" component of the AB macromolecule) and
transfer of information of an associated coding tag to a recoding
tag via primer extension. Coding tags A and B are of different
sequence, and for ease of identification in this illustration, are
also of different length. The different lengths facilitate analysis
of coding tag transfer by gel electrophoresis, but are not required
for analysis by next generation sequencing. The binding of A' and
B' binding agents are illustrated as alternative possibilities for
a single binding cycle. If a second cycle is added, the extended
recording tag would be further extended. Depending on which of A'
or B' binding agents are added in the first and second cycles, the
extended recording tags can contain coding tag information of the
form AA, AB, BA, and BB. Thus, the extended recording tag contains
information on the order of binding events as well as the identity
of binders. Similarly, FIG. 24B illustrates the interaction of a CD
macromolecule with a C-specific binding agent ("C'", an
oligonucleotide sequence complementary to the "C" component of the
CD macromolecule) and transfer of information of an associated
coding tag to a recording tag via primer extension, and a
D-specific binding agent ("D'", an oligonucleotide sequence
complementary to the "D" component of the CD macromolecule) and
transfer of information of an associated coding tag to a recording
tag via primer extension. Coding tags C and D are of different
sequence and for ease of identification in this illustration are
also of different length. The different lengths facilitate analysis
of coding tag transfer by gel electrophoresis, but are not required
for analysis by next generation sequencing. The binding of C' and
D' binding agents are illustrated as alternative possibilities for
a single binding cycle. If a second cycle is added, the extended
recording tag would be further extended. Depending on which of C'
or D' binding agents are added in the first and second cycles, the
extended recording tags can contain coding tag information of the
form CC, CD, DC, and DD. Coding tags may optionally comprise a UMI.
The inclusion of UMIs in coding tags allows additional information
to be recorded about a binding event; it allows binding events to
be distinguished at the level of individual binding agents. This
can be useful if an individual binding agent can participate in
more than one binding event (e.g. its binding affinity is such that
it can disengage and re-bind sufficiently frequently to participate
in more than one event). It can also be useful for
error-correction. For example, under some circumstances a coding
tag might transfer information to the recording tag twice or more
in the same binding cycle. The use of a UMI would reveal that these
were likely repeated information transfer events all linked to a
single binding event.
[0278] FIG. 25 illustrates exemplary DNA target macromolecules (AB)
and immobilized on beads and assayed by binding agents attached to
coding tags. An A-specific binding agent ("A'", oligonucleotide
complementary to A component of AB macromolecule) interacts with an
AB macromolecule and information of an associated coding tag is
transferred to a recording tag by ligation. A B-specific binding
agent ("B'", an oligonucleotide complementary to B component of AB
macromolecule) interacts with an AB macromolecule and information
of an associated coding tag is transferred to a recording tag by
ligation. Coding tags A and B are of different sequence and for
ease of identification in this illustration are also of different
length. The different lengths facilitate analysis of coding tag
transfer by gel electrophoresis, but are not required for analysis
by next generation sequencing.
[0279] FIGS. 26A-B illustrate exemplary DNA-peptide macromolecules
for binding/coding tag transfer via primer extension. FIG. 26A
illustrates an exemplary oligonucleotide-peptide target
macromolecule ("A" oligonucleotide-cMyc peptide) immobilized on
beads. A cMyc-specific binding agent (e.g. antibody) interacts with
the cMyc peptide portion of the macromolecule and information of an
associated coding tag is transferred to a recording tag. The
transfer of information of the cMyc coding tag to a recording tag
may be analyzed by gel electrophoresis. FIG. 26B illustrates an
exemplary oligonucleotide-peptide target macromolecule ("C"
oligonucleotide-hemagglutinin (HA) peptide) immobilized on beads.
An HA-specific binding agent (e.g., antibody) interacts with the HA
peptide portion of the macromolecule (KDDDDKYD, SEQ ID NO:183) and
information of an associated coding tag is transferred to a
recording tag. The transfer of information of the coding tag to a
recording tag may be analyzed by gel electrophoresis. The binding
of cMyc antibody-coding tag and HA antibody-coding tag are
illustrated as alternative possibilities for a single binding
cycle. If a second binding cycle is performed, the extended
recording tag would be further extended. Depending on which of cMyc
antibody-coding tag or HA antibody-coding tag are added in the
first and second binding cycles, the extended recording tags can
contain coding tag information of the form cMyc-HA, HA-cMyc,
cMyc-cMyc, and HA-HA. Although not illustrated, additional binding
agents can also be introduced to enable detection of the A and C
oligonucleotide components of the macromolecules. Thus, hybrid
macromolecules comprising different types of backbone can be
analyzed via transfer of information to a recording tag and readout
of the extended recording tag, which contains information on the
order of binding events as well as the identity of the binding
agents.
[0280] FIGS. 27A-D. Generation of Error-Correcting Barcodes. FIG.
27A: A subset of 65 error-correcting barcodes (SEQ ID NOS:1-65)
were selected from a set of 77 barcodes derived from the R software
package `DNABarcodes`
(https://bioconductor.riken.jp/packages/3.3/bioc/manuals/DNABarcodes/man/-
DNABarcodes.pdf) using the command parameters
[create.dnabarcodes(n=15,dist=10)]. This algorithm generates 15-mer
"Hamming" barcodes that can correct substitution errors out to a
distance of four substitutions, and detect errors out to nine
substitutions. The subset of 65 barcodes was created by filtering
out barcodes that didn't exhibit a variety of nanopore current
levels (for nanopore-based sequencing) or that were too correlated
with other members of the set. FIG. 27B: A plot of the predicted
nanopore current levels for the 15-mer barcodes passing through the
pore. The predicted currents were computed by splitting each 15-mer
barcode word into composite sets of 11 overlapping 5-mer words, and
using a 5-mer R9 nanopore current level look-up table
(template_median68pA.5mers.model
(https://github.com/jts/nanopolish/tree/master/etc/r9-models) to
predict the corresponding current level as the barcode passes
through the nanopore, one base at a time. As can be appreciated
from (B), this set of 65 barcodes exhibit unique current signatures
for each of its members. FIG. 27C: Generation of PCR products as
model extended recording tags for nanopore sequencing is shown
using overlapping sets of DTR and DTR primers. PCR amplicons are
then ligated to form a concatenated extended recording tag model.
FIG. 27D: Nanopore sequencing read of exemplary "extended recording
tag" model (read length 734 bases, SEQ ID NO:168) generated as
shown in FIG. 27C. The MinIon R9.4 Read has a quality score of 7.2
(poor read quality). However, barcode sequences can easily be
identified using lalign even with a poor quality read (Qscore=7.2).
A 15-mer spacer element is underlined. Barcodes can align in either
forward or reverse orientation, denoted by BC or BC' designation.
The following barcodes are shown: BC_9, SEQ ID NO:9; BC_1', SEQ ID
NO:66; BC_11', SEQ ID NO:76; BC_4, SEQ ID NO:4; BC_1, SEQ ID NO:1;
BC_12, SEQ ID NO:12; BC_2, SEQ ID NO:2; BC_11, SEQ ID NO:11.
[0281] FIGS. 28A-D. Analyte-specific labeling of proteins with
recording tags. FIG. 28A: A binding agent targeting a protein
analyte of interest in its native conformation comprises an
analyte-specific barcode (BC.sub.A') that hybridizes to a
complementary analyte-specific barcode (BC.sub.A) on a DNA
recording tag. Alternatively, the DNA recording tag could be
attached to the binding agent via a cleavable linker, and the DNA
recording tag is "clicked" to the protein directly and is
subsequently cleaved from the binding agent (via the cleavable
linker). The DNA recording tag comprises a reactive coupling moiety
(such as a click chemistry reagent (e.g., azide, mTet, etc.) for
coupling to the protein of interest, and other functional
components (e.g., universal priming sequence (P1), sample barcode
(BC.sub.S), analyte specific barcode (BC.sub.A), and spacer
sequence (Sp)). A sample barcode (BC.sub.S) can also be used to
label and distinguish proteins from different samples. The DNA
recording tag may also comprise an orthogonal coupling moiety
(e.g., mTet) for subsequent coupling to a substrate surface. For
click chemistry coupling of the recording tag to the protein of
interest, the protein is pre-labeled with a click chemistry
coupling moiety cognate for the click chemistry coupling moiety on
the DNA recording tag (e.g., alkyne moiety on protein is cognate
for azide moiety on DNA recording tag). Examples of reagents for
labeling the DNA recording tag with coupling moieties for click
chemistry coupling include alkyne-NHS reagents for lysine labeling,
alkyne-benzophenone reagents for photoaffinity labeling, etc. FIG.
28B: After the binding agent binds to a proximal target protein,
the reactive coupling moiety on the recording tag (e.g., azide)
covalently attaches to the cognate click chemistry coupling moiety
(shown as a triple line symbol) on the proximal protein. FIG. 28C:
After the target protein analyte is labeled with the recording tag,
the attached binding agent is removed by digestion of uracils (U)
using a uracil-specific excision reagent (e.g., USER.TM.). FIG.
28D: The DNA recording tag labeled target protein analyte is
immobilized to a substrate surface using a suitable bioconjugate
chemistry reaction, such as click chemistry (alkyne-azide binding
pair, methyl tetrazine (mTET)-trans-cyclooctene (TCO) binding pair,
etc.). In certain embodiments, the entire target protein-recording
tag labeling assay is performed in a single tube comprising many
different target protein analytes using a pool of binding agents
and a pool of recording tags. After targeted labeling of protein
analytes within a sample with recording tags comprising a sample
barcode (BC.sub.S), multiple protein analyte samples can be pooled
before the immobilization step in FIG. 28D. Accordingly, in certain
embodiments, up to thousands of protein analytes across hundreds of
samples can be labeled and immobilized in a single tube next
generation protein assay (NGPA), greatly economizing on expensive
affinity reagents (e.g., antibodies).
[0282] FIGS. 29A-E. Conjugation of DNA recording tags to
polypeptides. FIG. 29A: A denatured polypeptide is labeled with a
bifunctional click chemistry reagent, such as alkyne-NHS ester
(acetylene-PEG-NETS ester) reagent or alkyne-benzophenone to
generate an alkyne-labeled (triple line symbol) polypeptide. An
alkyne can also be a strained alkyne, such as cyclooctynes
including Dibenzocyclooctyl (DBCO), etc. FIG. 29B: An example of a
DNA recording tag design that is chemically coupled to the
alkyne-labeled polypeptide is shown. The recording tag comprises a
universal priming sequence (P1), a barcode (BC), and a spacer
sequence (Sp). The recording tag is labeled with a mTet moiety for
coupling to a substrate surface and an azide moiety for coupling
with the alkyne moiety of the labeled polypeptide. FIG. 29C: A
denatured, alkyne-labeled protein or polypeptide is labeled with a
recording tag via the alkyne and azide moieties. Optionally, the
recording tag-labeled polypeptide can be further labeled with a
compartment barcode, e.g., via annealing to complementary sequences
attached to a compartment bead and primer extension (also referred
to as polymerase extension), or a shown in FIGS. 20H-J. FIG. 29D:
Protease digestion of the recording tag-labeled polypeptide creates
a population of recording tag-labeled peptides. In some
embodiments, some peptides will not be labeled with any recording
tags. In other embodiments, some peptides may have one or more
recording tags attached. FIG. 29E: Recording tag-labeled peptides
are immobilized onto a substrate surface using an inverse electron
demand Diels-Alder (iEDDA) click chemistry reaction between the
substrate surface functionalized with TCO groups and the mTet
moieties of the recording tags attached to the peptides. In certain
embodiments, clean-up steps may be employed between the different
stages shown. The use of orthogonal click chemistries (e.g.,
azide-alkyne and mTet-TCO) allows both click chemistry labeling of
the polypeptides with recording tags, and click chemistry
immobilization of the recording tag-labeled peptides onto a
substrate surface (see, McKay et al., 2014, Chem. Biol.
21:1075-1101, incorporated by reference in its entirety).
[0283] FIGS. 30A-E. Writing sample barcodes into recording tags
after initial DNA tag labeling of polypeptides. FIG. 30A: A
denatured polypeptide is labeled with a bifunctional click
chemistry reagent such as an alkyne-NHS reagent or
alkyne-benzophenone to generate an alkyne-labeled polypeptide. FIG.
30B: After alkyne (or alternative click chemistry moiety) labeling
of the polypeptide, DNA tags comprising a universal priming
sequence (P1) and labeled with an azide moiety and an mTet moiety
are coupled to the polypeptide via the azide-alkyne interaction. It
is understood that other click chemistry interactions may be
employed. FIG. 30C: A recording tag DNA construct comprising a
sample barcode information (BC.sub.S') and other recording tag
functional components (e.g., universal priming sequence (P1'),
spacer sequence (Sp')) anneals to the DNA tag-labeled polypeptide
via complementary universal priming sequences (P1-P1'). Recording
tag information is transferred to the DNA tag by polymerase
extension. FIG. 30D: Protease digestion of the recording
tag-labeled polypeptide creates a population of recording
tag-labeled peptides. FIG. 30E: Recording tag-labeled peptides are
immobilized onto a substrate surface using an inverse electron
demand Diels-Alder (iEDDA) click chemistry reaction between a
surface functionalized with TCO groups and the mTet moieties of the
recording tags attached to the peptides. In certain embodiments,
clean-up steps may be employed between the different stages shown.
The use of orthogonal click chemistries (e.g., azide-alkyne and
mTet-TCO) allows both click chemistry labeling of the polypeptides
with recording tags, and click chemistry immobilization of the
recording tag-labeled polypeptides onto a substrate surface (see,
McKay et al., 2014, Chem. Biol. 21:1075-1101, incorporated by
reference in its entirety).
[0284] FIGS. 31A-E. Bead compartmentalization for barcoding
polypeptides. FIG. 31A: A polypeptide is labeled in solution with a
heterobifunctional click chemistry reagent using standard
bioconjugation or photoaffinity labeling techniques. Possible
labeling sites include .epsilon.-amine of lysine residues (e.g.,
with NHS-alkyne as shown) or the carbon backbone of the peptide
(e.g., with benzophenone-alkyne). FIG. 31B: Azide-labeled DNA tags
comprising a universal priming sequence (P1) are coupled to the
alkyne moieties of the labeled polypeptide. FIG. 31C: The DNA
tag-labeled polypeptide is annealed to DNA recording tag labeled
beads via complementary DNA sequences (P1 and P1'). The DNA
recording tags on the bead comprises a spacer sequence (Sp'), a
compartment barcode sequence (BC.sub.P'), an optional unique
molecular identifier (UMI), and a universal sequence (P1'). The DNA
recording tag information is transferred to the DNA tags on the
polypeptide via polymerase extension (alternatively, ligation could
be employed). After information transfer, the resulting polypeptide
comprises multiple recording tags containing several functional
elements including compartment barcodes. FIG. 31D: Protease
digestion of the recording tag-labeled polypeptide creates a
population of recording tag-labeled peptides. The recording
tag-labeled peptides are dissociated from the beads, and FIG. 31E:
re-immobilized onto a sequencing substrate (e.g., using iEDDA click
chemistry between mTet and TCO moieties as shown).
[0285] FIGS. 32A-H. Example of workflow for Next Generation Protein
Assay (NGPA). A protein sample is labeled with a DNA recording tag
comprised of several functional units, e.g., a universal priming
sequence (P1), a barcode sequence (BC), an optional UMI sequence,
and a spacer sequence (Sp) (enables information transfer with a
binding agent coding tag). FIG. 32A: The labeled proteins are
immobilized (passively or covalently) to a substrate (e.g., bead,
porous bead or porous matrix). FIG. 32B: The substrate is blocked
with protein and, optionally, competitor oligonucleotides (Sp')
complementary to the spacer sequence are added to minimize
non-specific interaction of the analyte recording tag sequence.
FIG. 32C: Analyte-specific antibodies (w/ associated coding tags)
are incubated with substrate-bound protein. The coding tag may
comprise a uracil base for subsequent uracil specific cleavage.
FIG. 32D: After antibody binding, excess competitor
oligonucleotides (Sp'), if added, are washed away. The coding tag
transiently anneals to the recording tag via complementary spacer
sequences, and the coding tag information is transferred to the
recording tag in a primer extension reaction to generate an
extended recording tag. If the immobilized protein is denatured,
the bound antibody and annealed coding tag can be removed under
alkaline wash conditions such as with 0.1N NaOH. If the immobilized
protein is in a native conformation, then milder conditions may be
needed to remove the bound antibody and coding tag. An example of
milder antibody removal conditions is outlined in panels E-H. FIG.
32E: After information transfer from the coding tag to the
recording tag, the coding tag is nicked (cleaved) at its uracil
site using a uracil-specific excision reagent (e.g., USER.TM.)
enzyme mix. FIG. 32F: The bound antibody is removed from the
protein using a high-salt, low/high pH wash. The truncated DNA
coding tag remaining attached to the antibody is short and rapidly
elutes off as well. The longer DNA coding tag fragment may or may
not remain annealed to the recording tag. FIG. 32G: A second
binding cycle commences as in steps (B)-(D) and a second primer
extension step transfers the coding tag information from the second
antibody to the extended recording tag via primer extension. FIG.
32H: The result of two binding cycles is a concatenate of binding
information from the first antibody and second antibody attached to
the recording tag.
[0286] FIGS. 33A-D. Single-step Next Generation Protein Assay
(NGPA) using multiple binding agents and enzymatically-mediated
sequential information transfer. NGPA assay with immobilized
protein molecule simultaneously bound by two cognate binding agents
(e.g., antibodies). After multiple cognate antibody binding events,
a combined primer extension and DNA nicking step is used to
transfer information from the coding tags of bound antibodies to
the recording tag. The caret symbol ({circumflex over ( )}) in the
coding tags represents a double stranded DNA nicking endonuclease
site. FIG. 33A: In the example shown, the coding tag of the
antibody bound to epitope 1 (Epi #1) of a protein transfers coding
tag information (e.g., encoder sequence) to the recording tag in a
primer extension step following hybridization of complementary
spacer sequences. FIG. 33B: Once the double stranded DNA duplex
between the extended recording tag and coding tag is formed, a
nicking endonuclease that cleaves only one strand of DNA on a
double-stranded DNA substrate, such as Nt.BsmAI, which is active at
37.degree. C., is used to cleave the coding tag. Following the
nicking step, the duplex formed from the truncated coding
tag-binding agent and extended recording tag is thermodynamically
unstable and dissociates. The longer coding tag fragment may or may
not remain annealed to the recording tag. FIG. 33C: This allows the
coding tag from the antibody bound to epitope #2 (Epi #2) of the
protein to anneal to the extended recording tag via complementary
spacer sequences, and the extended recording tag to be further
extended by transferring information from the coding tag of Epi #2
antibody to the extended recording tag via primer extension. FIG.
33D: Once again, after a double stranded DNA duplex is formed
between the extended recording tag and coding tag of Epi #2
antibody, the coding tag is nicked by a nicking endonuclease, such
Nb.BssSI. In certain embodiments, use of a non-strand displacing
polymerase during primer extension (also referred to as polymerase
extension) is preferred. A non-strand displacing polymerase
prevents extension of the cleaved coding tag stub that remains
annealed to the recording tag by more than a single base. The
process shown on FIG. 33A-33D can repeat itself until all the
coding tags of proximal bound binding agents are "consumed" by the
hybridization, information transfer to the extended recording tag,
and nicking steps. The coding tag can comprise an encoder sequence
identical for all binding agents (e.g., antibodies) specific for a
given analyte (e.g., cognate protein), can comprise an
epitope-specific encoder sequence, or can comprise a unique
molecular identifier (UMI) to distinguish between different
molecular events.
[0287] FIGS. 34A-C: Controlled density of recording tag-peptide
immobilization using titration of reactive moieties on substrate
surface. FIG. 34A: Peptide density on a substrate surface may be
titrated by controlling the density of functional coupling moieties
on the surface of the substrate. This can be accomplished by
derivitizing the surface of the substrate with an appropriate ratio
of active coupling molecules to "dummy" coupling molecules. In the
example shown, NHS-PEG-TCO reagent (active coupling molecule) is
combined with NHS-mPEG (dummy molecule) in a defined ratio to
derivitize an amine surface with TCO. Functionalized PEGs come in
various molecular weights from 300 to over 40,000. FIG. 34B: A
bifunctional 5' amine DNA recording tag (mTet is other functional
moiety) is coupled to a N-terminal Cys residue of a peptide using a
succinimidyl 4-(N-maleimidomethyl)cyclohexane-1 (SMCC) bifunctional
cross-linker. The internal mTet-dT group on the recording tag is
created from an azide-dT group using mTetrazine-Azide. FIG. 34C:
The recording tag labeled peptides are immobilized to the activated
substrate surface from (A) using the iEDDA click chemistry reaction
with mTet and TCO. The mTet-TCO iEDDA coupling reaction is
extremely fast, efficient, and stable (mTet-TCO is more stable than
Tet-TCO).
[0288] FIGS. 35A-C. Next Generation Protein Sequencing (NGPS)
Binding Cycle-Specific Coding Tags. FIG. 35A: Design of NGPS assay
with a cycle-specific N-terminal amino acid (NTAA) binding agent
coding tags. An NTAA binding agent (e.g., antibody specific for
N-terminal DNP-labeled tyrosine) binds to a DNP-labeled NTAA of a
peptide (VLPVRAGLWAEVDY, SEQ ID NO:184) associated with a recording
tag comprising a universal priming sequence (P1), barcode (BC) and
spacer sequence (Sp). When the binding agent binds to a cognate
NTAA of the peptide, the coding tag associated with the NTAA
binding agent comes into proximity of the recording tag and anneals
to the recording tag via complementary spacer sequences. Coding tag
information is transferred to the recording tag via primer
extension. To keep track of which binding cycle a coding tag
represents, the coding tag can comprise of a cycle-specific
barcode. In certain embodiments, coding tags of binding agents that
bind to an analyte have the same encoder barcode independent of
cycle number, which is combined with a unique binding
cycle-specific barcode. In other embodiments, a coding tag for a
binding agent to an analyte comprises a unique encoder barcode for
the combined analyte-binding cycle information. In either approach,
a common spacer sequence can be used for binding agents' coding
tags in each binding cycle. FIG. 35B: In this example, binding
agents from each binding cycle have a short binding cycle-specific
barcode to identify the binding cycle, which together with the
encoder barcode that identifies the binding agent, provides a
unique combination barcode that identifies a particular binding
agent-binding cycle combination. FIG. 35C: After completion of the
binding cycles, the extended recording tag can be converted into an
amplifiable library using a capping cycle step where, for example,
a cap comprising a universal priming sequence P1' linked to a
universal priming sequence P2 and spacer sequence Sp' initially
anneals to the extended recording tag via complementary P1 and P1'
sequences to bring the cap in proximity to the extended recording
tag. The complementary Sp and Sp' sequences in the extended
recording tag and cap anneal and primer extension adds the second
universal primer sequence (P2) to the extended recording tag.
[0289] FIGS. 36A-36F. DNA based model system for demonstrating
information transfer from coding tags to recording tags. Exemplary
binding and intra-molecular writing was demonstrated by an
oligonucleotide model system. The targeting agent A' and B' in
coding tags were designed to hybridize to target binding regions A
and B in recording tags. Recording tag (RT) mix was prepared by
pooling two recoding tags, saRT_Abc_v2 (A target) and saRT_Bbc_V2
(B target), at equal concentrations. Recording tags are
biotinylated at their 5' end and contain a unique target binding
region, a universal forward primer sequence, a unique DNA barcode,
and an 8 base common spacer sequence (Sp). The coding tags contain
unique encoder barcodes base flanked by 8 base common spacer
sequences (Sp'), one of which is covalently linked to A or B target
agents via polyethylene glycol linker. FIG. 36A. Biotinylated
recording tag oligonucleotides (saRT_Abc_v2 and saRT_Bbc_V2) along
with a biotinylated Dummy-T10 oligonucleotide were immobilized to
streptavidin beads. The recording tags were designed with A or B
capture sequences (recognized by cognate binding agents--A' and B',
respectively), and corresponding barcodes (rtA_BC and rtB_BC) to
identify the binding target. All barcodes in this model system were
chosen from the set of 65 15-mer barcodes (SEQ ID NOS:1-65). In
some cases, 15-mer barcodes were combined to constitute a longer
barcode for ease of gel analysis. In particular, rtA_BC=BC_1+BC_2;
rtB_BC=BC_3. Two coding tags for binding agents cognate to the A
and B sequences of the recording tags, namely CT_A'-bc (encoder
barcode=BC_5) and CT_B'-bc (encoder barcode=BC_5+BC_6) were also
synthesized. Complementary blocking oligos (DupCT_A'BC and
DupCT_AB'BC) to a portion of the coding tag sequence (leaving a
single stranded Sp' sequence) were optionally pre-annealed to the
coding tags prior to annealing of coding tags to the
bead-immobilized recording tags. A strand displacing polymerase
removes the blocking oligo during polymerase extension. A barcode
key (inset) indicates the assignment of 15-mer barcodes to the
functional barcodes in the recording tags and coding tags. FIG.
36B. The recording tag barcode design and coding tag encoder
barcode design provide an easy gel analysis of "intra-molecular"
vs. "inter-molecular" interactions between recording tags and
coding tags. In this design, undesired "inter-molecular"
interactions (A recording tag with B' coding tag, and B recording
tag with A' coding tag) generate gel products that are wither 15
bases longer or shorter than the desired "intra-molecular" (A
recording tag with A' coding tag; B recording tag with B' coding
tag) interaction products. The primer extension step changes the A'
and B' coding tag barcodes (ctA'_BC, ctB'_BC) to the reverse
complement barcodes (ctA_BC and ctB_BC). FIG. 36C. A primer
extension assay demonstrated information transfer from coding tags
to recording tags, and addition of adapter sequences via primer
extension on annealed EndCap oligo for PCR analysis. FIG. 36D.
Optimization of "intra-molecular" information transfer via
titration of surface density of recording tags via use of Dummy-T20
oligo. Biotinylated recording tag oligos were mixed with
biotinylated Dummy-T20 oligo at various ratios from 1:0, 1:10, all
the way down to 1:10000. At reduced recording tag density
(1:10.sup.3 and 1:10.sup.4), "intra-molecular" interactions
predominate over "inter-molecular" interactions. FIG. 36E. As a
simple extension of the DNA model system, a simple protein binding
system comprising Nano-Tag.sub.15 peptide-Streptavidin binding pair
is illustrated (K.sub.D.about.4 nM) (Perbandt et al., 2007,
Proteins 67:1147-1153), but any number of peptide-binding agent
model systems can be employed. Nano-Tag.sub.15 peptide sequence is
(fM)DVEAWLGARVPLVET (SEQ ID NO:131) (fM=formyl-Met).
Nano-Tag.sub.15 peptide further comprises a short, flexible linker
peptide (GGGGS) and a cysteine residue for coupling to the DNA
recording tag. Other examples peptide tag-cognate binding agent
pairs include: calmodulin binding peptide (CBP)-calmodulin
(K.sub.D.about.2 pM) (Mukherjee et al., 2015, J. Mol. Biol. 427:
2707-2725), amyloid-beta (A.beta.16-27) peptide-US7/Lcn2 anticalin
(0.2 nM) (Rauth et al., 2016, Biochem. J. 473: 1563-1578), PA
tag/NZ-1 antibody (K.sub.D.about.400 pM), FLAG-M2 Ab (28 nM),
HA-4B2 Ab (1.6 nM), and Myc-9E10 Ab (2.2 nM) (Fujii et al., 2014,
Protein Expr. Purif. 95:240-247). FIG. 36F. As a test of
intra-molecular information transfer from the binding agent's
coding tag to the recording tag via primer extension, an
oligonucleotide "binding agent" that binds to complementary DNA
sequence "A" can be used in testing and development. This
hybridization event has essentially greater than fM affinity.
Streptavidin may be used as a test binding agent for the
Nano-tag.sub.15 peptide epitope. The peptide tag-binding agent
interaction is high affinity, but can easily be disrupted with an
acidic and/or high salt washes (Perbandt et al., supra).
[0290] FIGS. 37A-B. Use of nano- or micro-emulsion PCR to transfer
information from UMI-labeled N or C terminus to DNA tags labeling
body of polypeptide. FIG. 37A. A polypeptide is labeled, at its N-
or C-terminus with a nucleic acid molecule comprising a unique
molecular identifier (UMI). The UMI may be flanked by sequences
that are used to prime subsequent PCR. The polypeptide is then
"body labeled" at internal sites with a separate DNA tag comprising
sequence complementary to a priming sequence flanking the UMI. FIG.
37B. The resultant labeled polypeptides are emulsified and undergo
an emulsion PCR (ePCR) (alternatively, an emulsion in vitro
transcription-RT-PCR (IVT-RT-PCR) reaction or other suitable
amplification reaction can be performed) to amplify the N- or
C-terminal UMI. A microemulsion or nanoemulsion is formed such that
the average droplet diameter is 50-1000 nm, and that on average
there is fewer than one polypeptide per droplet. A snapshot of a
droplet content pre- and post PCR is shown in the left panel and
right panel, respectively. The UMI amplicons hybridize to the
internal polypeptide body DNA tags via complementary priming
sequences and the UMI information is transferred from the amplicons
to the internal polypeptide body DNA tags via primer extension.
[0291] FIG. 38. Single Cell Proteomics. Cells are encapsulated and
lysed in droplets containing polymer-forming subunits (e.g.,
acrylamide). The polymer-forming subunits are polymerized (e.g.,
polyacrylamide), and proteins are cross-linked to the polymer
matrix. The emulsion droplets are broken and polymerized gel beads
that contain a single cell protein lysate attached to the permeable
polymer matrix are released. The proteins are cross-linked to the
polymer matrix in either their native conformation or in a
denatured state by including a denaturant such as urea in the lysis
and encapsulation buffer. Recording tags comprising a compartment
barcode and other recording tag components (e.g., universal priming
sequence (P1), spacer sequence (Sp), optional unique molecular
identifier (UMI)) are attached to the proteins using a number of
methods known in the art and disclosed herein, including
emulsification with barcoded beads, or combinatorial indexing. The
polymerized gel bead containing the single cell protein can also be
subjected to proteinase digest after addition of the recording tag
to generate recording tag labeled peptides suitable for peptide
sequencing. In certain embodiments, the polymer matrix can be
designed such that is dissolves in the appropriate additive such as
disulfide cross-linked polymer that break upon exposure to a
reducing agent such as tris(2-carboxyethyl)phosphine (TCEP) or
dithiothreitol (DTT).
[0292] FIG. 39. Enhancement of amino acid cleavage reaction using a
bifunctional N-terminal amino acid (NTAA) modifier and a chimeric
cleavage reagent. Steps A-B. A peptide attached to a solid-phase
substrate is modified with a bifunctional NTAA modifier, such as
biotin-phenyl isothiocyanate (PITC). Step C. A low affinity
Edmanase (>.mu.M Kd) is recruited to biotin-PITC labeled NTAAs
using a streptavidin-Edmanase chimeric protein. Step D. The
efficiency of Edmanase cleavage is greatly improved due to the
increase in effective local concentration as a result of the
biotin-strepavidin interaction. Step E. The cleaved biotin-PITC
labeled NTAA and associated streptavidin-Edmanase chimeric protein
diffuse away after cleavage. A number of other bioconjugation
recruitment strategies can also be employed. An azide modified PITC
is commercially available (4-Azidophenyl isothiocyanate, Sigma),
allowing a number of simple transformations of azide-PITC into
other bioconjugates of PITC, such as biotin-PITC via a click
chemistry reaction with alkyne-biotin.
[0293] FIGS. 40A-H: Generation of C-terminal recording tag-labeled
peptides from protein lysate (may be encapsulated in a gel bead).
FIG. 40A. A denatured polypeptide is reacted with an acid anhydride
to label lysine residues. In one embodiment, a mix of alkyne
(mTet)-substituted citraconic anhydride+proprionic anhydride is
used to label the lysines with mTet. (shown as striped rectangles).
FIG. 40B. The result is an alkyne (mTet)-labeled polypeptide, with
a fraction of lysines blocked with a proprionic group (shown as
squares on the polypeptide chain). The alkyne (mTet) moiety is
useful in click-chemistry based DNA labeling. FIG. 40C. DNA tags
(shown as solid rectangles) are attached by click chemistry using
azide or trans-cyclooctene (TCO) labels for alkyne or mTet
moieties, respectively. FIG. 40D. Barcodes and functional elements
such as a spacer (Sp) sequence and universal priming sequence are
appended to the DNA tags using a primer extension step as shown in
FIG. 31 to produce recording tag-labeled polypeptide. The barcodes
may be a sample barcode, a partition barcode, a compartment
barcode, a spatial location barcode, etc., or any combination
thereof. FIG. 40E. The resulting recording tag-labeled polypeptide
is fragmented into recording tag-labeled peptides with a protease
or chemically. FIG. 40F. For illustration, a peptide fragment
labeled with two recording tags is shown. FIG. 40G. A DNA tag
comprising universal priming sequence that is complementary to the
universal priming sequence in the recording tag is ligated to the
C-terminal end of the peptide. The C-terminal DNA tag also
comprises a moiety for conjugating the peptide to a surface. FIG.
40H. The complementary universal priming sequences in the
C-terminal DNA tag and a stochastically selected recording tag
anneal. An intra-molecular primer extension reaction is used to
transfer information from the recording tag to the C-terminal DNA
tag. FIG. 40I. The internal recording tags on the peptide are
coupled to lysine residues via maleic anhydride, which coupling is
reversible at acidic pH. The internal recording tags are cleaved
from the peptide's lysine residues at acidic pH, leaving the
C-terminal recording tag. The newly exposed lysine residues can
optionally be blocked with a non-hydrolyzable anhydride, such as
proprionic anhydride.
[0294] FIG. 41. Workflow for a Preferred Embodiment of NGPS
Assay.
[0295] FIG. 42. Exemplary Steps of NGPS Sequencing assay. An
N-terminal amino acid (NTAA) acetylation or amidination step on a
recording tag-labeled, surface bound peptide can occur before or
after binding by an NTAA binding agent, depending on whether NTAA
binding agents have been engineered to bind to acetylated NTAAs or
native NTAAs. In the first case, in Step A, the peptide is
initially acetylated at the NTAA by chemical means using acetic
anhydride or enzymatically with an N-terminal acetyltransferase
(NAT). Step B. The NTAA is recognized by an NTAA binding agent,
such as an engineered anticalin, aminoacyl tRNA synthetase (aaRS),
ClpS, etc. A DNA coding tag is attached to the binding agent and
comprises a barcode encoder sequence that identifies the particular
NTAA binding agent. Step C. After binding of the acetylated NTAA by
the NTAA binding agent, the DNA coding tag transiently anneals to
the recording tag via complementary sequences and the coding tag
information is transferred to the recording tag via polymerase
extension. In an alternative embodiment, the recording tag
information is transferred to the coding tag via polymerase
extension. Step D. The acetylated NTAA is cleaved from the peptide
by an engineered acylpeptide hydrolase (APH), which catalyzes the
hydrolysis of terminal acetylated amino acid from acetylated
peptides. After cleavage of the acetylated NTAA, the cycle repeats
itself starting with acetylation of the newly exposed NTAA.
N-terminal acetylation is used as an exemplary mode of NTAA
modification/cleavage, but other N-terminal moieties, such as a
guanyl moiety can be substituted with a concomitant change in
cleavage chemistry. If guanidination is employed, the guanylated
NTAA can be cleaved under mild conditions using 0.5-2% NaOH
solution (see Hamada, 2016, incorporated by reference in its
entirety). APH is a serine peptidase able to catalyse the removal
of Na-acetylated amino acids from blocked peptides and it belongs
to the prolyl oligopeptidase (POP) family (clan SC, family S9). It
is a crucial regulator of N-terminally acetylated proteins in
eukaryal, bacterial and archaeal cells.
[0296] FIGS. 43A-B. Exemplary recording tag-coding tag design
features. FIG. 43A: Structure of an exemplary recording tag
associated protein (or peptide) and bound binding agent (e.g.,
anticalin) with associated coding tag. A thymidine (T) base is
inserted between the spacer (Sp') and barcode (BC') sequence on the
coding tag to accommodate a stochastic non-templated 3' terminal
adenosine (A) addition in the primer extension reaction. FIG. 43B:
DNA coding tag is attached to a binding agent (e.g., anticalin) via
SpyCatcher-SpyTag protein-peptide interaction.
[0297] FIG. 44. Enhancement of NTAA Cleavage Reaction Using
Hybridization of Cleavage Agent to Recording Tag. Steps A and B. A
recording tag-labeled peptide attached to a solid-phase substrate
(e.g., bead) is modified or labeled at the NTAA (Mod), e.g., with
PITC, DNP, SNP, an acetyl modifier, guanidinylation, etc. Step C. A
cleavage enzyme (e.g., acylpeptide hydrolase (APH), amino peptidase
(AP), Edmanase, etc.) is attached to a DNA tag comprising a
universal priming sequence complementary to the universal priming
sequence on the recording tag. The cleavage enzyme is recruited to
the modified NTAA via hybridization of complementary universal
priming sequences on the cleavage enzyme's DNA tag and the
recording tag. Step D. This hybridization step greatly improves the
effective affinity of the cleavage enzyme for the NTAA. Step E. The
cleaved NTAA diffuses away and associated cleavage enzyme can be
removed by stripping the hybridized DNA tag.
[0298] FIG. 45. Cyclic degradation peptide sequencing using peptide
ligase+protease+diaminopeptidase. Butelase I ligates the
TEV-Butelase I peptide substrate (TENLYFQNHV, SEQ ID NO:132) to the
NTAA of the query peptide. Butelase requires an NHV motif at the
C-terminus of the peptide substrate. After ligation, Tobacco Etch
Virus (TEV) protease is used to cleave the chimeric peptide
substrate after the glutamine (Q) residue, leaving a chimeric
peptide having an asparagine (N) residue attached to the N-terminus
of the query peptide. Diaminopeptidase (DAP) or
Dipeptidyl-peptidase, which cleaves two amino acid residues from
the N-terminus, shortens the N-added query peptide by two amino
acids effectively removing the asparagine residue (N) and the
original NTAA on the query peptide. The newly exposed NTAA is read
using binding agents as provided herein, and then the entire cycle
is repeated "n" times for "n" amino acids sequenced. The use of a
streptavidin-DAP metalloenzyme chimeric protein and tethering a
biotin moiety to the N-terminal asparagine residue may allow
control of DAP processivity.
DETAILED DESCRIPTION
[0299] Terms not specifically defined herein should be given the
meanings that would be given to them by one of skill in the art in
light of the disclosure and the context. As used in the
specification, however, unless specified to the contrary, the terms
have the meaning indicated.
I. Introduction
[0300] The present disclosure provides, in part, methods of
highly-parallel, high throughput digital macromolecule
characterization and quantitation, with direct applications to
protein and peptide characterization and sequencing (see, FIG. 1B,
FIG. 2A). The methods described herein use binding agents
comprising a coding tag with identifying information in the form of
a nucleic acid molecule or sequenceable polymer, wherein the
binding agents interact with a macromolecule of interest. Multiple,
successive binding cycles, each cycle comprising exposing a
plurality macromolecules, preferably representing pooled samples,
immobilized on a solid support to a plurality of binding agents,
are performed. During each binding cycle, the identity of each
binding agent that binds to the macromolecule, and optionally
binding cycle number, is recorded by transferring information from
the binding agent coding tag to a recording tag co-localized with
the macromolecule. In an alternative embodiment, information from
the recording tag comprising identifying information for the
associated macromolecule may be transferred to the coding tag of
the bound binding agent (e.g., to form an extended coding tag) or
to a third "di-tag" construct. Multiple cycles of binding events
build historical binding information on the recording tag
co-localized with the macromolecule, thereby producing an extended
recording tag comprising multiple coding tags in co-linear order
representing the temporal binding history for a given
macromolecule. In addition, cycle-specific coding tags can be
employed to track information from each cycle, such that if a cycle
is skipped for some reason, the extended recording tag can continue
to collect information in subsequent cycles, and identify the cycle
with missing information.
[0301] Alternatively, instead of writing or transferring
information from the coding tag to recording tag, information can
be transferred from a recording tag comprising identifying
information for the associated macromolecule to the coding tag
forming an extended coding tag or to a third di-tag construct. The
resulting extended coding tags or di-tags can be collected after
each binding cycle for subsequent sequence analysis. The
identifying information on the recording tags comprising barcodes
(e.g., partition tags, compartment tags, sample tags, fraction
tags, UMIs, or any combination thereof) can be used to map the
extended coding tag or di-tag sequence reads back to the
originating macromolecule. In this manner, a nucleic acid encoded
library representation of the binding history of the macromolecule
is generated. This nucleic acid encoded library can be amplified,
and analyzed using very high-throughput next generation digital
sequencing methods, enabling millions to billions of molecules to
be analyzed per run. The creation of a nucleic acid encoded library
of binding information is useful in another way in that it enables
enrichment, subtraction, and normalization by DNA-based techniques
that make use of hybridization. These DNA-based methods are easily
and rapidly scalable and customizable, and more cost-effective than
those available for direct manipulation of other types of
macromolecule libraries, such as protein libraries. Thus, nucleic
acid encoded libraries of binding information can be processed
prior to sequencing by one or more techniques to enrich and/or
subtract and/or normalize the representation of sequences. This
enables information of maximum interest to be extracted much more
efficiently, rapidly and cost-effectively from very large libraries
whose individual members may initially vary in abundance over many
orders of magnitude. Importantly, these nucleic-acid based
techniques for manipulating library representation are orthogonal
to more conventional methods, and can be used in combination with
them. For example, common, highly abundant proteins, such as
albumin, can be subtracted using protein-based methods, which may
remove the majority but not all the undesired protein.
Subsequently, the albumin-specific members of an extended recording
tag library can also be subtracted, thus achieving a more complete
overall subtraction.
[0302] In one aspect, the present disclosure provides a
highly-parallelized approach for peptide sequencing using a
Edman-like degradation approach, allowing the sequencing from a
large collection of DNA recording tag-labeled peptides (e.g.,
millions to billions). These recording tag labeled peptides are
derived from a proteolytic digest or limited hydrolysis of a
protein sample, and the recording tag labeled peptides are
immobilized randomly on a sequencing substrate (e.g., porous beads)
at an appropriate inter-molecular spacing on the substrate.
Modification of N-terminal amino acid (NTAA) residues of the
peptides with small chemical moieties, such as phenylthiocarbamoyl
(PTC), dinitrophenol (DNP), sulfonyl nitrophenol (SNP), dansyl,
7-methoxy coumarin, acetyl, or guanidinyl, that catalyze or recruit
an NTAA cleavage reaction allows for cyclic control of the
Edman-like degradation process. The modifying chemical moieties may
also provide enhanced binding affinity to cognate NTAA binding
agents. The modified NTAA of each immobilized peptide is identified
by the binding of a cognate NTAA binding agent comprising a coding
tag, and transferring coding tag information (e.g., encoder
sequence providing identifying information for the binding agent)
from the coding tag to the recording tag of the peptide (e.g,
primer extension or ligation). Subsequently, the modified NTAA is
removed by chemical methods or enzymatic means. In certain
embodiments, enzymes (e.g., Edmanase) are engineered to catalyze
the removal of the modified NTAA. In other embodiments, naturally
occurring exopeptidases, such as aminopeptidases or acyl peptide
hydrolases, can be engineered to cleave a terminal amino acid only
in the presence of a suitable chemical modification.
II. Definitions
[0303] In the following description, certain specific details are
set forth in order to provide a thorough understanding of various
embodiments. However, one skilled in the art will understand that
the present compounds may be made and used without these details.
In other instances, well-known structures have not been shown or
described in detail to avoid unnecessarily obscuring descriptions
of the embodiments. Unless the context requires otherwise,
throughout the specification and claims which follow, the word
"comprise" and variations thereof, such as, "comprises" and
"comprising," are to be construed in an open, inclusive sense, that
is, as "including, but not limited to." In addition, the term
"comprising" (and related terms such as "comprise" or "comprises"
or "having" or "including") is not intended to exclude that in
other certain embodiments, for example, an embodiment of any
composition of matter, composition, method, or process, or the
like, described herein, may "consist of" or "consist essentially
of" the described features. Headings provided herein are for
convenience only and do not interpret the scope or meaning of the
claimed embodiments.
[0304] Reference throughout this specification to "one embodiment"
or "an embodiment" means that a particular feature, structure or
characteristic described in connection with the embodiment is
included in at least one embodiment. Thus, the appearances of the
phrases "in one embodiment" or "in an embodiment" in various places
throughout this specification are not necessarily all referring to
the same embodiment. Furthermore, the particular features,
structures, or characteristics may be combined in any suitable
manner in one or more embodiments.
[0305] As used herein, the singular forms "a," "an" and "the"
include plural referents unless the context clearly dictates
otherwise. Thus, for example, reference to "a peptide" includes one
or more peptides, or mixtures of peptides. Also, and unless
specifically stated or obvious from context, as used herein, the
term "or" is understood to be inclusive and covers both "or" and
"and".
[0306] As used herein, the term "macromolecule" encompasses large
molecules composed of smaller subunits. Examples of macromolecules
include, but are not limited to peptides, polypeptides, proteins,
nucleic acids, carbohydrates, lipids, macrocycles. A macromolecule
also includes a chimeric macromolecule composed of a combination of
two or more types of macromolecules, covalently linked together
(e.g., a peptide linked to a nucleic acid). A macromolecule may
also include a "macromolecule assembly", which is composed of
non-covalent complexes of two or more macromolecules. A
macromolecule assembly may be composed of the same type of
macromolecule (e.g., protein-protein) or of two more different
types of macromolecules (e.g., protein-DNA).
[0307] As used herein, the term "peptide" encompasses peptides,
polypeptides and proteins, and refers to a molecule comprising a
chain of two or more amino acids joined by peptide bonds. In
general terms, a peptide having more than 20-30 amino acids is
commonly referred to as a polypeptide, and one having more than 50
amino acids is commonly referred to as a protein. The amino acids
of the peptide are most typically L-amino acids, but may also be
D-amino acids, modified amino acids, amino acid analogs, amino acid
mimetics, or any combination thereof. Peptides may be naturally
occurring, synthetically produced, or recombinantly expressed.
Peptides may also comprise additional groups modifying the amino
acid chain, for example, functional groups added via
post-translational modification.
[0308] As used herein, the term "amino acid" refers to an organic
compound comprising an amine group, a carboxylic acid group, and a
side-chain specific to each amino acid, which serve as a monomeric
subunit of a peptide. An amino acid includes the 20 standard,
naturally occurring or canonical amino acids as well as
non-standard amino acids. The standard, naturally-occurring amino
acids include Alanine (A or Ala), Cysteine (C or Cys), Aspartic
Acid (D or Asp), Glutamic Acid (E or Glu), Phenylalanine (F or
Phe), Glycine (G or Gly), Histidine (H or His), Isoleucine (I or
Ile), Lysine (K or Lys), Leucine (L or Leu), Methionine (M or Met),
Asparagine (N or Asn), Proline (P or Pro), Glutamine (Q or Gln),
Arginine (R or Arg), Serine (S or Ser), Threonine (T or Thr),
Valine (V or Val), Tryptophan (W or Trp), and Tyrosine (Y or Tyr).
An amino acid may be an L-amino acid or a D-amino acid.
Non-standard amino acids may be modified amino acids, amino acid
analogs, amino acid mimetics, non-standard proteinogenic amino
acids, or non-proteinogenic amino acids that occur naturally or are
chemically synthesized. Examples of non-standard amino acids
include, but are not limited to, selenocysteine, pyrrolysine, and
N-formylmethionine, .beta.-amino acids, Homo-amino acids, Proline
and Pyruvic acid derivatives, 3-substituted alanine derivatives,
glycine derivatives, ring-substituted phenylalanine and tyrosine
derivatives, linear core amino acids, N-methyl amino acids.
[0309] As used herein, the term "post-translational modification"
refers to modifications that occur on a peptide after its
translation by ribosomes is complete. A post-translational
modification may be a covalent modification or enzymatic
modification. Examples of post-translation modifications include,
but are not limited to, acylation, acetylation, alkylation
(including methylation), biotinylation, butyrylation,
carbamylation, carbonylation, deamidation, deiminiation,
diphthamide formation, disulfide bridge formation, eliminylation,
flavin attachment, formylation, gamma-carboxylation, glutamylation,
glycylation, glycosylation, glypiation, heme C attachment,
hydroxylation, hypusine formation, iodination, isoprenylation,
lipidation, lipoylation, malonylation, methylation,
myristolylation, oxidation, palmitoylation, pegylation,
phosphopantetheinylation, phosphorylation, prenylation,
propionylation, retinylidene Schiff base formation,
S-glutathionylation, S-nitrosylation, S-sulfenylation, selenation,
succinylation, sulfination, ubiquitination, and C-terminal
amidation. A post-translational modification includes modifications
of the amino terminus and/or the carboxyl terminus of a peptide.
Modifications of the terminal amino group include, but are not
limited to, des-amino, N-lower alkyl, N-di-lower alkyl, and N-acyl
modifications. Modifications of the terminal carboxy group include,
but are not limited to, amide, lower alkyl amide, dialkyl amide,
and lower alkyl ester modifications (e.g., wherein lower alkyl is
C.sub.1-C.sub.4 alkyl). A post-translational modification also
includes modifications, such as but not limited to those described
above, of amino acids falling between the amino and carboxy
termini. The term post-translational modification can also include
peptide modifications that include one or more detectable
labels.
[0310] As used herein, the term "binding agent" refers to a nucleic
acid molecule, a peptide, a polypeptide, a protein, carbohydrate,
or a small molecule that binds to, associates, unites with,
recognizes, or combines with a macromolecule or a component or
feature of a macromolecule. A binding agent may form a covalent
association or non-covalent association with the macromolecule or
component or feature of a macromolecule. A binding agent may also
be a chimeric binding agent, composed of two or more types of
molecules, such as a nucleic acid molecule-peptide chimeric binding
agent or a carbohydrate-peptide chimeric binding agent. A binding
agent may be a naturally occurring, synthetically produced, or
recombinantly expressed molecule. A binding agent may bind to a
single monomer or subunit of a macromolecule (e.g., a single amino
acid of a peptide) or bind to a plurality of linked subunits of a
macromolecule (e.g., a di-peptide, tri-peptide, or higher order
peptide of a longer peptide, polypeptide, or protein molecule). A
binding agent may bind to a linear molecule or a molecule having a
three-dimensional structure (also referred to as conformation). For
example, an antibody binding agent may bind to linear peptide,
polypeptide, or protein, or bind to a conformational peptide,
polypeptide, or protein. A binding agent may bind to an N-terminal
peptide, a C-terminal peptide, or an intervening peptide of a
peptide, polypeptide, or protein molecule. A binding agent may bind
to an N-terminal amino acid, C-terminal amino acid, or an
intervening amino acid of a peptide molecule. A binding agent may
preferably bind to a chemically modified or labeled amino acid over
a non-modified or unlabeled amino acid. For example, a binding
agent may preferably bind to an amino acid that has been modified
with an acetyl moiety, guanyl moiety, dansyl moiety, PTC moiety,
DNP moiety, SNP moiety, etc., over an amino acid that does not
possess said moiety. A binding agent may bind to a
post-translational modification of a peptide molecule. A binding
agent may exhibit selective binding to a component or feature of a
macromolecule (e.g., a binding agent may selectively bind to one of
the 20 possible natural amino acid residues and with bind with very
low affinity or not at all to the other 19 natural amino acid
residues). A binding agent may exhibit less selective binding,
where the binding agent is capable of binding a plurality of
components or features of a macromolecule (e.g., a binding agent
may bind with similar affinity to two or more different amino acid
residues). A binding agent comprises a coding tag, which is joined
to the binding agent by a linker.
[0311] As used herein, the term "linker" refers to one or more of a
nucleotide, a nucleotide analog, an amino acid, a peptide, a
polypeptide, or a non-nucleotide chemical moiety that is used to
join two molecules. A linker may be used to join a binding agent
with a coding tag, a recording tag with a macromolecule (e.g.,
peptide), a macromolecule with a solid support, a recording tag
with a solid support, etc. In certain embodiments, a linker joins
two molecules via enzymatic reaction or chemistry reaction (e.g.,
click chemistry).
[0312] As used herein, the term "proteomics" refers to quantitative
analysis of the proteome within cells, tissues, and bodily fluids,
and the corresponding spatial distribution of the proteome within
the cell and within tissues. Additionally, proteomics studies
include the dynamic state of the proteome, continually changing in
time as a function of biology and defined biological or chemical
stimuli.
[0313] As used herein, the term "non-cognate binding agent" refers
to a binding agent that is not capable of binding or binds with low
affinity to a macromolecule feature, component, or subunit being
interrogated in a particular binding cycle reaction as compared to
a "cognate binding agent", which binds with high affinity to the
corresponding macromolecule feature, component, or subunit. For
example, if a tyrosine residue of a peptide molecule is being
interrogated in a binding reaction, non-cognate binding agents are
those that bind with low affinity or not at all to the tyrosine
residue, such that the non-cognate binding agent does not
efficiently transfer coding tag information to the recording tag
under conditions that are suitable for transferring coding tag
information from cognate binding agents to the recording tag.
Alternatively, if a tyrosine residue of a peptide molecule is being
interrogated in a binding reaction, non-cognate binding agents are
those that bind with low affinity or not at all to the tyrosine
residue, such that recording tag information does not efficiently
transfer to the coding tag under suitable conditions for those
embodiments involving extended coding tags rather than extended
recording tags.
[0314] The terminal amino acid at one end of the peptide chain that
has a free amino group is referred to herein as the "N-terminal
amino acid" (NTAA). The terminal amino acid at the other end of the
chain that has a free carboxyl group is referred to herein as the
"C-terminal amino acid" (CTAA). The amino acids making up a peptide
may be numbered in order, with the peptide being "n" amino acids in
length. As used herein, NTAA is considered the n.sup.th amino acid
(also referred to herein as the "n NTAA"). Using this nomenclature,
the next amino acid is the n-1 amino acid, then the n-2 amino acid,
and so on down the length of the peptide from the N-terminal end to
C-terminal end. In certain embodiments, an NTAA, CTAA, or both may
be modified or labeled with a chemical moiety.
[0315] As used herein, the term "barcode" refers to a nucleic acid
molecule of about 2 to about 30 bases (e.g., 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29 or 30 bases) providing a unique identifier tag or
origin information for a macromolecule (e.g., protein, polypeptide,
peptide), a binding agent, a set of binding agents from a binding
cycle, a sample macromolecules, a set of samples, macromolecules
within a compartment (e.g., droplet, bead, or separated location),
macromolecules within a set of compartments, a fraction of
macromolecules, a set of macromolecule fractions, a spatial region
or set of spatial regions, a library of macromolecules, or a
library of binding agents. A barcode can be an artificial sequence
or a naturally occurring sequence. In certain embodiments, each
barcode within a population of barcodes is different. In other
embodiments, a portion of barcodes in a population of barcodes is
different, e.g, at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99%
of the barcodes in a population of barcodes is different. A
population of barcodes may be randomly generated or non-randomly
generated. In certain embodiments, a population of barcodes are
error correcting barcodes. Barcodes can be used to computationally
deconvolute the multiplexed sequencing data and identify sequence
reads derived from an individual macromolecule, sample, library,
etc. A barcode can also be used for deconvolution of a collection
of macromolecules that have been distributed into small
compartments for enhanced mapping. For example, rather than mapping
a peptide back to the proteome, the peptide is mapped back to its
originating protein molecule or protein complex.
[0316] A "sample barcode", also referred to as "sample tag"
identifies from which sample a macromolecule derives.
[0317] A "spatial barcode" which region of a 2-D or 3-D tissue
section from which a macromolecule derives. Spatial barcodes may be
used for molecular pathology on tissue sections. A spatial barcode
allows for multiplex sequencing of a plurality of samples or
libraries from tissue section(s).
[0318] As used herein, the term "coding tag" refers to a nucleic
acid molecule of about 2 bases to about 100 bases, including any
integer including 2 and 100 and in between, that comprises
identifying information for its associated binding agent. A "coding
tag" may also be made from a "sequencable polymer" (see, e.g., Niu
et al., 2013, Nat. Chem. 5:282-292; Roy et al., 2015, Nat. Commun.
6:7237; Lutz, 2015, Macromolecules 48:4759-4767; each of which are
incorporated by reference in its entirety). A coding tag comprises
an encoder sequence, which is optionally flanked by one spacer on
one side or flanked by a spacer on each side. A coding tag may also
be comprised of an optional UMI and/or an optional binding
cycle-specific barcode. A coding tag may be single stranded or
double stranded. A double stranded coding tag may comprise blunt
ends, overhanging ends, or both. A coding tag may refer to the
coding tag that is directly attached to a binding agent, to a
complementary sequence hybridized to the coding tag directly
attached to a binding agent (e.g., for double stranded coding
tags), or to coding tag information present in an extended
recording tag. In certain embodiments, a coding tag may further
comprise a binding cycle specific spacer or barcode, a unique
molecular identifier, a universal priming site, or any combination
thereof.
[0319] As used herein, the term "encoder sequence" or "encoder
barcode" refers to a nucleic acid molecule of about 2 bases to
about 30 bases (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30
bases) in length that provides identifying information for its
associated binding agent. The encoder sequence may uniquely
identify its associated binding agent. In certain embodiments, an
encoder sequence is provides identifying information for its
associated binding agent and for the binding cycle in which the
binding agent is used. In other embodiments, an encoder sequence is
combined with a separate binding cycle-specific barcode within a
coding tag. Alternatively, the encoder sequence may identify its
associated binding agent as belonging to a member of a set of two
or more different binding agents. In some embodiments, this level
of identification is sufficient for the purposes of analysis. For
example, in some embodiments involving a binding agent that binds
to an amino acid, it may be sufficient to know that a peptide
comprises one of two possible amino acids at a particular position,
rather than definitively identify the amino acid residue at that
position. In another example, a common encoder sequence is used for
polyclonal antibodies, which comprises a mixture of antibodies that
recognize more than one epitope of a protein target, and have
varying specificities. In other embodiments, where an encoder
sequence identifies a set of possible binding agents, a sequential
decoding approach can be used to produce unique identification of
each binding agent. This is accomplished by varying encoder
sequences for a given binding agent in repeated cycles of binding
(see, Gunderson et al., 2004, Genome Res. 14:870-7). The partially
identifying coding tag information from each binding cycle, when
combined with coding information from other cycles, produces a
unique identifier for the binding agent, e.g., the particular
combination of coding tags rather than an individual coding tag (or
encoder sequence) provides the uniquely identifying information for
the binding agent. Preferably, the encoder sequences within a
library of binding agents possess the same or a similar number of
bases.
[0320] As used herein the term "binding cycle specific tag",
"binding cycle specific barcode", or "binding cycle specific
sequence" refers to a unique sequence used to identify a library of
binding agents used within a particular binding cycle. A binding
cycle specific tag may comprise about 2 bases to about 8 bases
(e.g., 2, 3, 4, 5, 6, 7, or 8 bases) in length. A binding cycle
specific tag may be incorporated within a binding agent's coding
tag as part of a spacer sequence, part of an encoder sequence, part
of a UMI, or as a separate component within the coding tag.
[0321] As used herein, the term "spacer" (Sp) refers to a nucleic
acid molecule of about 1 base to about 20 bases (e.g., 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases)
in length that is present on a terminus of a recording tag or
coding tag. In certain embodiments, a spacer sequence flanks an
encoder sequence of a coding tag on one end or both ends. Following
binding of a binding agent to a macromolecule, annealing between
complementary spacer sequences on their associated coding tag and
recording tag, respectively, allows transfer of binding information
through a primer extension reaction or ligation to the recording
tag, coding tag, or a di-tag construct. Sp' refers to spacer
sequence complementary to Sp. Preferably, spacer sequences within a
library of binding agents possess the same number of bases. A
common (shared or identical) spacer may be used in a library of
binding agents. A spacer sequence may have a "cycle specific"
sequence in order to track binding agents used in a particular
binding cycle. The spacer sequence (Sp) can be constant across all
binding cycles, be specific for a particular class of
macromolecules, or be binding cycle number specific. Macromolecule
class-specific spacers permit annealing of a cognate binding
agent's coding tag information present in an extended recording tag
from a completed binding/extension cycle to the coding tag of
another binding agent recognizing the same class of macromolecules
in a subsequent binding cycle via the class-specific spacers. Only
the sequential binding of correct cognate pairs results in
interacting spacer elements and effective primer extension. A
spacer sequence may comprise sufficient number of bases to anneal
to a complementary spacer sequence in a recording tag to initiate a
primer extension (also referred to as polymerase extension)
reaction, or provide a "splint" for a ligation reaction, or mediate
a "sticky end" ligation reaction. A spacer sequence may comprise a
fewer number of bases than the encoder sequence within a coding
tag.
[0322] As used herein, the term "recording tag" refers to a nucleic
acid molecule or sequenceable polymer molecule (see, e.g., Niu et
al., 2013, Nat. Chem. 5:282-292; Roy et al., 2015, Nat. Commun.
6:7237; Lutz, 2015, Macromolecules 48:4759-4767; each of which are
incorporated by reference in its entirety) that comprises
identifying information for a macromolecule to which it is
associated. In certain embodiments, after a binding agent binds a
macromolecule, information from a coding tag linked to a binding
agent can be transferred to the recording tag associated with the
macromolecule while the binding agent is bound to the
macromolecule. In other embodiments, after a binding agent binds a
macromolecule, information from a recording tag associated with the
macromolecule can be transferred to the coding tag linked to the
binding agent while the binding agent is bound to the
macromolecule. A recoding tag may be directly linked to a
macromolecule, linked to a macromolecule via a multifunctional
linker, or associated with a macromolecule by virtue of its
proximity (or co-localization) on a solid support. A recording tag
may be linked via its 5' end or 3' end or at an internal site, as
long as the linkage is compatible with the method used to transfer
coding tag information to the recording tag or vice versa. A
recording tag may further comprise other functional components,
e.g., a universal priming site, unique molecular identifier, a
barcode (e.g., a sample barcode, a fraction barcode, spatial
barcode, a compartment tag, etc.), a spacer sequence that is
complementary to a spacer sequence of a coding tag, or any
combination thereof. The spacer sequence of a recording tag is
preferably at the 3'-end of the recording tag in embodiments where
polymerase extension is used to transfer coding tag information to
the recording tag.
[0323] As used herein, the term "primer extension", also referred
to as "polymerase extension", refers to a reaction catalyzed by a
nucleic acid polymerase (e.g., DNA polymerase) whereby a nucleic
acid molecule (e.g., oligonucleotide primer, spacer sequence) that
anneals to a complementary strand is extended by the polymerase,
using the complementary strand as template.
[0324] As used herein, the term "unique molecular identifier" or
"UMI" refers to a nucleic acid molecule of about 3 to about 40
bases (3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, or 40 bases in length providing a unique identifier tag
for each macromolecule (e.g., peptide) or binding agent to which
the UMI is linked. A macromolecule UMI can be used to
computationally deconvolute sequencing data from a plurality of
extended recording tags to identify extended recording tags that
originated from an individual macromolecule. A binding agent UMI
can be used to identify each individual binding agent that binds to
a particular macromolecule. For example, a UMI can be used to
identify the number of individual binding events for a binding
agent specific for a single amino acid that occurs for a particular
peptide molecule. It is understood that when UMI and barcode are
both referenced in the context of a binding agent or macromolecule,
that the barcode refers to identifying information other that the
UMI for the individual binding agent or macromolecule (e.g., sample
barcode, compartment barcode, binding cycle barcode).
[0325] As used herein, the term "universal priming site" or
"universal primer" or "universal priming sequence" refers to a
nucleic acid molecule, which may be used for library amplification
and/or for sequencing reactions. A universal priming site may
include, but is not limited to, a priming site (primer sequence)
for PCR amplification, flow cell adaptor sequences that anneal to
complementary oligonucleotides on flow cell surfaces enabling
bridge amplification in some next generation sequencing platforms,
a sequencing priming site, or a combination thereof. Universal
priming sites can be used for other types of amplification,
including those commonly used in conjunction with next generation
digital sequencing. For example, extended recording tag molecules
may be circularized and a universal priming site used for rolling
circle amplification to form DNA nanoballs that can be used as
sequencing templates (Drmanac et al., 2009, Science 327:78-81).
Alternatively, recording tag molecules may be circularized and
sequenced directly by polymerase extension from universal priming
sites (Korlach et al., 2008, Proc. Natl. Acad. Sci. 105:1176-1181).
The term "forward" when used in context with a "universal priming
site" or "universal primer" may also be referred to as "5" or
"sense". The term "reverse" when used in context with a "universal
priming site" or "universal primer" may also be referred to as "3"
or "antisense".
[0326] As used herein, the term "extended recording tag" refers to
a recording tag to which information of at least one binding
agent's coding tag (or its complementary sequence) has been
transferred following binding of the binding agent to a
macromolecule. Information of the coding tag may be transferred to
the recording tag directly (e.g., ligation) or indirectly (e.g.,
primer extension). Information of a coding tag may be transferred
to the recording tag enzymatically or chemically. An extended
recording tag may comprise binding agent information of 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175,
200 or more coding tags. The base sequence of an extended recording
tag may reflect the temporal and sequential order of binding of the
binding agents identified by their coding tags, may reflect a
partial sequential order of binding of the binding agents
identified by the coding tags, or may not reflect any order of
binding of the binding agents identified by the coding tags. In
certain embodiments, the coding tag information present in the
extended recording tag represents with at least 25%, 30%, 35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97% 98%, 99%, or 100% identity the macromolecule
sequence being analyzed. In certain embodiments where the extended
recording tag does not represent the macromolecule sequence being
analyzed with 100% identity, errors may be due to off-target
binding by a binding agent, or to a "missed" binding cycle (e.g.,
because a binding agent fails to bind to a macromolecule during a
binding cycle, because of a failed primer extension reaction), or
both.
[0327] As used herein, the term "extended coding tag" refers to a
coding tag to which information of at least one recording tag (or
its complementary sequence) has been transferred following binding
of a binding agent, to which the coding tag is joined, to a
macromolecule, to which the recording tag is associated.
Information of a recording tag may be transferred to the coding tag
directly (e.g., ligation), or indirectly (e.g., primer extension).
Information of a recording tag may be transferred enzymatically or
chemically. In certain embodiments, an extended coding tag
comprises information of one recording tag, reflecting one binding
event. As used herein, the term "di-tag" or "di-tag construct" or
"di-tag molecule" refers to a nucleic acid molecule to which
information of at least one recording tag (or its complementary
sequence) and at least one coding tag (or its complementary
sequence) has been transferred following binding of a binding
agent, to which the coding tag is joined, to a macromolecule, to
which the recording tag is associated (see, FIG. 11B). Information
of a recording tag and coding tag may be transferred to the di-tag
indirectly (e.g., primer extension). Information of a recording tag
may be transferred enzymatically or chemically. In certain
embodiments, a di-tag comprises a UMI of a recording tag, a
compartment tag of a recording tag, a universal priming site of a
recording tag, a UMI of a coding tag, an encoder sequence of a
coding tag, a binding cycle specific barcode, a universal priming
site of a coding tag, or any combination thereof.
[0328] As used herein, the term "solid support", "solid surface",
or "solid substrate" or "substrate" refers to any solid material,
including porous and non-porous materials, to which a macromolecule
(e.g., peptide) can be associated directly or indirectly, by any
means known in the art, including covalent and non-covalent
interactions, or any combination thereof. A solid support may be
two-dimensional (e.g., planar surface) or three-dimensional (e.g.,
gel matrix or bead). A solid support can be any support surface
including, but not limited to, a bead, a microbead, an array, a
glass surface, a silicon surface, a plastic surface, a filter, a
membrane, nylon, a silicon wafer chip, a flow through chip, a flow
cell, a biochip including signal transducing electronics, a
channel, a microtiter well, an ELISA plate, a spinning
interferometry disc, a nitrocellulose membrane, a
nitrocellulose-based polymer surface, a polymer matrix, a
nanoparticle, or a microsphere. Materials for a solid support
include but are not limited to acrylamide, agarose, cellulose,
nitrocellulose, glass, gold, quartz, polystyrene, polyethylene
vinyl acetate, polypropylene, polymethacrylate, polyethylene,
polyethylene oxide, polysilicates, polycarbonates, Teflon,
fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic
acid, polyactic acid, polyorthoesters, functionalized silane,
polypropylfumerate, collagen, glycosaminoglycans, polyamino acids,
dextran, or any combination thereof. Solid supports further include
thin film, membrane, bottles, dishes, fibers, woven fibers, shaped
polymers such as tubes, particles, beads, microspheres,
microparticles, or any combination thereof. For example, when solid
surface is a bead, the bead can include, but is not limited to, a a
ceramic bead, polystyrene bead, a polymer bead, a methylstyrene
bead, an agarose bead, an acrylamide bead, a solid core bead, a
porous bead, a paramagnetic bead, a glass bead, or a controlled
pore bead. A bead may be spherical or an irregularly shaped. A
bead's size may range from nanometers, e.g. 100 nm, to millimeters,
e.g., 1 mm. In certain embodiments, beads range in size from about
0.2 micron to about 200 microns, or from about 0.5 micron to about
5 micron. n some embodiments, beads can be about 1, 1.5, 2, 2.5,
2.8, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10,
10.5, 15, or 20 .mu.m in diameter. In certain embodiments, "a bead"
solid support may refer to an individual bead or a plurality of
beads.
[0329] As used herein, the term "nucleic acid molecule" or
"polynucleotide" refers to a single- or double-stranded
polynucleotide containing deoxyribonucleotides or ribonucleotides
that are linked by 3'-5' phosphodiester bonds, as well as
polynucleotide analogs. A nucleic acid molecule includes, but is
not limited to, DNA, RNA, and cDNA. A polynucleotide analog may
possess a backbone other than a standard phosphodiester linkage
found in natural polynucleotides and, optionally, a modified sugar
moiety or moieties other than ribose or deoxyribose. Polynucleotide
analogs contain bases capable of hydrogen bonding by Watson-Crick
base pairing to standard polynucleotide bases, where the analog
backbone presents the bases in a manner to permit such hydrogen
bonding in a sequence-specific fashion between the oligonucleotide
analog molecule and bases in a standard polynucleotide. Examples of
polynucleotide analogs include, but are not limited to xeno nucleic
acid (XNA), bridged nucleic acid (BNA), glycol nucleic acid (GNA),
peptide nucleic acids (PNAs), .gamma.PNAs, morpholino
polynucleotides, locked nucleic acids (LNAs), threose nucleic acid
(TNA), 2'-O-Methyl polynucleotides, 2'-O-alkyl ribosyl substituted
polynucleotides, phosphorothioate polynucleotides, and
boronophosphate polynucleotides. A polynucleotide analog may
possess purine or pyrimidine analogs, including for example,
7-deaza purine analogs, 8-halopurine analogs, 5-halopyrimidine
analogs, or universal base analogs that can pair with any base,
including hypoxanthine, nitroazoles, isocarbostyril analogues,
azole carboxamides, and aromatic triazole analogues, or base
analogs with additional functionality, such as a biotin moiety for
affinity binding.
[0330] As used herein, "nucleic acid sequencing" means the
determination of the order of nucleotides in a nucleic acid
molecule or a sample of nucleic acid molecules.
[0331] As used herein, "next generation sequencing" refers to
high-throughput sequencing methods that allow the sequencing of
millions to billions of molecules in parallel. Examples of next
generation sequencing methods include sequencing by synthesis,
sequencing by ligation, sequencing by hybridization, polony
sequencing, ion semiconductor sequencing, and pyrosequencing. By
attaching primers to a solid substrate and a complementary sequence
to a nucleic acid molecule, a nucleic acid molecule can be
hybridized to the solid substrate via the primer and then multiple
copies can be generated in a discrete area on the solid substrate
by using polymerase to amplify (these groupings are sometimes
referred to as polymerase colonies or polonies). Consequently,
during the sequencing process, a nucleotide at a particular
position can be sequenced multiple times (e.g., hundreds or
thousands of times)--this depth of coverage is referred to as "deep
sequencing." Examples of high throughput nucleic acid sequencing
technology include platforms provided by Illumina, BGI, Qiagen,
Thermo-Fisher, and Roche, including formats such as parallel bead
arrays, sequencing by synthesis, sequencing by ligation, capillary
electrophoresis, electronic microchips, "biochips," microarrays,
parallel microchips, and single-molecule arrays, as reviewed by
Service (Science 311:1544-1546, 2006).
[0332] As used herein, "single molecule sequencing" or "third
generation sequencing" refers to next-generation sequencing methods
wherein reads from single molecule sequencing instruments are
generated by sequencing of a single molecule of DNA. Unlike next
generation sequencing methods that rely on amplification to clone
many DNA molecules in parallel for sequencing in a phased approach,
single molecule sequencing interrogates single molecules of DNA and
does not require amplification or synchronization. Single molecule
sequencing includes methods that need to pause the sequencing
reaction after each base incorporation (`wash-and-scan` cycle) and
methods which do not need to halt between read steps. Examples of
single molecule sequencing methods include single molecule
real-time sequencing (Pacific Biosciences), nanopore-based
sequencing (Oxford Nanopore), duplex interrupted nanopore
sequencing, and direct imaging of DNA using advanced
microscopy.
[0333] As used herein, "analyzing" the macromolecule means to
quantify, characterize, distinguish, or a combination thereof, all
or a portion of the components of the macromolecule. For example,
analyzing a peptide, polypeptide, or protein includes determining
all or a portion of the amino acid sequence (contiguous or
non-continuous) of the peptide. Analyzing a macromolecule also
includes partial identification of a component of the
macromolecule. For example, partial identification of amino acids
in the macromolecule protein sequence can identify an amino acid in
the protein as belonging to a subset of possible amino acids.
Analysis typically begins with analysis of the n NTAA, and then
proceeds to the next amino acid of the peptide (i.e., n-1, n-2,
n-3, and so forth). This is accomplished by cleavage of the n NTAA,
thereby converting the n-1 amino acid of the peptide to an
N-terminal amino acid (referred to herein as the "n-1 NTAA").
Analyzing the peptide may also include determining the presence and
frequency of post-translational modifications on the peptide, which
may or may not include information regarding the sequential order
of the post-translational modifications on the peptide. Analyzing
the peptide may also include determining the presence and frequency
of epitopes in the peptide, which may or may not include
information regarding the sequential order or location of the
epitopes within the peptide. Analyzing the peptide may include
combining different types of analysis, for example obtaining
epitope information, amino acid sequence information,
post-translational modification information, or any combination
thereof.
[0334] As used herein, the term "compartment" refers to a physical
area or volume that separates or isolates a subset of
macromolecules from a sample of macromolecules. For example, a
compartment may separate an individual cell from other cells, or a
subset of a sample's proteome from the rest of the sample's
proteome. A compartment may be an aqueous compartment (e.g.,
microfluidic droplet), a solid compartment (e.g., picotiter well or
microtiter well on a plate, tube, vial, gel bead), or a separated
region on a surface. A compartment may comprise one or more beads
to which macromolecules may be immobilized.
[0335] As used herein, the term "compartment tag" or "compartment
barcode" refers to a single or double stranded nucleic acid
molecule of about 4 bases to about 100 bases (including 4 bases,
100 bases, and any integer between) that comprises identifying
information for the constituents (e.g., a single cell's proteome),
within one or more compartments (e.g., microfluidic droplet). A
compartment barcode identifies a subset of macromolecules in a
sample, e.g., a subset of protein sample, that have been separated
into the same physical compartment or group of compartments from a
plurality (e.g., millions to billions) of compartments. Thus, a
compartment tag can be used to distinguish constituents derived
from one or more compartments having the same compartment tag from
those in another compartment having a different compartment tag,
even after the constituents are pooled together. By labeling the
proteins and/or peptides within each compartment or within a group
of two or more compartments with a unique compartment tag, peptides
derived from the same protein, protein complex, or cell within an
individual compartment or group of compartments can be identified.
A compartment tag comprises a barcode, which is optionally flanked
by a spacer sequence on one or both sides, and an optional
universal primer. The spacer sequence can be complementary to the
spacer sequence of a recording tag, enabling transfer of
compartment tag information to the recording tag. A compartment tag
may also comprise a universal priming site, a unique molecular
identifier (for providing identifying information for the peptide
attached thereto), or both, particularly for embodiments where a
compartment tag comprises a recording tag to be used in downstream
peptide analysis methods described herein. A compartment tag can
comprise a functional moiety (e.g., aldehyde, NHS, mTet, alkyne,
etc.) for coupling to a peptide. Alternatively, a compartment tag
can comprise a peptide comprising a recognition sequence for a
protein ligase to allow ligation of the compartment tag to a
peptide of interest. A compartment can comprise a single
compartment tag, a plurality of identical compartment tags save for
an optional UMI sequence, or two or more different compartment
tags. In certain embodiments each compartment comprises a unique
compartment tag (one-to-one mapping). In other embodiments,
multiple compartments from a larger population of compartments
comprise the same compartment tag (many-to-one mapping). A
compartment tag may be joined to a solid support within a
compartment (e.g., bead) or joined to the surface of the
compartment itself (e.g., surface of a picotiter well).
Alternatively, a compartment tag may be free in solution within a
compartment.
[0336] As used herein, the term "partition" refers to random
assignment of a unique barcode to a subpopulation of macromolecules
from a population of macromolecules within a sample. In certain
embodiments, partitioning may be achieved by distributing
macromolecules into compartments. A partition may be comprised of
the macromolecules within a single compartment or the
macromolecules within multiple compartments from a population of
compartments.
[0337] As used herein, a "partition tag" or "partition barcode"
refers to a single or double stranded nucleic acid molecule of
about 4 bases to about 100 bases (including 4 bases, 100 bases, and
any integer between) that comprises identifying information for a
partition. In certain embodiments, a partition tag for a
macromolecule refers to identical compartment tags arising from the
partitioning of macromolecules into compartment(s) labeled with the
same barcode.
[0338] As used herein, the term "fraction" refers to a subset of
macromolecules (e.g., proteins) within a sample that have been
sorted from the rest of the sample or organelles using physical or
chemical separation methods, such as fractionating by size,
hydrophobicity, isoelectric point, affinity, and so on. Separation
methods include HPLC separation, gel separation, affinity
separation, cellular fractionation, cellular organelle
fractionation, tissue fractionation, etc. Physical properties such
as fluid flow, magnetism, electrical current, mass, density, or the
like can also be used for separation.
[0339] As used herein, the term "fraction barcode" refers to a
single or double stranded nucleic acid molecule of about 4 bases to
about 100 bases (including 4 bases, 100 bases, and any integer
therebetween) that comprises identifying information for the
macromolecules within a fraction.
III. Methods of Analysing Macromolecules
[0340] The methods described herein provide a highly-parallelized
approach for macromolecule analysis. Highly multiplexed
macromolecule binding assays are converted into a nucleic acid
molecule library for readout by next generation sequencing. The
methods provided herein are particularly useful for protein or
peptide sequencing.
[0341] In a preferred embodiment, protein samples are labeled at
the single molecule level with at least one nucleic acid recording
tag that includes a barcode (e.g., sample barcode, compartment
barcode) and an optional unique molecular identifier. The protein
samples undergo proteolytic digest to produce a population of
recording tag labeled peptides (e.g., millions to billions). These
recording tag labeled peptides are pooled and immobilized randomly
on a solid support (e.g., porous beads). The pooled, immobilized,
recording tag labeled peptides are subjected to multiple,
successive binding cycles, each binding cycle comprising exposure
to a plurality of binding agents (e.g., binding agents for all
twenty of the naturally occurring amino acids) that are labeled
with coding tags comprising an encoder sequence that identifies the
associated binding agent. During each binding cycle, information
about the binding of a binding agent to the peptide is captured by
transferring a binding agent's coding tag information to the
recording tag (or transferring the recording tag information to the
coding tag or transferring both recording tag information and
coding tag information to a separate di-tag construct). Upon
completion of binding cycles, a library of extended recording tags
(or extended coding tags or di-tag constructs) is generated that
represents the binding histories of the assayed peptides, which can
be analyzed using very high-throughput next generation digital
sequencing methods. The use of nucleic acid barcodes in the
recording tag allows deconvolution of a massive amount of peptide
sequencing data, e.g., to identify which sample, cell, subset of
proteome, or protein, a peptide sequence originated from.
[0342] In one aspect, a method for analysing a macromolecule is
provided comprising: (a) providing a macromolecule and an
associated or co-localized recording tag joined to a solid support;
(b) contacting the macromolecule with a first binding agent capable
of binding to the macromolecule, wherein the first binding agent
comprises a first coding tag with identifying information regarding
the first binding agent; (c) transferring the information of the
first coding tag to the recording tag to generate a first order
extended recording tag; (d) contacting the macromolecule with a
second binding agent capable of binding to the macromolecule,
wherein the second binding agent comprises a second coding tag with
identifying information regarding the second binding agent; (e)
transferring the information of the second coding tag is
transferred to the first order extended recording tag to generate a
second order extended recording tag; and (f) analysing the second
order extended tag (see, e.g., FIGS. 2A-D).
[0343] In certain embodiments, the contacting steps (b) and (d) are
performed in sequential order, e.g., the first binding agent and
the second binding agent are contacted with the macromolecule in
separate binding cycle reactions. In other embodiments, the
contacting steps (b) and (d) are performed at the same time, e.g.,
as in a single binding cycle reaction comprising the first binding
agent, the second binding agent, and optionally additional binding
agents. In a preferred embodiment, the contacting steps (b) and (d)
each comprise contacting the macromolecule with a plurality of
binding agents.
[0344] In certain embodiments, the method further comprises between
steps (e) and (f) the following steps: (x) repeating steps (d) and
(e) one or more times by replacing the second binding agent with a
third (or higher order) binding agent capable of binding to the
macromolecule, wherein the third (or higher order) binding agent
comprises a third (or higher order) coding tag with identifying
information regarding the third (or higher order) bind agent; and
(y) transferring the information of the third (or higher order)
coding tag to the second (or higher order) extended recording tag
to generate a third (or higher order) extended recording tag; and
(z) analysing the third (or higher order) extended recording
tag.
[0345] The third (or higher order) binding agent may be contacted
with the macromolecule in a separate binding cycle reaction from
the first binding agent and the second binding agent.
Alternatively, the third (or higher order) binding agent may be
contacted with the macromolecule in a single binding cycle reaction
with the first binding agent, and the second binding agent.
[0346] In a second aspect, a method for analyzing a macromolecule
is provided comprising the steps of: (a) providing a macromolecule,
an associated first recording tag and an associated second
recording tag joined to a solid support; (b) contacting the
macromolecule with a first binding agent capable of binding to the
macromolecule, wherein the first binding agent comprises a first
coding tag with identifying information regarding the first binding
agent; (c) transferring the information of the first coding tag to
the first recording tag to generate a first extended recording tag;
(d) contacting the macromolecule with a second binding agent
capable of binding to the macromolecule, wherein the second binding
agent comprises a second coding tag with identifying information
regarding the second binding agent; (e) transferring the
information of the second coding tag to the second recording tag to
generate a second extended recording tag; and (f) analyzing the
first and second extended recording tags.
[0347] In certain embodiments, contacting steps (b) and (d) are
performed in sequential order, e.g., the first binding agent and
the second binding agent are contacted with the macromolecule in
separate binding cycle reactions. In other embodiments, contacting
steps (b) and (d) are performed at the same time, e.g., as in a
single binding cycle reaction comprising the first binding agent,
the second binding agent, and optionally additional binding
agents.
[0348] In certain embodiments, step (a) further comprises providing
an associated third (or higher order) recording tag joined to the
solid support. In further embodiments, the method further
comprises, between steps (e) and (f), the following steps: (x)
repeating steps (d) and (e) one or more times by replacing the
second binding agent with a third (or higher order) binding agent
capable of binding to the macromolecule, wherein the third (or
higher order) binding agent comprises a third (or higher order)
coding tag with identifying information regarding the third (or
higher order) bind agent; and (y) transferring the information of
the third (or higher order) coding tag to the third (or higher
order) recording tag to generate a third (or higher order) extended
recording tag; and (z) analysing the first, second and third (or
higher order) extended recording tags.
[0349] The third (or higher order) binding agent may be contacted
with the macromolecule in a separate binding cycle reaction from
the first binding agent and the second binding agent.
Alternatively, the third (or higher order) binding agent may be
contacted with the macromolecule in a single binding cycle reaction
with the first binding agent, and the second binding agent.
[0350] In certain embodiments, the first coding tag, second coding
tag, and any higher order coding tags each have a binding cycle
specific sequence.
[0351] In a third aspect, a method of analyzing a peptide is
provided comprising the steps of: (a) providing a peptide and an
associated recording tag joined to a solid support; (b) modifying
the N-terminal amino acid (NTAA) of the peptide with a chemical
moiety to produce a modified NTAA; (c) contacting the peptide with
a first binding agent capable of binding to the modified NTAA,
wherein the first binding agent comprises a first coding tag with
identifying information regarding the first binding agent; (d)
transferring the information of the first coding tag to the
recording tag to generate an extended recording tag; and (e)
analyzing the extended recording tag (see, e.g. FIG. 3).
[0352] In certain embodiments, step (c) further comprises
contacting the peptide with a second (or higher order) binding
agent comprising a second (or higher order) coding tag with
identifying information regarding the second (or higher order)
binding agent, wherein the second (or higher order) binding agent
is capable of binding to a modified NTAA other than the modified
NTAA of step (b). In further embodiments, contacting the peptide
with the second (or higher order) binding agent occurs in
sequential order following the peptide being contacted with the
first binding agent, e.g., the first binding agent and the second
(or higher order) binding agent are contacted with the peptide in
separate binding cycle reactions. In other embodiments, contacting
the peptide with the second (or higher order) binding agent occurs
simultaneously with the peptide being contacted with the first
binding agent, e.g., as in a single binding cycle reaction
comprising the first binding agent and the second (or higher order)
binding agent).
[0353] In certain embodiments, the chemical moiety is add to the
NTAA via chemical reaction or enzymatic reaction.
[0354] In certain embodiments, the chemical moiety used for
modifying the NTAA is a phenylthiocarbamoyl (PTC), dinitrophenol
(DNP) moiety; a sulfonyloxynitrophenyl (SNP) moiety, a dansyl
moiety; a 7-methoxy coumarin moiety;
[0355] a thioacyl moiety; a thioacetyl moiety; an acetyl moiety; a
guanidnyl moiety; or a thiobenzyl moiety.
[0356] A chemical moiety may be added to the NTAA using a chemical
agent. In certain embodiments, the chemical agent for modifying an
NTAA with a PTC moiety is a phenyl isothiocyanate or derivative
thereof; the chemical agent for modifying an NTAA with a DNP moiety
is 2,4-dinitrobenzenesulfonic acid (DNBS) or an aryl halide such as
1-Fluoro-2,4-dinitrobenzene (DNFB); the chemical agent for
modifying an NTAA with a sulfonyloxynitrophenyl (SNP) moiety is
4-sulfonyl-2-nitrofluorobenzene (SNFB); the chemical agent for
modifying an NTAA with a dansyl group is a sulfonyl chloride such
as dansyl chloride; the chemical agent for modifying an NTAA with a
7-methoxy coumarin moiety is 7-methoxycoumarin acetic acid (MCA);
the chemical agent for modifying an NTAA with a thioacyl moiety is
a thioacylation reagent; the chemical agent for modifying an NTAA
with a thioacetyl moiety is a thioacetylation reagent; the chemical
agent for modifying an NTAA with an acetyl moiety is an acetylating
reagent (e.g., acetic anhydride); the chemical agent for modifying
an NTAA with a guanidnyl (amidinyl) moiety is a guanidinylating
reagent, or the chemical agent for modifying an NTAA with a
thiobenzyl moiety is a thiobenzylation reagent.
[0357] In a fourth aspect the present disclosure provides, a method
for analyzing a peptide is provided comprising the steps of: (a)
providing a peptide and an associated recording tag joined to a
solid support; (b) modifying the N-terminal amino acid (NTAA) of
the peptide with a chemical moiety to produce a modified NTAA; (c)
contacting the peptide with a first binding agent capable of
binding to the modified NTAA, wherein the first binding agent
comprises a first coding tag with identifying information regarding
the first binding agent; (d) transferring the information of the
first coding tag to the recording tag to generate a first extended
recording tag; (e) removing the modified NTAA to expose a new NTAA;
(f) modifying the new NTAA of the peptide with a chemical moiety to
produce a newly modified NTAA; (g) contacting the peptide with a
second binding agent capable of binding to the newly modified NTAA,
wherein the second binding agent comprises a second coding tag with
identifying information regarding the second binding agent; (h)
transferring the information of the second coding tag to the first
extended recording tag to generate a second extended recording tag;
and (i) analyzing the second extended recording tag.
[0358] In certain embodiments, the contacting steps (c) and (g) are
performed in sequential order, e.g., the first binding agent and
the second binding agent are contacted with the peptide in separate
binding cycle reactions.
[0359] In certain embodiments, the method further comprises between
steps (h) and (i) the following steps: (x) repeating steps (e),
(f), and (g) one or more times by replacing the second binding
agent with a third (or higher order) binding agent capable of
binding to the modified NTAA, wherein the third (or higher order)
binding agent comprises a third (or higher order) coding tag with
identifying information regarding the third (or higher order) bind
agent; and (y) transferring the information of the third (or higher
order) coding tag to the second (or higher order) extended
recording tag to generate a third (or higher order) extended
recording tag; and (z) analysing the third (or higher order)
extended recording tag.
[0360] In certain embodiments, the chemical moiety is add to the
NTAA via chemical reaction or enzymatic reaction.
[0361] In certain embodiments, the chemical moiety is a
phenylthiocarbamoyl (PTC), dinitrophenol (DNP) moiety; a
sulfonyloxynitrophenyl (SNP) moiety, a dansyl moiety; a 7-methoxy
coumarin moiety; a thioacyl moiety; a thioacetyl moiety; an acetyl
moiety; a guanyl moiety; or a thiobenzyl moiety.
[0362] A chemical moiety may be added to the NTAA using a chemical
agent. In certain embodiments, the chemical agent for modifying an
NTAA with a PTC moiety is a phenyl isothiocyanate or derivative
thereof; the chemical agent for modifying an NTAA with a DNP moiety
is 2,4-dinitrobenzenesulfonic acid (DNBS) or an aryl halide such as
1-Fluoro-2,4-dinitrobenzene (DNFB); the chemical agent for
modifying an NTAA with a sulfonyloxynitrophenyl (SNP) moiety is
4-sulfonyl-2-nitrofluorobenzene (SNFB); the chemical agent for
modifying an NTAA with a dansyl group is a sulfonyl chloride such
as dansyl chloride; the chemical reagent for modifying an NTAA with
a 7-methoxy coumarin moiety is 7-methoxycoumarin acetic acid (MCA);
the chemical agent for modifying an NTAA with a thioacyl moiety is
a thioacylation reagent; the chemical agent for modifying an NTAA
with a thioacetyl moiety is a thioacetylation reagent; the chemical
agent for modifying an NTAA with an acetyl moiety is an acetylating
agent (e.g., acetic anhydride); the chemical agent for modifying an
NTAA with a guanyl moiety is a guanidinylating reagent, or the
chemical agent for modifying an NTAA with a thiobenzyl moiety is a
thiobenzylation reagent.
[0363] In a fifth aspect, a method for analyzing a peptide is
provided comprising the steps of: (a) providing a peptide and an
associated recording tag joined to a solid support; (b) contacting
the peptide with a first binding agent capable of binding to the
N-terminal amino acid (NTAA) of the peptide, wherein the first
binding agent comprises a first coding tag with identifying
information regarding the first binding agent; (c) transferring the
information of the first coding tag to the recording tag to
generate an extended recording tag; and (d) analyzing the extended
recording tag.
[0364] In certain embodiments, step (b) further comprises
contacting the peptide with a second (or higher order) binding
agent comprising a second (or higher order) coding tag with
identifying information regarding the second (or higher order)
binding agent, wherein the second (or higher order) binding agent
is capable of binding to a NTAA other than the NTAA of the peptide.
In further embodiments, the contacting the peptide with the second
(or higher order) binding agent occurs in sequential order
following the peptide being contacted with the first binding agent,
e.g., the first binding agent and the second (or higher order)
binding agent are contacted with the peptide in separate binding
cycle reactions. In other embodiments, the contacting the peptide
with the second (or higher order) binding agent occurs at the same
time as the peptide the being contacted with first binding agent,
e.g., as in a single binding cycle reaction comprising the first
binding agent and the second (or higher order) binding agent.
[0365] In a sixth aspect, a method for analyzing a peptide is
provided, comprising the steps of: (a) providing a peptide and an
associated recording tag joined to a solid support; (b) contacting
the peptide with a first binding agent capable of binding to the
N-terminal amino acid (NTAA) of the peptide, wherein the first
binding agent comprises a first coding tag with identifying
information regarding the first binding agent; (c) transferring the
information of the first coding tag to the recording tag to
generate a first extended recording tag; (d) removing the NTAA to
expose a new NTAA of the peptide; (e) contacting the peptide with a
second binding agent capable of binding to the new NTAA, wherein
the second binding agent comprises a second coding tag with
identifying information regarding the second binding agent; (f)
transferring the information of the second coding tag to the first
extended recording tag to generate a second extended recording tag;
and (g) analyzing the second extended recording tag.
[0366] In certain embodiments, the method further comprises between
steps (f) and (g) the following steps: (x) repeating steps (d),
(e), and (f) one or more times by replacing the second binding
agent with a third (or higher order) binding agent capable of
binding to the macromolecule, wherein the third (or higher order)
binding agent comprises a third (or higher order) coding tag with
identifying information regarding the third (or higher order) bind
agent; and (y) transferring the information of the third (or higher
order) coding tag to the second (or higher order) extended
recording tag to generate a third (or higher order) extended
recording tag; and wherein the third (or higher order) extended
recording tag is analyzed in step (g).
[0367] In certain embodiments, the contacting steps (b) and (e) are
performed in sequential order, e.g., the first binding agent and
the second binding agent are contacted with the peptide in separate
binding cycle reactions.
[0368] In any of the embodiments provided herein, the methods
comprise analyzing a plurality of macromolecules in parallel. In a
preferred embodiment, the methods comprise analyzing a plurality of
peptides in parallel.
[0369] In any of the embodiments provided herein, the step of
contacting a macromolecule (or peptide) with a binding agent
comprises contacting the macromolecule (or peptide) with a
plurality of binding agents.
[0370] In any of the embodiments provided herein, the macromolecule
may be a protein, polypeptide, or peptide. In further embodiments,
the peptide may be obtained by fragmenting a protein or polypeptide
from a biological sample.
[0371] In any of the embodiments provided herein, the macromolecule
may be or comprise a carbohydrate, lipid, nucleic acid, or
macrocycle.
[0372] In any of the embodiments provided herein, the recording tag
may be a DNA molecule, a DNA molecule with modified bases, an RNA
molecule, a BNA, molecule, a XNA molecule, an LNA molecule, a PNA
molecule, a .gamma.PNA molecule (Dragulescu-Andrasi et al., 2006,
J. Am. Chem. Soc. 128:10258-10267), a GNA molecule, or any
combination thereof.
[0373] In any of the embodiments provided herein, the recording tag
may comprise a universal priming site. In further embodiments, the
universal priming site comprises a priming site for amplification,
ligation, sequencing, or a combination thereof.
[0374] In any of the embodiments provided herein, the recording tag
may comprise a unique molecular identifier, a compartment tag, a
partition barcode, sample barcode, a fraction barcode, a spacer
sequence, or any combination thereof.
[0375] In any of the embodiments provided herein, the coding tag
may comprise a unique molecular identifier (UMI), an encoder
sequence, a binding cycle specific sequence, a spacer sequence, or
any combination thereof.
[0376] In any of the embodiments provided herein, the binding cycle
specific sequence in the coding tag may be a binding cycle-specific
spacer sequence.
[0377] In certain embodiments, a binding cycle specific sequence is
encoded as a separate barcode from the encoder sequence. In other
embodiments, the encoder sequence and binding cycle specific
sequence is set forth in a single barcode that is unique for the
binding agent and for each cycle of binding.
[0378] In certain embodiments, the spacer sequence comprises a
common binding cycle sequence that is shared among binding agents
from the multiple binding cycles. In other embodiments, the spacer
sequence comprises a unique binding cycle sequence that is shared
among binding agents from the same binding cycle.
[0379] In any of the embodiments provided herein, the recording tag
may comprise a barcode.
[0380] In any of the embodiments provided herein, the macromolecule
and the associated recording tag(s) may be covalently joined to the
solid support.
[0381] In any of the embodiments provided herein, the solid support
may be a bead, a porous bead, a porous matrix, an expandable gel
bead or matrix, an array, a glass surface, a silicon surface, a
plastic surface, a filter, a membrane, nylon, a silicon wafer chip,
a flow through chip, a biochip including signal transducing
electronics, a microtiter well, an ELISA plate, a spinning
interferometry disc, a nitrocellulose membrane, a
nitrocellulose-based polymer surface, a nanoparticle, or a
microsphere.
[0382] In any of the embodiments provided herein, the solid support
may be a polystyrene bead, a polymer bead, an agarose bead, an
acrylamide bead, a solid core bead, a porous bead, a paramagnetic
bead, glass bead, or a controlled pore bead.
[0383] In any of the embodiments provided herein, a plurality of
macromolecules and associated recording tags may be joined to a
solid support. In further embodiments, the plurality of
macromolecules are spaced apart on the solid support at an average
distance .gtoreq.50 nm, .gtoreq.100 nm, or .gtoreq.200 nm.
[0384] In any of the embodiments provided herein, the binding agent
may be a polypeptide or protein. In further embodiments, the
binding agent is a modified or variant aminopeptidase, a modified
or variant amino acyl tRNA synthetase, a modified or variant
anticalin, or a modified or variant ClpS.
[0385] In any of the embodiments provided herein, the binding agent
may be capable of selectively binding to the macromolecule.
[0386] In any of the embodiments provided herein, the coding tag
may be a DNA molecule, DNA molecule with modified bases, an RNA
molecule, a BNA molecule, an XNA molecule, a LNA molecule, a GNA
molecule, a PNA molecule, a .gamma.PNA molecule, or a combination
thereof.
[0387] In any of the embodiments provided herein, the binding agent
and the coding tag may be joined by a linker.
[0388] In any of the embodiments provided herein, the binding agent
and the coding tag may be joined by a SpyTag/SpyCatcher or
SnoopTag/SnoopCatcher peptide-protein pair (Zakeri, et al., 2012,
Proc Natl Acad Sci USA 109(12): E690-697; Veggiani et al., 2016,
Proc. Natl. Acad. Sci. USA 113:1202-1207, each of which is
incorporated by reference in its entirety).
[0389] In any of the embodiments provided herein, the transferring
of information of the coding tag to the recording tag is mediated
by a DNA ligase. Alternatively, the transferring of information of
the coding tag to the recording tag is mediated by a DNA polymerase
or chemical ligation.
[0390] In any of the embodiments provided herein, analyzing the
extended recording tag may comprise nucleic acid sequencing. In
further embodiments, nucleic acid sequencing is sequencing by
synthesis, sequencing by ligation, sequencing by hybridization,
polony sequencing, ion semiconductor sequencing, or pyrosequencing.
In other embodiments, nucleic acid sequencing is single molecule
real-time sequencing, nanopore-based sequencing, nanogap tunneling
sequencing, or direct imaging of DNA using advanced microscopy.
[0391] In any of the embodiments provided herein, the extended
recording tag may be amplified prior to analysis.
[0392] In any of the embodiments provided herein, the order of the
coding tag information contained on the extended recording tag may
provide information regarding the order of binding by the binding
agents to the macromolecule and thus, the sequence of analytes
detected by the binding agents.
[0393] In any of the embodiments provided herein, the frequency of
a particular coding tag information (e.g., encoder sequence)
contained on the extended recording tag may provide information
regarding the frequency of binding by a particular binding agent to
the macromolecule and thus, the frequency of the analyte in the
macromolecule detected by the binding agent.
[0394] In any of the embodiments disclosed herein, multiple
macromolecule (e.g., protein) samples, wherein a population of
macromolecules within each sample are labeled with recording tags
comprising a sample specific barcode, can be pooled. Such a pool of
macromolecule samples may be subjected to binding cycles within a
single-reaction tube.
[0395] In any of the embodiments provided herein, the plurality of
extended recording tags representing a plurality of macromolecules
may be analyzed in parallel.
[0396] In any of the embodiments provided herein, the plurality of
extended recording tags representing a plurality of macromolecules
may be analyzed in a multiplexed assay.
[0397] In any of the embodiments provided herein, the plurality of
extended recording tags may undergo a target enrichment assay prior
to analysis.
[0398] In any of the embodiments provided herein, the plurality of
extended recording tags may undergo a subtraction assay prior to
analysis.
[0399] In any of the embodiments provided herein, the plurality of
extended recording tags may undergo a normalization assay to reduce
highly abundant species prior to analysis.
[0400] In any of the embodiments provided herein, the NTAA may be
removed by a modified aminopeptidase, a modified amino acid tRNA
synthetase, a mild Edman degradation, an Edmanase enzyme, or
anhydrous TFA.
[0401] In any of the embodiments provided herein, at least one
binding agent may bind to a terminal amino acid residue. In certain
embodiments the terminal amino acid residue is an N-terminal amino
acid or a C-terminal amino acid.
[0402] In any of the embodiments described herein, at least one
binding agent may bind to a post-translationally modified amino
acid.
[0403] Features of the aforementioned embodiments are provided in
further detail in the following sections.
IV. Macromolecules
[0404] In one aspect, the present disclosure relates to the
analysis of macromolecules. A macromolecule is a large molecule
composed of smaller subunits. In certain embodiments, a
macromolecule is a protein, a protein complex, polypeptide,
peptide, nucleic acid molecule, carbohydrate, lipid, macrocycle, or
a chimeric macromolecule.
[0405] A macromolecule (e.g., protein, polypeptide, peptide)
analyzed according the methods disclosed herein may be obtained
from a suitable source or sample, including but not limited to:
biological samples, such as cells (both primary cells and cultured
cell lines), cell lysates or extracts, cell organelles or vesicles,
including exosomes, tissues and tissue extracts; biopsy; fecal
matter; bodily fluids (such as blood, whole blood, serum, plasma,
urine, lymph, bile, cerebrospinal fluid, interstitial fluid,
aqueous or vitreous humor, colostrum, sputum, amniotic fluid,
saliva, anal and vaginal secretions, perspiration and semen, a
transudate, an exudate (e.g., fluid obtained from an abscess or any
other site of infection or inflammation) or fluid obtained from a
joint (normal joint or a joint affected by disease such as
rheumatoid arthritis, osteoarthritis, gout or septic arthritis) of
virtually any organism, with mammalian-derived samples, including
microbiome-containing samples, being preferred and human-derived
samples, including microbiome-containing samples, being
particularly preferred; environmental samples (such as air,
agricultural, water and soil samples); microbial samples including
samples derived from microbial biofilms and/or communities, as well
as microbial spores; research samples including extracellular
fluids, extracellular supernatants from cell cultures, inclusion
bodies in bacteria, cellular compartments including mitochondrial
compartments, and cellular periplasm.
[0406] In certain embodiments, a macromolecule is a protein, a
protein complex, a polypeptide, or peptide. Amino acid sequence
information and post-translational modifications of a peptide,
polypeptide, or protein are transduced into a nucleic acid encoded
library that can be analyzed via next generation sequencing
methods. A peptide may comprise L-amino acids, D-amino acids, or
both. A peptide, polypeptide, protein, or protein complex may
comprise a standard, naturally occurring amino acid, a modified
amino acid (e.g., post-translational modification), an amino acid
analog, an amino acid mimetic, or any combination thereof. In some
embodiments, a peptide, polypeptide, or protein is naturally
occurring, synthetically produced, or recombinantly expressed. In
any of the aforementioned peptide embodiments, a peptide,
polypeptide, protein, or protein complex may further comprise a
post-translational modification.
[0407] Standard, naturally occurring amino acids include Alanine (A
or Ala), Cysteine (C or Cys), Aspartic Acid (D or Asp), Glutamic
Acid (E or Glu), Phenylalanine (F or Phe), Glycine (G or Gly),
Histidine (H or His), Isoleucine (I or Ile), Lysine (K or Lys),
Leucine (L or Leu), Methionine (M or Met), Asparagine (N or Asn),
Proline (P or Pro), Glutamine (Q or Gln), Arginine (R or Arg),
Serine (S or Ser), Threonine (T or Thr), Valine (V or Val),
Tryptophan (W or Trp), and Tyrosine (Y or Tyr). Non-standard amino
acids include selenocysteine, pyrrolysine, and N-formylmethionine,
.beta.-amino acids, Homo-amino acids, Proline and Pyruvic acid
derivatives, 3-substituted Alanine derivatives, Glycine
derivatives, Ring-substituted Phenylalanine and Tyrosine
Derivatives, Linear core amino acids, and N-methyl amino acids.
[0408] A post-translational modification (PTM) of a peptide,
polypeptide, or protein may be a covalent modification or enzymatic
modification. Examples of post-translation modifications include,
but are not limited to, acylation, acetylation, alkylation
(including methylation), biotinylation, butyrylation,
carbamylation, carbonylation, deamidation, deiminiation,
diphthamide formation, disulfide bridge formation, eliminylation,
flavin attachment, formylation, gamma-carboxylation, glutamylation,
glycylation, glycosylation (e.g., N-linked, O-linked, C-linked,
phosphoglycosylation), glypiation, heme C attachment,
hydroxylation, hypusine formation, iodination, isoprenylation,
lipidation, lipoylation, malonylation, methylation,
myristolylation, oxidation, palmitoylation, pegylation,
phosphopantetheinylation, phosphorylation, prenylation,
propionylation, retinylidene Schiff base formation,
S-glutathionylation, S-nitrosylation, S-sulfenylation, selenation,
succinylation, sulfination, ubiquitination, and C-terminal
amidation. A post-translational modification includes modifications
of the amino terminus and/or the carboxyl terminus of a peptide,
polypeptide, or protein. Modifications of the terminal amino group
include, but are not limited to, des-amino, N-lower alkyl,
N-di-lower alkyl, and N-acyl modifications. Modifications of the
terminal carboxy group include, but are not limited to, amide,
lower alkyl amide, dialkyl amide, and lower alkyl ester
modifications (e.g., wherein lower alkyl is C.sub.1-C.sub.4 alkyl).
A post-translational modification also includes modifications, such
as but not limited to those described above, of amino acids falling
between the amino and carboxy termini of a peptide, polypeptide, or
protein. Post-translational modification can regulate a protein's
"biology" within a cell, e.g., its activity, structure, stability,
or localization. Phosphorylation is the most common
post-translational modification and plays an important role in
regulation of protein, particularly in cell signaling (Prabakaran
et al., 2012, Wiley Interdiscip Rev Syst Biol Med 4: 565-583). The
addition of sugars to proteins, such as glycosylation, has been
shown to promote protein folding, improve stability, and modify
regulatory function. The attachment of lipids to proteins enables
targeting to the cell membrane. A post-translational modification
can also include peptide, polypeptide, or protein modifications to
include one or more detectable labels.
[0409] In certain embodiments, a peptide, polypeptide, or protein
can be fragmented. For example, the fragmented peptide can be
obtained by fragmenting a protein from a sample, such as a
biological sample. The peptide, polypeptide, or protein can be
fragmented by any means known in the art, including fragmentation
by a protease or endopeptidase. In some embodiments, fragmentation
of a peptide, polypeptide, or protein is targeted by use of a
specific protease or endopeptidase. A specific protease or
endopeptidase binds and cleaves at a specific consensus sequence
(e.g., TEV protease which is specific for ENLYFQ\S consensus
sequence). In other embodiments, fragmentation of a peptide,
polypeptide, or protein is non-targeted or random by use of a
non-specific protease or endopeptidase. A non-specific protease may
bind and cleave at a specific amino acid residue rather than a
consensus sequence (e.g., proteinase K is a non-specific serine
protease). Proteinases and endopeptidases are well known in the
art, and examples of such that can be used to cleave a protein or
polypeptide into smaller peptide fragments include proteinase K,
trypsin, chymotrypsin, pepsin, thermolysin, thrombin, Factor Xa,
furin, endopeptidase, papain, pepsin, subtilisin, elastase,
enterokinase, Genenase.TM. I, Endoproteinase LysC, Endoproteinase
AspN, Endoproteinase GluC, etc. (Granvogl et al., 2007, Anal
Bioanal Chem 389: 991-1002). In certain embodiments, a peptide,
polypeptide, or protein is fragmented by proteinase K, or
optionally, a thermolabile version of proteinase K to enable rapid
inactivation. Proteinase K is quite stable in denaturing reagents,
such as urea and SDS, enabling digestion of completely denatured
proteins. Protein and polypeptide fragmentation into peptides can
be performed before or after attachment of a DNA tag or DNA
recording tag.
[0410] Chemical reagents can also be used to digest proteins into
peptide fragments. A chemical reagent may cleave at a specific
amino acid residue (e.g., cyanogen bromide hydrolyzes peptide bonds
at the C-terminus of methionine residues). Chemical reagents for
fragmenting polypeptides or proteins into smaller peptides include
cyanogen bromide (CNBr), hydroxylamine, hydrazine, formic acid,
BNPS-skatole [2-(2-nitrophenylsulfenyl)-3-methylindole],
iodosobenzoic acid, .NTCB+Ni (2-nitro-5-thiocyanobenzoic acid),
etc.
[0411] In certain embodiments, following enzymatic or chemical
cleavage, the resulting peptide fragments are approximately the
same desired length, e.g., from about 10 amino acids to about 70
amino acids, from about 10 amino acids to about 60 amino acids,
from about 10 amino acids to about 50 amino acids, about 10 to
about 40 amino acids, from about 10 to about 30 amino acids, from
about 20 amino acids to about 70 amino acids, from about 20 amino
acids to about 60 amino acids, from about 20 amino acids to about
50 amino acids, about 20 to about 40 amino acids, from about 20 to
about 30 amino acids, from about 30 amino acids to about 70 amino
acids, from about 30 amino acids to about 60 amino acids, from
about 30 amino acids to about 50 amino acids, or from about 30
amino acids to about 40 amino acids. A cleavage reaction may be
monitored, preferably in real time, by spiking the protein or
polypeptide sample with a short test FRET (fluorescence resonance
energy transfer) peptide comprising a peptide sequence containing a
proteinase or endopeptidase cleavage site. In the intact FRET
peptide, a fluorescent group and a quencher group are attached to
either end of the peptide sequence containing the cleavage site,
and fluorescence resonance energy transfer between the quencher and
the fluorophore leads to low fluorescence. Upon cleavage of the
test peptide by a protease or endopeptidase, the quencher and
fluorophore are separated giving a large increase in fluorescence.
A cleavage reaction can be stopped when a certain fluorescence
intensity is achieved, allowing a reproducible cleavage end point
to be achieved.
[0412] A sample of macromolecules (e.g., peptides, polypeptides, or
proteins) can undergo protein fractionation methods prior to
attachment to a solid support, where proteins or peptides are
separated by one or more properties such as cellular location,
molecular weight, hydrophobicity, or isoelectric point, or protein
enrichment methods. Alternatively, or additionally, protein
enrichment methods may be used to select for a specific protein or
peptide (see, e.g., Whiteaker et al., 2007, Anal. Biochem.
362:44-54, incorporated by reference in its entirety) or to select
for a particular post translational modification (see, e.g., Huang
et al., 2014. J. Chromatogr. A 1372:1-17, incorporated by reference
in its entirety). Alternatively, a particular class or classes of
proteins such as immunoglobulins, or immunoglobulin (Ig) isotypes
such as IgG, can be affinity enriched or selected for analysis. In
the case of immunoglobulin molecules, analysis of the sequence and
abundance or frequency of hypervariable sequences involved in
affinity binding are of particular interest, particularly as they
vary in response to disease progression or correlate with healthy,
immune, and/or or disease phenotypes. Overly abundant proteins can
also be subtracted from the sample using standard immunoaffinity
methods. Depletion of abundant proteins can be useful for plasma
samples where over 80% of the protein constituent is albumin and
immunoglobulins. Several commercial products are available for
depletion of plasma samples of overly abundant proteins, such as
PROTIA and PROT20 (Sigma-Aldrich).
[0413] In certain embodiments, the macromolecule is comprised of a
protein or polypeptide. In one embodiment, the protein or
polypeptide is labeled with DNA recording tags through standard
amine coupling chemistries (see, e.g., FIGS. 2B, 2C, 28, 29, 31,
40). The .epsilon.-amino group (e.g., of lysine residues) and the
N-terminal amino group are particularly susceptible to labeling
with amine-reactive coupling agents, depending on the pH of the
reaction (Mendoza and Vachet 2009). In a particular embodiment
(see, e.g., FIG. 2B and FIGS. 29A-29E), the recording tag is
comprised of a reactive moiety (e.g., for conjugation to a solid
surface, a multifunctional linker, or a macromolecule), a linker, a
universal priming sequence, a barcode (e.g., compartment tag,
partition barcode, sample barcode, fraction barcode, or any
combination thereof), an optional UMI, and a spacer (Sp) sequence
for facilitating information transfer to/from a coding tag. In
another embodiment, the protein can be first labeled with a
universal DNA tag, and the barcode-Sp sequence (representing a
sample, a compartment, a physical location on a slide, etc.) are
attached to the protein later through and enzymatic or chemical
coupling step. (see, e.g., FIGS. 20, 30, 31, 40). A universal DNA
tag comprises a short sequence of nucleotides that are used to
label a protein or polypeptide macromolecule and can be used as
point of attachment for a barcode (e.g., compartment tag, recording
tag, etc.). For example, a recording tag may comprise at its
terminus a sequence complementary to the universal DNA tag. In
certain embodiments, a universal DNA tag is a universal priming
sequence. Upon hybridization of the universal DNA tags on the
labeled protein to complementary sequence in recording tags (e.g.,
bound to beads), the annealed universal DNA tag may be extended via
primer extension, transferring the recording tag information to the
DNA tagged protein. In a particular embodiment, the protein is
labeled with a universal DNA tag prior to proteinase digestion into
peptides. The universal DNA tags on the labeled peptides from the
digest can then be converted into an informative and effective
recording tag.
[0414] In certain embodiments, a protein macromolecule can be
immobilized to a solid support by an affinity capture reagent (and
optionally covalently crosslinked), wherein the recording tag is
associated with the affinity capture reagent directly, or
alternatively, the protein can be directly immobilized to the solid
support with a recording tag (see, e.g., FIG. 2C).
V. Solid Support
[0415] Macromolecules of the present disclosure are joined to a
surface of a solid support (also referred to as "substrate
surface"). The solid support can be any porous or non-porous
support surface including, but not limited to, a bead, a microbead,
an array, a glass surface, a silicon surface, a plastic surface, a
filter, a membrane, nylon, a silicon wafer chip, a flow cell, a
flow through chip, a biochip including signal transducing
electronics, a microtiter well, an ELISA plate, a spinning
interferometry disc, a nitrocellulose membrane, a
nitrocellulose-based polymer surface, a nanoparticle, or a
microsphere. Materials for a solid support include but are not
limited to acrylamide, agarose, cellulose, nitrocellulose, glass,
gold, quartz, polystyrene, polyethylene vinyl acetate,
polypropylene, polymethacrylate, polyethylene, polyethylene oxide,
polysilicates, polycarbonates, Teflon, fluorocarbons, nylon,
silicon rubber, polyanhydrides, polyglycolic acid, polyactic acid,
polyorthoesters, functionalized silane, polypropylfumerate,
collagen, glycosaminoglycans, polyamino acids, or any combination
thereof. Solid supports further include thin film, membrane,
bottles, dishes, fibers, woven fibers, shaped polymers such as
tubes, particles, beads, microparticles, or any combination
thereof. For example, when solid surface is a bead, the bead can
include, but is not limited to, a polystyrene bead, a polymer bead,
an agarose bead, an acrylamide bead, a solid core bead, a porous
bead, a paramagnetic bead, glass bead, or a controlled pore
bead.
[0416] In certain embodiments, a solid support is a flow cell. Flow
cell configurations may vary among different next generation
sequencing platforms. For example, the Illumina flow cell is a
planar optically transparent surface similar to a microscope slide,
which contains a lawn of oligonucleotide anchors bound to its
surface. Template DNA, comprise adapters ligated to the ends that
are complimentary to oligonucleotides on the flow cell surface.
Adapted single-stranded DNAs are bound to the flow cell and
amplified by solid-phase "bridge" PCR prior to sequencing. The 454
flow cell (454 Life Sciences) supports a "picotiter" plate, a fiber
optic slide with .about.1.6 million 75-picoliter wells. Each
individual molecule of sheared template DNA is captured on a
separate bead, and each bead is compartmentalized in a private
droplet of aqueous PCR reaction mixture within an oil emulsion.
Template is clonally amplified on the bead surface by PCR, and the
template-loaded beads are then distributed into the wells of the
picotiter plate for the sequencing reaction, ideally with one or
fewer beads per well. SOLiD (Supported Oligonucleotide Ligation and
Detection) instrument from Applied Biosystems, like the 454 system,
amplifies template molecules by emulsion PCR. After a step to cull
beads that do not contain amplified template, bead-bound template
is deposited on the flow cell. A flow cell may also be a simple
filter frit, such as a TWIST.TM. DNA synthesis column (Glen
Research).
[0417] In certain embodiments, a solid support is a bead, which may
refer to an individual bead or a plurality of beads. In some
embodiments, the bead is compatible with a selected next generation
sequencing platform that will be used for downstream analysis
(e.g., SOLiD or 454). In some embodiments, a solid support is an
agarose bead, a paramagnetic bead, a polystyrene bead, a polymer
bead, an acrylamide bead, a solid core bead, a porous bead, a glass
bead, or a controlled pore bead. In further embodiments, a bead may
be coated with a binding functionality (e.g., amine group, affinity
ligand such as streptavidin for binding to biotin labeled
macromolecule, antibody) to facilitate binding to a
macromolecule.
[0418] Proteins, polypeptides, or peptides can be joined to the
solid support, directly or indirectly, by any means known in the
art, including covalent and non-covalent interactions, or any
combination thereof (see, e.g., Chan et al., 2007, PLoS One
2:e1164; Cazalis et al., Bioconj. Chem. 15:1005-1009; Soellner et
al., 2003, J. Am. Chem. Soc. 125:11790-11791; Sun et al., 2006,
Bioconjug. Chem. 17-52-57; Decreau et al., 2007, J. Org. Chem.
72:2794-2802; Camarero et al., 2004, J. Am. Chem. Soc.
126:14730-14731; Girish et al., 2005, Bioorg. Med. Chem. Lett.
15:2447-2451; Kalia et al., 2007, Bioconjug. Chem. 18:1064-1069;
Watzke et al., 2006, Angew Chem. Int. Ed. Engl. 45:1408-1412;
Parthasarathy et al., 2007, Bioconjugate Chem. 18:469-476; and
Bioconjugate Techniques, G. T. Hermanson, Academic Press (2013),
and are each hereby incorporated by reference in their entirety).
For example, the peptide may be joined to the solid support by a
ligation reaction. Alternatively, the solid support can include an
agent or coating to facilitate joining, either direct or
indirectly, the peptide to the solid support. Any suitable molecule
or materials may be employed for this purpose, including proteins,
nucleic acids, carbohydrates and small molecules. For example, in
one embodiment the agent is an affinity molecule. In another
example, the agent is an azide group, which group can react with an
alkynyl group in another molecule to facilitate association or
binding between the solid support and the other molecule.
[0419] Proteins, polypeptides, or peptides can be joined to the
solid support using methods referred to as "click chemistry." For
this purpose any reaction which is rapid and substantially
irreversible can be used to attach proteins, polypeptides, or
peptides to the solid support. Exemplary reactions include the
copper catalyzed reaction of an azide and alkyne to form a triazole
(Huisgen 1,3-dipolar cycloaddition), strain-promoted azide alkyne
cycloaddition (SPAAC), reaction of a diene and dienophile
(Diels-Alder), strain-promoted alkyne-nitrone cycloaddition,
reaction of a strained alkene with an azide, tetrazine or
tetrazole, alkene and azide [3+2] cycloaddition, alkene and
tetrazine inverse electron demand Diels-Alder (IEDDA) reaction
(e.g., m-tetrazine (mTet) and trans-cyclooctene (TCO)), alkene and
tetrazole photoreaction, Staudinger ligation of azides and
phosphines, and various displacement reactions, such as
displacement of a leaving group by nucleophilic attack on an
electrophilic atom (Horisawa 2014, Knall, Hollauf et al. 2014).
Exemplary displacement reactions include reaction of an amine with:
an activated ester; an N-hydroxysuccinimide ester; an isocyanate;
an isothioscyanate or the like.
[0420] In some embodiments the macromolecule and solid support are
joined by a functional group capable of formation by reaction of
two complementary reactive groups, for example a functional group
which is the product of one of the foregoing "click" reactions. In
various embodiments, functional group can be formed by reaction of
an aldehyde, oxime, hydrazone, hydrazide, alkyne, amine, azide,
acylazide, acylhalide, nitrile, nitrone, sulfhydryl, disulfide,
sulfonyl halide, isothiocyanate, imidoester, activated ester (e.g.,
N-hydroxysuccinimide ester, pentynoic acid STP ester), ketone,
.alpha.,.beta.-unsaturated carbonyl, alkene, maleimide,
.alpha.-haloimide, epoxide, aziridine, tetrazine, tetrazole,
phosphine, biotin or thiirane functional group with a complementary
reactive group. An exemplary reaction is a reaction of an amine
(e.g., primary amine) with an N-hydroxysuccinimide ester or
isothiocyanate.
[0421] In yet other embodiments, the functional group comprises an
alkene, ester, amide, thioester, disulfide, carbocyclic,
heterocyclic or heteroaryl group. In further embodiments, the
functional group comprises an alkene, ester, amide, thioester,
thiourea, disulfide, carbocyclic, heterocyclic or heteroaryl group.
In other embodiments, the functional group comprises an amide or
thiourea. In some more specific embodiments, functional group is a
triazolyl functional group, an amide, or thiourea functional
group.
[0422] In a preferred embodiment, iEDDA click chemistry is used for
immobilizing macromolecules (e.g., proteins, polypeptides,
peptides) to a solid support since it is rapid and delivers high
yields at low input concentrations. In another preferred
embodiment, m-tetrazine rather than tetrazine is used in an iEDDA
click chemistry reaction, as m-tetrazine has improved bond
stability.
[0423] In a preferred embodiment, the substrate surface is
functionalized with TCO, and the recording tag-labeled protein,
polypeptide, peptide is immobilized to the TCO coated substrate
surface via an attached m-tetrazine moiety (FIG. 34).
[0424] Proteins, polypeptides, or peptides can be immobilized to a
surface of a solid support by its C-terminus, N-terminus, or an
internal amino acid, for example, via an amine, carboxyl, or
sulfydryl group. Standard activated supports used in coupling to
amine groups include CNBr-activated, NHS-activated,
aldehyde-activated, azlactone-activated, and CDI-activated
supports. Standard activated supports used in carboxyl coupling
include carbodiimide-activated carboxyl moieties coupling to amine
supports. Cysteine coupling can employ maleimide, idoacetyl, and
pyridyl disulfide activated supports. An alternative mode of
peptide carboxy terminal immobilization uses anhydrotrypsin, a
catalytically inert derivative of trypsin that binds peptides
containing lysine or arginine residues at their C-termini without
cleaving them.
[0425] In certain embodiments, a protein, polypeptide, or peptide
is immobilized to a solid support via covalent attachment of a
solid surface bound linker to a lysine group of the protein,
polypeptide, or peptide.
[0426] Recording tags can be attached to the protein, polypeptide,
or peptides pre- or post-immobilization to the solid support. For
example, proteins, polypeptides, or peptides can be first labeled
with recording tags and then immobilized to a solid surface via a
recording tag comprising at two functional moieties for coupling
(see, FIGS. 28A-28D). One functional moiety of the recording tag
couples to the protein, and the other functional moiety immobilizes
the recording tag-labeled protein to a solid support.
[0427] Alternatively, proteins, polypeptides, or peptides are
immobilized to a solid support prior to labeling of the proteins,
polypeptides or peptides with recording tags. For example, proteins
can first be derivitized with reactive groups such as click
chemistry moieties. The activated protein molecules can then be
attached to a suitable solid support and then labeled with
recording tags using the complementary click chemistry moiety. As
an example, proteins derivatized with alkyne and mTet moieties may
be immobilized to beads derivatized with azide and TCO and attached
to recording tags labeled with azide and TCO.
[0428] It is understood that the methods provided herein for
attaching macromolecules (e.g., proteins, polypeptides, or
peptides) to the solid support may also be used to attach recording
tags to the solid support or attach recording tags to
macromolecules (e.g., proteins polypeptides, or peptides).
[0429] In certain embodiments, the surface of a solid support is
passivated (blocked) to minimize non-specific absorption to binding
agents. A "passivated" surface refers to a surface that has been
treated with outer layer of material to minimize non-specific
binding of a binding agent. Methods of passivating surfaces include
standard methods from the fluorescent single molecule analysis
literature, including passivating surfaces with polymer like
polyethylene glycol (PEG) (Pan et al., 2015, Phys. Biol.
12:045006), polysiloxane (e.g., Pluronic F-127), star polymers
(e.g., star PEG) (Groll et al., 2010, Methods Enzymol. 472:1-18),
hydrophobic dichlorodimethylsilane (DDS)+self-assembled Tween-20
(Hua et al., 2014, Nat. Methods 11:1233-1236), and diamond-like
carbon (DLC), DLC+PEG (Stavis et al., 2011, Proc. Natl. Acad. Sci.
USA 108:983-988). In addition to covalent surface modifications, a
number of passivating agents can be employed as well including
surfactants like Tween-20, polysiloxane in solution (Pluronic
series), poly vinyl alcohol, (PVA), and proteins like BSA and
casein. Alternatively, density of proteins, polypeptide, or
peptides can be titrated on the surface or within the volume of a
solid substrate by spiking a competitor or "dummy" reactive
molecule when immobilizing the proteins, polypeptides or peptides
to the solid substrate (see, FIG. 36A).
[0430] In certain embodiments where multiple macromolecules are
immobilized on the same solid support, the macromolecules can be
spaced appropriately to reduce the occurrence of or prevent a
cross-binding or inter-molecular event, e.g., where a binding agent
binds to a first macromolecule and its coding tag information is
transferred to a recording tag associated with a neighboring
macromolecule rather than the recording tag associated with the
first macromolecule. To control macromolecule (e.g., protein,
polypeptide, or peptide spacing) spacing on the solid support, the
density of functional coupling groups (e.g., TCO) may be titrated
on the substrate surface (see, FIG. 34). In some embodiments,
multiple macromolecules are spaced apart on the surface or within
the volume (e.g., porous supports) of a solid support at a distance
of about 50 nm to about 500 nm, or about 50 nm to about 400 nm, or
about 50 nm to about 300 nm, or about 50 nm to about 200 nm, or
about 50 nm to about 100 nm. In some embodiments, multiple
macromolecules are spaced apart on the surface of a solid support
with an average distance of at least 50 nm, at least 60 nm, at
least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at
least 150 nm, at least 200 nm, at least 250 nm, at least 300 nm, at
least 350 nm, at least 400 nm, at least 450 nm, or at least 500 nm.
In some embodiments, multiple macromolecules are spaced apart on
the surface of a solid support with an average distance of at least
50 nm. In some embodiments, macromolecules are spaced apart on the
surface or within the volume of a solid support such that,
empirically, the relative frequency of inter- to intra-molecular
events is <1:10; <1:100; <1:1,000; or <1:10,000. A
suitable spacing frequency can be determined empirically using a
functional assay (see, Example 23), and can be accomplished by
dilution and/or by spiking a "dummy" spacer molecule that competes
for attachments sites on the substrate surface.
[0431] For example, as shown in FIG. 34A, PEG-5000 (MW.about.5000)
is used to block the interstitial space between peptides on the
substrate surface (e.g., bead surface). In addition, the peptide is
coupled to a functional moiety that is also attached to a PEG-5000
molecule. In a preferred embodiment, this is accomplished by
coupling a mixture of NHS-PEG-5000-TCO+NHS-PEG-5000-Methyl to
amine-derivatized beads (see FIG. 34A). The stoichiometric ratio
between the two PEGs (TCO vs. methyl) is titrated to generate an
appropriate density of functional coupling moieties (TCO groups) on
the substrate surface; the methyl-PEG is inert to coupling. The
effective spacing between TCO groups can be calculated by measuring
the density of TCO groups on the surface. In certain embodiments,
the mean spacing between coupling moieties (e.g., TCO) on the solid
surface is at least 50 nm, at least 100 nm, at least 250 nm, or at
least 500 nm. After PEG5000-TCO/methyl derivatized of the beads,
the excess NH.sub.2 groups on the surface are quenched with a
reactive anhydride (e.g. acetic or succinic anhydride).
VI. Recording Tags
[0432] At least one recording tag is associated or co-localized
directly or indirectly with the macromolecule and joined to the
solid support (see, e.g., FIGS. 5A-5B). A recording tag may
comprise DNA, RNA, PNA, .gamma.PNA, GNA, BNA, XNA, TNA,
polynucleotide analogs, or a combination thereof. A recording tag
may be single stranded, or partially or completely double stranded.
A recording tag may have a blunt end or overhanging end. In certain
embodiments, upon binding of a binding agent to a macromolecule,
identifying information of the binding agent's coding tag is
transferred to the recording tag to generate an extended recording
tag. Further extensions to the extended recording tag can be made
in subsequent binding cycles.
[0433] A recording tag can be joined to the solid support, directly
or indirectly (e.g., via a linker), by any means known in the art,
including covalent and non-covalent interactions, or any
combination thereof. For example, the recording tag may be joined
to the solid support by a ligation reaction. Alternatively, the
solid support can include an agent or coating to facilitate
joining, either direct or indirectly, of the recording tag, to the
solid support. Strategies for immobilizing nucleic acid molecules
to solid supports (e.g., beads) have been described in U.S. Pat.
No. 5,900,481; Steinberg et al. (2004, Biopolymers 73:597-605);
Lund et al., 1988 (Nucleic Acids Res. 16: 10861-10880); and
Steinberg et al. (2004, Biopolymers 73:597-605), each of which is
incorporated herein by reference in its entirety.
[0434] In certain embodiments, the co-localization of a
macromolecule (e.g., peptide) and associated recording tag is
achieved by conjugating macromolecule and recording tag to a
bifunctional linker attached directly to the solid support surface
Steinberg et al. (2004, Biopolymers 73:597-605). In further
embodiments, a trifunctional moiety is used to derivitize the solid
support (e.g., beads), and the resulting bifunctional moiety is
coupled to both the macromolecule and recording tag.
[0435] Methods and reagents (e.g., click chemistry reagents and
photoaffinity labelling reagents) such as those described for
attachment of macromolecules and solid supports, may also be used
for attachment of recording tags.
[0436] In a particular embodiment, a single recording tag is
attached to a macromolecule (e.g., peptide), preferably via the
attachment to a de-blocked N- or C-terminal amino acid. In another
embodiment, multiple recording tags are attached to the
macromolecule (e.g., protein, polypeptide, or peptide), preferably
to the lysine residues or peptide backbone. In some embodiments, a
macromolecule (e.g., protein or polypeptide) labeled with multiple
recording tags is fragmented or digested into smaller peptides,
with each peptide labeled on average with one recording tag.
[0437] In certain embodiments, a recording tag comprises an
optional, unique molecular identifier (UMI), which provides a
unique identifier tag for each macromolecule (e.g., protein,
polypeptide, peptide) to which the UMI is associated with. A UMI
can be about 3 to about 40 bases, about 3 to about 30 bases, about
3 to about 20 bases, or about 3 to about 10 bases, or about 3 to
about 8 bases. In some embodiments, a UMI is about 3 bases, 4
bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases, 10 bases, 11
bases, 12 bases, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases,
18 bases, 19 bases, 20 bases, 25 bases, 30 bases, 35 bases, or 40
bases in length. A UMI can be used to de-convolute sequencing data
from a plurality of extended recording tags to identify sequence
reads from individual macromolecules. In some embodiments, within a
library of macromolecules, each macromolecule is associated with a
single recording tag, with each recording tag comprising a unique
UMI. In other embodiments, multiple copies of a recording tag are
associated with a single macromolecule, with each copy of the
recording tag comprising the same UMI. In some embodiments, a UMI
has a different base sequence than the spacer or encoder sequences
within the binding agents' coding tags to facilitate distinguishing
these components during sequence analysis.
[0438] In certain embodiments, a recording tag comprises a barcode,
e.g., other than the UMI if present. A barcode is a nucleic acid
molecule of about 3 to about 30 bases, about 3 to about 25 bases,
about 3 to about 20 bases, about 3 to about 10 bases, about 3 to
about 10 bases, about 3 to about 8 bases in length. In some
embodiments, a barcode is about 3 bases, 4 bases, 5 bases, 6 bases,
7 bases, 8 bases, 9 bases, 10 bases, 11 bases, 12 bases, 13 bases,
14 bases, 15 bases, 20 bases, 25 bases, or 30 bases in length. In
one embodiment, a barcode allows for multiplex sequencing of a
plurality of samples or libraries. A barcode may be used to
identify a partition, a fraction, a compartment, a sample, a
spatial location, or library from which the macromolecule (e.g.,
peptide) derived. Barcodes can be used to de-convolute multiplexed
sequence data and identify sequence reads from an individual sample
or library. For example, a barcoded bead is useful for methods
involving emulsions and partitioning of samples, e.g., for purposes
of partitioning the proteome.
[0439] A barcode can represent a compartment tag in which a
compartment, such as a droplet, microwell, physical region on a
solid support, etc. is assigned a unique barcode. The association
of a compartment with a specific barcode can be achieved in any
number of ways such as by encapsulating a single barcoded bead in a
compartment, e.g., by direct merging or adding a barcoded droplet
to a compartment, by directly printing or injecting a barcode
reagents to a compartment, etc. The barcode reagents within a
compartment are used to add compartment-specific barcodes to the
macromolecule or fragments thereof within the compartment. Applied
to protein partitioning into compartments, the barcodes can be used
to map analysed peptides back to their originating protein
molecules in the compartment. This can greatly facilitate protein
identification. Compartment barcodes can also be used to identify
protein complexes.
[0440] In other embodiments, multiple compartments that represent a
subset of a population of compartments may be assigned a unique
barcode representing the subset.
[0441] Alternatively, a barcode may be a sample identifying
barcode. A sample barcode is useful in the multiplexed analysis of
a set of samples in a single reaction vessel or immobilized to a
single solid substrate or collection of solid substrates (e.g., a
planar slide, population of beads contained in a single tube or
vessel, etc.). Macromolecules from many different samples can be
labeled with recording tags with sample-specific barcodes, and then
all the samples pooled together prior to immobilization to a solid
support, cyclic binding, and recording tag analysis. Alternatively,
the samples can be kept separate until after creation of a
DNA-encoded library, and sample barcodes attached during PCR
amplification of the DNA-encoded library, and then mixed together
prior to sequencing. This approach could be useful when assaying
analytes (e.g., proteins) of different abundance classes. For
example, the sample can be split and barcoded, and one portion
processed using binding agents to low abundance analytes, and the
other portion processed using binding agents to higher abundance
analytes. In a particular embodiment, this approach helps to adjust
the dynamic range of a particular protein analyte assay to lie
within the "sweet spot" of standard expression levels of the
protein analyte.
[0442] In certain embodiments, peptides, polypeptides, or proteins
from multiple different samples are labeled with recording tags
containing sample-specific barcodes. The multi-sample barcoded
peptides, polypeptides, or proteins can be mixed together prior to
a cyclic binding reaction. In this way, a highly-multiplexed
alternative to a digital reverse phase protein array (RPPA) is
effectively created (Guo, Liu et al. 2012, Assadi, Lamerz et al.
2013, Akbani, Becker et al. 2014, Creighton and Huang 2015). The
creation of a digital RPPA-like assay has numerous applications in
translational research, biomarker validation, drug discovery,
clinical, and precision medicine.
[0443] In certain embodiments, a recording tag comprises a
universal priming site, e.g., a forward or 5' universal priming
site. A universal priming site is a nucleic acid sequence that may
be used for priming a library amplification reaction and/or for
sequencing. A universal priming site may include, but is not
limited to, a priming site for PCR amplification, flow cell adaptor
sequences that anneal to complementary oligonucleotides on flow
cell surfaces (e.g., Illumina next generation sequencing), a
sequencing priming site, or a combination thereof. A universal
priming site can be about 10 bases to about 60 bases. In some
embodiments, a universal priming site comprises an Illumina P5
primer (5'-AATGATACGGCGACCACCGA-3'--SEQ ID NO:133) or an Illumina
P7 primer (5'-CAAGCAGAAGACGGCATACGAGAT-3'-SEQ ID NO:134).
[0444] In certain embodiments, a recording tag comprises a spacer
at its terminus, e.g., 3' end. As used herein reference to a spacer
sequence in the context of a recording tag includes a spacer
sequence that is identical to the spacer sequence associated with
its cognate binding agent, or a spacer sequence that is
complementary to the spacer sequence associated with its cognate
binding agent. The terminal, e.g., 3', spacer on the recording tag
permits transfer of identifying information of a cognate binding
agent from its coding tag to the recording tag during the first
binding cycle (e.g., via annealing of complementary spacer
sequences for primer extension or sticky end ligation).
[0445] In one embodiment, the spacer sequence is about 1-20 bases
in length, about 2-12 bases in length, or 5-10 bases in length. The
length of the spacer may depend on factors such as the temperature
and reaction conditions of the primer extension reaction for
transferring coding tag information to the recording tag.
[0446] In a preferred embodiment, the spacer sequence in the
recording is designed to have minimal complementarity to other
regions in the recording tag; likewise the spacer sequence in the
coding tag should have minimal complementarity to other regions in
the coding tag. In other words, the spacer sequence of the
recording tags and coding tags should have minimal sequence
complementarity to components such unique molecular identifiers,
barcodes (e.g., compartment, partition, sample, spatial location),
universal primer sequences, encoder sequences, cycle specific
sequences, etc. present in the recording tags or coding tags.
[0447] As described for the binding agent spacers, in some
embodiments, the recording tags associated with a library of
macromolecules share a common spacer sequence. In other
embodiments, the recording tags associated with a library of
macromolecules have binding cycle specific spacer sequences that
are complementary to the binding cycle specific spacer sequences of
their cognate binding agents, which can be useful when using
non-concatenated extended recording tags (see (FIGS. 10A-10C)).
[0448] The collection of extended recording tags can be
concatenated after the fact (see, e.g., (FIGS. 10A-10C)). After the
binding cycles are complete, the bead solid supports, each bead
comprising on average one or fewer than one macromolecule per bead,
each macromolecule having a collection of extended recording tags
that are co-localized at the site of the macromolecule, are placed
in an emulsion. The emulsion is formed such that each droplet, on
average, is occupied by at most 1 bead. An optional assembly PCR
reaction is performed in-emulsion to amplify the extended recording
tags co-localized with the macromolecule on the bead and assemble
them in co-linear order by priming between the different cycle
specific sequences on the separate extended recording tags (Xiong,
Peng et al. 2008). Afterwards the emulsion is broken and the
assembled extended recording tags are sequenced.
[0449] In another embodiment, the DNA recording tag is comprised of
a universal priming sequence (U1), one or more barcode sequences
(BC.sub.S), and a spacer sequence (Sp1) specific to the first
binding cycle. In the first binding cycle, binding agents employ
DNA coding tags comprised of an Sp1 complementary spacer, an
encoder barcode, and optional cycle barcode, and a second spacer
element (Sp2). The utility of using at least two different spacer
elements is that the first binding cycle selects one of potentially
several DNA recording tags and a single DNA recording tag is
extended resulting in a new Sp2 spacer element at the end of the
extended DNA recording tag. In the second and subsequent binding
cycles, binding agents contain just the Sp2' spacer rather than
Sp1'. In this way, only the single extended recording tag from the
first cycle is extended in subsequent cycles. In another
embodiment, the second and subsequent cycles can employ binding
agent specific spacers.
[0450] In some embodiments, a recording tag comprises from 5' to 3'
direction: a universal forward (or 5') priming sequence, a UMI, and
a spacer sequence. In some embodiments, a recording tag comprises
from 5' to 3' direction: a universal forward (or 5') priming
sequence, an optional UMI, a barcode (e.g., sample barcode,
partition barcode, compartment barcode, spatial barcode, or any
combination thereof), and a spacer sequence. In some other
embodiments, a recording tag comprises from 5' to 3' direction: a
universal forward (or 5') priming sequence, a barcode (e.g., sample
barcode, partition barcode, compartment barcode, spatial barcode,
or any combination thereof), an optional UMI, and a spacer
sequence.
[0451] Combinatorial approaches may be used to generate UMIs from
modified DNA and PNAs. In one example, a UMI may be constructed by
"chemical ligating" together sets of short word sequences
(4-15mers), which have been designed to be orthogonal to each other
(Spiropulos and Heemstra 2012). A DNA template is used to direct
the chemical ligation of the "word" polymers. The DNA template is
constructed with hybridizing arms that enable assembly of a
combinatorial template structure simply by mixing the
sub-components together in solution (see, FIG. 12C). In certain
embodiments, there are no "spacer" sequences in this design. The
size of the word space can vary from 10's of words to 10,000's or
more words. In certain embodiments, the words are chosen such that
they differ from one another to not cross hybridize, yet possess
relatively uniform hybridization conditions. In one embodiment, the
length of the word will be on the order of 10 bases, with about
1000's words in the subset (this is only 0.1% of the total 10-mer
word space .about.4.sup.10=1 million words). Sets of these words
(1000 in subset) can be concatenated together to generate a final
combinatorial UMI with complexity=1000.sup.n power. For 4 words
concatenated together, this creates a UMI diversity of 10.sup.12
different elements. These UMI sequences will be appended to the
macromolecule (peptides, proteins, etc.) at the single molecule
level. In one embodiment, the diversity of UMIs exceeds the number
of molecules of macromolecules to which the UMIs are attached. In
this way, the UMI uniquely identifies the macromolecule of
interest. The use of combinatorial word UMI's facilitates readout
on high error rate sequencers, (e.g. nanopore sequencers, nanogap
tunneling sequencing, etc.) since single base resolution is not
required to read words of multiple bases in length. Combinatorial
word approaches can also be used to generate other
identity-informative components of recording tags or coding tags,
such as compartment tags, partition barcodes, spatial barcodes,
sample barcodes, encoder sequences, cycle specific sequences, and
barcodes. Methods relating to nanopore sequencing and DNA encoding
information with error-tolerant words (codes) are known in the art
(see, e.g., Kiah et al., 2015, Codes for DNA sequence profiles.
IEEE International Symposium on Information Theory (ISIT); Gabrys
et al., 2015, Asymmetric Lee distance codes for DNA-based storage.
IEEE Symposium on Information Theory (ISIT); Laure et al., 2016,
Coding in 2D: Using Intentional Dispersity to Enhance the
Information Capacity of Sequence-Coded Polymer Barcodes. Angew.
Chem. Int. Ed. doi:10.1002/anie.201605279; Yazdi et al., 2015, IEEE
Transactions on Molecular, Biological and Multi-Scale
Communications 1:230-248; and Yazdi et al., 2015, Sci Rep 5:14138,
each of which is incorporated by reference in its entirety). Thus,
in certain embodiments, an extended recording tag, an extended
coding tag, or a di-tag construct in any of the embodiments
described herein is comprised of identifying components (e.g., UMI,
encoder sequence, barcode, compartment tag, cycle specific
sequence, etc.) that are error correcting codes. In some
embodiments, the error correcting code is selected from: Hamming
code, Lee distance code, asymmetric Lee distance code, Reed-Solomon
code, and Levenshtein-Tenengolts code. For nanopore sequencing, the
current or ionic flux profiles and asymmetric base calling errors
are intrinsic to the type of nanopore and biochemistry employed,
and this information can be used to design more robust DNA codes
using the aforementioned error correcting approaches. An
alternative to employing robust DNA nanopore sequencing barcodes,
one can directly use the current or ionic flux signatures of
barcode sequences (U.S. Pat. No. 7,060,507, incorporated by
reference in its entirety), avoiding DNA base calling entirely, and
immediately identify the barcode sequence by mapping back to the
predicted current/flux signature as described by Laszlo et al.
(2014, Nat. Biotechnol. 32:829-833, incorporated by reference in
its entirety). In this paper, Laszlo et al. describe the current
signatures generated by the biological nanopore, MspA, when passing
different word strings through the nanopore, and the ability to map
and identify DNA strands by mapping resultant current signatures
back to an in silico prediction of possible current signatures from
a universe of sequences (2014, Nat. Biotechnol. 32:829-833).
Similar concepts can be applied to DNA codes and the electrical
signal generated by nanogap tunneling current-based DNA sequencing
(Ohshiro et al., 2012, Sci Rep 2: 501).
[0452] Thus, in certain embodiments, the identifying components of
a coding tag, recording tag, or both are capable of generating a
unique current or ionic flux or optical signature, wherein the
analysis step of any of the methods provided herein comprises
detection of the unique current or ionic flux or optical signature
in order to identify the identifying components. In some
embodiments, the identifying components are selected from an
encoder sequence, barcode, UMI, compartment tag, cycle specific
sequence, or any combination thereof.
[0453] In certain embodiments, all or substantially amount of the
macromolecules (e.g., proteins, polypeptides, or peptides) (e.g.,
at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, 99%, or 100%) within a sample are labeled with a
recording tag. Labeling of the macromolecules may occur before or
after immobilization of the macromolecules to a solid support.
[0454] In other embodiments, a subset of macromolecules (e.g.,
proteins, polypeptides, or peptides) within a sample are labeled
with recording tags. In a particular embodiment, a subset of
macromolecules from a sample undergo targeted (analyte specific)
labeling with recording tags. Targeted recording tag labeling of
proteins may be achieved using target protein-specific binding
agents (e.g., antibodies, aptamers, etc.) that are linked a short
target-specific DNA capture probe, e.g., analyte-specific barcode,
which anneal to complementary target-specific bait sequence, e.g.,
analyte-specific barcode, in recording tags (see, FIG. 28A). The
recording tags comprise a reactive moiety for a cognate reactive
moiety present on the target protein (e.g., click chemistry
labeling, photoaffinity labeling). For example, recording tags may
comprise an azide moiety for interacting with alkyne-derivatized
proteins, or recording tags may comprise a benzophenone for
interacting with native proteins, etc. (see FIGS. 28A-B). Upon
binding of the target protein by the target protein specific
binding agent, the recording tag and target protein are coupled via
their corresponding reactive moieties (see, FIG. 28B-C). After the
target protein is labeled with the recording tag, the
target-protein specific binding agent may be removed by digestion
of the DNA capture probe linked to the target-protein specific
binding agent. For example, the DNA capture probe may be designed
to contain uracil bases, which are then targeted for digestion with
a uracil-specific excision reagent (e.g., USER.TM.), and the
target-protein specific binding agent may be dissociated from the
target protein.
[0455] In one example, antibodies specific for a set of target
proteins can be labeled with a DNA capture probe (e.g., analyte
barcode BC.sub.A in FIG. 28A that hybridizes with recording tags
designed with complementary bait sequence (e.g., analyte barcode
BC.sub.A' in FIG. 28A). Sample-specific labeling of proteins can be
achieved by employing DNA-capture probe labeled antibodies
hybridizing with complementary bait sequence on recording tags
comprising of sample-specific barcodes.
[0456] In another example, target protein-specific aptamers are
used for targeted recording tag labeling of a subset of proteins
within a sample. A target specific-aptamer is linked to a DNA
capture probe that anneals with complementary bait sequence in a
recording tag. The recording tag comprises a reactive chemical or
photo-reactive chemical probes (e.g. benzophenone (BP)) for
coupling to the target protein having a corresponding reactive
moiety. The aptamer binds to its target protein molecule, bringing
the recording tag into close proximity to the target protein,
resulting in the coupling of the recording tag to the target
protein.
[0457] Photoaffinity (PA) protein labeling using photo-reactive
chemical probes attached to small molecule protein affinity ligands
has been previously described (Park, Koh et al. 2016). Typical
photo-reactive chemical probes include probes based on benzophenone
(reactive diradical, 365 nm), phenyldiazirine (reactive carbon, 365
nm), and phenylazide (reactive nitrene free radical, 260 nm),
activated under irradiation wavelengths as previously described
(Smith and Collins 2015). In a preferred embodiment, target
proteins within a protein sample are labeled with recording tags
comprising sample barcodes using the method disclosed by Li et al.
in which a bait sequence in a benzophenone labeled recording tag is
hybridized to a DNA capture probe attached to a cognate binding
agent (e.g., nucleic acid aptamer (see (FIGS. 28A-28D)) (Li, Liu et
al. 2013). For photoaffinity labeled protein targets, the use of
DNA/RNA aptamers as target protein-specific binding agents are
preferred over antibodies since the photoaffinity moiety can
self-label the antibody rather than the target protein. In
contrast, photoaffinity labeling is less efficient for nucleic
acids than proteins, making aptamers a better vehicle for
DNA-directed chemical or photo-labeling. Similar to photo-affinity
labeling, one can also employ DNA-directed chemical labeling of
reactive lysine's (or other moieties) in the proximity of the
aptamer binding site in a manner similar to that described by Rosen
et al. (Rosen, Kodal et al. 2014, Kodal, Rosen et al. 2016).
[0458] In the aforementioned embodiments, other types of linkages
besides hybridization can be used to link the target specific
binding agent and the recording tag (see, FIG. 28A). For example,
the two moieties can be covalently linked, using a linker that is
designed to be cleaved and release the binding agent once the
captured target protein (or other macromolecule) is covalently
linked to the recording tag as shown in FIG. 28B. A suitable linker
can be attached to various positions of the recording tag, such as
the 3' end, or within the linker attached to the 5' end of the
recording tag.
VII. Binding Agents and Coding Tags
[0459] The methods described herein use a binding agent capable of
binding to the macromolecule. A binding agent can be any molecule
(e.g., peptide, polypeptide, protein, nucleic acid, carbohydrate,
small molecule, and the like) capable of binding to a component or
feature of a macromolecule. A binding agent can be a naturally
occurring, synthetically produced, or recombinantly expressed
molecule. A binding agent may bind to a single monomer or subunit
of a macromolecule (e.g., a single amino acid of a peptide) or bind
to multiple linked subunits of a macromolecule (e.g., dipeptide,
tripeptide, or higher order peptide of a longer peptide
molecule).
[0460] In certain embodiments, a binding agent may be designed to
bind covalently. Covalent binding can be designed to be conditional
or favored upon binding to the correct moiety. For example, an NTAA
and its cognate NTAA-specific binding agent may each be modified
with a reactive group such that once the NTAA-specific binding
agent is bound to the cognate NTAA, a coupling reaction is carried
out to create a covalent linkage between the two. Non-specific
binding of the binding agent to other locations that lack the
cognate reactive group would not result in covalent attachment.
Covalent binding between a binding agent and its target allows for
more stringent washing to be used to remove binding agents that are
non-specifically bound, thus increasing the specificity of the
assay.
[0461] In certain embodiments, a binding agent may be a selective
binding agent. As used herein, selective binding refers to the
ability of the binding agent to preferentially bind to a specific
ligand (e.g., amino acid or class of amino acids) relative to
binding to a different ligand (e.g., amino acid or class of amino
acids). Selectivity is commonly referred to as the equilibrium
constant for the reaction of displacement of one ligand by another
ligand in a complex with a binding agent. Typically, such
selectivity is associated with the spatial geometry of the ligand
and/or the manner and degree by which the ligand binds to a binding
agent, such as by hydrogen bonding or Van der Waals forces
(non-covalent interactions) or by reversible or non-reversible
covalent attachment to the binding agent. It should also be
understood that selectivity may be relative, and as opposed to
absolute, and that different factors can affect the same, including
ligand concentration. Thus, in one example, a binding agent
selectively binds one of the twenty standard amino acids. In an
example of non-selective binding, a binding agent may bind to two
or more of the twenty standard amino acids.
[0462] In the practice of the methods disclosed herein, the ability
of a binding agent to selectively bind a feature or component of a
macromolecule need only be sufficient to allow transfer of its
coding tag information to the recording tag associated with the
macromolecule, transfer of the recording tag information to the
coding tag, or transferring of the coding tag information and
recording tag information to a di-tag molecule. Thus, selectively
need only be relative to the other binding agents to which the
macromolecule is exposed. It should also be understood that
selectivity of a binding agent need not be absolute to a specific
amino acid, but could be selective to a class of amino acids, such
as amino acids with nonpolar or non-polar side chains, or with
electrically (positively or negatively) charged side chains, or
with aromatic side chains, or some specific class or size of side
chains, and the like.
[0463] In a particular embodiment, the binding agent has a high
affinity and high selectivity for the macromolecule of interest. In
particular, a high binding affinity with a low off-rate is
efficacious for information transfer between the coding tag and
recording tag. In certain embodiments, a binding agent has a Kd of
<10 nM, <5 nM, <1 nM, <0.5 nM, or <0.1 nM. In a
particular embodiment, the binding agent is added to the
macromolecule at a concentration >10.times., >100.times., or
>1000.times. its Kd to drive binding to completion. A detailed
discussion of binding kinetics of an antibody to a single protein
molecule is described in Chang et al. (Chang, Rissin et al.
2012).
[0464] To increase the affinity of a binding agent to small
N-terminal amino acids (NTAAs) of peptides, the NTAA may be
modified with an "immunogenic" hapten, such as dinitrophenol (DNP).
This can be implemented in a cyclic sequencing approach using
Sanger's reagent, dinitrofluorobenzene (DNFB), which attaches a DNP
group to the amine group of the NTAA. Commercial anti-DNP
antibodies have affinities in the low nM range (.about.8 nM,
LO-DNP-2) (Bilgicer, Thomas et al. 2009); as such it stands to
reason that it should be possible to engineer high-affinity NTAA
binding agents to a number of NTAAs modified with DNP (via DNFB)
and simultaneously achieve good binding selectivity for a
particular NTAA. In another example, an NTAA may be modified with
sulfonyl nitrophenol (SNP) using 4-sulfonyl-2-nitrofluorobenzene
(SNFB). Similar affinity enhancements may also be achieved with
alternative NTAA modifiers, such as an acetyl group or an amidinyl
(guanidinyl) group.
[0465] In certain embodiments, a binding agent may bind to an NTAA,
a CTAA, an intervening amino acid, dipeptide (sequence of two amino
acids), tripeptide (sequence of three amino acids), or higher order
peptide of a peptide molecule. In some embodiments, each binding
agent in a library of binding agents selectively binds to a
particular amino acid, for example one of the twenty standard
naturally occurring amino acids. The standard, naturally-occurring
amino acids include Alanine (A or Ala), Cysteine (C or Cys),
Aspartic Acid (D or Asp), Glutamic Acid (E or Glu), Phenylalanine
(F or Phe), Glycine (G or Gly), Histidine (H or His), Isoleucine (I
or Ile), Lysine (K or Lys), Leucine (L or Leu), Methionine (M or
Met), Asparagine (N or Asn), Proline (P or Pro), Glutamine (Q or
Gln), Arginine (R or Arg), Serine (S or Ser), Threonine (T or Thr),
Valine (V or Val), Tryptophan (W or Trp), and Tyrosine (Y or
Tyr).
[0466] In certain embodiments, a binding agent may bind to a
post-translational modification of an amino acid. In some
embodiments, a peptide comprises one or more post-translational
modifications, which may be the same of different. The NTAA, CTAA,
an intervening amino acid, or a combination thereof of a peptide
may be post-translationally modified. Post-translational
modifications to amino acids include acylation, acetylation,
alkylation (including methylation), biotinylation, butyrylation,
carbamylation, carbonylation, deamidation, deiminiation,
diphthamide formation, disulfide bridge formation, eliminylation,
flavin attachment, formylation, gamma-carboxylation, glutamylation,
glycylation, glycosylation, glypiation, heme C attachment,
hydroxylation, hypusine formation, iodination, isoprenylation,
lipidation, lipoylation, malonylation, methylation,
myristolylation, oxidation, palmitoylation, pegylation,
phosphopantetheinylation, phosphorylation, prenylation,
propionylation, retinylidene Schiff base formation,
S-glutathionylation, S-nitrosylation, S-sulfenylation, selenation,
succinylation, sulfination, ubiquitination, and C-terminal
amidation (see, also, Seo and Lee, 2004, J. Biochem. Mol. Biol.
37:35-44).
[0467] In certain embodiments, a lectin is used as a binding agent
for detecting the glycosylation state of a protein, polypeptide, or
peptide. Lectins are carbohydrate-binding proteins that can
selectively recognize glycan epitopes of free carbohydrates or
glycoproteins. A list of lectins recognizing various glycosylation
states (e.g., core-fucose, sialic acids, N-acetyl-D-lactosamine,
mannose, N-acetyl-glucosamine) include: A, AAA, AAL, ABA, ACA, ACG,
ACL, AOL, ASA, BanLec, BC2L-A, BC2LCN, BPA, BPL, Calsepa, CGL2,
CNL, Con, ConA, DBA, Discoidin, DSA, ECA, EEL, F17AG, Gal1, Gal1-S,
Gal2, Gal3, Gal3C-S, Gal7-S, Gal9, GNA, GRFT, GS-I, GS-II, GSL-I,
GSL-II, HHL, HIHA, HPA, I, II, Jacalin, LBA, LCA, LEA, LEL, Lentil,
Lotus, LSL-N, LTL, MAA, MAH, MAL_I, Malectin, MOA, MPA, MPL, NPA,
Orysata, PA-HL, PA-IL, PALa, PHA-E, PHA-L, PHA-P, PHAE, PHAL, PNA,
PPL, PSA, PSL1a, PTL, PTL-I, PWM, RCA120, RS-Fuc, SAMB, SBA, SJA,
SNA, SNA-I, SNA-II, SSA, STL, TJA-I, TJA-II, TxLCI, UDA, UEA-I,
UEA-II, VFA, VVA, WFA, WGA (see, Zhang et al., 2016, MABS
8:524-535).
[0468] In certain embodiments, a binding agent may bind to a
modified or labeled NTAA. A modified or labeled NTAA can be one
that is labeled with PITC, 1-fluoro-2,4-dinitrobenzene (Sanger's
reagent, DNFB), dansyl chloride (DNS-Cl, or
1-dimethylaminonaphthalene-5-sulfonyl chloride),
4-sulfonyl-2-nitrofluorobenzene (SNFB), an acetylating reagent, a
guanidination reagent, a thioacylation reagent, a thioacetylation
reagent, or a thiobenzylation reagent.
[0469] In certain embodiments, a binding agent can be an aptamer
(e.g., peptide aptamer, DNA aptamer, or RNA aptamer), an antibody,
an anticalin, an ATP-dependent Clp protease adaptor protein (ClpS),
an antibody binding fragment, an antibody mimetic, a peptide, a
peptidomimetic, a protein, or a polynucleotide (e.g., DNA, RNA,
peptide nucleic acid (PNA), a .gamma.PNA, bridged nucleic acid
(BNA), xeno nucleic acid (XNA), glycerol nucleic acid (GNA), or
threose nucleic acid (TNA), or a variant thereof).
[0470] As used herein, the terms antibody and antibodies are used
in a broad sense, to include not only intact antibody molecules,
for example but not limited to immunoglobulin A, immunoglobulin G,
immunoglobulin D, immunoglobulin E, and immunoglobulin M, but also
any immunoreactivity component(s) of an antibody molecule that
immuno-specifically bind to at least one epitope. An antibody may
be naturally occurring, synthetically produced, or recombinantly
expressed. An antibody may be a fusion protein. An antibody may be
an antibody mimetic. Examples of antibodies include but are not
limited to, Fab fragments, Fab' fragments, F(ab').sub.2 fragments,
single chain antibody fragments (scFv), miniantibodies, diabodies,
crosslinked antibody fragments, Affibody.TM., nanobodies, single
domain antibodies, DVD-Ig molecules, alphabodies, affimers,
affitins, cyclotides, molecules, and the like. Immunoreactive
products derived using antibody engineering or protein engineering
techniques are also expressly within the meaning of the term
antibodies. Detailed descriptions of antibody and/or protein
engineering, including relevant protocols, can be found in, among
other places, J. Maynard and G. Georgiou, 2000, Ann. Rev. Biomed.
Eng. 2:339-76; Antibody Engineering, R. Kontermann and S. Dubel,
eds., Springer Lab Manual, Springer Verlag (2001); U.S. Pat. No.
5,831,012; and S. Paul, Antibody Engineering Protocols, Humana
Press (1995).
[0471] As with antibodies, nucleic acid and peptide aptamers that
specifically recognize a peptide can be produced using known
methods. Aptamers bind target molecules in a highly specific,
conformation-dependent manner, typically with very high affinity,
although aptamers with lower binding affinity can be selected if
desired. Aptamers have been shown to distinguish between targets
based on very small structural differences such as the presence or
absence of a methyl or hydroxyl group and certain aptamers can
distinguish between D- and L-enantiomers. Aptamers have been
obtained that bind small molecular targets, including drugs, metal
ions, and organic dyes, peptides, biotin, and proteins, including
but not limited to streptavidin, VEGF, and viral proteins. Aptamers
have been shown to retain functional activity after biotinylation,
fluorescein labeling, and when attached to glass surfaces and
microspheres. (see, Jayasena, 1999, Clin Chem 45:1628-50; Kusser
2000, J. Biotechnol. 74: 27-39; Colas, 2000, Curr Opin Chem Biol
4:54-9). Aptamers which specifically bind arginine and AMP have
been described as well (see, Patel and Suri, 2000, J. Biotech.
74:39-60). Oligonucleotide aptamers that bind to a specific amino
acid have been disclosed in Gold et al. (1995, Ann. Rev. Biochem.
64:763-97). RNA aptamers that bind amino acids have also been
described (Ames and Breaker, 2011, RNA Biol. 8; 82-89; Mannironi et
al., 2000, RNA 6:520-27; Famulok, 1994, J. Am. Chem. Soc.
116:1698-1706).
[0472] A binding agent can be made by modifying naturally-occurring
or synthetically-produced proteins by genetic engineering to
introduce one or more mutations in the amino acid sequence to
produce engineered proteins that bind to a specific component or
feature of a macromolecule (e.g., NTAA, CTAA, or
post-translationally modified amino acid or a peptide). For
example, exopeptidases (e.g., aminopeptidases, carboxypeptidases),
exoproteases, mutated exoproteases, mutated anticalins, mutated
ClpSs, antibodies, or tRNA synthetases can be modified to create a
binding agent that selectively binds to a particular NTAA. In
another example, carboxypeptidases can be modified to create a
binding agent that selectively binds to a particular CTAA. A
binding agent can also be designed or modified, and utilized, to
specifically bind a modified NTAA or modified CTAA, for example one
that has a post-translational modification (e.g., phosphorylated
NTAA or phosphorylated CTAA) or one that has been modified with a
label (e.g., PTC, 1-fluoro-2,4-dinitrobenzene (using Sanger's
reagent, DNFB), dansyl chloride (using DNS-Cl, or
1-dimethylaminonaphthalene-5-sulfonyl chloride), or using a
thioacylation reagent, a thioacetylation reagent, an acetylation
reagent, an amidination (guanidination) reagent, or a
thiobenzylation reagent). Strategies for directed evolution of
proteins are known in the art (e.g., reviewed by Yuan et al., 2005,
Microbiol. Mol. Biol. Rev. 69:373-392), and include phage display,
ribosomal display, mRNA display, CIS display, CAD display,
emulsions, cell surface display method, yeast surface display,
bacterial surface display, etc.
[0473] In some embodiments, a binding agent that selectively binds
to a modified NTAA can be utilized. For example, the NTAA may be
reacted with phenylisothiocyanate (PITC) to form a
phenylthiocarbamoyl-NTAA derivative. In this manner, the binding
agent may be fashioned to selectively bind both the phenyl group of
the phenylthiocarbamoyl moiety as well as the alpha-carbon R group
of the NTAA. Use of PITC in this manner allows for subsequent
cleavage of the NTAA by Edman degradation as discussed below. In
another embodiment, the NTAA may be reacted with Sanger's reagent
(DNFB), to generate a DNP-labeled NTAA (see FIG. 3). Optionally,
DNFB is used with an ionic liquid such as
1-ethyl-3-methylimidazolium bis[(trifluoromethyl)sulfonyl]imide
([emim][Tf2N]), in which DNFB is highly soluble. In this manner,
the binding agent may be engineered to selectively bind the
combination of the DNP and the R group on the NTAA. The addition of
the DNP moiety provides a larger "handle" for the interaction of
the binding agent with the NTAA, and should lead to a higher
affinity interaction. In yet another embodiment, a binding agent
may be an aminopeptidase that has been engineered to recognize the
DNP-labeled NTAA providing cyclic control of aminopeptidase
degradation of the peptide. Once the DNP-labeled NTAA is cleaved,
another cycle of DNFB derivitization is performed in order to bind
and cleave the newly exposed NTAA. In preferred particular
embodiment, the aminopeptidase is a monomeric metallo-protease,
such an aminopeptidase activated by zinc (Calcagno and Klein 2016).
In another example, a binding agent may selectively bind to an NTAA
that is modified with sulfonyl nitrophenol (SNP), e.g., by using
4-sulfonyl-2-nitrofluorobenzene (SNFB). In yet another embodiment,
a binding agent may selectively bind to an NTAA that is acetylated
or amidated.
[0474] Other reagents that may be used to modify the NTAA include
trifluoroethyl isothiocyanate, allyl isothiocyanate, and
dimethylaminoazobenzene isothiocyanate.
[0475] A binding agent may be engineered for high affinity for a
modified NTAA, high specificity for a modified NTAA, or both. In
some embodiments, binding agents can be developed through directed
evolution of promising affinity scaffolds using phage display.
[0476] Engineered aminopeptidase mutants that bind to and cleave
individual or small groups of labelled (biotinylated) NTAAs have
been described (see, PCT Publication No. WO2010/065322,
incorporated by reference in its entirety). Aminopeptidases are
enzymes that cleave amino acids from the N-terminus of proteins or
peptides. Natural aminopeptidases have very limited specificity,
and generically cleave N-terminal amino acids in a processive
manner, cleaving one amino acid off after another (Kishor et al.,
2015, Anal. Biochem. 488:6-8). However, residue specific
aminopeptidases have been identified (Eriquez et al., J. Clin.
Microbiol. 1980, 12:667-71; Wilce et al., 1998, Proc. Natl. Acad.
Sci. USA 95:3472-3477; Liao et al., 2004, Prot. Sci. 13:1802-10).
Aminopeptidases may be engineered to specifically bind to 20
different NTAAs representing the standard amino acids that are
labeled with a specific moiety (e.g., PTC, DNP, SNP, etc.). Control
of the stepwise degradation of the N-terminus of the peptide is
achieved by using engineered aminopeptidases that are only active
(e.g., binding activity or catalytic activity) in the presence of
the label. In another example, Havranak et al. (U.S. Patent
Publication 2014/0273004) describes engineering aminoacyl tRNA
synthetases (aaRSs) as specific NTAA binders. The amino acid
binding pocket of the aaRSs has an intrinsic ability to bind
cognate amino acids, but generally exhibits poor binding affinity
and specificity. Moreover, these natural amino acid binders don't
recognize N-terminal labels. Directed evolution of aaRS scaffolds
can be used to generate higher affinity, higher specificity binding
agents that recognized the N-terminal amino acids in the context of
an N-terminal label.
[0477] In another example, highly-selective engineered ClpSs have
also been described in the literature. Emili et al. describe the
directed evolution of an E. coli ClpS protein via phage display,
resulting in four different variants with the ability to
selectively bind NTAAs for aspartic acid, arginine, tryptophan, and
leucine residues (U.S. Pat. No. 9,566,335, incorporated by
reference in its entirety).
[0478] In a particular embodiment, anticalins are engineered for
both high affinity and high specificity to labeled NTAAs (e.g. DNP,
SNP, acetylated, etc.). Certain varieties of anticalin scaffolds
have suitable shape for binding single amino acids, by virtue of
their beta barrel structure. An N-terminal amino acid (either with
or without modification) can potentially fit and be recognized in
this "beta barrel" bucket. High affinity anticalins with engineered
novel binding activities have been described (reviewed by Skerra,
2008, FEBS J. 275: 2677-2683). For example, anticalins with high
affinity binding (low nM) to fluorescein and digoxygenin have been
engineered (Gebauer and Skerra 2012). Engineering of alternative
scaffolds for new binding functions has also been reviewed by Banta
et al. (2013, Annu. Rev. Biomed. Eng. 15:93-113).
[0479] The functional affinity (avidity) of a given monovalent
binding agent may be increased by at least an order of magnitude by
using a bivalent or higher order multimer of the monovalent binding
agent (Vauquelin and Charlton 2013). Avidity refers to the
accumulated strength of multiple, simultaneous, non-covalent
binding interactions. An individual binding interaction may be
easily dissociated. However, when multiple binding interactions are
present at the same time, transient dissociation of a single
binding interaction does not allow the binding protein to diffuse
away and the binding interaction is likely to be restored. An
alternative method for increasing avidity of a binding agent is to
include complementary sequences in the coding tag attached to the
binding agent and the recording tag associated with the
macromolecule.
[0480] In some embodiments, a binding agent can be utilized that
selectively binds a modified C-terminal amino acid (CTAA).
Carboxypeptidases are proteases that cleave terminal amino acids
containing a free carboxyl group. A number of carboxypeptidases
exhibit amino acid preferences, e.g., carboxypeptidase B
preferentially cleaves at basic amino acids, such as arginine and
lysine. A carboxypeptidase can be modified to create a binding
agent that selectively binds to particular amino acid. In some
embodiments, the carboxypeptidase may be engineered to selectively
bind both the modification moiety as well as the alpha-carbon R
group of the CTAA. Thus, engineered carboxypeptidases may
specifically recognize 20 different CTAAs representing the standard
amino acids in the context of a C-terminal label. Control of the
stepwise degradation from the C-terminus of the peptide is achieved
by using engineered carboxypeptidases that are only active (e.g.,
binding activity or catalytic activity) in the presence of the
label. In one example, the CTAA may be modified by a
para-Nitroanilide or 7-amino-4-methylcoumarinyl group.
[0481] Other potential scaffolds that can be engineered to generate
binders for use in the methods described herein include: an
anticalin, an amino acid tRNA synthetase (aaRS), ClpS, an
Affilin.RTM., an Adnectin.TM., a T cell receptor, a zinc finger
protein, a thioredoxin, GST A1-1, DARPin, an affimer, an affitin,
an alphabody, an avimer, a Kunitz domain peptide, a monobody, a
single domain antibody, EETI-II, HPSTI, intrabody, lipocalin,
PHD-finger, V(NAR) LDTI, evibody, Ig(NAR), knottin, maxibody,
neocarzinostatin, pVIII, tendamistat, VLR, protein A scaffold,
MTI-II, ecotin, GCN4, Im9, kunitz domain, microbody, PBP,
trans-body, tetranectin, WW domain, CBM4-2, DX-88, GFP, iMab, Ldl
receptor domain A, Min-23, PDZ-domain, avian pancreatic
polypeptide, charybdotoxin/10Fn3, domain antibody (Dab), a2p8
ankyrin repeat, insect defensing A peptide, Designed AR protein,
C-type lectin domain, staphylococcal nuclease, Src homology domain
3 (SH3), or Src homology domain 2 (SH2).
[0482] A binding agent may be engineered to withstand higher
temperatures and mild-denaturing conditions (e.g., presence of
urea, guanidinium thiocyanate, ionic solutions, etc.). The use of
denaturants helps reduce secondary structures in the surface bound
peptides, such as .alpha.-helical structures, .beta.-hairpins,
.beta.-strands, and other such structures, which may interfere with
binding of binding agents to linear peptide epitopes. In one
embodiment, an ionic liquid such as 1-ethyl-3-methylimidazolium
acetate ([EMIM]+[ACE] is used to reduce peptide secondary structure
during binding cycles (Lesch, Heuer et al. 2015).
[0483] Any binding agent described also comprises a coding tag
containing identifying information regarding the binding agent. A
coding tag is a nucleic acid molecule of about 3 bases to about 100
bases that provides unique identifying information for its
associated binding agent. A coding tag may comprise about 3 to
about 90 bases, about 3 to about 80 bases, about 3 to about 70
bases, about 3 to about 60 bases, about 3 bases to about 50 bases,
about 3 bases to about 40 bases, about 3 bases to about 30 bases,
about 3 bases to about 20 bases, about 3 bases to about 10 bases,
or about 3 bases to about 8 bases. In some embodiments, a coding
tag is about 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases,
9 bases, 10 bases, 11 bases, 12 bases, 13 bases, 14 bases, 15
bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 25 bases,
30 bases, 35 bases, 40 bases, 55 bases, 60 bases, 65 bases, 70
bases, 75 bases, 80 bases, 85 bases, 90 bases, 95 bases, or 100
bases in length. A coding tag may be composed of DNA, RNA,
polynucleotide analogs, or a combination thereof. Polynucleotide
analogs include PNA, .gamma.PNA, BNA, GNA, TNA, LNA, morpholino
polynucleotides, 2'-O-Methyl polynucleotides, alkyl ribosyl
substituted polynucleotides, phosphorothioate polynucleotides, and
7-deaza purine analogs.
[0484] A coding tag comprises an encoder sequence that provides
identifying information regarding the associated binding agent. An
encoder sequence is about 3 bases to about 30 bases, about 3 bases
to about 20 bases, about 3 bases to about 10 bases, or about 3
bases to about 8 bases. In some embodiments, an encoder sequence is
about 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9
bases, 10 bases, 11 bases, 12 bases, 13 bases, 14 bases, 15 bases,
20 bases, 25 bases, or 30 bases in length. The length of the
encoder sequence determines the number of unique encoder sequences
that can be generated. Shorter encoding sequences generate a
smaller number of unique encoding sequences, which may be useful
when using a small number of binding agents. Longer encoder
sequences may be desirable when analyzing a population of
macromolecules. For example, an encoder sequence of 5 bases would
have a formula of 5'-NNNNN-3' (SEQ ID NO:135), wherein N may be any
naturally occurring nucleotide, or analog. Using the four naturally
occurring nucleotides A, T, C, and G, the total number of unique
encoder sequences having a length of 5 bases is 1,024. In some
embodiments, the total number of unique encoder sequences may be
reduced by excluding, for example, encoder sequences in which all
the bases are identical, at least three contiguous bases are
identical, or both. In a specific embodiment, a set of .gtoreq.50
unique encoder sequences are used for a binding agent library.
[0485] In some embodiments, identifying components of a coding tag
or recording tag, e.g., the encoder sequence, barcode, UMI,
compartment tag, partition barcode, sample barcode, spatial region
barcode, cycle specific sequence or any combination thereof, is
subject to Hamming distance, Lee distance, asymmetric Lee distance,
Reed-Solomon, Levenshtein-Tenengolts, or similar methods for
error-correction. Hamming distance refers to the number of
positions that are different between two strings of equal length.
It measures the minimum number of substitutions required to change
one string into the other. Hamming distance may be used to correct
errors by selecting encoder sequences that are reasonable distance
apart. Thus, in the example where the encoder sequence is 5 base,
the number of useable encoder sequences is reduced to 256 unique
encoder sequences (Hamming distance of 1.fwdarw.4.sup.4 encoder
sequences=256 encoder sequences). In another embodiment, the
encoder sequence, barcode, UMI, compartment tag, cycle specific
sequence, or any combination thereof is designed to be easily read
out by a cyclic decoding process (Gunderson, 2004, Genome Res.
14:870-7). In another embodiment, the encoder sequence, barcode,
UMI, compartment tag, partition barcode, spatial barcode, sample
barcode, cycle specific sequence, or any combination thereof is
designed to be read out by low accuracy nanopore sequencing, since
rather than requiring single base resolution, words of multiple
bases (.about.5-20 bases in length) need to be read. A subset of
15-mer, error-correcting Hamming barcodes that may be used in the
methods of the present disclosure are set forth in SEQ ID NOS:1-65
and their corresponding reverse complementary sequences as set
forth in SEQ ID NO:66-130.
[0486] In some embodiments, each unique binding agent within a
library of binding agents has a unique encoder sequence. For
example, 20 unique encoder sequences may be used for a library of
20 binding agents that bind to the 20 standard amino acids.
Additional coding tag sequences may be used to identify modified
amino acids (e.g, post-translationally modified amino acids). In
another example, 30 unique encoder sequences may be used for a
library of 30 binding agents that bind to the 20 standard amino
acids and 10 post-translational modified amino acids (e.g.,
phosphorylated amino acids, acetylated amino acids, methylated
amino acids). In other embodiments, two or more different binding
agents may share the same encoder sequence. For example, two
binding agents that each bind to a different standard amino acid
may share the same encoder sequence.
[0487] In certain embodiments, a coding tag further comprises a
spacer sequence at one end or both ends. A spacer sequence is about
1 base to about 20 bases, about 1 base to about 10 bases, about 5
bases to about 9 bases, or about 4 bases to about 8 bases. In some
embodiments, a spacer is about 1 base, 2 bases, 3 bases, 4 bases, 5
bases, 6 bases, 7 bases, 8 bases, 9 bases, 10 bases, 11 bases, 12
bases, 13 bases, 14 bases, 15 bases or 20 bases in length. In some
embodiments, a spacer within a coding tag is shorter than the
encoder sequence, e.g., at least 1 base, 2, bases, 3 bases, 4
bases, 5 bases, 6, bases, 7 bases, 8 bases, 9 bases, 10 bases, 11
bases, 12 bases, 13 bases, 14 bases, 15 bases, 20 bases, or 25
bases shorter than the encoder sequence. In other embodiments, a
spacer within a coding tag is the same length as the encoder
sequence. In certain embodiments, the spacer is binding agent
specific so that a spacer from a previous binding cycle only
interacts with a spacer from the appropriate binding agent in a
current binding cycle. An example would be pairs of cognate
antibodies containing spacer sequences that only allow information
transfer if both antibodies sequentially bind to the macromolecule.
A spacer sequence may be used as the primer annealing site for a
primer extension reaction, or a splint or sticky end in a ligation
reaction. A 5' spacer on a coding tag (see FIG. 5A, "*Sp'") may
optionally contain pseudo complementary bases to a 3' spacer on the
recording tag to increase T.sub.m (Lehoud et al., 2008, Nucleic
Acids Res. 36:3409-3419).
[0488] In some embodiments, the coding tags within a collection of
binding agents share a common spacer sequence used in an assay
(e.g. the entire library of binding agents used in a multiple
binding cycle method possess a common spacer in their coding tags).
In another embodiment, the coding tags are comprised of a binding
cycle tags, identifying a particular binding cycle. In other
embodiments, the coding tags within a library of binding agents
have a binding cycle specific spacer sequence. In some embodiments,
a coding tag comprises one binding cycle specific spacer sequence.
For example, a coding tag for binding agents used in the first
binding cycle comprise a "cycle 1" specific spacer sequence, a
coding tag for binding agents used in the second binding cycle
comprise a "cycle 2" specific spacer sequence, and so on up to "n"
binding cycles. In further embodiments, coding tags for binding
agents used in the first binding cycle comprise a "cycle 1"
specific spacer sequence and a "cycle 2" specific spacer sequence,
coding tags for binding agents used in the second binding cycle
comprise a "cycle 2" specific spacer sequence and a "cycle 3"
specific spacer sequence, and so on up to "n" binding cycles. This
embodiment is useful for subsequent PCR assembly of
non-concatenated extended recording tags after the binding cycles
are completed (see FIGS. 10A-10C). In some embodiments, a spacer
sequence comprises a sufficient number of bases to anneal to a
complementary spacer sequence in a recording tag or extended
recording tag to initiate a primer extension reaction or sticky end
ligation reaction.
[0489] A cycle specific spacer sequence can also be used to
concatenate information of coding tags onto a single recording tag
when a population of recording tags is associated with a
macromolecule. The first binding cycle transfers information from
the coding tag to a randomly-chosen recording tag, and subsequent
binding cycles can prime only the extended recording tag using
cycle dependent spacer sequences. More specifically, coding tags
for binding agents used in the first binding cycle comprise a
"cycle 1" specific spacer sequence and a "cycle 2" specific spacer
sequence, coding tags for binding agents used in the second binding
cycle comprise a "cycle 2" specific spacer sequence and a "cycle 3"
specific spacer sequence, and so on up to "n" binding cycles.
Coding tags of binding agents from the first binding cycle are
capable of annealing to recording tags via complementary cycle 1
specific spacer sequences. Upon transfer of the coding tag
information to the recording tag, the cycle 2 specific spacer
sequence is positioned at the 3' terminus of the extended recording
tag at the end of binding cycle 1. Coding tags of binding agents
from the second binding cycle are capable of annealing to the
extended recording tags via complementary cycle 2 specific spacer
sequences. Upon transfer of the coding tag information to the
extended recording tag, the cycle 3 specific spacer sequence is
positioned at the 3' terminus of the extended recording tag at the
end of binding cycle 2, and so on through "n" binding cycles. This
embodiment provides that transfer of binding information in a
particular binding cycle among multiple binding cycles will only
occur on (extended) recording tags that have experienced the
previous binding cycles. However, sometimes a binding agent will
fail to bind to a cognate macromolecule. Oligonucleotides
comprising binding cycle specific spacers after each binding cycle
as a "chase" step can be used to keep the binding cycles
synchronized even if the event of a binding cycle failure. For
example, if a cognate binding agent fails to bind to a
macromolecule during binding cycle 1, adding a chase step following
binding cycle 1 using oligonucleotides comprising both a cycle 1
specific spacer, a cycle 2 specific spacer, and a "null" encoder
sequence. The "null" encoder sequence can be the absence of an
encoder sequence or, preferably, a specific barcode that positively
identifies a "null" binding cycle. The "null" oligonucleotide is
capable of annealing to the recording tag via the cycle 1 specific
spacer, and the cycle 2 specific spacer is transferred to the
recording tag. Thus, binding agents from binding cycle 2 are
capable of annealing to the extended recording tag via the cycle 2
specific spacer despite the failed binding cycle 1 event. The
"null" oligonucleotide marks binding cycle 1 as a failed binding
event within the extended recording tag.
[0490] In preferred embodiment, binding cycle-specific encoder
sequences are used in coding tags. Binding cycle-specific encoder
sequences may be accomplished either via the use of completely
unique analyte (e.g., NTAA)-binding cycle encoder barcodes or
through a combinatoric use of an analyte (e.g., NTAA) encoder
sequence joined to a cycle-specific barcode (see FIG. 35B). The
advantage of using a combinatoric approach is that fewer total
barcodes need to be designed. For a set of 20 analyte binding
agents used across 10 cycles, only 20 analyte encoder sequence
barcodes and 10 binding cycle specific barcodes need to be
designed. In contrast, if the binding cycle is embedded directly in
the binding agent encoder sequence, then a total of 200 independent
encoder barcodes may need to be designed. An advantage of embedding
binding cycle information directly in the encoder sequence is that
the total length of the coding tag can be minimized when employing
error-correcting barcodes on a nanopore readout. The use of
error-tolerant barcodes allows highly accurate barcode
identification using sequencing platforms and approaches that are
more error-prone, but have other advantages such as rapid speed of
analysis, lower cost, and/or more portable instrumentation. One
such example is a nanopore-based sequencing readout.
[0491] In some embodiments, a coding tag comprises a cleavable or
nickable DNA strand within the second (3') spacer sequence proximal
to the binding agent (see, FIG. 32). For example, the 3' spacer may
have one or more uracil bases that can be nicked by uracil-specific
excision reagent (USER). USER generates a single nucleotide gap at
the location of the uracil. In another example, the 3' spacer may
comprise a recognition sequence for a nicking endonuclease that
hydrolyzes only one strand of a duplex. Preferably, the enzyme used
for cleaving or nicking the 3' spacer sequence acts only on one DNA
strand (the 3' spacer of the coding tag), such that the other
strand within the duplex belonging to the (extended) recording tag
is left intact. These embodiments is particularly useful in assays
analysing proteins in their native conformation, as it allows the
non-denaturing removal of the binding agent from the (extended)
recording tag after primer extension has occurred and leaves a
single stranded DNA spacer sequence on the extended recording tag
available for subsequent binding cycles.
[0492] The coding tags may also be designed to contain palindromic
sequences. Inclusion of a palindromic sequence into a coding tag
allows a nascent, growing, extended recording tag to fold upon
itself as coding tag information is transferred. The extended
recording tag is folded into a more compact structure, effectively
decreasing undesired inter-molecular binding and primer extension
events.
[0493] In some embodiments, a coding tag comprises analyte-specific
spacer that is capable of priming extension only on recording tags
previously extended with binding agents recognizing the same
analyte. An extended recording tag can be built up from a series of
binding events using coding tags comprising analyte-specific
spacers and encoder sequences. In one embodiment, a first binding
event employs a binding agent with a coding tag comprised of a
generic 3' spacer primer sequence and an analyte-specific spacer
sequence at the 5' terminus for use in the next binding cycle;
subsequent binding cycles then use binding agents with encoded
analyte-specific 3' spacer sequences. This design results in
amplifiable library elements being created only from a correct
series of cognate binding events. Off-target and cross-reactive
binding interactions will lead to a non-amplifiable extended
recording tag. In one example, a pair of cognate binding agents to
a particular macromolecule analyte is used in two binding cycles to
identify the analyte. The first cognate binding agent contains a
coding tag comprised of a generic spacer 3' sequence for priming
extension on the generic spacer sequence of the recording tag, and
an encoded analyte-specific spacer at the 5' end, which will be
used in the next binding cycle. For matched cognate binding agent
pairs, the 3' analyte-specific spacer of the second binding agent
is matched to the 5' analyte-specific spacer of the first binding
agent. In this way, only correct binding of the cognate pair of
binding agents will result in an amplifiable extended recording
tag. Cross-reactive binding agents will not be able to prime
extension on the recording tag, and no amplifiable extended
recording tag product generated. This approach greatly enhances the
specificity of the methods disclosed herein. The same principle can
be applied to triplet binding agent sets, in which 3 cycles of
binding are employed. In a first binding cycle, a generic 3' Sp
sequence on the recording tag interacts with a generic spacer on a
binding agent coding tag. Primer extension transfers coding tag
information, including an analyte specific 5' spacer, to the
recording tag. Subsequent binding cycles employ analyte specific
spacers on the binding agents' coding tags.
[0494] In certain embodiments, a coding tag may further comprise a
unique molecular identifier for the binding agent to which the
coding tag is linked. A UMI for the binding agent may be useful in
embodiments utilizing extended coding tags or di-tag molecules for
sequencing readouts, which in combination with the encoder sequence
provides information regarding the identity of the binding agent
and number of unique binding events for a macromolecule.
[0495] In another embodiment, a coding tag includes a randomized
sequence (a set of N's, where N=a random selection from A, C, G, T,
or a random selection from a set of words). After a series of "n"
binding cycles and transfer of coding tag information to the
(extended) recording tag, the final extended recording tag product
will be composed of a series of these randomized sequences, which
collectively form a "composite" unique molecule identifier (UMI)
for the final extended recording tag. If for instance each coding
tag contains an (NN) sequence (4*4=16 possible sequences), after 10
sequencing cycles, a combinatoric set of 10 distributed 2-mers is
formed creating a total diversity of 16.sup.10.about.10.sup.12
possible composite UMI sequences for the extended recording tag
products. Given that a peptide sequencing experiment uses
.about.10.sup.9 molecules, this diversity is more than sufficient
to create an effective set of UMIs for a sequencing experiment.
Increased diversity can be achieved by simply using a longer
randomized region (NNN, NNNN, etc.) within the coding tag.
[0496] A coding tag may include a terminator nucleotide
incorporated at the 3' end of the 3' spacer sequence. After a
binding agent binds to a macromolecule and their corresponding
coding tag and recording tags anneal via complementary spacer
sequences, it is possible for primer extension to transfer
information from the coding tag to the recording tag, or to
transfer information from the recording tag to the coding tag.
Addition of a terminator nucleotide on the 3' end of the coding tag
prevents transfer of recording tag information to the coding tag.
It is understood that for embodiments described herein involving
generation of extended coding tags, it may be preferable to include
a terminator nucleotide at the 3' end of the recording tag to
prevent transfer of coding tag information to the recording
tag.
[0497] A coding tag may be a single stranded molecule, a double
stranded molecule, or a partially double stranded. A coding tag may
comprise blunt ends, overhanging ends, or one of each. In some
embodiments, a coding tag is partially double stranded, which
prevents annealing of the coding tag to internal encoder and spacer
sequences in a growing extended recording tag.
[0498] A coding tag is joined to a binding agent directly or
indirectly, by any means known in the art, including covalent and
non-covalent interactions. In some embodiments, a coding tag may be
joined to binding agent enzymatically or chemically. In some
embodiments, a coding tag may be joined to a binding agent via
ligation. In other embodiments, a coding tag is joined to a binding
agent via affinity binding pairs (e.g., biotin and
streptavidin).
[0499] In some embodiments, a binding agent is joined to a coding
tag via SpyCatcher-SpyTag interaction (see, FIG. 43B). The SpyTag
peptide forms an irreversible covalent bond to the SpyCatcher
protein via a spontaneous isopeptide linkage, thereby offering a
genetically encoded way to create peptide interactions that resist
force and harsh conditions (Zakeri et al., 2012, Proc. Natl. Acad.
Sci. 109:E690-697; Li et al., 2014, J. Mol. Biol. 426:309-317). A
binding agent may be expressed as a fusion protein comprising the
SpyCatcher protein. In some embodiments, the SpyCatcher protein is
appended on the N-terminus or C-terminus of the binding agent. The
SpyTag peptide can be coupled to the coding tag using standard
conjugation chemistries (Bioconjugate Techniques, G. T. Hermanson,
Academic Press (2013)).
[0500] In other embodiments, a binding agent is joined to a coding
tag via SnoopTag-SnoopCatcher peptide-protein interaction. The
SnoopTag peptide forms an isopeptide bond with the SnoopCatcher
protein (Veggiani et al., Proc. Natl. Acad. Sci. USA, 2016,
113:1202-1207). A binding agent may be expressed as a fusion
protein comprising the SnoopCatcher protein. In some embodiments,
the SnoopCatcher protein is appended on the N-terminus or
C-terminus of the binding agent. The SnoopTag peptide can be
coupled to the coding tag using standard conjugation
chemistries.
[0501] In yet other embodiments, a binding agent is joined to a
coding tag via the HaloTag.RTM. protein fusion tag and its chemical
ligand. HaloTag is a modified haloalkane dehalogenase designed to
covalently bind to synthetic ligands (HaloTag ligands) (Los et al.,
2008, ACS Chem. Biol. 3:373-382). The synthetic ligands comprise a
chloroalkane linker attached to a variety of useful molecules. A
covalent bond forms between the HaloTag and the chloroalkane linker
that is highly specific, occurs rapidly under physiological
conditions, and is essentially irreversible.
[0502] In certain embodiments, a macromolecule is also contacted
with a non-cognate binding agent. As used herein, a non-cognate
binding agent is referring to a binding agent that is selective for
a different macromolecule feature or component than the particular
macromolecule being considered. For example, if the n NTAA is
phenylalanine, and the peptide is contacted with three binding
agents selective for phenylalanine, tyrosine, and asparagine,
respectively, the binding agent selective for phenylalanine would
be first binding agent capable of selectively binding to the
n.sup.th NTAA (i.e., phenylalanine), while the other two binding
agents would be non-cognate binding agents for that peptide (since
they are selective for NTAAs other than phenylalanine). The
tyrosine and asparagine binding agents may, however, be cognate
binding agents for other peptides in the sample. If the n NTAA
(phenylalanine) was then cleaved from the peptide, thereby
converting the n-1 amino acid of the peptide to the n-1 NTAA (e.g.,
tyrosine), and the peptide was then contacted with the same three
binding agents, the binding agent selective for tyrosine would be
second binding agent capable of selectively binding to the n-1 NTAA
(i.e., tyrosine), while the other two binding agents would be
non-cognate binding agents (since they are selective for NTAAs
other than tyrosine).
[0503] Thus, it should be understood that whether an agent is a
binding agent or a non-cognate binding agent will depend on the
nature of the particular macromolecule feature or component
currently available for binding. Also, if multiple macromolecules
are analyzed in a multiplexed reaction, a binding agent for one
macromolecule may be a non-cognate binding agent for another, and
vice versa. According, it should be understood that the following
description concerning binding agents is applicable to any type of
binding agent described herein (i.e., both cognate and non-cognate
binding agents).
VIII. Cyclic Transfer of Coding Tag Information to Recording
Tags
[0504] In the methods described herein, upon binding of a binding
agent to a macromolecule, identifying information of its linked
coding tag is transferred to a recording tag associated with the
macromolecule, thereby generating an "extended recording tag." An
extended recording tag may comprise information from a binding
agent's coding tag representing each binding cycle performed.
However, an extended recording tag may also experience a "missed"
binding cycle, e.g., because a binding agent fails to bind to the
macromolecule, because the coding tag was missing, damaged, or
defective, because the primer extension reaction failed. Even if a
binding event occurs, transfer of information from the coding tag
to the recording tag may be incomplete or less than 100% accurate,
e.g., because a coding tag was damaged or defective, because errors
were introduced in the primer extension reaction). Thus, an
extended recording tag may represent 100%, or up to 95%, 90%, 85%,
80%, 75%, 70%, 65%, 60%, 65%, 55%, 50%, 45%, 40%, 35%, 30% of
binding events that have occurred on its associated macromolecule.
Moreover, the coding tag information present in the extended
recording tag may have at least 30%, 35%, 40%, 45%, 50%, 55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identity the
corresponding coding tags.
[0505] In certain embodiments, an extended recording tag may
comprise information from multiple coding tags representing
multiple, successive binding events. In these embodiments, a
single, concatenated extended recording tag can be representative
of a single macromolecule (see, FIG. 2A). As referred to herein,
transfer of coding tag information to a recording tag also includes
transfer to an extended recording tag as would occur in methods
involving multiple, successive binding events.
[0506] In certain embodiments, the binding event information is
transferred from a coding tag to a recording tag in a cyclic
fashion (see FIGS. 2A and 2C). Cross-reactive binding events can be
informatically filtered out after sequencing by requiring that at
least two different coding tags, identifying two or more
independent binding events, map to the same class of binding agents
(cognate to a particular protein). An optional sample or
compartment barcode can be included in the recording tag, as well
an optional UMI sequence. The coding tag can also contain an
optional UMI sequence along with the encoder and spacer sequences.
Universal priming sequences (U1 and U2) may also be included in
extended recording tags for amplification and NGS sequencing (see
FIG. 2A).
[0507] Coding tag information associated with a specific binding
agent may be transferred to a recording tag using a variety of
methods. In certain embodiments, information of a coding tag is
transferred to a recording tag via primer extension (Chan, McGregor
et al. 2015). A spacer sequence on the 3'-terminus of a recording
tag or an extended recording tag anneals with complementary spacer
sequence on the 3' terminus of a coding tag and a polymerase (e.g.,
strand-displacing polymerase) extends the recording tag sequence,
using the annealed coding tag as a template (see, FIGS. 5-7). In
some embodiments, oligonucleotides complementary to coding tag
encoder sequence and 5' spacer can be pre-annealed to the coding
tags to prevent hybridization of the coding tag to internal encoder
and spacer sequences present in an extended recording tag. The 3'
terminal spacer, on the coding tag, remaining single stranded,
preferably binds to the terminal 3' spacer on the recording tag. In
other embodiments, a nascent recording tag can be coated with a
single stranded binding protein to prevent annealing of the coding
tag to internal sites. Alternatively, the nascent recording tag can
also be coated with RecA (or related homologues such as uvsX) to
facilitate invasion of the 3' terminus into a completely double
stranded coding tag (Bell et al., 2012, Nature 491:274-278). This
configuration prevents the double stranded coding tag from
interacting with internal recording tag elements, yet is
susceptible to strand invasion by the RecA coated 3' tail of the
extended recording tag (Bell, et al., 2015, Elife 4: e08646). The
presence of a single-stranded binding protein can facilitate the
strand displacement reaction.
[0508] In a preferred embodiment, a DNA polymerase that is used for
primer extension possesses strand-displacement activity and has
limited or is devoid of 3'-5 exonuclease activity. Several of many
examples of such polymerases include Klenow exo- (Klenow fragment
of DNA Pol 1), T4 DNA polymerase exo-, T7 DNA polymerase exo
(Sequenase 2.0), Pfu exo-, Vent exo-, Deep Vent exo-, Bst DNA
polymerase large fragment exo-, Bca Pol, 9.degree. N Pol, and Phi29
Pol exo-. In a preferred embodiment, the DNA polymerase is active
at room temperature and up to 45.degree. C. In another embodiment,
a "warm start" version of a thermophilic polymerase is employed
such that the polymerase is activated and is used at about
40.degree. C.-50.degree. C. An exemplary warm start polymerase is
Bst 2.0 Warm Start DNA Polymerase (New England Biolabs).
[0509] Additives useful in strand-displacement replication include
any of a number of single-stranded DNA binding proteins (SSB
proteins) of bacterial, viral, or eukaryotic origin, such as SSB
protein of E. coli, phage T4 gene 32 product, phage T7 gene 2.5
protein, phage Pf3 SSB, replication protein A RPA32 and RPA14
subunits (Wold, 1997); other DNA binding proteins, such as
adenovirus DNA-binding protein, herpes simplex protein ICP8, BMRF1
polymerase accessory subunit, herpes virus UL29 SSB-like protein;
any of a number of replication complex proteins known to
participate in DNA replication, such as phage T7 helicase/primase,
phage T4 gene 41 helicase, E. coli Rep helicase, E. coli recBCD
helicase, recA, E. coli and eukaryotic topoisomerases (Champoux,
2001).
[0510] Mis-priming or self-priming events, such as when the
terminal spacer sequence of the recoding tag primes extension
self-extension may be minimized by inclusion of single stranded
binding proteins (T4 gene 32, E. coli SSB, etc.), DMSO (1-10%),
formamide (1-10%), BSA(10-100 ug/ml), TMACl (1-5 mM), ammonium
sulfate (10-50 mM), betaine (1-3 M), glycerol (5-40%), or ethylene
glycol (5-40%), in the primer extension reaction.
[0511] Most type A polymerases are devoid of 3' exonuclease
activity (endogenous or engineered removal), such as Klenow exo-,
T7 DNA polymerase exo-(Sequenase 2.0), and Taq polymerase catalyzes
non-templated addition of a nucleotide, preferably an adenosine
base (to lesser degree a G base, dependent on sequence context) to
the 3' blunt end of a duplex amplification product. For Taq
polymerase, a 3' pyrimidine (C>T) minimizes non-templated
adenosine addition, whereas a 3' purine nucleotide (G>A) favours
non-templated adenosine addition. In embodiments using Taq
polymerase for primer extension, placement of a thymidine base in
the coding tag between the spacer sequence distal from the binding
agent and the adjacent barcode sequence (e.g., encoder sequence or
cycle specific sequence) accommodates the sporadic inclusion of a
non-templated adenosine nucleotide on the 3' terminus of the spacer
sequence of the recording tag. (FIG. 43A). In this manner, the
extended recording tag (with or without a non-templated adenosine
base) can anneal to the coding tag and undergo primer
extension.
[0512] Alternatively, addition of non-templated base can be reduced
by employing a mutant polymerase (mesophilic or thermophilic) in
which non-templated terminal transferase activity has been greatly
reduced by one or more point mutations, especially in the 0-helix
region (see U.S. Pat. No. 7,501,237) (Yang, Astatke et al. 2002).
Pfu exo-, which is 3' exonuclease deficient and has
strand-displacing ability, also does not have non-templated
terminal transferase activity.
[0513] In another embodiment, optimal polymerase extension buffers
are comprised of 40-120 mM buffering agent such as Tris-Acetate,
Tris-HCl, HEPES, etc. at a pH of 6-9.
[0514] Self-priming/mis-priming events initiated by self-annealing
of the terminal spacer sequence of the extended recording tag with
internal regions of the extended recording tag may be minimized by
including pseudo-complementary bases in the recording/extended
recording tag (Lahoud, Timoshchuk et al. 2008), (Hoshika, Chen et
al. 2010). Pseudo-complementary bases show significantly reduced
hybridization affinities for the formation of duplexes with each
other due the presence of chemical modification. However, many
pseudo-complementary modified bases can form strong base pairs with
natural DNA or RNA sequences. In certain embodiments, the coding
tag spacer sequence is comprised of multiple A and T bases, and
commercially available pseudo-complementary bases 2-aminoadenine
and 2-thiothymine are incorporated in the recording tag using
phosphoramidite oligonucleotide synthesis. Additional
pseudocomplementary bases can be incorporated into the extended
recording tag during primer extension by adding
pseudo-complementary nucleotides to the reaction (Gamper, Arar et
al. 2006).
[0515] To minimize non-specific interaction of the coding tag
labeled binding agents in solution with the recording tags of
immobilized proteins, competitor (also referred to as blocking)
oligonucleotides complementary to recording tag spacer sequences
are added to binding reactions to minimize non-specific interaction
s (FIG. 32A-D). Blocking oligonucleotides are relatively short.
Excess competitor oligonucleotides are washed from the binding
reaction prior to primer extension, which effectively dissociates
the annealed competitor oligonucleotides from the recording tags,
especially when exposed to slightly elevated temperatures (e.g.,
30-50.degree. C.). Blocking oligonucleotides may comprise a
terminator nucleotide at its 3' end to prevent primer
extension.
[0516] In certain embodiments, the annealing of the spacer sequence
on the recording tag to the complementary spacer sequence on the
coding tag is metastable under the primer extension reaction
conditions (i.e., the annealing Tm is similar to the reaction
temperature). This allows the spacer sequence of the coding tag to
displace any blocking oligonucleotide annealed to the spacer
sequence of the recording tag.
[0517] Coding tag information associated with a specific binding
agent may also be transferred to a recording tag via ligation (see,
e.g., FIGS. 6 and 7). Ligation may be a blunt end ligation or
sticky end ligation. Ligation may be an enzymatic ligation
reaction. Examples of ligases include, but are not limited to T4
DNA ligase, T7 DNA ligase, T3 DNA ligase, Taq DNA ligase, E. coli
DNA ligase, 9.degree. N DNA ligase, Electroligase.RTM..
Alternatively, a ligation may be a chemical ligation reaction (see
FIG. 7). In the illustration, a spacer-less ligation is
accomplished by using hybridization of a "recording helper"
sequence with an arm on the coding tag. The annealed complement
sequences are chemically ligated using standard chemical ligation
or "click chemistry" (Gunderson, Huang et al. 1998, Peng, Li et al.
2010, El-Sagheer, Cheong et al. 2011, El-Sagheer, Sanzone et al.
2011, Sharma, Kent et al. 2012, Roloff and Seitz 2013, Litovchick,
Clark et al. 2014, Roloff, Ficht et al. 2014).
[0518] In another embodiment, transfer of PNAs can be accomplished
with chemical ligation using published techniques. The structure of
PNA is such that it has a 5' N-terminal amine group and an
unreactive 3' C-terminal amide. Chemical ligation of PNA requires
that the termini be modified to be chemically active. This is
typically done by derivitizing the 5' N-terminus with a cysteinyl
moiety and the 3' C-terminus with a thioester moiety. Such modified
PNAs easily couple using standard native chemical ligation
conditions (Roloff et al., 2013, Bioorgan. Med. Chem.
21:3458-3464).
[0519] In some embodiments, coding tag information can be
transferred using topoisomerase. Topoisomerase can be used be used
to ligate a topo-charged 3' phosphate on the recording tag to the
5' end of the coding tag, or complement thereof (Shuman et al.,
1994, J. Biol. Chem. 269:32678-32684).
[0520] As described herein, a binding agent may bind to a
post-translationally modified amino acid. Thus, in certain
embodiments involving peptide macromolecules, an extended recording
tag comprises coding tag information relating to amino acid
sequence and post-translational modifications. In some embodiments,
detection of internal post-translationally modified amino acids
(e.g., phosphorylation, glycosylation, succinylation,
ubiquitination, S-Nitrosylation, methylation, N-acetylation,
lipidation, etc.) is be accomplished prior to detection and
cleavage of terminal amino acids (e.g., NTAA or CTAA). In one
example, a peptide is contacted with binding agents for PTM
modifications, and associated coding tag information are
transferred to the recording tag as described above (see FIG. 8A).
Once the detection and transfer of coding tag information relating
to amino acid modifications is complete, the PTM modifying groups
can be removed before detection and transfer of coding tag
information for the primary amino acid sequence using N-terminal or
C-terminal degradation methods. Thus, resulting extended recording
tags indicate the presence of post-translational modifications in a
peptide sequence, though not the sequential order, along with
primary amino acid sequence information (see FIG. 8B).
[0521] In some embodiments, detection of internal
post-translationally modified amino acids may occur concurrently
with detection of primary amino acid sequence. In one example, an
NTAA (or CTAA) is contacted with a binding agent specific for a
post-translationally modified amino acid, either alone or as part
of a library of binding agents (e.g., library composed of binding
agents for the 20 standard amino acids and selected
post-translational modified amino acids). Successive cycles of
terminal amino acid cleavage and contact with a binding agent (or
library of binding agents) follow. Thus, resulting extended
recording tags indicate the presence and order of
post-translational modifications in the context of a primary amino
acid sequence.
[0522] In certain embodiments, an ensemble of recording tags may be
employed per macromolecule to improve the overall robustness and
efficiency of coding tag information transfer (see, e.g., (FIGS.
9A-9B). The use of an ensemble of recording tags associated with a
given macromolecule rather than a single recording tag improves the
efficiency of library construction due to potentially higher
coupling yields of coding tags to recording tags, and higher
overall yield of libraries. The yield of a single concatenated
extended recording tag is directly dependent on the stepwise yield
of concatenation, whereas the use of multiple recording tags
capable of accepting coding tag information does not suffer the
exponential loss of concatenation.
[0523] An example of such an embodiment is shown in (FIGS. 9A-9B
and FIGS. 10A-10C). In FIGS. 9A and 10A, multiple recording tags
are associated with a single macromolecule (by spatial
co-localization or confinement of a single macromolecule to a
single bead) on a solid support. Binding agents are exposed to the
solid support in cyclical fashion and their corresponding coding
tag transfers information to one of the co-localized multiple
recording tags in each cycle. In the example shown in FIG. 9A, the
binding cycle information is encoded into the spacer present on the
coding tag. For each binding cycle, the set of binding agents is
marked with a designated cycle-specific spacer sequence (FIGS. 9A
and 9B). For example, in the case of NTAA binding agents, the
binding agents to the same amino acid residue are be labelled with
different coding tags or comprise cycle-specific information in the
spacer sequence to denote both the binding agent identity and cycle
number.
[0524] As illustrated in FIG. 9A, in a first cycle of binding
(Cycle 1), a plurality of NTAA binding agents is contacted with the
macromolecule. The binding agents used in Cycle 1 possess a common
spacer sequence that is complementary to the spacer sequence of the
recording tag. The binding agents used in Cycle 1 also possess a
3'-spacer sequence comprising Cycle 1 specific sequence. During
binding Cycle 1, a first NTAA binding agent binds to the free
terminus of the macromolecule, the complementary sequences of the
common spacer sequence in the first coding tag and recording tag
anneal, and the information of a first coding tag is transferred to
a cognate recording tag via primer extension from the common spacer
sequence. Following removal of the NTAA to expose a new NTAA,
binding Cycle 2 contacts a plurality of NTAA binding agents that
possess a common spacer sequence that is complementary to the
spacer sequence of a recording tag. The binding agents used in
Cycle 2 also possess a 3'-spacer sequence comprising Cycle 2
specific sequence. A second NTAA binding agent binds to the NTAA of
the macromolecule, and the information of a second coding tag is
transferred to a recording tag via primer extension. These cycles
are repeated up to "n" binding cycles, generating a plurality of
extended recording tags co-localized with the single macromolecule,
wherein each extended recording tag possesses coding tag
information from one binding cycle. Because each set of binding
agents used in each successive binding cycle possess cycle specific
spacer sequences in the coding tags, binding cycle information can
be associated with binding agent information in the resulting
extended recording tags.
[0525] In an alternative embodiment, multiple recording tags are
associated with a single macromolecule on a solid support (e.g.,
bead) as in FIG. 9A, but in this case binding agents used in a
particular binding cycle have coding tags flanked by a
cycle-specific spacer for the current binding cycle and a cycle
specific spacer for the next binding cycle (FIGS. 10A and 10B). The
reason for this design is to support a final assembly PCR step
(FIG. 10C) to convert the population of extended recording tags
into a single co-linear, extended recording tag. A library of
single, co-linear extended recording tag can be subjected to
enrichment, subtraction and/or normalization methods prior to
sequencing. In the first binding cycle (Cycle 1), upon binding of a
first binding agent, the information of a coding tag comprising a
Cycle 1 specific spacer (C'1) is transferred to a recording tag
comprising a complementary Cycle 1 specific spacer (C1) at its
terminus. In the second binding cycle (Cycle 2), upon binding of a
second binding agent, the information of a coding tag comprising a
Cycle 2 specific spacer (C'2) is transferred to a different
recording tag comprising a complementary Cycle 2 specific spacer
(C2) at its terminus. This process continues until the n.sup.th
binding cycle. In some embodiments, the n.sup.th coding tag in the
extended recording tag is capped with a universal reverse priming
sequence, e.g., the universal reverse priming sequence can be
incorporated as part of the n.sup.th coding tag design or the
universal reverse priming sequence can be added in a subsequent
reaction after the n.sup.th binding cycle, such as an amplification
reaction using a tailed primer. In some embodiments, at each
binding cycle a macromolecule is exposed to a collection of binding
agents joined to coding tags comprising identifying information
regarding their corresponding binding agents and binding cycle
information (FIGS. 9A-9B and FIGS. 10A-10C). In a particular
embodiment, following completion of the n.sup.th binding cycle, the
bead substrates coated with extended recording tags are placed in
an oil emulsion such that on average there is fewer than or
approximately equal to 1 bead/droplet. Assembly PCR is then used to
amplify the extended recording tags from the beads, and the
multitude of separate recording tags are assembled collinear order
by priming via the cycle specific spacer sequences within the
separate extended recording tags (FIG. 10C) (Xiong et al., 2008,
FEMS Microbiol. Rev. 32:522-540). Alternatively, instead of using
cycle-specific spacer with the binding agents' coding tags, a cycle
specific spacer can be added separately to the extended recording
tag during or after each binding cycle. One advantage of using a
population of extended recording tags, which collectively represent
a single macromolecule vs. a single concatenated extended recording
tag representing a single macromolecule is that a higher
concentration of recording tags can increase efficiency of transfer
of the coding tag information. Moreover, a binding cycle can be
repeated several times to ensure completion of cognate binding
events. Furthermore, surface amplification of extended recording
tags may be able to provide redundancy of information transfer (see
FIG. 4B). If coding tag information is not always transferred, it
should in most cases still be possible to use the incomplete
collection of coding tag information to identify macromolecules
that have very high information content, such as proteins. Even a
short peptide can embody a very large number of possible protein
sequences. For example, a 10-mer peptide has 20.sup.10 possible
sequences. Therefore, partial or incomplete sequence that may
contain deletions and/or ambiguities can often still be mapped
uniquely.
[0526] In some embodiments, in which proteins in their native
conformation are being queried, the cyclic binding assays are
performed with binding agents harbouring coding tags comprised of a
cleavable or nickable DNA strand within the spacer element proximal
to the binding agent (FIGS. 32A-32H). For example, the spacer
proximal to the binding agent may have one or more uracil bases
that can be nicked by uracil-specific excision reagent (USER). In
another example, the spacer proximal to the binding agent may
comprise a recognition sequence for a nicking endonuclease that
hydrolyzes only one strand of a duplex. This design allows the
non-denaturing removal of the binding agent from the extended
recording tag and creates a free single stranded DNA spacer element
for subsequent immunoassay cycles. In a preferred embodiment, a
uracil base is incorporated into the coding tag to permit enzymatic
USER removal of the binding agent after the primer extension step
(FIGS. 32E-F). After USER excision of uracils, the binding agent
and truncated coding tag can be removed under a variety of mild
conditions including high salt (4M NaCl, 25% formamide) and mild
heat to disrupt the protein-binding agent interaction. The other
truncated coding tag DNA stub remaining annealed on the recording
tag (FIG. 32F) readily dissociates at slightly elevated
temperatures.
[0527] Coding tags comprised of a cleavable or nickable DNA strand
within the spacer element proximal to the binding agent also allows
for a single homogeneous assay for transferring of coding tag
information from multiple bound binding agents (see FIGS. 33A-D).
In a preferred embodiment, the coding tag proximal to the binding
agent comprises a nicking endonuclease sequence motif, which is
recognized and nicked by a nicking endonuclease at a defined
sequence motif in the context of dsDNA. After binding of multiple
binding agents, a combined polymerase extension (devoid of
strand-displacement activity)+nicking endonuclease reagent mix is
used to generate repeated transfers of coding tags to the proximal
recording tag or extended recording tag. After each transfer step,
the resulting extended recording tag-coding tag duplex is nicked by
the nicking endonuclease releasing the truncated spacer attached to
the binding agent and exposing the extended recording tag 3' spacer
sequence, which is capable of annealing to the coding tags of
additional proximal bound binding agents (FIGS. 33B-D). The
placement of the nicking motif in the coding tag spacer sequence is
designed to create a metastable hybrid, which can easily be
exchanged with a non-cleaved coding tag spacer sequence. In this
way, if two or more binding agents simultaneously bind the same
protein molecule, binding information via concatenation of coding
tag information from multiply bound binding agents onto the
recording tag occurs in a single reaction mix without any cyclic
reagent exchanges (FIGS. 33C-D). This embodiment is particularly
useful for the next generation protein assay (NGPA), especially
with polyclonal antibodies (or mixed population of monoclonal
antibody) to multivalent epitopes on a protein.
[0528] For embodiments involving analysis of denatured proteins,
polypeptides, and peptides, the bound binding agent and annealed
coding tag can be removed following primer extension by using
highly denaturing conditions (e.g., 0.1-0.2 N NaOH, 6M Urea, 2.4 M
guanidinium isothiocyanate, 95% formamide, etc.).
IX. Cyclic Transfer of Recording Tag Information to Coding Tags or
Di-Tag Constructs
[0529] In another aspect, rather than writing information from the
coding tag to the recording tag following binding of a binding
agent to a macromolecule, information may be transferred from the
recording tag comprising an optional UMI sequence (e.g. identifying
a particular peptide or protein molecule) and at least one barcode
(e.g., a compartment tag, partition barcode, sample barcode,
spatial location barcode, etc.), to the coding tag, thereby
generating an extended coding tag (see FIG. 11A). In certain
embodiments, the binding agents and associated extended coding tags
are collected following each binding cycle and, optionally, prior
to Edman degradation chemistry steps. In certain embodiments, the
coding tags comprise a binding cycle specific tag. After completion
of all the binding cycles, such as detection of NTAAs in cyclic
Edman degradation, the complete collection of extended coding tags
can be amplified and sequenced, and information on the peptide
determined from the association between UMI (peptide identity),
encoder sequence (NTAA binding agent), compartment tag (single cell
or subset of proteome), binding cycle specific sequence (cycle
number), or any combination thereof. Library elements with the same
compartment tag/UMI sequence map back to the same cell, subset of
proteome, molecule, etc. and the peptide sequence can be
reconstructed. This embodiment may be useful in cases where the
recording tag sustains too much damage during the Edman degradation
process.
[0530] Provided herein are methods for analyzing a plurality of
macromolecules, comprising: (a) providing a plurality of
macromolecules and associated recording tags joined to a solid
support; (b) contacting the plurality of macromolecules with a
plurality of binding agents capable of binding to the plurality of
macromolecules, wherein each binding agent comprises a coding tag
with identifying information regarding the binding agent; (c) (i)
transferring the information of the macromolecule associated
recording tags to the coding tags of the binding agents that are
bound to the macromolecules to generate extended coding tags (see
FIG. 11A); or (ii) transferring the information of macromolecule
associated recording tags and coding tags of the binding agents
that are bound to the macromolecules to a di-tag construct (see
FIG. 11B); (d) collecting the extended coding tags or di-tag
constructs; (e) optionally repeating steps (b)-(d) for one or more
binding cycles; (f) analyzing the collection of extended coding
tags or di-tag constructs.
[0531] In certain embodiments, the information transfer from the
recording tag to the coding tag can be accomplished using a primer
extension step where the 3' terminus of recording tag is optionally
blocked to prevent primer extension of the recording tag (see,
e.g., FIG. 11A). The resulting extended coding tag and associated
binding agent can be collected after each binding event and
completion of information transfer. In an example illustrated in
FIG. 11B, the recording tag is comprised of a universal priming
site (U2'), a barcode (e.g., compartment tag "CT"), an optional UMI
sequence, and a common spacer sequence (Sp1). In certain
embodiments, the barcode is a compartment tag representing an
individual compartment, and the UMI can be used to map sequence
reads back to a particular protein or peptide molecule being
queried. As illustrated in the example in FIG. 11B, the coding tag
is comprised of a common spacer sequence (Sp2'), a binding agent
encoder sequence, and universal priming site (U3). Prior to the
introduction of the coding tag-labeled binding agent, an
oligonucleotide (U2) that is complementary to the U2' universal
priming site of the recording tag and comprises a universal priming
sequence U1 and a cycle specific tag, is annealed to the recording
tag U2'. Additionally, an adapter sequence, Sp1'-Sp2, is annealed
to the recording tag Sp1. This adapter sequence also capable of
interacting with the Sp2' sequence on the coding tag, bringing the
recording tag and coding tag in proximity to each other. A gap-fill
extension ligation assay is performed either prior to or after the
binding event. If the gap fill is performed before the binding
cycle, a post-binding cycle primer extension step is used to
complete di-tag formation. After collection of di-tags across a
number of binding cycles, the collection of di-tags is sequenced,
and mapped back to the originating peptide molecule via the UMI
sequence. It is understood that to maximize efficacy, the diversity
of the UMI sequences must exceed the diversity of the number of
single molecules tagged by the UMI.
[0532] In certain embodiments, the macromolecule is a protein or a
peptide. The peptide may be obtained by fragmenting a protein from
a biological sample.
[0533] The recording tag may be a DNA molecule, RNA molecule, PNA
molecule, BNA molecule, XNA molecule, LNA molecule a .gamma.PNA
molecule, or a combination thereof. The recording tag comprises a
UMI identifying the macromolecule (e.g., peptide) to which it is
associated. In certain embodiments, the recording tag further
comprises a compartment tag. The recording tag may also comprise a
universal priming site, which may be used for downstream
amplification. In certain embodiments, the recording tag comprises
a spacer at its 3' terminus. A spacer may be complementary to a
spacer in the coding tag. The 3'-terminus of the recording tag may
be blocked (e.g., photo-labile 3' blocking group) to prevent
extension of the recording tag by a polymerase, facilitating
transfer of information of the macromolecule associated recording
tag to the coding tag or transfer of information of the
macromolecule associated recording tag and coding tag to a di-tag
construct.
[0534] The coding tag comprises an encoder sequence identifying the
binding agent to which the coding agent is linked. In certain
embodiments, the coding tag further comprises a unique molecular
identifier (UMI) for each binding agent to which the coding tag is
linked. The coding tag may comprise a universal priming site, which
may be used for downstream amplification. The coding tag may
comprise a spacer at its 3'-terminus. The spacer may be
complementary to the spacer in the recording tag and can be used to
initiate a primer extension reaction to transfer recording tag
information to the coding tag. The coding tag may also comprise a
binding cycle specific sequence, for identifying the binding cycle
from which an extended coding tag or di-tag originated.
[0535] Transfer of information of the recording tag to the coding
tag may be effected by primer extension or ligation. Transfer of
information of the recording tag and coding tag to a di-tag
construct may be generated a gap fill reaction, primer extension
reaction, or both.
[0536] A di-tag molecule comprises functional components similar to
that of an extended recording tag. A di-tag molecule may comprise a
universal priming site derived from the recording tag, a barcode
(e.g., compartment tag) derived from the recording tag, an optional
unique molecular identifier (UMI) derived from the recording tag,
an optional spacer derived from the recording tag, an encoder
sequence derived from the coding tag, an optional unique molecular
identifier derived from the coding tag, a binding cycle specific
sequence, an optional spacer derived from the coding tag, and a
universal priming site derived from the coding tag.
[0537] In certain embodiments, the recording tag can be generated
using combinatorial concatenation of barcode encoding words. The
use of combinatorial encoding words provides a method by which
annealing and chemical ligation can be used to transfer information
from a PNA recording tag to a coding tag or di-tag construct (see,
e.g., FIGS. 12A-D). In certain embodiments where the methods of
analyzing a peptide disclosed herein involve cleavage of a terminal
amino acid via an Edman degradation, it may be desirable employ
recording tags resistant to the harsh conditions of Edman
degradation, such as PNA. One harsh step in the Edman degradation
protocol is anhydrous TFA treatment to cleave the N-terminal amino
acid. This step will typically destroy DNA. PNA, in contrast to
DNA, is highly-resistant to acid hydrolysis. The challenge with PNA
is that enzymatic methods of information transfer become more
difficult, i.e., information transfer via chemical ligation is a
preferred mode. In FIG. 11B, recording tag and coding tag
information are written using an enzymatic gap-fill extension
ligation step, but this is not currently feasibly with PNA
template, unless a polymerase is developed that uses PNA. The
writing of the barcode and UMI from the PNA recording tag to a
coding tag is problematic due to the requirement of chemical
ligation, products which are not easily amplified. Methods of
chemical ligation have been extensively described in the literature
(Gunderson et al. 1998, Genome Res. 8:1142-1153; Peng et al., 2010,
Eur. J. Org. Chem. 4194-4197; El-Sagheer et al., 2011, Org. Biomol.
Chem. 9:232-235; El-Sagheer et al., 2011, Proc. Natl. Acad. Sci.
USA 108:11338-11343; Litovchick et al., 2014, Artif. DNA PNA XNA 5:
e27896; Roloff et al., 2014, Methods Mol. Biol. 1050:131-141).
[0538] To create combinatorial PNA barcodes and UMI sequences, a
set of PNA words from an n-mer library can be combinatorially
ligated. If each PNA word derives from a space of 1,000 words, then
four combined sequences generate a coding space of
1,000.sup.4=10.sup.12 codes. In this way, from a starting set of
4,000 different DNA template sequences, over 10.sup.12 PNA codes
can be generated (FIG. 12A). A smaller or larger coding space can
be generated by adjusting the number of concatenated words, or
adjusting the number of elementary words. As such, the information
transfer using DNA sequences hybridized to the PNA recording tag
can be completed using DNA word assembly hybridization and chemical
ligation (see FIG. 12B). After assembly of the DNA words on the PNA
template and chemical ligation of the DNA words, the resulting
intermediate can be used to transfer information to/from the coding
tag (see FIG. 12C and FIG. 12D).
[0539] In certain embodiments, the macromolecule and associated
recording tag are covalently joined to the solid support. The solid
support may be a bead, an array, a glass surface, a silicon
surface, a plastic surface, a filter, a membrane, nylon, a silicon
wafer chip, a flow through chip, a biochip including signal
transducing electronics, a microtiter well, an ELISA plate, a
spinning interferometry disc, a nitrocellulose membrane, a
nitrocellulose-based polymer surface, a nanoparticle, or a
microsphere. The solid support may be a polystyrene bead, a polymer
bead, an agarose bead, an acrylamide bead, a solid core bead, a
porous bead, a paramagnetic bead, a glass bead, or a controlled
pore bead.
[0540] In certain embodiments, the binding agent is a protein or a
polypeptide. In some embodiments, the binding agent is a modified
or variant aminopeptidase, a modified or variant amino acyl tRNA
synthetase, a modified or variant anticalin, a modified or variant
ClpS, or a modified or variant antibody or binding fragment
thereof. In certain embodiments, the binding agent binds to a
single amino acid residue, a di-peptide, a tri-peptide, or a
post-translational modification of the peptide. In some
embodiments, the binding agent binds to an N-terminal amino acid
residue, a C-terminal amino acid residue, or an internal amino acid
residue. In some embodiments, the binding agent binds to an
N-terminal peptide, a C-terminal peptide, or an internal peptide.
In some embodiments, the binding agent is a site-specific covalent
label of an amino acid of post-translational modification of a
peptide.
[0541] In certain embodiments, following contacting the plurality
of macromolecules with a plurality of binding agents in step (b),
complexes comprising the macromolecule and associated binding
agents are dissociated from the solid support and partitioned into
an emulsion of droplets or microfluidic droplets. In some
embodiments, each microfluidic droplet comprises at most one
complex comprising the macromolecule and the binding agents.
[0542] In certain embodiments, the recording tag is amplified prior
to generating an extended coding tag or di-tag construct. In
embodiments where complexes comprising the macromolecule and
associated binding agents are partitioned into droplets or
microfluidic droplets such that there is at most one complex per
droplet, amplification of recording tags provides additional
recording tags as templates for transferring information to coding
tags or di-tag constructs (see FIG. 13 and FIG. 14). Emulsion
fusion PCR may be used to transfer the recording tag information to
the coding tag or to create a population of di-tag constructs.
[0543] The collection of extended coding tags or di-tag constructs
that are generated may be amplified prior to analysis. Analysis of
the collection of extended coding tags or di-tag constructs may
comprise a nucleic acid sequencing method. The sequencing by
synthesis, sequencing by ligation, sequencing by hybridization,
polony sequencing, ion semiconductor sequencing, or pyrosequencing.
The nucleic acid sequencing method may be single molecule real-time
sequencing, nanopore-based sequencing, or direct imaging of DNA
using advanced microscopy.
[0544] Edman degradation and methods that chemically label
N-terminal amines such as PITC, Sanger's agent (DNFB), SNFB,
acetylation reagents, amidination (guanidination) reagents, etc.
can also modify internal amino acids and the exocyclic amines on
standard nucleic acid or PNA bases such as adenine, guanine, and
cytosine. In a certain embodiments, the peptide's .epsilon.-amines
of lysine residues are blocked with an acid anhydride, a
guandination agent, or similar blocking reagent, prior to
sequencing. Although exocyclic amines of DNA bases are much less
reactive the primary N-terminal amine of peptides, controlling the
reactivity of amine reactive agents toward N-terminal amines
reducing non-target activity toward internal amino acids and
exocyclic amines on DNA bases is important to the sequencing assay.
The selectivity of the modification reaction can be modulated by
adjusting reaction conditions such as pH, solvent (aqueous vs.
organic, aprotic, non-polar, polar aprotic, ionic liquids, etc.),
bases and catalysts, co-solvents, temperature, and time. In
addition, reactivity of exocyclic amines on DNA bases is modulated
by whether the DNA is in ssDNA or dsDNA form. To minimize
modification, prior to NTAA chemical modification, the recording
tag can be hybridized with complementary DNA probes: P1', {Sample
BC.sub.S}', {Sp-BC}', etc. In another embodiment, the use of
nucleic acids having protected exocyclic amines can also be used
(Ohkubo, Kasuya et al. 2008). In yet another embodiment, "less
reactive" amine labeling compounds, such as SNFB, mitigates
off-target labeling of internal amino acids and exocylic amines on
DNA (Carty and Hirs 1968). SNFB is less reactive than DNFB due to
the fact that the para sulfonyl group is more electron withdrawing
the para nitro group, leading to less active fluorine substitution
with SNFB than DNFB.
[0545] Titration of coupling conditions and coupling reagents to
optimize NTAA .alpha.-amine modification and minimize off-target
amino acid modification or DNA modification is possible through
careful selection of chemistry and reaction conditions
(concentrations, temperature, time, pH, solvent type, etc.). For
instance, DNFB is known to react with secondary amines more readily
in aprotic solvents such as acetonitrile versus in water. Mild
modification of the exocyclic amines may still allow a
complementary probe to hybridize the sequence but would likely
disrupt polymerase-based primer extension. It is also possible to
protect the exocylic amine while still allowing hydrogen bonding.
This was described in a recent publication in which protected bases
are still capable of hybridizing to targets of interest (Ohkubo,
Kasuya et al. 2008). In one embodiment, an engineered polymerase is
used to incorporate nucleotides with protected bases during
extension of the recording tag on a DNA coding tag template. In
another embodiment, an engineered polymerase is used to incorporate
nucleotides on a recording tag PNA template (w/ or w/o protected
bases) during extension of the coding tag on the PNA recording tag
template. In another embodiment, the information can be transferred
from the recording tag to the coding tag by annealing an exogenous
oligonucleotide to the PNA recording tag. Specificity of
hybridization can be facilitated by choosing UMIs which are
distinct in sequence space, such as designs based on assembly of
n-mer words (Gerry, Witowski et al. 1999).
[0546] While Edman-like N-terminal peptide degradation sequencing
can be used to determine the linear amino acid sequence of the
peptide, an alternative embodiment can be used to perform partial
compositional analysis of the peptide with methods utilizing
extended recording tags, extended coding tags, and di-tags. Binding
agents or chemical labels can be used to identify both N-terminal
and internal amino acids or amino acid modifications on a peptide.
Chemical agents can covalently modify amino acids (e.g., label) in
a site-specific manner (Sletten and Bertozzi 2009, Basle, Joubert
et al. 2010) (Spicer and Davis 2014). A coding tag can be attached
to a chemical labeling agent that targets a single amino acid, to
facilitate encoding and subsequent identification of site-specific
labeled amino acids (see, FIG. 13).
[0547] Peptide compositional analysis does not require cyclic
degradation of the peptide, and thus circumvents issues of exposing
DNA containing tags to harsh Edman chemistry. In a cyclic binding
mode, one can also employ extended coding tags or di-tags to
provide compositional information (amino acids or
dipeptide/tripeptide information), PTM information, and primary
amino acid sequence. In one embodiment, this composition
information can be read out using an extended coding tag or di-tag
approach described herein. If combined with UMI and compartment tag
information, the collection of extended coding tags or di-tags
provides compositional information on the peptides and their
originating compartmental protein or proteins. The collection of
extended coding tags or di-tags mapping back to the same
compartment tag (and ostensibly originating protein molecule) is a
powerful tool to map peptides with partial composition information.
Rather than mapping back to the entire proteome, the collection of
compartment tagged peptides is mapped back to a limited subset of
protein molecules, greatly increasing the uniqueness of
mapping.
[0548] Binding agents used herein may recognize a single amino
acid, dipeptide, tripeptide, or even longer peptide sequence
motifs. Tessler (2011, Digital Protein Analysis: Technologies for
Protein Diagnostics and Proteomics through Single Molecule
Detection. Ph.D., Washington University in St. Louis) demonstrated
that relatively selective dipeptide antibodies can be generated for
a subset of charged dipeptide epitopes (Tessler 2011). The
application of directed evolution to alternate protein scaffolds
(e.g., aaRSs, anticalins, ClpSs, etc.) and aptamers may be used to
expand the set of dipeptide/tripeptide binding agents. The
information from dipeptide/tripeptide compositional analysis
coupled with mapping back to a single protein molecule may be
sufficient to uniquely identify and quantitate each protein
molecule. At a maximum, there are a total of 400 possible dipeptide
combinations. However, a subset of the most frequent and most
antigenic (charged, hydrophilic, hydrophobic) dipeptide should
suffice to which to generate binding agents. This number may
constitute a set of 40-100 different binding agents. For a set of
40 different binding agents, the average 10-mer peptide has about
an 80% chance of being bound by at least one binding agent.
Combining this information with all the peptides deriving from the
same protein molecule may allow identification of the protein
molecule. All this information about a peptide and its originating
protein can be combined to give more accurate and precise protein
sequence characterization.
[0549] A recent digital protein characterization assay has been
proposed that uses partial peptide sequence information
(Swaminathan et al., 2015, PLoS Comput. Biol. 11:e1004080) (Yao,
Docter et al. 2015). Namely, the approach employs fluorescent
labeling of amino acids which are easily labeled using standard
chemistry such as cysteine, lysine, arginine, tyrosine,
aspartate/glutamate (Basle, Joubert et al. 2010). The challenge
with partial peptide sequence information is that the mapping back
to the proteome is a one-to-many association, with no unique
protein identified. This one-to-many mapping problem can be solved
by reducing the entire proteome space to limited subset of protein
molecules to which the peptide is mapped back. In essence, a single
partial peptide sequence may map back to 100's or 1000's of
different protein sequences, however if it is known that a set of
several peptides (for example, 10 peptides originating from a
digest of a single protein molecule) all map back to a single
protein molecule contained in the subset of protein molecules
within a compartment, then it is easier to deduce the identity of
the protein molecule. For instance, an intersection of the peptide
proteome maps for all peptides originating from the same molecule
greatly restricts the set of possible protein identities (see FIGS.
15A-15B).
[0550] In particular, mappability of a partial peptide sequence or
composition is significantly enhanced by making innovative use of
compartmental tags and UMIs. Namely, the proteome is initially
partitioned into barcoded compartments, wherein the compartmental
barcode is also attached to a UMI sequence. The compartment barcode
is a sequence unique to the compartment, and the UMI is a sequence
unique to each barcoded molecule within the compartment (see FIG.
16). In one embodiment, this partitioning is accomplished using
methods similar to those disclosed in PCT Publication
WO2016/061517, which is incorporated by reference in its entirety,
by direct interaction of a DNA tag labeled polypeptide with the
surface of a bead via hybridization to DNA compartment barcodes
attached to the bead (see FIG. 31C). A primer extension step
transfers information from the bead-linked compartment barcode to
the DNA tag on the polypeptide (FIG. 20). In another embodiment,
this partitioning is accomplished by co-encapsulating UMI
containing, barcoded beads and protein molecules into droplets of
an emulsion. In addition, the droplet optionally contains a
protease that digests the protein into peptides. A number of
proteases can be used to digest the reporter tagged polypeptides
(Switzar, Giera et al. 2013). Co-encapsulation of enzymatic
ligases, such as butelase I, with proteases may will call for
modification to the enzyme, such as pegylation, to make it
resistant to protease digestion (Frokjaer and Otzen 2005, Kang,
Wang et al. 2010). After digestion, the peptides are ligated to the
barcode-UMI tags. In the preferred embodiment, the barcode-UMI tags
are retained on the bead to facilitate downstream biochemical
manipulations (see FIG. 13).
[0551] After barcode-UMI ligation to the peptides, the emulsion is
broken and the beads harvested. The barcoded peptides can be
characterized by their primary amino acid sequence, or their amino
acid composition. Both types of information about the peptide can
be used to map it back to a subset of the proteome. In general,
sequence information maps back to a much smaller subset of the
proteome than compositional information. Nonetheless, by combining
information from multiple peptides (sequence or composition) with
the same compartment barcode, it is possible to uniquely identify
the protein or proteins from which the peptides originate. In this
way, the entire proteome can be characterized and quantitated.
Primary sequence information on the peptides can be derived by
performing a peptide sequencing reaction with extended recording
tag creation of a DNA Encoded Library (DEL) representing the
peptide sequence. In the preferred embodiment, the recording tag is
comprised of a compartmental barcode and UMI sequence. This
information is used along with the primary or PTM amino acid
information transferred from the coding tags to generate the final
mapped peptide information.
[0552] An alternative to peptide sequence information is to
generate peptide amino acid or dipeptide/tripeptide compositional
information linked to compartmental barcodes and UMIs. This is
accomplished by subjecting the beads with UMI-barcoded peptides to
an amino acid labeling step, in which select amino acids (internal)
on each peptide are site-specifically labeled with a DNA tag
comprising amino acid code information and another amino acid UMI
(AA UMI) (see, FIG. 13). The amino acids (AAs) most tractable to
chemical labeling are lysines, arginines, cysteines, tyrosines,
tryptophans, and aspartates/glutamates, but it may also be feasible
to develop labeling schemes for the other AAs as well (Mendoza and
Vachet, 2009). A given peptide may contain several AAs of the same
type. The presence of multiple amino acids of the same type can be
distinguished by virtue of the attached AA UMI label. Each labeling
molecule has a different UMI within the DNA tag enabling counting
of amino acids. An alternative to chemical labeling is to "label"
the AAs with binding agents. For instance, a tyrosine-specific
antibody labeled with a coding tag comprising AA code information
and an AA UMI could be used mark all the tyrosines of the peptides.
The caveat with this approach is the steric hindrance encountered
with large bulky antibodies, ideally smaller scFvs, anticalins, or
ClpS variants would be used for this purpose.
[0553] In one embodiment, after tagging the AAs, information is
transferred between the recording tag and multiple coding tags
associated with bound or covalently coupled binding agents on the
peptide by compartmentalizing the peptide complexes such that a
single peptide is contained per droplet and performing an emulsion
fusion PCR to construct a set of extended coding tags or di-tags
characterizing the amino acid composition of the compartmentalized
peptide. After sequencing the di-tags, information on peptides with
the same barcodes can be mapped back to a single protein
molecule.
[0554] In a particular embodiment, the tagged peptide complexes are
disassociated from the bead (see FIG. 13), partitioned into small
mini-compartments (e.g., micro-emulsion) such that on average only
a single labeled/bound binding agent peptide complex resides in a
given compartment. In a particular embodiment, this
compartmentalization is accomplished through generation of
micro-emulsion droplets (Shim, Ranasinghe et al. 2013, Shembekar,
Chaipan et al. 2016). In addition to the peptide complex, PCR
reagents are also co-encapsulated in the droplets along with three
primers (U1, Sp, and U2.sub.tr). After droplet formation, a few
cycles of emulsion PCR are performed (.about.5-10 cycles) at higher
annealing temperature such than only U1 and Sp anneal and amplify
the recording tag product (see FIG. 13). After this initial 5-10
cycles of PCR, the annealing temperature is reduced such that
U2.sub.tr and the Sp.sub.tr on the amino acid code tags participate
in the amplification, and another .about.10 rounds are performed.
The three-primer emulsion PCR effectively combines the peptide
UMI-barcode with all the AA code tags generating a di-tag library
representation of the peptide and its amino acid composition. Other
modalities of performing the three primer PCR and concatenation of
the tags can also be employed. Another embodiment is the use of a
3' blocked U2 primer activated by photo-deblocking, or addition of
an oil soluble reductant to initiate 3' deblocking of a labile
blocked 3' nucleotide. Post-emulsion PCR, another round of PCR can
be performed with common primers to format the library elements for
NGS sequencing.
[0555] In this way, the different sequence components of the
library elements are used for counting and classification purposes.
For a given peptide (identified by the compartment barcode-UMI
combination), there are many library elements, each with an
identifying AA code tag and AA UMI (see FIG. 13). The AA code and
associated UMI is used to count the occurrences of a given amino
acid type in a given peptide. Thus the peptide (perhaps a GluC,
LysC, or Endo AsnN digest) is characterized by its amino acid
composition (e.g., 2 Cys, 1 Lys, 1 Arg, 2 Tyr, etc.) without regard
to spatial ordering. This nonetheless provides a sufficient
signature to map the peptide to a subset of the proteome, and when
used in combination with the other peptides derived from the same
protein molecule, to uniquely identify and quantitate the
protein.
X. Terminal Amino Acid (TAA) Labelling Methods
[0556] In certain embodiments, a terminal amino acid (e.g., NTAA or
CTAA) of a peptide is modified or labeled prior to contacting the
peptide with a binding agent in the methods described herein.
[0557] In some embodiments, the NTAA is reacted with
phenylisothiocyanate (PITC) to generate a phenylthiocarbamoyl
(PTC)-NTAA derivative. Edman degradation typically uses phenyl
isothiocyanate (PITC) to label the N-terminus. PITC has two
properties well suited for the methods disclosed herein: (1) PITC
labels the N-terminus amine group with high efficiency; and (2) the
resultant PTC derivitized NTAA undergoes self-isomerization, upon
acid treatment, resulting in cleaving of the amino acid from the
remaining peptide.
[0558] Other reagents that may be used to label the NTAA include:
4-sulfophenyl isothiocyanate, 3-pyridyl isothiocyante (PYITC),
2-piperidinoethyl isothiocyanate (PEITC), 3-(4-morpholino) propyl
isothiocyanate (MPITC), 3-(diethylamino)propyl isothiocyanate
(DEPTIC) (Wang et al., 2009, Anal Chem 81: 1893-1900),
(1-fluoro-2,4-dinitrobenzene (Sanger's reagent, DNFB), dansyl
chloride (DNS-Cl, or 1-dimethylaminonaphthalene-5-sulfonyl
chloride), 4-sulfonyl-2-nitrofluorobenzene (SNFB), acetylation
reagents, amidination (guanidination) reagents,
2-carboxy-4,6-dinitrochlorobenzene, 7-methoxycoumarin acetic acid,
a thioacylation reagent, a thioacetylation reagent, and a
thiobenzylation reagent. If the NTAA is blocked to labelling, there
are a number of approaches to unblock the terminus, such as
removing N-acetyl blocks with acyl peptide hydrolase (APH)
(Farries, Harris et al., 1991, Eur. J. Biochem. 196:679-685).
Methods of unblocking the N-terminus of a peptide are known in the
art (see, e.g., Krishna et al., 1991, Anal. Biochem. 199:45-50;
Leone et al., 2011, Curr. Protoc. Protein Sci., Chapter
11:Unit11.7; Fowler et al., 2001, Curr. Protoc. Protein Sci.,
Chapter 11: Unit 11.7, each of which is hereby incorporated by
reference in its entirety).
[0559] Dansyl chloride reacts with the free amine group of a
peptide to yield a dansyl derivative of the NTAA. DNFB and SNFB
react the .alpha.-amine groups of a peptide to produce DNP-NTAA,
and SNP-NTAA, respectively. Additionally, both DNFB and SNFB also
react with the with .epsilon.-amine of lysine residues. DNFB also
reacts with tyrosine and histidine amino acid residues. SNFB has
better selectivity for amine groups than DNFB, and is preferred for
NTAA modification (Carty and Hirs 1968). In certain embodiments,
lysine .epsilon.-amines are pre-blocked with an organic anhydride
prior to polypeptide protease digestion into peptides.
[0560] Another useful NTAA modifier is an acetyl group since a
known enzyme exists to remove acetylated NTAAs, namely acyl peptide
hydrolases (APH) which cleaves the N-terminal acetylated amino
acid, effectively shortening the peptide by a single amino acid
{Chang, 2015 #373; Friedmann, 2013 #374}. The NTAA can be
chemically acetylated with acetic anhydride or enzymatically
acetylated with N-terminal acetyltransferases (NAT) {Chang, 2015
#373; Friedmann, 2013 #374}. Yet another useful NTAA modifier is an
amidinyl (guanidinyl) moiety since a proven cleavage chemistry of
the amidinated NTAA is known in the literature, namely mild
incubation of the N-terminal amidinated peptide with 0.5-2% NaOH
results in cleavage of the N-terminal amino acid {Hamada, 2016
#383}. This effectively provides a mild Edman-like chemical
N-terminal degradation peptide sequencing process. Moreover,
certain amidination (guanidination) reagents and the downstream
NaOH cleavage are quite compatible with DNA encoding.
[0561] The presence of the DNP/SNP, acetyl, or amidinyl
(guanidinyl) group on the NTAA may provide a better handle for
interaction with an engineered binding agent. A number of
commercial DNP antibodies exist with low nM affinities. Other
methods of labeling the NTAA include labeling with trypligase
(Liebscher et al., 2014, Angew Chem Int Ed Engl 53:3024-3028) and
amino acyl transferase (Wagner, et al., 2011, J Am Chem Soc
133:15139-15147).
[0562] Isothiocyates, in the presence of ionic liquids, have been
shown to have enhanced reactivity to primary amines. Ionic liquids
are excellent solvents (and serve as a catalyst) in organic
chemical reactions and can enhance the reaction of isothiocyanates
with amines to form thioureas. An example is the use of the ionic
liquid 1-butyl-3-methyl-imidazolium tetraflouoraborate [Bmim][BF4]
for rapid and efficient labeling of aromatic and aliphatic amines
by phenyl isothiocyanate (PITC) (Le, Chen et al. 2005). Edman
degradation involves the reaction of isothiocyanates, such at PITC,
with the amino N-terminus of peptides. As such, in one embodiment
ionic liquids are used to improve the efficiency of the Edman
degradation process by providing milder labeling and degradation
conditions. For instance, the use of 5% (vol./vol.) PITC in ionic
liquid [Bmim][BF4] at 25.degree. C. for 10 min. is more efficient
than labeling under standard Edman PITC derivatization conditions
which employ 5% (vol./vol.) PITC in a solution containing pyridine,
ethanol, and ddH2O (1:1:1 vol./vol./vol.) at 55.degree. C. for 60
min (Wang, Fang et al. 2009). In a preferred embodiment, internal
lysine, tyrosine, histidine, and cysteine amino acids are blocked
within the polypeptide prior to fragmentation into peptides. In
this way, only the peptide .alpha.-amine group of the NTAA is
accessible for modification during the peptide sequencing reaction.
This is particularly relevant when using DNFB (Sanger' reagent) and
dansyl chloride.
[0563] In certain embodiments, the NTAA have been blocked prior to
the NTAA labelling step (particularly the original N-terminus of
the protein). If so, there are a number of approaches to unblock
the N-terminus, such as removing N-acetyl blocks with acyl peptide
hydrolase (APH) (Farries, Harris et al. 1991). A number of other
methods of unblocking the N-terminus of a peptide are known in the
art (see, e.g., Krishna et al., 1991, Anal. Biochem. 199:45-50;
Leone et al., 2011, Curr. Protoc. Protein Sci., Chapter
11:Unit11.7; Fowler et al., 2001, Curr. Protoc. Protein Sci.,
Chapter 11: Unit 11.7, each of which is hereby incorporated by
reference in its entirety).
[0564] The CTAA can be modified with a number of different
carboxyl-reactive reagents as described by Hermanson (Hermanson
2013). In another example, the CTAA is modified with a mixed
anhydride and an isothiocyanate to generate a thiohydantoin ((Liu
and Liang 2001) and U.S. Pat. No. 5,049,507). The thiohydantoin
modified peptide can be cleaved at elevated temperature in base to
expose the penultimate CTAA, effectively generating a C-terminal
based peptide degradation sequencing approach (Liu and Liang 2001).
Other modifications that can be made to the CTAA include addition
of a para-nitroanilide group and addition of
7-amino-4-methylcoumarinyl group.
XI. Terminal Amino Acid Cleavage Methods
[0565] In certain embodiments relating to analyzing peptides,
following binding of a terminal amino acid (N-terminal or
C-terminal) by a binding agent and transfer of coding tag
information to a recording tag, transfer of recording tag
information to a coding tag, transfer of recording tag information
and coding tag information to a di-tag construct, the terminal
amino acid is removed or cleaved from the peptide to expose a new
terminal amino acid. In some embodiments, the terminal amino acid
is an NTAA. In other embodiments, the terminal amino acid is a
CTAA.
[0566] Cleavage of a terminal amino acid can be accomplished by any
number of known techniques, including chemical cleavage and
enzymatic cleavage. An example of chemical cleavage is Edman
degradation. During Edman degradation of the peptide the n NTAA is
reacted with phenyl isothiocyanate (PITC) under mildly alkaline
conditions to form the phenylthiocarbamoyl-NTAA derivative. Next,
under acidic conditions, the phenylthiocarbamoyl-NTAA derivative is
cleaved generating a free thiazolinone derivative, and thereby
converting the n-1 amino acid of the peptide to an N-terminal amino
acid (n-1 NTAA). The steps in this process are illustrated
below:
##STR00001##
[0567] Typical Edman Degradation, as described above requires
deployment of harsh high temperature chemical conditions (e.g.,
anhydrous TFA) for long incubation times. These conditions are
generally not compatible with nucleic acid encoding of
macromolecules.
[0568] To convert chemical Edman Degradation to a nucleic acid
encoding-friendly approach, the harsh chemical steps are replaced
with mild chemical degradation or efficient enzymatic steps. In one
embodiment, chemical Edman degradation can be employed using milder
conditions than original described. Several milder cleavage
conditions for Edman degradation have been described in the
literature, including replacing anhydrous TFA with triethylamine
acetate in acetonitrile (see, e.g., Barrett, 1985, Tetrahedron
Lett. 26:4375-4378, incorporated by reference in its entirety).
Cleavage of the NTAA may also be accomplished using thioacylation
degradation, which uses milder cleavage conditions as compared to
Edman degradation (see, U.S. Pat. No. 4,863,870).
[0569] In another embodiment, cleavage by anhydrous TFA may be
replaced with an "Edmanase", an engineered enzyme that catalyzes
the removal of the PITC-derivatized N-terminal amino acid via
nucleophilic attack of the thiourea sulfur atom on the carbonyl
group of the scissile peptide bond under mild conditions (see, U.S.
Patent Publication US2014/0273004, incorporated by reference in its
entirety). Edmanase was made by modifying cruzain, a cysteine
protease from Trypanosoma cruzi (Borgo, 2014). A C25G mutation
removes the catalytic cysteine residue while three mutations (G65S,
A138C, L160Y) were selected to create steric fit with the phenyl
moiety of the Edman reagent (PITC).
[0570] Enzymatic cleavage of a NTAA may also be accomplished by an
aminopeptidase. Aminopeptidases naturally occur as monomeric and
multimeric enzymes, and may be metal or ATP-dependent. Natural
aminopeptidases have very limited specificity, and generically
cleave N-terminal amino acids in a processive manner, cleaving one
amino acid off after another. For the methods described here,
aminopeptidases may be engineered to possess specific binding or
catalytic activity to the NTAA only when modified with an
N-terminal label. For example, an aminopeptidase may be engineered
such than it only cleaves an N-terminal amino acid if it is
modified by a group such as DNP/SNP, PTC, dansyl chloride, acetyl,
amidinyl, etc. In this way, the aminopeptidase cleaves only a
single amino acid at a time from the N-terminus, and allows control
of the degradation cycle. In some embodiments, the modified
aminopeptidase is non-selective as to amino acid residue identity
while being selective for the N-terminal label. In other
embodiments, the modified aminopeptidase is selective for both
amino acid residue identity and the N-terminal label. An example of
a model of modifying the specificity of enzymatic NTAA degradation
is illustrated by Borgo and Havranek, where through
structure-function aided design, a methionine aminopeptidase was
converted into a leucine aminopeptidase (Borgo and Havranek 2014).
A similar approach can be taken with a modified NTAA, such as
DNP/SNP-modified NTAAs, wherein an aminopeptidase is engineered
(using both structural-function based-design and directed
evolution) to cleave only an N-terminal amino acid having a DNP/SNP
group present. Engineered aminopeptidase mutants that bind to and
cleave individual or small groups of labelled (biotinylated) NTAAs
have been described (see, PCT Publication No. WO2010/065322).
[0571] In certain embodiments, a compact monomeric metalloenzymatic
aminopeptidase is engineered to recognize and cleave DNP-labeled
NTAAs. The use of a monomeric metallo-aminopeptidase has two key
advantages: 1) compact monomeric proteins are much easier to
display and screen using phage display; 2) a metallo-aminopeptidase
has the unique advantage in that its activity can be turned on/off
at will by adding or removing the appropriate metal cation.
Exemplary aminopeptidases include the M28 family of
aminopeptidases, such as Streptomyces sp. KK506 (SKAP) (Yoo, Ahn et
al. 2010), Streptomyces griseus (SGAP), Vibrio proteolyticus
(VPAP), (Spungin and Blumberg 1989, Ben-Meir, Spungin et al. 1993).
These enzymes are stable, robust, and active at room temperature
and pH 8.0, and thus compatible with mild conditions preferred for
peptide analysis.
[0572] In another embodiment, cyclic cleavage is attained by
engineering the aminopeptidase to be active only in the presence of
the N-terminal amino acid label. Moreover, the aminopeptidase may
be engineered to be non-specific, such that it does not selectively
recognize one particular amino acid over another, but rather just
recognizes the labeled N-terminus. In a preferred embodiment, a
metallopeptidase monomeric aminopeptidase (e.g. Vibro leucine
aminopeptidase) (Hernandez-Moreno, Villasenor et al. 2014), is
engineered to cleave only modified NTAAs (e.g., PTC, DNP, SNP,
acetylated, acylated, etc.)
[0573] In yet another embodiment, cyclic cleavage is attained by
using an engineered acylpeptide hydrolase (APH) to cleave an
acetylated NTAA. APH is a serine peptidase that is capable of
catalyzing the removal of Na-acetylated amino acids from blocked
peptides, and is a key regulator of N-terminally acetylated
proteins in eukaryal, bacterial and archaeal cells. In certain
embodiments, the APH is a dimeric and has only exopeptidase
activity (Gogliettino, Balestrieri et al. 2012, Gogliettino, Riccio
et al. 2014). The engineered APH may have higher affinity and less
selectivity than endogenous or wild type APHs.
[0574] In yet another embodiment, amidination (guanidinylation) of
the NTAA is employed to enable mild cleavage of the labeled NTAA
using NaOH (Hamada, 2016, incorporated by reference in its
entirety). A number of amidination (guanidinylation) reagents are
known in the art including: S-methylisothiurea,
3,5-dimethylpyrazole-1-carboxamidine, S-ethylthiouronium bromide,
S-ethylthiouronium chloride, O-methylisourea, O-methylisouronium
sulfate, O-methylisourea hydrogen sulfate, 2-methyl-1-nitroisourea,
aminoiminomethanesulfonic acid, cyanamide, cyanoguanide,
dicyandiamide, 3,5-dimethyl-1-guanylpyrazole nitrate and
3,5-dimethyl pyrazole,
N,N'-bis(ortho-chloro-Cbz)-S-methylisothiourea and
N,N'-bis(ortho-bromo-Cbz)-S-methylisothiourea (Katritzky, 2005,
incorporated by reference in its entirety).
[0575] An example of a NTAA labeling, binding, and degradation
workflow is as follows (see FIGS. 41 and 42): a large collection of
recording tag labeled peptides (e.g., 50 million-1 billion) from a
proteolytic digest are immobilized randomly on a single molecule
sequencing substrate (e.g., porous beads) at an appropriate
intramolecular spacing. In a cyclic manner, the N-terminal amino
acid (NTAA) of each peptide are modified with a small chemical
moiety (e.g., DNP, SNP, acetyl) to provide cyclic control of the
NTAA degradation process, and enhance binding affinity by a cognate
binding agent. The modified N-terminal amino acid (e.g., DNP-NTAA,
SNP-NTAA, acetyl-NTAA) of each immobilized peptide is bound by the
cognate NTAA binding agent, and information from the coding tag
associated with the bound NTAA binding agent is transferred to the
recording tag associated with the immobilized peptide. After NTAA
recognition, binding, and transfer of coding tag information to the
recording tag, the labelled NTAA is removed by exposure to an
engineered aminopeptidase (e.g., for DNP-NTAA or SNP-NTAA) or
engineered APH (e.g., for acetyl-NTAA), that is capable of NTAA
cleavage only in the presence of the label. Other NTAA labels
(e.g., PITC) could also be employed with a suitably engineered
aminopeptidase. In a particular embodiment, a single engineered
aminopeptidase or APH universally cleaves all possible NTAAs
(including post-translational modification variants) that possess
the N-terminal amino acid label. In another particular embodiment,
two, three, four, or more engineered aminopeptidases or APHs are
used to cleave the repertoire of labeled NTAAs.
[0576] Aminopeptidases with activity to DNP or SNP labeled NTAAs
may be selected using a screen combining tight-binding selection on
the apo-enzyme (inactive in absence of metal cofactor) followed by
a functional catalytic selection step, like the approach described
by Ponsard et al. in engineering the metallo-beta-lactamase enzyme
for benzylpenicillin (Ponsard, Galleni et al. 2001,
Fernandez-Gacio, Uguen et al. 2003). This two-step selection is
involves using a metallo-AP activated by addition of Zn2+ ions.
After tight binding selection to an immobilized peptide substrate,
Zn2+ is introduced, and catalytically active phage capable of
hydrolyzing the NTAA labeled with DNP or SNP leads to release of
the bound phage into the supernatant. Repeated selection rounds are
performed to enrich for active APs for DNP or SNP labeled NTAA
cleavage.
[0577] In any of the embodiments provided herein, recruitment of an
NTAA cleavage reagent to the NTAA may be enhanced via a chimeric
cleavage enzyme and chimeric NTAA modifier, wherein the chimeric
cleavage enzyme and chimeric NTAA modifier each comprise a moiety
capable of a tight binding reaction with each other (e.g.,
biotin-streptavidin) (see, FIG. 39). For example, an NTAA may be
modified with biotin-PITC, and a chimeric cleavage enzyme
(streptavidin-Edmanase) is recruited to the modified NTAA via the
streptavidin-biotin interaction, improving the affinity and
efficiency of the cleavage enzyme. The modified NTAA is cleaved and
diffuses away from the peptide along with the associated cleavage
enzyme. In the example of a chimeric Edmanase, this approach
effectively increases the affinity K.sub.D from .mu.M to
sub-picomolar. A similar cleavage enhancement can also be realized
via tethering using a DNA tag on the cleavage agent interacting
with the recording tag (see FIG. 44).
[0578] As an alternative to NTAA cleavage, a dipeptidyl amino
peptidase (DAP) can be used to cleave the last two N-terminal amino
acids from the peptide. In certain embodiments, a single NTAA can
be cleaved (see FIG. 45): FIG. 45 depicts an approach to N-terminal
degradation in which N-terminal ligation of a butelase I peptide
substrate attaches a TEV endopeptidase substrate to the N-terminal
of the peptide. After attachment, TEV endopeptidase cleaves the
newly ligated peptide from the query peptide (peptide undergoing
sequencing) leaving a single asparagine (N) attached to the NTAA.
Incubation with DAP, which cleaves two amino acids from the
N-terminus, results in a net removal of the original NTAA. This
whole process can be cycled in the N-terminal degradation
process.
[0579] For embodiments relating to CTAA binding agents, methods of
cleaving CTAA from peptides are also known in the art. For example,
U.S. Pat. No. 6,046,053 discloses a method of reacting the peptide
or protein with an alkyl acid anhydride to convert the
carboxy-terminal into oxazolone, liberating the C-terminal amino
acid by reaction with acid and alcohol or with ester. Enzymatic
cleavage of a CTAA may also be accomplished by a carboxypeptidase.
Several carboxypeptidases exhibit amino acid preferences, e.g.,
carboxypeptidase B preferentially cleaves at basic amino acids,
such as arginine and lysine. As described above, carboxypeptidases
may also be modified in the same fashion as aminopeptidases to
engineer carboxypeptidases that specifically bind to CTAAs having a
C-terminal label. In this way, the carboxypeptidase cleaves only a
single amino acid at a time from the C-terminus, and allows control
of the degradation cycle. In some embodiments, the modified
carboxypeptidase is non-selective as to amino acid residue identity
while being selective for the C-terminal label. In other
embodiments, the modified carboxypeptidase is selective for both
amino acid residue identity and the C-terminal label.
XII. Processing and Analysis of Extended Recording Tags, Extended
Coding Tags, or Di-Tags
[0580] Extended recording tag, extended coding tag, and di-tag
libraries representing the macromolecule(s) of interest can be
processed and analysed using a variety of nucleic acid sequencing
methods. Examples of sequencing methods include, but are not
limited to, chain termination sequencing (Sanger sequencing); next
generation sequencing methods, such as sequencing by synthesis,
sequencing by ligation, sequencing by hybridization, polony
sequencing, ion semiconductor sequencing, and pyrosequencing; and
third generation sequencing methods, such as single molecule real
time sequencing, nanopore-based sequencing, duplex interrupted
sequencing, and direct imaging of DNA using advanced
microscopy.
[0581] A library of extended recording tags, extended coding tags,
or di-tags may be amplified in a variety of ways. A library of
extended recording tags, extended coding tags, or di-tags may
undergo exponential amplification, e.g., via PCR or emulsion PCR.
Emulsion PCR is known to produce more uniform amplification (Hori,
Fukano et al. 2007). Alternatively, a library of extended recording
tags, extended coding tags, or di-tags may undergo linear
amplification, e.g., via in vitro transcription of template DNA
using T7 RNA polymerase. The library of extended recording tags,
extended coding tags, or di-tags can be amplified using primers
compatible with the universal forward priming site and universal
reverse priming site contained therein. A library of extended
recording tags, extended coding tags, or di-tags can also be
amplified using tailed primers to add sequence to either the
5'-end, 3'-end or both ends of the extended recording tags,
extended coding tags, or di-tags. Sequences that can be added to
the termini of the extended recording tags, extended coding tags,
or di-tags include library specific index sequences to allow
multiplexing of multiple libraries in a single sequencing run,
adaptor sequences, read primer sequences, or any other sequences
for making the library of extended recording tags, extended coding
tags, or di-tags compatible for a sequencing platform. An example
of a library amplification in preparation for next generation
sequencing is as follows: a 20 .mu.l PCR reaction volume is set up
using an extended recording tag library eluted from .about.1 mg of
beads (.about.10 ng), 200 uM dNTP, 1 .mu.M of each forward and
reverse amplification primers, 0.5 .mu.l (1 U) of Phusion Hot Start
enzyme (New England Biolabs) and subjected to the following cycling
conditions: 98.degree. C. for 30 sec followed by 20 cycles of
98.degree. C. for 10 sec, 60.degree. C. for 30 sec, 72.degree. C.
for 30 sec, followed by 72.degree. C. for 7 min, then hold at
4.degree. C.
[0582] In certain embodiments, either before, during or following
amplification, the library of extended recording tags, extended
coding tags, or di-tags can undergo target enrichment. Target
enrichment can be used to selectively capture or amplify extended
recording tags representing macromolecules of interest from a
library of extended recording tags, extended coding tags, or
di-tags before sequencing. Target enrichment for protein sequence
is challenging because of the high cost and difficulty in producing
highly-specific binding agents for target proteins. Antibodies are
notoriously non-specific and difficult to scale production across
thousands of proteins. The methods of the present disclosure
circumvent this problem by converting the protein code into a
nucleic acid code which can then make use of a wide range of
targeted DNA enrichment strategies available for DNA libraries.
Peptides of interest can be enriched in a sample by enriching their
corresponding extended recording tags. Methods of targeted
enrichment are known in the art, and include hybrid capture assays,
PCR-based assays such as TruSeq custom Amplicon (Illumina), padlock
probes (also referred to as molecular inversion probes), and the
like (see, Mamanova et al., 2010, Nature Methods 7: 111-118; Bodi
et al., J. Biomol. Tech. 2013, 24:73-86; Ballester et al., 2016,
Expert Review of Molecular Diagnostics 357-372; Mertes et al.,
2011, Brief Funct. Genomics 10:374-386; Nilsson et al., 1994,
Science 265:2085-8; each of which are incorporated herein by
reference in their entirety).
[0583] In one embodiment, a library of extended recording tags,
extended coding tags, or di-tags is enriched via a hybrid
capture-based assay (see, e.g., FIG. 17A and FIG. 17B). In a
hybrid-capture based assay, the library of extended recording tags,
extended coding tags, or di-tags is hybridized to target-specific
oligonucleotides or "bait oligonucleotide" that are labelled with
an affinity tag (e.g., biotin). Extended recording tags, extended
coding tags, or di-tags hybridized to the target-specific
oligonucleotides are "pulled down" via their affinity tags using an
affinity ligand (e.g., streptavidin coated beads), and background
(non-specific) extended recording tags are washed away (see, e.g.,
(FIGS. 17A-17B). The enriched extended recording tags, extended
coding tags, or di-tags are then obtained for positive enrichment
(e.g., eluted from the beads).
[0584] For bait oligonucleotides synthesized by array-based "in
situ" oligonucleotide synthesis and subsequent amplification of
oligonucleotide pools, competing baits can be engineered into the
pool by employing several sets of universal primers within a given
oligonucleotide array. For each type of universal primer, the ratio
of biotinylated primer to non-biotinylated primer controls the
enrichment ratio. The use of several primer types enables several
enrichment ratios to be designed into the final oligonucleotide
bait pool.
[0585] A bait oligonucleotide can be designed to be complementary
to an extended recording tag, extended coding tag, or di-tag
representing a macromolecule of interest. The degree of
complementarity of a bait oligonucleotide to the spacer sequence in
the extended recording tag, extended coding tag, or di-tag can be
from 0% to 100%, and any integer in between. This parameter can be
easily optimized by a few enrichment experiments. In some
embodiments, the length of the spacer relative to the encoder
sequence is minimized in the coding tag design or the spacers are
designed such that they unavailable for hybridization to the bait
sequences. One approach is to use spacers that form a secondary
structure in the presence of a cofactor. An example of such a
secondary structure is a G-quadruplex, which is a structure formed
by two or more guanine quartets stacked on top of each other
(Bochman, Paeschke et al. 2012). A guanine quartet is a square
planar structure formed by four guanine bases that associate
through Hoogsteen hydrogen bonding. The G-quadruplex structure is
stabilized in the presence of a cation, e.g., K+ ions vs. Li+
ions.
[0586] To minimize the number of bait oligonucleotides employed, a
set of relatively unique peptides from each protein can be
bioinformatically identified, and only those bait oligonucleotides
complementary to the corresponding extended recording tag library
representations of the peptides of interest are used in the hybrid
capture assay. Sequential rounds or enrichment can also be carried
out, with the same or different bait sets.
[0587] To enrich the entire length of a macromolecule (e.g.,
protein or polypeptide) in a library of extended recording tags,
extended coding tags, or di-tags representing fragments thereof
(e.g., peptides), "tiled" bait oligonucleotides can be designed
across the entire nucleic acid representation of the protein.
[0588] In another embodiment, primer extension and ligation-based
mediated amplification enrichment (AmpliSeq, PCR, TruSeq TSCA,
etc.) can be used to select and module fraction enriched of library
elements representing a subset of macromolecules. Competing oligos
can also be employed to tune the degree of primer extension,
ligation, or amplification. In the simplest implementation, this
can be accomplished by having a mix of target specific primers
comprising a universal primer tail and competing primers lacking a
5' universal primer tail. After an initial primer extension, only
primers with the 5' universal primer sequence can be amplified. The
ratio of primer with and without the universal primer sequence
controls the fraction of target amplified. In other embodiments,
the inclusion of hybridizing but non-extending primers can be used
to modulate the fraction of library elements undergoing primer
extension, ligation, or amplification.
[0589] Targeted enrichment methods can also be used in a negative
selection mode to selectively remove extended recording tags,
extended coding tags, or di-tags from a library before sequencing.
Thus, in the example described above using biotinylated bait
oligonucleotides and streptavidin coated beads, the supernatant is
retained for sequencing while the bait-oligonucleotide:extended
recording tag, extended coding tag, or di-tag hybrids bound to the
beads are not analysed. Examples of undesirable extended recording
tags, extended coding tags, or di-tags that can be removed are
those representing over abundant macromolecule species, e.g., for
proteins, albumin, immunoglobulins, etc.
[0590] A competitor oligonucleotide bait, hybridizing to the target
but lacking a biotin moiety, can also be used in the hybrid capture
step to modulate the fraction of any particular locus enriched. The
competitor oligonucleotide bait competes for hybridization to the
target with the standard biotinylated bait effectively modulating
the fraction of target pulled down during enrichment (FIGS.
17A-17B). The ten orders dynamic range of protein expression can be
compressed by several orders using this competitive suppression
approach, especially for the overly abundant species such as
albumin. Thus, the fraction of library elements captured for a
given locus relative to standard hybrid capture can be modulated
from 100% down to 0% enrichment.
[0591] Additionally, library normalization techniques can be used
to remove overly abundant species from the extended recording tag,
extended coding tag, or di-tag library. This approach works best
for defined length libraries originating from peptides generated by
site-specific protease digestion such as trypsin, LysC, GluC, etc.
In one example, normalization can be accomplished by denaturing a
double-stranded library and allowing the library elements to
re-anneal. The abundant library elements re-anneal more quickly
than less abundant elements due to the second-order rate constant
of bimolecular hybridization kinetics (Bochman, Paeschke et al.
2012). The ssDNA library elements can be separated from the
abundant dsDNA library elements using methods known in the art,
such as chromatography on hydroxyapatite columns (VanderNoot, et
al., 2012, Biotechniques 53:373-380) or treatment of the library
with a duplex-specific nuclease (DSN) from Kamchatka crab (Shagin
et al., 2002, Genome Res. 12:1935-42) which destroys the dsDNA
library elements.
[0592] Any combination of fractionation, enrichment, and
subtraction methods, of the macromolecules before attachment to the
solid support and/or of the resulting extended recording tag
library can economize sequencing reads and improve measurement of
low abundance species.
[0593] In some embodiments, a library of extended recording tags,
extended coding tags, or di-tags is concatenated by ligation or
end-complementary PCR to create a long DNA molecule comprising
multiple different extended recorder tags, extended coding tags, or
di-tags, respectively (Du et al., 2003, BioTechniques 35:66-72;
Muecke et al., 2008, Structure 16:837-841; U.S. Pat. No. 5,834,252,
each of which is incorporated by reference in its entirety). This
embodiment is preferable for nanopore sequencing in which long
strands of DNA are analyzed by the nanopore sequencing device.
[0594] In some embodiments, direct single molecule analysis is
performed on an extended recording tag, extended coding tag, or
di-tag (see, e.g., Harris et al., 2008, Science 320:106-109). The
extended recording tags, extended coding tags, or di-tags can be
analysed directly on the solid support, such as a flow cell or
beads that are compatible for loading onto a flow cell surface
(optionally microcell patterned), wherein the flow cell or beads
can integrate with a single molecule sequencer or a single molecule
decoding instrument. For single molecule decoding, hybridization of
several rounds of pooled fluorescently-labelled of decoding
oligonucleotides (Gunderson et al., 2004, Genome Res. 14:970-7) can
be used to ascertain both the identity and order of the coding tags
within the extended recording tag. To deconvolute the binding order
of the coding tags, the binding agents may be labelled with
cycle-specific coding tags as described above (see also, Gunderson
et al., 2004, Genome Res. 14:970-7). Cycle-specific coding tags
will work for both a single, concatenated extended recording tag
representing a single macromolecule, or for a collection of
extended recording tags representing a single macromolecule.
[0595] Following sequencing of the extended reporter tag, extended
coding tag, or di-tag libraries, the resulting sequences can be
collapsed by their UMIs and then associated to their corresponding
macromolecules (e.g., peptides, proteins, protein complex) and
aligned to the totality of the macromolecule type in the cell
(e.g., proteome for peptide, polypeptide, protein macromolecules).
Resulting sequences can also be collapsed by their compartment tags
and associated to their corresponding compartmental proteome, which
in a particular embodiment contains only a single or a very limited
number of protein molecules. Both protein identification and
quantification can easily be derived from this digital peptide
information.
[0596] In some embodiments, the coding tag sequence can be
optimized for the particular sequencing analysis platform. In a
particular embodiment, the sequencing platform is nanopore
sequencing. In some embodiments, the sequencing platform has a per
base error rate of >5%, >10%, >15%, >20%, >25%, or
>30%. For example, if the extended recording tag is to be
analyzed using a nanopore sequencing instrument, the barcode
sequences (e.g., encoder sequences) can be designed to be optimally
electrically distinguishable in transit through a nanopore. Peptide
sequencing according to the methods described herein may be
well-suited for nanopore sequencing, given that the single base
accuracy for nanopore sequencing is still rather low (75%-85%), but
determination of the "encoder sequence" should be much more
accurate (>99%). Moreover, a technique called duplex interrupted
nanopore sequencing (DI) can be employed with nanopore strand
sequencing without the need for a molecular motor, greatly
simplifying the system design (Derrington, Butler et al. 2010).
Readout of the extended recording tag via DI nanopore sequencing
requires that the spacer elements in the concatenated extended
recording tag library be annealed with complementary
oligonucleotides. The oligonucleotides used herein may comprise
LNAs, or other modified nucleic acids or analogs to increase the
effective Tm of the resultant duplexes. As the single-stranded
extended recording tag decorated with these duplex spacer regions
is passed through the pore, the double strand region will become
transiently stalled at the constriction zone enabling a current
readout of about three bases adjacent to the duplex region. In a
particular embodiment for DI nanopore sequencing, the encoder
sequence is designed in such a way that the three bases adjacent to
the spacer element create maximally electrically distinguishable
nanopore signals (Derrington et al., 2010, Proc. Natl. Acad. Sci.
USA 107:16060-5). As an alternative to motor-free DI sequencing,
the spacer element can be designed to adopt a secondary structure
such as a G-quartet, which will transiently stall the extended
recording tag, extended coding tag, or di-tag as it passes through
the nanopore enabling readout of the adjacent encoder sequence
(Shim, Tan et al. 2009, Zhang, Zhang et al. 2016). After proceeding
past the stall, the next spacer will again create a transient
stall, enabling readout of the next encoder sequence, and so
forth.
[0597] The methods disclosed herein can be used for analysis,
including detection, quantitation and/or sequencing, of a plurality
of macromolecules (e.g., peptides) simultaneously (multiplexing).
Multiplexing as used herein refers to analysis of a plurality of
macromolecules in the same assay. The plurality of macromolecules
can be derived from the same sample or different samples. The
plurality of macromolecules can be derived from the same subject or
different subjects. The plurality of macromolecules that are
analyzed can be different macromolecules (e.g., peptides), or the
same macromolecule (e.g., peptide) derived from different samples.
A plurality of macromolecules includes 2 or more macromolecules, 5
or more macromolecules, 10 or more macromolecules, 50 or more
macromolecules, 100 or more macromolecules, 500 or more
macromolecules, 1000 or more macromolecules, 5,000 or more
macromolecules, 10,000 or more macromolecules, 50,000 or more
macromolecules, 100,000 or more macromolecules, 500,000 or more
macromolecules, or 1,000,000 or more macromolecules.
[0598] Sample multiplexing can be achieved by upfront barcoding of
recording tag labeled macromolecule samples. Each barcode
represents a different sample, and samples can be pooled prior to
cyclic binding assays or sequence analysis. In this way, many
barcode-labeled samples can be simultaneously processed in a single
tube. This approach is a significant improvement on immunoassays
conducted on reverse phase protein arrays (RPPA) (Akbani, Becker et
al. 2014, Creighton and Huang 2015, Nishizuka and Mills 2016). In
this way, the present disclosure essentially provides a highly
digital sample and analyte multiplexed alternative to the RPPA
assay with a simple workflow.
XIII. Macromolecule Characterization Via Cyclic Rounds of NTAA
Recognition, Recording Tag Extension, and NTAA Cleavage
[0599] In certain embodiments, the methods for analyzing a
macromolecule provided in the present disclosure comprise multiple
binding cycles, where the macromolecule is contacted with a
plurality of binding agents, and successive binding of binding
agents transfers historical binding information in the form of a
nucleic acid based coding tag to at least one recording tag
associated with the macromolecule. In this way, a historical record
containing information about multiple binding events is generated
in a nucleic acid format.
[0600] In embodiments relating to methods of analyzing peptide
macromolecules using an N-terminal degradation based approach (see,
FIG. 3, FIG. 4, FIG. 41, and FIG. 42), following contacting and
binding of a first binding agent to an n NTAA of a peptide of n
amino acids and transfer of the first binding agent's coding tag
information to a recording tag associated with the peptide, thereby
generating a first order extended recording tag, the n NTAA is
cleaved as described herein. Cleavage of the n NTAA converts the
n-1 amino acid of the peptide to an N-terminal amino acid, which is
referred to herein as an n-1 NTAA. As described herein, the n NTAA
may optionally be labeled with a moiety (e.g., PTC, DNP, SNP,
acetyl, amidinyl, etc.), which is particularly useful in
conjunction with cleavage enzymes that are engineered to bind to a
labeled form of NTAA. If the n NTAA was labeled, the n-1 NTAA is
then labeled with the same moiety. A second binding agent is
contacted with the peptide and binds to the n-1 NTAA, and the
second binding agent's coding tag information is transferred to the
first order extended recording tag thereby generating a second
order extended recording tag (e.g., for generating a concatenated
n.sup.th order extended recording tag representing the peptide), or
to a different recording tag (e.g., for generating multiple
extended recording tags, which collectively represent the peptide).
Cleavage of the n-1 NTAA converts the n-2 amino acid of the peptide
to an N-terminal amino acid, which is referred to herein as n-2
NTAA. Additional binding, transfer, cleavage, and optionally NTAA
labeling, can occur as described above up to n amino acids to
generate an n.sup.th order extended recording tag or n separate
extended recording tags, which collectively represent the peptide.
As used herein, an n "order" when used in reference to a binding
agent, coding tag, or extended recording tag, refers to the n
binding cycle, wherein the binding agent and its associated coding
tag is used or the n binding cycle where the extended recording tag
is created.
[0601] In some embodiments, contacting of the first binding agent
and second binding agent to the macromolecule, and optionally any
further binding agents (e.g., third binding agent, fourth binding
agent, fifth binding agent, and so on), are performed at the same
time. For example, the first binding agent and second binding
agent, and optionally any further order binding agents, can be
pooled together, for example to form a library of binding agents.
In another example, the first binding agent and second binding
agent, and optionally any further order binding agents, rather than
being pooled together, are added simultaneously to the
macromolecule. In one embodiment, a library of binding agents
comprises at least 20 binding agents that selectively bind to the
20 standard, naturally occurring amino acids.
[0602] In other embodiments, the first binding agent and second
binding agent, and optionally any further order binding agents, are
each contacted with the macromolecule in separate binding cycles,
added in sequential order. In certain embodiments, the use of
multiple binding agents at the same time is preferred, because the
parallel approach saves time and because the binding agents are in
competition, which reduces non-specific binding by non-cognate
binding agents to a site that is bound by a cognate binding
agent.
[0603] The length of the final extended recording tags generated by
the methods described herein is dependent upon multiple factors,
including the length of the coding tag (e.g., encoder sequence and
spacer), the length of the recording tag (e.g., unique molecular
identifier, spacer, universal priming site, bar code), the number
of binding cycles performed, and whether coding tags from each
binding cycle are transferred to the same extended recording tag or
to multiple extended recording tags. In an example for a
concatenated extended recording tag representing a peptide and
produced by an Edman degradation like cleavage method, if the
coding tag has an encoder sequence of 5 bases that is flanked on
each side by a spacer of 5 bases, the coding tag information on the
final extended recording tag, which represents the peptide's
binding agent history, is 10 bases.times.number of Edman
Degradation cycles. For a 20-cycle run, the extended recording is
at least 200 bases (not including the initial recording tag
sequence). This length is compatible with standard next generation
sequencing instruments.
[0604] After the final binding cycle and transfer of the final
binding agent's coding tag information to the extended recording
tag, the recorder tag can be capped by addition of a universal
reverse priming site via ligation, primer extension or other
methods known in the art. In some embodiments, the universal
forward priming site in the recording tag is compatible with the
universal reverse priming site that is appended to the final
extended recording tag. In some embodiments, a universal reverse
priming site is an Illumina P7 primer
(5'-CAAGCAGAAGACGGCATACGAGAT-3'-SEQ ID NO:134) or an Illumina P5
primer (5'-AATGATACGGCGACCACCGA-3'--SEQ ID NO133). The sense or
antisense P7 may be appended, depending on strand sense of the
recording tag. An extended recording tag library can be cleaved or
amplified directly from the solid support (e.g., beads) and used in
traditional next generation sequencing assays and protocols.
[0605] In some embodiments, a primer extension reaction is
performed on a library of single stranded extended recording tags
to copy complementary strands thereof.
[0606] The NGPS peptide sequencing assay comprises several chemical
and enzymatic steps in a cyclical progression. The fact that NGPS
sequencing is single molecule confers several key advantages to the
process. The first key advantage of single molecule assay is the
robustness to inefficiencies in the various cyclical
chemical/enzymatic steps. This is enabled through the use of
cycle-specific barcodes present in the coding tag sequence.
[0607] Using cycle-specific coding tags, we track information from
each cycle. Since this is a single molecule sequencing approach,
even 70% efficiency at each binding/transfer cycle in the
sequencing process is more than sufficient to generate mappable
sequence information. As an example, a ten-base peptide sequence
"CPVQLWVDST" (SEQ ID NO:169) might be read as "CPXQXWXDXT" (SEQ ID
NO:170) on our sequence platform (where X=any amino acid; the
presence an amino acid is inferred by cycle number tracking). This
partial amino acid sequence read is more than sufficient to
uniquely map it back to the human p53 protein using BLASTP. As
such, none of our processes have to be perfect to be robust.
Moreover, when cycle-specific barcodes are combined with our
partitioning concepts, absolute identification of the protein can
be accomplished with only a few amino acids identified out of 10
positions since we know what set of peptides map to the original
protein molecule (via compartment barcodes).
XIV. Protein Normalization Via Fractionation, Compartmentalization,
and Limited Binding Capacity Resins
[0608] One of the key challenges with proteomics analysis is
addressing the large dynamic range in protein abundance within a
sample. Proteins span greater than 10 orders of dynamic range
within plasma (even "Top 20" depleted plasma). In certain
embodiments, subtraction of certain protein species (e.g., highly
abundant proteins) from the sample is performed prior to analysis.
This can be accomplished, for example, using commercially available
protein depletion reagents such as Sigma's PROT20 immuno-depletion
kit, which deplete the top 20 plasma proteins. Additionally, it
would be useful to have an approach that greatly reduced the
dynamic range even further to a manageable 3-4 orders. In certain
embodiments, a protein sample dynamic range can be modulated by
fractionating the protein sample using standard fractionation
methods, including electrophoresis and liquid chromatography (Zhou,
Ning et al. 2012), or partitioning the fractions into compartments
(e.g., droplets) loaded with limited capacity protein binding
beads/resin (e.g. hydroxylated silica particles) (McCormick 1989)
and eluting bound protein. Excess protein in each compartmentalized
fraction is washed away.
[0609] Examples of electrophoretic methods include capillary
electrophoresis (CE), capillary isoelectric focusing (CLEF),
capillary isotachophoresis (CITP), free flow electrophoresis,
gel-eluted liquid fraction entrapment electrophoresis (GELFrEE).
Examples of liquid chromatography protein separation methods
include reverse phase (RP), ion exchange (IE), size exclusion (SE),
hydrophilic interaction, etc. Examples of compartment partitions
include emulsions, droplets, microwells, physically separated
regions on a flat substrate, etc. Exemplary protein binding
beads/resins include silica nanoparticles derivitized with phenol
groups or hydroxyl groups (e.g., StrataClean Resin from Agilent
Technologies, RapidClean from LabTech, etc.). By limiting the
binding capacity of the beads/resin, highly-abundant proteins
eluting in a given fraction will only be partially bound to the
beads, and excess proteins removed.
XV. Partitioning of Proteome of a Single Cell or Molecular
Subsampling
[0610] In another aspect, the present disclosure provides methods
for massively-parallel analysis of proteins in a sample using
barcoding and partitioning techniques. Current approaches to
protein analysis involve fragmentation of protein macromolecules
into shorter peptide molecules suitable for peptide sequencing.
Information obtained using such approaches is therefore limited by
the fragmentation step and excludes, e.g., long range continuity
information of a protein, including post-translational
modifications, protein-protein interactions occurring in each
sample, the composition of a protein population present in a
sample, or the origin of the protein macromolecule, such as from a
particular cell or population of cells. Long range information of
post-translation modifications within a protein molecule (e.g.,
proteoform characterization) provides a more complete picture of
biology, and long range information on what peptides belong to what
protein molecule provides a more robust mapping of peptide sequence
to underlying protein sequence (see FIG. 15A). This is especially
relevant when the peptide sequencing technology only provides
incomplete amino acid sequence information, such as information
from only 5 amino acid types. By using the partitioning methods
disclosed herein, combined with information from a number of
peptides originating from the same protein molecule, the identity
of the protein molecule (e.g. proteoform) can be more accurately
assessed. Association of compartment tags with proteins and
peptides derived from same compartment(s) facilitates
reconstruction of molecular and cellular information. In typical
proteome analysis, cells are lysed and proteins digested into short
peptides, disrupting global information on which proteins derive
from which cell or cell type, and which peptides derive from which
protein or protein complex. This global information is important to
understanding the biology and biochemistry within cells and
tissues.
[0611] Partitioning refers to the random assignment of a unique
barcode to a subpopulation of macromolecules from a population of
macromolecules within a sample. Partitioning may be achieved by
distributing macromolecules into compartments. A partition may be
comprised of the macromolecules within a single compartment or the
macromolecules within multiple compartments from a population of
compartments.
[0612] A subset of macromolecules or a subset of a protein sample
that has been separated into or on the same physical compartment or
group of compartments from a plurality (e.g., millions to billions)
of compartments are identified by a unique compartment tag. Thus, a
compartment tag can be used to distinguish constituents derived
from one or more compartments having the same compartment tag from
those in another compartment (or group of compartments) having a
different compartment tag, even after the constituents are pooled
together.
[0613] The present disclosure provides methods of enhancing protein
analysis by partitioning a complex proteome sample (e.g., a
plurality of protein complexes, proteins, or polypeptides) or
complex cellular sample into a plurality of compartments, wherein
each compartment comprises a plurality of compartment tags that are
the same within an individual compartment (save for an optional UMI
sequence) and are different from the compartment tags of other
compartments (see, FIG. 18, FIGS. 19 and FIGS. 20A-20L). The
compartments optionally comprise a solid support (e.g., bead) to
which the plurality of compartment tags are joined thereto. The
plurality of protein complexes, proteins, or polypeptides are
fragmented into a plurality of peptides, which are then contacted
to the plurality of compartment tags under conditions sufficient to
permit annealing or joining of the plurality of peptides with the
plurality of compartment tags within the plurality of compartments,
thereby generating a plurality of compartment tagged peptides.
Alternatively, the plurality of protein complexes, proteins, or
polypeptides are joined to a plurality of compartment tags under
conditions sufficient to permit annealing or joining of the
plurality of protein complexes, proteins or polypeptides with the
plurality of compartment tags within a plurality of compartments,
thereby generating a plurality of compartment tagged protein
complexes, proteins, polypeptides. The compartment tagged protein
complexes, proteins, or polypeptides are then collected from the
plurality of compartments and optionally fragmented into a
plurality of compartment tagged peptides. One or more compartment
tagged peptides are analyzed according to any of the methods
described herein.
[0614] In certain embodiments, compartment tag information is
transferred to a recording tag associated with a macromolecule
(e.g., peptide) via primer extension (FIGS. 5A-5B) or ligation
(FIG. 6).
[0615] In some embodiments, the compartment tags are free in
solution within the compartments. In other embodiments, the
compartment tags are joined directly to the surface of the
compartment (e.g., well bottom of microtiter or picotiter plate) or
a bead or bead within a compartment.
[0616] A compartment can be an aqueous compartment (e.g.,
microfluidic droplet) or a solid compartment. A solid compartment
includes, for example, a nanoparticle, a microsphere, a microtiter
or picotiter well or a separated region on an array, a glass
surface, a silicon surface, a plastic surface, a filter, a
membrane, nylon, a silicon wafer chip, a flow cell, a flow through
chip, a biochip including signal transducing electronics, an ELISA
plate, a spinning interferometry disc, a nitrocellulose membrane,
or a nitrocellulose-based polymer surface. In certain embodiments,
each compartment contains, on average, a single cell.
[0617] A solid support can be any support surface including, but
not limited to, a bead, a microbead, an array, a glass surface, a
silicon surface, a plastic surface, a filter, a membrane, nylon, a
silicon wafer chip, a flow cell, a flow through chip, a biochip
including signal transducing electronics, a microtiter well, an
ELISA plate, a spinning interferometry disc, a nitrocellulose
membrane, a nitrocellulose-based polymer surface, a nanoparticle,
or a microsphere. Materials for a solid support include but are not
limited to acrylamide, agarose, cellulose, nitrocellulose, glass,
gold, quartz, polystyrene, polyethylene vinyl acetate,
polypropylene, polymethacrylate, polyethylene, polyethylene oxide,
polysilicates, polycarbonates, Teflon, fluorocarbons, nylon,
silicon rubber, polyanhydrides, polyglycolic acid, polyactic acid,
polyorthoesters, functionalized silane, polypropylfumerate,
collagen, glycosaminoglycans, polyamino acids, or any combination
thereof. In certain embodiments, a solid support is a bead, for
example, a polystyrene bead, a polymer bead, an agarose bead, an
acrylamide bead, a solid core bead, a porous bead, a paramagnetic
bead, glass bead, or a controlled pore bead.
[0618] Various methods of partitioning samples into compartments
with compartment tagged beads is reviewed in Shembekar et al.,
(Shembekar, Chaipan et al. 2016). In one example, the proteome is
partitioned into droplets via an emulsion to enable global
information on protein molecules and protein complexes to be
recorded using the methods disclosed herein (see, e.g., FIG. 18 and
FIG. 19). In certain embodiments, the proteome is partitioned in
compartments (e.g., droplets) along with compartment tagged beads,
an activate-able protease (directly or indirectly via heat, light,
etc.), and a peptide ligase engineered to be protease-resistant
(e.g., modified lysines, pegylation, etc.). In certain embodiments,
the proteome can be treated with a denaturant to assess the peptide
constituents of a protein or polypeptide. If information regarding
the native state of a protein is desired, an interacting protein
complex can be partitioned into compartments for subsequent
analysis of the peptides derived therefrom.
[0619] A compartment tag comprises a barcode, which is optionally
flanked by a spacer or universal primer sequence on one or both
sides. The primer sequence can be complementary to the 3' sequence
of a recording tag, thereby enabling transfer of compartment tag
information to the recording tag via a primer extension reaction
(see, FIGS. 22A-B). The barcode can be comprised of a single
stranded nucleic acid molecule attached to a solid support or
compartment or its complementary sequence hybridized to solid
support or compartment, or both strands (see, e.g., FIG. 16). A
compartment tag can comprise a functional moiety, for example
attached to the spacer, for coupling to a peptide. In one example,
a functional moiety (e.g., aldehyde) is one that is capable of
reacting with the N-terminal amino acid residue on the plurality of
peptides. In another example, the functional moiety is capable of
reacting with an internal amino acid residue (e.g., lysine or
lysine labeled with a "click" reactive moiety) on the plurality of
peptides. In another embodiment, the functional moiety may simply
be a complementary DNA sequence capable of hybridizing to a DNA
tag-labeled protein. Alternatively, a compartment tag can be a
chimeric molecule, further comprising a peptide comprising a
recognition sequence for a protein ligase (e.g., butelase I or
homolog thereof) to allow ligation of the compartment tag to a
peptide of interest (see, FIG. 22A). A compartment tag can be a
component within a larger nucleic acid molecule, which optionally
further comprises a unique molecular identifier for providing
identifying information on the peptide that is joined thereto, a
spacer sequence, a universal priming site, or any combination
thereof. This UMI sequence generally differs among a population of
compartment tags within a compartment. In certain embodiments, a
compartment tag is a component within a recording tag, such that
the same tag that is used for providing individual compartment
information is also used to record individual peptide information
for the peptide attached thereto.
[0620] In certain embodiments, compartment tags can be formed by
printing, spotting, ink-jetting the compartment tags into the
compartment. In certain embodiments, a plurality of compartment
tagged beads is formed, wherein one barcode type is present per
bead, via split-and-pool oligonucleotide ligation or synthesis as
described by Klein et al., 2015, Cell 161:1187-1201; Macosko et
al., 2015, Cell 161:1202-1214; and Fan et al., 2015, Science
347:1258367. Compartment tagged beads can also be formed by
individual synthesis or immobilization. In certain embodiments, the
compartment tagged beads further comprise bifunctional recording
tags, in which one portion comprises the compartment tag comprising
a recording tag, and the other portion comprises a functional
moiety to which the digested peptides can be coupled (FIG. 19 and
FIG. 20).
[0621] In certain embodiments, the plurality of proteins or
polypeptides within the plurality of compartments is fragmented
into a plurality of peptides with a protease. A protease can be a
metalloprotease. In certain embodiments, the activity of the
metalloprotease is modulated by photo-activated release of metallic
cations. Examples of endopeptidases that can be used include:
trypsin, chymotrypsin, elastase, thermolysin, pepsin, clostripan,
glutamyl endopeptidase (GluC), endopeptidase ArgC, peptidyl-asp
metallo-endopeptidase (AspN), endopeptidase LysC and endopeptidase
LysN. Their mode of activation varies depending on buffer and
divalent cation requirements. Optionally, following sufficient
digestion of the proteins or polypeptides into peptide fragments,
the protease is inactivated (e.g., heat, fluoro-oil or silicone oil
soluble inhibitor, such as a divalent cation chelation agent).
[0622] In certain embodiments of peptide barcoding with compartment
tags, a protein molecule (optionally, denatured polypeptide) is
labeled with DNA tags by conjugation of the DNA tags to
.epsilon.-amine moieties of the protein's lysine groups or
indirectly via click chemistry attachment to a protein/polypeptide
pre-labeled with a reactive click moiety such as alkyne (see FIG.
2B and FIG. 20A). The DNA tag-labeled polypeptides are then
partitioned into compartments comprising compartment tags (e.g.,
DNA barcodes bound to beads contained within droplets) (see FIG.
20B), wherein a compartment tag contains a barcode that identifies
each compartment. In one embodiment, a single protein/polypeptide
molecule is co-encapsulated with a single species of DNA barcodes
associated with a bead (see FIG. 20B). In another embodiment, the
compartment can constitute the surface of a bead with attached
compartment (bead) tags similar to that described in PCT
Publication WO2016/061517 (incorporated by reference in its
entirety), except as applied to proteins rather than DNA. The
compartment tag can comprise a barcode (BC) sequence, a universal
priming site (U1'), a UMI sequence, and a spacer sequence (Sp). In
one embodiment, concomitant with or after partitioning, the
compartment tags are cleaved from the bead and hybridize to the DNA
tags attached to the polypeptide, for example via the complementary
U1 and U1' sequences on the DNA tag and compartment tag,
respectively. For partitioning on beads, the DNA tag-labeled
protein can be directly hybridized to the compartment tags on the
bead surface (see, FIG. 20C). After this hybridization step, the
polypeptides with hybridized DNA tags are extracted from the
compartments (e.g., emulsion "cracked", or compartment tags cleaved
from bead), and a polymerase-based primer extension step is used to
write the barcode and UMI information to the DNA tags on the
polypeptide to yield a compartment barcoded recording tag (see,
FIG. 20D). A LysC protease digestion may be used to cleave the
polypeptide into constituent peptides labeled at their C-terminal
lysine with a recording tag containing universal priming sequences,
a compartment tag, and a UMI (see, FIG. 20E). In one embodiment,
the LysC protease is engineered to tolerate DNA-tagged lysine
residues. The resultant recording tag labeled peptides are
immobilized to a solid substrate (e.g., bead) at an appropriate
density to minimize intermolecular interactions between recording
tagged peptides (see, FIGS. 20E and 20F).
[0623] Attachment of the peptide to the compartment tag (or vice
versa) can be directly to an immobilized compartment tag, or to its
complementary sequence (if double stranded). Alternatively, the
compartment tag can be detached from the solid support or surface
of the compartment, and the peptide and solution phase compartment
tag joined within the compartment. In one embodiment, the
functional moiety on the compartment tag (e.g., on the terminus of
oligonucleotide) is an aldehyde which is coupled directly to the
amine N-terminus of the peptide through a Schiff base (see FIG.
16). In another embodiment, the compartment tag is constructed as a
nucleic acid-peptide chimeric molecule comprising peptide motif
(n-X . . . XXCGSHV-c) for a protein ligase. The nucleic
acid-peptide compartment tag construct is conjugated to digested
peptides using a peptide ligase, such as butelase I or a homolog
thereof. Butelase I, and other asparaginyl endopeptidase (AEP)
homologues, can be used to ligate the C-terminus of the
oligonucleotide-peptide compartment tag construct to the N-terminus
of the digested peptides (Nguyen, Wang et al. 2014, Nguyen, Cao et
al. 2015). This reaction is fast and highly efficient. The
resultant compartment tagged peptides can be subsequently
immobilized to a solid support for nucleic-acid peptide analysis as
described herein.
[0624] In certain embodiments, compartment tags that are joined to
a solid support or surface of a compartment are released prior to
joining the compartment tags with the plurality of fragmented
peptides (see FIG. 18). In some embodiments, following collection
of the compartment tagged peptides from the plurality of
compartments, the compartment tagged peptides are joined to a solid
support in association with recording tags. Compartment tag
information can then be transferred from the compartment tag on the
compartment tagged peptide to the associated recording tag (e.g.,
via a primer extension reaction primed from complementary spacer
sequences within the recording tab and compartment tag). In some
embodiments, the compartment tags are then removed from the
compartment tagged peptides prior to peptide analysis according to
the methods described herein. In further embodiments, the sequence
specific protease (e.g., Endo AspN) that is initially used to
digest the plurality of proteins is also used to remove the
compartment tag from the N terminus of the peptide after transfer
of the compartment tag information to the associated recording tag
(see FIG. 22B).
[0625] Approaches for compartmental-based partitioning include
droplet formation through microfluidic devices using T-junctions
and flow focusing, emulsion generation using agitation or extrusion
through a membrane with small holes (e.g., track etch membrane),
etc. (see, FIG. 21). A challenge with compartmentalization is
addressing the interior of the compartment. In certain embodiments,
it may be difficult to conduct a series of different biochemical
steps within a compartment since exchanging fluid components is
challenging. As previously described, one can modify a limited
feature of the droplet interior, such as pH, chelating agent,
reducing agents, etc. by addition of the reagent to the fluoro-oil
of the emulsion. However, the number of compounds that have
solubility in both aqueous and organic phases is limited. One
approach is to limit the reaction in the compartment to essentially
the transfer of the barcode to the molecule of interest.
[0626] After labeling of the proteins/peptides with recording tags
comprised of compartment tags (barcodes), the protein/peptides are
immobilized on a solid-support at a suitable density to favor
intramolecular transfer of information from the coding tag of a
bound cognate binding agent to the corresponding recording tag/tags
attached to the bound peptide or protein molecule. Intermolecular
information transfer is minimized by controlling the intermolecular
spacing of molecules on the surface of the solid-support.
[0627] In certain embodiments, the compartment tags need not be
unique for each compartment in a population of compartments. A
subset of compartments (two, three, four, or more) in a population
of compartments may share the same compartment tag. For instance,
each compartment may be comprised of a population of bead surfaces
which act to capture a subpopulation of macromolecules from a
sample (many molecules are captured per bead). Moreover, the beads
comprise compartment barcodes which can be attached to the captured
macromolecules. Each bead has only a single compartment barcode
sequence, but this compartment barcode may be replicated on other
beads with in the compartment (many beads mapping to the same
barcode). There can be (although not required) a many-to-one
mapping between physical compartments and compartment barcodes,
moreover, there can be (although not required) a many-to-one
mapping between macromolecules within a compartment. A partition
barcode is defined as an assignment of a unique barcode to a
subsampling of macromolecules from a population of macromolecules
within a sample. This partition barcode may be comprised of
identical compartment barcodes arising from the partitioning of
macromolecules within compartments labeled with the same barcode.
The use of physical compartments effectively subsamples the
original sample to provide assignment of partition barcodes. For
instance, a set of beads labeled with 10,000 different compartment
barcodes is provided. Furthermore, suppose in a given assay, that a
population of 1 million beads are used in the assay. On average,
there are 100 beads per compartment barcode (Poisson distribution).
Further suppose that the beads capture an aggregate of 10 million
macromolecules. On average, there are 10 macromolecules per bead,
with 100 compartments per compartment barcode, there are
effectively 1000 macromolecules per partition barcode (comprised of
100 compartment barcodes for 100 distinct physical
compartments).
[0628] In another embodiment, single molecule partitioning and
partition barcoding of polypeptides is accomplished by labeling
polypeptides (chemically or enzymatically) with an amplifiable DNA
UMI tag (e.g., recording tag) at the N or C terminus, or both (see
FIGS. 37A-B). DNA tags are attached to the body of the polypeptide
(internal amino acids) via non-specific photo-labeling or specific
chemical attachment to reactive amino acids such as lysines as
illustrated in FIG. 2B. Information from the recording tag attached
to the terminus of the peptide is transferred to the DNA tags via
an enzymatic emulsion PCR (Williams, Peisajovich et al. 2006,
Schutze, Rubelt et al. 2011) or emulsion in vitro
transcription/reverse transcription (IVT/RT) step. In the preferred
embodiment, a nanoemulsion is employed such that, on average, there
is fewer than a single polypeptide per emulsion droplet with size
from 50 nm-1000 nm (Nishikawa, Sunami et al. 2012, Gupta, Eral et
al. 2016). Additionally, all the components of PCR are included in
the aqueous emulsion mix including primers, dNTPs, Mg2+,
polymerase, and PCR buffer. If IVT/RT is used, then the recording
tag is designed with a T7/SP6 RNA polymerase promoter sequence to
generate transcripts that hybridize to the DNA tags attached to the
body of the polypeptide (Ryckelynck, Baudrey et al. 2015). A
reverse transcriptase (RT) copies the information from the
hybridized RNA molecule to the DNA tag. In this way, emulsion PCR
or IVT/RT can be used to effectively transfer information from the
terminus recording tag to multiple DNA tags attached to the body of
the polypeptide.
[0629] Encapsulation of cellular contents via gelation in beads is
a useful approach to single cell analysis (Tamminen and Virta 2015,
Spencer, Tamminen et al. 2016). Barcoding single cell droplets
enables all components from a single cell to be labeled with the
same identifier (Klein, Mazutis et al. 2015, Gunderson, Steemers et
al. 2016, Zilionis, Nainys et al. 2017). Compartment barcoding can
be accomplished in a number of ways including direct incorporation
of unique barcodes into each droplet by droplet joining
(Raindance), by introduction of a barcoded beads into droplets
(10.times. Genomics), or by combinatorial barcoding of components
of the droplet post encapsulation and gelation using and split-pool
combinatorial barcoding as described by Gunderson et al.
(Gunderson, Steemers et al. 2016) and PCT Publication
WO2016/130704, incorporated by reference in its entirety. A similar
combinatorial labeling scheme can also be applied to nuclei as
described by Adey et al. (Vitak, Torkenczy et al. 2017).
[0630] The above droplet barcoding approaches have been used for
DNA analysis but not for protein analysis. Adapting the above
droplet barcoding platforms to work with proteins requires several
innovative steps. The first is that barcodes are primarily
comprised of DNA sequences, and this DNA sequence information needs
to be conferred to the protein analyte. In the case of a DNA
analyte, it is relatively straightforward to transfer DNA
information onto a DNA analyte. In contrast, transferring DNA
information onto proteins is more challenging, particularly when
the proteins are denatured and digested into peptides for
downstream analysis. This requires that each peptide be labeled
with a compartment barcode. The challenge is that once the cell is
encapsulated into a droplet, it is difficult to denature the
proteins, protease digest the resultant polypeptides, and
simultaneously label the peptides with DNA barcodes. Encapsulation
of cells in polymer forming droplets and their polymerization
(gelation) into porous beads, which can be brought up into an
aqueous buffer, provides a vehicle to perform multiple different
reaction steps, unlike cells in droplets (Tamminen and Virta 2015,
Spencer, Tamminen et al. 2016) (Gunderson, Steemers et al. 2016).
Preferably, the encapsulated proteins are crosslinked to the gel
matrix to prevent their subsequent diffusion from the gel beads.
This gel bead format allows the entrapped proteins within the gel
to be denatured chemically or enzymatically, labeled with DNA tags,
protease digested, and subjected to a number of other
interventions. FIG. 38 depicts exemplary encapsulation and lysis of
a single cell in a gel matrix.
XVI. Tissue and Single Cell Spatial Proteomics
[0631] Another use of barcodes is the spatial segmentation of a
tissue on the surface an array of spatially distributed DNA barcode
sequences. If tissue proteins are labelled with DNA recording tags
comprising barcodes reflecting the spatial position of the protein
within the cellular tissue mounted on the array surface, then the
spatial distribution of protein analytes within the tissue slice
can later be reconstructed after sequence analysis, much as is done
for spatial transcriptomics as described by Stahl et al. (2016,
Science 353(6294):78-82) and Crosetto et al. (Corsetto, Bienko et
al., 2015). The attachment of spatial barcodes can be accomplished
by releasing array-bound barcodes from the array and diffusing them
into the tissue section, or alternatively, the proteins in the
tissue section can be labeled with DNA recording tags, and then the
proteins digested with a protease to release labeled peptides that
can diffuse and hybridize to spatial barcodes on the array. The
barcode information can then be transferred (enzymatically or
chemically) to the recording tags attached to the peptides.
[0632] Spatial barcoding of the proteins within a tissue can be
accomplished by placing a fixed/permeabilized tissue slice,
chemically labelled with DNA recording tags, on a spatially encoded
DNA array, wherein each feature on the array has a spatially
identifiable barcode (see, FIGS. 23A-23C). To attach an array
barcode to the DNA tag, the tissue slice can be digested with a
protease, releasing DNA tag labelled peptides, which can diffuse
and hybridize to proximal array features adjacent to the tissue
slice. The array barcode information can be transferred to the DNA
tag using chemical/enzymatic ligation or polymerase extension.
Alternatively, rather than allowing the labelled peptides to
diffuse to the array surface, the barcodes sequences on the array
can be cleaved and allowed to diffuse into proximal areas on the
tissue slice and hybridize to DNA tag-labelled proteins therein.
Once again, the barcoding information can be transferred by
chemical/enzymatic ligation or polymerase extension. In this second
case, protease digestion can be performed following transfer of
barcode information. The result of either approach is a collection
of recording tag-labelled protein or peptides, wherein the
recording tag comprises a barcode harbouring 2-D spatial
information of the protein/peptides's location within the
originating tissue. Moreover, the spatial distribution of
post-translational modifications can be characterized. This
approach provides a sensitive and highly-multiplexed in situ
digital immunohistochemistry assay, and should form the basis of
modern molecular pathology leading to much more accurate diagnosis
and prognosis.
[0633] In another embodiment, spatial barcoding can be used within
a cell to identify the protein constituents/PTMs within the
cellular organelles and cellular compartments (Christoforou et al.,
2016, Nat. Commun. 7:8992, incorporated by reference in its
entirety). A number of approaches can be used to provide
intracellular spatial barcodes, which can be attached to proximal
proteins. In one embodiment, cells or tissue can be sub-cellular
fractionated into constituent organelles, and the different protein
organelle fractions barcoded. Other methods of spatial cellular
labelling are described in the review by Marx, 2015, Nat Methods
12:815-819, incorporated by reference in its entirety; similar
approaches can be used herein.
[0634] The following examples are provided for the purpose of
illustration, and not limitation.
EXAMPLES
Example 1: Digestion of Protein Sample with Proteinase K
[0635] A library of peptides is prepared from a protein sample by
digestion with a protease such as trypsin, Proteinase K, etc.
Trypsin cleaves preferably at the C-terminal side of positively
charged amino acids like lysine and arginine, whereas Proteinase K
cleaves non-selectively across the protein. As such, Proteinase K
digestions require careful titration using a preferred
enzyme-to-polypeptide ratio to provide sufficient proteolysis to
generate short peptides (.about.30 amino acids), but not
over-digest the sample. In general, a titration of the functional
activity needs to be performed for a given Proteinase K lot. In
this example, a protein sample is digested with proteinase K, for 1
h at 37.degree. C. at a 1:10-1:100 (w/w) enzyme:protein ratio in
1.times.PBS/1 mM EDTA/0.5 mM CaCl.sub.2/0.5% SDS (pH 8.0). After
incubation, PMSF is added to a 5 mM final concentration to inhibit
further digestion.
[0636] The specific activity of Proteinase K can be measured by
incubating the "chemical substrate" benzoyl arginine-p-nitroanilide
with Proteinase K and measuring the development of the yellow
colored p-nitroaniline product that absorbs at .about.410 nm.
Enzyme activity is measured in units, where one unit equals 1
.mu.mole of p-nitroanilide produced/min, and specific activity is
measured in units of enzyme activity/mg total protein. The specific
activity is then calculated by dividing the enzyme activity by the
total amount of protein in the solution.
Example 2: Sample Prep Using Sp3 on Bead Protease Digestion and
Labeling
[0637] Proteins are extracted and denatured using an SP3 sample
prep protocol as described by Hughes et al. (2014, Mol Syst Biol
10:757). After extraction, the protein mix (and beads) is
solubilized in 50 mM borate buffer (pH 8.0) w/1 mM EDTA
supplemented with 0.02% SDS at 37.degree. C. for 1 hr. After
protein solubilization, disulfide bonds are reduced by adding DTT
to a final concentration of 5 mM, and incubating the sample at
50.degree. C. for 10 min. The cysteines are alkylated by addition
of iodoacetamide to a final concentration of 10 mM and incubated in
the dark at room temperature for 20 min. The reaction is diluted
two-fold in 50 mM borate buffer, and Glu-C or Lys-C is added in a
final proteinase:protein ratio of 1:50 (w/w). The sample is
incubated at 37.degree. C. o/n (.about.16 hrs.) to complete
digestion. After sample digestion as described by Hughes et al.
(supra), the peptides are bound to the beads by adding 100%
acetonitrile to a final concentration of 95% acetonitrile and
washed with acetonitrile in an 8 min. incubation. After washing,
peptides are eluted off the beads in 10 .mu.l of 2% DMSO by a 5
min. pipette mixing step.
Example 3: Coupling of the Recording Tag to the Peptide
[0638] A DNA recording tag is coupled to a peptide in several ways
(see, Aslam et al., 1998, Bioconjugation: Protein Coupling
Techniques for the Biomedical Sciences, Macmillan Reference LTD;
Hermanson G T, 1996, Bioconjugate Techniques, Academic Press Inc.,
1996). In one approach, an oligonucleotide recording tag is
constructed with a 5' amine that couples to the C-terminus of the
peptide using carbdiimide chemistry, and an internal strained
alkyne, DBCO-dT (Glen Research, VA), that couples to azide beads
using click chemistry. The recording tag is coupled to the peptide
in solution using large molar excess of recording tag to drive the
carbodiimide coupling to completion, and limit peptide-peptide
coupling. Alternatively, the oligonucleotide is constructed with a
5' strained alkyne (DBCO-dT), and is coupled to an
azide-derivitized peptide (via azide-PEG-amine and carbodiimide
coupling to C-terminus of peptide), and the coupled to
aldehyde-reactive HyNic hydrazine beads. The recording tag
oligonucleotide can easily be labeled with an internal aldehyde
formylindole (Trilink) group for this purpose. Alternatively,
rather than coupling to the C-terminal amine, the recording tags
can instead be coupled to internal lysine residues (preferably
after a Lys-C digest, or alternatively a Glu-C digest). In one
approach, this can be accomplished by activating the lysine amine
with an NHS-azide (or NHS-PEG-azide) group and then coupling to a
5' amine-labeled recording tag. In another approach, a 5'
amine-labeled recording tag can be reacted with excess NHS
homo-bifunctional cross-linking reagents, such as DSS, to create a
5' NHS activated recording tag. This 5' NHS activated recording tag
can be directly coupled to the .epsilon.-amino group of the lysine
residues of the peptide.
Example 4: Size-Specific Labeling of Amino Acids on a Peptide
[0639] Five different examples of amino acids on proteins or
peptides that can be modified directly with activated DNA tags
(using activation with heterobifunctional amino acid site-specific
reagents) or indirectly via click chemistry heterobifunctional
reagent that site-specifically labels amino acids with a click
moiety that is later used to attach a cognate click moiety on the
DNA tag (Lundblad 2014). A typical protein input comprises 1 .mu.g
protein in 50 .mu.l appropriate aqueous buffer containing 0.1%
RapiGest.TM. SF surfactant, and 5 mM TCEP. RapiGest.TM. SD is
useful as an acid degradable surfactant for denaturing proteins
into polypeptides for improving labeling or digestion. The
following amino acid labeling strategies can be used: cysteines
using maleimide chemistry--200 .mu.M Sulfo-SMCC-activated DNA tags
are used to site-specifically label cysteines in 100 mM IVIES
buffer (pH 6.5)+1% TX-100 for 1 hr.; lysines using NHS
chemistry--200 .mu.M DSS or BS.sup.3-activated DNA tags are used to
site-specifically label lysine on solution phase proteins or the
bead-bound peptides in borate buffer (50 mM, pH 8.5)+1% TX-100 for
1 hr. at room temp; tyrosine is modified with
4-Phenyl-3H-1,2,4-triazoline-3,5(4H)-diones (PTAD) or diazonium
chemistry--for diazonium chemistry, DNA Tags are activated with EDC
and 4-carboxylbenzene diazonium tetrafluoroborate (Aikon
International, China). The diazo linkage with tyrosine is created
by incubating the protein or bead-bound peptides with 200 .mu.M
diazonium-derivitized DNA tags in borate buffer (50 mM, pH 8.5)+1%
TX-100 for 1 h on ice (Nguyen, Cao et al. 2015).
Aspartate/glutamate is modified using EDC chemistry--an
amine-labeled DNA tag is incubated with the bead-bound peptides and
100 mM EDC/50 mM imidazole in pH 6.5 IVIES for 1 hr. at room
temperature (Basle et al., 2010, Chem. Biol. 17:213-227). After
labeling, excess activated DNA tags are removed using protein
binding elution from C.sub.4 resin ZipTips (Millipore). The eluted
proteins are brought up 50 .mu.l.times.PBS buffer.
Example 5: Immobilizing Strained Alkyne Recording Tag-Labeled
Peptides to Azide-Activated Beads
[0640] Azide-derivitized Dynabeads.RTM. M-270 beads are generated
by reacting commercially-available amine Dynabeads.RTM. M-270 with
an azide PEG NHS ester heterobifunctional linker (JenKem
Technology, TX). Moreover, the surface density of azide can be
titrated by mixing in methoxy or hydroxyl PEG NHS ester in the
appropriate ratio. For a given peptide sample, 1-2 mg
azide-derivitized Dynabeads.RTM. M-270 beads
(.about.1.3.times.10.sup.8 beads) is diluted in 100 .mu.l borate
buffer (50 mM sodium borate, pH 8.5), 1 ng recording tag-peptide is
added, and incubated for 1 hr. at 23-37.degree. C. Wash 3.times.
with 200 .mu.l borate buffer.
Example 6: Creating Formylindole Reactive HyNic Beads
[0641] HyNic derivitization of amine beads creates formylindole
reactive beads. An aliquot of 20 mg Dynabeads.RTM. M-270 Amine
beads (2.8 .mu.m) beads are suspended in 200 ul borate buffer.
After a brief sonication, 1-2 mg Sulfo-S-HyNic (succinimidyl
6-hydrazinonicotinate acetone hydrazone, SANH) (Catalog #S-1002,
Solulink, San Diego) is added and the reaction mixture is shaken
for 1 hr. at room temperature. The beads are then washed 2.times.
with borate buffer, and 1.times. with citrate buffer (200 mM sodium
citrate). The beads are suspended in a final concentration of 10
mg/ml in citrate buffer.
Example 7: Immobilizing Recording Tag Formlindole-Labeled Peptides
to Activated Beads
[0642] An aliquot of 1-2 mg HyNic activated Dynabeads.RTM. M-270
beads (.about.1.3.times.10.sup.8 beads) are diluted in 100 .mu.l
citrate buffer supplemented with 50 mM aniline, .about.1 ng
recording tag peptide conjugate is added and incubated for 1 hr. at
37.degree. C. The beads are washed 3.times. with 200 .mu.l citrate
buffer, and re-suspended in 100 .mu.l borate buffer.
Example 8: Oligonucleotide Model System--Recording of Binding Agent
History by Transfer of Identifying Information of Coding Tag to
Recording Tag in Cyclic Fashion
[0643] For nucleic acid coding tags and recording tags, information
can be transferred from the coding tag on the bound binding agent
to the proximal recording tag by ligation or primer extension using
standard nucleic acid enzymology. This can be demonstrated with a
simple model system consisting of an oligonucleotide with the 5'
portion representing the binding agent target, and the 3' portion
representing the recording tag. The oligonucleotide can be
immobilized at an internal site using click chemistry through a
dT-alkyne modification (DBCO-dT, Glen Research). In the example
shown in FIG. 24A, the immobilized oligonucleotide (AB target)
contains two target binding regions, labeled A and B, to which
cognate oligonucleotide "binding agents" can bind, the A oligo and
the B oligo. The A oligo and B oligonucleotides are linked to
coding tags (differing in sequence and length) which interact with
the recording tag through a common spacer (Sp) to initiate primer
extension (or ligation). The length of Sp should be kept short
(e.g., 6-9 bases) to minimize non-specific interaction during
binding agent binding. In this particular example, the length of
the coding tag is designed to easily distinguish by gel analysis an
"A" oligo binding event (10 base encoder sequence) from a "B" oligo
binding event (20 base encoder sequence).
[0644] Simple analysis on a PAGE gel enables measurement of the
efficiency of A or B coding tag transfer, and allows easy
optimization of experimental parameters. In addition to the AB
target sequence, a similar oligonucleotide CD target sequence is
employed (see, FIG. 24B), except C and D are different
hybridization sequences non-interacting with A and B. Furthermore,
C and D contain coding tags of differing sequences and lengths,
comprising a 30 base DNA code and 40 base DNA code, respectively.
The purpose of the second target sequence, CD, is to assess cross
interaction between the AB and CD target molecules. Given specific
hybridization, the extended recording tag for the CD target should
not contain A or B coding tag information unless intermolecular
crossing occurs between the A or B coding tags connected to oligos
bound to the AB target. Likewise, the extended recording tag for
the AB target should contain no C or D coding tag information. In
the situation where the AB and CD targets are in close physical
proximity (i.e., <50 nm), there is likely to be cross talk.
Therefore, it is important to appropriately space out the target
macromolecules on the surface.
[0645] This oligonucleotide model system enables a full
characterization of the recording capability of binding agent
history. FIG. 25 illustrates information transfer via ligation
rather than primer extension. After initial optimization on gels,
various binding and assay protocols are performed and assessed by
sequencing. A unique molecular identifier (UMI) sequence is used
for counting purposes, and enables identification of reads
originating from a single macromolecule and provides a measure of
overall total macromolecule complexity in the original sample.
Exemplary historical binding protocols include: A-B--C-B-A,
A-B-A-A-B-A, A-B-C-D-A-C, etc. The resultant final products should
read: UMI-Sp-A-Sp-B-Sp-B-Sp-A-Sp+UMI-Sp-C-Sp;
[0646] UMI-Sp-A-Sp-B-Sp-A-Sp-A-Sp-B-Sp-A;
UMI-A-Sp-B-Sp-A+UMI-Sp-C-Sp-D-Sp-C-Sp, respectively. The results of
this analysis allow further optimization.
Example 9: Oligonucleotide-Peptide Model System--Recording of
Binding Agent History by Transfer of Identifying Information of
Coding Tag to Recording Tag in Cyclic Fashion
[0647] After validating the oligonucleotide model system, a peptide
model system is constructed from the oligonucleotide system by
conjugating a peptide epitope tag to the 5' end of the exemplary
target oligonucleotide sequence (FIGS. 26A and 26B). Exemplary
peptide epitope tags include: FLAG (DYKDDDDK) (SEQ ID NO:171), V5
(GKPIPNPLLGLDST) (SEQ ID NO:172), c-Myc (EQKLISEEDL) (SEQ ID
NO:173), HA (YPYDVPDYA) (SEQ ID NO:174), V5 (GKPIPNPLLGLDST) (SEQ
ID NO:175), StrepTag II (NWSHPQFEK) (SEQ ID NO:176), etc. An
optional Cys-Ser-Gly linker can be included for coupling of the
peptide epitope tag to the oligonucleotide. The AB oligonucleotide
template of Example 7 is replaced with an A_oligonucleotide-cMyc
peptide construct, and the CD oligonucleotide template of Example 7
is replaced with an C_oligonucleotide-HA peptide construct (see,
FIG. 26). The A_oligonucleotide-cMyc peptide construct also
contains a CSG linker and N-terminal phosphotyrosine. Likewise, the
cognate peptide binding agents, cMyc antibody and HA antibody, are
tagged with the B oligonucleotide coding tag, and D oligonucleotide
coding tag, respectively. The phosphotyrosine specific antibody is
tagged with a separate "E" coding tag. In this way, the peptide
model system parallels the oligonucleotide system, and both oligo
binding and antibody binding are tested in this model system.
[0648] Antibody staining of the immobilized DNA-peptide construct
using anti-c-myc antibody (2G8D5, mouse monoclonal, GenScript),
anti-HA antibody (5E11D8, mouse monoclonal, GenScript), strep-tag
II antibody (5A9F9, mouse monoclonal, GenScript), or anti-FLAG
antibody (5AE85, mouse monoclonal, GenScript) is performed using
0.1-1 .mu.g/ml in 1.times.PBST (PBS+0.1% Tween 20). Incubations are
typically done at room temperature for 30 min. Standard
pre-blocking using 1% PVP in 1.times.PBST, and post-stain washing
are also performed. Antibody de-staining is effectively
accomplished by washing with a high salt (1 M NaCl), and either low
pH (glycine, pH 2.5) or high pH (triethylamine, pH 11.5).
[0649] The target oligonucleotide contains an internal alkyne label
for attachment to azide beads, and the 5' terminus contains an
amino group for an SMCC-mediated attachment to a C-terminal
cysteine of the peptide as described by Williams et al. (2010, Curr
Protoc Nucleic Acid Chem. Chapter 4:Unit 4.41). Alternatively,
standard carbodiimide coupling is used for a conjugation reaction
of the oligonucleotide and peptide (Lu et al., 2010, Bioconjug.
Chem. 21:187-202). In this case, an excess of oligo is used to
drive the carbodiimide reaction and minimized peptide-peptide
coupling. After conjugation, the final product is purified by
excision and elution from a PAGE gel.
Example 10: Coding Tag Transfer Via Ligation of DNA/PNA Coding Tag
Complement to Recording Tag
[0650] A coding tag is transferred either directly or indirectly by
ligation to the recording tag to generate an extended recording
tag. In one implementation, an annealed complement of the coding
tag is ligated to the recording tag (FIG. 25). This coding tag
complement can either be a nucleic acid (DNA or RNA), peptide
nucleic acid (PNA), or some other coding molecule capable of being
ligated to a growing recording tag. The ligation can be enzymatic
in the case of DNA and RNA using standard ATP-dependent and
NADH-dependent ligases, or ligation can be chemical-mediated for
both DNA/RNA and especially the peptide nucleic acid, PNA.
[0651] For enzymatic ligation of DNA, the annealed coding tag
requires a 5' phosphate to ligate to the 3' hydroxyl of the
recording tag. Exemplary enzymatic ligation conditions are as
follows (Gunderson, Huang et al. 1998): The standard T4 DNA
ligation reaction includes: 50 mM Tris- HCl (pH 7.8), 10 mM MgCl2,
10 mM DTT, 1 mM ATP, 50 .mu.g/ml BSA, 100 mM NaCl, 0.1% TX-100 and
2.0 U/.mu.l T4 DNA ligase (New England Biolabs). E. coli DNA ligase
reaction includes 40 mM Tris-HCl (pH 8.0), 10 mM MgCl.sub.2, 5 mM
DTT, 0.5 mM NADH, 50 .mu.g/ml BSA, 0.1% TX-100, and 0.025 U/.mu.l
E. coli DNA ligase (Amersham). Taq DNA ligation reaction includes
20 mM Tris-HCl (pH 7.6), 25 mM potassium acetate, 10 mM magnesium
acetate, 10 mM DTT, 1 mM NADH, 50 .mu.g/ml BSA, 0.1% Triton X-100,
10% PEG, 100 mM NaCl, and 1.0 U/.mu.l Taq DNA ligase (New England
Biolabs). T4 and E. coli DNA ligase reactions are performed at room
temperature for 1 hr., and Taq DNA ligase reactions are performed
at 40.degree. C. for 1 hr.
[0652] Several methods of chemical ligation of templated of DNA/PNA
can be employed for DNA/PNA coding tag transfer. These include
standard chemical ligation and click chemistry approaches.
Exemplary chemical ligation conditions for template DNA ligation is
as follows (Gunderson, Huang et al. 1998): ligation of a template
3' phosphate reporter tag to a 5' phosphate coding tag takes place
within 1 hr. at room temperature in a reaction consisting of 50 mM
2-[N-morpholino]ethanesulfonic acid (MES) (pH 6.0 with KOH), 10 mM
MgCl.sub.2, 0.001% SDS, freshly prepared 200 mM EDC, 50 mM
imidazole (pH 6.0 with HCl) or 50 mM HOBt (pH 6.0 with HCl) and
3.0-4.0 M TMACl (Sigma).
[0653] Exemplary conditions for template-dependent ligation of PNA
include ligation of NH.sub.2--PNA-CHO polymers (e.g., coding tag
complement and extended recorder tag) and are described by Brudno
et al. (Brudno, Birnbaum et al. 2010). PNA has a 5' amine
equivalent and a 3' aldehyde equivalent wherein chemical ligation
couples the two moieties to create a Schiff base which is
subsequently reduced with sodium cyanoborohydride. The typical
reaction conditions for this coupling are: 100 mM TAPS (pH 8.5), 80
mM NaCl, and 80 mM sodium cyanoborohydride at room temperature for
60 min. Exemplary conditions for native chemical ligation using
functionalized PNAs containing 5' amino terminal 1,2-aminothiol
modifications and 3' C-terminal thioester modifications is
described by Roloff et al. (2014, Methods Mol. Biol. 1050:131-141).
Other N- and C-terminal PNA moieties can also be used for ligation.
Another example involves the chemical ligation of PNAs using click
chemistry. Using the approach of Peng et al. (2010, European J.
Org. Chem. 2010: 4194-4197), PNAs can be derivitized with 5' azide
and 3' alkyne and ligated using click chemistry. An exemplary
reaction condition for the "click" chemical ligation is: 1-2 mg
beads with templated PNA-PNA in 100 .mu.l of reaction mix
containing 10 mM potassium phosphate buffer, 100 mM KCl, 5 mM THPTA
(tris-hydroxypropyl trizolyl amine), 0.5 mM CuSO.sub.4, and 2.5 mM
Na-ascorbate. The chemical ligation reaction is incubated at room
temperature for 1 hr. Other exemplary methods of PNA ligation are
described by Sakurai et al. (Sakurai, Snyder et al. 2005).
Example 11: PNA Translation to DNA
[0654] PNA is translated into DNA using click chemistry-mediated
polymerization of DNA oligonucleotides annealed onto the PNA
template. The DNA oligos contain a reactive 5' azide and 3' alkyne
to create an inter-nucleotide triazole linkage capable of being
replicated by DNA polymerases (El-Sagheer et al., 2011, Proc. Natl.
Acad. Sci. USA 108:11338-11343). A complete set of DNA oligos (10
nM, in 1.times. hybridization buffer: 10 mM Na-borate (pH 8.5), 0.2
M NaCl) complementary to all possible coding tags in the PNA is
incubated (23-50.degree. C.) for 30 minutes with the solid-phase
bound PNA molecules. After annealing, the solid-phase bound PNA-DNA
constructs are washed 1.times. with sodium ascorbate buffer (10 mM
sodium ascorbate, 200 mM NaCl). The `click chemistry` reaction
conditions are as follows: PNA-DNA on beads are incubated in fresh
sodium ascorbate buffer and combined 1:1 with a mix of 10 mM
THPTA+2 mM CuSO.sub.4 and incubated for 1 hr. at room temperature.
The beads are then washed 1.times. with hybridization buffer and
2.times. with PCR buffer. After chemical ligation, the resultant
ligated DNA product is amplified by PCR under conditions as
described by El-Sagheer et al. (2011, Proc. Natl. Acad. Sci. USA
108:11338-11343).
Example 12: Mild N-Terminal Edman Degradation Compatible with
Nucleic Acid Recording and Coding Tags
[0655] Compatibility between N-terminal Edman degradation and DNA
encoding allows this approach to work for peptide sequencing. The
standard conditions for N-terminal Edman degradation, employing
anhydrous TFA, destroys DNA. However, this effect is mitigated by
developing milder cleavage conditions and developing modified DNA
with greater acid resistance. Milder conditions for N-terminal
Edman degradation are developed using a combination of cleavage
optimization of phenylthiocarbamoyl (PTC)-peptides and measured
stability of DNA/PNA encoded libraries under the cleavage
conditions. Moreover, native DNA can be stabilized against acid
hydrolysis, by using base modifications, such as 7-deaza purines
which reduce depurination at low pH, and 5' methyl modified
cytosine which reduces depyrimidation (Schneider and Chait, 1995,
Nucleic Acids Res. 23:1570-1575). T-rich coding tags may also be
useful given that thymine is the most stable base to acid
fragmentation. The conditions for mild N-terminal Edman degradation
replace anhydrous TFA cleavage with a mild 10 min. base cleavage
using triethylamine acetate in acetonitrile at 60.degree. C. as
described by Barrett et al. (1985, Tetrahedron Lett. 26:4375-4378,
incorporated by reference in its entirety). These mild conditions
are compatible with most types of DNA reporting and coding tags. As
an alternative, PNAs are used in coding tags since they are
completely acid-stable (Ray and Norden, 2000, FASEB J.
14:1041-1060).
[0656] The compatibility of using DNA coding tags/recording tags to
encode the identity of NTAA binders and perform mild N-terminal
Edman degradation reaction is demonstrated using the following
assay. Both anti-phosphotyrosine and anti-cMyc antibodies are used
to read out the model peptide. C-Myc and N-terminal phosphotyrosine
detection, coding tag writing, and removal of the N-terminal
phosphotyrosine using a single Edman degradation step. After this
step, the peptide is stained again with anti-phosphotyrosine and
anti-cMyc antibodies. Stability of the recording tag to N-terminal
degradation is assessed by qPCR. Effective removal of the
phosphotyrosine is indicated by absence of the E-oligonucleotide
coding tag information in the final recording tag sequence as
analyzed by sequencing, qPCR, or gel electrophoresis.
Example 13: Preparation of Compartment Tagged Beads
[0657] For preparation of compartment tagged beads, barcodes are
incorporated into oligonucleotides immobilized on beads using a
split-and-pool synthesis approach, using either phosphoramidite
synthesis or through split-and-pool ligation. A compartment tag can
further comprise a unique molecular identifier (UMI) to uniquely
label each peptide or protein molecule to which the compartment tag
is joined. An exemplary compartment tag sequence is as follows:
5'-NH.sub.2-GCGCAATCAG-XXXXXXXXXXXX-NNNNN-TGCAAGGAT-3' (SEQ ID
NO:177). The XXXXXXXXXXXX (SEQ ID NO:178) barcode sequence is a
fixed population of nucleobase sequences per bead generated by
split-pool on bead synthesis, wherein the fixed sequence differs
from bead to bead. The NNNNN (SEQ ID NO:179) sequence is randomized
within a bead to serve as a unique molecule identifier (UMI) for
the peptide molecule that is subsequently joined thereto. The
barcode sequence can be synthesized on beads using a split-and-pool
approach as described by Macosko et al. (2015, Cell 161:1202-1214,
incorporated by reference in its entirety). The UMI sequences can
be created by synthesizing an oligonucleotide using a degenerate
base mixture (mixture of all four phosphoramidite bases present at
each coupling step). The 5'-NH.sub.2 is activated with succinimidyl
4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and a
cysteine containing butelase I peptide substrate with the sequence
from N-terminus to C-terminus "CGGSSGSNHV" (SEQ ID NO:180) is
coupled to the SMCC activated compartment tagged beads using a
modified protocol described by Williams et al. (2010, Curr Protoc
Nucleic Acid Chem. Chapter 4:Unit 4.41). Namely, 200 .mu.l of
magnetic beads (10 mg/ml) are placed in a 1.5 ml Eppendorf tube. 1
ml of coupling buffer (100 mM KH.sub.2PO.sub.4 buffer, pH 7.2 with
5 mM EDTA, 0.01% Tween 20, pH 7.4) is added to the tube and
vortexed briefly. Freshly prepared 40 .mu.l Sulfo-SMCC (50 mg/ml in
DMSO, ThermoFisher) is added to the magnetic beads and mixed. The
reaction is incubated for 1 hr. at room temperature on a rotary
mixer. After incubation, the beads are separated from the
supernatant on a magnet, and washed 3.times. with 500 .mu.l
coupling buffer. The beads are re-suspended in 400 .mu.l coupling
buffer. 1 mL of CGGSSGSNHV (SEQ ID NO:180) peptide is added (1
mg/mL in coupling buffer after TCEP-reduction (5 mM) and ice cold
acetone precipitation) to the magnetic beads. The reaction is
incubated at room temperature for 2 hours on a rotary mixer. The
reaction is washed 1.times. with coupling buffer. 400 .mu.l
quenching buffer (100 mM KH.sub.2PO.sub.4 buffer, pH 7.2 with 10
mg/mL Mercaptosuccinic Acid, pH 7.4) is added to the reaction
mixture and incubated for 2 hrs. on a rotary mixer. The reaction
mixture is washed 3.times. with coupling buffer. The resultant
beads are re-suspended in storage buffer (10 mM KH.sub.2PO.sub.4
buffer, pH 7.2 with 0.02% NaN.sub.3, 0.01% Tween 20, pH 7.4) and
stored at 4.degree. C.
Example 14: Generation of Encapsulated Beads and Proteins
[0658] Compartment tagged beads and proteins are combined with a
zinc metallo-endopeptidase, such as endoproteinase AspN (Endo
AspN), an optional photo-caged Zn chelator (e.g., ZincCleav I), and
an engineered thermos-tolerant butelase I homolog (Bandara, Kennedy
et al. 2009, Bandara, Walsh et al. 2011, Cao, Nguyen et al. 2015).
Compartment tagged beads from Example 12 are mixed with proteins
and emulsified through a T-junction microfluidic or flow focusing
device (see FIG. 21). In a two-aqueous flow configuration, the
protein and Zn.sup.2+ in one flow can be combined with the
metallo-endopeptidase from the other flow to initiate digestion
immediately upon droplet formation. In the one flow configuration,
all reagents are premixed and emulsified together. This requires
use of the optional photo-caged Zn chelator (e.g., ZincCleav I) to
initiate protein digestion post droplet formation via exposure to
UV light. The concentrations and flow conditions are adjusted such
that, on average, there is less than one bead per droplet. In an
optimized experiment, 10.sup.8 femto-droplets can be made with an
occupancy of about 10% of the droplets containing beads (Shim et
al., 2013, ACS Nano 7:5955-5964). In the one flow approach, after
forming droplets, the protease is activated by exposing the
emulsion to UV-365 nm light to release the photo-caged Zn.sup.2+,
activating the Endo AspN protease. The emulsion is incubated for 1
hr. at 37.degree. C. to digest the proteins into peptides. After
digestion, the Endo AspN is inactivated by heating the emulsion to
80.degree. C. for 15 min. In the two-flow formulation, the
Zn.sup.2+ is introduced during the combining of the two flows into
a droplet. In this case, the Endo AspN can be inactivated by using
a photo-activated Zn.sup.2+ caging molecule in which the chelator
is activated upon exposure to UV light, or by adding an amphipathic
Zn.sup.2+ chelating agent to the oil phase, such as 2-alkylmalonic
acid, or EDTA-MO. Examples of amphipathic EDTA molecules include:
EDTA-MO, EDTA-BO, EDTA-BP, DPTA-MO, DPTA-BO, DPTA-BP, etc. (Ojha,
Singh et al. 2010, Moghaddam, de Campo et al. 2012). Other
modalities can also be used to control the reaction within the
droplet interior including changing the pH of the droplet through
addition of amphipathic acids or bases to the emulsion oil. For
example, droplet pH can be lowered using water/oil soluble acetic
acid. Addition of acetic acid to a fluoro-emulsion leads to
reduction of pH within the droplet compartment due to the
amphipathic nature of the acetic acid molecule (Mashaghi and van
Oijen, 2015, Sci Rep 5:11837). Likewise, addition of the base,
propyl amine, alkalinizes the droplet interior. Similar approaches
can be used for other types of amphipathic molecules such as
oil/water soluble redox reagents, reducing agents, chelating agents
and catalysts.
[0659] After digestion of the compartmentalized proteins into
peptides, the peptides are ligated to the compartment tags
(oligonucleotide peptide barcode chimeras) on the bead using
butelase I or a chemical ligation (e.g., aldehyde-amino, etc.)
(see, FIG. 16 and FIG. 22A). In an optional approach, an
oligo-thiodepsipeptide "chemical substrate" is employed to make the
butelase I ligation irreversible (Nguyen, Cao et al. 2015). After
ligation, the emulsion is "cracked", and the beads with immobilized
compartment tagged peptide constructs collected in bulk, or the
compartment tagged peptides are cleaved from the beads, and
collected in bulk. If the bead immobilized compartment tagged
peptides comprise a recording tag, these beads can be used directly
in nucleic acid encoding based peptide analysis methods described
herein. In contrast, if the compartment tagged peptides are cleaved
from the bead substrate, the compartment tagged peptides are then
associated with a recording tag by conjugation to the C-terminus of
the compartment tagged peptide, and immobilized on a solid support
for subsequent binding cycles with coding tagged binding agents and
sequencing analysis as described herein. Association of a recording
tag with a compartment tagged peptide can be accomplished using a
trifunctional linker molecule. After immobilization of the
compartment tagged peptide with an associated recording tag to a
solid support for cyclic sequencing analysis, the compartment
information is transferred to the associated recording tag using
primer extension or ligation (see, FIG. 22B). After transferring
the compartment tag information to the recording tag, the
compartment tag can be cleaved from the peptide using the same
enzyme used in the original peptide digestion (see, FIG. 22B). This
restores the original N-terminal end of the peptide, thus enabling
N-terminal degradation peptide sequencing methods as described
herein.
Example 15: Di-Tag Generation by Associating Recording Tags of
Peptides Covalently Modified with Amino Acid-Specific Coding Tags
Via Three Primer Fusion Emulsion PCR
[0660] Peptides with recording tags comprised of a compartment tag
and a molecular UMI are chemically modified with coding tag
site-specific chemical labels. The coding tag also contains a UMI
to enable counting of the number of amino acids of a given type
within a modified peptide. Using a modified protocol from Tyson and
Armor (Tyson and Armour 2012), emulsion PCRs are prepared in a
total aqueous volume of 100 .mu.l, containing 1.times. PHUSION.TM.
GC reaction buffer (Thermo Fisher Scientific), 200 .mu.M each dNTPs
(New England Biolabs), 1 .mu.M primer U1, 1 .mu.M primer U2tr, 25
nM primer Sp, 14 units PHUSION.TM. high fidelity DNA polymerase
(Thermo Fisher Scientific). 10 .mu.l aqueous phase is added every 5
to 10 seconds to 200 .mu.l oil phase (4.5% vol./vol.) Span 80, 0.4%
vol./vol. Tween 80 and 0.05% Triton X-100 dissolved in light
mineral oil (Sigma)) in a 2 ml cryo-vial while stirring at 1000 rpm
for a total of 5 minutes as previously described by Turner and
Hurles (2009, Nat. Protoc. 4:1771-1783). Average droplet size of
the resultant emulsion was about 5 microns. Other methods of
emulsion generation, such as the use of T-junctions and flow
focusing, can also be employed (Brouzes, Medkova et al. 2009).
After emulsion generation, 100 .mu.l of aqueous/oil mixture is
transferred to 0.5 ml PCR tubes and first-round amplification
carried out at the following conditions: 98.degree. C. for 30
seconds; 40 cycles of 98.degree. C. for 10 seconds, 70.degree. C.
for 30 seconds and 72.degree. C. for 30 seconds; followed by
extension at 72.degree. C. for 5 minutes. A second-round
amplification reaction is carried out at the following conditions:
98.degree. C. for 30 seconds; 40 cycles of 98.degree. C. for 10
seconds, 55.degree. C. for 30 seconds and 72.degree. C. for 30
seconds; followed by hold at 4.degree. C. Emulsions are disrupted
as soon as possible after the final cycle of the PCR by adding 200
.mu.l hexane (Sigma) directly to the PCR tube, vortexing for 20
seconds, and centrifuging at 13,000 g for 3 minutes.
Example 16: Sequencing Extended Recording Tag, Extended Coding Tag,
or Di-Tag Constructs
[0661] The spacer (Sp) or universal priming sites of a recording
tag or coding tag can be designed using only three bases (e.g., A,
C, and T) in the body of the sequence, and a fourth base (e.g., G)
at the 5' end of the sequence. For sequencing by synthesis (SBS),
this enables rapid dark base incorporation across the spacer
sequence using a mix of standard dark (unlabeled and
non-terminated) nucleotides (dATP, dGTP, and dTTP) and a single ffC
dye-labeled reversible terminator (e.g., fully functional cytosine
triphosphate). In this way, only the relevant encoder sequence,
unique molecular identifier(s), compartment tags, binding cycle
sequence of the extended reporter tag, extended coding tag, or
di-tag are SBS sequenced, and the non-relevant spacer or universal
priming sequences are "skipped over". The identities of the bases
for the spacer and the fourth base at the 5' end of the sequence
may be changed and the above identities are provided for purposes
of illustration only.
Example 17: Preparation of Protein Lysates
[0662] There are a wide variety of protocols known in the art for
making protein lysates from various sample types. Most variations
on the protocol depend on cell type and whether the extracted
proteins in the lysate in are to be analyzed in a non-denatured or
denatured state. For the NGPA assay, either native conformation or
denatured proteins can be immobilized to a solid substrate (see
FIG. 32A-32H). Moreover, after immobilization of native proteins,
the proteins immobilized on the substrate's surface can be
denatured. The advantage of employing denatured proteins are
two-fold. First of all, many antibody reagents bind linear epitopes
(e.g., Western Blot Abs), and denatured proteins provide better
access to linear epitopes. Secondly, the NGPA assay workflow is
simplified when using denatured proteins since the annealed coding
tag can be stripped from the extended recording tag using alkaline
(e.g., 0.1 NaOH) stripping conditions since the immobilized protein
is already denatured. This contrasts with the removal of annealed
coding tags using assays comprising proteins in their native
conformation, that require an enzymatic removal of the annealed
coding tag following binding event and information transfer.
[0663] Examples of non-denaturing protein lysis buffers include:
RPPA buffer consisting of 50 mm HEPES (pH 7.4), 150 mM NaCl, 1%
Triton X-100, 1.5 mM MgCl2, 10% glycerol; and commercial buffers
such as M-PER mammalian protein extraction reagent (Thermo-Fisher).
A denaturing lysis buffer comprises 50 mm HEPES (pH 8), 1% SDS. The
addition of Urea (1M-3M) or Guanidine HCl (1-8M) can also be used
in denaturing the protein sample. In addition to the above
components of lysis buffers, protease and phosphatase inhibitors
are also generally included. Examples of protease inhibitors and
typical concentrations include aptrotinin (2 .mu.g/ml), leupeptin
(5-10 .mu.g/ml), benzamidine (15 .mu.g/ml), pepstatin A (1
.mu.g/ml), PMSF (1 mM), EDTA (5 mM), and EGTA (1 mM). Examples of
phosphatase inhibitors include Na pyrophosphate (10 mM), sodium
fluoride (5-100 mM) and sodium orthovanadate (1 mM). Additional
additives can include DNAaseI to remove DNA from the protein
sample, and reducing agents such as DTT to reduce disulfide
bonds.
[0664] An example of a non-denaturing protein lysate protocol
prepared from tissue culture cells is as follows: Adherent cells
are trypsinized (0.05% trypsin-EDTA in PBS), collected by
centrifugation (200 g for 5 min.), and washed 2.times. in ice cold
PBS. Ice-cold M-PER mammalian extraction reagent (.about.1 mL per
10.sup.7 cells/100 mm dish or 150 cm.sup.2 flask) supplemented with
protease/phosphatase inhibitors and additives (e.g., EDTA free
complete inhibitors (Roche) and PhosStop (Roche) is added. The
resulting cell suspension is incubated on a rotating shaker at
4.degree. C. for 20 min. and then centrifuged at 4.degree. C. at
.about.12,000 rpm (depending on cell type) for 20 min to isolate
the protein supernatant. The protein is quantitated using the
BC.sub.A assay, and resuspended at 1 mg/ml in PBS. The protein
lysates can be used immediately or snap frozen in liquid nitrogen
and stored at -80.degree. C.
[0665] An example of a denaturing protein lysate protocol, based on
the SP3 protocol of Hughs et al., prepared from tissue culture
cells is as follows: adherent cells are trypsinized (0.05%
trypsin-EDTA in PBS), collected by centrifugation (200 g for 5
min.), and washed 2.times. in ice cold PBS. Ice-cold denaturing
lysis buffer (.about.1 mL per 10.sup.7 cells/100 mm dish or 150
cm.sup.2 flask) supplemented with protease/phosphatase inhibitors
and additives (e.g. 1.times. cOmplete Protease Inhibitor Cocktail
(Roche)) is added. The resulting cell suspension is incubated at
95.degree. C. for 5 min. and placed on ice for 5 min. Benzonase
Nuclease (500 U/ml) is added to the lysate and incubated at
37.degree. C. for 30 min. to remove DNA and RNA.
[0666] The proteins are reduced by addition of 5 .mu.L of 200 mM
DTT per 100 uL of lysate and incubated for 45.degree. C. for 30
min. Alklylation of protein cysteine groups is accomplished by
addition of 10 uL of 400 mM iodoacetamide per 100 uL of lysate and
incubated in the dark at 24.degree. for 30 min. Reactions are
quenched by addition of 10 uL of 200 mM DTT per 100 uL of lysate.
Proteins are optionally acylated by adding 2 ul an acid anhydride
and 100 ul of 1 M Na2CO3 (pH 8.5) per 100 ul of lysate. Incubate
for 30 min. at room temp. Valeric, benzoic, and proprionic
anhydride are recommended rather than acetic anhydride to enable
"in vivo" acetylated lysines to be distinguished from "in situ"
blocking of lysine groups by acylation (Sidoli, Yuan et al. 2015).
The reaction is quenched by addition of 5 mg of
Tris(2-aminoethyl)amine, polymer (Sigma) and incubation at room
temperature for 30 min. Polymer resin is removed by centrifuging
lysate at 2000 g for 1 min. through a 0.45 um cellulose acetate
Spin-X tube (Corning). The protein is quantitated using the BCA
assay, and resuspended at 1 mg/ml in PBS.
[0667] In additional examples, labeled peptides are generated using
a filter-aided sample preparation (FASP) protocol, as described by
Erde et al. in which a MWCO filtration device is used for protein
entrapment, alkylation, and peptidase digestion (Erde, Loo et al.
2014, Feist and Hummon 2015).
Example 18: Generation of Partition-Tagged Peptides
[0668] A DNA tag (with an optional sample barcode, and an
orthogonal attachment moiety) is used to label the .epsilon.-amino
groups on lysines of denatured polypeptides using standard
bioconjugation methods (Hermanson 2013), or alternatively, are
attached to the polypeptide using photoaffinity labeling (PAL)
methods such as benzophenone (Li, Liu et al. 2013). After labeling
of the polypeptide with DNA tags at lysine groups or randomly on CH
groups (via PAL) and blocking unlabeled groups via acylation with
an acyl anhydride, the DNA-tag labeled, acylated polypeptides are
annealed to compartment beads with attached DNA oligonucleotides
comprising a universal priming sequence, a compartment barcode, an
optional UMI, and a primer sequence complementary to a portion of
the DNA tag attached to the polypeptides. Because of the
cooperativity of multiple DNA hybridization tags, single
polypeptide molecule interacts primarily with a single bead
enabling writing of the same compartment barcode to all DNA tags of
the polypeptide molecule. After annealing, the polypeptide-bound
DNA tag primes a polymerase extension reaction on the annealed
bead-bound DNA sequence. In this manner, the compartment barcodes
and other functional elements are written onto the DNA tags
attached to the bound polypeptide. Upon completion of this step,
the polypeptide has a plurality of recording tags attached, wherein
the recording tag has a common spacer sequence, barcode sequences
(e.g. sample, fraction, compartment, spatial, etc.), optional UMIs
and other functional elements. This labeled polypeptide can be
digested into peptide fragments using standard endoproteases such
as trypsin, GluC, proteinase K, etc. Note: if trypsin is used for
digestion of lysine-labeled polypeptides, the polypeptide is only
cleaved at Arg residues not Lys residues (since Lys residues are
labeled). The protease digestion can be done on directly on the
beads or after removal of the labeled polypeptide from the barcoded
beads.
Example 19: Preparing DNA Recording Tag-Peptide Conjugates for
Model System
[0669] The recording tag oligonucleotides are synthesized with a 5'
NH.sub.2 group, and an internal mTetrazine group for later coupling
to beads (alkyne-dT is converted to mTetrazine-dT via an
mTet-PEG-N.sub.3 heterobifunctional crosslinking agent). The 5'
NH.sub.2 of the oligonucleotide is coupled to a reactive cysteine
on a peptide using an NHS/maleimide heterobifunctional
cross-linker, such as LC-SMCC (ThermoFisher Scientific), as
described by Williams et al. (Williams and Chaput 2010). In
particular, 20 nmols of 5' NH.sub.2-labeled oligonucleotides are
ethanol precipitated and resuspended in 180 ul of phosphate
coupling buffer (0.1 M potassium phosphate buffer, pH 7.2) in a
siliconized tube. 5 mg of LC-SMCC is resuspended in 1 mL of DMF (5
mg/ml) (store in aliquots at -20). An aliquot of 20 ul LC-SMCC (5
mg/ml) is added to 180 ul of the resuspended oligonucleotides,
mixed and incubated at room temperature for 1 hr. The mixture is
2.times. ethanol precipitated. The resultant malemide-derivitized
oligonucleotide is resuspended in 200 ul phosphate coupling buffer.
A peptide containing a cysteine residue (>95% purity, desalted)
is resuspended at 1 mg/ml (.about.0.5 mM) in DMSO. Approximately 50
nmol of peptide (100 ul) are added to the reaction mix, and
incubated at room temperature overnight. The resultant DNA
recording tag-peptide conjugate is purified using native-PAGE as
described by William et al. (Williams and Chaput 2010). Conjugates
are resuspended in phosphate coupling buffer at 100 uM
concentration in siliconized tubes.
Example 20: Development of Substrate for DNA-Peptide
Immobilization
[0670] Magnetic beads suitable for click-chemistry immobilization
are created by converting M-270 amine magnetic Dynabeads to either
azide or TCO-derivatized beads capable of coupling to alkyne or
methyl Tetrazine-labeled oligo-peptide conjugates, respectively
(see, e.g., FIGS. 29D-E; FIGS. 30D-E). Namely, 10 mg of M-270 beads
are washed and resuspended in 500 ul borate buffer (100 mM sodium
borate, pH 8.5). A mixture of TCO-PEG (12-120)-NHS (Nanocs) and
methyl-PEG (12-120)-NHS is resuspended at 1 mM in DMSO and
incubated with M-270 amine beads at room temperature overnight. The
ratio of the Methyl to TCO PEG is titrated to adjust the final TCO
surface density on the beads such that there is <100 TCO
moieties/um.sup.2 (see, e.g., FIG. 31E; FIG. 34). Unreacted amine
groups are capped with a mixture of 0.1M acetic anhydride and 0.1M
DIEA in DMF (500 ul for 10 mg of beads) at room temperature for 2
hrs. After capping and washing 3.times. in DMF, the beads are
resuspended in phosphate coupling buffer at 10 mg/ml.
Example 21: Immobilization of Recording Tag Labeled Peptides to
Substrate
[0671] Recording tag labeled peptides are immobilized on a
substrate via an IEDDA click chemistry reaction using an mTet group
on the recording tag and a TCO group on the surface of activated
beads or substrate. This reaction is fast and efficient, even at
low input concentrations of reactants. Moreover, the use of methyl
tetrazine confers greater stability to the bond (Selvaraj and Fox
2013, Knall, Hollauf et al. 2014, Wu and Devaraj 2016). 200 ng of
M-270 TCO beads are resuspended in 100 ul phosphate coupling
buffer. 5 pmol of DNA recording tag labeled peptides comprising an
mTet moiety on the recording tag is added to the beads for a final
concentration of .about.50 nM. The reaction is incubated for 1 hr.
at room temperature. After immobilization, unreacted TCO groups on
the substrate are quenched with 1 mM methyl tetrazine acid in
phosphate coupling buffer for 1 hr. at room temperature.
Example 22: N-Terminal Amino Acid (NTAA) Modification
Chemical NTAA Acetylation:
[0672] The NTAA of a peptide is acetylated using either acetic
anhydride or NETS-acetate in organic or aqueous solutions
(sulfo-NHS-acetate). For acetic anhydride derivatization, 10 mM of
acetic anhydride in DMF is incubated with the peptide for 30 min.
at RT (Halpin, Lee et al. 2004). Alternatively, the peptide is
acetylated in aqueous solution using 50 mM acetic anhydride in 100
mM 2-(N-morpholino)ethanesulfonate (MES) buffer (pH 6.0) and 1M
NaCl at RT for 30 min (Tse, Snyder et al. 2008). For NETS-acetate
derivatization, a stock solution of sulfo-NHS-acetate (100 mM in
DMSO) is prepared and added at a final concentration of 5-10 mM in
100 mM sodium phosphate buffer (pH 8.0) or 100 mM borate buffer (pH
9.4) and incubated for 10-30 min. at RT (Goodnow 2014).
Enzymatic NTAA Acetylation:
[0673] NTAA of a peptide is enzymatically acetylated by exposure to
N-Acetyl Transferase (SsArd1 from Sulfolobus solfataricus) using
the following conditions: peptides are incubated with 2 .mu.M
SsArd1 in NAT buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM
EDTA, 1 mM acetyl-CoA) at 65.degree. C. for 10 min (Chang and Hsu
2015).
Chemical NTAA Amidination (Guanidination):
[0674] Peptides are incubated with 10 mM
N,N-bis(tert-butoxycarbonyl) thiourea, 20 mM trimethylamine, and 12
mM Mukayama's reagent (2-chloro-1-methylpyridinium iodide) in DMF
at RT for 30 min. Alternatively, the peptides are incubated with 10
mM 1H-Pyrazole-1-carboxamidine Hydrochloride, 10 mM DIEA in DMF at
RT for 30 min. Standard deblocking methods are used to remove
protecting groups. Alternatively, the peptides are incubated with
10 mM S-methylisothiourea in PBS buffer (pH 8.0) or 100 mM borate
buffer (pH 8.0) for 30 min. at 10.degree. C. (Tse, Snyder et al.
2008).
PITC Labeling:
[0675] Peptide is incubated with 5% (vol./vol.) PITC in ionic
liquid [Bmim][BF4] at room temperature for 5 min. The reaction time
is optimized for quantitative PITC labelling of NTAA while
minimizing ectopic labeling of the exocyclic amines on nucleotide
bases present in the extended DNA recording tag.
DNFB Labeling:
[0676] 2,4-Dinitrofluorobenzene (DNFB) is prepared as a 5 mg/ml
stock in methanol. The solution is protected from light and
prepared fresh daily. Peptides are labeled by incubation in 0.5-5.0
ug/ml DNFB in 10 mM borate buffer (pH 8.0) at 37.degree. C. for
5-30 min.
SNFB Labeling:
[0677] 4-sulfonyl-2-nitro-fluorobenzene (SNFB) is prepared as a 5
mg/ml stock in methanol. The solution should be protected from
light and prepared fresh daily. Peptides are labeled by incubation
in 0.5-5.0 ug/ml DNFB in 10 mM borate buffer (pH 8.0) at 37.degree.
C. for 5-30 min.
Cleavage of Acetylated NTAA Peptides:
[0678] The acetylated NTAA is cleaved from the peptide by
incubation with 10 uM acylpeptide hydrolase (APH) enzyme (from
Sulfolobus solfataricus, SS02693) in 25 mM Tris-HCl (pH 7.5) at
90.degree. C. for 10 min (Gogliettino, Balestrieri et al.
2012).
Cleavage of Amidinated NTAA Peptides:
[0679] The amidinated (guanidinated) NTAA is cleaved from the
peptide by incubation in 0.1N NaOH for 10 min. at 37.degree. C.
(Hamada 2016).
Example 23: Demonstration of Intramolecular Transfer of Coding Tag
Information to Recording Tags with Model System
[0680] DNA model system was used to test the "intra-molecular"
transfer of coding tag information to recording tags that are
immobilized to beads (see, FIG. 36A). Two different types of
recording tag oligonucleotides were used. saRT_Abc_v2 (SEQ ID
NO:141) contained an "A" DNA capture sequence (SEQ ID NO:153)
(mimic epitope for "A'" binding agent) and a corresponding "A"
barcode (rtA_BC); saRT_Bbc_V2 (SEQ ID NO:142) contained a "B" DNA
capture sequence (SEQ ID NO:154) (mimic epitope for "B'" binding
agent) and a corresponding "B" barcode (rtB_BC). These barcodes
were combinations of the elementary 65 set of 15-mer barcodes (SEQ
ID NOS:1-65) and their reverse complementary sequences (SEQ ID
NOS:66-130). rtA_BC is a collinear combination of two barcodes,
BC_1 and BC_2, and rtB_BC is just the one barcode, BC_3. Likewise
the barcodes (encoder sequences) on the coding tags were also
comprised of barcodes from the elementary set of 65 15-mer barcodes
(SEQ ID NOS:1-65). CT_A'-bc_1PEG (SEQ ID NO:144) and CT_B'-bc (SEQ
ID NO:147) coding tags were comprised of complementary capture
sequences, A' and B', respectively, and were assigned the 15-mer
barcodes, BC_5, and BC_5 & BC_6, respectively. This design
set-up for the recording tags and coding tags enables easy gel
analysis. The desired "intra-molecular" primer extension generates
oligonucleotide products of similar size, whereas the undesired
"inter-molecular" extension generates one oligo product 15 bases
larger and another oligo product 15 bases shorter than the
"intra-molecular" product (FIG. 36B).
[0681] The effect of recording tag density on "intra-molecular" vs.
"inter-molecular" information transfer was evaluated. For correct
information transfer, "intra-molecular" information transfer ("A'"
coding tag to A recording tag; B' coding tag to B recording tag),
should be observed rather than "inter-molecular" information
transfer (A' coding tag binding to A recording tag but transferring
information to B recording tag, and vice versa). To test the effect
of recording tags spacing on the bead surface, biotinylated
recording tag oligonucleotides, saRT_Abc_v2 (SEQ ID NO:141) and
saRT_Bbc_v2 (SEQ ID NO:142), were mixed in a 1:1 ratio, and then
titrated against the saDummy-T10 oligonucleotide (SEQ ID NO:143) in
ratios of 1:0, 1:10, 1:10.sup.2, 1:10.sup.3, and 1:10.sup.4. A
total of 20 pmols of recording tag oligonucleotides was incubated
with 5 ul of M270 streptavidin beads (Thermo) in 50 ul
Immobilization buffer (5 mM Tris-Cl (pH 7.5), 0.5 mM EDTA, 1 M
NaCl) for 15 min. at 37.degree. C. The beads were washed 3.times.
with 100 ul Immobilization buffer at room temperature. Most
subsequent wash steps used a volume of 100 ul. Coding tags (duplex
annealing with DupCT sequences required for later cycles) were
annealed to the recording tags immobilized on the beads by
resuspending the beads in 25 ul of 5.times. Annealing buffer (50 mM
Tris-Cl (pH 7.5), 10 mM MgCl2) and adding the coding tag mix. The
coding tags annealed to the recording tags by heating to 65.degree.
C. for 1 min, and then allowed to slow cool to room temperature
(0.2.degree. C./sec). Alternatively, coding tags can be annealed in
PBST buffer at 37.degree. C. Beads were washed PBST (PBS+0.1%
Tween-20) at room temp, and washed 2.times. with PBST at 37.degree.
C. for 5 min. and washed 1.times. with PBST at room temp. and a
final wash in 1.times. Annealing buffer. The beads were resuspended
in 19.5 ul Extension buffer (50 mM Tris-Cl (pH 7.5), 2 mM MgSO4,
125 uM dNTPs, 50 mM NaCl, 1 mM dithiothreitol, 0.1% Tween-20, and
0.1 mg/ml BSA) and incubated at 37.degree. C. for 15 min. Klenow
exo-DNA polymerase (NEB, 5 U/ul) was added to the beads for a final
concentration of 0.125 U/ul, and incubated at 37.degree. C. for 5
min. After primer extension, beads were washed 2.times. with PBST,
and 1.times. with 50 ul 0.1 NaOH at room temp for 5 min., and
3.times. with PBST and 1.times. with PBS. To add the downstream PCR
adapter sequence, R1', the EndCap2T oligo (comprised of R1 (SEQ ID
NO:152) was hybridized and extended on the beads as done for the
coding tag oligonucleotides. After adding the adapter sequence, the
final extended recording tag oligonucleotides were eluted from the
streptavidin beads by incubation in 95% formamide/10 mM EDTA at
65.degree. C. for 5 min. Approximately 1/100.sup.th of the eluted
product was PCR amplified in 20 ul for 18 cycles, and 1 ul of PCR
product analyzed on a 10% denaturing PAGE gel. The resulting gels
demonstrates proof of principle of writing coding tag information
to the recording tag by polymerase extension (FIG. 36C), and the
ability to generate a primarily "intra-molecular" extension events
relative to "inter-molecular" extension events upon dilution of
recording tag density on the surface of the bead.
[0682] In this model system, the size of PCR products from
recording tags RT_ABC and RT_BBC that contain the corresponding
encoder sequence and universal reverse primer site is 100 base
pairs (FIG. 36C), while the products by incorrect pairings of
saRT_ABC (SEQ ID NO:141)/CT_B'BC (SEQ ID NO:147) and saRT_BBC (SEQ
ID NO:142)/CT_A'BC (SEQ ID NO:144) are 115 and 85 base pairs,
respectively. As shown in FIG. 36D, three bands were observed in
the presence of saRT_ABC (SEQ ID NO:141) and saRT_BBC (SEQ ID
NO:142) on beads at high density. It was expected that the recoding
tag extended on proximal coding tag binding to itself
(intra-molecular event) or neighbor recoding tag (inter-molecular
event) at the high density. However the bands of products by
incorrect pairings decreased by diluting the recoding tags in dummy
oligonucleotide, and disappeared at a ratio of 1:10000. This result
demonstrated that the recording tags were spaced out on beads
surface at the low density, resulting in decreased intermolecular
events.
TABLE-US-00001 TABLE 1 Model System Sequences SEQ ID Name Sequence
(5'-3') NO: saRT_Abc_
/5Biosg/TTTTTGCAAATGGCATTCTGACATCCCGTAGTCCGCGACACTAG 141 v2
ATGTCTAGCATGCCGCCGTGTCATGTGGAAACTGAGTG saRT_Bbc_
/5Biosg/TTTTTTTTTTGACTGGTTCCAATTGACAAGCCGTAGTCCGCGAC 142 v2
ACTAGTAAGCCGGTATATCAACTGAGTG saDummy- /5Biosg/TTTTTTTTTT/3SpC3/ 143
pT10 CT_A'-bc GGATGTCAGAATGCCATTTGCTTTTTTTTTT/iSP18/CACTCAGTCCTAAC
144 GCGTATACGCACTCAGT/3SpC3/ CT_A'-
GGATGTCAGAATGCCATTTGCTTTTTTTTTT/iSP18/CACTCAGTCCTAAC 145 bc_1PEG
GCGTATACGTCACTCAGT/3SpC3/ CT_A'bc_
GGATGTCAGAATGCCATTTGCTTTTTTTTTT/iSP18//iSP18//iSP18// 146 5PEG
iSP18//iSP18/CACTCAGTCCTAACGCGTATACGTCACTCAGT/3SpC3/ CT_B'bc
GCTTGTCAATTGGAACCAGTCTTTT/iSp18/CACTCAGTCCTAACGCGTAT 147
ACGGGAATCTCGGCAGTTCACTCAGT/3SpC3/ EndCap2T
CGATTTGCAAGGATCACTCGTCACTCAGTCCTAACGCGTATACG/3SpC3/ 148 Sp ACTGAGTG
149 Sp' CACTCAGT 150 P1_f2 CGTAGTCCGCGACACTAG 151 R1
CGATTTGCAAGGATCACTCG 152 dupCT_ CGTATACGCGTTAGGACTGAGTG/3SpC3/ 153
A'BC dupCT_ AACTGCCGAGATTCCCGTATACGCGTTAGGACTGAGTG/3SpC3/ 154 B'BC
/3SpC3/ = 3 C3 (three carbon) spacer /5Biosg/ = 5' Biotin /iSP18/ =
18-atom hexa-ethyleneglycol spacer
Example 24: Sequencing Extended Recording Tag, Extended Coding Tag,
or Di-Tag Constructs on Nanopore Sequencers
[0683] DNA barcodes can be designed to be tolerant to highly-error
prone NGS sequencers, such as nanopore-based sequencers where the
current base call error rate is on the order of 10% or more. A
number of error correcting code systems have been described in the
literature. These include Hamming codes, Reed-Solomon codes,
Levenshtein codes, Lee codes, etc. Error-tolerant barcodes were
based on Hamming and Levenshtein codes using R Bioconductor
package, "DNAbarcodes" capable of correcting insertion, deletion,
and substitution errors, depending on the design parameters chosen
(Buschmann and Bystrykh 2013). A set of 65 different 15-mer Hamming
barcodes are shown in FIG. 27A (as set forth in SEQ ID NOS:1-65 and
their reverse complementary sequences in SEQ ID NOS:66-130,
respectively). These barcodes have a minimum Hamming distance of 10
and are self-correcting out to four substitution errors and two
indel errors, more than sufficient to be accurately readout on a
nanopore sequencer with a 10% error rate. Moreover, these barcodes
have been filtered from a set of 77 original barcodes using the
predicted nanopore current signatures (see FIG. 27B). They were
filtered to have large current level differences across the
barcode, and to be maximally uncorrelated with other barcodes in
the set. In this way, actual raw nanopore current level plots from
assays using these barcodes can be mapped directly to the predicted
barcode signature without using base calling algorithms (Laszlo,
Derrington et al. 2014).
[0684] To mimic the analysis of extended recording tags, extended
coding tags, or di-tag constructs using nanopore sequencing, PCR
products comprised of a small subset of 15-mer barcodes using four
forward primers (DTF1 (SEQ ID NO:157), DTF2 (SEQ ID NO:158), DTF3
(SEQ ID NO:159), DTF4 (SEQ ID NO:160)) and four reverse primers
(DTR9 (SEQ ID NO:161), DTR10 (SEQ ID NO:162), DTR11 (SEQ ID
NO:163), DTR12 (SEQ ID NO:164)) were generated (FIG. 27C). This set
of 8 primers was included in a PCR reaction along with a flanking
forward primer F1 (SEQ ID NO:165), and reverse primer R1 (SEQ ID
NO:166). The DTF and DTR primers annealed via an complementary
15-mer spacer sequence (Sp15) (SEQ ID NO:167). The combination of 4
DTF forward and 4 DTR reverse primers leads to a set of 16 possible
PCR products.
PCR Conditions:
TABLE-US-00002 [0685] Reagent Final Conc. Fl (5' phosphorylated) 1
uM (SEQ ID NO: 165) R1 (5' phosphorylated) 1 uM (SEQ ID NO: 166)
DTF1-4 (SEQ ID NOS: 157-160); 0.3 nM ea DTR9-12 (SEQ ID NOS:
161-164) VeraSeq Buffer 2 1X dNTPs 200 uM water VeraSeq 2.0 Ultra
Pol 2 U/100 ul
PCR Cycling:
TABLE-US-00003 [0686] 98.degree. C. 30 sec 50.degree. C. 2 min
98.degree. C. 10 sec 55.degree. C. 15 sec 72.degree. C. 15 sec
Repeat last 3 steps for 19 cycles 72.degree. C. 5 min
[0687] After PCR, the amplicons were concatenated by blunt end
ligation (FIG. 27C) as follows: 20 ul PCR product was mixed
directly with 20 ul Quick Ligase Mix (NEB) and incubated overnight
at room temp. The resultant ligated product, .about.0.5-2 kb in
length, was purified using a Zymo purification column and eluted
into 20 ul water. About 7 ul of this purified ligation product was
used directly in the MinIon Library Rapid Sequencing Prep kit
(SQK-RAD002) and analyzed on a MinION Mk 1B (R9.4) device. An
example of a 734 bp nanopore read of quality score 7.2 (.about.80%
accuracy) is shown in FIG. 27D. Despite the poor sequencing
accuracy, a large number of barcodes are easily readable in the
sequence as indicated by lalign-based alignment of the barcodes to
the MinIon sequence read (FIG. 27D).
Example 25: Encapsulated Single Cells in Gel Beads
[0688] Single cells are encapsulated into droplets (.about.50
.mu.m) using standard techniques (Tamminen and Virta 2015, Spencer,
Tamminen et al. 2016) (see FIG. 38). A Polyacrylamide
(Acrylamide:bisacrylamide (29:1) (30% w/vol.)), benzophenone
methacrylamide (BM), and APS is included in the discontinuous phase
along with the cells to create droplets capable of polymerizing
upon addition of TEMED in the continuous oil phase (diffuses into
droplets). Benzophenone is cross-linked into the matrix of the
polyacrylamide gel droplet. This allows subsequent photoaffinity
crosslinking of the proteins to the polyacrylamide matrix (Hughes,
Spelke et al. 2014, Kang, Yamauchi et al. 2016). The proteins
immobilized within the resulting single cell gel bead, can be
single cell barcoded using a variety of methods. In one embodiment,
DNA tags are chemically or photo-chemically attached to the
immobilized proteins in the single cell gel beads using
amine-reactive agents or a photo-active benzophenone DNA tag as
previously described. The single cell gel beads can be encapsulated
in droplets containing barcodes via co-encapsulation of barcoded
beads as previously described and the DNA barcode tag transferred
to the proteins, or alternatively proteins within single cell gel
beads can be combinatorically indexed through a series of
pool-and-split steps as described by Amini, Cusanovich, and
Gunderson et al. (Amini, Pushkarev et al. 2014, Cusanovich, Daza et
al. 2015)(Gunderson, Steemers et al. 2016). In the simplest
implementation, the proteins within single cell gel beads are first
labeled with "click-chemistry" moieties (see FIG. 40B), and then
combinatorial DNA barcodes are clicked onto the protein samples
using the pool-and-split approach.
REFERENCES
[0689] Harlow, Ed, and David Lane. Using Antibodies. Cold Spring
Harbor, New York: Cold Spring Harbor Laboratory Press, 1999. [0690]
Hennessy B T, Lu Y, Gonzalez-Angulo A M, et al. A Technical
Assessment of the Utility of Reverse Phase Protein Arrays for the
Study of the Functional Proteome in Non-microdissected Human Breast
Cancers. Clinical proteomics. 2010; 6(4):129-151. [0691] Davidson,
G. R., S. D. Armstrong and R. J. Beynon (2011). "Positional
proteomics at the N-terminus as a means of proteome
simplification." Methods Mol Biol 753: 229-242. [0692] Zhang, L.,
Luo, S., and Zhang, B. (2016). The use of lectin microarray for
assessing glycosylation of therapeutic proteins. mAbs 8, 524-535.
[0693] Akbani, R., K. F. Becker, N. Carragher, T. Goldstein, L. de
Koning, U. Korf, L. Liotta, G. B. Mills, S. S. Nishizuka, M.
Pawlak, E. F. Petricoin, 3.sup.rd, H. B. Pollard, B. Serrels and J.
Zhu (2014). "Realizing the promise of reverse phase protein arrays
for clinical, translational, and basic research: a workshop report:
the RPPA (Reverse Phase Protein Array) society." Mol Cell
Proteomics 13(7): 1625-1643. [0694] Amini, S., D. Pushkarev, L.
Christiansen, E. Kostem, T. Royce, C. Turk, N. Pignatelli, A. Adey,
J. O. Kitzman, K. Vijayan, M. Ronaghi, J. Shendure, K. L. Gunderson
and F. J. Steemers (2014). "Haplotype-resolved whole-genome
sequencing by contiguity-preserving transposition and combinatorial
indexing." Nat Genet 46(12): 1343-1349. [0695] Assadi, M., J.
Lamerz, T. Jarutat, A. Farfsing, H. Paul, B. Gierke, E. Breitinger,
M. F. Templin, L. Essioux, S. Arbogast, M. Venturi, M. Pawlak, H.
Langen and T. Schindler (2013). "Multiple protein analysis of
formalin-fixed and paraffin-embedded tissue samples with reverse
phase protein arrays." Mol Cell Proteomics 12(9): 2615-2622. [0696]
Bailey, J. M. and J. E. Shively (1990). "Carboxy-terminal
sequencing: formation and hydrolysis of C-terminal
peptidylthiohydantoins." Biochemistry 29(12): 3145-3156. Bandara,
H. M., D. P. Kennedy, E. Akin, C. D. Incarvito and S. C. Burdette
(2009). "Photoinduced release of Zn2+ with ZinCleav-1: a
nitrobenzyl-based caged complex." Inorg Chem 48(17): 8445-8455.
[0697] Bandara, H. M., T. P. Walsh and S. C. Burdette (2011). "A
Second-generation photocage for Zn2+ inspired by TPEN:
characterization and insight into the uncaging quantum yields of
ZinCleav chelators." Chemistry 17(14): 3932-3941. [0698] Basle, E.,
N. Joubert and M. Pucheault (2010). "Protein chemical modification
on endogenous amino acids." Chem Biol 17(3): 213-227. [0699]
Bilgicer, B., S. W. Thomas, 3.sup.rd, B. F. Shaw, G. K. Kaufman, V.
M. Krishnamurthy, L. A. Estroff, J. Yang and G. M. Whitesides
(2009). "A non-chromatographic method for the purification of a
bivalently active monoclonal IgG antibody from biological fluids."
J Am Chem Soc 131(26): 9361-9367. [0700] Bochman, M. L., K.
Paeschke and V. A. Zakian (2012). "DNA secondary structures:
stability and function of G-quadruplex structures." Nat Rev Genet
13(11): 770-780. [0701] Borgo, B. and J. J. Havranek (2014).
"Motif-directed redesign of enzyme specificity." Protein Sci 23(3):
312-320. [0702] Brouzes, E., M. Medkova, N. Savenelli, D. Marran,
M. Twardowski, J. B. Hutchison, J. M. Rothberg, D. R. Link, N.
Perrimon and M. L. Samuels (2009). "Droplet microfluidic technology
for single-cell high-throughput screening." Proc Natl Acad Sci USA
106(34): 14195-14200. [0703] Brudno, Y., M. E. Birnbaum, R. E.
Kleiner and D. R. Liu (2010). "An in vitro translation, selection
and amplification system for peptide nucleic acids." Nat Chem Biol
6(2): 148-155. [0704] Calcagno, S. and C. D. Klein (2016).
"N-Terminal methionine processing by the zinc-activated Plasmodium
falciparum methionine aminopeptidase 1b." Appl Microbiol
Biotechnol. [0705] Cao, Y., G. K. Nguyen, J. P. Tam and C. F. Liu
(2015). "Butelase-mediated synthesis of protein thioesters and its
application for tandem chemoenzymatic ligation." Chem Commun (Camb)
51(97): 17289-17292. [0706] Carty, R. P. and C. H. Hirs (1968).
"Modification of bovine pancreatic ribonuclease A with
4-sulfonyloxy-2-nitrofluorobenzene. Isolation and identification of
modified proteins." J Biol Chem 243(20): 5244-5253. [0707] Chang,
L., D. M. Rissin, D. R. Fournier, T. Piech, P. P. Patel, D. H.
Wilson and D. C. Duffy (2012). "Single molecule enzyme-linked
immunosorbent assays: theoretical considerations." J Immunol
Methods 378(1-2): 102-115. [0708] Chang, Y. Y. and C. H. Hsu
(2015). "Structural basis for substrate-specific acetylation of
Nalpha-acetyltransferase Ard1 from Sulfolobus solfataricus." Sci
Rep 5: 8673. [0709] Christoforou, A., C. M. Mulvey, L. M. Breckels,
A. Geladaki, T. Hurrell, P. C. Hayward, T. Naake, L. Gatto, R.
Viner, A. Martinez Arias and K. S. Lilley (2016). "A draft map of
the mouse pluripotent stem cell spatial proteome." Nat Commun 7:
8992. [0710] Creighton, C. J. and S. Huang (2015). "Reverse phase
protein arrays in signaling pathways: a data integration
perspective." Drug Des Devel Ther 9: 3519-3527. [0711] Crosetto,
N., M. Bienko and A. van Oudenaarden (2015). "Spatially resolved
transcriptomics and beyond." Nat Rev Genet 16(1): 57-66. [0712]
Cusanovich, D. A., R. Daza, A. Adey, H. A. Pliner, L. Christiansen,
K. L. Gunderson, F. J. Steemers, C. Trapnell and J. Shendure
(2015). "Multiplex single-cell profiling of chromatin accessibility
by combinatorial cellular indexing." Science 348(6237): 910-914.
[0713] Derrington, I. M., T. Z. Butler, M. D. Collins, E. Manrao,
M. Pavlenok, M. Niederweis and J. H. Gundlach (2010). "Nanopore DNA
sequencing with MspA." Proc Natl Acad Sci USA 107(37): 16060-16065.
[0714] El-Sagheer, A. H., V. V. Cheong and T. Brown (2011). "Rapid
chemical ligation of oligonucleotides by the Diels-Alder reaction."
Org Biomol Chem 9(1): 232-235. [0715] El-Sagheer, A. H., A. P.
Sanzone, R. Gao, A. Tavassoli and T. Brown (2011). "Biocompatible
artificial DNA linker that is read through by DNA polymerases and
is functional in Escherichia coli." Proc Natl Acad Sci USA 108(28):
11338-11343. [0716] Emili, A., M. McLaughlin, K. Zagorovsky, J. B.
Olsen, W. C. W. Chan and S. S. Sidhu (2017). Protein Sequencing
Method and Reagents. USPTO. USA, The Governing Council of
University of Toronto. U.S. Pat. No. 9,566,335 B1. [0717] Erde, J.,
R. R. Loo and J. A. Loo (2014). "Enhanced FASP (eFASP) to increase
proteome coverage and sample recovery for quantitative proteomic
experiments." J Proteome Res 13(4): 1885-1895. [0718] Farries, T.
C., A. Harris, A. D. Auffret and A. Aitken (1991). "Removal of
N-acetyl groups from blocked peptides with acylpeptide hydrolase.
Stabilization of the enzyme and its application to protein
sequencing." Eur J Biochem 196(3): 679-685. [0719] Feist, P. and A.
B. Hummon (2015). "Proteomic challenges: sample preparation
techniques for microgram-quantity protein analysis from biological
samples." Int J Mol Sci 16(2): 3537-3563. [0720] Friedmann, D. R.
and R. Marmorstein (2013). "Structure and mechanism of non-histone
protein acetyltransferase enzymes." FEBS J 280(22): 5570-5581.
[0721] Frokjaer, S. and D. E. Otzen (2005). "Protein drug
stability: a formulation challenge." Nat Rev Drug Discov 4(4):
298-306. [0722] Fujii, Y., M. Kaneko, M. Neyazaki, T. Nogi, Y. Kato
and J. Takagi (2014). "PA tag: a versatile protein tagging system
using a super high affinity antibody against a dodecapeptide
derived from human podoplanin." Protein Expr Purif 95: 240-247.
[0723] Gebauer, M. and A. Skerra (2012). "Anticalins small
engineered binding proteins based on the lipocalin scaffold."
Methods Enzymol 503: 157-188. [0724] Gerry, N. P., N. E. Witowski,
J. Day, R. P. Hammer, G. Barany and F. Barany (1999). "Universal
DNA microarray method for multiplex detection of low abundance
point mutations." J Mol Biol 292(2): 251-262. [0725] Gogliettino,
M., M. Balestrieri, E. Cocca, S. Mucerino, M. Rossi, M. Petrillo,
E. Mazzella and G. Palmieri (2012). "Identification and
characterisation of a novel acylpeptide hydrolase from Sulfolobus
solfataricus: structural and functional insights." PLoS One 7(5):
e37921. [0726] Gogliettino, M., A. Riccio, M. Balestrieri, E.
Cocca, A. Facchiano, T. M. D'Arco, C. Tesoro, M. Rossi and G.
Palmieri (2014). "A novel class of bifunctional acylpeptide
hydrolases--potential role in the antioxidant defense systems of
the Antarctic fish Trematomus bernacchii." FEBS J 281(1): 401-415.
[0727] Granvogl, B., M. Ploscher and L. A. Eichacker (2007).
"Sample preparation by in-gel digestion for mass spectrometry-based
proteomics." Anal Bioanal Chem 389(4): 991-1002. [0728] Gunderson,
K. L., X. C. Huang, M. S. Morris, R. J. Lipshutz, D. J. Lockhart
and M. S. Chee (1998). "Mutation detection by ligation to complete
n-mer DNA arrays." Genome Res 8(11): 1142-1153. [0729] Gunderson,
K. L., F. J. Steemers, J. S. Fisher and R. Rigatti (2016). Methods
and Compositions for Analyzing Cellular Components. WIPO, Illumina,
Inc. [0730] Gunderson, K. L., F. J. Steemers, J. S. Fisher and R.
Rigatti (2016). Methods and compositions for analyzing cellular
components, Illumina, Inc. [0731] Guo, H., W. Liu, Z. Ju, P.
Tamboli, E. Jonasch, G. B. Mills, Y. Lu, B. T. Hennessy and D.
Tsavachidou (2012). "An efficient procedure for protein extraction
from formalin-fixed, paraffin-embedded tissues for reverse phase
protein arrays." Proteome Sci 10(1): 56. [0732] Hamada, Y. (2016).
"A novel N-terminal degradation reaction of peptides via
N-amidination." Bioorg Med Chem Lett 26(7): 1690-1695. [0733]
Hermanson, G. (2013). Bioconjugation Techniques, Academic Press.
[0734] Hernandez-Moreno, A. V., F. Villasenor, E. Medina-Rivero, N.
O. Perez, L. F. Flores-Ortiz, G. Saab-Rincon and G. Luna-Barcenas
(2014). "Kinetics and conformational stability studies of
recombinant leucine aminopeptidase." Int J Biol Macromol 64:
306-312. [0735] Hori, M., H. Fukano and Y. Suzuki (2007). "Uniform
amplification of multiple DNAs by emulsion PCR." Biochem Biophys
Res Commun 352(2): 323-328. [0736] Horisawa, K. (2014). "Specific
and quantitative labeling of biomolecules using click chemistry."
Front Physiol 5: 457. [0737] Hoshika, S., F. Chen, N. A. Leal and
S. A. Benner (2010). "Artificial genetic systems: self-avoiding DNA
in PCR and multiplexed PCR." Angew Chem Int Ed Engl 49(32):
5554-5557. [0738] Hughes, A. J., D. P. Spelke, Z. Xu, C. C. Kang,
D. V. Schaffer and A. E. Herr (2014). "Single-cell western
blotting." Nat Methods 11(7): 749-755. [0739] Hughes, C. S., S.
Foehr, D. A. Garfield, E. E. Furlong, L. M. Steinmetz and J.
Krijgsveld (2014). "Ultrasensitive proteome analysis using
paramagnetic bead technology." Mol Syst Biol 10: 757. [0740] Kang,
C. C., K. A. Yamauchi, J. Vlassakis, E. Sinkala, T. A. Duncombe and
A. E. Herr (2016). "Single cell-resolution western blotting." Nat
Protoc 11(8): 1508-1530. [0741] Kang, T. S., L. Wang, C. N.
Sarkissian, A. Gamez, C. R. Scriver and R. C. Stevens (2010).
"Converting an injectable protein therapeutic into an oral form:
phenylalanine ammonia lyase for phenylketonuria." Mol Genet Metab
99(1): 4-9. [0742] Katritzky, A. R. and B. V. Rogovoy (2005).
"Recent developments in guanylating agents." ARKIVOC iv (Issue in
Honor of Prof. Nikolai Zefirov): 49-87. [0743] Klein, A. M., L.
Mazutis, I. Akartuna, N. Tallapragada, A. Veres, V. Li, L. Peshkin,
D. A. Weitz and M. W. Kirschner (2015). "Droplet barcoding for
single-cell transcriptomics applied to embryonic stem cells." Cell
161(5): 1187-1201. [0744] Knall, A. C., M. Hollauf and C. Slugovc
(2014). "Kinetic studies of inverse electron demand Diels-Alder
reactions (iEDDA) of norbornenes and
3,6-dipyridin-2-yl-1,2,4,5-tetrazine." Tetrahedron Lett 55(34):
4763-4766. [0745] Le, Z. G., Z. C. Chen, Y. Hu and Q. G. Zheng
(2005). "Organic Reactions in Ionic Liquids: Ionic Liquid-promoted
Efficient Synthesis of Disubstituted and Trisubstituted Thioureas
Derivatives." Chinese Chemical Letters 16(2): 201-204. [0746]
Lesch, V., A. Heuer, V. A. Tatsis, C. Holm and J. Smiatek (2015).
"Peptides in the presence of aqueous ionic liquids: tunable
co-solutes as denaturants or protectants?" Phys Chem Chem Phys
17(39): 26049-26053. [0747] Li, G., Y. Liu, Y. Liu, L. Chen, S. Wu,
Y. Liu and X. Li (2013). "Photoaffinity labeling of
small-molecule-binding proteins by DNA-templated chemistry." Angew
Chem Int Ed Engl 52(36): 9544-9549. [0748] Litovchick, A., M. A.
Clark and A. D. Keefe (2014). "Universal strategies for the
DNA-encoding of libraries of small molecules using the chemical
ligation of oligonucleotide tags." Artif DNA PNA XNA 5(1): e27896.
[0749] Liu, Y. and S. Liang (2001). "Chemical carboxyl-terminal
sequence analysis of peptides and proteins using tribenzylsilyl
isothiocyanate." J Protein Chem 20(7): 535-541. [0750] Lundblad, R.
L. (2014). Chemical reagents for protein modification. Boca Raton,
CRC Press, Taylor & Francis Group. [0751] Mashaghi, S. and A.
M. van Oijen (2015). "External control of reactions in
microdroplets." Sci Rep 5: 11837. [0752] McCormick, R. M. (1989).
"A solid-phase extraction procedure for DNA purification." Anal
Biochem 181(1): 66-74. [0753] Mendoza, V. L. and R. W. Vachet
(2009). "Probing protein structure by amino acid-specific covalent
labeling and mass spectrometry." Mass Spectrom Rev 28(5): 785-815.
[0754] Mikami, T., T. Takao, K. Yanagi and H. Nakazawa (2012). "N
(alpha) Selective Acetylation of Peptides." Mass Spectrom (Tokyo)
1(2): A0010. [0755] Moghaddam, M. J., L. de Campo, N. Kirby and C.
J. Drummond (2012). "Chelating DTPA amphiphiles: ion-tunable
self-assembly structures and gadolinium complexes." Phys Chem Chem
Phys 14(37): 12854-12862. [0756] Mukherjee, S., M. Ura, R. J. Hoey
and A. A. Kossiakoff (2015). "A New Versatile Immobilization Tag
Based on the Ultra High Affinity and Reversibility of the
Calmodulin-Calmodulin Binding Peptide Interaction." J Mol Biol
427(16): 2707-2725. [0757] Namimatsu, S., M. Ghazizadeh and Y.
Sugisaki (2005). "Reversing the effects of formalin fixation with
citraconic anhydride and heat: a universal antigen retrieval
method." J Histochem Cytochem 53(1): 3-11. [0758] Nguyen, G. K., Y.
Cao, W. Wang, C. F. Liu and J. P. Tam (2015). "Site-Specific
N-Terminal Labeling of Peptides and Proteins using Butelase 1 and
Thiodepsipeptide." Angew Chem Int Ed Engl 54(52): 15694-15698.
[0759] Nguyen, G. K., S. Wang, Y. Qiu, X. Hemu, Y. Lian and J. P.
Tam (2014). "Butelase 1 is an Asx-specific ligase enabling peptide
macrocyclization and synthesis." Nat Chem Biol 10(9): 732-738.
[0760] Nishizuka, S. S. and G. B. Mills (2016). "New era of
integrated cancer biomarker discovery using reverse-phase protein
arrays." Drug Metab Pharmacokinet 31(1): 35-45. [0761] Ohkubo, A.,
R. Kasuya, K. Sakamoto, K. Miyata, H. Taguchi, H. Nagasawa, T.
Tsukahara, T. Watanobe, Y. Maki, K. Seio and M. Sekine (2008).
"`Protected DNA Probes` capable of strong hybridization without
removal of base protecting groups." Nucleic Acids Res 36(6):
1952-1964. [0762] Ojha, B., A. K. Singh, M. D. Adhikari, A. Ramesh
and G. Das (2010).
"2-Alkylmalonic acid: amphiphilic chelator and a potent inhibitor
of metalloenzyme." J Phys Chem B 114(33): 10835-10842. [0763] Peng,
X., H. Li and M. Seidman (2010). "A Template-Mediated Click-Click
Reaction: PNA-DNA, PNA-PNA (or Peptide) Ligation, and Single
Nucleotide Discrimination." European J Org Chem 2010(22):
4194-4197. [0764] Perbandt, M., O. Bruns, M. Vallazza, T. Lamla, C.
Betzel and V. A. Erdmann (2007). "High resolution structure of
streptavidin in complex with a novel high affinity peptide tag
mimicking the biotin binding motif." Proteins 67(4): 1147-1153.
[0765] Rauth, S., D. Hinz, M. Borger, M. Uhrig, M. Mayhaus, M.
Riemenschneider and A. Skerra (2016). "High-affinity Anticalins
with aggregation-blocking activity directed against the Alzheimer
beta-amyloid peptide." Biochem J 473(11): 1563-1578. [0766] Ray, A.
and B. Norden (2000). "Peptide nucleic acid (PNA): its medical and
biotechnical applications and promise for the future." FASEB J
14(9): 1041-1060. [0767] Riley, N. M., A. S. Hebert and J. J. Coon
(2016). "Proteomics Moves into the Fast Lane." Cell Syst 2(3):
142-143. [0768] Roloff, A., S. Ficht, C. Dose and O. Seitz (2014).
"DNA-templated native chemical ligation of functionalized peptide
nucleic acids: a versatile tool for single base-specific detection
of nucleic acids." Methods Mol Biol 1050: 131-141. [0769] Roloff,
A. and O. Seitz (2013). "The role of reactivity in DNA templated
native chemical PNA ligation during PCR." Bioorg Med Chem 21(12):
3458-3464. [0770] Sakurai, K., T. M. Snyder and D. R. Liu (2005).
"DNA-templated functional group transformations enable
sequence-programmed synthesis using small-molecule reagents." J Am
Chem Soc 127(6): 1660-1661. [0771] Schneider, K. and B. T. Chait
(1995). "Increased stability of nucleic acids containing
7-deaza-guanosine and 7-deaza-adenosine may enable rapid DNA
sequencing by matrix-assisted laser desorption mass spectrometry."
Nucleic Acids Res 23(9): 1570-1575. [0772] Selvaraj, R. and J. M.
Fox (2013). "trans-Cyclooctene--a stable, voracious dienophile for
bioorthogonal labeling." Curr Opin Chem Biol 17(5): 753-760. [0773]
Sharma, A. K., A. D. Kent and J. M. Heemstra (2012). "Enzyme-linked
small-molecule detection using split aptamer ligation." Anal Chem
84(14): 6104-6109. [0774] Shembekar, N., C. Chaipan, R. Utharala
and C. A. Merten (2016). "Droplet-based microfluidics in drug
discovery, transcriptomics and high-throughput molecular genetics."
Lab Chip 16(8): 1314-1331. [0775] Shenoy, N. R., J. E. Shively and
J. M. Bailey (1993). "Studies in C-terminal sequencing: new
reagents for the synthesis of peptidylthiohydantoins." J Protein
Chem 12(2): 195-205. [0776] Shim, J. U., R. T. Ranasinghe, C. A.
Smith, S. M. Ibrahim, F. Hollfelder, W. T. Huck, D. Klenerman and
C. Abell (2013). "Ultrarapid generation of femtoliter microfluidic
droplets for single-molecule-counting immunoassays." ACS Nano 7(7):
5955-5964. [0777] Shim, J. W., Q. Tan and L. Q. Gu (2009).
"Single-molecule detection of folding and unfolding of the
G-quadruplex aptamer in a nanopore nanocavity." Nucleic Acids Res
37(3): 972-982. [0778] Sidoli, S., Z. F. Yuan, S. Lin, K. Karch, X.
Wang, N. Bhanu, A. M. Arnaudo, L. M. Britton, X. J. Cao, M.
Gonzales-Cope, Y. Han, S. Liu, R. C. Molden, S. Wein, L.
Afjehi-Sadat and B. A. Garcia (2015). "Drawbacks in the use of
unconventional hydrophobic anhydrides for histone derivatization in
bottom-up proteomics PTM analysis." Proteomics 15(9): 1459-1469.
[0779] Sletten, E. M. and C. R. Bertozzi (2009). "Bioorthogonal
chemistry: fishing for selectivity in a sea of functionality."
Angew Chem Int Ed Engl 48(38): 6974-6998. [0780] Spencer, S. J., M.
V. Tamminen, S. P. Preheim, M. T. Guo, A. W. Briggs, I. L. Brito,
A. W. D, L. K. Pitkanen, F. Vigneault, M. P. Juhani Virta and E. J.
Alm (2016). "Massively parallel sequencing of single cells by
epicPCR links functional genes with phylogenetic markers." ISME J
10(2): 427-436. [0781] Spicer, C. D. and B. G. Davis (2014).
"Selective chemical protein modification." Nat Commun 5: 4740.
[0782] Spiropulos, N. G. and J. M. Heemstra (2012). "Templating
effect in DNA proximity ligation enables use of non-bioorthogonal
chemistry in biological fluids." Artif DNA PNA XNA 3(3): 123-128.
[0783] Switzar, L., M. Giera and W. M. Niessen (2013). "Protein
digestion: an overview of the available techniques and recent
developments." J Proteome Res 12(3): 1067-1077. [0784] Tamminen, M.
V. and M. P. Virta (2015). "Single gene-based distinction of
individual microbial genomes from a mixed population of microbial
cells." Front Microbiol 6: 195. [0785] Tessler, L. (2011). Digital
Protein Analysis: Technologies for Protein Diagnostics and
Proteomics through Single-Molecule Detection. Ph.D., WASHINGTON
UNIVERSITY IN ST. LOUIS. [0786] Tyson, J. and J. A. Armour (2012).
"Determination of haplotypes at structurally complex regions using
emulsion haplotype fusion PCR." BMC Genomics 13: 693. [0787]
Vauquelin, G. and S. J. Charlton (2013). "Exploring avidity:
understanding the potential gains in functional affinity and target
residence time of bivalent and heterobivalent ligands." Br J
Pharmacol 168(8): 1771-1785. [0788] Veggiani, G., T. Nakamura, M.
D. Brenner, R. V. Gayet, J. Yan, C. V. Robinson and M. Howarth
(2016). "Programmable polyproteams built using twin peptide
superglues." Proc Natl Acad Sci USA 113(5): 1202-1207. [0789] Wang,
D., S. Fang and R. M. Wohlhueter (2009). "N-terminal derivatization
of peptides with isothiocyanate analogues promoting Edman-type
cleavage and enhancing sensitivity in electrospray ionization
tandem mass spectrometry analysis." Anal Chem 81(5): 1893-1900.
[0790] Williams, B. A. and J. C. Chaput (2010). "Synthesis of
peptide-oligonucleotide conjugates using a heterobifunctional
crosslinker." Curr Protoc Nucleic Acid Chem Chapter 4: Unit4 41.
[0791] Wu, H. and N. K. Devaraj (2016). "Inverse Electron-Demand
Diels-Alder Bioorthogonal Reactions." Top Curr Chem (J) 374(1): 3.
[0792] Xiong, A. S., R. H. Peng, J. Zhuang, F. Gao, Y. Li, Z. M.
Cheng and Q. H. Yao (2008). "Chemical gene synthesis: strategies,
softwares, error corrections, and applications." FEMS Microbiol Rev
32(3): 522-540. [0793] Yao, Y., M. Docter, J. van Ginkel, D. de
Ridder and C. Joo (2015). "Single-molecule protein sequencing
through fingerprinting: computational assessment." Phys Biol 12(5):
055003. [0794] Zakeri, B., J. O. Fierer, E. Celik, E. C. Chittock,
U. Schwarz-Linek, V. T. Moy and M. Howarth (2012). "Peptide tag
forming a rapid covalent bond to a protein, through engineering a
bacterial adhesin." Proc Natl Acad Sci USA 109(12): E690-697.
[0795] Zhang, L., K. Zhang, S. Rauf, D. Dong, Y. Liu and J. Li
(2016). "Single-Molecule Analysis of Human Telomere Sequence
Interactions with G-quadruplex Ligand." Anal Chem 88(8): 4533-4540.
[0796] Zhou, H., Z. Ning, A. E. Starr, M. Abu-Farha and D. Figeys
(2012). "Advancements in top-down proteomics." Anal Chem 84(2):
720-734. [0797] Zilionis, R., J. Nainys, A. Veres, V. Savova, D.
Zemmour, A. M. Klein and L. Mazutis (2017). "Single-cell barcoding
and sequencing using droplet microfluidics." Nat Protoc 12(1):
44-73.
[0798] These and other changes can be made to the embodiments in
light of the above-detailed description. In general, in the
following claims, the terms used should not be construed to limit
the claims to the specific embodiments disclosed in the
specification and the claims, but should be construed to include
all possible embodiments along with the full scope of equivalents
to which such claims are entitled. Accordingly, the claims are not
limited by the disclosure.
[0799] The various embodiments described above can be combined to
provide further embodiments. All U.S. patents, U.S. patent
application publications, U.S. patent applications, foreign
patents, foreign patent applications, and non-patent publications
referred to in this specification and/or listed in the Application
Data Sheet, including U.S. Provisional Patent Application No.
62/330,841, U.S. Provisional Patent Application No. 62/339,071, and
U.S. Provisional Patent Application No. 62/376,886, are
incorporated herein by reference, in their entirety. are
incorporated herein by reference in their entirety. Aspects of the
embodiments can be modified, if necessary to employ concepts of the
various patents, applications and publications to provide yet
further embodiments.
Sequence CWU 1
1
184115DNAArtificial Sequenceoligonucleotide barcode BC_1
1atgtctagca tgccg 15215DNAArtificial Sequenceoligonucleotide
barcode BC_2 2ccgtgtcatg tggaa 15315DNAArtificial
Sequenceoligonucleotide barcode BC_3 3taagccggta tatca
15415DNAArtificial Sequenceoligonucleotide barcode BC_4 4ttcgatatga
cggaa 15515DNAArtificial Sequenceoligonucleotide barcode BC_5
5cgtatacgcg ttagg 15615DNAArtificial Sequenceoligonucleotide
barcode BC_6 6aactgccgag attcc 15715DNAArtificial
Sequenceoligonucleotide barcode BC_7 7tgatcttagc tgtgc
15815DNAArtificial Sequenceoligonucleotide barcode BC_8 8gagtcggtac
cttga 15915DNAArtificial Sequenceoligonucleotide barcode BC_9
9ccgcttgtga tctgg 151015DNAArtificial Sequenceoligonucleotide
barcode BC_10 10agatagcgta ccgga 151115DNAArtificial
Sequenceoligonucleotide barcode BC_11 11tccaggctca tcatc
151215DNAArtificial Sequenceoligonucleotide barcode BC_12
12gagtactaga gccaa 151315DNAArtificial Sequenceoligonucleotide
barcode BC_13 13gagcgtcaat aacgg 151415DNAArtificial
Sequenceoligonucleotide barcode BC_14 14gcggtatcta cactg
151515DNAArtificial Sequenceoligonucleotide barcode BC_15
15cttctccgaa gagaa 151615DNAArtificial Sequenceoligonucleotide
barcode BC_16 16tgaagcctgt gttaa 151715DNAArtificial
Sequenceoligonucleotide barcode BC_17 17ctggatggtt gtcga
151815DNAArtificial Sequenceoligonucleotide barcode BC_18
18actgcacggt tccaa 151915DNAArtificial Sequenceoligonucleotide
barcode BC_19 19cgagagatgg tcctt 152015DNAArtificial
Sequenceoligonucleotide barcode BC_20 20tcttgagaga caaga
152115DNAArtificial Sequenceoligonucleotide barcode BC_21
21aattcgcact gtgtt 152215DNAArtificial Sequenceoligonucleotide
barcode BC_22 22gtagtgccgc taaga 152315DNAArtificial
Sequenceoligonucleotide barcode BC_23 23cctatagcac aatcc
152415DNAArtificial Sequenceoligonucleotide barcode BC_24
24atcaccgagg ttgga 152515DNAArtificial Sequenceoligonucleotide
barcode BC_25 25gattcaacgg agaag 152615DNAArtificial
Sequenceoligonucleotide barcode BC_26 26acgaacctcg cacca
152715DNAArtificial Sequenceoligonucleotide barcode BC_27
27aggacttcaa gaaga 152815DNAArtificial Sequenceoligonucleotide
barcode BC_28 28ggttgaatcc tcgca 152915DNAArtificial
Sequenceoligonucleotide barcode BC_29 29aaccaacctc tagcg
153015DNAArtificial Sequenceoligonucleotide barcode BC_30
30acgcgaatat ctaac 153115DNAArtificial Sequenceoligonucleotide
barcode BC_31 31gttgagaatt acacc 153215DNAArtificial
Sequenceoligonucleotide barcode BC_32 32ctctctctgt gaacc
153315DNAArtificial Sequenceoligonucleotide barcode BC_33
33gccatcagta agaga 153415DNAArtificial Sequenceoligonucleotide
barcode BC_34 34gcaacgtgaa ttgag 153515DNAArtificial
Sequenceoligonucleotide barcode BC_35 35ctaagtagag ccaca
153615DNAArtificial Sequenceoligonucleotide barcode BC_36
36tgtctgttgg aagcg 153715DNAArtificial Sequenceoligonucleotide
barcode BC_37 37ttaatagaca gcgcg 153815DNAArtificial
Sequenceoligonucleotide barcode BC_38 38cgacgctcta acaag
153915DNAArtificial Sequenceoligonucleotide barcode BC_39
39catggcttat tgaga 154015DNAArtificial Sequenceoligonucleotide
barcode BC_40 40actaggtatg gccgg 154115DNAArtificial
Sequenceoligonucleotide barcode BC_41 41gtcctcgtct atcct
154215DNAArtificial Sequenceoligonucleotide barcode BC_42
42taggattccg ttacc 154315DNAArtificial Sequenceoligonucleotide
barcode BC_43 43tctgaccacc ggaag 154415DNAArtificial
Sequenceoligonucleotide barcode BC_44 44agagtcacct cgtgg
154515DNAArtificial Sequenceoligonucleotide barcode BC_45
45ctgatgtagt cgaag 154615DNAArtificial Sequenceoligonucleotide
barcode BC_46 46gtcggttgcg gatag 154715DNAArtificial
Sequenceoligonucleotide barcode BC_47 47tcctcctcct aagaa
154815DNAArtificial Sequenceoligonucleotide barcode BC_48
48attcggtcca cttca 154915DNAArtificial Sequenceoligonucleotide
barcode BC_49 49ccttacaggt ctgcg 155015DNAArtificial
Sequenceoligonucleotide barcode BC_50 50gatcattggc caatt
155115DNAArtificial Sequenceoligonucleotide barcode BC_51
51ttcaaggctg agttg 155215DNAArtificial Sequenceoligonucleotide
barcode BC_52 52tggctcgatt gaatc 155315DNAArtificial
Sequenceoligonucleotide barcode BC_53 53gtaagccatc cgctc
155415DNAArtificial Sequenceoligonucleotide barcode BC_54
54acacatgcgt agaca 155515DNAArtificial Sequenceoligonucleotide
barcode BC_55 55tgctatggat tcaag 155615DNAArtificial
Sequenceoligonucleotide barcode BC_56 56ccacgaggct tagtt
155715DNAArtificial Sequenceoligonucleotide barcode BC_57
57ggccaactaa ggtgc 155815DNAArtificial Sequenceoligonucleotide
barcode BC_58 58gcacctattc gacaa 155915DNAArtificial
Sequenceoligonucleotide barcode BC_59 59tggacacgat cggct
156015DNAArtificial Sequenceoligonucleotide barcode BC_60
60ctataattcc aacgg 156115DNAArtificial Sequenceoligonucleotide
barcode BC_61 61aacgtggtta gtaag 156215DNAArtificial
Sequenceoligonucleotide barcode BC_62 62caaggaacga gtggc
156315DNAArtificial Sequenceoligonucleotide barcode BC_63
63caccagaacg gaaga 156415DNAArtificial Sequenceoligonucleotide
barcode BC_64 64cgtacggtca agcaa 156515DNAArtificial
Sequenceoligonucleotide barcode BC_65 65tcggtgacag gctaa
156615DNAArtificial Sequenceoligonucleotide barcode BC_1 REV
66cggcatgcta gacat 156715DNAArtificial Sequenceoligonucleotide
barcode BC_2 REV 67ttccacatga cacgg 156815DNAArtificial
Sequenceoligonucleotide barcode BC_3 REV 68tgatataccg gctta
156915DNAArtificial Sequenceoligonucleotide barcode BC_4 REV
69ttccgtcata tcgaa 157015DNAArtificial Sequenceoligonucleotide
barcode BC_5 REV 70cctaacgcgt atacg 157115DNAArtificial
Sequenceoligonucleotide barcode BC_6 REV 71ggaatctcgg cagtt
157215DNAArtificial Sequenceoligonucleotide barcode BC_7 REV
72gcacagctaa gatca 157315DNAArtificial Sequenceoligonucleotide
barcode BC_8 REV 73tcaaggtacc gactc 157415DNAArtificial
Sequenceoligonucleotide barcode BC_9 REV 74ccagatcaca agcgg
157515DNAArtificial Sequenceoligonucleotide barcode BC_10 REV
75tccggtacgc tatct 157615DNAArtificial Sequenceoligonucleotide
barcode BC_11 REV 76gatgatgagc ctgga 157715DNAArtificial
Sequenceoligonucleotide barcode BC_12 REV 77ttggctctag tactc
157815DNAArtificial Sequenceoligonucleotide barcode BC_13 REV
78ccgttattga cgctc 157915DNAArtificial Sequenceoligonucleotide
barcode BC_14 REV 79cagtgtagat accgc 158015DNAArtificial
Sequenceoligonucleotide barcode BC_15 REV 80ttctcttcgg agaag
158115DNAArtificial Sequenceoligonucleotide barcode BC_16 REV
81ttaacacagg cttca 158215DNAArtificial Sequenceoligonucleotide
barcode BC_17 REV 82tcgacaacca tccag 158315DNAArtificial
Sequenceoligonucleotide barcode BC_18 REV 83ttggaaccgt gcagt
158415DNAArtificial Sequenceoligonucleotide barcode BC_19 REV
84aaggaccatc tctcg 158515DNAArtificial Sequenceoligonucleotide
barcode BC_20 REV 85tcttgtctct caaga 158615DNAArtificial
Sequenceoligonucleotide barcode BC_21 REV 86aacacagtgc gaatt
158715DNAArtificial Sequenceoligonucleotide barcode BC_22 REV
87tcttagcggc actac 158815DNAArtificial Sequenceoligonucleotide
barcode BC_23 REV 88ggattgtgct atagg 158915DNAArtificial
Sequenceoligonucleotide barcode BC_24 REV 89tccaacctcg gtgat
159015DNAArtificial Sequenceoligonucleotide barcode BC_25 REV
90cttctccgtt gaatc 159115DNAArtificial Sequenceoligonucleotide
barcode BC_26 REV 91tggtgcgagg ttcgt 159215DNAArtificial
Sequenceoligonucleotide barcode BC_27 REV 92tcttcttgaa gtcct
159315DNAArtificial Sequenceoligonucleotide barcode BC_28 REV
93tgcgaggatt caacc 159415DNAArtificial Sequenceoligonucleotide
barcode BC_29 REV 94cgctagaggt tggtt 159515DNAArtificial
Sequenceoligonucleotide barcode BC_30 REV 95gttagatatt cgcgt
159615DNAArtificial Sequenceoligonucleotide barcode BC_31 REV
96ggtgtaattc tcaac 159715DNAArtificial Sequenceoligonucleotide
barcode BC_32 REV 97ggttcacaga gagag 159815DNAArtificial
Sequenceoligonucleotide barcode BC_33 REV 98tctcttactg atggc
159915DNAArtificial Sequenceoligonucleotide barcode BC_34 REV
99ctcaattcac gttgc 1510015DNAArtificial Sequenceoligonucleotide
barcode BC_35 REV 100tgtggctcta cttag 1510115DNAArtificial
Sequenceoligonucleotide barcode BC_36 REV 101cgcttccaac agaca
1510215DNAArtificial Sequenceoligonucleotide barcode BC_37 REV
102cgcgctgtct attaa 1510315DNAArtificial Sequenceoligonucleotide
barcode BC_38 REV 103cttgttagag cgtcg 1510415DNAArtificial
Sequenceoligonucleotide barcode BC_39 REV 104tctcaataag ccatg
1510515DNAArtificial Sequenceoligonucleotide barcode BC_40 REV
105ccggccatac ctagt 1510615DNAArtificial Sequenceoligonucleotide
barcode BC_41 REV 106aggatagacg aggac 1510715DNAArtificial
Sequenceoligonucleotide barcode BC_42 REV 107ggtaacggaa tccta
1510815DNAArtificial Sequenceoligonucleotide barcode BC_43 REV
108cttccggtgg tcaga 1510915DNAArtificial Sequenceoligonucleotide
barcode BC_44 REV 109ccacgaggtg actct 1511015DNAArtificial
Sequenceoligonucleotide barcode BC_45 REV 110cttcgactac atcag
1511115DNAArtificial Sequenceoligonucleotide barcode BC_46 REV
111ctatccgcaa ccgac 1511215DNAArtificial Sequenceoligonucleotide
barcode BC_47 REV 112ttcttaggag gagga 1511315DNAArtificial
Sequenceoligonucleotide barcode BC_48 REV 113tgaagtggac cgaat
1511415DNAArtificial Sequenceoligonucleotide barcode BC_49 REV
114cgcagacctg taagg 1511515DNAArtificial Sequenceoligonucleotide
barcode BC_50 REV 115aattggccaa tgatc 1511615DNAArtificial
Sequenceoligonucleotide barcode BC_51 REV 116caactcagcc ttgaa
1511715DNAArtificial Sequenceoligonucleotide barcode BC_52 REV
117gattcaatcg agcca 1511815DNAArtificial Sequenceoligonucleotide
barcode BC_53 REV 118gagcggatgg cttac 1511915DNAArtificial
Sequenceoligonucleotide barcode BC_54 REV 119tgtctacgca tgtgt
1512015DNAArtificial Sequenceoligonucleotide barcode BC_55 REV
120cttgaatcca tagca 1512115DNAArtificial Sequenceoligonucleotide
barcode BC_56 REV 121aactaagcct cgtgg 1512215DNAArtificial
Sequenceoligonucleotide barcode BC_57 REV 122gcaccttagt tggcc
1512315DNAArtificial Sequenceoligonucleotide barcode BC_58 REV
123ttgtcgaata ggtgc 1512415DNAArtificial Sequenceoligonucleotide
barcode BC_59 REV 124agccgatcgt gtcca 1512515DNAArtificial
Sequenceoligonucleotide barcode BC_60 REV 125ccgttggaat tatag
1512615DNAArtificial Sequenceoligonucleotide barcode BC_61 REV
126cttactaacc acgtt
1512715DNAArtificial Sequenceoligonucleotide barcode BC_62 REV
127gccactcgtt ccttg 1512815DNAArtificial Sequenceoligonucleotide
barcode BC_63 REV 128tcttccgttc tggtg 1512915DNAArtificial
Sequenceoligonucleotide barcode BC_64 REV 129ttgcttgacc gtacg
1513015DNAArtificial Sequenceoligonucleotide barcode BC_65 REV
130ttagcctgtc accga 1513116PRTArtificial Sequencesynthetic
peptideMOD_RES1formyl-Methionine 131Met Asp Val Glu Ala Trp Leu Gly
Ala Arg Val Pro Leu Val Glu Thr1 5 10 1513210PRTArtificial
Sequencesynthetic peptide 132Thr Glu Asn Leu Tyr Phe Gln Asn His
Val1 5 1013320DNAArtificial Sequenceoligonucleotide primer
133aatgatacgg cgaccaccga 2013424DNAArtificial
Sequenceoligonucleotide primer 134caagcagaag acggcatacg agat
241355DNAArtificial Sequenceoligonucleotidemisc_feature(1)...(5)n =
A,T,C or G 135nnnnn 51368PRTArtificial Sequencesynthetic peptide
136Asp Tyr Lys Asp Asp Asp Asp Lys1 513714PRTArtificial
Sequencesynthetic peptide 137Gly Lys Pro Ile Pro Asn Pro Leu Leu
Gly Leu Asp Ser Thr1 5 1013810PRTArtificial Sequencesynthetic
peptide 138Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu1 5
101399PRTArtificial Sequencesynthetic peptide 139Tyr Pro Tyr Asp
Val Pro Asp Tyr Ala1 51409PRTArtificial Sequencesynthetic peptide
140Asn Trp Ser His Pro Gln Phe Glu Lys1 514182DNAArtificial
Sequencesynthetic oligonucleotidemodified_base1biotin 141tttttgcaaa
tggcattctg acatcccgta gtccgcgaca ctagatgtct agcatgccgc 60cgtgtcatgt
ggaaactgag tg 8214272DNAArtificial Sequencesynthetic
oligonucleotidemodified_base1biotin 142tttttttttt gactggttcc
aattgacaag ccgtagtccg cgacactagt aagccggtat 60atcaactgag tg
7214310DNAArtificial Sequencesynthetic
oligonucleotidemodified_base1biotinmodified_base10three carbon (3C)
spacer 143tttttttttt 1014462DNAArtificial Sequencesynthetic
oligonucleotidemodified_base(31)...(32)18-atom hexa-ethyleneglycol
spacermodified_base62three carbon (3C) spacer 144ggatgtcaga
atgccatttg cttttttttt tcactcagtc ctaacgcgta tacgcactca 60gt
6214563DNAArtificial Sequencesynthetic
oligonucleotidemodified_base(31)...(32)18-atom hexa-ethyleneglycol
spacermodified_base63three carbon (3C) spacer 145ggatgtcaga
atgccatttg cttttttttt tcactcagtc ctaacgcgta tacgtcactc 60agt
6314663DNAArtificial Sequencesynthetic
oligonucleotidemodified_base(31)...(32)five 18-atom
hexa-ethyleneglycol spacersmodified_base63three carbon (3C) spacer
146ggatgtcaga atgccatttg cttttttttt tcactcagtc ctaacgcgta
tacgtcactc 60agt 6314771DNAArtificial Sequencesynthetic
oligonucleotidemodified_base(25)...(26)18-atom hexa-ethyleneglycol
spacermodified_base63three carbon (3C) spacer) 147gcttgtcaat
tggaaccagt cttttcactc agtcctaacg cgtatacggg aatctcggca 60gttcactcag
t 7114844DNAArtificial Sequencesynthetic
oligonucleotidemodified_base44three carbon (3C) spacer
148cgatttgcaa ggatcactcg tcactcagtc ctaacgcgta tacg
441498DNAArtificial Sequencespacer sequence 149actgagtg
81508DNAArtificial Sequencespacer sequence 150cactcagt
815118DNAArtificial Sequenceoligonucleotide primer 151cgtagtccgc
gacactag 1815220DNAArtificial Sequenceoligonucleotide primer
152cgatttgcaa ggatcactcg 2015321DNAArtificial Sequencesynthetic
oligonucleotide 153gcaaatggca ttctgacatc c 2115421DNAArtificial
Sequencesynthetic oligonucleotide 154gactggttcc aattgacaag c
2115523DNAArtificial Sequencesynthetic
oligonucleotidemodified_base23three carbon (3C) spacer
155cgtatacgcg ttaggactga gtg 2315638DNAArtificial Sequencesynthetic
oligonucleotidemodified_base38three carbon (3C) spacer
156aactgccgag attcccgtat acgcgttagg actgagtg 3815746DNAArtificial
Sequenceoligonucleotide primer 157agtccgcgca atcagatgtc tagcatgccg
gatccggatc gatctc 4615846DNAArtificial Sequenceoligonucleotide
primer 158agtccgcgca atcagccgtg tcatgtggaa gatccggatc gatctc
4615946DNAArtificial Sequenceoligonucleotide primer 159agtccgcgca
atcagtaagc cggtatatca gatccggatc gatctc 4616046DNAArtificial
Sequenceoligonucleotide primer 160agtccgcgca atcagttcga tatgacggaa
gatccggatc gatctc 4616146DNAArtificial Sequenceoligonucleotide
primer 161tgcaaggatc actcgccaga tcacaagcgg gagatcgatc cggatc
4616246DNAArtificial Sequenceoligonucleotide primer 162tgcaaggatc
actcgtccgg tacgctatct gagatcgatc cggatc 4616346DNAArtificial
Sequenceoligonucleotide primer 163tgcaaggatc actcggatga tgagcctgga
gagatcgatc cggatc 4616446DNAArtificial Sequenceoligonucleotide
primer 164tgcaaggatc actcgttggc tctagtactc gagatcgatc cggatc
4616521DNAArtificial Sequenceoligonucleotide primer 165aatcgtagtc
cgcgcaatca g 2116621DNAArtificial Sequenceoligonucleotide primer
166acgatttgca aggatcactc g 2116716DNAArtificial Sequencespacer
sequence 167gatccggatc gatctc 16168734DNAArtificial
Sequenceextended recording tag construct 168aatcacggta caagtcactc
atccgtacgc tatctgagaa tcgtccagat ccggcatgct 60agtatctggt gcagactacg
attgttacag atcactcaga tgatgagcac agaaaatcgt 120cgaatcttcc
atcaccatcg aacagttacg attaatgtag tccgcacaat cgaatgtcta
180acatgccgaa tcccggacgt ctccagcttc taaaccaaca gtagtcgcac
aaatcattgt 240acggtacaag atctaacgag agatgatcgg atctgaccac
tttaaacact gattacgcag 300actacgatta cgatttaaga atcctcgtcc
ggtacaatca tagtccgcac aatcaaccgt 360gtcatgtgaa gatcagatcg
atctcgaata gcgtaccaga cagtgatctt gcaaatcgta 420atgtgtccgc
gccaatcgat agccatgaat cccagtcgat ctcccgcttg tgatctggcg
480atcgccttgt accgtcgtac gatttgagat cacctcgtta actcaagcta
aagatcgtcc 540ggatcgcttt ataaacatct gattgcgcgg tacgattatc
gtagtccgca catatcgaac 600ctgttgaaga tccggatcgt ctctccaggc
tcatcatccg agtgatcctt gcaaataatc 660atgtccgcac catcaggtgt
ctaacgcttg ccggatccga atcgatctct ccaggctcat 720catcgaagtg atgt
73416910PRTArtificial Sequencesynthetic peptide 169Cys Pro Val Gln
Leu Trp Val Asp Ser Thr1 5 1017010PRTArtificial Sequencesynthetic
peptideVARIANT(1)...(10)Xaa = Any Amino Acid 170Cys Pro Xaa Gln Xaa
Trp Xaa Asp Xaa Thr1 5 101718PRTArtificial SequenceFLAG epitope
peptide 171Asp Tyr Lys Asp Asp Asp Asp Lys1 517214PRTArtificial
SequenceV5 epitope peptide 172Gly Lys Pro Ile Pro Asn Pro Leu Leu
Gly Leu Asp Ser Thr1 5 1017310PRTArtificial Sequencec-Myc epitope
peptide 173Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu1 5
101749PRTArtificial SequenceHA epitope peptide 174Tyr Pro Tyr Asp
Val Pro Asp Tyr Ala1 517514PRTArtificial SequenceV5 epitope peptide
175Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr1 5
101769PRTArtificial SequenceStrepTag II peptide 176Asn Trp Ser His
Pro Gln Phe Glu Lys1 517736DNAArtificial Sequencesynthetic
nucloetidemisc_feature(11)...(22)compartment bar code n = A, C, T,
or Gmisc_feature(23)...(27)unique molecular identifier n = A, T, C
or G 177gcgcaatcag nnnnnnnnnn nnnnnnntgc aaggat
3617812DNAArtificial Sequencesynthetic
nucloetidemisc_feature(1)...(12)Compartment barcod n = A, T, C or G
178nnnnnnnnnn nn 121795DNAArtificial Sequencesynthetic
nucloetidemisc_feature(1)...(5)Unique molecular identifier; n = A,
T, C or G 179nnnnn 518010PRTArtificial Sequencebutelase I peptide
substrate 180Cys Gly Gly Ser Ser Gly Ser Asn His Val1 5
101816PRTArtificial SequenceButelase I substrate 181Cys Gly Ser Asn
Val His1 518210PRTArtificial SequencecMyc tag 182Leu Asp Glu Glu
Ser Ile Leu Lys Gly Glu1 5 101838PRTArtificial SequenceHA tag
183Lys Asp Asp Asp Asp Lys Tyr Asp1 518414PRTArtificial
Sequenceepitope 184Val Leu Pro Val Arg Ala Gly Leu Trp Ala Glu Val
Asp Tyr1 5 10
* * * * *
References