U.S. patent application number 17/386891 was filed with the patent office on 2021-12-30 for aad-1 event das-40278-9, related transgenic corn lines, and event-specific identification thereof.
The applicant listed for this patent is DOW AGROSCIENCES LLC. Invention is credited to Nicole ARNOLD, Jill BRYAN, Yunxing Cory CUI, Greg GILLES, Jennifer HAMILTON, Tina KAISER, Donald MAUM, Nathan VanOpdorp, Terry WRIGHT, Ning ZHOU.
Application Number | 20210403934 17/386891 |
Document ID | / |
Family ID | 1000005811168 |
Filed Date | 2021-12-30 |
United States Patent
Application |
20210403934 |
Kind Code |
A1 |
CUI; Yunxing Cory ; et
al. |
December 30, 2021 |
AAD-1 EVENT DAS-40278-9, RELATED TRANSGENIC CORN LINES, AND
EVENT-SPECIFIC IDENTIFICATION THEREOF
Abstract
This invention relates in part to plant breeding and herbicide
tolerant plants. This invention includes a novel AAD-1
transformation event in corn plants comprising a polynucleotide
sequence, as described herein, inserted into a specific site within
the genome of a corn cell. In some embodiments, said
event/polynucleotide sequence can be "stacked" with other traits,
including, for example, other herbicide tolerance gene(s) and/or
insect-inhibitory proteins. Additionally, the subject invention
provides assays for detecting the presence of the subject event in
a sample (or corn grain, for example). The assays can be based on
the DNA sequence of the recombinant construct, inserted into the
corn genome, and on the genomic sequences flanking the insertion
site. Kits and conditions useful in conducting the assays are also
provided.
Inventors: |
CUI; Yunxing Cory; (Cary,
NC) ; BRYAN; Jill; (Brownsburg, IN) ; MAUM;
Donald; (Champaign, IL) ; GILLES; Greg;
(Alpharetta, GA) ; WRIGHT; Terry; (Carmel, IN)
; HAMILTON; Jennifer; (Indianapolis, IN) ; ARNOLD;
Nicole; (Carmel, IN) ; VanOpdorp; Nathan;
(Indianapolis, IN) ; KAISER; Tina; (Carmel,
IN) ; ZHOU; Ning; (Kaunakakai, HI) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
DOW AGROSCIENCES LLC |
Indianapolis |
IN |
US |
|
|
Family ID: |
1000005811168 |
Appl. No.: |
17/386891 |
Filed: |
July 28, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16279055 |
Feb 19, 2019 |
11098322 |
|
|
17386891 |
|
|
|
|
14989787 |
Jan 6, 2016 |
10323287 |
|
|
16279055 |
|
|
|
|
13390969 |
May 7, 2012 |
9402358 |
|
|
PCT/US2010/045869 |
Aug 18, 2010 |
|
|
|
14989787 |
|
|
|
|
61235248 |
Aug 19, 2009 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12N 9/0071 20130101;
C12N 15/8274 20130101; C12Y 113/00 20130101; C12Q 1/6895 20130101;
C12Q 2600/16 20130101; C12N 9/0069 20130101 |
International
Class: |
C12N 15/82 20060101
C12N015/82; C12Q 1/6895 20060101 C12Q001/6895; C12N 9/02 20060101
C12N009/02 |
Claims
1. A transgenic corn plant comprising a recombinant polynucleotide
that encodes an aryloxyalkanoate dioxygenase (AAD-1) protein that
exhibits aryloxyalkanoate dioxygenase activity, wherein said
activity enzymatically degrades a phenoxy auxin herbicide and an
(R)-aryloxyphenoxypropionate herbicide, wherein said recombinant
polynucleotide hybridizes under stringent conditions with a
sequence consisting of nucleotides 6679 to 6700 of SEQ ID NO: 29 or
nucleotides 1863 to 1875 of SEQ ID NO: 29, or the full complement
of nucleotides 6679 to 6700 of SEQ ID NO: 29 or nucleotides 1863 to
1875 of SEQ ID NO: 29.
2. The transgenic corn plant of claim 1 wherein said AAD-1 protein
has at least 95% sequence identity with SEQ ID NO: 9.
3. The transgenic corn plant of claim 1 wherein said plant
comprises event DAS-40278-9 as present in the seed deposited with
American Type Culture Collection (ATCC) under Accession No.
PTA-10244.
4. A corn seed comprising a recombinant polynucleotide that encodes
an aryloxyalkanoate dioxygenase (AAD-1) protein that exhibits
aryloxyalkanoate dioxygenase activity, wherein said activity
enzymatically degrades a phenoxy auxin herbicide and an
(R)-aryloxyphenoxypropionate herbicide, wherein said recombinant
polynucleotide hybridizes under stringent conditions with a
sequence consisting of nucleotides 6679 to 6700 of SEQ ID NO: 29 or
nucleotides 1863 to 1875 of SEQ ID NO: 29, or the full complement
of nucleotides 6679 to 6700 of SEQ ID NO: 29 or nucleotides 1863 to
1875 of SEQ ID NO: 29.
5. A corn plant produced by growing the seed of claim 4, said plant
comprising said recombinant polynucleotide.
6. A progeny plant of the corn plant of claim 5, said progeny plant
comprising said recombinant polynucleotide.
7. A part of the plant of claim 5 wherein said part is selected
from the group consisting of pollen, ovule, flowers, shoots, roots,
and leaves, said part comprising said recombinant
polynucleotide.
8. A method of breeding a corn plant, said method comprising
crossing a first corn plant, comprising a recombinant
polynucleotide that hybridizes under stringent conditions with a
sequence consisting of nucleotides 6679 to 6700 of SEQ ID NO: 29 or
nucleotides 1863 to 1875 of SEQ ID NO: 29, or the full complement
of nucleotides 6679 to 6700 of SEQ ID NO: 29 or nucleotides 1863 to
1875 of SEQ ID NO: 29, with a second corn plant to produce a third
corn plant, and assaying said third corn plant for the presence of
said recombinant polynucleotide in the genome of the third
plant.
9. A method of controlling weeds, said method comprising applying
an aryloxyalkanoate herbicide to plants growing in a field, wherein
said plants growing in the field comprise a plant of claim 1.
10. The method of claim 9, wherein said herbicide is selected from
the group consisting of 2,4-D; 2,4-DB; 2,4-DP, MCPP, MCPA; and
MCPB.
11. The method of claim 9, wherein said herbicide is an
(R)-aryloxyphenoxypropionate herbicide, optionally wherein the
herbicide is (R)-quizalofop or (R)-haloxyfop.
12. The method of claim 9, wherein said method comprises applying a
second herbicide to said plants growing in the field.
13. The method of claim 12, wherein said second herbicide is
selected from the group consisting of glyphosate and dicamba.
14. A method of controlling weeds, said method comprising applying
an aryloxyalkanoate herbicide to a field, and planting the seed of
claim 4 in said field within 14 days after applying the
herbicide.
15. A method of controlling glyphosate-resistant weeds in an area
comprising a plant of claim 1, wherein said plant further comprises
a glyphosate tolerance trait, said method comprising applying an
aryloxyalkanoate herbicide to said area.
16. The method of claim 15 wherein said herbicide is a phenoxy
auxin or (R)-aryloxyphenoxypropionate herbicide.
17. The method of claim 16 wherein said herbicide is applied from a
tank mix with glyphosate.
18. The method of claim 17 wherein at least one of said weeds is a
glyphosate-resistant volunteer of a different species than said
plant.
19. A method of controlling weeds in an area under cultivation,
said area comprising a plurality of plants of claim 1, said method
comprising applying an aryloxy alkanoate herbicide over the top of
the plants.
20. A method of controlling weeds in an area under cultivation,
said method comprising applying an aryloxy alkanoate herbicide to a
field planted with the seed of claim 4, wherein the herbicide is
applied pre-emergence, post-emergence, or pre-emergence and
post-emergence to the plants, parts of the plants, and/or to the
area under cultivation.
21. The method of claim 19, said method comprising applying said
herbicide jointly with or separately from a second herbicide.
22. The method of claim 20, said method comprising applying said
herbicide jointly with or separately from a second herbicide.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 16/279,055, filed on Feb. 19, 2019, which is a continuation of
U.S. application Ser. No. 14/989,787, filed Jan. 6, 2016 (now U.S.
Pat. No. 10,323,287), which is a divisional of U.S. application
Ser. No. 13/390,969, filed May 7, 2012 (now U.S. Pat. No.
9,402,358), which is a national stage entry of PCT/US2010/045869,
filed Aug. 18, 2010 which claims priority to U.S. Provisional
Patent Application No. 61/235,248, filed on Aug. 19, 2009, the
disclosures of which are each incorporated by reference in their
entirety into the present application.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
[0002] Incorporated by reference in its entirety is a
computer-readable nucleotide/amino acid sequence listing submitted
concurrently herewith as an 18 kilobyte ASCII (Text) file named
"344351_ST25.txt", created on Jul. 19, 2021.
BACKGROUND OF THE INVENTION
[0003] The aad-1 gene (originally from Sphingobium herbicidovorans)
encodes the aryloxyalkanoate dioxygenase (AAD-1) protein. The trait
confers tolerance to 2,4-dichlorophenoxyacetic acid and
aryloxyphenoxypropionate (commonly referred to as "fop" herbicides
such as quizalofop) herbicides and may be used as a selectable
marker during plant transformation and in breeding nurseries. The
aad-1 gene, itself, for herbicide tolerance in plants was first
disclosed in WO 2005/107437 (see also US 2009-0093366).
[0004] The expression of heterologous or foreign genes in plants is
influenced by where the foreign gene is inserted in the chromosome.
This could be due to chromatin structure (e.g., heterochromatin) or
the proximity of transcriptional regulation elements (e.g.,
enhancers) close to the integration site (Weising et al., Ann. Rev.
Genet. 22:421-477, 1988), for example. The same gene in the same
type of transgenic plant (or other organism) can exhibit a wide
variation in expression level amongst different events. There may
also be differences in spatial or temporal patterns of expression.
For example, differences in the relative expression of a transgene
in various plant tissues may not correspond to the patterns
expected from transcriptional regulatory elements present in the
introduced gene construct.
[0005] Thus, large numbers of events are often created and screened
in order to identify an event that expresses an introduced gene of
interest to a satisfactory level for a given purpose. For
commercial purposes, it is common to produce hundreds to thousands
of different events and to screen those events for a single event
that has desired transgene expression levels and patterns. An event
that has desired levels and/or patterns of transgene expression is
useful for introgressing the transgene into other genetic
backgrounds by sexual outcrossing using conventional breeding
methods. Progeny of such crosses maintain the transgene expression
characteristics of the original transformant. This strategy is used
to ensure reliable gene expression in a number of varieties that
are well adapted to local growing conditions.
[0006] U.S. Patent Apps. 20020120964 A1 and 20040009504 A1 relate
to cotton event PV-GHGT07(1445) and compositions and methods for
the detection thereof. WO 02/100163 relates to cotton event
MONI5985 and compositions and methods for the detection thereof. WO
2004/011601 relates to corn event MON863 plants and compositions
and methods for the detection thereof. WO 2004/072235 relates to
cotton event MON 88913 and compositions and methods for the
detection thereof.
[0007] WO 2006/098952 relates to corn event 3272. WO 2007/142840
relates to corn event MIR162.
[0008] U.S. Pat. No. 7,179,965 relates to cotton having a cry1F
event and a cry1Ac event.
[0009] AAD-1 corn having the specific event disclosed herein has
not previously been disclosed.
BRIEF SUMMARY OF THE INVENTION
[0010] The present invention is related to the AAD-1 corn event
designated DAS-40278-9 having seed deposited with American Type
Culture Collection (ATCC) with Accession No. PTA-10244, and progeny
derived thereof. Other aspects of the invention comprise the
progeny plants, seeds and grain or regenerable parts of the plants
and seeds and progeny of corn event DAS-40278-9, as well as food or
feed products made from any thereof. The invention also includes
plant parts of corn event DAS-40278-9 that include, but are not
limited to, pollen, ovule, flowers, shoots, roots, and leaves, and
nuclei of vegetative cells, pollen cells, and egg cells. The
invention further relates to corn plants having tolerance to
phenoxy auxinic and/or aryloxyalkanoate herbicides, novel genetic
compositions of corn event DAS-40278-9, and aspects of agronomic
performance of corn plants comprising corn event DAS-40278-9.
[0011] This invention relates in part to plant breeding and
herbicide tolerant plants. This invention includes a novel aad-1
transformation event in corn plants comprising a polynucleotide
sequence, as described herein, inserted into a specific site within
the genome of a corn cell.
[0012] In some embodiments, said event/polynucleotide sequence can
be "stacked" with other traits, including, for example, other
herbicide tolerance gene(s) and/or insect-inhibitory proteins.
However, the subject invention includes plants having the single
event, as described herein.
[0013] The additional traits may be stacked into the plant genome
via plant breeding, re-transformation of the transgenic plant
containing corn event DAS-40278-9, or addition of new traits
through targeted integration via homologous recombination.
[0014] Other embodiments include the excision of polynucleotide
sequences which comprise corn event DAS-40278-9, including for
example, the pat gene expression cassette. Upon excision of a
polynucleotide sequence, the modified event may be re-targeted at a
specific chromosomal site wherein additional polynucleotide
sequences are stacked with corn event DAS-40278-9.
[0015] In one embodiment, the present invention encompasses a corn
chromosomal target site located on chromosome 2 at approximately 20
cM between SSR markers UMC1265 (see SEQ ID) NO:30 and SEQ ID NO:31)
and MMC0111 (see SEQ ID NO:32 and SEQ ID NO:33) at approximately 20
cM on the 2008 DAS corn linkage map, wherein the target site
comprises a heterologous nucleic acid. In another embodiment, the
present invention encompasses a corn chromosomal target site
comprising a location defined in or by SEQ ID NO:29 and the
residues thereof as described herein, as would be recognized by one
skilled in the art.
[0016] In one embodiment, the present invention encompasses a
method of making a transgenic corn plant comprising inserting a
heterologous nucleic acid at a position on chromosome 2 at
approximately 20 cM between SSR markers UMC1265 (see SEQ ID NO:30
and SEQ ID NO:31) and MMC0111 (see SEQ ID NO:32 and SEQ ID NO:33)
at approximately 20 cM on the 2008 DAS corn linkage map. In still
another embodiment, the inserted heterologous nucleic acid is
flanked 5' by all or part of the 5' flanking sequence as defined
herein with reference to SEQ ID NO:29, and flanked 3' by all or
part of the 5' flanking sequence as defined herein with reference
to SEQ ID NO:29.
[0017] Additionally, the subject invention provides assays for
detecting the presence of the subject event in a sample (of corn
grain, for example). The assays can be based on the DNA sequence of
the recombinant construct, inserted into the corn genome, and on
the genomic sequences flanking the insertion site. Kits and
conditions useful in conducting the assays are also provided.
[0018] Thus, the subject invention relates in part to the cloning
and analysis of the DNA sequences of a whole AAD-1 insert, and the
border regions thereof (in transgenic corn lines). These sequences
are unique. Based on these insert and border sequences,
event-specific primers were generated. PCR analysis demonstrated
that these events can be identified by analysis of the PCR
amplicons generated with these event-specific primer sets. Thus,
these and other related procedures can be used to uniquely identify
corn lines comprising the event of the subject invention.
BRIEF DESCRIPTION OF THE FIGURES
[0019] FIG. 1 shows a plasmid map of pDAS 1740.
[0020] FIG. 2 shows components of the insert for DAS-40278-9 (pDAS
1740).
[0021] FIG. 3 shows a restriction map and components of the insert
for DAS-40278-9 (pDAS 1740).
[0022] FIG. 4 shows amplicons, primers, and a cloning strategy for
the DNA insert and borders for DAS-40278-9.
[0023] FIG. 5 illustrates primer locations with respect to the
insert and borders for DAS-40278-9.
[0024] FIG. 6 illustrates the junction regions and insertion for
DAS-40278-9.
[0025] FIG. 7 is a breeding diagram referenced in Example 7.
BRIEF DESCRIPTION OF THE SEQUENCES
[0026] SEQ ID NOs: 1-28 are primers as described herein.
[0027] SEQ ID NO:29 provides insert and flanking sequences for the
subject event DAS-40278-9.
[0028] SEQ ID NOs: 30-33 are primers for flanking markers as
described in Example 4.
DETAILED DESCRIPTION OF THE INVENTION
[0029] This invention relates in part to plant breeding and
herbicide tolerant plants. This invention includes novel
transformation events of corn plants (maize) comprising a subject
aad-1 polynucleotide sequences, as described herein, inserted into
specific site within the genome of a corn cell. In some
embodiments, said polynucleotide sequence can be "stacked" with
other traits (such as other herbicide tolerance gene(s) and/or
gene(s) that encode insect-inhibitory proteins, for example. In
some embodiments said polynucleotide sequences can be excised and
subsequently re-targeted with additional polynucleotide sequences.
However, the subject invention includes plants having a single
event, as described herein.
[0030] Additionally, the subject invention provides assays for
detecting the presence of the subject event in a sample. Aspects of
the subject invention include methods of designing and/or producing
any diagnostic nucleic acid molecules exemplified or suggested
herein, particularly those based wholly or partially on the subject
flanking sequences.
[0031] More specifically, the subject invention relates in part to
transgenic corn event DAS-40278-9 (also known as pDAS 1740-278),
plant lines comprising these events, and the cloning and analysis
of the DNA sequences of this insert, and/or the border regions
thereof. Plant lines of the subject invention can be detected using
sequences disclosed and suggested herein.
[0032] In some embodiments, this invention relates to
herbicide-tolerant corn lines, and the identification thereof. The
subject invention relates in part to detecting the presence of the
subject event in order to determine whether progeny of a sexual
cross contain the event of interest. In addition, a method for
detecting the event is included and is helpful, for example, for
complying with regulations requiring the pre-market approval and
labeling of foods derived from recombinant crop plants, for
example. It is possible to detect the presence of the subject event
by any well-known nucleic acid detection method such as polymerase
chain reaction (PCR) or DNA hybridization using nucleic acid
probes. An event-specific PCR assay is discussed, for example, by
Windels et al. (Med. Fac. Landbouww, Univ. Gent 64/5b:459462,
1999). This related to the identification of glyphosate tolerant
soybean event 40-3-2 by PCR using a primer set spanning the
junction between the insert and flanking DNA. More specifically,
one primer included sequence from the insert and a second primer
included sequence from flanking DNA.
[0033] Corn was modified by the insertion of the aad-1 gene from
Sphingobium herbicidovorans which encodes the aryloxyalkanoate
dioxygenase (AAD-1) protein. The trait confers tolerance to
2,4-dichlorophenoxyacetic acid and aryloxyphenoxypropionate
(commonly referred to as "fop" herbicides such as quizalofop)
herbicides and may be used as a selectable marker during plant
transformation and in breeding nurseries. Transformation of corn
with a DNA fragment from the plasmid pDAS1740 was carried forward,
through breeding, to produce event DAS-40278-9.
[0034] Genomic DNA samples extracted from twenty individual corn
plants derived from five generations and four plants per generation
of event DAS-40278-9 were selected for molecular characterization
of the AAD-1 corn event DAS-40278-9. AAD-1 protein expression was
tested using an AAD-1 specific rapid test strip kit. Only plants
that tested positive for AAD-1 protein expression were selected for
subsequent molecular characterization. Southern hybridization
confirmed that the aad-1 gene is present in corn plants that tested
positive for AAD-1 protein expression, and the aad-1 gene was
inserted as a single intact copy in these plants when hybridized
with an aad-1 gene probe.
[0035] Molecular characterization of the inserted DNA in AAD-1 corn
event DAS-40278-9 is also described herein. The event was produced
via Whiskers transformation with the Fsp I fragment of plasmid pDAS
1740. Southern blot analysis was used to establish the integration
pattern of the inserted DNA fragment and determine insert/copy
number of the aad-1 gene in event DAS-40278-9. Data were generated
to demonstrate the integration and integrity of the aad-1 transgene
inserted into the corn genome. Characterization of the integration
of noncoding regions (designed to regulate the coding regions),
such as promoters and terminators, the matrix attachment regions
RB7 Mar v3 and RB7 Mar v4, as well as stability of the transgene
insert across generations, were evaluated. The stability of the
inserted DNA was demonstrated across five distinct generations of
plants. Furthermore, absence of transformation plasmid backbone
sequence including the Ampicillin resistance gene (Apr) region was
demonstrated by probes covering nearly the whole backbone region
flanking the restriction sites (Fsp I) of plasmid pDAS 1740. A
detailed physical map of the insertion was drawn based on these
Southern blot analyses of event DAS-40278-9.
[0036] Levels of AAD-1 protein were determined in corn tissues. In
addition, compositional analysis was performed on corn forage and
grain to investigate the equivalency between the isogenic
non-transformed corn line and the transgenic corn line DAS-40278-9
(unsprayed, sprayed with 2,4-D, sprayed with quizalofop, and
sprayed with 2,4-D and quizalofop). Agronomic characteristics of
the isogenic non-transformed corn line were also compared to the
DAS-40278-9 corn.
[0037] Field expression, nutrient composition, and agronomic trials
of a non-transgenic control and a hybrid corn line containing
Aryloxyalkanoate Dioxygenase-1 (AAD-1) were conducted in the same
year at six sites located in Iowa, Illinois (2 sites), Indiana,
Nebraska and Ontario, Canada. Expression levels are summarized
herein for the AAD-1 protein in leaf, pollen, root, forage, whole
plant, and grain, the results of agronomic determinations, and
compositional analysis of forage and grain samples from the control
and DAS-40278-9 AAD-1 corn.
[0038] The soluble, extractable AAD-1 protein was measured using a
quantitative enzyme-linked immunosorbent assay (ELISA) method in
corn leaf, pollen, root, forage, whole plant, and grain. Good
average expression values were observed in root and pollen tissue,
as discussed in more detail herein. Expression values were similar
for all the sprayed treatments as well as for the plots sprayed and
unsprayed with 2,4-D and quizalofop herbicides.
[0039] Compositional analyses, including proximates, minerals,
amino acids, fatty acids, vitamins, anti-nutrients, and secondary
metabolites were conducted to investigate the equivalency of
DAS-40278-9 AAD-1 corn (with or without herbicide treatments) to
the control. Results for DAS-40278-9 AAD-1 composition samples were
all as good as, or better than (biologically and agronomically),
based on control lines and/or conventional corn, analysis of
agronomic data collected from control and DAS-40278-9 AAD-1 corn
plots.
[0040] As alluded to above in the Background section, the
introduction and integration of a transgene into a plant genome
involves some random events (hence the name "event" for a given
insertion that is expressed). That is, with many transformation
techniques such as Agrobacterium transformation, the "gene gun,"
and WHISKERS, it is unpredictable where in the genome a transgene
will become inserted. Thus, identifying the flanking plant genomic
DNA on both sides of the insert can be important for identifying a
plant that has a given insertion event. For example, PCR primers
can be designed that generate a PCR amplicon across the junction
region of the insert and the host genome. This PCR amplicon can be
used to identify a unique or distinct type of insertion event.
[0041] As "events" are originally random events, as part of this
disclosure at least 2500 seeds of a corn line comprising the event
have been deposited and made available to the public without
restriction (but subject to patent rights), with the American Type
Culture Collection (ATCC), 10801 University Boulevard, Manassas,
Va., 20110. The deposit has been designated as ATCC Deposit No.
PTA-10244 (Yellow Dent maize hybrid seed (Zea Mays L.):DAS-40278-9;
Deposited on behalf of Dow AgroSciences LLC; Date of receipt of
seeds/strain(s) by the ATTC: Jul. 10, 2009; viability confirmed
Aug. 17, 2009). This deposit was made and will be maintained in
accordance with and under the terms of the Budapest Treaty with
respect to seed deposits for the purposes of patent procedure. The
deposit will be maintained without restriction at the ATCC
depository, which is a public depository, for a period of 30 years,
or five years after the most recent request, or for the effective
life of the patent, whichever is longer, and will be replaced if it
becomes nonviable during that period.
[0042] The deposited seeds are part of the subject invention.
Clearly, corn plants can be grown from these seeds, and such plants
are part of the subject invention. The subject invention also
relates to DNA sequences contained in these corn plants that are
useful for detecting these plants and progeny thereof. Detection
methods and kits of the subject invention can be directed to
identifying any one, two, or even all three of these events,
depending on the ultimate purpose of the test.
[0043] Definitions and examples are provided herein to help
describe the present invention and to guide those of ordinary skill
in the art to practice the invention. Unless otherwise noted, terms
are to be understood according to conventional usage by those of
ordinary skill in the relevant art. The nomenclature for DNA bases
as set forth at 37 CFR .sctn. 1.822 is used.
[0044] As used herein, the term "progeny" denotes the offspring of
any generation of a parent plat which comprises AAD-1 corn evend
DAS-40278-9.
[0045] A transgenic "event" is produced by transformation of plant
cells with heterologous DNA, i.e., a nucleic acid construct that
includes a transgene of interest, regeneration of a population of
plants resulting from the insertion of the transgene into the
genome of the plant, and selection of a particular plant
characterized by insertion into a particular genome location. The
term "event" refers to the original transformant and progeny of the
transformant that include the heterologous DNA. The term "event"
also refers to progeny produced by a sexual outcross between the
transformant and another variety that includes the
genomic/transgene DNA. Even after repeated back-crossing to a
recurrent parent, the inserted transgene DNA and flanking genomic
DNA (genomic/transgene DNA) from the transformed parent is present
in the progeny of the cross at the same chromosomal location. The
term "event" also refers to DNA from the original transformant and
progeny thereof comprising the inserted DNA and flanking genomic
sequence immediately adjacent to the inserted DNA that would be
expected to be transferred to a progeny that receives inserted DNA
including the transgene of interest as the result of a sexual cross
of one parental line that includes the inserted DNA (e.g., the
original transformant and progeny resulting from selfing) and a
parental line that does not contain the inserted DNA.
[0046] A "junction sequence" spans the point at which DNA inserted
into the genome is linked to DNA from the corn native genome
flanking the insertion point, the identification or detection of
one or the other junction sequences in a plant's genetic material
being sufficient to be diagnostic for the event. Included are the
DNA sequences that span the insertions in herein-described corn
events and similar lengths of flanking DNA. Specific examples of
such diagnostic sequences are provided herein; however, other
sequences that overlap the junctions of the insertions, or the
junctions of the insertions and the genomic sequence, are also
diagnostic and could be used according to the subject
invention.
[0047] The subject invention relates to the identification of such
flanking, junction, and insert sequences. Related PCR primers and
amplicons are included in the invention. According to the subject
invention, PCR analysis methods using amplicons that span across
inserted DNA and its borders can be used to detect or identify
commercialized transgenic corn varieties or lines derived from the
subject proprietary transgenic corn lines.
[0048] The entire sequences of each of these inserts, together with
portions of the respective flanking sequences, are provided herein
as SEQ ID NO:29. The coordinates of the insert and flanking
sequences for this event with respect to SEQ ID NO:29 (8557
basepairs total) are printed below. This is discussed in more
detail in Example 3.8, for example.
TABLE-US-00001 5' Flanking Insert 3' Flanking residue #s (SEQ: 29):
1-1873 1874-6689 6690-8557 length (bp): 1873 bp 4816 bp 1868 bp
[0049] This insertion event, and further components thereof, are
further illustrated in FIGS. 1 and 2. These sequences (particularly
the flanking sequences) are unique. Based on these insert and
border sequences, event-specific primers were generated. PCR
analysis demonstrated that these corn lines can be identified in
different corn genotypes by analysis of the PCR amplicons generated
with these event-specific primer sets. Thus, these and other
related procedures can be used to uniquely identify these corn
lines. The sequences identified herein are unique. For example,
BLAST searches against GENBANK databases did not reveal any
significant homology between the cloned border sequences and
sequences in the database.
[0050] Detection techniques of the subject invention are especially
useful in conjunction with plant breeding, to determine which
progeny plants comprise a given event, after a parent plant
comprising an event of interest is crossed with another plant line
in an effort to impart one or more additional traits of interest in
the progeny. These PCR analysis methods benefit corn breeding
programs as well as quality control, especially for commercialized
transgenic cornseeds. PCR detection kits for these transgenic corn
lines can also now be made and used. This can also benefit product
registration and product stewardship.
[0051] Furthermore, flanking corn/genomic sequences can be used to
specifically identify the genomic location of each insert. This
information can be used to make molecular marker systems specific
to each event. These can be used for accelerated breeding
strategies and to establish linkage data.
[0052] Still further, the flanking sequence information can be used
to study and characterize transgene integration processes, genomic
integration site characteristics, event sorting, stability of
transgenes and their flanking sequences, and gene expression
(especially related to gene silencing, transgene methylation
patterns, position effects, and potential expression-related
elements such as MARS [matrix attachment regions], and the
like).
[0053] In light of all the subject disclosure, it should be clear
that the subject invention includes seeds available under ATCC
Deposit No. PTA-10244. The subject invention also includes a
herbicide-resistant corn plant grown from a seed deposited with the
ATCC under accession number PTA-10244. The subject invention
further includes parts of said plant, such as leaves, tissue
samples, seeds produced by said plant, pollen, and the like.
[0054] Still further, the subject invention includes descendant
and/or progeny plants of plants grown from the deposited seed,
preferably a herbicide-resistant corn plant wherein said plant has
a genome comprising a detectable wild-type genomic DNA/insert DNA
junction sequence as described herein. As used herein, the term
"corn" means maize (Zea mays) and includes all varieties thereof
that can be bred with corn.
[0055] This invention further includes processes of making crosses
using a plant of the subject invention as at least one parent. For
example, the subject invention includes an F.sub.1 hybrid plant
having as one or both parents any of the plants exemplified herein.
Also within the subject invention is seed produced by such F.sub.1
hybrids of the subject invention. This invention includes a method
for producing an F.sub.1 hybrid seed by crossing an exemplified
plant with a different (e.g. in-bred parent) plant and harvesting
the resultant hybrid seed. The subject invention includes an
exemplified plant that is either a female parent or a male parent.
Characteristics of the resulting plants may be improved by careful
consideration of the parent plants.
[0056] A herbicide-tolerant corn plant can be bred by first
sexually crossing a first parental corn plant consisting of a corn
plant grown from seed of any one of the lines referred to herein,
and a second parental corn plant, thereby producing a plurality of
first progeny plants; and then selecting a first progeny plant that
is resistant to a herbicide (or that possesses at least one of the
events of the subject invention); and selfing the first progeny
plant, thereby producing a plurality of second progeny plants; and
then selecting from the second progeny plants a plant that is
resistant to a herbicide (or that possesses at least one of the
events of the subject invention). These steps can further include
the back-crossing of the first progeny plant or the second progeny
plant to the second parental corn plant or a third parental corn
plant. A corn crop comprising corn seeds of the subject invention,
or progeny thereof, can then be planted.
[0057] It is also to be understood that two different transgenic
plants can also be mated to produce offspring that contain two
independently segregating added, exogenous genes. Selfing of
appropriate progeny can produce plants that are homozygous for both
added, exogenous genes. Back-crossing to a parental plant and
out-crossing with a non-transgenic plant are also contemplated, as
is vegetative propagation. Other breeding methods commonly used for
different traits and crops are known in the art. Backcross breeding
has been used to transfer genes for a simply inherited, highly
heritable trait into a desirable homozygous cultivar or inbred
line, which is the recurrent parent. The source of the trait to be
transferred is called the donor parent. The resulting plant is
expected to have the attributes of the recurrent parent (e.g.,
cultivar) and the desirable trait transferred from the donor
parent. After the initial cross, individuals possessing the
phenotype of the donor parent are selected and repeatedly crossed
(backcrossed) to the recurrent parent. The resulting parent is
expected to have the attributes of the recurrent parent (e.g.,
cultivar) and the desirable trait transferred from the donor
parent.
[0058] The DNA molecules of the present invention can be used as
molecular markers in a marker assisted breeding (MAB) method. DNA
molecules of the present invention can be used in methods (such as,
AFLP markers, RFLP markers, RAPD markers, SNPs, and SSRs) that
identify genetically linked agronomically useful traits, as is
known in the art. The herbicide-resistance trait can be tracked in
the progeny of a cross with a corn plant of the subject invention
(or progeny thereof and any other corn cultivar or variety) using
the MAB methods. The DNA molecules are markers for this trait, and
MAB methods that are well known in the art can be used to track the
hebicide-resistance trait(s) in corn plants where at least one corn
line of the subject invention, or progeny thereof, was a parent or
ancestor. The methods of the present invention can be used to
identify any corn variety having the subject event.
[0059] Methods of the subject invention include a method of
producing a herbicide-tolerant corn plant wherein said method
comprises breeding with a plant of the subject invention. More
specifically, said methods can comprise crossing two plants of the
subject invention, or one plant of the subject invention and any
other plant. Preferred methods further comprise selecting progeny
of said cross by analyzing said progeny for an event detectable
according to the subject invention. For example, the subject
invention can be used to track the subject event through breeding
cycles with plants comprising other desirable traits, such as
agronomic traits such as those tested herein in various Examples.
Plants comprising the subject event and the desired trait can be
detected, identified, selected, and quickly used in further rounds
of breeding, for example. The subject event/trait can also be
combined through breeding, and tracked according to the subject
invention, with an insect resistant trait(s) and/or with further
herbicide tolerance traits. One preferred embodiment of the latter
is a plant comprising the subject event combined with a gene
encoding resistance to the herbicide dicamba.
[0060] Thus, the subject invention can be combined with, for
example, traits encoding glyphosate resistance (e.g., resistant
plant or bacterial EPSPS, GOX, GAT), glufosinate resistance (e.g.,
Pat, bar), acetolactate synthase (ALS)-inhibiting herbicide
resistance (e.g., imidazolinones [such as imazethapyr],
sulfonylureas, triazolopyrimidine sulfonanilide,
pyrmidinylthiobenzoates, and other chemistries [Csr1, SurA, et
al.]), bromoxynil resistance (e.g., Bxn), resistance to inhibitors
of HPPD (4-hydroxlphenyl-pyruvate-dioxygenase) enzyme, resistance
to inhibitors of phytoene desaturase (PDS), resistance to
photosystem II inhibiting herbicides (e.g., psbA), resistance to
photosystem I inhibiting herbicides, resistance to
protoporphyrinogen oxidase IX (PPO)-inhibiting herbicides (e.g.,
PPO-1), resistance to phenylurea herbicides (e.g., CYP76B1),
dicamba-degrading enzymes (see, e.g., US 20030135879), and others
could be stacked alone or in multiple combinations to provide the
ability to effectively control or prevent weed shifts and/or
resistance to any herbicide of the aforementioned classes.
[0061] Regarding additional herbicides, some additional preferred
ALS (also known as AHAS) inhibitors include the triazolopyrimidine
sulfonanilides (such as cloransulam-methyl, diclosulam, florasulam,
flumetsulam, metosulam, and penoxsulam), pyrimidinylthiobenzoates
(such as bispyribac and pyrithiobac), and flucarbazone. Some
preferred HPPD inhibitors include mesotrione, isoxaflutole, and
sulcotrione. Some preferred PPO inhibitors include flumiclorac,
flumioxazin, flufenpyr, pyraflufen, fluthiacet, butafenacil,
carfentrazone, sulfentrazone, and the diphenylethers (such as
acifluorfen, fomesafen, lactofen, and oxyfluorfen).
[0062] Additionally, AAD-1 alone or stacked with one or more
additional HTC traits can be stacked with one or more additional
input (e.g., insect resistance, fungal resistance, or stress
tolerance, et al.) or output (e.g., increased yield, improved oil
profile, improved fiber quality, et al.) traits. Thus, the subject
invention can be used to provide a complete agronomic package of
improved crop quality with the ability to flexibly and cost
effectively control any number of agronomic pests.
[0063] Methods to integrate a polynucleotide sequence within a
specific chromosomal site of a plant cell via homologous
recombination have been described within the art. For instance,
site specific integration as described in US Patent Application
Publication No. 2009/0111188 A1 describes the use of recombinases
or integrases to mediate the introduction of a donor polynucleotide
sequence into a chromosomal target. In addition, International
Patent Application No. WO 2008/021207 describes zinc finger
mediated-homologous recombination to integrate one or more donor
polynucleotide sequences within specific locations of the genome.
The use of recombinases such as FLP/FRT as described in U.S. Pat.
No. 6,720,475 or CRE/LOX as described in U.S. Pat. No. 5,658,772
can be utilized to integrate a polynucleotide sequence into a
specific chromosomal site. Finally the use of meganucleases for
targeting donor polynucleotides into a specific chromosomal
location was described in Puchta et al., PNAS USA 93 (1996) pp.
5055-5060.
[0064] Other various methods for site specific integration within
plant cells are generally known and applicable (Kumar et al.,
Trands in Plant Sci. 6 (4) (2001) pp. 155-159). Furthermore,
site-specific recombination systems which have been identified in
several prokaryotic and lower eukaryotic organisms may be applied
to use in plants. Examples of such systems include, but are not
limited too: the R/RS recombinase system from the pSR1 plasmid of
the yeast Zygosaccharomyces rouxii (Araki et al. (1985) J. Mol.
Biol. 182: 191-203), and the Gin/gix system of phage Mu (Maeser and
Kahlmann (1991) Mol. Gen. Genet. 230: 170-176).
[0065] In some embodiments of the present invention, it can be
desirable to integrate or stack a new transgene(s) in proximity to
an existing transgenic event. The transgenic event can be
considered a preferred genomic locus which was selected based on
unique characteristics such as single insertion site, normal
Mendelian segregation and stable expression, and a superior
combination of efficacy, including herbicide tolerance and
agronomic performance in and across multiple environmental
locations. The newly integrated transgenes should maintain the
transgene expression characteristics of the existing transformants.
Moreover, the development of assays for the detection and
confirmation of the newly integrated event would be overcome as the
genomic flanking sequences and chromosomal location of the newly
integrated event are already identified. Finally, the integration
of a new transgene into a specific chromosomal location which is
linked to an existing transgene would expedite the introgression of
the transgenes into other genetic backgrounds by sexual
out-crossing using conventional breeding methods.
[0066] In some embodiments of the present invention, it can be
desirable to excise polynucleotide sequences from a transgenic
event. For instance transgene excision as described in Provisional
U.S. Patent Application No. 61/297,628 describes the use of zinc
finger nucleases to remove a polynucleotide sequence, consisting of
a gene expression cassette, from a chromosomally integrated
transgenic event. The polynucleotide sequence which is removed can
be a selectable marker. Upon excision and removal of a
polynucleotide sequence the modified transgenic event can be
retargeted by the insertion of a polynucleotide sequence. The
excision of a polynucleotide sequence and subsequent retargeting of
the modified transgenic event provides advantages such as re-use of
a selectable marker or the ability to overcome unintended changes
to the plant transcriptome which results from the expression of
specific genes.
[0067] The subject invention discloses herein a specific site on
chromosome 2 in the corn genome that is excellent for insertion of
heterologous nucleic acids. Also disclosed is a 5' molecular
marker, a 3' molecular marker, a 5' flanking sequence, and a 3'
flanking sequence useful in identifying the location of a targeting
site on chromosome 2. Thus, the subject invention provides methods
to introduce heterologous nucleic acids of interest into this
pre-established target site or in the vicinity of this target site.
The subject invention also encompasses a corn seed and/or a corn
plant comprising any heterologous nucleotide sequence inserted at
the disclosed target site or in the general vicinity of such site.
One option to accomplish such targeted integration is to excise
and/or substitute a different insert in place of the pat expression
cassette exemplified herein. In this general regard, targeted
homologous recombination, for example and without limitation, can
be used according to the subject invention.
[0068] As used herein gene, event or trait "stacking" is combining
desired traits into one transgenic line. Plant breeders stack
transgenic traits by making crosses between parents that each have
a desired trait and then identifying offspring that have both of
these desired traits. Another way to stack genes is by transferring
two or more genes into the cell nucleus of a plant at the same time
during transformation. Another way to stack genes is by
re-transforming a transgenic plant with another gene of interest.
For example, gene stacking can be used to combine two or more
different traits, including for example, two or more different
insect traits, insect resistance trait(s) and disease resistance
trait(s), two or more herbicide resistance traits, and/or insect
resistance trait(s) and herbicide resistant trait(s). The use of a
selectable marker in addition to a gene of interest can also be
considered gene stacking.
[0069] "Homologous recombination" refers to a reaction between any
pair of nucleotide sequences having corresponding sites containing
a similar nucleotide sequence through which the two nucleotide
sequences can interact (recombine) to form a new, recombinant DNA
sequence. The sites of similar nucleotide sequence are each
referred to herein as a "homology sequence." Generally, the
frequency of homologous recombination increases as the length of
the homology sequence increases. Thus, while homologous
recombination can occur between two nucleotide sequences that are
less than identical, the recombination frequency (or efficiency)
declines as the divergence between the two sequences increases.
Recombination may be accomplished using one homology sequence on
each of the donor and target molecules, thereby generating a
"single-crossover" recombination product. Alternatively, two
homology sequences may be placed on each of the target and donor
nucleotide sequences. Recombination between two homology sequences
on the donor with two homology sequences on the target generates a
"double-crossover" recombination product. If the homology sequences
on the donor molecule flank a sequence that is to be manipulated
(e.g., a sequence of interest), the double-crossover recombination
with the target molecule will result in a recombination product
wherein the sequence of interest replaces a DNA sequence that was
originally between the homology sequences on the target molecule.
The exchange of DNA sequence between the target and donor through a
double-crossover recombination event is termed "sequence
replacement."
[0070] The subject AAD-1 enzyme enables transgenic expression
resulting in tolerance to combinations of herbicides that would
control nearly all broadleaf and grass weeds. AAD-1 can serve as an
excellent herbicide tolerant crop (HTC) trait to stack with other
HTC traits (e.g., glyphosate resistance, glufosinate resistance,
imidazolinone resistance, bromoxynil resistance, et al.), and
insect resistance traits (Cry1F, Cry1Ab, Cry 34/45, et al.) for
example. Additionally, AAD-1 can serve as a selectable marker to
aid in selection of primary transformants of plants genetically
engineered with a second gene or group of genes.
[0071] HTC traits of the subject invention can be used in novel
combinations with other HTC traits (including but not limited to
glyphosate tolerance). These combinations of traits give rise to
novel methods of controlling weed (and like) species, due to the
newly acquired resistance or inherent tolerance to herbicides
(e.g., glyphosate). Thus, in addition to the HTC traits, novel
methods for controlling weeds using herbicides, for which herbicide
tolerance was created by said enzyme in transgenic crops, are
within the scope of the invention.
[0072] Additionally, glyphosate tolerant crops grown worldwide are
prevalent. Many times in rotation with other glyphosate tolerant
crops, control of glyphosate-resistant volunteers may be difficult
in rotational crops. Thus, the use of the subject transgenic
traits, stacked or transformed individually into crops, provides a
tool for controlling other HTC volunteer crops.
[0073] A preferred plant, or a seed, of the subject invention
comprises in its genome the insert sequences, as identified herein,
together with at least 20-500 or more contiguous flanking
nucleotides on both sides of the insert, as identified herein.
Unless indicated otherwise, reference to flanking sequences refers
to those identified with respect to SEQ ID NO:29 (see the Table
above). Again, SEQ ID NO:29 includes the heterologous DNA inserted
in the original transformant and illustrative flanking genomic
sequences immediately adjacent to the inserted DNA. All or part of
these flanking sequences could be expected to be transferred to
progeny that receives the inserted DNA as a result of a sexual
cross of a parental line that includes the event.
[0074] The subject invention includes tissue cultures of
regenerable cells of a plant of the subject invention. Also
included is a plant regenerated from such tissue culture,
particularly where said plant is capable of expressing all the
morphological and physiological properties of an exemplified
variety. Preferred plants of the subject invention have all the
physiological and morphological characteristics of a plant grown
from the deposited seed. This invention further comprises progeny
of such seed and seed possessing the quality traits of
interest.
[0075] Manipulations (such as mutation, further transfection, and
further breeding) of plants or seeds, or parts thereof, may lead to
the creation of what may be termed "essentially derived" varieties.
The International Union for the Protection of New Varieties of
Plants (UPOV) has provided the following guideline for determining
if a variety has been essentially derived from a protected
variety:
[0076] [A] variety shall be deemed to be essentially derived from
another variety ("the initial variety") when
[0077] (i) it is predominantly derived from the initial variety, or
from a variety that is itself predominantly derived from the
initial variety, while retaining the expression of the essential
characteristics that result from the genotype or combination of
genotypes of the initial variety;
[0078] (ii) it is clearly distinguishable from the initial variety;
and
[0079] (iii) except for the differences which result from the act
of derivation, it conforms to the initial variety in the expression
of the essential characteristics that result from the genotype or
combination of genotypes of the initial variety.
[0080] UPOV, Sixth Meeting with International Organizations,
Geneva, Oct. 30, 1992; document prepared by the Office of the
Union.
[0081] As used herein, a "line" is a group of plants that display
little or no genetic variation between individuals for at least one
trait. Such lines may be created by several generations of
self-pollination and selection, or vegetative propagation from a
single parent using tissue or cell culture techniques.
[0082] As used herein, the terms "cultivar" and "variety" are
synonymous and refer to a line which is used for commercial
production.
[0083] "Stability" or "stable" means that with respect to the given
component, the component is maintained from generation to
generation and, preferably, at least three generations at
substantially the same level, e.g., preferably .+-.15%, more
preferably .+-.10%, most preferably .+-.5%. The stability may be
affected by temperature, location, stress and the time of planting.
Comparison of subsequent generations under field conditions should
produce the component in a similar manner.
[0084] "Commercial Utility" is defined as having good plant vigor
and high fertility, such that the crop can be produced by farmers
using conventional farming equipment, and the oil with the
described components can be extracted from the seed using
conventional crushing and extraction equipment. To be commercially
useful, the yield, as measured by seed weight, oil content, and
total oil produced per acre, is within 15% of the average yield of
an otherwise comparable commercial canola variety without the
premium value traits grown in the same region.
[0085] "Agronomically elite" means that a line has desirable
agronomic characteristics such as yield, maturity, disease
resistance, and the like, in addition to the insect resistance due
to the subject event(s). Agronomic traits, taken individually or in
any combination, as set forth in Examples, below, in a plant
comprising an event of the subject invention, are within the scope
of the subject invention. Any and all of these agronomic
characteristics and data points can be used to identify such
plants, either as a point or at either end or both ends of a range
of characteristics used to define such plants.
[0086] As one skilled in the art will recognize in light of this
disclosure, preferred embodiments of detection kits, for example,
can include probes and/or primers directed to and/or comprising
"junction sequences" or "transition sequences" (where the corn
genomic flanking sequence meets the insert sequence). For example,
this includes a polynucleotide probes, primers, and/or amplicons
designed to identify one or both junction sequences (where the
insert meets the flanking sequence), as indicated in Table 1. One
common design is to have one primer that hybridizes in the flanking
region, and one primer that hybridizes in the insert. Such primers
are often each about at least .about.15 residues in length. With
this arrangement, the primers can be used to generate/amplify a
detectable amplicon that indicates the presence of an event of the
subject invention. These primers can be used to generate an
amplicon that spans (and includes) a junction sequence as indicated
above.
[0087] The primer(s) "touching down" in the flanking sequence is
typically not designed to hybridize beyond about 200 bases or
beyond the junction. Thus, typical flanking primers would be
designed to comprise at least 15 residues of either strand within
200 bases into the flanking sequences from the beginning of the
insert. That is, primers comprising sequence of an appropriate size
in residues .about.1674-1873 and/or .about.6690-6890 of SEQ ID
NO:29 are within the scope of the subject invention. Insert primers
can likewise be designed anywhere on the insert, but residues
.about.1874-2074 and .about.6489-6689, can be used, for example,
non-exclusively for such primer design.
[0088] One skilled in the art will also recognize that primers and
probes can be designed to hybridize, under a range of standard
hybridization and/or PCR conditions, to a segment of SEQ ID NO:29
(or the complement), and complements thereof, wherein the primer or
probe is not perfectly complementary to the exemplified sequence.
That is, some degree of mismatch can be tolerated. For an
approximately 20 nucleotide primer, for example, typically one or
two or so nucleotides do not need to bind with the opposite strand
if the mismatched base is internal or on the end of the primer that
is opposite the amplicon. Various appropriate hybridization
conditions are provided below. Synthetic nucleotide analogs, such
as inosine, can also be used in probes. Peptide nucleic acid (PNA)
probes, as well as DNA and RNA probes, can also be used. What is
important is that such probes and primers are diagnostic for (able
to uniquely identify and distinguish) the presence of an event of
the subject invention.
[0089] It should be noted that errors in PCR amplification can
occur which might result in minor sequencing errors, for example.
That is, unless otherwise indicated, the sequences listed herein
were determined by generating long amplicons from corn genomic
DNAs, and then cloning and sequencing the amplicons. It is not
unusual to find slight differences and minor discrepancies in
sequences generated and determined in this manner, given the many
rounds of amplification that are necessary to generate enough
amplicon for sequencing from genomic DNAs. One skilled in the art
should recognize and be put on notice than any adjustments needed
due to these types of common sequencing errors or discrepancies are
within the scope of the subject invention.
[0090] It should also be noted that it is not uncommon for some
genomic sequence to be deleted, for example, when a sequence is
inserted during the creation of an event. Thus, some differences
can also appear between the subject flanking sequences and genomic
sequences listed in GENBANK, for example.
[0091] Some of these difference(s) are discussed below in the
Examples section. Adjustments to probes and primers can be made
accordingly.
[0092] The components of each of the "inserts" are illustrated in
FIGS. 1 and 2 and are discussed in more detail below in the
Examples. The DNA polynucleotide sequences of these components, or
fragments thereof, can be used as DNA primers or probes in the
methods of the present invention.
[0093] In some embodiments of the invention, compositions and
methods are provided for detecting the presence of the
transgene/genomic insertion region, in plants and seeds and the
like, from a corn plant. DNA sequences are provided that comprise
the subject transgene/genomic insertion region junction sequence
provided herein (between residues 1873-1874 and 6689-6690 of SEQ ID
NO:29), segments thereof, and complements of the exemplified
sequences and any segments thereof. The insertion region junction
sequence spans the junction between heterologous DNA inserted into
the genome and the DNA from the corn cell flanking the insertion
site. Such sequences can be diagnostic for the given event.
[0094] Based on these insert and border sequences, event-specific
primers can be generated. PCR analysis demonstrated that corn lines
of the subject invention can be identified in different corn
genotypes by analysis of the PCR amplicons generated with these
event-specific primer sets. These and other related procedures can
be used to uniquely identify these corn lines. Thus, PCR amplicons
derived from such primer pairs are unique and can be used to
identify these corn lines.
[0095] In some embodiments, DNA sequences that comprise a
contiguous fragment of the novel transgene/genomic insertion region
are an aspect of this invention. Included are DNA sequences that
comprise a sufficient length of polynucleotides of transgene insert
sequence and a sufficient length of polynucleotides of corn genomic
sequence from one or more of the three aforementioned corn plants
and/or sequences that are useful as primer sequences for the
production of an amplicon product diagnostic for one or more of
these corn plants.
[0096] Related embodiments pertain to DNA sequences that comprise
at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18, 19, 20, 21, 22, 23, 24, 25, or more contiguous nucleotides of a
transgene portion of a DNA sequence identified herein (such as SEQ
ID NO:29 and segments thereof), or complements thereof, and a
similar length of flanking corn DNA sequence from these sequences,
or complements thereof. Such sequences are useful as DNA primers in
DNA amplification methods. The amplicons produced using these
primers are diagnostic for any of the corn events referred to
herein. Therefore, the invention also includes the amplicons
produced by such DNA primers and homologous primers.
[0097] This invention also includes methods of detecting the
presence of DNA, in a sample, that corresponds to the corn event
referred to herein. Such methods can comprise: (a) contacting the
sample comprising DNA with a primer set that, when used in a
nucleic acid amplification reaction with DNA from at least one of
these corn events, produces an amplicon that is diagnostic for said
event(s); (b) performing a nucleic acid amplification reaction,
thereby producing the amplicon; and (c) detecting the amplicon.
[0098] Further detection methods of the subject invention include a
method of detecting the presence of a DNA, in a sample,
corresponding to at least one of said events, wherein said method
comprises: (a) contacting the sample comprising DNA with a probe
that hybridizes under stringent hybridization conditions with DNA
from at least one of said corn events and which does not hybridize
under the stringent hybridization conditions with a control corn
plant (non-event-of-interest DNA); (b) subjecting the sample and
probe to stringent hybridization conditions; and (c) detecting
hybridization of the probe to the DNA.
[0099] In still further embodiments, the subject invention includes
methods of producing a corn plant comprising the aad-1 event of the
subject invention, wherein said method comprises the steps of: (a)
sexually crossing a first parental corn line (comprising an
expression cassettes of the present invention, which confers said
herbicide resistance trait to plants of said line) and a second
parental corn line (that lacks this herbicide tolerance trait)
thereby producing a plurality of progeny plants; and (b) selecting
a progeny plant by the use of molecular markers. Such methods may
optionally comprise the further step of back-crossing the progeny
plant to the second parental corn line to producing a true-breeding
corn plant that comprises said insect tolerance trait.
[0100] According to another aspect of the invention, methods of
determining the zygosity of progeny of a cross with any one (or
more) of said three events are provided. Said methods can comprise
contacting a sample, comprising corn DNA, with a primer set of the
subject invention. Said primers, when used in a nucleic-acid
amplification reaction with genomic DNA from at least one of said
corn events, produces a first amplicon that is diagnostic for at
least one of said corn events. Such methods further comprise
performing a nucleic acid amplification reaction, thereby producing
the first amplicon; detecting the first amplicon; and contacting
the sample comprising corn DNA with said primer set (said primer
set, when used in a nucleic-acid amplification reaction with
genomic DNA from corn plants, produces a second amplicon comprising
the native corn genomic DNA homologous to the corn genomic region;
and performing a nucleic acid amplification reaction, thereby
producing the second amplicon. The methods further comprise
detecting the second amplicon, and comparing the first and second
amplicons in a sample, wherein the presence of both amplicons
indicates that the sample is heterozygous for the transgene
insertion.
[0101] DNA detection kits can be developed using the compositions
disclosed herein and methods well known in the art of DNA
detection. The kits are useful for identification of the subject
corn event DNA in a sample and can be applied to methods for
breeding corn plants containing this DNA. The kits contain DNA
sequences homologous or complementary to the amplicons, for
example, disclosed herein, or to DNA sequences homologous or
complementary to DNA contained in the transgene genetic elements of
the subject events. These DNA sequences can be used in DNA
amplification reactions or as probes in a DNA hybridization method.
The kits may also contain the reagents and materials necessary for
the performance of the detection method.
[0102] A "probe" is an isolated nucleic acid molecule to which is
attached a conventional detectable label or reporter molecule (such
as a radioactive isotope, ligand, chemiluminescent agent, or
enzyme). Such a probe is complementary to a strand of a target
nucleic acid, in the case of the present invention, to a strand of
genomic DNA from one of said corn events, whether from a corn plant
or from a sample that includes DNA from the event. Probes according
to the present invention include not only deoxyribonucleic or
ribonucleic acids but also polyamides and other probe materials
that bind specifically to a target DNA sequence and can be used to
detect the presence of that target DNA sequence.
[0103] "Primers" are isolated/synthesized nucleic acids that are
annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target
DNA strand, then extended along the target DNA strand by a
polymerase, e.g., a DNA polymerase. Primer pairs of the present
invention refer to their use for amplification of a target nucleic
acid sequence, e.g., by the polymerase chain reaction (PCR) or
other conventional nucleic-acid amplification methods.
[0104] Probes and primers are generally 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,
81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97,
98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111,
112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124,
125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137,
138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150,
151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163,
164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176,
177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189,
190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202,
203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215,
216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228,
229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241,
242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254,
255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267,
268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280,
281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293,
294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306,
307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319,
320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332,
333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345,
346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358,
359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371,
372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384,
385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397,
398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410,
411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423,
424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436,
437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449,
450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462,
463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475,
476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488,
489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, or 500
polynucleotides or more in length. Such probes and primers
hybridize specifically to a target sequence under high stringency
hybridization conditions. Preferably, probes and primers according
to the present invention have complete sequence similarity with the
target sequence, although probes differing from the target sequence
and that retain the ability to hybridize to target sequences may be
designed by conventional methods.
[0105] Methods for preparing and using probes and primers are
described, for example, in Molecular Cloning: A Laboratory Manual,
2nd ed., vol. 1-3, ed. Sambrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989. PCR-primer pairs
can be derived from a known sequence, for example, by using
computer programs intended for that purpose.
[0106] Primers and probes based on the flanking DNA and insert
sequences disclosed herein can be used to confirm (and, if
necessary, to correct) the disclosed sequences by conventional
methods, e.g., by re-cloning and sequencing such sequences.
[0107] The nucleic acid probes and primers of the present invention
hybridize under stringent conditions to a target DNA sequence. Any
conventional nucleic acid hybridization or amplification method can
be used to identify the presence of DNA from a transgenic event in
a sample. Nucleic acid molecules or fragments thereof are capable
of specifically hybridizing to other nucleic acid molecules under
certain circumstances. As used herein, two nucleic acid molecules
are said to be capable of specifically hybridizing to one another
if the two molecules are capable of forming an anti-parallel,
double-stranded nucleic acid structure. A nucleic acid molecule is
said to be the "complement" of another nucleic acid molecule if
they exhibit complete complementarity. As used herein, molecules
are said to exhibit "complete complementarity" when every
nucleotide of one of the molecules is complementary to a nucleotide
of the other. Two molecules are said to be "minimally
complementary" if they can hybridize to one another with sufficient
stability to permit them to remain annealed to one another under at
least conventional "low-stringency" conditions. Similarly, the
molecules are said to be "complementary" if they can hybridize to
one another with sufficient stability to permit them to remain
annealed to one another under conventional "high-stringency"
conditions. Conventional stringency conditions are described by
Sambrook et al., 1989. Departures from complete complementarity are
therefore permissible, as long as such departures do not completely
preclude the capacity of the molecules to form a double-stranded
structure. In order for a nucleic acid molecule to serve as a
primer or probe it need only be sufficiently complementary in
sequence to be able to form a stable double-stranded structure
under the particular solvent and salt concentrations employed.
[0108] As used herein, a substantially homologous sequence is a
nucleic acid sequence that will specifically hybridize to the
complement of the nucleic acid sequence to which it is being
compared under high stringency conditions. The term "stringent
conditions" is functionally defined with regard to the
hybridization of a nucleic-acid probe to a target nucleic acid
(i.e., to a particular nucleic-acid sequence of interest) by the
specific hybridization procedure discussed in Sambrook et al.,
1989, at 9.52-9.55. See also, Sambrook et al., 1989 at 9.47-9.52
and 9.56-9.58. Accordingly, the nucleotide sequences of the
invention may be used for their ability to selectively form duplex
molecules with complementary stretches of DNA fragments.
[0109] Depending on the application envisioned, one can use varying
conditions of hybridization to achieve varying degrees of
selectivity of probe towards target sequence. For applications
requiring high selectivity, one will typically employ relatively
stringent conditions to form the hybrids, e.g., one will select
relatively low salt and/or high temperature conditions, such as
provided by about 0.02 M to about 0.15 M NaCl at temperatures of
about 50.degree. C. to about 70.degree. C. Stringent conditions,
for example, could involve washing the hybridization filter at
least twice with high-stringency wash buffer (0.2.times.SSC, 0.1%
SDS, 65.degree. C.). Appropriate stringency conditions which
promote DNA hybridization, for example, 6.0.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C., followed by a
wash of 2.0.times.SSC at 50.degree. C. are known to those skilled
in the art, 6.3.1-6.3.6. For example, the salt concentration in the
wash step can be selected from a low stringency of about
2.0.times.SSC at 50.degree. C. to a high stringency of about
0.2.times.SSC at 50.degree. C. In addition, the temperature in the
wash step can be increased from low stringency conditions at room
temperature, about 22.degree. C., to high stringency conditions at
about 65.degree. C. Both temperature and salt may be varied, or
either the temperature or the salt concentration may be held
constant while the other variable is changed. Such selective
conditions tolerate little, if any, mismatch between the probe and
the template or target strand. Detection of DNA sequences via
hybridization is well-known to those of skill in the art, and the
teachings of U.S. Pat. Nos. 4,965,188 and 5,176,995 are exemplary
of the methods of hybridization analyses.
[0110] In a particularly preferred embodiment, a nucleic acid of
the present invention will specifically hybridize to one or more of
the primers (or amplicons or other sequences) exemplified or
suggested herein, including complements and fragments thereof,
under high stringency conditions. In one aspect of the present
invention, a marker nucleic acid molecule of the present invention
has the nucleic acid sequence set forth in SEQ ID NOS:3-14, or
complements and/or fragments thereof.
[0111] In another aspect of the present invention, a marker nucleic
acid molecule of the present invention shares between 80% and 100%
or 90% and 100% sequence identity with such nucleic acid sequences.
In a further aspect of the present invention, a marker nucleic acid
molecule of the present invention shares between 95% and 100%
sequence identity with such sequence. Such sequences may be used as
markers in plant breeding methods to identify the progeny of
genetic crosses. The hybridization of the probe to the target DNA
molecule can be detected by any number of methods known to those
skilled in the art, these can include, but are not limited to,
fluorescent tags, radioactive tags, antibody based tags, and
chemiluminescent tags.
[0112] Regarding the amplification of a target nucleic acid
sequence (e.g., by PCR) using a particular amplification primer
pair, "stringent conditions" are conditions that permit the primer
pair to hybridize only to the target nucleic-acid sequence to which
a primer having the corresponding wild-type sequence (or its
complement) would bind and preferably to produce a unique
amplification product, the amplicon.
[0113] The term "specific for (a target sequence)" indicates that a
probe or primer hybridizes under stringent hybridization conditions
only to the target sequence in a sample comprising the target
sequence.
[0114] As used herein, "amplified DNA" or "amplicon" refers to the
product of nucleic-acid amplification of a target nucleic acid
sequence that is part of a nucleic acid template. For example, to
determine whether the corn plant resulting from a sexual cross
contains transgenic event genomic DNA from the corn plant of the
present invention, DNA extracted from a corn plant tissue sample
may be subjected to nucleic acid amplification method using a
primer pair that includes a primer derived from flanking sequence
in the genome of the plant adjacent to the insertion site of
inserted heterologous DNA, and a second primer derived from the
inserted heterologous DNA to produce an amplicon that is diagnostic
for the presence of the event DNA. The amplicon is of a length and
has a sequence that is also diagnostic for the event. The amplicon
may range in length from the combined length of the primer pairs
plus one nucleotide base pair, and/or the combined length of the
primer pairs plus about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,
66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82,
83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,
113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125,
126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138,
139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151,
152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,
165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177,
178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190,
191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203,
204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216,
217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229,
230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242,
243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255,
256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268,
269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281,
282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294,
295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307,
308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320,
321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333,
334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346,
347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359,
360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372,
373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385,
386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398,
399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411,
412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424,
425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437,
438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450,
451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463,
464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476,
477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489,
490, 491, 492, 493, 494, 495, 496, 497, 498, 499, or 500, 750,
1000, 1250, 1500, 1750, 2000, or more nucleotide base pairs (plus
or minus any of the increments listed above). Alternatively, a
primer pair can be derived from flanking sequence on both sides of
the inserted DNA so as to produce an amplicon that includes the
entire insert nucleotide sequence. A member of a primer pair
derived from the plant genomic sequence may be located a distance
from the inserted DNA sequence. This distance can range from one
nucleotide base pair up to about twenty thousand nucleotide base
pairs. The use of the term "amplicon" specifically excludes primer
dimers that may be formed in the DNA thermal amplification
reaction.
[0115] Nucleic-acid amplification can be accomplished by any of the
various nucleic-acid amplification methods known in the art,
including the polymerase chain reaction (PCR). A variety of
amplification methods are known in the art and are described, inter
alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202. PCR amplification
methods have been developed to amplify up to 22 kb of genomic DNA.
These methods as well as other methods known in the art of DNA
amplification may be used in the practice of the present invention.
The sequence of the heterologous transgene DNA insert or flanking
genomic sequence from a subject corn event can be verified (and
corrected if necessary) by amplifying such sequences from the event
using primers derived from the sequences provided herein followed
by standard DNA sequencing of the PCR amplicon or of the cloned
DNA.
[0116] The amplicon produced by these methods may be detected by a
plurality of techniques. Agarose gel electrophoresis and staining
with ethidium bromide is a common well known method of detecting
DNA amplicons. Another such method is Genetic Bit Analysis where an
DNA oligonucleotide is designed which overlaps both the adjacent
flanking genomic DNA sequence and the inserted DNA sequence. The
oligonucleotide is immobilized in wells of a microwell plate.
Following PCR of the region of interest (using one primer in the
inserted sequence and one in the adjacent flanking genomic
sequence), a single-stranded PCR product can be hybridized to the
immobilized oligonucleotide and serve as a template for a single
base extension reaction using a DNA polymerase and labelled ddNTPs
specific for the expected next base. Readout may be fluorescent or
ELISA-based. A signal indicates presence of the insert/flanking
sequence due to successful amplification, hybridization, and single
base extension.
[0117] Another method is the Pyrosequencing technique as described
by Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method an
oligonucleotide is designed that overlaps the adjacent genomic DNA
and insert DNA junction. The oligonucleotide is hybridized to
single-stranded PCR product from the region of interest (one primer
in the inserted sequence and one in the flanking genomic sequence)
and incubated in the presence of a DNA polymerase, ATP,
sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate and
luciferin. DNTPs are added individually and the incorporation
results in a light signal that is measured. A light signal
indicates the presence of the transgene insert/flanking sequence
due to successful amplification, hybridization, and single or
multi-base extension.
[0118] Fluorescence Polarization is another method that can be used
to detect an amplicon of the present invention. Following this
method, an oligonucleotide is designed which overlaps the genomic
flanking and inserted DNA junction. The oligonucleotide is
hybridized to single-stranded PCR product from the region of
interest (one primer in the inserted DNA and one in the flanking
genomic DNA sequence) and incubated in the presence of a DNA
polymerase and a fluorescent-labeled ddNTP. Single base extension
results in incorporation of the ddNTP. Incorporation can be
measured as a change in polarization using a fluorometer. A change
in polarization indicates the presence of the transgene
insert/flanking sequence due to successful amplification,
hybridization, and single base extension.
[0119] TAQMAN (PE Applied Biosystems, Foster City, Calif.) is a
method of detecting and quantifying the presence of a DNA sequence.
Briefly, a FRET oligonucleotide probe is designed that overlaps the
genomic flanking and insert DNA junction. The FRET probe and PCR
primers (one primer in the insert DNA sequence and one in the
flanking genomic sequence) are cycled in the presence of a
thermostable polymerase and dNTPs. During specific amplification,
Taq DNA polymerase cleans and releases the fluorescent moiety away
from the quenching moiety on the FRET probe. A fluorescent signal
indicates the presence of the flanking/transgene insert sequence
due to successful amplification and hybridization.
[0120] Molecular Beacons have been described for use in sequence
detection. Briefly, a FRET oligonucleotide probe is designed that
overlaps the flanking genomic and insert DNA junction. The unique
structure of the FRET probe results in it containing secondary
structure that keeps the fluorescent and quenching moieties in
close proximity. The FRET probe and PCR primers (one primer in the
insert DNA sequence and one in the flanking genomic sequence) are
cycled in the presence of a thermostable polymerase and dNTPs.
Following successful PCR amplification, hybridization of the FRET
probe to the target sequence results in the removal of the probe
secondary structure and spatial separation of the fluorescent and
quenching moieties. A fluorescent signal results. A fluorescent
signal indicates the presence of the flanking genomic/transgene
insert sequence due to successful amplification and
hybridization.
[0121] Having disclosed a location in the corn genome that is
excellent for an insertion, the subject invention also comprises a
corn seed and/or a corn plant comprising at least one non-aad 1
insert in the general vicinity of this genomic location. One option
is to substitute a different insert in place of the aad-1 insert
exemplified herein. In these generally regards, targeted homologous
recombination, for example, can be used according to the subject
invention. This type of technology is the subject of for example,
WO 03/080809 A2 and the corresponding published U.S. application
(US 20030232410). Thus, the subject invention includes plants and
plant cells comprising a heterologous insert (in place of or with
multi-copies of aad-1), flanked by all or a recognizable part of
the flanking sequences identified herein (e.g. residues 1-1873 and
6690-8557 of SEQ ID NO:29).
[0122] All patents, patent applications, provisional applications,
and publications referred to or cited herein are incorporated by
reference in their entirety to the extent they are not inconsistent
with the explicit teachings of this specification.
[0123] The following examples are included to illustrate procedures
for practicing the invention and to demonstrate certain preferred
embodiments of the invention. These examples should not be
construed as limiting. It should be appreciated by those of skill
in the art that the techniques disclosed in the following examples
represent specific approaches used to illustrate preferred modes
for its practice. However, those of skill in the art should, in
light of the present disclosure, appreciate that many changes can
be made in these specific embodiments while still obtaining like or
similar results without departing from the spirit and scope of the
invention. Unless otherwise indicated, all percentages are by
weight and all solvent mixture proportions are by volume unless
otherwise noted.
[0124] The following abbreviations are used unless otherwise
indicated.
TABLE-US-00002 AAD-1 aryloxyalkanoate dioxygenase-1 bp base pair
.degree. C. degrees Celcius DNA deoxyribonucleic acid DIG
digoxigenin EDTA ethylenediaminetetraacetic acid kb kilobase .mu.g
microgram .mu.L microliter mL milliliter M molar mass OLP
overlapping probe PCR polymerase chain reaction PTU plant
transcription unit SDS sodium dodecyl sulfate SOP standard
operating procedure SSC a buffer solution containing a mixture of
sodium chloride and sodium citrate, pH 7.0 TBE a buffer solution
containing a mixture of Tris base, boric acid and EDTA, pH 8.3 V
volts
EXAMPLES
Example 1. Transformation and Selection of the AAD1 Event
pDAS1740-278
[0125] The AAD1 event, pDAS1740-278, was produced by
WHISKER-mediated transformation of maize line Hi-11. The
transformation method used is described in US Patent Application
#20090093366. An FspI fragment of plasmid pDAS1740, also referred
to as pDAB3812, (FIG. 1) was transformed into the maize line. This
plasmid construct contains the plant expression cassette containing
the RB7 MARv3:: Zea mays Ubiquitin 1 promoter v2//AAD1 v3//Zea mays
PER5 3'UTR::RB 7 MARv4 plant transcription unit (PTU).
[0126] Numerous events were produced. Those events that survived
and produced healthy, haloxyfop-resistant callus tissue were
assigned unique identification codes representing putative
transformation events, and continually transferred to fresh
selection medium. Plants were regenerated from tissue derived from
each unique event and transferred to the greenhouse.
[0127] Leaf samples were taken for molecular analysis to verify the
presence of the AAD-1 transgene by Southern Blot, DNA border
confirmation, and genomic marker assisted confirmation. Positive T0
plants were pollinated with inbred lines to obtain T1 seed. T1
plants of Event pDAS1470-278-9 (DAS-40278-9) was selected,
self-pollinated and characterized for five generations. Meanwhile,
the T1 plants were backcrossed and introgressed into elite
germplasm (XHH13) through marker-assisted selection for several
generations. This event was generated from an independent
transformed isolate. The event was selected based on its unique
characteristics such as single insertion site, normal Mendelian
segregation and stable expression, and a superior combination of
efficacy, including herbicide tolerance and agronomic performance
in broad genotype backgrounds and across multiple environmental
locations. The following examples contain the data which were used
to characterize event pDAS-1740-278-9.
Example 2. pDAS1740-278-9 Event Characterization Via Southern
Blot
[0128] Southern blot analysis was used to establish the integration
pattern of the inserted DNA fragment and determine insert/copy
number of the aad-1 gene in event pDAS-1740-278-9 (DAS-40278-9).
Data were generated to demonstrate the integration and integrity of
the aad-1 transgene inserted into the corn genome.
[0129] Southern blot data suggested that the pDAS1740/Fsp I
fragment insert in corn event DAS-40278-9 occurred as a simple
integration of a single, intact copy of the aad-1 PTU from plasmid
pDAS 1740. Detailed Southern blot analysis was conducted using
probes specific to gene, promoter, terminator, and other regulation
elements contained in the plasmid region and descriptive
restriction enzymes that have cleavage sites located within the
plasmid and produce hybridizing fragments internal to the plasmid
or fragments that span the junction of the plasmid with corn
genomic DNA (border fragments). The molecular weights indicated
from the Southern hybridization for the combination of the
restriction enzyme and the probe were unique for the event, and
established its identification patterns. These analyses also showed
that the plasmid fragment had been inserted into corn genomic DNA
without rearrangements of the aad-1 PTU. Identical hybridization
fragments were observed in five distinct generations of transgenic
corn event DAS-40278-9 indicating stability of inheritance of the
aad-1 PTU insertion across generations. Hybridization with a
mixture of three backbone probes located outside of the restriction
site of Fsp I on plasmid pDAS 1740 did not detect any specific
DNA/gene fragments, indicating the absence of the Ampicillin
resistance gene and the absence of the other vector backbone
regions immediately adjacent to the Fsp I restriction sites of the
plasmid pDAS 1740 in transgenic corn event DAS-40278-9. The
illustrated map of the insert in aad-1 corn event DAS-40278-9 is
presented in FIGS. 2-3.
Example 2.1 Corn Leaf Sample Collection and Genomic DNA (gDNA)
Isolation
[0130] gDNA prepared from leaf of the individual plants of the
aad-1 corn event DAS-40278-9. gDNA was extracted from leaf tissue
harvested from individual plants carrying aad-1 corn event
DAS-40278-9. Transgenic corn seeds from five distinct generations
of event DAS-40278-9 were used. Twenty individual corn plants,
derived from four plants per generation, for event DAS-40278-9 were
selected. In addition, gDNA was isolated from a conventional corn
plant, XHH13, which contains the genetic background that is
representative of the substance line, absent the aad-1 gene.
[0131] Prior to isolating the gDNA, leaf punches were taken from
each plant to test aad-1 protein expression using a rapid test
strip kit (American Bionostica, Swedesboro, N.J.) according to the
manufacturer's recommended procedure. Each leaf punch sample was
given a score of + or - for the presence or absence of aad-1,
respectively. Only positive plants from the five generations of
event DAS-40278-9 were subjected to further characterization.
[0132] Corn leaf samples were collected from the individual plants
of the event DAS-40278-9 and the conventional control XHH13. Leaf
samples were quickly frozen in liquid nitrogen and stored at
approximately -80.degree. C. until usage.
[0133] Individual genomic DNA was extracted from frozen corn leaf
tissue following the standard CTAB method. When necessary, some of
the genomic DNA was further purified with Qiagen Genomic-Tip
(Qiagen, Valencia, Calif.) following procedures recommended by the
manufacturer. Following extraction, the DNA was quantified
spectrofluorometrically using Pico Green reagent (Invitrogen,
Carlsbad, Calif.). The DNA was then visualized on an agarose gel to
confirm values from the Pico Green analysis and to determine the
DNA quality.
Example 2.2 DNA Digestion and Separation
[0134] For molecular characterization of the DNA, nine micrograms
(9 .mu.g) of genomic DNA from the corn event DAS-40278-9 DNA sample
and the conventional control were digested by adding approximately
five to eleven units of selected restriction enzyme per .mu.g of
DNA and the corresponding reaction buffer to each DNA sample. Each
sample was incubated at approximately 37.degree. C. overnight. The
restriction enzymes EcoR I, Nco I, Sac I, Fse I, and Hind III were
used for the digests (New England Biolabs, Ipswich, Mass.). A
positive hybridization control sample was prepared by combining
plasmid DNA, pDAS1740 (pDAB3812), with genomic DNA from the
conventional control at a ratio of approximately equivalent to 1
copy of transgene per corn genome, and digested using the same
procedures and restriction enzyme as the test samples. DNA from the
conventional corn control (XHH13) was digested using the same
procedures and restriction enzymes as the test samples to serve as
a negative control.
[0135] The digested DNA samples were precipitated with Quick-Precip
(Edge BioSystems, Gaithersburg, Md.) and resuspended in 1.times.
Blue Juice (Invitrogen, Carlsbad, Calif.) to achieve the desired
volume for gel loading. The DNA samples and molecular size markers
were then electrophoresed through 0.8% agarose gels with
1.times.TBE buffer (Fisher Scientific, Pittsburgh, Pa.) at 55-65
volts for approximately 18-22 hours to achieve fragment separation.
The gels were stained with ethidium bromide (Invitrogen, Carlsbad,
Calif.) and the DNA was visualized under ultraviolet (UV)
light.
Example 2.3 Southern Transfer and Membrane Treatment
[0136] Southern blot analysis was performed essentially as
described by Memelink, et al. (1994) Southern, Northern, and
Western Blot Analysis. Plant Mol. Biol. Manual F1:1-23. Briefly,
following electrophoretic separation and visualization of the DNA
fragments, the gels were depurinated with 0.25N HCl (Fisher
Scientific, Pittsburgh, Pa.) for approximately 15 minutes, and then
exposed to a denaturing solution (AccuGENE, Sigma, St. Louis, Mo.)
for approximately 30 minutes followed by neutralizing solution
(AccuGENE, Sigma, St. Louis, Mo.) for at least 30 minutes. Southern
transfer was performed overnight onto nylon membranes (Roche
Diagnostics, Indianapolis, Ind.) using a wicking system with
10.times.SSC (Sigma, St. Louis, Mo.). After transfer the membranes
were washed in a 2.times.SSC solution and the DNA was bound to the
membrane by UV crosslinking. This process resulted in Southern blot
membranes ready for hybridization.
Example 2.4 DNA Probe Labeling and Hybridization
[0137] The DNA fragments bound to the nylon membrane were detected
using a labeled probe. Probes used for the study were generated by
a PCR-based incorporation of a digoxigenin (DIG) labeled
nucleotide, [DIG-11]-dUTP, from fragments generated by primers
specific to gene elements and other regions from plasmid pDAS 1740.
Generation of DNA probes by PCR synthesis was carried out using a
PCR DIG Probe Synthesis Kit (Roche Diagnostics, Indianapolis, Ind.)
following the manufacturer's recommended procedures. A list of
probes used for the study is described in Table 1.
TABLE-US-00003 TABLE 1 Location and Length of Probes used in
Southern Analysis. Probe Position on Name Genetic Element pDAS1740
(bp) Length (bp) OLP1-3 ubiquitin promoter (ZmUbi1) 28-2123 2096
OLP2 aad-1 gene 2103-3022 920 OLP3A peroxidase terminator (ZmPer5)
3002-3397 396 OLP3B RB7 Mar v4 3375-4865 1491 OLP4ABC Backbone
(OLP4A) 4900-5848 949 Backbone Ap.sup.r gene (OLP4B) 5828-6681 855
Backbone (OLP4C) 6660-7144 485 OLP5-2 RB7 Mar v3 7124-8507 1384
[0138] Labeled probes were analyzed by agarose gel electrophoresis
to determine their quality and quantity. A desired amount of
labeled probe was then used for hybridization to the target DNA on
the nylon membranes for detection of the specific fragments using
the procedures described for DIG Easy Hyb Solution (Roche
Diagnostics, Indianapolis, Ind.). Briefly, nylon membrane blots
with DNA fixed on were briefly washed in 2.times.SSC and
prehybridized with 20-25 mL of prewarmed DIG Easy Hyb solution in
hybridization bottles at approximately 50.degree. C. for a minimal
of 30 minutes in a hybridization oven. The prehybridization
solution were then decanted and replaced with 20 mL of prewarmed
DIG Easy Hyb solution containing a desired amount of specific
probes predenatured by boiling in water for 5 minutes. The
hybridization step was then conducted at approximately
40-60.degree. C. overnight in the hybridization oven.
Example 2.5 Detection
[0139] At the end of the probe hybridization, DIG Easy Hyb
solutions containing the probes were decanted into clean tubes and
stored at -20.degree. C. These probes could be reused for 2-3 times
according to the manufacturer's recommended procedure. The membrane
blots were rinsed briefly and washed twice in clean plastic
containers with low stringency wash buffer (2.times.SSC, 0.1% SDS)
for approximately 5 minutes at room temperature, followed by
washing twice with high stringency wash buffer (0.1.times.SSC, 0.1%
SDS) for 15 minutes each at approximately 65.degree. C. The
membrane blots were then transferred to other clean plastic
containers and briefly washed with 1.times. washing buffer from the
DIG Wash and Block Buffer Set (Roche Diagnostics, Indianapolis,
Ind.) for approximately 2 minutes, proceeded to blocking in
1.times. blocking buffer for a minimum of 30 minutes, followed by
incubation with anti-DIG-AP (alkaline phosphatase) antibody
(1:5,000 dilution, Roche Diagnostics, Indianapolis, Ind.) in
1.times. blocking buffer for a minimum of 30 minutes. After 2-3
washes with 1.times. washing buffer, specific DNA probes remain
bound to the membrane blots and DIG-labeled DNA standards were
visualized using CDP-Star Chemiluminescent Nucleic Acid Detection
System (Roche Diagnostics, Indianapolis, Ind.) following the
manufacturer's recommendation. Blots were exposed to
chemiluminescent film (Roche Diagnostics, Indianapolis, Ind.) for
one or more time points to detect hybridizing fragments and to
visualize molecular size standards. Films were then developed with
an All-Pro 100 Plus film developer (Konica SRX-101) and images were
scanned for report. The number and sizes of detected bands were
documented for each probe. DIG-labeled DNA Molecular Weight Marker
II (MWM DIG II), visible after DIG detection as described, was used
to determine hybridizing fragment size on the Southern blots.
Example 2.6 Probe Stripping
[0140] DNA probes were stripped off the membrane blots after the
Southern hybridization data were obtained, and the membrane blots
could be reused for hybridization with a different DNA probe
according to the manufacturer's recommended procedures (DIG
Application Manual for Filter Hybridization, (2003). Roche
Diagnostics). Briefly, after signal detection and film exposure,
membrane blots were thoroughly rinsed with Milli-Q water and
followed by washing twice in stripping buffer (0.2N NaOH, 0.1% SDS)
for approximately 15 minutes at room temperature or at 37.degree.
C. The membrane blots were then briefly washed in 2.times.SSC and
were ready for prehybridization and hybridization with another DNA
probe. The membrane blots were exposed to a new chemiluminescent
film to ensure all the DNA probes were stripped of before
proceeding to the next hybridization. The re-exposed films were
kept along with the previous hybridization data package in the
study file for record.
Example 2.7 Southern Blot Results
[0141] Expected and observed fragment sizes with a particular
digest and probe, based on the known restriction enzyme sites of
the pDAS1740/Fsp I fragment, are given in Table 2. Two types of
fragments were identified from these digests and hybridizations:
internal fragments, where known enzyme sites flank the probe region
and are completely contained within the pDAS1740/Fsp I fragment and
border fragments where a known enzyme site is located at one end of
the probe region and a second site is expected in the corn genome.
Border fragment sizes vary by event because, in most cases, DNA
fragment integration sites are unique for each event. The border
fragments provide a means to locate a restriction enzyme site
relative to the integrated DNA and to evaluate the number of DNA
insertions. Based on the Southern blot analyses completed in this
study, it was concluded that a single copy of an intact aad-1 PTU
from plasmid pDAS1740/Fsp I inserted into the corn genome of event
DAS-40278-9 as detailed in the insert map (FIGS. 2-3).
TABLE-US-00004 TABLE 2 Predicted and Observed Hybridizing Fragments
in Southern Blot Analysis. Expected Observed DNA Restriction
Fragment Fragment Size Probe Enzymes Sizes (bp) .sup.1 (bp)2 aad-1
EcoR I pDAS1740 8512 8512 XHH13 none none DAS-40278-9 >3382
(border) ~12000 Nco I pDAS1740 8512 8512 XHH13 none none
DAS-40278-9 >2764 (border) ~4000 Sac I pDAS1740 8512 8512 XHH13
none none DAS-40278-9 >4389 (border) ~16000 Fse I/Hind pDAS1740
3361 3361 III XHH13 none none DAS-40278-9 3361 3361 ZmUbi1 Nco I
pDAS1740 8512 8512, ~3600* prom. XHH13 none ~3600* DAS-40278-9
>3472 (border) ~6300, ~3600* Sac I pDAS1740 8512 8512, ~3800*
XHH13 none ~3800* DAS-40278-9 >4389 (border) ~3800*, ~16000 Fse
I/Hind pDAS1740 3361 3361, ~6400* III XHH13 none ~6400* DAS-40278-9
3361 3361, ~6400*# ZmPer5 Nco I pDAS1740 8512 8512, -3900* term.
XHH13 none -3900* DAS-40278-9 >2764 (border) -4000, -3900* Sac I
pDAS1740 8512 8512, -9000* XHH13 none -9000* DAS-40278-9 >1847
(border) -1900, -9000* Fse I/Hind pDAS1740 3361 3361, -2100* III
XHH13 none -2100* DAS-40278-9 3361 3361, -2100* RB7 Nco I pDAS1740
8512 8512 mar4 XHH13 none none DAS-40278-9 >2764 (border) -4000
>3472 (border) -6300 Sac I pDAS1740 8512 8512 XHH13 none none
DAS-40278-9 >1847 (border) -1900 >4389 (border) -16000 RB7
Nco I pDAS1740 8512 8512 mar3 XHH13 none none DAS-40278-9 >2764
(border) -4000 >3472 (border) -6300 Sac I pDAS1740 8512 8512
XHH13 none none DAS-40278-9 >1847 (border) -1900 >4389
(border) -16000 backbone Nco I pDAS1740 8512 8512 XHH13 none none
DAS-40278-9 none none Sac I pDAS1740 8512 8512 XHH13 none none
DAS-40278-9 none none Note: *An asterisk after the observed
fragment size indicates endogenous sequence hybridization that was
detected across all samples (including negative controls) #Doublets
in the conventional control, BC3S1, and some BC3S2 samples as shown
.sup.1 Expected fragment sizes are based on the plasmid map of the
pDAS1740 (pDAB3812) in FIG. 1 2Observed fragment sizes are
considered approximately from these analyses and are based on the
indicated sizes of the DIG-labeled DNA Molecular Weight Marker II
fragments. Due to the incorporation of DIG molecules for
visualization, the marker fragments typically run approximately
5-10% larger than their actual indicated molecular weight.
[0142] Restriction enzymes with unique restriction site in plasmid
pDAS 1740, EcoR I, Nco I, Sac I, Fse I/Hind III, were selected to
characterize aad-1 gene insert in event DAS-40278-9. Border
fragment of >3382 bp, >2764 bp, >4389 bp was predicted to
hybridize with the aad-1 gene probe following EcoR I, Nco I, and
Sac I digest respectively (Table 2). Single aad-1 hybridization
band of .about.12000 bp, .about.4000 bp, and .about.16000 bp were
observed when EcoR I, Nco I, and Sac I were used respectively,
indicating a single site of aad-1 gene insertion in the corn genome
of event DAS-40278-9. Double digestion with Fse I and Hind III was
selected to release a fragment of 3361 bp which contains the aad-1
plant transcription unit (PTU, promoter/gene/terminator) (Table 2).
The predicted 3361 bp fragment was observed with the aad-1 gene
probe following Fse I/Hind III digestion. Results obtained with all
four enzymes/enzyme combination digestion of the DAS-40278-9 sample
followed by aad-1 gene probe hybridization indicated that a single
copy of an intact aad-1 PTU from plasmid pDAS 1740 was inserted
into the corn genome of event DAS-40278-9.
[0143] Restriction enzymes Nco I, Sac I and Fse I/Hind III were
selected to characterize the promoter (ZmUbil) region for aad-1 in
event DAS-40278-9. Nco I and Sac I digests are expected to generate
a border region fragment of >3472 bp and >4389 bp,
respectively, when hybridized to DNA probes specifically to the
ZmUbil promoter region (Table 2). Two hybridization bands of
.about.6300 bp and .about.3600 bp were detected with ZmUbil
promoter probe following Nco I digestion. The .about.3600 bp band,
however, was present across all sample lanes including the
conventional controls, suggesting that the .about.3600 bp band is a
non-specific signal band resulting from the homologous binding of
the corn-derived ubiquitin promoter (ZmUbil) probe to the corn
endogenous ubi gene. On the contrary, the .about.6300 bp signal
band was detected in the tested DAS-40278-9 samples but not in the
conventional controls, indicating that the .about.6300 bp band is
specific to the ZmUbil promoter probe from plasmid pDAS1740 and
therefore it is the expected Nco I/ZmUbil band indicated in Table
2. Similarly, two hybridization bands of .about.3800 bp and
.about.16000 bp were detected with ZmUbil promoter probe following
Sac I digestion. The .about.3800 bp band appeared in all sample
lanes including conventional controls and thus is considered as
non-specific hybridization of ZmUbil promoter probe to the corn
endogenous ubi gene. The .about.16000 bp hybridization band that is
only present in DAS-40278-9 samples is considered the expected Sac
I/ZmUbil band. Double digestion with Fse I/Hind III is expected to
release the aad-1 PTU fragment of 3361 bp that hybridizes to the
ZmUbil promoter probe (Table 2). This 3361 bp band and a
non-specific hybridization band of .about.6400 bp were detected by
ZmUbil promoter probe following Fse I/Hind III digestion. The
.about.6400 bp band is considered non-specific binding of the
ZmUbil promoter probe to the corn endogenous ubi gene because this
band is present in all sample lanes including the conventional
controls. Additionally, another band very close to .about.6400 bp
was observed in the conventional control, BC3S1, and some of the
BC3S2 samples. This additional band very close to .about.6400 bp is
also considered non-specific because it is present in the
conventional control XHH13 sample lanes and is most likely
associated with the genetic background of XHH13.
[0144] The same restriction enzymes/enzyme combination, Nco I, Sac
I and Fse I/Hind III were selected to characterize the terminator
(ZmPer5) region for aad-1 in event DAS-40278-9. Nco I digest is
expected to generate a border region fragment of >2764 bp when
hybridized to DNA probes specifically to the ZmPer5 terminator
region (Table 2). Two hybridization bands of .about.4000 bp and
.about.3900 bp were detected with ZmPer5 terminator probe following
Nco I digestion. The .about.3900 bp band was present across all
sample lanes including the conventional controls, suggesting that
the .about.3900 bp band is a non-specific signal band probably due
to the homologous binding of the corn-derived peroxidase gene
terminator (ZmPer5) probe to the corn endogenous per gene. On the
contrary, the .about.4000 bp signal band was detected in the tested
DAS-40278-9 samples but not in the conventional controls,
indicating that the .about.4000 bp band is specific to the ZmPer5
terminator probe from plasmid pDAS 1740 and therefore it is the
expected Nco I/ZmPer5 band indicated in Table 2. A >1847 bp
border fragment is expected to hybridized to the ZmPer5 terminator
probe following Sac I digestion. Two hybridization bands of
.about.1900 bp and .about.9000 bp were detected with ZmPer5
terminator probe following Sac I digestion. The .about.9000 bp band
appeared in all sample lanes including conventional controls and
thus considered as non-specific hybridization of ZmPer5 terminator
probe to the corn endogenous per gene. The .about.1900 bp
hybridization band that was only present in DAS-40278-9 samples is
considered the expected Sac I/ZmPer5 band. Double digestion with
Fse I/Hind III is expected to release the aad-1 PTU fragment of
3361 bp that hybridizes to the ZmPer5 terminator probe (Table 2).
This 3361 bp band and an additional non-specific hybridization band
of .about.2100 bp were detected by ZmPer5 terminator probe
following Fse I/Hind III digestion. The additional .about.2100 bp
band is the non-specific binding of the ZmPer5 terminator probe to
the corn endogenous gene since this band is present in all sample
lanes including the negative controls. Results obtained with these
digestions of the DAS-40278-9 sample followed by ZmUbil promoter
and ZmPer5 terminator probe hybridization further confirmed that a
single copy of an intact aad-1 PTU from plasmid pDAS 1740 was
inserted into the corn genome of event DAS-40278-9.
[0145] Restriction enzymes, Nco I and Sac I, were selected to
characterize the rest of the components from pDAS1740/Fsp I
fragment in AAD-1 corn event DAS-40278-9 (Table 2). DNA sequences
of components RB7 Mar v3 and RB7 Mar v4 have over 99.7% identity,
therefore DNA probes specific for RB7 Mar v3 or RB7 Mar v4 were
expected to hybridize to DNA fragments containing either version of
the RB7 Mar. Two border fragments of >2764 bp and >3472 bp
were expected to hybridize with RB7 Mar v4 and RB7 Mar v3 probes
following Nco I digestion (Table 2). Two hybridization bands of
.about.4000 bp and .about.6300 bp were observed with either RB7 Mar
v4 or RB7 Mar v3 probe after Nco I digestion in DAS-40278-9
samples. Similarly, two border fragments of >1847 bp and
>4389 bp were predicted with RB7 Mar v4 and RB7 Mar v3 probes
following Sac I digestion (Table 2). Hybridization bands of
.about.1900 bp and .about.16000 bp were detected in DAS-40278-9
samples with RB7 Mar v4 or RB7 Mar v3 probe after Sac I
digestion.
[0146] Taken together, the Southern hybridization results obtained
with these element probes indicated that the DNA inserted in corn
event DAS-40278-9 contains an intact aad-1 PTU along with the
matrix attachment regions RB7 Mar v3 and RB7 Mar v4 at the 5' and
3' ends of the insert, respectively.
Example 2.8 Absence of Backbone Sequences
[0147] Equal molar ratio combination of three DNA fragments (Table
1) covering nearly the entire Fsp I backbone region (4867-7143 bp
in plasmid pDAS 1740) of plasmid pDAS 1740 were used as the
backbone probe to characterize AAD-1 corn event DAS-40278-9.
Plasmid pDAS 1740/Fsp I fragment was used to generate event
DAS-40278-9, therefore, no specific hybridization signal was
expected with the backbone probe combination (Table 2) following
any restriction enzyme digestion. It was confirmed that no specific
hybridization signal was detected with backbone probe following Nco
I or Sac I digestion in all DAS-40278-9 samples. Positive control
lanes contained the expected hybridizing bands demonstrating that
the probes were capable of hybridizing to any homologous DNA
fragments if present in the samples. The data suggested that the
insertion in corn event DAS-40278-9 did not include any vector
backbone sequence outside of the Fsp I region from plasmid pDAS
1740.
[0148] Leaf samples from five distinct generations of the event
DAS-40278-9 were used to conduct the Southern blot analysis for
molecular characterization. The integration pattern was
investigated using selected restriction enzyme digest and probe
combinations to characterize the inserted gene, aad-1, as well as
the non-coding regions including promoter, terminator of gene
expression, and the matrix attachment regions.
[0149] Southern blot characterization of the DNA inserted into
event DAS-40278-9 indicate that a single intact copy of the aad-1
PTU has been integrated into event DAS-40278-9. The molecular
weights indicated by the Southern hybridization for the combination
of the restriction enzyme and the probe were unique for the event,
and established its identification patterns. The hybridization
pattern is identical across all five generations, indicating that
the insert is stable in the corn genome. Hybridization with probes
covering the backbone region beyond the pDAS1740/Fsp I
transformation fragment from plasmid pDAS1740 confirms that no
vector backbone sequences have been incorporated into the event
DAS-40278-9.
Example 3. Cloning and Characterization of DNA Sequence in the
Insert and the Flanking Border Regions of Corn Event
DAS-40278-9
[0150] To characterize the inserted DNA and describe the genomic
insertion site, DNA sequences of the insert and the border regions
of event DAS-40278-9 were determined. In total, 8557 bp of event
DAS-40278-9 genomic sequence were confirmed, comprising 1873 bp of
5' flanking border sequence, 1868 bp of 3' flanking border
sequence, and 4816 bp of DNA insert. The 4816 bp DNA insert
contains an intact aad-1 expression cassette, a 259 bp partial MAR
v3 on the 5' terminus, and a 1096 bp partial MAR v4 on the 3'
terminus. Sequence analysis revealed a 21 bp insertion at
5'-integration junction and a two base pair deletion from the
insertion locus of the corn genome. A one base pair insertion was
found at 3'-integration junction between the corn genome and the
DAS-40278-9 insert. Also, a single base change (T to C) was found
in the insert at position 5212 in the non-coding region of the 3'
UTR. None of these changes affect the open reading frame
composition of the aad-1 expression cassette.
[0151] PCR amplification based on the event DAS-40278-9 insert and
border sequences confirmed that the border regions were of corn
origin and that the junction regions could be used for
event-specific identification of DAS-40278-9. Analysis of the
sequence spanning the junction regions indicated that no novel open
reading frames (ORF>=200 codons) resulted from the DNA insertion
in event DAS-40278-9 and also no genomic open reading frames were
interrupted by the DAS-40278-9 integration in the native corn
genome. Overall, characterization of the insert and border
sequences of the AAD-1 corn event DAS-40278-9 indicated that a
single intact copy of the aad-1 expression cassette was integrated
into the native corn genome.
Example 3.1 Genomic DNA Extraction and Quantification
[0152] Genomic DNA was extracted from lyophilized or freshly ground
leaf tissues using a modified CTAB method. DNA samples were
dissolved in 1.times.TE (10 mM Tris pH8.0, 1 mM EDTA) (Fluka,
Sigma, St. Louis, Mo.) and quantified with the Pico Green method
according to manufacturer's instructions (Molecular Probes, Eugene,
Oreg.). For PCR analysis, DNA samples were diluted with molecular
biology grade water (5 PRIME, Gaithersburg, Md.) to result in a
concentration of 10-100 ng/.mu.L.
Example 3.2 PCR Primers
[0153] Table 3 lists the primer sequences that were used to clone
the DNA insert and the flanking border regions of event
DAS-40278-9, with positions and descriptions marked in FIG. 4.
Table 4 lists the primer sequences that were used to confirm the
insert and border sequences. The primer positions were marked in
FIGS. 4 and 5, respectively. All primers were synthesized by
Integrated DNA Technologies, Inc. (Coralville, Iowa). Primers were
dissolved in water (5 PRIME, Gaithersburg, Md.) to a concentration
of 100 .mu.M for the stock solution and diluted with water to a
concentration of 10 .mu.M for the working solution.
TABLE-US-00005 TABLE 3 List of primer sequences used in the cloning
of the insert in Corn Event DAS-40278-9 and flanking border
sequence. Size Location Primer Name (bp) (bp) Sequence Purpose
5End3812_A 26 2231-2256 (-) Seq ID No: 1: 5' Primary PCR for 5'
TGCACTGCAGGTCGACTCTAGAGGAT-3' border sequence 5End3812_B 23
2110-2132 (-) Seq ID No: 2: 5'- Second PCR for 5'
GCGGTGGCCACTATTTTCAGAAG-3' border sequence 3End3812_C 26 5535-5560
(+) Seq ID No: 3: 5'- Primary PCR for 3'
TTGTTACGGCATATATCCAATAGCGG-3' border sequence 3End3812_D 26
5587-5612 (+) Seq ID No: 4: 5'- Secondary PCR for 3'
CCGTGGCCTATTTTCAGAAGAAGTTC-3' border sequence Amp 1F 23 736-758 (+)
Seq ID NO: 5: 5'- Amplification of the ACAACCATATTGGCTTTGGCTGA-3'
insert, Amplicon 1, used with Amp 1R Amp 1R 28 2475-2502 (-) Seq ID
NO: 6: Amplification of the 5'CCTGTTGTCAAAATACTCAATTGTCCTT- insert,
Amplicon 1, 3' used with Amp 1F Amp 2F 23 1696-1718 (+) Seq ID NO:
7: 5'- Amplification of the CTCCATTCAGGAGACCTCGCTTG-3' insert,
Amplicon 2, used with Amp 2R Amp 2R 23 3376-3398 (-) Seq ID NO: 8:
Amplification of the 5'GTACAGGTCGCATCCGTGTACGA-3' insert, Amplicon
2, used with Amp 2F Amp 3F 25 3254-3278 (+) Seq ID NO: 9: 5'-
Amplification of the CCCCCCCTCTCTACCTTCTCTAGAT-3' insert, Amplicon
3, used with Amp 3R Amp 3R 23 4931-4953 (-) Seq ID NO: 10: 5'-
Amplification of the GTCATGCCCTCAATTCTCTGACA-3' insert, Amplicon 3,
used with Amp 3F Amp 4F 23 4806-4828 (+) Seq ID NO: 11: 5'-
Amplification of the GTCGCTTCAGCAACACCTCAGTC-3' insert, Amplicon 4
used with Amp 4R Amp 4R 23 6767-6789 (-) Seq ID NO: 12: 5'-
Amplification of the AGCTCAGATCAAAGACACACCCC-3' insert, Amplicon 5,
used with Amp 5F Amp 5F 28 6300-6327 (+) Seq ID NO: 13: 5'-
Amplification of the TCGTTTGACTAATTTTTCGTTGATGTAC-3' insert,
Amplicon 5, used with Amp 5R Amp 5R 23 7761-7783 (-) Seq ID NO: 14:
5'- Amplification of the TCTCACTTTCGTGTCATCGGTCG-3' insert,
Amplicon 5, used with Amp 5F (+): Direct sequence; (-):
Complementary sequence;
TABLE-US-00006 TABLE 4 List of primer sequences used in the
confirmation of corn genomic DNA Size Location Primer Name (bp)
(bp) Sequence Purpose 1F5End01 17 1816-1832 (+) Seq ID NO: 15: 5'-
Confirmation of 5' border CCAGCACGAACCATTGA-3' genomic DNA, used
with A15End01 1F5End02 24 1629-1652 (+) Seq ID NO: 16: 5'-
Confirmation of 5' border CGTGTATATAAGGTCCAGAGGGTA- genomic DNA,
used with 3' A15End02 A15End01 17 4281-4297 (-) Seq ID NO: 17: 5'-
Confirmation of 5' border TTGGGAGAGAGGGCTGA-3' genomic DNA, used
with 1F5End01 A15End02 20 4406-4426 (-) Seq ID NO: 18: 5'-
Confirmation of 5' border TGGTAAGTGTGGAAGGCATC-3' genomic DNA, used
with 1F5End02 1F3End03 20 8296-8315 (-) Seq ID NO: 19: 5'-
Confirmation of genomic GAGGTACAACCGGAGCGTTT-3' DNA, used with
1F5End03 1F3End04 19 8419-8437 (-) Seq ID NO: 20: 5'- Confirmation
of genomic CCGACGCTTTTCTGGAGTA-3' DNA, used with 1F5End04 1F5End03
22 378-399 (+) Seq ID NO: 21: 5'- Confirmation of genomic
TGTGCCACATAATCACGTAACA-3' DNA, used with 1F3End03 1F5End04 20
267-286 (+) Seq ID NO: 22: 5'- Confirmation of genomic
GAGACGTATGCGAAAATTCG-3' DNA, used with 1F3End04 A13End01 22
4973-4994 (+) Seq ID NO: 23: 5'- Confirmation of 3' border
TTGCTTCAGTTCCTCTATGAGC-3' genomic DNA, used with 1F3End05 1F3End 05
19 7060-7078 (-) Seq ID NO: 24: 5'- Confirmation of 3' border
TCCGTGTCCACTCCTTTGT-3' genomic DNA, used with A13End01 1F5End T1F
22 2033-2054 (-) Seq ID NO: 25: 5'- 278 specific sequence
GCAAAGGAAAACTGCCATTCTT-3' amplification at 5' junction 1F5EndT1R 20
1765-1784 (+) Seq ID NO: 26: 5'- 278 specific sequence
TCTCTAAGCGGCCCAAACTT-3' amplification at 5' junction Corn278-F 23
1884-1906 (-) Seq ID NO: 27: 5'- 278 specific sequence
ATTCTGGCTTTGCTGTAAATCGT-3' amplification at 5' junction Corn278-R
24 1834-1857 (+) Seq ID NO: 28: 5'- 278 specific sequence
TTACAATCAACAGCACCGTACCTT amplification at 5' junction (+): Direct
sequence; (-): Complementary sequence;
Example 3.3. Genome Walking
[0154] The GenomeWalker.TM. Universal Kit (Clontech Laboratories,
Inc., Mountain View, Calif.) was used to clone the 5' and 3'
flanking border sequences of corn event DAS-40278-9. According to
the manufacturer's instruction, about 2.5 .mu.g of genomic DNA from
AAD-1 corn event DAS-40278-9 was digested overnight with EcoR V,
Stu I (both provided by the kit) or Sca I (New England Biolabs,
Ipswich, Mass.). Digested DNA was purified using the DNA Clean
& Concentrator.TM.-25 (ZYMO Research, Orange, Calif.) followed
by ligation to GenomeWalker.TM. adaptors to construct
GenomeWalker.TM. libraries. Each GenomeWalker.TM. library was used
as DNA template for primary PCR amplification with the adaptor
primer AP1, provided in the kit, and each construct-specific primer
5End3812_A and 3End3812_C. One microliter of 1:25 dilution of
primary PCR reaction was then used as template for secondary PCR
amplification with the nested adaptor primer AP2 and each nested
construct-specific primer 5End3812_B and 3End3812_D. TaKaRa LA
Taq.TM. HS (Takara Bio Inc., Shiga, Japan) was used in the PCR
amplification. In a 50 .mu.L PCR reaction, 1 .mu.L of DNA template,
8 .mu.L of 2.5 mM of dNTP mix, 0.2 .mu.M of each primer, 2.5 units
of TaKaRa LA Taq.TM. HS DNA Polymerase, 5 .mu.l of 10.times.LA PCR
Buffer II (Mg2+ plus), and 1.5 .mu.L of 25 mM MgCl.sub.2 were used.
Specific PCR conditions are listed in Table 5.
TABLE-US-00007 TABLE 5 Conditions for Genome Walking of the AAD-1
Corn Event DAS-40278-9 to Amplify the Flanking Border Regions Pre-
Final denature Denature Anneal Extension Denature Anneal Extension
Extension Target (.degree. C./ (.degree. C./ (.degree. C./
(.degree. C./ (.degree. C./ (.degree. C./ (.degree. C./ (.degree.
C./ Sequence Primer Set min) sec.) sec.) min:sec) sec.) sec.)
min:sec) min) 5' border 5End3812_A/ 95/3 95/30
68.sup.-0.5/cycle.fwdarw.64/30 68/10:00 95/30 64/30 68/10:00 72/10
AP1 8 cycles 22 cycles 5End3812_B/ 95/30
68.sup.-0.5/cycle.fwdarw.64/30 68/10:00 95/30 64/30 68/10:00 AP2 8
cycles 22 cycles 3' border 3End3812_C/ 95/3 95/30
68.sup.-0.5/cycle.fwdarw.64/30 68/10:00 95/30 64/30 68/10:00 72/10
AP1 8 cycles 22 cycles 3' border 3End3812_D/ 95/3 95/30
68.sup.-0.5/cycle.fwdarw.64/30 68/10:00 95/30 64/30 68/10:00 72/10
(nested) AP2 8 cycles 22 cycles
Example 3.4. Conventional PCR
[0155] Standard PCR was used to clone and confirm the DNA insert
and border sequence in the corn event DAS-40278-9. TaKaRa LA
Taq.TM. (Takara Bio Inc., Shiga, Japan), HotStarTaq DNA Polymerase
(Qiagen, Valencia, Calif.), Expand High Fidelity PCR System (Roche
Diagnostics, Inc., Indianapolis, Ind.), or the Easy-A.RTM.
High-Fidelity PCR Cloning Enzyme & Master Mix (Stratagene,
LaJolla, Calif.) was used for conventional PCR amplification
according to the manufacturer's recommended procedures. Specific
PCR conditions and amplicon descriptions are listed in Table 6.
TABLE-US-00008 TABLE 6 Conditions for Standard PCR Amplification of
the Border Regions in the Corn Event DAS-40278-9 Pre- Final
denature Denature Anneal Extension Extension Target Primer
(.degree. C./ (.degree. C./ (.degree. C./ (.degree. C./ (.degree.
C./ Sequence Set min) sec.) sec.) min:sec) min) 5' border 1F5End01/
95/3 95/30 60/30 68/5:00 72/10 AI5End01 35 cycles 5' border
1F5End02/ 95/3 95/30 60/30 68/5:00 72/10 AI5End02 35 cycles Across
the 1F3End03/ 95/3 95/30 60/30 68/5:00 72/10 insert locus 1F5End03
35 cycles Across the 1F3End04/ 95/30 60/30 68/5:00 72/10 1F5End04
35 cycles 5' junction Amp 1F/ 95/2 94/60 55/60 72/2:00 72/10
(Amplicon 1) Amp 1R 35 cycles Amplicon 2 Amp 1F/ 95/2 94/60 55/60
72/2:00 72/10 Amp 1R 35 cycles Amplicon 3 Amp 1F/ 95/2 94/60 55/60
72/2:00 72/10 Amp 1R 35 cycles Amplicon 4 Amp 1F/ 95/2 94/60 55/60
72/2:00 72/10 Amp 1R 35 cycles 3' junction Amp 1F/ 95/2 94/60 55/60
72/2:00 72/10 (Amplicon 5) Amp 1R 35 cycles 3' border 1F3End05/
95/3 95/30 60/30 68/5:00 72/10 A13End01 35 cycles indicates data
missing or illegible when filed
Example 3.5 PCR Product Detection, Purification, Sub-Cloning of PCR
Products, and Sequencing
[0156] PCR products were inspected by electrophoresis using 1.2% or
2% E-gel (Invitrogen, Carlsbad, Calif.) according to the product
instruction. Fragment size was estimated by comparison with the DNA
markers. If necessary, PCR fragments were purified by excising the
fragments from 1% agarose gel in 1.times.TBE stained with ethidium
bromide, using the QiAquick Gel Extraction Kit (Qiagen, Carlsbad,
Calif.).
[0157] PCR fragments were sub-cloned into the pCR.RTM.4-TOPO.RTM.
using TOPO TA Cloning.RTM. Kit for Sequencing (Invitrogen,
Carlsbad, Calif.) according to the product instruction.
Specifically, two to five microliters of the TOPO.RTM. cloning
reaction was transformed into the One Shot chemically competent
TOP10 cells following the manufacturer's instruction. Cloned
fragments were verified by minipreparation of the plasmid DNA
(QIAprep Spin Miniprep Kit, Qiagen, Carlsbad, Calif.) followed by
restriction digestion with EcoR I or by direct colony PCR using T3
and T7 primers, provided in the kit. Plasmid DNA or glycerol stocks
of the selected colonies were then sent for sequencing.
[0158] After sub-cloning, the putative target PCR products were
sequenced initially to confirm that the expected DNA fragments had
been cloned. The colonies containing appropriate DNA sequences were
selected for primer walking to determine the complete DNA
sequences. Sequencing was performed by Cogenics (Houston,
Tex.).
[0159] Final assembly of insert and border sequences was completed
using Sequencher software (Version 4.8 Gene Codes Corporation, Ann
Arbor, Mich.). Annotation of the insert and border sequences of
corn event DAS-40278-9 was performed using the Vector NTI (Version
10 and 11, Invitrogen, Carlsbad, Calif.).
[0160] Homology searching was done using the BLAST program against
the GenBank database. Open reading frame (ORF) analysis using
Vector NTI (Version 11, Invitrogen) was performed to identify ORFs
(>=200 codons) in the full insert and flanking border
sequences.
Example 3.6 5' End Border Sequence
[0161] A DNA fragment was amplified from each corn event
DAS-40278-9 GenomeWalker.TM. library using the specific nested
primer set for 5' end of the transgene. An approximately 800 bp PCR
product was observed from both the event DAS-40278-9 EcoR V and Stu
I GenomeWalker.TM. libraries. The Sca I GenomeWalker.TM. library
generated a product around 2 kb. The fragments were cloned into
pCR.RTM. 4-TOPO and six colonies from each library were randomly
picked for end sequencing to confirm the insert contained the
expected sequences. Complete sequencing by primer walking of the
inserts revealed that the fragments amplified from corn event
DAS-40278-9 Stu I, EcoR V, and Sca I GenomeWalker.TM. libraries
were 793, 822, and 2132 bp, respectively. The DNA fragments
generated from the Stu I and EcoR V GenomeWalker.TM. libraries were
a 100% match to the DNA fragment generated from Sca
GenomeWalker.TM. library, suggesting that these DNA fragments were
amplified from the 5' region of the transgene insert. BLAST search
of the resultant 1873 bp corn genomic sequence indicated a high
similarity to the sequence of a corn BAC clone. Moreover, sequence
analysis of the insertion junction indicated that 917 bp of the MAR
v3 at its 5' end region was truncated compared to the plasmid
pDAS1740/Fsp I fragment, leaving a 259 bp partial MAR v3 at the 5'
region of the aad-1 expression cassette.
Example 3.7 3' End Border Sequence
[0162] A DNA fragment with size of approximately 3 kb was amplified
from corn event DAS-40278-9 Stu I GenomeWalker.TM. library using
the specific nested primer set for the 3' end of the transgene. The
DNA fragment was cloned into pCR.RTM.4-TOPO.RTM. and ten colonies
were randomly picked for end sequencing to confirm the insertion of
the expected sequences. Three clones with the expected inserts were
completely sequenced, generating a 2997 bp DNA fragment. Sequence
analysis of this DNA fragment revealed a partial MAR v4 element
(missing 70 bp of its 5' region) and 1867 bp corn genomic sequence.
BLAST search showed the 1867 bp genomic DNA sequence was a 100%
match to sequence in the same corn BAC clone as was identified with
the 5' border sequence.
Example 3.8 DNA Insert and Junction Sequence
[0163] The DNA insert and the junction regions were cloned from
corn event DAS-40278-9 using PCR based methods as previously
described. Five pairs of primers were designed based on the 5' and
3' flanking border sequences and the expected transgene sequence.
In total, five overlapping DNA fragments (Amplicon 1 of 1767 bp,
Amplicon 2 of 1703 bp, Amplicon 3 of 1700 bp, Amplicon 4 of 1984
bp, and Amplicon 5 of 1484 bp) were cloned and sequenced (FIG. 4).
The whole insert and flanking border sequences were assembled based
on overlapping sequence among the five fragments. The final
sequence confirms the presence of 4816 bp of the DNA insert derived
from pDAS1740/Fsp I, 1873 bp of the 5' flanking border sequence,
and 1868 bp of 3' flanking border sequence. The 4816 bp DNA insert
contains an intact aad-1 expression cassette, a 259 bp partial MAR
v3 on the 5' terminus, and a 1096 bp partial MAR v4 on the 3'
terminus (Seq ID No: 29).
[0164] At least two clones for each primer pair were used for
primer walking in order to obtain the complete sequence information
on the DNA insert and its border sequences. Sequence analysis
indicated a 21 bp insertion at 5'-integration junction between corn
genome DNA and the integrated partial MAR v3 from the pDAS1740/Fsp
I. BLAST search and Vector NTI analysis results indicated that the
21 bp insert DNA did not demonstrate homology to any plant species
DNA or the pDAS1740 plasmid DNA. A single base pair insertion was
found at the 3'-integration junction between corn genome DNA and
the partial MAR v4 from the pDAS 1740/Fsp I. DNA integration also
resulted in a two base pair deletion at the insertion locus of the
corn genome (FIG. 6). In addition, one nucleotide difference (T to
C) at the position of 5212 bp was observed in the non-translated 3'
UTR region of the DNA insert (Seq ID No: 29). However, none of
these changes seem to be critical to aad-1 expression or create any
new ORFs (>=200 codons) across the junctions in the insert of
DAS-40278-9.
Example 3.9 Confirmation of Corn Genomic Sequences
[0165] To confirm the insertion site of event DAS-40278-9 transgene
in the corn genome, PCR amplification was carried out with
different pairs of primers (FIG. 4). Genomic DNA from event
DAS-40278-9 and other transgenic or non-transgenic corn lines was
used as a template. Two aad-1 specific primers, A15End01 and
A15End02, and two primers designed according to the 5' end border
sequence, 1F5End01 and 1F5End02, were used to amplify DNA fragments
spanning the aad-1 gene to 5' end border sequence. Similarly, to
amplify a DNA fragment spanning the aad-1 to 3' end border
sequence, 1F3End05 primer derived from the 3' end border sequence
and aad-1 specific AI3End01 primer were used. DNA fragments with
expected sizes were amplified only from the genomic DNA of AAD-1
corn event DAS-40278-9, with each primer pair consisting of one
primer located on the flanking border of AAD-1 corn event
DAS-40278-9 and one aad-1 specific primer. The control DNA samples
did not yield PCR products with the same primer pairs indicating
that the cloned 5' and 3' end border sequences are indeed the
upstream and downstream sequence of the inserted aad-1 gene
construct, respectively. It is noted that a faint band with size of
about 8 kb was observed in all the corn samples including AAD-1
corn event DAS-40278-9, AAD-1 corn event DAS-40474 and non
transgenic corn line XHH13 when the primer pair of 1F5End01 and
AI5End01 were used for PCR amplification. An observed faint band
(on a prepared gel) could be a result of nonspecific amplification
in corn genome with this pair of primers.
[0166] To further confirm the DNA insertion in the corn genome, two
primers located at the 5' end border sequence, 1F5End03 and
1F5End04, and two primers located at the 3' end border sequence,
1F3End03 and 1F3End04, were used to amplify DNA fragments spanning
the insertion locus. PCR amplification with either the primer pair
of 1F5End03/1F3End03 or the primer pair of 1F5End04/1F3End04
resulted in a fragment with expected size of approximately 8 kb
from the genomic DNA of AAD-1 corn event DAS-40278-9. In contrast,
no PCR products resulted from the genomic DNA of AAD-1 corn event
DAS-40474-7 or the non-transgenic corn line XHH13. Given that AAD-1
corn event DAS-40278-9 and event DAS-40474-7 were generated by
transformation of Hill, followed by backcrossing the original
transgenic events with the corn line XHH13, the majority of genome
in each of these two events is theoretically from the corn line
XHH13. It is very likely that only the flanking border sequences
close to the aad-1 transgene are carried over from the original
genomic DNA and preserved during the AAD-1 event introgression
process, while other regions of genome sequences might have been
replaced by the genome sequences of XHH13. Therefore, it is not
surprising that no fragments were amplified from the genomic DNA of
AAD-1 corn event DAS-40474-7 and XHH13 with either the primer pair
of 1F5End03/1F3End03 or the primer pair of 1F5End04/1F3End04.
Approximately 3.1 and 3.3 kb fragments were amplified with the
primer pair of 1F5End03/1F3End03 and 1F5End04/1F3End04 respectively
in the genomic DNA of the corn lines Hill and B73 but not in the
corn line A188. The results indicate that the border sequences
originated from the genome of the corn line B73.
[0167] Additional cloning of corn genomic DNA from B73/HiII was
performed to ensure validity of the flanking border sequences. The
PCR amplified fragments were sequenced in order to prove the insert
DNA region integrated into the specific location of B73/HiII
genomic DNA. Primers were designed based on the sequence obtained.
Primer set Amp 1F/Amp 5R was used to amplify a 2212 bp fragment
spanning the 5' to 3' junctions from native B73/HiII genome without
insert DNA. Sequence analysis revealed that there was a two base
pair deletion from the native B73 genome in the transgene insertion
locus. Analysis of the DNA sequences from the cloned native B73
genomic fragment identified one ORF (>=200 codons) located
downstream of the 3'-integration junction region. Additionally,
there are no other ORFs across the original locus where the AAD-1
corn event DAS-40278-9 integrated. BLAST search also confirmed that
both 5' end and 3' end border sequences from the event DAS40278-9
are located side by side on the same corn BAC clone.
[0168] Given the uniqueness of the 5'-integration junction of the
AAD-1 corn event DAS-40278-9, two pairs of specific PCR primers,
1F5EndT1F/1F5EndT1R and Corn278-F/Corn278-R, were designed to
amplify this insert-to-plant genome junction. As predicted, the
desired DNA fragment was only generated in the genomic DNA of the
AAD-1 corn event DAS-40278-9 but not any other transgenic or
non-transgenic corn lines. Therefore, those two primer pairs can be
used as AAD-1 corn event DAS-40278-9 event-specific
identifiers.
Example 4 Genomic Characterization Via Flanking SSR Markers of
DAS-40278-9
[0169] To characterize and describe the genomic insertion site,
marker sequences located in proximity to the insert were
determined. A panel of polymorphic SSR markers were used to
identify and map the transgene location. Event pDAS 1740-278 is
located on chromosome 2 at approximately 20 cM between SSR markers
UMC1265 and MMC0111 at approximately 20 cM on the 2008 DAS corn
linkage map. Table 6A summarizes the primer information for these
two makers found to be in close proximity to transgene
pDAS1740-278.
TABLE-US-00009 TABLE 6A Primer names, dye labels, locus positions,
forward and reverse primer sequences, and significant notes for
flanking makers associated with event pDAS1740-278. Primer Name
Label Chr ~cM Bin Forward Primer Reverse Primer Notes umc1265 NED 2
20 2.02 Seq ID No: 30: Seq ID No: 31: Left 5'-GCCTAGTCGCC
5'-TGTGTTCTTGATT flanking TACCCTACCAAT- GGGTGAGACAT- marker 3' 3'
mmc0111 FAM 2 20 2.03 Seq ID No: 32: Seq ID No: 33: Right
5'-TACTGGGG 5'-AATCTATGT flanking ATTAGAGCAGAAG- GTGAACAGCAGC-
marker 3' 3'
Example 4.1 gDNA Isolation
[0170] gDNA was extracted from leaf punches using the DNEasy 96
Plant Test Kit (Qiagen, Valencia, Calif.). Modifications were made
to the protocol to accommodate for automation. Isolated gDNA was
quantified using the PicoGreen.RTM. dye from Molecular Probes, Inc.
(Eugene, Oreg.). The concentration of gDNA was diluted to 5
ng/.mu.l for all samples using sterile deionized water.
Example 4.2 Screening of gDNA with Markers
[0171] The diluted gDNA was genotyped with a subset of simple
sequence repeats (SSR) markers. SSR markers were synthesized by
Applied Biosystems (Foster City, Calif.) with forward primers
labeled with either 6-FAM, HEX/VIC, or NED (blue, green and yellow,
respectively) fluorescent tags. The markers were divided into
groups or panels based upon their fluorescent tag and amplicon size
to facilitate post-PCR multiplexing and analysis.
[0172] PCR was carried out in 384-well assay plates with each
reaction containing 5 ng of genomic DNA, 1.25.times.PCR buffer
(Qiagen, Valencia, Calif.), 0.20 .mu.M of each forward and reverse
primer, 1.25 mM MgCl.sub.2, 0.015 mM of each dNTP, and 0.3 units of
HotStart Taq DNA polymerase (Qiagen, Valencia, Calif.).
Amplification was performed in a GeneAmp PCR System 9700 with a
384-dual head module (Applied Biosystems, Foster City, Calif.). The
amplification program was as follows: (1) initial activation of Taq
at 95.degree. C. for 12 minutes; (2) 30 sec at 94.degree. C.; (3)
30 sec at 55.degree. C.; (4) 30 sec at 72.degree. C.; (5) repeat
steps 2-4 for 40 cycles; and (6) 30 min final extension at
72.degree. C. The PCR products for each SSR marker panel were
multiplexed together by adding 2 .mu.l of each PCR product from the
same plant to sterile deionized water for a total volume of 60
.mu.l. Of the multiplexed PCR products, 0.5 ul were stamped into
384-well loading plates containing 5 .mu.l of loading buffer
comprised of a 1:100 ratio of GeneScan 500 base pair LIZ size
standard and ABI HiDi Formamide (Applied Biosystems, Foster City,
Calif.). The samples were then loaded onto an ABI Prism 3730xl DNA
Analyzer (Applied Biosystems, Foster City, Calif.) for capillary
electrophoresis using the manufacturer's recommendations with a
total run time of 36 minutes. Marker data was collected by the ABI
Prism 3730xl Automated Sequencer Data Collection software Version
4.0 and extracted via GeneMapper 4.0 software (Applied Biosystems)
for allele characterization and fragment size labeling.
Example 4.3 SSR Marker Results
[0173] The primer data for the flanking markers which were
identified in the closest proximity to the transgene are listed in
Table 6. The two closest associated markers, UMC1265 and MMC0111,
are located approximately 20 cM away from the transgene insert on
chromosome 2.
Example 5 Characterization of Acid-1 Protein in Event
DAS-40278-9
[0174] The biochemical properties of the recombinant aad-1 protein
derived from the transgenic maize event DAS-40278-9 were
characterized. Sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE, stained with Coomassie blue and
glycoprotein detection methods), western blot, immunodiagnostic
test strip assays, matrix assisted laser desorption/ionization
time-of-flight mass spectrometry (MALDI-TOF MS) and protein
sequencing analysis by tandem MS were used to characterize the
biochemical properties of the protein.
Example 5.1 Immunodiagnostic Strip Assay
[0175] The presence of the aad-1 protein in the leaf tissue of
DAS-40278-9 was confirmed using commercially prepared
immunodiagnostic test strips from American Bionostica. The strips
were able to discriminate between transgenic and nontransgenic
plants by testing crude leaf extracts (data not shown). The
non-transgenic extracts (XHH13) did not contain detectable amounts
of immunoreactive protein. This result was also confirmed by
western blot analysis.
[0176] To test for the expression of the aad-1 protein, an
immunodiagnostic strip analysis was performed. Four leaf punches
were collected from each plant for XHH13 (control plant) and event
DAS-40278-9 bp pinching the tissue between the snap-cap lids of
individually labeled 1.5-mL microfuge tubes. Upon receipt in the
lab, 0.5 mL of aad-1 extraction buffer (American Bionostica,
Swedesboro, N.J.) was added to each tube, and the tissue was
homogenized using a disposable pestle followed by shaking the
sample for .about.10 seconds. After homogenization, the test strip
was placed in the tube and allowed to develop for .about.5 minutes.
The presence or absence of the aad-1 protein in the plant extract
was confirmed based on the appearance (or lack of appearance) of a
test line on the immunodiagnostic strip. Once the expression of the
aad-1 protein was confirmed for the transgenic event, the maize
stalk tissue was harvested and lyophilized and stored at
approximately -80.degree. C. until use.
Example 5.2 Purification of the Aad-1 Protein from Corn
[0177] Immuno-purified, maize-derived aad-1 protein (molecular
weight: .about.33 kDa) or crude aqueous extracts from corn stalk
tissue were prepared. All leaf and stalk tissues were harvested and
transported to the laboratory as follows: The leaves were cut from
the plant with scissors and placed in cloth bags and stored at
approximately -20.degree. C. for future use. Separately, the stalks
were cut off just above the soil line, placed in cloth bags and
immediately frozen at approximately -80.degree. C. for .about.6
hours. The stalks were then placed in a lyophilizer for 5 days to
remove water. Once the tissues were completely dried they were
ground to a fine powder with dry ice and stored at approximately
-80.degree. C. until needed.
[0178] The maize-derived aad-1 protein was extracted from
lyophilized stalk tissue in a phosphate-based buffer (see Table 7
for buffer components) by weighing out .about.30 grams of
lyophilized tissue into a chilled 1000 mL glass blender and adding
500 mL of extraction buffer. The tissue was blended on high for 60
seconds and the soluble proteins were harvested by centrifuging the
sample for 20 minutes at 30,000.times.g. The pellet was
re-extracted as described, and the supernatants were combined and
filtered through a 0.45.mu. filter. The filtered supernatants were
loaded at approximately +4.degree. C. onto an anti-aad-1
immunoaffinity column that was conjugated with a monoclonal
antibody prepared by Strategic Biosolution Inc. (MAb 473F1 85.1;
Protein A purified; Lot #: 609.03C-2-4; 6.5 mg/mL (.about.35.2 mg
total)) (Windham, Me.); Conjugated to CNBr-activated Sepharose 4B
(GE Healthcare, Piscataway, N.J.). The non-bound proteins were
collected and the column was washed extensively with pre-chilled 20
mM ammonium bicarbonate buffer, pH 8.0. The bound proteins were
eluted with 3.5 M NaSCN, (Sigma, St. Louis, Mo.), 50 mM Tris
(Sigma, St. Louis, Mo.) pH 8.0 buffer. Seven 5-mL-fractions were
collected and fraction numbers 27 were dialyzed overnight at
approximately +4.degree. C. against 10 mM Tris, pH 8.0 buffer. The
fractions were examined by SDS-PAGE and western blot and the
remaining samples were stored at approximately +4.degree. C. until
used for subsequent analyses.
TABLE-US-00010 TABLE 7 The commercially available reference
substances used in this study are listed in the following table:
Reference Substance Product Name Lot Number Assay Reference Soybean
Trypsin A component of the IA110577 Glycosylation Pierce Cat #:
1856274 Inhibitor GelCode Glycoprotein Staining Kit Horseradish A
component of the JG124509 Glycosylation Pierce Cat #: 1856273
Peroxidase GelCode Glycoprotein Staining Kit Bovine Serum
Pre-Diluted BSA FH71884A Glycosylation, Pierce Cat #: 23208 Albumin
Fraction V Protein Assay SDS-PAGE (BSA) Standard Set and Western
Blot Prestained Molecular Novex Sharp 469212 & Western Blot
Invitrogen Cat #: LC5800, Weight Markers Prestained Protein 419493
Molecular Weight Markers Markers of 260, 160, 110, 80, 60, 50, 40,
30, 20, 15, 10 and 3.5 kDa Molecular Weight Invitrogen Mark12 39983
& SDS-PAGE Invitrogen Cat #: LC5677, Markers Protein Marker Mix
399895 Molecular Weight Markers of 200, 116.3, 97.4, 66.3, 55.4,
36.5, 31.0, 21.5, 14.4, 6.0, 3.5 and 2.5 kDa
[0179] The protein that bound to the immunoaffinity column was
examined by SDSPAGE and the results showed that the eluted
fractions contained the aad-1 protein at an approximate molecular
weight of 33 kDa. In addition, a western blot was also performed
and was positive for the aad-1 protein. The maize-derived aad-1
protein was isolated from .about.30 g of lyophilized stalk
material.
Example 5.3 SDS-PAGE and Western Blot
[0180] Lyophilized tissue from event DAS-40278-9 and XHH13 stalk
(.about.100 mg) were weighed out in 2-mL microfuge tubes and
extracted with .about.1 mL of PBST (Sigma, St. Louis, Mo.)
containing 10% plant protease inhibitor cocktail (Sigma, St. Louis,
Mo.). The extraction was facilitated by adding 4 small ball
bearings and Geno-Grinding the sample for 1 minute. After grinding,
the samples were centrifuged for 5 minutes at 20,000.times.g and
the supernatants were mixed 4:1 with 5.times. Laemmli sample buffer
(2% SDS, 50 mM Tris pH 6.8, 0.2 mg/mL bromophenol blue, 50% (w/w)
glycerol containing 10% freshly added 2-mercaptoethanol) and heated
for 5 minutes at .about.100.degree. C. After a brief
centrifugation, 45 .mu.L of the supernatant was loaded directly
onto a BioRad Criterion SDS-PAGE gel (Bio-Rad, Hercules, Calif.)
fitted in a Criterion Cell gel module. A positive reference
standard of microbe-derived aad-1 was resuspended at 1 mg/mL in
PBST pH 7.4 and further diluted with PBST. The sample was then
mixed with Bio-Rad Laemmli buffer with 5% 2-mercaptoethanol and
processed as described earlier. The electrophoresis was conducted
with Tris/glycine/SDS buffer (Bio-Rad, Hercules, Calif.) at
voltages of 150-200 V until the dye front approached the end of the
gel. After separation, the gel was cut in half and one half was
stained with Pierce GelCode Blue protein stain and the other half
was electro-blotted to a nitrocellulose membrane (Bio-Rad,
Hercules, Calif.) with a Mini trans-blot electrophoretic transfer
cell (Bio-Rad, Hercules, Calif.) for 60 minutes under a constant
voltage of 100 volts. The transfer buffer contained 20% methanol
and Tris/glycine buffer from Bio-Rad. For immunodetection, the
membrane was probed with an aad-1 specific polyclonal rabbit
antibody (Strategic Biosolution Inc., Newark, Del., Protein A
purified rabbit polyclonal antibody Lot #: DAS F1 197-15 1, 1.6
mg/mL). A conjugate of goat anti-rabbit IgG (H+L) and alkaline
phosphatase (Pierce Chemical, Rockford, Ill.) was used as the
secondary antibody. SigmaFast BCIP/NBT substrate was used for
development and visualization of the immunoreactive protein bands.
The membrane was washed extensively with water to stop the reaction
and a record of the results was captured with a digital scanner
(Hewlett Packard, Palo Alto, Calif.).
[0181] In the P. fluorescens-produced aad-1 the major protein band,
as visualized on Coomassie stained SDS-PAGE gels, was approximately
33 kDa. As expected, the corresponding maize-derived aad-1 protein
(event DAS-40278-9) was identical in size to the microbe-expressed
proteins. Predictably, the plant purified fractions contained a
minor amount of non-immunoreactive impurities in addition to the
aad-1 protein. The co-purified proteins were likely retained on the
column by weak interactions with the column matrix or leaching of
the monoclonal antibody off of the column under the harsh elution
conditions. Other researchers have also reported the non-specific
adsorption of peptides and amino acids on cyanogen-bromide
activated Sepharose 4B immunoadsorbents (Kennedy and Barnes, 1983;
Holroyde et al., 1976; Podlaski and Stem, 2008).
[0182] The Pseudomonas-derived aad-1 protein showed a positive
signal of the expected size by polyclonal antibody western blot
analysis. This was also observed in the DAS-40278-9 transgenic
maize stalk extract. In the aad-1 western blot analysis, no
immunoreactive proteins were observed in the control XHH13 extract
and no alternate size proteins (aggregates or degradation products)
were seen in the transgenic samples.
Example 5.4 Detection of Post-Translational Glycosylation
[0183] The immunoaffinity chromatography-purified, maize-derived
aad-1 protein (Fraction #3) was mixed 4:1 with 5.times. Laemmli
buffer. The microbe-derived aad-1, soybean trypsin inhibitor,
bovine serum albumin and horseradish peroxidase were diluted with
Milli-Q water to the approximate concentration of the plant-derived
aad-1 and mixed with Bio-Rad Laemmli buffer. The proteins were then
heated at .about.95.degree. C. for 5 minutes and centrifuged at
20000.times.g for 2 minutes to obtain a clarified supernatant. The
resulting supernatants were applied directly to a Bio-RadCriterion
Gel and electrophoresed with XT MES running buffer (Bio-Rad,
Hercules, Calif.) essentially as described above except that the
electrophoresis was run at 170 V for .about.60 minutes. After
electrophoresis, the gel was cut in half and one half was stained
with GelCode Blue stain for total protein according to the
manufacturers' protocol. After the staining was complete, the gel
was scanned with a Molecular Dynamics densitometer to obtain a
permanent visual record of the gel. The other half of the gel was
stained with a GelCode Glycoprotein Staining Kit (Pierce Chemical,
Rockford, Ill.) according to the manufacturers' protocol to
visualize glycoproteins. The glycoproteins (with a detection limit
as low as 0.625 ng per band) were visualized as magenta bands on a
light pink background. After the glycoprotein staining was
complete, the gel was scanned with a Hewlett Packard digital
scanner to obtain a permanent visual record of the gel. After the
image of the glycosylation staining was captured, the gel was
stained with GelCode Blue to verify the presence of the
non-glycosylated proteins. The results showed that both the maize-
and microbe-derived aad-1 proteins had no detectable covalently
linked carbohydrates. This result was also confirmed by peptide
mass fingerprinting.
Example 5.5 Mass Spectrometry Peptide Mass Fingerprinting and
Sequencing of Maize- and Pseudomonas-Derived Aad-1
[0184] Mass Spectrometry analysis of the Pseudomonas- and
maize-derived aad-1 was conducted. The aad-1 protein derived from
transgenic corn stalk (event DAS-40278-9) was subjected to
in-solution digestion by trypsin followed by MALDI-TOF MS and
ESI-LC/MS. The masses of the detected peptides were compared to
those deduced based on potential protease cleavage sites in the
sequence of maize-derived aad-1 protein. The theoretical cleavage
was generated in silico using Protein Analysis Worksheet (PAWS)
freeware from Proteometrics LLC. The aad-1 protein, once denatured,
is readily digested by proteases and will generate numerous peptide
peaks.
[0185] In the trypsin digest of the transgenic-maize-derived aad-1
protein (event DAS-40278-9), the detected peptide fragments covered
nearly the entire protein sequence lacking only one small tryptic
fragment at the C-terminal end of the protein, F.sup.248 to
R.sup.253 and one short (2 amino acids) peptide fragment. This
analysis confirmed the maize-derived protein amino acid sequence
matched that of the microbe-derived aad-1 protein. Results of these
analyses indicate that the amino acid sequence of the maize-derived
aad-1 protein was equivalent to the P. fluorescens-expressed
protein.
Example 5.5.1 Tryptic Peptide Fragment Sequencing
[0186] In addition to the peptide mass fingerprinting, the amino
acid residues at the N- and C-termini of the maize-derived aad-1
protein (immunoaffinity purified from maize event DAS-40278-9) were
sequenced and compared to the sequence of the microbe-derived
protein. The protein sequences were obtained, by tandem mass
spectrometry, for the first 11 residues of the microbe- and
maize-derived proteins (Table 8). The amino acid sequences for both
proteins were A' H A A L S P L S Q R'' (SEQ ID NO:30) showing the
N-terminal methionine had been removed by an aminopeptidase (Table
8). The N-terminal aad-1 protein sequence was expected to be M' A H
A A L S P L S Q R'.sup.2. (SEQ ID NO:31) These results suggest that
during or after translation in maize and P. fluorescens, the
N-terminal methionine is cleaved by a methionine aminopeptidase
(MAP). MAPs cleave methionyl residues rapidly when the second
residue on the protein is small, such as Gly, Ala, Ser, Cys, Thr,
Pro, and Val (Walsh, 2006). In addition to the methionine being
removed, a small portion of the N-terminal peptide of the aad-1
protein was shown to have been acetylated after the N-terminal
methionine was cleaved (Table 8). This result is encountered
frequently with eukaryotic (plant) expressed proteins since
approximately 80-90% of the N-terminal residues are modified
(Polevoda and Sherman, 2003). Also, it has been shown that proteins
with serine and alanine at the N-termini are the most frequently
acetylated (Polevoda and Sherman, 2002). The two cotranslational
processes, cleavage of N-terminal methionine residue and N-terminal
acetylation, are by far the most common modifications and occur on
the vast majority (.about.85%) of eukaryotic proteins (Polevoda and
Sherman, 2002). However, examples demonstrating biological
significance associated with N-terminal acetylation are rare
(Polevoda and Sherman, 2000).
TABLE-US-00011 TABLE 8 Summary of N-terminal Sequence Data of AAD-1
Maize- and Microbe-Derived Proteins Source Expected N-terminal
Sequence.sup.1 P. fluorescens M.sup.1AHAALSPLSQR.sup.12 (SEQ ID NO:
31) Maize Event DAS-40278-9 M.sup.1AHAALSPLSQR.sup.12
Relative.sup.3 Source Expected N-terminal Sequence.sup.2 Abundance
P. fluorescens AHAALSPLSQR.sup.12 100% Maize Event DAS-40278-9
AHAALSPLSQR.sup.12 31% Maize Event DAS-40278-9
.sup.N-AcAHAALSPLSQR.sup.12 3% (SEQ ID NO: 30) Maize Event
DAS-40278-9 HAALSPLSQR.sup.12 50% (SEQ ID NO: 32) Maize Event
DAS-40278-9 AALSPLSQR.sup.12 6% (SEQ ID NO: 33) Maize Event
DAS-40278-9 ALSPLSQR.sup.12 12% (SEQ ID NO: 34) .sup.1Expected
N-terminal sequence of the first 12 amino acid residues of P.
fluorescens-and maize-derived AAD-1 .sup.2Detected N-terminal
sequences of P. fluorescens-and maize-derived AAD-1. .sup.3The
tandem MS data for the N-terminal peptides revealed a mixture of
AHAALSPLSQR (acetylated) and N-Acetyl-AHAALSPLSQR (acetylated).
''Ragged N-terminal ends'' were also detected (peptides
corresponding to amino acid sequences HAALSPLSQR, AALSPLSQR, and
ALSPLSQR). The relative abundance, an estimate of relative peptide
fragment quantify, was made based on the corresponding LC peak
areas measured at 214 nm. Notes: Numbers in superscript (Rx)
indicate amino acid residue numbers in the sequence. Amino acid
residue abbreviations: A: alanine H: histidine L: leucine M:
methionine P: proline Q: glutamine R: arginine S: serine T:
threonine
[0187] In addition to N-acetylation, there was also slight
N-terminal truncation that appeared during purification of the
maize-derived aad-1 protein (Table 8). These "ragged-ends" resulted
in the loss of amino acids A2, H.sup.3 and A.sup.4 (in varying
forms and amounts) from the maize-derived protein. This truncation
is thought to have occurred during the purification of the aad-1
protein as the western blot probe of the crude leaf extracts
contained a single crisp band at the same MW as the microbe-derived
aad-1 protein. The extraction buffer for the western blotted
samples contained an excess of a protease inhibitor cocktail which
contains a mixture of protease inhibitors with broad specificity
for the inhibition of serine, cysteine, aspartic, and
metalloproteases, and aminopeptidases.
[0188] The C-terminal sequence of the maize- and microbe-derived
aad-1 proteins were determined as described above and compared to
the expected amino acid sequences (Table 9). The results indicated
the measured sequences were identical to the expected sequences,
and both the maize- and microbe-derived aad-1 proteins were
identical and unaltered at the C-terminus.
TABLE-US-00012 TABLE 9 Summary of C-terminal Sequence Data of AAD-1
Maize- and Microbe Derived Proteins Source Expected C-terminal
Sequence.sup.1 P. fluorescens .sup.287TTVGGVRPAR.sup.296 Maize
Event DAS-40278-9 .sup.287TTVGGVRPAR.sup.296 (SEQ ID NO: 35) Source
Detected C-terminal Sequence.sup.2 P. fluorescens
.sup.287TTVGGVRPAR.sup.296 Maize Event DAS-40278-9
.sup.287TTVGGVRPAR.sup.296 (SEQ ID NO: 35) .sup.1Expected
C-terminal sequence of the last 10 amino acid residues of P.
fluorescens-and maize-derived AAD-1. .sup.2Detected C-terminal
sequences of P. fluorescens-and maize-derived AAD-1. Notes: Numbers
in superscript (Rx) indicate amino acid residue numbers in the
sequence. Amino acid residue abbreviations: A: alanine G: glycine
P: proline R: arginine T: threonine V: valine
Example 6 Field Expression, Nutrient Composition Analysis and
Agronomic Characteristics of a Hybrid Maize Line Containing Event
DAS-40278-9
[0189] The purpose of this study was to determine the levels of
AAD-1 protein found in corn tissues. In addition, compositional
analysis was performed on corn forage and grain to investigate the
equivalency between the isogenic non-transformed corn line and the
transgenic corn line DAS-40278-9 (unsprayed, sprayed with 2,4-D,
sprayed with quizalofop, and sprayed with 2,4-D and quizalofop).
Agronomic characteristics of the isogenic non-transformed corn line
were also compared to the DAS-40278-9 corn. The Field expression,
composition, and agronomic trials were conducted at six test sites
located within the major corn-producing regions of the U.S and
Canada. These sites represent regions of diverse agronomic
practices and environmental conditions. The trials were located in
Iowa, Illinois (2 sites), Indiana, Nebraska and Ontario,
Canada.
[0190] All site mean values for the control, unsprayed AAD-1,
AAD-1+quizalofop, AAD-1+2,4-D and AAD-1+both entry samples were
within literature ranges for corn. A limited number of significant
differences between unsprayed AAD-1, AAD-1+quizalofop, AAD-1+2,4-D
or AAD-1+both corn and the control were observed, but the
differences were not considered to be biologically meaningful
because they were small and the results were within ranges found
for commercial corn. Plots of the composition results do not
indicate any biologically-meaningful treatment-related
compositional differences among unsprayed AAD-1, AAD-1+quizalofop,
AAD-1+2,4-D or AAD-1+both corn and the control corn line. In
conclusion, unsprayed AAD-1, AAD-1+quizalofop, AAD-1+2,4-D and
AAD-1+both corn composition results confirm equivalence of AAD-1
(Event DAS 40278-9) corn to conventional corn lines.
Example 6.1 Corn Lines Tested
[0191] Hybrid seed containing the DAS-40278-9 event and control
plants which are conventional hybrid seed of the same genetic
background as the test substance line, but do not contain the
DAS-40278-9 event, are listed in Table 10.
TABLE-US-00013 TABLE 10 Test Entry Description 1 Non-aad-1 Control
2 aad-1 unsprayed 3 aad-1 sprayed w/quizalofop 4 aad-1 sprayed
w/2,4-D 5 aad-1 sprayed w/2,4-D and quizalofop
[0192] The corn plants described above were grown at locations
within the major corn growing regions of the U.S. and Canada. The
six field testing facilities, Richland, Iowa; Carlyle, Ill.;
Wyoming, Ill.; Rockville, Ind.; York, Nebr.; and Branchton,
Ontario, Canada (referred to as IA, IL1, IL2, IN, NE and ON)
represent regions of diverse agronomic practices and environmental
conditions for corn.
[0193] The test and control corn seed was planted at a seeding rate
of approximately 24 seeds per row with seed spacing within each row
of approximately 10 inches (25 cm). At each site, 4 replicate plots
of each treatment were established, with each plot consisting of
2-25 ft rows. Plots were arranged in a randomized complete block
(RCB) design, with a unique randomization at each site. Each corn
plot was bordered by 2 rows of a non-transgenic maize hybrid of
similar maturity. The entire trial site was surrounded by a minimum
of 12 rows (or 30 ft) of a non-transgenic maize hybrid of similar
relative maturity.
[0194] Appropriate insect, weed, and disease control practices were
applied to produce an agronomically acceptable crop. The monthly
maximum and minimum temperatures along with rainfall and irrigation
were average for the site. These ranges are typically encountered
in corn production.
Example 6.2 Herbicide Applications
[0195] Herbicide treatments were applied with a spray volume of
approximately 20 gallons per acre (187 L/ha). These applications
were designed to replicate maximum label rate commercial practices.
Table 11 lists the herbicides that were used.
TABLE-US-00014 TABLE 11 Herbicide TSN Concentration Weedar 64
026491-0006 39%, 3.76 lb ae.sup.a/gal, 451 g ae/l Assure II 106155
10.2%, 0.87 lb ai.sup.b/gal, 104 g ai/l .sup.aae = acid equivalent.
.sup.bai = active ingredient.
[0196] 2,4-D (Weedar 64) was applied as 3 broadcast over-the-top
applications to Test Entries 4 and 5 (seasonal total of 3 lb ae/A).
Individual applications were at pre-emergence and approximately V4
and V8-V8.5 stages. Individual target application rates were 1.0 lb
ac/A for Weedar 64, or 1120 g ae/ha. Actual application rates
ranged from 1096-1231 g ae/A.
[0197] Quizalofop (Assure II) was applied as a single broadcast
over-the-top application to Test Entries 3 and 5. Application
timing was at approximately V6 growth stage. The target application
rate was 0.0825 lb ai/A for AssureII, or 92 g ai/ha. Actual
application rates ranged from 90.8-103 g ai/ha.
Example 6.3 Agronomic Data Collection and Results
[0198] Agronomic characteristics were recorded for all test entries
within Blocks 2, 3, and 4 at each location. Table 12 lists the
following characteristics that were measured.
TABLE-US-00015 TABLE 12 Trait Evaluation Timing Description of Data
Early Population V1 and V4 Number of plants emerged per plot.
Seedling Vigor V4 Visual estimate of average vigor of emerged
plants per plot Plant Vigor/Injury Approximately 1-2 Injury from
herbicide applications. weeks after applications Time to Silking
Approximately 50% The number of accumulated heat units from the
time of Silking planting until approximately 50% of the plants have
Time to Pollen Approximately 50% The number of accumulated heat
units from the time of Shed Pollen shed planting until
approximately 50% of the plants are shedding pollen Pollen
Viability Approximately 50% Evaluation of pollen color and shape
over time Plant Height Approximately R6 Height to the tip of the
tassel Ear Height Approximately R6 Height to the base of the
primary ear Stalk Lodging Approximately R6 Visual estimate of
percent of plants in the plot with stalks broken below the primary
ear Root Lodging Approximately R6 Visual estimate of percent of
plants in the plot leaning approximately 30.degree. or more in the
first ~1/2 meter above the soil surface Final Population
Approximately R6 The number of plants remaining per plot Days to
Maturity Approximately R6 The number of accumulated heat units from
the time of planting until approximately 50% of the plants have
reached physiological maturity. Stay Green Approximately R6 Overall
plant health Disease Incidence Approximately R6 Visual estimate of
foliar disease incidence Insect Damage Approximately R6 Visual
estimate of insect damage Note: Heat Unit = ((MAX temp + MIN
temp/2) -50.degree. F. indicates data missing or illegible when
filed
An analysis of the agronomic data collected from the control, aad-1
unsprayed, aad-1+2,4-D, aad-1+quizalofop, and aad-1+both entries
was conducted. For the across-site analysis, no statistically
significant differences were observed for early population (V1 and
V4), vigor, final population, crop injury, time to silking, time to
pollen shed, stalk lodging, root lodging, disease incidence, insect
damage, days to maturity, plant height, and pollen viability (shape
and color) values in the across location summary analysis (Table
13). For stay green and ear height, significant paired t-tests were
observed between the control and the aad-1+quizalofop entries, but
were not accompanied by significant overall treatment effects or
False Discovery Rates (FDR) adjusted p-values (Table 13).
TABLE-US-00016 TABLE 13 Summary Analysis of Agronomic
Characteristics Results Across Locations for the DAS-40278-9 aad-1
Corn (Sprayed and Unsprayed) and Control Sprayed Sprayed Overall
Trt. Unsprayed Sprayed 2,4-D Both Effect (P-value,.sup.b Quizalofop
(P-value, (P-value, Analyte (Pr > F).sup.a Control Adj. P).sup.c
(P-value, Adj. P) Adj. P) Early population (0.351) 42.8 41.3 41.7
41.9 44.1 V1 (no. of plants) (0.303, 0.819) (0.443, 8.819) (0.556,
0.819) (0.393, 0.819) Early population (0.768) 43.1 43.3 43.7 44.3
44.8 V4 (no. of plants) (0.883, 0984) (0.687, 0.863) (0.423, 0.819)
(0.263, 0.819) Seedling Vigor.sup.d (0.308) 7.69 7.39 7.36 7.58
7.78 (0.197, 0.819) (0.161, 0.819) (0.633, 0.819) 0.729, 0.889)
Final population (0.873) 40.1 39.6 39.7 39.9 41.1 (number of
plants) (0.747, 0.889) (0.802, 0.924) (0.943, 1.00) (0.521, 0.819)
Crop Injury- NA.sup.1 0 0 0 0 0 1.sup.st app..sup.e Crop Injury-
(0.431) 0 0 0 0 0.28 2.sup.nd app..sup.e (1.00, 1.00) (1.00, 1.00)
(1.00, 1.00) (0.130, 0.819) Crop Injury- NA 0 0 0 0 0 3.sup.rd
app..sup.e Crop Injury- NA 0 0 0 0 0 4.sup.th app..sup.e Time to
Silking (0.294) 1291 1291 1293 1304 1300 (heat units).sup.f (0.996,
1.00) (0.781, 0.917) (0.088, 0.819) (0.224, 0.819) Time to Pollen
(0.331) 1336 1331 1342 1347 1347 shed (heat units).sup.f (0.564,
0.819) (0.480, 0.819) (0.245, 0.819) (0.245, 0.819) Pollen Shape
(0.872) 10.9 10.9 11.3 11.4 11.3 0 minutes (%).sup.g (0.931, 1.00)
(0.546, 0.819) (0.439, 0.819) (0.605, 0.819) Pollen Shape (0.486)
49.2 50.8 46.4 48.1 51.9 30 minutes (%) (0.618, 0.819) (0.409,
0.819) (0.739, 0.889) (0.409, 0.819) Pollen Shape (0.724) 74.4 74.7
73.6 73.9 75.0 60 minutes (%) (0.809, 0.924) (0.470, 0819) (0.629,
0.819) (0.629, 0.819) Pollen Shape (0.816) 82.6 82.6 82.6 82.6 82.5
120 minutes (%) (1.00, 1.00) (1.00, 1.00) (1.00, 1.00) (0.337,
0.819) Pollen Color (0.524) 51.9 52.5 48.9 50.3 53.6 30 minutes (%)
(0.850, 0.960) (0.306, 0.819) (0.573, 0.819) (0.573, 0.819) Pollen
Color (0.332) 75.3 75.9 74.2 74.2 75.9 60 minutes (%) (0.612,
0.819) (0.315, 0.819) (0.315, 0.819) (0.612, 0.819) Pollen Color NA
84.0 84.0 84.0 84.0 84.0 120 minutes (%) Stalk Lodging (%) (0.261)
5.11 5.22 5.00 5.00 5.00 (0.356, 0.819) (0.356, 0.819) (0.356,
0.819) (0.356, 0.819) Root Lodging (%) (0.431) 0.44 0.17 0.72 0.17
0.11 (0.457, 0.819) (0.457, 0.819) (0.457, 0.819) (0.373, 0.819)
Stay Green.sup.i (0.260) 4.67 4.28 3.92 4.17 4.11 (0.250, 0.819)
(0.034.sup.m, 0.819) (0.144, 0.819) (0.106, 0.819) Disease
Incidence.sup.j (0.741) 6.42 6.22 6.17 6.17 6.17 (0.383, 0.819)
(0.265, 0.819) (0.265, 0.819) (0.265, 0.819) Insect Damage.sup.k
(0.627) 7.67 7.78 7.78 7.72 7.56 (0.500, 0.819) (0.0500, 0.819)
(0.736, 0.889) (0.500, 0.819) Days to Maturity (04.87) 2411 2413
2415 2416 2417 (heat units).sup.f (0.558, 0819) ((0.302, 0.819)
(0.185, 0.819) (0.104, 0.819) Plant Height (cm) (0.676) 294 290 290
291 291 (0.206, 0.819) (0.209, 0.819) (0.350, 0.819) (0.286, 0.819)
Ear Height (cm) (0.089) 124 120 118 121 118 (0.089, 0.819)
(0.018.sup.m, 0.786) (0.214, 0.819) (0.016.sup.m, 0.786)
.sup.aOverall treatment effect estimated using an F-test.
.sup.bComparison of the sprayed and unsprayed treatments to the
control using a t-test. .sup.cP-values adjusted using a False
Discovery Rate (FDR) procedure. .sup.dVisual estimate on 1-9 scale;
9 = tall plants with large robust leaves. .sup.e0-100% scale; with
0 = no injury and 100 = dead plant. .sup.fThe number of heat units
that have accumulated from the time of planting. .sup.g0-100%
scale; with % pollen grains with collapsed walls. .sup.h0-100%
scale; with % pollen grains with intense yellow color. .sup.iVisual
estimate on 1-9 scale with 1 no visible green tissue. .sup.jVisual
estimate on 1-9 scale with 1 being poor disease resistance.
.sup.kVisual estimate on 1-9 scale with 1 being poor insect
resistance. .sup.lNA = statistical analysis not performed since no
variability across replicate or treatment. .sup.mStatistical
difference indicated by P-Value <0.05.
Example 6.4 Sample Collection
[0199] Samples for expression and composition analysis were
collected as listed in Table 14.
TABLE-US-00017 TABLE 14 Approx. Samples per Entry Growth Sample
Control Test Entries Block Tissue Stage.sup.a Size Entry 1 2-5 1
Leaf V2-4 3 leaves 3 3 (expression) Leaf V9 3 leaves 3 3
Pollen.sup.b R1 Root.sup.b R1 1 plant 3 3 Leaf.sup.b R1 1 plant 3 3
Forage R4 1 leaf 3 3 Whole Plant R6 2 plants.sup.c 3 3 Grain R6- 2
plants.sup.c 1 3 3 Maturity Growth Sample Control Test Entries
Block Tissue Stage.sup.a Size Entry 1 2-5 2-4 Forage R4 3
plants.sup.c 1 1 (compo- Grain R6- 5 ears sition) Maturity
.sup.aApproximate growth stage. .sup.bThe pollen, root, and leaf
samples collected at R1 collected from the same plant. .sup.cTwo
plants chopped, combined and sub-sampled for expression, or 3
plants for composition
Example 6.5 Determination of Aad-1 Protein in Corn Samples
[0200] Samples of corn were analyzed for the amount of aad-1
protein. Soluble extractable aad-1 protein is quantified using an
enzyme-linked immunosorbent assay (ELISA) kit purchased from Beacon
Analytical System, Inc. (Portland, Me.).
[0201] Samples of corn tissues were isolated from the test plants
and prepared for expression analysis by coarse grinding,
lyophilizing and fine-grinding (if necessary) with a Geno/Grinder
(Certiprep, Metuchen, N.J.). No additional preparation was required
for pollen. The aad-1 protein was extracted from corn tissues with
a phosphate buffered saline solution containing the detergent
Tween-20 (PBST) containing 0.5% Bovine Serum Albumin (BSA). For
pollen, the protein was extracted with a 0.5% PBST/BSA buffer
containing 1 mg/mL of sodium ascorbate and 2% protease inhibitor
cocktail. The plant tissue and pollen extracts were centrifuged;
the aqueous supernatant was collected, diluted with appropriate
buffer if necessary, and analyzed using an aad-1 ELISA kit in a
sandwich format. The kit used the following steps. An aliquot of
the diluted sample and a biotinylated anti-aad-1 monoclonal
antibody are incubated in the wells of a microtiter plate coated
with an immobilized anti-aad-1 monoclonal antibody. These
antibodies bind with aad-1 protein in the wells and form a
"sandwich" with aad-1 protein bound between soluble and the
immobilized antibody. The unbound samples and conjugate are then
removed from the plate by washing with PBST. An excess amount of
streptavidin-enzyme (alkaline phosphatase) conjugate is added to
the wells for incubation. At the end of the incubation period, the
unbound reagents were removed from the plate by washing. Subsequent
addition of an enzyme substrate generated a colored product. Since
the aad-1 was bound in the antibody sandwich, the level of color
development was related to the concentration of aad-1 in the sample
(i.e., lower residue concentrations result in lower color
development). The absorbance at 405 nm was measured using a
Molecular Devices V-max or Spectra Max 190 plate reader. A
calibration curve was generated and the aad-1 concentration in
unknown samples was calculated from the polynomial regression
equation using Soft-MAX Pro.TM. software which was compatible with
the plate reader. Samples were analyzed in duplicate wells with the
average concentration of the duplicate wells being reported.
[0202] A summary of the aad-1 protein concentrations (averaged
across sites) in the various corn matrices is shown in Table 15.
aad-1 average protein concentration ranged from 2.87 ng/mg dry
weight in R1 stage root to 127 ng/mg in pollen. Expression results
for the unsprayed and sprayed plots were similar. The aad-1 protein
was not detected in any control samples, with the exception of one
control root sample from the Indiana site.
TABLE-US-00018 TABLE 15 Summary of Mean Concentration Levels of
aad-1 Protein Measured in the aad-1Unsprayed, aad-1 + Quizalofop,
aad-1 + 2,4-D and aad-1 + Quizalofop and 2,4-D in Maize Tissues
AAD-1 ng/mg Corn Tissue Dry Weight Tissue Treatment Mean Std. Dev.
Range V2-V4 AAD-1 Unsprayed 13.4 8.00 1.98-29.9 Leaf AAD-1 +
Quizalofop 13.3 6.89 4.75-24.5 AAD-1 + 2,4-D 14.2 7.16 4.98-26.7
AAD-1_Quizalofop and 2,4-D 12.3 7.09 4.07-22.5 V9 Leaf AAD-1
Unsprayed 5.96 2.50 2.67-10.9 AAD-1 + Quizalofop 5.38 1.84
2.52-9.15 AAD-1 + 2,4-D 6.37 2.41 3.03-10.9 AAD-1_Quizalofop and
2,4-D 6.52 2.38 3.11-11.1 R1 Leaf AAD-1 Unsprayed 5.57 1.66
3.47-9.34 AAD-1 + Quizalofop 5.70 1.63 2.70-7.78 AAD-1 + 2,4-D 5.99
1.90 2.40-9.42 AAD-1_Quizalofop and 2,4-D 6.06 2.27 1.55-10.2
Pollen AAD-1 Unsprayed 127 36.2 56.3-210 AAD-1 + Quizalofop 108
29.9 52.2-146 AAD-1 + 2,4-D 113 30.2 37.5-137 AAD-1_Quizalofop and
2,4-D 112 32.6 45.4-162 R1 Root AAD-1 Unsprayed 2.92 1.87 0.42-6.10
AAD-1 + Quizalofop 3.09 1.80 0.56-6.06 AAD-1 + 2,4-D 3.92 2.03
0.91-7.62 AAD-1_Quizalofop and 2,4-D 2.87 1.23 1.09-5.56 R4 Forage
AAD-1 Unsprayed 6.87 2.79 2.37-12.1 AAD-1 + Quizalofop 7.16 2.84
3.05-11.6 AAD-1 + 2,4-D 7.32 2.46 2.36-10.6 AAD-1_Quizalofop and
2,4-D 6.84 2.31 2.25-10.3 Whole AAD-1 Unsprayed 4.53 2.55 0.78-8.88
plant AAD-1 + Quizalofop 4.61 2.22 0.75-8.77 AAD-1 + 2,4-D 5.16
2.53 0.83-10.2 AAD-1_Quizalofop and 2,4-D 4.55 1.77 1.30-8.21 Grain
AAD-1 Unsprayed 5.00 1.53 2.66-8.36 AAD-1 + Quizalofop 4.63 1.51
1.07-6.84 AAD-1 + 2,4-D 4.98 1.78 2.94-9.10 AAD-1_Quizalofop and
2,4-D 4.61 1.62 1.81-7.49 .sup.a ND--value less than the method
Limit Of Detection (LOD) .sup.b Values in parentheses are between
the method LOD and Limit Of quantitation (LOQ).
Example 6.6 Compositional Analysis
[0203] Samples of corn forage and grain were analyzed at for
nutrient content with a variety of tests. The analyses performed
for forage included ash, total fat, moisture, protein,
carbohydrate, crude fiber, acid detergent fiber, neutral detergent
fiber, calcium and phosphorus. The analyses performed for grain
included proximates (ash, total fat, moisture, protein,
carbohydrate, crude fiber, acid detergent fiber), neutral detergent
fiber (NDF), minerals, amino acids, fatty acids, vitamins,
secondary metabolites and anti-nutrients. The results of the
nutritional analysis for corn forage and grain were compared with
values reported in literature (see; Watson, 1982 (4); Watson, 1984
(5); ILSI Crop Composition Database, 2006 (6); OECD Consensus
Document on Compositional Considerations for maize, 2002 (7); and
Codex Alimentarius Commission 2001 (8)).
Example 6.6.1 Proximate, Fiber and Mineral Analysis of Forage
[0204] An analysis of the protein, fat, ash, moisture,
carbohydrate, ADF, NDF, calcium and phosphorus in corn forage
samples from the control, unsprayed aad-1, aad-1+quizalofop,
aad-1+2,4-D and aad-1+both entries was performed. A summary of the
results across all locations is shown in Table 16. For the
across-site and individual-site analysis, all proximate, fiber and
mineral mean values were within literature ranges. No statistical
differences were observed in the across-site analysis between the
control and transgenic entries for moisture, ADF, NDF, calcium and
phosphorus. For protein and ash, significant paired t-tests were
observed for the unsprayed AAD-1 (protein), the aad-1+quizalofop
(protein), and aad-1+both (ash), but were not accompanied by
significant overall treatment effects or FDR adjusted p-values. For
fat, both a significant paired t-test and adjusted p-value was
observed for aad-1+quizalofop compared with the control, but a
significant overall treatment effect was not observed. For
carbohydrates, a statistically significant overall treatment
effect, paired t-test and FDR adjusted p-value was observed between
the aad-1+quizalofop and the control. Also for carbohydrates, a
significant paired t-test for the unsprayed aad-1 entry was
observed, but without a significant FDR adjusted p-value. These
differences are not biologically meaningful since all across-site
results for these analytes were within the reported literature
ranges for corn, and differences from the control were small
(<23%).
TABLE-US-00019 TABLE 16 Summary of the Proximate, Fiber and Mineral
Analysis of Corn Forage from All Sites. Overall Sprayed Sprayed
Sprayed Treatment Unsprayed Quizalofop 2,4-D Both Literature Effect
(P-value.sup.c (P-value, (P-value, (P-value, Values.sup.a (Pr >
F).sup.b Control Adj. P).sup.d Adj. P) Adj. P) Adj. P) Proximate (%
dry weight) Protein 3.14-15.9 (0.054) 7.65 6.51 6.41 7.17 7.13
(0.016.sup.c, 0.066) (0.010.sup.c, 0.051) (0.285, 0.450) (0.245,
0.402) Fat 0.296-6.7 (0.068) 2.29 2.08 1.78 2.10 2.01 (0.202,
0.357) (0.005.sup.e, 0.028.sup.e) (0.233, 0.391) (0.093, 0.213) Ash
1.3-10.5 (0.072) 3.90 3.84 4.03 3.99 4.40 (0.742, 0.859) (0.525,
0.708) (0.673, 0.799) (0.019e, 0.069) Moisture 53.3-87.5 (0.819)
69.5 69.2 69.5 69.8 70.0 (0.651, 0.782) (0.988, 0.988) (0.699,
0.820) (0.501, 0.687) Carbohydrates 66.9-94.5 (0.026.sup.e) 86.1
87.6 87.8 86.8 86.5 (0.015.sup.e, 0.061) (0.006.sup.e, 0.034.sup.e)
(0.262, 0.424) (0.538, 0.708) Fiber (% dry weight) Acid 16.1-47.4
(0.968) 26.5 26.6 26.8 26.0 26.8 Detergent (0.925, 0.970) (0.833,
0.925) (0.677, 0.800) (0.851, 0.937) Fiber (ADF) Neutral 20.3-63.7
(0.345) 41.6 43.6 43.3 41.3 41.6 Detergent (0.169, 0.322) (0.242,
0.402) (0.809, 0.911) (0.978, 0.985) Fiber (NDF) Minerals (% dry
weight) Calcium 0.071-0.6 (0.321) 0.212 0.203 0.210 0.215 0.231
(0.532, 0.708) (0.930, 0.970) (0.815, 0.911) (0.150, 0.296)
Phosphorus 0.094-0.55 (0.163) 0.197 0.189 0.202 0.203 0.200 (0.198,
0.354) (0.427, 0.615) (0.288, 0.450) (0.608, 0.762) .sup.aCombined
range. .sup.bOverall treatment effect estimated using an F-test.
.sup.cComparison of the transgenic treatments to the control using
t-tests. .sup.dP-values adjusted using a False Discovery Rate (FDR)
procedure. .sup.eStatistical difference indicated by P-value
<0.05.
Example 6.6.2 Proximate and Fiber Analysis of Grain
[0205] A summary of the results for proximates (protein, fat, ash,
moisture, cholesterol and carbohydrates) and fiber (ADF, NDF and
total dietary fiber) in corn grain across all locations is shown in
Table 17. All results for proximates and fiber were within
literature ranges, and no significant differences in the
across-site analysis were observed between the control and
transgenic entries for fat, ash, NDF and total dietary fiber. For
moisture, a significant overall treatment effect was observed, but
not accompanied by significant paired t-tests or FDR adjusted
p-values. For ADF, a significant paired t-test was observed for
aad-1+both, but no significant overall treatment effect or FDR
adjusted p-value was seen. For both protein and carbohydrates,
significant pair-tests, adjusted p-values and overall treatment
effects were found for the unsprayed aad-1, aad-1+quizalofop, and
aad-1+both. Since these differences were small (<12%) and all
values were within literature ranges, the differences are not
considered biologically meaningful.
TABLE-US-00020 TABLE 17 Summary of the Proximate and Fiber Analysis
of Corn Grain from All Sites. Overall Sprayed Sprayed Sprayed
Treatment Unsprayed Quizalofop 2,4-D Both Literature Effect
(P-value.sup.c (P-value, (P-value, (P-value, Values.sup.a (Pr >
F).sup.b Control Adj. P).sup.d Adj. P) Adj. P) Adj. P) Proximate (%
dry weight) Protein 6-17.3 (0.003.sup.e) 9.97 10.9 11.1 10.5 10.9
(0.002.sup.e, 0.016.sup.e) (0.0004.sup.e, 0.013.sup.e) (0.061,
0.161) (0.002.sup.e, 0.015.sup.e) Fat 1.2-18.8 (0.369) 4.26 4.19
4.16 4.26 4.22 (0.238, 0.397) (0.095, 0.215) (0.955, 0.977) (0.427,
0.615) Ash 0.62-6.28 (0.553) 1.45 1.55 1.52 1.45 1.51 (0.178,
0.330) (0.364, 0.557) (0.982, 0.985) (0.397, 0.587) Moisture
6.1-40.5 (0.038.sup.e) 25.1 25.5 24.4 24.5 24.5 (0.406, 0.594)
(0.056, 0.152) (0.117, 0.254) (0.114, 0.250) Cholesterol NR.sup.f
NA.sup.g <LOQ <LOQ <LOQ <LOQ <LOQ Carbohydrate
63.3-89.8 (0.005.sup.e) 84.3 83.3 83.2 83.8 83.4 (0.002.sup.e,
0.015.sup.e)) (0.001.sup.e, 0.013.sup.e) (0.074, 0.185)
(0.003.sup.e, 0.019.sup.e) Fiber (% dry weight) Acid 1.82-11.3
(0.247) 4.23 3.94 3.99 3.89 3.82 Detergent (0.130, 0.269) (0.197,
0.354) (0.078, 0.193) (0.035.sup.e, 0.106) Fiber (ADF) Neutral
5.59-22.6 (0.442) 10.6 10.3 9.89 9.90 10.3 Detergent (0.455, 0.638)
(0.120, 0.254) (0.121, 0.254) (0.552, 0.708) Fiber (NDF) Total
Dietary 8.3-35.3 (0.579) 13.4 12.8 12.9 13.1 12.9 Fiber (0.164,
0.313) (0.195, 0.353) (0.487, 0.679) (0.215, 0.370) .sup.aCombined
range. .sup.bOverall treatment effect estimated using an F-test.
.sup.ccomparison of the transgenic treatments to the control using
t-tests. .sup.dP-values adjusted using a False Discovery Rate (FDR)
procedure. .sup.eStatistical difference indicated by P-Value
<0.05. .sup.fNR = not reported. .sup.gNA = statistical analysis
was snot performed since a majority of the data was <LOQ.
Example 6.6.3 Mineral Analysis of Grain
[0206] An analysis of corn grain samples for the minerals calcium,
chromium, copper, iodine, iron, magnesium, manganese, molybdenum,
phosphorus, potassium, selenium, sodium, and zinc was performed. A
summary of the results across all locations is shown in Table 18.
All results were within the reported literature ranges. For the
across-site analysis, no significant differences were observed for
calcium, copper, iron, and potassium. Mean results for chromium,
iodine, selenium and sodium were below the limit of quantitation of
the method. For magnesium and phosphorus, significant paired
t-tests were observed for the unsprayed aad-1 and the
aad-1+quizalofop entries, but were not accompanied by significant
overall treatment effects or FDR adjusted p-values. For manganese
and molybdenum, a significant paired t-test was observed for the
unsprayed aad-1, but a significant FDR adjusted p-value and overall
treatment effect was not found. For the aad-1+both entry, a
significant paired t-test was observed for zinc, but a significant
FDR adjusted p-value or overall treatment effect was not present.
Additionally, these differences from the control were small
(<13%), and all values were within literature ranges, when
available.
TABLE-US-00021 TABLE 18 Summary of the Mineral Analysis of Corn
Grain from All Sites. Overall Sprayed Sprayed Sprayed Minerals
Treatment Unsprayed Quizalofop 2,4-D Both (mg/100 g Literature
Effect (P-value.sup.c (P-value, (P-value, (P-value, dry wt.)
Values.sup.a (Pr > F).sup.b Control Adj. P).sup.d Adj. P) Adj.
P) Adj. P) Calcium 1.27-100 (0.493) 4.05 4.21 4.12 4.04 4.06
(0.146, 0.289) (0.505, 0.687) (0.944, 0977) (0898, 0.957) Chromium
0.006-0.016 NA.sup.e <LOQ <LOQ <LOQ <LOQ <LOQ Copper
0073-1.85 (0963) 0.144 0.151 0.146 0.141 0.149 (0.655, 0.782)
(0.890, 0.957) (0.817, 0.911) (0.749, 0863) Iodine 7.3-81 NA
<LOQ <LOQ <LOQ <LOQ <LOQ Iron 0.1-10 (0.333) 2.49
2.60 2.56 2.51 2.59 (0.086, 0.206) (0.310, 0.482) (0.801, 0.911)
(0.145, 0.289) Magnesium 59.4-1000 (0.072) 122 129 128 126 127
(0.010.sup.f, 0.051) (0.017.sup.f, 0.066) (0.145, 0.289) (0.070,
0.177) Manganese 0.07-5.4 (0.099) 0.525 0.551 0.524 0.526 0.532
(0.025.sup.f, 0.082) (0.884, 0.957) (0.942, 0.977) (0.505, 0.687)
Molybdenum NR (0.143) 261 229 236 244 234 (0.020.sup.f, 0.072)
(0.067, 0.173) (0.206, 0.362) (0.046, 0.132) Phosphorus 147-750
(0.102) 289 303 300 299 298 (0.012.sup.f, 0.057) (0.035.sup.f,
0.106) (0.055, 0.150) (0.085, 0.206) Potassium 181-720 (0.453) 362
368 359 364 357 (0.330, 0.510) (0.655, 0.782) (0.722, 0.839)
(0.454, 0.638) Selenium 0.001-01 NA <LOQ <LOQ <LOQ <LOQ
<LOQ Sodium 0-150 NA <LOQ <LOQ <LOQ <LOQ <LOQ
Zinc 0.65-3.72 (0.166) 2.26 2.32 2.34 2.29 2.37 (0.183, 0.336)
(0.108, 0.238) (0.627, 0.768) (0.027.sup.f, 0.085) .sup.aCombined
range. .sup.bOverall treatment effect estimated using an F-test.
.sup.cComparison of the transgenic treatments to the control using
t-tests. .sup.dP-values adjusted using a False Discovery Rate (FDR)
procedure .sup.eNA = statistical analyusis was not performed since
a majority fo the data was <LOQ. .sup.fStatistical difference
indicated by P-value <0.05.
Example 6.6.4 Amino Acid Analysis of Grain
[0207] Corn samples were analyzed for amino acid content in the
control, unsprayed aad-1, aad-1+quizalofop, aad-1+2,4-D and
aad-1+both corn, and a summary of the results over all locations
and by individual field site are shown in Table 19. Levels of all
amino acids were within the reported literature ranges, and no
significant differences in the across-site analysis were observed
for arginine, lysine, and tyrosine. Significant differences were
observed for several of the amino acids in the across-site
analysis. In these instances, the amino acid content of the control
was lower than the aad-1 transgenic lines, which may be related to
the overall lower protein content in the control grain compared
with the aad-1 lines. For the unsprayed aad-1 entry, significant
overall treatment effects along with significant paired t-tests and
FDR adjusted p-values were found for all amino acids except
arginine, glycine, lysine, tryptophan and tyrosine. For the
aad-1+quizalofop entry, significant overall treatment effects along
with significant paired t-tests and FDR adjusted p-values were
found for all amino acids except arginine, cysteine, glycine,
lysine, tryptophan and tyrosine. For the aad-1+2,4-D entry,
significant overall treatment effects along with significant paired
t-tests (with significant FDR adjusted p-values) were found for all
amino acids except arginine, aspartic acid, glycine, histidine,
lysine, tyrosine and valine. For the aad-1+both entry, significant
overall treatment effects along with significant paired t-tests and
FDR adjusted p-values were found for all amino acids except
arginine, glycine, lysine, serine, tryptophan and tyrosine.
Although there were many differences observed for amino acids, the
differences were small (<15%), not observed across all sites,
and all mean values were within reported literature ranges.
TABLE-US-00022 TABLE 19 Summary of the Amino Acid Analysis of Corn
Grain from All Sites. Overall Sprayed Sprayed Sprayed Treatment
Unsprayed Quizalofop 2,4-D Both Amino Acids Literature Effect
(P-value.sup.c (P-value, (P-value, (P-value, (% dry wt.)
Values.sup.a (Pr > F).sup.b Control Adj. P).sup.d Adj. P) Adj.
P) Adj. P) Alanine 0.44-1.39 (0.002.sup.e) 0.806 0.901 0.900 0.863
0.894 (0.0005.sup.e, 0.013.sup.e) (0.005.sup.e, 0.013.sup.e)
(0.021.sup.e, 0.074) (0.001.sup.e, 0.013.sup.e) Arginine 0.12-0.64
(0.371) 0486 0.499 0.505 0.487 0.484 (0.286, 0.450) (0.139, 0.283)
(0.929, 0.970) (0.897, 0.957) Aspartic 0.34-1.21 (0.010.sup.e)
0.712 0.768 0.764 0.743 0.762 Acid (0.002.sup.e, 0.015.sup.e)
(0.003.sup.e, 0.021) (0.060, 0.160) (0.004.sup.e, 0.027.sup.e)
Cysteine 0.08-0.51 (0.033.sup.e) 0.213 0.225 0.223 0.223 0.226
(0.009.sup.e, 0.050.sup.e) (0.020.sup.e, 0.072) (0.018.sup.e,
0.067) (0.005.sup.e, 0.028.sup.e) Glutamic 0.97-3.54 (0.001.sup.e)
1.97 2.22 2.21 2.12 2.20 Acid (0.0003.sup.e, 0.013.sup.e) (0.0004,
0.013.sup.e) (0.017.sup.e, 0.067) (0.001.sup.e, 0.013.sup.e)
Glycine 0.18-0.54 (0.052) 0.383 0.397 0.398 0.390 0.397
(0.018.sup.e, 0.067) (0.013.sup.e, 0.059) (0.217, 0.371)
(0.016.sup.e, 0.066) Histidine 0.14-0.43 (0.005.sup.e) 0.283 0.303
0.302 0.295 0.302 (0.001.sup.e, 0.013.sup.e) (0.002.sup.e,
0.014.sup.e) (0.036, 0.109) (0.002.sup.e, 0.014.sup.e) Isoleucine
0.18-0.71 (0.003.sup.e) 0.386 0.427 0.427 0.410 0.431 (0.001.sup.e,
0.014.sup.e) (0.001.sup.e, 0.014.sup.e) (0.044.sup.e, 0127)
(0.001.sup.e, 0.013.sup.e) Leucine 0.64-2.49 (0.001.sup.e) 1.35
1.54 1.54 1.47 1.53 (0.0003.sup.e, 0.013.sup.e) (0.003.sup.e,
0.013.sup.e) (0.013.sup.e, 0.059) (0.001.sup.e, 0.013.sup.e) Lysine
0.05-056 (0.211) 0.310 0.315 0.316 0.309 0.316 (0.210, 0.367)
(0.128, 0.265) (0.879, 0.956) (0.102, 0.226) Methionine 0.10-0.47
(0.003.sup.e) 0.195 0.209 0.209 0.205 0.208 (0.001.sup.e,
0.013.sup.e) (0.001e, 0.013.sup.e) (0.014.sup.e, 0.061)
(0.001.sup.e, 0.014.sup.e) Phenyl- 0.24-0.93 (0.002.sup.e) 0551
0.617 0.619 0.592 0.615 alanine (0.001.sup.e, 0.013.sup.e)
(0.001.sup.e, 0.013.sup.e) (0.023.sup.e, 0.077) (0.001.sup.e,
0.013.sup.e) Proline 0.46-1.63 (0.002.sup.e) 0.910 1.01 1.01 0.975
0.997 (0.0004.sup.e, 0.013.sup.e) (0.001.sup.e, 0.013.sup.e)
(0.012.sup.e, 0.059) (0.001.sup.e, 0.014.sup.e) Serine 0.24-0.91
(0.009.sup.e) 0.498 0.550 0.550 0.529 0.536 (0.002.sup.e,
0.014.sup.e) (0.001.sup.e, 0.014.sup.e) (0.042.sup.e, 0.122)
(0.015.sup.e, 0.061) Threonine 0.22-0.67 (0.005.sup.e) 0.364 0394
0394 0.384 0.390 (0.001.sup.e, 0.014.sup.e) (0.001e, 0.013.sup.e)
(0.023.sup.e, 0.077) (0.003.sup.e, 0.020.sup.e) Tryptophan
0.03-0.22 0.088) 0.052 0.055 0.056 0.056 0.056 (0.067, 0.173)
(0.025.sup.e, 0.082) (0.014.sup.e, 0.060) (0.029.sup.e, 0.092)
Tyrosine 0.10-0.79 (0.390) 0.336 0.355 0.375 0.339 0.314 (0.535,
0.708) (0.214, 0.370) (0.907, 0.964) (0.500, 0.687) Valine
0.21-0.86 (0.005.sup.e) 0.495 0.537 0.538 0.519 0.538 (0.002.sup.e,
0.014.sup.e) (0.002.sup.e, 0.014.sup.e) (0.054, 0.148)
(0.001.sup.e, 0.014.sup.e) .sup.aCombined range. .sup.bOverall
treatment effect estimated using an F-test. .sup.cComparison of the
transgenic treatments to the control using t-tests. .sup.dP-values
adjusted using a False Discovery Rate (FDR) procedure
.sup.eStatistical difference indicated by P-value <0.05.
Example 6.6.5 Fatty Acid Analysis of Grain
[0208] An analysis of corn grain samples for fatty acids was
performed. A summary of the results across all locations is shown
in Table 20. All results for the control, unsprayed aad-1,
aad-1+quizalofop, aad-1+2,4-D and aad-1+both corn grain samples
analyzed for these fatty acids were within the published literature
ranges. Results for caprylic (8:0), capric (10:0), lauric (12:0),
myristic (14:0), myristoleic (14:1), pentadecanoic (15:0),
pentadecenoic (15:1), heptadecanoic (17:0), heptadecanoic (17:1),
gamma linolenic (18:3), eicosadienoic (20:2), eicosatrienoic
(20:3), and arachidonic (20:4) were below the method Limit of
Quantitation (LOQ). In the across-site analysis, no significant
differences were observed for 16:0 palmitic, 16:1 pamitoleic, 18:0
stearic, 18:2 linoleic, 18:3 linolenic, and 20:0 arachidic. For
18:1 oleic and 20:1 eicosenoic, significant paired t-tests were
observed for the unsprayed aad-1 (18:1) and the aad-1+2,4-D (18:1
and 20:1) entries, but were not accompanied by significant overall
treatment effects or FDR adjusted p-values. For 22:0 behenic, a
significant overall treatment effect and significant paired t-tests
for aad-1+2,4-D and aad-1+both were found, but significant FDR
adjusted p-values were not present.
TABLE-US-00023 TABLE 20 Summary of the Fatty Acid Analysis of Corn
Grain from All Sites. Overall Sprayed Sprayed Sprayed Fatty Acids
Treatment Unsprayed Quizalofop 2,4-D Both (% total Literature
Effect (P-value.sup.d (P-value, (P-value, (P-value, fatty
acids).sup.a Values.sup.b (Pr > F).sup.c Control Adj. P).sup.e
Adj. P) Adj. P) Adj. P) 8:0 Caparylic 0.13-0.34 NA.sup.f <LOQ
<LOQ <LOQ <LOQ <LOQ 10:0 Capric ND NA <LOQ <LOQ
<LOQ <LOQ <LOQ 12:0 Lauric ND-0.687 NA <LOQ <LOQ
<LOQ <LOQ <LOQ 14:0 Myristic ND-0.3 NA <LOQ <LOQ
<LOQ <LOQ <LOQ 14.1 Myristoleic NR NA <LOQ <LOQ
<LOQ <LOQ <LOQ 15:0 Pentadecanoic NR NA <LOQ <LOQ
<LOQ <LOQ <LOQ 15:1 Pentadecenoic NR NA <LOQ <LOQ
<LOQ <LOQ <LOQ 16:0 Palmitic 7-20.7 (0.559) 9.83 9.88 9.95
9.78 9.90 (0.618, 0.763) (0.280, 0.445) (0.617, 0.763) (0.544,
0.708) 16:1 Palmitoleic ND-1.0 (0.552) 0.056 0.044 0.047 0.041
0.079 (0.804, 0.911) (0.551, 0.708) (0.555, 0.708) (0.392, 0.582)
17:0 Heptadecanoic ND-0.11 NA <LOQ <LOQ <LOQ <LOQ
<LOQ 17:1 Heptadecenoic ND-0.1 NA <LOQ <LOQ <LOQ
<LOQ <LOQ 18:0 Stearic ND-3.4 (0.561) 2.04 1.98 2.01 2.00
2.02 (0.119, 0.254) (0.437, 0.626) (0.259, 0.421) (0.598, 0.756)
18:1 Oleic 17.4-46 (0.076) 31.3 30.4 30.8 30.4 30.7 (0.013.sup.g,
0.059) (0.178, 0.329) (0.015.sup.g, 0.061) (0092, 0.213) 18:2
Linoleic 34.0-70 (0.474) 47.5 48.3 48.4 48.0 48.5 (0.189, 0.345)
(0.144, 0.289) (0.453, 0.638) (0.119, 0.254) 18:3 Gamma NR NA
<LOQ <LOQ <LOQ <LOQ <LOQ Linolenic 18:3 Linoleic
ND-2.25 (0.479) 1.04 1.05 1.06 1.04 1.06 (0.537, 0.708) (0.202,
0.357) (0.842, 0.932) (0.266, 0.428) 20:4 Arachidonic 0.1-2 (0.379)
0.400 0.386 0.393 0.390 0.390 (0.061, 0.161) (0.341, 0.525) (0.153,
0.297) (0.175, 0.328) 20:1 Eicosenoic 0.17-1.92 (0.107) 0.232 0.226
0.230 0.223 0.227 (0.089, 0.210) (0.497, 0.687) (.013.sup.g, 0.059)
(0.121, 0.254) 20:2 Eicosadienoic ND-0.53 NA <LOQ <LOQ
<LOQ <LOQ <LOQ 20:3 Eicosatrienoic 0.275 NA <LOQ
<LOQ <LOQ <LOQ <LOQ 20:4 Arachidonic 0.465 NA <LOQ
<LOQ <LOQ <LOQ <LOQ 22:0 Behemic ND-0.5 (0.044.sup.g)
0.136 0.088 0.076 0.086 0.108 (0.093, 0.213) (0.887, 0.957)
(0011.sup.g, 0.054) (0.023.sup.g. 0.077) .sup.aResults converted
from unites of % dry weight to % fatty acids. .sup.bCombined range.
.sup.cOverall treatment effect estimated using an F-test.
.sup.dComparison of the transgenic treatments to the control using
t-tests. .sup.e P-values adjusted using a False Discovery rate
(FDR) procedure. .sup.fNA = statistical analysis was not performed
since a majority of the data was <LOQ. .sup.gStatistical
difference indicated by P-value <0.05.
Example 6.6.6. Vitamin Analysis of Grain
[0209] The levels of vitamin A, B1, B2, B5, B6, B12, C, D, E,
niacin, and folic acid in corn grain samples from the control,
unsprayed aad-1, aad-1+quizalofop, aad-1+2,4-D and aad-1+both corn
entries were determined. A summary of the results across all
locations is shown in Table 21. Vitamins B12, D and E were not
quantifiable by the analytical methods used. All mean results
reported for vitamins were similar to reported literature values,
when available. Results for the vitamins without reported
literature ranges (vitamins B5 and C) were similar to control
values obtained (<22% difference from control). For the
across-site analysis, no statistical differences were observed,
with the exception of vitamins B 1, C and niacin. Significant
paired t-tests for Vitamins B1 were observed between the control
and unsprayed aad-1, aad-1+quizalofop, and aad-1+both, but were not
accompanied by significant overall treatment effects or FDR
adjusted p-values. For vitamin C, a significant overall treatment
effect was observed along with significant paired t-tests and FDR
adjusted p-values for aad-1+quizalofop and aad-1+2,4-D. Similarly
for niacin, a significant overall treatment effect was observed
along with significant paired t-tests and FDR adjusted p-values for
aad-1+quizalofop and aad-1+both. A significant paired t-test for
the aad-1+2,4-D was also found for niacin for the aad-1+2,4-D
entry, but was not accompanied by a significant overall treatment
effect or FDR adjusted p-value. Since the differences were not
observed across sites and values were within literature ranges
(when available), the differences are not considered biologically
meaningful.
TABLE-US-00024 TABLE 21 Summary of Vitamin Analysis of Corn Grain
from All Sites. Overall Sprayed Sprayed Sprayed Vitamins Treatment
Unsprayed Quizalofop 2,4-D Both (mg/kg Literature Effect
(P-value.sup.c (P-value, (P-value, (P-value, dry weight)
Values.sup.b (Pr > F).sup.b Control Adj. P).sup.d Adj. P) Adj.
P) Adj. P) Beta Carotene 0.19-46.8 (0.649) 1.80 1.85 1.80 1.82 1.87
(Vitamin A) (0.372, 0.566) (0.967, 0.983) (0770, 0.883) (0.221,
0.376) Vitam B1 1.3-40 (0.068) 3.47 3.63 3.67 3.54 3.64 (Thiamin)
(00.041.sup.e, 0.121) (0.013.sup.e, 0.059) (0.375, 0.567)
(0.032.sup.e, 0.100) Vitamin B2 0.25-5.6 (0.803) 2.15 2.05 2.08
1.99 2.07 (Riboflavin) (0.443, 0.631) (0.600, 0.756) (0.227, 0.383)
(0.543, 0.708) Vitamin B5 NR.sup.f (0.820) 5.28 5.17 5.09 5.29 5.10
(Pantothenic acid) (0.623, 0.766) (0.391, 0.582) (0.968, 0.983)
(0.424, 0.615) Vitamin B6 3.68-11.3 (0.431) 6.52 6.57 6.66 6.66
7.08 (Pyridoxine) (0.859, 0.938) (0.652, 0.782) (0.652, 0.782)
(0.088, 0.210) Vitamin B12 NR NA.sup.g <LOQ <LOQ <LOQ
<LOQ <LOQ Vitamin C NR (0.018.sup.c) 22.4 21.2 17.5 18.0 20.4
(0.268, 0.429) (0.005.sup.c, 0.028.sup.e) (0.004.sup.c,
0.026.sup.c) (0.068, 0.173) Vitamin D NR NA <LOQ <LOQ <LOQ
<LOQ <LOQ Vitamin E (alpha 1.5-68.7 (0.558) <LOQ <LOQ
<LOQ <LOQ <LOQ Tocopherol) Niacin (Nicotinic 9.3-70
(0.013.sup.e) 26.1 24.2 22.9 23.7 22.9 acid, Vit. B3) (0.050,
0.140) (0.002.sup.e, 0.017 ) (0.018.sup.e, 0.067) (0.002.sup.e,
0.016.sup.e) Folic Acid 0.15-683 (0.881) 0.594 0.588 0.574 0.592
0.597 (0.779, 0.890) (0.403, 0.592) (0.931, 0.970) (0.916, 0.970)
.sup.aCombined range. .sup.bOverall treatment effect estimated
using an F-test. .sup.ccomparison of the transgenic treatments to
the control using t-tests. .sup.dP-values adjusted using a False
Discovery Rate (FDR) procedure. .sup.eStatistical difference
indicated by P-value <0.05. .sup.fNR = not reported. .sup.gNA =
statistical analysis was not performed since a majority of the data
was <LOQ.
Example 6.6.7 Anti-Nutrient and Secondary Metabolite Analysis of
Grain
[0210] The secondary metabolite (coumaric acid, ferulic acid,
furfural and inositol) and anti-nutrient (phytic acid, raffinose,
and trypsin inhibitor) levels in corn grain samples from the
control, unsprayed aad-1, aad-1+quizalofop, aad-1+2,4-D and
aad-1+both corn entries were determined. A summary of the results
across all locations is shown in Table 22 and 23. For the
across-site analysis, all values were within literature ranges. No
significant differences between the aad-1 entries and the control
entry results were observed in the across-site analysis for
inositol and trypsin inhibitor. Results for furfural and raffinose
were below the method's limit of quantitation. Significant paired
t-tests were observed for coumaric acid (unsprayed aad-1,
aad-1+2,4-D and aad-1+both), and ferulic acid (aad-1+quizalofop and
aad-1+both). These differences were not accompanied by significant
overall treatment effects or FDR adjusted p-values and were similar
to the control (<10% difference). A significant overall
treatment effect, paired t-test, and FDR adjusted p-value was found
for phytic acid (unsprayed aad-1). Since all results were within
literature ranges and similar to the control (<11% difference),
these differences are not considered to be biologically
meaningful.
TABLE-US-00025 TABLE 22 Summary of Secondary Metabolite Analysis of
Corn Grain from All Sites. Overall Sprayed Sprayed Sprayed
Secondary Treatment Unsprayed Quizalofop 2,4-D Both Metabolite
Literature Effect (P-value.sup.c (P-value, (P-value, (P-value, (%
dry weight) Values.sup.a (Pr > F).sup.b Control Adj. P).sup.d
Adj. P) Adj. P) Adj. P) Coumaric Acid 0.003- (0.119) 0.021 0.020
0.020 0.019 0.020 0.058 (0.038 , (0.090, (0.022 , (0.029 , 0.113)
0.211) 0.074) 0.091) Ferulic Acid 0.02- (0.077) 0.208 0.199 0.196
0.200 0.197 0.389 (0.051, (0.010 , (0.080, (0.019 , 0.141) 0.051)
0.196) 0.069) Furfural 0.0003- NA.sup.f <LOQ <LOQ <LOQ
<LOQ <LOQ 0.0006 Inositol 0.0089- (0.734) 0.218 0.224 0.218
0.213 0.211 0.377 (0.548, (0.973, (0.612, (0.526, 0.708) 0.984)
0.763) 0.708) .sup.aCombined range. .sup.bOverall treatment effect
estimated using an F-test. .sup.cComparison of the transgenic
treatments to the control using t-tests. .sup.dP-values adjusted
using a False Discovery Rate (FDR) procedure. .sup.eStatistical
difference indicated by P-value <0.05. .sup.fNA = statistical
analysis was not performed since a majority of the data was
<LOQ. indicates data missing or illegible when filed
TABLE-US-00026 TABLE 23 Summary of Anti-Nutrient Analysis of Corn
Grain from All Sites. Overall Sprayed Sprayed Sprayed Treatment
Unsprayed Quizalofop 2,4-D Both Anti-Nutrient Literature Effect
(P-value.sup.c (P-value, (P-value, (P-value, (% dry weight)
Values.sup.a (Pr > F).sup.b Control Adj. P).sup.d Adj. P) Adj.
P) Adj. P) Phytic Acid 0.11- (0.046.sup.e) 0.727 0.806 0.767 0.755
0.761 1.57 (0.003.sup.e, (0.099, (0.245, (0.158, 0.020.sup.e)
0.224) 0.402) 0.304) Raffinose 0.02- NA.sup.f <LOQ <LOQ
<LOQ <LOQ <LOQ 0.32 Trypsin Inhibitor 1.09- (0.742) 5.08
5.10 4.87 5.45 5.18 (TIU/mg) 7.18 (0.954, (0.631, (0.387, (0.813,
0.977) 0.770) 0.582) 0.911) .sup.aCombined range. .sup.bOverall
treatment effect estimated using an F-test. .sup.cComparison of the
transgenic treatments to the control using t-tests. .sup.dP-values
adjusted using a False Discovery Rate (FDR) procedure.
.sup.eStatistical difference indicated by P-value <0.05.
.sup.fNA = statistical analysis was not performed since a majority
of the data was <LOQ.
Example 7 Additional Agronomic Trials
[0211] Agronomic characteristics of corn line 40278 compared to a
near-isoline corn line were evaluated across diverse environments.
Treatments included 4 genetically distinct hybrids and their
appropriate near-isoline control hybrids tested across a total of
21 locations.
[0212] The four test hybrids were medium to late maturity hybrids
ranging from 99 to 113 day relative maturity. Experiment A tested
event DAS-40278-9 in the genetic background Inbred C.times.BC3S1
conversion. This hybrid has a relative maturity of 109 days and was
tested at 16 locations (Table 24). Experiment B tested the hybrid
background Inbred E.times.BC3S1 conversion, a 113 day relative
maturity hybrid. This hybrid was tested at 14 locations, using a
slightly different set of locations than Experiment A (Table 24).
Experiments C and D tested hybrid backgrounds BC2S1
conversion.times.Inbred D and BC2S1 conversion.times.Inbred F,
respectively. Both of these hybrids have a 99 day relative maturity
and were tested at the same 10 locations.
TABLE-US-00027 TABLE 24 Locations of agronomic trials Experiment
Location 2A 2B 2C 2D Atlantic, IA X X Fort Dodge, IA X X X X
Huxley, IA X X X X Nora Springs, IA X Wyman, IA X X Lincoln, IL X
Pontiac, IL X X X X Princeton, IL X X Seymour, IL X Shannon, IL X X
X Viola, IL X X Bremen, IN X X X X Evansville, IN X Fowler, IN X X
X X Mt. Vernon, IN X Olivia, MN X X Wayne, NE X X York, NE X X
Arlington, WI X X X Patteville, WI X X X Watertown, WI X X
[0213] For each trial, a randomized complete block design was used
with two replications per location and two row plots. Row length
was 20 feet and each row was seeded at 34 seeds per row. Standard
regional agronomic practices were used in the management of the
trials.
[0214] Data were collected and analyzed for eight agronomic
characteristics; plant height, ear height, stalk lodging, root
lodging, final population, grain moisture, test weight, and yield.
The parameters plant height and ear height provide information
about the appearance of the hybrids. The agronomic characteristics
of percent stalk lodging and root lodging determine the
harvestability of a hybrid. Final population count measures seed
quality and seasonal growing conditions that affect yield. Percent
grain moisture at harvest defines the maturity of the hybrid, and
yield (bushels/acre adjusted for moisture) and test weight (weight
in pounds of a bushel of corn adjusted to 15.5% moisture) describe
the reproductive capability of the hybrid.
[0215] Analysis of variance was conducted across the field sites
using a linear model. Entry and location were included in the model
as fixed effects. Mixed models including location and location by
entry as random effects were explored, but location by entry
explained only a small portion of variance and its variance
component was often not significantly different from zero. For
stock and root lodging a logarithmic transformation was used to
stabilize the variance, however means and ranges are reported on
the original scale. Significant differences were declared at the
95% confidence level. The significance of an overall treatment
effect was estimated using a t-test.
[0216] Results from these agronomic characterization trials can be
found in Table 25. No statistically significant differences were
found for any of the four 40278 hybrids compared to the isoline
controls (at p<0.05) for the parameters of ear height, stalk
lodging, root lodging, grain moisture, test weight, and yield.
Final population count and plant height were statistically
different in Experiments A and B, respectively, but similar
differences were not seen in comparisons with the other 40278
hybrids tested. Some of the variation seen may be due to low levels
of genetic variability remaining from the backcrossing of the
DAS-40278-9 event into the elite inbred lines. The overall range of
values for the measured parameters are all within the range of
values obtained for traditional corn hybrids and would not lead to
a conclusion of increased weediness. In summary, agronomic
characterization data indicate that 40278 corn is biologically
equivalent to conventional corn.
TABLE-US-00028 TABLE 25 Analysis of agronomic characteristics
Treat- Range P- Parameter (units) ment Mean Min Max value
Experiment A Plant Height (inches) AAD-1 96.31 94.00 99.00 0.6174
Control 95.41 95.00 98.00 Ear Height (inches) AAD-1 41.08 30.00
48.00 0.4538 Control 44.42 40.00 47.00 Stalk Lodging (%) AAD-1 3.64
0.00 27.70 0.2020 Control 2.49 0.00 28.57 Root Lodging (%) AAD-1
1.00 0.00 7.81 0.7658 Control 0.89 0.00 28.33 Final Population
AAD-1 31.06 27.00 36.00 0.0230 (plants/acre in 1000's) Control
32.17 27.00 36.00 Grain Moisture (%) AAD-1 22.10 14.32 27.80 0.5132
Control 21.84 14.52 31.00 Test Weight (lb/ AAD-1 54.94 51.10 56.80
0.4123 bushel) Control 54.66 51.00 56.80 Yield (bushels/acre) AAD-1
193.50 138.85 229.38 0.9712 Control 187.05 99.87 256.72 Experiment
B Plant Height (inches) AAD-1 106.92 104.00 108.00 0.0178 Control
100.79 95.00 104.00 Ear Height (inches) AAD-1 51.75 49.00 50.00
0.1552 Control 45.63 38.00 50.00 Stalk Lodging (%) AAD-1 1.24 0.00
15.07 0.1513 Control 0.72 0.00 22.22 Root Lodging (%) AAD-1 0.64
0.00 6.15 0.2498 Control 0.40 0.00 9.09 Final Population AAD-1
31.30 26.00 37.00 0.4001 (plants/acre in 1000's) Control 30.98
25.00 35.00 Grain Moisture (%) AAD-1 23.71 14.34 28.70 0.9869
Control 23.72 13.39 31.10 Test Weight (lb/ AAD-1 56.96 50.90 59.50
0.2796 bushel) Control 56.67 52.00 60.10 Yield (bushels/acre) AAD-1
200.08 102.32 258.36 0.2031 Control 205.41 95.35 259.03 Experiment
C Plant Height (inches) AAD-1 95.92 94.00 96.00 0.1262 Control
90.92 90.00 90.00 Ear Height (inches) AAD-1 47.75 41.00 50.00
0.4630 Control 43.75 37.00 46.00 Stalk Lodging (%) AAD-1 6.74 0.00
27.47 0.4964 Control 5.46 0.00 28.12 Root Lodging (%) AAD-1 0.3512
0.00 7.58 0.8783 Control 0.3077 0.00 33.33 Final Population AAD-1
32.78 29.00 36.00 0.0543 (plants/acre in 1000's) Control 31.68
24.00 35.00 Grain Moisture (%) AAD-1 19.09 13.33 25.90 0.5706
Control 19.36 13.66 26.50 Test Weight (lb/ AAD-1 54.62 42.10 58.80
0.1715 bushel) Control 55.14 52.80 58.40 Yield (bushels/acre) AAD-1
192.48 135.96 243.89 0.2218 Control 200.35 129.02 285.58 Experiment
D Stalk Lodging (%) AAD-1 7.29 0.00 9.26 0.4364 Control 4.17 0.00
39.06 Final Population AAD-1 29.93 27.00 34.00 0.0571 (plants/acre
in 1000's) Control 31.86 29.00 35.00 Grain Moisture (%) AAD-1 18.74
19.40 24.40 0.4716 Control 19.32 13.35 25.70 Test Weight (lb/ AAD-1
56.59 54.80 58.30 0.0992 bushel) Control 55.50 52.70 57.40 Yield
(bushels/acre) AAD-1 203.55 196.51 240.17 0.7370 Control 199.82
118.56 264.11
Example 8 Use of Corn Event DAS-40278-9 Insertion Site for Targeted
Integration
[0217] Consistent agronomic performance of the transgene of corn
event DAS-40278-9 over several generations under field conditions
suggests that these identified regions around the corn event
DAS-40278-9 insertion site provide good genomic locations for the
targeted integration of other transgenic genes of interest. Such
targeted integration overcomes the problems with so-called
"position effect," and the risk of creating a mutation in the
genome upon integration of the transgene into the host. Further
advantages of such targeted integration include, but are not
limited to, reducing the large number of transformation events that
must be screened and tested before obtaining a transgenic plant
that exhibits the desired level of transgene expression without
also exhibiting abnormalities resulting from the inadvertent
insertion of the transgene into an important locus in the host
genome. Moreover, such targeted integration allows for stacking
transgenes rendering the breeding of elite plant lines with both
genes more efficient.
[0218] Using the disclosed teaching, a skilled person is able to
target polynucleic acids of interest to the same insertion site on
chromosome 2 as that in corn event DAS-40278-9 or to a site in
close proximity to the insertion site in corn event DAS-40278-9.
One such method is disclosed in International Patent Application
No. WO2008/021207, herein incorporated by reference in its
entirety.
[0219] Briefly, up to 20 Kb of the genomic sequence flanking 5' to
the insertion site and up to 20 Kb of the genomic sequence flanking
3' to the insertion site (portions of which are identified with
reference to SEQ ID NO:29) are used to flank the gene or genes of
interest that are intended to be inserted into a genomic location
on chromosome 2 via homologous recombination. The gene or genes of
interest can be placed exactly as in the corn event DAS-40278-9
insertion site or can be placed anywhere within the 20 Kb regions
around the corn event DAS-40278-9 insertion sites to confer
consistent level of transgene expression without detrimental
effects on the plant. The DNA vectors containing the gene or genes
of interest and flanking sequences can be delivered into plant
cells via one of the several methods known to those skilled in the
art, including but not limited to Agrobacterium-mediated
transformation. The insertion of the donor DNA vector into the corn
event DAS-40278-9 target site can be further enhanced by one of the
several methods, including but not limited to the co-expression or
up-regulation of recombination enhancing genes or down-regulation
of endogenous recombination suppression genes. Furthermore, it is
known in the art that double-stranded cleavage of specific
sequences in the genome can be used to increase homologous
recombination frequency, therefore insertion into the corn event
DAS-40278-9 insertion site and its flanking regions can be enhanced
by expression of natural or designed sequence-specific
endonucleases for cleaving these sequences. Thus, using the
teaching provided herein, any heterologous nucleic acid can be
inserted on corn chromosome 2 at a target site located between a 5'
molecular marker discussed in Example 4 and a 3' molecular marker
discussed in Example 4, preferably within SEQ ID NO:29, and/or
regions thereof as discussed elsewhere herein.
Example 9 Excision of the Pat Gene Expression Cassette from Corn
Event DAS-40278-9
[0220] The removal of a selectable marker gene expression cassette
is advantageous for targeted insertion into the genomic loci of
corn event DAS-40278-9. The removal of the pat selectable marker
from corn event DAS-40278-9 allows for the re-use of the pat
selectable marker in targeted integration of polynucleic acids into
chromosome 4 in subsequent generations of corn.
[0221] Using the disclosed teaching, a skilled person is able to
excise polynucleic acids of interest from corn event DAS-40278-9.
One such method is disclosed in Provisional U.S. Patent Application
No. 61/297,628, herein incorporated by reference in its
entirety.
[0222] Briefly, sequence-specific endonucleases such as zinc finger
nucleases are designed which recognize, bind and cleave specific
DNA sequences that flank a gene expression cassette. The zinc
finger nucleases are delivered into the plant cell by crossing a
parent plant which contains transgenic zinc finger nuclease
expression cassettes to a second parent plant which contains corn
event DAS-40278-9. The resulting progeny are grown to maturity and
analyzed for the loss of the pat expression cassette via leaf
painting with a herbicide which contains glufosinate. Progeny
plants which are not resistant to the herbicide are confirmed
molecularly and advanced for self-fertilization. The excision and
removal of the pat expression cassette is molecularly confirmed in
the progeny obtained from the self-fertilization. Using the
teaching provided herein, any heterologous nucleic acid can be
excised from corn chromosome 2 at a target site located between a
5' molecular marker and a 3' molecular marker as discussed in
Example 4, preferably within SEQ ID NO:29 or the indicated regions
thereof.
Example 10--Resistance to Brittlesnap
[0223] Brittlesnap refers to breakage of corn stalks by high winds
following applications of growth regulator herbicides, usually
during periods of fast growth. Mechanical "push" tests, which use a
bar to physically push the corn to simulate damage due to high
winds, were performed on hybrid corn containing event DAS-40278-9
and control plants not containing event DAS-40278-9. The treatments
were completed at four different geographical locations and were
replicated four times (there was an exception for one trial which
was only replicated three times). The plots consisted of eight
rows: four rows of each of the two hybrids, with two rows
containing event DAS-40278-9 and two rows without the event. Each
row was twenty feet in length. Corn plants were grown to the V4
developmental stage, and a commercial herbicide containing 2,4-D
(Weedar 64, Nufarm Inc., Burr Ridge, Ill.) was applied at rates of
1120 g ac/ha, 2240 g ae/ha and 4480 g ae/ha. Seven days after
application of the herbicide, a mechanical push test was performed.
The mechanical push test for brittlesnap consisted of pulling a
4-foot bar down the two rows of corn to simulate wind damage.
Height of the bar and speed of travel were set to provide a low
level of stalk breakage (10% or less) with untreated plants to
ensure a test severe enough to demonstrate a difference between
treatments. The directionality of the brittlesnap treatment was
applied against leaning corn.
[0224] Two of the trial locations experienced high winds and
thunderstorms 2-3 days after application of the 2,4-D herbicide. On
two consecutive days, a thunderstorm commenced in Huxley Iowa. Wind
speeds of 2 to 17 m s.sup.-1 with high speeds of 33 m s.sup.-1 were
reported at the site of the field plot. The wind direction was
variable. On one day, a thunderstorm was reported in Lanesboro
Minn. Winds of high velocity were reported at the site of this
field plot. In addition, both storms produced rain. The combination
of rain and wind attributed to the reported brittlesnap damage.
[0225] Assessments of the brittlesnap damage which resulted from
the mechanical push test (and inclement weather) were made by
visually rating the percentage of injury. Prior to the mechanical
brittlesnap bar treatment, plant stand counts were made for the
hybrid corn containing event DAS-40278-9 and controls. Several days
after the brittlesnap bar treatment the plot stand counts were
reassessed. The percentage of leaning and percentage of reduced
stand within the plot was determined (Table 26). The data from the
trials demonstrated that hybrid corn containing event DAS-40278-9
has less propensity for brittlesnap as compared to the null plants
following an application of 2,4-D.
TABLE-US-00029 TABLE 26 DAS-40278-9 Corn Brittlesnap Tolerance to
V4 Application of 2,4-D Amine. The percentage of brittlesnap was
calculated for hybrid corn plants containing event DAS- 40278-9 and
compared to control plants which do not contain the event. 278 (SL
B01- Null Null 278//4X (SLB01// 278 (SLB01VX- (SLB01VX// Treatment
P811XTR) 4XP811XTR) 278/BE9515XT) BE9515XT) Before Mechanical
Snapping Mean.sup.3 % Leaning 7-8 Days After Application.sup.1
Weedar 64 0% 38% 0% 33% 1120 g ac/ha Weedar 64 1% 42% 0% 33% 2240 g
ac/ha Weedar 64 2% 55% 1% 46% 4480 g ac/ha Untreated 0% 0% 0% 0%
After Mechanical Snapping Mean.sup.3 % Leaning 11-14 Days After
Application Weedar 64 0% 19% 1% 24% 1120 g ac/ha Weedar 64 4% 30%
7% 27% 2240 g ac/ha Weedar 64 4% 26% 6% 28% 4480 g ac/ha Untreated
0% 0% 0% 0% After Mechanical Snapping Mean.sup.3 % Stand Reduction
11-14 Days After Application Weedar 64 3% 38% 6% 42% 1120 g ac/ha
Weedar 64 9% 35% 12% 41% 2240 g ac/ha Weedar 64 9% 40% 16% 40% 4480
g ac/ha Untreated 0% 0% 0% 0% .sup.1Thunderstorm and high winds
occurred 2-3 days after application in two trials .sup.2Treatments
replicated four times in a randomized complete block design (one
trial was only completed for three replications .sup.3Means
corrected for occurrences in untreated (untreated means forced to
zero)
Example 11 Protein Analysis of Grain
[0226] Grain with increased total protein content was produced from
hybrid corn containing event DAS-40278-9 as compared to control
plants not containing the event. Two consecutive multisite field
trails were conducted that included non-sprayed and
herbicide-treatments with three different herbicide combinations.
In 7 of the 8 statistical comparisons, the DAS-40278-9 event
produced grain with significantly higher total protein content
(Table 27). This data is corroborated by analyses of individual
amino acids.
TABLE-US-00030 TABLE 27 Protein content of grain from multisite
field trials Non- Event DAS- Event DAS- Event DAS- Event DAS-40278-
2008 Field transgenic 40278-9 40278-9 40278-9 9 quizalofop Season
Near-isoline unsprayed quizalofop 2,4-D and 2,4-D Mean 9.97 10.9
11.1 10.5 10.9 % increase 0 9.3 11.3 5.3 9.3 over isoline Paired
t-test NA 0.0002 0.0004 0.061 0.002 Mean 10.9 11.6 11.7 11.7 11.5 %
increase 0 6.4 7.3 7.2 5.5 over isoline Paired t-test NA 0.0048
0.001 0.0012 0.0079
Example 12 Additional Agronomic Trials
[0227] Agronomic characteristics of hybrid corn containing event
DAS-40278-9 compared to near-isoline corn were collected from
multiple field trials across diverse geographic environments for a
growing season. The data were collected and analyzed for agronomic
characteristics as described in Example 7. The results for hybrid
corn lines containing event DAS-40278-9 as compared to null plants
are listed in Table 28. Additionally, agronomic characteristics for
the hybrid corn lines containing event DAS-40278-9 and null plants
sprayed with the herbicides quizalofop (280 g ae/ha) at the V3
stage of development and 2,4-D (2,240 g ae/ha) sprayed at the V6
stage of development are described in Table 29.
TABLE-US-00031 TABLE 28 yield, percent moisture, and final
population results for hybrid corn containing event DAS-40278-9 as
compared to the near-isoline control. Grain Final Population
Moisture (plants/acre Name Yield (%) Reported in 1000's) Hybrid
Corn Containing 218.1 21.59 31.69 DAS-40278-9 Control Hybrid Corn
217.4 21.91 30.42
TABLE-US-00032 TABLE 29 yield, percent moisture, percentage stock
lodging, percentage root lodging and total population for hybrid
corn lines containing event DAS-40278-9 as compared to the
near-isoline control. Final Population Grain Stock Lodge Root Lodge
(plants/acre reported Trial Yield Moisture (%) (%) (%) in 1000's)
Spray Trial Hybrid Corn #1 214.9 23.4 0.61 2.19 30 Containing DAS-
40278-9 Control Hybrid 177.9 23.46 0.97 36.32 28.36 Corn #1 LSD
(0.5) 13.3 1.107 0.89 10.7 1.1 Non Spray Hybrid Corn #1 219.6 22.3
0.95 1.78 30.8 Containing DAS- 40278-9 Control Hybrid 220.3 22.51
0.54 1.52 30.55 Corn #1 LSD (0.5) 6.9 0.358 0.98 1.65 0.7 Spray
Trial Hybrid Corn #2 198.6 26.76 0.38 2.08 29.29 Containing DAS-
40278-9 Control Hybrid 172.3 23.76 1.5 39.16 28.86 Corn #2 LSD
(0.5) 13.3 1.107 0.89 10.7 1.1 Non Spray Hybrid Corn #2 207.8 24.34
0.22 0.59 31 Containing DAS- 40278-9 Control Hybrid 206.2 24.88
0.35 0.12 30.94 Corn #2 LSD (0.5) 8.0 0.645 0.55 1.79 0.9
Sequence CWU 1
1
37126DNAArtificial SequencePrimer 1tgcactgcag gtcgactcta gaggat
26223DNAArtificial SequencePrimer 2gcggtggcca ctattttcag aag
23326DNAArtificial SequencePrimer 3ttgttacggc atatatccaa tagcgg
26426DNAArtificial SequencePrimer 4ccgtggccta ttttcagaag aagttc
26523DNAArtificial SequencePrimer 5acaaccatat tggctttggc tga
23628DNAArtificial SequencePrimer 6cctgttgtca aaatactcaa ttgtcctt
28723DNAArtificial SequencePrimer 7ctccattcag gagacctcgc ttg
23823DNAArtificial SequencePrimer 8gtacaggtcg catccgtgta cga
23925DNAArtificial SequencePrimer 9ccccccctct ctaccttctc tagat
251023DNAArtificial SequencePrimer 10gtcatgccct caattctctg aca
231123DNAArtificial SequencePrimer 11gtcgcttcag caacacctca gtc
231223DNAArtificial SequencePrimer 12agctcagatc aaagacacac ccc
231328DNAArtificial SequencePrimer 13tcgtttgact aatttttcgt tgatgtac
281423DNAArtificial SequencePrimer 14tctcactttc gtgtcatcgg tcg
231517DNAArtificial SequencePrimer 15ccagcacgaa ccattga
171624DNAArtificial SequencePrimer 16cgtgtatata aggtccagag ggta
241717DNAArtificial SequencePrimer 17ttgggagaga gggctga
171820DNAArtificial SequencePrimer 18tggtaagtgt ggaaggcatc
201920DNAArtificial SequencePrimer 19gaggtacaac cggagcgttt
202019DNAArtificial SequencePrimer 20ccgacgcttt tctggagta
192122DNAArtificial SequencePrimer 21tgtgccacat aatcacgtaa ca
222220DNAArtificial SequencePrimer 22gagacgtatg cgaaaattcg
202322DNAArtificial SequencePrimer 23ttgcttcagt tcctctatga gc
222419DNAArtificial SequencePrimer 24tccgtgtcca ctcctttgt
192522DNAArtificial SequencePrimer 25gcaaaggaaa actgccattc tt
222620DNAArtificial SequencePrimer 26tctctaagcg gcccaaactt
202723DNAArtificial SequencePrimer 27attctggctt tgctgtaaat cgt
232824DNAArtificial SequencePrimer 28ttacaatcaa cagcaccgta cctt
24298557DNAArtificial SequenceInsert and Flanking Sequences for
Event DAS-40278-9 29actggtattt aatatacttt aataaatatt attagattcc
tcgtcaaaga actttttaca 60atatatctat ttagaatcat atatgtcata gttttttttc
taagagtcta gtttactagt 120aaaatccgac tcacattttt cgaacttggg
atgcaacact taaatagtac aaaaccttgg 180tatgcagtat tttacattgt
aagattcaaa atttctaaag cagtatatat atgtttccag 240aaacttatag
atatagaaaa aacagagaga cgtatgcgaa aattcgataa aggtgtacat
300tggattcgca aggctaaata catatttatc gtggatccat gcagagtttg
ggtaataaaa 360ttagatactt ccaatcatgt gccacataat cacgtaacat
tagtaattta aatgacatta 420ccatgtccaa ctgatttaaa acacaaactc
ttcttgaacc atatagtttg acaaaccaaa 480tatatataac tggagctact
agttatgaat caattaaaaa ttactttgaa gattcaacgt 540agtgccagtt
tggctctagc acatctaacc agaagggcta aggctggctt caacaggaac
600agccaaatcc gagatcgagc catttgccat ttttgggtag ttagtttaac
tttcatatat 660cttcccatcc ttttttgcct agcctaaatg gctttgatgt
tgaagaccat attaatttgc 720ttcagtggca ctaggacaac catattggct
ttggctgacc cgttagagtt agcctaatgg 780gtggaagggg agggaagggg
aggatcgatg gtggcatgag agaggggttg acgatcacga 840tgatgatgcg
agtgaggagg agagggtggc gacgacacag gggagaaagg agagggacgc
900taggagcgtc aagggcgtgg gggaggggag ggtcggaggg atgaaggatg
acctaaatat 960tattgttgag tgatagaggg ttattcaact atccgacccg
tcgattttga tggtatgtta 1020aatttgtgtg tcatttgttt gatggattta
gtaaaggtta tgggtctaga ggtgattttt 1080gttgggtggg ttttacagag
tttaaactag cggattatat agtggtatag aagatatagt 1140tttattagaa
catctccaaa atgtgactcg aaataatacc cccaaaattt aaaatactac
1200atcattttga taaaaaaggt aaagtagagc actgttggaa cagtttttaa
aagttgtgcc 1260ctatatttta aaatagggta ctgatttaaa atattgttgt
gggggataga tatccccggg 1320tccactagaa ggcgagaagg cctcgcgtgt
ggccacgggc cagttacccc gcaaggccat 1380cccttcgtgg gtcgagctag
aattactggt agaatgggct gaccgaagaa ggcaacagac 1440tcgagcccaa
acaatccatc ggctcgtgcg ctatccacag aaactacccg actttccggc
1500gcatggcatc ctagaatatc ggggcgtatt agggatgagt cagcgagatt
ttcggaagat 1560tagttcagtt tgttcgctat tatttaggag acatatgatc
ctcatgtacg tatggagtgc 1620cccacggtcg tgtatataag gtccagaggg
taccccatca tttctatcga ccatctacct 1680atctcatcag cttttctcca
ttcaggagac ctcgcttgta acccaccaca tatagatcca 1740tcccaagaag
tagtgtatta cgcctctcta agcggcccaa acttgcagaa aaccgcctat
1800ccctctctcg tgcgtccagc acgaaccatt gagttacaat caacagcacc
gtaccttgaa 1860gcggaataca atgaaggtta gctacgattt acagcaaagc
cagaatacaa tgaaccataa 1920agtgattgaa gctcgaaata tacgaaggaa
caaatatttt taaaaaaata cgcaatgact 1980tggaacaaaa gaaagtgata
tattttttgt tcttaaacaa gcatcccctc taaagaatgg 2040cagttttcct
ttgcatgtaa ctattatgct cccttcgtta caaaaatttt ggactactat
2100tgggaacttc ttctgaaaat agtggccacc gcttaattaa ggcgcgccat
gcccgggcaa 2160gcggccgctt aattaaattt aaatgtttaa actaggaaat
ccaagcttgc atgcctgcag 2220atccccgggg atcctctaga gtcgacctgc
agtgcagcgt gacccggtcg tgcccctctc 2280tagagataat gagcattgca
tgtctaagtt ataaaaaatt accacatatt ttttttgtca 2340cacttgtttg
aagtgcagtt tatctatctt tatacatata tttaaacttt actctacgaa
2400taatataatc tatagtacta caataatatc agtgttttag agaatcatat
aaatgaacag 2460ttagacatgg tctaaaggac aattgagtat tttgacaaca
ggactctaca gttttatctt 2520tttagtgtgc atgtgttctc cttttttttt
gcaaatagct tcacctatat aatacttcat 2580ccattttatt agtacatcca
tttagggttt agggttaatg gtttttatag actaattttt 2640ttagtacatc
tattttattc tattttagcc tctaaattaa gaaaactaaa actctatttt
2700agttttttta tttaatagtt tagatataaa atagaataaa ataaagtgac
taaaaattaa 2760acaaataccc tttaagaaat taaaaaaact aaggaaacat
ttttcttgtt tcgagtagat 2820aatgccagcc tgttaaacgc cgtcgacgag
tctaacggac accaaccagc gaaccagcag 2880cgtcgcgtcg ggccaagcga
agcagacggc acggcatctc tgtcgctgcc tctggacccc 2940tctcgagagt
tccgctccac cgttggactt gctccgctgt cggcatccag aaattgcgtg
3000gcggagcggc agacgtgagc cggcacggca ggcggcctcc tcctcctctc
acggcaccgg 3060cagctacggg ggattccttt cccaccgctc cttcgctttc
ccttcctcgc ccgccgtaat 3120aaatagacac cccctccaca ccctctttcc
ccaacctcgt gttgttcgga gcgcacacac 3180acacaaccag atctccccca
aatccacccg tcggcacctc cgcttcaagg tacgccgctc 3240gtcctccccc
cccccccccc tctctacctt ctctagatcg gcgttccggt ccatgcatgg
3300ttagggcccg gtagttctac ttctgttcat gtttgtgtta gatccgtgtt
tgtgttagat 3360ccgtgctgct agcgttcgta cacggatgcg acctgtacgt
cagacacgtt ctgattgcta 3420acttgccagt gtttctcttt ggggaatcct
gggatggctc tagccgttcc gcagacggga 3480tcgatttcat gatttttttt
gtttcgttgc atagggtttg gtttgccctt ttcctttatt 3540tcaatatatg
ccgtgcactt gtttgtcggg tcatcttttc atgctttttt ttgtcttggt
3600tgtgatgatg tggtctggtt gggcggtcgt tctagatcgg agtagaattc
tgtttcaaac 3660tacctggtgg atttattaat tttggatctg tatgtgtgtg
ccatacatat tcatagttac 3720gaattgaaga tgatggatgg aaatatcgat
ctaggatagg tatacatgtt gatgcgggtt 3780ttactgatgc atatacagag
atgctttttg ttcgcttggt tgtgatgatg tggtgtggtt 3840gggcggtcgt
tcattcgttc tagatcggag tagaatactg tttcaaacta cctggtgtat
3900ttattaattt tggaactgta tgtgtgtgtc atacatcttc atagttacga
gtttaagatg 3960gatggaaata tcgatctagg ataggtatac atgttgatgt
gggttttact gatgcatata 4020catgatggca tatgcagcat ctattcatat
gctctaacct tgagtaccta tctattataa 4080taaacaagta tgttttataa
ttatttcgat cttgatatac ttggatgatg gcatatgcag 4140cagctatatg
tggatttttt tagccctgcc ttcatacgct atttatttgc ttggtactgt
4200ttcttttgtc gatgctcacc ctgttgtttg gtgttacttc tgcagggtac
ccccggggtc 4260gaccatggct catgctgccc tcagccctct ctcccaacgc
tttgagagaa tagctgtcca 4320gccactcact ggtgtccttg gtgctgagat
cactggagtg gacttgaggg aaccacttga 4380tgacagcacc tggaatgaga
tattggatgc cttccacact taccaagtca tctactttcc 4440tggccaagca
atcaccaatg agcagcacat tgcattctca agaaggtttg gaccagttga
4500tccagtgcct cttctcaaga gcattgaagg ctatccagag gttcagatga
tccgcagaga 4560agccaatgag tctggaaggg tgattggtga tgactggcac
acagactcca ctttccttga 4620tgcacctcca gctgctgttg tgatgagggc
catagatgtt cctgagcatg gcggagacac 4680tgggttcctt tcaatgtaca
cagcttggga gaccttgtct ccaaccatgc aagccaccat 4740cgaagggctc
aacgttgtgc actctgccac acgtgtgttc ggttccctct accaagcaca
4800gaaccgtcgc ttcagcaaca cctcagtcaa ggtgatggat gttgatgctg
gtgacagaga 4860gacagtccat cccttggttg tgactcatcc tggctctgga
aggaaaggcc tttatgtgaa 4920tcaagtctac tgtcagagaa ttgagggcat
gacagatgca gaatcaaagc cattgcttca 4980gttcctctat gagcatgcca
ccagatttga cttcacttgc cgtgtgaggt ggaagaaaga 5040ccaagtcctt
gtctgggaca acttgtgcac catgcaccgt gctgttcctg actatgctgg
5100caagttcaga tacttgactc gcaccacagt tggtggagtt aggcctgccc
gctgagtagt 5160tagcttaatc acctagagct cgtttaaact gagggcactg
aagtcgcttg acgtgctgaa 5220ttgtttgtga tgttggtggc gtattttgtt
taaataagta agcatggctg tgattttatc 5280atatgatcga tctttggggt
tttatttaac acattgtaaa atgtgtatct attaataact 5340caatgtataa
gatgtgttca ttcttcggtt gccatagatc tgcttatttg acctgtgatg
5400ttttgactcc aaaaaccaaa atcacaactc aataaactca tggaatatgt
ccacctgttt 5460cttgaagagt tcatctacca ttccagttgg catttatcag
tgttgcagcg gcgctgtgct 5520ttgtaacata acaattgtta cggcatatat
ccaatagcgg ccggcctcct gcagggttta 5580aacttgccgt ggcctatttt
cagaagaagt tcccaatagt agtccaaaat ttttgtaacg 5640aagggagcat
aatagttaca tgcaaaggaa aactgccatt ctttagaggg gatgcttgtt
5700taagaacaaa aaatatatca ctttcttttg ttccaagtca ttgcgtattt
ttttaaaaat 5760atttgttcct tcgtatattt cgagcttcaa tcactttatg
gttctttgta ttctggcttt 5820gctgtaaatc gtagctaacc ttcttcctag
cagaaattat taatacttgg gatatttttt 5880tagaatcaag taaattacat
attaccacca catcgagctg cttttaaatt catattacag 5940ccatataggc
ttgattcatt ttgcaaaatt tccaggatat tgacaacgtt aacttaataa
6000tatcttgaaa tattaaagct attatgatta ggggtgcaaa tggaccgagt
tggttcggtt 6060tatatcaaaa tcaaaccaaa ccaactatat cggtttggat
tggttcggtt ttgccgggtt 6120ttcagcattt tctggttttt tttttgttag
atgaatatta ttttaatctt actttgtcaa 6180atttttgata agtaaatata
tgtgttagta aaaattaatt ttttttacaa acatatgatc 6240tattaaaata
ttcttatagg agaattttct taataacaca tgatatttat ttattttagt
6300cgtttgacta atttttcgtt gatgtacact ttcaaagtta accaaattta
gtaattaagt 6360ataaaaatca atatgatacc taaataatga tatgttctat
ttaattttaa attatcgaaa 6420tttcacttca aattcgaaaa agatatataa
gaattttgat agattttgac atatgaatat 6480ggaagaacaa agagattgac
gcattttagt aacacttgat aagaaagtga tcgtacaacc 6540aattatttaa
agttaataaa aatggagcac ttcatattta acgaaatatt acatgccaga
6600agagtcgcaa atatttctag atatttttta aagaaaattc tataaaaagt
cttaaaggca 6660tatatataaa aactatatat ttatattttt tacccaaaag
caccgcaagg ggtagccctg 6720ggtgtgcgga cggactctaa acaccgacag
ctggcgcgcc aggtaggggg tgtgtctttg 6780atctgagcta gctcaatgac
cattacctcc aaatgcaaga tcgcccttcg ccccgggact 6840atgttttgct
ttggaaccat ctcatccata gcagatgaag agggaactct gcaccgcata
6900gcagatctat tggagaagaa gctttcctca gaaatctcga ggggagccag
ggcagaacag 6960cgggtggcac catcacccgc acctcaagcg aagatgacct
cttacaaacc gaaagtcggg 7020agctcaccta cccgaaaaac tccgctgtcc
acttcgccca caaaggagtg gacacggatt 7080actcgaaaga aggaagcgag
tgtcccgagt caggggacgg gaacacgcca agccatcttt 7140ccgacgcctt
cgccctcaaa tgaggatgga aagaagagcg ccatcgcgct ggctcctttc
7200taccccgacg tcctcttcat cagggggaga ttggagttag cacccgtctt
caacgatgag 7260ccaaccatgc aaggggaaga gcctccccag cgtgaggcgc
gacgacggag gaatagaagc 7320cagaacgtgc ggcgacatca cgaggctggg
gaacgggatc cggcgcaacc cgtatcccgg 7380gacgaagctt tagaagtagg
aaaaactccc gacgagtggg tacaccgaga aaggcggaac 7440tctcgccgcc
gtgatcgccg acaagcttag gaccgagaac gagagcaagc cgagcaaggt
7500gcaaggctgc gccgagagaa tgctctcttt gctcggaacc tgtaccccga
cttcgctcgt 7560gcaatgaaca cgccgagtga agtcggaggg gtactggccc
agatagctga cggcctcccg 7620cgaaccctag acacggaagg ctaccggcgg
ctgcttactc gagcagttaa tcaccttcta 7680cccatcacta atcctccaag
cgacctacgc catgccatca acagccggcg agacacgcgg 7740agctccatca
acgcttcgcg cgaccgatga cacgaaagtg agatagggaa ccgagaggag
7800tatgtccgag atcatgccat cctggcatga agtcatgcca cccgagctga
gtcggttgcg 7860gcctcgacca gtgtcccgtt ccagggacga tcaagatgac
acacaactgg ctcccctcct 7920tgggaccgac ctcacgaacg ccgacatgaa
gacacgtgcg gagtcttcgc acttactccg 7980tgtctccggg ccatccagtg
gcccctaact tcaaggtctc caacgtcagc aagtatgagc 8040gcaagcagga
cctgggtggc tggttagcca tctacacgat tgtcacatgg gccgccggag
8100cgacggagga cgtgatgaca gtgtattttc ccattgtcct agggcaagac
gcaatgcagt 8160ggctccgaca tctaccccaa cattgcatag acaattggag
cgacttcagt tggtgcttca 8220tcgccaactt ccagtccctc tttgacaagc
cggcgcagcc atgggaccta aaatccattg 8280ggcatcaggg cgatgaaacg
ctccggttgt acctcaagag gttttagacc atgaggaacc 8340acacccccga
agtcgccgag gcgggggtga ttgaagactt ctaccgagga tccaatgact
8400cggctttcgt ccgagccata ctccagaaaa gcgtcggcca cctccgaaca
cttgttccgg 8460gaggcagacc tctacatcac cacggattaa cgggcccagg
acctcatcgg aggcacgaaa 8520gccgcgccac acgcgccacg gtgtgacacg aaccagc
85573023DNAArtificial SequencePrimer for Flanking Marker
30gcctagtcgc ctaccctacc aat 233124DNAArtificial SequencePrimer for
Flanking Marker 31tgtgttcttg attgggtgag acat 243221DNAArtificial
SequencePrimer for Flanking Marker 32tactggggat tagagcagaa g
213321DNAArtificial SequencePrimer for Flanking Marker 33aatctatgtg
tgaacagcag c 213431DNAartificial sequence5' end border with
DAS-40278-9 Insert 34acagcaccgt accttgaagc ggaatacaat g
313512DNAartificial sequence5' original locus 35acagcaccgt cc
123632DNAartificial sequence3' end border with DAS-40278-9 Insert
36ttacccaaaa gcaccgcaag gggtagccct gg 323731DNAartificial
sequence3' original locus 37tacccaaaag caccgcaagg ggtagccctg g
31
* * * * *