U.S. patent application number 17/372803 was filed with the patent office on 2021-12-30 for arthrogenic alphavirus vaccine.
The applicant listed for this patent is GRIFFITH UNIVERSITY. Invention is credited to Surendran Mahalingam, Adam Taylor.
Application Number | 20210401983 17/372803 |
Document ID | / |
Family ID | 1000005827752 |
Filed Date | 2021-12-30 |
United States Patent
Application |
20210401983 |
Kind Code |
A1 |
Mahalingam; Surendran ; et
al. |
December 30, 2021 |
ARTHROGENIC ALPHAVIRUS VACCINE
Abstract
The invention relates to a vaccine comprising live attenuated
recombinant alphavirus comprising mutated capsid protein. The
invention also relates to a method of preventing a subject from
contracting an alphaviral infection that would otherwise produce
clinical signs of disease. In an embodiment the mutated capsid
protein is Chikungunya virus (CHIKV) capsid protein having a
mutated nucleolar localisation signal/sequence (NoLS), preferably
the mutant NLS 101/95.
Inventors: |
Mahalingam; Surendran;
(Nathan, AU) ; Taylor; Adam; (Nathan, AU) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
GRIFFITH UNIVERSITY |
Nathan |
|
AU |
|
|
Family ID: |
1000005827752 |
Appl. No.: |
17/372803 |
Filed: |
July 12, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16304509 |
Nov 26, 2018 |
11090384 |
|
|
PCT/AU2017/050489 |
May 25, 2017 |
|
|
|
17372803 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01N 33/56983 20130101;
A61K 2039/5254 20130101; C12N 2770/36134 20130101; C07K 14/005
20130101; G01N 2333/181 20130101; C12N 2770/36122 20130101; C07K
19/00 20130101; Y02A 50/30 20180101; A61K 39/42 20130101; C07K
2319/09 20130101; C12N 2770/36162 20130101; A61P 31/14 20180101;
A61K 39/12 20130101; C12N 7/00 20130101 |
International
Class: |
A61K 39/42 20060101
A61K039/42; A61K 39/12 20060101 A61K039/12; C12N 7/00 20060101
C12N007/00; C07K 19/00 20060101 C07K019/00; C07K 14/005 20060101
C07K014/005; G01N 33/569 20060101 G01N033/569; A61P 31/14 20060101
A61P031/14 |
Foreign Application Data
Date |
Code |
Application Number |
May 27, 2016 |
AU |
2016902014 |
Feb 13, 2017 |
AU |
2017900446 |
Claims
1. (a) An isolated, purified, synthetic or recombinant Chikungunya
virus (CHIKV) mutated capsid protein; (b) an isolated, purified,
synthetic or recombinant CHIKV nascent structural polyprotein
comprising a mutated CHIKV capsid protein; (c) a recombinant CHIKV
genome encoding a mutated CHIKV capsid protein; (d) a recombinant
CHIKV comprising a mutated CHIKV capsid protein; (e) a live
attenuated recombinant CHIKV comprising a mutated CHIKV capsid
protein; (f) a chimeric alphavirus comprising a mutated CHIKV
capsid protein; (g) a live attenuated chimeric alphavirus
comprising a mutated CHIKV capsid protein; (h) an inactivated
attenuated recombinant CHIKV comprising a mutated CHIKV capsid
protein; or (i) an inactivated attenuated chimeric alphavirus
comprising a mutated CHIKV capsid protein, wherein the mutated
CHIKV capsid protein has at least a mutated nucleolar localization
region (NoLS) compared with wildtype CHIKV capsid protein and is
incapable or substantially incapable of nucleolar localization, and
wherein charged amino acids of the NoLS of wild-type CHIKV capsid
protein required for nucleolar transportation are shifted in
position, deleted and/or exchanged for one or more different amino
acids.
2. The protein, polyprotein, genome, recombinant CHIKV, live
attenuated recombinant CHIKV, chimeric alphavirus, live attenuated
chimeric alphavirus, inactivated attenuated recombinant CHIKV, or
inactivated attenuated chimeric alphavirus of claim 1, wherein for
the mutated CHIKV capsid protein: (i) positively charged amino
acids of the NoLS of wild-type CHIKV capsid protein required for
nucleolar transportation are shifted in position, deleted and/or
exchanged for one or more different amino acids; (ii) positively
charged amino acids of the NoLS of wild-type CHIKV capsid protein
required for nucleolar transportation are replaced with alanine;
(iii) one or more of amino acid positions 62, 63, 65, 66, 68, 69,
84, 85, 95, 96, 101 and 102 of the NoLS of wild-type CHIKV capsid
protein are shifted in position, replaced and/or deleted; (iv) at
least amino acid positions 62, 63, 65, 66, 68, 69, 101 and 102 of
the NoLS of wild-111999.8009.US01\ 153031782 type CHIKV capsid
protein are shifted in position, replaced and/or deleted; (v) at
least amino acid positions 62, 63, 65, 66, 68, 69, 95, 96, 101 and
102 of the NoLS of wild-type CHIKV capsid protein are shifted in
position, replaced and/or deleted; (vi) at least amino acid
positions 84, 85, 95, 96, 101 and 102 of the NoLS of wild-type
CHIKV capsid protein are shifted in position, replaced and/or
deleted; (vii) the mutated NoLS sequence comprises the sequence of
SEQ. ID NO. 4; (viii) the mutated NoLS sequence comprises the
sequence of SEQ. ID NO. 5; (ix) the mutated NoLS sequence comprises
the sequence of SEQ. ID NO. 6; or (x) the mutated NoLS sequence
comprises the sequence of SEQ. ID NO. 7.
3. The protein, polyprotein, genome, recombinant CHIKV, live
attenuated recombinant CHIKV, chimeric alphavirus, live attenuated
chimeric alphavirus, inactivated attenuated recombinant CHIKV, or
inactivated attenuated chimeric alphavirus of claim 1, wherein for
the mutated CHIKV capsid protein at least amino acid positions 62,
63, 65, 66, 68, 69, 101 and 102 of the NoLS of wild-type CHIKV
capsid protein are shifted in position, replaced and/or
deleted.
4. The protein, polyprotein, genome, recombinant CHIKV, live
attenuated recombinant CHIKV, chimeric alphavirus, live attenuated
chimeric alphavirus, inactivated attenuated recombinant CHIKV, or
inactivated attenuated chimeric alphavirus of claim 1, wherein for
the mutated CHIKV capsid protein at least amino acid positions 62,
63, 65, 66, 68, 69, 95, 96, 101 and 102 of the NoLS of wild-type
CHIKV capsid protein are shifted in position, replaced and/or
deleted;
5. The protein, polyprotein, genome, recombinant CHIKV, live
attenuated recombinant CHIKV, chimeric alphavirus, live attenuated
chimeric alphavirus, inactivated attenuated recombinant CHIKV, or
inactivated attenuated chimeric alphavirus of claim 1, wherein for
the mutated CHIKV capsid protein the mutated NoLS sequence
comprises the sequence of SEQ. ID NO. 6.
6. The protein, polyprotein, genome, recombinant CHIKV, live
attenuated recombinant CHIKV, chimeric alphavirus, live attenuated
chimeric alphavirus, inactivated attenuated recombinant CHIKV, or
inactivated attenuated chimeric alphavirus of claim 1, wherein for
the mutated CHIKV capsid protein the mutated NoLS sequence
comprises the sequence of SEQ. ID NO. 7.
7. The protein, polyprotein, genome, recombinant CHIKV, live
attenuated recombinant CHIKV, chimeric alphavirus, live attenuated
chimeric alphavirus, inactivated attenuated recombinant CHIKV, or
inactivated attenuated chimeric alphavirus of claim 1, wherein the
chimeric alphavirus of (f), (g) and (i) is selected from the group
consisting of Ross River virus (RRV), Barmah Forest virus (BFV),
O'nyong-nyong virus (ONNV), Mayaro virus (MAYV), Sindbis virus
group (causing Pogosta disease, Ockelbo disease and Karelian
fever), and Semliki Forest virus (SFV).
8. A pharmaceutical preparation comprising the protein,
polyprotein, genome, recombinant CHIKV, live attenuated recombinant
CHIKV, chimeric alphavirus, live attenuated chimeric alphavirus,
inactivated attenuated recombinant CHIKV, or inactivated attenuated
chimeric alphavirus of claim 1, or a pharmaceutically acceptable
derivative thereof, and at least one pharmaceutically acceptable
carrier.
9. The pharmaceutical preparation of claim 8, in the form of a
vaccine.
10. A method of (1) preventing a subject from contracting an
alphaviral infection naturally; (2) preventing a subject from
developing alphaviral disease; (3) eliciting an
alphaviral-protective immune response in a subject; or (4)
stimulating an anti-alphaviral immune response in a subject, said
method comprising the step of administering to the subject the
pharmaceutical preparation of claim 9.
11. A method of (1) treating a subject having alphaviral disease,
or (2) reducing the severity of alphaviral disease, said method
comprising the step of administering to the subject the
pharmaceutical preparation of claim 8.
12. An isolated, purified, synthetic or recombinant nucleic acid
encoding the protein, polyprotein, genome, recombinant CHIKV, live
attenuated recombinant CHIKV, chimeric alphavirus, live attenuated
chimeric alphavirus, inactivated attenuated recombinant CHIKV, or
inactivated attenuated chimeric alphavirus of claim 1.
13. A method of preparing a recombinant alphavirus, said method
comprising the steps of: (1) mutating a capsid protein of a CHIKV
to produce a recombinant alphavirus; and (2) enabling the
recombinant alphavirus to replicate, wherein the mutated CHIKV
capsid protein has at least a mutated nucleolar localization region
(NoLS) compared with wildtype CHIKV capsid protein and is incapable
or substantially incapable of nucleolar localization, and wherein
charged amino acids of the NoLS of wild-type CHIKV capsid protein
required for nucleolar transportation are shifted in position,
deleted and/or exchanged for one or more different amino acids.
14. The method of claim 13, wherein for the mutated CHIKV capsid
protein: positively charged amino acids of the NoLS of wild-type
CHIKV capsid protein required for nucleolar transportation are
shifted in position, deleted and/or exchanged for one or more
different amino acids; positively charged amino acids of the NoLS
of wild-type CHIKV capsid protein required for nucleolar
transportation are replaced with alanine; one or more of amino acid
positions 62, 63, 65, 66, 68, 69, 84, 85, 95, 96, 101 and 102 of
the NoLS of wild-type CHIKV capsid protein are shifted in position,
replaced and/or deleted; at least amino acid positions 62, 63, 65,
66, 68, 69, 101 and 102 of the NoLS of wild-type CHIKV capsid
protein are shifted in position, replaced and/or deleted; at least
amino acid positions 62, 63, 65, 66, 68, 69, 95, 96, 101 and 102 of
the NoLS of wild-type CHIKV capsid protein are shifted in position,
replaced and/or deleted; at least amino acid positions 84, 85, 95,
96, 101 and 102 of the NoLS of wild-type CHIKV capsid protein are
shifted in position, replaced and/or deleted; the mutated NoLS
sequence comprises the sequence of SEQ. ID NO. 4; the mutated NoLS
sequence comprises the sequence of SEQ. ID NO. 5; the mutated NoLS
sequence comprises the sequence of SEQ. ID NO. 6; or the mutated
NoLS sequence comprises the sequence of SEQ. ID NO. 7.
15. A vaccine or sub-unit vaccine comprising: a recombinant CHIKV
comprising a mutated CHIKV capsid protein; a recombinant CHIKV
nascent structural polyprotein comprising a mutated CHIKV capsid
protein; or, a recombinant CHIKV genome encoding a mutated capsid
protein, wherein the mutated CHIKV capsid protein is a nucleolar
localisation region (NoLS) mutant of wild-type CHIKV capsid protein
incapable or substantially incapable of nucleolar localisation, and
wherein charged amino acids of the NoLS of wild-type CHIKV capsid
protein required for nucleolar transportation are shifted in
position, deleted and/or exchanged for one or more different amino
acids.
16. The vaccine or sub-unit vaccine of claim 15, wherein:
positively charged amino acids of the NoLS of wild-type CHIKV
capsid protein required for nucleolar transportation are shifted in
position, deleted and/or exchanged for one or more different amino
acids; positively charged amino acids of the NoLS of wild-type
CHIKV capsid protein required for nucleolar transportation are
replaced with alanine; one or more of amino acid positions 62, 63,
65, 66, 68, 69, 84, 85, 95, 96, 101 and 102 of the NoLS of
wild-type CHIKV capsid protein are shifted in position, replaced
and/or deleted; at least amino acid positions 62, 63, 65, 66, 68,
69, 101 and 102 of the NoLS of wild-type CHIKV capsid protein are
shifted in position, replaced and/or deleted; at least amino acid
positions 62, 63, 65, 66, 68, 69, 95, 96, 101 and 102 of the NoLS
of wild-type CHIKV capsid protein are shifted in position, replaced
and/or deleted; at least amino acid positions 84, 85, 95, 96, 101
and 102 of the NoLS of wild-type CHIKV capsid protein are shifted
in position, replaced and/or deleted; the mutated NoLS sequence
comprises the sequence of SEQ. ID NO. 4; the mutated NoLS sequence
comprises the sequence of SEQ. ID NO. 5; the mutated NoLS sequence
comprises the sequence of SEQ. ID NO. 6; or the mutated NoLS
sequence comprises the sequence of SEQ. ID NO. 7.
Description
RELATED APPLICATIONS
[0001] This application is a continuation of U.S. patent
application Ser. No. 16/304,509, filed Nov. 26, 2018, which is a
371 national phase entry of International Application No.
PCT/AU2017/050489, filed May 25, 2017, which claims the benefit of
Australian application No. 2016902014, filed May 27, 2016, and
Australian application No. 2017900446, filed Feb. 13, 2017, all of
which are incorporated by reference.
TECHNICAL FIELD
[0002] The present invention relates to, inter alia, a vaccine
comprising live attenuated recombinant alphavirus comprising
mutated capsid protein. The present invention also relates to a
method of preventing a subject from contracting an alphaviral
infection that would otherwise produce clinical signs of disease.
In a preferred embodiment the mutated capsid protein is Chikungunya
virus (CHIKV) capsid protein having a mutated nucleolar
localisation signal/sequence (NoLS).
BACKGROUND ART
[0003] Chikungunya virus (CHIKV) is a mosquito-borne,
positive-sense single-stranded RNA virus and member of the Semliki
Forest virus serogroup and genus Alphavirus. This group includes
other alphaviruses that cause polyarthralgia and human joint
disorders such as Ross River virus (endemic in Australia and the
Pacific), O'nyong-nyong virus (Africa), Sindbis virus (SINAI)
(cause Pogosta disease [Finland], Ockelbo disease [Sweden] and
Karelian fever [Russia]), Barmah Forest virus (Australia) and
Mayaro virus (South and Central America). All of these viruses are
transmitted by mosquitoes and have the ability to cause huge
epidemics and emerge in new locations.
[0004] CHIKV replication takes place in the host cell cytoplasm.
Upon entry into the cell, CHIKV particles undergo disassembly and
the viral RNA genome is translated from two open reading frames to
generate the non-structural and structural polyproteins. These
polyproteins undergo cis and trans cleavage to form the mature
viral proteins. Non-structural proteins largely form part of the
replication complex, synthesising genomic and subgenomic RNA.
Structural proteins package genomic RNA and, upon transit through
the endoplasmic reticulum and golgi apparatus, are added to mature
virions that bud from the cell containing a lipid bilayer.
[0005] Capsid protein is one of five structural proteins expressed
from the subgenomic RNA of CHIKV and undergoes cis cleavage, via
its serine protease activity, from the nascent structural
polyprotein to form the mature viral protein. In a structural
capacity, capsid protein recognises the packaging signals present
in viral genomic RNA, allowing efficient assembly of the
nucleocapsid core. The multifunctional capsid protein has a number
of key roles in the alphavirus lifecycle.
[0006] The CHIKV capsid protein localises to the nucleolus of host
cells. Semliki Forest virus (SFV) capsid protein is the only other
alphavirus capsid protein reported to localise to the nucleolus of
host cells. [Favre D1, Studer E, Michel M R. Arch Virol. 1994; 137
(1-2):149-55. Two nucleolar targeting signals present in the
N-terminal part of Semliki Forest virus capsid protein]. Two
nucleolar targeting signals have previously been identified in the
N-terminal part of the SFV capsid protein.
[0007] In humans, CHIKV infection typically causes a sharp onset of
crippling joint pains, severe fever and rash. Joint disease ranges
from mild arthralgia to severe, debilitating arthritis, with
redness, swelling and synovial effusions. Although CHIKV disease is
usually self-limiting and rarely fatal, the arthralgia is extremely
painful and debilitating, typically lasting for 1 week but often
much longer. Chronic arthralgia/arthritis frequently occurs after
recovery from acute infection and is associated with persistence of
viral RNA and protein in synovial macrophages and muscle [Hoarau J,
et al. Persistent chronic inflammation and infection by chikungunya
arthritogenic alphavirus in spite of a robust host immune response.
J Immunol 2010 184:5914.27. Labadie K, et al. Chikungunya disease
in nonhuman primates involves long-term viral persistence in
macrophages. J Clin Invest. 2010 120:894]. Both the acute
arthralgia and the chronic disease result in major losses in
productivity. The very high (up to 50% of the population) and fast
(45,000 cases in 1 week) attack rates for CHIKV, the chronic
arthropathy, and the occasional severe clinical manifestations and
mortality (infants and the elderly), cause a considerable economic
and social burden. During major outbreaks CHIKV has also been shown
to be a significant cause of CNS disease, particularly in infants
and the elderly, with a case-fatality rate of CHIKV-associated
encephalitis estimated to be 16.6% [Gerardin P, Couderc T, Bintner
M et al. Chikungunya virus-associated encephalitis: A cohort study
on La Reunion Island, 2005-2009. Neurology.
10.1212/WNL.0000000000002234. (2015)]. CHIKV is now a global
problem, with outbreaks reported on most continents. Most recently
CHIKV spread to the Americas affecting 43 countries and causing
over 2 million cases of CHIKV disease between 2013-2015.
[0008] Currently there are no antivirals or commercially available
vaccines to prevent CHIKV disease.
[0009] As mentioned, the Semliki Forest virus (SFV) serogroup
includes other alphaviruses that are closely related to CHIKV,
causing polyarthralgia and human joint disorders. These include,
but are not limited to, Ross River virus (RRV), O'nyong-nyong virus
(ONNV), Sindbis virus (SINV) (cause Pogosta disease, Ockelbo
disease and Karelian fever), Barmah Forest virus (BFV) and Mayaro
virus (MAYV). A growing body of evidence indicates cross-reactivity
of alphavirus antibodies with broadly neutralising effects both in
vitro and in vivo.
[0010] A number of strategies are currently being used to design a
CHIKV-specific vaccine. These include chimeric live vaccines, which
are highly attenuated and immunogenic in mice [Wang E, Kim D Y,
Weaver S. C., Frolov I. Chimeric Chikungunya viruses are
nonpathogenic in highly sensitive mouse models but efficiently
induce a protective immune response. J. Virol. 85(17), 9249-9252
(2011). Plante K, Wang E, Partidos C D et al. Novel chikungunya
vaccine candidate with an IRES-based attenuation and host range
alteration mechanism. PLoS Pathog. 7(7), e1002142 (2011)],
virus-like particle based vaccines, which protected monkeys against
viremia after challenge [Kahata W, Yang Z Y, Andersen H et al. A
virus-like particle vaccine for epidemic chikungunya virus protects
nonhuman primates against infection. Nat. Med. 16(3), 334-338
(2010)], and DNA vaccine design based on consensus envelope protein
sequences [Muthumani K, Lankaraman K M, Laddy D J et al.
Immunogenicity of novel consensus-based DNA vaccines against
chikungunya virus. Vaccine 26(40), 5128-5134 (2008)].
[0011] Unlike a live-attenuated vaccine, some of these vaccine
strategies will require multiple immunizations and will be
expensive to manufacture.
SUMMARY OF INVENTION
[0012] Described herein is, inter alia, a vaccine comprising live
attenuated recombinant alphavirus comprising mutated capsid
protein.
[0013] According to a 1.sup.st form of the present invention, there
is provided an isolated, purified, synthetic or recombinant
alphaviral mutated capsid protein or a mutated nucleolar
localisation region/signal/sequence (NoLS) thereof.
[0014] According to a 2.sup.nd form of the present invention, there
is provided an isolated, purified, synthetic or recombinant
alphaviral nascent structural polyprotein comprising a mutated
capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof.
[0015] According to a 3.sup.rd form of the present invention, there
is provided a recombinant alphaviral genome encoding a mutated
capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof.
[0016] According to a 4.sup.th form of the present invention, there
is provided a recombinant alphavirus comprising mutated capsid
protein or a mutated nucleolar localisation region/signal/sequence
(NoLS) thereof.
[0017] According to a 5.sup.th form of the present invention, there
is provided a live attenuated recombinant alphavirus comprising
mutated capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof.
[0018] According to a 6.sup.th form of the present invention, there
is provided a chimeric alphavirus comprising mutated capsid protein
or a mutated nucleolar localisation region/signal/sequence (NoLS)
thereof.
[0019] According to a 7.sup.th form of the present invention, there
is provided a live attenuated chimeric alphavirus comprising
mutated capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof.
[0020] According to an 8.sup.th form of the present invention,
there is provided a vaccine comprising:
[0021] an isolated, purified, synthetic or recombinant alphaviral
mutated capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof;
[0022] an isolated, purified, synthetic or recombinant alphaviral
nascent structural polyprotein comprising a mutated capsid protein
or a mutated nucleolar localisation region/signal/sequence (NoLS)
thereof,
[0023] a recombinant alphaviral genome encoding a mutated capsid
protein or a mutated nucleolar localisation region/signal/sequence
(NoLS) thereof;
[0024] a recombinant alphavirus comprising mutated capsid protein
or a mutated nucleolar localisation region/signal/sequence (NoLS)
thereof;
[0025] a live attenuated recombinant alphavirus comprising mutated
capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof;
[0026] a chimeric alphavirus comprising mutated capsid protein or a
mutated nucleolar localisation region/signal/sequence (NoLS)
thereof; or
[0027] a live attenuated chimeric alphavirus comprising mutated
capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof.
[0028] According to a 9.sup.th form of the present invention, there
is provided a sub-unit vaccine comprising: recombinant alphavirus
comprising mutated capsid protein or a mutated nucleolar
localisation region/signal/sequence (NoLS) thereof, recombinant
alphaviral nascent structural polyprotein comprising a mutated
capsid protein or a mutated nucleolar localisation
region/signal/sequence (NoLS) thereof, or recombinant alphaviral
genome encoding a mutated capsid protein or a mutated nucleolar
localisation region/signal/sequence (NoLS) thereof.
[0029] According to a 10.sup.th form of the present invention,
there is provided a serum containing alphavirus-neutralising
antibodies obtained from a subject immunised with or administered
the vaccine of the 8.sup.th form of the invention or the 9.sup.th
form of the invention, the protein of the 1.sup.st form of the
invention, the polyprotein of the 2.sup.nd form of the invention,
the genome of the 3.sup.rd form of the invention, or the alphavirus
of any one of the 4.sup.th to 7.sup.th forms of the invention.
[0030] According to an 11.sup.th form of the present invention,
there is provided at least one alphavirus-neutralising antibody
obtained from a subject immunised with the vaccine of the 8.sup.th
form of the invention or the 9.sup.th form of the invention, the
protein of the Pt form of the invention, the polyprotein of the 2nd
form of the invention, the genome of the 3.sup.rd form of the
invention, or the alphavirus of any one of the 4.sup.th to 7.sup.th
forms of the invention.
[0031] According to a 12.sup.th form of the present invention,
there is provided a pharmaceutical preparation comprising: (1) the
protein of the 1.sup.st form of the invention or a pharmaceutically
acceptable derivative thereof; (2) the polyprotein of the 2.sup.nd
form of the invention or a pharmaceutically acceptable derivative
thereof; (3) the genome of the 3.sup.rd form of the invention or a
pharmaceutically acceptable derivative thereof, (4) the alphavirus
of any one of the 4.sup.th to 7.sup.th forms of the invention or a
pharmaceutically acceptable derivative thereof; (5) the vaccine of
the 8.sup.th or 9.sup.th form of the invention or a
pharmaceutically acceptable derivative thereof; (6) the serum of
the 10.sup.th form of the invention or a pharmaceutically
acceptable derivative thereof; or (7) the least one
alphavirus-neutralising antibody of the 11.sup.th form of the
invention or a pharmaceutically acceptable derivative thereof, and
at least one pharmaceutically acceptable carrier.
[0032] According to a 13.sup.th form of the present invention,
there is provided an immunogenic composition comprising: (1) the
protein of the 1.sup.st form of the invention; (2) the polyprotein
of the 2.sup.nd form of the invention; (3) the genome of the
3.sup.rd form of the invention; (4) the alphavirus of any one of
the 4.sup.th to 7.sup.th forms of the invention; (5) the vaccine of
the 8.sup.th or 9.sup.th form of the invention; (6) the serum of
the 10.sup.th form of the invention; or (7) the least one
alphavirus-neutralising antibody of the 11.sup.th form of the
invention.
[0033] According to a 14.sup.th form of the present invention,
there is provided a method of (1) preventing a subject from
contracting an alphaviral infection naturally; (2) preventing a
subject from developing alphaviral disease; (3) eliciting an
alphaviral-protective immune response in a subject; or (4)
stimulating an anti-alphaviral immune response in a subject, said
method comprising the step of administering to the subject: (1) the
protein of the 1.sup.st form of the invention; (2) the polyprotein
of the 2.sup.nd form of the invention; (3) the genome of the
3.sup.rd form of the invention; (4) the alphavirus of any one of
the 4.sup.th to 7.sup.th forms of the invention; or (5) the vaccine
of the 8.sup.th or 9.sup.th form of the invention. Alternatively,
there is provided use of (1) the protein of the 1st form of the
invention; (2) the polyprotein of the 2nd form of the invention;
(3) the genome of the 3.sup.rd form of the invention; (4) the
alphavirus of any one of the 4.sup.th to 7.sup.th forms of the
invention; or (5) the vaccine of the 8.sup.th or 9.sup.th form of
the invention (in the preparation of a medicament) for (1)
preventing a subject from contracting an alphaviral infection
naturally; (2) preventing a subject from developing alphaviral
disease; (3) eliciting an alphaviral-protective immune response in
a subject; or (4) stimulating an anti-alphaviral immune response in
a subject.
[0034] According to a 15.sup.th form of the present invention,
there is provided a method of (1) treating a subject having
alphaviral disease, or (2) reducing the severity of alphaviral
disease, said method comprising the step of administering to the
subject: (1) the serum of the 10.sup.th form of the invention or a
pharmaceutically acceptable derivative thereof; or (2) the least
one alphavirus-neutralising antibody of the 11.sup.st form of the
invention or a pharmaceutically acceptable derivative thereof.
Alternatively, there is provided use of (1) the serum of the
10.sup.th form of the invention or a pharmaceutically acceptable
derivative thereof, or (2) the least one alphavirus-neutralising
antibody of the 11.sup.st form of the invention or a
pharmaceutically acceptable derivative thereof (in the preparation
of a medicament) for (1) treating a subject having alphaviral
disease, or (2) reducing the severity of alphaviral disease.
[0035] According to a 16.sup.th form of the present invention,
there is provided a method of screening or diagnosing whether a
subject has an alphaviral infection or disease, said method
comprising the step of: (1) testing the subject, or biological
sample obtained from the subject, for reactivity with the serum of
the 10.sup.th form of the invention or the at least one
alphavirus-neutralising antibody of the 11.sup.th form of the
invention, wherein reactivity indicates that the subject has an
alphaviral infection or disease; and, optionally: (2) treating the
subject.
[0036] According to a 17.sup.th form of the present invention,
there is provided an isolated, purified, synthetic or recombinant
nucleic acid encoding the alphavirus capsid protein according to
the 1.sup.st form of the invention or the polypeptide according to
the 2.sup.nd form of the invention.
[0037] According to an 18.sup.th form of the present invention,
there is provided an isolated, purified, synthetic or recombinant
alphaviral genome encoding a mutated capsid protein.
[0038] According to a 19.sup.th form of the present invention,
there is provided a vector comprising the nucleic acid according to
the 17.sup.th form of the invention or the genome according to the
18.sup.th form of the invention.
[0039] According to a 20.sup.th form of the present invention,
there is provided a cell comprising said vector according to the
19.sup.th form of the invention.
[0040] According to a 21.sup.st form of the present invention,
there is provided a kit for carrying out the method according to
any one of the 14.sup.th to 16.sup.th forms of the invention.
[0041] According to a 22.sup.nd form of the present invention,
there is provided a method of preparing (1) the vaccine of the
8.sup.th or 9.sup.th form of the invention, or (2) the recombinant
alphavirus of any one of 4.sup.th to 7.sup.th forms of the
invention, said method comprising the steps of: (1) mutating a
capsid protein of an alphavirus to produce a recombinant
alphavirus; and (2) enabling the recombinant alphavirus to
replicate.
[0042] Preferred features, embodiments and variations of the
invention may be discerned from the following Detailed Description
which provides sufficient information for those skilled in the art
to perform the invention. The Detailed Description is not to be
regarded as limiting the scope of the preceding Summary of
Invention in any way.
[0043] The reference to any prior art in this specification is not,
and should not be taken as an acknowledgement or any form of
suggestion that the prior art forms part of the common general
knowledge.
DETAILED DESCRIPTION
[0044] The present inventors have primarily developed a
live-attenuated recombinant chikungunya virus (CHIKV) vaccine
having a mutated capsid protein. The inventors have identified
amino acids within the CHIKV wildtype capsid protein of importance
for nucleolar localisation and viral replication, which they then
mutated to produce a preferred form of the recombinant vaccine. In
a disease model of CHIKV, mice infected with the recombinant
vaccine/mutant CHIKV showed no signs of disease, significantly
reduced virus titres and reduction in the levels of
pro-inflammatory mediators versus wildtype CHIKV-infected mice.
Mutant CHIKV infected mice challenged with wildtype CHIKV showed no
sign of disease and significantly reduced viraemia versus mock
infected mice challenged with wildtype CHIKV. Serum recovered from
mutant CHIKV-infected mice was able to neutralise CHIKV infectivity
in vitro 30 days post infection. With cross reactivity of
neutralising antibodies acting between close members of the
alphavirus family, the recombinant vaccine can also potentially act
as a vaccine for other arthritogenic alphaviruses, such as Ross
River virus (RRV), Barmah Forest virus (BFV), O'nyong-nyong virus
(ONNV), Mayaro virus (MAYV), Sindbis virus group (causing Pogosta
disease, Ockelbo disease and Karelian fever), and Semliki Forest
virus (SFV). Similarly, it is thought that a mutated capsid protein
from a closely related alphavirus other than CHIKV (such as from
SFV) can be used in the development of a SFV-based live-attenuated
recombinant vaccine. Moreover, a chimeric alphavirus containing a
mutated capsid protein may offer much better vaccine protection,
greater immunogenicity and/or neutralisation to the desired
alphavirus, for not only arthritogenic alphaviruses but also
encephalitic alphaviruses.
[0045] The mutated capsid protein can be developed based on any
suitable type of alphavirus, including CHIKV, RRV, BFV, Sindbis
virus group (causing Pogosta disease, Ockelbo disease and Karelian
fever), SFV, ONNV and MAYV. In some embodiments, the mutated capsid
protein can comprise a mutated nucleolar localisation
region/signal/sequence (NoLS) compared with the wildtype capsid
protein. For example, one or more polar (eg. serine, threonine,
asparagine, glutamine, histidine and tyrosine) or charged amino
acids (eg. lysine, arginine, aspartate and glutamate) can be
shifted in position, deleted and/or exchanged for a hydrophobic
amino acid (eg. alanine, valine, leucine, isoleucine, proline,
phenylalanine, tryptophan, cysteine and methionine). For example, a
charged amino acid can be replaced by a non-charged amino acid. In
some embodiments, the mutated capsid protein can comprise one or
more mutations other than in the NoLS. In some embodiments, the
mutated capsid protein can comprise a mutated NoLS as well as one
or more mutations other than in the NoLS. In some embodiments, the
mutated capsid protein can comprise a mutated alphaviral NoLS fused
to a different polypeptide, said different polypeptide having been
derived from the same type of alphavirus or from a different type
of alphavirus. For example, the different polypeptide can derive
from a capsid protein from the same or different alphavirus. In
other embodiments, the different protein may not be derived from an
alphavirus. The mutated capsid protein is preferably a mutant of a
wild-type capsid protein. Preferably the mutated capsid protein is
based on CHIKV capsid protein [see SEQ. ID NO. 1].
[0046] In one embodiment the mutated capsid protein is incapable or
substantially incapable of nucleolar localisation.
[0047] In another embodiment the mutated capsid protein enables
assemblage of a nucleocapsid core of the recombinant alphavirus but
substantially reduces the ability of the recombinant alphavirus to
replicate.
[0048] In yet another embodiment the mutated capsid protein causes
reduced or no clinical signs of alphavirus disease when
administered to a subject.
[0049] In another embodiment the mutated capsid protein is
incapable or substantially incapable of nucleolar localisation, the
mutated capsid protein enables assemblage of a nucleocapsid core of
the recombinant alphavirus but substantially reduces the ability of
the recombinant alphavirus to replicate, and the mutated capsid
protein causes reduced or no clinical signs of alphavirus disease
when administered to a subject.
[0050] In another embodiment the mutated capsid protein causes a
defect in infectious virus particle formation, causing reduction
and delay of release of viral progeny.
[0051] The mutated capsid protein can have any suitable number of
amino acid substitutions, additions and/or deletions differing from
wild-type capsid protein, including one, two, three, four, five,
six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 or
even more amino acid substitutions, additions and/or deletions.
Preferably, the mutated capsid protein is a mutant of the wild-type
CHIKV capsid protein. Examples are shown in FIG. 1A [SEQ. ID NOS. 4
to 7]. In some embodiments, one or more amino acids of the NoLS of
wild-type CHIKV capsid protein can be shifted in position, replaced
and/or deleted. In some embodiments, one or more of amino acid
positions 58 to 110 of wild-type CHIKV capsid protein can be
shifted in position, replaced and/or deleted. In some embodiments,
one or more of amino acid positions 62, 63, 65, 66, 68, 69, 84, 85,
95, 96, 101 and 102 of wild-type CHIKV capsid protein can be
shifted in position, replaced and/or deleted. In some embodiments,
at least amino acid positions 62, 63, 65, 66, 68, 69, 84, 85, 95,
96, 101 and 102 of wild-type CHIKV capsid protein can be shifted in
position, replaced and/or deleted.
[0052] In one embodiment, the mutated capsid protein is incapable
or substantially incapable of nucleolar localisation by way of
having at least one mutation in the nucleolar localisation
region/signal/sequence (NoLS) compared with the wildtype capsid
protein. By "at least one mutation" it is meant that the mutated
capsid protein can have at least one amino acid substitution,
addition and/or deletion, including one, two, three, four, five,
six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 or
even more amino acid substitutions, additions and/or deletions.
Examples are shown in FIG. 1A [SEQ. ID NOS. 4 to 7].
[0053] Preferably, the mutated capsid protein is a NoLS mutant of
the wild-type CHIKV capsid protein. For example, one or more amino
acids of the wild-type CHIKV capsid protein required for nucleolar
localisation can be replaced by one or more other types of amino
acids, or one or more of the amino acids required for nucleolar
localisation may be deleted. Examples are shown in FIG. 1A [SEQ. ID
NOS. 4 to 7].
[0054] In some embodiments, the mutated capsid protein can have one
or more amino acid substitutions, additions and/or deletions
present between residues 58 and 110 of wild type CHIKV capsid
protein. Examples are shown in FIG. 1A [SEQ. ID NOS. 4 to 7].
[0055] In some embodiments, the mutated capsid protein can have one
or more amino acid substitutions, additions and/or deletions
between residues 66 to 83 and/or 92 to 105 of wild type Semliki
Forest Virus capsid protein [see FIG. 11, SEQ. ID NO. 2].
[0056] In another embodiment, the mutated capsid protein may enable
assemblage of a nucleocapsid core of the recombinant alphavirus but
substantially reduce the ability of the recombinant alphavirus to
replicate by way of having at least one mutation. Again, the
mutated capsid protein can have at least one amino acid
substitution, addition and/or deletion, including one, two, three,
four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,
51, 52 or even more amino acid substitutions, additions and/or
deletions. Preferably, the mutated capsid protein is a mutant of
the wild-type CHIKV capsid protein. For example, one or more amino
acids of the wild-type CHIKV capsid protein can be replaced by one
or more other types of amino acids, or one or more of the amino
acids may be deleted. Examples are shown in FIG. 1A [SEQ. ID NOS. 4
to 7].
[0057] Suitable mutated capsid protein (partial) sequences having a
mutated NoLS signal/sequence are shown in FIG. 1A and include
mutants NLS 101/95 [SEQ. ID NO. 7] and NLS 101 [SEQ. ID NO. 6]. For
the mutant NLS 101/95, positively charged amino acids required for
nucleolar transportation have been replaced with alanine. For
clarity, mutants NLS 101/95 and NLS 101 each have a protein
sequence identical to the wild-type CHIKV capsid protein, except
for the amino acid differences shown in FIG. 1A.
[0058] The full wild-type sequence of CHIKV capsid protein can be
found at www.ncbi.nlm.nih.gov/nuccore/KT449801.1 and is also shown
in FIG. 11 [SEQ. ID NO. 1].
[0059] If it is found that mutation of the capsid NoLS
signal/sequence does not offer a substantial level of attenuation,
then one or more additional mutations (eg. amino acid substitution,
insertion and/or deletion) which further attenuate the virus
containing the NoLS mutation can be made. The one or more
additional mutations (eg. amino acid substitution, insertion and/or
deletion) can be made in the capsid protein or elsewhere in the
genome of the alphavirus.
[0060] Likewise, suitable mutated capsid proteins can be developed
from the capsid proteins of other alphaviruses, such as the capsid
protein of SFV. FIG. 11 shows the NoLS region of the SFV wild-type
capsid protein sequence [SEQ. ID NO. 2]. Mutations as described
above for CHKV capsid protein may be made to the SFV wild-type
capsid protein.
[0061] By "incapable or substantially incapable of nucleolar
localisation" it is meant that the mutated capsid protein is
substantially absent from the nucleolus. An example of this is
mutant NLS 101/95 [see SEQ. ID NO. 7].
[0062] By "enables assemblage of a nucleocapsid core of the
recombinant alphavirus but substantially reduces the ability of the
recombinant alphavirus to replicate" it is meant that the ability
of the recombinant alphavirus to replicate is significantly
diminished, yet the alphavirus is still able to elicit an effective
immune response. An example of this is mutant NLS 101/95 [see SEQ.
ID NO. 7].
[0063] By "live attenuated" it is meant that the virus demonstrates
substantially reduced or preferably no clinical signs of disease
when administered to a subject.
[0064] The vaccine can comprise live virus or inactivated virus. If
inactivated, it can be inactivated in any suitable way (e.g. using
high or low temperatures, or chemically).
[0065] Preferably the vaccine provides long-lived immunity to the
subject. For example, if vaccinated with mutant CHIKV capsid
protein, then preferably the subject is provided with long-lived
immunity to CHIKV disease.
[0066] Preferably the vaccine is able to protect against CHIKV
isolates of differing genotypes (large number of isolates from
different localities and regions).
[0067] The subject may also be provided with long-lived immunity to
one or more other types of alphaviruses.
[0068] The vaccine, especially the live attenuated vaccine, may
offer cross protection against other arthritogenic alphaviruses,
such as CHIKV, RRV, BFV, Sindbis virus group (causing Pogosta
disease, Ockelbo disease and Karelian fever), SFV, MAYV or ONNV,
which share a greater degree of structural and genetic homology to
CHIKV. That is, a live attenuated vaccine based on CHKV mutant
protein may offer cross protection against RRV, BFV, Sindbis virus
group, SFV, MAYV and/or ONNV.
[0069] The chimeric alphavirus may be effective against
encephalitic alphaviruses, such as Eastern equine encephalitis
virus (EEEV) and Venezuelan equine encephalitis virus (VEEV), which
are more distantly related. The chimeric alphavirus may comprise
mutated capsid protein and all or part of the structural
polyprotein or non-structural polyprotein of an encephalitic
alphavirus. In an embodiment, the chimeric alphavirus comprises the
mutant capsid protein of CHIKV or other closely related alphavirus
and all or part of the structural polyprotein or non-structural
polyprotein of an encephalitic alphavirus.
[0070] A chimeric alphavirus, containing the mutant NLS 101/95
capsid protein of CHIKV [see SEQ. ID NO. 7] and proteins of a
desired alphavirus, may offer greater immunogenicity and/or
neutralisation to the desired alphavirus.
[0071] The chimeric alphavirus can be prepared in any suitable way.
Such techniques are described in the following reference: Roy C J,
Adams A P, Wang E, Leal G, Seymour R L, Sivasubramani S K, Mega W,
Frolov I, Didier P J, Weaver S. C. Vaccine. 2013. A chimeric
Sindbis-based vaccine protects cynomolgus macaques against a lethal
aerosol challenge of eastern equine encephalitis virus.
[0072] The recombinant alphavirus comprising mutated capsid protein
can be prepared in any suitable way. The vaccine comprising live
attenuated recombinant alphavirus comprising mutated capsid protein
can be of any suitable form and can be prepared in any suitable
way. Similarly, live attenuated recombinant alphavirus comprising
mutated capsid protein can be of any suitable form and can be
prepared in any suitable way. Such techniques are described in the
following reference, the entire contents of which are incorporated
herein by way of cross-reference: Chu H, Das S. C., Fuchs J F,
Suresh M, Weaver S. C., Stinchcomb D T, Partidos C D, Osorio J E.
Deciphering the protective role of adaptive immunity to CHIKV/IRES
a novel candidate vaccine against Chikungunya in the A129 mouse
model. Vaccine. 2013 Jul. 18; 31(33):3353-60. doi:
10.1016/j.vaccine.2013.05.059. Epub 2013 May 29.
[0073] In some embodiments the vaccine can be prepared by way of
passing recombinant alphavirus through a filter, such as a 0.22
.mu.m hydrophilic PVDF membrane or hydrophilic Polyethersulfone
membrane.
[0074] In some embodiments the vaccine can be stored long term and
remain viable at a temperature of between about -20.degree. C. and
about -80.degree. C. By "long-term" it is meant that the vaccine
can remain viable for at least 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,
56, 57, 58, 59 or 60 days. In some embodiments it is possible that
the vaccine can remain viable for more than 60 days.
[0075] The live attenuated recombinant alphavirus comprising
mutated capsid protein can be in the form of an isolate. The
isolate may comprise cells, such as mammalian, insect (eg.
mosquito) or other types of cells.
[0076] The serum containing alphavirus-neutralising antibodies can
be of any suitable form and can be prepared in any suitable way.
The at least one alphavirus-neutralising antibody can be prepared
in any suitable way. The antibody can be isolated, recombinant or
purified. Preferably there are many alphavirus-neutralising
antibodies. Such techniques are described in the following
reference, the entire contents of which are incorporated herein by
way of cross-reference: Fox J M, Long F, Edeling M A, Lin H, van
Duijl-Richter M K, Fong R H, Kahle K M, Smit J M4, Jin J, Simmons
G, Doranz B J, Crowe J E Jr, Fremont D H, Rossmann M G, Diamond
Miss. Broadly Neutralizing Alphavirus Antibodies Bind an Epitope on
E2 and Inhibit Entry and Egress. Cell. 2015 Nov. 19;
163(5):1095-107. doi: 10.1016/j.cell.2015.10.050. Epub 2015 Nov.
6.
[0077] The pharmaceutical preparation can be prepared in any
suitable way.
[0078] The method of preventing the subject from contracting an
alphaviral infection, treating a subject having an alphaviral
infection, or reducing the severity of an alphaviral infection, can
be carried out in any suitable way.
[0079] The vaccine, live attenuated recombinant alphavirus,
pharmaceutical preparation and immunogenic composition (described
hereafter as "the compositions") can be administered independently,
either systemically or locally, by any method standard in the art,
for example, subcutaneously, intravenously, parenterally,
intraperitoneally, intradermally, intramuscularly, topically, or
nasally.
[0080] The compositions can comprise conventional non-toxic,
physiologically or pharmaceutically acceptable ingredients or
vehicles suitable for the method of administration and are well
known to an individual having ordinary skill in this art. The
compositions can, for example, comprise an adjuvant. The term
"pharmaceutically acceptable carrier" as used herein is intended to
include diluents such as saline and aqueous buffer solutions. The
compositions can be in aqueous or lyophilized form.
[0081] A variety of devices are known in the art for delivery of
the compositions including, but not limited to, syringe and needle
injection, bifurcated needle administration, administration by
intradermal patches or pumps, intradermal needle-free jet delivery
(intradermal etc), intradermal particle delivery, or aerosol powder
delivery.
[0082] The compositions can be administered independently one or
more times to achieve, maintain or improve upon a desired
effect/result. It is well within the skill of an artisan to
determine dosage or whether a suitable dosage of the composition
comprises a single administered dose or multiple administered
doses. An appropriate dosage depends on the subject's health, the
induction of immune response and/or prevention of infection caused
by the alphavirus, the route of administration and the formulation
used. For example, a therapeutically active amount of the compound
may vary according to factors such as the disease state, age, sex,
and weight of the subject, and the ability of the composition to
elicit a desired response in the subject. Dosage regima may be
adjusted to provide the optimum therapeutic response. For example,
a subject may be administered a `booster` vaccination one or two
weeks following the initial administration.
[0083] The method of screening or diagnosing whether a subject has
an alphaviral infection or disease can be carried out in any
suitable way.
[0084] Some forms of the invention concern a biological sample or a
step of isolating one or more biological samples from a subject.
Typically, any form of the invention concerning testing of a
subject etc. may involve the step of isolating one or more
biological samples from the subject and testing that/those.
[0085] The biological sample can be any suitable sample derived
from the subject--obtained either non-invasively or invasively. It
can be cellular- or extracellular-derived, or both. For example: 1.
Buccal (mouth) cells--obtained by swishing mouthwash in the mouth
or by swabbing or brushing the inside of the cheek with a swab or
brush; 2. Blood--obtained by pricking the finger and collecting the
drops (dried blood spot) or by venepuncture (whole blood); 3.
Skin--obtained by a (punch) biopsy; 4. Organ tissue--obtained by
biopsy; 5. Plasma--obtained by blood plasma fractionation; 6.
Urine--obtained by urination; 7. Faeces--obtained by stool sample;
8. Cerebrospinal fluid--obtained by spinal tap; and 9.
Sputum--obtained by expectoration or nasotracheal suctioning.
[0086] Techniques for biological sample collection are well known
to skilled persons.
[0087] The isolated, purified, synthetic or recombinant alphavirus
capsid protein or polyprotein or genome can be prepared in any
suitable way. The isolated, purified, synthetic or recombinant
genome or nucleic acid encoding the alphavirus capsid protein can
be prepared in any suitable way. The vector can also be prepared in
any suitable way.
[0088] The cell (insect, mammalian or other) comprising the vector
can be prepared in any suitable way.
[0089] The kit for carrying out the above mentioned methods can
contain any suitable components or articles--eg. vaccine comprising
live attenuated alphavirus, live attenuated recombinant alphavirus,
pharmaceutical formulation etc; serum or one or more antibodies;
one or more articles and/or reagents for performance of the method,
such as means for providing the test sample itself; and,
instructions.
[0090] Suitable protocols for carrying out one or more of the
above-mentioned techniques can be found in "Current Protocols in
Molecular Biology", July 2008, JOHN WILEY AND SONS; D. M. WEIR
ANDCC BLACKWELL, "Handbook Of Experimental Immunology", vol. I-IV,
1986; JOHN E. COLIGAN, ADA M. KRUISBEEK, DAVID H. MARGULIES, ETHAN
M. SHEVACH, WARREN STROBER, "Current Protocols in Immunology",
2001, JOHN WILEY & SONS; "Immunochemical Methods In Cell And
Molecular Biology", 1987, ACADEMIC PRESS; SAMBROOK ET AL.,
"Molecular Cloning: A Laboratory Manual, 3d ed.,", 2001, COLD
SPRING HARBOR LABORATORY PRESS; "Vaccine Design, Methods and
Protocols", Volume 2, Vaccines for Veterinary Diseases, Sunil
Thomas in Methods in Molecular Biology (2016); and, "Vaccine
Design, Methods and Protocols", Volume 1: Vaccines for Human
Diseases, Sunil Thomas in Methods in Molecular Biology (2016), the
entire contents of which are incorporated herein by way of
cross-reference.
[0091] Any suitable type of subject can be used. The subject can be
any suitable mammal. Mammals include humans, primates, livestock
and farm animals (eg. horses, sheep and pigs), companion animals
(eg. dogs and cats), and laboratory test animals (eg. rats, mice
and rabbits). The subject is preferably human.
[0092] `Nucleic acid` as used herein includes `polynucleotide`,
`oligonucleotide`, and `nucleic acid molecule`, and generally means
a polymer of DNA or RNA, which can be single-stranded or
double-stranded, synthesized or obtained (e.g., isolated and/or
purified) from natural sources, which can contain natural,
non-natural or altered nucleotides, and which can contain a
natural, non-natural or altered internucleotide linkage, such as a
phosphoroamidate linkage or a phosphorothioate linkage, instead of
the phosphodiester found between the nucleotides of an unmodified
oligonucleotide.
[0093] As used herein, the term `recombinant` refers to (i)
molecules that are constructed outside living cells by joining
natural or synthetic nucleic acid segments to nucleic acid
molecules that can replicate in a living cell, or (ii) molecules
that result from the replication of those described in (i) above.
For purposes herein, the replication can be in vitro replication or
in vivo replication.
[0094] The terms `isolated` or `purified` as used herein mean
essentially free of association with other biological
components/contaminants, e.g., as a naturally occurring protein
that has been separated from cellular and other contaminants by the
use of antibodies or other methods or as a purification product of
a recombinant host cell culture.
[0095] Any of the features described herein can be combined in any
combination with any one or more of the other features described
herein within the scope of the invention.
[0096] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practise or testing of the present
invention.
[0097] In the present specification and claims (if any), the word
`comprising` and its derivatives including `comprises` and
`comprise` include each of the stated integers but does not exclude
the inclusion of one or more further integers.
[0098] Particularly preferred embodiments of the invention are
defined below.
[0099] 1. An isolated, purified, synthetic or recombinant
Chikungunya virus (CHIKV) or Semliki Forest virus (SFV) alphaviral
mutated capsid protein.
[0100] 2. An isolated, purified, synthetic or recombinant CHKV or
SFV alphaviral nascent structural polyprotein comprising a mutated
capsid protein.
[0101] 3. A recombinant CHKV or SFV alphaviral genome encoding a
mutated capsid protein.
[0102] 4. A recombinant CHKV or SFV alphavirus comprising mutated
capsid protein.
[0103] 5. A live attenuated recombinant CHKV or SFV alphavirus
comprising mutated capsid protein.
[0104] 6. A chimeric CHKV or SFV alphavirus comprising mutated
capsid protein.
[0105] 7. A live attenuated chimeric CHKV or SFV alphavirus
comprising mutated capsid protein.
[0106] 8. A vaccine comprising:
[0107] an isolated, purified, synthetic or recombinant CHKV or SFV
alphaviral mutated capsid protein;
[0108] an isolated, purified, synthetic or recombinant CHKV or SFV
alphaviral nascent structural polyprotein comprising a mutated
capsid protein;
[0109] a recombinant CHKV or SFV alphaviral genome encoding a
mutated capsid protein;
[0110] a recombinant CHKV or SFV alphavirus comprising mutated
capsid protein;
[0111] a live attenuated recombinant CHKV or SFV alphavirus
comprising mutated capsid protein;
[0112] a chimeric CHKV or SFV alphavirus comprising mutated capsid
protein; or
[0113] a live attenuated chimeric CHKV or SFV alphavirus comprising
mutated capsid protein.
[0114] 9. A sub-unit vaccine comprising: recombinant CHKV or SFV
alphavirus comprising mutated capsid protein; recombinant CHKV or
SFV alphaviral nascent structural polyprotein comprising a mutated
capsid protein; or recombinant CHKV or SFV alphaviral genome
encoding a mutated capsid protein.
[0115] 10. A serum containing alphavirus-neutralising antibodies
obtained from a subject immunised with or administered the vaccine
of paragraph 8 or paragraph 9, the protein of paragraph 1, the
polyprotein of paragraph 2, the genome of paragraph 3, or the
alphavirus of any one of paragraphs 4 to 7.
[0116] 11. At least one alphavirus-neutralising antibody obtained
from a subject immunised with or administered the vaccine of
paragraph 8 or paragraph 9, the protein of paragraph 1, the
polyprotein of paragraph 2, the genome of paragraph 3, or the
alphavirus of any one of paragraphs 4 to 7.
[0117] 12. A pharmaceutical preparation comprising: (1) the protein
of paragraph 1 or a pharmaceutically acceptable derivative thereof;
(2) the polyprotein of paragraph 2 or a pharmaceutically acceptable
derivative thereof; (3) the genome of paragraph 3 or a
pharmaceutically acceptable derivative thereof; (4) the alphavirus
of any one of paragraphs 4 to 7 or a pharmaceutically acceptable
derivative thereof; (5) the vaccine of paragraph 8 or paragraph 9
or a pharmaceutically acceptable derivative thereof; (6) the serum
of paragraph 10 or a pharmaceutically acceptable derivative
thereof; or (7) the least one alphavirus-neutralising antibody of
paragraph 11 or a pharmaceutically acceptable derivative thereof,
and at least one pharmaceutically acceptable carrier.
[0118] 13. An immunogenic composition comprising: (1) the protein
of paragraph 1; (2) the polyprotein of paragraph 2; (3) the genome
of paragraph 3; (4) the alphavirus of any one of paragraphs 4 to 7;
(5) the vaccine of paragraph 8 or paragraph 9; (6) the serum of
paragraph 10; or (7) the least one alphavirus-neutralising antibody
of paragraph 11.
[0119] 14. A method of (1) preventing a subject from contracting an
alphaviral infection naturally; (2) preventing a subject from
developing alphaviral disease; (3) eliciting an
alphaviral-protective immune response in a subject; or (4)
stimulating an anti-alphaviral immune response in a subject, said
method comprising the step of administering to the subject: (1) the
protein of paragraph 1; (2) the polyprotein of paragraph 2; (3) the
genome of paragraph 3; (4) the alphavirus of any one of paragraphs
4 to 7; or (5) the vaccine of paragraph 8 or paragraph 9.
[0120] 15. A method of (1) treating a subject having alphaviral
disease, or (2) reducing the severity of alphaviral disease, said
method comprising the step of administering to the subject: (1) the
serum of paragraph 10 or a pharmaceutically acceptable derivative
thereof; or (2) the least one alphavirus-neutralising antibody of
paragraph 11 or a pharmaceutically acceptable derivative
thereof.
[0121] 16. A method of screening or diagnosing whether a subject
has an alphaviral infection or disease, said method comprising the
step of: (1) testing the subject, or biological sample obtained
from the subject, for reactivity with the serum of paragraph 10 or
the at least one alphavirus-neutralising antibody of paragraph 11,
wherein reactivity indicates that the subject has an alphaviral
infection or disease; and, optionally: (2) treating the
subject.
[0122] 17. An isolated, purified, synthetic or recombinant nucleic
acid encoding the alphavirus capsid protein of paragraph 1 or the
polypeptide of paragraph 2.
[0123] 18. An isolated, purified, synthetic or recombinant CHIKV or
SFV alphaviral genome encoding a mutated capsid protein.
[0124] 19. A vector comprising the nucleic acid of paragraph 17 or
the genome of paragraph 18.
[0125] 20. A cell comprising the vector of paragraph 19.
[0126] 21. A kit for carrying out the method according to paragraph
14, 15 or 16.
[0127] 22. A method of preparing (1) the vaccine of paragraph 8 or
paragraph 9, or (2) the recombinant alphavirus of any one of
paragraphs 4 to 7, said method comprising the steps of: (1)
mutating a capsid protein of a CHICKV or SFV alphavirus to produce
a recombinant alphavirus; and (2) enabling the recombinant
alphavirus to replicate.
[0128] 23. The protein of paragraph 1, the polyprotein of paragraph
2, the genome of paragraph 3, the alphavirus of any one of
paragraphs 4 to 6, the vaccine of paragraph 8 or 9, the serum of
paragraph 10, the at least one antibody of paragraph 11, the
pharmaceutical preparation of paragraph 12, the immunogenic
composition of paragraph 13, the method of any one of paragraphs 14
to 16, the nucleic acid of paragraph 17, the genome of paragraph
18, the vector of paragraph 19, the cell of paragraph 20, the kit
of paragraph 21, or the method of paragraph 22, wherein the mutated
capsid protein has: a mutated nucleolar localisation
region/signal/sequence (NoLS) compared with the wildtype capsid
protein; one or more mutations other than in the NoLS; a mutated
NoLS as well as one or more mutations other than in the NoLS; one
or more amino acids of the NoLS of wild-type CHIKV capsid protein
shifted in position, replaced and/or deleted; one or more of amino
acid positions 58 to 110 of wild-type CHIKV capsid protein shifted
in position, replaced and/or deleted; one or more of amino acid
positions 62, 63, 65, 66, 68, 69, 84, 85, 95, 96, 101 and 102 of
wild-type CHIKV capsid protein shifted in position, replaced and/or
deleted; at least amino acid positions 62, 63, 65, 66, 68, 69, 84,
85, 95, 96, 101 and 102 of wild-type CHIKV capsid protein shifted
in position, replaced and/or deleted; or a sequence as shown or as
substantially shown in any one of SEQ. ID NOS. 1 and 4 to 7.
[0129] 24. The protein of paragraph 1, the polyprotein of paragraph
2, the genome of paragraph 3, the alphavirus of any one of
paragraphs 4 to 6, the vaccine of paragraph 8 or 9, the serum of
paragraph 10, the at least one antibody of paragraph 11, the
pharmaceutical preparation of paragraph 12, the immunogenic
composition of paragraph 13, the method of any one of paragraphs 14
to 16, the nucleic acid of paragraph 17, the genome of paragraph
18, the vector of paragraph 19, the cell of paragraph 20, the kit
of paragraph 21, or the method of paragraph 22, wherein the mutated
capsid protein is Capsid-101/95 (CHIKV-NoLS) [SEQ. ID NO. 7].
[0130] 25. An isolated, purified, synthetic or recombinant
alphaviral mutated capsid protein.
[0131] 26. An isolated, purified, synthetic or recombinant
alphaviral nascent structural polyprotein comprising a mutated
capsid protein.
[0132] 27. A recombinant alphaviral genome encoding a mutated
capsid protein.
[0133] 28. A recombinant alphavirus comprising mutated capsid
protein.
[0134] 29. A live attenuated recombinant alphavirus comprising
mutated capsid protein.
[0135] 30. A chimeric alphavirus comprising mutated capsid
protein.
[0136] 31. A live attenuated chimeric alphavirus comprising mutated
capsid protein.
[0137] 32. A vaccine comprising:
[0138] an isolated, purified, synthetic or recombinant alphaviral
mutated capsid protein;
[0139] an isolated, purified, synthetic or recombinant alphaviral
nascent structural polyprotein comprising a mutated capsid
protein;
[0140] a recombinant alphaviral genome encoding a mutated capsid
protein;
[0141] a recombinant alphavirus comprising mutated capsid
protein;
[0142] a live attenuated recombinant alphavirus comprising mutated
capsid protein;
[0143] a chimeric alphavirus comprising mutated capsid protein;
or
[0144] a live attenuated chimeric alphavirus comprising mutated
capsid protein.
[0145] 33. A sub-unit vaccine comprising: recombinant alphavirus
comprising mutated capsid protein; recombinant alphaviral nascent
structural polyprotein comprising a mutated capsid protein; or
recombinant alphaviral genome encoding a mutated capsid
protein.
[0146] 34. A serum containing alphavirus-neutralising antibodies
obtained from a subject immunised with or administered the vaccine
of paragraph 32 or paragraph 33, the protein of paragraph 25, the
polyprotein of paragraph 26, the genome of paragraph 27, or the
alphavirus of any one of paragraphs 28 to 31.
[0147] 35. At least one alphavirus-neutralising antibody obtained
from a subject immunised with the vaccine of paragraph 32 or
paragraph 33, the protein of paragraph 25, the polyprotein of
paragraph 26, the genome of paragraph 27, or the alphavirus of any
one of paragraphs 28 to 31.
[0148] 36. A pharmaceutical preparation comprising: (1) the protein
of paragraph 25 or a pharmaceutically acceptable derivative
thereof; (2) the polyprotein of paragraph 26 or a pharmaceutically
acceptable derivative thereof; (3) the genome of paragraph 27 or a
pharmaceutically acceptable derivative thereof; (4) the alphavirus
of any one of paragraphs 28 to 31 or a pharmaceutically acceptable
derivative thereof; (5) the vaccine of paragraph 32 or paragraph 33
or a pharmaceutically acceptable derivative thereof; (6) the serum
of paragraph 34 or a pharmaceutically acceptable derivative
thereof; or (7) the least one alphavirus-neutralising antibody of
paragraph 35 or a pharmaceutically acceptable derivative thereof,
and at least one pharmaceutically acceptable carrier.
[0149] 37. An immunogenic composition comprising: (1) the protein
of paragraph 25; (2) the polyprotein of paragraph 26; (3) the
genome of paragraph 27; (4) the alphavirus of any one of paragraphs
28 to 31; (5) the vaccine of paragraph 32 or paragraph 33; (6) the
serum of paragraph 34; or (7) the least one alphavirus-neutralising
antibody of paragraph 35.
[0150] 38. A method of (1) preventing a subject from contracting an
alphaviral infection naturally; (2) preventing a subject from
developing alphaviral disease; (3) eliciting an
alphaviral-protective immune response in a subject; or (4)
stimulating an anti-alphaviral immune response in a subject, said
method comprising the step of administering to the subject: (1) the
protein of paragraph 25; (2) the polyprotein of paragraph 26; (3)
the genome of paragraph 27; (4) the alphavirus of any one of
paragraphs 28 to 31; or (5) the vaccine of paragraph 32 or
paragraph 33.
[0151] 39. A method of (1) treating a subject having alphaviral
disease, or (2) reducing the severity of alphaviral disease, said
method comprising the step of administering to the subject: (1) the
serum of paragraph 34 or a pharmaceutically acceptable derivative
thereof; or (2) the least one alphavirus-neutralising antibody of
paragraph 35 or a pharmaceutically acceptable derivative
thereof.
[0152] 40. A method of screening or diagnosing whether a subject
has an alphaviral infection or disease, said method comprising the
step of: (1) testing the subject, or biological sample obtained
from the subject, for reactivity with the serum of paragraph 34 or
the at least one alphavirus-neutralising antibody of paragraph 35,
wherein reactivity indicates that the subject has an alphaviral
infection or disease; and, optionally: (2) treating the
subject.
[0153] 41. An isolated, purified, synthetic or recombinant nucleic
acid encoding the alphavirus capsid protein according to paragraph
25 or the polypeptide according to paragraph 26.
[0154] 42. An isolated, purified, synthetic or recombinant
alphaviral genome encoding a mutated capsid protein.
[0155] 43. A vector comprising the nucleic acid according to
paragraph 41 or the genome according to claim 42.
[0156] 44. A cell comprising the vector according to paragraph
43.
[0157] 45. A kit for carrying out the method according to any one
of paragraphs 38 to 40.
[0158] 46. A method of preparing (1) the vaccine of paragraph 32 or
paragraph 33, or (2) the recombinant alphavirus of any one of
paragraphs 28 to 31, said method comprising the steps of: (1)
mutating a capsid protein of an alphavirus to produce a recombinant
alphavirus; and (2) enabling the recombinant alphavirus to
replicate.
[0159] 47. The protein of paragraph 25, the polyprotein of
paragraph 26, the genome of paragraph 27, the alphavirus of any one
of paragraphs 28 to 31, the vaccine of paragraph 32 or 33, the
serum of paragraph 34, the at least one antibody of paragraph 35,
the pharmaceutical preparation of paragraph 36, the immunogenic
composition of paragraph 37, the method of any one of paragraphs 38
to 40, the nucleic acid of paragraph 41, the genome of paragraph
42, the vector of paragraph 43, the cell of paragraph 44, the kit
of paragraph 45, or the method of paragraph 46, wherein the mutated
capsid protein has: a mutated nucleolar localisation
region/signal/sequence (NoLS) compared with the wildtype capsid
protein; one or more mutations other than in the NoLS; a mutated
NoLS as well as one or more mutations other than in the NoLS; one
or more amino acids of the NoLS of wild-type CHIKV capsid protein
shifted in position, replaced and/or deleted; one or more of amino
acid positions 58 to 110 of wild-type CHIKV capsid protein shifted
in position, replaced and/or deleted; one or more of amino acid
positions 62, 63, 65, 66, 68, 69, 84, 85, 95, 96, 101 and 102 of
wild-type CHIKV capsid protein shifted in position, replaced and/or
deleted; at least amino acid positions 62, 63, 65, 66, 68, 69, 84,
85, 95, 96, 101 and 102 of wild-type CHIKV capsid protein shifted
in position, replaced and/or deleted; or a sequence as shown or as
substantially shown in any one of SEQ. ID NOS. 1 and 4 to 7.
[0160] 48. The invention of any one of paragraphs 25 to 46, wherein
the alphaviral mutated capsid protein is derived from an alphavirus
such as Ross River virus (RRV), Barmah Forest virus (BFV),
O'nyong-nyong virus (ONNV), Mayaro virus (MAYV), Sindbis virus
group (causing Pogosta disease, Ockelbo disease and Karelian
fever), or Semliki Forest virus (SFV).
[0161] 49. The method of paragraph 38 or 39, wherein the alphaviral
infection or disease is caused by Ross River virus (RRV), Barmah
Forest virus (BFV), O'nyong-nyong virus (ONNV), Mayaro virus
(MAYV), Sindbis virus group (causing Pogosta disease, Ockelbo
disease and Karelian fever) or Semliki Forest virus (SFV), or other
type of alphavirus.
BRIEF DESCRIPTION OF FIGURES
[0162] FIGS. 1A and 1B. FIG. 1A Partial sequence alignment of
wild-type CHIKV capsid protein (WT--also known as "Capsid-WT")
[SEQ. ID NO. 3] and mutated CHIKV capsid proteins (Capsid-NLS
63/66/69 [SEQ. ID NO. 4], Capsid-NLS 85/95/101 [SEQ. ID NO. 5],
Capsid-101 [SEQ. ID NO. 6] and Capsid-101/95 [SEQ. ID NO. 7]--also
known as "Capsid-NoLS"). FIG. 1B EGFP-tagged capsid protein
subcellular localisation. Vero cells separately transfected with
pEGFP, pCapsid-WTEGFP, pCapsid-NLS 63/66/69-EGFP, pCapsid-NLS
85/95/101-EGFP, pCapsid-101-EGFP and pCapsid-NoLSEGFP. Vero cells
in the top panel show EGFP (enhanced green fluorescent protein)
fluorescence. Vero cells in the middle panel show indirect
immunofluorescence using nucleolin-specific antibody. Vero cells in
the bottom panel show a merge of the top and middle panels.
[0163] FIGS. 2A and 2B. FIG. 2A Fluorescence loss in photobleaching
(FLIP) analysis performed on live Vero cells transfected with
either pCapsid-WTEGFP (labelled "WT") or capsid protein mutants
pCapsid-101-EGFP (labelled "101") and pCapsid-NoLSEGFP (labelled
"101/95"). FIG. 2B Fluorescence loss in the cytoplasm was assessed
over a 280 sec period during continual photobleaching of a section
of the nucleus. Fluorescence recovery curves were constructed; data
were normalized following the bleaching period so that the initial
prebleaching was set as 1 and the fully bleached fluorescence
intensity was set as 0.
[0164] FIG. 3. Mutation of capsid protein NoLS does not affect
capsid protein autoprotease activity. Vero cells were transfected
with pEGFP, pCapsid-EGFP, pCapsid-101-EGFP or pCapsid-NoLS-EGFP or
plasmids expressing EGFP-tagged WT Capsid-W, Capsid-101-W and
Capsid-NoLS-W. EGFP-tagged WT Capsid-W, Capsid-101-W and
Capsid-NoLS-W contain the C-terminal tryptophan (W261) required for
capsid protein autoproteolytic cleavage. Cells were lysed at 24 h
post transfection and cell lysates were analysed for cleavage of
EGFP from capsid protein by Western blot and EGFP-specific
antibody.
[0165] FIGS. 4A and 4B. Subcellular localisation of capsid protein
in CHIKV-WT or CHIKV-NoLS infected mammalian and mosquito cells.
Vero FIG. 4A or C6/36 FIG. 4B cells were infected with CHIKV-WT or
CHIKV-NoLS at an MOI 1 pfu/cell. Cells were fixed and permeabilised
at 24 h post infection and indirect immunofluorescence performed
using capsid protein-specific antibodies. Images are representative
of at least 6 fields of view. The white bar represents 15
.mu.m.
[0166] FIGS. 4C-4E. CHIKV containing the NoLS mutation in capsid
protein shows attenuation in vitro. Multistep growth kinetics in
BHK-21 FIG. 4C and C6/36 FIG. 4D cells were obtained by infecting
cells with CHIKV-WT or CHIKV-NoLS at an MOI of 0.1 pfu/cell.
Supernatants were collected at indicated time points and infectious
virus quantified by plaque assay. **, P<0.01; ***, P<0.001
using two-way ANOVA with Bonferroni post-tests. Each symbol
represents the mean.+-.standard error for 3 independent
experiments. FIG. 4E Plaque size (mm) in infected BHK-21 cells.
***, P<0.001 using Student's unpaired t-tests. Each symbol
represents the diameter of a single plaque.
[0167] FIGS. 5A-5C. Viraemia post infection. FIG. 5A Graphs showing
CHIKV-WT and CHIKV-NoLS viral titers in ankle joint of
CHIKV-infected mice at day 3 post-infection, titrated by plaque
assay. FIG. 5B Graphs showing mRNA expression of inflammatory
mediators of CHIKV disease in the ankle joint as analysed by
qRT-PCR at day 3 post-infection, the inflammatory mediators being
monocyte chemoattractant protein-1 (MCP-1), interferon gamma
(IFN.gamma.) and tumor necrosis factor alpha (TNF.alpha.). FIG. 5C
Graph showing CHIKV-WT and CHIKV-NoLS viral titers in serum and
ankle joint of CHIKV-infected mice post-infection, titrated by
plaque assay.
[0168] FIGS. 6A and 6B. FIG. 6A Photographs of CHIKV-WT and
CHIKV-NoLS infected C57BL/6 mice at day 3 post-infection. FIG. 6B
Graph showing CHIKV-induced footpad swelling (width.times.breadth),
monitored daily.
[0169] FIGS. 7A-7C. FIG. 7A Photographs of challenged/infected
CHIKV-NoLS immunised C57BL/6 mice at day 6
post-challenge/infection. The photograph on the left shows a mock
challenge, the middle photograph shows CHIKV-NoLS immunised mice
challenged with CHIKV-WT (labelled "WT Challenge"), and the
photograph on the right shows CHIKV-NoLS immunised mice challenged
with CHIKV-NoLS (labelled "NoLS Challenge"). FIG. 7B) Graph showing
CHIKV titer of CHIKV-NoLS immunised mice challenged with CHIKV-WT
(labelled "WT Challenge"), CHIKV-NoLS (labelled "NoLS Challenge")
or mock challenge. FIG. 7C Graph showing CHIKV-induced footpad
swelling (width.times.breadth) of challenged/infected CHIKV-NoLS
immunised mice, monitored daily--mock challenge (labelled
"Mock-CHIKV Ch"), CHIKV-WT challenge (labelled "CHIKV-WT-CHIKV
Ch"), and CHIKV-NoLS challenge (labelled "CHIKV-NoLS-CHIKV
Ch").
[0170] FIGS. 8A and 8B. Neutralising capacity of pooled mouse sera
collected at day 7, 15 and 30 post-infection with mock challenge
(labelled "Mock"), CHIKV-WT challenge (labelled "WT"), and
CHIKV-NoLS challenge (labelled "NoLS"). FIG. 8A Pooled mouse sera
(n>7) was serially diluted and mixed with CHIKV-ZsGreen (MOI 1)
for 2 hours before infection of Vero cells for 1 hour and
incubation at 37.degree. C. for six hours. Infectivity was measured
as % ZsGreen+ve live cells by flow cytometry. FIG. 8B Graph showing
% ZsGreen+ve live cells at days 7, 15 and 30.
[0171] FIG. 9. Graph showing the ability of CHIKV-NoLS immunised
mice (day 30 post immunisation) to protect against the development
of viraemia following Ross River virus (RRV) challenge--mock
challenge (labelled "Mock Challenge"), CHIKV-WT challenge (labelled
"WT Challenge"), and CHIKV-NoLS challenge (labelled "NoLS
Challenge"). 2 way ANOVA with Bonferoni post test; ***P<0.001;
*P<0.05.
[0172] FIG. 10. Western blot of capsid protein EGFP-tagged
constructs to confirm expression levels in Vero cells. The blot
compares the expression levels of pEGFP (labelled "GFP"),
pCapsid-WTEGFP (labelled "C prot wt"), pCapsid-101-EGFP (labelled
"101") and pCapsid-NoLSEGFP (labelled "101/95") using EGFP and
Actin-specific antibodies. Actin was used as a load control.
[0173] FIG. 11. Protein sequence alignment of CHIKV wild-type
capsid protein [SEQ. ID NO. 1] and SFV wild-type capsid protein
[SEQ. ID NO. 2], with amino acids found important for nucleolar
transportation shown in underline.
[0174] FIGS. 12A-12D. CHIKV RNA synthesis is not affected by
mutation of the capsid protein NoLS. BHK-21 and C6/36 cells were
infected with CHIKV-WT or CHIKV-NoLS at an MOI of 0.1 pfu/cell. The
viral genome copy number in the culture supernatants and viral RNA
copy number in infected cells were determined by quantitative
RT-PCR at the indicated times post infection. FIG. 12A BHK-21
cell-associated virus, FIG. 12B C6/36 cell-associated virus, FIG.
12C BHK-21 culture supernatant, FIG. 12D C6/36 culture supernatant.
***, P<0.001 using two-way ANOVA with Bonferroni post-tests.
Each bar represents the mean.+-.standard error for 3 independent
experiments.
[0175] FIG. 13. Graph of virus titer versus hours post infection
showing multistep growth kinetics of CHIKV-WT and CHIKV-NoLS in
Vero cells to assess phenotypic stability. **, P<0.01 and ***,
P<0.001 using two-way ANOVA with Bonferroni post-tests.
[0176] FIG. 14. CHIKV-NoLS or CHIKV-WT plaque size (mm) plotted
against viral passage number in infected Vero cells. Each symbol
represents the diameter of a single plaque with the
mean.+-.standard deviation.
[0177] FIG. 15. Graph of average CHIKV-NoLS titres before and after
0.22 .mu.m filtration. A T-175 flask of P0 CHIKV-NoLS was thawed
and the cell suspension was spun at 2000 rpm for 5 min to pellet
cell debris. The supernatant (unfiltered) was collected and
.about.10 ml supernatant was filtered through either a 0.22 .mu.m
pore size hydrophilic Polyethersulfone (PES) membrane or 0.22 .mu.m
pore size hydrophilic PVDF membrane.
[0178] FIGS. 16A and 16B. FIG. 16A Graph showing the effect of
temperature on the titre of CHIKV-NoLS during long term storage.
(B) Graph showing the effect of temperature on the titre of
CHIKV-WT during long term storage. CHIKV-NoLS and CHIKV-WT were
diluted to 5.times.10.sup.5 pfu/ml and vials stored at 21.degree.
C., 4.degree. C., -20.degree. C. and -80.degree. C. At the
indicated time points infectious CHIKV-NoLS (A) and CHIKV-WT FIG.
16B were quantified by plaque assay.
MATERIALS AND METHODS
[0179] Site-Directed Mutagenesis of Capsid Protein
[0180] Capsid protein cDNA was amplified from the ICRES vector
(University of Tartu) and cloned into commercially available EGFP
(enhanced GFP) plasmid. Site-directed mutants of CHIKV capsid
protein were generated using a QuikChange II site-directed
mutagenesis kit (Agilent), as per the manufacturer's
instructions.
[0181] Western Blot Analysis
[0182] Cells were transfected with pEGFP, pCapsid-WTEGFP (wild type
capsid protein), or the capsid protein mutants pCapsid-NLS
63/66/69-EGFP, pCapsid-NLS 85/95/101-EGFP, pCapsid-101-EGFP and
pCapsid-NoLSEGFP using Lipofectamine.RTM. 2000 transfection reagent
(Thermo Fisher Scientific) as per the manufacturer's instructions.
After 24 h, the cell lysates were analyzed by Western blot analysis
using EGFP and Actin-specific antibodies. Actin served as a loading
control.
[0183] Confocal Imaging
[0184] Cells were grown on polylysine-treated coverslips. Cells
were fixed in 4% paraformaldehyde and permeabilized in 1% Triton
X-100. The cells were then blocked in 1% bovine serum albumin (BSA)
made in PBS and incubated at 37.degree. C. for 1 h. Primary
antibody, nucleolin, was diluted 1:100 in 1% BSA and incubated with
the cells for 1 h at 37.degree. C. Texas Red anti-mouse (Vector
Laboratories) was diluted 1:500 in 1% BSA and incubated with the
cells for 1 h at 37.degree. C. Coverslips were mounted in
Vectorshield mounting medium (Vector Laboratories), and staining
was visualized on an Olympus FV1000 confocal microscope.
[0185] Live Cell Imaging
[0186] Cells were plated on glass-based 33-mm culture dishes and
imaged at 24 h post-transfection using an Upright LSM 510 META
Axioplan 2 confocal microscope (Zeiss). Cells were maintained at
37.degree. C. and, during imaging, the cell culture medium was
exchanged for CO.sub.2-independent medium (Thermo Fisher).
Fluorescence loss was measured using the ROI mean module of the LSM
510 software.
[0187] Flow Cytometry for Cytotoxicity
[0188] Transfected cells were collected and stained with 1 .mu.g/mL
propidium iodide. Cells were fixed in 4% paraformaldehyde and
analysed using the CyAn ADP flow cytometer (Beckman Coutler) with
Kaluza software.
[0189] Multi Step Growth Kinetics
[0190] Cells were infected at a multiplicity of infection (MOI) of
0.1 pfu/cell. Following adsorption of virus for 1 h at 37.degree.
C., cell monolayers were washed and fresh growth medium was added.
Supernatants were collected at indicated time points and infectious
virus quantified by plaque assay.
[0191] Ankle Cytokines
[0192] RNA was extracted from mouse tissues using TRIzol
(Invitrogen, Melbourne, Victoria, Australia) according to the
manufacturer's instructions. 1 .mu.g of RNA was reverse transcribed
using random primers and reverse transcriptase (Sigma Aldrich,
Sydney, Australia) according to the manufacturer's instructions.
Quantitative PCR was performed with 50 ng of template cDNA,
QuantiTect Primer Assay kits (Qiagen, Hilden, Germany) and
SYBR.RTM. Green Real-time PCR reagent in a CFX96 Touch.TM.
Real-Time PCR System. Data were normalized to the housekeeping gene
HPRT1 and the fold change in messenger RNA (mRNA) expression
relative to mock-infected PBS treated samples for each gene was
calculated using the .DELTA..DELTA.Ct method. Briefly,
.DELTA..DELTA.Ct=.DELTA.Ct (RRV-infected)-.DELTA.Ct (Mock-infected)
where .DELTA.Ct=Ct (gene of interest)-Ct (housekeeping gene--HPRT).
The fold change for each gene was calculated as
2-.DELTA..DELTA.Ct.
[0193] In Vivo Infections and Disease Monitoring
[0194] 21-day-old C57BL/6 mice were subcutaneously infected with
10.sup.4 pfu CHIKV-WT or CHIKV-NoLS in the ventral/lateral side of
the foot and monitored daily for signs of CHIKV-induced footpad
swelling (width.times.breadth). Animal experiments were approved by
the Animal Ethics Committee of Griffith University (GLY/05/15/AEC).
All procedures involving animals conformed to the National Health
and Medical Research Council Australian code of practice for the
care and use of animals for scientific purposes 8th edition
2013.
[0195] Viral Titer Assay
[0196] Ankle joint and serum were collected and assayed for viral
titer using plaque assay. Tissue samples were homogenized in 1 mL
of PBS and 10-fold serial dilutions of homogenate and sera were
added in triplicate to Vero cells. Virus was allowed to incubate
for 1 h at 37.degree. C. in a 5% CO.sub.2 incubator before virus
was removed and the cells overlaid with OPTI-MEM (Invitrogen,
Melbourne, Victoria, Australia) containing 3% FCS and 1% agarose
(Sigma Aldrich, Sydney, Australia) and incubated for 48 h in a 5%
CO.sub.2 incubator. Cells were fixed in 1% formalin and virus
plaques were made visible by staining with 0.1% crystal violet.
[0197] In Vivo Immunisation and Challenge
[0198] 21-day-old C57BL/6 mice were subcutaneously immunised with
one dose of 10.sup.4 pfu CHIKV-WT or CHIKV-NoLS in the
ventral/lateral side of the foot. At 30 days post immunisation,
mice were either challenged with 10.sup.4 pfu CHIKV-WT in the
ventral/lateral side of the foot and monitored daily for signs of
CHIKV-induced footpad swelling or 10.sup.4 pfu Ross River virus
(RRV) subcutaneously in the thorax and viraemia measured. Animal
experiments were approved by the Animal Ethics Committee of
Griffith University (GLY/05/15/AEC). All procedures involving
animals conformed to the National Health and Medical Research
Council Australian code of practice for the care and use of animals
for scientific purposes 8th edition 2013.
[0199] In Vitro Neutralisation
[0200] Pooled mouse sera (n>7) was serially diluted and mixed
with CHIKV-ZsGreen (MOI 1) for 2 h before infection of Vero cells
for 1 h and incubation at 37.degree. C. for 6 h. Infectivity was
measured as % ZsGreen+ve live cells by flow cytometry.
[0201] Oligonucleotides, Plasmids, and Antibodies.
[0202] To generate pCapsid-EGFP, cDNA corresponding to CHIKV capsid
protein was amplified by PCR using primers CHIKCprotF (5'
GCGGCGCAAGCTTATGGAGTTCATCCCAACCC 3'-SEQ. ID NO. 8) and CHIKCprotR
(5' CGCGGATCCGACTCTTCGGCCCCCTCG 3'-SEQ. ID NO. 9) and cloned into
pEGFP-N1 (Takara Bio USA, Inc.). To generate pCapsidW-EGFP
containing tryptophan residue required for capsid protein
autoproteolytic cleavage at the C-terminal of capsid protein,
primers CHIKCprotF and CHIKCprotWR (5' CGCGGATCCGACCACTCTTCGGCC
3'-SEQ. ID NO. 10) were used and the obtained fragment was cloned
into pEGFP-N1. pSP6-CHIKV-ZsGreen, a plasmid containing cDNA of
CHIKV variant expressing the ZsGreen marker protein, was
constructed using a full-length infectious cDNA clone of the La
Reunion CHIKV isolate LR2006-OPY1 as described previously (Pohjala
L, Utt A, Varjak M, Lulla A, Merits A, Ahola T, Tammela P. 2011.
Inhibitors of Alphavirus Entry and Replication Identified with a
Stable Chikungunya Replicon Cell Line and Virus-Based Assays. Plos
One 6). Oligonucleotides used in site-directed mutagenesis are
listed in Table 1. Mutants were generated using a QuikChange II
site-directed mutagenesis kit (Agilent Technologies USA, Inc.).
Antibodies to nucleolin (Santa Cruz Biotech USA, Inc.), EGFP (BD
Biosciences, USA), and actin (Santa Cruz Biotech USA, Inc.) were
purchased from the respective suppliers. Monoclonal capsid protein
antibody was made in house and characterised as described
previously (Goh L Y H, Hobson-Peters J, Prow N A, Gardner J,
Bielefeldt-Ohmann H, Suhrbier A, Hall R A. 2015. Monoclonal
antibodies specific for the capsid protein of chikungunya virus
suitable for multiple, applications. Journal of General Virology
96:507-512; Goh L Y H, Hobson-Peters J, Prow N A, Baker K, Piyasena
T B H, Taylor C T, Rana A, Hastie M L, Gorman J J, Hall R A. 2015.
The Chikungunya Virus Capsid Protein Contains Linear B Cell
Epitopes in the N- and C-Terminal Regions that are Dependent on an
Intact C-Terminus for Antibody Recognition. Viruses-Basel
7:2943-2964. A cocktail of anti-capsid monoclonal antibodies (1.7B2
and 4.1H11) was used for immunofluorescence.
TABLE-US-00001 TABLE 1 Oligonucleotides used in site-directed
mutagenesis Primer name Sequence SEQ. ID NO. K84/85A sense 5'
caaaacaacacaaatcaagcggcgcagccacctaaaaagaaac 11 K84/85A antisense 3'
gttttgttgtgtttagttcgccgcgtcggtggatttttctttg 12 K95/96A sense 5'
gaaaccggctcaagcggcaaagaagccgggc 13 K95/96A antisense 3'
ctttggccgagttcgccgtttcttcggcccg 14 R101/102A sense 5'
gaagccgggcgccgcagagaggatgtgcatgaaaatcg 15 R101/102A antisense 3'
cttcggcccgcggcgtctctcctacacgtacttttagc 16 R62/63A sense 5'
gcggtaccccaacagaagccagccgcgaatcggaagaataag 17 R62/63A antisense 3'
cgccatggggttgtcttcggtcggcgcttagccttcttattc 18 K68/69A sense 5'
gaatcggaagaatgcggcgcaaaagcaaaaacaacaggcgcc 19 K68/69A antisense 3'
cttagccttcttacgccgcgttttcgtttttgttgtccgcgg 20 RK65/66A sense 5'
cagccgcgaatgcggcgaatgcggcgcaaaag 21 RK65/66A antisense 3'
gtcggcgcttacgccgcttacgccgcgttttc 22
[0203] Cell Culture, Transfection and Virus Propagation.
[0204] Vero and BHK-21 cells were cultured in Opti-MEM, Gibco.RTM.
(Thermo Fisher Scientific, Australia), supplemented with 3% fetal
calf serum (FCS). C6/36 cells were cultured in Leibovitz's L-15
medium, Gibco.RTM. (Thermo Fisher Scientific, Australia),
supplemented with 10% tryptose phosphate broth and 10% FCS. Plasmid
transfections were carried out with Lipofectamine 2000 (Thermo
Fisher Scientific, Australia) according to the manufacturer's
instructions.
[0205] Mice
[0206] C57BL/6 WT mice were obtained from the Animal Resources
Centre (Perth, Australia) and bred in-house. All animal experiments
were performed in accordance with the guidelines set out by the
Griffith University Animal Ethics Committee. Twenty one-day-old
C57BL/6 male and female mice, in equal distribution, were
inoculated in the ventral/lateral side of the foot with 10.sup.4
plaque-forming units (pfu) CHIKV-WT or CHIKV-NoLS diluted in PBS to
a volume of 20 .mu.l. Mock-infected mice were inoculated with PBS
alone. Mice were weighed and scored for disease signs every 24 h
and sacrificed by CO.sub.2 asphyxiation at experimental end points.
CHIKV-induced footpad swelling was assessed by measuring the height
and width of the perimetatarsal area of the hind foot, using
Kincrome digital vernier callipers. At 30 days post infection mice
were challenged in the ventral/lateral side of the foot with
10.sup.4 pfu CHIKV-WT, weighed and scored for disease signs every
24 h and viraemia measured at day 1, 2 and 3 post challenge or
10.sup.4 pfu Ross River virus (RRV) subcutaneously in the thorax
and viraemia measured at day 1 and 2 post challenge.
[0207] Neutralisation Assay
[0208] The neutralising capacity of antibody from CHIKV-WT or
CHIKV-NoLS infected mice at day 30 post infection was analysed by
immunofluorescence-based cell infection assays using Vero cells and
CHIKV-ZsGreen. Infectious virus, taken at an amount sufficient for
multiplicity of infection (MOI) 0.4, was mixed with diluted
(10.sup.-3, 10.sup.-2 and 10.sup.-3), heat-inactivated (56.degree.
C. for 30 mins) pooled mouse sera, followed by incubation for 2 h
at 37.degree. C. Virus-antibody mixtures were added to Vero cells
and incubated at 37.degree. C. for 1 h. The virus inoculum was
removed, cells washed with PBS, and Opti-MEM containing 3% FCS
added, followed by incubation for 6 h at 37.degree. C. Cells were
gently resuspended, stained with LIVE/DEAD.RTM. Near Infrared cell
stain (Thermo Fisher Scientific, Australia) and fixed in 4%
paraformaldehyde. Infectivity was measured as % ZsGreen+ve live
cells using BD LSR II Fortessa Cell Analyser and quantified with
FlowJo software (Treestar USA Inc.).
[0209] Immunofluorescence Microscopy and FLIP (Fluorescence Loss in
Photobleaching)
[0210] Cells grown on polylysine-treated coverslips were fixed in
4% paraformaldehyde and permeabilised in 1% Triton X-100. Cells
were then blocked in 1% bovine serum albumin (BSA) made in PBS and
incubated at 37.degree. C. for 1 h. Primary antibodies were diluted
1:100 in 1% BSA and incubated with the cells for 1 h at 37.degree.
C. Alexa Fluor 647 conjugated secondary antibody, Invitrogen.TM.
(Thermo Fisher Scientific, Australia), was diluted 1:500 in 1% BSA
and incubated with the cells for 1 h at 37.degree. C. Coverslips
were mounted in Vectorshield mounting medium (Vector Laboratories,
USA) and staining was visualised on an Olympus FluoView.TM. FV1000
confocal microscope. For FLIP analysis, Vero cells were plated on
glass-based 33-mm culture dishes and imaged at 24 h post
transfection using an LSM 510 META confocal microscope (Zeiss,
Oberkochen, Germany). Cells were maintained at 37.degree. C. and,
during imaging, the cell culture medium was exchanged for
CO.sub.2-independent medium, Invitrogen.TM. (Thermo Fisher
Scientific, Australia). Fluorescence loss at the region of interest
(ROI) was normalised using the relative fluorescence intensity from
the LSM 510 software; initial fluorescence intensity was set as
1.
[0211] In Vitro Viral Replication Kinetics
[0212] BHK-21 and C6/36 cells were infected with CHIKV-WT or
CHIKV-NoLS at MOI 0.1, allowed to incubate for 1 h at 37.degree. C.
in a 5% CO.sub.2 incubator before virus was removed and the cells
washed with PBS and overlaid with Opti-MEM containing 3% FCS. At
various times post infection supernatant aliquots were harvested
and vial titre measured by plaque assay as outlined below. To
determine the virus RNA genome copy number in culture supernatants
and virus positive strand RNA copy number in infected cells
supernatant was collected and monolayers washed three times in PBS.
RNA extraction was performed using TRIzol.RTM., Invitrogen.TM.
(Thermo Fisher Scientific, Australia), according to the
manufacturer's instructions. Extracted RNA was reverse transcribed
using random nonamer primers and M-MLV reverse transcriptase
(Sigma-Aldrich USA, Inc.) according to the manufacturer's
instructions. Standard curve was generated using serial dilutions
of a full-length infectious cDNA clone of the La Reunion CHIKV
isolate LR2006-OPY1. Quantification of viral load was performed
using SYBR.RTM. Green Real-time PCR reagent in 12.5 .mu.L reaction
volume to detect E1 region. Primers CHIKV E1F (5'
CCCGGTAAGAGCGGTGAA 3'-SEQ. ID NO. 23) and CHIKV E1R (5'
CTTCCGGTATGTCGATG3'-SEQ. ID NO. 24) were used to detect CHIKV
genomic, antigenomic and subgenomic RNAs. All reactions were
performed using a CFX96 Touch.TM. Real-Time PCR System. Standard
curve was plotted and copy numbers of amplified products were
interpolated from standard curve using Graphpad Prism software to
determine viral RNA copy number.
[0213] Viral Titre Assay
[0214] Mice were sacrificed at days 1, 2, 3, and 4 post infection
with the ankle joint and serum collected and assayed for viral
titre using plaque assay. Tissue samples were homogenised in 1 ml
of PBS and 10-fold serial dilutions of homogenate and sera were
added in triplicate to Vero cells. Virus was allowed to incubate
for 1 h at 37.degree. C. in a 5% CO.sub.2 incubator before virus
was removed and the cells overlaid with Opti-MEM containing 3% FCS
and 1 agarose (Sigma-Aldrich USA, Inc.) and incubated for 48 h in a
5% CO.sub.2 incubator. Cells were fixed in 1% formalin and virus
plaques were made visible by staining with 0.1% crystal violet.
Results were expressed as pfu/ml or pfu per gram of tissue
(pfu/g).
[0215] Quantitative RT-PCR
[0216] RNA was extracted from tissues using TRIzol.RTM.,
Invitrogen.TM. (Thermo Fisher Scientific, Australia), according to
the manufacturer's instructions. 1 .mu.g of total RNA was reverse
transcribed using random nonamer primers and M-MLV reverse
transcriptase (Sigma-Aldrich USA, Inc.) according to the
manufacturer's instructions. Quantitative PCR was performed with 50
ng of template cDNA, QuantiTect Primer Assay kits (Qiagen, Hilden,
Germany) and SYBR.RTM. Green Real-time PCR reagent in a CFX96
Touch.TM. Real-Time PCR System using a standard three-step melt
program (95.degree. C. for 15 s, 55.degree. C. for 30 s and
72.degree. C. for 30 s). Data were normalised to HPRT1 and the fold
change in mRNA expression relative to mock-infected PBS treated
samples for each gene was calculated using the
.DELTA..DELTA.C.sub.T method. Briefly,
.DELTA..DELTA.C.sub.T=.DELTA.C.sub.T (Virus
infected)-.DELTA.C.sub.T (Mock infected) where
.DELTA.C.sub.T=C.sub.T (gene of interest)-C.sub.T (housekeeping
gene). The fold change for each gene is calculated as
2.sup.-.DELTA..DELTA.CT.
[0217] Statistical Analysis
[0218] Two-way ANOVA with Bonferroni post-tests was used to examine
in vitro viral growth kinetic data and viraemia. Student's unpaired
t-tests were used to analyse quantitative RT-PCR and ankle titers
at day 3 post infection. One-way ANOVA with Bonferroni post-tests
was used to examine neutralisation assay. A P-value <0.05 was
considered to be significant.
[0219] Results and Discussion
Example 1--Identification of the CHIKV Capsid Protein Nucleolar
Localisation Sequence
[0220] In order to identify the minimal CHIKV capsid protein
nucleolar localisation sequence (NoLS), site-directed mutagenesis
was performed on recombinant EGFP-tagged CHIKV capsid protein at a
region in the N-terminus rich in basic amino acids. Amino acids of
the protein were replaced with alanine. Ten amino acids,
constituting the minimal NoLS of the CHIKV capsid protein, were
identified.
[0221] Four mutant capsid proteins were generated and their
sequence differences are shown in the sequence alignment of FIG. 1A
together with the sequence of wild-type CHIKV Capsid protein
("Capsid-WT", labelled as "WT"). The mutated CHIKV capsid proteins
were Capsid-NLS 63/66/69 (labelled "NLS 63/66/69"), Capsid-NLS
85/95/101 (labelled "NLS 85/95/10"), Capsid-101 (labelled "101"),
and Capsid-101/95 (labelled "101/95") which will also be referred
to herein as "Capsid-NoLS".
[0222] The 10 amino acid changes in Capsid-101/95 are likely to be
the minimal residues required for nucleolar localisation of the
capsid protein.
Example 2--Subcellular Localisation of Mutant CHIKV Capsid
Proteins
[0223] The subcellular localisation of the mutant capsid proteins
in Vero cells was investigated using confocal microscopy. As seen
in FIG. 1B, Capsid-WT (labelled as "WT") localised to the
nucleolus. Capsid-101 (labelled as "101") showed a reduced ability
to localise to the nucleolus, but was still observed in the
nucleolus. Capsid-101/95 (labelled as "101/95") comprised the
minimal nucleolar localisation sequence and showed a complete
absence from the nucleolus.
[0224] Indirect immunofluorescence, using capsid-specific
antibodies, was further used to analyse the subcellular
localisation of CHIKV capsid protein in CHIKV-WT and CHIKV-NoLS
infected Vero cells and mosquito (Aedes albopictus) derived C6/36
cells. Results show that in CHIKV-WT infected Vero cells capsid
protein accumulates in subnuclear bodies reminiscent of the
nucleolus at 24 h post infection (FIG. 4A). In CHIKV-NoLS infected
Vero cells these punctae are absent. Thus, in the context of the
virus the NoLS mutation causes similar disruption of capsid protein
subnuclear localisation in infected Vero cells. The NoLS mutation
is therefore stable in the virus, resulting in a phenotypic
disruption of capsid protein subnuclear localisation.
[0225] Interestingly, in CHIKV-WT infected C6/36 cells capsid
protein did not accumulate in subnuclear bodies and was found
predominantly in the cytoplasm at 24 h post infection (FIG. 12B).
In CHIKV-NoLS infected C6/36 cells capsid protein was also found to
predominate in the cytoplasm, similar to the localisation observed
in CHIKV-WT infected C6/36 cells. Subnuclear localisation of capsid
protein is therefore not a characteristic of CHIKV infection in
insect cells and mutation of the NoLS has no effect on the
subcellular localisation of capsid protein in infected C6/36
cells.
Example 3--Trafficking Ability of Mutant CHIKV Capsid Protein
[0226] Fluorescence loss in photobleaching (FLIP) analysis was
performed on live Vero cells transfected with either EGFP-tagged
wild-type capsid protein or the capsid protein mutants. FLIP
analysis was used to investigate the mobility of Capsid-101/95
(labelled "101/95") compared to Capsid-WT (labelled "wt") and
mutant Capsid-101 (labelled "101"). Fluorescence loss in the
cytoplasm was assessed over a 280 sec period during continual
photobleaching of a section of the nucleus. This allowed analysis
of the nuclear trafficking rates of the mutants. Fluorescence
recovery curves were constructed; data were normalized following
the bleaching period so that the initial prebleaching was set as 1
and the fully bleached fluorescence intensity was set as 0.
[0227] As seen in FIGS. 2A and 2B, Capsid-WT showed almost total
fluorescence loss after 280 sec, indicating mobility of the protein
and trafficking into the nucleus from the cytoplasm. However,
mutants Capsid-101 and Capsid-101/95 showed a distinct inability to
traffic to the nucleus with fluorescence intensity remaining
relatively high. At later times there also appeared to be a
cumulative effect of the additional mutations, with Capsid-101/95
more immobile than Capsid-101. These results suggest that mutation
of the nucleolar localisation sequence has a major effect on the
trafficking ability of capsid protein and perhaps consequently on
its subcellular localization.
Example 4--Mutation of the NoLS Did not Affect Capsid Protein
Autoproteolytic Cleavage
[0228] Mutation of the NoLS and its effect on capsid protein
autoprotease activity was analysed. Constructs expressing
EGFP-tagged WT Capsid-W, Capsid-101-W and Capsid-NoLS-W, containing
the C-terminal tryptophan (W261) required for capsid protein
autoproteolytic cleavage, were generated. FIG. 3 shows that all
constructs lacking W261 residue from the conserved cleavage site
were unable to cleave EGFP from capsid protein. However, capsid
protease efficiently cleaved EGFP from capsid protein in all
constructs that contained W261, including the NoLS mutants of
capsid protein (FIG. 3). Thus, mutation of the NoLS has no effect
on the autocatalytic protease activity of CHIKV capsid protein.
Example 5--CHIKV Containing the NOLs Mutation in Capsid Protein
Shows Attenuation In Vitro
[0229] To assess the importance of capsid protein nucleolar
localisation on CHIKV replication, the effect of the NoLS mutation
in the context of a full-length CHIKV infectious clone-derived
virus was examined. CHIKV containing the NoLS mutation in capsid
protein (CHIKV-NoLS) was rescued and propagated in Vero cells.
Plaque purification of virus and Sanger sequencing of the entire
CHIKV genome confirmed the NoLS mutation was maintained in passaged
virus in the absence of additional mutations. Indirect
immunofluorescence, using capsid-specific antibodies, was used to
analyse the subcellular localisation of CHIKV capsid protein in
CHIKV-WT and CHIKV-NoLS infected Vero cells and mosquito (Aedes
albopictus) derived C6/36 cells.
[0230] Results show that in CHIKV-WT infected Vero cells capsid
protein accumulates in subnuclear bodies reminiscent of the
nucleolus at 24 h post infection (FIG. 4A). In CHIKV-NoLS infected
Vero cells these punctae are absent. Thus, in the context of the
virus the NoLS mutation causes similar disruption of capsid protein
subnuclear localisation in infected Vero cells. The NoLS mutation
is therefore stable in the virus, resulting in a phenotypic
disruption of capsid protein subnuclear localisation.
Interestingly, in CHIKV-WT infected C6/36 cells capsid protein did
not accumulate in subnuclear bodies and was found predominantly in
the cytoplasm at 24 h post infection (FIG. 4B). In CHIKV-NoLS
infected C6/36 cells capsid protein was also found to predominate
in the cytoplasm, similar to the localisation observed in CHIKV-WT
infected C6/36 cells. Subnuclear localisation of capsid protein is
therefore not a characteristic of CHIKV infection in insect cells
and mutation of the NoLS has no effect on the subcellular
localisation of capsid protein in infected C6/36 cells.
[0231] To examine the replication kinetics of CHIKV-WT and
CHIKV-NoLS in mammalian (BHK-21) and mosquito (C6/36) cells, cells
were infected at a multiplicity of infection (MOI) of 0.1 pfu/cell
and multistep growth kinetics analysed. CHIKV-NoLS grew to
significantly lower titers than CHIKV-WT in both BHK-21 cells (FIG.
4C) and C6/36 cells (FIG. 4D). Furthermore, CHIKV-NoLS had a small
plaque phenotype in BHK-21 cells (FIG. 4E), indicating a reduced
ability of the virus to spread from the initial site of infection
and thus attenuation.
Example 6--CHIKV Mutant Capsid Protein--Effect on Disease and
Viraemia
[0232] Viral titers in serum and ankle joint, and expression of
inflammatory mediators of CHIKV disease, were investigated in
mutant Capsid-101/95 infected mice. The results are shown in FIGS.
5A-5C and FIGS. 6A and 6B. Viral titers in serum and ankle joint,
and expression of inflammatory mediators of CHIKV disease in
Capsid-101/95 infected mice were significantly reduced compared to
Capsid-WT infected mice.
[0233] At day 3 post-infection the expression of inflammatory
mediators of CHIKV disease in the ankle joint was analysed by
qRT-PCR. Monocyte chemoattractant protein-1 (MCP-1), interferon
gamma (IFN.gamma.) and tumor necrosis factor alpha (TNF.alpha.)
were dramatically under expressed in the ankle tissue of
Capsid-101/95 (labelled "CHIKV-NoLS") infected mice compared to
Capsid-WT (labelled "CHIKV-WT") infected mice (see FIG. 5B). These
soluble immune mediators are key markers of disease progression and
severity in CHIKV infected mice. Low expression of these mediators
is likely linked to the lack of disease signs in Capsid-101/95
(CHIKV-NoLS) infected mice.
[0234] The amount of infectious virus in the blood and joint tissue
is intimately linked to disease severity in CHIKV-infected mice. At
day 3 post-infection the amount of live virus in the serum and
ankle tissue of Capsid-101/95 (CHIKV-NoLS) infected mice was
dramatically reduced compared to Capsid-WT (labelled "CHIKV-WT")
infected mice (see FIG. 5A). Reduced Capsid-101/95 (CHIKV-NoLS)
titers are also likely linked to the reduced disease severity in
Capsid-101/95 (CHIKV-NoLS) infected mice.
[0235] As seen in FIGS. 6A and 6B, Capsid-101/95 (CHIKV-NoLS)
infected mice showed no signs of acute CHIKV disease. Capsid-101/95
(CHIKV-NoLS) infected mice developed no footpad swelling. The
results suggest that Capsid-101/95 (CHIKV-NoLS) is highly
attenuated in mice. With low reactogenicity, Capsid-101/95
(CHIKV-NoLS) is a suitable candidate for a live attenuated
vaccine.
Example 7--Mice Immunised with CHIKV Capsid Protein Show Protective
Immunity
[0236] As seen in FIGS. 7A-7C, Capsid-101/95 (CHIKV-NoLS) immunised
mice were protected from CHIKV disease when challenged with
Capsid-WT (labelled "CHIKV-WT"). Mice immunised with Capsid-101/95
(CHIKV-NoLS) showed no signs of footpad swelling upon challenge
with Capsid-WT at day 30 post immunisation (see FIG. 7C) and
developed no detectable viraemia from days 1-3 post challenge (see
FIG. 7B). Immunisation with CHIKV-NoLS protected mice from CHIKV
challenge for up to 30 days, indicating Capsid-101/95 (CHIKV-NoLS)
is immunogenic after one dose and immunity is long lived.
Example 8--Sera from CHIKV Capsid Protein Infected Mice Neutralise
Infectious CHIKV
[0237] As seen in FIGS. 8A and 8B, sera from Capsid-101/95
(CHIKV-NoLS) infected mice preincubated with CHIKV was able to
neutralise infectious CHIKV in vitro. Antibodies induced by
Capsid-101/95 (CHIKV-NoLS) infection efficiently neutralised CHIKV
in vitro.
Example 9--CHIKV Capsid Protein Immunisation Reduces Peak Viraemia
in Ross River Virus Challenged Mice
[0238] As seen in FIG. 9, Capsid-101/95 (CHIKV-NoLS) immunisation
reduced peak viraemia in Ross River virus (RRV) challenged mice.
Capsid-101/95 (CHIKV-NoLS) immunised mice showed significantly
reduced peak (day 2) and early viraemia, day 1 and 2 post
challenge, upon challenge with related alphavirus RRV. By reducing
viraemia, an indicator of disease outcome, Capsid-101/95
(CHIKV-NoLS) has the potential to offer cross protection against
the disease caused by other arthritogenic alphaviruses such as RRV,
BFV, SFV, MAYV and/or ONNV.
Example 10--CHIKV Capsid Protein Immunisation Reduces Peak Viraemia
in Ross River Virus Challenged Mice
[0239] To determine whether the mutant CHIKV capsid proteins
Capsid-101 (labelled "101") and Capsid-101/95 (labelled "101/95")
expressed at levels similar to the wild-type Capsid-WT (labelled "C
prot wt"), each mutant was transfected into Vero cells, and cell
lysates were assayed by Western blot analysis using an GFP-specific
antibody and, loading control, Actin antibody. The results showed
that both Capsid-101 (labelled "101") and Capsid-101/95 (labelled
"101/95") expressed at levels similar to that for the wild-type
capsid protein Capsid-WT.
Example 11--SFV Capsid Protein NoLS
[0240] The SFV capsid protein is the only other alphavirus capsid
protein currently known to localise to the nucleolus. [Favre Dl,
Studer E, Michel M R. Arch Virol. 1994; 137(1-2):149-55. Two
nucleolar targeting signals present in the N-terminal part of
Semliki Forest virus capsid protein]. Two nucleolar targeting
signals have previously been identified in the N-terminal part of
the SFV capsid protein.
[0241] FIG. 11 shows a protein sequence alignment of CHIKV
wild-type capsid protein and SFV wild-type capsid protein, with
CHKV amino acids found important for nucleolar transportation shown
in underline. Based on the CHIKV and SFV sequence similarities, a
mutated SFV capsid protein could be developed which would not
localise within the nucleolus--that is, SFV mutant capsid proteins
similar to the mutant CHIKV capsid proteins Capsid-101 and
Capsid-101/95 could be developed. Mutation of the NoLS of SFV the
capsid protein would attenuate its replication and subsequently act
as a SFV vaccine and offer cross protection to other
alphaviruses.
Example 12--Cross-Reactivity of Alphavirus Antibodies and Chimeric
Alphavirus
[0242] A growing body of evidence indicates cross-reactivity of
alphavirus antibodies with broadly neutralising effects both in
vitro and in vivo. A live attenuated vaccine comprising mutated
CHIKV capsid protein is likely to offer cross protection against
other arthritogenic alphaviruses, such as RRV, BFV, SFV, ONNV and
MAYV, which share a greater degree of structural and genetic
homology to CHIKV than other types of alphaviruses. It is less
likely to be effective against encephalitic alphaviruses, such as
Eastern equine encephalitis virus (EEEV) and Venezuelan equine
encephalitis virus (VEEV), which are more distantly related. For
this reason, a chimeric alphavirus may be constructed (such as
taught by Roy C J, Adams A P, Wang E, Leal G, Seymour R L,
Sivasubramani S K, Mega W, Frolov I, Didier P J, Weaver S. C.
Vaccine. 2013. A chimeric Sindbis-based vaccine protects cynomolgus
macaques against a lethal aerosol challenge of eastern equine
encephalitis virus.), containing all or part of the structural
polyprotein or non-structural polyprotein of an encephalitic
alphavirus and, for example, the NoLS mutant capsid protein of
CHIKV. On this point, it must be remembered that the entire
structural polyprotein of alphaviruses can be swapped from one
alpahvirus to another forming chimeric viruses. A chimeric
alphavirus containing the CHIKV capsid with the NoLS mutation may
offer much better vaccine protection, greater immunogenicity and/or
neutralisation to the desired alphavirus, for not only
arthritogenic alphaviruses but also encephalitic alphaviruses
(subject to a similar level of attenuation).
Example 13--Identification of Antibody Subtypes
[0243] The humoral and cellular responses in subjects following
vaccination with a mutant CHIKV capsid protein (or other alphaviral
capsid protein) can be measured. A global view of antibody
responses (i.e. identify different antibody subtypes) can be
obtained. It is likely that the live attenuated recombinant vaccine
will induce a strong antibody response with some antibody subtypes
dominating the response. Identifying these antibody subtypes
associated with strong neutralization may have diagnostic value.
For instance, the absence of CHIKV-specific antibody subtype in an
unvaccinated subject infected with CHIKV may serve as a specific
marker of subjects with increased risk of developing severe disease
that can progress to chronic disease. Also, any antibody subtype
identified as neutralizing can be administered to subjects with
high viremia. The vaccine may also influence cellular response and
T cell responses which can also be measured.
Example 14--Attenuation of CHIKV NoLs in Mammalian and Insect Cells
Based on Synthesis of Viral RNA and Virus Gene Copy Number
[0244] To further investigate the attenuation of CHIKV-NoLS in
mammalian and insect cells, complementary RT-qPCR analysis of virus
genome copy number in the culture supernatants and virus RNA copy
number in infected cells was performed. Results suggest that
synthesis of viral RNA remains unperturbed by the NoLS mutation in
both BHK-21 (FIG. 12A) and C6/36 (FIG. 12B) cells. Furthermore, by
12 h post infection the copy number of CHIKV-NoLS RNAs in infected
BHK-21 (FIG. 12A) and C6/36 (FIG. 12B) cells significantly exceeded
these in CHIKV-WT infected cells. The difference is potentially due
to increased survival of CHIKV-NoLS infected cells allowing
prolonged or more efficient synthesis of viral RNA and/or due to
reduced competition between viral replicase and capsid protein for
binding viral genomic RNAs. However, the genome copy numbers of
CHIKV-NoLS in culture supernatants did not show any increase up to
12 h post infection in both BHK-21 (FIG. 12C) and C6/36 (FIG. 12D)
cells indicating that no or very little virus was released. This
result correlates with the delayed release and reduced titers of
infectious CHIKV-NoLS recovered from culture supernatants (FIGS. 4C
and 4D). In contrast, for CHIKV-WT infected cells virus titres
started to increase at 8 h post infection. Results suggest that,
although synthesis of viral RNA in infected cells was not reduced,
mutation of the capsid protein NoLS causes a defect in infectious
virus particle formation causing reduction and delay of release of
viral progeny. Together, these data suggests that subnuclear
localisation of CHIKV capsid protein in not a hallmark of infection
across different host cells and that the attenuation of CHIKV-NoLS
in both mammalian and insect cells is likely the result of a defect
in infectious virus particle formation due to the NoLS
mutation.
Example 15--Multi Step Growth Kinetics of P5 CHIKV-NoLS
[0245] The CHIKV-NoLS vaccine candidate was passaged in Vero cells
to assess phenotypic stability. T-75 flasks were grown to 90-95%
confluency and infected at a multiplicity of infection (MOI) of 0.1
PFU/cell with CHIKV-NoLS or CHIKV-WT. Following 24 h of incubation
at 37.degree. C., culture media was used to infect another flask of
Vero cells at MOI of 0.1. After 5 serial passages the growth
kinetics of P5 CHIKV-NoLS was compared to CHIKV-WT and CHIKV-NoLS
at passage 0 (P0).
[0246] C636 insect cells were infected at a multiplicity of
infection (MOI) of 0.1 pfu/cell. Following adsorption of virus for
1 h at 37.degree. C., cell monolayers were washed and fresh growth
medium was added. Supernatants were collected at indicated time
points and infectious virus quantified by plaque assay.
[0247] As seen in FIG. 13, P5 CHIKV-NoLS shows similar multi step
replication kinetics to P0 CHIKV-NoLS. P0 CHIKV-NoLS and P5
CHIKV-NoLS show significantly reduced infectious titers at 24 and
48 hours post infection. This indicates that after 5 passages in
Vero cells, replication of CHIKV-NoLS in insect cells remains
significantly impaired compared to CHIKV-WT. The attenuated
replication phenotype of CHIKV-NoLS remains stable after 5 passages
in Vero cells.
Example 16--CHIKV NoLs Stability Following Cell Culture
Passage--Plaque Size
[0248] The CHIKV-NoLS vaccine candidate was passaged in Vero cells
to assess phenotypic stability. T-75 flasks were grown to 90-95%
confluency and infected at a multiplicity of infection (MOI) of 0.1
PFU/cell with CHIKV-NoLS or CHIKV-WT. Following 24 h of incubation
at 37.degree. C., culture media was used to infect another flask of
Vero cells at MOT of 0.1. After 10 serial passages Vero plaque
sizes were measured and compared to assess stability. Results are
shown in FIG. 14.
[0249] CHIKV-NoLS has a small plaque phenotype in mammalian cells,
indicating a reduced ability of the virus to spread from the
initial site of infection and thus attenuation. To assess its
phenotypic stability, CHIKV-NoLS was passaged 10 times in Vero
cells at 37.degree. C. using a multiplicity of infection of 0.1
PFU/cell.
[0250] The average plaque size of CHIKV-NoLS remained notably
smaller than CHIKV-WT after 10 passages. CHIKV-NoLS also exhibited
more homogeneous plaque morphology than CHIKV-WT. Results show
that, after 10 passages, CHIKV-NoLS does not revert to a CHIKV-WT
plaque phenotype and suggest that the CHIKV-NoLS vaccine candidate
remains attenuated in its ability to spread from the initial site
of infection.
Example 17--Effect of Filtration on CHIKV NoLs
[0251] This example shows that a viable live attenuated vaccine
candidate can be produced in large quantities, with little loss of
vaccine yield following filtration.
[0252] To examine the loss of CHIKV-NoLS yield during virus
propagation filtration, the titer of CHIKV-NoLS before and after
0.22 .mu.m filtration was measured. The results are shown in FIG.
15.
[0253] Average CHIKV-NoLS titers before and after filtration:
Unfiltered--1.57.times.10.sup.6 PFU/ml; PVDF (hydrophilic PVDF
membrane 0.22 .mu.m pore size)--1.09.times.10.sup.6 PFU/ml; and PES
(hydrophilic Polyethersulfone membrane 0.22 .mu.m pore
size)--1.19.times.10.sup.6 PFU/ml.
Example 18--Effect of Temperature on CHIKV NoLs During Long-Term
Storage
[0254] This example shows that a viable live attenuated vaccine
candidate can be stored long-term at either -20.degree. C. or
-80.degree. C.
[0255] Although able to be stored stably at -80.degree. C., storage
of CHIKV-NoLS at -20.degree. C. or 4.degree. C. would reduce the
cost of storing CHIKV-NoLS. Storage at -20.degree. C., the
temperature of a regular freezer, would also increase the
accessibility of CHIKV-NoLS to wider populations.
[0256] The effect of temperature (21.degree. C., 4.degree. C.,
-20.degree. C. and -80.degree. C.) on long-term CHIKV-NoLS storage
is shown in FIG. 16A and the effect of temperature (21.degree. C.,
4.degree. C., -20.degree. C. and -80.degree. C.) on long-term
CHIKV-WT storage is shown in FIG. 16B.
[0257] No infectious CHIKV-NoLS or CHIKV-WT was detected after 28
days when stored at 21.degree. C., room temperature. After 56 days
at 4.degree. C. the titer of CHIKV-NoLS fell to 110 pfu/ml and
CHIKV-WT to 450 pfu/ml. The titer of CHIKV-NoLS and CHIKV-WT
remained stable after 56 days when stored at either -20.degree. C.
or -80.degree. C.
[0258] The above Examples demonstrate the following:
[0259] Mutating the NoLs of CHIKV capsid protein attenuates CHIKV
replication in vitro.
[0260] Capsid-101/95 (CHIKV-NoLS) infected mice showed no disease
signs, reduced viraemia and reduced expression of inflammatory
mediators, making Capsid-101/95 (CHIKV-NoLS) an ideal live
attenuated vaccine candidate.
[0261] Capsid-101/95 (CHIKV-NoLS) immunised mice are protected from
disease when challenged with CHIKV wild-type capsid protein.
[0262] Capsid-101/95 (CHIKV-NoLS) immunised mice develop CHIKV
specific neutralising antibodies.
[0263] Capsid-101/95 (CHIKV-NoLS) is likely to offer alphaviral
cross protection, including viraemia upon Ross River virus
challenge.
[0264] A viable live attenuated vaccine candidate can be produced
in large quantities, with little loss of vaccine yield following
filtration.
[0265] A viable live attenuated vaccine candidate can be stored
long-term at either -20.degree. C. or -80.degree. C.
[0266] In compliance with the statute, the invention has been
described in language more or less specific to structural or
methodical features. It is to be understood that the invention is
not limited to specific features shown or described since the means
herein described comprises preferred forms of putting the invention
into effect. The invention is, therefore, claimed in any of its
forms or modifications within the proper scope of the appended
claims (if any) appropriately interpreted by those skilled in the
art.
Sequence CWU 1
1
241261PRTChikungunya virus 1Met Glu Phe Ile Pro Thr Gln Thr Phe Tyr
Asn Arg Arg Tyr Gln Pro1 5 10 15Arg Pro Trp Thr Pro Arg Pro Thr Ile
Gln Val Ile Arg Pro Arg Pro 20 25 30Arg Pro Gln Arg Gln Ala Gly Gln
Leu Ala Gln Leu Ile Ser Ala Val 35 40 45Asn Lys Leu Thr Met Arg Ala
Val Pro Gln Gln Lys Pro Arg Arg Asn 50 55 60Arg Lys Asn Lys Lys Gln
Lys Gln Lys Gln Gln Ala Pro Gln Asn Asn65 70 75 80Thr Asn Gln Lys
Lys Gln Pro Pro Lys Lys Lys Pro Ala Gln Lys Lys 85 90 95Lys Lys Pro
Gly Arg Arg Glu Arg Met Cys Met Lys Ile Glu Asn Asp 100 105 110Cys
Ile Phe Glu Val Lys His Glu Gly Lys Val Thr Gly Tyr Ala Cys 115 120
125Leu Val Gly Asp Lys Val Met Lys Pro Ala His Val Lys Gly Thr Ile
130 135 140Asp Asn Ala Asp Leu Ala Lys Leu Ala Phe Lys Arg Ser Ser
Lys Tyr145 150 155 160Asp Leu Glu Cys Ala Gln Ile Pro Val His Met
Lys Ser Asp Ala Ser 165 170 175Lys Phe Thr His Glu Lys Pro Glu Gly
Tyr Tyr Asn Trp His His Gly 180 185 190Ala Val Gln Tyr Ser Gly Gly
Arg Phe Thr Ile Pro Thr Gly Ala Gly 195 200 205Lys Pro Gly Asp Ser
Gly Arg Pro Ile Phe Asp Asn Lys Gly Arg Val 210 215 220Val Ala Ile
Val Leu Gly Gly Ala Asn Glu Gly Ala Arg Thr Ala Leu225 230 235
240Ser Val Val Thr Trp Asn Lys Asp Ile Val Thr Lys Ile Thr Pro Glu
245 250 255Gly Ala Glu Glu Trp 2602267PRTSemliki Forest virus 2Met
Asn Tyr Ile Pro Thr Gln Thr Phe Tyr Gly Arg Arg Trp Arg Pro1 5 10
15Arg Pro Ala Ala Arg Pro Trp Pro Leu Gln Ala Thr Pro Val Ala Pro
20 25 30Val Val Pro Asp Phe Gln Ala Gln Gln Met Gln Gln Leu Ile Ser
Ala 35 40 45Val Asn Ala Leu Thr Met Arg Gln Asn Ala Ile Ala Pro Ala
Arg Pro 50 55 60Pro Lys Pro Lys Lys Lys Lys Thr Thr Lys Pro Lys Pro
Lys Thr Gln65 70 75 80Pro Lys Lys Ile Asn Gly Lys Thr Gln Gln Gln
Lys Lys Lys Asp Lys 85 90 95Gln Ala Asp Lys Lys Lys Lys Lys Pro Gly
Lys Arg Glu Arg Met Cys 100 105 110Met Lys Ile Glu Asn Asp Cys Ile
Phe Glu Val Lys His Glu Gly Lys 115 120 125Val Thr Gly Tyr Ala Cys
Leu Val Gly Asp Lys Val Met Lys Pro Ala 130 135 140His Val Lys Gly
Val Ile Asp Asn Ala Asp Leu Ala Lys Leu Ala Phe145 150 155 160Lys
Lys Ser Ser Lys Tyr Asp Leu Glu Cys Ala Gln Ile Pro Val His 165 170
175Met Arg Ser Asp Ala Ser Lys Tyr Thr His Glu Lys Pro Glu Gly His
180 185 190Tyr Asn Trp His His Gly Ala Val Gln Tyr Ser Gly Gly Arg
Phe Thr 195 200 205Ile Pro Thr Gly Ala Gly Lys Pro Gly Asp Ser Gly
Arg Pro Ile Phe 210 215 220Asp Asn Lys Gly Arg Val Val Ala Ile Val
Leu Gly Gly Ala Asn Glu225 230 235 240Gly Ser Arg Thr Ala Leu Ser
Val Val Thr Trp Asn Lys Asp Met Val 245 250 255Thr Arg Val Thr Pro
Glu Gly Ser Glu Glu Trp 260 265353PRTChikungunya virus 3Gln Gln Lys
Pro Arg Arg Asn Arg Lys Asn Lys Lys Gln Lys Gln Lys1 5 10 15Gln Gln
Ala Pro Gln Asn Asn Thr Asn Gln Lys Lys Gln Pro Pro Lys 20 25 30Lys
Lys Pro Ala Gln Lys Lys Lys Lys Pro Gly Arg Arg Glu Arg Met 35 40
45Cys Met Lys Ile Glu 50453PRTChikungunya virus 4Gln Gln Lys Pro
Ala Ala Asn Ala Ala Asn Ala Ala Gln Lys Gln Lys1 5 10 15Gln Gln Ala
Pro Gln Asn Asn Thr Asn Gln Lys Lys Gln Pro Pro Lys 20 25 30Lys Lys
Pro Ala Gln Lys Lys Lys Lys Pro Gly Arg Arg Glu Arg Met 35 40 45Cys
Met Lys Ile Glu 50553PRTChikungunya virus 5Gln Gln Lys Pro Arg Arg
Asn Arg Lys Asn Lys Lys Gln Lys Gln Lys1 5 10 15Gln Gln Ala Pro Gln
Asn Asn Thr Asn Gln Ala Ala Gln Pro Pro Lys 20 25 30Lys Lys Pro Ala
Gln Ala Ala Lys Lys Pro Gly Ala Ala Glu Arg Met 35 40 45Cys Met Lys
Ile Glu 50653PRTChikungunya virus 6Gln Gln Lys Pro Ala Ala Asn Ala
Ala Asn Ala Ala Gln Lys Gln Lys1 5 10 15Gln Gln Ala Pro Gln Asn Asn
Thr Asn Gln Lys Lys Gln Pro Pro Lys 20 25 30Lys Lys Pro Ala Gln Lys
Lys Lys Lys Pro Gly Ala Ala Glu Arg Met 35 40 45Cys Met Lys Ile Glu
50753PRTChikungunya virus 7Gln Gln Lys Pro Ala Ala Asn Ala Ala Asn
Ala Ala Gln Lys Gln Lys1 5 10 15Gln Gln Ala Pro Gln Asn Asn Thr Asn
Gln Lys Lys Gln Pro Pro Lys 20 25 30Lys Lys Pro Ala Gln Ala Ala Lys
Lys Pro Gly Ala Ala Glu Arg Met 35 40 45Cys Met Lys Ile Glu
50832DNAArtificial SequenceOligonucleotide 8gcggcgcaag cttatggagt
tcatcccaac cc 32927DNAArtificial SequenceBased on CHIKV Capsid
Protein sequence 9cgcggatccg actcttcggc cccctcg 271024DNAArtificial
SequenceBased on CHIKV Capsid Protein sequence 10cgcggatccg
accactcttc ggcc 241143DNAArtificial SequenceOligonucleotide
11caaaacaaca caaatcaagc ggcgcagcca cctaaaaaga aac
431243DNAArtificial SequenceOligonucleotide 12gttttgttgt gtttagttcg
ccgcgtcggt ggatttttct ttg 431331DNAArtificial
SequenceOligonucleotide 13gaaaccggct caagcggcaa agaagccggg c
311431DNAArtificial SequenceOligonucleotide 14ctttggccga gttcgccgtt
tcttcggccc g 311538DNAArtificial SequenceOligonucleotide
15gaagccgggc gccgcagaga ggatgtgcat gaaaatcg 381638DNAArtificial
SequenceOligonucleotide 16cttcggcccg cggcgtctct cctacacgta cttttagc
381742DNAArtificial SequenceOligonucleotide 17gcggtacccc aacagaagcc
agccgcgaat cggaagaata ag 421842DNAArtificial
SequenceOligonucleotide 18cgccatgggg ttgtcttcgg tcggcgctta
gccttcttat tc 421942DNAArtificial SequenceOligonucleotide
19gaatcggaag aatgcggcgc aaaagcaaaa acaacaggcg cc
422042DNAArtificial SequenceOligonucleotide 20cttagccttc ttacgccgcg
ttttcgtttt tgttgtccgc gg 422132DNAArtificial
SequenceOligonucleotide 21cagccgcgaa tgcggcgaat gcggcgcaaa ag
322232DNAArtificial SequenceOligonucleotide 22gtcggcgctt acgccgctta
cgccgcgttt tc 322318DNAArtificial SequenceOligonucleotide
23cccggtaaga gcggtgaa 182417DNAArtificial SequenceOligonucleotide
24cttccggtat gtcgatg 17
* * * * *
References