U.S. patent application number 17/467574 was filed with the patent office on 2021-12-30 for cd4 t cells provide antibody access to immunoprivileged tissue.
The applicant listed for this patent is YALE UNIVERSITY. Invention is credited to Norifumi Iijima, Akiko Iwasaki.
Application Number | 20210401955 17/467574 |
Document ID | / |
Family ID | 1000005827974 |
Filed Date | 2021-12-30 |
United States Patent
Application |
20210401955 |
Kind Code |
A1 |
Iijima; Norifumi ; et
al. |
December 30, 2021 |
CD4 T cells provide antibody access to immunoprivileged tissue
Abstract
The present disclosure relates to compositions and methods for
treating or preventing a disease or disorder of immunoprivileged
tissue. It is described herein that an immunogenic composition
which induces production of memory CD4 T cells allows for the
access of a therapeutic antibody to the immunoprivileged
tissue.
Inventors: |
Iijima; Norifumi; (Osaka,
JP) ; Iwasaki; Akiko; (New Haven, CT) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
YALE UNIVERSITY |
New Haven |
CT |
US |
|
|
Family ID: |
1000005827974 |
Appl. No.: |
17/467574 |
Filed: |
September 7, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
15596048 |
May 16, 2017 |
11147862 |
|
|
17467574 |
|
|
|
|
62337000 |
May 16, 2016 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
A61K 2035/122 20130101;
A61K 39/02 20130101; A61K 39/0007 20130101; A61K 39/395 20130101;
A61K 2039/5152 20130101; A61K 39/00 20130101; A61K 39/0002
20130101; A61K 39/0005 20130101; A61K 39/0011 20130101; A61K 35/12
20130101; A61K 2039/5156 20130101 |
International
Class: |
A61K 39/00 20060101
A61K039/00; A61K 35/12 20060101 A61K035/12; A61K 39/02 20060101
A61K039/02; A61K 39/395 20060101 A61K039/395 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under
A1064705, A1062428 and A1054359 awarded by National Institutes of
Health. The government has certain rights in the invention.
Claims
1. A method for treating or preventing a disease or disorder of an
immunoprivileged tissue in a subject in need thereof comprising:
a.) administering an immunogenic agent to induce a immune response
in the subject; and b.) administering a therapeutic agent, whereby
the immune response allows access of the therapeutic agent to the
immunoprivileged tissue.
2. The method of claim 1, wherein the immunogenic agent is a
vaccine.
3. The method of claim 1, wherein the immunogenic agent comprises
an antigen.
4. The method of claim 1, wherein the therapeutic agent is an
antibody or antibody fragment that binds to an antigen associated
with the disease or disorder.
5. The method of claim 4, wherein the antigen associated with the
disease or disorder is different from the antigen of the
immunogenic agent.
6. The method of claim 1, wherein the immune response comprises the
activation or production of memory CD4 T cells.
7. The method of claim 1, wherein the immunoprivileged tissue is
selected from the group consisting of: brain, spinal cord,
peripheral nervous system, testes, eye, placenta, and liver.
8. The method of claim 1, wherein the therapeutic agent comprises
an antibody or antibody fragment that specifically binds a
tumor-specific or tumor-associated antigen.
9. The method of claim 8, wherein the method treats or prevents
cancer.
10. The method of claim 1, wherein the therapeutic agent comprises
an antibody or antibody fragment that specifically binds an antigen
associated with a neurological disorder.
11. A composition for treating or preventing a disease or disorder
of an immunoprivileged tissue in a subject in need thereof
comprising: a.) an immunogenic agent to induce a immune response in
the subject; and b.) a therapeutic agent.
12. The composition of claim 11, wherein the immunogenic agent is a
vaccine.
13. The composition of claim 11, wherein the immunogenic agent
comprises an antigen.
14. The composition of claim 11, wherein the therapeutic agent
comprises an antibody or antibody fragment that binds to an antigen
associated with the disease or disorder.
15. The composition of claim 11, wherein the antigen associated
with the disease or disorder is different from the antigen of the
immunogenic agent.
16. The composition of claim 11, wherein the immunoprivileged
tissue is selected from the group consisting of: brain, spinal
cord, peripheral nervous system, testes, eye, placenta, and
liver.
17. The composition of claim 11, wherein the therapeutic agent
comprises an antibody or antibody fragment that binds to a
tumor-specific or tumor-associated antigen.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims priority to U.S. Provisional
Patent Application No. 62/337,000 filed May 16, 2016, which is
hereby incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
[0003] Circulating antibodies can access most tissues to mediate
surveillance and elimination of invading pathogens.
Immunoprivileged tissues such as the brain and the peripheral
nervous system are shielded from plasma proteins by the blood-brain
barrier (Hawkins et al., 2005, Pharmacol. Rev. 57, 173-185) and
blood-nerve barrier (Weerasuriya, A. et al., 2011, Methods Mol.
Biol. 686, 149-173), respectively. Yet, circulating antibodies must
somehow gain access to these tissues to mediate their antimicrobial
functions.
[0004] It is unclear how antibodies protect against pathogens that
enter peripheral tissues devoid of constitutive antibody transport
mechanisms. Blood brain barriers consisting of tight junction
between capillary endothelial cells, thick basement membrane and
astrocytes' foot processes effectively block the diffusion of
antibodies to the brain (Weerasuriya, A. et al., 2011, Methods Mol.
Biol. 686, 149-173), while blood nerve barriers consisting of
endoneurial vascular endothelium and the perineurium block antibody
access to the peripheral neurons 3. Such barriers are critical in
preventing access by autoreactive antibodies (Milligan, G. N. et
al., J. Immunol. 160, 6093-6100). At the same time, because certain
pathogens target and replicate within immunoprivileged sites, a
host mechanism to enable directed antibody delivery to these
tissues must exist.
[0005] There is thus a need in the art for compositions and methods
for treating and preventing infection of immunoprivileged sites.
The present invention addresses this unmet need in the art.
SUMMARY OF THE INVENTION
[0006] In one aspect, the present invention provides a method for
treating or preventing a disease or disorder of an immunoprivileged
tissue in a subject in need thereof. In one embodiment, the method
comprises administering an immunogenic agent to induce an immune
response in the subject; and administering a therapeutic agent,
whereby the immune response allows access of the therapeutic agent
to the immunoprivileged tissue.
[0007] In one embodiment, the immunogenic agent is a vaccine. In
one embodiment, the immunogenic agent comprises an antigen.
[0008] In one embodiment, the therapeutic agent is an antibody or
antibody fragment that binds to an antigen associated with the
disease or disorder. In one embodiment, the antigen associated with
the disease or disorder is different from the antigen of the
immunogenic agent. In one embodiment, the immune response comprises
the activation or production of memory CD4 T cells.
[0009] In one embodiment, the disease or disorder comprises a
pathogen-mediated infection selected from the group consisting of:
a viral infection, a bacterial infection, a fungal infection, a
protozoan infection, a prion infection, and a helminth infection.
In one embodiment, the method treats or prevents
infection-associated inflammation. In one embodiment, the method
treats or prevents an infection-associated condition selected from
the group consisting of: encephalitis, meningitis,
meningoencephalitis, epidural abscess, subdural abscess, brain
abscess, and progressive multifocal leukoencephalopathy (PML).
[0010] In one embodiment, the immunoprivileged tissue is selected
from the group consisting of: brain, spinal cord, peripheral
nervous system, testes, eye, placenta, and liver.
[0011] In one embodiment, the therapeutic agent comprises an
antibody or antibody fragment that specifically binds a
tumor-specific or tumor-associated antigen. In one embodiment, the
method treats or prevents cancer.
[0012] In one embodiment, the therapeutic agent comprises an
antibody or antibody fragment that specifically binds an antigen
associated with a neurological disorder.
[0013] In one aspect, the present invention provides a composition
for treating or preventing a disease or disorder of an
immunoprivileged tissue in a subject in need thereof. In one
embodiment, the composition comprises an immunogenic agent to
induce an immune response in the subject; and a therapeutic
agent.
[0014] In one embodiment, the immunogenic agent is a vaccine. In
one embodiment, the immunogenic agent comprises an antigen.
[0015] In one embodiment, the therapeutic agent is an antibody or
antibody fragment that binds to an antigen associated with the
disease or disorder. In one embodiment, the antigen associated with
the disease or disorder is different from the antigen of the
immunogenic agent. In one embodiment, the immune response comprises
the activation or production of memory CD4 T cells.
[0016] In one embodiment, the disease or disorder comprises a
pathogen-mediated infection selected from the group consisting of:
a viral infection, a bacterial infection, a fungal infection, a
protozoan infection, a prion infection, and a helminth infection.
In one embodiment, the immunoprivileged tissue is selected from the
group consisting of: brain, spinal cord, peripheral nervous system,
testes, eye, placenta, and liver.
[0017] In one embodiment, the therapeutic agent comprises an
antibody or antibody fragment that specifically binds a
tumor-specific or tumor-associated antigen. In one embodiment, the
therapeutic agent comprises an antibody or antibody fragment that
specifically binds an antigen associated with a neurological
disorder.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The following detailed description of embodiments of the
invention will be better understood when read in conjunction with
the appended drawings. It should be understood that the invention
is not limited to the precise arrangements and instrumentalities of
the embodiments shown in the drawings.
[0019] FIG. 1A through FIG. 1G are a set of images depicting the
results of experiments demonstrating that intranasal immunization
confers B-cell-dependent neuron protection following genital HSV-2
challenge. FIG. 1A through FIG. 1D: C57/BL6 mice were immunized
with TK--HSV-2 (10.sup.5 plaque-forming units (p.f.u.)) via
intranasal (i.n.; n=12), intraperitoneal (i.p.; n=5) or
intravaginal (ivag.; n=11) routes. Five to 6 weeks later, these
mice and naive mice (n=4) were challenged with a lethal dose of WT
HSV-2 (10.sup.4 p.f.u.). Mortality (FIG. 1A), clinical score (FIG.
1B) and virus titer in vaginal wash (FIG. 1C) were measured on
indicated days after challenge. FIG. 1D: Six days after challenge,
virus titer in tissue homogenates including DRG and spinal cord was
measured. FIG. 1E through FIG. 1G: BALB/c mice (n=10) or
B-cell-deficient JHD mice (n=6) were immunized intranasally with
TK--HSV-2 (5.times.10.sup.4 p.f.u.). Six weeks later, these mice
and naive mice (n=4) were challenged with lethal WT HSV-2 (10.sup.5
p.f.u.). Mortality (FIG. 1E) and clinical score (FIG. 1F) were
measured. FIG. 1G: Six days after challenge, virus titer in tissue
homogenates including DRG and spinal cord was measured by plaque
assay. Data are means.+-.s.e.m. *P<0.05; **P<0.01;
***P<0.001; ****P<0.0001 (two-tailed unpaired Student's
t-test).
[0020] FIG. 2A through FIG. 2G are a set of images depicting the
results of experiments demonstrating antibody-mediated
neuroprotection on CD4 T cells but not on FcRn-mediated transport.
FIG. 2A and FIG. 2B: C57/BL6 (WT) mice (n=4) and FcRn.sup.-/-
(n=10) mice were immunized intranasally with TK--HSV-2 (10.sup.5
p.f.u.), and 6 weeks later challenged with a lethal dose of WT
HSV-2 (10.sup.4 p.f.u.). Mortality (FIG. 2A) and clinical score
(FIG. 2B) were measured. FIG. 2C and FIG. 2D: .mu.MT mice were
immunized with TK--HSV-2 (10.sup.5 p.f.u.) intranasally. Five to 6
weeks later, naive mice (n=3), naive mice receiving immune serum
intravenously (n=4), .mu.MT mice (n=23) and .mu.MT mice receiving
immune serum intravenously (n=10) were challenged with a lethal
dose of WT HSV-2, and mortality (FIG. 2C) and clinical score (FIG.
2D) were assessed. Immune serum prepared from mice immunized 4
weeks previously with TK--HSV-2 (200 .mu.l per mouse) was injected
3 h before challenge, and 3 and 6 days after challenge. FIG. 2E
& FIG. 2F, WT C57/BL6 mice (n=5) and IFN-.gamma.R.sup.-/- mice
(n=8) immunized intranasally with TK--HSV-2 (10.sup.5 p.f.u.) 6
weeks previously were challenged with a lethal dose of WT HSV-2,
and mortality (FIG. 2E) and clinical score (FIG. 2F) were assessed.
Depletion of CD4 T cells (n=4) or neutralization of IFN-.gamma.
(n=5) was performed on days -4, and -1, 2 and 4 after challenge by
intravenous injection of anti-CD4 (GK1.5) or anti-IFN-.gamma.
(XMG1.2), respectively. FIG. 2G: Six days after challenge, virus
titer in tissue homogenates including DRG and spinal cord was
measured by plaque assay (FIG. 2E). Data are means.+-.s.e.m.
*P<0.05; **P<0.01 (two-tailed unpaired Student's t-test).
[0021] FIG. 3A through FIG. 3D are a set of images depicting the
results of experiments demonstrating that memory of CD4+ T cells
are required for antibody access to neuronal tissues. Naive WT mice
or WT and .mu.MT mice intranasally immunized with TK--HSV-2
(10.sup.5 p.f.u.) 6 weeks earlier were challenged with a lethal
dose of WT HSV-2 intravaginally. Six days after the challenge,
after extensive perfusion, HSV-2-specific (FIG. 3A, FIG. 3C) and
total Ig (FIG. 3B, FIG. 3D) levels in tissue homogenates of DRG and
spinal cord were analyzed by ELISA. To deplete CD4 T cells,
CD4-specific antibody was injected on days -4, and -1, 2 and 4 days
after challenge. Data are means.+-.s.e.m. *P<0.05; **P<0.01;
***P<0.001 (two-tailed unpaired Student's t-test).
[0022] FIG. 4A through FIG. 4F are a set of images depicting the
results of experiments demonstrating that
.alpha.4-Integrin-dependent recruitment of memory CD4.sup.+ T cells
required for antibody access to neuronal tissues. WT mice immunized
intranasally with TK.sup.- HSV-2 6 weeks earlier were challenged
with a lethal dose of WT HSV-2. Neutralization of .alpha.4-integrin
was performed on days 2 and 4 after challenge by intravenous
injection of anti-.alpha.4 integrin (CD49d) antibody. FIG. 4A: Six
days after challenge, after extensive perfusion, HSV-2-specific
IFN-.gamma..sup.+ CD4.sup.+ T cells in DRG and spinal cord were
detected by flow cytometry. FIG. 4B: The number of
IFN-.gamma.-secreting CD4 T cells among 50,000 cells of CD45''
leukocytes in DRG and spinal cord is depicted. Data are
means.+-.s.e.m. *P<0.05; **P<0.01; ***P<0.001 (two-tailed
unpaired Student's t-test). FIG. 4C: Frozen sections of DRG were
stained with antibodies against CD4, VCAM-1 or CD31. Nuclei are
depicted by 4',6-diamidino-2-phenylindole (DAPI) stain (blue).
Images were captured using a .times.10 or .times.40 objective lens.
Scale bars, 100 .mu.m. Arrowhead indicates VCAM-1.sup.+ cells in
parenchyma of DRG. Data are representative of at least three
similar experiments. HSV-2-specific antibodies in the DRG (FIG. 4D)
and spinal cord (FIG. 4E) were analyzed by ELISA. Data are
means.+-.s.e.m. *P<0.05 (two-tailed paired Student's t-test)
Albumin level in tissue homogenates was analyzed by ELISA (FIG.
4F). Depletion of CD4 T cells or neutralization of IFN-.gamma. was
performed on days -4, and -1, 2 and 4 days after challenge by
intravenous injection of anti-CD4 (GK1.5) or anti-IFN-.gamma.
(XMG1.2), respectively. Data are means.+-.s.e.m. *P<0.05;
**P<0.01; ***P<0.001 (two-tailed paired Student's
t-test).
[0023] FIG. 5A through FIG. 5H are a set of images depicting the
results of experiments demonstrating that in the absence of TRM, B
cells are required for the protection of the host against genital
HSV-2 challenge. FIG. 5A: C57BL/6 mice and .mu.MT mice were
immunized intravaginally or intranasally with TK--HSV-2. Five weeks
later, vaginal tissue sections were stained for CD4.sup.+ cells
(red) and MHC class II.sup.+ cells (green). Blue labelling depicts
nuclear staining with DAPI (blue). Images were captured using a
.times.10 or .times.40 objective lens. Scale bars, 100 .mu.m. Data
are representative of three similar experiments. FIG. 5B through
Figure D: BALB/c mice and JHD mice were immunized with TK--HSV-2
(10.sup.5 p.f.u.) intranasally or intravaginally. Six weeks later,
the number of total CD4+ T cells and HSV-2-specific CD4.sup.+ T
cells in the vagina (FIG. 5B), spleen (FIG. 5C) and peripheral
blood (FIG. 5D) were analyzed by flow cytometry. Percentages and
total number of IFN-.gamma..sup.+ cells among CD4.sup.+CD90.2.sup.+
cells are shown. Data are means.+-.s.e.m. *P<0.05; **P<0.001;
***P<0.001 (two-tailed unpaired Student's t-test). FIG. 5E:
C57/BL6 mice were immunized intravaginally (naive.fwdarw.D7) or
intranasally (WT/i.n..fwdarw.D0) with TK--HSV-2 virus. At the
indicated time points (D7: 7 days after immunization;
WT/i.n..fwdarw.D0: 6 weeks after immunization), total viral genomic
DNA in the vaginal tissues, DRG and spinal cord were measured by
quantitative PCR. FIG. 5F-FIG. 5H: Intravaginally immunized C57BL/6
(WT), .mu.MT and HEL-BCR Tg mice (left partner) were surgically
joined with naive WT mice (right partner). Three weeks after
parabiosis, the naive partner was challenged with a lethal dose of
WT HSV-2 intravaginally. Mortality (FIG. 5E), clinical score (FIG.
5F) and virus titer in vaginal wash (FIG. 5G) following viral
challenge are depicted.
[0024] FIG. 6A and FIG. 6B are a set of images depicting the
results of experiments demonstrating that mucosal TK--HSV-2
immunization generates higher levels of virus-specific IgG2b and
IgG2c compared with intraperitoneal immunization. WT mice were
immunized with TK.sup.-HSV-2 (10.sup.5 p.f.u. per mouse) via
intravaginal, intraperitoneal or intranasal routes. Six weeks
later, these mice were challenged with a lethal dose of WT HSV-2
intravaginally. At the indicated days after challenge,
HSV-2-specific Ig (FIG. 6A) and total Ig (FIG. 6B) in serum were
analyzed by ELISA. Data are means.+-.s.e.m. *P<0.05
(Mann-Whitney U-test).
[0025] FIG. 7A and FIG. 7B are a set of images depicting the
results of experiments demonstrating that the enhancement of
antibody access to the DRG with IFN-.gamma.. WT mice immunized with
TK--HSV-2 (10.sup.5 p.f.u. per mouse) intranasally 6 weeks earlier
were challenged with a lethal dose of WT HSV-2 intravaginally. Six
days after challenge, after extensive perfusion, HSV-2-specific
(FIG. 7A) and total Ig (FIG. 7B) in DRG homogenates were analyzed
by ELISA. Depletion of CD4 T cells or neutralization of IFN-.gamma.
was performed on days -4, and -1, 2 and 4 days after challenge by
intravenous injection of anti-CD4 (GK1.5) or anti-IFN-.gamma.
(XMG1.2), respectively. Data are means.+-.s.e.m. *P<0.05;
**P<0.001 (two-tailed unpaired Student's t-test).
[0026] FIG. 8A through FIG. 8D, are a set of images depicting the
results of experiments investigating the neutralization of
IFN-.gamma., demonstrating that .alpha.4-integrin or depletion of
CD4 T cells has no impact on circulating immunoglobulin levels.
FIG. 8A and FIG. 8B: WT mice immunized intranasally with TK--HSV-2
6-8 weeks earlier were challenged with a lethal dose of WT HSV-2.
Depletion of CD4 T cells or neutralization of IFN-.gamma. was
performed on days -4, and -1, 2 and 4 days after challenge by
intravenous injection of anti-CD4 (GK1.5) or anti-IFN-.gamma.
(XMG1.2), respectively. At time points indicated, HSV-2-specific Ig
in the blood (n=4) (FIG. 8A) and total Ig in the blood (n=4) (FIG.
8B) were measured. FIG. 8C and FIG. 8D: WT mice immunized
intranasally with TK--HSV-2 6 weeks earlier were challenged with a
lethal dose of WT HSV-2. Neutralization of .alpha.4-integrin was
performed on days 2 and 4 after challenge by intravenous injection
of anti-.alpha.4-integrin/CD49b antibody. Six days later,
HSV-2-specific antibody (FIG. 8C) and total antibody (FIG. 8D) in
the blood were measured. Data are representative of three similar
experiments.
[0027] FIG. 9A through FIG. 9D are a set of images depicting the
results of experiments demonstrating that an irrelevant
immunization failed to increase the levels of total antibodies in
neuronal tissues. FIG. 9A, C57BL/6 mice were immunized with a
sublethal dose of influenza A/PR8 virus (10 p.f.u. per mouse)
intranasally. Three weeks later, Flu-specific IFN-.gamma..sup.+
CD4.sup.+ T cells in spleen and neuronal tissues (DRG and spinal
cord) (CD45.2.sup.+) following co-culture with HI-Flu/PR8 loaded
splenocytes (CD45.1.sup.+) were analyzed by flow cytometry. As a
control, lymphocytes isolated from spleen of TK.sup.- HSV-2
intranasally immunized mice 6 weeks after vaccination were used for
co-culture. (***P<0.001; two-tailed unpaired Student's t-test).
FIG. 9B through FIG. 9D: C57BL/6 mice were immunized with a
sublethal dose of influenza A/PR8 virus (10 p.f.u. per mouse). Four
weeks later, these mice were challenged with a lethal dose of WT
HSV-2 (10.sup.4 p.f.u. per mouse) intravaginally. Six days after
challenge, total antibodies in lysate in DRG (FIG. 9B), spinal cord
(FIG. 9C) and blood (FIG. 9D) were measured by ELISA.
[0028] FIG. 10A and FIG. 10B are a set of images depicting the
results of experiments demonstrating that most CD4 T cells
recruited to the DRG and spinal cord of immunized mice are
localized in the parenchyma of neuronal tissues. FIG. 10A: C57BL/6
mice were immunized intranasally with TK.sup.-HSV-2. Six days after
challenge of immunized mice 6 weeks prior, neuronal tissue sections
(DRG and spinal cord) were stained for CD4.sup.+ cells and
VCAM-1.sup.+ cells or CD31.sup.+ cells (red or green). Blue
labelling depicts nuclear staining with DAPI (blue). Images were
captured using a .times.10 or .times.40 objective lens. Scale bars,
100 .mu.m. FIG. 10B: C57BL/6 mice were immunized intranasally with
TK.sup.-HSV-2. Six weeks later, mice were challenged with WT HSV-2
intravaginal and neuronal tissues were collected 6 days later. DRG
and spinal cord were stained for CD4.sup.+ cells (red) and MHC
class 11 cells, CD11b.sup.+ cells or Ly6G.sup.+ cells (green). Blue
labelling depicts nuclear staining with DAPI (blue). Images were
captured using a .times.10 or .times.40 objective lens. Scale bars,
100 .mu.m. Data are representative of at least three similar
experiments.
[0029] FIG. 11A and FIG. 11B are a set of images depicting the
results of experiments demonstrating that intravascular staining
reveals the localization of CD4 T cells in the parenchyma of
neuronal tissues. FIG. 11A and FIG. 11B: C57BL/6 mice immunized
intranasally with TK.sup.-HSV-2 6 weeks previously were challenged
with lethal WT HSV-2. Six days after challenge, Alexa Fluor
700-conjugated anti-CD90.2 antibody (3 .mu.g per mouse) was
injected intravenously (tail vain) into immunized mice. Five
minutes later, these mice were killed for fluorescence-activated
cell sorting analysis of intravascular versus extravascular
lymphocytes. Data are representative of at least two similar
experiments.
[0030] FIG. 12A through FIG. 12C are a set of images depicting the
results of experiments demonstrating increased epithelial and
vascular permeability in vaginal tissues using recombinant
IFN-.gamma.. FIG. 12A, WT mice immunized with TK.sup.-HSV-2
(10.sup.5 p.f.u.) intranasally 6 weeks earlier were injected
intravaginally with recombinant mouse IFN-.gamma. (10 .mu.g per
mouse) (n=3) or PBS (n=3). At the indicated time points,
HSV-2-specific Ig (FIG. 12A) and total Ig (FIG. 12B) in vaginal
wash were measured by ELISA. FIG. 12C: Two days after rIFN-.gamma.
treatment, vaginal tissue sections were stained for VCAM-1.sup.+
cells (red) or CD4.sup.+ cells (green) and CD31.sup.+ cells
(green). Blue labelling depicts nuclear staining with DAPI (blue).
Images were captured using a .times.10 or .times.40 objective lens.
Scale bars, 100 .mu.m. Data are representative of at least three
similar experiments.
[0031] FIG. 13A and FIG. 13B are a set of images depicting the
results of experiments demonstrating vascular permeability in DRG
and spinal cord augmented following WT HSV-2 challenge. FIG. 13A,
C57BL/6 mice were immunized intranasally with TK.sup.-HSV-2. Six
days after challenge of mice immunized 6 weeks previously, neuronal
tissue sections (DRG and spinal cord) were stained for CD4.sup.+
cells (red) and mouse albumin (green). Blue labelling depicts
nuclear staining with DAPI (blue). FIG. 13B, C57BL/6 mice were
immunized intranasally with TK.sup.-HSV-2. Six weeks later, these
mice were challenged with lethal WT HSV-2. Six days after
challenge, Oregon green 488-conjugated dextran (70 kDa) (5 mg
ml.sup.-1, 200 .mu.l per mouse) was injected intravenously into
intranasally immunized mice. Forty-five minutes later, these mice
were killed for immunohistochemical analysis. GM, grey matter; WM,
white matter. Data are representative of three similar
experiments.
[0032] FIG. 14A through FIG. 14D are a set of images depicting the
results of experiments demonstrating the requirement of memory
CD4.sup.+ T cells for the increase in antibody levels and vascular
permeability in the brain following VSV immunization and challenge.
FIG. 14A, C57BL/6 mice were immunized intravenously with WT VSV
(2.times.10.sup.6 p.f.u. per mouse). Five weeks later, these mice
were challenged intranasally with WT VSV (1.times.10.sup.7 p.f.u.
per mouse). Six days after challenge, VSV-specific
IFN-.gamma..sup.+ CD4.sup.+ T cells in spleen (CD45.2.sup.+)
following co-culture with HI-VSV loaded splenocytes (CD45.1.sup.+)
or HI HSV-2 loaded splenocytes were analysed by flow cytometry.
Data are means.+-.s.e.m. *P<0.05; **P<0.001 (two-tailed
unpaired Student's t-test). FIG. 14B and FIG. 14C: Five weeks after
VSV immunization, these mice were challenged intranasally with WT
VSV (1.times.10.sup.7 p.f.u. per mouse). Six days after challenge,
VSV-specific antibodies and total antibodies in lysate of brain
(FIG. 14B) and serum (FIG. 14C) were measured by ELISA. Depletion
of CD4 T cells was performed on -4, -1, 2 and 4 days after
challenge by intravenous injection of anti-CD4 (GK1.5). FIG. 14D:
Albumin levels in tissue homogenates were analysed by ELISA. Data
are means.+-.s.e.m. *P<0.05; *P<0.01; ***P<0.001
(Mann-Whitney U-test).
DETAILED DESCRIPTION
[0033] The present invention provides compositions and methods of
treating a disease or disorder in immunoprivileged tissue. For
example, in some embodiments, the invention provides compositions
and methods for treating an infection in immunoprivileged tissue.
The present invention relates to inducing a CD4 T cell response,
for example a memory CD4 T cell response, in a subject to allow for
antibody access in the immunoprivileged tissue.
[0034] In one embodiment, the invention provides a composition for
treating a disease or disorder comprising (1) an immunogenic agent
(e.g., a vaccine) to induce an immune response and (2) a
therapeutic antibody or antibody fragment directed to an antigen
associated with the disease or disorder. In some embodiments, the
immunogenic agent is a vaccine comprising an antigen associated
with the disease or disorder. In some embodiments, the antigen of
the vaccine is the same as the antigen to which the antibody or
antibody fragment is directed. In some embodiments, the antigen of
the vaccine is different from the antigen to which the antibody or
antibody fragment is directed.
[0035] In one embodiment, the composition is useful for treating a
pathogenic infection, where the composition comprises (1) an
immunogenic agent (e.g., a vaccine) to induce a pathogen-specific
immune response and (2) a therapeutic antibody or antibody fragment
directed to an antigen of the pathogen. In some embodiments, the
immunogenic agent is a vaccine comprising an antigen of the
pathogen.
[0036] In one embodiment, the composition is useful for treating
cancer in the immunoprivileged tissue, where the composition
comprises (1) an immunogenic agent (e.g., a vaccine) to induce a
tumor-specific immune response and (2) a therapeutic antibody or
antibody fragment directed to an antigen associated with the tumor.
In some embodiments, the immunogenic agent is a vaccine comprising
an antigen associated with the tumor.
[0037] In one embodiment, the invention provides a method of
treating a disease or disorder in a subject comprising (1)
administering to the subject an immunogenic agent to induce an
immune response, and (2) administering to the subject a therapeutic
antibody or antibody fragment directed to an antigen. In one
embodiment, the immunogenic agent is a vaccine comprising an
antigen associated with the disease or disorder. The method may be
used to treat or prevent a disease or disorder in any
immunoprivileged tissue, including but not limited to the brain,
spinal cord, peripheral nervous system, testes, eye, placenta,
liver, and the like. The method may be used to treat or prevent any
disease or disorder of immunoprivileged tissue, including, but not
limited to, pathogenic infection, cancer, and neurodegenerative
disease, such as Alzheimer's disease.
[0038] In one embodiment, the invention provides a method of
treating a pathogenic infection in a subject comprising (1)
administering to the subject an immunogenic agent to induce a
pathogen-specific immune response, and (2) administering to the
subject a therapeutic antibody or antibody fragment directed to an
antigen of the pathogen. In one embodiment, the immunogenic agent
is a vaccine comprising an antigen of the pathogen. The method may
be used to treat or prevent any pathogenic infection, including,
but not limited to a viral infection, bacterial infection, fungal
infection, parasitic infection, helminth infection, protozoan
infection, prion infection and the like.
[0039] In one embodiment, the invention provides a method of
treating cancer in a subject comprising (1) administering to the
subject an immunogenic agent to induce a tumor-specific immune
response, and (2) administering to the subject a therapeutic
antibody or antibody fragment directed to tumor-specific antigen.
In one embodiment, the immunogenic agent is a vaccine comprising a
tumor-specific antigen.
Definitions
[0040] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs.
[0041] As used herein, each of the following terms has the meaning
associated with it in this section.
[0042] The articles "a" and "an" are used herein to refer to one or
to more than one (i.e., to at least one) of the grammatical object
of the article. By way of example, "an element" means one element
or more than one element.
[0043] "About" as used herein when referring to a measurable value
such as an amount, a temporal duration, and the like, is meant to
encompass variations of .+-.20%, .+-.10%, .+-.5%, .+-.1%, or
.+-.0.1% from the specified value, as such variations are
appropriate to perform the disclosed methods.
[0044] The term "antibody," as used herein, refers to an
immunoglobulin molecule, which specifically binds with an antigen.
Antibodies can be intact immunoglobulins derived from natural
sources or from recombinant sources and can be immunoreactive
portions of intact immunoglobulins. Antibodies are typically
tetramers of immunoglobulin molecules. The antibodies in the
present invention may exist in a variety of forms including, for
example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and
F(ab).sub.2, as well as single chain antibodies and humanized
antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al.,
1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New
York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA
85:5879-5883; Bird et al., 1988, Science 242:423-426).
[0045] The term "antibody fragment" refers to a portion of an
intact antibody and refers to the antigenic determining variable
regions of an intact antibody. Examples of antibody fragments
include, but are not limited to, Fab, Fab', F(ab')2, and Fv
fragments, linear antibodies, scFv antibodies, and multispecific
antibodies formed from antibody fragments.
[0046] An "antibody heavy chain," as used herein, refers to the
larger of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations.
[0047] An "antibody light chain," as used herein, refers to the
smaller of the two types of polypeptide chains present in all
antibody molecules in their naturally occurring conformations.
.kappa. and .lamda. light chains refer to the two major antibody
light chain isotypes.
[0048] By the term "synthetic antibody" as used herein, is meant an
antibody, which is generated using recombinant DNA technology, such
as, for example, an antibody expressed by a bacteriophage. The term
should also be construed to mean an antibody which has been
generated by the synthesis of a DNA molecule encoding the antibody
and which DNA molecule expresses an antibody protein, or an amino
acid sequence specifying the antibody, wherein the DNA or amino
acid sequence has been obtained using synthetic DNA or amino acid
sequence technology which is available and well known in the art.
The term should also be construed to mean an antibody, which has
been generated by the synthesis of an RNA molecule encoding the
antibody. The RNA molecule expresses an antibody protein, or an
amino acid sequence specifying the antibody, wherein the RNA has
been obtained by transcribing DNA (synthetic or cloned) or other
technology, which is available and well known in the art.
[0049] The term "antigen" or "Ag" as used herein is defined as a
molecule that provokes an adaptive immune response. This immune
response may involve either antibody production, or the activation
of specific immunogenically-competent cells, or both. The skilled
artisan will understand that any macromolecule, including virtually
all proteins or peptides, can serve as an antigen. Furthermore,
antigens can be derived from recombinant or genomic DNA or RNA. A
skilled artisan will understand that any DNA or RNA, which
comprises a nucleotide sequences or a partial nucleotide sequence
encoding a protein that elicits an adaptive immune response
therefore encodes an "antigen" as that term is used herein.
Furthermore, one skilled in the art will understand that an antigen
need not be encoded solely by a full length nucleotide sequence of
a gene. It is readily apparent that the present invention includes,
but is not limited to, the use of partial nucleotide sequences of
more than one gene and that these nucleotide sequences are arranged
in various combinations to elicit the desired immune response.
Moreover, a skilled artisan will understand that an antigen need
not be encoded by a "gene" at all. It is readily apparent that an
antigen can be generated synthesized or can be derived from a
biological sample. Such a biological sample can include, but is not
limited to a tissue sample, a tumor sample, a cell or a biological
fluid.
[0050] The term "adjuvant" as used herein is defined as any
molecule to enhance an antigen-specific adaptive immune
response.
[0051] A "disease" is a state of health of an animal wherein the
animal cannot maintain homeostasis, and wherein if the disease is
not ameliorated then the animal's health continues to deteriorate.
In contrast, a "disorder" in an animal is a state of health in
which the animal is able to maintain homeostasis, but in which the
animal's state of health is less favorable than it would be in the
absence of the disorder. Left untreated, a disorder does not
necessarily cause a further decrease in the animal's state of
health.
[0052] An "effective amount" as used herein, means an amount which
provides a therapeutic or prophylactic benefit.
[0053] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a
defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if
transcription and translation of mRNA corresponding to that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and the
non-coding strand, used as the template for transcription of a gene
or cDNA, can be referred to as encoding the protein or other
product of that gene or cDNA.
[0054] "Expression vector" refers to a vector comprising a
recombinant polynucleotide comprising expression control sequences
operatively linked to a nucleotide sequence to be expressed. An
expression vector comprises sufficient cis-acting elements for
expression; other elements for expression can be supplied by the
host cell or in an in vitro expression system. Expression vectors
include all those known in the art, such as cosmids, plasmids
(e.g., naked or contained in liposomes) RNA, and viruses (e.g.,
lentiviruses, retroviruses, adenoviruses, and adeno-associated
viruses) that incorporate the recombinant polynucleotide.
[0055] "Immunogen" refers to any substance introduced into the body
in order to generate an immune response. That substance can a
physical molecule, such as a protein, or can be encoded by a
vector, such as DNA, mRNA, or a virus.
[0056] By the term "immune reaction," as used herein, is meant the
detectable result of stimulating and/or activating an immune
cell.
[0057] "Immune response," as the term is used herein, means a
process that results in the activation and/or invocation of an
effector function in either the T cells, B cells, natural killer
(NK) cells, and/or antigen-presenting cells (APCs). Thus, an immune
response, as would be understood by the skilled artisan, includes,
but is not limited to, any detectable antigen-specific or
allogeneic activation of a helper T cell or cytotoxic T cell
response, production of antibodies, T cell-mediated activation of
allergic reactions, macrophage infiltration, and the like.
[0058] "Immune cell," as the term is used herein, means any cell
involved in the mounting of an immune response. Such cells include,
but are not limited to, T cells, B cells, NK cells,
antigen-presenting cells (e.g., dendritic cells and macrophages),
monocytes, neutrophils, eosinophils, basophils, and the like.
[0059] "Isolated" means altered or removed from the natural state.
For example, a nucleic acid or a peptide naturally present in a
living animal is not "isolated," but the same nucleic acid or
peptide partially or completely separated from the coexisting
materials of its natural state is "isolated." An isolated nucleic
acid or protein can exist in substantially purified form, or can
exist in a non-native environment such as, for example, a host
cell.
[0060] In the context of the present invention, the following
abbreviations for the commonly occurring nucleosides (nucleobase
bound to ribose or deoxyribose sugar via N-glycosidic linkage) are
used. "A" refers to adenosine, "C" refers to cytidine, "G" refers
to guanosine, "T" refers to thymidine, and "U" refers to
uridine.
[0061] Unless otherwise specified, a "nucleotide sequence encoding
an amino acid sequence" includes all nucleotide sequences that are
degenerate versions of each other and that encode the same amino
acid sequence. The phrase nucleotide sequence that encodes a
protein or an RNA may also include introns to the extent that the
nucleotide sequence encoding the protein may in some version
contain an intron(s).
[0062] By the term "modulating," as used herein, is meant mediating
a detectable increase or decrease in the level of a response in a
subject compared with the level of a response in the subject in the
absence of a treatment or compound, and/or compared with the level
of a response in an otherwise identical but untreated subject. The
term encompasses perturbing and/or affecting a native signal or
response thereby mediating a beneficial therapeutic response in a
subject.
[0063] The terms "patient," "subject," "individual," and the like
are used interchangeably herein, and refer to any animal, or cells
thereof whether in vitro or in situ, amenable to the methods
described herein. In some non-limiting embodiments, the patient,
subject or individual is a human.
[0064] The term "polynucleotide" as used herein is defined as a
chain of nucleotides. Furthermore, nucleic acids are polymers of
nucleotides. Thus, nucleic acids and polynucleotides as used herein
are interchangeable. One skilled in the art has the general
knowledge that nucleic acids are polynucleotides, which can be
hydrolyzed into the monomeric "nucleotides." The monomeric
nucleotides can be hydrolyzed into nucleosides. As used herein
polynucleotides include, but are not limited to, all nucleic acid
sequences which are obtained by any means available in the art,
including, without limitation, recombinant means, i.e., the cloning
of nucleic acid sequences from a recombinant library or a cell
genome, using ordinary cloning technology and PCR.TM., and the
like, and by synthetic means.
[0065] As used herein, the terms "peptide," "polypeptide," and
"protein" are used interchangeably, and refer to a compound
comprised of amino acid residues covalently linked by peptide
bonds. A protein or peptide must contain at least two amino acids,
and no limitation is placed on the maximum number of amino acids
that can comprise a protein's or peptide's sequence. Polypeptides
include any peptide or protein comprising two or more amino acids
joined to each other by peptide bonds. As used herein, the term
refers to both short chains, which also commonly are referred to in
the art as peptides, oligopeptides and oligomers, for example, and
to longer chains, which generally are referred to in the art as
proteins, of which there are many types. "Polypeptides" include,
for example, biologically active fragments, substantially
homologous polypeptides, oligopeptides, homodimers, heterodimers,
variants of polypeptides, modified polypeptides, derivatives,
analogs, fusion proteins, among others. The polypeptides include
natural peptides, recombinant peptides, synthetic peptides, or a
combination thereof.
[0066] By the term "specifically binds," as used herein with
respect to an antibody, is meant an antibody which recognizes a
specific antigen, but does not substantially recognize or bind
other molecules in a sample. For example, an antibody that
specifically binds to an antigen from one species may also bind to
that antigen from one or more other species. But, such
cross-species reactivity does not itself alter the classification
of an antibody as specific. In another example, an antibody that
specifically binds to an antigen may also bind to different allelic
forms of the antigen. However, such cross reactivity does not
itself alter the classification of an antibody as specific. In some
instances, the terms "specific binding" or "specifically binding,"
can be used in reference to the interaction of an antibody, a
protein, or a peptide with a second chemical species, to mean that
the interaction is dependent upon the presence of a particular
structure (e.g., an antigenic determinant or epitope) on the
chemical species; for example, an antibody recognizes and binds to
a specific protein structure rather than to proteins generally. If
an antibody is specific for epitope "A", the presence of a molecule
containing epitope A (or free, unlabeled A), in a reaction
containing labeled "A" and the antibody, will reduce the amount of
labeled A bound to the antibody.
[0067] The term "therapeutic" as used herein means a treatment
and/or prophylaxis. A therapeutic effect is obtained by
suppression, diminution, remission, or eradication of at least one
sign or symptom of a disease or disorder state.
[0068] The term "therapeutically effective amount" refers to the
amount of the subject compound that will elicit the biological or
medical response of a tissue, system, or subject that is being
sought by the researcher, veterinarian, medical doctor or other
clinician. The term "therapeutically effective amount" includes
that amount of a compound that, when administered, is sufficient to
prevent development of, or alleviate to some extent, one or more of
the signs or symptoms of the disorder or disease being treated. The
therapeutically effective amount will vary depending on the
compound, the disease and its severity and the age, weight, etc.,
of the subject to be treated.
[0069] To "treat" a disease as the term is used herein, means to
reduce the frequency or severity of at least one sign or symptom of
a disease or disorder experienced by a subject.
[0070] The term "transfected" or "transformed" or "transduced" as
used herein refers to a process by which exogenous nucleic acid is
transferred or introduced into the host cell. A "transfected" or
"transformed" or "transduced" cell is one which has been
transfected, transformed or transduced with exogenous nucleic acid.
The cell includes the primary subject cell and its progeny.
[0071] A "vector" is a composition of matter which comprises an
isolated nucleic acid and which can be used to deliver the isolated
nucleic acid to the interior of a cell. Numerous vectors are known
in the art including, but not limited to, linear polynucleotides,
polynucleotides associated with ionic or amphiphilic compounds,
plasmids, and viruses. Thus, the term "vector" includes an
autonomously replicating plasmid or a virus. The term should also
be construed to include non-plasmid and non-viral compounds which
facilitate transfer of nucleic acid into cells, such as, for
example, polylysine compounds, liposomes, and the like. Examples of
viral vectors include, but are not limited to, adenoviral vectors,
adeno-associated virus vectors, retroviral vectors, and the
like.
[0072] Ranges: throughout this disclosure, various aspects of the
invention can be presented in a range format. It should be
understood that the description in range format is merely for
convenience and brevity and should not be construed as an
inflexible limitation on the scope of the invention. Accordingly,
the description of a range should be considered to have
specifically disclosed all the possible subranges as well as
individual numerical values within that range. For example,
description of a range such as from 1 to 6 should be considered to
have specifically disclosed subranges such as from 1 to 3, from 1
to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as
well as individual numbers within that range, for example, 1, 2,
2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of
the range.
Description
[0073] The present invention provides compositions and methods for
treating a disease or disorder in an immunoprivileged tissue in a
subject in need thereof. The present invention is based in part
upon the discovery that memory CD4 T cells are required to allow
antibody access to immunoprivileged tissue. For example, it is
demonstrated herein that both antibodies and CD4 T cells are
required to protect the host after immunization at a distal site.
It is shown that memory CD4 T cells migrate to the immunoprivileged
tissue, secrete interferon-.gamma., and mediate local increase in
vascular permeability, enabling antibody access. The results reveal
a previously unappreciated role of CD4 T cells in mobilizing
antibodies to the peripheral sites of infection where they help to
limit infection.
[0074] The present invention provides a composition for treating or
preventing a disease or disorder comprising a first agent and a
second agent. In one embodiment, the first agent induces an immune
response in the subject. For example, in one embodiment, the first
agent induces the activation and production of memory CD4 T cells.
In some embodiments, the first agent is an immunogenic composition
(e.g., vaccine) that induces an immune response. In one embodiment,
the second agent is a therapeutic agent directed to the disease or
disorder. For example, in one embodiment, the second agent is an
antibody or antibody fragment that specifically binds to an antigen
associated with the disease or disorder. The memory CD4 T cells
induced by the first agent allows the second agent to access the
immunoprivileged tissue.
[0075] The present invention provides methods for treating or
preventing a disease or disorder of immunoprivileged tissue in a
subject in need thereof.
[0076] In one embodiment, the method comprises administering to the
subject a first agent and a second agent. In one embodiment, the
first agent induces an immune response in the subject. For example,
in one embodiment, the first agent induces the activation and
production of memory CD4 T cells. In some embodiments, the first
agent is an immunogenic composition (e.g., vaccine) that induces an
immune response. In one embodiment, the second agent is a
therapeutic agent directed to the disease or disorder. For example,
in one embodiment, the second agent is an antibody or antibody
fragment that specifically binds to an antigen associated with the
disease or disorder. In one embodiment, the method comprises
administering a vaccine to induce an immune response in the
subject; and administering a therapeutic antibody or antibody
fragment that binds to an antigen associated with the disease or
disorder.
[0077] In one embodiment, the compositions and methods of the
present invention may be used to treat or prevent a disease or
disorder in any immunoprivileged tissue, including but not limited
to the brain, spinal cord, peripheral nervous system, testes, eye,
placenta, liver, and the like.
[0078] In one embodiment, the compositions and methods of the
present invention may be used to treat or prevent any pathogenic
infection, including, but not limited to a viral infection,
bacterial infection, fungal infection, parasitic infection,
helminth infection and the like.
[0079] In one embodiment, the compositions and methods of the
present invention may be used to treat or prevent cancer.
[0080] In one embodiment, the compositions and methods of the
present invention may be used to treat or prevent a neurological
disorder, including, but not limited to, Alzheimer's disease.
[0081] Compositions
[0082] The present invention provides compositions for treating or
preventing a disease or disorder comprising a first agent and a
second agent. In one embodiment, the first agent induces an immune
response in the subject. In some embodiments, the first agent is an
immunogenic agent (e.g., vaccine) that induces an immune
response.
[0083] In one embodiment, the second agent is a therapeutic agent
targeted to an antigen associated with the disease or disorder. For
example, in one embodiment, the second agent is an antibody or
antibody fragment that specifically binds to the antigen.
[0084] Immunogenic Agent
[0085] In one embodiment, the composition of the present invention
comprises an immunogenic agent. In some embodiments, the
immunogenic agent comprises a peptide, nucleic acid molecule, cell,
or the like, that induces an antigen-specific immune response. For
example, in one embodiment, the immunogenic agent comprises an
antigen. In some embodiments, the agent is associated with the
disease or disorder being treated. In some embodiments, the antigen
is associated with the pathogenic infection being treated. In some
embodiments, the antigen is a tumor-specific antigen or a
tumor-associated antigen.
[0086] In some embodiments, the immunogenic agent is a vaccine. For
the immunogenic agent to be useful as a vaccine, the immunogenic
agent must induce an immune response to the antigen in a cell,
tissue or mammal (e.g., a human). In some embodiments, the vaccine
induces a protective immune response in the mammal. In one
embodiment, the vaccine induces the activation and production of
memory CD4 T cells in the mammal. As used herein, an "immunogenic
agent" may comprise an antigen (e.g., a peptide or polypeptide), a
nucleic acid encoding an antigen (e.g., an antigen expression
vector), and a cell expressing or presenting an antigen or cellular
component. In some embodiments, the immunogenic agent is an
inactivated pathogen, attenuated pathogen, temperature-sensitive
pathogen, or the like, which can be used to induce a
pathogen-specific immune response.
[0087] In some embodiments, the antigen comprises a viral antigen,
including but not limited to an antigen of Zika virus, Ebola virus,
Japanese encephalitis virus, mumps virus, measles virus, rabies
virus, varicella-zoster, Epstein-Barr virus (HHV-4),
cytomegalovirus, herpes simplex virus 1 (HSV-1) and herpes simplex
virus 2 (HSV-2), human immunodeficiency virus-1 (HIV-1), JC virus,
arborviruses, enteroviruses, and West Nile virus, dengue virus,
poliovirus, and varicella zoster virus. In some embodiments, the
antigen comprises a bacterial antigen, including, but not limited
to, an antigen of Streptococcus pneumoniae, Neisseria meningitides,
Streptococcus agalactia, and Escherichia coli. In some embodiments,
the antigen comprises a fungal or protozoan antigen, including, but
not limited to, an antigen of Candidiasis, Aspergillosis,
Cryptococcosis, and Toxoplasma gondii.
[0088] In some embodiments, the antigen comprises a tumor-specific
antigen or a tumor-associated antigen, including but not limited
to: differentiation antigens such as MART-1/MelanA (MART-I), gp100
(Pmel 17), tyrosinase, TRP-1, TRP-2 and tumor-specific multilineage
antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15;
overexpressed embryonic antigens such as CEA; overexpressed
oncogenes and mutated tumor-suppressor genes such as p53, Ras,
HER-2/neu; unique tumor antigens resulting from chromosomal
translocations; such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR;
and viral antigens, such as the Epstein Barr virus antigens EBVA
and the human papillomavirus (HPV) antigens E6 and E7. Other large,
protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6,
RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72,
CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-Catenin, CDK4, Mum-1,
p 15, p 16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG,
BCA225, BTAA, CA 125, CA 15-3\CA 27.29\BCAA, CA 195, CA 242, CA-50,
CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344,
MA-50, MG7-Ag, MOV18, NB/70K, NY-CO-1, RCAS1, SDCCAG16, TA-90\Mac-2
binding protein\cyclophilin C-associated protein, TAAL6, TAG72,
TLP, Aim2, Art-4, EphA2, EZH2, Fosl1, PTH-rP, Sox11, Whsc2, YKL-40
and TPS.
[0089] In some embodiments, the antigen comprises an antigen
associated with a neurological disorder. Exemplary antigens
associated with a neurological disorder include, but are not
limited to various monomeric and aggregated forms of A.beta., tau,
BACE1, .alpha.-synuclein, huntingtin, TAR-DNA binding protein 43
kDA, superoxide dismutase 1, prion protein, and fragments
thereof.
[0090] In particular embodiments the immunogenic agent comprises or
encodes all or part of any antigen described herein, or an
immunologically functional equivalent thereof. In other
embodiments, the immunogenic agent is in a mixture that comprises
an additional immunostimulatory agent or nucleic acids encoding
such an agent. Immunostimulatory agents include but are not limited
to an additional antigen, an immunomodulator, an antigen presenting
cell or an adjuvant. In other embodiments, one or more of the
additional agent(s) is covalently bonded to the antigen or an
immunostimulatory agent, in any combination. In some embodiments,
the immunogenic agent is conjugated to or comprises an HLA anchor
motif amino acids. In some instances, the immunogenic agent of the
invention can be used to induce an antigen-specific immune
response, including the production of memory CD4 T cells, in the
subject.
[0091] A vaccine of the present invention may vary in its
composition of peptides, nucleic acids and/or cellular components.
In a non-limiting example, an antigen might also be formulated with
an adjuvant. Of course, it will be understood that various
compositions described herein may further comprise additional
components. For example, one or more vaccine components may be
comprised in a lipid or liposome. In another non-limiting example,
a vaccine may comprise one or more adjuvants. A vaccine of the
present invention, and its various components, may be prepared
and/or administered by any method disclosed herein or as would be
known to one of ordinary skill in the art, in light of the present
disclosure.
[0092] Exemplary adjuvants include, but is not limited to,
alpha-interferon, gamma-interferon, platelet derived growth factor
(PDGF), TNF.alpha., TNF.beta., GM-CSF, epidermal growth factor
(EGF), cutaneous T cell-attracting chemokine (CTACK), epithelial
thymus-expressed chemokine (TECK), mucosae-associated epithelial
chemokine (MEC), IL-12, IL-15, MHC, CD80, CD86 including IL-15
having the signal sequence deleted and optionally including the
signal peptide from IgE. Other genes which may be useful adjuvants
include those encoding: MCP-I, MIP-Ia, MIP-Ip, IL-8, RANTES,
L-selectin, P-selectin, E-selectin, CD34, GlyCAM-1, MadCAM-1,
LFA-I, VLA-I, Mac-1, p150.95, PECAM, ICAM-I, ICAM-2, ICAM-3, CD2,
LFA-3, M-CSF, G-CSF, IL-4, mutant forms of IL-18, CD40, CD40L,
vascular growth factor, fibroblast growth factor, IL-7, nerve
growth factor, vascular endothelial growth factor, Fas, TNF
receptor, Fit, Apo-1, p55, WSL-I, DR3, TRAMP, Apo-3, AIR, LARD,
NGRF, DR4, DR5, KILLER, TRAIL-R2, TRICK2, DR6, Caspase ICE, Fos,
c-jun, Sp-I, Ap-I, Ap-2, p38, p65Rel, MyD88, IRAK, TRAF6, IkB,
Inactive NIK, SAP K, SAP-I, JNK, interferon response genes, NFkB,
Bax, TRAIL, TRAILrec, TRAILrecDRC5, TRAIL-R3, TRAIL-R4, RANK, RANK
LIGAND, Ox40, Ox40 LIGAND, NKG2D, MICA, MICB, NKG2A, NKG2B, NKG2C,
NKG2E, NKG2F, TAP 1, TAP2, anti-CTLA4-sc, anti-LAG3-Ig,
anti-TIM3-Ig and functional fragments thereof.
[0093] In one embodiment, the peptide vaccine of the invention
includes, but is not limited to a peptide mixed with adjuvant
substances and a peptide which is introduced together with an APC.
The most common cells used for the latter type of vaccine are bone
marrow and peripheral blood derived dendritic cells, as these cells
express costimulatory molecules that help activation of T cells.
WO00/06723 discloses a cellular vaccine composition which includes
an APC presenting tumor associated antigen peptides. Presenting the
peptide can be effected by loading the APC with a polynucleotide
(e.g., DNA, RNA, etc.) encoding the peptide or loading the APC with
the peptide itself.
[0094] When an immunogenic agent induces an anti-pathogen immune
response upon inoculation into an animal, the immunogenic agent is
decided to have anti-pathogen immunity inducing effect. The
pathogen-specific immune response can be detected by observing in
vivo or in vitro the response of the immune system in the host
against the peptide.
[0095] For example, a method for detecting the induction of
cytotoxic T lymphocytes is well known. A foreign substance that
enters the living body is presented to T cells and B cells by the
action of APCs. T cells that respond to the antigen presented by
APC in an antigen specific manner differentiate into cytotoxic T
cells (also referred to as cytotoxic T lymphocytes or CTLs) due to
stimulation by the antigen. These antigen stimulated cells then
proliferate. This process is referred to herein as "activation" of
T cells. Therefore, CTL induction by a certain peptide or
combination of peptides of the invention can be evaluated by
presenting the peptide to a T cell by APC, and detecting the
induction of CTL. Furthermore, APCs have the effect of activating
CD4+ T cells, CD8+ T cells, macrophages, eosinophils and NK
cells.
[0096] A method for evaluating the inducing action of CTL using
dendritic cells (DCs) as APC is well known in the art. DC is a
representative APC having the strongest CTL inducing action among
APCs. In this method, the peptide or combination of peptides are
initially contacted with DC and then this DC is contacted with T
cells. Detection of T cells having cytotoxic effects against the
cells of interest after the contact with DC shows that the peptide
or combination of peptides have an activity of inducing the
cytotoxic T cells. Furthermore, the induced immune response can be
also examined by measuring IFN-gamma produced and released by CTL
in the presence of antigen-presenting cells that carry immobilized
peptide or combination of peptides by visualizing using
anti-IFN-gamma antibodies, such as an ELISPOT assay.
[0097] Apart from DC, peripheral blood mononuclear cells (PBMCs)
may also be used as the APC. The induction of CTL is reported to be
enhanced by culturing PBMC in the presence of GM-CSF and IL-4.
Similarly, CTL has been shown to be induced by culturing PBMC in
the presence of keyhole limpet hemocyanin (KLH) and IL-7.
[0098] The induction of a pathogen-specific immune response can be
further confirmed by observing the induction of antibody production
against the specific pathogen. In one embodiment, the induction of
a pathogen-specific immune response can be further confirmed by
observing the activation and production of memory CD4 T cells.
[0099] Therapeutic Agent
[0100] In one embodiment, the composition comprises a therapeutic
agent. In some embodiments, the therapeutic agent comprises a
peptide, nucleic acid molecule, small molecule, antibody, or the
like. In some embodiments, the therapeutic agent is targeted to a
site of disease or infection in the immunoprivileged tissue. In
some embodiments, the therapeutic agent is targeted to the pathogen
of the infected immunoprivileged tissue. For example, in some
embodiments, the therapeutic agent comprises an antibody or
antibody fragment that binds to the pathogen or antigen of the
pathogen. In some embodiments, the therapeutic agent comprises an
antibody or antibody fragment that binds to a tumor-specific
antigen or tumor-associated antigen. In some embodiments, the
therapeutic agent comprises an antibody or antibody fragment that
binds to an antigen associated with a neurological disease.
[0101] In one embodiment, the therapeutic agent comprises a
therapeutic antibody or antibody fragment. The therapeutic antibody
or antibody fragment includes any antibody known in the art which
binds the pathogen, induces the killing of the pathogen, reduces
pathogenic infection, or prevents spread of the pathogenic
infection. The therapeutic antibody or antibody fragment includes
any antibody known in the art which binds to a tumor cell, induces
the killing of the tumor cell, or prevents tumor cell proliferation
or metastasis. In some embodiments, the therapeutic agent comprises
a T-cell that has been modified to express an antibody or antibody
fragment (e.g., chimeric antigen receptor T-cell). In one
embodiment, the therapeutic agent comprises an antibody-drug
conjugate.
[0102] In some embodiments, the therapeutic antibody or antibody
fragment binds to the same antigen of the immunogenic agent. In
some embodiments, the antigen to which therapeutic antibody or
antibody fragment binds to a different from the antigen of the
immunogenic agent. In some embodiments, the antigen to which the
therapeutic agent binds and the antigen of the immunogenic agent
are each associated with the same disease, disorder, or
infection.
[0103] Methods of making and using antibodies are well known in the
art. For example, polyclonal antibodies useful in the present
invention are generated by immunizing rabbits according to standard
immunological techniques well-known in the art (see, e.g., Harlow
et al., 1988, In: Antibodies, A Laboratory Manual, Cold Spring
Harbor, N.Y.). Such techniques include immunizing an animal with a
chimeric protein comprising a portion of another protein such as a
maltose binding protein or glutathione (GSH) tag polypeptide
portion, and/or a moiety such that the antigenic protein of
interest is rendered immunogenic (e.g., an antigen of interest
conjugated with keyhole limpet hemocyanin, KLH) and a portion
comprising the respective antigenic protein amino acid residues.
The chimeric proteins are produced by cloning the appropriate
nucleic acids encoding the marker protein into a plasmid vector
suitable for this purpose, such as but not limited to, pMAL-2 or
pCMX.
[0104] However, the invention should not be construed as being
limited solely to methods and compositions including these
antibodies or to these portions of the antigens. Rather, the
invention should be construed to include other antibodies, as that
term is defined elsewhere herein, to antigens, or portions thereof.
Further, the present invention should be construed to encompass
antibodies, inter alia, bind to the specific antigens of interest,
and they are able to bind the antigen present on Western blots, in
solution in enzyme linked immunoassays, in fluorescence activated
cells sorting (FACS) assays, in magenetic-actived cell sorting
(MACS) assays, and in immunofluorescence microscopy of a cell
transiently transfected with a nucleic acid encoding at least a
portion of the antigenic protein, for example.
[0105] One skilled in the art would appreciate, based upon the
disclosure provided herein, that the antibody can specifically bind
with any portion of the antigen and the full-length protein can be
used to generate antibodies specific therefor. However, the present
invention is not limited to using the full-length protein as an
immunogen. Rather, the present invention includes using an
immunogenic portion of the protein to produce an antibody that
specifically binds with a specific antigen. That is, the invention
includes immunizing an animal using an immunogenic portion, or
antigenic determinant, of the antigen.
[0106] Once armed with the sequence of a specific antigen of
interest and the detailed analysis localizing the various conserved
and non-conserved domains of the protein, the skilled artisan would
understand, based upon the disclosure provided herein, how to
obtain antibodies specific for the various portions of the antigen
using methods well-known in the art or to be developed.
[0107] The skilled artisan would appreciate, based upon the
disclosure provided herein, that that present invention includes
use of a single antibody recognizing a single antigenic epitope but
that the invention is not limited to use of a single antibody.
Instead, the invention encompasses use of at least one antibody
where the antibodies can be directed to the same or different
antigenic protein epitopes.
[0108] The generation of polyclonal antibodies is accomplished by
inoculating the desired animal with the antigen and isolating
antibodies which specifically bind the antigen therefrom using
standard antibody production methods such as those described in,
for example, Harlow et al. (1988, In: Antibodies, A Laboratory
Manual, Cold Spring Harbor, N.Y.).
[0109] Monoclonal antibodies directed against full length or
peptide fragments of a protein or peptide may be prepared using any
well-known monoclonal antibody preparation procedures, such as
those described, for example, in Harlow et al. (1988, In:
Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.) and in
Tuszynski et al. (1988, Blood, 72:109-115). Quantities of the
desired peptide may also be synthesized using chemical synthesis
technology. Alternatively, DNA encoding the desired peptide may be
cloned and expressed from an appropriate promoter sequence in cells
suitable for the generation of large quantities of peptide.
Monoclonal antibodies directed against the peptide are generated
from mice immunized with the peptide using standard procedures as
referenced herein.
[0110] Nucleic acid encoding the monoclonal antibody obtained using
the procedures described herein may be cloned and sequenced using
technology which is available in the art, and is described, for
example, in Wright et al. (1992, Critical Rev. Immunol.
12:125-168), and the references cited therein. Further, the
antibody of the invention may be "humanized" using the technology
described in, for example, Wright et al., and in the references
cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst
77:755-759), and other methods of humanizing antibodies well-known
in the art or to be developed.
[0111] The present invention also includes the use of humanized
antibodies specifically reactive with epitopes of an antigen of
interest. The humanized antibodies of the invention have a human
framework and have one or more complementarity determining regions
(CDRs) from an antibody, typically a mouse antibody, specifically
reactive with an antigen of interest. When the antibody used in the
invention is humanized, the antibody may be generated as described
in Queen, et al. (U.S. Pat. No. 6,180,370), Wright et al., (supra)
and in the references cited therein, or in Gu et al. (1997,
Thrombosis and Hematocyst 77(4):755-759). The method disclosed in
Queen et al. is directed in part toward designing humanized
immunoglobulins that are produced by expressing recombinant DNA
segments encoding the heavy and light chain complementarity
determining regions (CDRs) from a donor immunoglobulin capable of
binding to a desired antigen, such as an epitope on an antigen of
interest, attached to DNA segments encoding acceptor human
framework regions. Generally speaking, the invention in the Queen
patent has applicability toward the design of substantially any
humanized immunoglobulin. Queen explains that the DNA segments will
typically include an expression control DNA sequence operably
linked to the humanized immunoglobulin coding sequences, including
naturally-associated or heterologous promoter regions. The
expression control sequences can be eukaryotic promoter systems in
vectors capable of transforming or transfecting eukaryotic host
cells or the expression control sequences can be prokaryotic
promoter systems in vectors capable of transforming or transfecting
prokaryotic host cells. Once the vector has been incorporated into
the appropriate host, the host is maintained under conditions
suitable for high level expression of the introduced nucleotide
sequences and as desired the collection and purification of the
humanized light chains, heavy chains, light/heavy chain dimers or
intact antibodies, binding fragments or other immunoglobulin forms
may follow (Beychok, Cells of Immunoglobulin Synthesis, Academic
Press, New York, (1979), which is incorporated herein by
reference).
[0112] The invention also includes functional equivalents of the
antibodies described herein. Functional equivalents have binding
characteristics comparable to those of the antibodies, and include,
for example, hybridized and single chain antibodies, as well as
fragments thereof. Methods of producing such functional equivalents
are disclosed in PCT Application WO 93/21319 and PCT Application WO
89/09622.
[0113] Functional equivalents include polypeptides with amino acid
sequences substantially the same as the amino acid sequence of the
variable or hypervariable regions of the antibodies. "Substantially
the same" amino acid sequence is defined herein as a sequence with
at least 70%, at least about 80%, at least about 90%, at least
about 95%, or at least 99% homology to another amino acid sequence
(or any integer in between 70 and 99), as determined by the FASTA
search method in accordance with Pearson and Lipman, 1988 Proc.
Nat'l. Acad. Sci. USA 85: 2444-2448. Chimeric or other hybrid
antibodies have constant regions derived substantially or
exclusively from human antibody constant regions and variable
regions derived substantially or exclusively from the sequence of
the variable region of a monoclonal antibody from each stable
hybridoma.
[0114] Single chain antibodies (scFv) or Fv fragments are
polypeptides that consist of the variable region of the heavy chain
of the antibody linked to the variable region of the light chain,
with or without an interconnecting linker. Thus, the Fv comprises
an antibody combining site.
[0115] Functional equivalents of the antibodies of the invention
further include fragments of antibodies that have the same, or
substantially the same, binding characteristics to those of the
whole antibody. Such fragments may contain one or both Fab
fragments or the F(ab').sub.2 fragment. The antibody fragments
contain all six complement determining regions of the whole
antibody, although fragments containing fewer than all of such
regions, such as three, four or five complement determining
regions, are also functional. The functional equivalents are
members of the IgG immunoglobulin class and subclasses thereof, but
may be or may combine with any one of the following immunoglobulin
classes: IgM, IgA, IgD, or IgE, and subclasses thereof. Heavy
chains of various subclasses, such as the IgG subclasses, are
responsible for different effector functions and thus, by choosing
the desired heavy chain constant region, hybrid antibodies with
desired effector function are produced. Exemplary constant regions
are gamma 1 (IgG1), gamma 2 (IgG2), gamma 3 (IgG3), and gamma 4
(IgG4). The light chain constant region can be of the kappa or
lambda type.
[0116] The immunoglobulins of the present invention can be
monovalent, divalent or polyvalent. Monovalent immunoglobulins are
dimers (HL) formed of a hybrid heavy chain associated through
disulfide bridges with a hybrid light chain. Divalent
immunoglobulins are tetramers (H2L2) formed of two dimers
associated through at least one disulfide bridge.
[0117] Methods
[0118] The invention provides a method for treating, or preventing
infection disease or disorder of immunoprivileged tissue. The
therapeutic compounds or compositions of the invention may be
administered prophylactically or therapeutically to subjects
suffering from or at risk of (or susceptible to) developing the
disease or disorder. Such subjects may be identified using standard
clinical methods. In the context of the present invention,
prophylactic administration occurs prior to the manifestation of
overt clinical symptoms, such that an infection is prevented or
alternatively delayed in its progression. In the context of the
field of medicine, the term "prevent" encompasses any activity
which reduces the burden of mortality or morbidity from the disease
or disorder. Prevention can occur at primary, secondary and
tertiary prevention levels. While primary prevention avoids the
development of a disease, secondary and tertiary levels of
prevention encompass activities aimed at preventing the progression
of an infection and the emergence of symptoms as well as reducing
the negative impact of an already established disease by restoring
function and reducing disease or disorder-related
complications.
[0119] In one embodiment, the method comprises administering to the
subject an immunogenic agent (e.g., a vaccine), as described
elsewhere herein. In one embodiment, the immunogenic agent
comprises an adjuvant. An adjuvant refers to a compound that
enhances the immune response against the peptide or combination of
peptides when administered together (or successively) with the
peptide having immunological activity. Examples of suitable
adjuvants include cholera toxin, salmonella toxin, alum and such,
but are not limited thereto. Furthermore, a vaccine of this
invention may be combined appropriately with a pharmaceutically
acceptable carrier. Examples of such carriers are sterilized water,
physiological saline, phosphate buffer, culture fluid and such.
Furthermore, the vaccine may contain as necessary, stabilizers,
suspensions, preservatives, surfactants and such. The vaccine is
administered systemically or locally. Vaccine administration may be
performed by single administration or boosted by multiple
administrations.
[0120] When using cells of the invention (e.g., peptide-load
antigen presenting cell or peptide-specific IFN.gamma.-secreting
CD4+ T cells) as the vaccine, the disease or disorder may be
treated or prevent, for example, by the ex vivo method. For
example, PBMCs of the subject receiving treatment or prevention are
collected, contacted ex vivo with an antigen or nucleic acid
encoding an antigen. Following the induction of peptide-load
antigen presenting cells or peptide-specific IFN.gamma.-secreting
CD4+ T cells, the cells may be administered to the subject. The
cells can be induced by introducing a vector encoding the peptide
or combination of peptides into them ex vivo. The cells induced in
vitro can be cloned prior to administration. By cloning and growing
cells having high activity of damaging target cells, cellular
immunotherapy can be performed more effectively. Furthermore, cells
of the invention isolated in this manner may be used for cellular
immunotherapy not only against individuals from whom the cells are
derived, but also against similar types of diseases in other
individuals.
[0121] In one embodiment, the method comprises administering to the
subject a therapeutic agent, as described elsewhere herein. For
example, in one embodiment, the method comprises administering a
therapeutic antibody or antibody fragment that binds to an
antigen.
[0122] The different agents may be administered to the subject in
any order and in any suitable interval. For example, in some
embodiments, the immunogenic agent and the therapeutic agent are
administered simultaneously or near simultaneously. In some
embodiments, the method comprises a staggered administration of the
agents, where the immunogenic agent is administered and the
therapeutic agent is administered at some later time point. In some
embodiments, the method comprises a staggered administration of the
agents, where the therapeutic agent is administered and the
immunogenic agent is administered at some later time point. Any
suitable interval of administration which produces the desired
therapeutic effect may be used.
[0123] The method of the present invention may be used to treat any
pathogenic infection of immunoprivileged tissue. The method may be
used to treat or prevent a pathogenic infection in any
immunoprivileged tissue, including but not limited to the brain,
spinal cord, peripheral nervous system, testes, eye, placenta,
liver, and the like. For example, the method may be used to treat
or prevent infections caused by a virus, a fungus, a protozoan, a
parasite, an arthropod, a prion, a mycobacterium, or a bacterium,
including a bacterium that has developed resistance to one or more
antibiotics. Exemplary viral infections treated or prevented by way
of the present method include, but is not limited to infections
caused by Zika virus, ebola virus, Japanese encephalitis virus,
mumps virus, measles virus, rabies virus, varicella-zoster,
Epstein-Barr virus (HHV-4), cytomegalovirus, herpes simplex virus 1
(HSV-1) and herpes simplex virus 2 (HSV-2), human immunodeficiency
virus-1 (HIV-1), JC virus, arborviruses, enteroviruses, and West
Nile virus, dengue virus, poliovirus, and varicella zoster virus.
Exemplary bacterial infections treated or prevented by way of the
present method include, but is not limited to infections caused by
Streptococcus pneumoniae, Neisseria meningitides, Streptococcus
agalactia, and Escherichia coli. Exemplary fungal or protozoan
infections treated or prevented by way of the present method
include, but is not limited to infections caused by Candidiasis,
Aspergillosis, Cryptococcosis, and Toxoplasma gondii.
[0124] In some embodiments, the present invention provides a method
for treating or preventing a disease or disorder associated with
infection of immunoprivileged tissue, including but not limited to
meningitis, encephalitis, meningoencephalitis, epidural abscess,
subdural abscess, brain abscess, and progressive multifocal
leukoencephalopathy (PML).
[0125] The method of the present invention may be used to treat or
prevent cancer. The method may be used to reduce tumor growth,
proliferation, or metastasis in any immunoprivileged tissue,
including but not limited to the brain, spinal cord, peripheral
nervous system, testes, eye, placenta, liver, and the like.
Exemplary forms of cancer treated or prevented by way of the
present invention, include, but is not limited to glioblastoma,
meningioma, acoustic neuroma, astrocytoma, chordoma, CNS lymphoma,
craniopharyngioma, brain stem glioma, ependymoma, mixed glioma,
optic nerve glioma, supependymoma, medullablastoma, meningioma,
metastatic brain tumors, oligodendroglioma, pituitary tumors,
primitive neuroectodermal, schwannoma, juvenile pilocytic
astrocytoma, pineal tumor, rhaboid tumor, spinal cancer, spinal
cord tumor, testicular cancer, intraocular melanoma, and liver
cancer, hepatocellular cancer, bile duct cancer, and
hepatoblastoma.
[0126] The method of the present invention may be used to treat or
prevent a neurological disorder. Exemplary neurological disorders
treated or prevented by way of the present invention, include, but
is not limited to Alzheimer's disease, Parkinson's disease,
tauopathy, frontotemporal dementia, Huntington's disease, and prion
disease.
[0127] The treatment and prophylactic methods of the invention may
be used to treat or prevent a disease or disorder of
immunoprivileged tissue in any subject in need. For example, in
some embodiments, the subject includes, but is not limited to
humans and other primates and mammals including commercially
relevant mammals such as non-human primates, cattle, pigs, horses,
sheep, cats, dogs, rats, and mice.
[0128] In some embodiments, the method comprises further
administering an additional therapeutic agent, including, but not
limited to, an antibiotic, antiviral agent, antifungal agent, and
anti-inflammatory agent. In one embodiment, the antibiotic is
selected from Amoxicillin, Ampicillin, Cloxacillin, Dicloxacillin,
Nafcillin, Oxacillin, Penicillin G, Penicillin V, Piperacillin,
Cefadroxil (cefadroxyl), Cefalexin (cephalexin), Cefalotin
(cephalothin), Cefapirin (cephapirin), Cefazolin (cephazolin),
Cefradine (cephradine), Cefaclor, Cefotetan, Cefoxitin, Cefprozil
(cefproxil), Cefuroxime, Cefdinir, Cefixime, Cefotaxime,
Cefpodoxime, Ceftizoxime, Ceftriaxone, Ceftazidime, Cefepime,
Ceftobiprole, Ceftaroline, Aztreonam, Imipenem, Imipenem,
cilastatin, Doripenem, Meropenem, Ertapenem, Azithromycin,
Erythromycin, Clarithromycin, Dirithromycin, Roxithromycin,
Clindamycin, Lincomycin, Amikacin, Gentamicin, Tobramycin,
Ciprofloxacin, Levofloxacin, Moxifloxacin,
Trimethoprim-Sulfamethoxazole, Doxycycline, Tetracycline,
Vancomycin, Teicoplanin, Telavancin, and Linezolid. Exemplary
antiviral agents that can be used with the methods of the invention
include, but are not limited to, Abacavir, Aciclovir, Acyclovir,
Adefovir, Amantadine, Amprenavir, Ampligen, Arbidol, Atazanavir,
Atripla, Balavir, Cidofovir, Combivir, Dolutegravir, Darunavir,
Delavirdine, Didanosine, Docosanol, Edoxudine, Efavirenz,
Emtricitabine, Enfuvirtide, Entecavir, Ecoliever, Famciclovir,
Fomivirsen, Fosamprenavir, Foscarnet, Fosfonet, Ganciclovir,
Ibacitabine, Imunovir, Idoxuridine, Imiquimod, Indinavir, Inosine,
Interferon type III, Interferon type II, Interferon type I,
Interferon, Lamivudine, Lopinavir, Loviride, Maraviroc, Moroxydine,
Methisazone, Nelfinavir, Nevirapine, Nexavir, Nitazoxanide, Novir,
Peginterferon alfa-2a, Penciclovir, Peramivir, Pleconaril,
Podophyllotoxin, Raltegravir, Ribavirin, Rimantadine, Ritonavir,
Pyramidine, Saquinavir, Sofosbuvir, Stavudine, Telaprevir,
Tenofovir, Tenofovir disoproxil, Tipranavir, Trifluridine,
Trizivir, Tromantadine, Truvada, Valaciclovir, Valganciclovir,
Vicriviroc, Vidarabine, Viramidine, Zalcitabine, Zanamivir, and
Zidovudine. Non-limiting examples of anti-inflammatory agents
include non-steroidal anti-inflammatory drugs (NSAIDs), steroidal
anti-inflammatory drugs, beta-agonists, anticholingeric agents, and
methyl xanthines. Examples of NSAIDs include, but are not limited
to, aspirin, ibuprofen, celecoxib, diclofenac, etodolac,
fenoprofen, indomethacin, ketoralac, oxaprozin, nabumentone,
sulindac, tolmentin, rofecoxib, naproxen, ketoprofen, nabumetone,
diclofenac & misoprostol, ibuprofen, ketorolac, valdecoxib,
meloxicam, flurbiprofen, and piroxicam. Such NSAIDs function by
inhibiting a cyclooxygenase enzyme (e.g., COX-1 and/or COX-2).
Examples of steroidal anti-inflammatory drugs include, but are not
limited to, glucocorticoids, dexamethasone, cortisone,
hydrocortisone, prednisone, prednisolone, triamcinolone,
azulfidine, and eicosanoids such as prostaglandins, thromboxanes,
and leukotrienes.
[0129] In some embodiments, the method comprises further
administering an additional anti-cancer treatment modality
including, but not limited to, chemotherapy, radiation, surgery,
hormonal therapy, or a combination thereof.
[0130] Pharmaceutical
[0131] The therapeutic and prophylactic methods of the invention
thus encompass the use of pharmaceutical compositions. The
pharmaceutical compositions useful for practicing the invention may
be administered to deliver a dose of between 1 ng/kg/day and 100
mg/kg/day. In one embodiment, the invention envisions
administration of a dose which results in a concentration of the
compound of the present invention between 1 .mu.M and 10 .mu.M in a
mammal.
[0132] Typically, dosages which may be administered in a method of
the invention to an animal that ranges in amount from 0.5 .mu.g to
about 50 mg per kilogram of body weight of the animal. While the
precise dosage administered will vary depending upon any number of
factors, including but not limited to, the type of animal and type
of disease state being treated, the age of the animal and the route
of administration. In one embodiment, the dosage of the compound
will vary from about 1 .mu.g to about 10 mg per kilogram of body
weight of the animal. In one embodiment, the dosage will vary from
about 3 .mu.g to about 1 mg per kilogram of body weight of the
animal.
[0133] The compound may be administered to an animal as frequently
as several times daily, or it may be administered less frequently,
such as once a day, once a week, once every two weeks, once a
month, or even less frequently, such as once every several months
or even once a year or less. The frequency of the dose will be
readily apparent to the skilled artisan and will depend upon any
number of factors, such as, but not limited to, the type and
severity of the disease being treated, the type and age of the
animal, etc. The formulations of the pharmaceutical compositions
described herein may be prepared by any method known or hereafter
developed in the art of pharmacology. In general, such preparatory
methods include the step of bringing the active ingredient into
association with a carrier or one or more other accessory
ingredients, and then, if necessary or desirable, shaping or
packaging the product into a desired single- or multi-dose
unit.
[0134] Although the description of pharmaceutical compositions
provided herein are principally directed to pharmaceutical
compositions which are suitable for ethical administration to
humans, it will be understood by the skilled artisan that such
compositions are generally suitable for administration to animals
of all sorts. Modification of pharmaceutical compositions suitable
for administration to humans in order to render the compositions
suitable for administration to various animals is well understood,
and the ordinarily skilled veterinary pharmacologist can design and
perform such modification with merely ordinary, if any,
experimentation. Subjects to which administration of the
pharmaceutical compositions of the invention is contemplated
include, but are not limited to, humans and other primates, mammals
including commercially relevant mammals such as non-human primates,
cattle, pigs, horses, sheep, cats, and dogs.
[0135] Pharmaceutical compositions that are useful in the methods
of the invention may be prepared, packaged, or sold in formulations
suitable for ophthalmic, oral, rectal, vaginal, parenteral,
topical, pulmonary, intranasal, buccal, or another route of
administration. Other contemplated formulations include projected
nanoparticles, liposomal preparations, resealed erythrocytes
containing the active ingredient, and immunologically-based
formulations.
[0136] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in bulk, as a single unit dose, or as a
plurality of single unit doses. As used herein, a "unit dose" is
discrete amount of the pharmaceutical composition comprising a
predetermined amount of the active ingredient. The amount of the
active ingredient is generally equal to the dosage of the active
ingredient which would be administered to a subject or a convenient
fraction of such a dosage such as, for example, one-half or
one-third of such a dosage.
[0137] The relative amounts of the active ingredient, the
pharmaceutically acceptable carrier, and any additional ingredients
in a pharmaceutical composition of the invention will vary,
depending upon the identity, size, and condition of the subject
treated and further depending upon the route by which the
composition is to be administered. By way of example, the
composition may comprise between 0.1% and 100% (w/w) active
ingredient.
[0138] In addition to the active ingredient, a pharmaceutical
composition of the invention may further comprise one or more
additional pharmaceutically active agents. Other active agents
useful in the treatment of fibrosis include anti-inflammatories,
including corticosteroids, and immunosuppressants.
[0139] Controlled- or sustained-release formulations of a
pharmaceutical composition of the invention may be made using
conventional technology.
[0140] As used herein, "parenteral administration" of a
pharmaceutical composition includes any route of administration
characterized by physical breaching of a tissue of a subject and
administration of the pharmaceutical composition through the breach
in the tissue. Parenteral administration thus includes, but is not
limited to, administration of a pharmaceutical composition by
injection of the composition, by application of the composition
through a surgical incision, by application of the composition
through a tissue-penetrating non-surgical wound, and the like. In
particular, parenteral administration is contemplated to include,
but is not limited to, intraocular, intravitreal, subcutaneous,
intraperitoneal, intramuscular, intrasternal injection,
intratumoral, and kidney dialytic infusion techniques.
[0141] Formulations of a pharmaceutical composition suitable for
parenteral administration comprise the active ingredient combined
with a pharmaceutically acceptable carrier, such as sterile water
or sterile isotonic saline. Such formulations may be prepared,
packaged, or sold in a form suitable for bolus administration or
for continuous administration. Injectable formulations may be
prepared, packaged, or sold in unit dosage form, such as in ampules
or in multi-dose containers containing a preservative. Formulations
for parenteral administration include, but are not limited to,
suspensions, solutions, emulsions in oily or aqueous vehicles,
pastes, and implantable sustained-release or biodegradable
formulations. Such formulations may further comprise one or more
additional ingredients including, but not limited to, suspending,
stabilizing, or dispersing agents. In one embodiment of a
formulation for parenteral administration, the active ingredient is
provided in dry (i.e. powder or granular) form for reconstitution
with a suitable vehicle (e.g. sterile pyrogen-free water) prior to
parenteral administration of the reconstituted composition.
[0142] The pharmaceutical compositions may be prepared, packaged,
or sold in the form of a sterile injectable aqueous or oily
suspension or solution. This suspension or solution may be
formulated according to the known art, and may comprise, in
addition to the active ingredient, additional ingredients such as
the dispersing agents, wetting agents, or suspending agents
described herein. Such sterile injectable formulations may be
prepared using a non-toxic parenterally-acceptable diluent or
solvent, such as water or 1,3-butane diol, for example. Other
acceptable diluents and solvents include, but are not limited to,
Ringer's solution, isotonic sodium chloride solution, and fixed
oils such as synthetic mono- or di-glycerides. Other
parentally-administrable formulations which are useful include
those which comprise the active ingredient in microcrystalline
form, in a liposomal preparation, or as a component of a
biodegradable polymer system. Compositions for sustained release or
implantation may comprise pharmaceutically acceptable polymeric or
hydrophobic materials such as an emulsion, an ion exchange resin, a
sparingly soluble polymer, or a sparingly soluble salt.
[0143] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for pulmonary
administration via the buccal cavity. Such a formulation may
comprise dry particles which comprise the active ingredient and
which have a diameter in the range from about 0.5 to about 7
nanometers, or about 1 to about 6 nanometers. Such compositions are
conveniently in the form of dry powders for administration using a
device comprising a dry powder reservoir to which a stream of
propellant may be directed to disperse the powder or using a
self-propelling solvent/powder-dispensing container such as a
device comprising the active ingredient dissolved or suspended in a
low-boiling propellant in a sealed container. In one embodiment,
such powders comprise particles wherein at least 98% of the
particles by weight have a diameter greater than 0.5 nanometers and
at least 95% of the particles by number have a diameter less than 7
nanometers. In one embodiment, at least 95% of the particles by
weight have a diameter greater than 1 nanometer and at least 90% of
the particles by number have a diameter less than 6 nanometers. In
some instances dry powder compositions include a solid fine powder
diluent such as sugar and are conveniently provided in a unit dose
form.
[0144] Low boiling propellants generally include liquid propellants
having a boiling point of below 65.degree. F. at atmospheric
pressure. Generally the propellant may constitute 50 to 99.9% (w/w)
of the composition, and the active ingredient may constitute 0.1 to
20% (w/w) of the composition. The propellant may further comprise
additional ingredients such as a liquid non-ionic or solid anionic
surfactant or a solid diluent (in some instances having a particle
size of the same order as particles comprising the active
ingredient).
[0145] Pharmaceutical compositions of the invention formulated for
pulmonary delivery may also provide the active ingredient in the
form of droplets of a solution or suspension. Such formulations may
be prepared, packaged, or sold as aqueous or dilute alcoholic
solutions or suspensions, optionally sterile, comprising the active
ingredient, and may conveniently be administered using any
nebulization or atomization device. Such formulations may further
comprise one or more additional ingredients including, but not
limited to, a flavoring agent such as saccharin sodium, a volatile
oil, a buffering agent, a surface active agent, or a preservative
such as methylhydroxybenzoate. In one embodiment, the droplets
provided by this route of administration have an average diameter
in the range from about 0.1 to about 200 nanometers.
[0146] The formulations described herein as being useful for
pulmonary delivery are also useful for intranasal delivery of a
pharmaceutical composition of the invention.
[0147] Another formulation suitable for intranasal administration
is a coarse powder comprising the active ingredient and having an
average particle from about 0.2 to 500 micrometers. Such a
formulation is administered in the manner in which snuff is taken
i.e. by rapid inhalation through the nasal passage from a container
of the powder held close to the nares.
[0148] Formulations suitable for nasal administration may, for
example, comprise from about as little as 0.1% (w/w) and as much as
100% (w/w) of the active ingredient, and may further comprise one
or more of the additional ingredients described herein.
[0149] A pharmaceutical composition of the invention may be
prepared, packaged, or sold in a formulation suitable for buccal
administration. Such formulations may, for example, be in the form
of tablets or lozenges made using conventional methods, and may,
for example, 0.1 to 20% (w/w) active ingredient, the balance
comprising an orally dissolvable or degradable composition and,
optionally, one or more of the additional ingredients described
herein. Alternately, formulations suitable for buccal
administration may comprise a powder or an aerosolized or atomized
solution or suspension comprising the active ingredient. In one
embodiment, such powdered, aerosolized, or aerosolized
formulations, when dispersed, have an average particle or droplet
size in the range from about 0.1 to about 200 nanometers, and may
further comprise one or more of the additional ingredients
described herein.
[0150] As used herein, "additional ingredients" include, but are
not limited to, one or more of the following: excipients; surface
active agents; dispersing agents; inert diluents; granulating and
disintegrating agents; binding agents; lubricating agents;
sweetening agents; flavoring agents; coloring agents;
preservatives; physiologically degradable compositions such as
gelatin; aqueous vehicles and solvents; oily vehicles and solvents;
suspending agents; dispersing or wetting agents; emulsifying
agents, demulcents; buffers; salts; thickening agents; fillers;
emulsifying agents; antioxidants; antibiotics; antifungal agents;
stabilizing agents; and pharmaceutically acceptable polymeric or
hydrophobic materials. Other "additional ingredients" which may be
included in the pharmaceutical compositions of the invention are
known in the art and described, for example in Remington's
Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co.,
Easton, Pa.), which is incorporated herein by reference.
EXPERIMENTAL EXAMPLES
[0151] The invention is further described in detail by reference to
the following experimental examples. These examples are provided
for purposes of illustration only, and are not intended to be
limiting unless otherwise specified. Thus, the invention should in
no way be construed as being limited to the following examples, but
rather, should be construed to encompass any and all variations
which become evident as a result of the teaching provided
herein.
[0152] Without further description, it is believed that one of
ordinary skill in the art can, using the preceding description and
the following illustrative examples, make and utilize the present
invention and practice the claimed methods. The following working
examples are not to be construed as limiting in any way the
remainder of the disclosure.
Example 1
[0153] The materials and methods employed in these experiments are
now described.
[0154] Mice
[0155] Six- to eight-week-old female C57BL/6 (CD45.2.sup.+) and
congenic C57BL/6 B6.SJL-PtprcaPep3b/BoyJ (B6.Ly5.1) (CD45.1.sup.+)
mice, B6.129 S2-Igh.sup.tmlCgn/J (.mu.MT) mice, anti-HEL B-cell
receptor (BCR)-transgenic C57BL/6-TgN (IghelMD4) (HELTg) mice,
CBy.PL(B6)-Thy1.sup.a/ScrJ (Thy1.1.sup.+ BALB/c) mice and
B6.129X1-Fcgrt.sup.tm1Dcr/DcrJ. (FcRn.sup.-/-) mice were purchased
from the National Cancer Institute and Jackson Laboratory. JHD mice
(B-cell deficient on BALB/c background) were obtained from Taconic
Animal Models.
[0156] Viruses
[0157] HSV-2 strains 186syn.sup.- TK.sup.- and 186syn.sup.+ were
obtained. These viruses were propagated and titered on Vero cells
(ATCC CCL-81) as previously described (Laidlaw, B. J. et al., 2014,
Immunity 41, 633-645). Influenza virus A/Puerto Rico/3/334 (A/PR8:
H1N1) and WT/VSV were propagated as previously described (Laidlaw,
B. J. et al., 2014, Immunity 41, 633-645, Sasai, M., et al., 2010,
Science 329, 1530-1534).
[0158] Virus Infection
[0159] Six- to eight-week-old female mice injected subcutaneously
with Depo Provera (Pharmacia Upjohn, 2 mg per mouse) were immunized
intravaginally, intraperitoneally or intranasally with 10.sup.5
p.f.u. of HSV-2 (186syn-TK-) as previously described (Iijima, N. et
al., 2014, Science 346, 93-98). For secondary challenge, immunized
mice were challenged vaginally with 10.sup.4 p.f.u. of WT HSV-2
(186syn.sup.+) (100% lethal dose for naive mice). In the case of
BALB/c and JHD mice, these mice were immunized with
5.times.10.sup.4 to 10.sup.5 p.f.u. of HSV-2. For secondary
challenge, immunized mice were challenged with 10.sup.5 p.f.u. of
WT HSV-2 (100% lethal dose for naive mice). The severity of disease
was scored as follows: 0, no sign; 1, slight genital erythema and
oedema; 2, moderate genital inflammation; 3, purulent genital
lesions; 4, hind-limb paralysis; 5, pre-moribund (Laidlaw, B. J. et
al., 2014, Immunity 41, 633-645). Owing to humane concerns, the
animals were euthanized before reaching moribund state. To measure
virus titer in peripheral tissues, vaginal tissues, DRG and spinal
cord were harvested in ABC buffer (0.5 mM MgCl.sub.26H.sub.2O, 0.9
mM CaCl.sub.22H.sub.2O, 1% glucose, 5% HI FBS and
penicillin-streptomycin) including 1% amphotericin-B (Sigma).
Thereafter, these tissues were homogenized by lysing matrix D (MP
Biomedicals), followed by clarifying by centrifugation. Viral
titers were obtained by titration of tissue samples on a Vero cell
monolayer. Protein concentration in tissue homogenates was measured
by a DC protein assay kit (Bio-Rad Laboratories). C57BL/6 mice were
immunized intravenously with WT/VSV (2.times.10.sup.6 p.f.u. per
mouse) or intranasally with influenza A/PR8 (10 p.f.u. per mouse).
For secondary challenge, VSV-immunized mice were re-infected
intranasally with WT/VSV (1.times.10.sup.7 p.f.u. per mouse).
[0160] Antibodies
[0161] Anti-CD90.2 (30-H12), anti-CD90.1 (OX-7), anti-CD45.2 (104),
anti-CD45.1 (A20), anti-CD4 (GK1.5, RM4-5 and RM4-4), anti-CD19
(6D5), anti-CD45R/B220 (RA3-6B2), anti-MHC class II (I-A/I-E,
M5/114.15.2), anti-CD69 (H1.2F3), anti-CD44 (IM7), anti-CD49d
(R1-2), anti-NKp46 (29A1.4) and anti-IFN-.gamma. (XMG1.2 and
R4-6A2) were purchased from e-Bioscience or Biolegend.
[0162] Isolation of Leukocytes from Peripheral Tissues
[0163] The genital tracts of vaginal tissues treated with
Depo-Provera were dissected from the urethra and cervix. Before
collection of neuronal tissues, mice were perfused extensively
using transcardiac perfusion and perfusion through inferior vena
cava and great saphenous vein with more than 30 ml of PBS. The DRG
and the adjacent region of the spinal cord were harvested in PBS
for flow cytometry or ABC buffer for tissue homogenization. The
tissues in PBS were then incubated with 0.5 mg ml.sup.-1 Dispase II
(Roche) for 15 min at 37.degree. C. Thereafter, vaginal tissues
were digested with 1 mg ml.sup.-1 collagenase D (Roche) and 30
.mu.g ml.sup.-1 DNase I (Sigma-Aldrich) at 37.degree. C. for 25
min. The resulting cells were filtered through a 70-.mu.m filter
(Iijima, N. et al., 2011, Proc. Natl Acad. Sci. USA 108, 284-289),
Johnson, A. J. et al., 2008, J. Virol. 82, 9678-9688).
[0164] Flow Cytometry
[0165] Preparation of single-cell suspensions from spleen, draining
lymph nodes (inguinal lymph node and iliac lymph nodes), vagina and
neuronal tissues were described previously. Multiparameter analyses
were performed on an LSR II flow cytometer (Becton Dickinson) and
analyzed using FlowJo software (Tree Star). To detect
HSV-2-specific CD4.sup.+ T cells or VSV-specific CD4.sup.+ T cells
(CD45.1.sup.+ or CD45.2.sup.+, single-cell suspensions from vaginal
tissues of TK.sup.-HSV-2-immunized mice or VSV immunized mice were
stimulated in the presence of 5 .mu.g ml.sup.-1 Brefeldin A with
naive splenocytes (CD45.1.sup.+CD45.2.sup.+) loaded with
heat-inactivated HSV-2 antigen, heat-inactivated WT VSV and
heat-inactivated influenza virus A/PR8 for around 12 h (Iijima, N.
et al., 2014, Science 346, 93-98). To detect HSV-2-specific
CD4.sup.+ T cells in BALB/c and JHD mice, single-cell suspensions
(CD90.2.sup.+) from vaginal tissues of TK.sup.-HSV-2-immunized mice
were stimulated with naive splenocytes (CD90.1.sup.+) loaded with
heat-inactivated HSV-2 antigen.
[0166] In Vivo Treatment with Neutralizing/Depleting Antibodies
[0167] C57BL/6 mice or BALB/c mice were immunized with
TK.sup.-HSV-2 virus. Five to eight weeks later, these mice were
injected intravenously (tail vain) with 300 .mu.g of anti-CD4
(GK1.5; BioXCell) or anti-IFN-.gamma. (XMG1.2; BioXCell) antibody
at days -4, -1, 2 and 4 after HSV-2 challenge. In vivo depletion
for CD4 was confirmed by fluorescence-activated cell sorting
analysis of the cell suspension from spleen. For the neutralization
of .alpha.4-integrin, purified anti-mouse .alpha.4 integrin/CD49d
(PS/2; SouthernBiotech) was given a tail vain injection of 300
.mu.g antibody at days 2 and 4 after challenge.
[0168] Parabiosis
[0169] Parabiosis was performed as previously described with slight
modifications (Iijima et al., 2014, Science, 346: 93-98). Naive or
immunized C57BL/6 mice, HELTg and .mu.MT mice were anaesthetized
with a mixture of ketamine/xylazine (100 mg/kg and 10 mg/kg body
weight respectively). After shaving the corresponding lateral
aspects of each mouse, matching skin incisions were made from
behind the ear to hip and sutured together with Chromic Gut (4-0,
Henry Schein) absorbable suture, then these areas were clipped with
7-mm stainless-steel wound clips (Roboz).
[0170] Measurement of Virus-Specific Ig and Total Ig in Serum and
Tissue Homogenates
[0171] Ninety-six-well EIA/RIA plates were filled with 100 .mu.l of
heat-inactivated purified HSV-2 (10.sup.4-10.sup.5 p.f.u.
equivalent per 100 .mu.l) or heat-inactivated purified VSV
(5.times.10.sup.5 p.f.u. equivalent per 100 .mu.l) for
virus-specific Ig measurement or goat anti-mouse Ig (1:1,000;
SouthernBiotech, 1010-01) for total Ig measurement in carbonate
buffer (pH 9.5) and then incubated overnight at 4.degree. C. On the
following day, these plates were washed with PBS-Tween 20 and
blocked for 2 h with 5% FBS in PBS. Tissue samples and serum
samples in ABC buffer were then plated in the wells and incubated
for at least 4 h at ambient temperature. After washing in PBS-Tween
20, HRP-conjugated anti-mouse IgG1, IgG3, IgM, IgA, IgG2a, IgG2b or
IgG2c (SouthernBiotech) was added to the wells for 1 h, followed by
washing and adding TMB solution (eBioscience). Reactions were
stopped with 1 N H2504 and absorbance was measured at 450 nm. The
sample antibody titers were defined by using Ig standard (C57BL/6
Mouse Immunoglobulin Panel; SouthernBiotech) or mouse IgG2a
(HOPC-1; SouthernBiotech).
[0172] Albumin ELISA
[0173] Using tissue homogenates (DRG and spinal cord) prepared
after extensive perfusion, albumin ELISA (Genway) was performed
according to instruction.
[0174] Immunofluorescence Staining
[0175] Frozen sections 8 .mu.m in thickness were cut, fixed and
left to dry at ambient temperature. These tissues were stained with
the antibodies (anti-CD4 (H129.19), anti-MHC class II (M5/114.15.2)
anti-VCAM-1 (429/MVCAM.A), anti-CD31 (390 and MEC13.3), anti-Ly6G
(1A8), anti-CD11b (M1/70) and anti-mouse albumin (Goat pAb/Bethyl
Laboratories)) as previously described (Iijima, N. et al., 2014,
Science 346, 93-98). These slides were washed and incubated with
DAPI and mounted with Fluoromount-G (SouthernBiotech). They were
analyzed by fluorescence microscopy (BX51; Olympus).
[0176] Vascular Permeability Assays
[0177] Spinal column was harvested from intranasal
TK.sup.-HSV-2-immunized mice 45 min after tail vein injection with
200 .mu.l of 5 mg ml.sup.-1 Oregon Green 488-conjugated dextran (70
kDa, D7173, Thermo Fisher Scientific) in PBS. Spine was then fixed
with 4% paraformaldehyde in PBS overnight, and frozen sections cut
(8 .mu.m in thickness) for immunohistochemical analysis (Knowland,
D. et al., 2014, Neuron 82, 603-617).
[0178] DNA Isolation from Tissues
[0179] C57BL/6 mice were immunized intranasally with TK.sup.-HSV-2.
Six weeks later, vaginal tissues, DRG and spinal cord of these mice
were lysed in 10 mg ml.sup.-1 Proteinase K (Roche) to isolate DNA
at 55.degree. C. overnight. After removing these tubes, phenol
equilibrated with Tris pH 8.0 was added. Thereafter, upper aqueous
phase was added to phenol/chloroform (1:1). The upper aqueous phase
was re-suspended with sodium acetate, pH 6.0, and 100% ethanol at
room temperature. After shaking and centrifuging, the concentration
of isolated DNA pellet was measured. The level of HSV-2 genomic DNA
in peripheral tissues on the basis of HSV-2 gD (forward primer:
AGCGAGGATAACCTGGGATT (SEQ ID NO: 1); reverse primer:
GGGATAAAGCGGGGTAACAT (SEQ ID NO: 2)) was analyzed by quantitative
PCR using purified viral DNA genome as standard.
[0180] Statistical Analysis
[0181] Survival curves were analyzed using a log-rank test. For
other data, normally distributed continuous variable comparisons
used a two-tailed unpaired Student's t-test or paired Student's
t-test with Prism software. To compare two non-parametric data
sets, a Mann-Whitney U-test was used.
[0182] The results of the experiments are now described.
[0183] To investigate the mechanism of antibody-mediated protection
within the barrier-protected tissues, a mouse model of genital
herpes infection was used. Herpes simplex virus type 2 (HSV-2)
enters the host through the mucosal epithelia, and infects the
innervating neurons in the dorsal root ganglia (DRG) to establish
latency (Koelle, D. M. et al., 2008, Annu. Rev. Med. 59, 381-395,
Knipe, D. M. et al., 2008 Nature Rev. Microbiol. 6, 211-221).
Vaginal immunization by an attenuated HSV-2 with deletion of the
thymidine kinase gene (TK.sup.-HSV-2) provides complete protection
from lethal disease following genital challenge with wild-type (WT)
HSV-2 (Parr, M. B. et al., 1994, Lab. Invest. 70, 369-380) by
establishing tissue-resident memory T cells (TRM) (Iijima, N. et
al., 2014, Science 346, 93-98). In vaginally immunized mice,
interferon (IFN)-.gamma.-secretion by CD4 T cells, but not
antibodies, are required for protection (Milligan, G. N. et al.,
1998, J. Immunol. 160, 6093-6100, Parr, M. B. et al., 2000,
Immunology 101, 126-131). In contrast, distal immunization with the
same virus fails to establish TRM and provides only partial
protection (Iijima, N. et al., 2014, 2014, Science 346, 93-98).
Nevertheless, of the distal immunization routes tested, intranasal
immunization with TK.sup.-HSV-2 provided the most robust protection
against intravaginal challenge with WT HSV-2, whereas
intraperitoneal immunization provided the least protection (FIG. 1A
through FIG. 1D) Sato, A. et al., 2014, J. Virol. 88, 13699-13708,
Jones, C. A. et al., 2000, Virology 278, 137-150). As shown
previously (Iijima, N. et al., 2014, Science 346, 93-98), intransal
immunization did not establish TRM in the genital mucosa (FIG. 5A,
FIG. 5B), despite generating a comparable circulating memory T-cell
pool (FIG. 5C, FIG. 5D). After vaginal HSV-2 challenge, mice that
were immunized intranasally with TK--HSV-2 were unable to control
viral replication within the vaginal mucosa (FIG. 1C), but had
significantly reduced viral replication in the innervating neurons
of the DRG (FIG. 1D). Notably, it was found that protection
conferred by intranasal immunization required B cells, as JHD mice
(deficient in B cells) were not protected by intranasal
immunization (FIG. 1E-FIG. 1G). In the absence of B cells,
intranasal immunization was unable to control viral replication in
the DRG and spinal cord (FIG. 1G).
[0184] In mice immunized intranasally with TK.sup.-HSV-2, no
evidence of infection in the DRG or the spinal cord was found (FIG.
5E). Moreover, the intranasal route of immunization was not unique
in conferring protective response, as parabiotic mice sharing
circulation with intravaginally immunized partners were also partly
protected from vaginal challenge with WT HSV-2 in the absence of
T.sub.RM (Iijima, N. et al., 2014, Science 346, 93-98). (FIG.
5F-FIG. 5H). It was found that the B cells in the immunized
partners were required to confer protection in the naive conjoined
mice, as partners of immunized .mu.MT mice were unprotected (FIG.
5F-FIG. 5H). Moreover, antigen-specific B cells were required to
confer protection, as intravaginally immunized partners whose B
cells bore an irrelevant B cell receptor (against hen egg lysozyme
(HEL)) were unable to confer protection in the conjoined naive
partner (FIG. 5F-FIG. 5H). As observed for the intranasal
immunization, viral control conferred by the immunized parabiotic
partner was not observed in the vaginal mucosa (FIG. 5H),
demonstrating that protection occurs in the innervating
neurons.
[0185] Next, the basis for superior protection by antibodies
following different routes of immunization was investigated.
Intravaginal, intranasal and intraperitoneal routes of immunization
with TK.sup.-HSV-2 results in comparable circulating CD4 T-cell
memory responses (Iijima, N. et al., 2014, Science 346, 93-98).
While no differences were seen for other isotypes, the intranasal
and intravaginal routes of immunization were superior to
intraperitoneal route in generating higher levels of systemic
HSV-2-specific immunoglobulin-G (IgG).sub.2b and IgG2c responses
(FIG. 6A-FIG. 6B). These results indicated that higher levels of
circulating virus-specific IgG2b and IgG2c correlate with
protection against vaginal HSV-2 challenge.
[0186] It was next determined how antibody access to the DRG and
spinal cord is mediated. Even though the peripheral nervous tissues
are protected from antibody diffusion through the blood-nerve
barrier, it was formally possible that secretion of antibody into
the tissue occurs through transport of serum antibody by the
neonatal Fc receptor for IgG (FcRn) (Roopenian, D. C. et al., 2007,
Nature Rev. Immunol. 7, 715-725) expressed on the endothelial cells
within the infected tissues. However, it was found that mice
deficient in FcRn immunized intranasally with TK--HSV-2 were
equally protected as the WT counterpart from vaginal HSV-2
infection (FIG. 2A and FIG. 2B). Thus, circulating HSV-2-specific
antibodies are somehow mobilized to the neuronal tissues following
local viral infection in an FcRn-independent manner, and are
required for protection of the host.
[0187] If circulating antibodies are sufficient, passive transfer
of HSV-2-specific antibodies alone should be able to protect the
host. However, it has been shown (McDermott, M. R. et al., 1990, J.
Gen. Virol. 71, 1497-1504, Morrison, L. A. et al., 2001 J. Virol.
75, 1195-1204) that intravenous injection of HSV-2-specific
antibodies alone fails to protect naive mice against HSV-2
challenge (FIG. 2C and FIG. 2D). In contrast, consistent with a
previous study (Morrison, L. A. et al., 2001, J. Virol. 75,
1195-1204), it was discovered that B-cell-deficient .mu.MT mice
immunized intranasally with TK--HSV-2 and given systemic
administration of HSV-2-specific antiserum were protected (FIG. 2C
and FIG. 2D). Thus, these results demonstrate that it is the
secreted antibodies, and not B cells themselves, in concert with
non-B-cell immune cells, probably T cells induced by immunization,
that seem to be required for protection. To test this possibility,
CD4 T cells from mice previously immunized were depleted
intranasally just before intravaginal HSV-2 challenge. In this
setting, differentiation of B cells and antibody responses were
allowed to occur fully in the presence of CD4 T-cell help for 6
weeks. Mice acutely depleted of CD4 T cells succumbed to infection
with HSV-2 (FIG. 2E and FIG. 2F), whereas depletion of CD8 T cells
and natural killer (NK) cells had no effect (Sato, A. et al., 2014,
J. Virol. 88, 13699-13708). Moreover, neutralization of IFN-.gamma.
before challenge, or genetic deficiency in IFN-.gamma.R, also
rendered intranasally immunized mice more susceptible to
intravaginal HSV-2 challenge (FIG. 2E and FIG. 2F). Of note,
depletion of CD4 T cells from intranasally immunized mice just
before the viral challenge rendered mice incapable of viral control
in the DRG, to a similar extent as the immunized B-cell-deficient
.mu.MT mice (FIG. 2G). It was observed that intranasal immunization
conferred near-complete protection from HSV-2 in the DRG but
variable protection in the spinal cord (FIG. 1D and FIG. 2G).
Because HSV-2 can differentially seed the DRG and spinal cord
through sensory neurons and autonomic neurons (Ohashi, M. et al.,
2011, J. Virol. 85, 3030-3032), these data demonstrate that the
efficacy of antibody-mediated protection may depend on the route of
viral entry. Further, these results indicate that circulating
antibodies, CD4 T cells and IFN-.gamma. collectively mediate
neuroprotection against HSV-2.
[0188] Given that antibody-mediated protection occurs at the level
of the innervating neurons and not within the vagina (FIG. 1C and
FIG. 5H), it is hypothesized that CD4 T cells will control delivery
of antibodies to the tissue parenchyma through secretion of
IFN-.gamma.. Low levels of virus-specific and total antibodies were
detected in the DRG or spinal cord at steady state in immunized
mice (FIG. 3A-FIG. 3D; WT/intranasally.fwdarw.D0), and undetectable
levels of antibodies in these tissues in previously unimmunized
mice 6 days after an acute infection with HSV-2 (FIG. 3A-FIG. 3D;
WT/naive.fwdarw.D6). However, in mice immunized intranasally with
TK--HSV-2 6 weeks earlier, increase in the levels of antibodies was
detected 6 days after intravaginal HSV-2 challenge within the DRG
and in the spinal cord (FIG. 3A-FIG. 3D;
WT/intranasally.fwdarw.D6). Moreover, CD4 T cells were required for
access of virus-specific antibodies to the restricted tissue such
as the DRG, as depletion of CD4 T cells completely diminished
antibody levels in this tissue and spinal cord (FIG. 3D;
WT/intranasally+anti-CD4.fwdarw.D6). Further, similar requirement
for CD4 T cells (FIG. 3B, FIG. 3D) and IFN-.gamma. (FIG. 7A-FIG.
7B) was found for diffusion of total IgG2b and IgG2c isotypes into
the DRG, demonstrating that the delivery mechanism does not
discriminate virus-specificity of the antibodies. In contrast to
the neuronal tissues, acute depletion of CD4 or IFN-.gamma.
blockade once antibody responses were established had no
significant impact on the serum levels of anti-HSV-2 or total
antibodies (FIG. 8A and FIG. 8B. To determine whether
antigen-specific memory CD4 T cells were required to mediate
antibody access to the neuronal tissues, mice were primed
intranasally with a heterologous virus, influenza A virus and, 4
weeks later, were challenged with HSV-2 intravaginally. In contrast
to mice harboring cognate memory CD4 T cells, antibody access to
neuronal tissues following intravaginal HSV-2 challenge was not
observed in mice that had irrelevant memory CD4 T cells (against
influenza A virus) (FIG. 9A-FIG. 9D). These data indicate that
antigen-specific memory CD4 T cells are required for antibody
access to the neuronal tissues.
[0189] It was hypothesized that memory CD4 T cell might enter the
barrier-protected tissues and mobilize antibody access through
local secretion of IFN-.gamma.. In support of this idea, it was
found that IFN-.gamma.-secreting HSV-2-specific CD4 T cells entered
the DRG and spinal cord around 6 days after genital HSV-2 challenge
in mice that received intranasal immunization 6 weeks previously
(FIG. 4A and FIG. 4B; WT/intranasally.fwdarw.D6). Some increase in
innate leukocytes bearing CD11b, Ly6G or MHCII was observed in DRG
and spinal cord 6 days after challenge (FIG. 10A). IFN-.gamma.
secretion was confined to the memory CD4 T-cell population within
the DRG (FIG. 4A). Moreover, entry of effector CD4 T cells to the
DRG and spinal cord at 6 days after primary vaginal HSV-2 infection
was much less efficient than their memory counterpart (FIG. 4A and
FIG. 4B; WT/naive.fwdarw.D6), demonstrated the intrinsic ability of
T cells to migrate into these neuronal tissues is enhanced with
memory development.
[0190] Interaction of .alpha.4.beta.1 (or VLA4) and VCAM-1
contributes to T-cell recruitment across the blood-brain barrier
(Man, S. et al., 2007, Brain Pathol. 17, 243-250). Memory CD4 T
cells generated against HSV-2 expresses CD49d which is the integrin
.alpha.4 subunit (Iijima, N. et al., 2014, Science 346, 93-98). It
was found that the entry of memory CD4 T cells into the nervous
tissue was strictly dependent on .alpha.4 integrin, as antibody
blockade of .alpha.4 prevented their entry into the DRG and spinal
cord (FIG. 4A and FIG. 4B). The expression of ligand for
.alpha.4.beta.1, VCAM-1, was observed in the endothelium of DRG and
spinal cord in immune-challenged mice (FIG. 4C and FIG. 10B).
Further, analysis of tissue sections revealed that the CD4 T cells
were found in the parenchyma of the DRG and spinal cord, as well as
within their epineurium and meninges, but not within the
vasculature (FIG. 4C, FIG. 10A and FIG. 10B). Notably, many CD4 T
cells were found adjacent to the cell body of neurons within the
DRG. Some VCAM-1 staining was found in the cytosol of neuronal cell
bodies (arrowhead FIG. 4C). Additionally, intravascular staining
(Anderson, K. G. et al., 2014. Nature Protocols 9, 209-222) with
antibody to CD90.2 revealed that the vast majority of the CD4 T
cells in the DRG and spinal cord are sequestered from circulation
(FIG. 11A, FIG. 11B). Thus, CD4 T cells recruited to the neuronal
tissues access the parenchyma of the DRG and spinal cord. Notably,
.alpha.4 integrin blockade of CD4 T-cell recruitment resulted in
diminished access of virus-specific antibody to the DRG and spinal
cord (FIG. 4D and FIG. 4E), with no effect on blood levels of
virus-specific antibody (FIG. 8C) or the total antibody levels of
various isotypes in circulation (FIG. 8D). Collectively, these data
indicate that memory CD4 T cells enter the neuronal tissue and
secrete IFN-.gamma. to promote antibody access to the DRG and
spinal cord.
[0191] How might IFN-.gamma. secreted by CD4 T cells enable
circulating antibody to access the neuronal tissues? IFN-.gamma.
acts on the endothelial cells to remodel tight junctions and
increase permeability (Capaldo, C. T. et al. 2014, Mol. Biol. Cell
25, 2710-2719). It was observed that recombinant IFN-.gamma.
injected intravaginally was sufficient to enable antibody access to
the vaginal lumen, suggesting that IFN-.gamma. is sufficient to
induce both vascular and epithelial permeability in peripheral
tissues (FIG. 12A) and to enhance VCAM-1 expression on endothelial
cells (FIG. 12B). To assess whether antibody access to the neuronal
tissues mediated by CD4 T cells and IFN-.gamma. is through
increased vascular permeability, the measured release of blood
albumin into the neuronal tissue following genital HSV-2 challenge
in intranasally immunized mice was demonstrated. Notably, it was
observed that vascular permeability occurred in the DRG and spinal
cord in a CD4 T-cell- and IFN-.gamma.-dependent manner, as measured
by leakage of blood albumin to the neuronal tissues by ELISA and
immunohistochemical analysis (FIG. 4F and Figure. 13A). It was
confirmed that CD4-dependent vascular permeability to the DRG and
the spinal cord using intravenous injection of 70 kDa fluorescein
isothiocyanate (FITC)-dextran, which has a similar size to IgG
(FIG. 13B). Collectively, the results support the notion that CD4 T
cells enable antibody delivery to the sites of infection by
secreting IFN-.gamma. and enhancing microvascular permeability.
This mechanism of antibody delivery is crucial for host immune
protection, as depletion of CD4 T cells, inhibition of CD4 T-cell
migration into the neuronal tissues or neutralization of
IFN-.gamma. renders immune mice susceptible to infection.
[0192] To determine whether the findings extend beyond HSV-2, the
determination of antibody access to the neuronal tissue following a
different neurotropic virus, vesicular stomatitis virus (VSV), a
negative sense RNA virus of the Rhabdoviridae family, was
investigated. Upon intranasally inoculation, VSV infects olfactory
sensory neurons in the nasal mucosa and enters the CNS through the
olfactory bulb (Reiss, C. S. et al., 1998, Ann. NY Acad. Sci. 855,
751-761). In contrast, intravenous infection with VSV is well
tolerated, and generates robust T- and B-cell responses (FIG.
14A-FIG. 14D) (Thomsen, A. R. et al., 1997, Int. Immunol. 9,
1757-1766). To determine whether antibody access to the brain
requires memory CD4 T cells, mice were immunized with VSV
intravenously. Five weeks later, immunized mice were challenged
with VSV intranasally. Entry of VSV-specific antibodies was
monitored in the brain 6 days after intranasal challenge.
Consistent with the data obtained from HSV-2 infection, a striking
dependence on CD4 T cells of antibody access to the brain was
observed (FIG. 14B). Further, anti-.alpha.4 antibody treatment of
mice immediately before intranasal VSV challenge also diminished
antibody access to the brain, without impacting VSV-specific
antibodies in circulation (FIG. 14C). Furthermore, it was
determined that vascular permeability to the brain was dependent on
.alpha.4 integrin, as antibody blockade of .alpha.4 integrin
resulted in diminished albumin leakage to the brain (FIG. 14D).
Taken together, these results indicate that the requirement for
.alpha.4-integrin and memory CD4 T cells for antibody access
applies to two distinct neurotropic viruses, HSV-2 and VSV, and
suggest a general mechanism of antibody access to the
immunoprivileged tissues protected by the blood-nerve barriers.
[0193] These results demonstrate a role of CD4 T cells in
controlling antibody access to neuronal tissues through local
migration and secretion of IFN-.gamma.. Circulating CD4 memory T
cells effectively target antibody delivery to the sites of
infection through their secretion of IFN-.gamma., presumably upon
recognition of cognate antigenic peptides presented by local
antigen-presenting cells (Laidlaw, B. J. et al., 2014, Immunity 41,
633-645, Iijima, N. et al., 2008, J. Exp. Med. 205, 3041-3052).
These results indicate the requirement for CD4 T-cell help at the
effector phase of the antibody response, and add to the growing
appreciation of CD4 T cells in paving the way to other effector
cell types such as CD8 T cells (Laidlaw, B. J. et al., 2014,
Immunity 41, 633-645), Nakanishi, Y. et al., 2009, Nature 462,
510-513), Reboldi, A. et al., 2009, Nature Immunol. 10, 514-523).
The experimental data demonstrates that the requirement for CD4 T
cells for antibody access in neuronal tissue reflects an additional
layer of control imposed by the immunoprivileged sites. In
accessible tissues, inflammatory leukocytes can migrate and, in
response to PAMPs, secrete cytokines such as TNF-.alpha. that are
sufficient to trigger vascular permeability independently of CD4 T
cells. However, after neurotropic viral infections, the infected
neurons are expected to be poor at producing inflammatory cytokines
that remodel vascular tight junctions. At the same time,
recruitment of innate leukocytes is blocked by shutdown of specific
chemokines in the ganglia of HSV-1-infected mice (Stock, A. et al.,
2014, 1 Exp. Med. 211, 751-759). Curiously, expression of
T-cell-trophic chemokines CXCL9 and CXCL10 was preserved in the DRG
of infected mice (Stock, A. et al., 2014, J. Exp. Med. 211,
751-759), suggesting that access by lymphocytes is permitted. Thus,
in neuronal tissues, the entry of viral-specific CD4 T cells is
crucial to provide cytokines that permit antibodies through the
induction of vascular permeability.
[0194] The results implicate that antibody-based vaccines or
treatment against neurotropic viruses would benefit from generating
robust circulating CD4 T-cell memory responses.
[0195] The disclosures of each and every patent, patent
application, and publication cited herein are hereby incorporated
herein by reference in their entirety. While this invention has
been disclosed with reference to specific embodiments, it is
apparent that other embodiments and variations of this invention
may be devised by others skilled in the art without departing from
the true spirit and scope of the invention. The appended claims are
intended to be construed to include all such embodiments and
equivalent variations.
Sequence CWU 1
1
2120DNAArtificial SequenceChemically synthesized 1agcgaggata
acctgggatt 20220DNAArtificial SequenceChemically Synthesized
2gggataaagc ggggtaacat 20
* * * * *