U.S. patent application number 17/066565 was filed with the patent office on 2021-12-23 for nanotube spectrometer array and making a nanotube spectrometer array.
The applicant listed for this patent is Government of the United States of America, as represented by the Secretary of Commerce, Government of the United States of America, as represented by the Secretary of Commerce. Invention is credited to Ming Zheng.
Application Number | 20210399225 17/066565 |
Document ID | / |
Family ID | 1000006010508 |
Filed Date | 2021-12-23 |
United States Patent
Application |
20210399225 |
Kind Code |
A9 |
Zheng; Ming |
December 23, 2021 |
NANOTUBE SPECTROMETER ARRAY AND MAKING A NANOTUBE SPECTROMETER
ARRAY
Abstract
A nanotube spectrometer array includes: a substrate including
block receivers; photodetectors arranged in an array with each
photodetector including: a single wall carbon nanotube disposed on
the substrate in a block receiver and disposed laterally along the
block receiver; a source electrode on the single wall carbon
nanotube; a drain electrode on the single wall carbon nanotube,
such that the source and drain electrodes are separated from each
other by a photoreceiver portion of the single wall carbon
nanotube; and a gate electrode disposed on the substrate such that
substrate is interposed between the gate electrode and the single
wall carbon nanotube. The single wall carbon nanotube in each
photodetector is a different chirality so that each photodetector
absorbs light with a maximum photon absorptivity at a difference
wavelength that is based on the chirality of the single wall carbon
nanotube of the photodetector.
Inventors: |
Zheng; Ming; (Rockville,
MD) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
Government of the United States of America, as represented by the
Secretary of Commerce |
Gaithersburg |
MD |
US |
|
|
Prior
Publication: |
|
Document Identifier |
Publication Date |
|
US 20210111349 A1 |
April 15, 2021 |
|
|
Family ID: |
1000006010508 |
Appl. No.: |
17/066565 |
Filed: |
October 9, 2020 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
62913294 |
Oct 10, 2019 |
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
G01J 3/2803 20130101;
H01L 51/0048 20130101; G01J 3/0294 20130101; B82Y 20/00
20130101 |
International
Class: |
H01L 51/00 20060101
H01L051/00; G01J 3/28 20060101 G01J003/28; G01J 3/02 20060101
G01J003/02 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with United States Government
support from the National Institute of Standards and Technology
(NIST), an agency of the United States Department of Commerce. The
Government has certain rights in the invention. Licensing inquiries
may be directed to the Technology Partnerships Office, NIST,
Gaithersburg, Md., 20899; voice (301) 301-975-2573; email
tpo@nist.gov; reference NIST Docket Number 20-003US1.
Claims
1. A nanotube spectrometer array comprising: a substrate comprising
a plurality of block receivers; a plurality of photodetectors
arranged in an array, each photodetector comprising: a single wall
carbon nanotube disposed on the substrate in a block receiver, such
that the single wall carbon nanotube is disposed laterally along
the block receiver; a source electrode disposed on a first terminus
of the single wall carbon nanotube; a drain electrode disposed on a
second terminus of the single wall carbon nanotube, such that the
source electrode and the drain electrode are separated from each
other by a photoreceiver portion of the single wall carbon
nanotube; and a gate electrode disposed on the substrate such that
substrate is interposed between the gate electrode and the single
wall carbon nanotube, wherein the single wall carbon nanotube in
each photodetector comprises a different chirality, so that each
photodetector absorbs light with a maximum photon absorptivity at a
difference wavelength that is based on the chirality of the single
wall carbon nanotube of the photodetector.
2. The nanotube spectrometer array of claim 1, wherein the
substrate comprises an element from Group III, Group IV, or Group V
of the periodic table of elements.
3. The nanotube spectrometer array of claim 1, wherein the single
wall carbon nanotubes in adjacent photodetectors are arranged
parallel to one another.
4. The nanotube spectrometer array of claim 1, wherein the single
wall carbon nanotubes comprise an E11 to E44 photoabsorption from
200 nm to 2000 nm.
5. The nanotube spectrometer array of claim 1, wherein a separation
pitch of the single wall carbon nanotubes in adjacent
photodetectors is from 10 nm to 100 nm.
6. The nanotube spectrometer array of claim 1, wherein the nanotube
spectrometer array includes from 2 to 200 different chiralities of
single wall carbon nanotubes.
7. The nanotube spectrometer array of claim 1, wherein the
photodetectors cover a surface area from 0.1 .mu.m.sup.2 to 100
.mu.m.sup.2.
8. A process for making a nanotube spectrometer array, the process
comprising: providing a composition comprising a plurality of
nanocomposites disposed in a solvent, individual nanocomposites
comprise a single wall carbon nanotube and a surfactant disposed on
the single wall carbon nanotube, and the single wall carbon
nanotube of the nanocomposites in the composition comprise a
plurality of chiralities; subjecting the composition to
compositional separation such that the nanocomposites are separated
based on chirality of the single wall carbon nanotubes into
separate single chirality products, such that each single chirality
product: comprises single wall carbon nanotubes consisting
essentially of a single chirality disposed in solvent, and has a
different chirality of single wall carbon nanotubes than other
single chirality products; independently, for each or a selected
single chirality product: adding single stranded DNA and surfactant
solubilizing agent to the single chirality product, wherein a
nucleobase sequence of the single stranded DNA added is different
for each single chirality product so that each different chirality
is present with single stranded DNA that has different nucleobase
sequence; removing the surfactant from the single wall carbon
nanotube with the surfactant solubilizing agent; and disposing,
after removing the surfactant, the single stranded DNA on the
single wall carbon nanotube to form ssDNA-wrapped SWCNT comprising
the single stranded DNA disposed on the single wall carbon
nanotube, such that each different chirality has disposed on the
single wall carbon nanotube the single stranded DNA with different
nucleobase sequence; making a scaffold that comprises-DNA arranged
in alternating walls separated by a trench between neighboring
walls, the trench bounded by walls and a floor; forming single
stranded DNA anchor disposed on the floor; contacting the floor
with the single chirality products; hybridizing the ssDNA-wrapped
SWCNT to the single stranded DNA anchor when a nucleotide base
sequence of the ssDNA-wrapped SWCNT complements a nucleotide base
sequence of single stranded DNA anchor; forming a duplex DNA from
hybridizing the ssDNA-wrapped SWCNT to the single stranded DNA
anchor to anchor the ssDNA-wrapped SWCNT to the floor through the
duplex DNA, such that the ssDNA-wrapped SWCNT is laterally disposed
along the floor in the trench to form a unit cell; such that a DNA
nanotube block is formed and comprises an array of unit cells;
forming a plurality of photodetectors arranged in array by:
disposing the DNA nanotube block on a substrate, the substrate
comprising a block receiver; receiving the DNA nanotube block in
the block receiver; removing the scaffold and DNA nanotube block
from the single wall carbon nanotube to provide the single wall
carbon nanotube disposed in the block receiver; forming a source
electrode on a first terminus of the single wall carbon nanotube;
forming a drain electrode on a second terminus of the single wall
carbon nanotube, the first terminus separated from the second
terminus by a photoreceiver portion of the single wall carbon
nanotube, wherein each photodetector comprises the single wall
carbon nanotube, the source electrode, and the drain electrode
disposed on the substrate, to make the nanotube spectrometer array
that comprises the plurality of photodetectors arranged in the
array.
9. The process of claim 8, wherein the substrate comprises an
element from Group III, Group IV, or Group V of the periodic table
of elements.
10. The process of claim 8, wherein the single wall carbon
nanotubes in adjacent photodetectors are arranged parallel to one
another.
11. The process of claim 8, wherein the single wall carbon
nanotubes comprise an E11 to E44 photoabsorption from 200 nm to
2000 nm.
12. The process of claim 8, wherein a separation pitch of the
single wall carbon nanotubes in adjacent photodetectors is from 10
nm to 100 nm.
13. The process of claim 8, wherein the nanotube spectrometer array
includes from 2 to 200 different chiralities of single wall carbon
nanotubes.
14. The process of claim 8, wherein the photodetectors cover a
surface area from 0.1 .mu.m.sup.2 to 100 .mu.m.sup.2.
15. The process of claim 8, further comprising forming a gate
electrode on the substrate.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The application claims priority to U.S. Provisional Patent
Application Ser. No. 62/913,294 filed Oct. 10, 2019, the disclosure
of which is incorporated herein by reference in its entirety.
SEQUENCE LISTING
[0003] This application contains a Sequence Listing. CD-ROM discs
Copy 1 and Copy 2 are identical, contain a copy of the Sequence
Listing under 37 CFR Section 1.821 (e), and are read-only memory
computer-readable compact discs. Each CD-ROM disc contains a copy
of the Sequence Listing in ASCII text format. The Sequence Listing
is named "20_003US1 Sequence Listing_ST25.txt." The copies of the
Sequence Listing on the CD-ROM discs are hereby incorporated by
reference in their entirety.
BRIEF DESCRIPTION
[0004] Disclosed is a nanotube spectrometer array comprising: a
substrate comprising a plurality of block receivers; a plurality of
photodetectors arranged in an array, each photodetector comprising:
a single wall carbon nanotube disposed on the substrate in a block
receiver, such that the single wall carbon nanotube is disposed
laterally along the block receiver; a source electrode disposed on
a first terminus of the single wall carbon nanotube; a drain
electrode disposed on a second terminus of the single wall carbon
nanotube, such that the source electrode and the drain electrode
are separated from each other by a photoreceiver portion of the
single wall carbon nanotube; and a gate electrode disposed on the
substrate such that substrate is interposed between the gate
electrode and the single wall carbon nanotube, wherein the single
wall carbon nanotube in each photodetector comprises a different
chirality, so that each photodetector absorbs light with a maximum
photon absorptivity at a difference wavelength that is based on the
chirality of the single wall carbon nanotube of the
photodetector.
[0005] Disclosed is a process for making a nanotube spectrometer
array, the process comprising: providing a composition comprising a
plurality of nanocomposites disposed in a solvent, individual
nanocomposites comprise a single wall carbon nanotube and a
surfactant disposed on the single wall carbon nanotube, and the
single wall carbon nanotube of the nanocomposites in the
composition comprise a plurality of chiralities; subjecting the
composition to compositional separation such that the
nanocomposites are separated based on chirality of the single wall
carbon nanotubes into separate single chirality products, such that
each single chirality product: comprises single wall carbon
nanotubes consisting essentially of a single chirality disposed in
solvent, and has a different chirality of single wall carbon
nanotubes; independently, for each or a selected single chirality
product: adding single stranded DNA and surfactant solubilizing
agent to the single chirality product, wherein a nucleobase
sequence of the single stranded DNA added is different for each
single chirality product so that each different chirality is
present with single stranded DNA that has different nucleobase
sequence; removing the surfactant from the single wall carbon
nanotube with the surfactant solubilizing agent; and disposing,
after removing the surfactant, the single stranded DNA on the
single wall carbon nanotube to form ssDNA-wrapped SWCNT comprising
the single stranded DNA disposed on the single wall carbon
nanotube, such that each different chirality has disposed on the
single wall carbon nanotube the single stranded DNA with different
nucleobase sequence; making a scaffold that comprises DNA arranged
in alternating walls separated by a trench between neighboring
walls, the trench bounded by walls and a floor; forming single
stranded DNA anchor disposed on the floor; contacting the floor
with the single chirality products; hybridizing the ssDNA-wrapped
SWCNT to the single stranded DNA anchor when a nucleotide base
sequence of the ssDNA-wrapped SWCNT complements a nucleotide base
sequence of single stranded DNA anchor; forming a duplex DNA from
hybridizing to anchor the ssDNA-wrapped SWCNT to the floor such
that the ssDNA-wrapped SWCNT is laterally disposed along the floor
in the trench to form a unit cell; such that a DNA nanotube block
is formed and comprises an array of unit cells; forming a plurality
of photodetectors arranged in array by: disposing the DNA nanotube
block on a substrate, the substrate comprising a block receiver;
receiving the DNA nanotube block in the block receiver; removing
the scaffold and DNA nanotube block from the single wall carbon
nanotube to provide the single wall carbon nanotube disposed in the
block receiver; forming a source electrode on a first terminus of
the single wall carbon nanotube; forming a drain electrode on a
second terminus of the single wall carbon nanotube, the first
terminus separated from the second terminus by a photoreceiver
portion of the single wall carbon nanotube, wherein each
photodetector comprises the single wall carbon nanotube, the second
terminus, and the drain electrode disposed on the substrate, to
make the nanotube spectrometer array that comprises the plurality
of photodetectors arranged in the array.
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] The following description should not be considered limiting
in any way. With reference to the accompanying drawings, like
elements are numbered alike.
[0007] FIG. 1 shows a nanotube spectrometer array;
[0008] FIG. 2 shows a perspective view of a photodetector;
[0009] FIG. 3 shows a plan view of the photodetector shown in FIG.
2;
[0010] FIG. 4 shows: (A) a cross-section along line A-A of an
embodiment of a photodetector shown in FIG. 3; (B)) a cross-section
along line A-A of an embodiment of a photodetector shown in FIG. 3;
(C) a cross-section along line B-B of the photodetector shown in
FIG. 3;
[0011] FIG. 5 shows a cross-section of a scaffold;
[0012] FIG. 6 shows bundles that represent the sidewall and the
bottom layer, respectively, within a feature-repeating unit of
trench-like DNA templates. Arrows indicate extension directions of
the repeating units;
[0013] FIG. 7 shows a perspective view of a unit cell for making a
nanotube spectrometer array;
[0014] FIG. 8 shows: (A) a plan view of the unit cell shown in FIG.
7, (B) a cross-section along line A-A of the unit cell shown in
panel A, and (C) a cross-section along line B-B of the unit cell
shown in panel A;
[0015] FIG. 9 shows assembling CNT arrays with 24-nm inter-CNT
pitch; designs (A and D), zoomed-in TEM images along the x and z
projection direction (B and E), liquid-mode AFM images along the x
and z projection direction (C and F) (left), and height profiles (C
and F) (right) for the DNA template (A to C) and the assembled CNT
array (D to F), respectively. Dashed lines [in (C) and (F), left]
represent the locations for the height profile. Arrows in the AFM
image (F) indicate assembled CNTs. The orientation of the assembled
CNTs in (F) may be distorted by AFM tips during imaging;
[0016] FIG. 10 shows programming inter-CNT pitches with DNA brick
crystal templates. (A to C) Designs (top row) and zoomed-in TEM
images along the x and z projection direction (bottom row) for the
DNA templates (left) and the assembled CNT arrays (right) at 16.8
nm (A), 12.6 nm (B), and 10.4 nm (C) inter-CNT pitches,
respectively. Arrows in the TEM images indicate the assembled
CNTs;
[0017] FIG. 11 shows two-step DNA wrapping around CNTs;
[0018] FIG. 12 shows: design (A), zoomed-out (B), and zoomed-in (C)
TEM images of the DNA brick crystal with 25.3-nm trench periodicity
along x direction. Feature-repeating unit of the designed crystal
is denoted using colored bundles. Arrows in A represent the growth
directions of the crystal template. DNA brick crystals are diluted
500 folds prior to imaging. The scale bar in B is 10 .mu.m. The
scale bar in C is 500 nm;
[0019] FIG. 13 shows TEM images of typical DNA brick crystals with
25.3-nm trench periodicity along x direction. The scale bars are
500 nm;
[0020] FIG. 14 shows zoomed-in TEM images for 9 randomly selected
DNA brick crystals with 25.3-nm trench periodicity along x
direction. The scale bar is 100 nm;
[0021] FIG. 15 shows design (A), zoomed-out (B), and zoomed-in (C)
TEM images of the DNA brick crystal with 16.8-nm trench periodicity
along x direction. Feature-repeating unit of the designed crystal
is denoted using colored bundles. Arrows in A represent the growth
directions of the crystal template. DNA brick crystals are diluted
500 folds prior to imaging. The scale bar in B is 10 .mu.m. The
scale bar in C is 500 nm;
[0022] FIG. 16 shows TEM images of typical DNA brick crystals with
16.8-nm trench periodicity along x direction. The scale bars are
500 nm;
[0023] FIG. 17 shows zoomed-in TEM images for 9 randomly selected
DNA brick crystals with 16.8-nm trench periodicity along x
direction. The scale bar is 100 nm;
[0024] FIG. 18 shows design (A), zoomed-out (B), and zoomed-in (C)
TEM images of the DNA brick crystal with 12.7-nm trench periodicity
along x direction. Feature-repeating unit of the designed crystal
is denoted using colored bundles. Arrows in A represent the growth
directions of the crystal template. DNA brick crystals are diluted
500 folds prior to imaging. The scale bar in B is 10 .mu.m. The
scale bar in C is 500 nm;
[0025] FIG. 19 shows TEM images of typical DNA brick crystals with
12.7-nm trench periodicity along x direction. The scale bars are
500 nm;
[0026] FIG. 20 shows zoomed-in TEM images for 9 randomly selected
DNA brick crystals with 12.7-nm trench periodicity along x
direction. The scale bar is 100 nm;
[0027] FIG. 21 shows design (A), zoomed-out (B), and zoomed-in (C)
TEM images of the DNA brick crystal with 10.6-nm trench periodicity
along x direction. Feature-repeating unit of the designed crystal
is denoted using colored bundles. Arrows in A represent the growth
directions of the crystal template. DNA brick crystals are diluted
500 folds prior to imaging. The scale bar in B is 10 .mu.m. The
scale bar in C is 500 nm;
[0028] FIG. 22 shows TEM images of typical DNA brick crystals with
10.6-nm trench periodicity along x direction. The scale bars are
500 nm;
[0029] FIG. 23 shows zoomed-in TEM images for 9 randomly selected
DNA brick crystals with 10.6-nm trench periodicity along x
direction. The scale bar is 100 nm;
[0030] FIG. 24 shows designs of DNA handles on DNA brick crystals.
Bundles represent a feature-repeating unit of designed DNA brick
crystals with 25.3-nm (A), 16.8-nm (B), 12.7-nm (C), and 10.6-nm
(D) trench periodicity along x direction. Some bundles are the
sidewalls of DNA nanotrench; and some bundles are the bottom layer
of DNA nanotrench. Some arrows denote the DNA handles. Some arrows
show growth directions of the crystal template. Numbers indicate
the spacing between DNA handles in A;
[0031] FIG. 25 shows zoomed-out (A) and zoomed-in (B) TEM images of
the DNA-wrapped CNTs. The scale bar in A is 500 nm. The scale bar
in B is 100 nm;
[0032] FIG. 26 shows design (A), zoomed-out (B) and zoomed-in (C)
TEM images of the CNT arrays assembled on DNA brick crystal with
24.1-nm trench periodicity along x direction. Feature-repeating
unit of the designed brick crystal template is denoted using
colored bundles (blue and orange). Rods denote the CNTs. Arrows in
A represent the growth directions of the crystal template.
CNT-decorated DNA brick crystals are diluted 6 folds prior to
imaging. The scale bar in B is 10 .mu.m. The scale bar in C is 500
nm.
[0033] FIG. 27 shows zoomed-in TEM images for 9 randomly selected
CNT arrays assembled on DNA brick crystals with 24.1-nm trench
periodicity along x direction. Arrows indicate the CNTs within the
DNA nanotrenches. The scale bar is 100 nm;
[0034] FIG. 28 shows tilted AFM images for DNA brick crystals
before (A) and after (B) CNT assembly;
[0035] FIG. 29 shows design (A), zoomed-out (B) and zoomed-in (C)
TEM images of the CNT arrays assembled on DNA brick crystal with
16.8-nm trench periodicity along x direction. Feature-repeating
unit of the designed brick crystal template is denoted using
bundles. Rods denote the CNTs. Arrows in A represent the growth
directions of the crystal template. CNT-decorated DNA brick
crystals are diluted 6 folds prior to imaging. The scale bar in B
is 10 .mu.m. The scale bar in C is 500 nm;
[0036] FIG. 30 shows zoomed-in TEM images for 9 randomly selected
CNT arrays assembled on DNA brick crystals with 16.8-nm trench
periodicity along x direction. Arrows indicate the CNTs within the
DNA nanotrenches. The scale bar is 100 nm;
[0037] FIG. 31 shows design (A), zoomed-out (B) and zoomed-in (C)
TEM images of the CNT arrays assembled on DNA brick crystal with
12.6-nm trench periodicity along x direction. Feature-repeating
unit of the designed crystal is denoted using bundles. Rods denote
the CNTs. Arrows in A represent the growth directions of the
crystal template. CNT-decorated DNA brick crystals are diluted 6
folds prior to imaging. The scale bar in B is 10 .mu.m. The scale
bar in C is 500 nm;
[0038] FIG. 32 shows zoomed-in TEM images for 9 randomly selected
CNT arrays assembled on DNA brick crystals with 12.6-nm trench
periodicity along x direction. Arrows indicate the CNTs within the
DNA nanotrenches. The scale bar is 100 nm;
[0039] FIG. 33 shows design (A), zoomed-out (B) and zoomed-in (C)
TEM images of the CNT arrays assembled on DNA brick crystal with
10.4-nm trench periodicity along x direction. Feature-repeating
unit of the designed crystal is denoted using bundles. Rods denote
the CNTs. Arrows in A represent the growth directions of the
crystal template. CNT-decorated DNA brick crystals are diluted 6
folds prior to imaging. The scale bar in B is 10 .mu.m. The scale
bar in C is 500 nm;
[0040] FIG. 34 shows zoomed-in TEM images for 9 randomly selected
CNT arrays assembled on DNA brick crystals with 10.4-nm trench
periodicity along x direction. Arrows indicate the CNTs within the
DNA nanotrenches. The scale bar is 100 nm;
[0041] FIG. 35 shows TEM image for the assembly defect. Some arrows
indicate the CNTs within the DNA nanotrenches. Some arrows indicate
the empty DNA nanotrenches, which are counted as the assembly
defects. The stoichiometry between CNTs and the DNA brick crystals
is one third of the optimal value (that is, off-stoichiometry
product). The scale bar is 200 nm;
[0042] FIG. 36 shows distribution of inter-CNT pitches. At each
prescribed inter-CNT pitch, the percentage of counts indicated the
distribution of experimentally observed pitch values along x
direction. The inter-CNT pitch was measured from the TEM images of
10 randomly selected DNA brick crystals. For each prescribed
inter-CNT pitch, the numbers of total counted CNTs were around
50-300. Because the DNA brick crystals exhibited uneven width, the
CNT counts varied from template to template. And at similar crystal
width, DNA brick crystals with smaller pitch (i.e. 10.4 nm) had
more CNT counts than that at larger pitch (i.e. 25.2 nm). For every
two neighboring CNTs, we measured three different positions along
the longitudinal axis of CNTs. The distribution of inter-CNT
pitches revealed the assembly precision of CNTs within DNA
nanotrenches. When the trench width was 6 nm, we noticed that the
majority (>95%) of CNTs exhibited pitch variation less than 1
nm, indicative of sub-2 nm positioning precision within the narrow
DNA nanotrenches;
[0043] FIG. 37 shows zoomed-out AFM images for the deposited
substrate before (left) and after (right) the liftoff process to
remove salt residues and surface DNAs. Both images are scanned at
the identical regions on the substrate. The bright cross shapes on
both images are the fine alignment fiducial markers written with
e-beam lithography. The scale bars are 3 .mu.m. The bright spots in
the left AFM image are salt residues. The arrows indicate the
CNT-decorated DNA brick crystal before (left) and after (right) the
liftoff process. After the liftoff process, most of salt residues
(bright spots in the left) and surface DNAs (green arrow in the
left) with height higher than 8 nm were removed (evidenced by the
absence of bright spots and lowered heights of DNA area in the
right image). The residual height was around 1 nm, as indicated by
the height change in AFM;
[0044] FIG. 38 shows constructing bottom-gated CNT FETs at 24-nm
inter-CNT pitch. (A) Design schematic for DNA removal and
depositing the source or drain electrodes. Bundles are a structural
repeating unit of DNA brick crystals with 24 nm periodicity along
the x direction. Rods are CNTs. Electrodes are shown. (B) Left, AFM
image of the assembled CNT arrays after DNA removal. The scale bar
is 50 nm. The circle indicates one residue after DNA removal.
Right, AFM image of the fabricated FET. The scale bar is 300 nm.
CNTs are not visible in the AFM image due to their small diameter
compared to the electrode thickness. (C) The I.sub.ds-V.sub.gs
curve plotted in both logarithmic (left axis) and linear (right
axis) scales at V.sub.ds of -0.5 V for a dual-channel CNT FET.
I.sub.ds is normalized to the inter-CNT pitch;
[0045] FIG. 39 shows multichannel CNT FETs with ssDNAs at channel
interface. (A) Design schematic for the rinsing-after-fixing
approach. Arrows indicate the extension direction of DNA templates
and the assembled CNTs. (B) Zoomed-in AFM image along the x and z
projection direction for CNT arrays after template removal. Arrows
indicate the assembled CNTs. Scale bar, 25 nm. (C) Design schematic
for introducing ssDNAs at channel interface and FET fabrication.
(D) The I.sub.ds-V.sub.gs curves [drain-to-source current density
(I.sub.ds) versus V.sub.gs plotted in logarithmic at a V.sub.ds of
-0.5 V] for a multichannel DNA-containing CNT FET before and after
thermal annealing;
[0046] FIG. 40 shows constructing top-gated high-performance CNT
FETs. (A) Design schematic for the fabrication of top-gated
DNA-free FETs. (B) Zoomed-in SEM image along the x and z projection
direction for the constructed multichannel CNT FET. Scale bar, 100
nm. (C and D) The I.sub.ds-V.sub.gs curves (solid lines, plotted in
logarithmic scale corresponding to left axis) and gm-V.sub.gs
curves (dotted lines, plotted in linear scale corresponding to
right axis) for single-channel (C) and multichannel (D) CNT FETs.
Shown (C) and (D) are V.sub.ds of -0.8, -0.5, and -0.1 V. Arrows
indicate the corresponding axes. (E) Benchmarking of the current
multichannel CNT FET in (D) with other reports of high-performance
CNT FETs;
[0047] FIG. 41 shows a centimeter-scale oriented placement of
fixed-width arrays. (A) Design schematic for the oriented placement
of the fixed-width CNT-decorated DNA templates on a Si substrate.
From left to right, the panels show fabricating cavities on a
spin-coated PMMA layer, depositing CNT-decorated DNA templates onto
the PMMA cavities, and liftoff to remove the PMMA layer. (B) From
left to right, zoomed-out and zoomed-in optical and SEM images of
the aligned structures on the Si wafer after PMMA liftoff. The
scale bars in the bottom left, middle, and right images are 10, 1,
and 0.5 .mu.m, respectively. The rectangles indicate the selected
areas for zoomed-in views. The arrows in the right panel indicate
the aligned arrays. (C) The statistics of counts (left axis) and
the cumulative percentages (right axis) for the aligned structures
in (B) at each specific orientation. (D) Plot of angular
distributions of the aligned arrays versus the lengths of the DNA
templates;
[0048] FIG. 42 shows zoomed-out (A) and zoomed-in (B) TEM images of
the DNA-wrapped CNTs. The scale bar in A is 200 nm. The scale bar
in B is 100 nm;
[0049] FIG. 43 shows height profiles of CNTs. AFM images (A) and
corresponding height profiles (B) for three different CNTs. Dashed
lines in (A) represent the positions for the height profiles in
(B). The scale bar is 100 nm. As shown in the height profiles, the
CNT diameter distribution is ranging from less than 1 nm to
.about.1.5 nm;
[0050] FIG. 44 shows SEM image of fixed CNT array after DNA
removal. In the circle area, both ends of CNTs were fixed by two
metal bars, and used for FET construction. In other circle areas,
the unfixed CNT ends may be disturbed during DNA removal, and were
not used for FET construction. The scale bar is 500 nm;
[0051] FIG. 45 shows AFM images of the fixed CNT arrays after DNA
removal. (A) 3D zoomed-out view of the CNT arrays fixed by two
metal bars. (B) zoomed-in view of CNTs fixed by metal bar. The
scale bar is 25 nm. (C) more zoomed-in AFM images of the fixed CNT
arrays after DNA removal. The scale bar is 50 nm;
[0052] FIG. 46 shows schematics for different compositions at
channel interface. (A) after assembly and (B) after removing DNA
templates and metal ions;
[0053] FIG. 47 shows zoomed-out SEM image of the constructed
multichannel DNA-containing CNT FET. The scale bar is 200 nm;
[0054] FIG. 48 shows I.sub.ds-V.sub.gs curves for multichannel
DNA-containing CNT FETs. The CNT FETs before (A) and after (B)
thermal annealing. Different lines represent distinct CNT FETs.
Lines in (A) and (B) represent the CNT FETs. (C) One DNA-containing
CNT FET in (A) under repeated measurements from 2 to -3 V.
Different lines represent distinct measurements. The V.sub.ds in
(A), (B), and (C) were all set at -0.5 V. I.sub.ds was normalized
to the inter-CNT pitch;
[0055] FIG. 49 shows design schematics of the constructed
single-channel DNA-free CNT FET. (A) side view and (B) top view of
the FET design;
[0056] FIG. 50 shows I.sub.ds-V.sub.gs curves for all the
operational single-channel DNA-free CNT FETs. Different lines
represent distinct CNT FETs. The V.sub.ds was set at -0.5 V;
[0057] FIG. 51 shows constructed multichannel DNA-free CNT FET. (A)
side view and (B) top view of the FET design;
[0058] FIG. 52 shows a zoomed-out SEM image of the constructed
multichannel DNA-free CNT FET. The scale bar is 200 nm;
[0059] FIG. 53 shows I.sub.ds-V.sub.gs curves for the all the
operational multichannel DNA-free CNT FETs. Different lines
represent distinct CNT FETs. I.sub.ds was normalized to the
inter-CNT pitch. The V.sub.ds was set at -0.5 V;
[0060] FIG. 54 shows Is-V& curves for the multichannel DNA-free
CNT FET with highest on-current density at 200 nm channel length.
Different lines represent distinct V.sub.gs. V.sub.gs was ranging
from -1.8 V to 0.2 V, at a step of 0.2 V. I.sub.ds was normalized
to the inter-CNT pitch;
[0061] FIG. 55 shows transport performance for the multichannel
DNA-free CNT FET with 100-nm channel length. (A) I.sub.ds-V.sub.gs
curve (left axis, plotted in logarithmic scale) and gm-V.sub.gs
curve (right axis, plotted in linear scale) at Vds of -0.5 V. Both
I.sub.ds and gm were normalized to the inter-CNT pitch. (B)
I.sub.ds-V.sub.gs curve. Different colored lines represent distinct
V.sub.gs. V.sub.gs was ranging from -1.4 V to 0.6 V, at a step of
0.2 V;
[0062] FIG. 56 shows I.sub.ds-V.sub.ds curve for the multichannel
DNA-free CNT FET containing metallic CNT impurity. The Vds was set
at -0.5 V. I.sub.ds was normalized to the inter-CNT pitch;
[0063] FIG. 57 shows performance comparisons for the constructed
multichannel CNT FETs with different interfacial compositions. From
(A) to (E), transconductance, subthreshold swing, threshold
voltage, on-state conductance, and I.sub.on/I.sub.off are compared
for different FET samples. Squares represent multichannel
DNA-containing CNT FETs before annealing. Circles represent
thermal-annealed multichannel DNA-containing CNT FETs. Triangles
represent multichannel DNA-free CNT FETs. Sample number was the
assigned testing number for each FET. From (F) to (J), statistics
of transconductance, subthreshold swing, threshold voltage,
on-state conductance, and I.sub.on/I.sub.off for different channel
compositions. Bars represent multichannel DNA-containing CNT FETs
before annealing. Other bars represent thermal-annealed
multichannel DNA-containing CNT FETs. Yet other bars represent
multichannel DNA-free CNT FETs. All the performance data were
acquired at the V.sub.ds of -0.5 V. For multichannel DNA-containing
CNT FETs before and after annealing, the performance data were
acquired at the V.sub.gs of -3.0 V. For multichannel DNA-free CNT
FETs, the performance data were acquired at the V.sub.gs of -1.5
V;
[0064] FIG. 58 shows benchmarking of CNT FETs with different
inter-CNT pitches. Benchmarking of our multichannel CNT FET with
other reports (evenly spaced inter-CNT pitches) regarding: (A),
subthreshold swing, (B), transconductance (gm), and (C), on-state
conductance (Gon). Channel lengths are ranging from 100 nm to 500
nm. In each panel, transport performance (i.e., subthreshold swing,
on-state conductance, and transconductance) are plotted versus
structural parameter (inter-CNT pitch). High transport performance
requires the demonstration of small subthreshold swing, high
transconductance, and high on-state conductance simultaneously.
Multichannel CNT FET exhibits smallest subthreshold swing, highest
transconductance, and 2nd highest on-state conductance, compared to
other FETs with different inter-CNT pitches.
[0065] FIG. 59 shows benchmarking of CNT FETs with different CNT
densities. Benchmarking of our multichannel CNT FET with other
reports using high-density CNT thin films (uneven inter-CNT pitch)
regarding: (A), subthreshold swing, (B), transconductance (gm), and
(C), on-state conductance (Gon). Channel lengths are ranging from
100 nm to 500 nm. In each panel, transport performance (i.e.
subthreshold swing, on-state conductance, and transconductance) are
plotted versus structural parameter (CNT density). High transport
performance requires the demonstration of small subthreshold swing,
high transconductance, and high on-state conductance
simultaneously. Our multichannel CNT FET exhibits 2nd smallest
subthreshold swing, highest transconductance, and 3rd highest
on-state conductance, compared to other FETs with different CNT
densities. Notably, FET with smallest subthreshold swing exhibits
an on-current density less than 5 .mu.A/pm, which does not meet the
transport requirements of high-performance CNT FET;
[0066] FIG. 60 shows a zoomed-out TEM image for the assembled
fixed-width CNT array with 16 nm inter-CNT pitch. Fixed-width DNA
template exhibited a prescribed width around 34 nm. Yellow arrows
indicate the assembled CNTs on DNA templates. The scale bar is 100
nm;
[0067] FIG. 61 shows a zoomed-out (A) and zoomed-in (B) SEM images
for the PMMA cavities on flat Si substrate. The scale bars are 10
.mu.m in (A) and 2 .mu.m in (B);
[0068] FIG. 62 shows SEM images for CNT-decorated DNA templates
aligned on 120 cavities. The circles in the zoomed-out SEM images
indicate the zoomed-in positions. The arrows in the zoomed-in SEM
images indicate the aligned DNA templates. The scale bars are 2
.mu.m;
[0069] FIG. 63 shows SEM image for DNA templates placed within the
rectangular PMMA cavity sites. The width of the PMMA cavities was
designed as 2 .mu.m at a length-to-width aspect ratio of 1. The
scale bar is 4 .mu.m; and
[0070] FIG. 64 shows different approaches for preparing CNT arrays
with designer array width, inter-array spacing and CNT counts over
centimeter-scale. (A) continuous CNT film (with random
orientations) is processed with a post-assembly etching step to
produce designer array width, inter-array spacing, and CNT counts.
(B) placing fixed-width CNT arrays (assembled using 3D DNA
nanotrenches) within the pre-fabricated PMMA cavities, followed by
PMMA liftoff and DNA removal, can produce array geometries without
a post-assembly etching.
DETAILED DESCRIPTION
[0071] A detailed description of one or more embodiments is
presented herein by way of exemplification and not limitation.
[0072] It has been discovered that a nanotube spectrometer array
and processes disclosed herein provide a plurality of
photodetectors that each include single wall carbon nanotubes
having unique chirality such that each photodetector in the
nanotube spectrometer array detects a unique wavelength of
light.
[0073] A carbon nanotube (CNT) is a family of one-dimensional (D)
molecules with diverse atomic and electronic structures. Each type
of CNT has unique properties. Chirality maps for CNTs provide a way
of showing structural diversity. Each CNT has a helicity and
handedness.
[0074] To overcome the diversity of structures in a sample of CNTs
through purification, sorting CNTs can be accomplished as disclosed
in U.S. Pat. No. 9,545,584 for Fractionating Nanomaterials by A
Liquid Multiphase Composition, the disclosure of which is
incorporated by reference in its entirety. DNA is a powerful tool
for such fractionation, wherein interaction of DNA and CNT is
dependent on helicity and handedness of CNT and on DNA sequences.
Taking advantage of such interaction, CNTs are purified with by
handedness and helicity. Moreover, such process purifies both
surfactant-coated CNTs and DNA-coated CNTs through a difference in
solvation energy or hydrophobicity of different CNTs. For
DNA-wrapped CNTs, a solvation energy spectrum for a mixture of CNTs
is determined by a sequence of nucleotide bases of the DNA.
[0075] The nanotube spectrometer array disclosed herein is also
referred to as a photon perceptron array that can operate as a
photon perceptron or artificial eye. The photo response of a CNT is
related to its absorption spectrum and varies from CNT to CNT. An
array of CNTs with known structures can be disposed on a substrate
to form a spectrometer in an area, e.g., of one square micron, and
such a spectrometer can cover a spectral range, e.g., from UV to
near IR and THz with quasi metallic CNTs that have milli-electron
volt (meV) band gap. An array of such spectrometers can be disposed
on a wafer for spectral imaging and can arise from deterministic
placement of CNTs of different chiralities. In this respect, DNA
origami technology can be combined with DNA-wrapped CNTs with a DNA
block that can place DNA wrapped CNTs in a parallel arrangement
with a pitch of separation that is controlled with a
nanometer-scale precision. A FET device is made by removing the DNA
for electrical contact with CNT.
[0076] Nanotube spectrometer array 200 provides broad spectral
absorption for photodetection over a broad range of photon
wavelength that can be selected through selectively including
specific chiralities of single wall CNTs (SWCNTs). In an
embodiment, with reference to FIG. 1, FIG. 2, FIG. 3, and FIG. 4,
nanotube spectrometer array 200 includes: substrate 221 comprising
a plurality of block receivers 222; a plurality of photodetectors
228 arranged in array 229, each photodetector 228 comprising:
single wall carbon nanotube 205 disposed on substrate 221 in block
receiver 222, such that single wall carbon nanotube 205 is disposed
laterally along block receiver 222; source electrode 223 disposed
on first terminus 224 of single wall carbon nanotube 205; drain
electrode 225 disposed on second terminus 226 of single wall carbon
nanotube 205, such that source electrode 223 and drain electrode
225 are separated from each other by photoreceiver portion 227 of
single wall carbon nanotube 205; and gate electrode 230 disposed on
substrate 221 such that substrate 221 is interposed between gate
electrode 230 and single wall carbon nanotube 205, wherein single
wall carbon nanotube 205 in each photodetector 228 comprises a
different chirality, so that each photodetector 228 absorbs light
with a maximum photon absorptivity at a difference wavelength that
is based on the chirality of single wall carbon nanotube 205 of
photodetector 228. With reference to FIG. 2, it should be
appreciated that single wall carbon nanotubes 205 have different
chirality (n, m), wherein a number of single wall carbon nanotubes
can be from 1 to k for integer k that can be, e.g., from 1 to 1000,
although an upper range of k is not limited but can be selected
based on bands of absorption of wavelengths of single wall carbon
nanotubes 205 and a range of wavelength detection desired for
nanotube spectrometer array 200. Accordingly, for k number of
single wall carbon nanotubes 205, chiralities of single wall carbon
nanotubes 205 can be (n1, m1), (n2, m2), . . . , (n.sub.k,
m.sub.k). Likewise, for k number of single wall carbon nanotubes
205, nanotube spectrometer array 200 can include k number of
photodetectors 228 as shown in FIG. 3.
[0077] In an embodiment, photodetector 228 is in electrical
communication with drain controller 231 via drain wire 233 and in
electrical communication with gate controller 232 via gate wire
234. Here, drain controller 231 provides electrical current to
source electrode 223 and receives drain current from drain
electrode 225. Gate controller 232 provides an electrical bias to
gate electrode 230 to activate single wall carbon nanotube 205 to
flow electrical current from absorption of a photon from source
electrode 223 to drain electrode 225. According to an embodiment,
photodetectors 228 are individually and independently controlled
and addressed through drain controller 231 and gate controller
232.
[0078] In an embodiment, single wall carbon nanotubes 205 in
adjacent photodetectors 228 are arranged parallel to one another
but angle between adjacent single wall carbon nanotubes 205 can be
arbitrary and selected to effect a desired device response. In an
embodiment, single wall carbon nanotubes 205 include an E11 to E44
photoabsorption from 200 nm to 2000 nm. For detecting various
ranges of wavelengths by nanotube spectrometer array 200, nanotube
spectrometer array 200 can include from 2 to 200 different
chiralities of single wall carbon nanotubes 205. For spatial
detection of phootons, a separation pitch of single wall carbon
nanotubes 205 can be selected; e.g., the separation pitch of single
wall carbon nanotubes 205 in adjacent photodetectors 228 can be
from 10 nm to 100 nm. Nanotube spectrometer array 200 can include
from 2 to 200 different chiralities of single wall carbon nanotubes
205. A size of nanotube spectrometer array 200 can be made for a
particular application or environment of application, such as
photodetectors 228 covering a surface area from 0.1 .mu.m.sup.2 to
100 .mu.m.sup.2.
[0079] Components of nanotube spectrometer array 200 can be made
from and include various materials. Substrate 221 can be a material
on which other elements, e.g., single wall carbon nanotube 205, can
be formed. Substrate 221 can include an element from group III, IV,
or V of the periodic table such as silicon, germanium, and the like
or combination of such elements. To provide a selected electrical
conductivity, e.g., to provide electrical insulation between
photodetectors 228, substrate 221 can be, e.g., silicon
dioxide.
[0080] Single wall carbon nanotube 205 are disposed on substrate
221 and independently can absorb photons, such that individual
single wall carbon nanotubes 205 absorb different wavelengths of
light. To produce purified chiralities of single wall carbon
nanotubes 205, a composition that includes single wall carbon
nanotube 205 having a plurality of different chiralities of SWCNTs
is subjected to fractionation. The fractionatation occurs according
to the processes described in U.S. Pat. No. 9,545,584.
[0081] According to an embodiment, the composition (also referred
to as nanoparticle composition) subject to fractionating includes
the first nanoparticles and the second nanoparticles, collectively
referred to hereafter as "the nanoparticles" for convenience. In
some embodiments, the first nanoparticles and the second
nanoparticles are a carbon allotrope, a derivatized carbon
allotrope, or a combination comprising at least one of the
foregoing. In an embodiment, the nanoparticles are SWCNTs.
Moreover, SWCNTs can include metallated CNTs. It should be
appreciated that single wall carbon nanotube 205 are tubular
fullerene-like structures having open or closed ends and which are
inorganic and made entirely or partially of carbon or another atom
(e.g., boron, nitrogen, and the like). In an embodiment, single
wall carbon nanotube 205 include additional components such as
metals or metalloids, which are incorporated into the structure of
single wall carbon nanotube 205, included as a dopant, form a
surface coating, or a combination of at least one of the
foregoing.
[0082] As used herein, the term "carbon nanotube" refers to a
variety of hollow, partially filled, or filled forms of rod-shaped
and toroidal-shaped hexagonal graphite layers. Filled carbon
nanotubes include carbon nanotubes that contain various other
atomic, molecular, or atomic and molecular species within its
interior. A carbon nanotube that has a hollow interior can be
filled with a non-carbon material using wet chemistry techniques to
produce a filled carbon nanotube.
[0083] CNTs can be imagined as a cylindrical, rolled-up rectangular
strip of graphene. CNTs can have one of several geometrical
arrangements of the lattice carbon atoms In general, single-walled
nanotubes are distinguished from each other by a double index (n,
m), where n and m are integers that describe how to cut a strip of
graphene such that its edges join seamlessly when the strip is
wrapped onto a surface of a cylinder. For (n, n)-SWCNTs, the
resultant SWCNT is an "arm-chair" SWCNT. The label "arm chair"
indicates that, when the SWCNT is cut perpendicularly to the tube
axis, only the sides of the hexagons (from the graphene hexagonal
carbon lattice) are exposed, and their pattern around a periphery
of the tube edge resembles the arm and seat of an arm chair
repeated n times. For (n, m=0), the resultant SWNT is "zigzag" or
(n,0)-SWNT, and the label "zigzag" indicates that, when the tube is
cut perpendicular to the tube axis, the atoms located at the edge
of the tube have a zigzag arrangement. For (n.noteq.m, m.noteq.0),
the resulting SWCNT has chirality. Chiral SWCNTs have a left-handed
or a right-handed screw axis, like DNA. Nanocone SWCNTs have a
first end of larger diameter than a diameter of its other end.
SWCNTs in which the ends attach to each other form a torus shape
referred to as a nanotoroid.
[0084] Furthermore, the electronic properties of SWCNTs are
dependent on their conformation. It should be appreciated that the
electronic properties give rise to electronic transitions and
electronic band structures in the SWCNTs that govern absorption of
photons and that support electrical current conduction. Allowed
electronic wave functions of SWCNTs are different from an infinite
two-dimensional electronic system of graphene or a hexagonal
graphite monolayer. A periodic boundary condition exists in SWCNTs
for propagation of electrons around the circumference of the SWCNT.
As such, SWCNTs have a different electronic band structure for
different conformations of SWCNTs. Consequently, SWCNTs are either
metallic (which are highly electrically conductive) or are
semiconducting (which have a bandgap from a few millielectron volts
(meV) to one electron volt (eV)). For n=m or n-m a multiple of
three, the SWCNT is metallic. For any other n, m combination, the
SWCNT is semiconducting. Accordingly, armchair single wall carbon
nanotube 205 are metallic and have an extremely high electrical
conductivity.
[0085] Carbon atoms in single wall carbon nanotube 205 can be
displaced or substituted by another element. In an embodiment,
single wall carbon nanotube 205 can include a metal or metalloid
oxide such as silica, alumina, titania, tungsten oxide, iron
oxides, combinations thereof, or the like, a metal or metalloid
carbide such as tungsten carbide, silicon carbide, boron carbide,
or the like; a metal or metalloid nitride such as titanium nitride,
boron nitride, silicon nitride, or the like; or a combination
comprising at least one of the foregoing.
[0086] In some embodiments, single wall carbon nanotube 205 can
include a metal such as an alkali metal, an alkaline earth metal,
an inner transition metal (a lanthanide or actinide), a transition
metal, or a post-transition metal. Examples of such metals include
magnesium, aluminum, iron, tin, titanium, platinum, palladium,
cobalt, nickel, vanadium, chromium, manganese, cobalt, nickel,
zirconium, ruthenium, hafnium, tantalum, tungsten, rhenium, osmium,
alloys thereof, or a combination comprising at least one of the
foregoing. In other embodiments, single wall carbon nanotube 205
include those coated with one or more layers of metals such as
iron, tin, titanium, platinum, palladium, cobalt, nickel, vanadium,
alloys thereof, or a combination including at least one of the
foregoing.
[0087] According to an embodiment, single wall carbon nanotube 205
are a carbon allotrope, a derivatized carbon allotrope, or a
combination comprising at least one of the foregoing. Derivatized
single wall carbon nanotube 205 include functionalized carbon
allotropes or carbon atom deletion or substitution with another
atom, e.g., a nonmetal (e.g., O, N, P, S, F, and the like), a
metal, a metalloid, a poor metal, and the like. Single wall carbon
nanotube 205 can be derivatized to include a variety of different
functional groups such as, for example, carboxy (e.g., carboxylic
acid groups), epoxy, ether, ketone, amine, hydroxy, alkoxy, alkyl,
aryl, aralkyl, alkaryl, lactone, functionalized polymeric or
oligomeric groups, and the like. In an embodiment, single wall
carbon nanotubes 205 include a combination of derivatized single
wall carbon nanotubes 205 and underivatized single wall carbon
nanotubes 205. For example, the surface or edges of single wall
carbon nanotube 205 is derivatized to increase dispersibility in or
interaction with the polymers. The derivatized single wall carbon
nanotube 205 can be hydrophilic, hydrophobic, oxophilic,
lipophilic, or can possess a combination of these properties to
provide a balance of desirable net properties by incorporation of a
functional group. According to an embodiment, single wall carbon
nanotube 205 is derivatized to include a functional group that is
hydrophilic, hydrophobic, oxophilic, lipophilic, or oleophilic.
[0088] In an exemplary embodiment, single wall carbon nanotube 205
is derivatized by, e.g., amination to include amine groups, where
amination may be accomplished by nitration followed by reduction,
or by nucleophilic substitution of a leaving group by an amine,
substituted amine, or protected amine, followed by deprotection as
necessary. In another embodiment, single wall carbon nanotube 205
is derivatized by oxidative methods to produce an epoxy, hydroxy
group or glycol group using a peroxide, or by cleavage of a double
bond by for example a metal mediated oxidation such as a
permanganate oxidation to form ketone, aldehyde, or carboxylic acid
functional groups.
[0089] Where the functional groups are alkyl, aryl, aralkyl,
alkaryl, functionalized polymeric or oligomeric groups, or a
combination of these groups, the functional groups are attached
through intermediate functional groups (e.g., carboxy, amino) or
directly to the derivatized nanoparticle by a carbon-carbon bond
without intervening heteroatoms, a carbon-oxygen bond (where the
nanoparticle contains an oxygen-containing functional group such as
hydroxy or carboxylic acid), or by a carbon-nitrogen bond (where
the nanoparticle contains a nitrogen-containing functional group
such as an amine or an amide). In an embodiment, the nanoparticle
can be derivatized by metal mediated reaction with a C6-30 aryl or
C7-30 aralkyl halide (F, Cl, Br, I) in a carbon-carbon bond forming
step, such as by a palladium-mediated reaction such as the Stille
reaction, Suzuki coupling, or diazo coupling or by an organocopper
coupling reaction.
[0090] In another embodiment, single wall carbon nanotube 205 is
directly metallated by reaction with e.g., an alkali metal such as
lithium, sodium, or potassium, followed by reaction with a C1-30
alkyl or C7-30 alkaryl compound with a leaving group such as a
halide (Cl, Br, I) or other leaving group (e.g., tosylate,
mesylate, etc.) in a carbon-carbon bond forming step. The aryl or
aralkyl halide (or the alkyl or alkaryl compound) can be
substituted with a functional group such as hydroxy, carboxy,
ether, or the like. Exemplary groups include hydroxy groups,
carboxylic acid groups, alkyl groups such as methyl, ethyl, propyl,
butyl, pentyl, hexyl, octyl, dodecyl, octadecyl, and the like; aryl
groups including phenyl and hydroxyphenyl; alkaryl groups such as
benzyl groups attached via the aryl portion, such as in a
4-methylphenyl, 4-hydroxymethylphenyl, or 4-(2-hydroxyethyl)phenyl
(also referred to as a phenethylalcohol) group, or the like, or
aralkyl groups attached at the benzylic (alkyl) position such as
found in a phenylmethyl or 4-hydroxyphenyl methyl group, at the
2-position in a phenethyl or 4-hydroxyphenethyl group, or the
like.
[0091] In another embodiment, single wall carbon nanotube 205 is
further derivatized by grafting certain polymer chains to the
functional groups. For example, polymer chains such as acrylic
chains having carboxylic acid functional groups, hydroxy functional
groups, or amine functional groups; polyamines such as
polyethyleneamine or polyethyleneimine; or poly(alkylene glycols)
such as poly(ethylene glycol) and poly(propylene glycol) can be
included by reaction with functional groups.
[0092] The degree of functionalization varies from 1 functional
group for every 5 carbon centers to 1 functional group for every
100 carbon centers, depending on the functional group, and the
method of functionalization.
[0093] Single wall carbon nanotube 205 can be produced by chemical
vapor deposition such as high-pressure carbon monoxide conversion
(HiPco), laser ablation, arc discharge, plasma torch, coalescence,
or a catalytic processes. Synthetic methods for producing carbon
nanotubes can produce single-walled and multi-walled carbon
nanotubes with a distribution of chiralities and diameters. Certain
nanoparticle syntheses produce multi-walled carbon nanotubes having
an outer wall diameter from 0.9 nm to 100 nm and single-walled
carbon nanotubes having a diameter from 0.5 nm to 3 nm. As such,
many nanoparticle compositions include a plurality of different
carbon nanotubes and carbonaceous impurities. Advantageously, the
process for fractionating the composition separates single wall
nanoparticles from other constituents in a mixture and also
separates the single wall carbon nanotubes by chirality.
[0094] In an embodiment, the composition includes single wall
carbon nanotubes 205 that have a different property including a
length, chirality, handedness, (n,m) index, metallicity, or a
combination including at least one of the foregoing. In some
embodiments, single wall carbon nanotubes 205 include a functional
group, which includes carboxy, epoxy, ether, ketone, amine,
hydroxy, alkoxy, alkyl, aryl, aralkyl, alkaryl, lactone, a
functionalized polymeric or oligomeric group, or a combination
including at least one of the foregoing.
[0095] Various solvents can be used in the composition as described
in U.S. Pat. No. 9,545,584.
[0096] Source electrode 223 and drain electrode 225 are
electrically conductive and can be a metal (e.g., gold), an
electrically conductive dopant disposed in a supporting matrix
(e.g., an electrically conductive polymer disposed in polymer,
glass, and the like), or thin film such as indium tin oxide. Gate
electrode 230 can be disposed on substrate 221 to mediate
electrical current conductivity across single wall carbon nanotube
205 from source electrode 223 to drain electrode 225. Gate
electrode 230 can include an element from group III, IV, or V of
the periodic table of elements or a combination thereof, e.g.,
silicon, binary semiconductors, ternary semiconductors and the
like. Wires (e.g., drain wire 233, gate wire 234) interconnect
electrodes (223, 225, 230) to controllers (e.g., 231, 232) for
controlling independent operation of. Wire are electrically
conductive and can be, e.g., gold. In an embodiment, as shown in
panel A of FIG. 4, gate electrode 230 can be a continuous layer so
that each photodetector 228 (e.g., first photodetector 228.1,
second photodetector 228.2, . . . , k-th photodetector 228.k) are
controlled by a common gate electrode 230. In an embodiment, as
shown in panel B of FIG. 4, gate electrode 230 can be a segmented
layer so that each photodetector 228 (e.g., first photodetector
228.1, second photodetector 228.2, . . . , k-th photodetector 228k)
is independently controlled by a different gate electrode 230.
[0097] Nanotube spectrometer array 200 can be made in various ways.
In an embodiment, with reference to FIG. 5, FIG. 6, FIG. 7, and
FIG. 8, a process for making nanotube spectrometer array 200
includes: providing composition 201 including a plurality of
nanocomposites 202 disposed in a solvent, individual nanocomposites
202 include single wall carbon nanotube 205 and surfactant 203
disposed on single wall carbon nanotube 205, and single wall carbon
nanotube 205 of nanocomposites 202 in composition 201 include a
plurality of chiralities; subjecting composition 201 to
compositional separation such that nanocomposites 202 are separated
based on chirality of single wall carbon nanotubes 205 into
separate single chirality products, such that each single chirality
product: includes single wall carbon nanotubes 205 consisting
essentially of a single chirality disposed in solvent 204, and has
a different chirality of single wall carbon nanotubes 205 than
other single chirality products; independently, for each or a
selected single chirality product: adding single stranded DNA 208
and a surfactant solubilizing agent to the single chirality
product, wherein a nucleobase sequence of single stranded DNA 208
added is different for each single chirality product so that each
different chirality is present with single stranded DNA 208 that
has a different nucleobase sequence; removing the surfactant from
single wall carbon nanotube 205 with the surfactant solubilizing
agent; and disposing, after removing the surfactant, single
stranded DNA 208 on single wall carbon nanotube 205 to form
ssDNA-wrapped SWCNT 217 including single stranded DNA 208 disposed
on single wall carbon nanotube 205, such that each different
chirality has disposed on single wall carbon nanotube 205 the
single stranded DNA 208 with the different nucleobase sequence;
making scaffold 211 that includes DNA 212 arranged in alternating
walls 213 separated by trench 214 between neighboring walls 213,
trench 214 bounded by walls 213 and floor 216; forming single
stranded DNA anchor 215 disposed on floor 216; contacting floor 216
with the single chirality products; hybridizing ssDNA-wrapped SWCNT
217 to single stranded DNA anchor 215 when a nucleotide base
sequence of the ssDNA-wrapped SWCNT 217 complements a nucleotide
base sequence of single stranded DNA anchor 215; forming duplex DNA
218 from hybridizing ssDNA-wrapped SWCNT 217 to single stranded DNA
anchor 215 to anchor ssDNA-wrapped SWCNT 217 to floor 216 through
duplex DNA 218, such that ssDNA-wrapped SWCNT 217 is laterally
disposed along floor 216 in the trench 214 to form unit cell 219;
such that DNA nanotube block 220 is formed and includes an array of
unit cells 219; forming a plurality of photodetectors 228 arranged
in array 229 by: disposing DNA nanotube block 220 on substrate 221,
substrate 221 including block receiver 222; receiving DNA nanotube
block 220 in block receiver 222; removing scaffold 211 and DNA
nanotube block 220 from single wall carbon nanotube 205 to provide
single wall carbon nanotube 205 disposed in block receiver 222;
forming (e.g., by electron beam lithography) source electrode 223
on first terminus 224 of single wall carbon nanotube 205; forming
(e.g., by electron beam lithography) drain electrode 225 on second
terminus 226 of single wall carbon nanotube 205, first terminus 224
separated from second terminus 226 by photoreceiver portion 227
(that can have a length that is e.g., from 100 nm to 1000 nm along
a lateral length of single wall carbon nanotube 205) of single wall
carbon nanotube 205, wherein each photodetector 228 comprises
single wall carbon nanotube 205, source electrode 223, and drain
electrode 225 disposed on substrate 221, to make nanotube
spectrometer array 200 that includes the plurality of
photodetectors 228 arranged in array 229.
[0098] The process for making nanotube spectrometer array 200 also
can include repetitively removing individual portions of the
composition and independently collecting the single chirality
products that include single wall carbon nanotubes 202 that include
a single chirality as individual single chirality nanotubes
disposed in a solvent.
[0099] Nanotube spectrometer array 200 and processes disclosed
herein have numerous beneficial uses including imaging, dispersed
absorption, time resolution studies, and the like. Advantageously,
nanotube spectrometer array 200 overcomes limitations of technical
deficiencies of conventional compositions in terms of spectrometer
size, spatial resolution, and spectral range.
[0100] Beneficially, nanotube spectrometer array 200 includes the
plurality of photodetectors 228, wherein each spectrometer 228
makes use of wavelength multiplexing for spectral reconstruction.
Photodetectors 228 includes photodiodes of SWCNTs having different
structures covering an optical response, e.g., from 200 nm to 2000
nm or greater (e.g., to a THz frequency). A footprint of a single
spectrometer 228 can be one micrometer, which can be two orders of
magnitude smaller than conventional spectrometers. Moreover,
nanotube spectrometer array 200 provides high-density array of
spectrometers 228. By selecting SWCNT 205 of proper handedness,
nanotube spectrometer array 200 can perform circular dichroism
measurements by each spectrometer 228. Nanotube spectrometer array
200 can be integrated with high-density SWCNT logic circuits to
provide on-chip spectral measurement and signal processing.
Moreover, fabrication of nanotube spectrometer array 200 can occur
via purification of .about.50 distinct single-chirality SWCNT
species whose E.sub.11 to E.sub.44 van Hove transitions (or even
higher-order van Hove transitions) absorption peaks span the range
from 200 nm to 2000 nm. Length uniformity of purified SWCNTs can be
controlled, and endohedral filling or covalent modification can be
introduced to enhance optoelectronic response of purified SWCNTs.
It is further contemplated that quasi-metallic SWCNTs can provide a
THz photodetector 228. Moreover, spatial distribution of wavelength
absorption along a surface of nanotube spectrometer array 200 can
be accomplished by coating each single-chirality SWCNT species by a
unique ssDNA sequence such that during disposition of ssDNA-wrapped
SWCNT 217 in block receiver 222 is done site specifically with
regard to an absorption spectrum of individual single wall carbon
nanotubes 205 along a surface of nanotube spectrometer array 200.
In this manner, design DNA brick or other types of DNA origami
structures make DNA/SWCNT complexes as DNA nanotube blocks 220.
Within each complex, DNA origami structures serve as the substrate
to hold 50 SWCNTs of different (n, m) in parallel, e.g., with 20 nm
tube-tube separation. This forms a basic unit of spectrometer 222
with a dimension of .about.1 .mu.m.times.1 .mu.m. As a result,
spectral imaging can be performed with so that cross-analysis of
spectral and spatial information provides decomposition of detected
photons. Due to its high-density and broad spectral coverage,
nanotube spectrometer array 200 provides spectral imaging for many
fields of science and technology and can be an artificial eye with
full spectral response for artificial visual perception and object
reconstruction with full chromaticity.
[0101] Nanotube spectrometer array 200 and processes herein
unexpectedly exceed a minimum size limit achievable by conventional
microfabrication process and conventional photo-detecting materials
and provides much higher spatial resolution for spectral
imaging.
[0102] The articles and processes herein are illustrated further by
the following Examples, which are non-limiting.
EXAMPLES
Example 1. Precise Pitch-Scaling of Carbon Nanotube Arrays within
Three-Dimensional DNA Nanotrenches
[0103] Semiconducting carbon nanotubes (CNTs) are an attractive
platform for field-effect transistors (FETs) because they
potentially can outperform silicon as dimensions shrink. Challenges
to achieving superior performance include creating highly aligned
and dense arrays of nanotubes as well as removing coatings that
increase contact resistance. Sun et al. aligned CNTs by wrapping
them with single-stranded DNA handles and binding them into DNA
origami bricks that formed an array of channels with precise
intertube pitches as small as 10.4 nanometers. Zhao et al. then
constructed single and multichannel FETs by attaching the arrays to
a polymer-templated silicon wafer. After adding metal contacts
across the CNTs to fix them to the substrate, they washed away all
of the DNA and then deposited electrodes and gate dielectrics. The
FETs showed high on-state performance and fast on-off
switching.
[0104] Precise fabrication of semiconducting carbon nanotubes
(CNTs) into densely aligned evenly spaced arrays is required for
ultra-scaled technology nodes. We report the precise scaling of
inter-CNT pitch using a supramolecular assembly method called
spatially hindered integration of nanotube electronics
Specifically, by using DNA brick crystal-based nanotrenches to
align DNA-wrapped CNTs through DNA hybridization, we constructed
parallel CNT arrays with a uniform pitch as small as 10.4
nanometers, at an angular deviation<2.degree. and an assembly
yield>95%.
[0105] Although conventional transistor lithography successfully
scales the channel pitch (spacing between two adjacent channels
within individual transistor) of bulk materials (that is, Si), the
performance drops for patterning one-dimensional (1D)
semiconductors, such as carbon nanotubes (CNTs), at ultra-scaled
technology nodes. The projected channel pitches [.about.10 nm or
less (I)] for multichannel CNTs are smaller than the fabrication
feasibility of current lithography. Alternatively, thin-film
approaches, which use physical forces, or chemical recognition to
assemble CNTs, provide a density exceeding 500 CNTs/.mu.m. However,
assembly defects, including crossing, bundling (i.e., multiple CNTs
aggregated side by side), and irregular pitches (11), are widely
observed in such CNT thin films.
[0106] Structural DNA nanotechnology, in particular DNA origami and
DNA bricks, can produce user-prescribed 2D or 3D objects at 2-nm
feature resolution Self-assembled DNA structures have been used to
pattern diverse materials, including oxides, graphene, plasmonic
materials, polymers, and CNTs. Despite these demonstrations,
unconfined surface rotation still limits the precise pitch scaling
achieved within a DNA template. Additionally, CNT arrays assembled
by using double-stranded DNAs (dsDNAs) contain only a small number
of CNTs per single-orientation domain (2.4 on average), less than
the desired value of six CNTs.
[0107] By using nanotrenches based on DNA brick crystals to
spatially confine the DNA hybridization-mediated CNT alignment, we
developed a spatially hindered integration of nanotube electronics
(SHINE) method for building evenly spaced CNT arrays (FIG. 8). DNA
hybridizations between single-stranded handles within the
nanotrenches and the antihandles (sequences complementary to the
DNA handles) on CNTs compensated for the electrostatic repulsions
during assembly. DNA nanotrenches also confined the orientation of
individual CNTs precisely along their longitudinal axis.
[0108] Programming the DNA trench periodicity thus rationally
scaled the inter-CNT pitch from 24.1 to 104 nm Misaligned CNTs
could not access the DNA handles and were repelled from the DNA
templates by electrostatic repulsion. The pitch precision,
indicative of array uniformity, improved when compared to the
values for CNT thin films. The design for SHINE began by
constructing parallel nanotrenches along the x direction (FIG. 8).
The feature-repeating unit of DNA brick crystal template (17)
contained 6768 base pairs. The sidewall and the bottom layer within
the unit consisted of 6 helices by 8 helices by 94 base pairs and 6
helices by 4 helices by 94 base pairs along the x and y and z
directions, respectively. At the top surface of the bottom layer,
we introduced four 14-nucleotide (nt) single-stranded DNA (ssDNA)
handles by extending the 3' or 5' ends of four selected DNA bricks
(FIG. 24). Extending the repeating units along the x and z
directions yielded DNA templates with parallel nanotrenches.
[0109] The micrometer-scale DNA templates were folded through a
multistage isothermal reaction. Next, DNA antihandles were wrapped
onto CNTs through noncovalent interactions (FIG. 11). Finally,
under mild conditions, the hybridization between the DNA handles
and the antihandles mediated CNT assembly within the DNA
nanotrenches at the prescribed inter-CNT pitch.
[0110] Transmission electron microscopy (TEM) imaging confirmed the
successful formation of the designed DNA templates (FIGS. 9, A and
B, and FIGS. 12 to 14), as well as the confined assembly of evenly
spaced CNT arrays within the DNA nanotrenches (FIGS. 9, E and F,
and FIGS. 26 and 27). In the zoomed-out TEM images (FIGS. 12 and
13), the assembled DNA templates exhibited wide dimensional
distributions. One typical DNA template (FIG. 9C) exhibited the
maximal dimensions of 1.3 .mu.m by 200 nm in the x and z
directions. In the zoomed-in TEM images, DNA templates exhibited
alternative dark (bottom layer)-bright (sidewall) regions (FIG. 9B
and FIG. 27), and each region corresponded to six-layered DNA
helices along the x direction as designed (FIG. 9A). The measured
nanotrench periodicity was 25 3+0.3 nm (N=50 nanotrenches from 10
different templates) along the x direction after drying on the
surface (corresponding to 2.1 nm diameter per dehydrated dsDNA).
The ssDNA handles were not visible in the negatively stained TEM
images.
[0111] After CNT assembly, we found bright parallel lines that
appeared exclusively on the dark bottom regions, indicative of the
aligned CNTs along the longitudinal axis of the nanotrenches (FIGS.
9, D and E, and FIGS. 26 and 27) The relatively larger diameter of
CNTs as compared with the unwrapped CNTs was caused by the stained
dsDNA layer around CNTs (FIG. 25). Despite a few local twists in
individual CNTs, we did not observe crossing or bundling CNT
defects within the DNA nanotrenches. The measured inter-CNT pitch
was 24.1.+-.1.7 nm (N=50 CNTs from 10 different templates. For
every two neighboring CNTs, we measured three different positions
along the longitudinal axis of CNT). Slightly smaller inter-CNT
pitch, compared to the x-direction periodicity of the DNA
templates, was the result of statistical variance of the small
sample size. The integrity of the DNA templates was not affected by
CNT assembly, as indicated by the consistent six-layered DNA
helices (along the x direction) in both the DNA sidewall and bottom
layer (FIG. 9E).
[0112] To evaluate the pitch precision, we calculated (i) the
standard deviation, (ii) the range value, (iii) the percent
relative range, and (iv) the index of dispersion for count value
(IDC value) for inter-CNT pitch. The range of inter-CNT pitch
variation, defined as the difference between the maximum and the
minimum pitch values, was 7.8 nm. The percent relative range of the
inter-CNT pitch, defined as the range of inter-CNT pitch divided by
the average value of inter-CNT pitch (24.1 nm), was 32%. For
comparison, on a flat substrate, a range>30 nm and a percent
relative range>140% have been reported for CNT arrays with
similar average pitch.
[0113] The IDC value [defined as the standard deviation squared
divided by the average pitch squared] for CNT arrays (.about.40
CNTs/pm) from SHINE was 0.005, two orders of magnitude smaller than
for CNT arrays of similar density fabricated from thin-film
approaches Hence, by limiting the rotation of CNTs with DNA
sidewalls, SHINE provided higher precision for assembling
ultra-dense CNT arrays than flat substrate-based assembly.
Similarly, SHINE produced a smaller angular deviation (less than
2.degree., defined as the longitudinal-axis difference between CNTs
and the DNA nanotrenches) than previously obtained on flat DNA
template, where >75% CNTs exhibited angular
deviations>5.degree..
[0114] Because both DNA templates (FIGS. 12 and 13) and CNTs (FIG.
25) exhibited uneven widths and lengths, we observed a variable
number of CNTs (ranging from 4 to 15) on different templates, as
well as z-direction offset for CNTs from trench to trench (FIG.
27). Notably, although the width of the DNA nanotrench (12 nm) was
larger than the diameter of individual CNTs, we did not observe CNT
bundling within individual trenches.
[0115] We further analyzed the assembly yield of aligned CNTs by
TEM counting (FIG. 12) The assembly yield was defined as the total
number of inner nanotrenches occupied by correctly assembled
parallel CNT arrays divided by the total number of inner DNA
nanotrenches. Partially formed DNA nanotrenches on the boundaries
were excluded A>95% assembly yield was observed for 10 randomly
selected DNA templates (more than 50 inner trenches were counted,
FIG. 9E and FIG. 27), and <5% of inner nanotrenches were
unoccupied by CNTs (FIG. 35).
[0116] In liquid-mode atomic force microscopy (AFM) images (FIG. 9F
and FIG. 28), we observed new peaks (with heights .about.15 to 17
nm) within the nanotrenches (FIG. 28) after CNT assembly. The
height changes of the new peaks (5 to 7 nm), relative to the height
of the bottom layer beneath (.about.10 nm in height, FIG. 9C),
approximated the sum of dsDNA handle length (3 to 5 nm, depending
on different conformations) and DNA-wrapped CNT diameter (.about.1
to 3 nm, FIG. 25). Therefore, only single-layer CNTs were
assembled. The ssDNA handles were not visible in the AFM images. We
observed wider inter-CNT pitch (.about.32 nm) in liquid-mode AFM
when compared with that from the TEM images. The pitch change was
ascribed to the larger diameter of hydrated dsDNAs (2.6-nm diameter
per helix) in liquid condition than of the fully dehydrated dsDNAs
(2.1-nm diameter per helix under vacuum). The 32-nm inter-CNT pitch
on the hydrated DNA templates could shrink to .about.24 nm after
dehydration under heat.
[0117] By programming DNA nanotrenches with different trench
periodicities along the x direction, we further demonstrated
prescribed scaling of inter-CNT pitches at 16.8, 12.6, and 10.4 nm
(FIG. 10) Within the feature-repeating units of the
small-periodicity DNA templates, we used 2 helices by 8 helices by
94 base pairs for the nanotrench sidewalls (FIG. 10, A to C, top
left). In the bottom layers, 6 helices by 4 helices by 94 base
pairs, 4 helices by 4 helices by 94 base pairs, and 3 helices by 4
helices by 94 base pairs were used for different nanotrench
periodicities.
[0118] We assembled DNA templates and CNT arrays using approaches
similar to those in FIG. 8. Assembled DNA templates exhibited
measured nanotrench periodicities of 16.8+0.4 nm, 12.7.+-.0.2 nm,
and 10.6.+-.0.1 nm (N=50 to 300 nanotrenches from 10 individual
templates for each design) along x direction (FIG. 10, A to C,
bottom left, and FIGS. 15 to 23). Notably, we observed slightly
twisted nanotrench sidewalls after drying in vacuum, probably
because of the relatively low structural stiffness of the two-layer
DNA sidewalls. However, the average periodicities were not affected
by the twisting of the DNA sidewalls. In the zoomed-out view,
different template designs showed typical dimensions of .about.1.3
.mu.m by 300 nm along the x and z directions (FIGS. 15, 16, 18, 19,
21, and 22).
[0119] After CNT assembly, parallel CNTs were aligned within the
DNA nanotrenches (designs in FIG. 10, A to C, top right; TEM images
in FIG. 10, A to C bottom right; FIGS. 29 to 34). The inter-CNT
pitches varied from 16 8.+-.1.5 nm to 12.6.+-.0 6 nm to 10.4.+-.0.4
nm, respectively (N=50 to 300 CNTs from 10 individual templates for
each design). Both the 10.4-nm pitch value and 0.4-nm standard
deviation (smaller than the diameter of individual CNTs) were
beyond current lithography-defined channel pitches.
[0120] The IDC values were 0.008, 0.002, and 0.001,
respectively-orders of magnitude smaller than those from thin-film
approaches (FIG. 14). The range and the percent relative range of
the inter-CNT pitch variation were 5.9 nm and 36%, 2.7 nm and 24%,
and 1.9 nm and 18% for 16.8-, 12.6-, and 10.4-nm inter-CNT pitches,
respectively Narrower DNA nanotrenches improved the precision of
CNT assembly (FIG. 36). When the width of DNA nanotrenches was
decreased to .about.6 nm (in 10.4-nm pitch CNT arrays), the range
value of inter-CNT pitch was decreased to <2 nm and the IDC
value (0.001) improved by eightfold, compared to a 5.9-nm range
value and IDC value of 0.008 in 12-nm DNA trench width (in 16.8-nm
pitch CNT arrays). The angular deviations for the assembled CNTs
were less than 2.degree.. Under the optimized buffer conditions
(supplementary text S1.4), the assembly yields were over 95% (FIGS.
30, 32, and 34).
[0121] The synergy between electrostatic repulsions and DNA
hybridization, enabled by the spatial confinement of nanotrenches,
helped to eliminate the CNT assembly disorders. In the absence of
DNA hybridization, CNTs could not be assembled within the DNA
nanotrenches because of the electrostatic repulsions between the
negatively charged CNTs and nanotrench sidewalls. The hybridization
between DNA handles within the nanotrenches and the DNA antihandles
wrapping around CNTs stabilized CNTs within the DNA nanotrenches
and resulted in an assembly yield >95%. The absence of effective
DNA hybridizations in misaligned CNTs eliminated the assembly
disorder by the electrostatic repulsions. The correctly assembled
CNTs spatially shielded the DNA handles beneath from being accessed
by other CNTs and repelled one another because of negative surface
charge. Even for DNA nanotrenches (width from 6 to 12 nm) more than
twofold larger than the diameter of single CNTs, we did not observe
CNT bundling within individual trenches and achieved an IDC value
of 0.001.
[0122] Microliter assembly solution at sub-10 pM template
concentration simultaneously provided millions of assembled CNT
arrays at evenly spaced pitches, demonstrating the scalability of
SHINE. We further tested using thermal annealing to remove DNA
templates (FIGS. 37 and 38) and constructed proof-of-concept
transistors from parallel CNT arrays (FIG. 38). The thermal
decomposition of DNAs produced residual contaminations around CNTs
that adversely affected the transistor performance. Thus, both low
on-state current and large subthreshold swing values were recorded.
By contrast, improving interface cleanliness for SHINE promotes
transport performance comparable with chemical vapor
deposition-grown or polymer-wrapped CNT arrays in a follow-up
study. Additionally, using purer semiconducting CNTs may further
improve performance.
[0123] Assembly of the designed DNA templates followed a multistage
isothermal reaction. In brief, 90 .mu.L mixture of unpurified DNA
bricks (IDTDNA Inc., pH 7.9, containing 300-600 nM of each brick,
without careful adjustment of each brick stoichiometry), 5 mM Tris,
1 mM EDTA, and 40 mM MgCl.sub.2 was incubated at 80.degree. C. for
15 min, 44.degree. C. for 12 h, 39.degree. C. for 72 h, and
31.degree. C. for 8 h sequentially. The as-synthesized DNA
templates were used without further purification.
[0124] With regard to wrapping CNTs with DNA, semiconducting
CNT-enriched powder was used. The labeled purity for semiconducting
CNTs was 95%, and the powder was used without further purification.
Wrapping single-stranded DNAs onto CNT surface followed previous
reports.
[0125] First, strand L1 (25 pM, sequence:
GATGCGAGGCTATTCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT (Sequence
ID No. 1)) was mixed with CNT powder (0.1 mg) in buffer
(1.times.TBE and 100 mM NaCl at pH 8.3). The mixture was sonicated
for 1 h, followed by high-speed centrifuge at 16,000 g for 30 min
to remove aggregates. The supernatant solution was then purified
using 100 kD Amicon filter (EMD Millipore) to get rid of excessive
DNAs. Strand L2 (10 .mu.M, sequence: AGAATAGCCTCGCATCCCACTTACCACTTA
(Sequence ID No. 2)) was added to the purified CNT-L1 sample and
annealed from 37.degree. C. to 23.degree. C. within 2 h, followed
by incubation at 23.degree. C. for 16 h. L2-wrapped CNTs were used
without further purification. Notably, all the CNTs used in the
manuscript exhibited irregular lengths.
[0126] We also tested using the electric arc CNTs (CNT powder,
containing both metallic and semiconducting CNTs, were purchased
from Carbon Solutions, Inc.). Semiconducting CNTs were purified and
enriched using previously published method. The purity for the
enriched semiconducting CNTs was .about.95%. The method for
wrapping DNAs onto the enriched semiconducting CNTs was identical
to the method above. Note, after wrapping L1, we purified the
L1-wrapped CNTs by a surfactant/DNA exchange process according to
the previous published method.
[0127] With regard to, assembly of CNT arrays on DNA templates,
L2-wrapped CNTs (0.4 .mu.L) were mixed with 0.4 .mu.L diluted DNA
templates (10.times. dilution into 15 mM MgCl2 solution) into 6
.mu.L final solution containing 10 mM MgCl2 and 400 mM NaCl (for
24-nm inter-CNT pitch sample) or 10 mM MgCl2, 300 mM NaCl, and 300
mM LiCl (for 16-/12-/10-nm inter-CNT pitch sample). The reaction
buffer was incubated at 33.degree. C. for 9 h, and then stored at
4.degree. C. without further purification.
[0128] For the assembly of DNA brick crystals and DNA-wrapped CNTs,
the buffer solutions were used according to previous reports. For
the assembly of CNTs on DNA brick crystals with 24 nm inter-CNT
pitch, we used a buffer solution containing 10 mM MgCl2 and 400 mM
NaCl. Without NaCl, DNA-wrapped CNTs may aggregate during the
incubation at 33.degree. C. For 16-/12-/10-nm pitch DNA brick
crystals, we further introduced lithium ion (300 mM) into the
buffer to lower the electrostatic repulsions between the negatively
charged DNA helices and CNTs.
[0129] Here, 0.6 .mu.L as-prepared (without purification) DNA
templates solution or CNT-decorated DNA templates solution was
diluted into 5 .mu.L water and adsorbed onto glow discharged
carbon-coated TEM grids for 4 min. Then the remaining solution was
wiped away, followed by negative staining using 6 .mu.L 2% aqueous
uranyl formate solution (7 sec) and a quick water rinsing. Imaging
was performed using an JEOL 1200 operated at 80 kV.
[0130] A 7 .mu.L as-prepared DNA templates solution or
CNT-decorated DNA templates solution was deposited onto a 1-cm2
sized silicon chip followed by stepwise rinsing in 50%, 95%, and
99.5% ethanol. The sample was imaged on a multimode SPM via tapping
mode.
[0131] The following five-step fabrication process is used to
remove surface DNA, clean the substrate, and construct the
electrodes onto CNTs: (1) a low resolution (>912 magnification)
SEM imaging (LEO 1550) at 10 keV to identify the suitable areas for
device fabrication; (2) fabricating fine alignment markers with
e-beam lithography around the selected CNT arrays; (3) thermal
annealing of the Si substrate at 550-C under Argon to clean the
substrate and to reduce the DNA thickness; (4) using AFM (peak
force mode) for precise registration of the assembled CNTs with
respect to the fiducial markers; and (5) two-step e-beam
lithography for fabricating the contact electrodes onto the
assembled CNT arrays and electrical pads. Notably, after step 3,
the surface roughness of the substrate is reduced from 1 nm before
cleaning to 0.3 nm after cleaning. And the thickness of the DNA
residues is reduced to less than 1 nm.
[0132] A 200-nm thick PMMA layer is spun onto the Si wafer and the
fine alignment marker pattern is written using an ebeam tool (a
current of 0.5 nA at a dose of 1800 .mu.C/cm2). The alignment
marker pattern is developed in a 1:3 mixture of MIBK and IPA. A
10-nm thick titanium film is deposited using thermal evaporation in
a homebuilt evaporator. Liftoff is performed at room temperature in
acetone without sonication followed by an IPA rinse and the sample
is dried with Nitrogen. Finally, thermal annealing is performed
using rapid thermal annealing tool with 20 psi Argon at 1 slm/min
flow rate under 550.degree. C. for 30 minutes. Notably, writing the
markers before or after DNA deposition does not significantly
affect the effectiveness of DNA removal.
[0133] A 200-nm thick PMMA is spun onto the Si wafer and the fine
electrical contact pattern is written using Leica ebeam VB6 HR tool
(a current of 0.5 nA at a dose of 1800 .mu.C/cm2). The contact
pattern is developed in a 1:3 mixture of MIBK and IPA, and then
dried with compressed Nitrogen. To remove any residual DNA prior to
metal deposition, sample is dipped in DNA Exitus Plus (AppliChem)
solution for 15 sec followed by a DI water rinse and a quick dip (2
sec) in HCl followed by DI water rinse, then dried with Nitrogen. A
stacking metal film of 1-nm thick titanium, 20-nm thick palladium,
and 10-nm thick gold is deposited using thermal evaporation on a
homebuilt evaporator. Liftoff is performed at room temperature in
acetone without sonication, followed by an IPA rinse, and the
sample is dried with Nitrogen.
[0134] For large electrical contact pads connecting to the fine
electrical contacts, a 450-nm thick PMMA is spun onto the sample.
Proximity corrected contact pad pattern is exposed using Leica
ebeam VB6 HR tool with a current of 5 nA and dose depending on the
area within the pattern. The contact pads pattern are developed in
a 1:3 mixture of MIBK and IPA, then dried with compressed Nitrogen.
A stacking metal film of 5-nm thick titanium and 50-nm thick gold
is deposited using thermal evaporation on a homebuilt evaporator.
Liftoff is performed at room temperature in acetone without
sonication, followed by an IPA rinse, and the sample is dried with
Nitrogen.
[0135] The electrical measurements on the constructed CNT FETs are
performed at room temperature in a vacuum probe station connected
to an Agilent B1500A Semiconductor Device Analyzer.
[0136] Assembly yield was estimated using TEM images. Assembly
yield was defined as the total inner nanotrenches occupied by the
correctly formed parallel CNT arrays over the total numbers of
inner DNA nanotrenches. Two peripheral DNA nanotrenches on the
boundaries were excluded considering the incomplete crystal
formation on the growing edges. CNTs on 10 randomly selected DNA
brick crystals were counted.
[0137] In the TEM images, the following occupation status for DNA
nanotrenches were observed: (1) DNA trench contains one CNT,
aligned along the longitudinal axis of the nanotrench, (2) DNA
trench contains multiple CNTs, aligned along the longitudinal axis
of the nanotrench, and CNTs are in the end-to-end conformation, (3)
empty DNA trench. In our calculation, both (1) and (2) were
considered as the trenches correctly occupied by the aligned
CNTs.
Assembly .times. .times. Yield = Number .times. .times. Trenches
.times. .times. with .times. .times. aligned .times. .times. CNTs
NumberTotal .times. .times. inner .times. .times. trenches
##EQU00001##
[0138] Crossing or the bundling of CNTs within the DNA trenches was
not shown, and the assembly yield does not include these typical
misalignment defects. Hence, the definition of assembly yield does
not over-estimate the yield for forming the uniform parallel CNT
arrays.
[0139] CNT orientation was estimated using TEM images. The angular
deviation of CNTs was defined as the difference between the
longitudinal axis of CNT and the longitudinal axis of DNA
nanotrenches. CNTs on 10 randomly selected DNA brick crystals were
analyzed.
[0140] The range of inter-CNT pitch variation was defined as the
difference between the maximum and minimum pitch values of adjacent
CNTs. And the percent relative range of the inter-CNT pitch,
defined as the range of inter-CNT pitch divided by the average
value of inter-CNT pitch. The inter-CNT pitch was measured on TEM
images. And CNTs on 10 randomly selected DNA brick crystals were
measured. For every two neighboring CNTs, we measured three
different positions along the longitudinal axis of CNT.
[0141] Mathematically, CNT arrays with 10-nm inter-CNT pitch
exhibit local density of 100 CNTs/pm. However, CNT density does not
reflect the array uniformity. Different from the uniform inter-CNT
pitch demonstrated in the manuscript, other approaches for
preparing CNT arrays with 100 CNTs/pm or higher density, including
the repeated transfers (11), directional growth, and
Langmuir-Schaefer approach, exhibit irregular array morphologies.
Uneven inter-CNT pitch (ranging from 2 nm to a few micrometers in
the same array) or random CNT orientation and the resulted crossing
CNTs are often observed in these thin-film approaches.
[0142] It has been reported that IDC value (representative of CNT
disorder) impacts the gate delay and the energy increase per cycle
at 16 nm node. Their simulations indicate that, simply by reducing
the IDC value from 0.5 to 0.1, both the gate delay and the energy
increase per cycle improve by more than 50%. So smaller IDC values
(higher array uniformity) lead to better device performance.
However, many previous reports on the high-density CNT arrays
exhibit IDC values higher than 0.5.
[0143] At ultra-scaled technology nodes, semiconductor industry
typically has a high standard on the uniformity of the
semiconductor channels. In Si CMOS at 14 nm technology node, the
fin pitch variation is typically less than 3 nm, leading to an IDC
value smaller than 0.01 This value is comparable to our
demonstration for CNT channels.
[0144] Based on the discussions above, when using the parallel CNT
arrays in the ultra-scaled technology nodes, the maximum allowed
pitch variation and the IDC value should be similar to our
demonstration.
Example 2. DNA-Directed Nanofabrication of High-Performance Carbon
Nanotube Field-Effect Transistors
[0145] Semiconducting carbon nanotubes (CNTs) are an attractive
platform for field-effect transistors (FETs) because they
potentially can outperform silicon as dimensions shrink. Challenges
to achieving superior performance include creating highly aligned
and dense arrays of nanotubes as well as removing coatings that
increase contact resistance. Sun et al aligned CNTs by wrapping
them with single-stranded DNA handles and binding them into DNA
origami bricks that formed an array of channels with precise
intertube pitches as small as 10.4 nanometers Zhao et al. then
constructed single and multichannel FETs by attaching the arrays to
a polymer-templated silicon wafer. After adding metal contacts
across the CNTs to fix them to the substrate, they washed away all
of the DNA and then deposited electrodes and gate dielectrics. The
FETs showed high on-state performance and fast on-off
switching.
[0146] Biofabricated semiconductor arrays exhibit smaller channel
pitches than those created using existing lithographic methods.
However, the metal ions within biolattices and the sub micrometer
dimensions of typical biotemplates result in both poor transport
performance and a lack of large-area array uniformity. Using
DNA-templated parallel carbon nanotube (CNT) arrays as model
systems, we developed a rinsing-after-fixing approach to improve
the key transport performance metrics by more than a factor of 10
compared with those of previous biotemplated field-effect
transistors. We also used spatially confined placement of assembled
CNT arrays within polymethyl methacrylate cavities to demonstrate
centimeter-scale alignment. At the interface of high-performance
electronics and biomolecular self-assembly, such approaches may
enable the production of scalable biotemplated electronics that are
sensitive to local biological environments.
[0147] In projected high-performance, energy-efficient field-effect
transistors (FETs), evenly spaced small-pitch (where pitch refers
to the spacing between two adjacent channels within an individual
FET) semiconductor channels are often required. Smaller channel
pitch leads to higher integration density and on-state performance,
but it has the risk of enhanced destructive short-range screening
and electrostatic interactions in low-dimensional semiconductors,
such as carbon nanotubes (CNTs). Evenly spaced alignment minimizes
the channel disorder that affects the switching between on and off
states. Therefore, although high-density CNT thin films exhibit
on-state performance comparable to that of Si FETs, degraded gate
modulation and increased subthreshold swing are observed because of
the disorder in the arrays.
[0148] Biomolecules such as DNAs can be used to organize CNTs into
prescribed arrays. On the basis of the spatially hindered
integration of nanotube electronics (SHINE), biofabrication further
scales the evenly spaced channel pitch beyond lithographic
feasibility. However, none of the biotemplated CNT FETs have
exhibited performance comparable to that of those constructed with
lithography or thin-film approaches. Additionally, during the
surface placement of biotemplated materials, broad orientation
distributions prevent their large-scale alignment.
[0149] In this Example, small regions of nanometer-precise
biomolecular assemblies can be integrated into the large arrays of
solid-state high-performance electronics. We used the parallel
semiconducting CNT arrays assembled through SHINE as model systems.
At the FET channel interface, we observed lower on-state
performance induced by high concentrations of DNA and metal ions
Using a rinsing-after-fixing approach, we eliminated the
contamination without degrading CNT alignment. On the basis of the
uniform inter-CNT pitch and clean channel interface, we constructed
solid-state multichannel PMOS (p-channel metal-oxide semiconductor)
CNT FETs that displayed high on-state performance and fast on-off
switching simultaneously. Using lithography-defined polymethyl
methacrylate (PMMA) cavities to spatially confine the placement of
the CNT-decorated DNA templates, we demonstrated aligned arrays
with prescribed geometries over a 0.35-cm.sup.2-area substrate.
Building high-performance, ultra-scaled devices at the
biology-electronics interface may enable diverse applications in
the post-Si era, such as multiplexed biomolecular sensors and
three-dimensional (3D) FETs with nanometer-to-centimeter array
scalability.
[0150] We assembled DNA-templated CNT arrays using DNA-based SHINE.
We applied a rinsing-after-fixing approach (FIG. 39A) to remove the
DNA templates. Starting from the surface-deposited DNA-templated
CNT arrays, both ends of the DNA-templated CNT arrays were first
fixed onto a Si wafer with deposited metal bars (first step in FIG.
39A). DNA templates and high-concentration metal salts (1 to 2 M)
within the DNA helices were gently removed through sequential
rinsing with water and low-concentration H.sub.2O.sub.2 (second
step in FIG. 39A and FIG. 46). The inter-CNT pitch and the
alignment quality of the assembled CNTs were not degraded during
the rinsing process (FIG. 39B and FIGS. 44 and 45).
[0151] To explore the effect of single-stranded DNAs (ssDNAs) at
the channel interface, we first fabricated the source and drain
electrodes onto the rinsed CNT arrays (FIG. 39C, left). Next,
ssDNAs were introduced exclusively into the predefined channel area
(first step in FIG. 39C; channel length .about.200 nm). Finally, a
gate dielectric of HfO.sub.2 and a gate electrode of Pd were
sequentially fabricated (second and third steps in FIG. 39C and
FIG. 47).
[0152] Out of 19 FETs we constructed, 63% (12 of 19) showed typical
gate modulation (on-state current density divided by off-state
current density, I.sub.on/I.sub.off, exceeded 10.sup.3 FIG. 48).
The other seven devices exhibited I.sub.on/I.sub.off<5, which
was caused by the presence of metallic CNTs within the array. At a
drain-to-source bias (V.sub.ds) of -0.5 V one typical multichannel
DNA-containing CNT FET (FIG. 39D) exhibited a threshold voltage
(V.sub.th) of .about.-2 V, an I.sub.on of 50 .mu.A/.mu.m
(normalized to the inter-CNT pitch) at a gate-to-source bias
(V.sub.gs) of -3 V, a subthreshold swing of 146 mV per decade, a
peak transconductance (g.sub.m) of 23 .mu.S/.mu.m, and an on-state
conductance (G.sub.on) of 0.10 mS/.mu.m. Statistics over all of the
12 operational FETs exhibited a V.sub.th distribution of -2.+-.0.10
V, an I.sub.on of 4 to 50 .mu.A/.mu.m, and a subthreshold swing of
164.+-.44 mV per decade (FIG. 48A). The transport performance was
stable during repeated measurements (FIG. 48C).
[0153] We annealed the above DNA-containing FETs at 400.degree. C.
for 30 min under vacuum to thermally decompose ssDNAs, and we then
recharacterized the transport performance. Compared with the
unannealed samples, thermal annealing (FIG. 39D and FIGS. 48 and
57) slightly shifted the average V.sub.th (.about.0.35 V, for a
V.sub.th of -1.65.+-.0.17 V after annealing) and increased the
average subthreshold swing by .about.70 mV per decade (subthreshold
swing of 230+112 mV per decade after annealing) Other on-state
performance metrics, including g.sub.m and G.sub.on, as well as FET
morphology, did not substantially change after annealing.
[0154] To build high-performance CNT FETs from biotemplates, we
deposited a composite gate dielectric (Y.sub.2O.sub.3 and Hf.sub.2)
into the rinsed channel area instead of introducing ssDNAs (FIGS.
40, A and B, and FIGS. 51 and 52). Of all the FETs constructed, 54%
(6 of 11) showed gate modulation (FIG. 53). The other 5 of 11 FETs
contained at least one metallic CNT within the channel (FIG. 56).
Using an identical fabrication process, we also constructed another
nine operational single-channel DNA-free CNT FETs for comparing
transport performance (FIG. 49). The single-channel CNT FET
(channel length .about.200 nm) with the highest on-state
performance exhibited an on-state current of 10 .mu.A per CNT
(V.sub.ds of -0.5 V) at the thermionic limit of subthreshold swing
(i.e., 60 mV per decade; FIG. 40C and FIG. 50).
[0155] At a V.sub.ds of -0.5 V, the multichannel DNA-free CNT FET
(channel length .about.200 nm, inter-CNT pitch of 24 nm) with the
highest on-state performance (FIG. 40D and FIG. 54) exhibited a
V.sub.th of -0.26 V, an I.sub.on of 154 .mu.A/.mu.m (at a V.sub.gs
of -1.5 V), and a subthreshold swing of 100 mV per decade. The
g.sub.m and G.sub.on values were 0.37 and 0.31 mS/.mu.m,
respectively. The noise in the g.sub.m-V.sub.gs curves may
originate from thermal noise, or disorder and scattering within the
composite gate construct. The on-state current further increased to
.about.250 .mu.A/.mu.m, alongside a g.sub.m of 0.45 mS/.mu.m and a
subthreshold swing of 110 mV per decade, at a V.sub.ds of -0.8
V.
[0156] At a similar channel length and V.sub.ds (-0.5 V), we
benchmarked the transport performance (g.sub.m and subthreshold
swing) against that of conventional thin-film FETs using chemical
vapor deposition (CVD)-grown or polymer-wrapped CNTs (FIG. 40E and
FIGS. 58 and 59). Both high on-state performance (a g.sub.m of
.about.0.37 mS/.mu.m) and fast on-off switching (a subthreshold
swing of .about.100 mV per decade) could be simultaneously achieved
within the same solid-state FET, whereas thin-film CNT FETs with a
similar subthreshold swing (.about.100 mV per decade) exhibited a
>50% smaller g.sub.m.
[0157] When the channel length was scaled to 100 nm, we achieved an
I.sub.on of 300 .mu.A/.mu.m (at a V.sub.ds of -0.5 V and a V.sub.gs
of -1.5 V) and a subthreshold swing of 160 mV per decade (FIG. 55).
Both the G.sub.on and the g.sub.m values were thus promoted to 0.6
mS/.mu.m. The DNA-free CNT FETs exhibited comparable I.sub.on to
that of thin-film FETs from aligned CVD-grown CNT arrays, even at
60% smaller CNT density [.about.40 CNTs/pm versus >100
CNTs/.mu.m in]. The effective removal of the contaminations, such
as DNA and metal ions, and the shorter channel length contributed
to the high I.sub.on. Notably, a previous study had fixed CNTs
directly with the source and drain electrodes. Because
contamination could not be fully removed from the electrode contact
areas, the on-state performance (g.sub.m and G.sub.on) decreased by
a factor of 10.
[0158] Furthermore, the subthreshold swing difference between the
multichannel (average value of 103 mV per decade) and the
single-channel CNT FETs (average value of 86 mV per decade in FIG.
50) was reduced to 17 mV per decade. Theoretical simulations
suggest that, under identical gate constructs, the uneven diameter
of CNTs and the alignment disorder (including crossing CNTs) raise
the subthreshold swing We observed a wide diameter distribution of
the DNA-wrapped CNTs in atomic force microscopy (AFM) images (FIG.
43) and transmission electron microscopy images (FIG. 42) Hence,
the small subthreshold swing difference above indicated that
effective gate modulation and evenly spaced CNT alignment were
achieved using SHINE (i.e., the absence of crossing or bundling
CNTs within the channel area).
[0159] Statistics across all the operational multichannel DNA-free
FETs exhibited a V.sub.th of -0.32.+-.0.27 V, an I.sub.on of 25 to
154 .mu.A/.mu.m (at a V.sub.ds of -0.5 V and a V.sub.gs of -1.5 V),
and a subthreshold swing of 103.+-.30 mV per decade. Different
amounts of narrow CNTs (i.e., those with diameters<1 nm) within
FETs led to the wide distribution of I.sub.on. Because the Schottky
barrier and the bandgap increase with narrower CNT diameters, lower
CNT conductance is often observed in narrow CNTs than in those with
diameters>1.4 nm.
[0160] When comparing the transport performance differences between
DNA-containing and DNA-free FETs (FIG. 57), we observed a largely
negatively shifted V.sub.th (-2 versus -0.32 V), a higher
drain-to-source current density (I.sub.ds) at a positive V.sub.gs
(mostly 10 to 200 versus 0.1 to 10 nA/.mu.m), and a more than one
order of magnitude smaller g.sub.m (4 to 50 versus 70 to 370
.mu.S/.mu.m). Thus, high-concentration ssDNAs and metal ions within
multichannel FETs deteriorated the transport performance. Thermal
annealing did not fully eliminate the adverse effect because of the
presence of insoluble and nonsublimable annealing products, such as
metal phosphates.
[0161] When CNT-decorated DNA templates were deposited onto a flat
Si wafer, random orientations of DNA templates were formed through
unconfined surface rotation We solved this issue by using 3D
polymeric cavities to confine the surface orientation during
large-area placement. We first assembled fixed-width CNT arrays
(FIG. 60) with a prescribed inter-CNT pitch of 16 nm (two CNTs per
array). Next, in a typical 500 .mu.m-by-500 .mu.m write-field on
the PMMA-coated Si substrate (with >20 write-fields on a
0.35-cm.sup.2 substrate), we fabricated densely aligned crenellated
parapet-like PMMA cavities (cavity density of
.about.2.times.10.sup.7 cavities/cm.sup.2; FIG. 61). The minimum
and the maximum designed widths of an individual cavity along the z
direction were 180 and 250 nm, respectively.
[0162] After DNA deposition and PMMA liftoff (FIG. 41A), >85% of
the initial cavities (.about.600 cavities were counted) were
occupied by DNA templates (FIG. 41B and FIG. 62) The measured
angular distribution-defined as the difference between the
longitudinal axis of the DNA templates and the x direction of the
substrate--was 56% within .+-.1.degree. and 90% within
.+-.7.degree. (FIG. 41C), per scanning electron microscopy
(SEM)-based counting of all of the remaining DNA templates within
the 600 cavity sites. This value included improvable effects from
the fabrication defects of PMMA cavity sites, the variation during
DNA placement, and any disturbance from PMMA liftoff. Notably, the
angular distribution was still improved compared with previous
large-scale placement of DNA-templated materials. CNTs were not
visible under SEM because they were embedded within the DNA
trenches and shielded from the SEM detector by DNA helices.
[0163] Both the lengths of the DNA templates and the aspect ratio
of the PMMA cavities affected the angular distribution. Longer DNA
templates (with lengths>1 .mu.m) exhibited narrower angular
distribution (0.degree..+-.3.4.degree. in FIG. 41D) than those of
shorter DNA templates (with lengths<500 nm,
1.degree..+-.11.degree. in FIG. 41D) Additionally, PMMA cavities
with a higher length-to-width aspect ratio (i.e., 10 in FIG. 41B
and FIG. 61) provided better orientation controllability than those
with a lower aspect ratio (i.e., 1 in FIG. 63). Hence, longer DNA
templates, as well as a higher length-to-width aspect ratio of PMMA
cavities, were beneficial in improving the angular distribution.
Because PMMA cavities were wider than the DNA templates, we
observed up to three DNA templates, as well as the offset of DNA
templates along the x and z directions, within a few PMMA cavities.
Notably, DNA templates did not fully cover the individual PMMA
cavities, even for a saturated DNA solution.
[0164] Two-dimensional hydrophilic surface patterns, with shape and
dimensions identical to those of the DNA structures, could direct
the orientation of the deposited DNA structures. However, it is
difficult to design patterns adaptive to DNA templates with
variable lengths. In contrast, effective spatial confinement relies
mainly on the lengths of the DNA templates and the aspect ratio of
PMMA cavities and is applicable to irregular template lengths.
Therefore, the anisotropic biotemplated CNT arrays with uneven
lengths could be aligned along the longitudinal direction of the
cavities (supplementary text section S4.1 and FIG. 64).
[0165] To further promote the on-state performance, scaling the
inter-CNT pitch into <10 nm may be beneficial. However, at 2-nm
inter-CNT pitch, the enhanced electrostatic interactions may affect
the on-off switching. Therefore, the correlation between the
inter-CNT pitch and performance metrics of CNT FETs needs to be
verified. Combined with large-area fabrications through
conventional lithography and directed assembly of block copolymers,
biomolecular assembly could provide a high-resolution paradigm for
programmable electronics over large areas. The hybrid
electronic-biological devices may also integrate electrical stimuli
and biological inputs and outputs, producing ultra-scaled sensors
or bioactuators.
[0166] A 7 .mu.L as-prepared CNT-decorated DNA template solution
was deposited onto a 1-cm2 sized silicon substrate followed by
stepwise rinsing in 50%, 95%, and 99.5% ethanol. The sample was
imaged on a Multimode SPM (Vecco) via tapping mode.
[0167] A 7 .mu.L as-prepared CNT-decorated DNA template solution
was deposited onto a 1-cm2 sized silicon substrate followed by
stepwise rinsing in 50%, 95%, and 99.5% ethanol. The dried silicon
substrate was imaged on a HITACHI S-4800 system operated at 5 kV
under high vacuum.
[0168] A 0.6 .mu.L as-prepared (without purification) CNT-decorated
DNA template was diluted into 5 .mu.L water and adsorbed onto glow
discharged carbon-coated TEM grids for 4 min. Then the remaining
solution was wiped away, followed by negative staining using 6
.mu.L 2% aqueous uranyl formate solution (7 sec) and a quick water
rinsing. Imaging was performed using an JEOL 2100 operated at 120
kV.
[0169] A 0.35-cm2 sized silicon substrate was firstly spin-coated
with polymethyl methacrylate (PMMA) resist (Allresist AR-P 672.045)
and patterned using electron-beam lithography (Raith Voyager, with
an exposure dose of 325 .mu.C/cm2 at 0.9 nA current). The patterned
PMMA layer was developed in a 1:3 mixture of methylisobutyl ketone
(MIBK) and isopropyl alcohol (IPA), followed by rinsing with IPA
and drying with nitrogen. The solution of CNT-decorated DNA
templates was dipped onto the lithography defined patterns. Then
the silicon substrate was kept in a sealed chamber for 2 hours.
During this process, the DNA templates diffused into the PMMA
cavities. Si substrate was then dried, followed by PMMA liftoff,
leaving only the aligned DNA templates on the flat Si substrate.
Finally, we imaged the sample with SEM.
[0170] We applied the following process to remove the assembled DNA
templates while retaining CNT alignment: (1) fabricating alignment
markers on Si wafer with electron-beam lithography; (2) depositing
the CNT-decorated DNA templates onto Si wafer and registering the
positions with low-magnification SEM; (3) fabricating metal bars to
fix the assembled CNT arrays onto Si wafer; and (4) removing DNA
templates by continuously water and H2O2 rinsing. We used the
length-sorted CNTs (semiconducting purity .about.95%) from NIST,
and the length range was 300 to 1000 nm.
[0171] A 230-nm thick PMMA layer was spun onto Si wafer (with
300-nm thick SiO2 on top) and the fine alignment marker pattern was
written using Raith Voyager system (at a current of 9 nA and a dose
of 780 .mu.C/cm2). The alignment marker pattern was developed in a
1:3 mixture of MIBK and IPA. A stacking titanium/gold film (5-nm
thick titanium and 45-nm thick gold) was deposited using DE400
e-beam evaporation system. Liftoff was performed at room
temperature in acetone without sonication, followed by an ethanol
rinsing. The sample was dried with nitrogen.
[0172] A 9 .mu.L solution of the assembled CNT-decorated DNA
templates was dipped onto the oxygen plasma-cleaned marked Si
wafer, followed by the incubation at room temperature for 1 hour.
After that, the remaining solution was blown away with nitrogen.
The Si wafer was sequentially rinsed with 75%, 95%, and 99%
ethanol, followed by air drying. The Si wafer was then imaged under
SEM at low magnification (operated at 1 kV). The positions of the
CNT-decorated DNA templates were registered relative to the
alignment markers.
[0173] A 230-nm thick PMMA layer was spun onto the CNT-deposited Si
wafer. The metal bar pattern was written using Raith Voyager system
(at a current of 400 .mu.A and a dose of 750 .mu.C/cm2). The metal
bar pattern was developed in a 1:3 mixture of MIBK and IPA. A
stacking film of 5-nm thick titanium and 60-nm thick gold was
deposited using DE400 e-beam evaporation system. Liftoff was
performed at room temperature in acetone without sonication,
followed by an ethanol rinse. The sample was dried with nitrogen.
DNA removal was then performed by sequential water and H2O2 (5%)
rinsing
[0174] For FET construction, we used electron-beam lithography for
fabricating the source, drain, and gate electrodes onto the
assembled CNT arrays and constructing the electrical contact
pads.
[0175] Source/drain electrodes. A 230-nm thick PMMA layer was spun
onto the cleaned CNT arrays, followed by writing the source and the
drain electrodes patterns with Raith Voyager system (at a current
of 400 pA and a dose of 750 .mu.C/cm2). The source and the drain
electrodes patterns were developed in a 1:3 mixture of MIBK and
IPA. A stacking film of 0.5-nm thick titanium, 30-nm thick
palladium, and 40-nm thick gold was deposited using DE400 e-beam
evaporation system. Liftoff was performed at room temperature in
acetone without sonication, followed by an ethanol rinsing. The
sample was dried with nitrogen.
[0176] Gate electrode. Next, a layer of 230-nm thick PMMA layer was
spun onto the Si wafer, followed by writing the channel patterns
with Raith Voyager system (at a current of 400 pA and a dose of 750
.mu.C/cm2). One-nanometer thick yttrium metal film was first
deposited using DE400 e-beam evaporation system Liftoff was
performed at 70.degree. C. in acetone. Then, the yttrium film was
oxidized in air at 250.degree. C.
[0177] A 230-nm thick PMMA layer was then spun onto the
Y.sub.2O.sub.3-coated Si wafer, followed by writing the gate
electrode pattern with Raith Voyager system (at a current of 400 pA
and a dose of 750 .mu.C/cm2). The gate electrode pattern was
developed in a 1:3 mixture of MIBK and IPA. Eight-nanometer thick
HfO2 was next deposited using atomic layer deposition at 90.degree.
C. A 15-nanometer thick palladium film was finally deposited using
DE400 e-beam evaporation system. Liftoff was performed at room
temperature in acetone without sonication, followed by ethanol
rinsing. The sample was dried with nitrogen.
[0178] Contact pads. For fabricating large electrical contact pads
connecting to the electrodes, a 230-nm thick PMMA layer was first
spun onto the sample. Contact pad pattern was exposed using Raith
Voyager system (at a current of 9 nA and a dose of 750 .mu.C/cm2).
The contact pad pattern was developed in a 1.3 mixture of MIBK and
IPA, then dried with nitrogen A stacking film of 5-nm thick
titanium and 70-nm thick gold was deposited using DE400 e-beam
evaporation system. Liftoff was performed at room temperature in
acetone without sonication, followed by ethanol rinsing. And the
sample was dried with nitrogen.
[0179] Electrical measurements for CNT FETs. The electrical
measurements for the constructed CNT FETs were performed at room
temperature in a probe station connected to a Keithley 4200 SCS
Semiconductor Device Analyzer.
[0180] Introducing ssDNAs at channel interface. After fabricating
the source and drain electrodes, we applied the following processes
to introduce ssDNAs at channel interface and construct the gate
dielectric accordingly: (1) a 230-nm thick PMMA layer was spun onto
the wafer, followed by writing the gate electrode pattern with
Raith Voyager system (at a current of 400 pA and a dose of 750
.mu.C/cm2). The gate electrode pattern was developed in a 1:3
mixture of MIBK and IPA; (2) 10 .mu.L solution of L1 (1 .mu.M) was
dipped onto the fixed CNT arrays, and incubated at room temperature
for 1.5 h; (3) the remaining solution was blown away with nitrogen,
followed by sequential rinsing with 75%, 95%, and 99%, ethanol, (4)
9-nanometer thick HfO2 medium was grown within the developed
pattern through atomic layer deposition (Savannah) at 90.degree.
C.; and (5) a 15-nanometer thick palladium film was then deposited
using DE400 e-beam evaporation system. Liftoff was performed at
room temperature in acetone without sonication, followed by ethanol
rinsing. The sample was dried with nitrogen.
[0181] After that, constructing contact pads and the electrical
measurements were performed using identical approaches in
Supplementary Sect. S1.6.
[0182] To further improve the FET performance, it is necessary to
increase the on-state conductance while lower the subthreshold
swing. Towards higher on-state conductance, several strategies have
been suggested in previous reports. For example, when applying the
gate overdrive (Vgs-Vth) up to 6 V, on-current density around 0.5
mA/pm has been reported (at 100 nm Lch). However, at ultra-scaled
technology nodes, the supply voltage (Vdd) is typically below 1 V,
which limits the available voltage range of Vgs. Meanwhile, raising
CNT density to 500 CNTs/.mu.m, as well as scaling the channel
length to 10 nm, could also provide on current density of 0.8
mA/.mu.m (at gate overdrive around 3 V). But high CNT density also
presents challenges in promoting the conductance per CNT, because
of the strong inter-CNT screening effect at high CNT density. As a
result, the on-state conductance per CNT is lowered to less than 2
.mu.A/CNT, around 10% of the single-channel CNT FET at identical
channel length. Besides, subthreshold swing around 500 mV/decade is
produced due to the destructive crossing CNTs and diameter
distribution at high CNT density. Using 3D DNA nanotrenches, the
formation of crossing CNTs could be minimized. Hence, by exploring
the correlation between inter-CNT pitch and the on-state
conductance, the optimized inter-CNT pitch could balance the
competing needs on higher CNT density and lower inter-CNT
interactions. Together with the short channel design, the on-state
conductance of multichannel CNT FETs will be maximized.
[0183] Decreasing the subthreshold swing to 60 to 80 mV/decade is
recommended by the International Technology Roadmap for
Semiconductors. Notably, decreasing the subthreshold swing should
not degrade the on-state conductance. In the CNT FETs constructed
from CNT thin films, subthreshold swing of 60 mV/decade has been
reported. However, the on-current density is as small as 100
nA/.mu.m, which does not meet the requirements of high-performance
electronics. Based on our demonstration in the manuscript, the
subthreshold swing of the multichannel CNT FETs is slightly higher
than that of single-channel CNT FETs. Because of the absence of
crossing CNTs, the small difference value (17 mV/decade) is
ascribed to the diameter distribution. Hence, when CNTs with
uniform diameter are available, 31) DNA nanotrenches could in
principle build multichannel CNT FETs with subthreshold swing
identical to the single-channel CNT FETs. Further decreasing the
subthreshold swing to the thermionic limit of 60 mV/decade or even
smaller relies on the gate efficiency. For instance, using a
graphene-contacted design, single-channel CNT FETs have been
demonstrated with both subthreshold swing of sub-60 mV/decade and
on-state current of 8 .mu.A/CNT Integrating the graphene-contacted
design within multichannel CNT FETs may promote the on/off
switching than current metal contacts.
[0184] Higher CNT purity is also necessary for improving the
successful rate of FET construction. For the projected CNT FET
architecture, 95% semiconducting CNT purity produces 73% successful
rate in the six-channel CNT FETs, and 54% successful rate in the
twelve-channel FETs. Considering high-performance micro-processors
contain up to 1 billion FETs, a semiconducting CNT purity higher
than 99.99999998% is necessary to ensure all the FETs are
operational.
[0185] In digital circuits, it is quite common to have larger
spacing values outside individual FETs than the semiconductor
channel pitch. In Si circuits, for example, Samsung's 14 nm
technology node has a uniform fin pitch of 49 nm (FET width is less
than 250 nm); whereas the spacing between two nearest fins in
neighboring FETs can be as large as 700 nm, 13 times larger than
the fin pitch. Similar spacing differences have also been observed
in Intel's 22 nm, 14 nm, and 10 nm Si technology nodes. The larger
spacing between two nearest FETs may accommodate the interconnect
metal wires And the larger inter-FET spacing is adjustable tailored
to different circuit architectures.
[0186] Existing thin-film approaches employ a post-assembly etching
approach to prepare arrays with designer width, inter-array
spacings, and CNT counts over centimeter-scale. Continuous CNT film
first covers the entire surface of the substrate. Then a post
assembly etching (via oxygen plasma) is introduced to etch away
CNTs out of the channel area (FIG. 64A). Hence, both array width
and inter-array spacing could be fabricated tailored to FET/circuit
layouts. Importantly, inter-array spacing is necessary to prevent
stray conducting pathways and accommodate metal contacts. It has
been reported that the presence of CNTs beneath the contacts lowers
the adhesion of metal contacts to the substrate surface. After the
post-assembly etching, full surface coverage CNT films are etched
into several individual arrays with width around 50 nm to a few
hundred nanometers, tailored to FET layouts
[0187] In comparison, we demonstrate a different strategy to
achieve the designer width, inter-array spacings, and CNT counts in
the manuscript (FIG. 64B). Using 3D DNA nanotrenches, CNT arrays
are assembled with designer inter-CNT pitches and CNT counts on
fixed-width 3D DNA templates And the CNT counts per array could be
programmed by different template widths. The assembled CNT arrays
are then placed within the pre-fabricated PMMA cavities, followed
by PMMA liftoff and DNA removal. Without post-assembly etching,
prescribed inter-array spacing is demonstrated after the
centimeter-scale oriented placement. Because the inter-array
spacing is defined by lithography of PMMA cavities, in principle,
it could be further scaled to sub-200 nm. Therefore, the maximum
array density is around 105 arrays/cm, close to that of Si fins at
10-nm technology node (less than 3.times.105 arrays/cm). The array
width and inter-array spacing from our approach are also similar to
those fabricated from the post-assembly etching approach.
[0188] While one or more embodiments have been shown and described,
modifications and substitutions may be made thereto without
departing from the spirit and scope of the invention. Accordingly,
it is to be understood that the present invention has been
described by way of illustrations and not limitation Embodiments
herein can be used independently or can be combined.
[0189] All ranges disclosed herein are inclusive of the endpoints,
and the endpoints are independently combinable with each other. The
ranges are continuous and thus contain every value and subset
thereof in the range Unless otherwise stated or contextually
inapplicable, all percentages, when expressing a quantity, are
weight percentages. The suffix "(s)" as used herein is intended to
include both the singular and the plural of the term that it
modifies, thereby including at least one of that term (e.g., the
colorant(s) includes at least one colorants). "Optional" or
"optionally" means that the subsequently described event or
circumstance can or cannot occur, and that the description includes
instances where the event occurs and instances where it does not.
As used herein, "combination" is inclusive of blends, mixtures,
alloys, reaction products, and the like.
[0190] As used herein, "a combination thereof" refers to a
combination comprising at least one of the named constituents,
components, compounds, or elements, optionally together with one or
more of the same class of constituents, components, compounds, or
elements.
[0191] All references are incorporated herein by reference.
[0192] The use of the terms "a" and "an" and "the" and similar
referents in the context of describing the invention (especially in
the context of the following claims) are to be construed to cover
both the singular and the plural, unless otherwise indicated herein
or clearly contradicted by context. "Or" means "and/or." It should
further be noted that the terms "first," "second," "primary,"
"secondary," and the like herein do not denote any order, quantity,
or importance, but rather are used to distinguish one element from
another. The modifier "about" used in connection with a quantity is
inclusive of the stated value and has the meaning dictated by the
context (e.g., it includes the degree of error associated with
measurement of the particular quantity). The conjunction "or" is
used to link objects of a list or alternatives and is not
disjunctive; rather the elements can be used separately or can be
combined together under appropriate circumstances.
Sequence CWU 1
1
2156DNAArtificial SequenceLab synthesized, Single strand DNA
1gatgcgaggc tattctgtgt gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt gtgtgt
56230DNAArtificial SequenceSingle strand DNA Lab synthesized
2agaatagcct cgcatcccac ttaccactta 30
* * * * *