U.S. patent application number 17/388769 was filed with the patent office on 2021-12-23 for oligonucleotide primers for quantifying and/or detecting human male dna and kits containing the same.
The applicant listed for this patent is QIAGEN GmbH. Invention is credited to Stefan Otto CORNELIUS, Margaretha KONIG, Ralf PEIST, Mario SCHERER, Miroslav VRANES.
Application Number | 20210395801 17/388769 |
Document ID | / |
Family ID | 1000005825941 |
Filed Date | 2021-12-23 |
United States Patent
Application |
20210395801 |
Kind Code |
A1 |
VRANES; Miroslav ; et
al. |
December 23, 2021 |
OLIGONUCLEOTIDE PRIMERS FOR QUANTIFYING AND/OR DETECTING HUMAN MALE
DNA AND KITS CONTAINING THE SAME
Abstract
Oligonucleotide primers and probes for quantifying and/or
detecting human male DNA in a forensic sample. The oligonucleotides
are useful for amplifying a multicopy locus within the human
Y-chromosome (MCL-Y) that shares at least 80% sequence identity to
a sequence according to SEQ ID NO. 3 over a stretch of at least 60
base pairs. The oligonucleotides hybridize under stringent
conditions to a nucleic acid having at least one sequence selected
from the group consisting of SEQ ID NO. 3 to SEQ ID NO. 11 and/or
SEQ ID NO. 17 to SEQ ID NO. 25. Kits including the oligonucleotide
primers, probes and/or primer pairs and reagents for performing an
amplification reaction on DNA recovered from a forensic sample are
also disclosed.
Inventors: |
VRANES; Miroslav; (Hilden,
DE) ; PEIST; Ralf; (Hilden, DE) ; SCHERER;
Mario; (Hilden, DE) ; CORNELIUS; Stefan Otto;
(Hilden, DE) ; KONIG; Margaretha; (Hilden,
DE) |
|
Applicant: |
Name |
City |
State |
Country |
Type |
QIAGEN GmbH |
Hilden |
|
DE |
|
|
Family ID: |
1000005825941 |
Appl. No.: |
17/388769 |
Filed: |
July 29, 2021 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
16333076 |
Mar 13, 2019 |
11078527 |
|
|
PCT/EP2017/073311 |
Sep 15, 2017 |
|
|
|
17388769 |
|
|
|
|
Current U.S.
Class: |
1/1 |
Current CPC
Class: |
C12Q 2525/151 20130101;
C12Q 2600/166 20130101; C12Q 1/6876 20130101; C12Q 2600/16
20130101; C12Q 1/686 20130101; C12Q 1/6879 20130101; C12Q 1/6851
20130101; C12Q 1/6806 20130101; C12Q 1/6827 20130101 |
International
Class: |
C12Q 1/6827 20060101
C12Q001/6827; C12Q 1/6879 20060101 C12Q001/6879; C12Q 1/6851
20060101 C12Q001/6851; C12Q 1/6806 20060101 C12Q001/6806; C12Q
1/686 20060101 C12Q001/686; C12Q 1/6876 20060101 C12Q001/6876 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 22, 2016 |
EP |
16189210.4 |
Claims
1. An oligonucleotide primer or probe that hybridizes under
stringent conditions to a nucleic acid having at least one sequence
selected from the group consisting of: SEQ ID NO. 3; SEQ ID NO. 4;
SEQ ID NO. 5; SEQ ID NO. 6; SEQ ID NO. 7; SEQ ID NO. 8; SEQ ID NO.
9; SEQ ID NO. 10; SEQ ID NO. 11; SEQ ID NO. 17; SEQ ID NO. 18; SEQ
ID NO. 19; SEQ ID NO. 20; SEQ ID NO. 21; SEQ ID NO. 22; SEQ ID NO.
23; SEQ ID NO. 24; and SEQ ID NO. 25.
2. The oligonucleotide primer or probe according to claim 1,
wherein the oligonucleotide primer or probe is selected from the
group consisting of: SEQ ID NO. 1; SEQ ID NO. 2; SEQ ID NO. 12; SEQ
ID NO. 13; SEQ ID NO. 14; SEQ ID NO. 15; and SEQ ID NO. 16.
3. The oligonucleotide primer or probe according to claim 1,
wherein the oligonucleotide primer or probe is selected from the
group consisting of: the reverse complement of SEQ ID NO. 1; the
reverse complement of SEQ ID NO. 2; the reverse complement of SEQ
ID NO. 12; the reverse complement of SEQ ID NO. 13; the reverse
complement of SEQ ID NO. 14; the reverse complement of SEQ ID NO.
15; and the reverse complement of SEQ ID NO. 16.
4. The oligonucleotide primer or probe according to claim 1,
wherein the oligonucleotide primer or probe is selected from the
group consisting of: a primer that shares at least 90% sequence
identity with SEQ ID NO. 1; a primer that shares at least 90%
sequence identity with SEQ ID NO. 2; a probe that shares at least
90% sequence identity with SEQ ID NO. 12; a primer that shares at
least 90% sequence identity with SEQ ID NO. 13; a primer that
shares at least 90% sequence identity with SEQ ID NO. 14; a primer
that shares at least 90% sequence identity with SEQ ID NO. 15; and
a probe that shares at least 90% sequence identity with SEQ ID NO.
16.
5. The oligonucleotide primer according to claim 1, wherein the
oligonucleotide primer or probe is selected from the group
consisting of: the reverse complement of a primer that shares at
least 90% sequence identity with SEQ ID NO. 1; the reverse
complement of a primer that shares at least 90% sequence identity
with SEQ ID NO. 2; the reverse complement of a primer that shares
at least 90% sequence identity with SEQ ID NO. 12; the reverse
complement of a primer that shares at least 90% sequence identity
with SEQ ID NO. 13; the reverse complement of a primer that shares
at least 90% sequence identity with SEQ ID NO. 14; the reverse
complement of a primer that shares at least 90% sequence identity
with SEQ ID NO. 15; and the reverse complement of a primer that
shares at least 90% sequence identity with SEQ ID NO. 16.
6. An oligonucleotide primer pair selected from the group
consisting of: SEQ ID NO. 1 and SEQ ID NO. 2; SEQ ID NO. 2 and SEQ
ID NO. 13; SEQ ID NO. 2 and SEQ ID NO. 14; SEQ ID NO. 2 and SEQ ID
NO. 15; the reverse complement of SEQ ID NO. 1 and the reverse
complement of SEQ ID NO. 2; the reverse complement of SEQ ID NO. 2
and the reverse complement of SEQ ID NO. 13; the reverse complement
of SEQ ID NO. 2 and the reverse complement of SEQ ID NO. 14; the
reverse complement of SEQ ID NO. 2 and the reverse complement of
SEQ ID NO. 15; a primer that shares at least 90% sequence identity
with SEQ ID NO. 1 and a primer that shares at least 90% sequence
identity with SEQ ID NO. 2; a primer that shares at least 90%
sequence identity with SEQ ID NO. 2 and a primer that shares at
least 90% sequence identity with SEQ ID NO. 13; a primer that
shares at least 90% sequence identity with SEQ ID NO. 2 and a
primer that shares at least 90% sequence identity with SEQ ID NO.
14; a primer that shares at least 90% sequence identity with SEQ ID
NO. 2 and a primer that shares at least 90% sequence identity with
SEQ ID NO. 15; the reverse complement of a primer that shares at
least 90% sequence identity with SEQ ID NO. 1 and the reverse
complement of a primer that shares at least 90% sequence identity
with SEQ ID NO. 2; the reverse complement of a primer that shares
at least 90% sequence identity with SEQ ID NO. 2 and the reverse
complement of a primer that shares at least 90% sequence identity
with SEQ ID NO. 13; the reverse complement of a primer that shares
at least 90% sequence identity with SEQ ID NO. 2 and the reverse
complement of a primer that shares at least 90% sequence identity
with SEQ ID NO. 14; and the reverse complement of a primer that
shares at least 90% sequence identity with SEQ ID NO. 2 and the
reverse complement of a primer that shares at least 90% sequence
identity with SEQ ID NO. 15.
7. The oligonucleotide primer pair according to claim 6, wherein
the primer pair is a primer that shares at least 90% sequence
identity with SEQ ID NO. 1 and a primer that shares at least 90%
sequence identity with SEQ ID NO. 2, or the reverse complements
thereof.
8. The oligonucleotide primer pair according to claim 6, wherein
the primer pair is a primer that shares at least 90% sequence
identity with SEQ ID NO. 2 and a primer that shares at least 90%
sequence identity with SEQ ID NO. 13, or the reverse complements
thereof.
9. The oligonucleotide primer pair according to claim 6, wherein
the primer pair is a primer that shares at least 90% sequence
identity with SEQ ID NO. 2 and a primer that shares at least 90%
sequence identity with SEQ ID NO. 14, or the reverse complements
thereof.
10. The oligonucleotide primer pair according to claim 6, wherein
the primer pair is a primer that shares at least 90% sequence
identity with SEQ ID NO. 2 and a primer that shares at least 90%
sequence identity with SEQ ID NO. 15, or the reverse complements
thereof.
11. A kit comprising an oligonucleotide primer or probe according
to claim 1 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
12. A kit comprising an oligonucleotide primer or probe according
to claim 2 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
13. A kit comprising an oligonucleotide primer or probe according
to claim 3 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
14. A kit comprising an oligonucleotide primer or probe according
to claim 4 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
15. A kit comprising an oligonucleotide primer or probe according
to claim 5 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
16. A kit comprising an oligonucleotide primer pair according to
claim 6 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
17. A kit comprising an oligonucleotide primer pair according to
claim 7 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
18. A kit comprising an oligonucleotide primer pair according to
claim 8 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
19. A kit comprising an oligonucleotide primer pair according to
claim 9 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
20. A kit comprising an oligonucleotide primer pair according to
claim 10 and reagents for performing an amplification reaction on
DNA recovered from a forensic sample.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a division of U.S. application Ser. No.
16/333,076, filed Mar. 13, 2019, now U.S. Pat. No. 11,078,527 B2,
which was a U.S. National Stage of PCT/EP2017/073311, filed Sep.
15, 2017, and claims priority to European Patent App. No.
16189210.4, filed Sep. 22, 2016.
FIELD OF THE INVENTION
[0002] The present invention is in the field of molecular biology,
diagnostics, more particularly in the field of analytical and
forensic sciences. The invention is further in the field of nucleic
acid amplification and quantification, more particularly in the
field of DNA quantification.
BACKGROUND OF THE INVENTION
[0003] The determination of the quantity of DNA recovered from
forensic samples as well as other samples is a critical step in the
overall DNA typing process, but also in the detection of DNA in
various other fields of science. A narrow range of input DNA from
0.5 to 2 ng is often needed to produce optimal results with for
example multiplex DNA typing kits. Therefore, in order to ensure
that a positive result is a positive result and/or a negative
result is a negative result due to the absence of DNA,
quantification of DNA is of absolute importance. Furthermore, the
quality of standards for forensic DNA testing laboratories requires
human-specific DNA quantification. This is due to isolation
techniques that can recover human DNA as well as bacterial and
other exogenous DNA. A number of procedures have been developed to
permit quantification of human-specific DNA including start-blot
techniques, liquid based hybridization assays and real-time
polymerase chain reaction (PCR). Currently, real-time PCR is the
dominant technique due to its wide dynamic range and ease of
automation.
[0004] The modern short tandem repeat (STR) kits have become much
more sensitive and can obtain good results even using low amounts
of DNA. Therefore, there is a desire for a method, kit and nucleic
acid region that allows precise and accurate quantification of
human DNA even in low concentrated samples.
[0005] There are certain quantification and detection kits already
available. One such kit is the Quantifiler Human Kit (Applied
Biosystems) another kit is Quantifiler Duo Kit (Applied Biosystems)
another kit is the Plexor HY Real-Time PCR Quantification Kit
(Promega). Both the Quantifiler Duo Kit and the Plexor HY Kit
target an autosomal and a gonosomal (Y-chromosome) target on the
genome.
[0006] However, the kits currently on the market present some
drawbacks. According to LaSalle et al. (Forensic Science
International: Genetics, (2011) 5: 185-193) the Quantifiler Kits
are more accurate in the quantification but have a lower dynamic
range as the Plexor HY. The Plexor HY offers a higher dynamic range
due to the amplification of a multicopy target, but a lower
accuracy. This lower accuracy can be attributed to the multicopy
target. If less than the full set of 20 copies on a genome amplify,
because of, for example, instability in the target copy number,
than the ratio between the amplification between autosomal and
gonosomal (Y) target may vary. The dynamic range of the Plexor HY
kit is slightly better than that of the other kit (LaSalle et al.,
Forensic Science International: Genetics, (2011) 5: 185-193). In a
statistical comparison, it has been demonstrated a significant
difference between the two kits (LaSalle et al., Forensic Science
International: Genetics, (2011) 5: 185-193).
[0007] Another important parameter in forensics is the degradation
grade of the DNA that has to be analyzed. Since the amplicon size
of the Quantifiler Human and Plexor HY vary from 62 to 133 base
pairs (bp), significant differences might be expected when the kits
are applied to degraded DNA. Also, inhibitors must be taken into
account. It may well be that DNA is present in the reaction no
result is obtained due to the presence of inhibitory
substances.
[0008] In cases of sexual assault samples, a quantification of the
DNA is challenging, due to the presence of DNA molecules from both,
the female victim as well as the male attacker. Furthermore, in a
typical sample, the amount of female DNA exceeds the amount of male
DNA by several orders of magnitude. Thus, a sensitive, male
specific DNA quantification method which can accurately detect and
quantify male DNA even in a high background of female DNA, is
therefore of great interest.
[0009] Reported herein is a qPCR-based DNA quantification system
that is highly sensitive to detect low amounts of male DNA in a
high background of female DNA and assess in parallel the male DNA
degradation and/or integrity of the male DNA.
SUMMARY OF THE INVENTION
[0010] The invention relates to a method for detecting and/or
quantifying DNA, in particular the fraction of male DNA in a
sample, (i) wherein the method comprises the step of amplification
of a multicopy locus within the Y-chromosome (MCL-Y), wherein said
locus shares at least 85% sequence identity to a sequence according
to SEQ ID NO. 3 over a stretch of at least 60 base pairs (bp) or
with the reverse complement thereof or, (ii) wherein the locus is
amplifiable with a primer pair according to SEQ ID NO. 1 and 2 or
the reverse complement thereof.
[0011] A second aspect of the present invention relates to a primer
or primer pair wherein at least one primer hybridizes under
stringent conditions to a sequence according to SEQ ID NO 3.
Preferably, both primers of the primer pair hybridize.
[0012] A third aspect of the present invention relates to a kit for
performing a method as disclosed herein, wherein said kit
comprises: a. at least one primer selected from the group
consisting of: SEQ ID NO 1 and SEQ ID NO 2; b. reagents to perform
the amplification reaction; c. instructions for performing the
method as disclosed herein.
[0013] Maternal blood stream contains low amounts of cell-free
fetal DNA (cffDNA) which is freely circulating. Analysis of cffDNA
provides a method of non-invasive prenatal diagnosis, testing and
can be used e.g. for early determination of fetal sex. The present
method also enables the detection and analysis of male cell-free
fetal DNA and aids in identification of fetal sex. Furthermore the
present method significantly decreases the risk of false sex
determination of the embryo since contaminating male genomic DNA,
e.g. introduced into the sample from the environment, can be
assessed by the Degradation Index generated by the small and large
PCR system for the male targets used in the invention.
DESCRIPTION OF THE INVENTION
[0014] In case of forensic samples from sexual assaults the female
DNA usually exceeds the amount of male DNA. To choose the proper
method for genetic analysis it is advisable to test for male DNA
present in the sample, which was collected from a crime scene and
to quantify the amount of male DNA in order to know how much of
this DNA should be used in the genetic analysis e.g. STR reaction.
The typical STR kit detects genetic length polymorphisms on
different autosomal chromosomes, but in some cases, such as with
sexual assault samples, the analysis of length polymorphisms
exclusively on the Y-chromosome could be advantageous, because the
female DNA does not contain these length polymorphisms.
[0015] Surprisingly, the inventors have found that multicopy loci
on the Y-chromosome are superior to other loci when used for
detection and/or quantification of nucleic acids, because the
sensitivity of the reaction can be enhanced. This is an important
aspect of the present invention due to its relevancy in the field
of forensic science.
[0016] In particular, the inventors have astonishingly found that
sequence identified in SEQ ID NO. 3 and/or sequences that share
sequence similarity, i.e. SEQ ID NO. 4 with it may be found many
times on the Y-chromosome. In particular, said sequence SEQ ID NO.
3 or sequences very similar thereto are present nine times on the
human Y-chromosome. This finding provides a valuable advantage of
the present method.
[0017] The invention relates to a method for detecting and/or
quantifying DNA in particular the fraction of male DNA in a sample,
(i) wherein the method comprises the step of amplification of a
multicopy locus within the Y-chromosome (MCL-Y), wherein said locus
shares at least 85% sequence identity to a sequence according to
SEQ ID NO. 3 over a stretch of at least 60 base pairs (bp) or with
the reverse complement thereof or, (ii) wherein the locus is
amplifiable with a primer pair according to SEQ ID NO. 1 and 2 or
the reverse complement thereof.
[0018] In the context of the present invention, the term
"amplifiable" refers to the property of a locus of being amplified
by any amplification method. A person skilled in the art knows that
the achievement of the amplification reaction depends on the
experimental condition used.
[0019] The invention relates to a method, wherein the amplification
step is performed using at least one primer selected from one of
the groups consisting of (i) SEQ ID NO. 1 and SEQ ID NO. 2, (ii) a
reverse complement of SEQ ID NO. 1 and SEQ ID NO. 2 and (iii) a
primer that shares at least 90% sequence identity with one of the
primers with SEQ ID NO. 1 and SEQ ID NO. 2 or a reverse complement
thereof.
TABLE-US-00001 SEQ ID NO. 1 5'GAAAGGCCTCATCAGGGCTCAG 3' Downstream
primer 81 bp fragment SEQ ID NO. 2 5'TCCTCACTGGGAAACATGAGGAATGAC 3'
Upstream primer
[0020] The invention relates to a method, wherein the amplification
step is performed using a primer pair selected from one of the
groups consisting of (i) SEQ ID NO. 1 and SEQ ID NO. 2, (ii) a
reverse complement of SEQ ID NO. 1 and SEQ ID NO. 2 and (iii) a
primer that shares at least 90% sequence identity with one of the
primers with SEQ ID NO. 1 and SEQ ID NO. 2 or a reverse complement
thereof.
[0021] The sequences distributed throughout the genome are not all
exactly identical. It is important that the selected primers bind
also to the nearly identical sequences. Thus, ideally the locus
shares at least 60%, 70%, 80%, 90% or even 95% or 98% sequence
identity to a sequence according to SEQ ID NO. 3 over a stretch of
60 bp.
[0022] The locus may also be chosen from any of SEQ ID NO. 3 to 11.
Thus, if SEQ ID NO. 3 is claimed herein the same applies to 4 to
11.
TABLE-US-00002 SEQ ID NO. 3 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgaccc
(chrY: 9529589 - aagcagctgggaacacacgggGTCATTCCTCATGTTT 9529669 81
bp) CCCAGTGAGGA 3' SEQ ID NO. 4 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc
(chrY: 9509276 - caagcagctgggaacacacgggGTCATTCCTCATGTT 9509356 81
bp) TCCCAGTGAGGA 3' SEQ ID NO. 5 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc
(chrY: 9488994 - caagcagctgggaacacatgggGTCATTCCTCATGTT 9489074 81
bp) TCCCAGTGAGGA 3' SEQ ID NO. 6 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc
(chrY: 9468664 - caagcagctgggaacacacgggGTCATTCCTCATGTT 9468744 81
bp) TCCCAGTGAGGA 3' SEQ ID NO. 7 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc
(chrY: 9400130 - caagcagctgggaacacacgggGTCATTCCTCATGTT 9400210 81
bp) TCCCAGTGAGGA 3' SEQ ID NO. 8 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc
(chrY: 9379784 - caagcagctgggaacacacgggGTCATTCCTCATGTT 9379864 81
bp) TCCCAGTGAGGA 3' SEQ ID NO. 9 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc
(chrY: 9359506 - caagcagctgggaacacacgggGTCATTCCTCATGTT 9359586 81
bp) TCCCAGTGAGGA 3' SEQ ID NO. 10
5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc (chrY: 9339191 -
caagcagctgggaacacatgggGTCATTCCTCATGTT 9339271 81 bp) TCCCAGTGAGGA
3' SEQ ID NO. 11 5'GAAAGGCCTCATCAGGGCTCAGaaaggtgacc (chrY: 6247926
- caagcagctgggaacacacgggGTCATTCCTCATGTT 6248006 81 bp) TCCCAGTGAGGA
3' SEQ ID NO. 12 5'ggtgacccaagcagctgggaacaca 3' Probe for 81 bp
fragment SEQ ID NO. 13 5'CATGAACGTCCTGGATTCTGTCACTC 3' Downstream
primer no. 3 SEQ ID NO. 14 5' Downstream primer
TCACTCTCTGTCTTCCTCTCAAGGAATTTCTA no. 4 C 3' SEQ ID NO. 15
5'GCCATGAACGTCCTGGATTCTGTCAC 3' Downstream primer no. 5 SEQ ID NO.
16 5'CAGGCTCCCTGAATAGGCAGGTGTG 3' Probe for larger fragment SEQ ID
NO: 17 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13-
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9529589 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9529947)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
18 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9509276 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9509634)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
19 5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9488994 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9489352)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
20 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9468664 +
atgcgcagtataagggggttgacacacctgcctattcagggagcc 9469020)
tgggtgctcatttcagaaatgtagaaactgaggctcctttcgtacat
gtagaaattccttgagaggaagacaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
21 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9400130 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9400488)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
22 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9379784 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9380142)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
23 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9359506
atgcccagtataagggggttgacacacctgcctattcagggagcc 9359864
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
24 5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9339191 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9339549)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
25 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 13
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 6247926 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 6248284)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagaGAGTGACAGAATC CAGGACGTTCATG 3' SEQ ID NO.
26 5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcaccattctgagtcctgatgaggcctttc SEQ ID NO. 2 and
ccgatggattcccctgacagatcctatgtaaggacctgtggtgcaa Downstream primer
tcccctgcaatcctacaagaggatgaagccacctgaagaggga SEQ ID NO. 14
acagagatttcaggtgagctgttcagttggaactgaagctttttgatc Locus:chrY:9549757
+ cccaggataaggaggttgacacacctgcctattcagggagcctg 309550096)
gaggctcatttcagaaatgtagaaattgagcctcctttcatacatG
TAGAAATTCCTTGAGAGGAAGACAGAGtGTGA 3' SEQ ID NO. 27
5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9529589 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9529927
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 28
5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9509276 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9509614)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 29
5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9488994 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9489332)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 30
5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9468664 +
atgcgcagtataagggggttgacacacctgcctattcagggagcc 9469002)
tgggtgctcatttcagaaatgtagaaactgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGtGac A 3' SEQ ID NO. 31
5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9400130 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9400468)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 32
5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9379784 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9380122)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 33
5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9359506 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9359844)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 34
5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9339191 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9339529)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 35
5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 14
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 6247926 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 6248264)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacat
GTAGAAATTCCTTGAGAGGAAGACAGAGAGT GA 3' SEQ ID NO. 36
5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcaccattctgagtcctgatgaggcctttc SEQ ID NO. 2 and
ccgatggattcccctgacagatcctatgtaaggacctgtggtgcaa
Downstream primer tcccctgcaatcctacaagaggatgaagccacctgaagaggga SEQ
ID NO. 15 acagagatttcaggtgagctgttcagttggaactgaagctttttgatc
Locus:chrY: 9549757 + cccaggataaggaggttgacacacctgcctattcagggagcctg
9550118) gaggctcatttcagaaatgtagaaattgagcctcctttcatacatgt
agaaattccttgagaggaagacagagtGTGACAGAATCC AGGACaTTCATGGC 3' SEQ ID
NO. 37 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9529589 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9529949)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3' SEQ ID
NO. 38 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9509276 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9509636)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3' SEQ ID
NO. 39 5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9488994 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9489354)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3' SEQ ID
NO. 40 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9468664 +
atgcgcagtataagggggttgacacacctgcctattcagggagcc 9469022)
tgggtgctcatttcagaaatgtagaaactgaggctcctttcgtacat
gtagaaattccttgagaggaagacagaGTGACAGAATCC AGGACGTTCATGGC 3' SEQ ID
NO. 41 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9400130
atgcccagtataagggggttgacacacctgcctattcagggagcc 9400490)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3' SEQ ID
NO. 42 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9379784 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9380144)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3' SEQ ID
NO. 43 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9359506 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9359866)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3' SEQ ID
NO. 44 5'TCCTCACTGGGAAACATGAGGAATGACcccat (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 9339191 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 9339551)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3' SEQ ID
NO. 45 5'TCCTCACTGGGAAACATGAGGAATGACcccgt (Upstream primer
gtgttcccagctgcttgggtcacctttctgagccctgatgaggcctttc SEQ ID NO. 2 and
ccgattgagtcccctgacagatcctatgtaaggacctgtggcgca Downstream primer
atcccctgcaatactacaagaggatgaagccacctgaagaggg SEQ ID NO. 15
aacagagacgtcaggtgagccgttagttggcactggagctgtttg Locus:chrY: 6247926 +
atgcccagtataagggggttgacacacctgcctattcagggagcc 6248286)
tgggtgctcatttcagaaatgtagaaattgaggctcctttcgtacatg
tagaaattccttgagaggaagacagagaGTGACAGAATC CAGGACGTTCATGGC 3'
[0023] The inventors have astonishingly developed a very versatile
system for degradation analysis.
[0024] The degradation status/integrity of male DNA can be assessed
by using for example, at least two differently sized genomic
regions in a qPCR in one vessel. The amplified targets have to have
equal amplification efficiencies, causing co-amplification of the
targets with the same efficiency. In case of degraded male DNA the
mean length of the male DNA fragments in the sample will decrease
leading to a loss of efficiency in amplification of the longer PCR
systems. The shorter the fragments in the degraded male DNA sample
the higher the differences in amplification efficiencies between
the shorter and larger PCR systems will become. Hereby, the
integrity of male DNA or degradation status of the male DNA can be
expressed by a ratio of the quantification of the systems used. The
ratio is designated as degradation index. Therefore, in one aspect
of the present invention, the status of DNA integrity and/or
degradation is expressed by the ratio of the quantification of the
at least two overlapping regions within the at least one locus.
[0025] Therefore, in one aspect of the present invention, the
status of DNA integrity and/or degradation is expressed by the
ratio of the quantification of the at least two overlapping regions
within the at least one locus.
[0026] Here, the smaller fragment is combined with different larger
fragments, depending on the extent of degradation of the nucleic
acid.
[0027] The larger fragment may be a: [0028] (i) 359 bp or 357 bp
fragment (primers SEQ ID NO. 2 and SEQ ID NO. 13), [0029] (ii) a
340 bp fragment or a 339 bp fragment (e.g. primers SEQ ID NO. 2 and
SEQ ID NO. 14), or a [0030] (iii) 359 bp fragment, 361 bp fragment
or a 362 bp fragment (SEQ ID NO. 2 and SEQ ID NO. 15).
[0031] Uniquely the system is set-up so that one of the primers in
the primer pairs is common to the two or more fragments, being
amplified. Thus, the two fragments small and large may have a
common up-stream or down-stream primer. Here, it is preferred that
the upstream primer (SEQ ID NO. 2) is common to all
amplifications.
[0032] The determination of percent identity between two sequences
is accomplished using the mathematical algorithm of Karlin and
Altschul (Proc. Natl. Acad. Sci. USA (1993) 90: 5873-5877). Such an
algorithm is the basis of the BLASTN and BLASTP programs of
Altschul et al. (J. Mol. Biol. (1990) 215: 403-410). BLAST
nucleotide searches are performed with the BLASTN program,
score=100, word length=12, to obtain nucleotide sequences
homologous SEQ ID NO. 1. To obtain gapped alignments for
comparative purposes, Gapped BLAST is utilized as described by
Altschul et al. (Nucleic Acids Res. (1997) 25: 3389-3402). When
utilizing BLAST and Gapped BLAST programs, the default parameters
of the respective programs are used.
[0033] The forensic workflow of sexual assault samples suggests the
quantification of the male DNA before the STR reaction is carried
out. This is done first to help in the decision of which kind of
STR Kit has to be used for the genetic analysis, and then to
determine how much DNA was obtained from a sample, e.g. collected
from a crime scene, and how much of this DNA should be used in a
STR reaction. Different STR Kits are available, the typical STR Kit
detects genetic length polymorphisms on different autosomal
chromosomes, but in some cases, such as with sexual assault
samples, the analysis of length polymorphisms exclusively on the
Y-chromosome could be advantageous, because the female DNA doesn't
have a Y chromosome.
[0034] The typical STR reaction works optimally in certain range of
template DNA and the whole analysis is very labour-intensive,
therefore methodologies are needed that ensure a very high success
rate in the STR analysis. Therefore, it is a real advantage if the
quantification kit enables the user not only to surely identify the
amount of DNA present but also to assess the absence of inhibitors,
which could compromise the STR reaction result, which would result
in failure or loss of valuable sample material, which could be
further purified in case critical inhibition is observed.
[0035] According to one embodiment of the present invention, said
multicopy locus within the human Y-chromosome (MCL-Y) is about 81
bp in length. As used herein, the term "about" refers to a range
comprising +/-20% of the value of reference. Thus, said multicopy
locus can have a length ranging from 65 to 95 bp.
[0036] Preferably, the method comprises the step of amplification
of a multicopy locus within the Y-chromosome (MCL-Y), wherein said
locus shares at least 85%, 90%, 95% or 99% sequence identity to a
sequence according to SEQ ID NO. 3 over a stretch of at least 60
base pairs (bp) or with the reverse complement thereof.
[0037] The present method shows an improved sensibility over other
commercially available methods. In particular, according to another
embodiment the nucleic acid of a genome in a sample is detected
and/or quantified at the lowest concentration of 0.125
pg/.mu.l.
[0038] According to another embodiment of the present application,
the amplification product of at least one nucleic acid is between
60 and 200 bp in length.
[0039] Preferably, the amplification step is performed using at
least one primer selected from one of the groups consisting of (i)
SEQ ID NO. 1 and SEQ ID NO. 2, (ii) a reverse complement of SEQ ID
NO. 1 and SEQ ID NO. 2 and (iii) a primer that shares at least 90%
sequence identity with one of the primers with SEQ ID NO. 1 and SEQ
ID NO. 2 or a reverse complement thereof. These may be combined
with a second overlapping amplicon wherein the primer pairs used
have a sequence according to (iv) SEQ ID NO. 2 and SEQ ID NO. 13,
SEQ ID NO. 2 and SEQ ID NO. 14, (v) and SEQ ID NO. 2 and SEQ ID NO.
15; see also FIG. 2. When measuring additionally degradation, the
amplicon SEQ ID NO. 1 and 2 is combined with an amplicon selected
from (i) SEQ ID NO. 2 and SEQ ID NO. 13, (ii) SEQ ID NO. 2 and SEQ
ID NO. 14, or (iii) SEQ ID NO. 2 and SEQ ID NO. 15.
[0040] In a preferred embodiment the amplification reaction
comprises amplifying at least two overlapping regions using at
least one common primer, or two common primers or three common
primer or more.
[0041] Preferably, the amplification step is performed using a
primer pair selected from one of the groups consisting of (i) SEQ
ID NO. 1 and SEQ ID NO. 2, (ii) a reverse complement of SEQ ID NO.
1 and SEQ ID NO. 2, and (iii) a primer that shares at least 90%
sequence identity with one of the primers with SEQ ID NO. 1 and SEQ
ID NO. 2 or a reverse complement thereof optionally combined with
one or more of the pairs selected from (i) SEQ ID NO. 2 and SEQ ID
NO. 13, (ii) SEQ ID NO. 2 and SEQ ID NO. 14, or (iii) SEQ ID NO. 2
and SEQ ID NO. 15.
[0042] Ideally, the amplification is performed using a primer pair
with a sequence according to SEQ ID NO. 1 and SEQ ID NO. 2.
[0043] Preferably, the sample originates from one of the following
tissues types comprising whole blood, blood fractions, oral
specimen, urine, human bioptic tissue or other parts of the human
body upon availability for isolation of a genome.
[0044] The best use of the sample is, e.g. a rape case wherein,
said sample comprises male and female genomic DNA. The ratios of
the amounts may be (male/female): 1/2, 1/3, 1/4, 1/10, 1/20, 1/50,
1/100, 1/1000, 1/5000, 1/10.000 or even 1/40.000, or even
1/400.000. It may also be (female/male): 1/2, 1/3, 1/4, 1/10, 1/20,
1/50, 1/100, 1/1000, 1/5000, 1/10.000 or even 1/40.000, or even
1/400.000. The method has shown to be able to identify 1 pg of male
DNA in 400 ng of female DNA.
[0045] The present method also enables the detection and analysis
of the degradation status of male DNA in non-degraded or also
degraded female DNA.
[0046] Preferably, the amplification method is a polymerase chain
reaction (PCR) or a real-time PCR reaction and the amount of
nucleic acid determined is quantified either during the
amplification process or as an end point measurement at the end of
the amplification reaction.
[0047] At best the amplification reaction for carrying out the
method of the present invention comprises: [0048] a. Tris-HCl at a
pH of between 8 and 8.8 and/or, [0049] b. potassium salt selected
from the group of, potassium chloride and potassium sulphate
and/or, [0050] c. an ammonium salt, preferably ammonium chloride or
ammonium sulphate and/or, [0051] d. magnesium chloride and/or,
[0052] e. a hot-start polymerase.
[0053] The invention relates to an oligonucleotide primer or primer
pair, wherein at least one primer of said primer pair hybridizes
under stringent conditions to a nucleic acid with a sequence
according to SEQ ID NO. 3 to SEQ ID NO. 11 and/or 17 to 25.
Preferably, both primers hybridize under stringent conditions.
[0054] As used herein, the term "stringent conditions" refer to
conditions under which a nucleic acid having complementarity to a
target sequence predominantly hybridizes with the target sequence
and substantially does not hybridize to non-target sequences.
Stringent conditions are generally sequence-dependent, and vary
depending on a number of parameters, such as temperature, ionic
strength and the presence of other compounds such as organic
solvents, under which nucleic acid hybridizations are conducted.
The person skilled in the art is familiar with such conditions, and
thus they are not given here. Non-limiting examples of stringent
conditions are described in detail in Tijssen (1993), Laboratory
techniques in biochemistry and molecular biology--Hybridization
with nucleic acid probes Part 1, second chapter "Overview of
principles of hybridization and the strategy of nucleic acid probe
assay", Elsevier, N.Y.
[0055] The invention also encompasses an oligonucleotide primer or
primer pair for use in a method for detecting and/or quantifying
DNA, in particular the fraction of male DNA, in a sample according
to the first aspect of the present invention, wherein at least one
primer, preferably both primers, of said primer pair hybridizes
under stringent conditions to a nucleic acid with a sequence
according to SEQ ID NO. 3 to SEQ ID NO. 11 and/or 17 to 25.
[0056] Claimed are the oligonucleotides with the following
sequences SEQ ID NO. 1, 2, 12, 13, 14, 15 and 16 or
oligonucleotides that share a sequence identity of no less than,
90%, 95% or 99% to these, or the reverse complement thereof.
[0057] According to another embodiment, claimed are
oligonucleotides with the following sequences SEQ ID NO. 1, 2, 12,
13, 14, 15 and 16 or oligonucleotides that share a sequence
identity of no less than, 90%, 95% or 99% to these, or the reverse
complement thereof for use in a method for detecting and/or
quantifying DNA, in particular the fraction of male DNA, in a
sample according to the first aspect of the present invention.
[0058] Claimed is also a kit for performing a method as disclosed
herein, wherein said kit comprises at least one oligonucleotide
primer selected from the group consisting of SEQ ID NO. 1 and SEQ
ID NO. 2, or a primer as disclosed herein.
[0059] According to another embodiment, the sample subjected to the
present method originates from one of the following specimens
comprising whole blood, blood fractions, oral fluids, body fluids,
human bioptic tissue or other parts of the human body upon
availability for isolation of a genome. As used herein the terms
"oral fluids" and "body fluids" refers to fluids that are excreted
or secreted from the buccal cavity and from the body, respectively,
from which a genome can be isolated. As a non-limiting example,
oral and body fluids may comprise saliva, sputum, swab, urine.
[0060] In a preferred embodiment, the DNA or RNA analyzed is
fragmented. In another embodiment, the DNA or RNA analyzed is in a
composition with inhibitors.
[0061] As reported above, a typical forensic sample comprise a
mixture of male and female DNA wherein the amount of female DNA
exceeds the amount of male DNA by several orders of magnitude.
Thus, according to another embodiment, the sample comprises one or
more additional nucleic acids originating from a different genome.
As used herein, the term "different genome" refers to genome
isolated from a different subject, generally identified as female
DNA.
[0062] According to another embodiment of the present invention,
the amplification method is a polymerase chain reaction (PCR) or a
real-time PCR reaction and the amount of nucleic acid determined is
quantified either during the amplification process or as an end
point measurement at the end of the amplification reaction.
[0063] The amplification reaction according to the present method
may be either a non-isothermal method or an isothermal method.
[0064] The non-isothermal amplification method may be selected from
the group of polymerase chain reaction (PCR) (Saiki et al. Science
(1985) 230: 1350-1354), quantitative real-time PCR (rtPCR), ligase
chain reaction (LCR) (Landegren et al. Science (1988) 241:
1077-1080). Polymerase chain reaction amplification is
preferred.
[0065] The isothermal amplification method may be selected from the
group of helicase-dependent amplification (HDA) (Vincent et al.
EMBO Rep (2004) 5(8): 795-800), thermostable HDA (tHDA) (An et al.
J. Biol. Chem. (2005) 280(32): 28952-28958), strand displacement
amplification (SDA) (Walker et al. Nucleic Acids Res. (1992) 20(7):
1691-1696), multiple displacement amplification (MDA) (Dean et al.
Proc. Natl. Acad. Sci. USA (2002) 99(8): 5261-5266), rolling-circle
amplification (RCA) (Liu et al. J. Am. Chem. Soc. (1996) 118:
1587-1594), restriction aided RCA (Wang et al. Genome Res (2004)
14: 2357-2366), single primer isothermal amplification (SPIA)
(Dafforn et al. Biotechniques (2004), 37(5): 854-857),
transcription mediated amplification (TMA) (Vuorinen et al. J.
Clin. Microbiol. (1995) 33: 1856-1859), nicking enzyme
amplification reaction (NEAR) (Maples et al. US2009017453),
exponential amplification reaction (EXPAR) (Van Ness et al. Proc.
Natl. Acad. Sci. USA (2003) 100(8): 4504-4509), loop mediated
isothermal amplification (LAMP) (Notomi et al. Nucleic Acids Res.
(2000) 28(12): e63), recombinase polymerase amplification (RPA)
(Piepenburg et al. PloS Biol. (2006) 4(7): 1115-1120), nucleic acid
sequence based amplification (NASBA) (Kievits et al. J. Virol.
Methods (1991) 35: 273-286), smart-amplification process (SMAP)
(Mitani et al. Nat. Methods (2007) 4(3): 257-262).
[0066] By "isothermal amplification reaction" in context of the
present invention it is meant that the temperature does not
significantly change during the reaction. In a preferred
embodiment, the temperature of the isothermal amplification
reaction does not deviate by more than 10.degree. C., preferably by
not more than 5.degree. C., even more preferably not more than
2.degree. C. during the main enzymatic reaction step where
amplification takes place.
[0067] Depending on the method of isothermal amplification of
nucleic acids different enzymes are required for the amplification
reaction. Known isothermal methods for amplification of nucleic
acids are the above mentioned, wherein the at least one mesophilic
enzyme for amplifying nucleic acids under isothermal conditions is
selected from the group consisting of helicase, mesophilic
polymerases, mesophilic polymerases having strand displacement
activity, nicking enzymes, recombination proteins, ligases,
glycosylases and/or nucleases.
[0068] The amplification methods will comprise buffers, dNTPs or
NTPs in addition to the enzymes required.
[0069] As used herein, the term "dNTP" refers to
deoxyribonucleoside triphosphates. Non-limiting examples of such
dNTPs are dATP, dGTP, dCTP, dTTP, dUTP, which may also be present
in the form of labelled derivatives, for instance comprising a
fluorescent label, a radioactive label, a biotin label. dNTPs with
modified nucleotide bases are also encompassed, wherein the
nucleotide bases are for example hypoxanthine, xanthine,
7-methylguanine, inosine, xanthinosine, 7-methylguanosine,
5,6-dihydrouracil, 5-methylcytosine, pseudouridine, dihydrouridine,
5-methylcytidine. Furthermore, ddNTPs of the above-described
molecules are encompassed in the present invention.
[0070] As used herein, the term "NTP" refers to ribonucleoside
triphosphates. Non-limiting examples of such NTPs are ATP, GTP,
CTP, TTP, UTP, which may also be present in the form of labelled
derivatives, for instance comprising a fluorescent label, a
radioactive label, a biotin label.
[0071] According to another embodiment of the present invention,
the amplification reaction comprises, (a) Tris-HCl at a pH of
between 8 and 8.8 (at 20.degree. C.) and/or, (b) potassium salt
selected from the group of, potassium chloride and potassium
sulphate and/or, (c) an ammonium salt, preferably ammonium chloride
or ammonium sulphate and/or, (d) magnesium chloride and/or, (e) a
hot-start polymerase.
[0072] Preferably, the concentration of Tris-HCl is in the range
from 10 to 100 mM, most preferably in the range from 20 to 70 mM,
the concentration of K.sup.+ is in the range from 1-25 mM, most
preferred in the range from 2.5 to 20 mM, the concentration of
NH.sub.4.sup.+ in range from 1 to 40 mM, most preferred in the
range from 2.5 to 30 mM, and a concentration of Mg.sup.2+ of 0.5 mM
to 8 mM in excess to the concentration of the four dNTP's, most
preferred a concentration of Mg.sup.2+ of 0.7 mM to 5 mM in excess
to the concentration of the four dNTP's, a hot-start polymerase,
preferentially a hot-start polymerase allowing a hot-start time of
less than 5 min, most preferred below 2 min.
[0073] A second aspect of the present invention relates to a primer
or primer pair for amplifying at least one nucleic acids comprising
a multicopy locus within the human Y-chromosome (MLC-Y) selected
from the group consisting of: 5' GAAAGGCCTCATCAGGGCTCAG 3' (SEQ ID
NO 1) and 5' TCCTCACTGGGAAACATGAGGAATGAC 3' (SEQ ID NO 2).
[0074] According to an embodiment of the second aspect, at least
one primer hybridizes under stringent conditions to a region of the
Y-chromosome represented by multicopy loci according to SEQ ID NO.
3 to SEQ ID NO. 11.
[0075] According to a third aspect of the present invention, a kit
for detecting and/or quantifying human nucleic acids is disclosed,
wherein said kit comprises at least a primer, that under stringent
conditions, binds a sequence that shares at least 80% sequence
identity to a sequence according to SEQ ID NO. 3 to 11 over a
stretch of 80 bp, wherein in an amplification reaction, at least
one nucleic acid is amplified, the locus that is amplified is a
multicopy locus within the human Y-chromosome (MCL-Y). Is important
that the primer can bind at least SEQ ID NO. 3, 4, 5, 6, 7, 8, 9,
10 and/or SEQ ID NO. 11 or all of the above.
[0076] The invention further relates to a method for obtaining a
degradation index for male DNA of at least 6 when measuring
degraded DNA of 350 bp length and of at least 180 when measuring
degraded male DNA of 150 bp length and concentration of 2.3
ng/.mu.l.
[0077] Preferably in the method according to the invention, the
assessment of the status of male DNA degradation and/or integrity
of one or more nucleic acids in a sample is done in parallel with
the detection of the one or more nucleic acids that are quantified.
Preferably, the method addresses the status of male DNA degradation
and/or integrity even in the presence of high background female
DNA. In a further embodiment, the method may also be used for
non-invasive early determination of fetal sex.
[0078] The invention relates also in particular to assessing the
status of male DNA in the sample. This is done to assess the
integrity or degradation status of the male DNA in the sample.
Thus, the invention relates also to the use of the primers and/or
probes of FIG. 2 for this status analysis.
EXAMPLES
[0079] The commercially available quantification kits were set up
and analyzed as described in the respective handbooks. A serial
dilution of human DNAs (isolated from human blood from anonymous
donors using the QIAamp Investigator Kit) and mixtures thereof at
known concentrations was used as a template for all of the three
kits.
[0080] FIG. 1 shows the superiority of the present method
(Investigator Quantiplex Pro) compared to other methods available
on the market due to its increased sensitivity.
[0081] The Investigator Quantiplex Pro method provides high
accuracy to quantify all amounts of used template at their correct
concentrations, especially at the lowest concentrations of 0.125
pg/.mu.l were much more adequately quantified compared to the
Quantifiler TRIO method (based on Quantifiler TRIO Kit from Applied
Biosystems), which uses a multicopy target, and the PowerQuant
method (based on PowerQuant Kit from Promega) which also uses a
multicopy target. Quantifiler TRIO method (based on Quantifiler
TRIO Kit from Applied Biosystems showed high fluctuations below 5
pg/.mu.l and failed to quantify male DNA concentrations below 0.5
pg/.mu.l in the presence of female DNA background. The PowerQuant
method failed to quantify the male DNA fraction below 0.25 pg/.mu.l
in the presence or absence of background female DNA. 2 .mu.l of
given dilutions of the human reference DNA were used in each
reaction. DNA amounts are given in concentrations (pg/.mu.L) or as
total amount per reaction.
FIGURES
[0082] FIG. 1 shows the superiority of the present method
(Investigator Quantiplex Pro) compared to other methods available
on the market due to its increased sensitivity.
[0083] FIG. 2 shows a possible amplification set-up. It shows
different combinations of primer pairs for the amplification of a
multicopy locus within the Y-chromosome (MCL-Y).
[0084] FIG. 3 Measurement of degraded male DNA according to the
invention in humans.
[0085] The invention shows no significant increase for the Ct
values for the smallest PCR system (81 bp) for compromised DNA with
an average fragment length from 1500 bp and 500 bp. Only for 300 bp
and 150 bp there is an increase of Ct values. Surprisingly the
larger PCR system (359 bp) shows already a significant shift of Ct
values when applied on fragmented DNA of 1500 bp length.
Furthermore, the Ct values increase consistently on every further
tested fragment length from 500 bp, 300 bp, to 150 bp and reach
their maximum at 150 bp with more than 8 Ct values compared to
undegraded DNA. This allows for a precise assessment of the
degradation or integrity status of male DNA. 2.3 ng/.mu.l of male
DNA was used for every fragment size or undegraded male DNA.
[0086] FIG. 4 Degradation index generated by the invention.
[0087] Shown are the degradation indices (i.e. the ratio of the
amount of short fragments vs. the amount of long fragments (male
S/male L)) of the invention. Noticeably, the method according to
the invention (second column) obtains extremely high indices, in
particular for the small fragments (a value of almost 190, when 2.3
ng/.mu.l of male DNA was tested). This indicates a high sensitivity
for the detection of degraded male DNA.
[0088] FIG. 5 Measurement of degraded male DNA in background of
female DNA in humans.
[0089] Different fragmented male DNAs (each 0.76 ng/.mu.l) have
been spiked into non degraded female DNA (32 ng/.mu.l). The
invention shows no significant increase for the Ct values for the
smallest PCR system (81 bp) for compromised DNA with an average
fragment length for 500 bp. Only for 300 bp and 150 bp there is an
increase of Ct values. Surprisingly the larger PCR system (359 bp)
shows a significant shift of Ct values when applied on fragmented
DNA of 500 bp length. Furthermore, the Ct values increase
consistently on every further tested fragment length from 300 bp,
to 150 bp and reach their maximum at 150 bp with more than 8 Ct
values compared to undegraded DNA. This allows for a precise
assessment of the degradation or integrity status of male DNA in
female background DNA.
[0090] FIG. 6 Detection of male cell-free fetal DNA in cell-free
DNA from pregnant women.
[0091] Shown is the Degradation Index (DI) generated by applying
the invention on isolated cell free DNA from a pregnant woman. The
system is able to detect low amounts of male DNA with both PCR
systems for male targets, the small (81 bp) and the large one (359
bp). The small system detects the male cell free fetal DNA which is
sized between 150-220 bp. The large male PCR system performs
similarly to the small PCR system only on pure male genomic DNA or
on contaminating male genomic DNA (spike in controls); on male cell
free fetal DNA the performance will significantly drop due to the
size limitation of the fragments of male cell-free fetal DNA in the
cell-free DNA from pregnant women. This generates a high
Degradation Index (DI) for non-contaminated cell-free DNA from
women pregnant with a male embryo and a lower degradation index for
contaminated cell-free DNA from women pregnant with a male or
female embryo.
Sequence CWU 1
1
45122DNAArtificial SequenceSynthetic Primer 1gaaaggcctc atcagggctc
ag 22227DNAArtificial SequenceSynthetic Primer 2tcctcactgg
gaaacatgag gaatgac 27381DNAHomo sapiens 3gaaaggcctc atcagggctc
agaaaggtga cccaagcagc tgggaacaca cggggtcatt 60cctcatgttt cccagtgagg
a 81481DNAHomo sapiens 4gaaaggcctc atcagggctc agaaaggtga cccaagcagc
tgggaacaca cggggtcatt 60cctcatgttt cccagtgagg a 81581DNAHomo
sapiens 5gaaaggcctc atcagggctc agaaaggtga cccaagcagc tgggaacaca
tggggtcatt 60cctcatgttt cccagtgagg a 81681DNAHomo sapiens
6gaaaggcctc atcagggctc agaaaggtga cccaagcagc tgggaacaca cggggtcatt
60cctcatgttt cccagtgagg a 81781DNAHomo sapiens 7gaaaggcctc
atcagggctc agaaaggtga cccaagcagc tgggaacaca cggggtcatt 60cctcatgttt
cccagtgagg a 81881DNAHomo sapiens 8gaaaggcctc atcagggctc agaaaggtga
cccaagcagc tgggaacaca cggggtcatt 60cctcatgttt cccagtgagg a
81981DNAHomo sapiens 9gaaaggcctc atcagggctc agaaaggtga cccaagcagc
tgggaacaca cggggtcatt 60cctcatgttt cccagtgagg a 811081DNAHomo
sapiens 10gaaaggcctc atcagggctc agaaaggtga cccaagcagc tgggaacaca
tggggtcatt 60cctcatgttt cccagtgagg a 811181DNAHomo sapiens
11gaaaggcctc atcagggctc agaaaggtga cccaagcagc tgggaacaca cggggtcatt
60cctcatgttt cccagtgagg a 811225DNAArtificial SequenceSynthetic
Probe 12ggtgacccaa gcagctggga acaca 251326DNAArtificial
SequenceSynthetic Primer 13catgaacgtc ctggattctg tcactc
261433DNAArtificial SequenceSynthetic Primer 14tcactctctg
tcttcctctc aaggaatttc tac 331526DNAArtificial SequenceSynthetic
Primer 15gccatgaacg tcctggattc tgtcac 261625DNAArtificial
SequenceSynthetic Probe 16caggctccct gaataggcag gtgtg
2517359DNAHomo sapiens 17tcctcactgg gaaacatgag gaatgacccc
gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga tgaggccttt cccgattgag
tcccctgaca gatcctatgt aaggacctgt 120ggcgcaatcc cctgcaatac
tacaagagga tgaagccacc tgaagaggga acagagacgt 180caggtgagcc
gttagttggc actggagctg tttgatgccc agtataaggg ggttgacaca
240cctgcctatt cagggagcct gggtgctcat ttcagaaatg tagaaattga
ggctcctttc 300gtacatgtag aaattccttg agaggaagac agagagtgac
agaatccagg acgttcatg 35918359DNAHomo sapiens 18tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatg 35919359DNAHomo sapiens
19tcctcactgg gaaacatgag gaatgacccc atgtgttccc agctgcttgg gtcacctttc
60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatg 35920357DNAHomo sapiens
20tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc
60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgcgc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaactga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagtgacag aatccaggac gttcatg 35721359DNAHomo sapiens
21tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc
60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatg 35922359DNAHomo sapiens
22tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc
60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatg 35923359DNAHomo sapiens
23tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc
60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatg 35924359DNAHomo sapiens
24tcctcactgg gaaacatgag gaatgacccc atgtgttccc agctgcttgg gtcacctttc
60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatg 35925359DNAHomo sapiens
25tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc
60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatg 35926340DNAHomo sapiens
26tcctcactgg gaaacatgag gaatgacccc atgtgttccc agctgcttgg gtcaccattc
60tgagtcctga tgaggccttt cccgatggat tcccctgaca gatcctatgt aaggacctgt
120ggtgcaatcc cctgcaatcc tacaagagga tgaagccacc tgaagaggga
acagagattt 180caggtgagct gttcagttgg aactgaagct ttttgatccc
caggataagg aggttgacac 240acctgcctat tcagggagcc tggaggctca
tttcagaaat gtagaaattg agcctccttt 300catacatgta gaaattcctt
gagaggaaga cagagtgtga 34027339DNAHomo sapiens 27tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33928339DNAHomo sapiens 28tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33929339DNAHomo sapiens 29tcctcactgg
gaaacatgag gaatgacccc atgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33930339DNAHomo sapiens 30tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgcgc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaactga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagtgaca 33931339DNAHomo sapiens 31tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33932339DNAHomo sapiens 32tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33933339DNAHomo sapiens 33tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33934339DNAHomo sapiens 34tcctcactgg
gaaacatgag gaatgacccc atgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33935339DNAHomo sapiens 35tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtga 33936362DNAHomo sapiens 36tcctcactgg
gaaacatgag gaatgacccc atgtgttccc agctgcttgg gtcaccattc 60tgagtcctga
tgaggccttt cccgatggat tcccctgaca gatcctatgt aaggacctgt
120ggtgcaatcc cctgcaatcc tacaagagga tgaagccacc tgaagaggga
acagagattt 180caggtgagct gttcagttgg aactgaagct ttttgatccc
caggataagg aggttgacac 240acctgcctat tcagggagcc tggaggctca
tttcagaaat gtagaaattg agcctccttt 300catacatgta gaaattcctt
gagaggaaga cagagtgtga cagaatccag gacattcatg 360gc 36237361DNAHomo
sapiens 37tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg
gtcacctttc 60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt
aaggacctgt 120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc
tgaagaggga acagagacgt 180caggtgagcc gttagttggc actggagctg
tttgatgccc agtataaggg ggttgacaca 240cctgcctatt cagggagcct
gggtgctcat ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag
aaattccttg agaggaagac agagagtgac agaatccagg acgttcatgg 360c
36138361DNAHomo sapiens 38tcctcactgg gaaacatgag gaatgacccc
gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga tgaggccttt cccgattgag
tcccctgaca gatcctatgt aaggacctgt 120ggcgcaatcc cctgcaatac
tacaagagga tgaagccacc tgaagaggga acagagacgt 180caggtgagcc
gttagttggc actggagctg tttgatgccc agtataaggg ggttgacaca
240cctgcctatt cagggagcct gggtgctcat ttcagaaatg tagaaattga
ggctcctttc 300gtacatgtag aaattccttg agaggaagac agagagtgac
agaatccagg acgttcatgg 360c 36139361DNAHomo sapiens 39tcctcactgg
gaaacatgag gaatgacccc atgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatgg 360c 36140359DNAHomo
sapiens 40tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg
gtcacctttc 60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt
aaggacctgt 120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc
tgaagaggga acagagacgt 180caggtgagcc gttagttggc actggagctg
tttgatgcgc agtataaggg ggttgacaca 240cctgcctatt cagggagcct
gggtgctcat ttcagaaatg tagaaactga ggctcctttc 300gtacatgtag
aaattccttg agaggaagac agagtgacag aatccaggac gttcatggc
35941361DNAHomo sapiens 41tcctcactgg gaaacatgag gaatgacccc
gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga tgaggccttt cccgattgag
tcccctgaca gatcctatgt aaggacctgt 120ggcgcaatcc cctgcaatac
tacaagagga tgaagccacc tgaagaggga acagagacgt 180caggtgagcc
gttagttggc actggagctg tttgatgccc agtataaggg ggttgacaca
240cctgcctatt cagggagcct gggtgctcat ttcagaaatg tagaaattga
ggctcctttc 300gtacatgtag aaattccttg agaggaagac agagagtgac
agaatccagg acgttcatgg 360c 36142361DNAHomo sapiens 42tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatgg 360c 36143361DNAHomo
sapiens 43tcctcactgg gaaacatgag gaatgacccc gtgtgttccc agctgcttgg
gtcacctttc 60tgagccctga tgaggccttt cccgattgag tcccctgaca gatcctatgt
aaggacctgt 120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc
tgaagaggga acagagacgt 180caggtgagcc gttagttggc actggagctg
tttgatgccc agtataaggg ggttgacaca 240cctgcctatt cagggagcct
gggtgctcat ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag
aaattccttg agaggaagac agagagtgac agaatccagg acgttcatgg 360c
36144361DNAHomo sapiens 44tcctcactgg gaaacatgag gaatgacccc
atgtgttccc agctgcttgg gtcacctttc 60tgagccctga tgaggccttt cccgattgag
tcccctgaca gatcctatgt aaggacctgt 120ggcgcaatcc cctgcaatac
tacaagagga tgaagccacc tgaagaggga acagagacgt 180caggtgagcc
gttagttggc actggagctg tttgatgccc agtataaggg ggttgacaca
240cctgcctatt cagggagcct gggtgctcat ttcagaaatg tagaaattga
ggctcctttc 300gtacatgtag aaattccttg agaggaagac agagagtgac
agaatccagg acgttcatgg 360c 36145361DNAHomo sapiens 45tcctcactgg
gaaacatgag gaatgacccc gtgtgttccc agctgcttgg gtcacctttc 60tgagccctga
tgaggccttt cccgattgag tcccctgaca gatcctatgt aaggacctgt
120ggcgcaatcc cctgcaatac tacaagagga tgaagccacc tgaagaggga
acagagacgt 180caggtgagcc gttagttggc actggagctg tttgatgccc
agtataaggg ggttgacaca 240cctgcctatt cagggagcct gggtgctcat
ttcagaaatg tagaaattga ggctcctttc 300gtacatgtag aaattccttg
agaggaagac agagagtgac agaatccagg acgttcatgg 360c 361
* * * * *