Method For Reducing Differentiation Resistance Of Pluripotent Stem Cells

Abstract

In related-art methods of differentiating pluripotent stem cells into a desired cell type, there has not been established a differentiation induction method using human ES/iPS cells and being stable and highly efficient. A method of inducing differentiation into a desired cell type within a short period of time and with high efficiency by attenuating differentiation resistance of a pluripotent stem cell to generate a pluripotent stem cell that actively proceeds to a differentiated cell type has been found, and thus the present invention has been completed.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to a method of attenuating differentiation resistance of a pluripotent stem cell to a desired cell type, and more specifically, to a method of differentiating a pluripotent stem cell into a desired cell type with high efficiency and a differentiation inducer to be used for the differentiation method.

[0002] The present application claims priority from Japanese Patent Application No. 2015-211356, which is incorporated herein by reference.

BACKGROUND ART

[0003] (On Induction of Differentiation of Pluripotent Stem Cells)

[0004] Regenerative medicine using cells obtained by inducing differentiation of embryonic stem cells (ES cells) or induced pluripotent stem cells (iPS cells) is a therapeutic method for which the people have high expectations and which is desired to be realized soon. As regenerative medicine, a transplantation therapy with retinal pigment epithelial cells derived from iPS cells is fresh in memory. However, a technology for generating mature differentiated cells suited for cell transplantation rapidly and in a sufficient amount is still under development and has huge room for development.

[0005] A currently mainstream method of inducing differentiation of pluripotent stem cells into a desired cell type is a method involving sequentially adding cytokines/growth factors suited for respective differentiation stages to a medium to cause differentiation via an embryoid body and progenitor cells. This method has problems in, for example, that a culture period until differentiated cells of interest are obtained is long, that differentiation induction efficiency is not high, and that cells of different cell lineages are mixed with each other.

[0006] In recent years, attempts have been actively made to direct cell differentiation by forcibly expressing, in ES/iPS cells, one or a combination of a plurality of tissue-specifically expressed transcription factors. This differentiation induction method using transcription factors can directly induce ES/iPS cells into differentiated cells of interest, and hence is expected to be very effective means. However, even with this technique, cell differentiation induction efficiency is low. Accordingly, under the circumstances, it is difficult to obtain a sufficient amount of differentiated cells of interest required for regenerative medicine depending on the kind of cells.

[0007] In view of the foregoing, there has been a demand for development of a novel differentiation induction method for producing differentiated cells of interest from pluripotent stem cells more rapidly and more uniformly with higher efficiency.

[0008] (Current Situation of Induction of Differentiation of Pluripotent Stem Cells in Related Prior Art)

[0009] Non Patent Literatures 1 to 4, which are related art, are each directed to a system for facilitating induction of differentiation of ES/iPS cells. As an example, there is a disclosure that ES/iPS cells are induced into skeletal muscle differentiation.

CITATION LIST

Non Patent Literature

[0010] [NPL 1] Nature medicine 13: 642-648. [0011] [NPL 2] Cell stem cell 10: 610-619. [0012] [NPL 3] Mol Ther. November; 20(11): 2153-67. [0013] [NPL 4] PLoS One. 2013 Apr. 23; 8(4): e61540.

SUMMARY OF INVENTION

Problem to be Solved by Invention

[0014] In related-art methods of differentiating pluripotent stem cells into a desired cell type, there has not been established a differentiation induction method using human ES/iPS cells and being stable and highly efficient. Many attempts have been made, including a stepwise differentiation induction method based on the control of culture conditions or the addition of, for example, various cell growth factors/differentiation factors to a culture solution, but the use of complicated culture steps is a serious problem. In addition, there are also serious problems in, for example, that the speed of cell differentiation is low, and hence long-period culture is required, and that the differentiation efficiency is low, and hence it is difficult to obtain a sufficient number of required cells.

Means for Solving Problem

[0015] The inventors of the present invention have considered that the above-mentioned problems are partly due to the fact that pluripotent stem cells have a property of resisting cell differentiation by various mechanisms (stemness-maintaining property). In view of this, the inventors have found a method of inducing differentiation into a desired cell type within a short period of time and with high efficiency by attenuating differentiation resistance of a pluripotent stem cell to generate a pluripotent stem cell that actively proceeds to a differentiated cell type. Thus, the inventors have completed the present invention.

[0016] That is, the present disclosure includes the following. [0017] 1. A differentiation induction kit for differentiating a pluripotent stem cell into a desired cell type, including at least any one of the following items (1) to (5): [0018] (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced; [0019] (2) a pluripotent stem cell in which a demethylase is forcibly expressed; [0020] (3) a pluripotent stem cell and a demethylase gene; [0021] (4) a gene construct carrying a demethylase gene and a pluripotent stem cell; and [0022] (5) a pluripotent stem cell having a gene construct carrying a demethylase gene inserted into a genome thereof. [0023] 2. A differentiation induction kit according to the above-mentioned item 1, wherein the differentiation induction kit includes the above-mentioned item (1), (2), or (5). [0024] 3. A differentiation induction kit according to the above-mentioned item 1 or 2, wherein the demethylase is JMJD3. [0025] 4. A differentiation induction kit according to the above-mentioned item 1 or 2, wherein the demethylase is a demethylase containing only an enzymatically active region of JMJD3. [0026] 5. A differentiation induction kit according to the above-mentioned item 3, wherein the demethylase has an amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3. [0027] 6. A differentiation induction kit according to any one of the above-mentioned items 1 to 5, further including a transcription factor required for induction of differentiation into the desired cell type. [0028] 7. A differentiation induction kit for differentiating a pluripotent stem cell into a skeletal muscle cell, including at least any one of the following items (1) to (5): [0029] (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced, and a transcription factor MYOD1; [0030] (2) a pluripotent stem cell in which a demethylase is forcibly expressed, and a transcription factor MYOD1; [0031] (3) a pluripotent stem cell, a demethylase gene, and a transcription factor MYOD1; [0032] (4) a gene construct carrying a demethylase gene, a pluripotent stem cell, and a transcription factor MYOD1; and [0033] (5) a pluripotent stem cell having a gene construct carrying a demethylase gene inserted into a genome thereof, and a transcription factor MYOD1. [0034] 8. A differentiation induction kit for differentiating a pluripotent stem cell into a nerve cell, including at least any one of the following items (1) to (5): [0035] (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced, and transcription factors NEUROG1, NEUROG2, NEUROG3, NEUROD1, and NEUROD2; [0036] (2) a pluripotent stem cell in which a demethylase is forcibly expressed, and transcription factors NEUROG1, NEUROG2, NEUROG3, NEUROD1, and NEUROD2; [0037] (3) a pluripotent stem cell, a demethylase gene, and transcription factors NEUROG1, NEUROG2, NEUROG3, NEUROD1, and NEUROD2; [0038] (4) a gene construct carrying a demethylase gene, a pluripotent stem cell, and transcription factors NEUROG1, NEUROG2, NEUROG3, NEUROD1, and NEUROD2; and [0039] (5) a pluripotent stem cell having a gene construct carrying a demethylase gene inserted into a genome thereof, and transcription factors NEUROG1, NEUROG2, NEUROG3, NEUROD1, and NEUROD2. [0040] 9. A differentiation induction kit for differentiating a pluripotent stem cell into a liver cell, including at least any one of the following items (1) to (5): [0041] (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced, and a transcription factor HNF1A; [0042] (2) a pluripotent stem cell in which a demethylase is forcibly expressed, and a transcription factor HNF1A; [0043] (3) a pluripotent stem cell, a demethylase gene, and a transcription factor HNF1A; [0044] (4) a gene construct carrying a demethylase gene, a pluripotent stem cell, and a transcription factor HNF1A; and [0045] (5) a pluripotent stem cell having a gene construct carrying a demethylase gene inserted into a genome thereof, and a transcription factor HNF1A. [0046] 10. A method of differentiating a pluripotent stem cell into a desired cell type, including any one of the following steps (1) to (7): [0047] (1) a step of adding a demethylase gene and a transcription factor required for induction of differentiation into the desired cell type to a pluripotent stem cell; [0048] (2) a step of inserting a gene construct carrying a demethylase gene and a transcription factor gene required for induction of differentiation into the desired cell type into a genome of a pluripotent stem cell; [0049] (3) a step of inserting a gene construct carrying a demethylase gene into a genome of a pluripotent stem cell, followed by addition of a transcription factor required for induction of differentiation into the desired cell type to the cell; [0050] (4) a step of inserting a gene construct carrying a demethylase gene and a gene construct carrying a transcription factor required for induction of differentiation into the desired cell type into a genome of a pluripotent stem cell; [0051] (5) a step of adding a transcription factor required for induction of differentiation into the desired cell type to a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced; [0052] (6) a step of adding a transcription factor required for induction of differentiation into the desired cell type to a pluripotent stem cell in which a demethylase is forcibly expressed; and [0053] (7) a step of adding a demethylase and a transcription factor required for differentiation into the desired cell type to a pluripotent stem cell. [0054] 11. A method of differentiating a pluripotent stem cell according to the above-mentioned item 10, wherein the differentiation induction kit includes the above-mentioned step (1), (3), (6), or (7). [0055] 12. A method of differentiating a pluripotent stem cell according to the above-mentioned item 10 or 11, wherein the demethylase is JMJD3. [0056] 13. A method of differentiating a pluripotent stem cell according to the above-mentioned item 10 or 11, wherein the demethylase is a demethylase containing only an enzymatically active region of JMJD3. [0057] 14. A method of differentiating a pluripotent stem cell into a skeletal muscle cell, including any one of the following steps (1) to (7): [0058] (1) a step of adding a demethylase gene and a transcription factor MYOD1 to a pluripotent stem cell; [0059] (2) a step of inserting a gene construct carrying a demethylase gene and a desired transcription factor MYOD1 gene into a genome of a pluripotent stem cell; [0060] (3) a step of inserting a gene construct carrying a demethylase gene into a genome of a pluripotent stem cell, followed by addition of a transcription factor MYOD1 to the cell; [0061] (4) a step of inserting a gene construct carrying a demethylase gene and a gene construct carrying a transcription factor MYOD1 into a genome of a pluripotent stem cell; [0062] (5) a step of adding a transcription factor MYOD1 to a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced; [0063] (6) a step of adding a transcription factor MYOD1 to a pluripotent stem cell in which a demethylase is forcibly expressed; and (7) a step of adding a demethylase and a transcription factor MYOD1 to a pluripotent stem cell. [0064] 15. A method of differentiating a pluripotent stem cell into a nerve cell, including any one of the following steps (1) to (7): [0065] (1) a step of adding a demethylase gene and a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2 to a pluripotent stem cell; [0066] (2) a step of inserting a gene construct carrying a demethylase gene and a desired transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2 gene into a genome of a pluripotent stem cell; [0067] (3) a step of inserting a gene construct carrying a demethylase gene into a genome of a pluripotent stem cell, followed by addition of a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2 to the cell; [0068] (4) a step of inserting a gene construct carrying a demethylase gene and a gene construct carrying a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2 into a genome of a pluripotent stem cell; [0069] (5) a step of adding a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2 to a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced; [0070] (6) a step of adding a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2 to a pluripotent stem cell in which a demethylase is forcibly expressed; and [0071] (7) a step of adding a demethylase and a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2 to a pluripotent stem cell. [0072] 16. A method of differentiating a pluripotent stem cell into a liver cell, including any one of the following steps (1) to (7): [0073] (1) a step of adding a demethylase gene and a transcription factor HNF1A to a pluripotent stem cell; [0074] (2) a step of inserting a gene construct carrying a demethylase gene and a desired transcription factor HNF1A gene into a genome of a pluripotent stem cell; [0075] (3) a step of inserting a gene construct carrying a demethylase gene into a genome of a pluripotent stem cell, followed by addition of a transcription factor HNF1A to the cell; [0076] (4) a step of inserting a gene construct carrying a demethylase gene and a gene construct carrying a transcription factor HNF1A into a genome of a pluripotent stem cell; [0077] (5) a step of adding a transcription factor HNF1A to a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced; [0078] (6) a step of adding a transcription factor HNF1A to a pluripotent stem cell in which a demethylase is forcibly expressed; and [0079] (7) a step of adding a demethylase and a transcription factor HNF1A to a pluripotent stem cell. [0080] 17. A method of differentiating a pluripotent stem cell according to any one of the above-mentioned items 10 to 13, wherein the transcription factor required for induction of differentiation into the desired cell type is TCF-1, and the desired cell type is a hepatoblast. [0081] 18. A method of differentiating a pluripotent stem cell according to any one of the above-mentioned items 10 to 13, wherein the transcription factor required for induction of differentiation into the desired cell type is SOX9, and the desired cell type is a chondrocyte. [0082] 19. A method of differentiating a pluripotent stem cell according to any one of the above-mentioned items 10 to 13, wherein the transcription factor required for induction of differentiation into the desired cell type is RUNX3, and the desired cell type is an osteoblast.

Advantageous Effects of Invention

[0083] The method of differentiating a pluripotent stem cell into a desired cell type with high efficiency and differentiation induction kit for differentiating a pluripotent stem cell into a desired cell type with high efficiency of the present disclosure have at least any one of the following effects.

(1) The period of time required for cell differentiation starting with the pluripotent stem cell is shortened and/or the differentiation induction efficiency is improved. (2) As modified synthetic mRNA for a gene is used to introduce the gene into the pluripotent stem cell, the introduced gene is not integrated into the genome of the pluripotent stem cell, with the result that there is no risk of canceration or the like after cell differentiation induction. (3) In the introduction of the gene into the pluripotent stem cell using the modified synthetic mRNA, the timing and number of times of the addition of the mRNA for the gene can be easily changed, and hence optimal conditions specific to each of various desired cell types can be selected so as to differentiate the pluripotent stem cell into the desired cell types.

BRIEF DESCRIPTION OF DRAWINGS

[0084] FIG. 1A: A schematic diagram of a method of attenuating differentiation resistance of a pluripotent stem cell to a desired cell type of the present disclosure. FIG. 1B: When H3K27me3 in a human ES or iPS cell is attenuated or removed, a transcription factor (TF) binds to the promoter site of a downstream gene to enhance the expression of a group of development/differentiation-related genes, resulting in differentiation. FIG. 1C: A method of inducing differentiation of a human ES cell or an iPS cell by introducing modified synthetic mRNA for a demethylase, and then introducing modified synthetic mRNA for the transcription factor (TF). FIG. 1D: A method of inducing differentiation of a human ES cell or an iPS cell by simultaneously introducing the modified synthetic mRNAs for the demethylase and the transcription factor (TF).

[0085] FIG. 2: A schematic view of a differentiation induction method using modified synthetic mRNA for a target gene.

[0086] FIG. 3: A schematic view of a differentiation step using modified synthetic mRNA for a target gene.

[0087] FIG. 4: A method of introducing a target gene into the genome of a pluripotent stem cell.

[0088] FIGS. 5A-5H: The generation of H3K27me3-attenuated hESCs by JMJD3c expression. FIG. 5A: The structures of full-length JMJD3 (JMJD3f) and JMJD3c proteins. JMJD3c was designed to contain the JmjC domain (amino acids 1376 to 1484) having demethylase activity. FIG. 5B: hESCs were transfected with modified synthetic mRNA for human influenza virus hemagglutinin (HA)-tagged full-length JMJD3 (HA-JMJD3f) or HA-tagged JMJD3c (HA-JMJD3c), and were stained with an anti-HA antibody and an anti-H3K27me3 antibody. The arrowheads indicate the transfected cells.

[0089] FIG. 5C: The effects of transfection of the HA-JMJD3f and HA-JMJD3c mRNAs on H3K27me3 were analyzed by an immunoblotting method. Modified synthetic mRNA for a green fluorescent protein Emerald (Em) was transfected as a control. An anti-H3 antibody was used as a loading control. FIG. 5D: A plasmid vector for tet-on induction of JMJD3c in hESCs (JMJD3c-hESCs). FIG. 5E: JMJD3c-hESCs were stained with 5-bromo-4-chloro-3-indolyl-.beta.-D-galactopyranoside (X-gal) 3 days after doxycycline (Dox) treatment. FIG. 5F: HA-JMJD3c-induced H3K27me3 demethylation was detected 1 day to 3 days after DOX treatment.

[0090] FIG. 5G: A point mutation in a JMJD3c mutant (mut) was introduced at amino acid 1390 for demethylase inactivation. FIG. 5H: Confirmation of the influences of HA-JMJD3c and HA-JMJD3c mut on H3K27me3.

[0091] FIGS. 6A-6C: Development/differentiation-related genes whose gene expression are upregulated in JMJD3-hESCs. FIG. 6A: Morphologies of JMJD3-hESCs without Dox treatment (-JMJD3c) and with Dox treatment (+JMJD3c). FIG. 6B: Changes in H3K27me3 and H3K4me3 after Dox treatment (Day 0 to Day 3) were analyzed by ChIP-qPCR. POU5F1 and NANOG are stem cell genes, and T, MX1, SOX17, FOXA2, GATA4, GATA6, GSC, and EVX1 are mesendodermal differentiation-related genes. n=2 or 3. *P<0.05. The error bars indicate the standard error of the mean (SEM). FIG. 6C: qRT-PCR analyses for showing relative expression of stem cell genes and mesendodermal differentiation-related genes under differentiation conditions as compared with hESCs. Basal Medium represents a medium without cytokines and growth factors, activin A represents a medium for endodermal differentiation, activin A+BMP4+bFGF represents a medium for mesodermal differentiation, and JMJD3c represents a medium with Dox (forced expression of JMJD3c). The expression levels were normalized to the expression amount of glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

[0092] FIGS. 7A-7G: JMJD3c facilitates MYOD1-mediated muscle differentiation of hESCs. FIG. 7A: A schematic of a differentiation protocol. JMJD3c-hESCs were treated with or without Dox on from Day 1 to Day 2 after plating and were transfected with synthetic mRNA for MYOD1 or Emerald three times on from Day 2 to Day 3. The cells were collected on Day 5. FIG. 7B: RT-qPCR analyses of muscle differentiation-related genes in MYOD1-differentiated cells with Dox treatment (+JMJD3c) or without Dox treatment (-JMJD3c). - represents no transfection, Em represents Emerald transfection, and MYOD1 represents MYOD1 transfection. The expression levels were normalized to GAPDH. n=3. The error bars indicate the SEM. FIG. 7C: ChIP-qPCR analyses of H3K27me3, H3K4me3, and H3K27ac in the promoter regions of MYOG and MEF2C genes of MYOD1-transfected cells with Dox treatment (+JMJD3c) or without Dox treatment (-JMJD3c). For the promoter regions of the MYOG and MEF2C genes, two regions (FIGS. 7A to 7C) and three regions (FIG. 7A, 7B) were tested, respectively. GAPDH, POU5F1, and T each represent a positive control, and SOX1 represents a negative control. n=2 or 3. P<0.05. The error bars indicate the SEM. FIG. 7D: Immunostaining for myosin heavy chain isoform (MHC) in the cells in which JMJD3c, MYOD1, or JMJD3c+MYOD1 are forcibly expressed. FIG. 7E: The percentage of nuclei contained within MHC-stained cells. n=3. *P<0.01. The error bars indicate SEM. FIG. 7F: Immunostaining for MHC in the MYOD1-transfected cells in which JMJD3c or the JMJD3c mutant is forcibly expressed. FIG. 7G: The percentage of nuclei contained within MHC-stained cells. n=3. *P<0.01. The error bars indicate the SEM. FIGS. 8A-8G: Differentiation of hESCs and iPSCs into skeletal muscle cells by transfection of a demethylase and a transcription factor as synthetic mRNAs. FIG. 8A: A schematic of a differentiation induction protocol. hESC/iPSCs were transfected with synthetic mRNAs for JMJD3c or a red fluorescent protein mCherry twice on Day 1 and Day 2 and MYOD1 three times on Day 2 and Day 3. The cells were fixed for immunostaining on Day 5. FIG. 8B: Immunostaining for MHC in cells that were transfected with MYOD1 after mCherry or JMJD3c transfection. FIG. 8C: The percentage of nuclei contained within MHC-stained cells. n=3. *P<0.01. The error bars indicate the SEM. FIG. 8D: Representative staining images for showing muscular fusion (arrowheads). FIG. 8E: Induced myogenic cells were labeled with green fluorescence and cocultured with mouse C2C12 cells having nuclei labeled with red fluorescence. On Day 3 and Day 5 after coculturing, cell fusions were detected (arrowheads). FIG. 8F: iPSCs were transfected with mCherry or JMJD3c, followed by MYOD1, and were immunostained for MHC. FIG. 8G: The percentage of nuclei contained within MHC-stained cells. n=3. *P<0.01. The error bars indicate the SEM.

[0093] FIG. 9: Increases in expression of marker genes for hepatoblasts (TCF-1), chondrocytes (SOX9), and osteoblasts (RUNX3) through expression of respective transcription factors TCF-1, SOX9, and RUNX3 in combination with JMJD3c. AFP is a marker gene for hepatoblasts, COL2 is a marker gene for chondrocytes, and COL1A1 is a marker gene for osteoblasts. The expression levels were standardized to GAPDH. n=2. *P<0.05. The error bars indicate the SEM.

DESCRIPTION OF EMBODIMENTS

[0094] A method of inducing differentiation of a pluripotent stem cell into a desired cell type with high efficiency of the present disclosure (hereinafter sometimes referred to as "method of the present disclosure") is described below, though the method is not particularly limited as long as the method can attenuate differentiation resistance of a pluripotent stem cell to the desired cell type.

[0095] (Pluripotent Stem Cell)

[0096] The pluripotent stem cell to be used in the method of the present disclosure is not particularly limited, but is preferably derived from a mammal, more preferably derived from a human. The pluripotent stem cell is, for example, a human ES cell, a human iPS cell, or any combination thereof, is not particularly limited, and encompasses tissue stem cells derived from tissues and organs, dermal fibroblasts, and all kinds of cells derived from tissues or organs.

[0097] (Attenuating Differentiation Resistance of Pluripotent Stem Cell to Desired Cell Type)

[0098] In pluripotent stem cells, a special chromatin structure called a "bivalent domain" is formed in each promoter region of a group of genes involved in differentiation, and under a stemness-maintaining state, the group of genes involved in development/differentiation are in a standby state so as not to be easily expressed. In Examples of the present disclosure, it has been confirmed that "when a methyl group modification of a histone called H3K27me3 is removed or reduced in the "bivalent domain", the expression of differentiation genes required for induction of differentiation into the desired cell type is rapidly and efficiently facilitated" (see FIGS. 1A-1D).

[0099] That is, the "attenuating differentiation resistance of a pluripotent stem cell to a desired cell type" of the present disclosure means that the H3K27me3 modification of the pluripotent stem cell is substantially removed or reduced.

[0100] In addition, a state in which the H3K27me3 modification of the pluripotent stem cell has been substantially removed or reduced may be confirmed by a comparison to the degree of the H3K27me3 modification of a pluripotent stem cell that has not been subjected to the removing or the reducing. For example, the state (degree) in which the H3K27me3 modification of the pluripotent stem cell has been substantially removed or reduced is from 95 to 1, from 90 to 2, from 85 to 3, from 80 to 4, from 75 to 5, from 70 to 6, from 65 to 7, from 60 to 8, from 50 to 10, from 40 to 20, about 30, or 50 or less, 40 or less, 30 or less, 20 or less, or 10 or less when compared to the degree of the H3K27me3 modification of the pluripotent stem cell that has not been removed or reduced, which is defined as 100. The degree of the H3K27me3 modification of the pluripotent stem cell may be easily measured by using a commercially available anti-Histone H3K27me3 antibody, and the gene expression amount of H3K27me3 may be measured by a method known per se.

[0101] (Method of inducing Differentiation of Pluripotent Stem Cell into Desired Cell Type with High Efficiency of the Present Disclosure)

[0102] As described above, the method of the present disclosure is not particularly limited as long as the method can attenuate differentiation resistance of the pluripotent stem cell to the desired cell type, and may be exemplified by the following.

[0103] (Use of Modified Synthetic mRNA for Target Gene)

[0104] The method of the present disclosure includes adding (introducing, transfecting), to a pluripotent stem cell, a gene for a compound having an action of substantially removing or reducing H3K27me3 modification, and a gene for a transcription factor required for induction of differentiation of the pluripotent stem cell into the desired cell type.

[0105] The term "gene" as used herein encompasses not only double strands, but also their respective constituent single strands, such as plus strands (or sense strands) or complementary strands (or antisense strands), linear nucleic acids, and circular nucleic acids, and encompasses DNA, RNA, mRNA, cDNA, and the like, unless otherwise stated.

[0106] In addition, the term "target gene" is meant to encompass both or any one of the gene for the compound having an action of substantially removing or reducing H3K27me3 modification and the transcription factor required for induction of differentiation into the desired cell type.

[0107] In a step of the method of the present disclosure, a method known per se may be used without any particular limitation as a method of adding (introducing, transfecting) the gene for the compound having an action of substantially removing or reducing H3K27me3 modification and/or the transcription factor required for induction of differentiation into the desired cell type to the pluripotent stem cell. There is preferably used a method of inducing differentiation by efficiently introducing synthetic mRNA for a transcription factor into human pluripotent stem cells through use of a gene expression method involving using synthetic mRNA developed by Warren, Rossi, et al. (reference: Cell Stem Cell 7: 618-630, 2010.), which is a footprint-free forced gene expression method causing no gene integration into a host genome (see FIG. 2).

[0108] The timing at which the gene for the compound having an action of substantially removing or reducing H3K27me3 modification and the transcription factor required for induction of differentiation into the desired cell type are added to the pluripotent stem cell is not particularly limited, but it is preferred that the gene for the compound having an action of substantially removing or reducing H3K27me3 modification be added to the pluripotent stem cell before the addition of the transcription factor required for differentiation induction.

[0109] Further, with regard to the addition timing of each gene (mRNA), the addition may be performed, for example, one or more times, preferably two to five times, two to four times, two or three times, or two times every 12 hours to 64 hours, but the addition timing is not particularly limited thereto.

[0110] A more specific method may be exemplified by the following. (Synthesis of Modified mRNA encoding Amino Acid Sequence of Transcription Factor)

[0111] Modified mRNA is synthesized with reference to a method described in the literature "Warren et al., Cell Stem Cell, 2010 Nov. 5; 7 (5): 618-30." More detailed, mRNA is synthesized by in vitro transcription using a mixture of dNTPs (dNTPs: 3-0-Me-m7G (5')ppp(5')GARCA cap analog, 5-methylcytidine triphosphate, and pseudouridine triphosphate) obtained by modifying template DNA encoding the amino acid sequence of the transcription factor required for induction of differentiation into the desired cell type.

[0112] (Generation of Sendai Virus Vector encoding Amino Acid Sequence of Transcription Factor)

[0113] In order to express a mammalian (in particular, human) transcription factor, a Sendai virus vector capable of expressing a human transcription factor is preferably used. In particular, a mutant of a Sendai virus vector, such as an F protein-deficient mutant, has no infectivity, and is easy to handle (see Inoue et al., J Virol. 77: 23238-3246, 2003).

[0114] (Method of inducing Differentiation of Pluripotent Stem Cell into Desired Cell Type with High Efficiency)

[0115] A single transcription factor or a cocktail of two or more transcription factors required for induction of differentiation into the desired cell type is prepared. The form of the transcription factors is not particularly limited, and may be any of synthetic mRNAs, a Sendai virus vector having incorporated therein a transcription factor (or a plurality of transcription factors), and nanoparticle capsules containing synthetic mRNAs.

[0116] A method of introducing the single transcription factor or cocktail of two or more transcription factors described above into cells is not particularly limited, and transfection with Lipofectamine, viral infection, or the like is utilized. A schematic view of the differentiation induction step of the method of the present disclosure is illustrated in FIG. 3.

[0117] (Use of Expression Vector)

[0118] In a step of the method of the present disclosure, an expression vector known per se having introduced therein the gene for the compound having an action of substantially removing or reducing H3K27me3 modification and/or the transcription factor required for induction of differentiation into the desired cell type may be used. Examples of the expression vector to be used in the present disclosure may include, but not particularly limited to, an animal cell expression plasmid vector and a Sendai virus vector.

[0119] A method of introducing the synthetic mRNA and the expression vector into the pluripotent stem cell is not particularly limited, for examples thereof may include a lipofection method, a liposome method, an electroporation method, a calcium phosphate coprecipitation method, a diethylaminoethyl (DEAE)-dextran method, a microinjection method, and a gene gun method. A particularly preferred example is a lipofection method.

[0120] Another method may involve using an expression vector for the gene for the compound having an action of substantially removing or reducing H3K27me3 modification, and using synthetic mRNA for the transcription factor required for induction of differentiation into the desired cell type, or may adopt the opposite pattern.

[0121] (Compound having Action of substantially removing or reducing H3K27Me3 Modification)

[0122] The compound having an action of substantially removing or reducing H3K27me3 modification of the present disclosure is not particularly limited, and is, for example, a demethylase (in particular, a demethylase having an action of removing a methyl group of H3K27me3), an antibody that specifically binds to H3K27me3, an antibody for a Polycomb-group proteins (PcG proteins) having an H3K27me3 modification action, small interfering RNA (siRNA), or an inhibitor.

[0123] In addition, not only by using those compounds alone, but also by using a plurality of kinds of compounds and/or a low-molecular-weight compound in combination, it is possible to efficiently "attenuate differentiation resistance of a pluripotent stem cell to a desired cell type (substantially remove or reduce H3K27me3 modification of a pluripotent stem cell)."

[0124] Examples of the low-molecular-weight compound may include, but not particularly limited to, histone deaceylase (HDAC) inhibitors, such as valproic acid.

[0125] Examples of the demethylase include AOF (LSD1), AOF1 (LSD2), FBXL11 (JHDM1A), Fbxl10 (JHDM1B), FBXL19 (JHDM1C), KIAA1718 (JHDM1D), PHF2 (JHDM1E), PHF8 (JHDM1F), JMJD1A(JHDM2A), JMJD1B(JHDM2B), JMJD1C (JHDM2C), JMJD2A (JHDM3A), JMJD2B (JHDM3B), JMJD2C (JHDM3C), JMJD2D (JHDM3D), RBP2 (JARID1A), PLU1 (JARID1B), SMCX (JARID1C), SMCY (JARID1D), Jumonji (JARID2), UTX(UTX), UTY(UTY), JMJD3 (JMJD3), JMJD4 (JMJD4), JMJD5(JMJD5), JMJD6(JMJD6), JMJD7(JMJD7), and JMJD8(JMJD8). Of those, JMJD3 or the like is preferred as a demethylase having an action of removing a methyl group of H3K27me3.

[0126] In addition, the demethylase of the present disclosure may also include the following: [0127] (1) a protected derivative, sugar chain-modified product, acylated derivative, or acetylated derivative of any one of the demethylases described above; [0128] (2) an enzyme that has 90% (or 92%, 94%, 96%, 98%, or 99%) or more homology to any one of the demethylases described above and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the demethylase; and [0129] (3) an enzyme that has 100 to 10, 50 to 30, 40 to 20, 10 to 5, or 5 to 1 amino acid substituted, deleted, inserted, and/or added in any one of the demethylases described above and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the demethylase.

[0130] Further, the gene of the demethylase of the present disclosure includes the following: [0131] (1) a gene encoding a polypeptide formed of the amino acid sequence of any one or more of the enzymes described above; [0132] (2) a gene encoding a polypeptide that has 1 to 20 (or 1 to 15, 1 to 10, 1 to 7, 1 to 5, or 1 to 3) amino acids substituted, deleted, inserted, and/or added in the amino acid sequence of any one or more of the enzymes described above and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the demethylase; and [0133] (3) a gene encoding a polypeptide that has 90% (or 92%, 94%, 96%, 98%, or 99%) or more homology to the amino acid sequence of any one or more of the enzymes described above and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the demethylase.

[0134] An enzyme having a mutation may be a naturally occurring one, or may be one obtained by introducing a mutation on the basis of a gene of natural origin. Means for introducing a mutation is known per se, and for example, a site-directed mutagenesis method, a homologous gene recombination method, a primer extension method, a polymerase chain reaction (hereinafter abbreviated as PCR), and the like may be used alone or in combination thereof as appropriate.

[0135] The method may be performed in conformity with any of methods described in the literatures ("Molecular Cloning: A Laboratory Manual, second edition" edited by Sambrook et al., 1989, Cold Spring Harbor Laboratory; and "Lab Manual: Genetic Engineering" edited by Masami Muramatsu, 1988, Maruzen), or by modifying these methods, and Ulmer's technology (Ulmer, K. M., "Science", 1983, volume 219, p. 666-671) may also be utilized. In the case of a peptide, from the viewpoint of preventing alteration of basic properties of the peptide (e.g., physical properties, function, physiological activity, or immunological activity) in the introduction of a mutation, for example, mutual substitution between homologous amino acids (e.g., polar amino acids, non-polar amino acids, hydrophobic amino acids, hydrophilic amino acids, positively charged amino acids, negatively charged amino acids, and aromatic amino acids) is easily conceivable.

[0136] (JMJD3)

[0137] JMJD3 is known as a demethylase for H3K27me3 of a histone (mouse NP 001017426, human NP 001073893), and even in its full length (NP 001073893, SEQ ID NO: 1), has an action of substantially removing or reducing the H3K27me3 modification of pluripotent stem cells. However, in Example 1 of the present disclosure, it has been confirmed that JMJD3c having the JmjC domain {SEQ ID NO: 2, catalytic domain: SEQ ID NO: 3 (amino acids 1376-1484)} has a stronger action of substantially removing or reducing H3K27me3 modification as compared to full-length JMJD3 (see Example 2).

[0138] In addition, the JMJD3 of the present disclosure encompasses the following embodiments as well: [0139] (1) a protected derivative, sugar chain-modified product, acylated derivative, or acetylated derivative of an amino acid sequence set forth in SEQ ID NO: 1; [0140] (2) an amino acid sequence that has 90% (or 92%, 94%, 96%, 98%, or 99%) or more homology to the amino acid sequence set forth in SEQ ID NO: 1 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the JMJD3; [0141] (3) an amino acid sequence that has 100 to 10, 50 to 30, 40 to 20, 10 to 5, or 5 to 1 amino acid substituted, deleted, inserted, and/or added in the amino acid sequence set forth in SEQ ID NO: 1 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the JMJD3; [0142] (4) a protected derivative, sugar chain-modified product, acylated derivative, or acetylated derivative of an amino acid sequence set forth in SEQ ID NO: 2; [0143] (5) an amino acid sequence that has 90% (or 92%, 94%, 96%, 98%, or 99%) or more homology to the amino acid sequence set forth in SEQ ID NO: 2 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the JMJD3c; [0144] (6) an amino acid sequence that has 100 to 10, 50 to 30, 40 to 20, 10 to 5, or 5 to 1 amino acid substituted, deleted, inserted, and/or added in the amino acid sequence set forth in SEQ ID NO: 2 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the JMJD3c; [0145] (7) a protected derivative, sugar chain-modified product, acylated derivative, or acetylated derivative of an amino acid sequence set forth in SEQ ID NO: 3; [0146] (8) an amino acid sequence that has 90% (or 92%, 94%, 96%, 98%, or 99%) or more homology to the amino acid sequence set forth in SEQ ID NO: 3 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the JMJD3; [0147] (9) an amino acid sequence that has 100 to 10, 50 to 30, 40 to 20, 10 to 5, or 5 to 1 amino acid substituted, deleted, inserted, and/or added in the amino acid sequence set forth in SEQ ID NO: 3 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to the JMJD3; and [0148] (10) an amino acid sequence that includes the amino acid sequence set forth in SEQ ID NO: 3 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to the JMJD3c.

[0149] It is appropriate that the "sequence homology" be generally 70% or more, preferably 80%, more preferably 85% or more, still more preferably 90% or more, even more preferably 95% or more, most preferably 98% or more of an entire amino acid sequence.

[0150] Further, the JMJD3 gene of the present disclosure encompasses the following: [0151] (1) a gene encoding a polypeptide formed of an amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3; [0152] (2) a gene encoding a polypeptide that has 1 to 20 (or 1 to 15, 1 to 10, 1 to 7, 1 to 5, or 1 to 3) amino acids substituted, deleted, inserted, and/or added in the amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3; [0153] (3) a gene encoding a polypeptide that has 90% (or 92%, 94%, 96%, 98%, or 99%) or more homology to the amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3 and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3; [0154] (4) a gene formed of a base sequence set forth in any one of SEQ ID NOS: 4 to 6; [0155] (5) a gene encoding a polypeptide that hybridizes with a base sequence complementary to the base sequence set forth in any one of SEQ ID NOS: 4 to 6 under stringent conditions and has a substantially equivalent action of substantially removing or reducing H3K27me3 modification to that of the amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3; [0156] (6) a gene that has a sequence of 1 to 50 (or 1 to 40, 1 to 30, 1 to 20, 1 to 15, 1 to 10, 1 to 5, or 1 to 3 bases substituted, deleted, inserted, and/or added in the gene (DNA) formed of the base sequence set forth in any one of SEQ ID NOS: 4 to 6; and [0157] (7) a gene having 90% (or 92%, 94%, 96%, 98%, or 99%) or more homology to the gene formed of the base sequence set forth in any one of SEQ ID NOS: 4 to 6.

[0158] (Transcription Factor required for Highly Efficient Induction of Differentiation into Desired Cell Type)

[0159] The form of the "transcription factor required for highly efficient induction of differentiation into the desired cell type" to be used in the method of the present disclosure is not particularly limited, for examples thereof may include, but not particularly limited to, nucleic acids, such as RNA and DNA, synthetic nucleic acids, and proteins. The following examples may be given.

[0160] In addition, in the method of the present disclosure, examples of the desired cell type may include a skeletal muscle (skeletal muscle cells), the liver (liver cells), and nerve (nerve cells).

[0161] {Transcription Factor required for Induction of Differentiation into Skeletal Muscle (in particular, Cells present in Skeletal Muscle)}

[0162] A method of inducing differentiation into a skeletal muscle is as described below.

[0163] A single transcription factor, or two or more transcription factors selected from the group consisting of MYOD1, NRF1, SALL4, ZIC1, KLF9, ZNF281, CTCF, HES1, HOXA2, TBX5, TP73, ERG, MAB21L3, PRDM1, NFIC, CTCFL, FOXP1, HEY1, PITX2, JUNB, KLF4, ESX1, TFAP2C, FOS, TFE3, FOSL1, GRHL2, TBX2, NFIB, and IRF4 are introduced into a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced.

[0164] In particular, the JMJD3c gene (SEQ ID NO: 80) and MYOD1 (myogenic differentiation 1: SEQ ID NO: 86, SEQ ID NO: 88) are added to pluripotent stem cells known per se.

[0165] {Transcription Factor required for Induction of Differentiation into Liver (in particular, Cells present in Liver, i.e., Liver Cells or Hepatoblasts)}

[0166] A method of inducing differentiation into the liver (in particular, the liver, liver cells, or the fetal liver) is as described below.

[0167] Liver: A single transcription factor, or two or more transcription factors selected from TCF-1, SALL4, TGIF1, MAB21L3, ZIC1, EGFLAM, PITX2, HNF4A, NRF1, ZNF281, CTCFL, TP73, TFE3, DLX6, and TCF4 are introduced into human pluripotent stem cells.

[0168] Fetal liver: A single transcription factor, or two or more transcription factors selected from TCF-1, SIX5, HNF4A, SIN3A, ID1, and HNF1A are introduced into human pluripotent stem cells.

[0169] In particular, the JMJD3c gene (SEQ ID NO: 80) and HNF1A (hepatocyte nuclear factor 1, alpha: SEQ ID NO: 87, SEQ ID NO: 94) are added to pluripotent stem cells known per se.

[0170] {Transcription Factor required for Induction of Differentiation into Neural Cells (in particular, Motoneurons or Peripheral Motoneuron Cells)}

[0171] A method of inducing differentiation into neural cells (in particular, motoneurons or peripheral motoneuron cells) is as described below.

[0172] A single transcription factor, or two or more, three or more, or four or more transcription factors selected from NEUROG1 (neurogenin 1: SEQ ID NO: 81), NEUROG2 (neurogenin 2: SEQ ID NO: 82), NEUROG3 (neurogenin 3: SEQ ID NO: 83), NEUROD1 (neurogenic differentiation 1: SEQ ID NO: 84), and NEUROD2 (neurogenic differentiation 2: SEQ ID NO: 85) or all of these transcription factors are introduced into human pluripotent stem cells.

[0173] In particular, the JMJD3c gene (SEQ ID NO: 80), and NEUROG1 (SEQ ID NO: 81, SEQ ID NO: 89), NEUROG2 (SEQ ID NO: 82, SEQ ID NO: 90), NEUROG3 (SEQ ID NO: 83, SEQ ID NO: 91), NEUROD1 (SEQ ID NO: 84, SEQ ID NO: 92), and NEUROD2 (SEQ ID NO: 85, SEQ ID NO: 93) are added to pluripotent stem cells known per se.

[0174] (Method of introducing Target Gene into Genome of Pluripotent Stem Cell)

[0175] In a step of the method of the present disclosure, a method known per se may be used without any particular limitation as a method of introducing the gene for the compound having an action of substantially removing or reducing H3K27me3 modification and/or the transcription factor required for highly efficient induction of differentiation into the desired cell type into the genome of the pluripotent stem cell. There may be preferably used an expression cassette inserted between PiggyBac transposase recognition sequences (PB sequences) developed by Woltjen et al. (reference: Nature 458: 766-770, 2009.), which is a mechanism by which a gene to be introduced is actively incorporated into pluripotent stem cells (in particular, the genome of human ES cells). The expression cassette is a system capable of efficiently establishing a genetically modified pluripotent stem cell line by introducing a drug selection cassette (see FIG. 4).

[0176] (Method of introducing Target Protein into Pluripotent Stem Cell)

[0177] In a step of the method of the present disclosure, a method known per se may be used as a method of introducing the compound (in particular, protein) having an action of substantially removing or reducing H3K27me3 modification and/or the transcription factor (protein) required for highly efficient induction of differentiation into the desired cell type into the genome of the pluripotent stem cell, and examples thereof may include: a method involving using a protein transfection reagent; a method involving using a fusion protein having added thereto a cell-penetrating peptide; and a microinjection method.

[0178] The "cell membrane permeable peptide" of the present disclosure is a peptide having a property of migrating into a cell, more specifically a property of permeating a cell membrane, still more specifically a property of permeating a cell membrane or a nuclear membrane to permeate into cytoplasm or a nucleus. The amino acid sequence of the peptide is not particularly limited, but examples thereof may include TAT (GRKKRRQRRRPQ: SEQ ID NO: 7), r8 {rrrrrrrr (D-form-R): SEQ ID NO: 8}, and MPG-8 ((3AFLGWLGAWGTMGWSPKKKRK: SEQ ID NO: 9).

[0179] The target protein encompasses both of the compound (in particular, protein) having an action of substantially removing or reducing H3K27me3 modification and/or the transcription factor (protein) required for highly efficient induction of differentiation into the desired cell type.

[0180] (Differentiation Induction Kit for inducing Differentiation of Pluripotent Stem Cell into Desired Cell Type with High Efficiency)

[0181] A differentiation induction kit for inducing differentiation of a pluripotent stem cell into a desired cell type with high efficiency of the present disclosure (hereinafter sometimes referred to as "kit of the present disclosure") includes any one or more of the following embodiments.

[0182] (1) Pluripotent Stem Cell in which H3K27me3 Modification has been substantially removed or reduced

[0183] A pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced can be easily generated by the method of the present disclosure described above.

[0184] A practitioner of the present disclosure can easily induce differentiation into the desired cell type by introducing the transcription factor required for induction of differentiation into the desired cell type as described above into the pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced.

[0185] In addition, the pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced encompasses a pluripotent stem cell having a gene construct inducible with doxycycline or the like inserted into the genome thereof so that a demethylase can be transiently forcibly expressed therein.

[0186] (2) Demethylase Gene for Kit of the Present Disclosure

[0187] A practitioner of the present disclosure can easily generate the pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced by adding a demethylase gene for a kit to a pluripotent stem cell known per se.

[0188] Examples of the demethylase gene for a kit may include, but not particularly limited to, mRNAs, DNAs, and proteins of demethylase genes (e.g., JMJD3c).

[0189] (3) Demethylase Gene for Kit and Gene containing Transcription Factor required for Induction of Differentiation into Desired Cell Type of the Present Disclosure.

[0190] A practitioner of the present disclosure can easily generate the pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced, and induce differentiation into the desired cell type with high efficiency by adding the demethylase gene for a kit and a gene containing the transcription factor required for induction of differentiation into the desired cell type to a pluripotent stem cell known per se.

[0191] The two genes may be present on one gene, or on separate genes. When the two genes are present on separate genes, the demethylase gene and the transcription factor required for induction of differentiation into the desired cell type may be added to the pluripotent stem cell simultaneously or at separate times.

[0192] (4) Demethylase for Kit of the Present Disclosure

[0193] A practitioner of the present disclosure can easily generate the pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced by adding a demethylase for a kit to a pluripotent stem cell known per se.

[0194] (5) Gene Construct carrying Demethylase Gene of the Present Disclosure

[0195] A practitioner of the present disclosure can easily generate the pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced by introducing a gene construct carrying a demethylase gene into the genome of a pluripotent stem cell known per se.

[0196] The gene construct may contain a promoter sequence, a gene expression-enhancing sequence, a marker gene, a reporter sequence, a drug resistance gene, and the like as required in addition to the demethylase gene.

[0197] (6) Gene Construct carrying Demethylase Gene and Transcription Factor required for Induction of Differentiation into Desired Cell Type of the Present Disclosure

[0198] A practitioner of the present disclosure can easily generate the pluripotent stem cell in which H3K27me3 modification has been substantially removed or reduced, and induce differentiation into the desired cell type by introducing a gene construct carrying a demethylase gene and a transcription factor required for induction of differentiation into the desired cell type into the genome of a pluripotent stem cell known per se.

[0199] The two genes may be present on one gene, or on separate genes. When the two genes are present on separate genes, the demethylase gene and the transcription factor required for induction of differentiation into the desired cell type may be introduced into the genome of the pluripotent stem cell simultaneously or at separate times.

[0200] The gene construct may contain a promoter sequence, a gene expression-enhancing sequence, a marker gene, a reporter sequence, a drug resistance gene, and the like as required in addition to the demethylase gene and the transcription factor required for induction of differentiation into the desired cell type.

[0201] A method of differentiating a pluripotent stem cell into a desired cell type of the present disclosure may be exemplified by, but not particularly limited to, a method including any one of the following steps (1) to (7): [0202] (1) a step of adding a demethylase gene and a transcription factor required for induction of differentiation into the desired cell type to a pluripotent stem cell; [0203] (2) a step of inserting a gene construct carrying a demethylase gene and a transcription factor gene required for induction of differentiation into the desired cell type into a genome of a pluripotent stem cell; [0204] (3) a step of inserting a gene construct carrying a demethylase gene into a genome of a pluripotent stem cell, followed by addition of a transcription factor required for induction of differentiation into the desired cell type to the cell; [0205] (4) a step of inserting a gene construct carrying a demethylase gene and a gene construct carrying a transcription factor required for induction of differentiation into the desired cell type into a genome of a pluripotent stem cell; [0206] (5) a step of adding a transcription factor required for induction of differentiation into the desired cell type to a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced; [0207] (6) a step of adding a transcription factor required for induction of differentiation into the desired cell type to a pluripotent stem cell in which a demethylase is forcibly expressed; and [0208] (7) a step of adding a demethylase and a transcription factor required for differentiation into the desired cell type to a pluripotent stem cell.

[0209] The present disclosure also encompasses any one of the following pluripotent stem cells for differentiation into a desired cell type: [0210] (1) a pluripotent stem cell for differentiation into a desired cell type, which has a histone in which H3K27me3 modification has been substantially removed or reduced; [0211] (2) a pluripotent stem cell for differentiation into a desired cell type, in which a demethylase is forcibly expressed; and [0212] (3) a pluripotent stem cell for differentiation into a desired cell type, which has a gene construct carrying a demethylase gene inserted into the genome thereof.

[0213] The present disclosure also encompasses a use of any one of the following pluripotent stem cells for differentiation into a desired cell type: [0214] (1) a pluripotent stem cell for differentiation into a desired cell type, which has a histone in which H3K27me3 modification has been substantially removed or reduced; [0215] (2) a pluripotent stem cell for differentiation into a desired cell type, in which a demethylase is forcibly expressed; and [0216] (3) a pluripotent stem cell for differentiation into a desired cell type, which has a gene construct carrying a demethylase gene inserted into the genome thereof.

[0217] The present disclosure also encompasses a use of any one of the following pluripotent stem cells for differentiation into a desired cell type, in production of a differentiation induction kit for differentiating a pluripotent stem cell into a desired cell type: [0218] (1) a pluripotent stem cell for differentiation into a desired cell type, which has a histone in which H3K27me3 modification has been substantially removed or reduced; [0219] (2) a pluripotent stem cell for differentiation into a desired cell type, in which a demethylase is forcibly expressed; and [0220] (3) a pluripotent stem cell for differentiation into a desired cell type, which has a gene construct carrying a demethylase gene inserted into the genome thereof.

[0221] The present disclosure is specifically described below by way of Examples. However, the present disclosure is not limited thereto. All of these Examples were carried out after being approved by the Ethics Committee of Keio University School of Medicine.

Example 1

[0222] (Materials and Methods)

[0223] Examples 2 to 7 were carried out using materials and methods described below. The details are as described below.

[0224] (Human Pluripotent Stem Cell Culture and Differentiation Induction Methods)

[0225] A human ES cell (hESC) lineage SEES-3 was obtained from the National Center for Child Health and Development, Japan (National Research Institute for Child Health and Development). Human induced pluripotent stem cells (hiPSCs) were generated from adult human fibroblasts by introducing mRNAs for POU5F1, SOX2, KLF4, and c-MYC. hESC/iPSCs were maintained under feeder cell-free conditions using StemFitAK-03medium (Ajinomoto) on iMatrix-511 (Nippi)-coated plates. A ROCK inhibitor Y-27632 was added to the medium during cell subculture in order to prevent detachment-induced apoptosis.

[0226] For early differentiation, the hESCs were cultured in a differentiation medium of RPMI 1640 (Gibco) supplemented with growth factors (100 ng/ml activin A for endodermal differentiation and 100 ng/ml activin A on Day 1, which was replaced with 10 ng/ml BMP4 and ng/ml bFGF for mesodermal differentiation). For myogenic differentiation, the hPSCs were cultured in a medium of a MEM (Gibco) supplemented with 5% KSR, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 2 mM glutamine, 0.1 mM .beta.-mercaptoethanol, and penicillin/streptomycin (50 U/50 .mu.g/ml) on iMatrix-511 or Matrigel (BD)-coated plates.

[0227] (Generation of JMJD3c-hESCs)

[0228] A full-length human JMJD3 clone was obtained from Addgene (plasmid ID #24167). A point mutation in the catalytic domain was introduced using PrimeSTAR Mutagenesis Basal Kit (Takara). HA-tagged JMJD3c and a mutant thereof were subcloned into a PiggyBac construct containing a tetracycline-responsive element IRES-.beta.geo, and a puromycin resistance gene controlled by a PGK promoter. Vectors were simultaneously introduced with PiggyBac transposase vectors into hESCs that consistently expressed a reverse tetracycline transactivator (SEE3-1v) using a GeneJuice transfection reagent (Novagen). Stable clones were established by puromycin selection. Inducible expression with doxycycline treatment was confirmed by X-Gal staining.

[0229] (Modified mRNA Synthesis and Transfection)

[0230] The protein-coding regions (Open Reading Frames, ORFs) of a red fluorescent protein mCherry, a green fluorescent protein Emerald and human influenza virus hemagglutinin (Hemagglutinin, HA)-tagged full-length or catalytic domains of JMJD3, and UTX were subcloned into a pCRII construct containing the 5' UTR and 3' UTR of mouse a-globin, which increased mRNA stability and translation efficiency, to prepare templates used to synthesize mRNAs.

[0231] Modified mRNAs were synthesized on the basis of the description of the literature "Cell stem cell 7, 618-630 (2010)". Briefly speaking, a T7 promoter and a poly (A) tail were added through PCR reaction using a KAPA taq kit (Kapa Biosystems). RNAs were synthesized from PCR products using a MEGAscript T7 kit (Ambion) together with ARCA cap analog (New England Biolabs), ATP, GTP, 5-Methyl-CTP (TriLink), and pseudo-UTP (TriLink). The synthetic mRNAs were purified using a MEGAclear kit (Ambion). RNA transfections were performed with Lipofectamine 2000 (Invitrogen) or Lipofectamine Messenger Max (Invitrogen), according to the instructions of the accompanying manual. The B18R interferon inhibitor (eBioscience) was added to the culture medium to increase the viability of the transfected cells. The medium was replaced 2 hours to 3 hours after each transfection.

[0232] (Antibody)

[0233] The following antibodies were used:

[0234] HA (Abcam #ab9110 for immunoblotting method and #ab18181 for immunostaining);

[0235] H3K4me3 (Millipore #07-473);

[0236] H3K27me3 (Millipore #07-449);

[0237] H3K27ac (Active Motif #39-133);

[0238] panH3 (Abcam #ab1791); and

[0239] MHC (R&D #MAB4470).

[0240] (Immunostaining)

[0241] The cells were fixed in 4% PFA for 10 minutes at room temperature and permeabilized in 0.5% Triton-X-containing PBS for 10 minutes. The cells were blocked in 2% BSA-containing PBS for 10 minutes, and cultured with primary antibodies in a blocking solution (1:500) for from 2 hours to 3 hours at room temperature or overnight at 4.degree. C. The cells were washed twice in PBS, and then cultured with Alexa dye-conjugated secondary antibodies (Invitrogen) in a blocking solution (1:500) for 1 hour at room temperature. Nuclei were counterstained with DAPI (Dako) for 5 minutes at room temperature. Immunofluorescence was visualized with an inverted fluorescence microscope IX73 (Olympus). Images were obtained using Olympus cellSens imaging software.

[0242] (Immunoblotting Method)

[0243] The cells were lysed with a sample buffer (50 mM Tris-HCl, pH 6.8, 2% SDS, 6% 2-mercaptoethanol, and 500 mg/ml urea). The proteins were separated by SDS-PAGE using a 4-15% polyacrylamide gel (Biorad) and were electrically transferred to polyvinylidene fluoride membranes (Biorad). The membranes were blocked for 1 hour in 0.1% Tween-20-containing Tris-buffered saline (TBST) and 5% skimmed milk. The membranes were washed in TBST and then incubated with primary antibodies in 2% BSA-containing TBS (1:1,000 dilution) overnight at 4.degree. C. The membranes were washed and then incubated with horseradish peroxidase-conjugated secondary antibodies (GE) for 1 hour at room temperature. The membranes were washed in TEST, and immunoreactivity was visualized using ECL Prime Detection Kit (GE) and detected using Luminescent Image Analyzer (LAS-4000; Fujifilm).

[0244] (qRT-PCR)

[0245] Total RNA was isolated with TRIzol reagent (Invitrogen), and cDNAs were generated with random hexamers using a Superscript III First-strand Synthesis kit (Invitrogen). Real-time PCR was performed using a SYBR Green PCR system (Takara). The primer sequences used for RT-PCR are listed in Tables 1 and 2 below.

TABLE-US-00001 TABLE 1 qRT-PCR Forward GAPDH GGTGGTCTCCTCTGACTTCAACA (SEQ ID NO: 10) POU5F1 CTTGAATCCCGAATGGAAAGGG (SEQ ID NO: 12) NANOG AGAAGGCCTCAGCACCTAC (SEQ ID NO: 14) T GCCCTCTCCCTCCCCTCCACGCACAG (SEQ ID NO: 16) MSX1 CGAGAGGACCCCGTGGATGCAGAG (SEQ ID NO: 18) SOX17 CGCTTTCATGGTGTGGGCTAAGGACG (SEQ ID NO: 20) FOXA2 TGGGAGCGGTGAAGATGGAAGGGCAC (SEQ ID NO: 22) GATA4 GCTCCTTCAGGCAGTGAGAG (SEQ ID NO: 24) GATA6 GTGCCCAGACCACTTGCTAT (SEQ ID NO: 26) GSC CGGTCCTCATCAGAGGAGTC (SEQ ID NO: 28) EVX1 CGGCTGGAGAAGGAATTCTA (SEQ ID NO: 30) MYOG GCCAGACTATCCCCTTCCTC (SEQ ID NO: 32) MEF2C AGGTCACCTGACATCCCAAG (SEQ ID NO: 34) CKM GAAGAGCATGACGGAGAAGG (SEQ ID NO: 36) SIX1 TGTTTGCGCATAAAGGAATG (SEQ ID NO: 38) AFP TGGGACCCGAACTTTCCA (SEQ ID NO: 40) COL2 TTTCCCAGGTCAAGATGGTC (SEQ ID NO: 42) COL1A1 CCTGGATGCCATCAAAGTCT (SEQ ID NO: 44) Reverse GAPDH GTGGTCGTTGAGGGCAATG (SEQ ID NO: 11) POU5F1 GTGTATATCCCAGGGTGATCCTC (SEQ ID NO: 13) NANOG GGCCTGATTGTTCCAGGATT (SEQ ID NO: 15) T CGGCGCCGTTGCTCACAGACCACAGG (SEQ ID NO: 17) MSX1 GGCGGCCATCTTCAGCTTCTCCAG (SEQ ID NO: 19) SOX17 TAGTTGGGGTGGTCCTGCATGTGCTG (SEQ ID NO: 21) FOXA2 TCATGCCAGCGCCCACGTACGACGAC (SEQ ID NO: 23) GATA4 CTGTGCCCGTAGTGAGATGA (SEQ ID NO: 25) GATA6 TGGAGTCATGGGAATGGAAT (SEQ ID NO: 27) GSC CCGAGTCCAAATCGCTTTTA (SEQ ID NO: 29) EVX1 ACACCTTGATGGTGGTTTCC (SEQ ID NO: 31) MYOG GAGGCCGCGTTATGATAAAA (SEQ ID NO: 33) MEF2C GTTAGCCCTCCAACTCCACA (SEQ ID NO: 35) CKM GTTGTCATTGTGCCAGATGC (SEQ ID NO: 37) SIX1 TGGGAAGGAAAATGCAAAAG (SEQ ID NO: 39) AFP GGCCACATCCAGGACTAGTTTC (SEQ ID NO: 41) COL2 CTTCAGCACCTGTCTCACCA (SEQ ID NO: 43) COL1A1 TCTTGTCCTTGGGGTTCTTG (SEQ ID NO: 45)

TABLE-US-00002 TABLE 2 ChIP-PCR Forward POU5F1 GGAGGTAAACCCAGCTCACA (SEQ ID NO: 46) NANOG GCTCAGGGATGAGCATGATT (SEQ ID NO: 48) T GGCACGGCCAAATAAGAATA (SEQ ID NO: 50) MSX1 TCCCTCATCTGATCCCAAAC (SEQ ID NO: 52) SOX17 AGCAAGATGCTGGGTGAGTC (SEQ ID NO: 54) FOXA2 TTCTTCGCTCTCAGTGCTCA (SEQ ID NO: 56) GATA4 GATCTTCGCGACAGTTCCTC (SEQ ID NO: 58) GATA6 TGCAGCCTACGCTCTTGTTA (SEQ ID NO: 60) GSC GACATGACGGAGATGGGTCT (SEQ ID NO: 62) EVX1 TCACACTCTCCTCCCCAATC (SEQ ID NO: 64) GAPDH CGGTGACTAACCCTGCGCTCCTG (SEQ ID NO: 66) MYOG_a CCTCCGGAAAGAATGGGACT (SEQ ID NO: 68) MYOG_b TTGGAGCCAAGGTTACCAGT (SEQ ID NO: 70) MYOG_c GGCCTCATTCACCTTCTTGA (SEQ ID NO: 72) MEF2C_a CATGCATTTTCAGGTCACCA (SEQ ID NO: 74) MEF2C_b GCACGTTTAAGACCCCAAAG (SEQ ID NO: 76) SOX1 CCGTCTCACTCCGTCTGAAT (SEQ ID NO: 78) Reverse POU5F1 TTTGGCCTTAGGGTTAAGCA (SEQ ID NO: 47) NANOG TGCCCAGTAACATCCACAAA (SEQ ID NO: 49) T GGTTCAATTCCTGGGTCGTA (SEQ ID NO: 51) MSX1 ACCAGCTCCTACTGCGAGAA (SEQ ID NO: 53) SOX17 CTACACACCCCTGGTTTTGG (SEQ ID NO: 55) FOXA2 GGCGAGTTAAAGGTGTGTACG (SEQ ID NO: 57) GATA4 CATGGCCAAGCTCTGATACA (SEQ ID NO: 59) GATA6 GTCAGTCAAGGCCATCCAC (SEQ ID NO: 61) GSC TGGAAGGTGCCTCACTTCTT (SEQ ID NO: 63) EVX1 TTACAGTACCGCTGGTGACG (SEQ ID NO: 65) GAPDH AGCTAGCCTCGCTCCACCTGACTT (SEQ ID NO: 67) MYOG_a TCTGTTAGCTGCTCTGAGTCT (SEQ ID NO: 69) MYOG_b CTCTCACAGCGCCTCCTG (SEQ ID NO: 71) MYOG_c TGGGCGTGTAAGGTGTGTAA (SEQ ID NO: 73) MEF2C_a CCCCTCCACTTTGATTCGTA (SEQ ID NO: 75) MEF2C_b CGGCCTCAGCTAAATGAAAG (SEQ ID NO: 77) SOX1 AGTGCAGGTCGGTCTCCAT (SEQ ID NO: 79)

[0246] {Chromatin Immunoprecipitation (ChIP) Analysis}

[0247] The cells were crosslinked with formaldehyde in PBS (final concentration: 1%) at room temperature for 10 minutes. The reaction was quenched with glycine (final concentration: 125 M). The cells were washed with PBS, and stored at -80.degree. C. until use. The cells were lysed in protease inhibitor cocktail-containing Lysis buffer 3 (10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% sodium deoxycholate, 0.5% N-lauroylsarcosine). Ultrasonication was performed using Handy Sonic UR-20P (Tomy Seiko Co., Ltd.) so as to generate DNA fragments of from about 150 bp to about 450 bp. The ultrasonicated lysate was diluted with protease inhibitor cocktail-containing ChIP dilution buffer (20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100), and then cultured overnight at 4.degree. C. together with 30 .mu.l of protein G magnetic beads (Invitrogen) precultured with 3 .mu.g of an antibody. The precipitate was washed three times with RIPA buffer (10 mM Tris-HCl, pH 7.5, 140 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate), and then washed once with 10 mM Tris-HCl, pH 8.0, 5 mM EDTA, 10 mM NaCl. Bound chromatin was eluted from the beads in elution buffer (20 mM Tris-HCl, pH 7.5, 5 mM EDTA, 50 mM NaCl, 1% SDS) at 68.degree. C., and decrosslinked at 68.degree. C. for 6 hours. DNA was treated with RNase A and protease K, and then purified by phenol-chloroform-isoamyl alcohol and isopropanol precipitation. Real-time PCR was performed using a SYBR Green PCR system (Takara). The primer sequences are listed in Tables 1 and 2 above.

[0248] (Coculture of Myogenic Cells and C2C12 Cells)

[0249] Induced myogenic cells were labeled with green fluorescence by introducing Emerald mRNA. The cells were cocultured with C2C12 cells expressing H2B-mCherry in a medium of DMEM (Gibco) supplemented with 2% horse serum.

[0250] (Statistical Analysis)

[0251] The statistical significance of differences between samples was assessed using Student's t-test for independent samples.

Example 2

[0252] (Generation of H3K27me3-deficient Pluripotent Stem Cells (Pluripotent Stem Cells having Histone in which H3K27me3 Modification has been substantially removed or reduced))

[0253] In this Example, pluripotent stem cells in which H3K27me3 had been demethylated (H3K27me3-deficient hESCs) were generated. Specifically, in order to demethylate the H3K27me3 of pluripotent stem cells, two methods of manipulating the expression of the demethylase JMJD3 were used. The details are as described below.

[0254] (1) Use of Modified Synthetic mRNA

[0255] A forced expression system for JMJD3 was generated through use of modified synthetic mRNAs. mRNAs encoding full-length JMJD3 (JMJD3f) and the catalytic domain-containing C-terminus (JMJD3c) were synthesized in vitro (FIG. 5A).

[0256] The N-terminus of each of those mRNAs was tagged with a hemagglutinin (HA) sequence for detecting a translated protein. At 8 hours after the introduction of the synthetic mRNAs into hESCs, the demethylation of H3K27me3 was detected by immunostaining and immunoblotting methods (FIG. 5B and FIG. 5C). The results showed that "the introduction of the JMJD3c mRNA induced a more significant decrease in H3K27me3 as compared to the JMJD3f mRNA," and the results showed that the catalytic domain of JMJD3 was able to sufficiently demethylate a nucleosome histone.

[0257] (2) Use of Plasmid Vector having inserted therein Demethylase Gene

[0258] A forced expression system for JMJD3c was generated through use of a plasmid vector having introduced therein JMJD3c. More specifically, a hESC line in which the expression of HA-JMJD3c was regulated by doxycycline (Dox) treatment was generated (JMJD3c-hESC) (FIG. 5D). Dox treatment (1 .mu.g/ml) induced HA-JMJD3c expression and a significant decrease in H3K27me3 in all hESCs (FIG. 5F). Forced expression of the JMJD3c mutant, which lacked catalytic function (FIG. 5G), did not induce any change in H3K27me3 (FIG. 5H). Thus, it was confirmed that JMJD3c removed or attenuated H3K27me3 through its demethylase activity.

[0259] That is, it was confirmed that pluripotent stem cells in which H3K27me3 modification had been substantially removed or reduced were generated.

[0260] It was confirmed that the expression level of H3K27me3 of pluripotent stem cells could be manipulated by each of the above-mentioned two methods. In addition, in the use of the modified synthetic mRNA, the timing and duration time of JMJD3c expression can be regulated, and hence the decrease in the expression level of H3K27me3 (or substantial removal of H3K27me3) can be performed at specific timing at which differentiation of pluripotent stem cells into a desired cell type is induced.

Example 3

[0261] (Confirmation of Changes in Developmental Genes in H3K27me3-deficient Pluripotent Stem Cells)

[0262] It was revealed that forced expression of JMJD3c (H3K27me3-deficient pluripotent stem cells) resulted in morphological changes in hESCs toward differentiation (FIG. 6A). It was confirmed that the morphological changes occurred even under culture conditions for maintaining an undifferentiated state.

[0263] Chromatin immunoprecipitation (ChIP) analysis revealed that decreases in H3K27me3 occurred in the promoters of genes whose gene expression had been upregulated in Dox-treated JMJD3c-hESCs, but those regions were still rich in H3K4me3 (FIG. 6B). This result means that the chromatin structure is brought into an active state.

[0264] In this Example, it was shown that, by demethylating H3K27me3, JMJD3c expression was able to cause enhancement of the expression of development/differentiation-related genes over cell differentiation resistance (stem cell-maintaining property).

[0265] As described above, forced expression of JMJD3c upregulates the expression of development/differentiation-related genes. In particular, genes associated with endodermal and mesodermal differentiation, such as SOX17, FOXA2, GATA4/6, EOMES, T, and MIXL1, were highly expressed 3 days after the Dox treatment (FIG. 6C). Further, enhancement of the expression of those genes was found also under undifferentiated state-maintaining culture conditions. Typically, the differentiation of hESC/iPSCs into mesoderm/endoderm requires changes into a differentiation medium including various cytokines and growth factors (e.g., activin A, BMP, and FGF). In order to evaluate the influence of JMJD3c on gene expression enhancement for early differentiation, the expression levels of development/differentiation-related genes under JMJD3c-expressed conditions and conventional differentiation conditions were compared to each other. It was confirmed by real-time PCR analysis that JMJD3 upregulated the expression of developmental genes in a non-differentiation medium to a degree similar to that under differentiation conditions using cytokines and growth factors (FIG. 6C).

[0266] Those results suggest that ectopic expression (forced expression) of the demethylase allows a transition from a pluripotency-maintaining state to an early differentiation state by directly enhancing the expression of development/differentiation-related genes, and this does not require various cytokines and growth factors. That is, pluripotent stem cells in which H3K27me3 modification has been substantially removed or reduced easily undergo a transition from a pluripotent state to an early differentiation state.

Example 4

[0267] (Confirmation of Differentiation of Pluripotent Stem Cells in which Demethylase is forcibly expressed into Desired Cell Type)

[0268] In the above-mentioned Examples, it was confirmed that H3K27 demethylation by JMJD3c changes the chromatin structure of hESCs to an active form for highly efficient induction of differentiation into a desired cell type. In view of this, it was considered that, when a transcription factor required for induction of differentiation into a desired cell type was introduced, differentiation into the desired cell type was able to be induced with high efficiency. Accordingly, in this Example, as an example of induction of differentiation into a desired cell type, a myogenic differentiation model using a myogenesis-regulating master transcription factor MYOD1 was adopted. It is known that forced expression of MYOD1 alone cannot cause sufficient epigenetic changes and transcriptional changes in hESCs, resulting in poor myogenic conversion (see Cell Reports 3, 661-670 (2013)).

[0269] In order to confirm whether JMJD3c was able to facilitate MYOD1-induced muscle cell differentiation, JMJD3c was transiently forcibly expressed in hESCs before forced expression of MYOD1 (FIG. 7A).

[0270] In this process, the JMJD3c-hESC line was used, and induced by introducing JMJD3c and MYOD1 by means of Dox treatment and synthetic mRNA, respectively.

[0271] Alterations in the expression of four genes (MYOG, MEF2C, CKM, and SIX1) serving as markers for skeletal muscle differentiation were examined. Real-time PCR analysis revealed that forced expression of MYOD1 alone did not induce upregulation of the expression of the muscle cell differentiation-related genes except SIX1.

[0272] However, when JMJD3c was forcibly expressed before forced expression of MYOD1, all of those genes showed significant expression upregulation. However, forced expression of JMJD3c alone did not alter the expression pattern of MYOD1 downstream genes. Those results confirmed that JMJD3c facilitated muscle differentiation mediated by MYOD1 gene expression.

[0273] Further, chromatin changes in the promoter regions of MYOG and MEF2C during differentiation mediated by forced expression of MYOD1 with or without forced expression of JMJD3c were examined using ChIP assay. It was revealed that the levels of H3K4me3 and H3K27me3 in those regions were lower than those of a positive control, such as GAPDH, POU5F1, or Brachyury (T), in both the hESCs and the differentiated cells (FIG. 7C), and there was no large difference between a JMJD3c-positive condition and a negative condition. Meanwhile, it was revealed that those regions were significantly enriched for H3K27 acetylation (H3K27ac) in the differentiated cells only under the JMJD3c-positive condition, but not under the negative condition (FIG. 7C). H3K27ac has been known to be directly involved in active transcription. Thus, it was suggested that the combination of JMJD3c and MYOD1 formed an active state of chromatin in myogenic genes.

[0274] Further, it was confirmed that JMJD3c/MYOD1-forcibly expressing hESCs were myosin heavy chain (MHC)-positive, and changed to myotube-like morphology at 4 days post differentiation (FIG. 7D). The percentage of MHC-positive cells was much higher than the percentage observed under the condition of overexpressing MYOD1 alone (FIG. 7E). Those results show that JMJD3c facilitates MYOD1-mediated differentiation of hESCs into skeletal muscle cells. However, forced expression of the JMJD3c mutant did not induce MYOD1-mediated myogenic differentiation (FIG. 7F and FIG. 7G). Thus, it was confirmed that the demethylation of H3K27me3 was essential to MYOD1-mediated differentiation of hESCs into muscle cells.

[0275] As apparent from the foregoing, differentiation into a desired cell type can be efficiently induced by introducing a transcription factor required for induction of differentiation into the desired cell type into H3K27me3-deficient cells (pluripotent stem cells having a histone in which H3K27me3 modification has been substantially removed or reduced).

Example 5

[0276] (Confirmation of Differentiation of Pluripotent Stem Cells into Desired Cell Type using Synthetic mRNA)

[0277] In Example 4 described above, it was confirmed that forced expression of the demethylase was able to facilitate MYOD1-mediated differentiation of hESCs into skeletal muscle cells.

[0278] In this Example, it was confirmed whether differentiation of hESCs into skeletal muscle cells was able to be induced by using only synthetic mRNAs for the demethylase JMJD3c and the transcription factor MYOD1 required for induction of differentiation into a desired cell type without altering the DNA of the pluripotent stem cells.

[0279] The mRNA for JMJD3c was transfected into hESCs twice, followed by three transfections with the MYOD1 mRNA (FIG. 8A). Two days after the last transfection of the MYOD1 mRNA, the majority of hESCs were differentiated into MHC-positive cells (FIG. 8B and FIG. 8C). As a control, hESCs were transfected with mRNAs for mCherry and MYOD1, but myogenic differentiation was not induced.

[0280] Some MHC-positive cells appeared to be fused cells (FIG. 8D), which was able to be further confirmed by a fusion assay with mouse C2C12 cells (FIG. 8E). Those results were able to confirm that the induced myotube-like cells became mature skeletal muscles in vitro.

[0281] Further, it was confirmed that the mRNA for JMJD3c facilitated MYOD1-mediated myogenic differentiation of fibroblast-derived hiPSCs (FIG. 8F and FIG. 8G). This suggests that JMJD3c facilitates direct conversion from a pluripotent state to a terminal differentiation state.

[0282] As apparent from the foregoing, differentiation into a desired cell type can be induced with high efficiency by introducing (adding) a transcription factor required for induction of differentiation into the desired cell type into pluripotent stem cells in which H3K27me3 modification has been substantially removed or reduced.

[0283] In related art, it is shown that skeletal muscle cells can be induced even when MYOD1 is used alone. However, in Non Patent Literature 4, drug selection needs to be performed in order to stably express the MYOD1 gene, and preculture is required for about 10 days prior to the initiation of differentiation induction. In addition, in Non Patent Literature 3, a PAX7 gene is introduced instead of the MYOD1 gene, but differentiation induction requires culture for about 1 month.

[0284] In addition, there is a report that skeletal muscle differentiation is induced by introducing a gene called BAF60C, and then introducing the MYOD1 gene (see Cell Rep. 2013 Mar. 28; 3 (3): 661-70.). However, differentiation induction takes 20 days, and requires the use of a lentiviral vector.

Example 6

[0285] (Transcription factors differentiate Pluripotent Stem Cells into Desired Cell Types)

[0286] In Examples 4 and 5 described above, it was confirmed that MYOD1-mediated induction of differentiation of hESCs into skeletal muscle cells was able to be facilitated by forcibly expressing the demethylase or adding the synthetic mRNA for the demethylase.

[0287] In this Example, it was confirmed whether differentiation of pluripotent stem cells into a plurality of desired cell types was able to be induced using respective transcription factors.

[0288] With reference to the method described in Example 4, JMJD3c-hESCs were treated with Dox (+JMJD3c) or without Dox (-JMJD3c) on from Day 1 to Day 2 after plating, and then, during Day 2, synthetic mRNA for TCF1, SOX9, RUNX3, or mCherry was introduced twice. The cells were collected on Day 4, and the expression of each differentiation marker gene was examined by RT-qPCR analysis.

[0289] The analysis results are shown in FIG. 9. In the cells transfected with the TCF1 transcription factor, AFP serving as a marker gene for hepatoblasts was significantly increased. In the cells transfected with the SOX9 transcription factor, COL2 serving as a marker gene for chondrocytes was significantly increased. In the cells transfected with the RUNX3 transcription factor, COL1A1 serving as a marker gene for osteoblasts was significantly increased.

[0290] Thus, it was confirmed that differentiation into desired cell types were able to be efficiently induced by introducing the transcription factors required for induction of differentiation into the desired cell types into H3K27me3-deficient cells (pluripotent stem cells having a histone in which H3K27me3 modification has been substantially removed or reduced).

Example 7

[0291] (Examples of Differentiation into Desired Cell Types using Pluripotent Stem Cells of the Present Disclosure)

[0292] In this Example, differentiation into various desired cell types was confirmed using pluripotent stem cells having a histone in which H3K27me3 modification had been substantially removed or reduced.

[0293] (Differentiation into Skeletal Muscle Cells)

[0294] With reference to the description of Example 5, during 4-day culture, human pluripotent stem cells were transfected with the JMJD3c gene (SEQ ID NO: 80) twice, and then transfected with the MYOD1 gene (SEQ ID NO: 86, SEQ ID NO: 88) three times. It was confirmed that the cells were differentiated into skeletal muscle cells through the 4-day culture.

[0295] (Differentiation into Liver Cells)

[0296] With reference to the description of Example 5, during 4-day culture, human pluripotent stem cells were transfected with the JMJD3c gene (SEQ ID NO: 80) twice, and then transfected with the HNF1A gene (SEQ ID NO: 87, SEQ ID NO: 94) three times. It was confirmed that the cells were differentiated into liver cells through the 4-day culture.

[0297] (Differentiation into Nerve Cells)

[0298] With reference to the description of Example 5, during 4-day culture, human pluripotent stem cells were transfected with the JMJD3c gene (SEQ ID NO: 80) twice, and then transfected with the NEUROG1 gene (SEQ ID NO: 81, SEQ ID NO: 89), the NEUROG2 gene (SEQ ID NO: 82, SEQ ID NO: 90), the NEUROG3 gene (SEQ ID NO: 83, SEQ ID NO: 91), the NEUROD1 gene (SEQ ID NO: 84, SEQ ID NO: 92), and the NEUROD2 gene (SEQ ID NO: 85, SEQ ID NO: 93) three times. It was confirmed that the cells were differentiated into nerve cells through the 4-day culture.

[0299] (Subject Matter of the Present Invention)

[0300] It has been confirmed that, in the method of the present disclosure, a differentiation efficiency of from 60% to 70% is achieved in 4 days from the initiation of differentiation induction without the addition of various cytokines and growth factors required for causing a transition from a pluripotent state to an early differentiation state and with only the addition of synthetic mRNA to pluripotent stem cells. That is, in the method of the present disclosure, differentiation induction can be achieved within a shorter period and with higher efficiency without requiring the various cytokines and growth factors that are required in related-art methods.

[0301] In Examples of the present disclosure, even when there was no environmental change, a histone demethylase {in particular, the catalytic domain of JMJD3 (JMJD3c)} enhanced the expression of development/differentiation-related genes in pluripotent stem cells, and facilitated the conversion of a gene expression pattern from a pluripotent stem cell pattern to a gene expression pattern of a differentiated cell. This suggests that, without being limited to JMJD3, any demethylase having an effect of removing or attenuating methylation suppressing the expression of development/differentiation-related genes can facilitate cell differentiation of pluripotent stem cells into differentiated cells.

[0302] In Examples of the present disclosure, it has been shown that the histone demethylase JMJD3 cancels the suppression of the expression of the differentiation-related genes by rapidly attenuating the methylation of H3K27. Particularly when modified synthetic mRNA for JMJD3c was used, significant attenuation of H3K27me3 was confirmed in several hours. Those results show that the histone demethylase antagonistically regulates H3K27 methylation by a PcG complex in human pluripotent stem cells.

[0303] In the pluripotent stem cells, forced expression of the histone demethylase caused demethylation of H3K27me3, and upregulated gene expression of many development/differentiation-related genes. Those changes were also found under human pluripotent stem cell culture conditions for maintaining pluripotency. The mutant of the histone demethylase (function-deficient mutant of JMJD3c) did not induce those phenomena, revealing that specific demethylation of H3K27 by the demethylase was directly involved in the increase of the transcription activity of development/differentiation-related genes.

[0304] In Examples of the present disclosure, it has also been revealed that, in the group of development/differentiation-related genes whose gene expression is upregulated by the demethylase activity of JMJD3, more mesodermal/endodermal differentiation related genes are included than genes involved in ectodermal differentiation. This shows that the demethylase activity of the JMJD3 gene effectively facilitates differentiation into mesendodermal cells, specifically bone, muscle, liver, circulatory, digestive, and reproductive cells. However, the demethylase activity of JMJD3 gene also upregulated the expression of a group of genes involved in ectodermal differentiation as compared to that in pluripotent stem cells, and hence is likely involved also in facilitating differentiation into, for example, nerve and epidermal cells.

[0305] H3K27me3 is not present in large amounts in the promoter regions of muscle cell differentiation-related genes in hESCs, and hence the demethylase activity of JMJD3c is considered to be indirectly involved in enhancement of the expression of the muscle cell differentiation-related genes via enhancement of the expression of a gene involved in early development/cell differentiation.

[0306] Thus, it has been shown that the demethylase activity allows the state of cells to undergo a transition from a pluripotency-maintaining state to a differentiated state by attenuating differentiation resistance of pluripotent stem cells. The attenuation of the differentiation resistance is not limited to only the activation of muscle differentiation-related genes, but also facilitates the activation of other differentiated cell genes.

INDUSTRIAL APPLICABILITY

[0307] According to the present disclosure, the novel method of differentiating a pluripotent stem cell into a desired cell type with high efficiency can be provided.

Sequence CWU 1

1

9411682PRTHomo sapiens 1Met His Arg Ala Val Asp Pro Pro Gly Ala Arg Ala Ala Arg Glu Ala1 5 10 15Phe Ala Leu Gly Gly Leu Ser Cys Ala Gly Ala Trp Ser Ser Cys Pro 20 25 30Pro His Pro Pro Pro Arg Ser Ala Trp Leu Pro Gly Gly Arg Cys Ser 35 40 45Ala Ser Ile Gly Gln Pro Pro Leu Pro Ala Pro Leu Pro Pro Ser His 50 55 60Gly Ser Ser Ser Gly His Pro Ser Lys Pro Tyr Tyr Ala Pro Gly Ala65 70 75 80Pro Thr Pro Arg Pro Leu His Gly Lys Leu Glu Ser Leu His Gly Cys 85 90 95Val Gln Ala Leu Leu Arg Glu Pro Ala Gln Pro Gly Leu Trp Glu Gln 100 105 110Leu Gly Gln Leu Tyr Glu Ser Glu His Asp Ser Glu Glu Ala Thr Arg 115 120 125Cys Tyr His Ser Ala Leu Arg Tyr Gly Gly Ser Phe Ala Glu Leu Gly 130 135 140Pro Arg Ile Gly Arg Leu Gln Gln Ala Gln Leu Trp Asn Phe His Thr145 150 155 160Gly Ser Cys Gln His Arg Ala Lys Val Leu Pro Pro Leu Glu Gln Val 165 170 175Trp Asn Leu Leu His Leu Glu His Lys Arg Asn Tyr Gly Ala Lys Arg 180 185 190Gly Gly Pro Pro Val Lys Arg Ala Ala Glu Pro Pro Val Val Gln Pro 195 200 205Val Pro Pro Ala Ala Leu Ser Gly Pro Ser Gly Glu Glu Gly Leu Ser 210 215 220Pro Gly Gly Lys Arg Arg Arg Gly Cys Asn Ser Glu Gln Thr Gly Leu225 230 235 240Pro Pro Gly Leu Pro Leu Pro Pro Pro Pro Leu Pro Pro Pro Pro Pro 245 250 255Pro Pro Pro Pro Pro Pro Pro Pro Leu Pro Gly Leu Ala Thr Ser Pro 260 265 270Pro Phe Gln Leu Thr Lys Pro Gly Leu Trp Ser Thr Leu His Gly Asp 275 280 285Ala Trp Gly Pro Glu Arg Lys Gly Ser Ala Pro Pro Glu Arg Gln Glu 290 295 300Gln Arg His Ser Leu Pro His Pro Tyr Pro Tyr Pro Ala Pro Ala Tyr305 310 315 320Thr Ala His Pro Pro Gly His Arg Leu Val Pro Ala Ala Pro Pro Gly 325 330 335Pro Gly Pro Arg Pro Pro Gly Ala Glu Ser His Gly Cys Leu Pro Ala 340 345 350Thr Arg Pro Pro Gly Ser Asp Leu Arg Glu Ser Arg Val Gln Arg Ser 355 360 365Arg Met Asp Ser Ser Val Ser Pro Ala Ala Thr Thr Ala Cys Val Pro 370 375 380Tyr Ala Pro Ser Arg Pro Pro Gly Leu Pro Gly Thr Thr Thr Ser Ser385 390 395 400Ser Ser Ser Ser Ser Ser Asn Thr Gly Leu Arg Gly Val Glu Pro Asn 405 410 415Pro Gly Ile Pro Gly Ala Asp His Tyr Gln Thr Pro Ala Leu Glu Val 420 425 430Ser His His Gly Arg Leu Gly Pro Ser Ala His Ser Ser Arg Lys Pro 435 440 445Phe Leu Gly Ala Pro Ala Ala Thr Pro His Leu Ser Leu Pro Pro Gly 450 455 460Pro Ser Ser Pro Pro Pro Pro Pro Cys Pro Arg Leu Leu Arg Pro Pro465 470 475 480Pro Pro Pro Ala Trp Leu Lys Gly Pro Ala Cys Arg Ala Ala Arg Glu 485 490 495Asp Gly Glu Ile Leu Glu Glu Leu Phe Phe Gly Thr Glu Gly Pro Pro 500 505 510Arg Pro Ala Pro Pro Pro Leu Pro His Arg Glu Gly Phe Leu Gly Pro 515 520 525Pro Ala Ser Arg Phe Ser Val Gly Thr Gln Asp Ser His Thr Pro Pro 530 535 540Thr Pro Pro Thr Pro Thr Thr Ser Ser Ser Asn Ser Asn Ser Gly Ser545 550 555 560His Ser Ser Ser Pro Ala Gly Pro Val Ser Phe Pro Pro Pro Pro Tyr 565 570 575Leu Ala Arg Ser Ile Asp Pro Leu Pro Arg Pro Pro Ser Pro Ala Gln 580 585 590Asn Pro Gln Asp Pro Pro Leu Val Pro Leu Thr Leu Ala Leu Pro Pro 595 600 605Ala Pro Pro Ser Ser Cys His Gln Asn Thr Ser Gly Ser Phe Arg Arg 610 615 620Pro Glu Ser Pro Arg Pro Arg Val Ser Phe Pro Lys Thr Pro Glu Val625 630 635 640Gly Pro Gly Pro Pro Pro Gly Pro Leu Ser Lys Ala Pro Gln Pro Val 645 650 655Pro Pro Gly Val Gly Glu Leu Pro Ala Arg Gly Pro Arg Leu Phe Asp 660 665 670Phe Pro Pro Thr Pro Leu Glu Asp Gln Phe Glu Glu Pro Ala Glu Phe 675 680 685Lys Ile Leu Pro Asp Gly Leu Ala Asn Ile Met Lys Met Leu Asp Glu 690 695 700Ser Ile Arg Lys Glu Glu Glu Gln Gln Gln His Glu Ala Gly Val Ala705 710 715 720Pro Gln Pro Pro Leu Lys Glu Pro Phe Ala Ser Leu Gln Ser Pro Phe 725 730 735Pro Thr Asp Thr Ala Pro Thr Thr Thr Ala Pro Ala Val Ala Val Thr 740 745 750Thr Thr Thr Thr Thr Thr Thr Thr Thr Thr Ala Thr Gln Glu Glu Glu 755 760 765Lys Lys Pro Pro Pro Ala Leu Pro Pro Pro Pro Pro Leu Ala Lys Phe 770 775 780Pro Pro Pro Ser Gln Pro Gln Pro Pro Pro Pro Pro Pro Pro Ser Pro785 790 795 800Ala Ser Leu Leu Lys Ser Leu Ala Ser Val Leu Glu Gly Gln Lys Tyr 805 810 815Cys Tyr Arg Gly Thr Gly Ala Ala Val Ser Thr Arg Pro Gly Pro Leu 820 825 830Pro Thr Thr Gln Tyr Ser Pro Gly Pro Pro Ser Gly Ala Thr Ala Leu 835 840 845Pro Pro Thr Ser Ala Ala Pro Ser Ala Gln Gly Ser Pro Gln Pro Ser 850 855 860Ala Ser Ser Ser Ser Gln Phe Ser Thr Ser Gly Gly Pro Trp Ala Arg865 870 875 880Glu Arg Arg Ala Gly Glu Glu Pro Val Pro Gly Pro Met Thr Pro Thr 885 890 895Gln Pro Pro Pro Pro Leu Ser Leu Pro Pro Ala Arg Ser Glu Ser Glu 900 905 910Val Leu Glu Glu Ile Ser Arg Ala Cys Glu Thr Leu Val Glu Arg Val 915 920 925Gly Arg Ser Ala Thr Asp Pro Ala Asp Pro Val Asp Thr Ala Glu Pro 930 935 940Ala Asp Ser Gly Thr Glu Arg Leu Leu Pro Pro Ala Gln Ala Lys Glu945 950 955 960Glu Ala Gly Gly Val Ala Ala Val Ser Gly Ser Cys Lys Arg Arg Gln 965 970 975Lys Glu His Gln Lys Glu His Arg Arg His Arg Arg Ala Cys Lys Asp 980 985 990Ser Val Gly Arg Arg Pro Arg Glu Gly Arg Ala Lys Ala Lys Ala Lys 995 1000 1005Val Pro Lys Glu Lys Ser Arg Arg Val Leu Gly Asn Leu Asp Leu 1010 1015 1020Gln Ser Glu Glu Ile Gln Gly Arg Glu Lys Ser Arg Pro Asp Leu 1025 1030 1035Gly Gly Ala Ser Lys Ala Lys Pro Pro Thr Ala Pro Ala Pro Pro 1040 1045 1050Ser Ala Pro Ala Pro Ser Ala Gln Pro Thr Pro Pro Ser Ala Ser 1055 1060 1065Val Pro Gly Lys Lys Ala Arg Glu Glu Ala Pro Gly Pro Pro Gly 1070 1075 1080Val Ser Arg Ala Asp Met Leu Lys Leu Arg Ser Leu Ser Glu Gly 1085 1090 1095Pro Pro Lys Glu Leu Lys Ile Arg Leu Ile Lys Val Glu Ser Gly 1100 1105 1110Asp Lys Glu Thr Phe Ile Ala Ser Glu Val Glu Glu Arg Arg Leu 1115 1120 1125Arg Met Ala Asp Leu Thr Ile Ser His Cys Ala Ala Asp Val Val 1130 1135 1140Arg Ala Ser Arg Asn Ala Lys Val Lys Gly Lys Phe Arg Glu Ser 1145 1150 1155Tyr Leu Ser Pro Ala Gln Ser Val Lys Pro Lys Ile Asn Thr Glu 1160 1165 1170Glu Lys Leu Pro Arg Glu Lys Leu Asn Pro Pro Thr Pro Ser Ile 1175 1180 1185Tyr Leu Glu Ser Lys Arg Asp Ala Phe Ser Pro Val Leu Leu Gln 1190 1195 1200Phe Cys Thr Asp Pro Arg Asn Pro Ile Thr Val Ile Arg Gly Leu 1205 1210 1215Ala Gly Ser Leu Arg Leu Asn Leu Gly Leu Phe Ser Thr Lys Thr 1220 1225 1230Leu Val Glu Ala Ser Gly Glu His Thr Val Glu Val Arg Thr Gln 1235 1240 1245Val Gln Gln Pro Ser Asp Glu Asn Trp Asp Leu Thr Gly Thr Arg 1250 1255 1260Gln Ile Trp Pro Cys Glu Ser Ser Arg Ser His Thr Thr Ile Ala 1265 1270 1275Lys Tyr Ala Gln Tyr Gln Ala Ser Ser Phe Gln Glu Ser Leu Gln 1280 1285 1290Glu Glu Lys Glu Ser Glu Asp Glu Glu Ser Glu Glu Pro Asp Ser 1295 1300 1305Thr Thr Gly Thr Pro Pro Ser Ser Ala Pro Asp Pro Lys Asn His 1310 1315 1320His Ile Ile Lys Phe Gly Thr Asn Ile Asp Leu Ser Asp Ala Lys 1325 1330 1335Arg Trp Lys Pro Gln Leu Gln Glu Leu Leu Lys Leu Pro Ala Phe 1340 1345 1350Met Arg Val Thr Ser Thr Gly Asn Met Leu Ser His Val Gly His 1355 1360 1365Thr Ile Leu Gly Met Asn Thr Val Gln Leu Tyr Met Lys Val Pro 1370 1375 1380Gly Ser Arg Thr Pro Gly His Gln Glu Asn Asn Asn Phe Cys Ser 1385 1390 1395Val Asn Ile Asn Ile Gly Pro Gly Asp Cys Glu Trp Phe Ala Val 1400 1405 1410His Glu His Tyr Trp Glu Thr Ile Ser Ala Phe Cys Asp Arg His 1415 1420 1425Gly Val Asp Tyr Leu Thr Gly Ser Trp Trp Pro Ile Leu Asp Asp 1430 1435 1440Leu Tyr Ala Ser Asn Ile Pro Val Tyr Arg Phe Val Gln Arg Pro 1445 1450 1455Gly Asp Leu Val Trp Ile Asn Ala Gly Thr Val His Trp Val Gln 1460 1465 1470Ala Thr Gly Trp Cys Asn Asn Ile Ala Trp Asn Val Gly Pro Leu 1475 1480 1485Thr Ala Tyr Gln Tyr Gln Leu Ala Leu Glu Arg Tyr Glu Trp Asn 1490 1495 1500Glu Val Lys Asn Val Lys Ser Ile Val Pro Met Ile His Val Ser 1505 1510 1515Trp Asn Val Ala Arg Thr Val Lys Ile Ser Asp Pro Asp Leu Phe 1520 1525 1530Lys Met Ile Lys Phe Cys Leu Leu Gln Ser Met Lys His Cys Gln 1535 1540 1545Val Gln Arg Glu Ser Leu Val Arg Ala Gly Lys Lys Ile Ala Tyr 1550 1555 1560Gln Gly Arg Val Lys Asp Glu Pro Ala Tyr Tyr Cys Asn Glu Cys 1565 1570 1575Asp Val Glu Val Phe Asn Ile Leu Phe Val Thr Ser Glu Asn Gly 1580 1585 1590Ser Arg Asn Thr Tyr Leu Val His Cys Glu Gly Cys Ala Arg Arg 1595 1600 1605Arg Ser Ala Gly Leu Gln Gly Val Val Val Leu Glu Gln Tyr Arg 1610 1615 1620Thr Glu Glu Leu Ala Gln Ala Tyr Asp Ala Phe Thr Leu Val Arg 1625 1630 1635Ala Arg Arg Ala Arg Gly Gln Arg Arg Arg Ala Leu Gly Gln Ala 1640 1645 1650Ala Gly Thr Gly Phe Gly Ser Pro Ala Ala Pro Phe Pro Glu Pro 1655 1660 1665Pro Pro Ala Phe Ser Pro Gln Ala Pro Ala Ser Thr Ser Arg 1670 1675 16802659PRTHomo sapiens 2Gln Ser Glu Glu Ile Gln Gly Arg Glu Lys Ser Arg Pro Asp Leu Gly1 5 10 15Gly Ala Ser Lys Ala Lys Pro Pro Thr Ala Pro Ala Pro Pro Ser Ala 20 25 30Pro Ala Pro Ser Ala Gln Pro Thr Pro Pro Ser Ala Ser Val Pro Gly 35 40 45Lys Lys Ala Arg Glu Glu Ala Pro Gly Pro Pro Gly Val Ser Arg Ala 50 55 60Asp Met Leu Lys Leu Arg Ser Leu Ser Glu Gly Pro Pro Lys Glu Leu65 70 75 80Lys Ile Arg Leu Ile Lys Val Glu Ser Gly Asp Lys Glu Thr Phe Ile 85 90 95Ala Ser Glu Val Glu Glu Arg Arg Leu Arg Met Ala Asp Leu Thr Ile 100 105 110Ser His Cys Ala Ala Asp Val Val Arg Ala Ser Arg Asn Ala Lys Val 115 120 125Lys Gly Lys Phe Arg Glu Ser Tyr Leu Ser Pro Ala Gln Ser Val Lys 130 135 140Pro Lys Ile Asn Thr Glu Glu Lys Leu Pro Arg Glu Lys Leu Asn Pro145 150 155 160Pro Thr Pro Ser Ile Tyr Leu Glu Ser Lys Arg Asp Ala Phe Ser Pro 165 170 175Val Leu Leu Gln Phe Cys Thr Asp Pro Arg Asn Pro Ile Thr Val Ile 180 185 190Arg Gly Leu Ala Gly Ser Leu Arg Leu Asn Leu Gly Leu Phe Ser Thr 195 200 205Lys Thr Leu Val Glu Ala Ser Gly Glu His Thr Val Glu Val Arg Thr 210 215 220Gln Val Gln Gln Pro Ser Asp Glu Asn Trp Asp Leu Thr Gly Thr Arg225 230 235 240Gln Ile Trp Pro Cys Glu Ser Ser Arg Ser His Thr Thr Ile Ala Lys 245 250 255Tyr Ala Gln Tyr Gln Ala Ser Ser Phe Gln Glu Ser Leu Gln Glu Glu 260 265 270Lys Glu Ser Glu Asp Glu Glu Ser Glu Glu Pro Asp Ser Thr Thr Gly 275 280 285Thr Pro Pro Ser Ser Ala Pro Asp Pro Lys Asn His His Ile Ile Lys 290 295 300Phe Gly Thr Asn Ile Asp Leu Ser Asp Ala Lys Arg Trp Lys Pro Gln305 310 315 320Leu Gln Glu Leu Leu Lys Leu Pro Ala Phe Met Arg Val Thr Ser Thr 325 330 335Gly Asn Met Leu Ser His Val Gly His Thr Ile Leu Gly Met Asn Thr 340 345 350Val Gln Leu Tyr Met Lys Val Pro Gly Ser Arg Thr Pro Gly His Gln 355 360 365Glu Asn Asn Asn Phe Cys Ser Val Asn Ile Asn Ile Gly Pro Gly Asp 370 375 380Cys Glu Trp Phe Ala Val His Glu His Tyr Trp Glu Thr Ile Ser Ala385 390 395 400Phe Cys Asp Arg His Gly Val Asp Tyr Leu Thr Gly Ser Trp Trp Pro 405 410 415Ile Leu Asp Asp Leu Tyr Ala Ser Asn Ile Pro Val Tyr Arg Phe Val 420 425 430Gln Arg Pro Gly Asp Leu Val Trp Ile Asn Ala Gly Thr Val His Trp 435 440 445Val Gln Ala Thr Gly Trp Cys Asn Asn Ile Ala Trp Asn Val Gly Pro 450 455 460Leu Thr Ala Tyr Gln Tyr Gln Leu Ala Leu Glu Arg Tyr Glu Trp Asn465 470 475 480Glu Val Lys Asn Val Lys Ser Ile Val Pro Met Ile His Val Ser Trp 485 490 495Asn Val Ala Arg Thr Val Lys Ile Ser Asp Pro Asp Leu Phe Lys Met 500 505 510Ile Lys Phe Cys Leu Leu Gln Ser Met Lys His Cys Gln Val Gln Arg 515 520 525Glu Ser Leu Val Arg Ala Gly Lys Lys Ile Ala Tyr Gln Gly Arg Val 530 535 540Lys Asp Glu Pro Ala Tyr Tyr Cys Asn Glu Cys Asp Val Glu Val Phe545 550 555 560Asn Ile Leu Phe Val Thr Ser Glu Asn Gly Ser Arg Asn Thr Tyr Leu 565 570 575Val His Cys Glu Gly Cys Ala Arg Arg Arg Ser Ala Gly Leu Gln Gly 580 585 590Val Val Val Leu Glu Gln Tyr Arg Thr Glu Glu Leu Ala Gln Ala Tyr 595 600 605Asp Ala Phe Thr Leu Val Arg Ala Arg Arg Ala Arg Gly Gln Arg Arg 610 615 620Arg Ala Leu Gly Gln Ala Ala Gly Thr Gly Phe Gly Ser Pro Ala Ala625 630 635 640Pro Phe Pro Glu Pro Pro Pro Ala Phe Ser Pro Gln Ala Pro Ala Ser 645 650 655Thr Ser Arg3109PRTHomo sapiens 3Gln Leu Tyr Met Lys Val Pro Gly Ser Arg Thr Pro Gly His Gln Glu1 5 10 15Asn Asn Asn Phe Cys Ser Val Asn Ile Asn Ile Gly Pro Gly Asp Cys 20 25 30Glu Trp Phe Ala Val His Glu His Tyr Trp Glu Thr Ile Ser Ala Phe 35 40 45Cys Asp Arg His Gly Val Asp Tyr Leu Thr Gly Ser Trp Trp Pro Ile 50 55 60Leu Asp Asp Leu Tyr Ala Ser Asn Ile Pro Val Tyr Arg Phe Val Gln65 70 75 80Arg Pro Gly Asp Leu Val Trp Ile Asn Ala Gly Thr Val His Trp Val 85 90 95Gln Ala Thr Gly Trp Cys Asn Asn Ile Ala Trp Asn Val 100 10545049DNAHomo sapiens 4atgcatcggg cagtggatcc tccaggggcc

cgcgctgcac gggaagcctt tgcccttggg 60ggcctgagct gtgctggggc ctggagctcc tgcccgcctc atccccctcc tcgtagcgca 120tggctgcctg gaggcagatg ctcagccagc attgggcagc ccccgcttcc tgctccccta 180cccccttcac atggcagtag ttctgggcac cccagcaaac catattatgc tccaggggcg 240cccactccaa gacccctcca tgggaagctg gaatccctgc atggctgtgt gcaggcattg 300ctccgggagc cagcccagcc agggctttgg gaacagcttg ggcaactgta cgagtcagag 360cacgatagtg aggaggccac acgctgctac cacagcgccc ttcgatacgg aggaagcttc 420gctgagctgg ggccccgcat tggccgactg cagcaggccc agctctggaa ctttcatact 480ggctcctgcc agcaccgagc caaggtcctg cccccactgg agcaagtgtg gaacttgcta 540caccttgagc acaaacggaa ctatggagcc aagcggggag gtcccccggt gaagcgagct 600gctgaacccc cagtggtgca gcctgtgcct cctgcagcac tctcaggccc ctcaggggag 660gagggcctca gccctggagg caagcgaagg agaggctgca actctgaaca gactggcctt 720cccccagggc tgccactgcc tccaccacca ttaccaccac caccaccacc accaccacca 780ccaccaccac ccctgcctgg cctggctacc agccccccat ttcagctaac caagccaggg 840ctgtggagta ccctgcatgg agatgcctgg ggcccagagc gcaagggttc agcaccccca 900gagcgccagg agcagcggca ctcgctgcct cacccatatc catacccagc tccagcgtac 960accgcgcacc cccctggcca ccggctggtc ccggctgctc ccccaggccc aggcccccgc 1020cccccaggag cagagagcca tggctgcctg cctgccaccc gtccccccgg aagtgacctt 1080agagagagca gagttcagag gtcgcggatg gactccagcg tttcaccagc agcaaccacc 1140gcctgcgtgc cttacgcccc ttcccggccc cctggcctcc ccggcaccac caccagcagc 1200agcagtagca gcagcagcaa cactggtctc cggggcgtgg agccgaaccc aggcattccc 1260ggcgctgacc attaccaaac tcccgcgctg gaggtctctc accatggccg cctggggccc 1320tcggcacaca gcagtcggaa accgttcttg ggggctcccg ctgccactcc ccacctatcc 1380ctgccacctg gaccttcctc accccctcca cccccctgtc cccgcctctt acgcccccca 1440ccaccccctg cctggttgaa gggtccggcc tgccgggcag cccgagagga tggagagatc 1500ttagaagagc tcttctttgg gactgaggga cccccccgcc ctgccccacc acccctcccc 1560catcgcgagg gcttcttggg gcctccggcc tcccgctttt ctgtgggcac tcaggattct 1620cacacccctc ccactccccc aaccccaacc accagcagta gcaacagcaa cagtggcagc 1680cacagcagca gccctgctgg gcctgtgtcc tttcccccac caccctatct ggccagaagt 1740atagaccccc ttccccggcc tcccagccca gcacagaacc cccaggaccc acctcttgta 1800cccctgactc ttgccctgcc tccagcccct ccttcctcct gccaccaaaa tacctcagga 1860agcttcaggc gcccggagag cccccggccc agggtctcct tcccaaagac ccccgaggtg 1920gggccggggc cacccccagg ccccctgagt aaagcccccc agcctgtgcc gcccggggtt 1980ggggagctgc ctgcccgagg ccctcgactc tttgattttc cccccactcc gctggaggac 2040cagtttgagg agccagccga attcaagatc ctacctgatg ggctggccaa catcatgaag 2100atgctggacg aatccattcg caaggaagag gaacagcaac aacacgaagc aggcgtggcc 2160ccccaacccc cgctgaagga gccctttgca tctctgcagt ctcctttccc caccgacaca 2220gcccccacca ctactgctcc tgctgtcgcc gtcaccacca ccaccaccac caccaccacc 2280accacggcca cccaggaaga ggagaagaag ccaccaccag ccctaccacc accaccgcct 2340ctagccaagt tccctccacc ctctcagcca cagccaccac cacccccacc ccccagcccg 2400gccagcctgc tcaaatcctt ggcctccgtg ctggagggac aaaagtactg ttatcggggg 2460actggagcag ctgtttccac ccggcctggg cccttgccca ccactcagta ttcccctggc 2520cccccatcag gtgctaccgc cctgccgccc acctcagcgg cccctagcgc ccagggctcc 2580ccacagccct ctgcttcctc gtcatctcag ttctctacct caggcgggcc ctgggcccgg 2640gagcgcaggg cgggcgaaga gccagtcccg ggccccatga cccccaccca accgccccca 2700cccctatctc tgccccctgc tcgctctgag tctgaggtgc tagaagagat cagccgggct 2760tgcgagaccc ttgtggagcg ggtgggccgg agtgccactg acccagccga cccagtggac 2820acagcagagc cagcggacag tgggactgag cgactgctgc cccccgcaca ggccaaggag 2880gaggctggcg gggtggcggc agtgtcaggc agctgtaagc ggcgacagaa ggagcatcag 2940aaggagcatc ggcggcacag gcgggcctgt aaggacagtg tgggtcgtcg gccccgtgag 3000ggcagggcaa aggccaaggc caaggtcccc aaagaaaaga gccgccgggt gctggggaac 3060ctggacctgc agagcgagga gatccagggt cgtgagaagt cccggcccga tcttggcggg 3120gcctccaagg ccaagccacc cacagctcca gcccctccat cagctcctgc accttctgcc 3180cagcccacac ccccgtcagc ctctgtccct ggaaagaagg ctcgggagga agccccaggg 3240ccaccgggtg tcagccgggc cgacatgctg aagctgcgct cacttagtga ggggcccccc 3300aaggagctga agatccggct catcaaggta gagagtggtg acaaggagac ctttatcgcc 3360tctgaggtgg aagagcggcg gctgcgcatg gcagacctca ccatcagcca ctgtgctgct 3420gacgtcgtgc gcgccagcag gaatgccaag gtgaaaggga agtttcgaga gtcctacctt 3480tcccctgccc agtctgtgaa accgaagatc aacactgagg agaagctgcc ccgggaaaaa 3540ctcaaccccc ctacacccag catctatctg gagagcaaac gggatgcctt ctcacctgtc 3600ctgctgcagt tctgtacaga ccctcgaaat cccatcacag tgatccgggg cctggcgggc 3660tccctgcggc tcaacttggg cctcttctcc accaagaccc tggtggaagc gagtggcgaa 3720cacaccgtgg aagttcgcac ccaggtgcag cagccctcag atgagaactg ggatctgaca 3780ggcactcggc agatctggcc ttgtgagagc tcccgttccc acaccaccat tgccaagtac 3840gcacagtacc aggcctcatc cttccaggag tctctgcagg aggagaagga gagtgaggat 3900gaggagtcag aggagccaga cagcaccact ggaacccctc ctagcagcgc accagacccg 3960aagaaccatc acatcatcaa gtttggcacc aacatcgact tgtctgatgc taagcggtgg 4020aagccccagc tgcaggagct gctgaagctg cccgccttca tgcgggtaac atccacgggc 4080aacatgctga gccacgtggg ccacaccatc ctgggcatga acacggtgca gctgtacatg 4140aaggtgcccg gcagccgaac gccaggccac caggagaata acaacttctg ctccgtcaac 4200atcaacattg gcccaggcga ctgcgagtgg ttcgcggtgc acgagcacta ctgggagacc 4260atcagcgctt tctgtgatcg gcacggcgtg gactacttga cgggttcctg gtggccaatc 4320ctggatgatc tctatgcatc caatattcct gtgtaccgct tcgtgcagcg acccggagac 4380ctcgtgtgga ttaatgcggg gactgtgcac tgggtgcagg ccaccggctg gtgcaacaac 4440attgcctgga acgtggggcc cctcaccgcc tatcagtacc agctggccct ggaacgatac 4500gagtggaatg aggtgaagaa cgtcaaatcc atcgtgccca tgattcacgt gtcatggaac 4560gtggctcgca cggtcaaaat cagcgacccc gacttgttca agatgatcaa gttctgcctg 4620ctgcagtcca tgaagcactg ccaggtgcaa cgcgagagcc tggtgcgggc agggaagaaa 4680atcgcttacc agggccgtgt caaggacgag ccagcctact actgcaacga gtgcgatgtg 4740gaggtgttta acatcctgtt cgtgacaagt gagaatggca gccgcaacac gtacctggta 4800cactgcgagg gctgtgcccg gcgccgcagc gcaggcctgc agggcgtggt ggtgctggag 4860cagtaccgca ctgaggagct ggctcaggcc tacgacgcct tcacgctggt gagggcccgg 4920cgggcgcgcg ggcagcggag gagggcactg gggcaggctg cagggacggg cttcgggagc 4980ccggccgcgc ctttccctga gcccccgccg gctttctccc cccaggcccc agccagcacg 5040tcgcgatga 504951980DNAHomo sapiens 5cagagcgagg agatccaggg tcgtgagaag tcccggcccg atcttggcgg ggcctccaag 60gccaagccac ccacagctcc agcccctcca tcagctcctg caccttctgc ccagcccaca 120cccccgtcag cctctgtccc tggaaagaag gctcgggagg aagccccagg gccaccgggt 180gtcagccggg ccgacatgct gaagctgcgc tcacttagtg aggggccccc caaggagctg 240aagatccggc tcatcaaggt agagagtggt gacaaggaga cctttatcgc ctctgaggtg 300gaagagcggc ggctgcgcat ggcagacctc accatcagcc actgtgctgc tgacgtcgtg 360cgcgccagca ggaatgccaa ggtgaaaggg aagtttcgag agtcctacct ttcccctgcc 420cagtctgtga aaccgaagat caacactgag gagaagctgc cccgggaaaa actcaacccc 480cctacaccca gcatctatct ggagagcaaa cgggatgcct tctcacctgt cctgctgcag 540ttctgtacag accctcgaaa tcccatcaca gtgatccggg gcctggcggg ctccctgcgg 600ctcaacttgg gcctcttctc caccaagacc ctggtggaag cgagtggcga acacaccgtg 660gaagttcgca cccaggtgca gcagccctca gatgagaact gggatctgac aggcactcgg 720cagatctggc cttgtgagag ctcccgttcc cacaccacca ttgccaagta cgcacagtac 780caggcctcat ccttccagga gtctctgcag gaggagaagg agagtgagga tgaggagtca 840gaggagccag acagcaccac tggaacccct cctagcagcg caccagaccc gaagaaccat 900cacatcatca agtttggcac caacatcgac ttgtctgatg ctaagcggtg gaagccccag 960ctgcaggagc tgctgaagct gcccgccttc atgcgggtaa catccacggg caacatgctg 1020agccacgtgg gccacaccat cctgggcatg aacacggtgc agctgtacat gaaggtgccc 1080ggcagccgaa cgccaggcca ccaggagaat aacaacttct gctccgtcaa catcaacatt 1140ggcccaggcg actgcgagtg gttcgcggtg cacgagcact actgggagac catcagcgct 1200ttctgtgatc ggcacggcgt ggactacttg acgggttcct ggtggccaat cctggatgat 1260ctctatgcat ccaatattcc tgtgtaccgc ttcgtgcagc gacccggaga cctcgtgtgg 1320attaatgcgg ggactgtgca ctgggtgcag gccaccggct ggtgcaacaa cattgcctgg 1380aacgtggggc ccctcaccgc ctatcagtac cagctggccc tggaacgata cgagtggaat 1440gaggtgaaga acgtcaaatc catcgtgccc atgattcacg tgtcatggaa cgtggctcgc 1500acggtcaaaa tcagcgaccc cgacttgttc aagatgatca agttctgcct gctgcagtcc 1560atgaagcact gccaggtgca acgcgagagc ctggtgcggg cagggaagaa aatcgcttac 1620cagggccgtg tcaaggacga gccagcctac tactgcaacg agtgcgatgt ggaggtgttt 1680aacatcctgt tcgtgacaag tgagaatggc agccgcaaca cgtacctggt acactgcgag 1740ggctgtgccc ggcgccgcag cgcaggcctg cagggcgtgg tggtgctgga gcagtaccgc 1800actgaggagc tggctcaggc ctacgacgcc ttcacgctgg tgagggcccg gcgggcgcgc 1860gggcagcgga ggagggcact ggggcaggct gcagggacgg gcttcgggag cccggccgcg 1920cctttccctg agcccccgcc ggctttctcc ccccaggccc cagccagcac gtcgcgatga 19806327DNAHomo sapiens 6cagctgtaca tgaaggtgcc cggcagccga acgccaggcc accaggagaa taacaacttc 60tgctccgtca acatcaacat tggcccaggc gactgcgagt ggttcgcggt gcacgagcac 120tactgggaga ccatcagcgc tttctgtgat cggcacggcg tggactactt gacgggttcc 180tggtggccaa tcctggatga tctctatgca tccaatattc ctgtgtaccg cttcgtgcag 240cgacccggag acctcgtgtg gattaatgcg gggactgtgc actgggtgca ggccaccggc 300tggtgcaaca acattgcctg gaacgtg 327712PRTHuman immunodeficiency virus 7Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Pro Gln1 5 1088PRTArtificial Sequencer8 8Arg Arg Arg Arg Arg Arg Arg Arg1 5921PRTArtificial SequenceMPG-8 (The first amino acid "Ala" is modified into "bAla.") 9Ala Phe Leu Gly Trp Leu Gly Ala Trp Gly Thr Met Gly Trp Ser Pro1 5 10 15Lys Lys Lys Arg Lys 201023DNAArtificial SequenceqRT-PCR forward primer for GAPDH 10ggtggtctcc tctgacttca aca 231119DNAArtificial SequenceqRT-PCR reverse primer for GAPDH 11gtggtcgttg agggcaatg 191222DNAArtificial SequenceqRT-PCR forward primer for POU5F1 12cttgaatccc gaatggaaag gg 221323DNAArtificial SequenceqRT-PCR reverse primer for POU5F1 13gtgtatatcc cagggtgatc ctc 231419DNAArtificial SequenceqRT-PCR forward primer for NANOG 14agaaggcctc agcacctac 191520DNAArtificial SequenceqRT-PCR reverse primer for NANOG 15ggcctgattg ttccaggatt 201626DNAArtificial SequenceqRT-PCR forward primer for T 16gccctctccc tcccctccac gcacag 261726DNAArtificial SequenceqRT-PCR reverse primer for T 17cggcgccgtt gctcacagac cacagg 261824DNAArtificial SequenceqRT-PCR forward primer for MSX1 18cgagaggacc ccgtggatgc agag 241924DNAArtificial SequenceqRT-PCR reverse primer for MSX1 19ggcggccatc ttcagcttct ccag 242026DNAArtificial SequenceqRT-PCR forward primer for SOX17 20cgctttcatg gtgtgggcta aggacg 262126DNAArtificial SequenceqRT-PCR reverse primer for SOX17 21tagttggggt ggtcctgcat gtgctg 262226DNAArtificial SequenceqRT-PCR forward primer for FOXA2 22tgggagcggt gaagatggaa gggcac 262326DNAArtificial SequenceqRT-PCR reverse primer for FOXA2 23tcatgccagc gcccacgtac gacgac 262420DNAArtificial SequenceqRT-PCR forward primer for GATA4 24gctccttcag gcagtgagag 202520DNAArtificial SequenceqRT-PCR reverse primer for GATA4 25ctgtgcccgt agtgagatga 202620DNAArtificial SequenceqRT-PCR forward primer for GATA6 26gtgcccagac cacttgctat 202720DNAArtificial SequenceqRT-PCR reverse primer for GATA6 27tggagtcatg ggaatggaat 202820DNAArtificial SequenceqRT-PCR forward primer for GSC 28cggtcctcat cagaggagtc 202920DNAArtificial SequenceqRT-PCR reverse primer for GSC 29ccgagtccaa atcgctttta 203020DNAArtificial SequenceqRT-PCR forward primer for EVX1 30cggctggaga aggaattcta 203120DNAArtificial SequenceqRT-PCR reverse primer for EVX1 31acaccttgat ggtggtttcc 203220DNAArtificial SequenceqRT-PCR forward primer for MYOG 32gccagactat ccccttcctc 203320DNAArtificial SequenceqRT-PCR reverse primer for MYOG 33gaggccgcgt tatgataaaa 203420DNAArtificial SequenceqRT-PCR forward primer for MEF2C 34aggtcacctg acatcccaag 203520DNAArtificial SequenceqRT-PCR reverse primer for MEF2C 35gttagccctc caactccaca 203620DNAArtificial SequenceqRT-PCR forward primer for CKM 36gaagagcatg acggagaagg 203720DNAArtificial SequenceqRT-PCR reverse primer for CKM 37gttgtcattg tgccagatgc 203820DNAArtificial SequenceqRT-PCR forward primer for SIX1 38tgtttgcgca taaaggaatg 203920DNAArtificial SequenceqRT-PCR reverse primer for SIX1 39tgggaaggaa aatgcaaaag 204018DNAArtificial SequenceqRT-PCR forward primer for AFP 40tgggacccga actttcca 184122DNAArtificial SequenceqRT-PCR reverse primer for AFP 41ggccacatcc aggactagtt tc 224220DNAArtificial SequenceqRT-PCR forward primer for COL2 42tttcccaggt caagatggtc 204320DNAArtificial SequenceqRT-PCR reverse primer for COL2 43cttcagcacc tgtctcacca 204420DNAArtificial SequenceqRT-PCR forward primer for COL1A1 44cctggatgcc atcaaagtct 204520DNAArtificial SequenceqRT-PCR reverse primer for COL1A1 45tcttgtcctt ggggttcttg 204620DNAArtificial SequenceChIP-PCR forward primer for POU5F1 46ggaggtaaac ccagctcaca 204720DNAArtificial SequenceChIP-PCR reverse primer for POU5F1 47tttggcctta gggttaagca 204820DNAArtificial SequenceChIP-PCR forward primer for NANOG 48gctcagggat gagcatgatt 204920DNAArtificial SequenceChIP-PCR reverse primer for NANOG 49tgcccagtaa catccacaaa 205020DNAArtificial SequenceChIP-PCR forward primer for T 50ggcacggcca aataagaata 205120DNAArtificial SequenceChIP-PCR reverse primer for T 51ggttcaattc ctgggtcgta 205220DNAArtificial SequenceChIP-PCR forward primer for MSX1 52tccctcatct gatcccaaac 205320DNAArtificial SequenceChIP-PCR reverse primer for MSX1 53accagctcct actgcgagaa 205420DNAArtificial SequenceChIP-PCR forward primer for SOX17 54agcaagatgc tgggtgagtc 205520DNAArtificial SequenceChIP-PCR reverse primer for SOX17 55ctacacaccc ctggttttgg 205620DNAArtificial SequenceChIP-PCR forward primer for FOXA2 56ttcttcgctc tcagtgctca 205721DNAArtificial SequenceChIP-PCR reverse primer for FOXA2 57ggcgagttaa aggtgtgtac g 215820DNAArtificial SequenceChIP-PCR forward primer for GATA4 58gatcttcgcg acagttcctc 205920DNAArtificial SequenceChIP-PCR reverse primer for GATA4 59catggccaag ctctgataca 206020DNAArtificial SequenceChIP-PCR forward primer for GATA6 60tgcagcctac gctcttgtta 206119DNAArtificial SequenceChIP-PCR reverse primer for GATA6 61gtcagtcaag gccatccac 196220DNAArtificial SequenceChIP-PCR forward primer for GSC 62gacatgacgg agatgggtct 206320DNAArtificial SequenceChIP-PCR reverse primer for GSC 63tggaaggtgc ctcacttctt 206420DNAArtificial SequenceChIP-PCR forward primer for EVX1 64tcacactctc ctccccaatc 206520DNAArtificial SequenceChIP-PCR reverse primer for EVX1 65ttacagtacc gctggtgacg 206623DNAArtificial SequenceChIP-PCR forward primer for GAPDH 66cggtgactaa ccctgcgctc ctg 236724DNAArtificial SequenceChIP-PCR reverse primer for GAPDH 67agctagcctc gctccacctg actt 246820DNAArtificial SequenceChIP-PCR forward primer for MYOG_a 68cctccggaaa gaatgggact 206921DNAArtificial SequenceChIP-PCR reverse primer for MYOG_a 69tctgttagct gctctgagtc t 217020DNAArtificial SequenceChIP-PCR forward primer for MYOG_b

70ttggagccaa ggttaccagt 207118DNAArtificial SequenceChIP-PCR reverse primer for MYOGb 71ctctcacagc gcctcctg 187220DNAArtificial SequenceChIP-PCR forward primer for MYOG_c 72ggcctcattc accttcttga 207320DNAArtificial SequenceChIP-PCR reverse primer for MYOG_c 73tgggcgtgta aggtgtgtaa 207420DNAArtificial SequenceChIP-PCR forward primer for MEF2C_a 74catgcatttt caggtcacca 207520DNAArtificial SequenceChIP-PCR reverse primer for MEF2C_a 75cccctccact ttgattcgta 207620DNAArtificial SequenceChIP-PCR forward primer for MEF2C_b 76gcacgtttaa gaccccaaag 207720DNAArtificial SequenceChIP-PCR reverse primer for MEF2C_b 77cggcctcagc taaatgaaag 207820DNAArtificial SequenceChIP-PCR forward primer for SOX1 78ccgtctcact ccgtctgaat 207919DNAArtificial SequenceChIP-PCR reverse primer for SOX1 79agtgcaggtc ggtctccat 19802541DNAHomo sapiens 80gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggcttagcca ccatgtaccc atacgatgtt ccagattacg ctcctaagaa aaagaggaag 240gtgcagagcg aggagatcca gggtcgtgag aagtcccggc ccgatcttgg cggggcctcc 300aaggccaagc cacccacagc tccagcccct ccatcagctc ctgcaccttc tgcccagccc 360acacccccgt cagcctctgt ccctggaaag aaggctcggg aggaagcccc agggccaccg 420ggtgtcagcc gggccgacat gctgaagctg cgctcactta gtgaggggcc ccccaaggag 480ctgaagatcc ggctcatcaa ggtagagagt ggtgacaagg agacctttat cgcctctgag 540gtggaagagc ggcggctgcg catggcagac ctcaccatca gccactgtgc tgctgacgtc 600gtgcgcgcca gcaggaatgc caaggtgaaa gggaagtttc gagagtccta cctttcccct 660gcccagtctg tgaaaccgaa gatcaacact gaggagaagc tgccccggga aaaactcaac 720ccccctacac ccagcatcta tctggagagc aaacgggatg ccttctcacc tgtcctgctg 780cagttctgta cagaccctcg aaatcccatc acagtgatcc ggggcctggc gggctccctg 840cggctcaact tgggcctctt ctccaccaag accctggtgg aagcgagtgg cgaacacacc 900gtggaagttc gcacccaggt gcagcagccc tcagatgaga actgggatct gacaggcact 960cggcagatct ggccttgtga gagctcccgt tcccacacca ccattgccaa gtacgcacag 1020taccaggcct catccttcca ggagtctctg caggaggaga aggagagtga ggatgaggag 1080tcagaggagc cagacagcac cactggaacc cctcctagca gcgcaccaga cccgaagaac 1140catcacatca tcaagtttgg caccaacatc gacttgtctg atgctaagcg gtggaagccc 1200cagctgcagg agctgctgaa gctgcccgcc ttcatgcggg taacatccac gggcaacatg 1260ctgagccacg tgggccacac catcctgggc atgaacacgg tgcagctgta catgaaggtg 1320cccggcagcc gaacgccagg ccaccaggag aataacaact tctgctccgt caacatcaac 1380attggcccag gcgactgcga gtggttcgcg gtgcacgagc actactggga gaccatcagc 1440gctttctgtg atcggcacgg cgtggactac ttgacgggtt cctggtggcc aatcctggat 1500gatctctatg catccaatat tcctgtgtac cgcttcgtgc agcgacccgg agacctcgtg 1560tggattaatg cggggactgt gcactgggtg caggccaccg gctggtgcaa caacattgcc 1620tggaacgtgg ggcccctcac cgcctatcag taccagctgg ccctggaacg atacgagtgg 1680aatgaggtga agaacgtcaa atccatcgtg cccatgattc acgtgtcatg gaacgtggct 1740cgcacggtca aaatcagcga ccccgacttg ttcaagatga tcaagttctg cctgctgcag 1800tccatgaagc actgccaggt gcaacgcgag agcctggtgc gggcagggaa gaaaatcgct 1860taccagggcc gtgtcaagga cgagccagcc tactactgca acgagtgcga tgtggaggtg 1920tttaacatcc tgttcgtgac aagtgagaat ggcagccgca acacgtacct ggtacactgc 1980gagggctgtg cccggcgccg cagcgcaggc ctgcagggcg tggtggtgct ggagcagtac 2040cgcactgagg agctggctca ggcctacgac gccttcacgc tggtgagggc ccggcgggcg 2100cgcgggcagc ggaggagggc actggggcag gctgcaggga cgggcttcgg gagcccggcc 2160gcgcctttcc ctgagccccc gccggctttc tccccccagg ccccagccag cacgtcgcga 2220tgaacccagc tttcttgtac aaagtggtga tggccgctgt ttaaaacttt tatcaagctt 2280atcgataccg tcgacctcga atgctgcctt ctgcggggct tgccttctgg ccatgccctt 2340cttctctccc ttgcacctgt acctcttggt ctttgaataa agcctgagta ggaagtgagg 2400gtctagaact agtgtcgacg caaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2460aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2520aaaaaaaaaa aaaaaaaaaa a 2541811222DNAHomo sapiens 81gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggctccacca tgccagcccg ccttgagacc tgcatctccg acctcgactg cgccagcagc 240agcggcagtg acctatccgg cttcctcacc gacgaggaag actgtgccag actccaacag 300gcagcctccg cttcggggcc gcccgcgccg gcccgcaggg gcgcgcccaa tatctcccgg 360gcgtctgagg ttccaggggc acaggacgac gagcaggaga ggcggcggcg ccgcggccgg 420acgcgggtcc gctccgaggc gctgctgcac tcgctgcgca ggagccggcg cgtcaaggcc 480aacgatcgcg agcgcaaccg catgcacaac ttgaacgcgg ccctggacgc actgcgcagc 540gtgctgccct cgttccccga cgacaccaag ctcaccaaaa tcgagacgct gcgcttcgcc 600tacaactaca tctgggctct ggccgagaca ctgcgcctgg cggatcaagg gctgcccgga 660ggcggtgccc gggagcgcct cctgccgccg cagtgcgtcc cctgcctgcc cggtccccca 720agccccgcca gcgacgcgga gtcctggggc tcaggtgccg ccgccgcctc cccgctctct 780gaccccagta gcccagccgc ctccgaagac ttcacctacc gccccggcga ccctgttttc 840tccttcccaa gcctgcccaa agacttgctc cacacaacgc cctgtttcat tccttaccac 900taggacccag ctttcttgta caaagtggtg atggccgctg tttaaaactt ttatcaagct 960tatcgatacc gtcgacctcg aatgctgcct tctgcggggc ttgccttctg gccatgccct 1020tcttctctcc cttgcacctg tacctcttgg tctttgaata aagcctgagt aggaagtgag 1080ggtctagaac tagtgtcgac gcaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1140aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1200aaaaaaaaaa aaaaaaaaaa aa 1222821357DNAHomo sapiens 82gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggctccgcgg ccgccccctt caccatgttc gtcaaatccg agaccttgga gttgaaggag 240gaagaggacg tgttagtgct gctcggatcg gcctcccccg ccttggcggc cctgaccccg 300ctgtcatcca gcgccgacga agaagaggag gaggagccgg gcgcgtcagg tggggcgcgt 360cggcagcgcg gggctgaggc cgggcagggg gcgcggggcg gcgtggctgc gggtgcggag 420ggctgccggc ccgcacggct gctgggtctg gtacacgatt gcaaacggcg cccttcccgg 480gcgcgggccg tctcccgagg cgccaagacg gccgagacgg tgcagcgcat caagaagacc 540cgtagactga aggccaacaa ccgcgagcga aaccgcatgc acaacctcaa cgcggcactg 600gacgcgctgc gcgaggtgct ccccacgttc cccgaggacg ccaagctcac caagatcgag 660accctgcgct tcgcccacaa ctacatctgg gcactcaccg agaccctgcg cctggcggat 720cactgcgggg gcggcggcgg gggcctgccg ggggcgctct tctccgaggc agtgttgctg 780agcccgggag gcgccagcgc cgccctgagc agcagcggag acagcccctc gcccgcctcc 840acgtggagtt gcaccaacag ccccgcgccg tcctcctccg tgtcctccaa ttccacctcc 900ccctacagct gcactttatc gcccgccagc ccggccgggt cagacatgga ctattggcag 960cccccacctc ccgacaagca ccgctatgca cctcacctcc ccatagccag ggattgtatc 1020tagaagggtg ggcgcgccga cccagctttc ttgtacaaag tggtgatggc cgctgtttaa 1080aacttttatc aagcttatcg ataccgtcga cctcgaatgc tgccttctgc ggggcttgcc 1140ttctggccat gcccttcttc tctcccttgc acctgtacct cttggtcttt gaataaagcc 1200tgagtaggaa gtgagggtct agaactagtg tcgacgcaaa aaaaaaaaaa aaaaaaaaaa 1260aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1320aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaa 1357831153DNAHomo sapiens 83gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggcttcacca tgacgcctca accctcgggt gcgcccactg tccaagtgac ccgtgagacg 240gagcggtcct tccccagagc ctcggaagac gaagtgacct gccccacgtc cgccccgccc 300agccccactc gcacacgggg gaactgcgca gaggcggaag agggaggctg ccgaggggcc 360ccgaggaagc tccgggcacg gcgcggggga cgcagccggc ctaagagcga gttggcactg 420agcaagcagc gacggagtcg gcgaaagaag gccaacgacc gcgagcgcaa tcgaatgcac 480aacctcaact cggcactgga cgccctgcgc ggtgtcctgc ccaccttccc agacgacgcg 540aagctcacca agatcgagac gctgcgcttc gcccacaact acatctgggc gctgactcaa 600acgctgcgca tagcggacca cagcttgtac gcgctggagc cgccggcgcc gcactgcggg 660gagctgggca gcccaggcgg ttcccccggg gactgggggt ccctctactc cccagtctcc 720caggctggca gcctgagtcc cgccgcgtcg ctggaggagc gacccgggct gctgggggcc 780accttttccg cctgcttgag cccaggcagt ctggctttct cagattttct gtgagaccca 840gctttcttgt acaaagtggt gatggccgct gtttaaaact tttatcaagc ttatcgatac 900cgtcgacctc gaatgctgcc ttctgcgggg cttgccttct ggccatgccc ttcttctctc 960ccttgcacct gtacctcttg gtctttgaat aaagcctgag taggaagtga gggtctagaa 1020ctagtgtcga cgcaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1080aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1140aaaaaaaaaa aaa 1153841609DNAHomo sapiens 84gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggctccgcgg ccgccccctt caccatgacc aaatcgtaca gcgagagtgg gctgatgggc 240gagcctcagc cccaaggtcc tccaagctgg acagacgagt gtctcagttc tcaggacgag 300gagcacgagg cagacaagaa ggaggacgac ctcgaagcca tgaacgcaga ggaggactca 360ctgaggaacg ggggagagga ggaggacgaa gatgaggacc tggaagagga ggaagaagag 420gaagaggagg atgacgatca aaagcccaag agacgcggcc ccaaaaagaa gaagatgact 480aaggctcgcc tggagcgttt taaattgaga cgcatgaagg ctaacgcccg ggagcggaac 540cgcatgcacg gactgaacgc ggcgctagac aacctgcgca aggtggtgcc ttgctattct 600aagacgcaga agctgtccaa aatcgagact ctgcgcttgg ccaagaacta catctgggct 660ctgtcggaga tcctgcgctc aggcaaaagc ccagacctgg tctccttcgt tcagacgctt 720tgcaagggct tatcccaacc caccaccaac ctggttgcgg gctgcctgca actcaatcct 780cggacttttc tgcctgagca gaaccaggac atgccccccc acctgccgac ggccagcgct 840tccttccctg tacaccccta ctcctaccag tcgcctgggc tgcccagtcc gccttacggt 900accatggaca gctcccatgt cttccacgtt aagcctccgc cgcacgccta cagcgcagcg 960ctggagccct tctttgaaag ccctctgact gattgcacca gcccttcctt tgatggaccc 1020ctcagcccgc cgctcagcat caatggcaac ttctctttca aacacgaacc gtccgccgag 1080tttgagaaaa attatgcctt taccatgcac tatcctgcag cgacactggc aggggcccaa 1140agccacggat caatcttctc aggcaccgct gcccctcgct gcgagatccc catagacaat 1200attatgtcct tcgatagcca ttcacatcat gagcgagtca tgagtgccca gctcaatgcc 1260atatttcatg attagaaggg tgggcgcgcc gacccagctt tcttgtacaa agtggtgatg 1320gccgctgttt aaaactttta tcaagcttat cgataccgtc gacctcgaat gctgccttct 1380gcggggcttg ccttctggcc atgcccttct tctctccctt gcacctgtac ctcttggtct 1440ttgaataaag cctgagtagg aagtgagggt ctagaactag tgtcgacgca aaaaaaaaaa 1500aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1560aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaa 1609851687DNAHomo sapiens 85gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggctccgcgg ccgccccctt caccatgctg acccgcctgt tcagcgagcc cggccttctc 240tcggacgtgc ccaagttcgc cagctggggc gacggcgaag acgacgagcc gaggagcgac 300aagggcgacg cgccgccacc gccaccgcct gcgcccgggc caggggctcc ggggccagcc 360cgggcggcca agccagtccc tctccgtgga gaagagggga cggaggccac gttggccgag 420gtcaaggagg aaggcgagct ggggggagag gaggaggagg aagaggagga ggaagaagga 480ctggacgagg cggagggcga gcggcccaag aagggcgggc ccaagaagcg caagatgacc 540aaggcgcgct tggagcgctc caagcttcgg cggcagaagg cgaacgcgcg ggagcgcaac 600cgcatgcacg acctgaacgc agccctggac aacctgcgca aggtggtgcc ctgctactcc 660aagacgcaga agctgtccaa gatcgagacg ctgcgcctag ccaagaacta tatctgggcg 720ctctcggaga tcctgcgctc cggcaagcgg ccagacctag tgtcctacgt gcagactctg 780tgcaagggtc tgtcgcagcc caccaccaat ctggtggccg gctgtctgca gctcaactct 840cgcaacttcc tcacggagca aggcgccgac ggtgccggcc gcttccacgg ctcgggcggc 900ccgttcgcca tgcaccccta cccgtacccg tgctcgcgcc tggcgggcgc acagtgccag 960gcggccggcg gcctgggcgg cggcgcggcg cacgccctgc ggacccacgg ctactgcgca 1020gcctacgaga cgctgtatgc ggcggcaggc ggtggcggcg cgagcccgga ctacaacagc 1080tccgagtacg agggcccgct cagccccccg ctctgtctca atggcaactt ctcactcaag 1140caggactcct cgcccgacca cgagaaaagc taccactact ctatgcacta ctcggcgctg 1200cccggttcgc ggcccacggg ccacgggcta gtcttcggct cgtcggctgt gcgcgggggc 1260gtccactcgg agaatctctt gtcttacgat atgcaccttc accacgaccg gggccccatg 1320tacgaggagc tcaatgcgtt ttttcataac tgaaagggtg ggcgcgccga cccagctttc 1380ttgtacaaag tggtgatggc cgctgtttaa aacttttatc aagcttatcg ataccgtcga 1440cctcgaatgc tgccttctgc ggggcttgcc ttctggccat gcccttcttc tctcccttgc 1500acctgtacct cttggtcttt gaataaagcc tgagtaggaa gtgagggtct agaactagtg 1560tcgacgcaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1620aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1680aaaaaaa 1687861574DNAHomo sapiens 86gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggctccgcgg ccgccccctt caccgctagg gataacaggg taatagaagg agccgccacc 240atggagctac tgtcgccacc gctccgcgac gtagacctga cggcccccga cggctctctc 300tgctcctttg ccacaacgga cgacttctat gacgacccgt gtttcgactc cccggacctg 360cgcttcttcg aagacctgga cccgcgcctg atgcacgtgg gcgcgctcct gaaacccgaa 420gagcactcgc acttccccgc ggcggtgcac ccggccccgg gcgcacgtga ggacgagcat 480gtgcgcgcgc ccagcgggca ccaccaggcg ggccgctgcc tactgtgggc ctgcaaggcg 540tgcaagcgca agaccaccaa cgccgaccgc cgcaaggccg ccaccatgcg cgagcggcgc 600cgcctgagca aagtaaatga ggcctttgag acactcaagc gctgcacgtc gagcaatcca 660aaccagcggt tgcccaaggt ggagatcctg cgcaacgcca tccgctatat cgagggcctg 720caggctctgc tgcgcgacca ggacgccgcg ccccctggcg ccgcagccgc cttctatgcg 780ccgggcccgc tgcccccggg ccgcggcggc gagcactaca gcggcgactc cgacgcgtcc 840agcccgcgct ccaactgctc cgacggcatg atggactaca gcggcccccc gagcggcgcc 900cggcggcgga actgctacga aggcgcctac tacaacgagg cgcccagcga acccaggccc 960gggaagagtg cggcggtgtc gagcctagac tgcctgtcca gcatcgtgga gcgcatctcc 1020accgagagcc ctgcggcgcc cgccctcctg ctggcggacg tgccttctga gtcgcctccg 1080cgcaggcaag aggctgccgc ccccagcgag ggagagagca gcggcgaccc cacccagtca 1140ccggacgccg ccccgcagtg ccctgcgggt gcgaacccca acccgatata ccaggtgctc 1200tgagtttcct gtgaacaatt gctcctctct taaggtagca aagggtgggc gcgccgaccc 1260agctttcttg tacaaagtgg tgatggccgc tgtttaaaac ttttatcaag cttatcgata 1320ccgtcgacct cgaatgctgc cttctgcggg gcttgccttc tggccatgcc cttcttctct 1380cccttgcacc tgtacctctt ggtctttgaa taaagcctga gtaggaagtg agggtctaga 1440actagtgtcg acgcaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1500aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1560aaaaaaaaaa aaaa 1574872414DNAHomo sapiens 87gggttggacc ctcgtacaga agctaatacg actcactata gggaaataag agagaaaaga 60agagtaagaa gaaatataag agccaccccg cggtggcggc cgctctagaa ctagtggatc 120ccccgggctg caggaattcg ataaaagcga tcgcccatca caagtttgta caaaaaagca 180ggctccacca tggtttctaa actgagccag ctgcagacgg agctcctggc ggccctgctg 240gagtcagggc tgagcaaaga ggcactgctc caggcactgg gtgagccggg gccctacctc 300ctggctggag aaggccccct ggacaagggg gagtcctgcg gcggcggtcg aggggagctg 360gctgagctgc ccaatgggct gggggagact cggggctccg aggacgagac ggacgacgat 420ggggaagact tcacgccacc catcctcaaa gagctggaga acctcagccc tgaggaggcg 480gcccaccaga aagccgtggt ggagaccctt ctgcaggagg acccgtggcg tgtggcgaag 540atggtcaagt cctacctgca gcagcacaac atcccacagc gggaggtggt cgataccact 600ggcctcaacc agtcccacct gtcccaacac ctcaacaagg gcactcccat gaagacgcag 660aagcgggccg ccctgtacac ctggtacgtc cgcaagcagc gagaggtggc gcagcagttc 720acccatgcag ggcagggagg gctgattgaa gagcccacag gtgatgagct accaaccaag 780aaggggcgga ggaaccgttt caagtggggc ccagcatccc agcagatcct gttccaggcc 840tatgagaggc agaagaaccc tagcaaggag gagcgagaga cgctagtgga ggagtgcaat 900agggcggaat gcatccagag aggggtgtcc ccatcacagg cacaggggct gggctccaac 960ctcgtcacgg aggtgcgtgt ctacaactgg tttgccaacc ggcgcaaaga agaagccttc 1020cggcacaagc tggccatgga cacgtacagc gggccccccc cagggccagg cccgggacct 1080gcgctgcccg ctcacagctc ccctggcctg cctccacctg ccctctcccc cagtaaggtc 1140cacggtgtgc gctatggaca gcctgcgacc agtgagactg cagaagtacc ctcaagcagc 1200ggcggtccct tagtgacagt gtctacaccc ctccaccaag tgtcccccac gggcctggag 1260cccagccaca gcctgctgag tacagaagcc aagctggtct cagcagctgg gggccccctc 1320ccccctgtca gcaccctgac agcactgcac agcttggagc agacatcccc aggcctcaac 1380cagcagcccc agaacctcat catggcctca cttcctgggg tcatgaccat cgggcctggt 1440gagcctgcct ccctgggtcc tacgttcacc aacacaggtg cctccaccct ggtcatcggc 1500ctggcctcca cgcaggcaca gagtgtgccg gtcatcaaca gcatgggcag cagcctgacc 1560accctgcagc ccgtccagtt ctcccagccg ctgcacccct cctaccagca gccgctcatg 1620ccacctgtgc agagccatgt gacccagagc cccttcatgg ccaccatggc tcagctgcag 1680agcccccacg ccctctacag ccacaagccc gaggtggccc agtacaccca cacaggcctg 1740ctcccgcaga ctatgctcat caccgacacc accaacctga gcgccctggc cagcctcacg 1800cccaccaagc aggtcttcac ctcagacact gaggcctcca gtgagtccgg gcttcacacg 1860ccggcatctc aggccaccac cctccacgtc cccagccagg accctgccgg catccagcac 1920ctgcagccgg cccaccggct cagcgccagc cccacagtgt cctccagcag cctggtgctg 1980taccagagct cagactccag caatggccag agccacctgc tgccatccaa ccacagcgtc 2040atcgagacct tcatctccac ccagatggcc tcttcctccc agttgtgagc ggccgcaccc 2100agctttcttg tacaaagtgg tgatggccgc tgtttaaaac ttttatcaag cttatcgata 2160ccgtcgacct cgaatgctgc cttctgcggg gcttgccttc tggccatgcc cttcttctct 2220cccttgcacc tgtacctctt ggtctttgaa taaagcctga gtaggaagtg agggtctaga 2280actagtgtcg acgcaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2340aaaaaaaaaa aaaaaaaaaa

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2400aaaaaaaaaa aaaa 241488320PRTHomo sapiens 88Met Glu Leu Leu Ser Pro Pro Leu Arg Asp Val Asp Leu Thr Ala Pro1 5 10 15Asp Gly Ser Leu Cys Ser Phe Ala Thr Thr Asp Asp Phe Tyr Asp Asp 20 25 30Pro Cys Phe Asp Ser Pro Asp Leu Arg Phe Phe Glu Asp Leu Asp Pro 35 40 45Arg Leu Met His Val Gly Ala Leu Leu Lys Pro Glu Glu His Ser His 50 55 60Phe Pro Ala Ala Val His Pro Ala Pro Gly Ala Arg Glu Asp Glu His65 70 75 80Val Arg Ala Pro Ser Gly His His Gln Ala Gly Arg Cys Leu Leu Trp 85 90 95Ala Cys Lys Ala Cys Lys Arg Lys Thr Thr Asn Ala Asp Arg Arg Lys 100 105 110Ala Ala Thr Met Arg Glu Arg Arg Arg Leu Ser Lys Val Asn Glu Ala 115 120 125Phe Glu Thr Leu Lys Arg Cys Thr Ser Ser Asn Pro Asn Gln Arg Leu 130 135 140Pro Lys Val Glu Ile Leu Arg Asn Ala Ile Arg Tyr Ile Glu Gly Leu145 150 155 160Gln Ala Leu Leu Arg Asp Gln Asp Ala Ala Pro Pro Gly Ala Ala Ala 165 170 175Ala Phe Tyr Ala Pro Gly Pro Leu Pro Pro Gly Arg Gly Gly Glu His 180 185 190Tyr Ser Gly Asp Ser Asp Ala Ser Ser Pro Arg Ser Asn Cys Ser Asp 195 200 205Gly Met Met Asp Tyr Ser Gly Pro Pro Ser Gly Ala Arg Arg Arg Asn 210 215 220Cys Tyr Glu Gly Ala Tyr Tyr Asn Glu Ala Pro Ser Glu Pro Arg Pro225 230 235 240Gly Lys Ser Ala Ala Val Ser Ser Leu Asp Cys Leu Ser Ser Ile Val 245 250 255Glu Arg Ile Ser Thr Glu Ser Pro Ala Ala Pro Ala Leu Leu Leu Ala 260 265 270Asp Val Pro Ser Glu Ser Pro Pro Arg Arg Gln Glu Ala Ala Ala Pro 275 280 285Ser Glu Gly Glu Ser Ser Gly Asp Pro Thr Gln Ser Pro Asp Ala Ala 290 295 300Pro Gln Cys Pro Ala Gly Ala Asn Pro Asn Pro Ile Tyr Gln Val Leu305 310 315 32089237PRTHomo sapiens 89Met Pro Ala Arg Leu Glu Thr Cys Ile Ser Asp Leu Asp Cys Ala Ser1 5 10 15Ser Ser Gly Ser Asp Leu Ser Gly Phe Leu Thr Asp Glu Glu Asp Cys 20 25 30Ala Arg Leu Gln Gln Ala Ala Ser Ala Ser Gly Pro Pro Ala Pro Ala 35 40 45Arg Arg Gly Ala Pro Asn Ile Ser Arg Ala Ser Glu Val Pro Gly Ala 50 55 60Gln Asp Asp Glu Gln Glu Arg Arg Arg Arg Arg Gly Arg Thr Arg Val65 70 75 80Arg Ser Glu Ala Leu Leu His Ser Leu Arg Arg Ser Arg Arg Val Lys 85 90 95Ala Asn Asp Arg Glu Arg Asn Arg Met His Asn Leu Asn Ala Ala Leu 100 105 110Asp Ala Leu Arg Ser Val Leu Pro Ser Phe Pro Asp Asp Thr Lys Leu 115 120 125Thr Lys Ile Glu Thr Leu Arg Phe Ala Tyr Asn Tyr Ile Trp Ala Leu 130 135 140Ala Glu Thr Leu Arg Leu Ala Asp Gln Gly Leu Pro Gly Gly Gly Ala145 150 155 160Arg Glu Arg Leu Leu Pro Pro Gln Cys Val Pro Cys Leu Pro Gly Pro 165 170 175Pro Ser Pro Ala Ser Asp Ala Glu Ser Trp Gly Ser Gly Ala Ala Ala 180 185 190Ala Ser Pro Leu Ser Asp Pro Ser Ser Pro Ala Ala Ser Glu Asp Phe 195 200 205Thr Tyr Arg Pro Gly Asp Pro Val Phe Ser Phe Pro Ser Leu Pro Lys 210 215 220Asp Leu Leu His Thr Thr Pro Cys Phe Ile Pro Tyr His225 230 23590272PRTHomo sapiens 90Met Phe Val Lys Ser Glu Thr Leu Glu Leu Lys Glu Glu Glu Asp Val1 5 10 15Leu Val Leu Leu Gly Ser Ala Ser Pro Ala Leu Ala Ala Leu Thr Pro 20 25 30Leu Ser Ser Ser Ala Asp Glu Glu Glu Glu Glu Glu Pro Gly Ala Ser 35 40 45Gly Gly Ala Arg Arg Gln Arg Gly Ala Glu Ala Gly Gln Gly Ala Arg 50 55 60Gly Gly Val Ala Ala Gly Ala Glu Gly Cys Arg Pro Ala Arg Leu Leu65 70 75 80Gly Leu Val His Asp Cys Lys Arg Arg Pro Ser Arg Ala Arg Ala Val 85 90 95Ser Arg Gly Ala Lys Thr Ala Glu Thr Val Gln Arg Ile Lys Lys Thr 100 105 110Arg Arg Leu Lys Ala Asn Asn Arg Glu Arg Asn Arg Met His Asn Leu 115 120 125Asn Ala Ala Leu Asp Ala Leu Arg Glu Val Leu Pro Thr Phe Pro Glu 130 135 140Asp Ala Lys Leu Thr Lys Ile Glu Thr Leu Arg Phe Ala His Asn Tyr145 150 155 160Ile Trp Ala Leu Thr Glu Thr Leu Arg Leu Ala Asp His Cys Gly Gly 165 170 175Gly Gly Gly Gly Leu Pro Gly Ala Leu Phe Ser Glu Ala Val Leu Leu 180 185 190Ser Pro Gly Gly Ala Ser Ala Ala Leu Ser Ser Ser Gly Asp Ser Pro 195 200 205Ser Pro Ala Ser Thr Trp Ser Cys Thr Asn Ser Pro Ala Pro Ser Ser 210 215 220Ser Val Ser Ser Asn Ser Thr Ser Pro Tyr Ser Cys Thr Leu Ser Pro225 230 235 240Ala Ser Pro Ala Gly Ser Asp Met Asp Tyr Trp Gln Pro Pro Pro Pro 245 250 255Asp Lys His Arg Tyr Ala Pro His Leu Pro Ile Ala Arg Asp Cys Ile 260 265 27091214PRTHomo sapiens 91Met Thr Pro Gln Pro Ser Gly Ala Pro Thr Val Gln Val Thr Arg Glu1 5 10 15Thr Glu Arg Ser Phe Pro Arg Ala Ser Glu Asp Glu Val Thr Cys Pro 20 25 30Thr Ser Ala Pro Pro Ser Pro Thr Arg Thr Arg Gly Asn Cys Ala Glu 35 40 45Ala Glu Glu Gly Gly Cys Arg Gly Ala Pro Arg Lys Leu Arg Ala Arg 50 55 60Arg Gly Gly Arg Ser Arg Pro Lys Ser Glu Leu Ala Leu Ser Lys Gln65 70 75 80Arg Arg Ser Arg Arg Lys Lys Ala Asn Asp Arg Glu Arg Asn Arg Met 85 90 95His Asn Leu Asn Ser Ala Leu Asp Ala Leu Arg Gly Val Leu Pro Thr 100 105 110Phe Pro Asp Asp Ala Lys Leu Thr Lys Ile Glu Thr Leu Arg Phe Ala 115 120 125His Asn Tyr Ile Trp Ala Leu Thr Gln Thr Leu Arg Ile Ala Asp His 130 135 140Ser Leu Tyr Ala Leu Glu Pro Pro Ala Pro His Cys Gly Glu Leu Gly145 150 155 160Ser Pro Gly Gly Ser Pro Gly Asp Trp Gly Ser Leu Tyr Ser Pro Val 165 170 175Ser Gln Ala Gly Ser Leu Ser Pro Ala Ala Ser Leu Glu Glu Arg Pro 180 185 190Gly Leu Leu Gly Ala Thr Phe Ser Ala Cys Leu Ser Pro Gly Ser Leu 195 200 205Ala Phe Ser Asp Phe Leu 21092356PRTHomo sapiens 92Met Thr Lys Ser Tyr Ser Glu Ser Gly Leu Met Gly Glu Pro Gln Pro1 5 10 15Gln Gly Pro Pro Ser Trp Thr Asp Glu Cys Leu Ser Ser Gln Asp Glu 20 25 30Glu His Glu Ala Asp Lys Lys Glu Asp Asp Leu Glu Ala Met Asn Ala 35 40 45Glu Glu Asp Ser Leu Arg Asn Gly Gly Glu Glu Glu Asp Glu Asp Glu 50 55 60Asp Leu Glu Glu Glu Glu Glu Glu Glu Glu Glu Asp Asp Asp Gln Lys65 70 75 80Pro Lys Arg Arg Gly Pro Lys Lys Lys Lys Met Thr Lys Ala Arg Leu 85 90 95Glu Arg Phe Lys Leu Arg Arg Met Lys Ala Asn Ala Arg Glu Arg Asn 100 105 110Arg Met His Gly Leu Asn Ala Ala Leu Asp Asn Leu Arg Lys Val Val 115 120 125Pro Cys Tyr Ser Lys Thr Gln Lys Leu Ser Lys Ile Glu Thr Leu Arg 130 135 140Leu Ala Lys Asn Tyr Ile Trp Ala Leu Ser Glu Ile Leu Arg Ser Gly145 150 155 160Lys Ser Pro Asp Leu Val Ser Phe Val Gln Thr Leu Cys Lys Gly Leu 165 170 175Ser Gln Pro Thr Thr Asn Leu Val Ala Gly Cys Leu Gln Leu Asn Pro 180 185 190Arg Thr Phe Leu Pro Glu Gln Asn Gln Asp Met Pro Pro His Leu Pro 195 200 205Thr Ala Ser Ala Ser Phe Pro Val His Pro Tyr Ser Tyr Gln Ser Pro 210 215 220Gly Leu Pro Ser Pro Pro Tyr Gly Thr Met Asp Ser Ser His Val Phe225 230 235 240His Val Lys Pro Pro Pro His Ala Tyr Ser Ala Ala Leu Glu Pro Phe 245 250 255Phe Glu Ser Pro Leu Thr Asp Cys Thr Ser Pro Ser Phe Asp Gly Pro 260 265 270Leu Ser Pro Pro Leu Ser Ile Asn Gly Asn Phe Ser Phe Lys His Glu 275 280 285Pro Ser Ala Glu Phe Glu Lys Asn Tyr Ala Phe Thr Met His Tyr Pro 290 295 300Ala Ala Thr Leu Ala Gly Ala Gln Ser His Gly Ser Ile Phe Ser Gly305 310 315 320Thr Ala Ala Pro Arg Cys Glu Ile Pro Ile Asp Asn Ile Met Ser Phe 325 330 335Asp Ser His Ser His His Glu Arg Val Met Ser Ala Gln Leu Asn Ala 340 345 350Ile Phe His Asp 35593382PRTHomo sapiens 93Met Leu Thr Arg Leu Phe Ser Glu Pro Gly Leu Leu Ser Asp Val Pro1 5 10 15Lys Phe Ala Ser Trp Gly Asp Gly Glu Asp Asp Glu Pro Arg Ser Asp 20 25 30Lys Gly Asp Ala Pro Pro Pro Pro Pro Pro Ala Pro Gly Pro Gly Ala 35 40 45Pro Gly Pro Ala Arg Ala Ala Lys Pro Val Pro Leu Arg Gly Glu Glu 50 55 60Gly Thr Glu Ala Thr Leu Ala Glu Val Lys Glu Glu Gly Glu Leu Gly65 70 75 80Gly Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Gly Leu Asp Glu Ala 85 90 95Glu Gly Glu Arg Pro Lys Lys Gly Gly Pro Lys Lys Arg Lys Met Thr 100 105 110Lys Ala Arg Leu Glu Arg Ser Lys Leu Arg Arg Gln Lys Ala Asn Ala 115 120 125Arg Glu Arg Asn Arg Met His Asp Leu Asn Ala Ala Leu Asp Asn Leu 130 135 140Arg Lys Val Val Pro Cys Tyr Ser Lys Thr Gln Lys Leu Ser Lys Ile145 150 155 160Glu Thr Leu Arg Leu Ala Lys Asn Tyr Ile Trp Ala Leu Ser Glu Ile 165 170 175Leu Arg Ser Gly Lys Arg Pro Asp Leu Val Ser Tyr Val Gln Thr Leu 180 185 190Cys Lys Gly Leu Ser Gln Pro Thr Thr Asn Leu Val Ala Gly Cys Leu 195 200 205Gln Leu Asn Ser Arg Asn Phe Leu Thr Glu Gln Gly Ala Asp Gly Ala 210 215 220Gly Arg Phe His Gly Ser Gly Gly Pro Phe Ala Met His Pro Tyr Pro225 230 235 240Tyr Pro Cys Ser Arg Leu Ala Gly Ala Gln Cys Gln Ala Ala Gly Gly 245 250 255Leu Gly Gly Gly Ala Ala His Ala Leu Arg Thr His Gly Tyr Cys Ala 260 265 270Ala Tyr Glu Thr Leu Tyr Ala Ala Ala Gly Gly Gly Gly Ala Ser Pro 275 280 285Asp Tyr Asn Ser Ser Glu Tyr Glu Gly Pro Leu Ser Pro Pro Leu Cys 290 295 300Leu Asn Gly Asn Phe Ser Leu Lys Gln Asp Ser Ser Pro Asp His Glu305 310 315 320Lys Ser Tyr His Tyr Ser Met His Tyr Ser Ala Leu Pro Gly Ser Arg 325 330 335Pro Thr Gly His Gly Leu Val Phe Gly Ser Ser Ala Val Arg Gly Gly 340 345 350Val His Ser Glu Asn Leu Leu Ser Tyr Asp Met His Leu His His Asp 355 360 365Arg Gly Pro Met Tyr Glu Glu Leu Asn Ala Phe Phe His Asn 370 375 38094632PRTHomo sapiens 94Met Val Ser Lys Leu Ser Gln Leu Gln Thr Glu Leu Leu Ala Ala Leu1 5 10 15Leu Glu Ser Gly Leu Ser Lys Glu Ala Leu Leu Gln Ala Leu Gly Glu 20 25 30Pro Gly Pro Tyr Leu Leu Ala Gly Glu Gly Pro Leu Asp Lys Gly Glu 35 40 45Ser Cys Gly Gly Gly Arg Gly Glu Leu Ala Glu Leu Pro Asn Gly Leu 50 55 60Gly Glu Thr Arg Gly Ser Glu Asp Glu Thr Asp Asp Asp Gly Glu Asp65 70 75 80Phe Thr Pro Pro Ile Leu Lys Glu Leu Glu Asn Leu Ser Pro Glu Glu 85 90 95Ala Ala His Gln Lys Ala Val Val Glu Thr Leu Leu Gln Glu Asp Pro 100 105 110Trp Arg Val Ala Lys Met Val Lys Ser Tyr Leu Gln Gln His Asn Ile 115 120 125Pro Gln Arg Glu Val Val Asp Thr Thr Gly Leu Asn Gln Ser His Leu 130 135 140Ser Gln His Leu Asn Lys Gly Thr Pro Met Lys Thr Gln Lys Arg Ala145 150 155 160Ala Leu Tyr Thr Trp Tyr Val Arg Lys Gln Arg Glu Val Ala Gln Gln 165 170 175Phe Thr His Ala Gly Gln Gly Gly Leu Ile Glu Glu Pro Thr Gly Asp 180 185 190Glu Leu Pro Thr Lys Lys Gly Arg Arg Asn Arg Phe Lys Trp Gly Pro 195 200 205Ala Ser Gln Gln Ile Leu Phe Gln Ala Tyr Glu Arg Gln Lys Asn Pro 210 215 220Ser Lys Glu Glu Arg Glu Thr Leu Val Glu Glu Cys Asn Arg Ala Glu225 230 235 240Cys Ile Gln Arg Gly Val Ser Pro Ser Gln Ala Gln Gly Leu Gly Ser 245 250 255Asn Leu Val Thr Glu Val Arg Val Tyr Asn Trp Phe Ala Asn Arg Arg 260 265 270Lys Glu Glu Ala Phe Arg His Lys Leu Ala Met Asp Thr Tyr Ser Gly 275 280 285Pro Pro Pro Gly Pro Gly Pro Gly Pro Ala Leu Pro Ala His Ser Ser 290 295 300Pro Gly Leu Pro Pro Pro Ala Leu Ser Pro Ser Lys Val His Gly Val305 310 315 320Arg Tyr Gly Gln Pro Ala Thr Ser Glu Thr Ala Glu Val Pro Ser Ser 325 330 335Ser Gly Gly Pro Leu Val Thr Val Ser Thr Pro Leu His Gln Val Ser 340 345 350Pro Thr Gly Leu Glu Pro Ser His Ser Leu Leu Ser Thr Glu Ala Lys 355 360 365Leu Val Ser Ala Ala Gly Gly Pro Leu Pro Pro Val Ser Thr Leu Thr 370 375 380Ala Leu His Ser Leu Glu Gln Thr Ser Pro Gly Leu Asn Gln Gln Pro385 390 395 400Gln Asn Leu Ile Met Ala Ser Leu Pro Gly Val Met Thr Ile Gly Pro 405 410 415Gly Glu Pro Ala Ser Leu Gly Pro Thr Phe Thr Asn Thr Gly Ala Ser 420 425 430Thr Leu Val Ile Gly Leu Ala Ser Thr Gln Ala Gln Ser Val Pro Val 435 440 445Ile Asn Ser Met Gly Ser Ser Leu Thr Thr Leu Gln Pro Val Gln Phe 450 455 460Ser Gln Pro Leu His Pro Ser Tyr Gln Gln Pro Leu Met Pro Pro Val465 470 475 480Gln Ser His Val Thr Gln Ser Pro Phe Met Ala Thr Met Ala Gln Leu 485 490 495Gln Ser Pro His Ala Leu Tyr Ser His Lys Pro Glu Val Ala Gln Tyr 500 505 510Thr His Thr Gly Leu Leu Pro Gln Thr Met Leu Ile Thr Asp Thr Thr 515 520 525Asn Leu Ser Ala Leu Ala Ser Leu Thr Pro Thr Lys Gln Val Phe Thr 530 535 540Ser Asp Thr Glu Ala Ser Ser Glu Ser Gly Leu His Thr Pro Ala Ser545 550 555 560Gln Ala Thr Thr Leu His Val Pro Ser Gln Asp Pro Ala Gly Ile Gln 565 570 575His Leu Gln Pro Ala His Arg Leu Ser Ala Ser Pro Thr Val Ser Ser 580 585 590Ser Ser Leu Val Leu Tyr Gln Ser Ser Asp Ser Ser Asn Gly Gln Ser 595 600 605His Leu Leu Pro Ser Asn His Ser Val Ile Glu Thr Phe Ile Ser Thr 610 615 620Gln Met Ala Ser Ser Ser Gln Leu625 630

Claims

1.-16. (canceled)

17. A differentiation induction kit for differentiating a pluripotent stem cell into a desired cell type, comprising at least any one of the following items (1) to (3): (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced; (2) a pluripotent stem cell in which JMJD3 is forcibly expressed; and (3) a pluripotent stem cell having a gene construct carrying JMJD3 inserted into a genome thereof, wherein the JMJD3 has demethylase activity that induces differentiation of the pluripotent stem cell by removing a methyl group of H3K27me3.

18. The differentiation induction kit according to claim 17, wherein the JMJD3 is a demethylase containing only an enzymatically active region of JMJD3.

19. The differentiation induction kit according to claim 17, wherein the JMJD3 has an amino acid sequence set forth in any one of SEQ ID NOS: 1 to 3.

20. The differentiation induction kit according to claim 17, further comprising a transcription factor required for induction of differentiation into the desired cell type.

21. The differentiation induction kit according to claim 17, wherein the desired cell type is a skeletal muscle cell, comprising at least any one of the following items (1) to (3): (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced, and a transcription factor MYOD1; (2) a pluripotent stem cell in which JMJD3 is forcibly expressed, and a transcription factor MYOD1; and (3) a pluripotent stem cell having a gene construct carrying JMJD3 inserted into a genome thereof, and a transcription factor MYOD1.

22. The differentiation induction kit according to claim 17, wherein the desired cell type is a nerve cell, comprising at least any one of the following items (1) to (3): (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced, and a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2; (2) a pluripotent stem cell in which JMJD3 is forcibly expressed, and a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2; and (3) a pluripotent stem cell having a gene construct carrying JMJD3 inserted into a genome thereof, and a transcription factor NEUROG1, NEUROG2, NEUROG3, NEUROD1, and/or NEUROD2.

23. The differentiation induction kit according to claim 17, wherein the desired cell type is a liver cell, comprising at least any one of the following items (1) to (3): (1) a pluripotent stem cell having a histone in which H3K27me3 modification has been substantially removed or reduced, and a transcription factor HNF1A; (2) a pluripotent stem cell in which JMJD3 is forcibly expressed, and a transcription factor HNF1A; and (3) a pluripotent stem cell having a gene construct carrying JMJD3 inserted into a genome thereof, and a transcription factor HNF1A.